Defining Electron Bifurcation in the Electron-Transferring Flavoprotein Family.
Garcia Costas, Amaya M; Poudel, Saroj; Miller, Anne-Frances; Schut, Gerrit J; Ledbetter, Rhesa N; Fixen, Kathryn R; Seefeldt, Lance C; Adams, Michael W W; Harwood, Caroline S; Boyd, Eric S; Peters, John W
2017-11-01
Electron bifurcation is the coupling of exergonic and endergonic redox reactions to simultaneously generate (or utilize) low- and high-potential electrons. It is the third recognized form of energy conservation in biology and was recently described for select electron-transferring flavoproteins (Etfs). Etfs are flavin-containing heterodimers best known for donating electrons derived from fatty acid and amino acid oxidation to an electron transfer respiratory chain via Etf-quinone oxidoreductase. Canonical examples contain a flavin adenine dinucleotide (FAD) that is involved in electron transfer, as well as a non-redox-active AMP. However, Etfs demonstrated to bifurcate electrons contain a second FAD in place of the AMP. To expand our understanding of the functional variety and metabolic significance of Etfs and to identify amino acid sequence motifs that potentially enable electron bifurcation, we compiled 1,314 Etf protein sequences from genome sequence databases and subjected them to informatic and structural analyses. Etfs were identified in diverse archaea and bacteria, and they clustered into five distinct well-supported groups, based on their amino acid sequences. Gene neighborhood analyses indicated that these Etf group designations largely correspond to putative differences in functionality. Etfs with the demonstrated ability to bifurcate were found to form one group, suggesting that distinct conserved amino acid sequence motifs enable this capability. Indeed, structural modeling and sequence alignments revealed that identifying residues occur in the NADH- and FAD-binding regions of bifurcating Etfs. Collectively, a new classification scheme for Etf proteins that delineates putative bifurcating versus nonbifurcating members is presented and suggests that Etf-mediated bifurcation is associated with surprisingly diverse enzymes. IMPORTANCE Electron bifurcation has recently been recognized as an electron transfer mechanism used by microorganisms to maximize energy conservation. Bifurcating enzymes couple thermodynamically unfavorable reactions with thermodynamically favorable reactions in an overall spontaneous process. Here we show that the electron-transferring flavoprotein (Etf) enzyme family exhibits far greater diversity than previously recognized, and we provide a phylogenetic analysis that clearly delineates bifurcating versus nonbifurcating members of this family. Structural modeling of proteins within these groups reveals key differences between the bifurcating and nonbifurcating Etfs. Copyright © 2017 American Society for Microbiology.
Defining Electron Bifurcation in the Electron-Transferring Flavoprotein Family
Garcia Costas, Amaya M.; Poudel, Saroj; Miller, Anne-Frances; Schut, Gerrit J.; Ledbetter, Rhesa N.; Seefeldt, Lance C.; Adams, Michael W. W.
2017-01-01
ABSTRACT Electron bifurcation is the coupling of exergonic and endergonic redox reactions to simultaneously generate (or utilize) low- and high-potential electrons. It is the third recognized form of energy conservation in biology and was recently described for select electron-transferring flavoproteins (Etfs). Etfs are flavin-containing heterodimers best known for donating electrons derived from fatty acid and amino acid oxidation to an electron transfer respiratory chain via Etf-quinone oxidoreductase. Canonical examples contain a flavin adenine dinucleotide (FAD) that is involved in electron transfer, as well as a non-redox-active AMP. However, Etfs demonstrated to bifurcate electrons contain a second FAD in place of the AMP. To expand our understanding of the functional variety and metabolic significance of Etfs and to identify amino acid sequence motifs that potentially enable electron bifurcation, we compiled 1,314 Etf protein sequences from genome sequence databases and subjected them to informatic and structural analyses. Etfs were identified in diverse archaea and bacteria, and they clustered into five distinct well-supported groups, based on their amino acid sequences. Gene neighborhood analyses indicated that these Etf group designations largely correspond to putative differences in functionality. Etfs with the demonstrated ability to bifurcate were found to form one group, suggesting that distinct conserved amino acid sequence motifs enable this capability. Indeed, structural modeling and sequence alignments revealed that identifying residues occur in the NADH- and FAD-binding regions of bifurcating Etfs. Collectively, a new classification scheme for Etf proteins that delineates putative bifurcating versus nonbifurcating members is presented and suggests that Etf-mediated bifurcation is associated with surprisingly diverse enzymes. IMPORTANCE Electron bifurcation has recently been recognized as an electron transfer mechanism used by microorganisms to maximize energy conservation. Bifurcating enzymes couple thermodynamically unfavorable reactions with thermodynamically favorable reactions in an overall spontaneous process. Here we show that the electron-transferring flavoprotein (Etf) enzyme family exhibits far greater diversity than previously recognized, and we provide a phylogenetic analysis that clearly delineates bifurcating versus nonbifurcating members of this family. Structural modeling of proteins within these groups reveals key differences between the bifurcating and nonbifurcating Etfs. PMID:28808132
Tunneling induced electron transfer between separated protons
NASA Astrophysics Data System (ADS)
Vindel-Zandbergen, Patricia; Meier, Christoph; Sola, Ignacio R.
2018-04-01
We study electron transfer between two separated protons using local control theory. In this symmetric system one can favour a slow transfer by biasing the algorithm, achieving high efficiencies for fixed nuclei. The solution can be parametrized using a sequence of a pump followed by a dump pulse that lead to tunneling-induced electron transfer. Finally, we study the effect of the nuclear kinetic energy on the efficiency. Even in the absence of relative motion between the protons, the spreading of the nuclear wave function is enough to reduce the yield of electronic transfer to less than one half.
NASA Astrophysics Data System (ADS)
Imai, Shigeru; Ito, Masato
2018-06-01
In this paper, anomalous single-electron transfer in common-gate quadruple-dot turnstile devices with asymmetric junction capacitances is revealed. That is, the islands have the same total number of excess electrons at high and low gate voltages of the swing that transfers a single electron. In another situation, two electrons enter the islands from the source and two electrons leave the islands for the source and drain during a gate voltage swing cycle. First, stability diagrams of the turnstile devices are presented. Then, sequences of single-electron tunneling events by gate voltage swings are investigated, which demonstrate the above-mentioned anomalous single-electron transfer between the source and the drain. The anomalous single-electron transfer can be understood by regarding the four islands as “three virtual islands and a virtual source or drain electrode of a virtual triple-dot device”. The anomalous behaviors of the four islands are explained by the normal behavior of the virtual islands transferring a single electron and the behavior of the virtual electrode.
NASA Astrophysics Data System (ADS)
Delor, Milan; Archer, Stuart A.; Keane, Theo; Meijer, Anthony J. H. M.; Sazanovich, Igor V.; Greetham, Gregory M.; Towrie, Michael; Weinstein, Julia A.
2017-11-01
Ultrafast electron transfer in condensed-phase molecular systems is often strongly coupled to intramolecular vibrations that can promote, suppress and direct electronic processes. Recent experiments exploring this phenomenon proved that light-induced electron transfer can be strongly modulated by vibrational excitation, suggesting a new avenue for active control over molecular function. Here, we achieve the first example of such explicit vibrational control through judicious design of a Pt(II)-acetylide charge-transfer donor-bridge-acceptor-bridge-donor 'fork' system: asymmetric 13C isotopic labelling of one of the two -C≡C- bridges makes the two parallel and otherwise identical donor→acceptor electron-transfer pathways structurally distinct, enabling independent vibrational perturbation of either. Applying an ultrafast UVpump(excitation)-IRpump(perturbation)-IRprobe(monitoring) pulse sequence, we show that the pathway that is vibrationally perturbed during UV-induced electron transfer is dramatically slowed down compared to its unperturbed counterpart. One can thus choose the dominant electron transfer pathway. The findings deliver a new opportunity for precise perturbative control of electronic energy propagation in molecular devices.
Low-Field Nuclear Polarization Using Nitrogen Vacancy Centers in Diamonds
NASA Astrophysics Data System (ADS)
Hovav, Y.; Naydenov, B.; Jelezko, F.; Bar-Gill, N.
2018-02-01
It was recently demonstrated that bulk nuclear polarization can be obtained using nitrogen vacancy (NV) color centers in diamonds, even at ambient conditions. This is based on the optical polarization of the NV electron spin, and using several polarization transfer methods. One such method is the nuclear orientation via electron spin locking (NOVEL) sequence, where a spin-locked sequence is applied on the NV spin, with a microwave power equal to the nuclear precession frequency. This was performed at relatively high fields, to allow for both polarization transfer and noise decoupling. As a result, this scheme requires accurate magnetic field alignment in order preserve the NV properties. Such a requirement may be undesired or impractical in many practical scenarios. Here we present a new sequence, termed the refocused NOVEL, which can be used for polarization transfer (and detection) even at low fields. Numerical simulations are performed, taking into account both the spin Hamiltonian and spin decoherence, and we show that, under realistic parameters, it can outperform the NOVEL sequence.
Molecular implementation of molecular shift register memories
NASA Technical Reports Server (NTRS)
Beratan, David N. (Inventor); Onuchic, Jose N. (Inventor)
1991-01-01
An electronic shift register memory (20) at the molecular level is described. The memory elements are based on a chain of electron transfer molecules (22) and the information is shifted by photoinduced (26) electron transfer reactions. Thus, multi-step sequences of charge transfer reactions are used to move charge with high efficiency down a molecular chain. The device integrates compositions of the invention onto a VLSI substrate (36), providing an example of a molecular electronic device which may be fabricated. Three energy level schemes, molecular implementation of these schemes, optical excitation strategies, charge amplification strategies, and error correction strategies are described.
Atkinson, Joshua T; Campbell, Ian; Bennett, George N; Silberg, Jonathan J
2016-12-27
The ferredoxin (Fd) protein family is a structurally diverse group of iron-sulfur proteins that function as electron carriers, linking biochemical pathways important for energy transduction, nutrient assimilation, and primary metabolism. While considerable biochemical information about individual Fd protein electron carriers and their reactions has been acquired, we cannot yet anticipate the proportion of electrons shuttled between different Fd-partner proteins within cells using biochemical parameters that govern electron flow, such as holo-Fd concentration, midpoint potential (driving force), molecular interactions (affinity and kinetics), conformational changes (allostery), and off-pathway electron leakage (chemical oxidation). Herein, we describe functional and structural gaps in our Fd knowledge within the context of a sequence similarity network and phylogenetic tree, and we propose a strategy for improving our understanding of Fd sequence-function relationships. We suggest comparing the functions of divergent Fds within cells whose growth, or other measurable output, requires electron transfer between defined electron donor and acceptor proteins. By comparing Fd-mediated electron transfer with biochemical parameters that govern electron flow, we posit that models that anticipate energy flow across Fd interactomes can be built. This approach is expected to transform our ability to anticipate Fd control over electron flow in cellular settings, an obstacle to the construction of synthetic electron transfer pathways and rational optimization of existing energy-conserving pathways.
Electron-transfer oxidation properties of DNA bases and DNA oligomers.
Fukuzumi, Shunichi; Miyao, Hiroshi; Ohkubo, Kei; Suenobu, Tomoyoshi
2005-04-21
Kinetics for the thermal and photoinduced electron-transfer oxidation of a series of DNA bases with various oxidants having the known one-electron reduction potentials (E(red)) in an aqueous solution at 298 K were examined, and the resulting electron-transfer rate constants (k(et)) were evaluated in light of the free energy relationship of electron transfer to determine the one-electron oxidation potentials (E(ox)) of DNA bases and the intrinsic barrier of the electron transfer. Although the E(ox) value of GMP at pH 7 is the lowest (1.07 V vs SCE) among the four DNA bases, the highest E(ox) value (CMP) is only 0.19 V higher than that of GMP. The selective oxidation of GMP in the thermal electron-transfer oxidation of GMP results from a significant decrease in the pH dependent oxidation potential due to the deprotonation of GMP*+. The one-electron reduced species of the photosensitizer produced by photoinduced electron transfer are observed as the transient absorption spectra when the free energy change of electron transfer is negative. The rate constants of electron-transfer oxidation of the guanine moieties in DNA oligomers with Fe(bpy)3(3+) and Ru(bpy)3(3+) were also determined using DNA oligomers containing different guanine (G) sequences from 1 to 10 G. The rate constants of electron-transfer oxidation of the guanine moieties in single- and double-stranded DNA oligomers with Fe(bpy)3(2+) and Ru(bpy)3(3+) are dependent on the number of sequential guanine molecules as well as on pH.
Simkovic, Martin; Degala, Gregory D; Eaton, Sandra S; Frerman, Frank E
2002-06-15
Electron transfer flavoprotein-ubiquinone oxidoreductase (ETF-QO) is an iron-sulphur flavoprotein and a component of an electron-transfer system that links 10 different mitochondrial flavoprotein dehydrogenases to the mitochondrial bc1 complex via electron transfer flavoprotein (ETF) and ubiquinone. ETF-QO is an integral membrane protein, and the primary sequences of human and porcine ETF-QO were deduced from the sequences of the cloned cDNAs. We have expressed human ETF-QO in Sf9 insect cells using a baculovirus vector. The cDNA encoding the entire protein, including the mitochondrial targeting sequence, was present in the vector. We isolated a membrane-bound form of the enzyme that has a molecular mass identical with that of the mature porcine protein as determined by SDS/PAGE and has an N-terminal sequence that is identical with that predicted for the mature holoenzyme. These data suggest that the heterologously expressed ETF-QO is targeted to mitochondria and processed to the mature, catalytically active form. The detergent-solubilized protein was purified by ion-exchange and hydroxyapatite chromatography. Absorption and EPR spectroscopy and redox titrations are consistent with the presence of flavin and iron-sulphur centres that are very similar to those in the equivalent porcine and bovine proteins. Additionally, the redox potentials of the two prosthetic groups appear similar to those of the other eukaryotic ETF-QO proteins. The steady-state kinetic constants of human ETF-QO were determined with ubiquinone homologues, a ubiquinone analogue, and with human wild-type ETF and a Paracoccus-human chimaeric ETF as varied substrates. The results demonstrate that this expression system provides sufficient amounts of human ETF-QO to enable crystallization and mechanistic investigations of the iron-sulphur flavoprotein.
Park, Jeong-Hoon; Park, Jong-Hun; Je Seong, Hoon; Sul, Woo Jun; Jin, Kang-Hyun; Park, Hee-Deung
2018-07-01
To provide insight into direct interspecies electron transfer via granular activated carbon (GAC), the effect of GAC supplementation on anaerobic digestion was evaluated. Compared to control samples, the GAC supplementation increased the total amount of methane production and its production rate by 31% and 72%, respectively. 16S rDNA sequencing analysis revealed a shift in the archaeal community composition; the Methanosarcina proportion decreased 17%, while the Methanosaeta proportion increased 5.6%. Metagenomic analyses based on shotgun sequencing demonstrated that the abundance of pilA and omcS genes belonging to Geobacter species decreased 69.4% and 29.4%, respectively. Furthermore, the analyses suggested a carbon dioxide reduction pathway rather than an acetate decarboxylation pathway for methane formation. Taken together, these results suggest that GAC improved methane production performance by shifting the microbial community and altering functional genes associated with direct interspecies electron transfer via conductive materials. Copyright © 2018 Elsevier Ltd. All rights reserved.
Potential for direct interspecies electron transfer in methanogenic wastewater digester aggregates.
Morita, Masahiko; Malvankar, Nikhil S; Franks, Ashley E; Summers, Zarath M; Giloteaux, Ludovic; Rotaru, Amelia E; Rotaru, Camelia; Lovley, Derek R
2011-01-01
Mechanisms for electron transfer within microbial aggregates derived from an upflow anaerobic sludge blanket reactor converting brewery waste to methane were investigated in order to better understand the function of methanogenic consortia. The aggregates were electrically conductive, with conductivities 3-fold higher than the conductivities previously reported for dual-species aggregates of Geobacter species in which the two species appeared to exchange electrons via interspecies electron transfer. The temperature dependence response of the aggregate conductance was characteristic of the organic metallic-like conductance previously described for the conductive pili of Geobacter sulfurreducens and was inconsistent with electron conduction through minerals. Studies in which aggregates were incubated with high concentrations of potential electron donors demonstrated that the aggregates had no significant capacity for conversion of hydrogen to methane. The aggregates converted formate to methane but at rates too low to account for the rates at which that the aggregates syntrophically metabolized ethanol, an important component of the reactor influent. Geobacter species comprised 25% of 16S rRNA gene sequences recovered from the aggregates, suggesting that Geobacter species may have contributed to some but probably not all of the aggregate conductivity. Microorganisms most closely related to the acetate-utilizing Methanosaeta concilii accounted for more than 90% of the sequences that could be assigned to methane producers, consistent with the poor capacity for hydrogen and formate utilization. These results demonstrate for the first time that methanogenic wastewater aggregates can be electrically conductive and suggest that direct interspecies electron transfer could be an important mechanism for electron exchange in some methanogenic systems.
Pitteri, Sharon J.; Chrisman, Paul A.; McLuckey, Scott A.
2005-01-01
In this study, the electron-transfer dissociation (ETD) behavior of cations derived from 27 different peptides (22 of which are tryptic peptides) has been studied in a 3D quadrupole ion trap mass spectrometer. Ion/ion reactions between peptide cations and nitrobenzene anions have been examined at both room temperature and in an elevated temperature bath gas environment to form ETD product ions. From the peptides studied, the ETD sequence coverage tends to be inversely related to peptide size. At room temperature, very high sequence coverage (~100%) was observed for small peptides (≤7 amino acids). For medium-sized peptides composed of 8–11 amino acids, the average sequence coverage was 46%. Larger peptides with 14 or more amino acids yielded an average sequence coverage of 23%. Elevated-temperature ETD provided increased sequence coverage over room-temperature experiments for the peptides of greater than 7 residues, giving an average of 67% for medium-sized peptides and 63% for larger peptides. Percent ETD, a measure of the extent of electron transfer, has also been calculated for the peptides and also shows an inverse relation with peptide size. Bath gas temperature does not have a consistent effect on percent ETD, however. For the tryptic peptides, fragmentation is localized at the ends of the peptides suggesting that the distribution of charge within the peptide may play an important role in determining fragmentation sites. A triply protonated peptide has also been studied and shows behavior similar to the doubly charged peptides. These preliminary results suggest that for a given charge state there is a maximum size for which high sequence coverage is obtained and that increasing the bath gas temperature can increase this maximum. PMID:16131079
Tsai, M H; Saier, M H
1995-06-01
Electron transfer flavoproteins (ETF) are alpha beta-heterodimers found in eukaryotic mitochondria and bacteria. We have identified currently sequenced protein members of the ETF-alpha and ETF-beta families. Members of these two families include (a) the ETF subunits of mammals and bacteria, (b) homologous pairs of proteins (FixB/FixA) that are essential for nitrogen fixation in some bacteria, and (c) a pair of carnitine-inducible proteins encoded by two open reading frames in Escherichia coli (YaaQ and YaaR). These three groups of proteins comprise three clusters on both the ETF-alpha and ETF-beta phylogenetic trees, separated from each other by comparable phylogenetic distances. This fact suggests that these two protein families evolved with similar overall rates of evolutionary divergence. Relative regions of sequence conservation are evaluated, and signature sequences for both families are derived.
NV Diamond Micro-Magnetometer Baseline Studies
2009-08-12
to define circular masks of diameters ranging from 100-250nm on the surface. An anisotropic etch was used to transfer the pattern into the crystal...between NV and nearby 13C. (b) Pulse sequence for transfer of electron spin coherence to nuclear spin and repetitive readout. (c) Cumulative Rabi
NASA Astrophysics Data System (ADS)
Weisbrod, Chad R.; Kaiser, Nathan K.; Syka, John E. P.; Early, Lee; Mullen, Christopher; Dunyach, Jean-Jacques; English, A. Michelle; Anderson, Lissa C.; Blakney, Greg T.; Shabanowitz, Jeffrey; Hendrickson, Christopher L.; Marshall, Alan G.; Hunt, Donald F.
2017-09-01
High resolution mass spectrometry is a key technology for in-depth protein characterization. High-field Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR MS) enables high-level interrogation of intact proteins in the most detail to date. However, an appropriate complement of fragmentation technologies must be paired with FTMS to provide comprehensive sequence coverage, as well as characterization of sequence variants, and post-translational modifications. Here we describe the integration of front-end electron transfer dissociation (FETD) with a custom-built 21 tesla FT-ICR mass spectrometer, which yields unprecedented sequence coverage for proteins ranging from 2.8 to 29 kDa, without the need for extensive spectral averaging (e.g., 60% sequence coverage for apo-myoglobin with four averaged acquisitions). The system is equipped with a multipole storage device separate from the ETD reaction device, which allows accumulation of multiple ETD fragment ion fills. Consequently, an optimally large product ion population is accumulated prior to transfer to the ICR cell for mass analysis, which improves mass spectral signal-to-noise ratio, dynamic range, and scan rate. We find a linear relationship between protein molecular weight and minimum number of ETD reaction fills to achieve optimum sequence coverage, thereby enabling more efficient use of instrument data acquisition time. Finally, real-time scaling of the number of ETD reactions fills during method-based acquisition is shown, and the implications for LC-MS/MS top-down analysis are discussed. [Figure not available: see fulltext.
First principles design of a core bioenergetic transmembrane electron-transfer protein
DOE Office of Scientific and Technical Information (OSTI.GOV)
Goparaju, Geetha; Fry, Bryan A.; Chobot, Sarah E.
Here we describe the design, Escherichia coli expression and characterization of a simplified, adaptable and functionally transparent single chain 4-α-helix transmembrane protein frame that binds multiple heme and light activatable porphyrins. Such man-made cofactor-binding oxidoreductases, designed from first principles with minimal reference to natural protein sequences, are known as maquettes. This design is an adaptable frame aiming to uncover core engineering principles governing bioenergetic transmembrane electron-transfer function and recapitulate protein archetypes proposed to represent the origins of photosynthesis. This article is part of a Special Issue entitled Biodesign for Bioenergetics — the design and engineering of electronic transfer cofactors, proteinsmore » and protein networks, edited by Ronald L. Koder and J.L. Ross Anderson.« less
Complexity of genetic sequences modified by horizontal gene transfer and degraded-DNA uptake
NASA Astrophysics Data System (ADS)
Tremberger, George; Dehipawala, S.; Nguyen, A.; Cheung, E.; Sullivan, R.; Holden, T.; Lieberman, D.; Cheung, T.
2015-09-01
Horizontal gene transfer has been a major vehicle for efficient transfer of genetic materials among living species and could be one of the sources for noncoding DNA incorporation into a genome. Our previous study of lnc- RNA sequence complexity in terms of fractal dimension and information entropy shows a tight regulation among the studied genes in numerous diseases. The role of sequence complexity in horizontal transferred genes was investigated with Mealybug in symbiotic relation with a 139K genome microbe and Deinococcus radiodurans as examples. The fractal dimension and entropy showed correlation R-sq of 0.82 (N = 6) for the studied Deinococcus radiodurans sequences. For comparison the Deinococcus radiodurans oxidative stress tolerant catalase and superoxide dismutase genes under extracellular dGMP growth condition showed R-sq ~ 0.42 (N = 6); and the studied arsenate reductase horizontal transferred genes for toxicity survival in several microorganisms showed no correlation. Simulation results showed that R-sq < 0.4 would be improbable at less than one percent chance, suggestive of additional selection pressure when compared to the R-sq ~ 0.29 (N = 21) in the studied transferred genes in Mealybug. The mild correlation of R-sq ~ 0.5 for fractal dimension versus transcription level in the studied Deinococcus radiodurans sequences upon extracellular dGMP growth condition would suggest that lower fractal dimension with less electron density fluctuation favors higher transcription level.
Charge transfer in model peptides: obtaining Marcus parameters from molecular simulation.
Heck, Alexander; Woiczikowski, P Benjamin; Kubař, Tomáš; Giese, Bernd; Elstner, Marcus; Steinbrecher, Thomas B
2012-02-23
Charge transfer within and between biomolecules remains a highly active field of biophysics. Due to the complexities of real systems, model compounds are a useful alternative to study the mechanistic fundamentals of charge transfer. In recent years, such model experiments have been underpinned by molecular simulation methods as well. In this work, we study electron hole transfer in helical model peptides by means of molecular dynamics simulations. A theoretical framework to extract Marcus parameters of charge transfer from simulations is presented. We find that the peptides form stable helical structures with sequence dependent small deviations from ideal PPII helices. We identify direct exposure of charged side chains to solvent as a cause of high reorganization energies, significantly larger than typical for electron transfer in proteins. This, together with small direct couplings, makes long-range superexchange electron transport in this system very slow. In good agreement with experiment, direct transfer between the terminal amino acid side chains can be dicounted in favor of a two-step hopping process if appropriate bridging groups exist. © 2012 American Chemical Society
Real-time electron transfer in respiratory complex I
Verkhovskaya, Marina L.; Belevich, Nikolai; Euro, Liliya; Wikström, Mårten; Verkhovsky, Michael I.
2008-01-01
Electron transfer in complex I from Escherichia coli was investigated by an ultrafast freeze-quench approach. The reaction of complex I with NADH was stopped in the time domain from 90 μs to 8 ms and analyzed by electron paramagnetic resonance (EPR) spectroscopy at low temperatures. The data show that after binding of the first molecule of NADH, two electrons move via the FMN cofactor to the iron–sulfur (Fe/S) centers N1a and N2 with an apparent time constant of ≈90 μs, implying that these two centers should have the highest redox potential in the enzyme. The rate of reduction of center N2 (the last center in the electron transfer sequence) is close to that predicted by electron transfer theory, which argues for the absence of coupled proton transfer or conformational changes during electron transfer from FMN to N2. After fast reduction of N1a and N2, we observe a slow, ≈1-ms component of reduction of other Fe/S clusters. Because all elementary electron transfer rates between clusters are several orders of magnitude higher than this observed rate, we conclude that the millisecond component is limited by a single process corresponding to dissociation of the oxidized NAD+ molecule from its binding site, where it prevents entry of the next NADH molecule. Despite the presence of approximately one ubiquinone per enzyme molecule, no transient semiquinone formation was observed, which has mechanistic implications, suggesting a high thermodynamic barrier for ubiquinone reduction to the semiquinone radical. Possible consequences of these findings for the proton translocation mechanism are discussed. PMID:18316732
Habe, Hiroshi; Kobuna, Akinori; Hosoda, Akifumi; Kosaka, Tomoyuki; Endoh, Takayuki; Tamura, Hiroto; Yamane, Hisakazu; Nojiri, Hideaki; Omori, Toshio; Watanabe, Kazuya
2009-07-01
Desulfotignum balticum utilizes benzoate coupled to sulfate reduction. Two-dimensional polyacrylamide gel electrophoresis (2D-PAGE) analysis was conducted to detect proteins that increased more after growth on benzoate than on butyrate. A comparison of proteins on 2D gels showed that at least six proteins were expressed. The N-terminal sequences of three proteins exhibited significant identities with the alpha and beta subunits of electron transfer flavoprotein (ETF) from anaerobic aromatic-degraders. By sequence analysis of the fosmid clone insert (37,590 bp) containing the genes encoding the ETF subunits, we identified three genes, whose deduced amino acid sequences showed 58%, 74%, and 62% identity with those of Gmet_2267 (Fe-S oxidoreductase), Gmet_2266 (ETF beta subunit), and Gmet_2265 (ETF alpha subunit) respectively, which exist within the 300-kb genomic island of aromatic-degradation genes from Geobacter metallireducens GS-15. The genes encoding ETF subunits found in this study were upregulated in benzoate utilization.
Aronson, Samuel; Babb, Lawrence; Ames, Darren; Gibbs, Richard A; Venner, Eric; Connelly, John J; Marsolo, Keith; Weng, Chunhua; Williams, Marc S; Hartzler, Andrea L; Liang, Wayne H; Ralston, James D; Devine, Emily Beth; Murphy, Shawn; Chute, Christopher G; Caraballo, Pedro J; Kullo, Iftikhar J; Freimuth, Robert R; Rasmussen, Luke V; Wehbe, Firas H; Peterson, Josh F; Robinson, Jamie R; Wiley, Ken; Overby Taylor, Casey
2018-05-31
The eMERGE Network is establishing methods for electronic transmittal of patient genetic test results from laboratories to healthcare providers across organizational boundaries. We surveyed the capabilities and needs of different network participants, established a common transfer format, and implemented transfer mechanisms based on this format. The interfaces we created are examples of the connectivity that must be instantiated before electronic genetic and genomic clinical decision support can be effectively built at the point of care. This work serves as a case example for both standards bodies and other organizations working to build the infrastructure required to provide better electronic clinical decision support for clinicians.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Balla, J.; Espenson, J.H.; Bakac, A.
1995-03-16
In the absence of other reagents, the 17e molybdenum radical, ($eta{sup 5}-C{sub 5}H{sub 5})Mo(CO){sub 3}*, combines to form the stable dimer, [CpMo(CO){sub 3}]{sub 2}. In the presence of TMPD, however, an electron transfer process ensues, in which the normally persistent radical TMPD*{sup +} is produced. Under these conditions, the absorbance of the TMPD*{sup +} radical disappear shortly thereafter. Various kinetic tests have been applied to show that this is the result of a sequence of two electron transfer steps. One is the reaction between CpMo(CO){sub 3}* (Mo*) and TMPD, and the other is the reaction between Mo* and TMPD*{sup +}.more » The net result of the two reactions occurring in sequence is the disproportionation of the molybdenum radical, rather than the combination reaction that occurs in the absence of this redox-active amine. To the contrary, PhNMe{sub 2} shows no such effect, confirming that these observations are correctly attributed to electron transfer and not to ligand-catalyzed disproportionation. That the TMPD-catalyzed sequence really is disproportionation was confirmed by the chemical identification of the products, CpMo(CO){sub 3}{sup -} and CpMo(CO){sub 3}NCCH{sub 3}{sup +}. 40 refs., 8 figs., 1 tab.« less
NASA Astrophysics Data System (ADS)
Cunningham, Paul D.; Bricker, William P.; Díaz, Sebastián A.; Medintz, Igor L.; Bathe, Mark; Melinger, Joseph S.
2017-08-01
Sequence-selective bis-intercalating dyes exhibit large increases in fluorescence in the presence of specific DNA sequences. This property makes this class of fluorophore of particular importance to biosensing and super-resolution imaging. Here we report ultrafast transient anisotropy measurements of resonance energy transfer (RET) between thiazole orange (TO) molecules in a complex formed between the homodimer TOTO and double-stranded (ds) DNA. Biexponential homo-RET dynamics suggest two subpopulations within the ensemble: 80% intercalated and 20% non-intercalated. Based on the application of the transition density cube method to describe the electronic coupling and Monte Carlo simulations of the TOTO/dsDNA geometry, the dihedral angle between intercalated TO molecules is estimated to be 81° ± 5°, corresponding to a coupling strength of 45 ± 22 cm-1. Dye intercalation with this geometry is found to occur independently of the underlying DNA sequence, despite the known preference of TOTO for the nucleobase sequence CTAG. The non-intercalated subpopulation is inferred to have a mean inter-dye separation distance of 19 Å, corresponding to coupling strengths between 0 and 25 cm-1. This information is important to enable the rational design of energy transfer systems that utilize TOTO as a relay dye. The approach used here is generally applicable to determining the electronic coupling strength and intercalation configuration of other dimeric bis-intercalators.
Pierucci, Debora; Brumme, Thomas; Girard, Jean-Christophe; Calandra, Matteo; Silly, Mathieu G; Sirotti, Fausto; Barbier, Antoine; Mauri, Francesco; Ouerghi, Abdelkarim
2016-09-15
The transport properties of few-layer graphene are the directly result of a peculiar band structure near the Dirac point. Here, for epitaxial graphene grown on SiC, we determine the effect of charge transfer from the SiC substrate on the local density of states (LDOS) of trilayer graphene using scaning tunneling microscopy/spectroscopy and angle resolved photoemission spectroscopy (ARPES). Different spectra are observed and are attributed to the existence of two stable polytypes of trilayer: Bernal (ABA) and rhomboedreal (ABC) staking. Their electronic properties strongly depend on the charge transfer from the substrate. We show that the LDOS of ABC stacking shows an additional peak located above the Dirac point in comparison with the LDOS of ABA stacking. The observed LDOS features, reflecting the underlying symmetry of the two polytypes, were reproduced by explicit calculations within density functional theory (DFT) including the charge transfer from the substrate. These findings demonstrate the pronounced effect of stacking order and charge transfer on the electronic structure of trilayer or few layer graphene. Our approach represents a significant step toward understand the electronic properties of graphene layer under electrical field.
NASA Astrophysics Data System (ADS)
Wu, Jiandong; Wei, Juan; Hogan, John D.; Chopra, Pradeep; Joshi, Apoorva; Lu, Weigang; Klein, Joshua; Boons, Geert-Jan; Lin, Cheng; Zaia, Joseph
2018-03-01
Among dissociation methods, negative electron transfer dissociation (NETD) has been proven the most useful for glycosaminoglycan (GAG) sequencing because it produces informative fragmentation, a low degree of sulfate losses, high sensitivity, and translatability to multiple instrument types. The challenge, however, is to distinguish positional sulfation. In particular, NETD has been reported to fail to differentiate 4-O- versus 6-O-sulfation in chondroitin sulfate decasaccharide. This raised the concern of whether NETD is able to differentiate the rare 3-O-sulfation from predominant 6-O-sulfation in heparan sulfate (HS) oligosaccharides. Here, we report that NETD generates highly informative spectra that differentiate sites of O-sulfation on glucosamine residues, enabling structural characterizations of synthetic HS isomers containing 3-O-sulfation. Further, lyase-resistant 3-O-sulfated tetrasaccharides from natural sources were successfully sequenced. Notably, for all of the oligosaccharides in this study, the successful sequencing is based on NETD tandem mass spectra of commonly observed deprotonated precursor ions without derivatization or metal cation adduction, simplifying the experimental workflow and data interpretation. These results demonstrate the potential of NETD as a sensitive analytical tool for detailed, high-throughput structural analysis of highly sulfated GAGs. [Figure not available: see fulltext.
Pitteri, Sharon J.; Chrisman, Paul A.; Hogan, Jason M.; McLuckey, Scott A.
2005-01-01
Ion–ion reactions between a variety of peptide cations (doubly and triply charged) and SO2 anions have been studied in a 3-D quadrupole ion trap, resulting in proton and electron transfer. Electron transfer dissociation (ETD) gives many c- and z-type fragments, resulting in extensive sequence coverage in the case of triply protonated peptides with SO2·−. For triply charged neurotensin, in which a direct comparison can be made between 3-D and linear ion trap results, abundances of ETD fragments relative to one another appear to be similar. Reactions of doubly protonated peptides with SO2·− give much less structural information from ETD than triply protonated peptides. Collision-induced dissociation (CID) of singly charged ions formed in reactions with SO2·− shows a combination of proton and electron transfer products. CID of the singly charged species gives more structural information than ETD of the doubly protonated peptide, but not as much information as ETD of the triply protonated peptide. PMID:15762593
Effects of G-Quadruplex Topology on Electronic Transfer Integrals
Sun, Wenming; Varsano, Daniele; Di Felice, Rosa
2016-01-01
G-quadruplex is a quadruple helical form of nucleic acids that can appear in guanine-rich parts of the genome. The basic unit is the G-tetrad, a planar assembly of four guanines connected by eight hydrogen bonds. Its rich topology and its possible relevance as a drug target for a number of diseases have stimulated several structural studies. The superior stiffness and electronic π-π overlap between consecutive G-tetrads suggest exploitation for nanotechnologies. Here we inspect the intimate link between the structure and the electronic properties, with focus on charge transfer parameters. We show that the electronic couplings between stacked G-tetrads strongly depend on the three-dimensional atomic structure. Furthermore, we reveal a remarkable correlation with the topology: a topology characterized by the absence of syn-anti G-G sequences can better support electronic charge transfer. On the other hand, there is no obvious correlation of the electronic coupling with usual descriptors of the helix shape. We establish a procedure to maximize the correlation with a global helix shape descriptor. PMID:28335314
Kubař, Tomáš; Elstner, Marcus
2013-04-28
In this work, a fragment-orbital density functional theory-based method is combined with two different non-adiabatic schemes for the propagation of the electronic degrees of freedom. This allows us to perform unbiased simulations of electron transfer processes in complex media, and the computational scheme is applied to the transfer of a hole in solvated DNA. It turns out that the mean-field approach, where the wave function of the hole is driven into a superposition of adiabatic states, leads to over-delocalization of the hole charge. This problem is avoided using a surface hopping scheme, resulting in a smaller rate of hole transfer. The method is highly efficient due to the on-the-fly computation of the coarse-grained DFT Hamiltonian for the nucleobases, which is coupled to the environment using a QM/MM approach. The computational efficiency and partial parallel character of the methodology make it possible to simulate electron transfer in systems of relevant biochemical size on a nanosecond time scale. Since standard non-polarizable force fields are applied in the molecular-mechanics part of the calculation, a simple scaling scheme was introduced into the electrostatic potential in order to simulate the effect of electronic polarization. It is shown that electronic polarization has an important effect on the features of charge transfer. The methodology is applied to two kinds of DNA sequences, illustrating the features of transfer along a flat energy landscape as well as over an energy barrier. The performance and relative merit of the mean-field scheme and the surface hopping for this application are discussed.
Swaney, Danielle L; Wenger, Craig D; Thomson, James A; Coon, Joshua J
2009-01-27
Protein phosphorylation is central to the understanding of cellular signaling, and cellular signaling is suggested to play a major role in the regulation of human embryonic stem (ES) cell pluripotency. Here, we describe the use of conventional tandem mass spectrometry-based sequencing technology--collision-activated dissociation (CAD)--and the more recently developed method electron transfer dissociation (ETD) to characterize the human ES cell phosphoproteome. In total, these experiments resulted in the identification of 11,995 unique phosphopeptides, corresponding to 10,844 nonredundant phosphorylation sites, at a 1% false discovery rate (FDR). Among these phosphorylation sites are 5 localized to 2 pluripotency critical transcription factors--OCT4 and SOX2. From these experiments, we conclude that ETD identifies a larger number of unique phosphopeptides than CAD (8,087 to 3,868), more frequently localizes the phosphorylation site to a specific residue (49.8% compared with 29.6%), and sequences whole classes of phosphopeptides previously unobserved.
Brodie, Nicholas I; Huguet, Romain; Zhang, Terry; Viner, Rosa; Zabrouskov, Vlad; Pan, Jingxi; Petrotchenko, Evgeniy V; Borchers, Christoph H
2018-03-06
Top-down hydrogen-deuterium exchange (HDX) analysis using electron capture or transfer dissociation Fourier transform mass spectrometry (FTMS) is a powerful method for the analysis of secondary structure of proteins in solution. The resolution of the method is a function of the degree of fragmentation of backbone bonds in the proteins. While fragmentation is usually extensive near the N- and C-termini, electron capture (ECD) or electron transfer dissociation (ETD) fragmentation methods sometimes lack good coverage of certain regions of the protein, most often in the middle of the sequence. Ultraviolet photodissociation (UVPD) is a recently developed fast-fragmentation technique, which provides extensive backbone fragmentation that can be complementary in sequence coverage to the aforementioned electron-based fragmentation techniques. Here, we explore the application of electrospray ionization (ESI)-UVPD FTMS on an Orbitrap Fusion Lumos Tribrid mass spectrometer to top-down HDX analysis of proteins. We have incorporated UVPD-specific fragment-ion types and fragment-ion mixtures into our isotopic envelope fitting software (HDX Match) for the top-down HDX analysis. We have shown that UVPD data is complementary to ETD, thus improving the overall resolution when used as a combined approach.
Coherent manipulation of non-thermal spin order in optical nuclear polarization experiments
NASA Astrophysics Data System (ADS)
Buntkowsky, Gerd; Ivanov, Konstantin L.; Zimmermann, Herbert; Vieth, Hans-Martin
2017-03-01
Time resolved measurements of Optical Nuclear Polarization (ONP) have been performed on hyperpolarized triplet states in molecular crystals created by light excitation. Transfer of the initial electron polarization to nuclear spins has been studied in the presence of radiofrequency excitation; the experiments have been performed with different pulse sequences using different doped molecular systems. The experimental results clearly demonstrate the dominant role of coherent mechanisms of spin order transfer, which manifest themselves in well pronounced oscillations. These oscillations are of two types, precessions and nutations, having characteristic frequencies, which are the same for the different molecular systems and the pulse sequences applied. Hence, precessions and nutations constitute a general feature of polarization transfer in ONP experiments. In general, coherent manipulation of spin order transfer creates a powerful resource for improving the performance of the ONP method, which paves the way to strong signal enhancement in nuclear magnetic resonance.
Design and engineering of a man-made diffusive electron-transport protein.
Fry, Bryan A; Solomon, Lee A; Leslie Dutton, P; Moser, Christopher C
2016-05-01
Maquettes are man-made cofactor-binding oxidoreductases designed from first principles with minimal reference to natural protein sequences. Here we focus on water-soluble maquettes designed and engineered to perform diffusive electron transport of the kind typically carried out by cytochromes, ferredoxins and flavodoxins and other small proteins in photosynthetic and respiratory energy conversion and oxido-reductive metabolism. Our designs were tested by analysis of electron transfer between heme maquettes and the well-known natural electron transporter, cytochrome c. Electron-transfer kinetics were measured from seconds to milliseconds by stopped-flow, while sub-millisecond resolution was achieved through laser photolysis of the carbon monoxide maquette heme complex. These measurements demonstrate electron transfer from the maquette to cytochrome c, reproducing the timescales and charge complementarity modulation observed in natural systems. The ionic strength dependence of inter-protein electron transfer from 9.7×10(6) M(-1) s(-1) to 1.2×10(9) M(-1) s(-1) follows a simple Debye-Hückel model for attraction between +8 net charged oxidized cytochrome c and -19 net charged heme maquette, with no indication of significant protein dipole moment steering. Successfully recreating essential components of energy conversion and downstream metabolism in man-made proteins holds promise for in vivo clinical intervention and for the production of fuel or other industrial products. This article is part of a Special Issue entitled Biodesign for Bioenergetics--the design and engineering of electronic transfer cofactors, proteins and protein networks, edited by Ronald L. Koder and J.L. Ross Anderson. Copyright © 2015 Elsevier B.V. All rights reserved.
Li, Yongquan; Li, Hongyu
2014-03-01
Studies on Acidithiobacillus ferrooxidans accepting electrons from Fe(II) have previously focused on cytochrome c. However, we have discovered that, besides cytochrome c, type IV pili (Tfp) can transfer electrons. Here, we report conduction by Tfp of A. ferrooxidans analyzed with a conducting-probe atomic force microscope (AFM). The results indicate that the Tfp of A. ferrooxidans are highly conductive. The genome sequence of A. ferrooxidans ATCC 23270 contains two genes, pilV and pilW, which code for pilin domain proteins with the conserved amino acids characteristic of Tfp. Multiple alignment analysis of the PilV and PilW (pilin) proteins indicated that pilV is the adhesin gene while pilW codes for the major protein element of Tfp. The likely function of Tfp is to complete the circuit between the cell surface and Fe(II) oxides. These results indicate that Tfp of A. ferrooxidans might serve as biological nanowires transferring electrons from the surface of Fe(II) oxides to the cell surface. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Design and engineering of a man-made diffusive electron-transport protein
Fry, Bryan A.; Solomon, Lee A.; Dutton, P. Leslie
2016-01-01
Maquettes are man-made cofactor-binding oxidoreductases designed from first principles with minimal reference to natural protein sequences. Here we focus on water-soluble maquettes designed and engineered to perform diffusive electron transport of the kind typically carried out by cytochromes, ferredoxins and flavodoxins and other small proteins in photosynthetic and respiratory energy conversion and oxido-reductive metabolism. Our designs were tested by analysis of electron transfer between heme maquettes and the well-known natural electron transporter, cytochrome c. Electron-transfer kinetics were measured from seconds to milliseconds by stopped-flow, while sub-millisecond resolution was achieved through laser photolysis of the carbon monoxide maquette heme complex. These measurements demonstrate electron transfer from the maquette to cytochrome c, reproducing the timescales and charge complementarity modulation observed in natural systems. The ionic strength dependence of inter-protein electron transfer from 9.7 × 106 M−1s−1 to 1.2 × 109 M−1s−1 follows a simple Debye-Hückel model for attraction between +8 net charged oxidized cytochrome c and −19 net charged heme maquette, with no indication of significant protein dipole moment steering. Successfully recreating essential components of energy conversion and downstream metabolism in man-made proteins holds promise for in vivo clinical intervention and for the production of fuel or other industrial products. PMID:26423266
Comparison of intrinsic dynamics of cytochrome p450 proteins using normal mode analysis
Dorner, Mariah E; McMunn, Ryan D; Bartholow, Thomas G; Calhoon, Brecken E; Conlon, Michelle R; Dulli, Jessica M; Fehling, Samuel C; Fisher, Cody R; Hodgson, Shane W; Keenan, Shawn W; Kruger, Alyssa N; Mabin, Justin W; Mazula, Daniel L; Monte, Christopher A; Olthafer, Augustus; Sexton, Ashley E; Soderholm, Beatrice R; Strom, Alexander M; Hati, Sanchita
2015-01-01
Cytochrome P450 enzymes are hemeproteins that catalyze the monooxygenation of a wide-range of structurally diverse substrates of endogenous and exogenous origin. These heme monooxygenases receive electrons from NADH/NADPH via electron transfer proteins. The cytochrome P450 enzymes, which constitute a diverse superfamily of more than 8,700 proteins, share a common tertiary fold but < 25% sequence identity. Based on their electron transfer protein partner, cytochrome P450 proteins are classified into six broad classes. Traditional methods of pro are based on the canonical paradigm that attributes proteins' function to their three-dimensional structure, which is determined by their primary structure that is the amino acid sequence. It is increasingly recognized that protein dynamics play an important role in molecular recognition and catalytic activity. As the mobility of a protein is an intrinsic property that is encrypted in its primary structure, we examined if different classes of cytochrome P450 enzymes display any unique patterns of intrinsic mobility. Normal mode analysis was performed to characterize the intrinsic dynamics of five classes of cytochrome P450 proteins. The present study revealed that cytochrome P450 enzymes share a strong dynamic similarity (root mean squared inner product > 55% and Bhattacharyya coefficient > 80%), despite the low sequence identity (< 25%) and sequence similarity (< 50%) across the cytochrome P450 superfamily. Noticeable differences in Cα atom fluctuations of structural elements responsible for substrate binding were noticed. These differences in residue fluctuations might be crucial for substrate selectivity in these enzymes. PMID:26130403
Goto, Yuko; Yoshida, Naoko
2017-07-11
Anodes are crucial in determining the electricity recovery of microbial fuel cells (MFCs). In this study, graphene oxide (GO) was used as an anodic material for electricity recovery from artificial dialysis wastewater (ADWW). Anaerobic incubation of ADWW with GO for 21 days produced a hydrogel complex containing embedded microbial cells and microbially reduced GO (rGO). The rGO complex recovered 540 to 810 μA/cm 3 of catalytic current from ADWW after 10 days of electrochemical cultivation at 200 mV (vs. Ag/AgCl), which was approximately thirty times higher than that recovered from graphite felt (GF), a representative anode in MFCs. High-throughput sequencing analysis of prokaryotic 16S rRNA genes revealed a predominance of the Geobacter genus (35% of all prokaryotic sequences identified), particularly in the rGO complex after 20 days of polarization. The superior electricity recovery of the rGO complex was attributable to enhanced direct electron transfer via a well-developed biofilm, while indirect electron transfer via an electron mediator occurred in culture using GF.
Kim, Jiye; Kim, MinJung; An, JinWook; Kim, Yunje
2016-05-01
The aim of this study was to verify that the combination of focused ion beam (FIB) and scanning electron microscope/energy-dispersive X-ray (SEM/EDX) could be applied to determine the sequence of line crossings. The samples were transferred into FIB/SEM for FIB milling and an imaging operation. EDX was able to explore the chemical components and the corresponding elemental distribution in the intersection. The technique was successful in determining the sequence of heterogeneous line intersections produced using gel pens and red sealing ink with highest success rate (100% correctness). These observations show that the FIB/SEM was the appropriate instrument for an overall examination of document. © 2016 American Academy of Forensic Sciences.
Li, Xuesong; Markandeya, Nagula; Jonusauskas, Gediminas; McClenaghan, Nathan D; Maurizot, Victor; Denisov, Sergey A; Huc, Ivan
2016-10-07
A series of photoactive triads have been synthesized and investigated in order to elucidate photoinduced electron transfer and hole migration mechanism across nanosized, rigid helical foldamers. The triads are comprised of a central helical oligoamide foldamer bridge with 9, 14, 18, 19, or 34 8-amino-2-quinolinecarboxylic acid repeat units, and of two chromophores, an N-terminal oligo(para-phenylenevinylene) electron donor and a C-terminal perylene bis-imide electron acceptor. Time-resolved fluorescence and transient absorption spectroscopic studies showed that, following photoexcitation of the electron acceptor, fast electron transfer occurs initially from the oligoquinoline bridge to the acceptor chromophore on the picosecond time scale. The oligo(para-phenylenevinylene) electron donor is oxidized after a time delay during which the hole migrates across the foldamer from the acceptor to the donor. The charge separated state that is finally generated was found to be remarkably long-lived (>80 μs). While the initial charge injection rate is largely invariant for all foldamer lengths (ca. 60 ps), the subsequent hole transfer to the donor varies from 1 × 10 9 s -1 for the longest sequence to 17 × 10 9 s -1 for the shortest. In all cases, charge transfer is very fast considering the foldamer length. Detailed analysis of the process in different media and at varying temperatures is consistent with a hopping mechanism of hole transport through the foldamer helix, with individual hops occurring on the subpicosecond time scale (k ET = 2.5 × 10 12 s -1 in CH 2 Cl 2 ). This work demonstrates the possibility of fast long-range hole transfer over 300 Å (through bonds) across a synthetic modular bridge, an achievement that had been previously observed principally with DNA structures.
NASA Astrophysics Data System (ADS)
Leach, Franklin E.; Riley, Nicholas M.; Westphall, Michael S.; Coon, Joshua J.; Amster, I. Jonathan
2017-09-01
The structural characterization of sulfated glycosaminoglycan (GAG) carbohydrates remains an important target for analytical chemists attributable to challenges introduced by the natural complexity of these mixtures and the defined need for molecular-level details to elucidate biological structure-function relationships. Tandem mass spectrometry has proven to be the most powerful technique for this purpose. Previously, electron detachment dissociation (EDD), in comparison to other methods of ion activation, has been shown to provide the largest number of useful cleavages for de novo sequencing of GAG oligosaccharides, but such experiments are restricted to Fourier transform ion cyclotron resonance mass spectrometers (FTICR-MS). Negative electron transfer dissociation (NETD) provides similar fragmentation results, and can be achieved on any mass spectrometry platform that is designed to accommodate ion-ion reactions. Here, we examine for the first time the effectiveness of NETD-Orbitrap mass spectrometry for the structural analysis of GAG oligosaccharides. Compounds ranging in size from tetrasaccharides to decasaccharides were dissociated by NETD, producing both glycosidic and cross-ring cleavages that enabled the location of sulfate modifications. The highly-sulfated, heparin-like synthetic GAG, ArixtraTM, was also successfully sequenced by NETD. In comparison to other efforts to sequence GAG chains without fully ionized sulfate constituents, the occurrence of sulfate loss peaks is minimized by judicious precursor ion selection. The results compare quite favorably to prior results with electron detachment dissociation (EDD). Significantly, the duty cycle of the NETD experiment is sufficiently short to make it an effective tool for on-line separations, presenting a straightforward path for selective, high-throughput analysis of GAG mixtures. [Figure not available: see fulltext.
Coelho Graça, Didia; Hartmer, Ralf; Jabs, Wolfgang; Beris, Photis; Clerici, Lorella; Stoermer, Carsten; Samii, Kaveh; Hochstrasser, Denis; Tsybin, Yury O; Scherl, Alexander; Lescuyer, Pierre
2015-04-01
Hemoglobin disorder diagnosis is a complex procedure combining several analytical steps. Due to the lack of specificity of the currently used protein analysis methods, the identification of uncommon hemoglobin variants (proteoforms) can become a hard task to accomplish. The aim of this work was to develop a mass spectrometry-based approach to quickly identify mutated protein sequences within globin chain variants. To reach this goal, a top-down electron transfer dissociation mass spectrometry method was developed for hemoglobin β chain analysis. A diagnostic product ion list was established with a color code strategy allowing to quickly and specifically localize a mutation in the hemoglobin β chain sequence. The method was applied to the analysis of rare hemoglobin β chain variants and an (A)γ-β fusion protein. The results showed that the developed data analysis process allows fast and reliable interpretation of top-down electron transfer dissociation mass spectra by nonexpert users in the clinical area.
Swaney, Danielle L.; Wenger, Craig D.; Thomson, James A.; Coon, Joshua J.
2009-01-01
Protein phosphorylation is central to the understanding of cellular signaling, and cellular signaling is suggested to play a major role in the regulation of human embryonic stem (ES) cell pluripotency. Here, we describe the use of conventional tandem mass spectrometry-based sequencing technology—collision-activated dissociation (CAD)—and the more recently developed method electron transfer dissociation (ETD) to characterize the human ES cell phosphoproteome. In total, these experiments resulted in the identification of 11,995 unique phosphopeptides, corresponding to 10,844 nonredundant phosphorylation sites, at a 1% false discovery rate (FDR). Among these phosphorylation sites are 5 localized to 2 pluripotency critical transcription factors—OCT4 and SOX2. From these experiments, we conclude that ETD identifies a larger number of unique phosphopeptides than CAD (8,087 to 3,868), more frequently localizes the phosphorylation site to a specific residue (49.8% compared with 29.6%), and sequences whole classes of phosphopeptides previously unobserved. PMID:19144917
Carbon nanotube-enzyme conjugates for the fabrication of diagnostic biosensors
NASA Astrophysics Data System (ADS)
Karunwi, Olukayode Adedamola
The fabrication of multi-analyte biotransducers continues to be a major technical challenge when the length scales of the individual transducer elements are on the order of microns Generation-3 (Gen-3) biosensors and advanced enzyme biofuel cells will benefit from direct electron transfer to oxidoreductases facilitated by single-walled carbon nanotubes (SWNTs). Direct electron transfer helps to mitigate errors from the instability in oxygen tension, eliminate use of a mediator and produce a device with low operating potential close to the redox potential of the enzymes. Supramolecular conjugates of SWNT-glucose oxidase (GOx-SWNT) may be produced via ultrasonic processing. Using a Plackett-Burman experimental design to investigate the process of tip ultrasonication, conjugate formation was investigated as a function of ultrasonication times and functionalized SWNTs of various tube lengths. Supramolecular conjugates formed from shorter, -OH functionalized SWNTs using longer sonication times gave the most favored combination for forming bioactive conjugates. There has also been growing interest in the fabrication of CNT-enzyme supramolecular constructs that control the placement of SWNTs within tunneling distance of co-factors for enhanced electron transfer efficiency in generation 3 biosensors and advanced biofuel cells. These conjugate systems raise a series of questions such as: Which peptide sequences within the enzymes have high affinity for the SWNTs? And, are these high affinity sequences likely to be in the vicinity of the redox-active co-factor to allow for direct electron transfer? Phage display has recently been used to identify specific peptide sequences that have high affinity for SWNTs. Molecular dynamics simulations were performed to study the interactions of five discrete peptides with (16,0) SWNT in explicit water as well as with graphene. The end residues appear to dominate the progression of adsorption regardless of character. Sequences identified by phage display share some homology with key enzymes (GOx, lactate oxidase and laccase) used in biosensors and enzyme-based biofuel cells. Furthermore, the role of pyrrole electropolymerization as an additive technique for the biofabrication of side-by-side biotransducers for glucose and lactate with minimum cross-talk was investigated along with an electrodeposited layer of Fe/Ni hexacyanoferrate to serve as peroxide mediator, decorated with the electropolymerized PPy-Enzyme biorecognition layer, characterized in vitro, and implanted into the trapezius muscle of a piglet ( Sus scrofa) hemorrhage model. Internal calibration, response under controlled hemorrhage conditions, and post-resection re-characterization were used to evaluate biotransducer performance.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cheung, E.; Taylor, K.; Kornblatt, J.A.
1986-03-01
Rapid mixing of ferrocytochrome c peroxidase (cyt c peroxidase(II)) and ferricytochrome c (cyt c(III)) results in the reduction of cyt c(III) by cyt c peroxidase(II). In 10 mM phosphate, pH 7.0, the rate of decay of cyt c peroxidase(II) and the rate of accumulation of cyt c(II) give equal first-order rate constants. Equivalent results are obtained by pulse radiolysis using isopropanol radical as the reducing agent. This rate is independent of the initial cyt c(III):cyt c peroxidase(II) ratios. These results are consistent with unimolecular electron transfer occurring within a cyt c(III)-cyt c peroxidase(II) complex. When cyt c is replaced bymore » porphyrin cyt c (iron-free cyt c), a complex still forms with cyt c peroxidase. On radiolysis intracomplex electron transfer occurs from the porphyrin cyt c anion radical to cyt c peroxidase(III). This large rate increase suggest that the barrier for intracomplex electron transfer is large. Finally, the authors have briefly investigated how the cyt c peroxidase(II) ..-->.. cyt c(III) rate depends on the primary structure of cyt c(III). They find the reactivity order to be as follows: yeast > horse > tuna.« less
Ishizaki, Kimitsune; Schauer, Nicolas; Larson, Tony R; Graham, Ian A; Fernie, Alisdair R; Leaver, Christopher J
2006-09-01
In mammals, the electron transfer flavoprotein (ETF) is a heterodimeric protein composed of two subunits, alpha and beta, that is responsible for the oxidation of at least nine mitochondrial matrix flavoprotein dehydrogenases. Electrons accepted by ETF are further transferred to the main respiratory chain via the ETF ubiquinone oxide reductase (ETFQO). Sequence analysis of the unique Arabidopsis homologues of two subunits of ETF revealed their high similarity to both subunits of the mammalian ETF. Yeast two-hybrid experiments showed that the Arabidopsis ETFalpha and ETFbeta can form a heteromeric protein. Isolation and characterization of two independent T-DNA insertional Arabidopsis mutants of the ETFbeta gene revealed accelerated senescence and early death compared to wild-type during extended darkness. Furthermore in contrast to wild-type, the etfb mutants demonstrated a significant accumulation of several amino acids, isovaleryl CoA and phytanoyl CoA during dark-induced carbohydrate deprivation. These phenotypic characteristics of etfb mutants are broadly similar to those that we observed previously in Arabidopsis etfqo mutants, suggesting functional association between ETF and ETFQO in Arabidopsis, and confirming the essential roles of the ETF/ETFQO electron transfer complex in the catabolism of leucine and involvement in the chlorophyll degradation pathway activated during dark-induced carbohydrate deprivation.
The R package 'RLumModel': Simulating charge transfer in quartz
NASA Astrophysics Data System (ADS)
Friedrich, Johannes; Kreutzer, Sebastian; Schmidt, Christoph
2017-04-01
Kinetic models of quartz luminescence have gained an important role for predicting experimental results and for understanding charge transfers in (natural) quartz as well as for other dosimetric materials, e.g., Al2O3:C. We present the R package 'RLumModel', offering an easy-to-use tool for simulating quartz luminescence signals (TL, OSL, LM-OSL and RF) based on five integrated and published parameter sets as well as the possibility to use own parameters. Simulation commands can be created (a) using the Risø Sequence Editor, (b) a built-in SAR sequence generator or (c) self-explanatory keywords for customised sequences. Results can be analysed seamlessly using the R package 'Luminescence' along with a visualisation of concentrations of electrons and holes in every trap/centre as well as in the valence and conduction band during all stages of the simulation. Modelling luminescence signals can help understanding charge transfer processes occurring in nature or during measurements in the laboratory. This will lead to a better understanding of several processes concerning geoscientific questions, because quartz is the second most abundant mineral in the Earth's continental crust.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Antonacci, R.; Colombo, I.; Volta, M.
The electron-transfer flavoprotein (ETF), located in the mitochondrial matrix, is a nuclear-encoded enzyme delivering to the respiratory chain electrons by straight-chain acyl-CoA dehydrogenases and other dehydrogenases. ETF is composed of a 35-kDa [alpha]-subunit that is cleaved to a 32-kDa protein during mitochondrial import (ETFA) and a [beta]-subunit that reaches the mitochondrion unmodified (ETFB). The cDNA encoding both these subunits has been cloned and sequenced. 14 refs., 1 fig.
De novo peptide sequencing using CID and HCD spectra pairs.
Yan, Yan; Kusalik, Anthony J; Wu, Fang-Xiang
2016-10-01
In tandem mass spectrometry (MS/MS), there are several different fragmentation techniques possible, including, collision-induced dissociation (CID) higher energy collisional dissociation (HCD), electron-capture dissociation (ECD), and electron transfer dissociation (ETD). When using pairs of spectra for de novo peptide sequencing, the most popular methods are designed for CID (or HCD) and ECD (or ETD) spectra because of the complementarity between them. Less attention has been paid to the use of CID and HCD spectra pairs. In this study, a new de novo peptide sequencing method is proposed for these spectra pairs. This method includes a CID and HCD spectra merging criterion and a parent mass correction step, along with improvements to our previously proposed algorithm for sequencing merged spectra. Three pairs of spectral datasets were used to investigate and compare the performance of the proposed method with other existing methods designed for single spectrum (HCD or CID) sequencing. Experimental results showed that full-length peptide sequencing accuracy was increased significantly by using spectra pairs in the proposed method, with the highest accuracy reaching 81.31%. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Effect of protons on the redox chemistry of colloidal zinc oxide nanocrystals.
Valdez, Carolyn N; Braten, Miles; Soria, Ashley; Gamelin, Daniel R; Mayer, James M
2013-06-12
Electron transfer (ET) reactions of colloidal 3-5 nm diameter ZnO nanocrystals (NCs) with molecular reagents are explored in aprotic solvents. Addition of an excess of the one-electron reductant Cp*2Co (Cp* = pentamethylcyclopentadienyl) gives NCs that are reduced by up to 1-3 electrons per NC. Protons can be added stoichiometrically to the NCs by either a photoreduction/oxidation sequence or by addition of acid. The added protons facilitate the reduction of the ZnO NCs. In the presence of acid, NC reduction by Cp*2Co can be increased to over 15 electrons per NC. The weaker reductant Cp*2Cr transfers electrons only to ZnO NCs in the presence of protons. Cp*2M(+) counterions are much less effective than protons at stabilizing reduced NCs. With excess Cp*2Co or Cp*2Cr, the extent of reduction increases roughly linearly with the number of protons added. Some of the challenges in understanding these results are discussed.
NASA Astrophysics Data System (ADS)
Yang, C. H.; Shen, G. Z.; Ao, Z. M.; Xu, Y. W.
2016-09-01
Using the transfer matrix method, the carrier tunneling properties in graphene superlattice generated by the Thue-Morse sequence and Kolakoski sequence are investigated. The positions and strength of the transmission can be modulated by the barrier structures, the incident energy and angle, the height and width of the potential. These carriers tunneling characteristic can be understood from the energy band structures in the corresponding superlattice systems and the carrier’s states in well/barriers. The transmission peaks above the critical incident angle rely on the carrier’s resonance in the well regions. The structural diversity can modulate the electronic and transport properties, thus expanding its applications.
Development of an Electrochemistry Teaching Sequence Using a Phenomenographic Approach
ERIC Educational Resources Information Center
Rodriguez-Velazquez, Sorangel
2013-01-01
Electrochemistry is the area of chemistry that studies electron transfer reactions across an interface. Chemistry education researchers have acknowledged that difficulties in electrochemistry instruction arise due to the level of abstraction of the topic, lack of adequate explanations and representations found in textbooks, and a quantitative…
Wilks, A; Black, S M; Miller, W L; Ortiz de Montellano, P R
1995-04-04
A human heme oxygenase (hHO-1) gene without the sequence coding for the last 23 amino acids has been expressed in Escherichia coli behind the pho A promoter. The truncated enzyme is obtained in high yields as a soluble, catalytically-active protein, making it available for the first time for detailed mechanistic studies. The purified, truncated hHO-1/heme complex is spectroscopically indistinguishable from that of the rat enzyme and converts heme to biliverdin when reconstituted with rat liver cytochrome P450 reductase. A self-sufficient heme oxygenase system has been obtained by fusing the truncated hHO-1 gene to the gene for human cytochrome P450 reductase without the sequence coding for the 20 amino acid membrane binding domain. Expression of the fusion protein in pCWori+ yields a protein that only requires NADPH for catalytic turnover. The failure of exogenous cytochrome P450 reductase to stimulate turnover and the insensitivity of the catalytic rate toward changes in ionic strength establish that electrons are transferred intramolecularly between the reductase and heme oxygenase domains of the fusion protein. The Vmax for the fusion protein is 2.5 times higher than that for the reconstituted system. Therefore, either the covalent tether does not interfere with normal docking and electron transfer between the flavin and heme domains or alternative but equally efficient electron transfer pathways are available that do not require specific docking.
Petruk, Ariel A.; Bartesaghi, Silvina; Trujillo, Madia; Estrin, Darío A.; Murgida, Daniel; Kalyanaraman, Balaraman; Marti, Marcelo A.; Radi, Rafael
2012-01-01
Experimental studies in hemeproteins and model Tyr/Cys-containing peptides exposed to oxidizing and nitrating species suggest that intramolecular electron transfer (IET) between tyrosyl radicals (Tyr-O●) and Cys residues controls oxidative modification yields. The molecular basis of this IET process is not sufficiently understood with structural atomic detail. Herein, we analyzed using molecular dynamics and quantum mechanics-based computational calculations, mechanistic possibilities for the radical transfer reaction in Tyr/Cys-containing peptides in solution and correlated them with existing experimental data. Our results support that Tyr-O● to Cys radical transfer is mediated by an acid/base equilibrium that involves deprotonation of Cys to form the thiolate, followed by a likely rate-limiting transfer process to yield cysteinyl radical and a Tyr phenolate; proton uptake by Tyr completes the reaction. Both, the pKa values of the Tyr phenol and Cys thiol groups and the energetic and kinetics of the reversible IET are revealed as key physico-chemical factors. The proposed mechanism constitutes a case of sequential, acid/base equilibrium-dependent and solvent-mediated, proton-coupled electron transfer and explains the dependency of oxidative yields in Tyr/Cys peptides as a function of the number of alanine spacers. These findings contribute to explain oxidative modifications in proteins that contain sequence and/or spatially close Tyr-Cys residues. PMID:22640642
Copper and the oxidation of hemoglobin: a comparison of horse and human hemoglobins.
Rifkind, J M; Lauer, L D; Chiang, S C; Li, N C
1976-11-30
Oxidation studies of hemoglobin by Cu(II) indicate that for horse hemoglobin, up to a Cu(II)/heme molar ratio of 0.5, all of the Cu(II) added is used to rapidly oxidize the heme. On the other hand, most of the Cu(II) added to human hemoglobin at low Cu(II)/heme molar ratios is unable to oxidize the heme. Only at Cu(II)/heme molar ratios greater than 0.5 does the amount of oxidation per added Cu(II) approach that of horse hemoglobin. At the same time, binding studies indicate that human hemoglobin has an additional binding site involving one copper for every two hemes, which has a higher copper affinity than the single horse hemoglobin binding site. The Cu(II) oxidation of human hemoglobin is explained utilizing this additional binding site by a mechanism where a transfer of electrons cannot occur between the heme and the Cu(II) bound to the high affinity human binding site. The electron transfer must involve the Cu(II) bound to the lower affinity human hemoglobin binding site, which is similar to the only horse hemoglobin site. The involvement of beta-2 histidine in the binding of this additional copper is indicated by a comparison of the amino acid sequences of various hemoglobins which possess the additional site, with the amino acid sequences of hemoglobins which do not possess the additional site. Zn(II), Hg(II), and N-ethylmaleimide (NEM) are found to decrease the Cu(II) oxidation of hemoglobin. The sulfhydryl reagents, Hg(II) and NEM, produce a very dramatic decrease in the rate of oxidation, which can only be explained by an effect on the rate for the actual transfer of electrons between the Cu(II) and the Fe(II). The effect of Zn(II) is much smaller and can, for the most part, be explained by the increased oxygen affinity, which affects the ligand dissociation process that must precede the electron transfer process.
Babauta, Jerome T; Atci, Erhan; Ha, Phuc T; Lindemann, Stephen R; Ewing, Timothy; Call, Douglas R; Fredrickson, James K; Beyenal, Haluk
2014-01-01
Phototrophic microbial mats frequently exhibit sharp, light-dependent redox gradients that regulate microbial respiration on specific electron acceptors as a function of depth. In this work, a benthic phototrophic microbial mat from Hot Lake, a hypersaline, epsomitic lake located near Oroville in north-central Washington, was used to develop a microscale electrochemical method to study local electron transfer processes within the mat. To characterize the physicochemical variables influencing electron transfer, we initially quantified redox potential, pH, and dissolved oxygen gradients by depth in the mat under photic and aphotic conditions. We further demonstrated that power output of a mat fuel cell was light-dependent. To study local electron transfer processes, we deployed a microscale electrode (microelectrode) with tip size ~20 μm. To enrich a subset of microorganisms capable of interacting with the microelectrode, we anodically polarized the microelectrode at depth in the mat. Subsequently, to characterize the microelectrode-associated community and compare it to the neighboring mat community, we performed amplicon sequencing of the V1-V3 region of the 16S gene. Differences in Bray-Curtis beta diversity, illustrated by large changes in relative abundance at the phylum level, suggested successful enrichment of specific mat community members on the microelectrode surface. The microelectrode-associated community exhibited substantially reduced alpha diversity and elevated relative abundances of Prosthecochloris, Loktanella, Catellibacterium, other unclassified members of Rhodobacteraceae, Thiomicrospira, and Limnobacter, compared with the community at an equivalent depth in the mat. Our results suggest that local electron transfer to an anodically polarized microelectrode selected for a specific microbial population, with substantially more abundance and diversity of sulfur-oxidizing phylotypes compared with the neighboring mat community.
Babauta, Jerome T.; Atci, Erhan; Ha, Phuc T.; Lindemann, Stephen R.; Ewing, Timothy; Call, Douglas R.; Fredrickson, James K.; Beyenal, Haluk
2014-01-01
Phototrophic microbial mats frequently exhibit sharp, light-dependent redox gradients that regulate microbial respiration on specific electron acceptors as a function of depth. In this work, a benthic phototrophic microbial mat from Hot Lake, a hypersaline, epsomitic lake located near Oroville in north-central Washington, was used to develop a microscale electrochemical method to study local electron transfer processes within the mat. To characterize the physicochemical variables influencing electron transfer, we initially quantified redox potential, pH, and dissolved oxygen gradients by depth in the mat under photic and aphotic conditions. We further demonstrated that power output of a mat fuel cell was light-dependent. To study local electron transfer processes, we deployed a microscale electrode (microelectrode) with tip size ~20 μm. To enrich a subset of microorganisms capable of interacting with the microelectrode, we anodically polarized the microelectrode at depth in the mat. Subsequently, to characterize the microelectrode-associated community and compare it to the neighboring mat community, we performed amplicon sequencing of the V1–V3 region of the 16S gene. Differences in Bray-Curtis beta diversity, illustrated by large changes in relative abundance at the phylum level, suggested successful enrichment of specific mat community members on the microelectrode surface. The microelectrode-associated community exhibited substantially reduced alpha diversity and elevated relative abundances of Prosthecochloris, Loktanella, Catellibacterium, other unclassified members of Rhodobacteraceae, Thiomicrospira, and Limnobacter, compared with the community at an equivalent depth in the mat. Our results suggest that local electron transfer to an anodically polarized microelectrode selected for a specific microbial population, with substantially more abundance and diversity of sulfur-oxidizing phylotypes compared with the neighboring mat community. PMID:24478768
DOE Office of Scientific and Technical Information (OSTI.GOV)
Babauta, Jerome T.; Atci, Erhan; Ha, Phuc T.
2014-01-01
Phototrophic microbial mats frequently exhibit sharp, light-dependent redox gradients that regulate microbial respiration on specific electron acceptors as a function of depth. In this work, a benthic phototrophic microbial mat from Hot Lake, a hypersaline, epsomitic lake located near Oroville in north-central Washington, was used to develop a microscale electrochemical method to study local electron transfer processes within the mat. To characterize the physicochemical variables influencing electron transfer, we initially quantified redox potential, pH, and dissolved oxygen gradients by depth in the mat under photic and aphotic conditions. We further demonstrated that power output of a mat fuel cell wasmore » light-dependent. To study local electron transfer processes, we deployed a microscale electrode (microelectrode) with tip size ~20 μm. To enrich a subset of microorganisms capable of interacting with the microelectrode, we anodically polarized the microelectrode at depth in the mat. Subsequently, to characterize the microelectrode- associated community and compare it to the neighboring mat community, we performed amplicon sequencing of the V1-V3 region of the 16S gene. Differences in Bray-Curtis beta diversity, illustrated by large changes in relative abundance at the phylum level, suggested successful enrichment of specific mat community members on the microelectrode surface. The microelectrode-associated community exhibited substantially reduced alpha diversity and elevated relative abundances of Prosthecochloris, Loktanella, Catellibacterium, other unclassified members of Rhodobacteraceae, Thiomicrospira, and Limnobacter, compared with the community at an equivalent depth in the mat. Our results suggest that local electron transfer to an anodically polarized microelectrode selected for a specific microbial population, with substantially more abundance and diversity of sulfur-oxidizing phylotypes compared with the neighboring mat community.« less
Alternating electron and proton transfer steps in photosynthetic water oxidation
Klauss, André; Haumann, Michael; Dau, Holger
2012-01-01
Water oxidation by cyanobacteria, algae, and plants is pivotal in oxygenic photosynthesis, the process that powers life on Earth, and is the paradigm for engineering solar fuel–production systems. Each complete reaction cycle of photosynthetic water oxidation requires the removal of four electrons and four protons from the catalytic site, a manganese–calcium complex and its protein environment in photosystem II. In time-resolved photothermal beam deflection experiments, we monitored apparent volume changes of the photosystem II protein associated with charge creation by light-induced electron transfer (contraction) and charge-compensating proton relocation (expansion). Two previously invisible proton removal steps were detected, thereby filling two gaps in the basic reaction-cycle model of photosynthetic water oxidation. In the S2 → S3 transition of the classical S-state cycle, an intermediate is formed by deprotonation clearly before electron transfer to the oxidant (). The rate-determining elementary step (τ, approximately 30 µs at 20 °C) in the long-distance proton relocation toward the protein–water interface is characterized by a high activation energy (Ea = 0.46 ± 0.05 eV) and strong H/D kinetic isotope effect (approximately 6). The characteristics of a proton transfer step during the S0 → S1 transition are similar (τ, approximately 100 µs; Ea = 0.34 ± 0.08 eV; kinetic isotope effect, approximately 3); however, the proton removal from the Mn complex proceeds after electron transfer to . By discovery of the transient formation of two further intermediate states in the reaction cycle of photosynthetic water oxidation, a temporal sequence of strictly alternating removal of electrons and protons from the catalytic site is established. PMID:22988080
Alternating electron and proton transfer steps in photosynthetic water oxidation.
Klauss, André; Haumann, Michael; Dau, Holger
2012-10-02
Water oxidation by cyanobacteria, algae, and plants is pivotal in oxygenic photosynthesis, the process that powers life on Earth, and is the paradigm for engineering solar fuel-production systems. Each complete reaction cycle of photosynthetic water oxidation requires the removal of four electrons and four protons from the catalytic site, a manganese-calcium complex and its protein environment in photosystem II. In time-resolved photothermal beam deflection experiments, we monitored apparent volume changes of the photosystem II protein associated with charge creation by light-induced electron transfer (contraction) and charge-compensating proton relocation (expansion). Two previously invisible proton removal steps were detected, thereby filling two gaps in the basic reaction-cycle model of photosynthetic water oxidation. In the S(2) → S(3) transition of the classical S-state cycle, an intermediate is formed by deprotonation clearly before electron transfer to the oxidant (Y Z OX). The rate-determining elementary step (τ, approximately 30 µs at 20 °C) in the long-distance proton relocation toward the protein-water interface is characterized by a high activation energy (E(a) = 0.46 ± 0.05 eV) and strong H/D kinetic isotope effect (approximately 6). The characteristics of a proton transfer step during the S(0) → S(1) transition are similar (τ, approximately 100 µs; E(a) = 0.34 ± 0.08 eV; kinetic isotope effect, approximately 3); however, the proton removal from the Mn complex proceeds after electron transfer to . By discovery of the transient formation of two further intermediate states in the reaction cycle of photosynthetic water oxidation, a temporal sequence of strictly alternating removal of electrons and protons from the catalytic site is established.
Three-dimensional structure of human electron transfer flavoprotein to 2.1-Å resolution
Roberts, David L.; Frerman, Frank E.; Kim, Jung-Ja P.
1996-01-01
Mammalian electron transfer flavoproteins (ETF) are heterodimers containing a single equivalent of flavin adenine dinucleotide (FAD). They function as electron shuttles between primary flavoprotein dehydrogenases involved in mitochondrial fatty acid and amino acid catabolism and the membrane-bound electron transfer flavoprotein ubiquinone oxidoreductase. The structure of human ETF solved to 2.1-Å resolution reveals that the ETF molecule is comprised of three distinct domains: two domains are contributed by the α subunit and the third domain is made up entirely by the β subunit. The N-terminal portion of the α subunit and the majority of the β subunit have identical polypeptide folds, in the absence of any sequence homology. FAD lies in a cleft between the two subunits, with most of the FAD molecule residing in the C-terminal portion of the α subunit. Alignment of all the known sequences for the ETF α subunits together with the putative FixB gene product shows that the residues directly involved in FAD binding are conserved. A hydrogen bond is formed between the N5 of the FAD isoalloxazine ring and the hydroxyl side chain of αT266, suggesting why the pathogenic mutation, αT266M, affects ETF activity in patients with glutaric acidemia type II. Hydrogen bonds between the 4′-hydroxyl of the ribityl chain of FAD and N1 of the isoalloxazine ring, and between αH286 and the C2-carbonyl oxygen of the isoalloxazine ring, may play a role in the stabilization of the anionic semiquinone. With the known structure of medium chain acyl-CoA dehydrogenase, we hypothesize a possible structure for docking the two proteins. PMID:8962055
Storoniak, Piotr; Rak, Janusz; Polska, Katarzyna; Blancafort, Lluís
2011-04-21
The UV electronic transition energies and their oscillator strengths for two stacked dimers having B-DNA geometries and consisting of 5-bromouracil ((Br)U) and a purine base were studied at the MS-CASPT2/6-311G(d) level with an active space of 12 orbitals and 12 electrons. The calculated energy of the first vertical (π,π*) transitions for the studied dimers remain in fair agreement with the maxima in the difference spectra measured for duplexes with the 5'-A(Br)U-3' or 5'-G(Br)U-3' sequences. Our MS-CASPT2 results show that the charge transfer (CT) states in which an electron is transferred from A/G to (Br)U are located at much higher energies than the first (π,π*) transitions, which involve local excitation (LE) of (Br)U. Moreover, CT transitions are characterized by small oscillator strengths, which implies that they could not be excited directly. The results of the current studies suggest that the formation of the reactive uracil-5-yl radical in DNA is preceded by the formation of the highly oxidative LE state of (Br)U, which is followed by electron transfer, presumably from guanine.
NASA Technical Reports Server (NTRS)
McManus, J. D.; Brune, D. C.; Han, J.; Sanders-Loehr, J.; Meyer, T. E.; Cusanovich, M. A.; Tollin, G.; Blankenship, R. E.
1992-01-01
Three small blue copper proteins designated auracyanin A, auracyanin B-1, and auracyanin B-2 have been isolated from the thermophilic green gliding photosynthetic bacterium Chloroflexus aurantiacus. All three auracyanins are peripheral membrane proteins. Auracyanin A was described previously (Trost, J. T., McManus, J. D., Freeman, J. C., Ramakrishna, B. L., and Blankenship, R. E. (1988) Biochemistry 27, 7858-7863) and is not glycosylated. The two B forms are glycoproteins and have almost identical properties to each other, but are distinct from the A form. The sodium dodecyl sulfate-polyacrylamide gel electrophoresis apparent monomer molecular masses are 14 (A), 18 (B-2), and 22 (B-1) kDa. The amino acid sequences of the B forms are presented. All three proteins have similar absorbance, circular dichroism, and resonance Raman spectra, but the electron spin resonance signals are quite different. Laser flash photolysis kinetic analysis of the reactions of the three forms of auracyanin with lumiflavin and flavin mononucleotide semiquinones indicates that the site of electron transfer is negatively charged and has an accessibility similar to that found in other blue copper proteins. Copper analysis indicates that all three proteins contain 1 mol of copper per mol of protein. All three auracyanins exhibit a midpoint redox potential of +240 mV. Light-induced absorbance changes and electron spin resonance signals suggest that auracyanin A may play a role in photosynthetic electron transfer. Kinetic data indicate that all three proteins can donate electrons to cytochrome c-554, the electron donor to the photosynthetic reaction center.
De novo design and engineering of functional metal and porphyrin-binding protein domains
NASA Astrophysics Data System (ADS)
Everson, Bernard H.
In this work, I describe an approach to the rational, iterative design and characterization of two functional cofactor-binding protein domains. First, a hybrid computational/experimental method was developed with the aim of algorithmically generating a suite of porphyrin-binding protein sequences with minimal mutual sequence information. This method was explored by generating libraries of sequences, which were then expressed and evaluated for function. One successful sequence is shown to bind a variety of porphyrin-like cofactors, and exhibits light- activated electron transfer in mixed hemin:chlorin e6 and hemin:Zn(II)-protoporphyrin IX complexes. These results imply that many sophisticated functions such as cofactor binding and electron transfer require only a very small number of residue positions in a protein sequence to be fixed. Net charge and hydrophobic content are important in determining protein solubility and stability. Accordingly, rational modifications were made to the aforementioned design procedure in order to improve its overall success rate. The effects of these modifications are explored using two `next-generation' sequence libraries, which were separately expressed and evaluated. Particular modifications to these design parameters are demonstrated to effectively double the purification success rate of the procedure. Finally, I describe the redesign of the artificial di-iron protein DF2 into CDM13, a single chain di-Manganese four-helix bundle. CDM13 acts as a functional model of natural manganese catalase, exhibiting a kcat of 0.08s-1 under steady-state conditions. The bound manganese cofactors have a reduction potential of +805 mV vs NHE, which is too high for efficient dismutation of hydrogen peroxide. These results indicate that as a high-potential manganese complex, CDM13 may represent a promising first step toward a polypeptide model of the Oxygen Evolving Complex of the photosynthetic enzyme Photosystem II.
Tsiatsiani, Liana; Giansanti, Piero; Scheltema, Richard A; van den Toorn, Henk; Overall, Christopher M; Altelaar, A F Maarten; Heck, Albert J R
2017-02-03
A key step in shotgun proteomics is the digestion of proteins into peptides amenable for mass spectrometry. Tryptic peptides can be readily sequenced and identified by collision-induced dissociation (CID) or higher-energy collisional dissociation (HCD) because the fragmentation rules are well-understood. Here, we investigate LysargiNase, a perfect trypsin mirror protease, because it cleaves equally specific at arginine and lysine residues, albeit at the N-terminal end. LysargiNase peptides are therefore practically tryptic-like in length and sequence except that following ESI, the two protons are now both positioned at the N-terminus. Here, we compare side-by-side the chromatographic separation properties, gas-phase fragmentation characteristics, and (phospho)proteome sequence coverage of tryptic (i.e., (X) n K/R) and LysargiNase (i.e., K/R(X) n ) peptides using primarily electron-transfer dissociation (ETD) and, for comparison, HCD. We find that tryptic and LysargiNase peptides fragment nearly as mirror images. For LysargiNase predominantly N-terminal peptide ions (c-ions (ETD) and b-ions (HCD)) are formed, whereas for trypsin, C-terminal fragment ions dominate (z-ions (ETD) and y-ions (HCD)) in a homologous mixture of complementary ions. Especially during ETD, LysargiNase peptides fragment into low-complexity but information-rich sequence ladders. Trypsin and LysargiNase chart distinct parts of the proteome, and therefore, the combined use of these enzymes will benefit a more in-depth and reliable analysis of (phospho)proteomes.
Biochemistry of Catabolic Reductive Dehalogenation.
Fincker, Maeva; Spormann, Alfred M
2017-06-20
A wide range of phylogenetically diverse microorganisms couple the reductive dehalogenation of organohalides to energy conservation. Key enzymes of such anaerobic catabolic pathways are corrinoid and Fe-S cluster-containing, membrane-associated reductive dehalogenases. These enzymes catalyze the reductive elimination of a halide and constitute the terminal reductases of a short electron transfer chain. Enzymatic and physiological studies revealed the existence of quinone-dependent and quinone-independent reductive dehalogenases that are distinguishable at the amino acid sequence level, implying different modes of energy conservation in the respective microorganisms. In this review, we summarize current knowledge about catabolic reductive dehalogenases and the electron transfer chain they are part of. We review reaction mechanisms and the role of the corrinoid and Fe-S cluster cofactors and discuss physiological implications.
Thrombin-Binding Aptamer Quadruplex Formation: AFM and Voltammetric Characterization
Diculescu, Victor Constantin; Chiorcea-Paquim, Ana-Maria; Eritja, Ramon; Oliveira-Brett, Ana Maria
2010-01-01
The adsorption and the redox behaviour of thrombin-binding aptamer (TBA) and extended TBA (eTBA) were studied using atomic force microscopy and voltammetry at highly oriented pyrolytic graphite and glassy carbon. The different adsorption patterns and degree of surface coverage were correlated with the sequence base composition, presence/absence of K+, and voltammetric behaviour of TBA and eTBA. In the presence of K+, only a few single-stranded sequences present adsorption, while the majority of the molecules forms stable and rigid quadruplexes with no adsorption. Both TBA and eTBA are oxidized and the only anodic peak corresponds to guanine oxidation. Upon addition of K+ ions, TBA and eTBA fold into a quadruplex, causing the decrease of guanine oxidation peak and occurrence of a new peak at a higher potential due to the oxidation of G-quartets. The higher oxidation potential of G-quartets is due to the greater difficulty of electron transfer from the inside of the quadruplex to the electrode surface than electron transfer from the more flexible single strands. PMID:20798847
Regulation of electron transfer processes affects phototrophic mat structure and activity
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ha, Phuc T.; Renslow, Ryan S.; Atci, Erhan
Phototrophic microbial mats are among the most diverse ecosystems in nature. These systems undergo daily cycles in redox potential caused by variations in light energy input and metabolic interactions among the microbial species. In this work, solid electrodes with controlled potentials were placed under mats to study the electron transfer processes between the electrode and the microbial mat. The phototrophic microbial mat was harvested from Hot Lake, a hypersaline, epsomitic lake located near Oroville (Washington, USA). We operated two reactors: graphite electrodes were polarized at potentials of -700 mV Ag/AgCl [cathodic (CAT) mat system] and +300 mV Ag/AgCl [anodic (AN)more » mat system] and the electron transfer rates between the electrode and mat were monitored. We observed a diel cycle of electron transfer rates for both AN and CAT mat systems. Interestingly, the CAT mats generated the highest reducing current at the same time points that the AN mats showed the highest oxidizing current. To characterize the physicochemical factors influencing electron transfer processes, we measured depth profiles of dissolved oxygen (DO) and sulfide in the mats using microelectrodes. We further demonstrated that the mat-to-electrode and electrode-to-mat electron transfer rates were light- and temperature-dependent. Using nuclear magnetic resonance (NMR) imaging, we determined that the electrode potential regulated the diffusivity and porosity of the microbial mats. Both porosity and diffusivity were higher in the CAT mats than in the AN mats. We also used NMR spectroscopy for high-resolution quantitative metabolite analysis and found that the CAT mats had significantly higher concentrations of osmoprotectants such as betaine and trehalose. Subsequently, we performed amplicon sequencing across the V4 region of the 16S rRNA gene of incubated mats to understand the impact of electrode potential on microbial community structure. In conclusion, these data suggested that variation in the electrochemical conditions under which mats were generated significantly impacted the relative abundances of mat members and mat metabolism.« less
Regulation of electron transfer processes affects phototrophic mat structure and activity
Ha, Phuc T.; Renslow, Ryan S.; Atci, Erhan; ...
2015-09-03
Phototrophic microbial mats are among the most diverse ecosystems in nature. These systems undergo daily cycles in redox potential caused by variations in light energy input and metabolic interactions among the microbial species. In this work, solid electrodes with controlled potentials were placed under mats to study the electron transfer processes between the electrode and the microbial mat. The phototrophic microbial mat was harvested from Hot Lake, a hypersaline, epsomitic lake located near Oroville (Washington, USA). We operated two reactors: graphite electrodes were polarized at potentials of -700 mV Ag/AgCl [cathodic (CAT) mat system] and +300 mV Ag/AgCl [anodic (AN)more » mat system] and the electron transfer rates between the electrode and mat were monitored. We observed a diel cycle of electron transfer rates for both AN and CAT mat systems. Interestingly, the CAT mats generated the highest reducing current at the same time points that the AN mats showed the highest oxidizing current. To characterize the physicochemical factors influencing electron transfer processes, we measured depth profiles of dissolved oxygen (DO) and sulfide in the mats using microelectrodes. We further demonstrated that the mat-to-electrode and electrode-to-mat electron transfer rates were light- and temperature-dependent. Using nuclear magnetic resonance (NMR) imaging, we determined that the electrode potential regulated the diffusivity and porosity of the microbial mats. Both porosity and diffusivity were higher in the CAT mats than in the AN mats. We also used NMR spectroscopy for high-resolution quantitative metabolite analysis and found that the CAT mats had significantly higher concentrations of osmoprotectants such as betaine and trehalose. Subsequently, we performed amplicon sequencing across the V4 region of the 16S rRNA gene of incubated mats to understand the impact of electrode potential on microbial community structure. In conclusion, these data suggested that variation in the electrochemical conditions under which mats were generated significantly impacted the relative abundances of mat members and mat metabolism.« less
Belevich, Nikolai P; Bertsova, Yulia V; Verkhovskaya, Marina L; Baykov, Alexander A; Bogachev, Alexander V
2016-02-01
Bacterial Na(+)-translocating NADH:quinone oxidoreductase (Na(+)-NQR) uses a unique set of prosthetic redox groups-two covalently bound FMN residues, a [2Fe-2S] cluster, FAD, riboflavin and a Cys4[Fe] center-to catalyze electron transfer from NADH to ubiquinone in a reaction coupled with Na(+) translocation across the membrane. Here we used an ultra-fast microfluidic stopped-flow instrument to determine rate constants and the difference spectra for the six consecutive reaction steps of Vibrio harveyi Na(+)-NQR reduction by NADH. The instrument, with a dead time of 0.25 ms and optical path length of 1 cm allowed collection of visible spectra in 50-μs intervals. By comparing the spectra of reaction steps with the spectra of known redox transitions of individual enzyme cofactors, we were able to identify the chemical nature of most intermediates and the sequence of electron transfer events. A previously unknown spectral transition was detected and assigned to the Cys4[Fe] center reduction. Electron transfer from the [2Fe-2S] cluster to the Cys4[Fe] center and all subsequent steps were markedly accelerated when Na(+) concentration was increased from 20 μM to 25 mM, suggesting coupling of the former step with tight Na(+) binding to or occlusion by the enzyme. An alternating access mechanism was proposed to explain electron transfer between subunits NqrF and NqrC. According to the proposed mechanism, the Cys4[Fe] center is alternatively exposed to either side of the membrane, allowing the [2Fe-2S] cluster of NqrF and the FMN residue of NqrC to alternatively approach the Cys4[Fe] center from different sides of the membrane. Copyright © 2015 Elsevier B.V. All rights reserved.
Fast electron transfer through a single molecule natively structured redox protein
NASA Astrophysics Data System (ADS)
Della Pia, Eduardo Antonio; Chi, Qijin; MacDonald, J. Emyr; Ulstrup, Jens; Jones, D. Dafydd; Elliott, Martin
2012-10-01
The electron transfer properties of proteins are normally measured as molecularly averaged ensembles. Through these and related measurements, proteins are widely regarded as macroscopically insulating materials. Using scanning tunnelling microscopy (STM), we present new measurements of the conductance through single-molecules of the electron transfer protein cytochrome b562 in its native conformation, under pseudo-physiological conditions. This is achieved by thiol (SH) linker pairs at opposite ends of the molecule through protein engineering, resulting in defined covalent contact between a gold surface and a platinum-iridium STM tip. Two different orientations of the linkers were examined: a long-axis configuration (SH-LA) and a short-axis configuration (SH-SA). In each case, the molecular conductance could be `gated' through electrochemical control of the heme redox state. Reproducible and remarkably high conductance was observed in this relatively complex electron transfer system, with single-molecule conductance values peaking around 18 nS and 12 nS for the SH-SA and SH-LA cytochrome b562 molecules near zero electrochemical overpotential. This strongly points to the important role of the heme co-factor bound to the natively structured protein. We suggest that the two-step model of protein electron transfer in the STM geometry requires a multi-electron transfer to explain such a high conductance. The model also yields a low value for the reorganisation energy, implying that solvent reorganisation is largely absent.The electron transfer properties of proteins are normally measured as molecularly averaged ensembles. Through these and related measurements, proteins are widely regarded as macroscopically insulating materials. Using scanning tunnelling microscopy (STM), we present new measurements of the conductance through single-molecules of the electron transfer protein cytochrome b562 in its native conformation, under pseudo-physiological conditions. This is achieved by thiol (SH) linker pairs at opposite ends of the molecule through protein engineering, resulting in defined covalent contact between a gold surface and a platinum-iridium STM tip. Two different orientations of the linkers were examined: a long-axis configuration (SH-LA) and a short-axis configuration (SH-SA). In each case, the molecular conductance could be `gated' through electrochemical control of the heme redox state. Reproducible and remarkably high conductance was observed in this relatively complex electron transfer system, with single-molecule conductance values peaking around 18 nS and 12 nS for the SH-SA and SH-LA cytochrome b562 molecules near zero electrochemical overpotential. This strongly points to the important role of the heme co-factor bound to the natively structured protein. We suggest that the two-step model of protein electron transfer in the STM geometry requires a multi-electron transfer to explain such a high conductance. The model also yields a low value for the reorganisation energy, implying that solvent reorganisation is largely absent. Electronic supplementary information (ESI) available: Experimental methods, DNA and protein sequences, additional STM statistical analysis and images, electrochemical data and It-z data analysis. See DOI: 10.1039/c2nr32131a
Histidine-rich stabilized polyplexes for cMet-directed tumor-targeted gene transfer
NASA Astrophysics Data System (ADS)
Kos, Petra; Lächelt, Ulrich; Herrmann, Annika; Mickler, Frauke Martina; Döblinger, Markus; He, Dongsheng; Krhač Levačić, Ana; Morys, Stephan; Bräuchle, Christoph; Wagner, Ernst
2015-03-01
Overexpression of the hepatocyte growth factor receptor/c-Met proto oncogene on the surface of a variety of tumor cells gives an opportunity to specifically target cancerous tissues. Herein, we report the first use of c-Met as receptor for non-viral tumor-targeted gene delivery. Sequence-defined oligomers comprising the c-Met binding peptide ligand cMBP2 for targeting, a monodisperse polyethylene glycol (PEG) for polyplex surface shielding, and various cationic (oligoethanamino) amide cores containing terminal cysteines for redox-sensitive polyplex stabilization, were assembled by solid-phase supported syntheses. The resulting oligomers exhibited a greatly enhanced cellular uptake and gene transfer over non-targeted control sequences, confirming the efficacy and target-specificity of the formed polyplexes. Implementation of endosomal escape-promoting histidines in the cationic core was required for gene expression without additional endosomolytic agent. The histidine-enriched polyplexes demonstrated stability in serum as well as receptor-specific gene transfer in vivo upon intratumoral injection. The co-formulation with an analogous PEG-free cationic oligomer led to a further compaction of pDNA polyplexes with an obvious change of shape as demonstrated by transmission electron microscopy. Such compaction was critically required for efficient intravenous gene delivery which resulted in greatly enhanced, cMBP2 ligand-dependent gene expression in the distant tumor.Overexpression of the hepatocyte growth factor receptor/c-Met proto oncogene on the surface of a variety of tumor cells gives an opportunity to specifically target cancerous tissues. Herein, we report the first use of c-Met as receptor for non-viral tumor-targeted gene delivery. Sequence-defined oligomers comprising the c-Met binding peptide ligand cMBP2 for targeting, a monodisperse polyethylene glycol (PEG) for polyplex surface shielding, and various cationic (oligoethanamino) amide cores containing terminal cysteines for redox-sensitive polyplex stabilization, were assembled by solid-phase supported syntheses. The resulting oligomers exhibited a greatly enhanced cellular uptake and gene transfer over non-targeted control sequences, confirming the efficacy and target-specificity of the formed polyplexes. Implementation of endosomal escape-promoting histidines in the cationic core was required for gene expression without additional endosomolytic agent. The histidine-enriched polyplexes demonstrated stability in serum as well as receptor-specific gene transfer in vivo upon intratumoral injection. The co-formulation with an analogous PEG-free cationic oligomer led to a further compaction of pDNA polyplexes with an obvious change of shape as demonstrated by transmission electron microscopy. Such compaction was critically required for efficient intravenous gene delivery which resulted in greatly enhanced, cMBP2 ligand-dependent gene expression in the distant tumor. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr06556e
Ishizaki, Kimitsune; Larson, Tony R.; Schauer, Nicolas; Fernie, Alisdair R.; Graham, Ian A.; Leaver, Christopher J.
2005-01-01
In mammals, electron-transfer flavoprotein:ubiquinone oxidoreductase (ETFQO) and electron-transfer flavoprotein (ETF) are functionally associated, and ETF accepts electrons from at least nine mitochondrial matrix flavoprotein dehydrogenases and transfers them to ubiquinone in the inner mitochondrial membrane. In addition, the mammalian ETF/ETFQO system plays a key role in β-oxidation of fatty acids and catabolism of amino acids and choline. By contrast, nothing is known of the function of ETF and ETFQO in plants. Sequence analysis of the unique Arabidopsis thaliana homologue of ETFQO revealed high similarity to the mammalian ETFQO protein. Moreover, green fluorescent protein cellular localization experiments suggested a mitochondrial location for this protein. RNA gel blot analysis revealed that Arabidopsis ETFQO transcripts accumulated in long-term dark-treated leaves. Analysis of three independent insertional mutants of Arabidopsis ETFQO revealed a dramatic reduction in their ability to withstand extended darkness, resulting in senescence and death within 10 d after transfer, whereas wild-type plants remained viable for at least 15 d. Metabolite profiling of dark-treated leaves of the wild type and mutants revealed a dramatic decline in sugar levels. In contrast with the wild type, the mutants demonstrated a significant accumulation of several amino acids, an intermediate of Leu catabolism, and, strikingly, high-level accumulation of phytanoyl-CoA. These data demonstrate the involvement of a mitochondrial protein, ETFQO, in the catabolism of Leu and potentially of other amino acids in higher plants and also imply a novel role for this protein in the chlorophyll degradation pathway activated during dark-induced senescence and sugar starvation. PMID:16055629
Electronic coupling through natural amino acids.
Berstis, Laura; Beckham, Gregg T; Crowley, Michael F
2015-12-14
Myriad scientific domains concern themselves with biological electron transfer (ET) events that span across vast scales of rate and efficiency through a remarkably fine-tuned integration of amino acid (AA) sequences, electronic structure, dynamics, and environment interactions. Within this intricate scheme, many questions persist as to how proteins modulate electron-tunneling properties. To help elucidate these principles, we develop a model set of peptides representing the common α-helix and β-strand motifs including all natural AAs within implicit protein-environment solvation. Using an effective Hamiltonian strategy with density functional theory, we characterize the electronic coupling through these peptides, furthermore considering side-chain dynamics. For both motifs, predictions consistently show that backbone-mediated electronic coupling is distinctly sensitive to AA type (aliphatic, polar, aromatic, negatively charged and positively charged), and to side-chain orientation. The unique properties of these residues may be employed to design activated, deactivated, or switch-like superexchange pathways. Electronic structure calculations and Green's function analyses indicate that localized shifts in the electron density along the peptide play a role in modulating these pathways, and further substantiate the experimentally observed behavior of proline residues as superbridges. The distinct sensitivities of tunneling pathways to sequence and conformation revealed in this electronic coupling database help improve our fundamental understanding of the broad diversity of ET reactivity and provide guiding principles for peptide design.
Le, Nguyen-Quoc-Khanh; Ou, Yu-Yen
2016-07-30
Cellular respiration is a catabolic pathway for producing adenosine triphosphate (ATP) and is the most efficient process through which cells harvest energy from consumed food. When cells undergo cellular respiration, they require a pathway to keep and transfer electrons (i.e., the electron transport chain). Due to oxidation-reduction reactions, the electron transport chain produces a transmembrane proton electrochemical gradient. In case protons flow back through this membrane, this mechanical energy is converted into chemical energy by ATP synthase. The convert process is involved in producing ATP which provides energy in a lot of cellular processes. In the electron transport chain process, flavin adenine dinucleotide (FAD) is one of the most vital molecules for carrying and transferring electrons. Therefore, predicting FAD binding sites in the electron transport chain is vital for helping biologists understand the electron transport chain process and energy production in cells. We used an independent data set to evaluate the performance of the proposed method, which had an accuracy of 69.84 %. We compared the performance of the proposed method in analyzing two newly discovered electron transport protein sequences with that of the general FAD binding predictor presented by Mishra and Raghava and determined that the accuracy of the proposed method improved by 9-45 % and its Matthew's correlation coefficient was 0.14-0.5. Furthermore, the proposed method enabled reducing the number of false positives significantly and can provide useful information for biologists. We developed a method that is based on PSSM profiles and SAAPs for identifying FAD binding sites in newly discovered electron transport protein sequences. This approach achieved a significant improvement after we added SAAPs to PSSM features to analyze FAD binding proteins in the electron transport chain. The proposed method can serve as an effective tool for predicting FAD binding sites in electron transport proteins and can help biologists understand the functions of the electron transport chain, particularly those of FAD binding sites. We also developed a web server which identifies FAD binding sites in electron transporters available for academics.
Faries, Kaitlyn M.; Kressel, Lucas L.; Wander, Marc J.; Holten, Dewey; Laible, Philip D.; Kirmaier, Christine; Hanson, Deborah K.
2012-01-01
Photosynthetic reaction centers convert light energy into chemical energy in a series of transmembrane electron transfer reactions, each with near 100% yield. The structures of reaction centers reveal two symmetry-related branches of cofactors (denoted A and B) that are functionally asymmetric; purple bacterial reaction centers use the A pathway exclusively. Previously, site-specific mutagenesis has yielded reaction centers capable of transmembrane charge separation solely via the B branch cofactors, but the best overall electron transfer yields are still low. In an attempt to better realize the architectural and energetic factors that underlie the directionality and yields of electron transfer, sites within the protein-cofactor complex were targeted in a directed molecular evolution strategy that implements streamlined mutagenesis and high throughput spectroscopic screening. The polycistronic approach enables efficient construction and expression of a large number of variants of a heteroligomeric complex that has two intimately regulated subunits with high sequence similarity, common features of many prokaryotic and eukaryotic transmembrane protein assemblies. The strategy has succeeded in the discovery of several mutant reaction centers with increased efficiency of the B pathway; they carry multiple substitutions that have not been explored or linked using traditional approaches. This work expands our understanding of the structure-function relationships that dictate the efficiency of biological energy-conversion reactions, concepts that will aid the design of bio-inspired assemblies capable of both efficient charge separation and charge stabilization. PMID:22247556
Han, Hongling; Londry, Frank A.; Erickson, David E.; McLuckey, Scott A.
2010-01-01
SUMMARY Broad-band resonance excitation via a tailored waveform in a high pressure collision cell (Q2) on a hybrid quadrupole/time-of-flight (QqTOF) tandem mass spectrometer has been implemented for cation transmission mode electron transfer ion/ion reactions of tryptic polypeptides. The frequency components in the broadband waveform were defined to excite the first generation intact electron transfer products for relatively large tryptic peptides. The optimum amplitude of the arbitrary waveform applied has been determined empirically to be 3.0 Vp-p, which is effective for relatively high mass-to-charge (m/z) ratio precursor ions with little elimination of sequence information for low m/z ions. The application of broadband activation during the transmission mode ion/ion reaction obviates frequency and amplitude tuning normally associated with ion trap collision induced dissociation (CID). This approach has been demonstrated with triply and doubly charged tryptic peptides with and without post-translational modifications. Enhanced structural information was achieved by production of a larger number of informative c- and z-type fragments using the tailored waveform on unmodified and modified (phosphorylated and glycosylated) peptides when the first generation intact electron transfer products fell into the defined frequency range. This approach can be applied to a wide range of tryptic peptide ions, making it attractive as a rapid and general approach for ETD LC-MS/MS of tryptic peptides in a QqTOF instrument. PMID:19305916
NASA Astrophysics Data System (ADS)
Yin, Yiheng; Niu, Yanxiong; Zhang, Huiyun; Zhang, Yuping; Liu, Haiyue
2016-02-01
Utilizing the transfer matrix method, we develop the electronic band structure and transport properties in Thue-Morse aperiodic graphene superlattices with magnetic barriers. It is found that the normal transmission is blocked and the position of the Dirac point can be shifted along the wavevector axis by changing the height and width ratio of magnetic barriers, which is intrinsic different from electronic field modulated superlattices. In addition, the angular threshold property of the transmission spectra and the oscillatory property of the conductance have been studied.
NASA Astrophysics Data System (ADS)
Nandipati, K. R.; Singh, H.; Nagaprasad Reddy, S.; Kumar, K. A.; Mahapatra, S.
2014-12-01
Optimally controlled initiation of intramolecular H-transfer in malonaldehyde is accomplished by designing a sequence of ultrashort (~80 fs) down-chirped pump-dump ultra violet (UV)-laser pulses through an optically bright electronic excited [ S 2 ( π π ∗)] state as a mediator. The sequence of such laser pulses is theoretically synthesized within the framework of optimal control theory (OCT) and employing the well-known pump-dump scheme of Tannor and Rice [D.J. Tannor, S.A. Rice, J. Chem. Phys. 83, 5013 (1985)]. In the OCT, the control task is framed as the maximization of cost functional defined in terms of an objective function along with the constraints on the field intensity and system dynamics. The latter is monitored by solving the time-dependent Schrödinger equation. The initial guess, laser driven dynamics and the optimized pulse structure (i.e., the spectral content and temporal profile) followed by associated mechanism involved in fulfilling the control task are examined in detail and discussed. A comparative account of the dynamical outcomes within the Condon approximation for the transition dipole moment versus its more realistic value calculated ab initio is also presented.
Effects of learning duration on implicit transfer.
Tanaka, Kanji; Watanabe, Katsumi
2015-10-01
Implicit learning and transfer in sequence acquisition play important roles in daily life. Several previous studies have found that even when participants are not aware that a transfer sequence has been transformed from the learning sequence, they are able to perform the transfer sequence faster and more accurately; this suggests implicit transfer of visuomotor sequences. Here, we investigated whether implicit transfer could be modulated by the number of trials completed in a learning session. Participants learned a sequence through trial and error, known as the m × n task (Hikosaka et al. in J Neurophysiol 74:1652-1661, 1995). In the learning session, participants were required to successfully perform the same sequence 4, 12, 16, or 20 times. In the transfer session, participants then learned one of two other sequences: one where the button configuration Vertically Mirrored the learning sequence, or a randomly generated sequence. Our results show that even when participants did not notice the alternation rule (i.e., vertical mirroring), their total working time was less and their total number of errors was lower in the transfer session compared with those who performed a Random sequence, irrespective of the number of trials completed in the learning session. This result suggests that implicit transfer likely occurs even over a shorter learning duration.
Delor, Milan; Sazanovich, Igor V; Towrie, Michael; Weinstein, Julia A
2015-04-21
The Born-Oppenheimer approximation refers to the assumption that the nuclear and electronic wave functions describing a molecular system evolve and can be determined independently. It is now well-known that this approximation often breaks down and that nuclear-electronic (vibronic) coupling contributes greatly to the ultrafast photophysics and photochemistry observed in many systems ranging from simple molecules to biological organisms. In order to probe vibronic coupling in a time-dependent manner, one must use spectroscopic tools capable of correlating the motions of electrons and nuclei on an ultrafast time scale. Recent developments in nonlinear multidimensional electronic and vibrational spectroscopies allow monitoring both electronic and structural factors with unprecedented time and spatial resolution. In this Account, we present recent studies from our group that make use of different variants of frequency-domain transient two-dimensional infrared (T-2DIR) spectroscopy, a pulse sequence combining electronic and vibrational excitations in the form of a UV-visible pump, a narrowband (12 cm(-1)) IR pump, and a broadband (400 cm(-1)) IR probe. In the first example, T-2DIR is used to directly compare vibrational dynamics in the ground and relaxed electronic excited states of Re(Cl)(CO)3(4,4'-diethylester-2,2'-bipyridine) and Ru(4,4'-diethylester-2,2'-bipyridine)2(NCS)2, prototypical charge transfer complexes used in photocatalytic CO2 reduction and electron injection in dye-sensitized solar cells. The experiments show that intramolecular vibrational redistribution (IVR) and vibrational energy transfer (VET) are up to an order of magnitude faster in the triplet charge transfer excited state than in the ground state. These results show the influence of electronic arrangement on vibrational coupling patterns, with direct implications for vibronic coupling mechanisms in charge transfer excited states. In the second example, we show unambiguously that electronic and vibrational movement are coupled in a donor-bridge-acceptor complex based on a Pt(II) trans-acetylide design motif. Time-resolved IR (TRIR) spectroscopy reveals that the rate of electron transfer (ET) is highly dependent on the amount of excess energy localized on the bridge following electronic excitation. Using an adaptation of T-2DIR, we are able to selectively perturb bridge-localized vibrational modes during charge separation, resulting in the donor-acceptor charge separation pathway being completely switched off, with all excess energy redirected toward the formation of a long-lived intraligand triplet state. A series of control experiments reveal that this effect is mode specific: it is only when the high-frequency bridging C≡C stretching mode is pumped that radical changes in photoproduct yields are observed. These experiments therefore suggest that one may perturb electronic movement by stimulating structural motion along the reaction coordinate using IR light. These studies add to a growing body of evidence suggesting that controlling the pathways and efficiency of charge transfer may be achieved through synthetic and perturbative approaches aiming to modulate vibronic coupling. Achieving such control would represent a breakthrough for charge transfer-based applications such as solar energy conversion and molecular electronics.
Fröbel, Sascha; Levi, Lucilla; Ulamec, Sabine M; Gilch, Peter
2016-05-04
Psoralens are heterocyclic compounds which are, among other uses, used to treat skin deseases in the framework of PUVA therapy. In the dark, they intercalate into DNA and can form photoadducts with thymines upon UV-A excitation, which harms the affected cells. We have recently discovered that after excitation of intercalated psoralens, an efficient photoinduced electron transfer (PET) from DNA occurs. Here, the PET is studied in detail by means of femtosecond transient absorption spectroscopy. Using DNA samples that contain either only GC or AT base pairs, we show that only guanine donates the electrons. Additionally, the substituent effects on PET are studied relying on three different psoralen derivatives. The substitution alters spectroscopic and electrochemical properties of the psoralens, which are determined by cyclic voltammetry and steady state spectroscopy. These experiments allow us to estimate the PET energetics, which are in line with the measured kinetics. Implications for the applications of psoralens are discussed. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Chan, Wai Yi Kelly; Chan, T. W. Dominic; O’Connor, Peter B.
2011-01-01
Electron-transfer dissociation (ETD) with supplemental activation of the doubly charged deamidated tryptic digested peptide ions allows differentiation of isoaspartic acid and aspartic acid residues using c + 57 or z• − 57 peaks. The diagnostic peak clearly localizes and characterizes the isoaspartic acid residue. Supplemental activation in ETD of the doubly charged peptide ions involves resonant excitation of the charge reduced precursor radical cations and leads to further dissociation, including extra backbone cleavages and secondary fragmentation. Supplemental activation is essential to obtain a high quality ETD spectrum (especially for doubly charged peptide ions) with sequence information. Unfortunately, the low-resolution of the ion trap mass spectrometer makes detection of the diagnostic peak for the aspartic acid residue difficult due to interference with side-chain loss from arginine and glutamic acid residues. PMID:20304674
Buttet, Géraldine F.; Willemin, Mathilde S.; Hamelin, Romain; Rupakula, Aamani; Maillard, Julien
2018-01-01
Organohalide respiration (OHR) is the energy metabolism of anaerobic bacteria able to use halogenated organic compounds as terminal electron acceptors. While the terminal enzymes in OHR, so-called reductive dehalogenases, are well-characterized, the identity of proteins potentially involved in electron transfer to the terminal enzymes remains elusive. Among the accessory genes identified in OHR gene clusters, the C subunit (rdhC) could well code for the missing redox protein between the quinol pool and the reductive dehalogenase, although it was initially proposed to act as transcriptional regulator. RdhC sequences are characterized by the presence of multiple transmembrane segments, a flavin mononucleotide (FMN) binding motif and two conserved CX3CP motifs. Based on these features, we propose a curated selection of RdhC proteins identified in general sequence databases. Beside the Firmicutes from which RdhC sequences were initially identified, the identified sequences belong to three additional phyla, the Chloroflexi, the Proteobacteria, and the Bacteriodetes. The diversity of RdhC sequences mostly respects the phylogenetic distribution, suggesting that rdhC genes emerged relatively early in the evolution of the OHR metabolism. PceC, the C subunit of the tetrachloroethene (PCE) reductive dehalogenase is encoded by the conserved pceABCT gene cluster identified in Dehalobacter restrictus PER-K23 and in several strains of Desulfitobacterium hafniense. Surfaceome analysis of D. restrictus cells confirmed the predicted topology of the FMN-binding domain (FBD) of PceC that is the exocytoplasmic face of the membrane. Starting from inclusion bodies of a recombinant FBD protein, strategies for successful assembly of the FMN cofactor and refolding were achieved with the use of the flavin-trafficking protein from D. hafniense TCE1. Mass spectrometry analysis and site-directed mutagenesis of rFBD revealed that threonine-168 of PceC is binding FMN covalently. Our results suggest that PceC, and more generally RdhC proteins, may play a role in electron transfer in the metabolism of OHR. PMID:29740408
Swanson, Michael A; Kathirvelu, Velavan; Majtan, Tomas; Frerman, Frank E; Eaton, Gareth R; Eaton, Sandra S
2011-01-01
Human electron transfer flavoprotein (ETF) is a soluble mitochondrial heterodimeric flavoprotein that links fatty acid β-oxidation to the main respiratory chain. The crystal structure of human ETF bound to medium chain acyl-CoA dehydrogenase indicates that the flavin adenine dinucleotide (FAD) domain (αII) is mobile, which permits more rapid electron transfer with donors and acceptors by providing closer access to the flavin and allows ETF to accept electrons from at least 10 different flavoprotein dehydrogenases. Sequence homology is high and low-angle X-ray scattering is identical for Paracoccus denitrificans (P. denitrificans) and human ETF. To characterize the orientations of the αII domain of P. denitrificans ETF, distances between enzymatically reduced FAD and spin labels in the three structural domains were measured by double electron-electron resonance (DEER) at X- and Q-bands. An FAD to spin label distance of 2.8 ± 0.15 nm for the label in the FAD-containing αII domain (A210C) agreed with estimates from the crystal structure (3.0 nm), molecular dynamics simulations (2.7 nm), and rotamer library analysis (2.8 nm). Distances between the reduced FAD and labels in αI (A43C) were between 4.0 and 4.5 ± 0.35 nm and for βIII (A111C) the distance was 4.3 ± 0.15 nm. These values were intermediate between estimates from the crystal structure of P. denitrificans ETF and a homology model based on substrate-bound human ETF. These distances suggest that the αII domain adopts orientations in solution that are intermediate between those which are observed in the crystal structures of free ETF (closed) and ETF bound to a dehydrogenase (open). PMID:21308847
Edgren, Tomas; Nordlund, Stefan
2004-04-01
In our efforts to identify the components participating in electron transport to nitrogenase in Rhodospirillum rubrum, we used mini-Tn5 mutagenesis followed by metronidazole selection. One of the mutants isolated, SNT-1, exhibited a decreased growth rate and about 25% of the in vivo nitrogenase activity compared to the wild-type values. The in vitro nitrogenase activity was essentially wild type, indicating that the mutation affects electron transport to nitrogenase. Sequencing showed that the Tn5 insertion is located in a region with a high level of similarity to fixC, and extended sequencing revealed additional putative fix genes, in the order fixABCX. Complementation of SNT-1 with the whole fix gene cluster in trans restored wild-type nitrogenase activity and growth. Using Western blotting, we demonstrated that expression of fixA and fixB occurs only under conditions under which nitrogenase also is expressed. SNT-1 was further shown to produce larger amounts of both ribulose 1,5-bisphosphate carboxylase/oxygenase and polyhydroxy alkanoates than the wild type, indicating that the redox status is affected in this mutant. Using Western blotting, we found that FixA and FixB are soluble proteins, whereas FixC most likely is a transmembrane protein. We propose that the fixABCX genes encode a membrane protein complex that plays a central role in electron transfer to nitrogenase in R. rubrum. Furthermore, we suggest that FixC is the link between nitrogen fixation and the proton motive force generated in the photosynthetic reactions.
Electronic coupling through natural amino acids
DOE Office of Scientific and Technical Information (OSTI.GOV)
Berstis, Laura; Beckham, Gregg T., E-mail: michael.crowley@nrel.gov, E-mail: gregg.beckham@nrel.gov; Crowley, Michael F., E-mail: michael.crowley@nrel.gov, E-mail: gregg.beckham@nrel.gov
2015-12-14
Myriad scientific domains concern themselves with biological electron transfer (ET) events that span across vast scales of rate and efficiency through a remarkably fine-tuned integration of amino acid (AA) sequences, electronic structure, dynamics, and environment interactions. Within this intricate scheme, many questions persist as to how proteins modulate electron-tunneling properties. To help elucidate these principles, we develop a model set of peptides representing the common α-helix and β-strand motifs including all natural AAs within implicit protein-environment solvation. Using an effective Hamiltonian strategy with density functional theory, we characterize the electronic coupling through these peptides, furthermore considering side-chain dynamics. For bothmore » motifs, predictions consistently show that backbone-mediated electronic coupling is distinctly sensitive to AA type (aliphatic, polar, aromatic, negatively charged and positively charged), and to side-chain orientation. The unique properties of these residues may be employed to design activated, deactivated, or switch-like superexchange pathways. Electronic structure calculations and Green’s function analyses indicate that localized shifts in the electron density along the peptide play a role in modulating these pathways, and further substantiate the experimentally observed behavior of proline residues as superbridges. The distinct sensitivities of tunneling pathways to sequence and conformation revealed in this electronic coupling database help improve our fundamental understanding of the broad diversity of ET reactivity and provide guiding principles for peptide design.« less
Tuning electronic transport via hepta-alanine peptides junction by tryptophan doping.
Guo, Cunlan; Yu, Xi; Refaely-Abramson, Sivan; Sepunaru, Lior; Bendikov, Tatyana; Pecht, Israel; Kronik, Leeor; Vilan, Ayelet; Sheves, Mordechai; Cahen, David
2016-09-27
Charge migration for electron transfer via the polypeptide matrix of proteins is a key process in biological energy conversion and signaling systems. It is sensitive to the sequence of amino acids composing the protein and, therefore, offers a tool for chemical control of charge transport across biomaterial-based devices. We designed a series of linear oligoalanine peptides with a single tryptophan substitution that acts as a "dopant," introducing an energy level closer to the electrodes' Fermi level than that of the alanine homopeptide. We investigated the solid-state electron transport (ETp) across a self-assembled monolayer of these peptides between gold contacts. The single tryptophan "doping" markedly increased the conductance of the peptide chain, especially when its location in the sequence is close to the electrodes. Combining inelastic tunneling spectroscopy, UV photoelectron spectroscopy, electronic structure calculations by advanced density-functional theory, and dc current-voltage analysis, the role of tryptophan in ETp is rationalized by charge tunneling across a heterogeneous energy barrier, via electronic states of alanine and tryptophan, and by relatively efficient direct coupling of tryptophan to a Au electrode. These results reveal a controlled way of modulating the electrical properties of molecular junctions by tailor-made "building block" peptides.
2010-01-01
dance of pgcA transcripts, consistent with increased expression of pgcA in the adapted strains. One of the mutations doubled the rate of Fe(III) oxide...sequenced bacterial genomes. BMC Genomics 8: 274. Herring, C.D., Raghunathan, A., Honisch, C., Patel, T., Apple- bee , M.K., Joyce, A.R., et al. (2006
ERIC Educational Resources Information Center
Wollmer, Richard D.; Bond, Nicholas A.
Two computer-assisted instruction programs were written in electronics and trigonometry to test the Wollmer Markov Model for optimizing hierarchial learning; calibration samples totalling 110 students completed these programs. Since the model postulated that transfer effects would be a function of the amount of practice, half of the students were…
Long-distance electron transfer by cable bacteria in aquifer sediments
Müller, Hubert; Bosch, Julian; Griebler, Christian; Damgaard, Lars Riis; Nielsen, Lars Peter; Lueders, Tillmann; Meckenstock, Rainer U
2016-01-01
The biodegradation of organic pollutants in aquifers is often restricted to the fringes of contaminant plumes where steep countergradients of electron donors and acceptors are separated by limited dispersive mixing. However, long-distance electron transfer (LDET) by filamentous ‘cable bacteria' has recently been discovered in marine sediments to couple spatially separated redox half reactions over centimeter scales. Here we provide primary evidence that such sulfur-oxidizing cable bacteria can also be found at oxic–anoxic interfaces in aquifer sediments, where they provide a means for the direct recycling of sulfate by electron transfer over 1–2-cm distance. Sediments were taken from a hydrocarbon-contaminated aquifer, amended with iron sulfide and saturated with water, leaving the sediment surface exposed to air. Steep geochemical gradients developed in the upper 3 cm, showing a spatial separation of oxygen and sulfide by 9 mm together with a pH profile characteristic for sulfur oxidation by LDET. Bacterial filaments, which were highly abundant in the suboxic zone, were identified by sequencing of 16S rRNA genes and fluorescence in situ hybridization (FISH) as cable bacteria belonging to the Desulfobulbaceae. The detection of similar Desulfobulbaceae at the oxic–anoxic interface of fresh sediment cores taken at a contaminated aquifer suggests that LDET may indeed be active at the capillary fringe in situ. PMID:27058505
Electron Transfer Dissociation of iTRAQ Labeled Peptide Ions
Han, Hongling; Pappin, Darryl J.; Ross, Philip L; McLuckey, Scott A.
2009-01-01
Triply and doubly charged iTRAQ (isobaric tagging for relative and absolute quantitation) labeled peptide cations from a tryptic peptide mixture of bovine carbonic anhydrase II were subjected to electron transfer ion/ion reactions to investigate the effect of charge bearing modifications associated with iTRAQ on the fragmentation pattern. It was noted that electron transfer dissociation (ETD) of triply charged or activated ETD (ETD + supplemental collisional activation of intact electron transfer species) of doubly charged iTRAQ tagged peptide ions yielded extensive sequence information, in analogy with ETD of unmodified peptide ions. That is, addition of the fixed charge iTRAQ tag showed relatively little deleterious effect on the ETD performance of the modified peptides. ETD of the triply charged iTRAQ labeled peptide ions followed by collision-induced dissociation (CID) of the product ion at m/z 162 yielded the reporter ion at m/z 116, which is the reporter ion used for quantitation via CID of the same precursor ions. The reporter ion formed via the two-step activation process is expected to provide quantitative information similar to that directly produced from CID. A 103 Da neutral loss species observed in the ETD spectra of all the triply and doubly charged iTRAQ labeled peptide ions is unique to the 116 Da iTRAQ reagent, which implies that this process also has potential for quantitation of peptides/proteins. Therefore, ETD with or without supplemental collisional activation, depending on the precursor ion charge state, has the potential to directly identify and quantify the peptides/proteins simultaneously using existing iTRAQ reagents. PMID:18646790
Liu, Yimo; Wang, Zheming; Liu, Juan; ...
2014-09-24
The multiheme, outer membrane c-type cytochrome (c-Cyt) OmcB of Geobacter sulfurreducens was previously proposed to mediate electron transfer across the outer membrane. However, the underlying mechanism has remained uncharacterized. In G. sulfurreducens, the omcB gene is part of two tandem four-gene clusters, each is predicted to encode a transcriptional factor (OrfR/OrfS), a porin-like outer membrane protein (OmbB/OmbC), a periplasmic c-type cytochrome (OmaB/OmaC), and an outer membrane c-Cyt (OmcB/OmcC), respectively. Here we showed that OmbB/OmbC, OmaB/OmaC and OmcB/OmcC of G. sulfurreducens PCA formed the porin-cytochrome (Pcc) protein complexes, which were involved in transferring electrons across the outer membrane. The isolated Pccmore » protein complexes reconstituted in proteoliposomes transferred electrons from reduced methyl viologen across the lipid bilayer of liposomes to Fe(III)-citrate and ferrihydrite. The pcc clusters were found in all eight sequenced Geobacter and 11 other bacterial genomes from six different phyla, demonstrating a widespread distribution of Pcc protein complexes in phylogenetically diverse bacteria. Deletion of ombB-omaB-omcB-orfS-ombC-omaC-omcC gene clusters had no impact on the growth of G. sulfurreducens PCA with fumarate, but diminished the ability of G. sulfurreducens PCA to reduce Fe(III)-citrate and ferrihydrite. Finally, complementation with the ombB-omaB-omcB gene cluster restored the ability of G. sulfurreducens PCA to reduce Fe(III)-citrate and ferrihydrite.« less
Dang, Xibei; Young, Nicolas L
2014-05-01
Ultraviolet photodissociation (UVPD) is a compelling fragmentation technique with great potential to enhance proteomics generally and top-down MS specifically. In this issue, Cannon et al. (Proteomics 2014, 14, XXXX-XXXX) use UVPD to perform top-down MS on several sequence variants of green fluorescent protein and compare the results to CID, higher energy collision induced dissociation, and electron transfer dissociation. As compared to the other techniques UVPD produces a wider variety of fragment ion types that are relatively evenly distributed across the protein sequences. Overall, their results demonstrate enhanced sequence coverage and higher confidence in sequence assignment via UVPD MS. Based on these and other recent results UVPD is certain to become an increasingly widespread and valuable tool for top-down proteomics. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shakib, Farnaz A.; Hanna, Gabriel, E-mail: gabriel.hanna@ualberta.ca
In a previous study [F. A. Shakib and G. Hanna, J. Chem. Phys. 141, 044122 (2014)], we investigated a model proton-coupled electron transfer (PCET) reaction via the mixed quantum-classical Liouville (MQCL) approach and found that the trajectories spend the majority of their time on the mean of two coherently coupled adiabatic potential energy surfaces. This suggested a need for mean surface evolution to accurately simulate observables related to ultrafast PCET processes. In this study, we simulate the time-dependent populations of the three lowest adiabatic states in the ET-PT (i.e., electron transfer preceding proton transfer) version of the same PCET modelmore » via the MQCL approach and compare them to the exact quantum results and those obtained via the fewest switches surface hopping (FSSH) approach. We find that the MQCL population profiles are in good agreement with the exact quantum results and show a significant improvement over the FSSH results. All of the mean surfaces are shown to play a direct role in the dynamics of the state populations. Interestingly, our results indicate that the population transfer to the second-excited state can be mediated by dynamics on the mean of the ground and second-excited state surfaces, as part of a sequence of nonadiabatic transitions that bypasses the first-excited state surface altogether. This is made possible through nonadiabatic transitions between different mean surfaces, which is the manifestation of coherence transfer in MQCL dynamics. We also investigate the effect of the strength of the coupling between the proton/electron and the solvent coordinate on the state population dynamics. Drastic changes in the population dynamics are observed, which can be understood in terms of the changes in the potential energy surfaces and the nonadiabatic couplings. Finally, we investigate the state population dynamics in the PT-ET (i.e., proton transfer preceding electron transfer) and concerted versions of the model. The PT-ET results confirm the participation of all of the mean surfaces, albeit in different proportions compared to the ET-PT case, while the concerted results indicate that the mean of the ground- and first-excited state surfaces only plays a role, due to the large energy gaps between the ground- and second-excited state surfaces.« less
Huang, Shengbing; Song, Wei; Lin, Qishui
2005-08-01
A membrane-bound protein was purified from rat liver mitochondria. After being digested with V8 protease, two peptides containing identical 14 amino acid residue sequences were obtained. Using the 14 amino acid peptide derived DNA sequence as gene specific primer, the cDNA of correspondent gene 5'-terminal and 3'-terminal were obtained by RACE technique. The full-length cDNA that encoded a protein of 616 amino acids was thus cloned, which included the above mentioned peptide sequence. The full length cDNA was highly homologous to that of human ETF-QO, indicating that it may be the cDNA of rat ETF-QO. ETF-QO is an iron sulfur protein located in mitochondria inner membrane containing two kinds of redox center: FAD and [4Fe-4S] center. After comparing the sequence from the cDNA of the 616 amino acids protein with that of the mature protein of rat liver mitochondria, it was found that the N terminal 32 amino acid residues did not exist in the mature protein, indicating that the cDNA was that of ETF-QOp. When the cDNA was expressed in Saccharomyces cerevisiae with inducible vectors, the protein product was enriched in mitochondrial fraction and exhibited electron transfer activity (NBT reductase activity) of ETF-QO. Results demonstrated that the 32 amino acid peptide was a mitochondrial targeting peptide, and both FAD and iron-sulfur cluster were inserted properly into the expressed ETF-QO. ETF-QO had a high level expression in rat heart, liver and kidney. The fusion protein of GFP-ETF-QO co-localized with mitochondria in COS-7 cells.
Olijnyk, Helmut
2005-01-12
Lattice vibrations in high-pressure phases of Y, Gd and Lu were studied by Raman spectroscopy. The observed phonon frequencies decrease towards the transitions to the dhcp and fcc phases. There is evidence that the entire structural sequence [Formula: see text] under pressure for the individual regular rare-earth metals and along the lanthanide series at ambient pressure involve softening of certain acoustic and optical phonon modes and of the elastic shear modulus C(44). Comparison is made to transitions between close-packed lattices in other metals, and possible correlations to s-d electron transfer are discussed.
Zhang, Shuo; Chang, Jiali; Lin, Chao; Pan, Yiran; Cui, Kangping; Zhang, Xiaoyuan; Liang, Peng; Huang, Xia
2017-12-01
To understand how granular activated carbon (GAC) promotes methanogenesis, batch tests of CH 4 production potential in anaerobic serum bottles with addition of GAC or not were conducted. Tests showed that GAC promoted methanogenesis remarkably, but the non-conductive zeolite did not. The qPCR demonstrated that the biomass on GAC contributed little to the promotion. High-throughput sequencing data implied that promotion was related with direct interspecies electron transfer between Geobacteraceae and Methanosaetaceae. According to the c-type cytochromes (c-Cyts) response to the supplement of GAC, it was speculated that GAC may play the role of c-Cyts' substitution. In the undefined cultures, the phenomenon that c-Cyts were repressed by GAC was first observed. This research provided new evidence to microbial mechanism of promoting methanogenesis via GAC. Copyright © 2017 Elsevier Ltd. All rights reserved.
Vasicek, Lisa; O'Brien, John P.; Browning, Karen S.; Tao, Zhihua; Liu, Hung-Wen; Brodbelt, Jennifer S.
2012-01-01
A protein's surface influences its role in protein-protein interactions and protein-ligand binding. Mass spectrometry can be used to give low resolution structural information about protein surfaces and conformations when used in combination with derivatization methods that target surface accessible amino acid residues. However, pinpointing the resulting modified peptides upon enzymatic digestion of the surface-modified protein is challenging because of the complexity of the peptide mixture and low abundance of modified peptides. Here a novel hydrazone reagent (NN) is presented that allows facile identification of all modified surface residues through a preferential cleavage upon activation by electron transfer dissociation coupled with a collision activation scan to pinpoint the modified residue in the peptide sequence. Using this approach, the correlation between percent reactivity and surface accessibility is demonstrated for two biologically active proteins, wheat eIF4E and PARP-1 Domain C. PMID:22393264
Han, Hongling; Xia, Yu; McLuckey, Scott A.
2008-01-01
A series of c- and z•-type product ions formed via gas-phase electron transfer ion/ion reactions between protonated polypeptides with azobenzene radical anions are subjected to ion trap collision activation in a linear ion trap. Fragment ions including a-, b-, y-type and ammonia-loss ions are typically observed in collision induced dissociation (CID) of c ions, showing almost identical CID patterns as those of the C-terminal amidated peptides consisting of the same sequences. Collisional activation of z• species mainly gives rise to side-chain losses and peptide backbone cleavages resulting in a-, b-, c-, x-, y-and z-type ions. Most of the fragmentation pathways of z• species upon ion trap CID can be accounted for by radical driven processes. The side-chain losses from z• species are different from the small losses observed from the charge-reduced peptide molecular species in electron transfer dissociation (ETD), which indicates rearrangement of the radical species. Characteristic side-chain losses are observed for several amino acid residues, which are useful to predict their presence in peptide/protein ions. Furthermore, the unique side-chain losses from leucine and isoleucine residues allow facile distinction of these two isomeric residues. PMID:17608403
Implicit transfer of spatial structure in visuomotor sequence learning.
Tanaka, Kanji; Watanabe, Katsumi
2014-11-01
Implicit learning and transfer in sequence learning are essential in daily life. Here, we investigated the implicit transfer of visuomotor sequences following a spatial transformation. In the two experiments, participants used trial and error to learn a sequence consisting of several button presses, known as the m×n task (Hikosaka et al., 1995). After this learning session, participants learned another sequence in which the button configuration was spatially transformed in one of the following ways: mirrored, rotated, and random arrangement. Our results showed that even when participants were unaware of the transformation rules, accuracy of transfer session in the mirrored and rotated groups was higher than that in the random group (i.e., implicit transfer occurred). Both those who noticed the transformation rules and those who did not (i.e., explicit and implicit transfer instances, respectively) showed faster performance in the mirrored sequences than in the rotated sequences. Taken together, the present results suggest that people can use their implicit visuomotor knowledge to spatially transform sequences and that implicit transfers are modulated by a transformation cost, similar to that in explicit transfer. Copyright © 2014 Elsevier B.V. All rights reserved.
Quantum Mechanical Modeling of Ballistic MOSFETs
NASA Technical Reports Server (NTRS)
Svizhenko, Alexei; Anantram, M. P.; Govindan, T. R.; Biegel, Bryan (Technical Monitor)
2001-01-01
The objective of this project was to develop theory, approximations, and computer code to model quasi 1D structures such as nanotubes, DNA, and MOSFETs: (1) Nanotubes: Influence of defects on ballistic transport, electro-mechanical properties, and metal-nanotube coupling; (2) DNA: Model electron transfer (biochemistry) and transport experiments, and sequence dependence of conductance; and (3) MOSFETs: 2D doping profiles, polysilicon depletion, source to drain and gate tunneling, understand ballistic limit.
Morita, Yo; Yoshida, Wataru; Savory, Nasa; Han, Sung Woong; Tera, Masayuki; Nagasawa, Kazuo; Nakamura, Chikashi; Sode, Koji; Ikebukuro, Kazunori
2011-08-15
By inserting an adenosine aptamer into an aptamer that forms a G-quadruplex, we developed an adaptor molecule, named the Gq-switch, which links an electrode with flavin adenine dinucleotide-dependent glucose dehydrogenase (FADGDH) that is capable of transferring electron to a electrode directly. First, we selected an FADGDH-binding aptamer and identified that its sequence is composed of two blocks of consecutive six guanine bases and it forms a polymerized G-quadruplex structure. Then, we inserted a sequence of an adenosine aptamer between the two blocks of consecutive guanine bases, and we found it also bound to adenosine. Then we named it as Gq-switch. In the absence of adenosine, the Gq-switch-FADGDH complex forms a 30-nm high bulb-shaped structure that changes in the presence of adenosine to give an 8-nm high wire-shaped structure. This structural change brings the FADGDH sufficiently close to the electrode for electron transfer to occur, and the adenosine can be detected from the current produced by the FADGDH. Adenosine was successfully detected with a concentration dependency using the Gq-switch-FADGDH complex immobilized Au electrode by measuring response current to the addition of glucose. Copyright © 2011 Elsevier B.V. All rights reserved.
Liu, Haisheng; Ma, Linbin; Ma, Changbei; Du, Junyan; Wang, Meilan; Wang, Kemin
2016-11-18
A new quencher-free Hg 2+ ion assay method was developed based on polymerase-assisted photoinduced electron transfer (PIET). In this approach, a probe is designed with a mercury ion recognition sequence (MRS) that is composed of two T-rich functional areas separated by a spacer of random bases at the 3'-end, and a sequence of stacked cytosines at the 5'-end, to which a fluorescein (FAM) is attached. Upon addition of Hg 2+ ions into this sensing system, the MRS folds into a hairpin structure at the 3'-end with Hg 2+ -mediated base pairs. In the presence of DNA polymerase, it will catalyze the extension reaction, resulting in the formation of stacked guanines, which will instantly quench the fluorescence of FAM through PIET. Under optimal conditions, the limit of detection for Hg 2+ ions was estimated to be 5 nM which is higher than the US Environmental Protection Agency (EPA) standard limit. In addition, no labeling with a quencher was requiring, and the present method is fairly simple, fast and low cost. It is expected that this cost-effective fluorescence method might hold considerable potential in the detection of Hg 2+ ions in real biological and environmental samples.
Chang, Christopher H.; King, Paul W.; Ghirardi, Maria L.; Kim, Kwiseon
2007-01-01
The [FeFe] hydrogenases HydA1 and HydA2 in the green alga Chlamydomonas reinhardtii catalyze the final reaction in a remarkable metabolic pathway allowing this photosynthetic organism to produce H2 from water in the chloroplast. A [2Fe-2S] ferredoxin is a critical branch point in electron flow from Photosystem I toward a variety of metabolic fates, including proton reduction by hydrogenases. To better understand the binding determinants involved in ferredoxin:hydrogenase interactions, we have modeled Chlamydomonas PetF1 and HydA2 based on amino-acid sequence homology, and produced two promising electron-transfer model complexes by computational docking. To characterize these models, quantitative free energy calculations at atomic resolution were carried out, and detailed analysis of the interprotein interactions undertaken. The protein complex model we propose for ferredoxin:HydA2 interaction is energetically favored over the alternative candidate by 20 kcal/mol. This proposed model of the electron-transfer complex between PetF1 and HydA2 permits a more detailed view of the molecular events leading up to H2 evolution, and suggests potential mutagenic strategies to modulate electron flow to HydA2. PMID:17660315
Chang, Christopher H; King, Paul W; Ghirardi, Maria L; Kim, Kwiseon
2007-11-01
The [FeFe] hydrogenases HydA1 and HydA2 in the green alga Chlamydomonas reinhardtii catalyze the final reaction in a remarkable metabolic pathway allowing this photosynthetic organism to produce H(2) from water in the chloroplast. A [2Fe-2S] ferredoxin is a critical branch point in electron flow from Photosystem I toward a variety of metabolic fates, including proton reduction by hydrogenases. To better understand the binding determinants involved in ferredoxin:hydrogenase interactions, we have modeled Chlamydomonas PetF1 and HydA2 based on amino-acid sequence homology, and produced two promising electron-transfer model complexes by computational docking. To characterize these models, quantitative free energy calculations at atomic resolution were carried out, and detailed analysis of the interprotein interactions undertaken. The protein complex model we propose for ferredoxin:HydA2 interaction is energetically favored over the alternative candidate by 20 kcal/mol. This proposed model of the electron-transfer complex between PetF1 and HydA2 permits a more detailed view of the molecular events leading up to H(2) evolution, and suggests potential mutagenic strategies to modulate electron flow to HydA2.
NASA Technical Reports Server (NTRS)
Trost, J. T.; Brune, D. C.; Blankenship, R. E.
1992-01-01
Photosynthetic reaction centers isolated from Heliobacillus mobilis exhibit a single major protein on SDS-PAGE of 47 000 Mr. Attempts to sequence the reaction center polypeptide indicated that the N-terminus is blocked. After enzymatic and chemical cleavage, four peptide fragments were sequenced from the Heliobacillus mobilis apoprotein. Only one of these sequences showed significant specific similarity to any of the protein and deduced protein sequences in the GenBank data base. This fragment is identical with 56% of the residues, including both cysteines, found in highly conserved region that is proposed to bind iron-sulfur center Fx in the Photosystem I reaction center peptide that is the psaB gene product. The similarity to the psaA gene product in this region is 48%. Redox titrations of laser-flash-induced photobleaching with millisecond decay kinetics on isolated reaction centers from Heliobacterium gestii indicate a midpoint potential of -414 mV with n = 2 titration behavior. In membranes, the behavior is intermediate between n = 1 and n = 2, and the apparent midpoint potential is -444 mV. This is compared to the behavior in Photosystem I, where the intermediate electron acceptor A1, thought to be a phylloquinone molecule, has been proposed to undergo a double reduction at low redox potentials in the presence of viologen redox mediators. These results strongly suggest that the acceptor side electron transfer system in reaction centers from heliobacteria is indeed analogous to that found in Photosystem I. The sequence similarities indicate that the divergence of the heliobacteria from the Photosystem I line occurred before the gene duplication and subsequent divergence that lead to the heterodimeric protein core of the Photosystem I reaction center.
Pandelia, Maria-Eirini; Nitschke, Wolfgang; Infossi, Pascale; Giudici-Orticoni, Marie-Thérèse; Bill, Eckhard; Lubitz, Wolfgang
2011-04-12
Iron-sulfur clusters are versatile electron transfer cofactors, ubiquitous in metalloenzymes such as hydrogenases. In the oxygen-tolerant Hydrogenase I from Aquifex aeolicus such electron "wires" form a relay to a diheme cytb, an integral part of a respiration pathway for the reduction of O(2) to water. Amino acid sequence comparison with oxygen-sensitive hydrogenases showed conserved binding motifs for three iron-sulfur clusters, the nature and properties of which were unknown so far. Electron paramagnetic resonance spectra exhibited complex signals that disclose interesting features and spin-coupling patterns; by redox titrations three iron-sulfur clusters were identified in their usual redox states, a [3Fe4S] and two [4Fe4S], but also a unique high-potential (HP) state was found. On the basis of (57)Fe Mössbauer spectroscopy we attribute this HP form to a superoxidized state of the [4Fe4S] center proximal to the [NiFe] site. The unique environment of this cluster, characterized by a surplus cysteine coordination, is able to tune the redox potentials and make it compliant with the [4Fe4S](3+) state. It is actually the first example of a biological [4Fe4S] center that physiologically switches between 3+, 2+, and 1+ oxidation states within a very small potential range. We suggest that the (1 + /2+) redox couple serves the classical electron transfer reaction, whereas the superoxidation step is associated with a redox switch against oxidative stress.
Pandelia, Maria-Eirini; Nitschke, Wolfgang; Infossi, Pascale; Giudici-Orticoni, Marie-Thérèse; Bill, Eckhard; Lubitz, Wolfgang
2011-01-01
Iron-sulfur clusters are versatile electron transfer cofactors, ubiquitous in metalloenzymes such as hydrogenases. In the oxygen-tolerant Hydrogenase I from Aquifex aeolicus such electron “wires” form a relay to a diheme cytb, an integral part of a respiration pathway for the reduction of O2 to water. Amino acid sequence comparison with oxygen-sensitive hydrogenases showed conserved binding motifs for three iron-sulfur clusters, the nature and properties of which were unknown so far. Electron paramagnetic resonance spectra exhibited complex signals that disclose interesting features and spin-coupling patterns; by redox titrations three iron-sulfur clusters were identified in their usual redox states, a [3Fe4S] and two [4Fe4S], but also a unique high-potential (HP) state was found. On the basis of 57Fe Mössbauer spectroscopy we attribute this HP form to a superoxidized state of the [4Fe4S] center proximal to the [NiFe] site. The unique environment of this cluster, characterized by a surplus cysteine coordination, is able to tune the redox potentials and make it compliant with the [4Fe4S]3+ state. It is actually the first example of a biological [4Fe4S] center that physiologically switches between 3+, 2+, and 1+ oxidation states within a very small potential range. We suggest that the (1 + /2+) redox couple serves the classical electron transfer reaction, whereas the superoxidation step is associated with a redox switch against oxidative stress. PMID:21444783
Electronic Interactions of Michler's Ketone with DNA Bases in Synthetic Hairpins.
Jalilov, Almaz S; Young, Ryan M; Eaton, Samuel W; Wasielewski, Michael R; Lewis, Frederick D
2015-01-01
The mechanism and dynamics of photoinduced electron transfer in two families of DNA hairpins possessing Michler's ketone linkers have been investigated by means of steady state and time-resolved transient absorption and emission spectroscopies. The excited state behavior of the diol linker employed in hairpin synthesis is similar to that of Michler's ketone in methanol solution. Hairpins possessing only a Michler's ketone linker undergo fast singlet state charge separation and charge recombination with an adjacent purine base, attributed to well-stacked ground state conformations, and intersystem crossing to the triplet state, attributed to poorly stacked ground state conformations. The failure of the triplet to undergo electron transfer reactions on the 7 ns time scale of our measurements is attributed to the low triplet energy and reduction potential of the twisted triplet state. Hairpins possessing both a Michler's ketone linker and a perylenediimide base surrogate separated by four base pairs undergo photoinduced hole transport from the diimide to Michler's ketone upon excitation of the diimide. The efficiency of hole transport is dependent upon the sequence of the intervening purine bases. © 2014 The American Society of Photobiology.
Partial De Novo Sequencing and Unusual CID Fragmentation of a 7 kDa, Disulfide-Bridged Toxin
NASA Astrophysics Data System (ADS)
Medzihradszky, Katalin F.; Bohlen, Christopher J.
2012-05-01
A 7 kDa toxin isolated from the venom of the Texas coral snake ( Micrurus tener tener) was subjected to collision-induced dissociation (CID) and electron-transfer dissociation (ETD) analyses both before and after reduction at low pH. Manual and automated approaches to de novo sequencing are compared in detail. Manual de novo sequencing utilizing the combination of high accuracy CID and ETD data and an acid-related cleavage yielded the N-terminal half of the sequence from the reduced species. The intact polypeptide, containing 3 disulfide bridges produced a series of unusual fragments in ion trap CID experiments: abundant internal amino acid losses were detected, and also one of the disulfide-linkage positions could be determined from fragments formed by the cleavage of two bonds. In addition, internal and c-type fragments were also observed.
NASA Astrophysics Data System (ADS)
Rykov, Alexandre I.; Li, Xuning; Wang, Junhu
2015-07-01
We report on the crystal structure refinements in the novel electron-transfer-active Prussian Blue analogs (PBA) KMn4II [Co1-xIII FexIII (CN)6 ]3 · nH2 O (n ≃ 12). The series of novel PBA with the end members of KMn4[ Co(CN)6]3 · 11.8H2 O and KMn4[ Fe(CN)6 ]3 · 10.5H2 O have been synthesized for the first time, all showing a number of extra-reflections incompatible with ordinary face-centered cell of the Fm-3m symmetry group. We have analyzed the Rietveld patterns for x = 0 , 0.53 , 1 and found that the extra-reflections could be well fitted using several primitive (P) cell symmetries. The best fitting quality was obtained using the noncentrosymmetric space group (S.G.) P 4 bar 3 m (Z=1) with the origin of coordinate system shifted into a zeolitic site. In this structure model, the Co-CN-Mn entities are bent owing to the charge introduced by the K+ insertion that induces also the electron transfer between Mn and Fe. Using Mössbauer spectroscopy the electron transfer activity is identified with the appearance of unsplit resonance at the isomer shift of typically -0.15 mm/s evidencing the low-spin state for Fe3+ and Fe2+ species. In the same P 4 bar 3 m phases doped with 2+57Fe into the Mn site, a sequence of discrete values of quadrupole splitting (0 mm/s, 0.9 mm/s, 1.8 mm/s) is observed and attributed to different conformations of the polyhedra, in which the ground states are orbital triplet, doublet and singlet, respectively.
Kinetic and Spectral Properties of Isovaleryl-CoA Dehydrogenase and Interaction with Ligands
Mohsen, Al-Walid A.; Vockley, Jerry
2014-01-01
Isovaleryl-CoA dehydrogenase (IVD) catalyzes the conversion of isovaleryl-CoA to 3-methylcrotonyl-CoA and the transfer of electrons to the electron transfer flavoprotein (ETF). Recombinant human IVD purifies with bound CoA-persulfide. A modified purification protocol was developed to isolate IVD without bound CoA-persulfide and to protect the protein thiols from oxidation. The CoA-persulfide-free IVD specific activity was 112.5 µmol porcine ETF•min−1•mg−1, which was ~20-fold higher than that of its CoA-persulfide bound form. The Km and catalytic efficiency (kcat/Km) for isovaleryl-CoA were 1.0 µM and 4.3 × 106•M−1•sec−1 per monomer, respectively, and its Km for ETF was 2.0 µM. Anaerobic titration of isovaleryl-CoA into an IVD solution resulted in a stable blue complex with increased absorbance at 310 nm, decreased absorbance at 373 and 447 nm, and the appearance of the charge transfer complex band at 584 nm. The apparent dissociation constant (KD app) determined spectrally for isovaleryl-CoA was 0.54 µM. Isovaleryl-CoA, acetoacetyl-CoA, methylenecyclopropylacetyl-CoA, and ETF induced CD spectral changes at the 250–500 nm region while isobutyryl-CoA did not, suggesting conformational changes occur at the flavin ring that are ligand specific. Replacement of the IVD Trp166 with a Phe did not block IVD interaction with ETF, indicating that its indole ring is not essential for electron transfer to ETF. A twelve amino acid synthetic peptide that matches the sequence of the ETF docking peptide competitively inhibited the enzyme reaction when ETF was used as the electron acceptor with a Ki of 1.5 mM. PMID:25450250
Manbeck, Gerald F.; Fujita, Etsuko; Concepcion, Javier J.
2016-08-18
Proton-coupled electron-transfer (PCET) reactions were studied in acetonitrile for a Photosystem II (PSII) inspired [Ru(bpy) 2(phen-imidazole-Ph(OH)( tBu) 2)] 2+, in which Ru(III) generated by a flash-quench sequence oxidizes the appended phenol and the proton is transferred to the hydrogen bonded imidazole base. In contrast to related systems, the donor and acceptor are strongly coupled, as indicated by the shift in the Ru III/IIcouple upon phenol oxidation, and intramolecular oxidation of the phenol by Ru(III) is energetically favorable by both stepwise or concerted pathways. The phenol oxidation occurs via a stepwise ET-PT mechanism with k ET = 2.7 × 10 7more » s ₋1 and a kinetic isotope effect (KIE) of 0.99 ± 0.03. The electron transfer reaction was characterized as adiabatic with λ DA = 1.16 eV and 280 < H DA < 540 cm ₋1 consistent with strong electronic coupling and slow solvent dynamics. Reduction of the phenoxyl radical by the quencher radical was examined as the analogue of the redox reaction between the PSII tyrosyl radical and the oxygen evolving complex (OEC). In our PSII-inspired complex, the recombination reaction activation energy is < 2 kcal mol ₋1. In conclusion, the reaction is nonadiabatic (V PCET ~ 22 cm ₋1 (H) and 49 cm ₋1 (D)), concerted, and exhibits an unexpected inverse KIE of 0.55 that is attributed to greater overlap of the reactant vibronic ground state with the OD vibronic states of the proton acceptor due to the smaller quantum spacing of the deuterium vibrational levels.« less
Electron density and plasma dynamics of a spherical theta pinch
NASA Astrophysics Data System (ADS)
Teske, C.; Liu, Y.; Blaes, S.; Jacoby, J.
2012-03-01
A spherical theta pinch for plasma stripper applications has been developed and investigated regarding the electron density and the plasma confinement during the pinching sequence. The setup consists of a 6 μH induction coil surrounding a 4000 ml spherical discharge vessel and a capacitor bank with interchangeable capacitors leading to an overall capacitance of 34 μF and 50 μF, respectively. A thyristor switch is used for driving the resonant circuit. Pulsed coil currents reached values of up to 26 kA with maximum induction of 500 mT. Typical gas pressures were 0.7 Pa up to 120 Pa with ArH2 (2.8% H2)-gas as a discharge medium. Stark broadening measurements of the Hβ emission line were carried out in order to evaluate the electron density of the discharge. In accordance with the density measurements, the transfer efficiency was estimated and a scaling law between electron density and discharge energy was established for the current setup. The densities reached values of up to 8 × 1022 m-3 for an energy of 1.6 kJ transferred into the plasma. Further, the pinching of the discharge plasma was documented and the different stages of the pinching process were analyzed. The experimental evidence suggests that concerning the recent setup of the spherical theta pinch, a linear scaling law between the transferred energy and the achievable plasma density can be applied for various applications like plasma strippers and pulsed ion sources.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wander, Matthew C.; Schoonen, Martin A.
White and green rusts are the active chemical reagents of buried scrap iron pollutant remediation. In this work, a comparison of the initial electron-transfer step for the reduction of CrO{sub 4}{sup -2} by Fe{sub (aq)}{sup 2+} and Fe(OH){sub 2}(s) is presented. Using hybrid density functional theory and Hartree-Fock cluster calculations for the aqueous reaction, the rate constant for the homogeneous reduction of chromium by ferrous iron was determined to be 5 x 10{sup -2} M{sup -1} s{sup -1} for the initial electron transfer. Using a combination of Hartree-Fock slab and cluster calculations for the heterogeneous reaction, the initial electron transfermore » for the heterogeneous reduction of chromium by ferrous iron was determined to be 1 x 10{sup 2} s{sup -1}. The difference in rates is driven by the respective free energies of reaction: 33.4 vs -653.2 kJ/mol. This computational result is apparently the opposite of what has been observed experimentally, but further analysis suggests that these results are fully convergent with experiment. The experimental heterogeneous rate is limited by surface passivation from slow intersheet electron transfer, while the aqueous reaction may be an autocatalytic heterogeneous reaction involving the iron oxyhydroxide product. As a result, it is possible to produce a clear model of the pollutant reduction reaction sequence for these two reactants.« less
Shimizu, Renee E; Wu, Allan D; Knowlton, Barbara J
2016-12-01
Effective learning results not only in improved performance on a practiced task, but also in the ability to transfer the acquired knowledge to novel, similar tasks. Using a modified serial reaction time (RT) task, the authors examined the ability to transfer to novel sequences after practicing sequences in a repetitive order versus a nonrepeating interleaved order. Interleaved practice resulted in better performance on new sequences than repetitive practice. In a second study, participants practiced interleaved sequences in a functional MRI (fMRI) scanner and received a transfer test of novel sequences. Transfer ability was positively correlated with cerebellar blood oxygen level dependent activity during practice, indicating that greater cerebellar engagement during training resulted in better subsequent transfer performance. Interleaved practice may thus result in a more generalized representation that is robust to interference, and the degree of activation in the cerebellum may be a reflection of the instantiation and engagement of internal models. (PsycINFO Database Record (c) 2016 APA, all rights reserved).
NASA Astrophysics Data System (ADS)
Olijnyk, Helmut
2005-01-01
Lattice vibrations in high-pressure phases of Y, Gd and Lu were studied by Raman spectroscopy. The observed phonon frequencies decrease towards the transitions to the dhcp and fcc phases. There is evidence that the entire structural sequence {\\mathrm {hcp \\to Sm\\mbox {-}type \\to dhcp \\to fcc}} under pressure for the individual regular rare-earth metals and along the lanthanide series at ambient pressure involve softening of certain acoustic and optical phonon modes and of the elastic shear modulus C44. Comparison is made to transitions between close-packed lattices in other metals, and possible correlations to s-d electron transfer are discussed.
Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta’ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa
2016-01-01
The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology. PMID:27435636
NASA Astrophysics Data System (ADS)
Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta'Ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa
2016-07-01
The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology.
Kletsov, Aleksey A; Glukhovskoy, Evgeny G; Chumakov, Aleksey S; Ortiz, Joseph V
2016-01-01
The conduction properties of DNA molecule, particularly its transverse conductance (electron transfer through nucleotide bridges), represent a point of interest for DNA chemistry community, especially for DNA sequencing. However, there is no fully developed first-principles theory for molecular conductance and current that allows one to analyze the transverse flow of electrical charge through a nucleotide base. We theoretically investigate the transverse electron transport through all four DNA nucleotide bases by implementing an unbiased ab initio theoretical approach, namely, the electron propagator theory. The electrical conductance and current through DNA nucleobases (guanine [G], cytosine [C], adenine [A] and thymine [T]) inserted into a model 1-nm Ag-Ag nanogap are calculated. The magnitudes of the calculated conductance and current are ordered in the following hierarchies: gA>gG>gC>gT and IG>IA>IT>IC correspondingly. The new distinguishing parameter for the nucleobase identification is proposed, namely, the onset bias magnitude. Nucleobases exhibit the following hierarchy with respect to this parameter: Vonset(A)
Swanson, Michael A; Kathirvelu, Velavan; Majtan, Tomas; Frerman, Frank E; Eaton, Gareth R; Eaton, Sandra S
2011-03-01
Human electron transfer flavoprotein (ETF) is a soluble mitochondrial heterodimeric flavoprotein that links fatty acid β-oxidation to the main respiratory chain. The crystal structure of human ETF bound to medium chain acyl-CoA dehydrogenase indicates that the flavin adenine dinucleotide (FAD) domain (αII) is mobile, which permits more rapid electron transfer with donors and acceptors by providing closer access to the flavin and allows ETF to accept electrons from at least 10 different flavoprotein dehydrogenases. Sequence homology is high and low-angle X-ray scattering is identical for Paracoccus denitrificans (P. denitrificans) and human ETF. To characterize the orientations of the αII domain of P. denitrificans ETF, distances between enzymatically reduced FAD and spin labels in the three structural domains were measured by double electron-electron resonance (DEER) at X- and Q-bands. An FAD to spin label distance of 2.8 ± 0.15 nm for the label in the FAD-containing αII domain (A210C) agreed with estimates from the crystal structure (3.0 nm), molecular dynamics simulations (2.7 nm), and rotamer library analysis (2.8 nm). Distances between the reduced FAD and labels in αI (A43C) were between 4.0 and 4.5 ± 0.35 nm and for βIII (A111C) the distance was 4.3 ± 0.15 nm. These values were intermediate between estimates from the crystal structure of P. denitrificans ETF and a homology model based on substrate-bound human ETF. These distances suggest that the αII domain adopts orientations in solution that are intermediate between those which are observed in the crystal structures of free ETF (closed) and ETF bound to a dehydrogenase (open). Copyright © 2011 The Protein Society.
Pancoska, Petr; Moravek, Zdenek; Moll, Ute M
2004-01-01
Nucleic acids are molecules of choice for both established and emerging nanoscale technologies. These technologies benefit from large functional densities of 'DNA processing elements' that can be readily manufactured. To achieve the desired functionality, polynucleotide sequences are currently designed by a process that involves tedious and laborious filtering of potential candidates against a series of requirements and parameters. Here, we present a complete novel methodology for the rapid rational design of large sets of DNA sequences. This method allows for the direct implementation of very complex and detailed requirements for the generated sequences, thus avoiding 'brute force' filtering. At the same time, these sequences have narrow distributions of melting temperatures. The molecular part of the design process can be done without computer assistance, using an efficient 'human engineering' approach by drawing a single blueprint graph that represents all generated sequences. Moreover, the method eliminates the necessity for extensive thermodynamic calculations. Melting temperature can be calculated only once (or not at all). In addition, the isostability of the sequences is independent of the selection of a particular set of thermodynamic parameters. Applications are presented for DNA sequence designs for microarrays, universal microarray zip sequences and electron transfer experiments.
Nanoparticle Selective Laser Processing for a Flexible Display Fabrication
NASA Astrophysics Data System (ADS)
Seung Hwan Ko,; Heng Pan,; Daeho Lee,; Costas P. Grigoropoulos,; Hee K. Park,
2010-05-01
To demonstrate a first step for a novel fabrication method of a flexible display, nanomaterial based laser processing schemes to demonstrate organic light emitting diode (OLED) pixel transfer and organic field effect transistor (OFET) fabrication on a polymer substrate without using any conventional vacuum or photolithography processes were developed. The unique properties of nanomaterials allow laser induced forward transfer of organic light emitting material at low laser energy while maintaining good fluorescence and also allow high resolution transistor electrode patterning at plastic compatible low temperature. These novel processes enable an environmentally friendly and cost effective process as well as a low temperature manufacturing sequence to realize inexpensive, large area, flexible electronics on polymer substrates.
Electrochemical studies of a truncated laccase produced in Pichia pastoris
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gelo-Pujic, M.; Kim, H.H.; Butlin, N.G.
1999-12-01
The cDNA that encodes an isoform is laccase from Trametes versicolor (LCCI), as well as a truncated version (LCCIa), was subcloned and expressed by using the yeast Pichia pastoris as the heterologous host. The amino acid sequence of LCCIa is identical to that of LCCI except that the final 11 amino acids at the C terminus of LCCI are replaced with a single cysteine residue. This modification was introduced for the purpose of improving the kinetics of electron transfer between an electrode and the copper-containing active site of laccase. The two laccases (LCCI and LCCIa) are compared in terms ofmore » their relative activity with two substrates that have different redox potentials. Results from electrochemical studies on solutions containing LCCI and LCCIa indicate that the redox potential of the active site of LCCIa is shifted to more negative values (411 mV versus normal hydrogen electrode voltage) than that found in other fungal laccases. In addition, replacing the 11 codons at the C terminus of the laccase gene with a single cysteine codon influences the rate of heterogeneous electron transfer between and electrode and the copper-containing active site. These results demonstrate for the first time that the rate of electron transfer between an oxidoreductase and an electrode can be enhanced by changes to the primary structure of a protein via site-directed mutagenesis.« less
ERIC Educational Resources Information Center
Lim-Quek, Muriel; And Others
This study tested the effects of two instructional sequences--principle-procedure and procedure-principle--on the application and transfer of learning. It was hypothesized that a principle-procedure sequence would result in better near-transfer and far-transfer and that students would prefer this sequence. The 38 freshmen enrolled in a business…
Irwin, Jodi A; Saunier, Jessica L; Strouss, Katharine M; Sturk, Kimberly A; Diegoli, Toni M; Just, Rebecca S; Coble, Michael D; Parson, Walther; Parsons, Thomas J
2007-06-01
In an effort to increase the quantity, breadth and availability of mtDNA databases suitable for forensic comparisons, we have developed a high-throughput process to generate approximately 5000 control region sequences per year from regional US populations, global populations from which the current US population is derived and global populations currently under-represented in available forensic databases. The system utilizes robotic instrumentation for all laboratory steps from pre-extraction through sequence detection, and a rigorous eight-step, multi-laboratory data review process with entirely electronic data transfer. Over the past 3 years, nearly 10,000 control region sequences have been generated using this approach. These data are being made publicly available and should further address the need for consistent, high-quality mtDNA databases for forensic testing.
2010-11-01
and Escherichia ferguso- . TABLE 2. General characteristics of the plasm ids from ETEC strains H10407 and E1392/75 Value in E. c·oli: Characteristic...0352). consetved proteins with unknown func- tions (CDSs 0673 to 0678), a flavoprotein electron transfer system (CDSs 1730 to 1734), the colanic...mediating diarrhea are not chromosomally encoded. indicating that the essential virulence factors are encoded on the plasm ids (61 ). Potentia l
Electron transfer precedes ATP hydrolysis during nitrogenase catalysis
Duval, Simon; Danyal, Karamatullah; Shaw, Sudipta; Lytle, Anna K.; Dean, Dennis R.; Hoffman, Brian M.; Antony, Edwin; Seefeldt, Lance C.
2013-01-01
The biological reduction of N2 to NH3 catalyzed by Mo-dependent nitrogenase requires at least eight rounds of a complex cycle of events associated with ATP-driven electron transfer (ET) from the Fe protein to the catalytic MoFe protein, with each ET coupled to the hydrolysis of two ATP molecules. Although steps within this cycle have been studied for decades, the nature of the coupling between ATP hydrolysis and ET, in particular the order of ET and ATP hydrolysis, has been elusive. Here, we have measured first-order rate constants for each key step in the reaction sequence, including direct measurement of the ATP hydrolysis rate constant: kATP = 70 s−1, 25 °C. Comparison of the rate constants establishes that the reaction sequence involves four sequential steps: (i) conformationally gated ET (kET = 140 s−1, 25 °C), (ii) ATP hydrolysis (kATP = 70 s−1, 25 °C), (iii) Phosphate release (kPi = 16 s−1, 25 °C), and (iv) Fe protein dissociation from the MoFe protein (kdiss = 6 s−1, 25 °C). These findings allow completion of the thermodynamic cycle undergone by the Fe protein, showing that the energy of ATP binding and protein–protein association drive ET, with subsequent ATP hydrolysis and Pi release causing dissociation of the complex between the Feox(ADP)2 protein and the reduced MoFe protein. PMID:24062462
Modular Homogeneous Chromophore–Catalyst Assemblies
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mulfort, Karen L.; Utschig, Lisa M.
2016-05-17
Photosynthetic reaction center (RC) proteins convert incident solar energy to chemical energy through a network of molecular cofactors which have been evolutionarily tuned to couple efficient light-harvesting, directional electron transfer, and long-lived charge separation with secondary reaction sequences. These molecular cofactors are embedded within a complex protein environment which precisely positions each cofactor in optimal geometries along efficient electron transfer pathways with localized protein environments facilitating sequential and accumulative charge transfer. By contrast, it is difficult to approach a similar level of structural complexity in synthetic architectures for solar energy conversion. However, by using appropriate self-assembly strategies, we anticipate thatmore » molecular modules, which are independently synthesized and optimized for either light-harvesting or redox catalysis, can be organized into spatial arrangements that functionally mimic natural photosynthesis. In this Account, we describe a modular approach to new structural designs for artificial photosynthesis which is largely inspired by photosynthetic RC proteins. We focus on recent work from our lab which uses molecular modules for light-harvesting or proton reduction catalysis in different coordination geometries and different platforms, spanning from discrete supramolecular assemblies to molecule–nanoparticle hybrids to protein-based biohybrids. Molecular modules are particularly amenable to high-resolution characterization of the ground and excited state of each module using a variety of physical techniques; such spectroscopic interrogation helps our understanding of primary artificial photosynthetic mechanisms. In particular, we discuss the use of transient optical spectroscopy, EPR, and X-ray scattering techniques to elucidate dynamic structural behavior and light-induced kinetics and the impact on photocatalytic mechanism. Two different coordination geometries of supramolecular photocatalyst based on the [Ru(bpy)3]2+ (bpy = 2,2'-bipyridine) light-harvesting module with cobaloxime-based catalyst module are compared, with progress in stabilizing photoinduced charge separation identified. These same modules embedded in the small electron transfer protein ferredoxin exhibit much longer charge-separation, enabled by stepwise electron transfer through the native [2Fe-2S] cofactor. We anticipate that the use of interchangeable, molecular modules which can interact in different coordination geometries or within entirely different structural platforms will provide important fundamental insights into the effect of environment on parameters such as electron transfer and charge separation, and ultimately drive more efficient designs for artificial photosynthesis.« less
Electrochemical behavior of meso-substituted iron porphyrins in alkaline aqueous media
NASA Astrophysics Data System (ADS)
Berezina, N. M.; Bazanov, M. I.; Maksimova, A. A.; Semeikin, A. S.
2017-12-01
The effect meso-substitution in iron porphyrin complexes has on their redox behavior in alkaline aqueous solutions is studied via cyclic voltammetry. The voltammetric features of the reduction of iron pyridylporphyrins suggest that the sites of electron transfer lie at the ligand, the metal ion, and the pyridyl moieties. The electron transfer reactions between the different forms of these compounds, including the oxygen reduction reaction they mediate, are outlined to show the sequence and potential ranges in which they occur in alkaline aqueous media. Under our experimental conditions, the iron porphyrins exist as μ-oxo dimmers whose activity for the electrocatalytic reduction of oxygen displays a considerable dependence on the nature of the substitutents and nitrogen isomerization (for pyridylporphyrins) and grows in the order (Fe( ms-Ph)4P)2O, (Fe[ ms-(Py-3)Ph3]P)2O, (Fe[ ms-(Py-4)4]P)2O, and (Fe[ ms-(Py-3)4]P)2O.
Learning to learn: From within-modality to cross-modality transfer during infancy.
Hupp, Julie M; Sloutsky, Vladimir M
2011-11-01
One critical aspect of learning is the ability to apply learned knowledge to new situations. This ability to transfer is often limited, and its development is not well understood. The current research investigated the development of transfer between 8 and 16 months of age. In Experiment 1, 8- and 16-month-olds (who were established to have a preference to the beginning of a visual sequence) were trained to attend to the end of a sequence. They were then tested on novel visual sequences. Results indicated transfer of learning, with both groups changing baseline preferences as a result of training. In Experiment 2, participants were trained to attend to the end of a visual sequence and were then tested on an auditory sequence. Unlike Experiment 1, only older participants exhibited transfer of learning by changing baseline preferences. These findings suggest that the generalization of learning becomes broader with development, with transfer across modalities developing later than transfer within a modality. Copyright © 2011 Elsevier Inc. All rights reserved.
Learning to Learn: From Within-Modality to Cross-Modality Transfer in Infancy
Hupp, Julie M.; Sloutsky, Vladimir M.
2011-01-01
One critical aspect of learning is the ability to apply learned knowledge to new situations. This ability to transfer is often limited, and its development is not well understood. The current research investigated the development of transfer between 8- and 16-months of age. In Experiment 1, 8- and 16-month-olds (who were established to have a preference to the beginning of a visual sequence) were trained to attend to the end of a sequence. They were then tested on novel visual sequences. Results indicated transfer of learning, as both groups changed baseline preferences as a result of training. In Experiment 2, participants were trained to attend to the end of a visual sequence and then tested on an auditory sequence. Unlike Experiment 1, only older participants exhibited transfer of learning by changing baseline preferences. These findings suggest that the generalization of learning becomes broader with development, with transfer across modalities developing later than transfer within a modality. PMID:21663920
Fidler, Andrew F; Singh, Ved P; Long, Phillip D; Dahlberg, Peter D; Engel, Gregory S
2013-10-21
Excitation energy transfer events in the photosynthetic light harvesting complex 2 (LH2) of Rhodobacter sphaeroides are investigated with polarization controlled two-dimensional electronic spectroscopy. A spectrally broadened pulse allows simultaneous measurement of the energy transfer within and between the two absorption bands at 800 nm and 850 nm. The phased all-parallel polarization two-dimensional spectra resolve the initial events of energy transfer by separating the intra-band and inter-band relaxation processes across the two-dimensional map. The internal dynamics of the 800 nm region of the spectra are resolved as a cross peak that grows in on an ultrafast time scale, reflecting energy transfer between higher lying excitations of the B850 chromophores into the B800 states. We utilize a polarization sequence designed to highlight the initial excited state dynamics which uncovers an ultrafast transfer component between the two bands that was not observed in the all-parallel polarization data. We attribute the ultrafast transfer component to energy transfer from higher energy exciton states to lower energy states of the strongly coupled B850 chromophores. Connecting the spectroscopic signature to the molecular structure, we reveal multiple relaxation pathways including a cyclic transfer of energy between the two rings of the complex.
12 CFR 1005.14 - Electronic fund transfer service provider not holding consumer's account.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 12 Banks and Banking 8 2012-01-01 2012-01-01 false Electronic fund transfer service provider not... PROTECTION ELECTRONIC FUND TRANSFERS (REGULATION E) § 1005.14 Electronic fund transfer service provider not holding consumer's account. (a) Provider of electronic fund transfer service. A person that provides an...
12 CFR 1005.14 - Electronic fund transfer service provider not holding consumer's account.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 12 Banks and Banking 8 2013-01-01 2013-01-01 false Electronic fund transfer service provider not... PROTECTION ELECTRONIC FUND TRANSFERS (REGULATION E) General § 1005.14 Electronic fund transfer service provider not holding consumer's account. (a) Provider of electronic fund transfer service. A person that...
12 CFR 1005.14 - Electronic fund transfer service provider not holding consumer's account.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 12 Banks and Banking 8 2014-01-01 2014-01-01 false Electronic fund transfer service provider not... PROTECTION ELECTRONIC FUND TRANSFERS (REGULATION E) General § 1005.14 Electronic fund transfer service provider not holding consumer's account. (a) Provider of electronic fund transfer service. A person that...
Factors that control catalytic two- versus four-electron reduction of dioxygen by copper complexes.
Fukuzumi, Shunichi; Tahsini, Laleh; Lee, Yong-Min; Ohkubo, Kei; Nam, Wonwoo; Karlin, Kenneth D
2012-04-25
The selective two-electron reduction of O(2) by one-electron reductants such as decamethylferrocene (Fc*) and octamethylferrocene (Me(8)Fc) is efficiently catalyzed by a binuclear Cu(II) complex [Cu(II)(2)(LO)(OH)](2+) (D1) {LO is a binucleating ligand with copper-bridging phenolate moiety} in the presence of trifluoroacetic acid (HOTF) in acetone. The protonation of the hydroxide group of [Cu(II)(2)(LO)(OH)](2+) with HOTF to produce [Cu(II)(2)(LO)(OTF)](2+) (D1-OTF) makes it possible for this to be reduced by 2 equiv of Fc* via a two-step electron-transfer sequence. Reactions of the fully reduced complex [Cu(I)(2)(LO)](+) (D3) with O(2) in the presence of HOTF led to the low-temperature detection of the absorption spectra due to the peroxo complex [Cu(II)(2)(LO)(OO)] (D) and the protonated hydroperoxo complex [Cu(II)(2)(LO)(OOH)](2+) (D4). No further Fc* reduction of D4 occurs, and it is instead further protonated by HOTF to yield H(2)O(2) accompanied by regeneration of [Cu(II)(2)(LO)(OTF)](2+) (D1-OTF), thus completing the catalytic cycle for the two-electron reduction of O(2) by Fc*. Kinetic studies on the formation of Fc*(+) under catalytic conditions as well as for separate examination of the electron transfer from Fc* to D1-OTF reveal there are two important reaction pathways operating. One is a rate-determining second reduction of D1-OTF, thus electron transfer from Fc* to a mixed-valent intermediate [Cu(II)Cu(I)(LO)](2+) (D2), which leads to [Cu(I)(2)(LO)](+) that is coupled with O(2) binding to produce [Cu(II)(2)(LO)(OO)](+) (D). The other involves direct reaction of O(2) with the mixed-valent compound D2 followed by rapid Fc* reduction of a putative superoxo-dicopper(II) species thus formed, producing D.
Gandini, C. L.; Sanchez-Puerta, M. V.
2017-01-01
Angiosperm mitochondrial genomes (mtDNA) exhibit variable quantities of alien sequences. Many of these sequences are acquired by intracellular gene transfer (IGT) from the plastid. In addition, frequent events of horizontal gene transfer (HGT) between mitochondria of different species also contribute to their expanded genomes. In contrast, alien sequences are rarely found in plastid genomes. Most of the plant-to-plant HGT events involve mitochondrion-to-mitochondrion transfers. Occasionally, foreign sequences in mtDNAs are plastid-derived (MTPT), raising questions about their origin, frequency, and mechanism of transfer. The rising number of complete mtDNAs allowed us to address these questions. We identified 15 new foreign MTPTs, increasing significantly the number of those previously reported. One out of five of the angiosperm species analyzed contained at least one foreign MTPT, suggesting a remarkable frequency of HGT among plants. By analyzing the flanking regions of the foreign MTPTs, we found strong evidence for mt-to-mt transfers in 65% of the cases. We hypothesize that plastid sequences were initially acquired by the native mtDNA via IGT and then transferred to a distantly-related plant via mitochondrial HGT, rather than directly from a foreign plastid to the mitochondrial genome. Finally, we describe three novel putative cases of mitochondrial-derived sequences among angiosperm plastomes. PMID:28262720
Transferable Denitrification Capability of Thermus thermophilus
Alvarez, Laura; Bricio, Carlos; Blesa, Alba; Hidalgo, Aurelio
2014-01-01
Laboratory-adapted strains of Thermus spp. have been shown to require oxygen for growth, including the model strains T. thermophilus HB27 and HB8. In contrast, many isolates of this species that have not been intensively grown under laboratory conditions keep the capability to grow anaerobically with one or more electron acceptors. The use of nitrogen oxides, especially nitrate, as electron acceptors is one of the most widespread capabilities among these facultative strains. In this process, nitrate is reduced to nitrite by a reductase (Nar) that also functions as electron transporter toward nitrite and nitric oxide reductases when nitrate is scarce, effectively replacing respiratory complex III. In many T. thermophilus denitrificant strains, most electrons for Nar are provided by a new class of NADH dehydrogenase (Nrc). The ability to reduce nitrite to NO and subsequently to N2O by the corresponding Nir and Nor reductases is also strain specific. The genes encoding the capabilities for nitrate (nar) and nitrite (nir and nor) respiration are easily transferred between T. thermophilus strains by natural competence or by a conjugation-like process and may be easily lost upon continuous growth under aerobic conditions. The reason for this instability is apparently related to the fact that these metabolic capabilities are encoded in gene cluster islands, which are delimited by insertion sequences and integrated within highly variable regions of easily transferable extrachromosomal elements. Together with the chromosomal genes, these plasmid-associated genetic islands constitute the extended pangenome of T. thermophilus that provides this species with an enhanced capability to adapt to changing environments. PMID:24141123
Water-Floating Giant Nanosheets from Helical Peptide Pentamers
NASA Astrophysics Data System (ADS)
Lee, Jaehun; Nam, Ki Tae
One of the important challenges in the development of protein-mimetic materials is to understand the sequence specific assembly behavior and the dynamic folding change. Conventional strategies to construct two dimensional nanostructures from the peptides have been limited to beta-sheet forming sequences in use of basic building blocks because of their natural tendency to form sheet like aggregations. Here we identified a new peptide sequence, YFCFY that can form dimers by the disulfide bridge, fold into helix and assemble into macroscopic flat sheet at the air/water interface. Because of large driving force for two dimensional assembly and high elastic modulus of the resulting sheet, the peptide assembly induces the flattening of initially round water droplet. Additionally, we found that stabilization of helix by the dimerization is a key determinant for maintaining macroscopic flatness over a few tens centimeter even with a uniform thickness below 10 nm. Furthermore, the capability to transfer 2D film from water droplet to other substrates allows for the multiple stacking of 2D peptide nanostructure, suggesting possible applications in the biomimetic catalysts, biosensor and 2D related electronic devices. This work was supported by Samsung Research Funding Center of Samsung Electronics under Project Number SRFC-MA1401-01.
Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease
NASA Astrophysics Data System (ADS)
Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.
2018-04-01
We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.
Exploring the molecular mechanisms of electron shuttling across the microbe/metal space
Paquete, Catarina M.; Fonseca, Bruno M.; Cruz, Davide R.; Pereira, Tiago M.; Pacheco, Isabel; Soares, Cláudio M.; Louro, Ricardo O.
2014-01-01
Dissimilatory metal reducing organisms play key roles in the biogeochemical cycle of metals as well as in the durability of submerged and buried metallic structures. The molecular mechanisms that support electron transfer across the microbe-metal interface in these organisms remain poorly explored. It is known that outer membrane proteins, in particular multiheme cytochromes, are essential for this type of metabolism, being responsible for direct and indirect, via electron shuttles, interaction with the insoluble electron acceptors. Soluble electron shuttles such as flavins, phenazines, and humic acids are known to enhance extracellular electron transfer. In this work, this phenomenon was explored. All known outer membrane decaheme cytochromes from Shewanella oneidensis MR-1 with known metal terminal reductase activity and a undecaheme cytochrome from Shewanella sp. HRCR-6 were expressed and purified. Their interactions with soluble electron shuttles were studied using stopped-flow kinetics, NMR spectroscopy, and molecular simulations. The results show that despite the structural similarities, expected from the available structural data and sequence homology, the detailed characteristics of their interactions with soluble electron shuttles are different. MtrC and OmcA appear to interact with a variety of different electron shuttles in the close vicinity of some of their hemes, and with affinities that are biologically relevant for the concentrations typical found in the medium for this type of compounds. All data support a view of a distant interaction between the hemes of MtrF and the electron shuttles. For UndA a clear structural characterization was achieved for the interaction with AQDS a humic acid analog. These results provide guidance for future work of the manipulation of these proteins toward modulation of their role in metal attachment and reduction. PMID:25018753
Indo, Y; Glassberg, R; Yokota, I; Tanaka, K
1991-01-01
In our previous study of eight glutaric acidemia type II (GAII) fibroblast lines by using [35S]methionine labeling and immunoprecipitation, three of them had a defect in the synthesis of the alpha-subunit of electron transfer flavoprotein (alpha-ETF) (Ikeda et al. 1986). In one of them (YH1313) the labeling of the mature alpha-ETF was barely detectable, while that of the precursor (p) was stronger. In another (YH605) no synthesis of immunoreactive p alpha-ETF was detectable. In the third cell line (YH1391) the rate of variant p alpha-ETF synthesis was comparable to normal, but its electrophoretic mobility was slightly faster than normal. In the present study, the northern blot analysis revealed that all three mutant cell lines contained p alpha-ETF mRNA and that their size and amount were comparable to normal. In immunoblot analysis, both alpha- and beta-ETF bands were barely detectable in YH1313 and YH605 but were detectable in YH1391 in amounts comparable to normal. Sequencing of YH1313 p alpha-ETF cDNA via PCR identified a transversion of T-470 to G. We then devised a simple PCR method for the 119-bp section (T-443/G-561) for detecting this mutation. In the upstream primer, A-466 was artificially replaced with C, to introduce a BstNI site into the amplified copies in the presence of G-470 from the variant sequence. The genomic DNA analysis using this method demonstrated that YH1313 was homozygous for T----G-470 transversion. It was not detected either in two other alpha-ETF-deficient GAII or in seven control cell lines. The alpha-ETF cDNA sequence in YH605 was identical to normal. Images Figure 1 Figure 2 Figure 3 Figure 5 PMID:1882842
MacGregor, Barbara J; Biddle, Jennifer F; Harbort, Christopher; Matthysse, Ann G; Teske, Andreas
2013-09-01
A near-complete draft genome has been obtained for a single vacuolated orange Beggiatoa (Cand. Maribeggiatoa) filament from a Guaymas Basin seafloor microbial mat, the third relatively complete sequence for the Beggiatoaceae. Possible pathways for sulfide oxidation; nitrate respiration; inorganic carbon fixation by both Type II RuBisCO and the reductive tricarboxylic acid cycle; acetate and possibly formate uptake; and energy-generating electron transport via both oxidative phosphorylation and the Rnf complex are discussed here. A role in nitrite reduction is suggested for an abundant orange cytochrome produced by the Guaymas strain; this has a possible homolog in Beggiatoa (Cand. Isobeggiatoa) sp. PS, isolated from marine harbor sediment, but not Beggiatoa alba B18LD, isolated from a freshwater rice field ditch. Inferred phylogenies for the Calvin-Benson-Bassham (CBB) cycle and the reductive (rTCA) and oxidative (TCA) tricarboxylic acid cycles suggest that genes encoding succinate dehydrogenase and enzymes for carboxylation and/or decarboxylation steps (including RuBisCO) may have been introduced to (or exported from) one or more of the three genomes by horizontal transfer, sometimes by different routes. Sequences from the two marine strains are generally more similar to each other than to sequences from the freshwater strain, except in the case of RuBisCO: only the Guaymas strain encodes a Type II enzyme, which (where studied) discriminates less against oxygen than do Type I RuBisCOs. Genes subject to horizontal transfer may represent key steps for adaptation to factors such as oxygen and carbon dioxide concentration, organic carbon availability, and environmental variability. © 2013.
Sequencing Larger Intact Proteins (30-70 kDa) with Activated Ion Electron Transfer Dissociation
NASA Astrophysics Data System (ADS)
Riley, Nicholas M.; Westphall, Michael S.; Coon, Joshua J.
2018-01-01
The analysis of intact proteins via mass spectrometry can offer several benefits to proteome characterization, although the majority of top-down experiments focus on proteoforms in a relatively low mass range (<30 kDa). Recent studies have focused on improving the analysis of larger intact proteins (up to 75 kDa), but they have also highlighted several challenges to be addressed. One major hurdle is the efficient dissociation of larger protein ions, which often to do not yield extensive fragmentation via conventional tandem MS methods. Here we describe the first application of activated ion electron transfer dissociation (AI-ETD) to proteins in the 30-70 kDa range. AI-ETD leverages infrared photo-activation concurrent to ETD reactions to improve sequence-informative product ion generation. This method generates more product ions and greater sequence coverage than conventional ETD, higher-energy collisional dissociation (HCD), and ETD combined with supplemental HCD activation (EThcD). Importantly, AI-ETD provides the most thorough protein characterization for every precursor ion charge state investigated in this study, making it suitable as a universal fragmentation method in top-down experiments. Additionally, we highlight several acquisition strategies that can benefit characterization of larger proteins with AI-ETD, including combination of spectra from multiple ETD reaction times for a given precursor ion, multiple spectral acquisitions of the same precursor ion, and combination of spectra from two different dissociation methods (e.g., AI-ETD and HCD). In all, AI-ETD shows great promise as a method for dissociating larger intact protein ions as top-down proteomics continues to advance into larger mass ranges. [Figure not available: see fulltext.
NASA Astrophysics Data System (ADS)
Doyle, Lucinda E.; Yung, Pui Yi; Mitra, Sumitra D.; Wuertz, Stefan; Williams, Rohan B. H.; Lauro, Federico M.; Marsili, Enrico
2017-07-01
Enrichment of electrochemically-active microorganisms (EAM) to date has mostly relied on microbial fuel cells fed with wastewater. This study aims to enrich novel EAM by exposing tropical sediment, not frequently reported in the literature, to sustained anodic potentials. Voltamperometric techniques and electrochemical impedance spectroscopy, performed over a wide range of potentials, characterise extracellular electron transfer (EET) over time. Applied potential is found to affect biofilm electrochemical signature. Geobacter metallireducens is heavily enriched on the electrodes, as determined by metagenomic and metatranscriptomic analysis, in the first report of the species in a lactate-fed system. Two novel isolates are grown in pure culture from the enrichment, identified by 16S rRNA gene sequencing as Aeromonas and Enterobacter, respectively. The names proposed are Aeromonas sp. CL-1 and Enterobacter sp. EA-1. Both isolates are capable of EET on carbon felt and screen-printed carbon electrodes without the addition of exogenous redox mediators. Enterobacter sp. EA-1 can also perform mediated electron transfer using the soluble redox mediator 2-hydroxy-1,4-naphthoquinone (HNQ). Both isolates are able to use acetate and lactate as electron donors. This work outlines a comprehensive methodology for characterising novel EAM from unconventional inocula.
Transfer of movement sequences: bigger is better.
Dean, Noah J; Kovacs, Attila J; Shea, Charles H
2008-02-01
Experiment 1 was conducted to determine if proportional transfer from "small to large" scale movements is as effective as transferring from "large to small." We hypothesize that the learning of larger scale movement will require the participant to learn to manage the generation, storage, and dissipation of forces better than when practicing smaller scale movements. Thus, we predict an advantage for transfer of larger scale movements to smaller scale movements relative to transfer from smaller to larger scale movements. Experiment 2 was conducted to determine if adding a load to a smaller scale movement would enhance later transfer to a larger scale movement sequence. It was hypothesized that the added load would require the participants to consider the dynamics of the movement to a greater extent than without the load. The results replicated earlier findings of effective transfer from large to small movements, but consistent with our hypothesis, transfer was less effective from small to large (Experiment 1). However, when a load was added during acquisition transfer from small to large was enhanced even though the load was removed during the transfer test. These results are consistent with the notion that the transfer asymmetry noted in Experiment 1 was due to factors related to movement dynamics that were enhanced during practice of the larger scale movement sequence, but not during the practice of the smaller scale movement sequence. The findings that the movement structure is unaffected by transfer direction but the movement dynamics are influenced by transfer direction is consistent with hierarchal models of sequence production.
Schneider, Sean E.; Thomas, James H.
2014-01-01
We show here that 105 regions in two Lepidoptera genomes appear to derive from horizontally transferred wasp DNA. We experimentally verified the presence of two of these sequences in a diverse set of silkworm (Bombyx mori) genomes. We hypothesize that these horizontal transfers are made possible by the unusual strategy many parasitoid wasps employ of injecting hosts with endosymbiotic polydnaviruses to minimize the host's defense response. Because these virus-like particles deliver wasp DNA to the cells of the host, there has been much interest in whether genetic information can be permanently transferred from the wasp to the host. Two transferred sequences code for a BEN domain, known to be associated with polydnaviruses and transcriptional regulation. These findings represent the first documented cases of horizontal transfer of genes between two organisms by a polydnavirus. This presents an interesting evolutionary paradigm in which host species can acquire new sequences from parasitoid wasps that attack them. Hymenoptera and Lepidoptera diverged ∼300 MYA, making this type of event a source of novel sequences for recipient species. Unlike many other cases of horizontal transfer between two eukaryote species, these sequence transfers can be explained without the need to invoke the sequences ‘hitchhiking’ on a third organism (e.g. retrovirus) capable of independent reproduction. The cellular machinery necessary for the transfer is contained entirely in the wasp genome. The work presented here is the first such discovery of what is likely to be a broader phenomenon among species affected by these wasps. PMID:25296163
Quantum tunneling resonant electron transfer process in Lorentzian plasmas
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hong, Woo-Pyo; Jung, Young-Dae, E-mail: ydjung@hanyang.ac.kr; Department of Applied Physics and Department of Bionanotechnology, Hanyang University, Ansan, Kyunggi-Do 426-791
The quantum tunneling resonant electron transfer process between a positive ion and a neutral atom collision is investigated in nonthermal generalized Lorentzian plasmas. The result shows that the nonthermal effect enhances the resonant electron transfer cross section in Lorentzian plasmas. It is found that the nonthermal effect on the classical resonant electron transfer cross section is more significant than that on the quantum tunneling resonant charge transfer cross section. It is shown that the nonthermal effect on the resonant electron transfer cross section decreases with an increase of the Debye length. In addition, the nonthermal effect on the quantum tunnelingmore » resonant electron transfer cross section decreases with increasing collision energy. The variation of nonthermal and plasma shielding effects on the quantum tunneling resonant electron transfer process is also discussed.« less
Ultrafast direct electron transfer at organic semiconductor and metal interfaces.
Xiang, Bo; Li, Yingmin; Pham, C Huy; Paesani, Francesco; Xiong, Wei
2017-11-01
The ability to control direct electron transfer can facilitate the development of new molecular electronics, light-harvesting materials, and photocatalysis. However, control of direct electron transfer has been rarely reported, and the molecular conformation-electron dynamics relationships remain unclear. We describe direct electron transfer at buried interfaces between an organic polymer semiconductor film and a gold substrate by observing the first dynamical electric field-induced vibrational sum frequency generation (VSFG). In transient electric field-induced VSFG measurements on this system, we observe dynamical responses (<150 fs) that depend on photon energy and polarization, demonstrating that electrons are directly transferred from the Fermi level of gold to the lowest unoccupied molecular orbital of organic semiconductor. Transient spectra further reveal that, although the interfaces are prepared without deliberate alignment control, a subensemble of surface molecules can adopt conformations for direct electron transfer. Density functional theory calculations support the experimental results and ascribe the observed electron transfer to a flat-lying polymer configuration in which electronic orbitals are found to be delocalized across the interface. The present observation of direct electron transfer at complex interfaces and the insights gained into the relationship between molecular conformations and electron dynamics will have implications for implementing novel direct electron transfer in energy materials.
Fapetu, Segun; Keshavarz, Taj; Clements, Mark; Kyazze, Godfrey
2016-09-01
To investigate the contribution of direct electron transfer mechanisms to electricity production in microbial fuel cells by physically retaining Shewanella oneidensis cells close to or away from the anode electrode. A maximum power output of 114 ± 6 mWm(-2) was obtained when cells were retained close to the anode using a dialysis membrane. This was 3.5 times more than when the cells were separated away from the anode. Without the membrane the maximum power output was 129 ± 6 mWm(-2). The direct mechanisms of electron transfer contributed significantly to overall electron transfer from S. oneidensis to electrodes, a result that was corroborated by another experiment where S. oneidensis cells were entrapped in alginate gels. S. oneidensis transfers electrons primarily by direct electron transfer as opposed to mediated electron transfer.
Suppression of BRCA2 by Mutant Mitochondrial DNA in Prostate Cancer
2011-05-01
Briefly, the electron transfer activities of complex I/III (NADH dehydrogenase/cytochrome bc1 complex: catalyzes the electron transfer from NADH to...ferricytochrome c) and complex II/III (succinate dehydrogenase/cytochrome bc1 complex: catalyzes the electron transfer from succinate to ferricytochrome...The electron transfer activity of complex IV (cytochrome c oxidase: catalyzes the final step of the respiratory chain by transferring electrons from
Restricted transfer of learning between unimanual and bimanual finger sequences
Bai, Wenjun
2016-01-01
When training bimanual skills, such as playing piano, people sometimes practice each hand separately and at a later stage combine the movements of the two hands. This poses the critical question of whether motor skills can be acquired by separately practicing each subcomponent or should be trained as a whole. In the present study, we addressed this question by training human subjects for 4 days in a unimanual or bimanual version of the discrete sequence production task. Both groups were then tested on trained and untrained sequences on both unimanual and bimanual versions of the task. Surprisingly, we found no evidence of transfer from trained unimanual to bimanual or from trained bimanual to unimanual sequences. In half the participants, we also investigated whether cuing the sequences on the left and right hand with unique letters would change transfer. With these cues, untrained sequences that shared some components with the trained sequences were performed more quickly than sequences that did not. However, the amount of this transfer was limited to ∼10% of the overall sequence-specific learning gains. These results suggest that unimanual and bimanual sequences are learned in separate representations. Making participants aware of the interrelationship between sequences can induce some transferrable component, although the main component of the skill remains unique to unimanual or bimanual execution. NEW & NOTEWORTHY Studies in reaching movement demonstrated that approximately half of motor learning can transfer across unimanual and bimanual contexts, suggesting that neural representations for unimanual and bimanual movements are fairly overlapping at the level of elementary movement. In this study, we show that little or no transfer occurred across unimanual and bimanual sequential finger movements. This result suggests that bimanual sequences are represented at a level of the motor hierarchy that integrates movements of both hands. PMID:27974447
Electrochemical Measurement of Electron Transfer Kinetics by Shewanella oneidensis MR-1*
Baron, Daniel; LaBelle, Edward; Coursolle, Dan; Gralnick, Jeffrey A.; Bond, Daniel R.
2009-01-01
Shewanella oneidensis strain MR-1 can respire using carbon electrodes and metal oxyhydroxides as electron acceptors, requiring mechanisms for transferring electrons from the cell interior to surfaces located beyond the cell. Although purified outer membrane cytochromes will reduce both electrodes and metals, S. oneidensis also secretes flavins, which accelerate electron transfer to metals and electrodes. We developed techniques for detecting direct electron transfer by intact cells, using turnover and single turnover voltammetry. Metabolically active cells attached to graphite electrodes produced thin (submonolayer) films that demonstrated both catalytic and reversible electron transfer in the presence and absence of flavins. In the absence of soluble flavins, electron transfer occurred in a broad potential window centered at ∼0 V (versus standard hydrogen electrode), and was altered in single (ΔomcA, ΔmtrC) and double deletion (ΔomcA/ΔmtrC) mutants of outer membrane cytochromes. The addition of soluble flavins at physiological concentrations significantly accelerated electron transfer and allowed catalytic electron transfer to occur at lower applied potentials (−0.2 V). Scan rate analysis indicated that rate constants for direct electron transfer were slower than those reported for pure cytochromes (∼1 s−1). These observations indicated that anodic current in the higher (>0 V) window is due to activation of a direct transfer mechanism, whereas electron transfer at lower potentials is enabled by flavins. The electrochemical dissection of these activities in living cells into two systems with characteristic midpoint potentials and kinetic behaviors explains prior observations and demonstrates the complementary nature of S. oneidensis electron transfer strategies. PMID:19661057
NASA Astrophysics Data System (ADS)
Jonas, David M.
2018-04-01
Femtosecond two-dimensional (2D) Fourier transform spectroscopy generates and probes several types of coherence that characterize the couplings between vibrational and electronic motions. These couplings have been studied in molecules with Jahn-Teller conical intersections, pseudo-Jahn-Teller funnels, dimers, molecular aggregates, photosynthetic light harvesting complexes, and photosynthetic reaction centers. All have closely related Hamiltonians and at least two types of vibrations, including one that is decoupled from the electronic dynamics and one that is nonadiabatically coupled. Polarized pulse sequences can often be used to distinguish these types of vibrations. Electronic coherences are rapidly obscured by inhomogeneous dephasing. The longest-lived coherences in these systems arise from delocalized vibrations on the ground electronic state that are enhanced by a nonadiabatic Raman excitation process. These characterize the initial excited-state dynamics. 2D oscillation maps are beginning to isolate the medium lifetime vibronic coherences that report on subsequent stages of the excited-state dynamics.
NASA Astrophysics Data System (ADS)
Furrer, Julien; Kramer, Frank; Marino, John P.; Glaser, Steffen J.; Luy, Burkhard
2004-01-01
Homonuclear Hartmann-Hahn transfer is one of the most important building blocks in modern high-resolution NMR. It constitutes a very efficient transfer element for the assignment of proteins, nucleic acids, and oligosaccharides. Nevertheless, in macromolecules exceeding ˜10 kDa TOCSY-experiments can show decreasing sensitivity due to fast transverse relaxation processes that are active during the mixing periods. In this article we propose the MOCCA-XY16 multiple pulse sequence, originally developed for efficient TOCSY transfer through residual dipolar couplings, as a homonuclear Hartmann-Hahn sequence with improved relaxation properties. A theoretical analysis of the coherence transfer via scalar couplings and its relaxation behavior as well as experimental transfer curves for MOCCA-XY16 relative to the well-characterized DIPSI-2 multiple pulse sequence are given.
Furrer, Julien; Kramer, Frank; Marino, John P; Glaser, Steffen J; Luy, Burkhard
2004-01-01
Homonuclear Hartmann-Hahn transfer is one of the most important building blocks in modern high-resolution NMR. It constitutes a very efficient transfer element for the assignment of proteins, nucleic acids, and oligosaccharides. Nevertheless, in macromolecules exceeding approximately 10 kDa TOCSY-experiments can show decreasing sensitivity due to fast transverse relaxation processes that are active during the mixing periods. In this article we propose the MOCCA-XY16 multiple pulse sequence, originally developed for efficient TOCSY transfer through residual dipolar couplings, as a homonuclear Hartmann-Hahn sequence with improved relaxation properties. A theoretical analysis of the coherence transfer via scalar couplings and its relaxation behavior as well as experimental transfer curves for MOCCA-XY16 relative to the well-characterized DIPSI-2 multiple pulse sequence are given.
Zhao, Jing; Wang, Mei; Fu, Aiyun; Yang, Hongfang; Bu, Yuxiang
2015-08-03
We present an ab initio molecular dynamics (AIMD) simulation study into the transfer dynamics of an excess electron from its cavity-shaped hydrated electron state to a hydrated nucleobase (NB)-bound state. In contrast to the traditional view that electron localization at NBs (G/A/C/T), which is the first step for electron-induced DNA damage, is related only to dry or prehydrated electrons, and a fully hydrated electron no longer transfers to NBs, our AIMD simulations indicate that a fully hydrated electron can still transfer to NBs. We monitored the transfer dynamics of fully hydrated electrons towards hydrated NBs in aqueous solutions by using AIMD simulations and found that due to solution-structure fluctuation and attraction of NBs, a fully hydrated electron can transfer to a NB gradually over time. Concurrently, the hydrated electron cavity gradually reorganizes, distorts, and even breaks. The transfer could be completed in about 120-200 fs in four aqueous NB solutions, depending on the electron-binding ability of hydrated NBs and the structural fluctuation of the solution. The transferring electron resides in the π*-type lowest unoccupied molecular orbital of the NB, which leads to a hydrated NB anion. Clearly, the observed transfer of hydrated electrons can be attributed to the strong electron-binding ability of hydrated NBs over the hydrated electron cavity, which is the driving force, and the transfer dynamics is structure-fluctuation controlled. This work provides new insights into the evolution dynamics of hydrated electrons and provides some helpful information for understanding the DNA-damage mechanism in solution. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Wu, Allan D.; Samra, Jasmine K.
2017-01-01
The cerebellum has been shown to be important for skill learning, including the learning of motor sequences. We investigated whether cerebellar transcranial direct current stimulation (tDCS) would enhance learning of fine motor sequences. Because the ability to generalize or transfer to novel task variations or circumstances is a crucial goal of real world training, we also examined the effect of tDCS on performance of novel sequences after training. In Study 1, participants received either anodal, cathodal or sham stimulation while simultaneously practising three eight-element key press sequences in a non-repeating, interleaved order. Immediately after sequence practice with concurrent tDCS, a transfer session was given in which participants practised three interleaved novel sequences. No stimulation was given during transfer. An inhibitory effect of cathodal tDCS was found during practice, such that the rate of learning was slowed in comparison to the anodal and sham groups. In Study 2, participants received anodal or sham stimulation and a 24 h delay was added between the practice and transfer sessions to reduce mental fatigue. Although this consolidation period benefitted subsequent transfer for both tDCS groups, anodal tDCS enhanced transfer performance. Together, these studies demonstrate polarity-specific effects on fine motor sequence learning and generalization. This article is part of the themed issue ‘New frontiers for statistical learning in the cognitive sciences’. PMID:27872369
Shimizu, Renee E; Wu, Allan D; Samra, Jasmine K; Knowlton, Barbara J
2017-01-05
The cerebellum has been shown to be important for skill learning, including the learning of motor sequences. We investigated whether cerebellar transcranial direct current stimulation (tDCS) would enhance learning of fine motor sequences. Because the ability to generalize or transfer to novel task variations or circumstances is a crucial goal of real world training, we also examined the effect of tDCS on performance of novel sequences after training. In Study 1, participants received either anodal, cathodal or sham stimulation while simultaneously practising three eight-element key press sequences in a non-repeating, interleaved order. Immediately after sequence practice with concurrent tDCS, a transfer session was given in which participants practised three interleaved novel sequences. No stimulation was given during transfer. An inhibitory effect of cathodal tDCS was found during practice, such that the rate of learning was slowed in comparison to the anodal and sham groups. In Study 2, participants received anodal or sham stimulation and a 24 h delay was added between the practice and transfer sessions to reduce mental fatigue. Although this consolidation period benefitted subsequent transfer for both tDCS groups, anodal tDCS enhanced transfer performance. Together, these studies demonstrate polarity-specific effects on fine motor sequence learning and generalization.This article is part of the themed issue 'New frontiers for statistical learning in the cognitive sciences'. © 2016 The Author(s).
New powerful statistics for alignment-free sequence comparison under a pattern transfer model.
Liu, Xuemei; Wan, Lin; Li, Jing; Reinert, Gesine; Waterman, Michael S; Sun, Fengzhu
2011-09-07
Alignment-free sequence comparison is widely used for comparing gene regulatory regions and for identifying horizontally transferred genes. Recent studies on the power of a widely used alignment-free comparison statistic D2 and its variants D*2 and D(s)2 showed that their power approximates a limit smaller than 1 as the sequence length tends to infinity under a pattern transfer model. We develop new alignment-free statistics based on D2, D*2 and D(s)2 by comparing local sequence pairs and then summing over all the local sequence pairs of certain length. We show that the new statistics are much more powerful than the corresponding statistics and the power tends to 1 as the sequence length tends to infinity under the pattern transfer model. Copyright © 2011 Elsevier Ltd. All rights reserved.
New Powerful Statistics for Alignment-free Sequence Comparison Under a Pattern Transfer Model
Liu, Xuemei; Wan, Lin; Li, Jing; Reinert, Gesine; Waterman, Michael S.; Sun, Fengzhu
2011-01-01
Alignment-free sequence comparison is widely used for comparing gene regulatory regions and for identifying horizontally transferred genes. Recent studies on the power of a widely used alignment-free comparison statistic D2 and its variants D2∗ and D2s showed that their power approximates a limit smaller than 1 as the sequence length tends to infinity under a pattern transfer model. We develop new alignment-free statistics based on D2, D2∗ and D2s by comparing local sequence pairs and then summing over all the local sequence pairs of certain length. We show that the new statistics are much more powerful than the corresponding statistics and the power tends to 1 as the sequence length tends to infinity under the pattern transfer model. PMID:21723298
Jones, Matthew; Talfournier, Francois; Bobrov, Anton; Grossmann, J Günter; Vekshin, Nikolai; Sutcliffe, Michael J; Scrutton, Nigel S
2002-03-08
The trimethylamine dehydrogenase-electron transferring flavoprotein (TMADH.ETF) electron transfer complex has been studied by fluorescence and absorption spectroscopies. These studies indicate that a series of conformational changes occur during the assembly of the TMADH.ETF electron transfer complex and that the kinetics of assembly observed with mutant TMADH (Y442F/L/G) or ETF (alpha R237A) complexes are much slower than are the corresponding rates of electron transfer in these complexes. This suggests that electron transfer does not occur in the thermodynamically most favorable state (which takes too long to form), but that one or more metastable states (which are formed more rapidly) are competent in transferring electrons from TMADH to ETF. Additionally, fluorescence spectroscopy studies of the TMADH.ETF complex indicate that ETF undergoes a stable conformational change (termed structural imprinting) when it interacts transiently with TMADH to form a second, distinct, structural form. The mutant complexes compromise imprinting of ETF, indicating a dependence on the native interactions present in the wild-type complex. The imprinted form of semiquinone ETF exhibits an enhanced rate of electron transfer to the artificial electron acceptor, ferricenium. Overall molecular conformations as probed by small-angle x-ray scattering studies are indistinguishable for imprinted and non-imprinted ETF, suggesting that changes in structure likely involve confined reorganizations within the vicinity of the FAD. Our results indicate a series of conformational events occur during the assembly of the TMADH.ETF electron transfer complex, and that the properties of electron transfer proteins can be affected lastingly by transient interaction with their physiological redox partners. This may have significant implications for our understanding of biological electron transfer reactions in vivo, because ETF encounters TMADH at all times in the cell. Our studies suggest that caution needs to be exercised in extrapolating the properties of in vitro interprotein electron transfer reactions to those occurring in vivo.
31 CFR 208.3 - Payment by electronic funds transfer.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 31 Money and Finance:Treasury 2 2011-07-01 2011-07-01 false Payment by electronic funds transfer... DISBURSEMENTS § 208.3 Payment by electronic funds transfer. Subject to § 208.4, and notwithstanding any other... electronic funds transfer. ...
48 CFR 18.124 - Electronic funds transfer.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 48 Federal Acquisition Regulations System 1 2011-10-01 2011-10-01 false Electronic funds transfer. 18.124 Section 18.124 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Electronic funds transfer. Electronic funds transfer payments may be waived for acquisitions to support...
48 CFR 18.124 - Electronic funds transfer.
Code of Federal Regulations, 2013 CFR
2013-10-01
... 48 Federal Acquisition Regulations System 1 2013-10-01 2013-10-01 false Electronic funds transfer. 18.124 Section 18.124 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Electronic funds transfer. Electronic funds transfer payments may be waived for acquisitions to support...
31 CFR 208.3 - Payment by electronic funds transfer.
Code of Federal Regulations, 2012 CFR
2012-07-01
... 31 Money and Finance:Treasury 2 2012-07-01 2012-07-01 false Payment by electronic funds transfer... DISBURSEMENTS § 208.3 Payment by electronic funds transfer. Subject to § 208.4, and notwithstanding any other... electronic funds transfer. ...
48 CFR 18.123 - Electronic funds transfer.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Electronic funds transfer. 18.123 Section 18.123 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Electronic funds transfer. Electronic funds transfer payments may be waived for acquisitions to support...
48 CFR 18.124 - Electronic funds transfer.
Code of Federal Regulations, 2012 CFR
2012-10-01
... 48 Federal Acquisition Regulations System 1 2012-10-01 2012-10-01 false Electronic funds transfer. 18.124 Section 18.124 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Electronic funds transfer. Electronic funds transfer payments may be waived for acquisitions to support...
48 CFR 18.124 - Electronic funds transfer.
Code of Federal Regulations, 2014 CFR
2014-10-01
... 48 Federal Acquisition Regulations System 1 2014-10-01 2014-10-01 false Electronic funds transfer. 18.124 Section 18.124 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Electronic funds transfer. Electronic funds transfer payments may be waived for acquisitions to support...
Voltage dependency of transmission probability of aperiodic DNA molecule
NASA Astrophysics Data System (ADS)
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Electrochemical Studies of a Truncated Laccase Produced in Pichia pastoris
Gelo-Pujic, Mirjana; Kim, Hyug-Han; Butlin, Nathan G.; Palmore, G. Tayhas R.
1999-01-01
The cDNA that encodes an isoform of laccase from Trametes versicolor (LCCI), as well as a truncated version (LCCIa), was subcloned and expressed by using the yeast Pichia pastoris as the heterologous host. The amino acid sequence of LCCIa is identical to that of LCCI except that the final 11 amino acids at the C terminus of LCCI are replaced with a single cysteine residue. This modification was introduced for the purpose of improving the kinetics of electron transfer between an electrode and the copper-containing active site of laccase. The two laccases (LCCI and LCCIa) are compared in terms of their relative activity with two substrates that have different redox potentials. Results from electrochemical studies on solutions containing LCCI and LCCIa indicate that the redox potential of the active site of LCCIa is shifted to more negative values (411 mV versus normal hydrogen electrode voltage) than that found in other fungal laccases. In addition, replacing the 11 codons at the C terminus of the laccase gene with a single cysteine codon (i.e., LCCI→LCCIa) influences the rate of heterogeneous electron transfer between an electrode and the copper-containing active site (khet for LCCIa = 1.3 × 10−4 cm s−1). These results demonstrate for the first time that the rate of electron transfer between an oxidoreductase and an electrode can be enhanced by changes to the primary structure of a protein via site-directed mutagenesis. PMID:10584012
Empirical transfer functions for stations in the Central California seismological network
Bakun, W.H.; Dratler, Jay
1976-01-01
A sequence of calibration signals composed of a station identification code, a transient from the release of the seismometer mass at rest from a known displacement from the equilibrium position, and a transient from a known step in voltage to the amplifier input are generated by the automatic daily calibration system (ADCS) now operational in the U.S. Geological Survey central California seismographic network. Documentation of a sequence of interactive programs to compute, from the calibration data, the complex transfer functions for the seismographic system (ground motion through digitizer) the electronics (amplifier through digitizer), and the seismometer alone are presented. The analysis utilizes the Fourier transform technique originally suggested by Espinosa et al (1962). Section I is a general description of seismographic calibration. Section II contrasts the 'Fourier transform' and the 'least-squares' techniques for analyzing transient calibration signals. Theoretical consideration for the Fourier transform technique used here are described in Section III. Section IV is a detailed description of the sequence of calibration signals generated by the ADCS. Section V is a brief 'cookbook description' of the calibration programs; Section VI contains a detailed sample program execution. Section VII suggests the uses of the resultant empirical transfer functions. Supplemental interactive programs by which smooth response functions, suitable for reducing seismic data to ground motion, are also documented in Section VII. Appendices A and B contain complete listings of the Fortran source Codes while Appendix C is an update containing preliminary results obtained from an analysis of some of the calibration signals from stations in the seismographic network near Oroville, California.
Kinetic and spectral properties of isovaleryl-CoA dehydrogenase and interaction with ligands.
Mohsen, Al-Walid A; Vockley, Jerry
2015-01-01
Isovaleryl-CoA dehydrogenase (IVD) catalyzes the conversion of isovaleryl-CoA to 3-methylcrotonyl-CoA and the transfer of electrons to the electron transfer flavoprotein (ETF). Recombinant human IVD purifies with bound CoA-persulfide. A modified purification protocol was developed to isolate IVD without bound CoA-persulfide and to protect the protein thiols from oxidation. The CoA-persulfide-free IVD specific activity was 112.5 μmol porcine ETF min(-)(1) mg(-)(1), which was ∼20-fold higher than that of its CoA-persulfide bound form. The Km and catalytic efficiency (kcat/Km) for isovaleryl-CoA were 1.0 μM and 4.3 × 10(6) M(-1) s(-1) per monomer, respectively, and its Km for ETF was 2.0 μM. Anaerobic titration of isovaleryl-CoA into an IVD solution resulted in a stable blue complex with increased absorbance at 310 nm, decreased absorbance at 373 and 447 nm, and the appearance of the charge transfer complex band at 584 nm. The apparent dissociation constant (KDapp) determined spectrally for isovaleryl-CoA was 0.54 μM. Isovaleryl-CoA, acetoacetyl-CoA, methylenecyclopropyl-acetyl-CoA, and ETF induced CD spectral changes at the 250-500 nm region while isobutyryl-CoA did not, suggesting conformational changes occur at the flavin ring that are ligand specific. Replacement of the IVD Trp166 with a Phe did not block IVD interaction with ETF, indicating that its indole ring is not essential for electron transfer to ETF. A twelve amino acid synthetic peptide that matches the sequence of the ETF docking peptide competitively inhibited the enzyme reaction when ETF was used as the electron acceptor with a Ki of 1.5 mM. Copyright © 2014 Elsevier B.V. and Société française de biochimie et biologie Moléculaire (SFBBM). All rights reserved.
Photoinduced electron transfer from semiconductor quantum dots to metal oxide nanoparticles
Tvrdy, Kevin; Frantsuzov, Pavel A.; Kamat, Prashant V.
2011-01-01
Quantum dot-metal oxide junctions are an integral part of next-generation solar cells, light emitting diodes, and nanostructured electronic arrays. Here we present a comprehensive examination of electron transfer at these junctions, using a series of CdSe quantum dot donors (sizes 2.8, 3.3, 4.0, and 4.2 nm in diameter) and metal oxide nanoparticle acceptors (SnO2, TiO2, and ZnO). Apparent electron transfer rate constants showed strong dependence on change in system free energy, exhibiting a sharp rise at small driving forces followed by a modest rise further away from the characteristic reorganization energy. The observed trend mimics the predicted behavior of electron transfer from a single quantum state to a continuum of electron accepting states, such as those present in the conduction band of a metal oxide nanoparticle. In contrast with dye-sensitized metal oxide electron transfer studies, our systems did not exhibit unthermalized hot-electron injection due to relatively large ratios of electron cooling rate to electron transfer rate. To investigate the implications of these findings in photovoltaic cells, quantum dot-metal oxide working electrodes were constructed in an identical fashion to the films used for the electron transfer portion of the study. Interestingly, the films which exhibited the fastest electron transfer rates (SnO2) were not the same as those which showed the highest photocurrent (TiO2). These findings suggest that, in addition to electron transfer at the quantum dot-metal oxide interface, other electron transfer reactions play key roles in the determination of overall device efficiency. PMID:21149685
Photoinduced electron transfer from semiconductor quantum dots to metal oxide nanoparticles.
Tvrdy, Kevin; Frantsuzov, Pavel A; Kamat, Prashant V
2011-01-04
Quantum dot-metal oxide junctions are an integral part of next-generation solar cells, light emitting diodes, and nanostructured electronic arrays. Here we present a comprehensive examination of electron transfer at these junctions, using a series of CdSe quantum dot donors (sizes 2.8, 3.3, 4.0, and 4.2 nm in diameter) and metal oxide nanoparticle acceptors (SnO(2), TiO(2), and ZnO). Apparent electron transfer rate constants showed strong dependence on change in system free energy, exhibiting a sharp rise at small driving forces followed by a modest rise further away from the characteristic reorganization energy. The observed trend mimics the predicted behavior of electron transfer from a single quantum state to a continuum of electron accepting states, such as those present in the conduction band of a metal oxide nanoparticle. In contrast with dye-sensitized metal oxide electron transfer studies, our systems did not exhibit unthermalized hot-electron injection due to relatively large ratios of electron cooling rate to electron transfer rate. To investigate the implications of these findings in photovoltaic cells, quantum dot-metal oxide working electrodes were constructed in an identical fashion to the films used for the electron transfer portion of the study. Interestingly, the films which exhibited the fastest electron transfer rates (SnO(2)) were not the same as those which showed the highest photocurrent (TiO(2)). These findings suggest that, in addition to electron transfer at the quantum dot-metal oxide interface, other electron transfer reactions play key roles in the determination of overall device efficiency.
Modular electron transfer circuits for synthetic biology
Agapakis, Christina M
2010-01-01
Electron transfer is central to a wide range of essential metabolic pathways, from photosynthesis to fermentation. The evolutionary diversity and conservation of proteins that transfer electrons makes these pathways a valuable platform for engineered metabolic circuits in synthetic biology. Rational engineering of electron transfer pathways containing hydrogenases has the potential to lead to industrial scale production of hydrogen as an alternative source of clean fuel and experimental assays for understanding the complex interactions of multiple electron transfer proteins in vivo. We designed and implemented a synthetic hydrogen metabolism circuit in Escherichia coli that creates an electron transfer pathway both orthogonal to and integrated within existing metabolism. The design of such modular electron transfer circuits allows for facile characterization of in vivo system parameters with applications toward further engineering for alternative energy production. PMID:21468209
Boehme, Simon C; Walvis, T Ardaan; Infante, Ivan; Grozema, Ferdinand C; Vanmaekelbergh, Daniël; Siebbeles, Laurens D A; Houtepen, Arjan J
2014-07-22
Understanding and controlling charge transfer between different kinds of colloidal quantum dots (QDs) is important for devices such as light-emitting diodes and solar cells and for thermoelectric applications. Here we study photoinduced electron transfer between CdTe and CdSe QDs in a QD film. We find that very efficient electron trapping in CdTe QDs obstructs electron transfer to CdSe QDs under most conditions. Only the use of thiol ligands results in somewhat slower electron trapping; in this case the competition between trapping and electron transfer results in a small fraction of electrons being transferred to CdSe. However, we demonstrate that electron trapping can be controlled and even avoided altogether by using the unique combination of electrochemistry and transient absorption spectroscopy. When the Fermi level is raised electrochemically, traps are filled with electrons and electron transfer from CdTe to CdSe QDs occurs with unity efficiency. These results show the great importance of knowing and controlling the Fermi level in QD films and open up the possibility of studying the density of trap states in QD films as well as the systematic investigation of the intrinsic electron transfer rates in donor-acceptor films.
Dipole-Guided Electron Capture Causes Abnormal Dissociations of Phosphorylated Pentapeptides
NASA Astrophysics Data System (ADS)
Moss, Christopher L.; Chung, Thomas W.; Wyer, Jean A.; Nielsen, Steen Brøndsted; Hvelplund, Preben; Tureček, František
2011-04-01
Electron transfer and capture mass spectra of a series of doubly charged ions that were phosphorylated pentapeptides of a tryptic type (pS,A,A,A,R) showed conspicuous differences in dissociations of charge-reduced ions. Electron transfer from both gaseous cesium atoms at 100 keV kinetic energies and fluoranthene anion radicals in an ion trap resulted in the loss of a hydrogen atom, ammonia, and backbone cleavages forming complete series of sequence z ions. Elimination of phosphoric acid was negligible. In contrast, capture of low-energy electrons by doubly charged ions in a Penning ion trap induced loss of a hydrogen atom followed by elimination of phosphoric acid as the dominant dissociation channel. Backbone dissociations of charge-reduced ions also occurred but were accompanied by extensive fragmentation of the primary products. z-Ions that were terminated with a deaminated phosphoserine radical competitively eliminated phosphoric acid and H2PO4 radicals. A mechanism is proposed for this novel dissociation on the basis of a computational analysis of reaction pathways and transition states. Electronic structure theory calculations in combination with extensive molecular dynamics mapping of the potential energy surface provided structures for the precursor phosphopeptide dications. Electron attachment produces a multitude of low lying electronic states in charge-reduced ions that determine their reactivity in backbone dissociations and H- atom loss. The predominant loss of H atoms in ECD is explained by a distortion of the Rydberg orbital space by the strong dipolar field of the peptide dication framework. The dipolar field steers the incoming electron to preferentially attach to the positively charged arginine side chain to form guanidinium radicals and trigger their dissociations.
Hot-electron transfer in quantum-dot heterojunction films.
Grimaldi, Gianluca; Crisp, Ryan W; Ten Brinck, Stephanie; Zapata, Felipe; van Ouwendorp, Michiko; Renaud, Nicolas; Kirkwood, Nicholas; Evers, Wiel H; Kinge, Sachin; Infante, Ivan; Siebbeles, Laurens D A; Houtepen, Arjan J
2018-06-13
Thermalization losses limit the photon-to-power conversion of solar cells at the high-energy side of the solar spectrum, as electrons quickly lose their energy relaxing to the band edge. Hot-electron transfer could reduce these losses. Here, we demonstrate fast and efficient hot-electron transfer between lead selenide and cadmium selenide quantum dots assembled in a quantum-dot heterojunction solid. In this system, the energy structure of the absorber material and of the electron extracting material can be easily tuned via a variation of quantum-dot size, allowing us to tailor the energetics of the transfer process for device applications. The efficiency of the transfer process increases with excitation energy as a result of the more favorable competition between hot-electron transfer and electron cooling. The experimental picture is supported by time-domain density functional theory calculations, showing that electron density is transferred from lead selenide to cadmium selenide quantum dots on the sub-picosecond timescale.
Analysis of the cytochrome c oxidase subunit II (COX2) gene in giant panda, Ailuropoda melanoleuca.
Ling, S S; Zhu, Y; Lan, D; Li, D S; Pang, H Z; Wang, Y; Li, D Y; Wei, R P; Zhang, H M; Wang, C D; Hu, Y D
2017-01-23
The giant panda, Ailuropoda melanoleuca (Ursidae), has a unique bamboo-based diet; however, this low-energy intake has been sufficient to maintain the metabolic processes of this species since the fourth ice age. As mitochondria are the main sites for energy metabolism in animals, the protein-coding genes involved in mitochondrial respiratory chains, particularly cytochrome c oxidase subunit II (COX2), which is the rate-limiting enzyme in electron transfer, could play an important role in giant panda metabolism. Therefore, the present study aimed to isolate, sequence, and analyze the COX2 DNA from individuals kept at the Giant Panda Protection and Research Center, China, and compare these sequences with those of the other Ursidae family members. Multiple sequence alignment showed that the COX2 gene had three point mutations that defined three haplotypes, with 60% of the sequences corresponding to haplotype I. The neutrality tests revealed that the COX2 gene was conserved throughout evolution, and the maximum likelihood phylogenetic analysis, using homologous sequences from other Ursidae species, showed clustering of the COX2 sequences of giant pandas, suggesting that this gene evolved differently in them.
Microbial Electrochemistry and its Application to Energy and Environmental Issues
NASA Astrophysics Data System (ADS)
Hastings, Jason Thomas
Microbial electrochemistry forms the basis of a wide range of topics from microbial fuel cells to fermentation of carbon food sources. The ability to harness microbial electron transfer processes can lead to a greener and cleaner future. This study focuses on microbial electron transfer for liquid fuel production, novel electrode materials, subsurface environments and removal of unwanted byproducts. In the first chapter, exocellular electron transfer through direct contact utilizing passive electrodes for the enhancement of bio-fuel production was tested. Through the application of microbial growth in a 2-cell apparatus on an electrode surface ethanol production was enhanced by 22.7% over traditional fermentation. Ethanol production efficiencies of close to 95% were achieved in a fraction of the time required by traditional fermentation. Also, in this chapter, the effect of exogenous electron shuttles, electrode material selection and resistance was investigated. Power generation was observed using the 2-cell passive electrode system. An encapsulation method, which would also utilize exocellular transfer of electrons through direct contact, was hypothesized for the suspension of viable cells in a conductive polymer substrate. This conductive polymer substrate could have applications in bio-fuel production. Carbon black was added to a polymer solution to test electrospun polymer conductivity and cell viability. Polymer morphology and cell viability were imaged using electron and optical microscopy. Through proper encapsulation, higher fuel production efficiencies would be achievable. Electron transfer through endogenous exocellular protein shuttles was observed in this study. Secretion of a soluble redox active exocellular protein by
14 CFR 1274.931 - Electronic funds transfer payment methods.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 14 Aeronautics and Space 5 2011-01-01 2010-01-01 true Electronic funds transfer payment methods... COOPERATIVE AGREEMENTS WITH COMMERCIAL FIRMS Other Provisions and Special Conditions § 1274.931 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods July 2002 Payments under this...
77 FR 40459 - Electronic Fund Transfers (Regulation E); Correction
Federal Register 2010, 2011, 2012, 2013, 2014
2012-07-10
... Electronic Fund Transfers (Regulation E); Correction AGENCY: Bureau of Consumer Financial Protection. ACTION... published the Final Rule (77 FR 6194), which implements the Electronic Fund Transfer Act, and the official... Sec. 1005.3(a) in the interim final rule, Electronic Fund Transfers (Regulation E), published on...
14 CFR 1274.931 - Electronic funds transfer payment methods.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 14 Aeronautics and Space 5 2013-01-01 2013-01-01 false Electronic funds transfer payment methods... COOPERATIVE AGREEMENTS WITH COMMERCIAL FIRMS Other Provisions and Special Conditions § 1274.931 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods July 2002 Payments under this...
Use of CID/ETD Mass Spectrometry to Analyze Glycopeptides
Mechref, Yehia
2013-01-01
Collision-induced dissociation (CID) tandem mass spectrometry (MS) does not allow the characterization of glycopeptides because of the fragmentation of their glycan structures and limited fragmentation of peptide backbones. Electron-transfer dissociation (ETD) tandem MS, on the other hand, offers an alternative approach allowing the fragmentation of only peptide backbones of glycopeptides. Characterization of glycopeptides using both CID and ETD is summarized in this unit. While CID provide information related to the composition of glycan moiety attached to a peptide backbone, ETD permits de novo sequencing of peptides, since it prompts only peptide backbone fragmentation while keeping posttranslational modifications intact. Radical anions transfer of electrons to peptide backbone which induces cleavage of the N-Cα bond is observed in ETD. The glycan moiety is retained on the peptide backbone, largely unaffected by the ETD process. Accordingly, ETD allows not only the identification of the amino acid sequence of a glycopeptide, but also the unambiguous assignment of its glycosylation site. When data acquired from both fragmentation techniques are combined, it is possible to characterize comprehensively the entire glycopeptide. This is achieved using an instrument capable of alternating between CID and ETD experiments during an LC-MS/MS analysis. This unit discusses the different fragmentation of glycopeptides observed in CID and ETD. Tables of residue masses associated with oxonium ions observed in CID are provided to help in the interpretation of CID mass spectra. The utility of both CID and ETD for better characterization of glycopeptides are demonstrated for a model glycoprotein. PMID:22470127
Monari, Stefano; Battistuzzi, Gianantonio; Borsari, Marco; Di Rocco, Giulia; Martini, Laura; Ranieri, Antonio; Sola, Marco
2009-10-15
The recombinant diheme cytochrome c(4) from the psycrophilic bacterium Pseudoalteromonas haloplanktis TAC 125 and its Met64Ala and Met164Ala variants, which feature a hydroxide ion axially bound to the heme iron at the N- and C-terminal domains, respectively, were found to exchange electrons efficiently with a gold electrode coated with a SAM of 11-mercapto-1-undecanoic acid. The mutation-induced removal of the redox equivalence of the two heme groups and changes in the net charge of the protein lobes yield two-centered protein systems with unprecedented properties in the electrode-immobilized state. The heterogeneous and intraheme electron transfer processes were characterized for these species in which the high- and low-potential heme groups are swapped over in the bilobal protein framework and experience a constrained (M64A) and unconstrained (M164A) orientation toward the electrode. The reduction thermodynamics for the native and mutated hemes were measured for the first time for a diheme cytochrome c. In the diffusing regime, they reproduce closely those for the corresponding centers in single-heme class-I cytochromes c, despite the low sequence identity. Larger differences are observed in the thermodynamics of the immobilized species and in the heterogeneous electron transfer rate constants. T-dependent kinetic measurements show that the proteins are positioned approximately 7 A from the HOOC-terminated SAM-coated electrode. Protein-electrode orientation and efficient intraheme ET enable the His,OH(-)-ligated heme A of the immobilized Met64Ala variant to carry out the reductive electrocatalysis of molecular oxygen. This system therefore constitutes a novel two-centered heme-based biocatalytic interface to be exploited for "third-generation" amperometric biosensing.
Electrons, life and the evolution of Earth's oxygen cycle.
Falkowski, Paul G; Godfrey, Linda V
2008-08-27
The biogeochemical cycles of H, C, N, O and S are coupled via biologically catalysed electron transfer (redox) reactions. The metabolic processes responsible for maintaining these cycles evolved over the first ca 2.3 Ga of Earth's history in prokaryotes and, through a sequence of events, led to the production of oxygen via the photobiologically catalysed oxidation of water. However, geochemical evidence suggests that there was a delay of several hundred million years before oxygen accumulated in Earth's atmosphere related to changes in the burial efficiency of organic matter and fundamental alterations in the nitrogen cycle. In the latter case, the presence of free molecular oxygen allowed ammonium to be oxidized to nitrate and subsequently denitrified. The interaction between the oxygen and nitrogen cycles in particular led to a negative feedback, in which increased production of oxygen led to decreased fixed inorganic nitrogen in the oceans. This feedback, which is supported by isotopic analyses of fixed nitrogen in sedimentary rocks from the Late Archaean, continues to the present. However, once sufficient oxygen accumulated in Earth's atmosphere to allow nitrification to out-compete denitrification, a new stable electron 'market' emerged in which oxygenic photosynthesis and aerobic respiration ultimately spread via endosymbiotic events and massive lateral gene transfer to eukaryotic host cells, allowing the evolution of complex (i.e. animal) life forms. The resulting network of electron transfers led a gas composition of Earth's atmosphere that is far from thermodynamic equilibrium (i.e. it is an emergent property), yet is relatively stable on geological time scales. The early coevolution of the C, N and O cycles, and the resulting non-equilibrium gaseous by-products can be used as a guide to search for the presence of life on terrestrial planets outside of our Solar System.
14 CFR § 1260.69 - Electronic funds transfer payment methods.
Code of Federal Regulations, 2014 CFR
2014-01-01
... 14 Aeronautics and Space 5 2014-01-01 2014-01-01 false Electronic funds transfer payment methods... GRANTS AND COOPERATIVE AGREEMENTS General Special Conditions § 1260.69 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods October 2000 (a) Payments under this grant will be made...
14 CFR 1260.69 - Electronic funds transfer payment methods.
Code of Federal Regulations, 2013 CFR
2013-01-01
... 14 Aeronautics and Space 5 2013-01-01 2013-01-01 false Electronic funds transfer payment methods... COOPERATIVE AGREEMENTS General Special Conditions § 1260.69 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods October 2000 (a) Payments under this grant will be made by the...
14 CFR 1260.69 - Electronic funds transfer payment methods.
Code of Federal Regulations, 2012 CFR
2012-01-01
... 14 Aeronautics and Space 5 2012-01-01 2012-01-01 false Electronic funds transfer payment methods... COOPERATIVE AGREEMENTS General Special Conditions § 1260.69 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods October 2000 (a) Payments under this grant will be made by the...
14 CFR 1260.69 - Electronic funds transfer payment methods.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 14 Aeronautics and Space 5 2011-01-01 2010-01-01 true Electronic funds transfer payment methods... COOPERATIVE AGREEMENTS General Special Conditions § 1260.69 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods October 2000 (a) Payments under this grant will be made by the...
Quantifying transfer after perceptual-motor sequence learning: how inflexible is implicit learning?
Sanchez, Daniel J; Yarnik, Eric N; Reber, Paul J
2015-03-01
Studies of implicit perceptual-motor sequence learning have often shown learning to be inflexibly tied to the training conditions during learning. Since sequence learning is seen as a model task of skill acquisition, limits on the ability to transfer knowledge from the training context to a performance context indicates important constraints on skill learning approaches. Lack of transfer across contexts has been demonstrated by showing that when task elements are changed following training, this leads to a disruption in performance. These results have typically been taken as suggesting that the sequence knowledge relies on integrated representations across task elements (Abrahamse, Jiménez, Verwey, & Clegg, Psychon Bull Rev 17:603-623, 2010a). Using a relatively new sequence learning task, serial interception sequence learning, three experiments are reported that quantify this magnitude of performance disruption after selectively manipulating individual aspects of motor performance or perceptual information. In Experiment 1, selective disruption of the timing or order of sequential actions was examined using a novel response manipulandum that allowed for separate analysis of these two motor response components. In Experiments 2 and 3, transfer was examined after selective disruption of perceptual information that left the motor response sequence intact. All three experiments provided quantifiable estimates of partial transfer to novel contexts that suggest some level of information integration across task elements. However, the ability to identify quantifiable levels of successful transfer indicates that integration is not all-or-none and that measurement sensitivity is a key in understanding sequence knowledge representations.
Implicit transfer of reversed temporal structure in visuomotor sequence learning.
Tanaka, Kanji; Watanabe, Katsumi
2014-04-01
Some spatio-temporal structures are easier to transfer implicitly in sequential learning. In this study, we investigated whether the consistent reversal of triads of learned components would support the implicit transfer of their temporal structure in visuomotor sequence learning. A triad comprised three sequential button presses ([1][2][3]) and seven consecutive triads comprised a sequence. Participants learned sequences by trial and error, until they could complete it 20 times without error. Then, they learned another sequence, in which each triad was reversed ([3][2][1]), partially reversed ([2][1][3]), or switched so as not to overlap with the other conditions ([2][3][1] or [3][1][2]). Even when the participants did not notice the alternation rule, the consistent reversal of the temporal structure of each triad led to better implicit transfer; this was confirmed in a subsequent experiment. These results suggest that the implicit transfer of the temporal structure of a learned sequence can be influenced by both the structure and consistency of the change. Copyright © 2013 Cognitive Science Society, Inc.
The influence of dielectric relaxation on intramolecular electron transfer
NASA Astrophysics Data System (ADS)
Heitele, H.; Michel-Beyerle, M. E.; Finckh, P.
1987-07-01
An unusually strong temperature dependence on the intramolecular electron-transfer rate has been observed for bridged donor-acceptor compounds in propylene glycol solution. In the frame of recent electron-transfer theories this effect reflects the influence of dielectric relaxation dynamics on electron transfer. With increasing dielectric relaxation time a smooth transition from non-adiabatic to solvent-controlled adiabatic behaviour is observed. The electron transfer rate in the solvent-controlled adiabatic limit is dominated by an inhomogeneous distribution of relaxation times.
Chen, Jing-Hua; Yu, Long-Jiang; Boussac, Alain; Wang-Otomo, Zheng-Yu; Kuang, Tingyun; Shen, Jian-Ren
2018-04-24
The thermophilic purple sulfur bacterium Thermochromatium tepidum possesses four main water-soluble redox proteins involved in the electron transfer behavior. Crystal structures have been reported for three of them: a high potential iron-sulfur protein, cytochrome c', and one of two low-potential cytochrome c 552 (which is a flavocytochrome c) have been determined. In this study, we purified another low-potential cytochrome c 552 (LPC), determined its N-terminal amino acid sequence and the whole gene sequence, characterized it with absorption and electron paramagnetic spectroscopy, and solved its high-resolution crystal structure. This novel cytochrome was found to contain five c-type hemes. The overall fold of LPC consists of two distinct domains, one is the five heme-containing domain and the other one is an Ig-like domain. This provides a representative example for the structures of multiheme cytochromes containing an odd number of hemes, although the structures of multiheme cytochromes with an even number of hemes are frequently seen in the PDB database. Comparison of the sequence and structure of LPC with other proteins in the databases revealed several characteristic features which may be important for its functioning. Based on the results obtained, we discuss the possible intracellular function of this LPC in Tch. tepidum.
Restricted transfer of learning between unimanual and bimanual finger sequences.
Yokoi, Atsushi; Bai, Wenjun; Diedrichsen, Jörn
2017-03-01
When training bimanual skills, such as playing piano, people sometimes practice each hand separately and at a later stage combine the movements of the two hands. This poses the critical question of whether motor skills can be acquired by separately practicing each subcomponent or should be trained as a whole. In the present study, we addressed this question by training human subjects for 4 days in a unimanual or bimanual version of the discrete sequence production task. Both groups were then tested on trained and untrained sequences on both unimanual and bimanual versions of the task. Surprisingly, we found no evidence of transfer from trained unimanual to bimanual or from trained bimanual to unimanual sequences. In half the participants, we also investigated whether cuing the sequences on the left and right hand with unique letters would change transfer. With these cues, untrained sequences that shared some components with the trained sequences were performed more quickly than sequences that did not. However, the amount of this transfer was limited to ∼10% of the overall sequence-specific learning gains. These results suggest that unimanual and bimanual sequences are learned in separate representations. Making participants aware of the interrelationship between sequences can induce some transferrable component, although the main component of the skill remains unique to unimanual or bimanual execution. NEW & NOTEWORTHY Studies in reaching movement demonstrated that approximately half of motor learning can transfer across unimanual and bimanual contexts, suggesting that neural representations for unimanual and bimanual movements are fairly overlapping at the level of elementary movement. In this study, we show that little or no transfer occurred across unimanual and bimanual sequential finger movements. This result suggests that bimanual sequences are represented at a level of the motor hierarchy that integrates movements of both hands. Copyright © 2017 the American Physiological Society.
12 CFR 205.15 - Electronic fund transfer of government benefits.
Code of Federal Regulations, 2011 CFR
2011-01-01
... 12 Banks and Banking 2 2011-01-01 2011-01-01 false Electronic fund transfer of government benefits. 205.15 Section 205.15 Banks and Banking FEDERAL RESERVE SYSTEM BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.15 Electronic fund transfer of government...
Code of Federal Regulations, 2014 CFR
2014-01-01
...-time electronic fund transfer from a consumer's account. The consumer must authorize the transfer. (ii... one-time electronic fund transfer (in providing a check to a merchant or other payee for the MICR... transfer. A consumer authorizes a one-time electronic fund transfer from his or her account to pay the fee...
NASA Astrophysics Data System (ADS)
McMillen, Chelsea L.; Wright, Patience M.; Cassady, Carolyn J.
2016-05-01
Matrix-assisted laser desorption/ionization (MALDI) in-source decay was studied in the negative ion mode on deprotonated peptides to determine its usefulness for obtaining extensive sequence information for acidic peptides. Eight biological acidic peptides, ranging in size from 11 to 33 residues, were studied by negative ion mode ISD (nISD). The matrices 2,5-dihydroxybenzoic acid, 2-aminobenzoic acid, 2-aminobenzamide, 1,5-diaminonaphthalene, 5-amino-1-naphthol, 3-aminoquinoline, and 9-aminoacridine were used with each peptide. Optimal fragmentation was produced with 1,5-diaminonphthalene (DAN), and extensive sequence informative fragmentation was observed for every peptide except hirudin(54-65). Cleavage at the N-Cα bond of the peptide backbone, producing c' and z' ions, was dominant for all peptides. Cleavage of the N-Cα bond N-terminal to proline residues was not observed. The formation of c and z ions is also found in electron transfer dissociation (ETD), electron capture dissociation (ECD), and positive ion mode ISD, which are considered to be radical-driven techniques. Oxidized insulin chain A, which has four highly acidic oxidized cysteine residues, had less extensive fragmentation. This peptide also exhibited the only charged localized fragmentation, with more pronounced product ion formation adjacent to the highly acidic residues. In addition, spectra were obtained by positive ion mode ISD for each protonated peptide; more sequence informative fragmentation was observed via nISD for all peptides. Three of the peptides studied had no product ion formation in ISD, but extensive sequence informative fragmentation was found in their nISD spectra. The results of this study indicate that nISD can be used to readily obtain sequence information for acidic peptides.
McMillen, Chelsea L; Wright, Patience M; Cassady, Carolyn J
2016-05-01
Matrix-assisted laser desorption/ionization (MALDI) in-source decay was studied in the negative ion mode on deprotonated peptides to determine its usefulness for obtaining extensive sequence information for acidic peptides. Eight biological acidic peptides, ranging in size from 11 to 33 residues, were studied by negative ion mode ISD (nISD). The matrices 2,5-dihydroxybenzoic acid, 2-aminobenzoic acid, 2-aminobenzamide, 1,5-diaminonaphthalene, 5-amino-1-naphthol, 3-aminoquinoline, and 9-aminoacridine were used with each peptide. Optimal fragmentation was produced with 1,5-diaminonphthalene (DAN), and extensive sequence informative fragmentation was observed for every peptide except hirudin(54-65). Cleavage at the N-Cα bond of the peptide backbone, producing c' and z' ions, was dominant for all peptides. Cleavage of the N-Cα bond N-terminal to proline residues was not observed. The formation of c and z ions is also found in electron transfer dissociation (ETD), electron capture dissociation (ECD), and positive ion mode ISD, which are considered to be radical-driven techniques. Oxidized insulin chain A, which has four highly acidic oxidized cysteine residues, had less extensive fragmentation. This peptide also exhibited the only charged localized fragmentation, with more pronounced product ion formation adjacent to the highly acidic residues. In addition, spectra were obtained by positive ion mode ISD for each protonated peptide; more sequence informative fragmentation was observed via nISD for all peptides. Three of the peptides studied had no product ion formation in ISD, but extensive sequence informative fragmentation was found in their nISD spectra. The results of this study indicate that nISD can be used to readily obtain sequence information for acidic peptides.
Wakitani, Shoichi; Torisu, Shidow; Yoshino, Taiki; Hattanda, Kazuhisa; Yamato, Osamu; Tasaki, Ryuji; Fujita, Haruo; Nishino, Koichiro
2014-01-01
Multiple acyl-CoA dehydrogenation deficiency (MADD; also known as glutaric aciduria type II) is a human autosomal recessive disease classified as one of the mitochondrial fatty-acid oxidation disorders. MADD is caused by a defect in the electron transfer flavoprotein (ETF) or ETF dehydrogenase (ETFDH) molecule, but as yet, inherited MADD has not been reported in animals. Here we present the first report of MADD in a cat. The affected animal presented with symptoms characteristic of MADD including hypoglycemia, hyperammonemia, vomiting, diagnostic organic aciduria, and accumulation of medium- and long-chain fatty acids in plasma. Treatment with riboflavin and L-carnitine ameliorated the symptoms. To detect the gene mutation responsible for MADD in this case, we determined the complete cDNA sequences of feline ETFα, ETFβ, and ETFDH. Finally, we identified the feline patient-specific mutation, c.692T>G (p.F231C) in ETFDH. The affected animal only carries mutant alleles of ETFDH. p.F231 in feline ETFDH is completely conserved in eukaryotes, and is located on the apical surface of ETFDH, receiving electrons from ETF. This study thus identified the mutation strongly suspected to have been the cause of MADD in this cat.
NASA Astrophysics Data System (ADS)
Viglino, Emilie; Lai, Cheuk Kuen; Mu, Xiaoyan; Chu, Ivan K.; Tureček, František
2016-09-01
We report a comprehensive study of collision-induced dissociation (CID) and near-UV photodissociation (UVPD) of a series of tyrosine-containing peptide cation radicals of the hydrogen-rich and hydrogen-deficient types. Stable, long-lived, hydrogen-rich peptide cation radicals, such as [AAAYR + 2H]+● and several of its sequence and homology variants, were generated by electron transfer dissociation (ETD) of peptide-crown-ether complexes, and their CID-MS3 dissociations were found to be dramatically different from those upon ETD of the respective peptide dications. All of the hydrogen-rich peptide cation radicals contained major (77%-94%) fractions of species having radical chromophores created by ETD that underwent photodissociation at 355 nm. Analysis of the CID and UVPD spectra pointed to arginine guanidinium radicals as the major components of the hydrogen-rich peptide cation radical population. Hydrogen-deficient peptide cation radicals were generated by intramolecular electron transfer in CuII(2,2 ':6 ',2 ″-terpyridine) complexes and shown to contain chromophores absorbing at 355 nm and undergoing photodissociation. The CID and UVPD spectra showed major differences in fragmentation for [AAAYR]+● that diminished as the Tyr residue was moved along the peptide chain. UVPD was found to be superior to CID in localizing Cα-radical positions in peptide cation radical intermediates.
Ni, Gaofeng; Christel, Stephan; Roman, Pawel; Wong, Zhen Lim; Bijmans, Martijn F M; Dopson, Mark
2016-09-01
Sulfide mineral processing often produces large quantities of wastewaters containing acid-generating inorganic sulfur compounds. If released untreated, these wastewaters can cause catastrophic environmental damage. In this study, microbial fuel cells were inoculated with acidophilic microorganisms to investigate whether inorganic sulfur compound oxidation can generate an electrical current. Cyclic voltammetry suggested that acidophilic microorganisms mediated electron transfer to the anode, and that electricity generation was catalyzed by microorganisms. A cation exchange membrane microbial fuel cell, fed with artificial wastewater containing tetrathionate as electron donor, reached a maximum whole cell voltage of 72 ± 9 mV. Stepwise replacement of the artificial anolyte with real mining process wastewater had no adverse effect on bioelectrochemical performance and generated a maximum voltage of 105 ± 42 mV. 16S rRNA gene sequencing of the microbial consortia resulted in sequences that aligned within the genera Thermoplasma, Ferroplasma, Leptospirillum, Sulfobacillus and Acidithiobacillus. This study opens up possibilities to bioremediate mining wastewater using microbial fuel cell technology. Copyright © 2016 The Authors. Published by Elsevier Masson SAS.. All rights reserved.
Sattley, W Matthew; Blankenship, Robert E
2010-06-01
The complete annotated genome sequence of Heliobacterium modesticaldum strain Ice1 provides our first glimpse into the genetic potential of the Heliobacteriaceae, a unique family of anoxygenic phototrophic bacteria. H. modesticaldum str. Ice1 is the first completely sequenced phototrophic representative of the Firmicutes, and heliobacteria are the only phototrophic members of this large bacterial phylum. The H. modesticaldum genome consists of a single 3.1-Mb circular chromosome with no plasmids. Of special interest are genomic features that lend insight to the physiology and ecology of heliobacteria, including the genetic inventory of the photosynthesis gene cluster. Genes involved in transport, photosynthesis, and central intermediary metabolism are described and catalogued. The obligately heterotrophic metabolism of heliobacteria is a key feature of the physiology and evolution of these phototrophs. The conspicuous absence of recognizable genes encoding the enzyme ATP-citrate lyase prevents autotrophic growth via the reverse citric acid cycle in heliobacteria, thus being a distinguishing differential characteristic between heliobacteria and green sulfur bacteria. The identities of electron carriers that enable energy conservation by cyclic light-driven electron transfer remain in question.
Crofts, Antony R; Holland, J Todd; Victoria, Doreen; Kolling, Derrick R J; Dikanov, Sergei A; Gilbreth, Ryan; Lhee, Sangmoon; Kuras, Richard; Kuras, Mariana Guergova
2008-01-01
Recent progress in understanding the Q-cycle mechanism of the bc(1) complex is reviewed. The data strongly support a mechanism in which the Q(o)-site operates through a reaction in which the first electron transfer from ubiquinol to the oxidized iron-sulfur protein is the rate-determining step for the overall process. The reaction involves a proton-coupled electron transfer down a hydrogen bond between the ubiquinol and a histidine ligand of the [2Fe-2S] cluster, in which the unfavorable protonic configuration contributes a substantial part of the activation barrier. The reaction is endergonic, and the products are an unstable ubisemiquinone at the Q(o)-site, and the reduced iron-sulfur protein, the extrinsic mobile domain of which is now free to dissociate and move away from the site to deliver an electron to cyt c(1) and liberate the H(+). When oxidation of the semiquinone is prevented, it participates in bypass reactions, including superoxide generation if O(2) is available. When the b-heme chain is available as an acceptor, the semiquinone is oxidized in a process in which the proton is passed to the glutamate of the conserved -PEWY- sequence, and the semiquinone anion passes its electron to heme b(L) to form the product ubiquinone. The rate is rapid compared to the limiting reaction, and would require movement of the semiquinone closer to heme b(L) to enhance the rate constant. The acceptor reactions at the Q(i)-site are still controversial, but likely involve a "two-electron gate" in which a stable semiquinone stores an electron. Possible mechanisms to explain the cyt b(150) phenomenon are discussed, and the information from pulsed-EPR studies about the structure of the intermediate state is reviewed. The mechanism discussed is applicable to a monomeric bc(1) complex. We discuss evidence in the literature that has been interpreted as shown that the dimeric structure participates in a more complicated mechanism involving electron transfer across the dimer interface. We show from myxothiazol titrations and mutational analysis of Tyr-199, which is at the interface between monomers, that no such inter-monomer electron transfer is detected at the level of the b(L) hemes. We show from analysis of strains with mutations at Asn-221 that there are coulombic interactions between the b-hemes in a monomer. The data can also be interpreted as showing similar coulombic interaction across the dimer interface, and we discuss mechanistic implications.
12 CFR 205.14 - Electronic fund transfer service provider not holding consumer's account.
Code of Federal Regulations, 2010 CFR
2010-01-01
... consumer learns of the loss or theft; and extends the time periods for reporting unauthorized transfers or... 12 Banks and Banking 2 2010-01-01 2010-01-01 false Electronic fund transfer service provider not... GOVERNORS OF THE FEDERAL RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.14 Electronic fund...
12 CFR 205.14 - Electronic fund transfer service provider not holding consumer's account.
Code of Federal Regulations, 2013 CFR
2013-01-01
... consumer learns of the loss or theft; and extends the time periods for reporting unauthorized transfers or... 12 Banks and Banking 2 2013-01-01 2013-01-01 false Electronic fund transfer service provider not... GOVERNORS OF THE FEDERAL RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.14 Electronic fund...
12 CFR 205.14 - Electronic fund transfer service provider not holding consumer's account.
Code of Federal Regulations, 2014 CFR
2014-01-01
... consumer learns of the loss or theft; and extends the time periods for reporting unauthorized transfers or... 12 Banks and Banking 2 2014-01-01 2014-01-01 false Electronic fund transfer service provider not... GOVERNORS OF THE FEDERAL RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.14 Electronic fund...
12 CFR 205.14 - Electronic fund transfer service provider not holding consumer's account.
Code of Federal Regulations, 2011 CFR
2011-01-01
... consumer learns of the loss or theft; and extends the time periods for reporting unauthorized transfers or... 12 Banks and Banking 2 2011-01-01 2011-01-01 false Electronic fund transfer service provider not... GOVERNORS OF THE FEDERAL RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.14 Electronic fund...
12 CFR 205.14 - Electronic fund transfer service provider not holding consumer's account.
Code of Federal Regulations, 2012 CFR
2012-01-01
... consumer learns of the loss or theft; and extends the time periods for reporting unauthorized transfers or... 12 Banks and Banking 2 2012-01-01 2012-01-01 false Electronic fund transfer service provider not... GOVERNORS OF THE FEDERAL RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.14 Electronic fund...
Television animation store: Recording pictures on a parallel transfer magnetic disc
NASA Astrophysics Data System (ADS)
Durey, A. J.
1984-12-01
The recording and replaying of digital video signals using a computer-type magnetic disc-drive as part of an electronic rostrum camera animation system is described. The system was developed to enable picture sequences to be generated directly as television signals, instead of using cine film. The characteristics of the disc-drive are described together with data processing, error protection and signal synchronization systems, which enable digital television YUV component signals, sampled at 12 MHz, 4 MHz and 4 MHz respectively, to be recorded and replayed in real time.
Vertical incidence of slow Ne 10+ ions on an LiF surface: Suppression of the trampoline effect
NASA Astrophysics Data System (ADS)
Wirtz, Ludger; Lemell, Christoph; Reinhold, Carlos O.; Hägg, Lotten; Burgdörfer, Joachim
2001-08-01
We present a Monte Carlo simulation of the neutralization of a slow Ne 10+ ion in vertical incidence on an LiF(1 0 0) surface. The rates for resonant electron transfer between surface F - ions and the projectile are calculated using a classical trajectory Monte Carlo simulation. We investigate the influence of the hole mobility on the neutralization sequence. It is shown that backscattering above the surface due to the local positive charge up of the surface ("trampoline effect") does not take place.
Quantifying transfer after perceptual-motor sequence learning: how inflexible is implicit learning?
Sanchez, Daniel J.; Yarnik, Eric N.
2015-01-01
Studies of implicit perceptual-motor sequence learning have often shown learning to be inflexibly tied to the training conditions during learning. Since sequence learning is seen as a model task of skill acquisition, limits on the ability to transfer knowledge from the training context to a performance context indicates important constraints on skill learning approaches. Lack of transfer across contexts has been demonstrated by showing that when task elements are changed following training, this leads to a disruption in performance. These results have typically been taken as suggesting that the sequence knowledge relies on integrated representations across task elements (Abrahamse, Jiménez, Verwey, & Clegg, Psychon Bull Rev 17:603–623, 2010a). Using a relatively new sequence learning task, serial interception sequence learning, three experiments are reported that quantify this magnitude of performance disruption after selectively manipulating individual aspects of motor performance or perceptual information. In Experiment 1, selective disruption of the timing or order of sequential actions was examined using a novel response manipulandum that allowed for separate analysis of these two motor response components. In Experiments 2 and 3, transfer was examined after selective disruption of perceptual information that left the motor response sequence intact. All three experiments provided quantifiable estimates of partial transfer to novel contexts that suggest some level of information integration across task elements. However, the ability to identify quantifiable levels of successful transfer indicates that integration is not all-or-none and that measurement sensitivity is a key in understanding sequence knowledge representations. PMID:24668505
Cipolla, Thomas M [Katonah, NY; Colgan, Evan George [Chestnut Ridge, NY; Coteus, Paul W [Yorktown Heights, NY; Hall, Shawn Anthony [Pleasantville, NY; Tian, Shurong [Mount Kisco, NY
2011-12-20
A cooling apparatus, system and like method for an electronic device includes a plurality of heat producing electronic devices affixed to a wiring substrate. A plurality of heat transfer assemblies each include heat spreaders and thermally communicate with the heat producing electronic devices for transferring heat from the heat producing electronic devices to the heat transfer assemblies. The plurality of heat producing electronic devices and respective heat transfer assemblies are positioned on the wiring substrate having the regions overlapping. A heat conduit thermally communicates with the heat transfer assemblies. The heat conduit circulates thermally conductive fluid therethrough in a closed loop for transferring heat to the fluid from the heat transfer assemblies via the heat spreader. A thermally conductive support structure supports the heat conduit and thermally communicates with the heat transfer assemblies via the heat spreader transferring heat to the fluid of the heat conduit from the support structure.
Pandit, Palash; Yamamoto, Koji; Nakamura, Toshikazu; Nishimura, Katsuyuki; Kurashige, Yuki; Yanai, Takeshi; Nakamura, Go; Masaoka, Shigeyuki; Furukawa, Ko; Yakiyama, Yumi; Kawano, Masaki
2015-01-01
Regulation of electron transfer on organic substances by external stimuli is a fundamental issue in science and technology, which affects organic materials, chemical synthesis, and biological metabolism. Nevertheless, acid/base-responsive organic materials that exhibit reversible electron transfer have not been well studied and developed, owing to the difficulty in inventing a mechanism to associate acid/base stimuli and electron transfer. We discovered a new phenomenon in which N–N linked bicarbazole (BC) and tetramethylbiacridine (TBA) derivatives undergo electron transfer disproportionation by acid stimulus, forming their stable radical cations and reduced species. The reaction occurs through a biradical intermediate generated by the acid-triggered N–N bond cleavage reaction of BC or TBA, which acts as a two electron acceptor to undergo electron transfer reactions with two equivalents of BC or TBA. In addition, in the case of TBA the disproportionation reaction is highly reversible through neutralization with NEt3, which recovers TBA through back electron transfer and N–N bond formation reactions. This highly reversible electron transfer reaction is possible due to the association between the acid stimulus and electron transfer via the acid-regulated N–N bond cleavage/formation reactions which provide an efficient switching mechanism, the ability of the organic molecules to act as multi-electron donors and acceptors, the extraordinary stability of the radical species, the highly selective reactivity, and the balance of the redox potentials. This discovery provides new design concepts for acid/base-regulated organic electron transfer systems, chemical reagents, or organic materials. PMID:29218181
Rate of Interfacial Electron Transfer through the 1,2,3-Triazole Linkage
Devaraj, Neal K.; Decreau, Richard A.; Ebina, Wataru; Collman, James P.; Chidsey, Christopher E. D.
2012-01-01
The rate of electron transfer is measured to two ferrocene and one iron tetraphenylporphyrin redox species coupled through terminal acetylenes to azide-terminated thiol monolayers by the Cu(I)-catalyzed azide–alkyne cycloaddition (a Sharpless “click” reaction) to form the 1,2,3-triazole linkage. The high yield, chemoselectivity, convenience, and broad applicability of this triazole formation reaction make such a modular assembly strategy very attractive. Electron-transfer rate constants from greater than 60,000 to 1 s−1 are obtained by varying the length and conjugation of the electron-transfer bridge and by varying the surrounding diluent thiols in the monolayer. Triazole and the triazole carbonyl linkages provide similar electronic coupling for electron transfer as esters. The ability to vary the rate of electron transfer to many different redox species over many orders of magnitude by using modular coupling chemistry provides a convenient way to study and control the delivery of electrons to multielectron redox catalysts and similar interfacial systems that require controlled delivery of electrons. PMID:16898751
Robust sensorimotor representation to physical interaction changes in humanoid motion learning.
Shimizu, Toshihiko; Saegusa, Ryo; Ikemoto, Shuhei; Ishiguro, Hiroshi; Metta, Giorgio
2015-05-01
This paper proposes a learning from demonstration system based on a motion feature, called phase transfer sequence. The system aims to synthesize the knowledge on humanoid whole body motions learned during teacher-supported interactions, and apply this knowledge during different physical interactions between a robot and its surroundings. The phase transfer sequence represents the temporal order of the changing points in multiple time sequences. It encodes the dynamical aspects of the sequences so as to absorb the gaps in timing and amplitude derived from interaction changes. The phase transfer sequence was evaluated in reinforcement learning of sitting-up and walking motions conducted by a real humanoid robot and compatible simulator. In both tasks, the robotic motions were less dependent on physical interactions when learned by the proposed feature than by conventional similarity measurements. Phase transfer sequence also enhanced the convergence speed of motion learning. Our proposed feature is original primarily because it absorbs the gaps caused by changes of the originally acquired physical interactions, thereby enhancing the learning speed in subsequent interactions.
Impact of Lateral Transfers on the Genomes of Lepidoptera
Drezen, Jean-Michel; Josse, Thibaut; Bézier, Annie; Gauthier, Jérémy; Huguet, Elisabeth
2017-01-01
Transfer of DNA sequences between species regardless of their evolutionary distance is very common in bacteria, but evidence that horizontal gene transfer (HGT) also occurs in multicellular organisms has been accumulating in the past few years. The actual extent of this phenomenon is underestimated due to frequent sequence filtering of “alien” DNA before genome assembly. However, recent studies based on genome sequencing have revealed, and experimentally verified, the presence of foreign DNA sequences in the genetic material of several species of Lepidoptera. Large DNA viruses, such as baculoviruses and the symbiotic viruses of parasitic wasps (bracoviruses), have the potential to mediate these transfers in Lepidoptera. In particular, using ultra-deep sequencing, newly integrated transposons have been identified within baculovirus genomes. Bacterial genes have also been acquired by genomes of Lepidoptera, as in other insects and nematodes. In addition, insertions of bracovirus sequences were present in the genomes of certain moth and butterfly lineages, that were likely corresponding to rearrangements of ancient integrations. The viral genes present in these sequences, sometimes of hymenopteran origin, have been co-opted by lepidopteran species to confer some protection against pathogens. PMID:29120392
Er, Tze-Kiong; Chen, Chih-Chieh; Liu, Yen-Yi; Chang, Hui-Chiu; Chien, Yin-Hsiu; Chang, Jan-Gowth; Hwang, Jenn-Kang; Jong, Yuh-Jyh
2011-10-21
Multiple acyl-coenzyme A dehydrogenase deficiency (MADD) is an autosomal recessive disease caused by the defects in the mitochondrial electron transfer system and the metabolism of fatty acids. Recently, mutations in electron transfer flavoprotein dehydrogenase (ETFDH) gene, encoding electron transfer flavoprotein:ubiquinone oxidoreductase (ETF:QO) have been reported to be the major causes of riboflavin-responsive MADD. To date, no studies have been performed to explore the functional impact of these mutations or their mechanism of disrupting enzyme activity. High resolution melting (HRM) analysis and sequencing of the entire ETFDH gene revealed a novel mutation (p.Phe128Ser) and the hotspot mutation (p.Ala84Thr) from a patient with MADD. According to the predicted 3D structure of ETF:QO, the two mutations are located within the flavin adenine dinucleotide (FAD) binding domain; however, the two residues do not have direct interactions with the FAD ligand. Using molecular dynamics (MD) simulations and normal mode analysis (NMA), we found that the p.Ala84Thr and p.Phe128Ser mutations are most likely to alter the protein structure near the FAD binding site as well as disrupt the stability of the FAD binding required for the activation of ETF:QO. Intriguingly, NMA revealed that several reported disease-causing mutations in the ETF:QO protein show highly correlated motions with the FAD-binding site. Based on the present findings, we conclude that the changes made to the amino acids in ETF:QO are likely to influence the FAD-binding stability.
2011-01-01
Background Multiple acyl-coenzyme A dehydrogenase deficiency (MADD) is an autosomal recessive disease caused by the defects in the mitochondrial electron transfer system and the metabolism of fatty acids. Recently, mutations in electron transfer flavoprotein dehydrogenase (ETFDH) gene, encoding electron transfer flavoprotein:ubiquinone oxidoreductase (ETF:QO) have been reported to be the major causes of riboflavin-responsive MADD. To date, no studies have been performed to explore the functional impact of these mutations or their mechanism of disrupting enzyme activity. Results High resolution melting (HRM) analysis and sequencing of the entire ETFDH gene revealed a novel mutation (p.Phe128Ser) and the hotspot mutation (p.Ala84Thr) from a patient with MADD. According to the predicted 3D structure of ETF:QO, the two mutations are located within the flavin adenine dinucleotide (FAD) binding domain; however, the two residues do not have direct interactions with the FAD ligand. Using molecular dynamics (MD) simulations and normal mode analysis (NMA), we found that the p.Ala84Thr and p.Phe128Ser mutations are most likely to alter the protein structure near the FAD binding site as well as disrupt the stability of the FAD binding required for the activation of ETF:QO. Intriguingly, NMA revealed that several reported disease-causing mutations in the ETF:QO protein show highly correlated motions with the FAD-binding site. Conclusions Based on the present findings, we conclude that the changes made to the amino acids in ETF:QO are likely to influence the FAD-binding stability. PMID:22013910
Ducote, Matthew J.; Prakash, Shubha; Pettis, Gregg S.
2000-01-01
Efficient interbacterial transfer of streptomycete plasmid pIJ101 requires the pIJ101 tra gene, as well as a cis-acting plasmid function known as clt. Here we show that the minimal pIJ101 clt locus consists of a sequence no greater than 54 bp in size that includes essential inverted-repeat and direct-repeat sequences and is located in close proximity to the 3′ end of the korB regulatory gene. Evidence that sequences extending beyond the minimal locus and into the korB open reading frame influence clt transfer function and demonstration that clt-korB sequences are intrinsically curved raise the possibility that higher-order structuring of DNA and protein within this plasmid region may be an inherent feature of efficient pIJ101 transfer. PMID:11073933
Ducote, M J; Prakash, S; Pettis, G S
2000-12-01
Efficient interbacterial transfer of streptomycete plasmid pIJ101 requires the pIJ101 tra gene, as well as a cis-acting plasmid function known as clt. Here we show that the minimal pIJ101 clt locus consists of a sequence no greater than 54 bp in size that includes essential inverted-repeat and direct-repeat sequences and is located in close proximity to the 3' end of the korB regulatory gene. Evidence that sequences extending beyond the minimal locus and into the korB open reading frame influence clt transfer function and demonstration that clt-korB sequences are intrinsically curved raise the possibility that higher-order structuring of DNA and protein within this plasmid region may be an inherent feature of efficient pIJ101 transfer.
NASA Astrophysics Data System (ADS)
Boriev, I. A.
2018-03-01
An analysis of the problem of so-called “abnormal” fast transfer of electrons in tokamak plasma, which turned out much faster than the result of accepted calculation, is given. Such transfer of hot electrons leads to unexpectedly fast destruction of the inner tokamak wall with ejection of its matter in plasma volume, what violates a condition of plasma confinement for controlled thermonuclear fusion. It is shown, taking into account real physics of electron drift in the gas (plasma) and using the conservation law for momentum of electron transfer (drift), that the drift velocity of elastically scattered electrons should be significantly greater than that of accepted calculation. The reason is that the relaxation time of the momentum of electron transfer, to which the electron drift velocity is proportional, is significantly greater (from 16 up to 4 times) than the electron free path time. Therefore, generally accepted replacement of the relaxation time, which is unknown a priori, by the electron free path time, leads to significant (16 times for thermal electrons) underestimation of electron drift velocity (mobility). This result means, that transfer of elastically (and isotropically) scattered electrons in the gas phase should be so fast, and corresponds to multiplying coefficient (16), introduced by D. Bohm to explain the observed by him “abnormal” fast diffusion of electrons.
DOE R&D Accomplishments Database
1998-09-21
In the late 1950s to early 1960s Rudolph A. Marcus developed a theory for treating the rates of outer-sphere electron-transfer reactions. Outer-sphere reactions are reactions in which an electron is transferred from a donor to an acceptor without any chemical bonds being made or broken. (Electron-transfer reactions in which bonds are made or broken are referred to as inner-sphere reactions.) Marcus derived several very useful expressions, one of which has come to be known as the Marcus cross-relation or, more simply, as the Marcus equation. It is widely used for correlating and predicting electron-transfer rates. For his contributions to the understanding of electron-transfer reactions, Marcus received the 1992 Nobel Prize in Chemistry. This paper discusses the development and use of the Marcus equation. Topics include self-exchange reactions; net electron-transfer reactions; Marcus cross-relation; and proton, hydride, atom and group transfers.
Odobel, Fabrice; Séverac, Marjorie; Pellegrin, Yann; Blart, Errol; Fosse, Céline; Cannizzo, Caroline; Mayer, Cédric R; Elliott, Kristopher J; Harriman, Anthony
2009-01-01
Ultrafast discharge of a single-electron capacitor: A variety of intramolecular electron-transfer reactions are apparent for polyoxometalates functionalized with covalently attached perylene monoimide chromophores, but these are restricted to single-electron events. (et=electron transfer, cr=charge recombination, csr=charge-shift reaction, PER=perylene, POM=polyoxometalate).A new strategy is introduced that permits covalent attachment of an organic chromophore to a polyoxometalate (POM) cluster. Two examples are reported that differ according to the nature of the anchoring group and the flexibility of the linker. Both POMs are functionalized with perylene monoimide units, which function as photon collectors and form a relatively long-lived charge-transfer state under illumination. They are reduced to a stable pi-radical anion by electrolysis or to a protonated dianion under photolysis in the presence of aqueous triethanolamine. The presence of the POM opens up an intramolecular electron-transfer route by which the charge-transfer state reduces the POM. The rate of this process depends on the molecular conformation and appears to involve through-space interactions. Prior reduction of the POM leads to efficient fluorescence quenching, again due to intramolecular electron transfer. In most cases, it is difficult to resolve the electron-transfer products because of relatively fast reverse charge shift that occurs within a closed conformer. Although the POM can store multiple electrons, it has not proved possible to use these systems as molecular-scale capacitors because of efficient electron transfer from the one-electron-reduced POM to the excited singlet state of the perylene monoimide.
Thermal transfer structures coupling electronics card(s) to coolant-cooled structure(s)
David, Milnes P; Graybill, David P; Iyengar, Madhusudan K; Kamath, Vinod; Kochuparambil, Bejoy J; Parida, Pritish R; Schmidt, Roger R
2014-12-16
Cooling apparatuses and coolant-cooled electronic systems are provided which include thermal transfer structures configured to engage with a spring force one or more electronics cards with docking of the electronics card(s) within a respective socket(s) of the electronic system. A thermal transfer structure of the cooling apparatus includes a thermal spreader having a first thermal conduction surface, and a thermally conductive spring assembly coupled to the conduction surface of the thermal spreader and positioned and configured to reside between and physically couple a first surface of an electronics card to the first surface of the thermal spreader with docking of the electronics card within a socket of the electronic system. The thermal transfer structure is, in one embodiment, metallurgically bonded to a coolant-cooled structure and facilitates transfer of heat from the electronics card to coolant flowing through the coolant-cooled structure.
NASA Astrophysics Data System (ADS)
Chiellini, Carolina; Bacci, Giovanni; Fani, Renato; Mocali, Stefano
2016-04-01
Different bacteria have evolved strategies to transfer electrons over their cell surface to (or from) their extracellular environment. This electron transfer enables the use of these bacteria in bioelectrochemical systems (BES) such as Microbial Fuel Cells (MFCs). In MFC research the biological reactions at the cathode have long been a secondary point of interest. However, bacterial biocathodes in MFCs represent a potential advantage compared to traditional cathodes, for both their low costs and their low impact on the environment. The main challenge in biocathode set-up is represented by the selection of a bacterial community able to efficiently accept electrons from the electrode, starting from an environmental matrix. In this work, a constant voltage was supplied on a two-chamber MFC filled up with soil over three weeks in order to simultaneously select an electron donor bacterial biomass on the anode and an electron acceptor biomass on the cathode, starting from the same soil. Next Generation Sequencing (NGS) analysis was performed to characterize the bacterial community of the initial soil, in the anode, in the cathode and in the control chamber not supplied with any voltage. Results highlighted that both the MFC conditions and the voltage supply affected the soil bacterial communities, providing a selection of different bacterial groups preferentially associated to the anode (Betaproteobacteria, Bacilli and Clostridia) and to the cathode (Actinobacteria and Alphaproteobacteria). These results confirmed that several electroactive bacteria are naturally present within a top soil and, moreover, different soil bacterial genera could provide different electrical properties.
Yang, Shui-Ping; Zhao, Wei; Hu, Pei-Pei; Wu, Ke-Yang; Jiang, Zhi-Hong; Bai, Li-Ping; Li, Min-Min; Chen, Jin-Xiang
2017-12-18
Reactions of La(NO 3 ) 3 ·6H 2 O with the polar, tritopic quaternized carboxylate ligands N-carboxymethyl-3,5-dicarboxylpyridinium bromide (H 3 CmdcpBr) and N-(4-carboxybenzyl)-3,5-dicarboxylpyridinium bromide (H 3 CbdcpBr) afford two water-stable metal-organic frameworks (MOFs) of {[La 4 (Cmdcp) 6 (H 2 O) 9 ]} n (1, 3D) and {[La 2 (Cbdcp) 3 (H 2 O) 10 ]} n (2, 2D). MOFs 1 and 2 absorb the carboxyfluorescein (FAM)-tagged probe DNA (P-DNA) and quench the fluorescence of FAM via a photoinduced electron transfer (PET) process. The nonemissive P-DNA@MOF hybrids thus formed in turn function as sensing platforms to distinguish conservative linear, single-stranded RNA sequences of Sudan virus with high selectivity and low detection limits of 112 and 67 pM, respectively (at a signal-to-noise ratio of 3). These hybrids also exhibit high specificity and discriminate down to single-base mismatch RNA sequences.
Yoshimatsu, Katsuhiko; Araya, Osamu; Fujiwara, Taketomo
2007-01-01
The composition of membrane-bound electron-transferring proteins from denitrifying cells of Haloarcula marismortui was compared with that from the aerobic cells. Accompanying nitrate reductase catalytic NarGH subcomplex, cytochrome b-561, cytochrome b-552, and halocyanin-like blue copper protein were induced under denitrifying conditions. Cytochrome b-561 was purified to homogeneity and was shown to be composed of a polypeptide with a molecular mass of 40 kDa. The cytochrome was autooxidizable and its redox potential was -27 mV. The N-terminal sequence of the cytochrome was identical to the deduced amino acid sequence of the narC gene product encoded in the third ORF of the nitrate reductase operon with a unique arrangement of ORFs. The sequence of the cytochrome was homologous with that of the cytochrome b subunit of respiratory cytochrome bc. A possibility that the cytochrome bc and the NarGH constructed a supercomplex was discussed.
Ye, Xueting; Zhao, Nan; Yu, Xi; Han, Xiaoli; Gao, Huiyuan; Zhang, Xiaozhe
2016-11-01
Panax ginseng is an important herb that has clear effects on the treatment of diverse diseases. Until now, the natural peptide constitution of this herb remains unclear. Here, we conduct an extensive characterization of Ginseng peptidome using MS-based data mining and sequencing. The screen on the charge states of precursor ions indicated that Ginseng is a peptide-rich herb in comparison of a number of commonly used herbs. The Ginseng peptides were then extracted and submitted to nano-LC-MS/MS analysis using different fragmentation modes, including CID, high-energy collisional dissociation, and electron transfer dissociation. Further database search and de novo sequencing allowed the identification of total 308 peptides, some of which might have important biological activities. This study illustrates the abundance and sequences of endogenous Ginseng peptides, thus providing the information of more candidates for the screening of active compounds for future biological research and drug discovery studies. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Ghosh, Hirendra N; Verma, Sandeep; Nibbering, Erik T J
2011-02-10
Femtosecond infrared spectroscopy is used to study both forward and backward electron transfer (ET) dynamics between coumarin 337 (C337) and the aromatic amine solvents aniline (AN), N-methylaniline (MAN), and N,N-dimethylaniline (DMAN), where all the aniline solvents can donate an electron but only AN and MAN can form hydrogen bonds with C337. The formation of a hydrogen bond with AN and MAN is confirmed with steady state FT-IR spectroscopy, where the C═O stretching vibration is a direct marker mode for hydrogen bond formation. Transient IR absorption measurements in all solvents show an absorption band at 2166 cm(-1), which has been attributed to the C≡N stretching vibration of the C337 radical anion formed after ET. Forward electron transfer dynamics is found to be biexponential with time constants τ(ET)(1) = 500 fs, τ(ET)(2) = 7 ps in all solvents. Despite the presence of hydrogen bonds of C337 with the solvents AN and MAN, no effect has been found on the forward electron transfer step. Because of the absence of an H/D isotope effect on the forward electron transfer reaction of C337 in AN, hydrogen bonds are understood to play a minor role in mediating electron transfer. In contrast, direct π-orbital overlap between C337 and the aromatic amine solvents causes ultrafast forward electron transfer dynamics. Backward electron transfer dynamics, in contrast, is dependent on the solvent used. Standard Marcus theory explains the observed backward electron transfer rates.
Xue, Ying; Zhou, Yun; Zhang, Keqin; Li, Ling; Kayoumu, Abudurexiti; Chen, Liye; Wang, Yuhui; Lu, Zhiqiang
2017-09-26
Glutaric aciduria type II (GA II) is an autosomal recessive disorder affecting fatty acid and amino acid metabolism. The late-onset form of GA II disorder is almost exclusively associated with mutations in the electron transfer flavoprotein dehydrogenase (ETFDH) gene. Till now, the clinical features of late-onset GA II vary widely and pose a great challenge for diagnosis. The aim of the current study is to characterize the clinical phenotypes and genetic basis of a late-onset GAII patient. In this study, we described the clinical and biochemical manifestations of a 23-year-old female Chinese patient with late-onset GA II, and performed genomic DNA-based PCR amplifications and sequence analysis of ETFDH gene of the whole pedigree. We also used in-silicon tools to analyze the mutation and evaluated the pathogenicity of the mutation according to the criteria proposed by American College of Medical Genetics and Genomics (ACMG). The muscle biopsy of this patient revealed lipid storage myopathy. Blood biochemical test and urine organic acid analyses were consistent with GA II. Direct sequence analysis of the ETFDH gene (NM_004453) revealed compound heterozygous mutations: c.250G > A (p.A84T) on exon 3 and c.920C > G (p.S307C) on exon 8. Both mutations were classified as "pathogenic" according to ACMG criteria. In conclusion, our study described the phenotype and genotype of a late-onset GA II patient, reiterating the importance of ETFDH gene screening in these patients.
NASA Astrophysics Data System (ADS)
Commodore, Juliette J.; Cassady, Carolyn J.
2016-09-01
Electrospray ionization (ESI) on mixtures of acidic fibrinopeptide B and two peptide analogs with trivalent lanthanide salts generates [M + Met + H]4+, [M + Met]3+, and [M + Met -H]2+, where M = peptide and Met = metal (except radioactive promethium). These ions undergo extensive and highly efficient electron transfer dissociation (ETD) to form metallated and non-metallated c- and z-ions. All metal adducted product ions contain at least two acidic sites, which suggest attachment of the lanthanide cation at the side chains of one or more acidic residues. The three peptides undergo similar fragmentation. ETD on [M + Met + H]4+ leads to cleavage at every residue; the presence of both a metal ion and an extra proton is very effective in promoting sequence-informative fragmentation. Backbone dissociation of [M + Met]3+ is also extensive, although cleavage does not always occur between adjacent glutamic acid residues. For [M + Met - H ]2+, a more limited range of product ions form. All lanthanide metal peptide complexes display similar fragmentation except for europium (Eu). ETD on [M + Eu - H]2+ and [M + Eu]3+ yields a limited amount of peptide backbone cleavage; however, [M + Eu + H]4+ dissociates extensively with cleavage at every residue. With the exception of the results for Eu(III), metallated peptide ion formation by ESI, ETD fragmentation efficiencies, and product ion formation are unaffected by the identity of the lanthanide cation. Adduction with trivalent lanthanide metal ions is a promising tool for sequence analysis of acidic peptides by ETD.
Wang, Hao; Straubinger, Robert M; Aletta, John M; Cao, Jin; Duan, Xiaotao; Yu, Haoying; Qu, Jun
2009-03-01
Protein arginine (Arg) methylation serves an important functional role in eucaryotic cells, and typically occurs in domains consisting of multiple Arg in close proximity. Localization of methylarginine (MA) within Arg-rich domains poses a challenge for mass spectrometry (MS)-based methods; the peptides are highly charged under electrospray ionization (ESI), which limits the number of sequence-informative products produced by collision induced dissociation (CID), and loss of the labile methylation moieties during CID precludes effective fragmentation of the peptide backbone. Here the fragmentation behavior of Arg-rich peptides was investigated comprehensively using electron-transfer dissociation (ETD) and CID for both methylated and unmodified glycine-/Arg-rich peptides (GAR), derived from residues 679-695 of human nucleolin, which contains methylation motifs that are widely-represented in biological systems. ETD produced abundant information for sequencing and MA localization, whereas CID failed to provide credible identification for any available charge state (z = 2-4). Nevertheless, CID produced characteristic neutral losses that can be employed to distinguish among different types of MA, as suggested by previous works and confirmed here with product ion scans of high accuracy/resolution by an LTQ/Orbitrap. To analyze MA-peptides in relatively complex mixtures, a method was developed that employs nano-LC coupled to alternating CID/ETD for peptide sequencing and MA localization/characterization, and an Orbitrap for accurate precursor measurement and relative quantification of MA-peptide stoichiometries. As proof of concept, GAR-peptides methylated in vitro by protein arginine N-methyltransferases PRMT1 and PRMT7 were analyzed. It was observed that PRMT1 generated a number of monomethylated (MMA) and asymmetric-dimethylated peptides, while PRMT7 produced predominantly MMA peptides and some symmetric-dimethylated peptides. This approach and the results may advance understanding of the actions of PRMTs and the functional significance of Arg methylation patterns.
Wang, Hao; Straubinger, Robert M.; Aletta, John M.; Cao, Jin; Duan, Xiaotao; Yu, Haoying; Qu, Jun
2012-01-01
Protein arginine (Arg) methylation serves an important functional role in eukaryotic cells, and typically occurs in domains consisting of multiple Arg in close proximity. Localization of methylarginine (MA) within Arg-rich domains poses a challenge for mass spectrometry (MS)-based methods; the peptides are highly-charged under electrospray ionization (ESI), which limits the number of sequence-informative products produced by collision induced dissociation (CID), and loss of the labile methylation moieties during CID precludes effective fragmentation of the peptide backbone. Here the fragmentation behavior of Arg-rich peptides was investigated comprehensively using electron transfer dissociation (ETD) and CID for both methylated and unmodified glycine-/Arg-rich peptides (GAR), derived from residues 679-695 of human nucleolin, which contains methylation motifs that are widely-represented in biological systems. ETD produced abundant information for sequencing and MA localization, whereas CID failed to provide credible identification for any available charge state (z=2-4). Nevertheless, CID produced characteristic neutral losses that can be employed to distinguish among different types of MA, as suggested by previous works and confirmed here with product ion scans of high accuracy/resolution by an LTQ/Orbitrap. To analyze MA-peptides in relatively complex mixtures, a method was developed that employs nano-LC coupled to alternating CID/ETD for peptide sequencing and MA localization/characterization, and an Orbitrap for accurate precursor measurement and relative quantification of MA-peptide stoichiometries. As proof of concept, GAR-peptides methylated in vitro by protein arginine N-methyltransferases PRMT1 and PRMT7 were analyzed. It was observed that PRMT1 generated a number of monomethylated (MMA) and asymmetric-dimethylated peptides, while PRMT7 produced predominantly MMA peptides and some symmetric-dimethylated peptides. This approach and the results may advance understanding of the actions of PRMTs and the functional significance of Arg methylation patterns. PMID:19110445
Photo-induced electron transfer method
Wohlgemuth, R.; Calvin, M.
1984-01-24
The efficiency of photo-induced electron transfer reactions is increased and the back transfer of electrons in such reactions is greatly reduced when a photo-sensitizer zinc porphyrin-surfactant and an electron donor manganese porphyrin-surfactant are admixed into phospholipid membranes. The phospholipids comprising said membranes are selected from phospholipids whose head portions are negatively charged. Said membranes are contacted with an aqueous medium in which an essentially neutral viologen electron acceptor is admixed. Catalysts capable of transferring electrons from reduced viologen electron acceptor to hydrogen to produce elemental hydrogen are also included in the aqueous medium. An oxidizable olefin is also admixed in the phospholipid for the purpose of combining with oxygen that coordinates with oxidized electron donor manganese porphyrin-surfactant.
Orf, Gregory S.; Saer, Rafael G.; Niedzwiedzki, Dariusz M.; Zhang, Hao; McIntosh, Chelsea L.; Schultz, Jason W.; Mirica, Liviu M.; Blankenship, Robert E.
2016-01-01
Light-harvesting antenna complexes not only aid in the capture of solar energy for photosynthesis, but regulate the quantity of transferred energy as well. Light-harvesting regulation is important for protecting reaction center complexes from overexcitation, generation of reactive oxygen species, and metabolic overload. Usually, this regulation is controlled by the association of light-harvesting antennas with accessory quenchers such as carotenoids. One antenna complex, the Fenna–Matthews–Olson (FMO) antenna protein from green sulfur bacteria, completely lacks carotenoids and other known accessory quenchers. Nonetheless, the FMO protein is able to quench energy transfer in aerobic conditions effectively, indicating a previously unidentified type of regulatory mechanism. Through de novo sequencing MS, chemical modification, and mutagenesis, we have pinpointed the source of the quenching action to cysteine residues (Cys49 and Cys353) situated near two low-energy bacteriochlorophylls in the FMO protein from Chlorobaculum tepidum. Removal of these cysteines (particularly removal of the completely conserved Cys353) through N-ethylmaleimide modification or mutagenesis to alanine abolishes the aerobic quenching effect. Electrochemical analysis and electron paramagnetic resonance spectra suggest that in aerobic conditions the cysteine thiols are converted to thiyl radicals which then are capable of quenching bacteriochlorophyll excited states through electron transfer photochemistry. This simple mechanism has implications for the design of bio-inspired light-harvesting antennas and the redesign of natural photosynthetic systems. PMID:27335466
Allosteric control of internal electron transfer in cytochrome cd1 nitrite reductase
Farver, Ole; Kroneck, Peter M. H.; Zumft, Walter G.; Pecht, Israel
2003-01-01
Cytochrome cd1 nitrite reductase is a bifunctional multiheme enzyme catalyzing the one-electron reduction of nitrite to nitric oxide and the four-electron reduction of dioxygen to water. Kinetics and thermodynamics of the internal electron transfer process in the Pseudomonas stutzeri enzyme have been studied and found to be dominated by pronounced interactions between the c and the d1 hemes. The interactions are expressed both in dramatic changes in the internal electron-transfer rates between these sites and in marked cooperativity in their electron affinity. The results constitute a prime example of intraprotein control of the electron-transfer rates by allosteric interactions. PMID:12802018
Toogood, Helen S; Leys, David; Scrutton, Nigel S
2007-11-01
Electron transferring flavoproteins (ETFs) are soluble heterodimeric FAD-containing proteins that function primarily as soluble electron carriers between various flavoprotein dehydrogenases. ETF is positioned at a key metabolic branch point, responsible for transferring electrons from up to 10 primary dehydrogenases to the membrane-bound respiratory chain. Clinical mutations of ETF result in the often fatal disease glutaric aciduria type II. Structural and biophysical studies of ETF in complex with partner proteins have shown that ETF partitions the functions of partner binding and electron transfer between (a) a 'recognition loop', which acts as a static anchor at the ETF-partner interface, and (b) a highly mobile redox-active FAD domain. Together, this enables the FAD domain of ETF to sample a range of conformations, some compatible with fast interprotein electron transfer. This 'conformational sampling' enables ETF to recognize structurally distinct partners, whilst also maintaining a degree of specificity. Complex formation triggers mobility of the FAD domain, an 'induced disorder' mechanism contrasting with the more generally accepted models of protein-protein interaction by induced fit mechanisms. We discuss the implications of the highly dynamic nature of ETFs in biological interprotein electron transfer. ETF complexes point to mechanisms of electron transfer in which 'dynamics drive function', a feature that is probably widespread in biology given the modular assembly and flexible nature of biological electron transfer systems.
2014-09-24
which nature uses strong electron correlation for efficient energy transfer, particularly in photosynthesis and bioluminescence, (ii) providing an...strong electron correlation for efficient energy transfer, particularly in photosynthesis and bioluminescence, (ii) providing an innovative paradigm...efficient energy transfer, particularly in photosynthesis and bioluminescence, (ii) providing an innovative paradigm for energy transfer in photovoltaic
Maeda, Kiminori; Lodge, Matthew T.J.; Harmer, Jeffrey; Freed, Jack H.; Edwards, Peter P.
2012-01-01
Electron transfer or quantum tunneling dynamics for excess or solvated electrons in dilute lithium-ammonia solutions have been studied by pulse electron paramagnetic resonance (EPR) spectroscopy at both X- (9.7 GHz) and W-band (94 GHz) frequencies. The electron spin-lattice (T1) and spin-spin (T2) relaxation data indicate an extremely fast transfer or quantum tunneling rate of the solvated electron in these solutions which serves to modulate the hyperfine (Fermi-contact) interaction with nitrogen nuclei in the solvation shells of ammonia molecules surrounding the localized, solvated electron. The donor and acceptor states of the solvated electron in these solutions are the initial and final electron solvation sites found before, and after, the transfer or tunneling process. To interpret and model our electron spin relaxation data from the two observation EPR frequencies requires a consideration of a multi-exponential correlation function. The electron transfer or tunneling process that we monitor through the correlation time of the nitrogen Fermi-contact interaction has a time scale of (1–10)×10−12 s over a temperature range 230–290K in our most dilute solution of lithium in ammonia. Two types of electron-solvent interaction mechanisms are proposed to account for our experimental findings. The dominant electron spin relaxation mechanism results from an electron tunneling process characterized by a variable donor-acceptor distance or range (consistent with such a rapidly fluctuating liquid structure) in which the solvent shell that ultimately accepts the transferring electron is formed from random, thermal fluctuations of the liquid structure in, and around, a natural hole or Bjerrum-like defect vacancy in the liquid. Following transfer and capture of the tunneling electron, further solvent-cage relaxation with a timescale of ca. 10−13 s results in a minor contribution to the electron spin relaxation times. This investigation illustrates the great potential of multi-frequency EPR measurements to interrogate the microscopic nature and dynamics of ultra fast electron transfer or quantum-tunneling processes in liquids. Our results also impact on the universal issue of the role of a host solvent (or host matrix, e.g. a semiconductor) in mediating long-range electron transfer processes and we discuss the implications of our results with a range of other materials and systems exhibiting the phenomenon of electron transfer. PMID:22568866
Wang, Fang; Zhang, Yonglai; Liu, Yang; Wang, Xuefeng; Shen, Mingrong; Lee, Shuit-Tong; Kang, Zhenhui
2013-03-07
Here we show a bias-mediated electron/energy transfer process at the CQDs-TiO(2) interface for the dynamic modulation of opto-electronic properties. Different energy and electron transfer states have been observed in the CQDs-TNTs system due to the up-conversion photoluminescence and the electron donation/acceptance properties of the CQDs decorated on TNTs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sontakke, Atul D., E-mail: sontakke.atul.55a@st.kyoto-u.ac.jp; Katayama, Yumiko; Tanabe, Setsuhisa
2015-03-30
A facile method to describe the electron transfer and energy transfer processes among lanthanide ions is presented based on the temperature dependent donor luminescence decay kinetics. The electron transfer process in Ce{sup 3+}-Yb{sup 3+} exhibits a steady rise with temperature, whereas the Ce{sup 3+}-Tb{sup 3+} energy transfer remains nearly unaffected. This feature has been investigated using the rate equation modeling and a methodology for the quantitative estimation of interaction parameters is presented. Moreover, the overall consequences of electron transfer and energy transfer process on donor-acceptor luminescence behavior, quantum efficiency, and donor luminescence decay kinetics are discussed in borate glass host.more » The results in this study propose a straight forward approach to distinguish the electron transfer and energy transfer processes between lanthanide ions in dielectric hosts, which is highly advantageous in view of the recent developments on lanthanide doped materials for spectral conversion, persistent luminescence, and related applications.« less
NASA Astrophysics Data System (ADS)
Yamaji, Minoru; Oshima, Juro; Hidaka, Motohiko
2009-06-01
Evidence for the coupled electron/proton transfer mechanism of the phenolic H-atom transfer between triplet π,π ∗ 3,3'-carbonylbis(7-diethylaminocoumarin) and phenol derivatives is obtained by using laser photolysis techniques. It was confirmed that the quenching rate constants of triplet CBC by phenols having positive Hammett constants do not follow the Rehm-Weller equation for electron transfer while those by phenols with negative Hammett constants do it. From the viewpoint of thermodynamic parameters for electron transfer, the crucial factors for phenolic H-atom transfer to π,π ∗ triplet are discussed.
Bridge-mediated hopping or superexchange electron-transfer processes in bis(triarylamine) systems
NASA Astrophysics Data System (ADS)
Lambert, Christoph; Nöll, Gilbert; Schelter, Jürgen
2002-09-01
Hopping and superexchange are generally considered to be alternative electron-transfer mechanisms in molecular systems. In this work we used mixed-valence radical cations as model systems for the investigation of electron-transfer pathways. We show that substituents attached to a conjugated bridge connecting two triarylamine redox centres have a marked influence on the near-infrared absorption spectra of the corresponding cations. Spectral analysis, followed by evaluation of the electron-transfer parameters using the Generalized Mulliken-Hush theory and simulation of the potential energy surfaces, indicate that hopping and superexchange are not alternatives, but are both present in the radical cation with a dimethoxybenzene bridge. We found that the type of electron-transfer mechanism depends on the bridge-reorganization energy as well as on the bridge-state energy. Because superexchange and hopping follow different distance laws, our findings have implications for the design of new molecular and polymeric electron-transfer materials.
Bollella, Paolo; Gorton, Lo; Antiochia, Riccarda
2018-04-24
Dehydrogenase based bioelectrocatalysis has been increasingly exploited in recent years in order to develop new bioelectrochemical devices, such as biosensors and biofuel cells, with improved performances. In some cases, dehydrogeases are able to directly exchange electrons with an appropriately designed electrode surface, without the need for an added redox mediator, allowing bioelectrocatalysis based on a direct electron transfer process. In this review we briefly describe the electron transfer mechanism of dehydrogenase enzymes and some of the characteristics required for bioelectrocatalysis reactions via a direct electron transfer mechanism. Special attention is given to cellobiose dehydrogenase and fructose dehydrogenase, which showed efficient direct electron transfer reactions. An overview of the most recent biosensors and biofuel cells based on the two dehydrogenases will be presented. The various strategies to prepare modified electrodes in order to improve the electron transfer properties of the device will be carefully investigated and all analytical parameters will be presented, discussed and compared.
Maróti, P; Hanson, D K; Baciou, L; Schiffer, M; Sebban, P
1994-06-07
Light-induced charge separation in the photosynthetic reaction center results in delivery of two electrons and two protons to the terminal quinone acceptor QB. In this paper, we have used flash-induced absorbance spectroscopy to study three strains that share identical amino acid sequences in the QB binding site, all of which lack the protonatable amino acids Glu-L212 and Asp-L213. These strains are the photosynthetically incompetent site-specific mutant Glu-L212/Asp-L213-->Ala-L212/Ala-L213 and two different photocompetent derivatives that carry both alanine substitutions and an intergenic suppressor mutation located far from QB (class 3 strain, Ala-Ala + Arg-M231-->Leu; class 4 strain, Ala-Ala + Asn-M43-->Asp). At pH 8 in the double mutant, we observe a concomitant decrease of nearly 4 orders of magnitude in the rate constants of second electron and proton transfer to QB compared to the wild type. Surprisingly, these rates are increased to about the same extent in both types of suppressor strains but remain > 2 orders of magnitude smaller than those of the wild type. In the double mutant, at pH 8, the loss of Asp-L213 and Glu-L212 leads to a substantial stabilization (> or = 60 meV) of the semiquinone energy level. Both types of compensatory mutations partially restore, to nearly the same level, the original free energy difference for electron transfer from primary quinone QA to QB. The pH dependence of the electron and proton transfer processes in the double-mutant and the suppressor strains suggests that when reaction centers of the double mutant are shifted to lower pH (1.5-2 units), they function like those of the suppressor strains at physiological pH. Our data suggest that the main effect of the compensatory mutations is to partially restore the negative electrostatic environment of QB and to increase an apparent "functional" pK of the system for efficient proton transfer to the active site. This emphasizes the role of the protein in tuning the electrostatic environment of its cofactors and highlights the possible long-range electrostatic effects.
Lampe, David J; Witherspoon, David J; Soto-Adames, Felipe N; Robertson, Hugh M
2003-04-01
We report the isolation and sequencing of genomic copies of mariner transposons involved in recent horizontal transfers into the genomes of the European earwig, Forficula auricularia; the European honey bee, Apis mellifera; the Mediterranean fruit fly, Ceratitis capitata; and a blister beetle, Epicauta funebris, insects from four different orders. These elements are in the mellifera subfamily and are the second documented example of full-length mariner elements involved in this kind of phenomenon. We applied maximum likelihood methods to the coding sequences and determined that the copies in each genome were evolving neutrally, whereas reconstructed ancestral coding sequences appeared to be under selection, which strengthens our previous hypothesis that the primary selective constraint on mariner sequence evolution is the act of horizontal transfer between genomes.
Herrera, Barbara
2011-05-01
In this article, a theoretical study of 1-5 proton transfers is presented. Two model systems which represent 1-5 proton transfer, 3-hidroxy-2-propenimine and salicyldenaniline have been studied as shown in Fig. 1. For this purpose, a DFT/B3LYP/6-311+G**, reaction force and reaction electronic flux analysis is made. The obtained results indicate that both proton transfers exhibit energetic and electronic differences emphasizing the role of the neighbor ring and the impact of conjugation on electronic properties.
Coherent Electron Transfer at the Ag / Graphite Heterojunction Interface
NASA Astrophysics Data System (ADS)
Tan, Shijing; Dai, Yanan; Zhang, Shengmin; Liu, Liming; Zhao, Jin; Petek, Hrvoje
2018-03-01
Charge transfer in transduction of light to electrical or chemical energy at heterojunctions of metals with semiconductors or semimetals is believed to occur by photogenerated hot electrons in metal undergoing incoherent internal photoemission through the heterojunction interface. Charge transfer, however, can also occur coherently by dipole coupling of electronic bands at the heterojunction interface. Microscopic physical insights into how transfer occurs can be elucidated by following the coherent polarization of the donor and acceptor states on the time scale of electronic dephasing. By time-resolved multiphoton photoemission spectroscopy (MPP), we investigate the coherent electron transfer from an interface state that forms upon chemisorption of Ag nanoclusters onto graphite to a σ symmetry interlayer band of graphite. Multidimensional MPP spectroscopy reveals a resonant two-photon transition, which dephases within 10 fs completing the coherent transfer.
Food Antioxidants: Chemical Insights at the Molecular Level.
Galano, Annia; Mazzone, Gloria; Alvarez-Diduk, Ruslán; Marino, Tiziana; Alvarez-Idaboy, J Raúl; Russo, Nino
2016-01-01
In this review, we briefly summarize the reliability of the density functional theory (DFT)-based methods to accurately predict the main antioxidant properties and the reaction mechanisms involved in the free radical-scavenging reactions of chemical compounds present in food. The analyzed properties are the bond dissociation energies, in particular those involving OH bonds, electron transfer enthalpies, adiabatic ionization potentials, and proton affinities. The reaction mechanisms are hydrogen-atom transfer, proton-coupled electron transfer, radical adduct formation, single electron transfer, sequential electron proton transfer, proton-loss electron transfer, and proton-loss hydrogen-atom transfer. Furthermore, the chelating ability of these compounds and its role in decreasing or inhibiting the oxidative stress induced by Fe(III) and Cu(II) are considered. Comparisons between theoretical and experimental data confirm that modern theoretical tools are not only able to explain controversial experimental facts but also to predict chemical behavior.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kryachko, E.S.
1999-06-03
The electronic coupling between the initial and final diabatic states is the major factor that determines the rate of electron transfer. A general formula for the adiabatic-to-diabatic mixing angle in terms of the electronic dipole moments is derived within a two-state model. It expresses the electronic coupling determining the rate of electronic transfer in terms of the off-diagonal diabatic dipole moment.
Photo-induced electron transfer method
Wohlgemuth, Roland; Calvin, Melvin
1984-01-01
The efficiency of photo-induced electron transfer reactions is increased and the back transfer of electrons in such reactions is greatly reduced when a photo-sensitizer zinc porphyrin-surfactant and an electron donor manganese porphyrin-surfactant are admixed into phospho-lipid membranes. The phospholipids comprising said membranes are selected from phospholipids whose head portions are negatively charged. Said membranes are contacted with an aqueous medium in which an essentially neutral viologen electron acceptor is admixed. Catalysts capable of transfering electrons from reduced viologen electron acceptor to hydrogen to produce elemental hydrogen are also included in the aqueous medium. An oxidizable olefin is also admixed in the phospholipid for the purpose of combining with oxygen that coordinates with oxidized electron donor manganese porphyrin-surfactant.
Application of Electron-Transfer Theory to Several Systems of Biological Interest
DOE R&D Accomplishments Database
Marcus, R. A.; Sutin, N.
1985-03-23
Electron-transfer reaction rates are compared with theoretically calculated values for several reactions in the bacterial photosynthetic reaction center. A second aspect of the theory, the cross-relation, is illustrated using protein-protein electron transfers.
Lu, Qiujun; Chen, Xiaogen; Liu, Dan; Wu, Cuiyan; Liu, Meiling; Li, Haitao; Zhang, Youyu; Yao, Shouzhuo
2018-05-15
The selective and sensitive detection of dopamine (DA) is of great significance for the identification of schizophrenia, Huntington's disease, and Parkinson's disease from the perspective of molecular diagnostics. So far, most of DA fluorescence sensors are based on the electron transfer from the fluorescence nanomaterials to DA-quinone. However, the limited electron transfer ability of the DA-quinone affects the level of detection sensitivity of these sensors. In this work, based on the DA can reduce Ag + into AgNPs followed by oxidized to DA-quinone, we developed a novel silicon nanoparticles-based electron transfer fluorescent sensor for the detection of DA. As electron transfer acceptor, the AgNPs and DA-quinone can quench the fluorescence of silicon nanoparticles effectively through the synergistic electron transfer effect. Compared with traditional fluorescence DA sensors, the proposed synergistic electron transfer-based sensor improves the detection sensitivity to a great extent (at least 10-fold improvement). The proposed sensor shows a low detection limit of DA, which is as low as 0.1 nM under the optimal conditions. This sensor has potential applicability for the detection of DA in practical sample. This work has been demonstrated to contribute to a substantial improvement in the sensitivity of the sensors. It also gives new insight into design electron transfer-based sensors. Copyright © 2018. Published by Elsevier B.V.
NASA Astrophysics Data System (ADS)
Sjulstok, Emil; Olsen, Jógvan Magnus Haugaard; Solov'Yov, Ilia A.
2015-12-01
Various biological processes involve the conversion of energy into forms that are usable for chemical transformations and are quantum mechanical in nature. Such processes involve light absorption, excited electronic states formation, excitation energy transfer, electrons and protons tunnelling which for example occur in photosynthesis, cellular respiration, DNA repair, and possibly magnetic field sensing. Quantum biology uses computation to model biological interactions in light of quantum mechanical effects and has primarily developed over the past decade as a result of convergence between quantum physics and biology. In this paper we consider electron transfer in biological processes, from a theoretical view-point; namely in terms of quantum mechanical and semi-classical models. We systematically characterize the interactions between the moving electron and its biological environment to deduce the driving force for the electron transfer reaction and to establish those interactions that play the major role in propelling the electron. The suggested approach is seen as a general recipe to treat electron transfer events in biological systems computationally, and we utilize it to describe specifically the electron transfer reactions in Arabidopsis thaliana cryptochrome-a signaling photoreceptor protein that became attractive recently due to its possible function as a biological magnetoreceptor.
PATHWAYS - ELECTRON TUNNELING PATHWAYS IN PROTEINS
NASA Technical Reports Server (NTRS)
Beratan, D. N.
1994-01-01
The key to understanding the mechanisms of many important biological processes such as photosynthesis and respiration is a better understanding of the electron transfer processes which take place between metal atoms (and other groups) fixed within large protein molecules. Research is currently focused on the rate of electron transfer and the factors that influence it, such as protein composition and the distance between metal atoms. Current models explain the swift transfer of electrons over considerable distances by postulating bridge-mediated tunneling, or physical tunneling pathways, made up of interacting bonds in the medium around and between donor and acceptor sites. The program PATHWAYS is designed to predict the route along which electrons travel in the transfer processes. The basic strategy of PATHWAYS is to begin by recording each possible path element on a connectivity list, including in each entry which two atoms are connected and what contribution the connection would make to the overall rate if it were included in a pathway. The list begins with the bonded molecular structure (including the backbone sequence and side chain connectivity), and then adds probable hydrogen bond links and through-space contacts. Once this list is completed, the program runs a tree search from the donor to the acceptor site to find the dominant pathways. The speed and efficiency of the computer search offers an improvement over manual techniques. PATHWAYS is written in FORTRAN 77 for execution on DEC VAX series computers running VMS. The program inputs data from four data sets and one structure file. The software was written to input BIOGRAF (old format) structure files based on x-ray crystal structures and outputs ASCII files listing the best pathways and BIOGRAF vector files containing the paths. Relatively minor changes could be made in the input format statements for compatibility with other graphics software. The executable and source code are included with the distribution. The main memory requirement for execution is 2.6 Mb. This program is available in DEC VAX BACKUP format on a 9-track 1600 BPI magnetic tape (standard distribution) or on a TK50 tape cartridge. PATHWAYS was developed in 1988. PATHWAYS is a copyrighted work with all copyright vested in NASA. DEC, VAX, VMS, and TK50 are trademarks of Digital Equipment Corporation. BIOGRAF is a trademark of Molecular Simulations, Inc., Sunnyvale, CA.
The gene transfer agent-like particle of the marine phototrophic bacterium Rhodovulum sulfidophilum.
Nagao, Nobuyoshi; Yamamoto, Junya; Komatsu, Hiroyuki; Suzuki, Hiromichi; Hirose, Yuu; Umekage, So; Ohyama, Takashi; Kikuchi, Yo
2015-12-01
Gene transfer agents (GTAs) are shaped like bacteriophage particles but have many properties that distinguish them from bacteriophages. GTAs play a role in horizontal gene transfer in nature and thus affect the evolution of prokaryotic genomes. In the course of studies on the extracellular production of designed RNAs using the marine bacterium Rhodovulum sulfidophilum , we found that this bacterium produces a GTA-like particle. The particle contains DNA fragments of 4.5 kb, which consist of randomly fragmented genomic DNA from the bacterium. This 4.5-kb DNA production was prevented while quorum sensing was inhibited. Direct observation of the particle by transmission electron microscopy revealed that the particle resembles a tailed phage and has a head diameter of about 40 nm and a tail length of about 60 nm. We also identified the structural genes for the GTA in the genome. Translated amino acid sequences and gene positions are closely related to those of the genes that encode the Rhodobacter capsulatus GTA. This is the first report of a GTA-like particle from the genus Rhodovulum . However, gene transfer activity of this particle has not yet been confirmed. The differences between this particle and other GTAs are discussed.
K 3 Fe(CN) 6 under External Pressure: Dimerization of CN – Coupled with Electron Transfer to Fe(III)
Li, Kuo; Zheng, Haiyan; Wang, Lijuan; ...
2015-09-14
The addition polymerization of charged monomers like C≡C 2– and C≡N– is scarcely seen at ambient conditions but can progress under external pressure with their conductivity significantly enhanced, which expands the research field of polymer science to inorganic salts. Moreover, the reaction pressures of transition metal cyanides like Prussian blue and K 3Fe(CN) 6 are much lower than that of alkali cyanides. To figure out the effect of the transition metal on the reaction, the crystal structure and electronic structure of K 3Fe(CN) 6 under external pressure are investigated by in situ neutron diffraction, in situ X-ray absorption fine structuremore » (XAFS), and neutron pair distribution functions (PDF) up to ~15 GPa. The cyanide anions react following a sequence of approaching–bonding–stabilizing. The Fe(III) brings the cyanides closer which makes the bonding progress at a low pressure (2–4 GPa). At ~8 GPa, an electron transfers from the CN to Fe(III), reduces the charge density on cyanide ions, and stabilizes the reaction product of cyanide. Finally, from this study we can conclude that bringing the monomers closer and reducing their charge density are two effective routes to decrease the reaction pressure, which is important for designing novel pressure induced conductor and excellent electrode materials.« less
ELECTRON TRANSFER MECHANISM AT THE SOLID-LIQUID INTERFACE OF PHYLLOSILICATES
Interfacial electron transfer processes on clay minerals have significant impact in natural environments and geochemical systems. Nitrobenzene was used as molecular probes to study the electron transfer mechanism at the solid-water interfaces of Fe-containing phyllosicates. For...
What’s New in Enzymatic Halogenations
Fujimori, Danica Galoniæ; Walsh, Christopher T.
2007-01-01
Summary The halogenation of thousands of natural products occurs during biosynthesis and often confers important functional properties. While haloperoxidases had been the default paradigm for enzymatic incorporation of halogens, via X+ equivalents into organic scaffolds, a combination of microbial genome sequencing, enzymatic studies and structural biology have provided deep new insights into enzymatic transfer of halide equivalents in three oxidation states. These are: (1) the halide ions (X−) abundant in nature, (2) halogen atoms (X•), and (3) the X+ equivalents. The mechanism of halogen incorporation is tailored to the electronic demands of specific substrates and involves enzymes with distinct redox coenzyme requirements. PMID:17881282
X.400: The Standard for Message Handling Systems.
ERIC Educational Resources Information Center
Swain, Leigh; Tallim, Paula
1990-01-01
Profiles X.400, the Open Systems Interconnection (OSI) Application layer standard that supports interpersonal electronic mail services, facsimile transfer, electronic data interchange, electronic funds transfer, electronic publishing, and electronic invoicing. Also discussed are an electronic directory to support message handling, compatibility…
Farnum, Byron H; Morseth, Zachary A; Brennaman, M Kyle; Papanikolas, John M; Meyer, Thomas J
2015-06-18
Degenerately doped In2O3:Sn semiconductor nanoparticles (nanoITO) have been used to study the photoinduced interfacial electron-transfer reactivity of surface-bound [Ru(II)(bpy)2(4,4'-(PO3H2)2-bpy)](2+) (RuP(2+)) molecules as a function of driving force over a range of 1.8 eV. The metallic properties of the ITO nanoparticles, present within an interconnected mesoporous film, allowed for the driving force to be tuned by controlling their Fermi level with an external bias while their optical transparency allowed for transient absorption spectroscopy to be used to monitor electron-transfer kinetics. Photoinduced electron transfer from excited-state -RuP(2+*) molecules to nanoITO was found to be dependent on applied bias and competitive with nonradiative energy transfer to nanoITO. Back electron transfer from nanoITO to oxidized -RuP(3+) was also dependent on the applied bias but without complication from inter- or intraparticle electron diffusion in the oxide nanoparticles. Analysis of the electron injection kinetics as a function of driving force using Marcus-Gerischer theory resulted in an experimental estimate of the reorganization energy for the excited-state -RuP(3+/2+*) redox couple of λ* = 0.83 eV and an electronic coupling matrix element, arising from electronic wave function overlap between the donor orbital in the molecule and the acceptor orbital(s) in the nanoITO electrode, of Hab = 20-45 cm(-1). Similar analysis of the back electron-transfer kinetics yielded λ = 0.56 eV for the ground-state -RuP(3+/2+) redox couple and Hab = 2-4 cm(-1). The use of these wide band gap, degenerately doped materials provides a unique experimental approach for investigating single-site electron transfer at the surface of oxide nanoparticles.
Chemical and charge transfer studies on interfaces of a conjugated polymer and ITO
NASA Astrophysics Data System (ADS)
David, Tanya M. S.; Arasho, Wondwosson; Smith, O'Neil; Hong, Kunlun; Bonner, Carl; Sun, Sam-Shajing
2017-08-01
Conjugated oligomers and polymers are very attractive for potential future plastic electronic and opto-electronic device applications such as plastic photo detectors and solar cells, thermoelectric devices, field effect transistors, and light emitting diodes. Understanding and optimizing charge transport between an active polymer layer and conductive substrate is critical to the optimization of polymer based electronic and opto-electronic devices. This study focused on the design, synthesis, self-assembly, and electron transfers and transports of a phosphonic acid end-functionalized polyphenylenevinylene (PPV) that was covalently attached and self-assembled onto an Indium Tin Oxide (ITO) substrate. This study demonstrated how atomic force microscopy (AFM) can be an effective characterization technique in conjunction with conventional electron transfer methods, including cyclic voltammetry (CV), towards determining electron transfer rates in polymer and polymer/conductor interface systems. This study found that the electron transfer rates of covalently attached and self-assembled films were much faster than the spin coated films. The knowledge from this study can be very useful for designing potential polymer based electronic and opto-electronic thin film devices.
Electron transfer by excited benzoquinone anions: slow rates for two-electron transitions.
Zamadar, Matibur; Cook, Andrew R; Lewandowska-Andralojc, Anna; Holroyd, Richard; Jiang, Yan; Bikalis, Jin; Miller, John R
2013-09-05
Electron transfer (ET) rate constants from the lowest excited state of the radical anion of benzoquinone, BQ(-•)*, were measured in THF solution. Rate constants for bimolecular electron transfer reactions typically reach the diffusion-controlled limit when the free-energy change, ΔG°, reaches -0.3 eV. The rate constants for ET from BQ(-•)* are one-to-two decades smaller at this energy and do not reach the diffusion-controlled limit until -ΔG° is 1.5-2.0 eV. The rates are so slow probably because a second electron must also undergo a transition to make use of the energy of the excited state. Similarly, ET, from solvated electrons to neutral BQ to form the lowest excited state, is slow, while fast ET is observed at a higher excited state, which can be populated in a transition involving only one electron. A simple picture based on perturbation theory can roughly account for the control of electron transfer by the need for transition of a second electron. The picture also explains how extra driving force (-ΔG°) can restore fast rates of electron transfer.
Glazer, Alexander N.; Mathies, Richard A.; Hung, Su-Chun; Ju, Jingyue
2000-01-01
Cyanine dyes are used as the donor fluorophore in energy transfer labels in which light energy is absorbed by a donor fluorophore and transferred to an acceptor fluorophore which responds to the transfer by emitting fluorescent light for detection. The cyanine dyes impart an unusually high sensitivity to the labels thereby improving their usefulness in a wide variety of biochemical procedures, particularly nucleic acid sequencing, nucleic acid fragment sizing, and related procedures.
Sequence specific motor performance gains after memory consolidation in children and adolescents.
Dorfberger, Shoshi; Adi-Japha, Esther; Karni, Avi
2012-01-01
Memory consolidation for a trained sequence of finger opposition movements, in 9- and 12-year-old children, was recently found to be significantly less susceptible to interference by a subsequent training experience, compared to that of 17-year-olds. It was suggested that, in children, the experience of training on any sequence of finger movements may affect the performance of the sequence elements, component movements, rather than the sequence as a unit; the latter has been implicated in the learning of the task by adults. This hypothesis implied a possible childhood advantage in the ability to transfer the gains from a trained to the reversed, untrained, sequence of movements. Here we report the results of transfer tests undertaken to test this proposal in 9-, 12-, and 17-year-olds after training in the finger-to-thumb opposition sequence (FOS) learning task. Our results show that the performance gains in the trained sequence partially transferred from the left, trained hand, to the untrained hand at 48-hours after a single training session in the three age-groups tested. However, there was very little transfer of the gains from the trained to the untrained, reversed, sequence performed by either hand. The results indicate sequence specific post-training gains in FOS performance, as opposed to a general improvement in performance of the individual, component, movements that comprised both the trained and untrained sequences. These results do not support the proposal that the reduced susceptibility to interference, in children before adolescence, reflects a difference in movement syntax representation after training.
Explicit instruction of rules interferes with visuomotor skill transfer.
Tanaka, Kanji; Watanabe, Katsumi
2017-06-01
In the present study, we examined the effects of explicit knowledge, obtained through instruction or spontaneous detection, on the transfer of visuomotor sequence learning. In the learning session, participants learned a visuomotor sequence, via trial and error. In the transfer session, the order of the sequence was reversed from that of the learning session. Before the commencement of the transfer session, some participants received explicit instruction regarding the reversal rule (i.e., Instruction group), while the others did not receive any information and were sorted into either an Aware or Unaware group, as assessed by interview conducted after the transfer session. Participants in the Instruction and Aware groups performed with fewer errors than the Unaware group in the transfer session. The participants in the Instruction group showed slower speed than the Aware and Unaware groups in the transfer session, and the sluggishness likely persisted even in late learning. These results suggest that explicit knowledge reduces errors in visuomotor skill transfer, but may interfere with performance speed, particularly when explicit knowledge is provided, as opposed to being spontaneously discovered.
Otte, Douglas A L; Woerpel, K A
2015-08-07
Addition of allylmagnesium reagents to an aliphatic aldehyde bearing a radical clock gave only addition products and no evidence of ring-opened products that would suggest single-electron-transfer reactions. The analogous Barbier reaction also did not provide evidence for a single-electron-transfer mechanism in the addition step. Other Grignard reagents (methyl-, vinyl-, t-Bu-, and triphenylmethylmagnesium halides) also do not appear to add to an alkyl aldehyde by a single-electron-transfer mechanism.
Evidence for protein conformational change at a Au(110)/protein interface
NASA Astrophysics Data System (ADS)
Messiha, H. L.; Smith, C. I.; Scrutton, N. S.; Weightman, P.
2008-07-01
Evidence is presented that reflection anisotropy spectroscopy (RAS) can provide real-time measurements of conformational change in proteins induced by electron transfer reactions. A bacterial electron transferring flavoprotein (ETF) has been modified so as to adsorb on an Au(110) electrode and enable reversible electron transfer to the protein cofactor in the absence of mediators. Reversible changes are observed in the RAS of this protein that are interpreted as arising from conformational changes accompanying the transfer of electrons.
Enhanced electron transfer kinetics through hybrid graphene-carbon nanotube films.
Henry, Philémon A; Raut, Akshay S; Ubnoske, Stephen M; Parker, Charles B; Glass, Jeffrey T
2014-11-01
We report the first study of the electrochemical reactivity of a graphenated carbon nanotube (g-CNT) film. The electron transfer kinetics of the ferri-ferrocyanide couple were examined for a g-CNT film and compared to the kinetics to standard carbon nanotubes (CNTs). The g-CNT film exhibited much higher catalytic activity, with a heterogeneous electron-transfer rate constant, k 0 , approximately two orders of magnitude higher than for standard CNTs. Scanning electron microscopy and Raman spectroscopy were used to correlate the higher electron transfer kinetics with the higher edge-density of the g-CNT film.
Enzymatic cellulose oxidation is linked to lignin by long-range electron transfer
Westereng, Bjørge; Cannella, David; Wittrup Agger, Jane; Jørgensen, Henning; Larsen Andersen, Mogens; Eijsink, Vincent G.H.; Felby, Claus
2015-01-01
Enzymatic oxidation of cell wall polysaccharides by lytic polysaccharide monooxygenases (LPMOs) plays a pivotal role in the degradation of plant biomass. While experiments have shown that LPMOs are copper dependent enzymes requiring an electron donor, the mechanism and origin of the electron supply in biological systems are only partly understood. We show here that insoluble high molecular weight lignin functions as a reservoir of electrons facilitating LPMO activity. The electrons are donated to the enzyme by long-range electron transfer involving soluble low molecular weight lignins present in plant cell walls. Electron transfer was confirmed by electron paramagnetic resonance spectroscopy showing that LPMO activity on cellulose changes the level of unpaired electrons in the lignin. The discovery of a long-range electron transfer mechanism links the biodegradation of cellulose and lignin and sheds new light on how oxidative enzymes present in plant degraders may act in concert. PMID:26686263
Jensen, Heather M.; TerAvest, Michaela A.; Kokish, Mark G.; ...
2016-03-22
Introducing extracellular electron transfer pathways into heterologous organisms offers the opportunity to explore fundamental biogeochemical processes and to biologically alter redox states of exogenous metals for various applications. While expression of the MtrCAB electron nanoconduit from Shewanella oneidensis MR-1 permits extracellular electron transfer in Escherichia coli, the low electron flux and absence of growth in these cells limits their practicality for such applications. In this paper, we investigate how the rate of electron transfer to extracellular Fe(III) and cell survival in engineered E. coli are affected by mimicking different features of the S. oneidensis pathway: the number of electron nanoconduits,more » the link between the quinol pool and MtrA, and the presence of flavin-dependent electron transfer. While increasing the number of pathways does not significantly improve the extracellular electron transfer rate or cell survival, using the native inner membrane component, CymA, significantly improves the reduction rate of extracellular acceptors and increases cell viability. Strikingly, introducing both CymA and riboflavin to Mtr-expressing E. coli also allowed these cells to couple metal reduction to growth, which is the first time an increase in biomass of an engineered E. coli has been observed under Fe 2O 3 (s) reducing conditions. Overall and finally, this work provides engineered E. coli strains for modulating extracellular metal reduction and elucidates critical factors for engineering extracellular electron transfer in heterologous organisms.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jensen, Heather M.; TerAvest, Michaela A.; Kokish, Mark G.
Introducing extracellular electron transfer pathways into heterologous organisms offers the opportunity to explore fundamental biogeochemical processes and to biologically alter redox states of exogenous metals for various applications. While expression of the MtrCAB electron nanoconduit from Shewanella oneidensis MR-1 permits extracellular electron transfer in Escherichia coli, the low electron flux and absence of growth in these cells limits their practicality for such applications. In this paper, we investigate how the rate of electron transfer to extracellular Fe(III) and cell survival in engineered E. coli are affected by mimicking different features of the S. oneidensis pathway: the number of electron nanoconduits,more » the link between the quinol pool and MtrA, and the presence of flavin-dependent electron transfer. While increasing the number of pathways does not significantly improve the extracellular electron transfer rate or cell survival, using the native inner membrane component, CymA, significantly improves the reduction rate of extracellular acceptors and increases cell viability. Strikingly, introducing both CymA and riboflavin to Mtr-expressing E. coli also allowed these cells to couple metal reduction to growth, which is the first time an increase in biomass of an engineered E. coli has been observed under Fe 2O 3 (s) reducing conditions. Overall and finally, this work provides engineered E. coli strains for modulating extracellular metal reduction and elucidates critical factors for engineering extracellular electron transfer in heterologous organisms.« less
Flavin Charge Transfer Transitions Assist DNA Photolyase Electron Transfer
NASA Astrophysics Data System (ADS)
Skourtis, Spiros S.; Prytkova, Tatiana; Beratan, David N.
2007-12-01
This contribution describes molecular dynamics, semi-empirical and ab-initio studies of the primary photo-induced electron transfer reaction in DNA photolyase. DNA photolyases are FADH--containing proteins that repair UV-damaged DNA by photo-induced electron transfer. A DNA photolyase recognizes and binds to cyclobutatne pyrimidine dimer lesions of DNA. The protein repairs a bound lesion by transferring an electron to the lesion from FADH-, upon photo-excitation of FADH- with 350-450 nm light. We compute the lowest singlet excited states of FADH- in DNA photolyase using INDO/S configuration interaction, time-dependent density-functional, and time-dependent Hartree-Fock methods. The calculations identify the lowest singlet excited state of FADH- that is populated after photo-excitation and that acts as the electron donor. For this donor state we compute conformationally-averaged tunneling matrix elements to empty electron-acceptor states of a thymine dimer bound to photolyase. The conformational averaging involves different FADH--thymine dimer confromations obtained from molecular dynamics simulations of the solvated protein with a thymine dimer docked in its active site. The tunneling matrix element computations use INDO/S-level Green's function, energy splitting, and Generalized Mulliken-Hush methods. These calculations indicate that photo-excitation of FADH- causes a π→π* charge-transfer transition that shifts electron density to the side of the flavin isoalloxazine ring that is adjacent to the docked thymine dimer. This shift in electron density enhances the FADH--to-dimer electronic coupling, thus inducing rapid electron transfer.
MacA is a second cytochrome c peroxidase of Geobacter sulfurreducens.
Seidel, Julian; Hoffmann, Maren; Ellis, Katie E; Seidel, Antonia; Spatzal, Thomas; Gerhardt, Stefan; Elliott, Sean J; Einsle, Oliver
2012-04-03
The metal-reducing δ-proteobacterium Geobacter sulfurreducens produces a large number of c-type cytochromes, many of which have been implicated in the transfer of electrons to insoluble metal oxides. Among these, the dihemic MacA was assigned a central role. Here we have produced G. sulfurreducens MacA by recombinant expression in Escherichia coli and have solved its three-dimensional structure in three different oxidation states. Sequence comparisons group MacA into the family of diheme cytochrome c peroxidases, and the protein indeed showed hydrogen peroxide reductase activity with ABTS(-2) as an electron donor. The observed K(M) was 38.5 ± 3.7 μM H(2)O(2) and v(max) was 0.78 ± 0.03 μmol of H(2)O(2)·min(-1)·mg(-1), resulting in a turnover number k(cat) = 0.46 · s(-1). In contrast, no Fe(III) reductase activity was observed. MacA was found to display electrochemical properties similar to other bacterial diheme peroxidases, in addition to the ability to electrochemically mediate electron transfer to the soluble cytochrome PpcA. Differences in activity between CcpA and MacA can be rationalized with structural variations in one of the three loop regions, loop 2, that undergoes conformational changes during reductive activation of the enzyme. This loop is adjacent to the active site heme and forms an open loop structure rather than a more rigid helix as in CcpA. For the activation of the protein, the loop has to displace the distal ligand to the active site heme, H93, in loop 1. A H93G variant showed an unexpected formation of a helix in loop 2 and disorder in loop 1, while a M297H variant that altered the properties of the electron transfer heme abolished reductive activation.
MacA is a Second Cytochrome c Peroxidase of Geobacter sulfurreducens
Seidel, Julian; Hoffmann, Maren; Ellis, Katie E.; Seidel, Antonia; Spatzal, Thomas; Gerhardt, Stefan; Elliott, Sean J.
2012-01-01
The metal-reducing δ-proteobacterium Geobacter sulfurreducens produces a large number of c-type cytochromes, many of which have been implicated in the transfer of electrons to insoluble metal oxides. Among these, the dihemic MacA was assigned a central role. Here we have produced G. sulfurreducens MacA by recombinant expression in Escherichia coli and have solved its three-dimensional structure in three different oxidation states. Sequence comparisons group MacA into the family of diheme cytochrome c peroxidases, and the protein indeed showed hydrogen peroxide reductase activity with ABTS2– as an electron donor. The observed KM was 38.5 ± 3.7 μM H2O2 and vmax was 0.78 ± 0.03 μmol H2O2·min–1·mg–1, resulting in a turnover number kcat = 0.46 · s–1. In contrast, no Fe(III) reductase activity was observed. MacA was found to display similar electrochemical properties to other bacterial diheme peroxidases, in additional to the ability to electrochemically mediate electron transfer to the soluble cytochrome PpcA. Differences in activity between CcpA and MacA can be rationalized with structural variations in one of the three loop regions, loop 2, that undergo conformational changes during reductive activation of the enzyme. This loop is adjacent to the active site heme and forms an open loop structure rather than a more rigid helix as in CcpA. For the activation of the protein the loop has to displace the distal ligand to the active site heme, H93, in loop 1. A H93G variant showed an unexpected formation of a helix in loop 2 and disorder in loop 1, while a M297H variant that altered the properties of the electron transfer heme abolished reductive activation. PMID:22417533
Photoinduced electron transfer between benzyloxy dendrimer phthalocyanine and benzoquinone
NASA Astrophysics Data System (ADS)
Zhang, Tiantian; Ma, Dongdong; Pan, Sujuan; Wu, Shijun; Jiang, Yufeng; Zeng, Di; Yang, Hongqin; Peng, Yiru
2016-10-01
Photo-induced electron transfer (PET) is an important and fundamental process in natural photosynthesis. To mimic such interesting PET process, a suitable donor and acceptor couple were properly chosen. Dendrimer phthalocyanines and their derivatives have emerged as promising materials for artificial photosynthesis systems. In this paper, the electron transfer between the light harvest dendrimer phthalocyanine (donor) and the 1,4-benzoquinone (acceptor) was studied by UV/Vis and fluorescence spectroscopic methods. It was found that fluorescence of phthalocyanine was quenched by benzoquinone (BQ) via excited state electron transfer, from the phthalocyanine to the BQ upon excitation at 610 nm. The Stern-Volmer constant (KSV) of electron transfer was calculated. Our study suggests that this dendritic phthalocyanine is an effective new electron donor and transmission complex and could be used as a potential artificial photosynthesis system.
Xuan Lin; Nurul Faridi; Claudio Casola
2016-01-01
Comparative genomics analyses empowered by the wealth of sequenced genomes have revealed numerous instances of horizontal DNA transfers between distantly related species. In  eukaryotes, repetitive DNA sequences known as transposable elements (TEs) are especially prone to  move across species boundaries. Such horizontal transposon transfers, or HTTs, are relatively  ...
Andersson, Mikael; Linke, Myriam; Chambron, Jean-Claude; Davidsson, Jan; Heitz, Valérie; Hammarström, Leif; Sauvage, Jean-Pierre
2002-04-24
A series of [2]-rotaxanes has been synthesized in which two Zn(II)-porphyrins (ZnP) electron donors were attached as stoppers on the rod. A macrocycle attached to a Au(III)-porphyrin (AuP+) acceptor was threaded on the rod. By selective excitation of either porphyrin, we could induce an electron transfer from the ZnP to the AuP+ unit that generated the same ZnP*+-AuP* charge-transfer state irrespective of which porphyrin was excited. Although the reactants were linked only by mechanical or coordination bonds, electron-transfer rate constants up to 1.2x10(10) x s(-1) were obtained over a 15-17 A edge-to-edge distance between the porphyrins. The resulting charge-transfer state had a relatively long lifetime of 10-40 ns and was formed in high yield (>80%) in most cases. By a simple variation of the link between the reactants, viz. a coordination of the phenanthroline units on the rotaxane rod and ring by either Ag+ or Cu+, we could enhance the electron-transfer rate from the ZnP to the excited 3AuP+. We interpret our data in terms of an enhanced superexchange mechanism with Ag+ and a change to a stepwise hopping mechanism with Cu+, involving the oxidized Cu(phen)22+ unit as a real intermediate. When the ZnP unit was excited instead, electron transfer from the excited 1ZnP to AuP+ was not affected, or even slowed, by Ag+ or Cu+. We discuss this asymmetry in terms of the different orbitals involved in mediating the reaction in an electron- and a hole-transfer mechanism. Our results show the possibility to tune the rates of electron transfer between noncovalently linked reactants by a convenient modification of the link. The different effect of Ag+ and Cu+ on the rate with ZnP and AuP+ excitation shows an additional possibility to control the electron-transfer reactions by selective excitation. We also found that coordination of the Cu+ introduced an energy-transfer reaction from 1ZnP to Cu(phen)2+ (k = 5.1x10(9) x s(-1)) that proceeded in competition with electron transfer to AuP+ and was followed by a quantitative energy transfer to give the 3ZnP state (k = 1.5x10(9) x s(-1)).
A molecular shift register based on electron transfer
NASA Technical Reports Server (NTRS)
Hopfield, J. J.; Onuchic, Josenelson; Beratan, David N.
1988-01-01
An electronic shift-register memory at the molecular level is described. The memory elements are based on a chain of electron-transfer molecules and the information is shifted by photoinduced electron-transfer reactions. This device integrates designed electronic molecules onto a very large scale integrated (silicon microelectronic) substrate, providing an example of a 'molecular electronic device' that could actually be made. The design requirements for such a device and possible synthetic strategies are discussed. Devices along these lines should have lower energy usage and enhanced storage density.
12 CFR 1005.6 - Liability of consumer for unauthorized transfers.
Code of Federal Regulations, 2012 CFR
2012-01-01
... transfers. 1005.6 Section 1005.6 Banks and Banking BUREAU OF CONSUMER FINANCIAL PROTECTION ELECTRONIC FUND TRANSFERS (REGULATION E) § 1005.6 Liability of consumer for unauthorized transfers. (a) Conditions for..., for an unauthorized electronic fund transfer involving the consumer's account only if the financial...
Toogood, Helen S; van Thiel, Adam; Scrutton, Nigel S; Leys, David
2005-08-26
Crystal structures of protein complexes with electron-transferring flavoprotein (ETF) have revealed a dual protein-protein interface with one region serving as anchor while the ETF FAD domain samples available space within the complex. We show that mutation of the conserved Glu-165beta in human ETF leads to drastically modulated rates of interprotein electron transfer with both medium chain acyl-CoA dehydrogenase and dimethylglycine dehydrogenase. The crystal structure of free E165betaA ETF is essentially identical to that of wild-type ETF, but the crystal structure of the E165betaA ETF.medium chain acyl-CoA dehydrogenase complex reveals clear electron density for the FAD domain in a position optimal for fast interprotein electron transfer. Based on our observations, we present a dynamic multistate model for conformational sampling that for the wild-type ETF. medium chain acyl-CoA dehydrogenase complex involves random motion between three distinct positions for the ETF FAD domain. ETF Glu-165beta plays a key role in stabilizing positions incompatible with fast interprotein electron transfer, thus ensuring high rates of complex dissociation.
Federal Register 2010, 2011, 2012, 2013, 2014
2012-06-08
... Information: Electronic Transfer Account (ETA) Financial Agency Agreement AGENCY: Financial Management Service... of information described below: Title: Electronic Transfer Account (ETA) Financial Agency Agreement... public and other Federal agencies to take this opportunity to comment on a continuing information...
Code of Federal Regulations, 2011 CFR
2011-07-01
...) Payment by electronic funds transfer is not required in the following cases: (1) Where an individual: (i... are not required to be made by electronic funds transfer, unless and until such payments become... waiver request with Treasury certifying that payment by electronic funds transfer would impose a hardship...
12 CFR 1005.7 - Initial disclosures.
Code of Federal Regulations, 2012 CFR
2012-01-01
... disclosures required by this section at the time a consumer contracts for an electronic fund transfer service or before the first electronic fund transfer is made involving the consumer's account. (b) Content of... Banks and Banking BUREAU OF CONSUMER FINANCIAL PROTECTION ELECTRONIC FUND TRANSFERS (REGULATION E...
Solvent effects on the oxidation (electron transfer) reaction of [Fe(CN) 6] 4- by [Co(NH 3) 5pz] 3+
NASA Astrophysics Data System (ADS)
Muriel, F.; Jiménez, R.; López, M.; Prado-Gotor, R.; Sánchez, F.
2004-03-01
Solvent effects on the title reaction were studied in different reaction media constituted by water and organic cosolvents (methanol, tert-butyl alcohol, ethyleneglycol and glucose) at 298.2 K. The results are considered in light of the Marcus-Hush approach for electron transfer reactions. Variations of the electron transfer rate constant are shown to be mainly due to changes in the reaction free energy. On the other hand the energies of the MMCT band, corresponding to the optical electron transfer within the ion pair [Fe(CN) 6] 4-/[Co(NH 3) 5pz] 3+, in the different reaction media, have been obtained. The activation free energies of the thermal electron transfer process have been calculated from the band ( Eop) data, and compared with those obtained from the kinetic study. Quantitative agreement is found between the two series of data. This shows the possibility of estimating activation free energies for electron transfer reactions from static (optical) measurements.
Graphene for amino acid biosensing: Theoretical study of the electronic transport
NASA Astrophysics Data System (ADS)
Rodríguez, S. J.; Makinistian, L.; Albanesi, E. A.
2017-10-01
The study of biosensors based on graphene has increased in the last years, the combination of excellent electrical properties and low noise makes graphene a material for next generation electronic devices. This work discusses the application of a graphene-based biosensor for the detection of amino acids histidine (His), alanine (Ala), aspartic acid (Asp), and tyrosine (Tyr). First, we present the results of modeling from first principles the adsorption of the four amino acids on a graphene sheet, we calculate adsorption energy, substrate-adsorbate distance, equilibrium geometrical configurations (upon relaxation) and densities of states (DOS) for each biomolecule adsorbed. Furthermore, in order to evaluate the effects of amino acid adsorption on the electronic transport of graphene, we modeled a device using first-principles calculations with a combination of Density Functional Theory (DFT) and Nonequilibrium Greens Functions (NEGF). We provide with a detailed discussion in terms of transmission, current-voltage curves, and charge transfer. We found evidence of differences in the electronic transport through the graphene sheet due to amino acid adsorption, reinforcing the possibility of graphene-based sensors for amino acid sequencing of proteins.
NASA Astrophysics Data System (ADS)
Qiu, Rui; Zhang, Baogang; Li, Jiaxin; Lv, Qing; Wang, Song; Gu, Qian
2017-08-01
Microbial fuel cells (MFCs) represent a promising approach for remediation of toxic vanadium (V) contaminated environment. Herein, enhanced V(V) reduction and bioelectricity generation are realized in MFCs with biocathode. Synergistically electrochemical and microbial reductions result in the nearly complete removals of V(V) within 7 d operation with initial concentration of 200 mg L-1. Maximum power density of 529 ± 12 mW m-2 is obtained. Electrochemical tests reveal that biocathode promotes electron transfers and reduces charge transfer resistance. XPS analysis confirms that V(IV) is the main reduction product, which precipitates naturally under neutral conditions. High-throughput 16S rRNA gene sequencing analysis indicates that the newly appeared Dysgonomonas is responsible for V(V) reduction and Klebsiella contributes mainly to bioelectricity generation in MFCs with biocathode. This study further improves the performance of remediating V(V) contaminated environment based on MFC technology.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kokhan, Oleksandr; Ponomarenko, Nina S.; Pokkuluri, P. Raj
PpcA, a tri-heme cytochrome c7 from Geobacter sulfurreducens was investigated as a model for photosensitizer-initiated electron transfer within a multi-heme "molecular wire" protein architecture. E. coli expression of PpcA was found to be tolerant of cysteine site-directed mutagenesis, demonstrated by the successful expression of natively folded proteins bearing cysteine mutations at a series of sites selected to vary characteristically with respect to the three -CXXCH- heme binding domains. A preliminary survey of 5 selected mutants found that the introduced cysteines can be readily covalently linked to a Ru(II)-(2,2'-bpy)2(4-bromomethyl-4’-methyl-2,2'-bpy) photosensitizer (where bpy = bipyridine), and that the linked constructs support bothmore » photo-oxidative and photo-reductive quenching of the photosensitizer excited-state, depending upon the initial heme redox state. For photo-oxidative electron transfer, apparent heme reduction risetimes were found to vary from 7 x 10-12 s to 5 x 10-8 s, depending upon the site of photosensitizer linking. The excited-state electron transfers are about 103-fold faster than any previously reported photosensitizer-redox protein covalently linked construct. Preliminary conformational analysis using molecular dynamics simulations shows that rates for electron transfer track both the distance and pathways for electron transfer. Two mutants with the fastest charge transfer rates, A23C and K29C, showed a significant role of specific paths for electron transfer. While K29C labeled mutant was expected to have approximately 0.8Å greater donor-acceptor distance, it showed 20-fold faster charge separation rate. Clear evidence for inter-heme electron transfer within the multi-heme protein is not detected within the lifetimes of the charge separated states. These results demonstrate an opportunity to develop multi-heme c-cytochromes for investigation of electron transfer in protein "molecular wires" and to serve as frameworks for metalloprotein designs that support multiple electron transfer redox chemistry.« less
Photoemission of Energetic Hot Electrons Produced via Up-Conversion in Doped Quantum Dots.
Dong, Yitong; Parobek, David; Rossi, Daniel; Son, Dong Hee
2016-11-09
The benefits of the hot electrons from semiconductor nanostructures in photocatalysis or photovoltaics result from their higher energy compared to that of the band-edge electrons facilitating the electron-transfer process. The production of high-energy hot electrons usually requires short-wavelength UV or intense multiphoton visible excitation. Here, we show that highly energetic hot electrons capable of above-threshold ionization are produced via exciton-to-hot-carrier up-conversion in Mn-doped quantum dots under weak band gap excitation (∼10 W/cm 2 ) achievable with the concentrated solar radiation. The energy of hot electrons is as high as ∼0.4 eV above the vacuum level, much greater than those observed in other semiconductor or plasmonic metal nanostructures, which are capable of performing energetically and kinetically more-challenging electron transfer. Furthermore, the prospect of generating solvated electron is unique for the energetic hot electrons from up-conversion, which can open a new door for long-range electron transfer beyond short-range interfacial electron transfer.
Rydzak, Thomas; Grigoryan, Marina; Cunningham, Zack J; Krokhin, Oleg V; Ezzati, Peyman; Cicek, Nazim; Levin, David B; Wilkins, John A; Sparling, Richard
2014-01-01
While annotation of the genome sequence of Clostridium thermocellum has allowed predictions of pathways catabolizing cellobiose to end products, ambiguities have persisted with respect to the role of various proteins involved in electron transfer reactions. A combination of growth studies modulating carbon and electron flow and multiple reaction monitoring (MRM) mass spectrometry measurements of proteins involved in central metabolism and electron transfer was used to determine the key enzymes involved in channeling electrons toward fermentation end products. Specifically, peptides belonging to subunits of ferredoxin-dependent hydrogenase and NADH:ferredoxin oxidoreductase (NFOR) were low or below MRM detection limits when compared to most central metabolic proteins measured. The significant increase in H2 versus ethanol synthesis in response to either co-metabolism of pyruvate and cellobiose or hypophosphite mediated pyruvate:formate lyase inhibition, in conjunction with low levels of ferredoxin-dependent hydrogenase and NFOR, suggest that highly expressed putative bifurcating hydrogenases play a substantial role in reoxidizing both reduced ferredoxin and NADH simultaneously. However, product balances also suggest that some of the additional reduced ferredoxin generated through increased flux through pyruvate:ferredoxin oxidoreductase must be ultimately converted into NAD(P)H either directly via NADH-dependent reduced ferredoxin:NADP(+) oxidoreductase (NfnAB) or indirectly via NADPH-dependent hydrogenase. While inhibition of hydrogenases with carbon monoxide decreased H2 production 6-fold and redirected flux from pyruvate:ferredoxin oxidoreductase to pyruvate:formate lyase, the decrease in CO2 was only 20 % of that of the decrease in H2, further suggesting that an alternative redox system coupling ferredoxin and NAD(P)H is active in C. thermocellum in lieu of poorly expressed ferredoxin-dependent hydrogenase and NFOR.
Quantum Calculations of Electron Tunneling in Respiratory Complex III.
Hagras, Muhammad A; Hayashi, Tomoyuki; Stuchebrukhov, Alexei A
2015-11-19
The most detailed and comprehensive to date study of electron transfer reactions in the respiratory complex III of aerobic cells, also known as bc1 complex, is reported. In the framework of the tunneling current theory, electron tunneling rates and atomistic tunneling pathways between different redox centers were investigated for all electron transfer reactions comprising different stages of the proton-motive Q-cycle. The calculations reveal that complex III is a smart nanomachine, which under certain conditions undergoes conformational changes gating electron transfer, or channeling electrons to specific pathways. One-electron tunneling approximation was adopted in the tunneling calculations, which were performed using hybrid Broken-Symmetry (BS) unrestricted DFT/ZINDO levels of theory. The tunneling orbitals were determined using an exact biorthogonalization scheme that uniquely separates pairs of tunneling orbitals with small overlaps out of the remaining Franck-Condon orbitals with significant overlap. Electron transfer rates in different redox pairs show exponential distance dependence, in agreement with the reported experimental data; some reactions involve coupled proton transfer. Proper treatment of a concerted two-electron bifurcated tunneling reaction at the Q(o) site is given.
Charge transfer from TiO2 into adsorbed benzene diazonium compounds
NASA Astrophysics Data System (ADS)
Merson, A.; Dittrich, Th.; Zidon, Y.; Rappich, J.; Shapira, Yoram
2004-08-01
Electron transfer from sol-gel-prepared TiO2 into adsorbed benzene diazonium compounds has been investigated using cyclic voltammetry, x-ray photoelectron spectroscopy, contact potential difference, and surface photovoltage spectroscopy. The results show that the potential of maximum electron transfer depends strongly on the dipole moment of the benzene compound. Two reactive surface sites at which electron transfer occurs have been identified.
Sung, Jooyoung; Nowak-Król, Agnieszka; Schlosser, Felix; Fimmel, Benjamin; Kim, Woojae; Kim, Dongho; Würthner, Frank
2016-07-27
We have elucidated excimer-mediated intramolecular electron transfer in cofacially stacked PBIs tethered by two phenylene-butadiynylene loops. The electron transfer between energetically equivalent PBIs is revealed by the simultaneous observation of the PBI radical anion and cation bands in the transient absorption spectra. The fluorescence decay time of the excimer states is in good agreement with the rise time of PBI radical bands in transient absorption spectra suggesting that the electron transfer dynamics proceed via the excimer state. We can conclude that the excimer state effectuates the efficient charge transfer in the cofacially stacked PBI dimer.
12 CFR 1005.6 - Liability of consumer for unauthorized transfers.
Code of Federal Regulations, 2014 CFR
2014-01-01
... transfers. 1005.6 Section 1005.6 Banks and Banking BUREAU OF CONSUMER FINANCIAL PROTECTION ELECTRONIC FUND TRANSFERS (REGULATION E) General § 1005.6 Liability of consumer for unauthorized transfers. (a) Conditions... this section, for an unauthorized electronic fund transfer involving the consumer's account only if the...
12 CFR 1005.6 - Liability of consumer for unauthorized transfers.
Code of Federal Regulations, 2013 CFR
2013-01-01
... transfers. 1005.6 Section 1005.6 Banks and Banking BUREAU OF CONSUMER FINANCIAL PROTECTION ELECTRONIC FUND TRANSFERS (REGULATION E) General § 1005.6 Liability of consumer for unauthorized transfers. (a) Conditions... this section, for an unauthorized electronic fund transfer involving the consumer's account only if the...
Single-Molecule Interfacial Electron Transfer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lu, H. Peter
This project is focused on the use of single-molecule high spatial and temporal resolved techniques to study molecular dynamics in condensed phase and at interfaces, especially, the complex reaction dynamics associated with electron and energy transfer rate processes. The complexity and inhomogeneity of the interfacial ET dynamics often present a major challenge for a molecular level comprehension of the intrinsically complex systems, which calls for both higher spatial and temporal resolutions at ultimate single-molecule and single-particle sensitivities. Combined single-molecule spectroscopy and electrochemical atomic force microscopy approaches are unique for heterogeneous and complex interfacial electron transfer systems because the static andmore » dynamic inhomogeneities can be identified and characterized by studying one molecule at a specific nanoscale surface site at a time. The goal of our project is to integrate and apply these spectroscopic imaging and topographic scanning techniques to measure the energy flow and electron flow between molecules and substrate surfaces as a function of surface site geometry and molecular structure. We have been primarily focusing on studying interfacial electron transfer under ambient condition and electrolyte solution involving both single crystal and colloidal TiO 2 and related substrates. The resulting molecular level understanding of the fundamental interfacial electron transfer processes will be important for developing efficient light harvesting systems and broadly applicable to problems in fundamental chemistry and physics. We have made significant advancement on deciphering the underlying mechanism of the complex and inhomogeneous interfacial electron transfer dynamics in dyesensitized TiO 2 nanoparticle systems that strongly involves with and regulated by molecule-surface interactions. We have studied interfacial electron transfer on TiO 2 nanoparticle surfaces by using ultrafast single-molecule spectroscopy and electrochemical AFM metal tip scanning microscopy, focusing on understanding the interfacial electron transfer dynamics at specific nanoscale electron transfer sites with high-spatially and temporally resolved topographic-and-spectroscopic characterization at individual molecule basis, characterizing single-molecule rate processes, reaction driving force, and molecule-substrate electronic coupling. One of the most significant characteristics of our new approach is that we are able to interrogate the complex interfacial electron transfer dynamics by actively pin-point energetic manipulation of the surface interaction and electronic couplings, beyond the conventional excitation and observation.« less
What Hinders Electron Transfer Dissociation (ETD) of DNA Cations?
NASA Astrophysics Data System (ADS)
Hari, Yvonne; Leumann, Christian J.; Schürch, Stefan
2017-12-01
Radical activation methods, such as electron transfer dissociation (ETD), produce structural information complementary to collision-induced dissociation. Herein, electron transfer dissociation of 3-fold protonated DNA hexamers was studied to gain insight into the fragmentation mechanism. The fragmentation patterns of a large set of DNA hexamers confirm cytosine as the primary target of electron transfer. The reported data reveal backbone cleavage by internal electron transfer from the nucleobase to the phosphate linker leading either to a•/ w or d/ z• ion pairs. This reaction pathway contrasts with previous findings on the dissociation processes after electron capture by DNA cations, suggesting multiple, parallel dissociation channels. However, all these channels merely result in partial fragmentation of the precursor ion because the charge-reduced DNA radical cations are quite stable. Two hypotheses are put forward to explain the low dissociation yield of DNA radical cations: it is either attributed to non-covalent interactions between complementary fragments or to the stabilization of the unpaired electron in stacked nucleobases. MS3 experiments suggest that the charge-reduced species is the intact oligonucleotide. Moreover, introducing abasic sites significantly increases the dissociation yield of DNA cations. Consequently, the stabilization of the unpaired electron by π-π-stacking provides an appropriate rationale for the high intensity of DNA radical cations after electron transfer. [Figure not available: see fulltext.
75 FR 33681 - Electronic Fund Transfers
Federal Register 2010, 2011, 2012, 2013, 2014
2010-06-15
... FEDERAL RESERVE SYSTEM 12 CFR Part 205 [Regulation E; Docket No. R-1343] Electronic Fund Transfers June 4, 2010. AGENCY: Board of Governors of the Federal Reserve System. ACTION: Final rule; correction..., published on June 4, 2010 (75 FR 31665) make the following correction: PART 205--ELECTRONIC FUND TRANSFERS...
[Characteristics of exosomes andmicroparticles discovered in human tears].
Grigor'eva, A E; Tamkovich, S N; Eremina, A V; Tupikin, A E; Kabilov, M R; Chernykh, V V; Vlassov, V V; Laktionov, P P; Ryabchikova, E I
2016-01-01
Exosomes represent a sort of extracellular vesicles, which transfer molecular signals in organism and possess markers of producing cells. Our study was aimed at search of exosomes in the tears of healthy humans, confirmation of their nature and examination of exosome morphological and molecular-biological characteristics. The tears (110-340 ml) were collected from 24 healthy donors (aged 46-60 years); individual probes were centrifuged at 20000 g for 15 min to pellet cell debris. The supernatants were examined in electron microscope using negative staining; and they were also used for isolation and purification of the exosomes by filtration (100 nm pore-size) and double ultracentrifugation (90 min at 100000 g, 4°C). The "pellets" were subjected to electron microscopy, immunolabeling. The RNA and DNA were isolated from the samples, and their sizes were evaluated by capillary electrophoresis, the concentration and localization of nucleic acids were determined. Sequencing of DNA was performed using MiSeq ("Illumina", USA), data were analyzed using CLC GW 7.5 ("Qiagen", USA). Sequences were mapped on human genome (hg19). Electron microscopy revealed in supernatants of the tears cell debris, spherical microparticles (20-40 nm), membrane vesicles and macromolecular aggregates. The "pellets" obtained after ultracentrifugation, contained microparticles (17%), spherical and cup-shaped EVs (40-100 nm, 83%), which were positive for CD63, CD9 and CD24 receptors (specific markers of exosomes). Our study showed presence of high amount of exosomes in human tears, and relation of the exosomes with RNA (size less than 200 nt) and DNA (size was 3-9 kb). Sequencing of the DNA showed that about 92% of the reads mapped to human genome.
NASA Astrophysics Data System (ADS)
Liu, Entao; Wang, Hua; Li, Yuan; Huang, Chuanyan
2015-04-01
In sedimentary basins, a transfer zone can be defined as a coordinated system of deformational features which has good prospects for hydrocarbon exploration. Although the term 'transfer zone' has been widely applied to the study of extensional basins, little attention has been paid to its controlling effect on sequence tracking pattern and depositional facies distribution. Fushan Depression is a half-graben rift sub-basin, located in the southeast of the Beibuwan Basin, South China Sea. In this study, comparative analysis of seismic reflection, palaeogeomorphology, fault activity and depositional facies distribution in the southern slope indicates that three different types of sequence stacking patterns (i.e. multi-level step-fault belt in the western area, flexure slope belt in the central area, gentle slope belt in the eastern area) were developed along the southern slope, together with a large-scale transfer zone in the central area, at the intersection of the western and eastern fault systems. Further analysis shows that the transfer zone played an important role in the diversity of sequence stacking patterns in the southern slope by dividing the Fushan Depression into two non-interfering tectonic systems forming different sequence patterns, and leading to the formation of the flexure slope belt in the central area. The transfer zone had an important controlling effect on not only the diversity of sequence tracking patterns, but also the facies distribution on the relay ramp. During the high-stand stage, under the controlling effect of the transfer zone, the sediments contain a significant proportion of coarser material accumulated and distributed along the ramp axis. By contrast, during the low-stand stage, the transfer zone did not seem to contribute significantly to the low-stand fan distribution which was mainly controlled by the slope gradient (palaeogeomorphology). Therefore, analysis of the transfer zone can provide a new perspective for basin analysis. In addition, the transfer zone area demonstrated unique hydrocarbon accumulation models different from the western and eastern areas. It was not only a structural high combined with sufficient coarse-grained reservoir quality sands, but was also associated with large-scale sublacustrine fan deposits with high quality reservoirs, indicating that the recognition of transfer zones can improve the prediction of hydrocarbon occurrences in similar settings.
Ebert, Sybille; Rieger, Paul-Gerhard; Knackmuss, Hans-Joachim
1999-01-01
2,4,6-Trinitrophenol (picric acid) and 2,4-dinitrophenol were readily biodegraded by the strain Nocardioides simplex FJ2-1A. Aerobic bacterial degradation of these π-electron-deficient aromatic compounds is initiated by hydrogenation at the aromatic ring. A two-component enzyme system was identified which catalyzes hydride transfer to picric acid and 2,4-dinitrophenol. Enzymatic activity was dependent on NADPH and coenzyme F420. The latter could be replaced by an authentic preparation of coenzyme F420 from Methanobacterium thermoautotrophicum. One of the protein components functions as a NADPH-dependent F420 reductase. A second component is a hydride transferase which transfers hydride from reduced coenzyme F420 to the aromatic system of the nitrophenols. The N-terminal sequence of the F420 reductase showed high homology with an F420-dependent NADP reductase found in archaea. In contrast, no N-terminal similarity to any known protein was found for the hydride-transferring enzyme. PMID:10217752
Laser pulses for coherent xuv Raman excitation
NASA Astrophysics Data System (ADS)
Greenman, Loren; Koch, Christiane P.; Whaley, K. Birgitta
2015-07-01
We combine multichannel electronic structure theory with quantum optimal control to derive femtosecond-time-scale Raman pulse sequences that coherently populate a valence excited state. For a neon atom, Raman target populations of up to 13% are obtained. Superpositions of the ground and valence Raman states with a controllable relative phase are found to be reachable with up to 4.5% population and arbitrary phase control facilitated by the pump pulse carrier-envelope phase. Analysis of the optimized pulse structure reveals a sequential mechanism in which the valence excitation is reached via a fast (femtosecond) population transfer through an intermediate resonance state in the continuum rather than avoiding intermediate-state population with simultaneous or counterintuitive (stimulated Raman adiabatic passage) pulse sequences. Our results open a route to coupling valence excitations and core-hole excitations in molecules and aggregates that locally address specific atoms and represent an initial step towards realization of multidimensional spectroscopy in the xuv and x-ray regimes.
Kim, Ki Tae; Kim, Hyun Woo; Moon, Dohyun; Rhee, Young Min; Kim, Byeang Hyean
2013-09-14
With the goal of developing a fluorescent nucleoside sensitive to its environment, in this study we synthesized (DNS)C, a novel modified 2'-deoxycytidine bearing a 5-(dimethylamino)naphthalene-1-sulfonyl (dansyl) moiety at the N4 position, and tested its properties in monomeric and oligomeric states. (DNS)C undergoes intramolecular photoinduced electron transfer between its dansyl and cytosine units, resulting in remarkable changes in fluorescence that depend on the choice of solvent. In addition, the fluorescence behavior and thermal stability of oligonucleotides containing (DNS)C are dependent on the nature of the flanking and neighboring bases. Notably, (DNS)C exhibits fluorescence enhancement only in fully matched duplex DNA containing a GGG triad sequence. The environmental sensitivity of (DNS)C can be exploited as a fluorescence tool for monitoring the interactions of DNA with other biomolecules, including DNA, RNA, and proteins.
Xiao, Lifen; Zhu, Wen; Chen, Jiqiang; Zhang, Ke
2017-02-01
Cyclic multiblock polymers with high-order blocks are synthesized via the combination of single-electron transfer living radical polymerization (SET-LRP) and copper-catalyzed azide-alkyne cycloaddition (CuAAC). The linear α,ω-telechelic multiblock copolymer is prepared via SET-LRP by sequential addition of different monomers. The SET-LRP approach allows well control of the block length and sequence as A-B-C-D-E, etc. The CuAAC is then performed to intramolecularly couple the azide and alkyne end groups of the linear copolymer and produce the corresponding cyclic copolymer. The block sequence and the cyclic topology of the resultant cyclic copolymer are confirmed by the characterization of 1 H nuclear magnetic resonance spectroscopy, gel permeation chromatography, Fourier transform infrared spectroscopy, and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Martínez-González, Eduardo; Frontana, Carlos
2014-05-07
In this work, experimental evidence of the influence of the electron transfer kinetics during electron transfer controlled hydrogen bonding between anion radicals of metronidazole and ornidazole, derivatives of 5-nitro-imidazole, and 1,3-diethylurea as the hydrogen bond donor, is presented. Analysis of the variations of voltammetric EpIcvs. log KB[DH], where KB is the binding constant, allowed us to determine the values of the binding constant and also the electron transfer rate k, confirmed by experiments obtained at different scan rates. Electronic structure calculations at the BHandHLYP/6-311++G(2d,2p) level for metronidazole, including the solvent effect by the Cramer/Truhlar model, suggested that the minimum energy conformer is stabilized by intramolecular hydrogen bonding. In this structure, the inner reorganization energy, λi,j, contributes significantly (0.5 eV) to the total reorganization energy of electron transfer, thus leading to a diminishment of the experimental k.
Diller, David J
2017-01-10
Here we present a new method for point charge calculation which we call Q ET (charges by electron transfer). The intent of this work is to develop a method that can be useful for studying charge transfer in large biological systems. It is based on the intuitive framework of the Q EQ method with the key difference being that the Q ET method tracks all pairwise electron transfers by augmenting the Q EQ pseudoenergy function with a distance dependent cost function for each electron transfer. This approach solves the key limitation of the Q EQ method which is its handling of formally charged groups. First, we parametrize the Q ET method by fitting to electrostatic potentials calculated using ab initio quantum mechanics on over 11,000 small molecules. On an external test set of over 2500 small molecules the Q ET method achieves a mean absolute error of 1.37 kcal/mol/electron when compared to the ab initio electrostatic potentials. Second, we examine the conformational dependence of the charges on over 2700 tripeptides. With the tripeptide data set, we show that the conformational effects account for approximately 0.4 kcal/mol/electron on the electrostatic potentials. Third, we test the Q ET method for its ability to reproduce the effects of polarization and electron transfer on 1000 water clusters. For the water clusters, we show that the Q ET method captures about 50% of the polarization and electron transfer effects. Finally, we examine the effects of electron transfer and polarizability on the electrostatic interaction between p38 and 94 small molecule ligands. When used in conjunction with the Generalized-Born continuum solvent model, polarization and electron transfer with the Q ET model lead to an average change of 17 kcal/mol on the calculated electrostatic component of ΔG.
Tomiki, Takeshi; Saitou, Naruya
2004-08-01
The four electron transfer energy metabolism systems, photosynthesis, aerobic respiration, denitrification, and sulfur respiration, are thought to be evolutionarily related because of the similarity of electron transfer patterns and the existence of some homologous proteins. How these systems have evolved is elusive. We therefore conducted a comprehensive homology search using PSI-BLAST, and phylogenetic analyses were conducted for the three homologous groups (groups 1-3) based on multiple alignments of domains defined in the Pfam database. There are five electron transfer types important for catalytic reaction in group 1, and many proteins bind molybdenum. Deletions of two domains led to loss of the function of binding molybdenum and ferredoxin, and these deletions seem to be critical for the electron transfer pattern changes in group 1. Two types of electron transfer were found in group 2, and all its member proteins bind siroheme and ferredoxin. Insertion of the pyridine nucleotide disulfide oxidoreductase domain seemed to be the critical point for the electron transfer pattern change in this group. The proteins belonging to group 3 are all flavin enzymes, and they bind flavin adenine dinucleotide (FAD) or flavin mononucleotide (FMN). Types of electron transfer in this group are divergent, but there are two common characteristics. NAD(P)H works as an electron donor or acceptor, and FAD or FMN transfers electrons from/to NAD(P)H. Electron transfer functions might be added to these common characteristics by the addition of functional domains through the evolution of group 3 proteins. Based on the phylogenetic analyses in this study and previous studies, we inferred the phylogeny of the energy metabolism systems as follows: photosynthesis (and possibly aerobic respiration) and the sulfur/nitrogen assimilation system first diverged, then the sulfur/nitrogen dissimilation system was produced from the latter system.
Predicting the Rate Constant of Electron Tunneling Reactions at the CdSe-TiO2 Interface.
Hines, Douglas A; Forrest, Ryan P; Corcelli, Steven A; Kamat, Prashant V
2015-06-18
Current interest in quantum dot solar cells (QDSCs) motivates an understanding of the electron transfer dynamics at the quantum dot (QD)-metal oxide (MO) interface. Employing transient absorption spectroscopy, we have monitored the electron transfer rate (ket) at this interface as a function of the bridge molecules that link QDs to TiO2. Using mercaptoacetic acid, 3-mercaptopropionic acid, 8-mercaptooctanoic acid, and 16-mercaptohexadecanoic acid, we observe an exponential attenuation of ket with increasing linker length, and attribute this to the tunneling of the electron through the insulating linker molecule. We model the electron transfer reaction using both rectangular and trapezoidal barrier models that have been discussed in the literature. The one-electron reduction potential (equivalent to the lowest unoccupied molecular orbital) of each molecule as determined by cyclic voltammetry (CV) was used to estimate the effective barrier height presented by each ligand at the CdSe-TiO2 interface. The electron transfer rate (ket) calculated for each CdSe-ligand-TiO2 interface using both models showed the results in agreement with the experimentally determined trend. This demonstrates that electron transfer between CdSe and TiO2 can be viewed as electron tunneling through a layer of linking molecules and provides a useful method for predicting electron transfer rate constants.
Sirjoosingh, Andrew; Hammes-Schiffer, Sharon
2011-03-24
The distinction between proton-coupled electron transfer (PCET) and hydrogen atom transfer (HAT) mechanisms is important for the characterization of many chemical and biological processes. PCET and HAT mechanisms can be differentiated in terms of electronically nonadiabatic and adiabatic proton transfer, respectively. In this paper, quantitative diagnostics to evaluate the degree of electron-proton nonadiabaticity are presented. Moreover, the connection between the degree of electron-proton nonadiabaticity and the physical characteristics distinguishing PCET from HAT, namely, the extent of electronic charge redistribution, is clarified. In addition, a rigorous diabatization scheme for transforming the adiabatic electronic states into charge-localized diabatic states for PCET reactions is presented. These diabatic states are constructed to ensure that the first-order nonadiabatic couplings with respect to the one-dimensional transferring hydrogen coordinate vanish exactly. Application of these approaches to the phenoxyl-phenol and benzyl-toluene systems characterizes the former as PCET and the latter as HAT. The diabatic states generated for the phenoxyl-phenol system possess physically meaningful, localized electronic charge distributions that are relatively invariant along the hydrogen coordinate. These diabatic electronic states can be combined with the associated proton vibrational states to generate the reactant and product electron-proton vibronic states that form the basis of nonadiabatic PCET theories. Furthermore, these vibronic states and the corresponding vibronic couplings may be used to calculate rate constants and kinetic isotope effects of PCET reactions.
Milani, Alberto; Tommasini, Matteo; Russo, Valeria; Li Bassi, Andrea; Lucotti, Andrea; Cataldo, Franco
2015-01-01
Summary Graphene, nanotubes and other carbon nanostructures have shown potential as candidates for advanced technological applications due to the different coordination of carbon atoms and to the possibility of π-conjugation. In this context, atomic-scale wires comprised of sp-hybridized carbon atoms represent ideal 1D systems to potentially downscale devices to the atomic level. Carbon-atom wires (CAWs) can be arranged in two possible structures: a sequence of double bonds (cumulenes), resulting in a 1D metal, or an alternating sequence of single–triple bonds (polyynes), expected to show semiconducting properties. The electronic and optical properties of CAWs can be finely tuned by controlling the wire length (i.e., the number of carbon atoms) and the type of termination (e.g., atom, molecular group or nanostructure). Although linear, sp-hybridized carbon systems are still considered elusive and unstable materials, a number of nanostructures consisting of sp-carbon wires have been produced and characterized to date. In this short review, we present the main CAW synthesis techniques and stabilization strategies and we discuss the current status of the understanding of their structural, electronic and vibrational properties with particular attention to how these properties are related to one another. We focus on the use of vibrational spectroscopy to provide information on the structural and electronic properties of the system (e.g., determination of wire length). Moreover, by employing Raman spectroscopy and surface enhanced Raman scattering in combination with the support of first principles calculations, we show that a detailed understanding of the charge transfer between CAWs and metal nanoparticles may open the possibility to tune the electronic structure from alternating to equalized bonds. PMID:25821689
Degree sequence in message transfer
NASA Astrophysics Data System (ADS)
Yamuna, M.
2017-11-01
Message encryption is always an issue in current communication scenario. Methods are being devised using various domains. Graphs satisfy numerous unique properties which can be used for message transfer. In this paper, I propose a message encryption method based on degree sequence of graphs.
49 CFR 225.37 - Optical media transfer and electronic submission.
Code of Federal Regulations, 2012 CFR
2012-10-01
... 49 Transportation 4 2012-10-01 2012-10-01 false Optical media transfer and electronic submission..., AND INVESTIGATIONS § 225.37 Optical media transfer and electronic submission. (a) A railroad has the option of submitting the following reports, updates, and amendments by way of optical media (CD-ROM), or...
49 CFR 225.37 - Optical media transfer and electronic submission.
Code of Federal Regulations, 2013 CFR
2013-10-01
... 49 Transportation 4 2013-10-01 2013-10-01 false Optical media transfer and electronic submission..., AND INVESTIGATIONS § 225.37 Optical media transfer and electronic submission. (a) A railroad has the option of submitting the following reports, updates, and amendments by way of optical media (CD-ROM), or...
49 CFR 225.37 - Optical media transfer and electronic submission.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 49 Transportation 4 2011-10-01 2011-10-01 false Optical media transfer and electronic submission..., AND INVESTIGATIONS § 225.37 Optical media transfer and electronic submission. (a) A railroad has the option of submitting the following reports, updates, and amendments by way of optical media (CD-ROM), or...
49 CFR 225.37 - Optical media transfer and electronic submission.
Code of Federal Regulations, 2014 CFR
2014-10-01
... 49 Transportation 4 2014-10-01 2014-10-01 false Optical media transfer and electronic submission..., AND INVESTIGATIONS § 225.37 Optical media transfer and electronic submission. (a) A railroad has the option of submitting the following reports, updates, and amendments by way of optical media (CD-ROM), or...
76 FR 708 - Electronic Funds Transfer of Depository Taxes; Correction
Federal Register 2010, 2011, 2012, 2013, 2014
2011-01-06
... DEPARTMENT OF THE TREASURY Internal Revenue Service 26 CFR Parts 1, 31, 40, and 301 [TD 9507] RIN 1545-BJ13 Electronic Funds Transfer of Depository Taxes; Correction AGENCY: Internal Revenue Service... Electronic Funds Transfer (EFT). The temporary and final regulations provide rules under which depositors...
76 FR 709 - Electronic Funds Transfer of Depository Taxes; Correction
Federal Register 2010, 2011, 2012, 2013, 2014
2011-01-06
... DEPARTMENT OF THE TREASURY Internal Revenue Service 26 CFR Parts 40 and 301 [TD 9507] RIN 1545-BJ13 Electronic Funds Transfer of Depository Taxes; Correction AGENCY: Internal Revenue Service (IRS...) providing guidance relating to Federal tax deposits (FTDs) by Electronic Funds Transfer (EFT). The temporary...
78 FR 49365 - Electronic Fund Transfers (Regulation E); Correction
Federal Register 2010, 2011, 2012, 2013, 2014
2013-08-14
... BUREAU OF CONSUMER FINANCIAL PROTECTION 12 CFR Part 1005 [Docket No. CFPB-2012-0050] RIN 3170-AA33 Electronic Fund Transfers (Regulation E); Correction AGENCY: Bureau of Consumer Financial Protection. ACTION... 2013 Final Rule, which along with three other final rules \\1\\ implements the Electronic Fund Transfer...
75 FR 52485 - Electronic Funds Transfer of Depository Taxes; Correction
Federal Register 2010, 2011, 2012, 2013, 2014
2010-08-26
... DEPARTMENT OF THE TREASURY Internal Revenue Service 26 CFR Parts 1, 31, 40, and 301 [REG-153340-09] RIN 1545-BJ13 Electronic Funds Transfer of Depository Taxes; Correction AGENCY: Internal Revenue... to Federal tax deposits (FTDs) by Electronic Funds Transfer (EFT). FOR FURTHER INFORMATION CONTACT...
Federal Register 2010, 2011, 2012, 2013, 2014
2011-10-31
...; Submission for OMB Review; Payment by Electronic Fund Transfer AGENCY: Department of Defense (DOD), General... collection requirement concerning payment by electronic fund transfer. A notice was published in the Federal... technological collection techniques or other forms of information technology. DATES: Submit comments on or...
Code of Federal Regulations, 2012 CFR
2012-07-01
... Fluorinated Heat Transfer Fluids Used by the Electronics Industry I Table I-2 to Subpart I Protection of... REPORTING Electronics Manufacturing Pt. 98, Subpt. I, Table I-2 Table I-2 to Subpart I—Examples of Fluorinated GHGs and Fluorinated Heat Transfer Fluids Used by the Electronics Industry Product type...
NASA Astrophysics Data System (ADS)
Sugawara, Hirotake; Yamamoto, Tappei
2016-09-01
In order to quantitatively evaluate the electron confinement effect of the confronting divergent magnetic fields (CDMFs) applied to an inductively coupled plasma, we analyzed the electron transfer between two regions divided by the separatrix of the CDMFs in Ar at 0.67 Pa at 300 K using a Monte Carlo method. A conventional transfer judgement was simply based on the electron passage across the separatrix from the upstream source region to the downstream diffusion region. An issue was an overestimation of the transfer due to temporary stay of electrons in the downstream region. Electrons may pass the downstream region during their gyration even in case they are effectively bound to the upstream region, where their guiding magnetic flux lines run. More than half of the transfers were temporary ones and such seeming transfers were relevantly excluded from the statistics by introducing a newly chosen criterion based on the passage of electron gyrocenters across the separatrix and collisional events in the downstream region. Simulation results showed a tendency that the ratio of the temporary transfers excluded was higher under stronger magnetic fields because of higher cyclotron frequency. Work supported by JSPS Kakenhi Grant Number 16K05626.
The role of defects in Fe(II) – goethite electron transfer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Andrade de Notini, Luiza; Latta, Drew; Neumann, Anke
Despite accumulating experimental evidence for Fe(II)-Fe(III) oxide electron transfer, computational chemical calculations suggest that oxidation of sorbed Fe(II) is not energetically feasible unless defects are present. Here we used isotope specific 57Fe Mössbauer spectroscopy to investigate whether Fe(II)-goethite electron transfer is influenced by defects. Specifically, we heated the mineral to try to anneal the goethite surface and ground goethite to try to create defects. We found that heating goethite results in less oxidation of sorbed Fe(II) by goethite. When goethite was re-ground after heating, electron transfer was partially restored. X-ray absorption spectroscopy (XAS) and X-ray magnetic circular dichroism (XMCD) ofmore » heated and ground goethite confirm that heating and grinding alter the surface structure of the goethite. We propose that the heating process annealed the surface and decreased the number of sites where electron transfer could occur. Our experimental findings suggest that surface defects play an important role in Fe(II)-goethite electron transfer as suggested by computational calculations. Our finding that defects influence heterogeneous Fe(II)-goethite electron transfer has important implications for Fe(II) driven recrystallization of Fe oxides, as well as X and Y.« less
Przybylski, Cédric; Benito, Juan M; Bonnet, Véronique; Mellet, Carmen Ortiz; García Fernández, José M
2016-12-15
Polycationic carbohydrates represent an attractive class of biomolecules for several applications and particularly as non viral gene delivery vectors. In this case, the establishment of structure-biological activity relationship requires sensitive and accurate characterization tools to both control and achieve fine structural deciphering. Electrospray-tandem mass spectrometry (ESI-MS/MS) appears as a suitable approach to address these questions. In the study herein, we have investigated the usefulness of electron transfer dissociation (ETD) to get structural data about five polycationic carbohydrates demonstrated as promising gene delivery agents. A particular attention was paid to determine the influence of charge states as well as both fluoranthene reaction time and supplementary activation (SA) on production of charge reduced species, fragmentation yield, varying from 2 to 62%, as well as to obtain the most higher both diversity and intensity of fragments, according to charge states and targeted compounds. ETD fragmentation appeared to be mainly directed toward pending group rather than carbohydrate cyclic scaffold leading to a partial sequencing for building blocks when amino groups are close to carbohydrate core, but allowing to complete structural deciphering of some of them, such as those including dithioureidocysteaminyl group which was not possible with CID only. Such findings clearly highlight the potential to help the rational choice of the suitable analytical conditions, according to the nature of the gene delivery molecules exhibiting polycationic features. Moreover, our ETD-MS/MS approach open the way to a fine sequencing/identification of grafted groups carried on various sets of oligo-/polysaccharides in various fields such as glycobiology or nanomaterials, even with unknown or questionable extraction, synthesis or modification steps. Copyright © 2016 Elsevier B.V. All rights reserved.
Yun, Jiae; Malvankar, Nikhil S; Ueki, Toshiyuki; Lovley, Derek R
2016-01-01
Studies with pure cultures of dissimilatory metal-reducing microorganisms have demonstrated that outer-surface c-type cytochromes are important electron transfer agents for the reduction of metals, but previous environmental proteomic studies have typically not recovered cytochrome sequences from subsurface environments in which metal reduction is important. Gel-separation, heme-staining and mass spectrometry of proteins in groundwater from in situ uranium bioremediation experiments identified a putative c-type cytochrome, designated Geobacter subsurface c-type cytochrome A (GscA), encoded within the genome of strain M18, a Geobacter isolate previously recovered from the site. Homologs of GscA were identified in the genomes of other Geobacter isolates in the phylogenetic cluster known as subsurface clade 1, which predominates in a diversity of Fe(III)-reducing subsurface environments. Most of the gscA sequences recovered from groundwater genomic DNA clustered in a tight phylogenetic group closely related to strain M18. GscA was most abundant in groundwater samples in which Geobacter sp. predominated. Expression of gscA in a strain of Geobacter sulfurreducens that lacked the gene for the c-type cytochrome OmcS, thought to facilitate electron transfer from conductive pili to Fe(III) oxide, restored the capacity for Fe(III) oxide reduction. Atomic force microscopy provided evidence that GscA was associated with the pili. These results demonstrate that a c-type cytochrome with an apparent function similar to that of OmcS is abundant when Geobacter sp. are abundant in the subsurface, providing insight into the mechanisms for the growth of subsurface Geobacter sp. on Fe(III) oxide and suggesting an approach for functional analysis of other Geobacter proteins found in the subsurface. PMID:26140532
Yun, Jiae; Malvankar, Nikhil S; Ueki, Toshiyuki; Lovley, Derek R
2016-02-01
Studies with pure cultures of dissimilatory metal-reducing microorganisms have demonstrated that outer-surface c-type cytochromes are important electron transfer agents for the reduction of metals, but previous environmental proteomic studies have typically not recovered cytochrome sequences from subsurface environments in which metal reduction is important. Gel-separation, heme-staining and mass spectrometry of proteins in groundwater from in situ uranium bioremediation experiments identified a putative c-type cytochrome, designated Geobacter subsurface c-type cytochrome A (GscA), encoded within the genome of strain M18, a Geobacter isolate previously recovered from the site. Homologs of GscA were identified in the genomes of other Geobacter isolates in the phylogenetic cluster known as subsurface clade 1, which predominates in a diversity of Fe(III)-reducing subsurface environments. Most of the gscA sequences recovered from groundwater genomic DNA clustered in a tight phylogenetic group closely related to strain M18. GscA was most abundant in groundwater samples in which Geobacter sp. predominated. Expression of gscA in a strain of Geobacter sulfurreducens that lacked the gene for the c-type cytochrome OmcS, thought to facilitate electron transfer from conductive pili to Fe(III) oxide, restored the capacity for Fe(III) oxide reduction. Atomic force microscopy provided evidence that GscA was associated with the pili. These results demonstrate that a c-type cytochrome with an apparent function similar to that of OmcS is abundant when Geobacter sp. are abundant in the subsurface, providing insight into the mechanisms for the growth of subsurface Geobacter sp. on Fe(III) oxide and suggesting an approach for functional analysis of other Geobacter proteins found in the subsurface.
Franco, Bernardo; González-Cerón, Gabriela; Servín-González, Luis
2003-11-01
The functionality of direct and inverted repeat sequences inside the cis acting locus of transfer (clt) of the Streptomyces plasmid pJV1 was determined by testing the effect of different deletions on plasmid transfer. The results show that the single most important element for pJV1 clt function is a series of evenly spaced 9 bp long direct repeats which match the consensus CCGCACA(C/G)(C/G), since their deletion caused a dramatic reduction in plasmid transfer. The presence of these repeats in the absence of any other clt sequences allowed plasmid transfer to occur at a frequency that was at least two orders of magnitude higher than that obtained in the complete absence of clt. A database search revealed regions with a similar organization, and in the same position, in Streptomyces plasmids pSN22 and pSLS, which have transfer proteins homologous to those of pJV1.
Fast electron microscopy via compressive sensing
Larson, Kurt W; Anderson, Hyrum S; Wheeler, Jason W
2014-12-09
Various technologies described herein pertain to compressive sensing electron microscopy. A compressive sensing electron microscope includes a multi-beam generator and a detector. The multi-beam generator emits a sequence of electron patterns over time. Each of the electron patterns can include a plurality of electron beams, where the plurality of electron beams is configured to impart a spatially varying electron density on a sample. Further, the spatially varying electron density varies between each of the electron patterns in the sequence. Moreover, the detector collects signals respectively corresponding to interactions between the sample and each of the electron patterns in the sequence.
Effect of group electronegativity on electron transfer in bis(hydrazine) radical cations.
Qin, Haimei; Zhong, Xinxin; Si, Yubing; Zhang, Weiwei; Zhao, Yi
2011-04-14
The radical cation of 4,10-ditert-butyl-5,9-diisopropyl-4,5,9,10-tetraazatetracyclo[6.2.2.2]-tetradecane (sBI4T(+)), as well as its substituted bis(hydrazine) radical cations, is chosen for the investigation of the electronegativity dependence of its intramolecular electron transfer. To do so, two parameters, reorganization energy and electronic coupling, are calculated with several ab initio approaches. It is found that the electronic couplings decrease with the increase of the group electronegativity while the reorganization energies do not show an explicit dependency. Furthermore, Marcus formula is employed to reveal those effect on the electron transfer rates. The predicted rates of electron transfer generally decrease with increasing group electronegativity, although not monotonically.
Guo, Xunmin; Liu, Zheyun; Song, Qinhua; Wang, Lijuan; Zhong, Dongping
2015-02-26
Many biomimetic chemical systems for repair of UV-damaged DNA showed very low repair efficiency, and the molecular origin is still unknown. Here, we report our systematic characterization of the repair dynamics of a model compound of indole-thymine dimer adduct in three solvents with different polarity. By resolving all elementary steps including three electron-transfer processes and two bond-breaking and bond-formation dynamics with femtosecond resolution, we observed the slow electron injection in 580 ps in water, 4 ns in acetonitrile, and 1.38 ns in dioxane, the fast back electron transfer without repair in 120, 150, and 180 ps, and the slow bond splitting in 550 ps, 1.9 ns, and 4.5 ns, respectively. The dimer bond cleavage is clearly accelerated by the solvent polarity. By comparing with the biological repair machine photolyase with a slow back electron transfer (2.4 ns) and a fast bond cleavage (90 ps), the low repair efficiency in the biomimetic system is mainly determined by the fast back electron transfer and slow bond breakage. We also found that the model system exists in a dynamic heterogeneous C-clamped conformation, leading to a stretched dynamic behavior. In water, we even identified another stacked form with ultrafast cyclic electron transfer, significantly reducing the repair efficiency. Thus, the comparison of the repair efficiency in different solvents is complicated and should be cautious, and only the dynamics by resolving all elementary steps can finally determine the total repair efficiency. Finally, we use the Marcus electron-transfer theory to analyze all electron-transfer reactions and rationalize all observed electron-transfer dynamics.
Comparative Analysis of Type IV Pilin in Desulfuromonadales
Shu, Chuanjun; Xiao, Ke; Yan, Qin; Sun, Xiao
2016-01-01
During anaerobic respiration, the bacteria Geobacter sulfurreducens can transfer electrons to extracellular electron accepters through its pilus. G. sulfurreducens pili have been reported to have metallic-like conductivity that is similar to doped organic semiconductors. To study the characteristics and origin of conductive pilin proteins found in the pilus structure, their genetic, structural, and phylogenetic properties were analyzed. The genetic relationships, and conserved structures and sequences that were obtained were used to predict the evolution of the pilins. Homologous genes that encode conductive pilin were found using PilFind and Cluster. Sequence characteristics and protein tertiary structures were analyzed with MAFFT and QUARK, respectively. The origin of conductive pilins was explored by building a phylogenetic tree. Truncation is a characteristic of conductive pilin. The structures of truncated pilins and their accompanying proteins were found to be similar to the N-terminal and C-terminal ends of full-length pilins respectively. The emergence of the truncated pilins can probably be ascribed to the evolutionary pressure of their extracellular electron transporting function. Genes encoding truncated pilins and proteins similar to the C-terminal of full-length pilins, which contain a group of consecutive anti-parallel beta-sheets, are adjacent in bacterial genomes. According to the genetic, structure, and phylogenetic analyses performed in this study, we inferred that the truncated pilins and their accompanying proteins probably evolved from full-length pilins by gene fission through duplication, degeneration, and separation. These findings provide new insights about the molecular mechanisms involved in long-range electron transport along the conductive pili of Geobacter species. PMID:28066394
Electron shuttles in biotechnology.
Watanabe, Kazuya; Manefield, Mike; Lee, Matthew; Kouzuma, Atsushi
2009-12-01
Electron-shuttling compounds (electron shuttles [ESs], or redox mediators) are essential components in intracellular electron transfer, while microbes also utilize self-produced and naturally present ESs for extracellular electron transfer. These compounds assist in microbial energy metabolism by facilitating electron transfer between microbes, from electron-donating substances to microbes, and/or from microbes to electron-accepting substances. Artificially supplemented ESs can create new routes of electron flow in the microbial energy metabolism, thereby opening up new possibilities for the application of microbes to biotechnology processes. Typical examples of such processes include halogenated-organics bioremediation, azo-dye decolorization, and microbial fuel cells. Herein we suggest that ESs can be applied widely to create new microbial biotechnology processes.
Isegawa, Miho; Gao, Jiali; Truhlar, Donald G
2011-08-28
Molecular fragmentation algorithms provide a powerful approach to extending electronic structure methods to very large systems. Here we present a method for including charge transfer between molecular fragments in the explicit polarization (X-Pol) fragment method for calculating potential energy surfaces. In the conventional X-Pol method, the total charge of each fragment is preserved, and charge transfer between fragments is not allowed. The description of charge transfer is made possible by treating each fragment as an open system with respect to the number of electrons. To achieve this, we applied Mermin's finite temperature method to the X-Pol wave function. In the application of this method to X-Pol, the fragments are open systems that partially equilibrate their number of electrons through a quasithermodynamics electron reservoir. The number of electrons in a given fragment can take a fractional value, and the electrons of each fragment obey the Fermi-Dirac distribution. The equilibrium state for the electrons is determined by electronegativity equalization with conservation of the total number of electrons. The amount of charge transfer is controlled by re-interpreting the temperature parameter in the Fermi-Dirac distribution function as a coupling strength parameter. We determined this coupling parameter so as to reproduce the charge transfer energy obtained by block localized energy decomposition analysis. We apply the new method to ten systems, and we show that it can yield reasonable approximations to potential energy profiles, to charge transfer stabilization energies, and to the direction and amount of charge transferred. © 2011 American Institute of Physics
Isegawa, Miho; Gao, Jiali; Truhlar, Donald G.
2011-01-01
Molecular fragmentation algorithms provide a powerful approach to extending electronic structure methods to very large systems. Here we present a method for including charge transfer between molecular fragments in the explicit polarization (X-Pol) fragment method for calculating potential energy surfaces. In the conventional X-Pol method, the total charge of each fragment is preserved, and charge transfer between fragments is not allowed. The description of charge transfer is made possible by treating each fragment as an open system with respect to the number of electrons. To achieve this, we applied Mermin's finite temperature method to the X-Pol wave function. In the application of this method to X-Pol, the fragments are open systems that partially equilibrate their number of electrons through a quasithermodynamics electron reservoir. The number of electrons in a given fragment can take a fractional value, and the electrons of each fragment obey the Fermi–Dirac distribution. The equilibrium state for the electrons is determined by electronegativity equalization with conservation of the total number of electrons. The amount of charge transfer is controlled by re-interpreting the temperature parameter in the Fermi–Dirac distribution function as a coupling strength parameter. We determined this coupling parameter so as to reproduce the charge transfer energy obtained by block localized energy decomposition analysis. We apply the new method to ten systems, and we show that it can yield reasonable approximations to potential energy profiles, to charge transfer stabilization energies, and to the direction and amount of charge transferred. PMID:21895159
Hoggard, Anneli; Wang, Lin-Yung; Ma, Lulu; Fang, Ying; You, Ge; Olson, Jana; Liu, Zheng; Chang, Wei-Shun; Ajayan, Pulickel M; Link, Stephan
2013-12-23
We present a quantitative analysis of the electron transfer between single gold nanorods and monolayer graphene under no electrical bias. Using single-particle dark-field scattering and photoluminescence spectroscopy to access the homogeneous linewidth, we observe broadening of the surface plasmon resonance for gold nanorods on graphene compared to nanorods on a quartz substrate. Because of the absence of spectral plasmon shifts, dielectric interactions between the gold nanorods and graphene are not important and we instead assign the plasmon damping to charge transfer between plasmon-generated hot electrons and the graphene that acts as an efficient acceptor. Analysis of the plasmon linewidth yields an average electron transfer time of 160 ± 30 fs, which is otherwise difficult to measure directly in the time domain with single-particle sensitivity. In comparison to intrinsic hot electron decay and radiative relaxation, we furthermore calculate from the plasmon linewidth that charge transfer between the gold nanorods and the graphene support occurs with an efficiency of ∼10%. Our results are important for future applications of light harvesting with metal nanoparticle plasmons and efficient hot electron acceptors as well as for understanding hot electron transfer in plasmon-assisted chemical reactions.
Ito, Akitaka; Stewart, David J.; Fang, Zhen; Brennaman, M. Kyle; Meyer, Thomas J.
2012-01-01
Distance-dependent energy transfer occurs from the Metal-to-Ligand Charge Transfer (MLCT) excited state to an anthracene-acrylate derivative (Acr-An) incorporated into the polymer network of a semirigid poly(ethyleneglycol)dimethacrylate monolith. Following excitation, to Acr-An triplet energy transfer occurs followed by long-range, Acr-3An—Acr-An → Acr-An—Acr-3An, energy migration. With methyl viologen dication (MV2+) added as a trap, Acr-3An + MV2+ → Acr-An+ + MV+ electron transfer results in sensitized electron transfer quenching over a distance of approximately 90 Å. PMID:22949698
Code of Federal Regulations, 2013 CFR
2013-07-01
... Fluorinated Heat Transfer Fluids Used by the Electronics Industry I Table I-2 to Subpart I of Part 98... GREENHOUSE GAS REPORTING Electronics Manufacturing Pt. 98, Subpt. I, Table I-2 Table I-2 to Subpart I of Part 98—Examples of Fluorinated GHGs and Fluorinated Heat Transfer Fluids Used by the Electronics Industry...
48 CFR 252.232-7011 - Payments in Support of Emergencies and Contingency Operations.
Code of Federal Regulations, 2011 CFR
2011-10-01
.... Internal Revenue Code. (ix) Electronic funds transfer banking information. (A) The Contractor shall include electronic funds transfer banking information on the invoice only if required elsewhere in this contract. (B) If electronic funds transfer banking information is not required to be on the invoice, in order for...
Federal Register 2010, 2011, 2012, 2013, 2014
2011-08-24
... 40 Cigars and cigarettes, Claims, Electronic fund transfers, Excise taxes, Labeling, Packaging and... that are not required to pay taxes through electronic funds transfer (EFT), this first payment period..., Electronic funds transfers, Excise taxes, Exports, Food additives, Fruit juices, Labeling, Liquors, Packaging...
Wang, Qi; Puntambekar, Ajinkya; Chakrapani, Vidhya
2017-09-14
Species from ambient atmosphere such as water and oxygen are known to affect electronic and optical properties of GaN, but the underlying mechanism is not clearly known. In this work, we show through careful measurement of electrical resistivity and photoluminescence intensity under various adsorbates that the presence of oxygen or water vapor alone is not sufficient to induce electron transfer to these species. Rather, the presence of both water and oxygen is necessary to induce electron transfer from GaN that leads to the formation of an electron depletion region on the surface. Exposure to acidic gases decreases n-type conductivity due to increased electron transfer from GaN, while basic gases increase n-type conductivity and PL intensity due to reduced charge transfer from GaN. These changes in the electrical and optical properties, as explained using a new electrochemical framework based on the phenomenon of surface transfer doping, suggest that gases interact with the semiconductor surface through electrochemical reactions occurring in an adsorbed water layer present on the surface.
The interaction of trimethylamine dehydrogenase and electron-transferring flavoprotein.
Shi, Weiwei; Mersfelder, John; Hille, Russ
2005-05-27
The interaction between the physiological electron transfer partners trimethylamine dehydrogenase (TMADH) and electron-transferring flavoprotein (ETF) from Methylophilus methylotrophus has been examined with particular regard to the proposal that the former protein "imprints" a conformational change on the latter. The results indicate that the absorbance change previously attributed to changes in the environment of the FAD of ETF upon binding to TMADH is instead caused by electron transfer from partially reduced, as-isolated TMADH to ETF. Prior treatment of the as-isolated enzyme with the oxidant ferricenium essentially abolishes the observed spectral change. Further, when the semiquinone form of ETF is used instead of the oxidized form, the mirror image of the spectral change seen with as-isolated TMADH and oxidized ETF is observed. This is attributable to a small amount of electron transfer in the reverse of the physiological direction. Kinetic determination of the dissociation constant and limiting rate constant for electron transfer within the complex of (reduced) TMADH with (oxidized) ETF is reconfirmed and discussed in the context of a recently proposed model for the interaction between the two proteins that involves "structural imprinting" of ETF.
Protein electron transfer: Dynamics and statistics
NASA Astrophysics Data System (ADS)
Matyushov, Dmitry V.
2013-07-01
Electron transfer between redox proteins participating in energy chains of biology is required to proceed with high energetic efficiency, minimizing losses of redox energy to heat. Within the standard models of electron transfer, this requirement, combined with the need for unidirectional (preferably activationless) transitions, is translated into the need to minimize the reorganization energy of electron transfer. This design program is, however, unrealistic for proteins whose active sites are typically positioned close to the polar and flexible protein-water interface to allow inter-protein electron tunneling. The high flexibility of the interfacial region makes both the hydration water and the surface protein layer act as highly polar solvents. The reorganization energy, as measured by fluctuations, is not minimized, but rather maximized in this region. Natural systems in fact utilize the broad breadth of interfacial electrostatic fluctuations, but in the ways not anticipated by the standard models based on equilibrium thermodynamics. The combination of the broad spectrum of static fluctuations with their dispersive dynamics offers the mechanism of dynamical freezing (ergodicity breaking) of subsets of nuclear modes on the time of reaction/residence of the electron at a redox cofactor. The separation of time-scales of nuclear modes coupled to electron transfer allows dynamical freezing. In particular, the separation between the relaxation time of electro-elastic fluctuations of the interface and the time of conformational transitions of the protein caused by changing redox state results in dynamical freezing of the latter for sufficiently fast electron transfer. The observable consequence of this dynamical freezing is significantly different reorganization energies describing the curvature at the bottom of electron-transfer free energy surfaces (large) and the distance between their minima (Stokes shift, small). The ratio of the two reorganization energies establishes the parameter by which the energetic efficiency of protein electron transfer is increased relative to the standard expectations, thus minimizing losses of energy to heat. Energetically efficient electron transfer occurs in a chain of conformationally quenched cofactors and is characterized by flattened free energy surfaces, reminiscent of the flat and rugged landscape at the stability basin of a folded protein.
Protein electron transfer: Dynamics and statistics.
Matyushov, Dmitry V
2013-07-14
Electron transfer between redox proteins participating in energy chains of biology is required to proceed with high energetic efficiency, minimizing losses of redox energy to heat. Within the standard models of electron transfer, this requirement, combined with the need for unidirectional (preferably activationless) transitions, is translated into the need to minimize the reorganization energy of electron transfer. This design program is, however, unrealistic for proteins whose active sites are typically positioned close to the polar and flexible protein-water interface to allow inter-protein electron tunneling. The high flexibility of the interfacial region makes both the hydration water and the surface protein layer act as highly polar solvents. The reorganization energy, as measured by fluctuations, is not minimized, but rather maximized in this region. Natural systems in fact utilize the broad breadth of interfacial electrostatic fluctuations, but in the ways not anticipated by the standard models based on equilibrium thermodynamics. The combination of the broad spectrum of static fluctuations with their dispersive dynamics offers the mechanism of dynamical freezing (ergodicity breaking) of subsets of nuclear modes on the time of reaction/residence of the electron at a redox cofactor. The separation of time-scales of nuclear modes coupled to electron transfer allows dynamical freezing. In particular, the separation between the relaxation time of electro-elastic fluctuations of the interface and the time of conformational transitions of the protein caused by changing redox state results in dynamical freezing of the latter for sufficiently fast electron transfer. The observable consequence of this dynamical freezing is significantly different reorganization energies describing the curvature at the bottom of electron-transfer free energy surfaces (large) and the distance between their minima (Stokes shift, small). The ratio of the two reorganization energies establishes the parameter by which the energetic efficiency of protein electron transfer is increased relative to the standard expectations, thus minimizing losses of energy to heat. Energetically efficient electron transfer occurs in a chain of conformationally quenched cofactors and is characterized by flattened free energy surfaces, reminiscent of the flat and rugged landscape at the stability basin of a folded protein.
Rackwitz, Jenny; Bald, Ilko
2018-03-26
During cancer radiation therapy high-energy radiation is used to reduce tumour tissue. The irradiation produces a shower of secondary low-energy (<20 eV) electrons, which are able to damage DNA very efficiently by dissociative electron attachment. Recently, it was suggested that low-energy electron-induced DNA strand breaks strongly depend on the specific DNA sequence with a high sensitivity of G-rich sequences. Here, we use DNA origami platforms to expose G-rich telomere sequences to low-energy (8.8 eV) electrons to determine absolute cross sections for strand breakage and to study the influence of sequence modifications and topology of telomeric DNA on the strand breakage. We find that the telomeric DNA 5'-(TTA GGG) 2 is more sensitive to low-energy electrons than an intermixed sequence 5'-(TGT GTG A) 2 confirming the unique electronic properties resulting from G-stacking. With increasing length of the oligonucleotide (i.e., going from 5'-(GGG ATT) 2 to 5'-(GGG ATT) 4 ), both the variety of topology and the electron-induced strand break cross sections increase. Addition of K + ions decreases the strand break cross section for all sequences that are able to fold G-quadruplexes or G-intermediates, whereas the strand break cross section for the intermixed sequence remains unchanged. These results indicate that telomeric DNA is rather sensitive towards low-energy electron-induced strand breakage suggesting significant telomere shortening that can also occur during cancer radiation therapy. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Meyenburg, I.; Hofeditz, N.; Ruess, R.; Rudolph, M.; Schlettwein, D.; Heimbrodt, W.
2018-05-01
We studied the electron transfer at the interface of organic-inorganic hybrids consisting of indoline derivatives (D149 and D131) on ZnO substrates using a new optical method. We revealed the electron transfer times from the excited dye, e.g. the excitons formed in the dye aggregates to the ZnO substrate by analyzing the photoluminescence transients of the excitons after femtosecond excitation and applying kinetic model calculations. We reveal the changes of the electron transfer times by applying electrical bias. Pushing the Fermi energy of the ZnO substrate towards the excited dye level the transfer time gets longer and eventually the electron transfer is suppressed. The level alignment between the excited dye state and the ZnO Fermi-level is estimated. The excited state of D131 is about 100 meV higher than the respective state of D149 compared to the ZnO conduction band. This leads to shorter electron transfer times and eventually to higher quantum efficiencies of the solar cells.
Dissociable effects of practice variability on learning motor and timing skills.
Caramiaux, Baptiste; Bevilacqua, Frédéric; Wanderley, Marcelo M; Palmer, Caroline
2018-01-01
Motor skill acquisition inherently depends on the way one practices the motor task. The amount of motor task variability during practice has been shown to foster transfer of the learned skill to other similar motor tasks. In addition, variability in a learning schedule, in which a task and its variations are interweaved during practice, has been shown to help the transfer of learning in motor skill acquisition. However, there is little evidence on how motor task variations and variability schedules during practice act on the acquisition of complex motor skills such as music performance, in which a performer learns both the right movements (motor skill) and the right time to perform them (timing skill). This study investigated the impact of rate (tempo) variability and the schedule of tempo change during practice on timing and motor skill acquisition. Complete novices, with no musical training, practiced a simple musical sequence on a piano keyboard at different rates. Each novice was assigned to one of four learning conditions designed to manipulate the amount of tempo variability across trials (large or small tempo set) and the schedule of tempo change (randomized or non-randomized order) during practice. At test, the novices performed the same musical sequence at a familiar tempo and at novel tempi (testing tempo transfer), as well as two novel (but related) sequences at a familiar tempo (testing spatial transfer). We found that practice conditions had little effect on learning and transfer performance of timing skill. Interestingly, practice conditions influenced motor skill learning (reduction of movement variability): lower temporal variability during practice facilitated transfer to new tempi and new sequences; non-randomized learning schedule improved transfer to new tempi and new sequences. Tempo (rate) and the sequence difficulty (spatial manipulation) affected performance variability in both timing and movement. These findings suggest that there is a dissociable effect of practice variability on learning complex skills that involve both motor and timing constraints.
Tan, Wenbing; Xi, Beidou; Wang, Guoan; Jiang, Jie; He, Xiaosong; Mao, Xuhui; Gao, Rutai; Huang, Caihong; Zhang, Hui; Li, Dan; Jia, Yufu; Yuan, Ying; Zhao, Xinyu
2017-03-21
The electron transfer capacities (ETCs) of soil humic substances (HSs) are linked to the type and abundance of redox-active functional moieties in their structure. Natural temperature can affect the chemical structure of natural organic matter by regulating their oxidative transformation and degradation in soil. However, it is unclear if there is a direct correlation between ETC of soil HS and mean annual temperature. In this study, we assess the response of the electron-accepting and -donating capacities (EAC and EDC) of soil HSs to temperature by analyzing HSs extracted from soil set along glacial-interglacial cycles through loess-palaeosol sequences and along natural temperature gradients through latitude and altitude transects. We show that the EAC and EDC of soil HSs increase and decrease, respectively, with increasing temperature. Increased temperature facilitates the prevalence of oxidative degradation and transformation of HS in soils, thus potentially promoting the preferentially oxidative degradation of phenol moieties of HS or the oxidative transformation of electron-donating phenol moieties to electron-accepting quinone moieties in the HS structure. Consequently, the EAC and EDC of HSs in soil increase and decrease, respectively. The results of this study could help to understand biogeochemical processes, wherein the redox functionality of soil organic matter is involved in the context of increasing temperature.
Shen, Qing; Ogomi, Yuhei; Park, Byung-wook; Inoue, Takafumi; Pandey, Shyam S; Miyamoto, Akari; Fujita, Shinsuke; Katayama, Kenji; Toyoda, Taro; Hayase, Shuzi
2012-04-07
Understanding the electron transfer dynamics at the interface between dye sensitizer and semiconductor nanoparticle is very important for both a fundamental study and development of dye-sensitized solar cells (DSCs), which are a potential candidate for next generation solar cells. In this study, we have characterized the ultrafast photoexcited electron dynamics in a newly produced linearly-linked two dye co-sensitized solar cell using both a transient absorption (TA) and an improved transient grating (TG) technique, in which tin(IV) 2,11,20,29-tetra-tert-butyl-2,3-naphthalocyanine (NcSn) and cis-diisothiocyanato-bis(2,2'-bipyridyl-4,4'-dicarboxylato)ruthenium(II) bis(tetrabutylammonium) (N719) are molecularly and linearly linked and are bonded to the surface of a nanocrystalline tin dioxide (SnO(2)) electrode by a metal-O-metal linkage (i.e. SnO(2)-NcSn-N719). By comparing the TA and TG kinetics of NcSn, N719, and hybrid NcSn-N719 molecules adsorbed onto both of the SnO(2) and zirconium dioxide (ZrO(2)) nanocrystalline films, the forward and backward electron transfer dynamics in SnO(2)-NcSn-N719 were clarified. We found that there are two pathways for electron injection from the linearly-linked two dye molecules (NcSn-N719) to SnO(2). The first is a stepwise electron injection, in which photoexcited electrons first transfer from N719 to NcSn with a transfer time of 0.95 ps and then transfer from NcSn to the conduction band (CB) of SnO(2) with two timescales of 1.6 ps and 4.2 ps. The second is direct photoexcited electron transfer from N719 to the CB of SnO(2) with a timescale of 20-30 ps. On the other hand, back electron transfer from SnO(2) to NcSn is on a timescale of about 2 ns, which is about three orders of magnitude slower compared to the forward electron transfer from NcSn to SnO(2). The back electron transfer from NcSn to N719 is on a timescale of about 40 ps, which is about one order slower compared to the forward electron transfer from N719 to NcSn. These results demonstrate that photoexcited electrons can be effectively injected into SnO(2) from both of the N719 and NcSn dyes.
12 CFR 205.9 - Receipts at electronic terminals; periodic statements.
Code of Federal Regulations, 2011 CFR
2011-01-01
... RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.9 Receipts at electronic terminals; periodic..., a financial institution shall make a receipt available to a consumer at the time the consumer initiates an electronic fund transfer at an electronic terminal. The receipt shall set forth the following...
12 CFR 205.9 - Receipts at electronic terminals; periodic statements.
Code of Federal Regulations, 2013 CFR
2013-01-01
... RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.9 Receipts at electronic terminals; periodic..., a financial institution shall make a receipt available to a consumer at the time the consumer initiates an electronic fund transfer at an electronic terminal. The receipt shall set forth the following...
12 CFR 205.9 - Receipts at electronic terminals; periodic statements.
Code of Federal Regulations, 2014 CFR
2014-01-01
... RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.9 Receipts at electronic terminals; periodic..., a financial institution shall make a receipt available to a consumer at the time the consumer initiates an electronic fund transfer at an electronic terminal. The receipt shall set forth the following...
12 CFR 205.9 - Receipts at electronic terminals; periodic statements.
Code of Federal Regulations, 2010 CFR
2010-01-01
... RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.9 Receipts at electronic terminals; periodic..., a financial institution shall make a receipt available to a consumer at the time the consumer initiates an electronic fund transfer at an electronic terminal. The receipt shall set forth the following...
12 CFR 205.9 - Receipts at electronic terminals; periodic statements.
Code of Federal Regulations, 2012 CFR
2012-01-01
... RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.9 Receipts at electronic terminals; periodic..., a financial institution shall make a receipt available to a consumer at the time the consumer initiates an electronic fund transfer at an electronic terminal. The receipt shall set forth the following...
Ultrafast above-threshold dynamics of the radical anion of a prototypical quinone electron-acceptor.
Horke, Daniel A; Li, Quansong; Blancafort, Lluís; Verlet, Jan R R
2013-08-01
Quinones feature prominently as electron acceptors in nature. Their electron-transfer reactions are often highly exergonic, for which Marcus theory predicts reduced electron-transfer rates because of a free-energy barrier that occurs in the inverted region. However, the electron-transfer kinetics that involve quinones can appear barrierless. Here, we consider the intrinsic properties of the para-benzoquinone radical anion, which serves as the prototypical electron-transfer reaction product involving a quinone-based acceptor. Using time-resolved photoelectron spectroscopy and ab initio calculations, we show that excitation at 400 and 480 nm yields excited states that are unbound with respect to electron loss. These excited states are shown to decay on a sub-40 fs timescale through a series of conical intersections with lower-lying excited states, ultimately to form the ground anionic state and avoid autodetachment. From an isolated electron-acceptor perspective, this ultrafast stabilization mechanism accounts for the ability of para-benzoquinone to capture and retain electrons.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jensen, Stephen C.; Bettis Homan, Stephanie; Weiss, Emily A.
2016-01-28
This paper describes the use of cadmium sulfide quantum dots (CdS QDs) as visible-light photocatalysts for the reduction of nitrobenzene to aniline through six sequential photoinduced, proton-coupled electron transfers. At pH 3.6–4.3, the internal quantum yield of photons-to-reducing electrons is 37.1% over 54 h of illumination, with no apparent decrease in catalyst activity. Monitoring of the QD exciton by transient absorption reveals that, for each step in the catalytic cycle, the sacrificial reductant, 3-mercaptopropionic acid, scavenges the excitonic hole in ~5 ps to form QD•–; electron transfer to nitrobenzene or the intermediates nitrosobenzene and phenylhydroxylamine then occurs on the nanosecondmore » time scale. The rate constants for the single-electron transfer reactions are correlated with the driving forces for the corresponding proton-coupled electron transfers. This result suggests, but does not prove, that electron transfer, not proton transfer, is rate-limiting for these reactions. Nuclear magnetic resonance analysis of the QD–molecule systems shows that the photoproduct aniline, left unprotonated, serves as a poison for the QD catalyst by adsorbing to its surface. Performing the reaction at an acidic pH not only encourages aniline to desorb but also increases the probability of protonated intermediates; the latter effect probably ensures that recruitment of protons is not rate-limiting.« less
Quantum state transfer in double-quantum-well devices
NASA Technical Reports Server (NTRS)
Jakumeit, Jurgen; Tutt, Marcel; Pavlidis, Dimitris
1994-01-01
A Monte Carlo simulation of double-quantum-well (DQW) devices is presented in view of analyzing the quantum state transfer (QST) effect. Different structures, based on the AlGaAs/GaAs system, were simulated at 77 and 300 K and optimized in terms of electron transfer and device speed. The analysis revealed the dominant role of the impurity scattering for the QST. Different approaches were used for the optimization of QST devices and basic physical limitations were found in the electron transfer between the QWs. The maximum transfer of electrons from a high to a low mobility well was at best 20%. Negative differential resistance is hampered by the almost linear rather than threshold dependent relation of electron transfer on electric field. By optimizing the doping profile the operation frequency limit could be extended to 260 GHz.
Dioxygen in Polyoxometalate Mediated Reactions.
Weinstock, Ira A; Schreiber, Roy E; Neumann, Ronny
2018-03-14
In this review article, we consider the use of molecular oxygen in reactions mediated by polyoxometalates. Polyoxometalates are anionic metal oxide clusters of a variety of structures that are soluble in liquid phases and therefore amenable to homogeneous catalytic transformations. Often, they are active for electron transfer oxidations of a myriad of substrates and upon reduction can be reoxidized by molecular oxygen. For example, the phosphovanadomolybdate, H 5 PV 2 Mo 10 O 40 , can oxidize Pd(0) thereby enabling aerobic reactions catalyzed by Pd and H 5 PV 2 Mo 10 O 40 . In a similar vein, polyoxometalates can stabilize metal nanoparticles, leading to additional transformations. Furthermore, electron transfer oxidation of other substrates such as halides and sulfur-containing compounds is possible. More uniquely, H 5 PV 2 Mo 10 O 40 and its analogues can mediate electron transfer-oxygen transfer reactions where oxygen atoms are transferred from the polyoxometalate to the substrate. This unique property has enabled correspondingly unique transformations involving carbon-carbon, carbon-hydrogen, and carbon-metal bond activation. The pathway for the reoxidation of vanadomolybdates with O 2 appears to be an inner-sphere reaction, but the oxidation of one-electron reduced polyoxotungstates has been shown through intensive research to be an outer-sphere reaction. Beyond electron transfer and electron transfer-oxygen transfer aerobic transformations, there a few examples of apparent dioxygenase activity where both oxygen atoms are donated to a substrate.
Eye vision system using programmable micro-optics and micro-electronics
NASA Astrophysics Data System (ADS)
Riza, Nabeel A.; Amin, M. Junaid; Riza, Mehdi N.
2014-02-01
Proposed is a novel eye vision system that combines the use of advanced micro-optic and microelectronic technologies that includes programmable micro-optic devices, pico-projectors, Radio Frequency (RF) and optical wireless communication and control links, energy harvesting and storage devices and remote wireless energy transfer capabilities. This portable light weight system can measure eye refractive powers, optimize light conditions for the eye under test, conduct color-blindness tests, and implement eye strain relief and eye muscle exercises via time sequenced imaging. Described is the basic design of the proposed system and its first stage system experimental results for vision spherical lens refractive error correction.
Conductance of single microRNAs chains related to the autism spectrum disorder
NASA Astrophysics Data System (ADS)
Oliveira, J. I. N.; Albuquerque, E. L.; Fulco, U. L.; Mauriz, P. W.; Sarmento, R. G.; Caetano, E. W. S.; Freire, V. N.
2014-09-01
The charge transport properties of single-stranded microRNAs (miRNAs) chains associated to autism disorder were investigated. The computations were performed within a tight-binding model, together with a transfer matrix technique, with ionization energies and hopping parameters obtained by quantum chemistry method. Current-voltage (I× V) curves of twelve miRNA chains related to the autism spectrum disorders were calculated and analysed. We have obtained both semiconductor and insulator behavior, and a relationship between the current intensity and the autism-related miRNA bases sequencies, suggesting that a kind of electronic biosensor can be developed to distinguish different profiles of autism disorders.
Iterative learning control with applications in energy generation, lasers and health care.
Rogers, E; Tutty, O R
2016-09-01
Many physical systems make repeated executions of the same finite time duration task. One example is a robot in a factory or warehouse whose task is to collect an object in sequence from a location, transfer it over a finite duration, place it at a specified location or on a moving conveyor and then return for the next one and so on. Iterative learning control was especially developed for systems with this mode of operation and this paper gives an overview of this control design method using relatively recent relevant applications in wind turbines, free-electron lasers and health care, as exemplars to demonstrate its applicability.
Quantum-Sequencing: Fast electronic single DNA molecule sequencing
NASA Astrophysics Data System (ADS)
Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant
2014-03-01
A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.
Picture of the Week: Hacking the bio-nano interface for better biofuels
) influence electron transfer between the enzyme and the electrode to determine the best placement of enzymes compounds) influence electron transfer between the enzyme and the electrode to determine the best placement studied how three quinones (a class of organic compounds) influence electron transfer between the enzyme
Lancaster, Kelly; Odom, Susan A; Jones, Simon C; Thayumanavan, S; Marder, Seth R; Brédas, Jean-Luc; Coropceanu, Veaceslav; Barlow, Stephen
2009-02-11
The electron spin resonance spectra of the radical cations of 4,4'-bis[di(4-methoxyphenyl)amino]tolane, E-4,4'-bis[di(4-methoxyphenyl)amino]stilbene, and E,E-1,4-bis{4-[di(4-methoxyphenyl)amino]styryl}benzene in dichloromethane exhibit five lines over a wide temperature range due to equivalent coupling to two 14N nuclei, indicating either delocalization between both nitrogen atoms or rapid intramolecular electron transfer on the electron spin resonance time scale. In contrast, those of the radical cations of 1,4-bis{4-[di(4-methoxyphenyl)amino]phenylethynyl}benzene and E,E-1,4-bis{4-[di(4-n-butoxyphenyl)amino]styryl}-2,5-dicyanobenzene exhibit line shapes that vary strongly with temperature, displaying five lines at room temperature and only three lines at ca. 190 K, indicative of slow electron transfer on the electron spin resonance time scale at low temperatures. The rates of intramolecular electron transfer in the latter compounds were obtained by simulation of the electron spin resonance spectra and display an Arrhenius temperature dependence. The activation barriers obtained from Arrhenius plots are significantly less than anticipated from Hush analyses of the intervalence bands when the diabatic electron-transfer distance, R, is equated to the N[symbol: see text]N distance. Comparison of optical and electron spin resonance data suggests that R is in fact only ca. 40% of the N[symbol: see text]N distance, while the Arrhenius prefactor indicates that the electron transfer falls in the adiabatic regime.
Characterization of circulating transfer RNA-Derived RNA fragments in cattle
USDA-ARS?s Scientific Manuscript database
The objective was to characterize naturally occurring circulating transfer RNA-derived RNA Fragments (tRFs) in cattle. Serum from eight clinically normal adult dairy cows was collected, and small non-coding RNAs were extracted immediately after collection and sequenced by Illumina MiSeq. Sequences a...
Role of protein fluctuation correlations in electron transfer in photosynthetic complexes.
Nesterov, Alexander I; Berman, Gennady P
2015-04-01
We consider the dependence of the electron transfer in photosynthetic complexes on correlation properties of random fluctuations of the protein environment. The electron subsystem is modeled by a finite network of connected electron (exciton) sites. The fluctuations of the protein environment are modeled by random telegraph processes, which act either collectively (correlated) or independently (uncorrelated) on the electron sites. We derived an exact closed system of first-order linear differential equations with constant coefficients, for the average density matrix elements and for their first moments. Under some conditions, we obtained analytic expressions for the electron transfer rates and found the range of parameters for their applicability by comparing with the exact numerical simulations. We also compared the correlated and uncorrelated regimes and demonstrated numerically that the uncorrelated fluctuations of the protein environment can, under some conditions, either increase or decrease the electron transfer rates.
Role of coherence and delocalization in photo-induced electron transfer at organic interfaces
NASA Astrophysics Data System (ADS)
Abramavicius, V.; Pranculis, V.; Melianas, A.; Inganäs, O.; Gulbinas, V.; Abramavicius, D.
2016-09-01
Photo-induced charge transfer at molecular heterojunctions has gained particular interest due to the development of organic solar cells (OSC) based on blends of electron donating and accepting materials. While charge transfer between donor and acceptor molecules can be described by Marcus theory, additional carrier delocalization and coherent propagation might play the dominant role. Here, we describe ultrafast charge separation at the interface of a conjugated polymer and an aggregate of the fullerene derivative PCBM using the stochastic Schrödinger equation (SSE) and reveal the complex time evolution of electron transfer, mediated by electronic coherence and delocalization. By fitting the model to ultrafast charge separation experiments, we estimate the extent of electron delocalization and establish the transition from coherent electron propagation to incoherent hopping. Our results indicate that even a relatively weak coupling between PCBM molecules is sufficient to facilitate electron delocalization and efficient charge separation at organic interfaces.
Alternative ground states enable pathway switching in biological electron transfer
Abriata, Luciano A.; Alvarez-Paggi, Damian; Ledesma, Gabirela N.; ...
2012-10-10
Electron transfer is the simplest chemical reaction and constitutes the basis of a large variety of biological processes, such as photosynthesis and cellular respiration. Nature has evolved specific proteins and cofactors for these functions. The mechanisms optimizing biological electron transfer have been matter of intense debate, such as the role of the protein milieu between donor and acceptor sites. Here we propose a mechanism regulating long-range electron transfer in proteins. Specifically, we report a spectroscopic, electrochemical, and theoretical study on WT and single-mutant CuA redox centers from Thermus thermophilus, which shows that thermal fluctuations may populate two alternative ground-state electronicmore » wave functions optimized for electron entry and exit, respectively, through two different and nearly perpendicular pathways. In conclusion, these findings suggest a unique role for alternative or “invisible” electronic ground states in directional electron transfer. Moreover, it is shown that this energy gap and, therefore, the equilibrium between ground states can be fine-tuned by minor perturbations, suggesting alternative ways through which protein–protein interactions and membrane potential may optimize and regulate electron–proton energy transduction.« less
Anodes Stimulate Anaerobic Toluene Degradation via Sulfur Cycling in Marine Sediments
Daghio, Matteo; Vaiopoulou, Eleni; Patil, Sunil A.; Suárez-Suárez, Ana; Head, Ian M.
2015-01-01
Hydrocarbons released during oil spills are persistent in marine sediments due to the absence of suitable electron acceptors below the oxic zone. Here, we investigated an alternative bioremediation strategy to remove toluene, a model monoaromatic hydrocarbon, using a bioanode. Bioelectrochemical reactors were inoculated with sediment collected from a hydrocarbon-contaminated marine site, and anodes were polarized at 0 mV and +300 mV (versus an Ag/AgCl [3 M KCl] reference electrode). The degradation of toluene was directly linked to current generation of up to 301 mA m−2 and 431 mA m−2 for the bioanodes polarized at 0 mV and +300 mV, respectively. Peak currents decreased over time even after periodic spiking with toluene. The monitoring of sulfate concentrations during bioelectrochemical experiments suggested that sulfur metabolism was involved in toluene degradation at bioanodes. 16S rRNA gene-based Illumina sequencing of the bulk anolyte and anode samples revealed enrichment with electrocatalytically active microorganisms, toluene degraders, and sulfate-reducing microorganisms. Quantitative PCR targeting the α-subunit of the dissimilatory sulfite reductase (encoded by dsrA) and the α-subunit of the benzylsuccinate synthase (encoded by bssA) confirmed these findings. In particular, members of the family Desulfobulbaceae were enriched concomitantly with current production and toluene degradation. Based on these observations, we propose two mechanisms for bioelectrochemical toluene degradation: (i) direct electron transfer to the anode and/or (ii) sulfide-mediated electron transfer. PMID:26497463
Circularization of the HIV-1 genome facilitates strand transfer during reverse transcription
Beerens, Nancy; Kjems, Jørgen
2010-01-01
Two obligatory DNA strand transfers take place during reverse transcription of a retroviral RNA genome. The first strand transfer involves a jump from the 5′ to the 3′ terminal repeat (R) region positioned at each end of the viral genome. The process depends on base pairing between the cDNA synthesized from the 5′ R region and the 3′ R RNA. The tertiary conformation of the viral RNA genome may facilitate strand transfer by juxtaposing the 5′ R and 3′ R sequences that are 9 kb apart in the linear sequence. In this study, RNA sequences involved in an interaction between the 5′ and 3′ ends of the HIV-1 genome were mapped by mutational analysis. This interaction appears to be mediated mainly by a sequence in the extreme 3′ end of the viral genome and in the gag open reading frame. Mutation of 3′ R sequences was found to inhibit the 5′–3′ interaction, which could be restored by a complementary mutation in the 5′ gag region. Furthermore, we find that circularization of the HIV-1 genome does not affect the initiation of reverse transcription, but stimulates the first strand transfer during reverse transcription in vitro, underscoring the functional importance of the interaction. PMID:20430859
Sun, Chang; Carey, Anne-Marie; Gao, Bing-Rong; Wraight, Colin A; Woodbury, Neal W; Lin, Su
2016-06-23
It has become increasingly clear that dynamics plays a major role in the function of many protein systems. One system that has proven particularly facile for studying the effects of dynamics on protein-mediated chemistry is the bacterial photosynthetic reaction center from Rhodobacter sphaeroides. Previous experimental and computational analysis have suggested that the dynamics of the protein matrix surrounding the primary quinone acceptor, QA, may be particularly important in electron transfer involving this cofactor. One can substantially increase the flexibility of this region by removing one of the reaction center subunits, the H-subunit. Even with this large change in structure, photoinduced electron transfer to the quinone still takes place. To evaluate the effect of H-subunit removal on electron transfer to QA, we have compared the kinetics of electron transfer and associated spectral evolution for the LM dimer with that of the intact reaction center complex on picosecond to millisecond time scales. The transient absorption spectra associated with all measured electron transfer reactions are similar, with the exception of a broadening in the QX transition and a blue-shift in the QY transition bands of the special pair of bacteriochlorophylls (P) in the LM dimer. The kinetics of the electron transfer reactions not involving quinones are unaffected. There is, however, a 4-fold decrease in the electron transfer rate from the reduced bacteriopheophytin to QA in the LM dimer compared to the intact reaction center and a similar decrease in the recombination rate of the resulting charge-separated state (P(+)QA(-)). These results are consistent with the concept that the removal of the H-subunit results in increased flexibility in the region around the quinone and an associated shift in the reorganization energy associated with charge separation and recombination.
Hankache, Jihane; Wenger, Oliver S
2012-02-28
Four rigid rod-like molecules comprised of a Ru(bpy)(3)(2+) (bpy = 2,2'-bipyridine) photosensitizer, a 9,10-anthraquinone electron acceptor, and a molecular bridge connecting the two redox partners were synthesized and investigated by optical spectroscopic and electrochemical means. An attempt was made to assess the relative importance of driving-force, solvent polarity, and bridge variation on the rates of photoinduced electron transfer in these molecules. Expectedly, introduction of tert-butyl substituents in the bipyridine ligands of the ruthenium complex and a change in solvent from dichloromethane to acetonitrile lead to a significant acceleration of charge transfer rates. In dichloromethane, photoinduced electron transfer is not competitive with the inherent excited-state deactivation processes of the photosensitizer. In acetonitrile, an increase in driving-force by 0.2 eV through attachment of tert-butyl substituents to the bpy ancillary ligands causes an increase in electron transfer rates by an order of magnitude. Replacement of a p-xylene bridge by a p-dimethoxybenzene spacer entails an acceleration of charge transfer rates by a factor of 3.5. In the dyads from this study, the relative order of importance of individual influences on electron transfer rates is therefore as follows: solvent polarity ≥ driving-force > donor-bridge energy gap.
CRADA Payment Options | NCI Technology Transfer Center | TTC
NCI TTC CRADA PAYMENT OPTIONS: Electronic Payments by Wire Transfer via Fedwire, Mail a check to the Institute or Center, or Automated Clearing House (ACH)/Electronic Funds Transfer (ETF) payments via Pay.gov (NCI ONLY).
Transfer coefficients in ultracold strongly coupled plasma
NASA Astrophysics Data System (ADS)
Bobrov, A. A.; Vorob'ev, V. S.; Zelener, B. V.
2018-03-01
We use both analytical and molecular dynamic methods for electron transfer coefficients in an ultracold plasma when its temperature is small and the coupling parameter characterizing the interaction of electrons and ions exceeds unity. For these conditions, we use the approach of nearest neighbor to determine the average electron (ion) diffusion coefficient and to calculate other electron transfer coefficients (viscosity and electrical and thermal conductivities). Molecular dynamics simulations produce electronic and ionic diffusion coefficients, confirming the reliability of these results. The results compare favorably with experimental and numerical data from earlier studies.
NASA Astrophysics Data System (ADS)
Bominaar, E. L.; Achim, C.; Borshch, S. A.
1999-06-01
Polynuclear transition-metal complexes, such as Fe-S clusters, are the prosthetic groups in a large number of metalloproteins and serve as temporary electron storage units in a number of important redox-based biological processes. Polynuclearity distinguishes clusters from mononuclear centers and confers upon them unique properties, such as spin ordering and the presence of thermally accessible excited spin states in clusters with paramagnetic sites, and fractional valencies in clusters of the mixed-valence type. In an earlier study we presented an effective-mode (EM) analysis of electron transfer from a binuclear mixed-valence donor with paramagnetic sites to a mononuclear acceptor which revealed that the cluster-specific attributes have an important impact on the kinetics of long-range electron transfer. In the present study, the validity of these results is tested in the framework of more detailed theories which we have termed the multimode semiclassical (SC) model and the quantum-mechanical (QM) model. It is found that the qualitative trends in the rate constant are the same in all treatments and that the semiclassical models provide a good approximation of the more rigorous quantum-mechanical description of electron transfer under physiologically relevant conditions. In particular, the present results corroborate the importance of electron transfer via excited spin states in reactions with a low driving force and justify the use of semiclassical theory in cases in which the QM model is computationally too demanding. We consider cases in which either one or two donor sites of a dimer are electronically coupled to the acceptor. In the case of multiconnectivity, the rate constant for electron transfer from a valence-delocalized (class-III) donor is nonadditive with respect to transfer from individual metal sites of the donor and undergoes an order-of-magnitude change by reversing the sign of the intradimer metal-metal resonance parameter (β). In the case of single connectivity, the rate constant for electron transfer from a valence-localized (class-II) donor can readily be tuned over several orders of magnitude by introducing differences in the electronic potentials at the two metal sites of the donor. These results indicate that theories of cluster-based electron transfer, in order to be realistic, need to consider both intrinsic electronic structure and extrinsic interactions of the cluster with the protein environment.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Park, Changwon; Atalla, Viktor; Smith, Sean
Charge transfer between an electron donor and an electron acceptor is widely accepted as being independent of their relative configurations if the interaction between them is weak; however, the limit of this concept for an interacting system has not yet been well established. Our study of prototypical electron donor–acceptor molecules, tetrathiafulvalene–tetracyanoquinodimethane, using density functional theory based on an advanced functional, clearly demonstrates that for interacting molecules, their configurational arrangement is as important as their individual electronic properties in the asymptotic limit to determine the charge transfer direction. For the first time, we demonstrate that by changing their relative orientation, onemore » can reverse the charge transfer direction of the pair, causing the molecules to exchange roles as donor and acceptor. In conclusion, our theory has important implications for understanding the interfacial charge-transfer mechanism of hybrid systems and related phenomena.« less
Sulfate-reducing bacteria: Microbiology and physiology
NASA Technical Reports Server (NTRS)
Peck, H. D.
1985-01-01
The sulfate reducing bacteria, the first nonphotosynthetic anaerobic bacteria demonstrated to contain c type cytochromes, perform electron transfer coupled to phosphorylation. A new bioenergetic scheme for the formation of a proton gradient for growth of Desulfovibrio on organic substrates and sulfate involving vectors electron transfer and consistent with the cellular localization of enzymes and electron transfer components was proposed. Hydrogen is produced in the cytoplasm from organic substrates and, as a permease molecule diffuses rapidly across the cytoplasmic membrane, it is oxidized to protons and electrons by the periplasmic hydrogenase. The electrons only are transferred across the cytoplasmic membrane to the cytoplasm where they are used to reduce sulfate to sulfide. The protons are used for transport or to drive a reversible ATPOSE. The net effect is the transfer of protons across the cytoplasmic membrane with the intervention of a proton pump. This type of H2 cycling is relevant to the bioenergetics of other types of anaerobic microorganisms.
Park, Changwon; Atalla, Viktor; Smith, Sean; ...
2017-06-16
Charge transfer between an electron donor and an electron acceptor is widely accepted as being independent of their relative configurations if the interaction between them is weak; however, the limit of this concept for an interacting system has not yet been well established. Our study of prototypical electron donor–acceptor molecules, tetrathiafulvalene–tetracyanoquinodimethane, using density functional theory based on an advanced functional, clearly demonstrates that for interacting molecules, their configurational arrangement is as important as their individual electronic properties in the asymptotic limit to determine the charge transfer direction. For the first time, we demonstrate that by changing their relative orientation, onemore » can reverse the charge transfer direction of the pair, causing the molecules to exchange roles as donor and acceptor. In conclusion, our theory has important implications for understanding the interfacial charge-transfer mechanism of hybrid systems and related phenomena.« less
Nanoantioxidant-driven plasmon enhanced proton-coupled electron transfer
NASA Astrophysics Data System (ADS)
Sotiriou, Georgios A.; Blattmann, Christoph O.; Deligiannakis, Yiannis
2015-12-01
Proton-coupled electron transfer (PCET) reactions involve the transfer of a proton and an electron and play an important role in a number of chemical and biological processes. Here, we describe a novel phenomenon, plasmon-enhanced PCET, which is manifested using SiO2-coated Ag nanoparticles functionalized with gallic acid (GA), a natural antioxidant molecule that can perform PCET. These GA-functionalized nanoparticles show enhanced plasmonic response at near-IR wavelengths, due to particle agglomeration caused by the GA molecules. Near-IR laser irradiation induces strong local hot-spots on the SiO2-coated Ag nanoparticles, as evidenced by surface enhanced Raman scattering (SERS). This leads to plasmon energy transfer to the grafted GA molecules that lowers the GA-OH bond dissociation enthalpy by at least 2 kcal mol-1 and therefore facilitates PCET. The nanoparticle-driven plasmon-enhancement of PCET brings together the so far unrelated research domains of nanoplasmonics and electron/proton translocation with significant impact on applications based on interfacial electron/proton transfer.Proton-coupled electron transfer (PCET) reactions involve the transfer of a proton and an electron and play an important role in a number of chemical and biological processes. Here, we describe a novel phenomenon, plasmon-enhanced PCET, which is manifested using SiO2-coated Ag nanoparticles functionalized with gallic acid (GA), a natural antioxidant molecule that can perform PCET. These GA-functionalized nanoparticles show enhanced plasmonic response at near-IR wavelengths, due to particle agglomeration caused by the GA molecules. Near-IR laser irradiation induces strong local hot-spots on the SiO2-coated Ag nanoparticles, as evidenced by surface enhanced Raman scattering (SERS). This leads to plasmon energy transfer to the grafted GA molecules that lowers the GA-OH bond dissociation enthalpy by at least 2 kcal mol-1 and therefore facilitates PCET. The nanoparticle-driven plasmon-enhancement of PCET brings together the so far unrelated research domains of nanoplasmonics and electron/proton translocation with significant impact on applications based on interfacial electron/proton transfer. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr04942c
DOE Office of Scientific and Technical Information (OSTI.GOV)
Denysenko, I. B.; Azarenkov, N. A.; Kersten, H.
2016-05-15
Analytical expressions describing the variation of electron energy distribution function (EEDF) in an afterglow of a plasma are obtained. Especially, the case when the electron energy loss is mainly due to momentum-transfer electron-neutral collisions is considered. The study is carried out for different EEDFs in the steady state, including Maxwellian and Druyvesteyn distributions. The analytical results are not only obtained for the case when the rate for momentum-transfer electron-neutral collisions is independent on electron energy but also for the case when the collisions are a power function of electron energy. Using analytical expressions for the EEDF, the effective electron temperaturemore » and charge of the dust particles, which are assumed to be present in plasma, are calculated for different afterglow durations. An analytical expression for the rate describing collection of electrons by dust particles for the case when the rate for momentum-transfer electron-neutral collisions is independent on electron energy is also derived. The EEDF profile and, as a result, the effective electron temperature and dust charge are sufficiently different in the cases when the rate for momentum-transfer electron-neutral collisions is independent on electron energy and when the rate is a power function of electron energy.« less
Sündermann, Axel; Oostenbrink, Chris
2013-01-01
Cytochrome P450 reductase (CYPOR) undergoes a large conformational change to allow for an electron transfer to a redox partner to take place. After an internal electron transfer over its cofactors, it opens up to facilitate the interaction and electron transfer with a cytochrome P450. The open conformation appears difficult to crystallize. Therefore, a model of a human CYPOR in the open conformation was constructed to be able to investigate the stability and conformational change of this protein by means of molecular dynamics simulations. Since the role of the protein is to provide electrons to a redox partner, the interactions with cytochrome P450 2D6 (2D6) were investigated and a possible complex structure is suggested. Additionally, electron pathway calculations with a newly written program were performed to investigate which amino acids relay the electrons from the FMN cofactor of CYPOR to the HEME of 2D6. Several possible interacting amino acids in the complex, as well as a possible electron transfer pathway were identified and open the way for further investigation by site directed mutagenesis studies. PMID:23832577
Electron transfer across a thermal gradient
Craven, Galen T.
2016-01-01
Charge transfer is a fundamental process that underlies a multitude of phenomena in chemistry and biology. Recent advances in observing and manipulating charge and heat transport at the nanoscale, and recently developed techniques for monitoring temperature at high temporal and spatial resolution, imply the need for considering electron transfer across thermal gradients. Here, a theory is developed for the rate of electron transfer and the associated heat transport between donor–acceptor pairs located at sites of different temperatures. To this end, through application of a generalized multidimensional transition state theory, the traditional Arrhenius picture of activation energy as a single point on a free energy surface is replaced with a bithermal property that is derived from statistical weighting over all configurations where the reactant and product states are equienergetic. The flow of energy associated with the electron transfer process is also examined, leading to relations between the rate of heat exchange among the donor and acceptor sites as functions of the temperature difference and the electronic driving bias. In particular, we find that an open electron transfer channel contributes to enhanced heat transport between sites even when they are in electronic equilibrium. The presented results provide a unified theory for charge transport and the associated heat conduction between sites at different temperatures. PMID:27450086
Chuang, Chi-Hung; Porel, Mintu; Choudhury, Rajib; Burda, Clemens; Ramamurthy, V
2018-01-11
Results of our study on ultrafast electron transfer (eT) dynamics from coumarins (coumarin-1, coumarin-480, and coumarin-153) incarcerated within octa acid (OA) capsules as electron donors to methyl viologen dissolved in water as acceptor are presented. Upon photoexcitation, coumarin inside the OA capsule transfers an electron to the acceptor electrostatically attached to the capsule leading to a long-lived radical-ion pair separated by the OA capsular wall. This charge-separated state returns to the neutral ground state via back electron transfer on the nanosecond time scale. This system allows for ultrafast electron transfer processes through a molecular wall from the apolar capsular interior to the highly polar (aqueous) environment on the femtosecond time scale. Employing femtosecond transient absorption spectroscopy, distinct rates of both forward (1-25 ps) and backward eT (700-1200 ps) processes were measured. Further understanding of the energetics is provided using Rehm-Weller analysis for the investigated photoinduced eT reactions. The results provide the rates of the eT across a molecular wall, akin to an isotropic solution, depending on the standard free energy of the reaction. The insights from this work could be utilized in the future design of efficient electron transfer processes across interfaces separating apolar and polar environments.
Reimers, Jeffrey R; McKemmish, Laura K; McKenzie, Ross H; Hush, Noel S
2015-10-14
While diabatic approaches are ubiquitous for the understanding of electron-transfer reactions and have been mooted as being of general relevance, alternate applications have not been able to unify the same wide range of observed spectroscopic and kinetic properties. The cause of this is identified as the fundamentally different orbital configurations involved: charge-transfer phenomena involve typically either 1 or 3 electrons in two orbitals whereas most reactions are typically closed shell. As a result, two vibrationally coupled electronic states depict charge-transfer scenarios whereas three coupled states arise for closed-shell reactions of non-degenerate molecules and seven states for the reactions implicated in the aromaticity of benzene. Previous diabatic treatments of closed-shell processes have considered only two arbitrarily chosen states as being critical, mapping these states to those for electron transfer. We show that such effective two-state diabatic models are feasible but involve renormalized electronic coupling and vibrational coupling parameters, with this renormalization being property dependent. With this caveat, diabatic models are shown to provide excellent descriptions of the spectroscopy and kinetics of the ammonia inversion reaction, proton transfer in N2H7(+), and aromaticity in benzene. This allows for the development of a single simple theory that can semi-quantitatively describe all of these chemical phenomena, as well as of course electron-transfer reactions. It forms a basis for understanding many technologically relevant aspects of chemical reactions, condensed-matter physics, chemical quantum entanglement, nanotechnology, and natural or artificial solar energy capture and conversion.
Electronic Transfer of School Records.
ERIC Educational Resources Information Center
Yeagley, Raymond
2001-01-01
Describes the electronic transfer of student records, notably the use of a Web-server named CHARLOTTE sponsored by the National Forum on Education Statistics and an Electronic Data Exchange system named SPEEDE/ExPRESS. (PKP)
Soltau, Sarah R.; Dahlberg, Peter D.; Niklas, Jens; Poluektov, Oleg G.; Mulfort, Karen L.
2016-01-01
A series of Ru–protein–Co biohybrids have been prepared using the electron transfer proteins ferredoxin (Fd) and flavodoxin (Fld) as scaffolds for photocatalytic hydrogen production. The light-generated charge separation within these hybrids has been monitored by transient optical and electron paramagnetic resonance spectroscopies. Two distinct electron transfer pathways are observed. The Ru–Fd–Co biohybrid produces up to 650 turnovers of H2 utilizing an oxidative quenching mechanism for Ru(ii)* and a sequential electron transfer pathway via the native [2Fe–2S] cluster to generate a Ru(iii)–Fd–Co(i) charge separated state that lasts for ∼6 ms. In contrast, a direct electron transfer pathway occurs for the Ru–ApoFld–Co biohybrid, which lacks an internal electron relay, generating Ru(i)–ApoFld–Co(i) charge separated state that persists for ∼800 μs and produces 85 turnovers of H2 by a reductive quenching mechanism for Ru(ii)*. This work demonstrates the utility of protein architectures for linking donor and catalytic function via direct or sequential electron transfer pathways to enable stabilized charge separation which facilitates photocatalysis for solar fuel production. PMID:28451142
Effects of learning with explicit elaboration on implicit transfer of visuomotor sequence learning.
Tanaka, Kanji; Watanabe, Katsumi
2013-08-01
Intervals between stimuli and/or responses have significant influences on sequential learning. In the present study, we investigated whether transfer would occur even when the intervals and the visual configurations in a sequence were drastically changed so that participants did not notice that the required sequences of responses were identical. In the experiment, two (or three) sequential button presses comprised a "set," and nine (or six) consecutive sets comprised a "hyperset." In the first session, participants learned either a 2 × 9 or 3 × 6 hyperset by trial and error until they completed it 20 times without error. In the second block, the 2 × 9 (3 × 6) hyperset was changed into the 3 × 6 (2 × 9) hyperset, resulting in different visual configurations and intervals between stimuli and responses. Participants were assigned into two groups: the Identical and Random groups. In the Identical group, the sequence (i.e., the buttons to be pressed) in the second block was identical to that in the first block. In the Random group, a new hyperset was learned. Even in the Identical group, no participants noticed that the sequences were identical. Nevertheless, a significant transfer of performance occurred. However, in the subsequent experiment that did not require explicit trial-and-error learning in the first session, implicit transfer in the second session did not occur. These results indicate that learning with explicit elaboration strengthens the implicit representation of the sequence order as a whole; this might occur independently of the intervals between elements and enable implicit transfer.
Production of vibrationally excited N 2 by electron impact
NASA Astrophysics Data System (ADS)
Campbell, L.; Brunger, M. J.; Cartwright, D. C.; Teubner, P. J. O.
2004-08-01
Energy transfer from electrons to neutral gases and ions is one of the dominant electron cooling processes in the ionosphere, and the role of vibrationally excited N 2 in this is particularly significant. We report here the results from a new calculation of electron energy transfer rates ( Q) for vibrational excitation of N 2, as a function of the electron temperature Te. The present study was motivated by the development of a new cross-section compilation for vibrational excitation processes in N 2 which supercedes those used in the earlier calculations of the electron energy transfer rates. We show that the energy dependence and magnitude of these cross sections, particularly in the region of the well-known 2Π g resonance in N 2, significantly affect the calculated values of Q. A detailed comparison between the current and previous calculated electron energy transfer rates is made and coefficients are provided so that these rates for transitions from level 0 to levels 1-10 can be calculated for electron temperatures less than 6000 K.
Photogeneration of Charge Carriers in Bilayer Assemblies of Conjugated Rigid-Rod Polymers
1994-07-08
photoinduced electron transfer and exciplex formation at the bilayer interface. Thus photocarrier generation on photoexcitation of the conjugated rigid...rod polymers in the bilayer occurs by photoinduced electron transfer, forming intermolecular exciplexes which dissociate efficiently in electric field...photogeneration, conjugated rigid-rod polymers, is. MACI COD bilayer assemblies, electron transfer, exciplexes . 11. SEOJUTY CLASUICA 10. 51(11MIE CLASSIMIAVION
Telematics and satellites. Part 1: Information systems
NASA Astrophysics Data System (ADS)
Burke, W. R.
1980-06-01
Telematic systems are identified and described. The applications are examined emphasizing the role played by satellite links. The discussion includes file transfer, examples of distributed processor systems, terminal communication, information retrieval systems, office information systems, electronic preparation and publishing of information, electronic systems for transfer of funds, electronic mail systems, record file transfer characteristics, intra-enterprise networks, and inter-enterprise networks.
Is back-electron transfer process in Betaine-30 coherent?
NASA Astrophysics Data System (ADS)
Rafiq, Shahnawaz; Scholes, Gregory D.
2017-09-01
The possible role of coherent vibrational motion in ultrafast photo-induced electron transfer remains unclear despite considerable experimental and theoretical advances. We revisited this problem by tracking the back-electron transfer (bET) process in Betaine-30 with broadband pump-probe spectroscopy. Dephasing time constant of certain high-frequency vibrations as a function of solvent shows a trend similar to the ET rates. In the purview of Bixon-Jortner model, high-frequency quantum vibrations bridge the reactant-product energy gap by providing activationless vibronic channels. Such interaction reduces the effective coupling significantly and thereby the coherence effects are eliminated due to energy gap fluctuations, making the back-electron transfer incoherent.
NASA Astrophysics Data System (ADS)
Li, Lesheng; Giokas, Paul G.; Kanai, Yosuke; Moran, Andrew M.
2014-06-01
Kinetic models based on Fermi's Golden Rule are commonly employed to understand photoinduced electron transfer dynamics at molecule-semiconductor interfaces. Implicit in such second-order perturbative descriptions is the assumption that nuclear relaxation of the photoexcited electron donor is fast compared to electron injection into the semiconductor. This approximation breaks down in systems where electron transfer transitions occur on 100-fs time scale. Here, we present a fourth-order perturbative model that captures the interplay between time-coincident electron transfer and nuclear relaxation processes initiated by light absorption. The model consists of a fairly small number of parameters, which can be derived from standard spectroscopic measurements (e.g., linear absorbance, fluorescence) and/or first-principles electronic structure calculations. Insights provided by the model are illustrated for a two-level donor molecule coupled to both (i) a single acceptor level and (ii) a density of states (DOS) calculated for TiO2 using a first-principles electronic structure theory. These numerical calculations show that second-order kinetic theories fail to capture basic physical effects when the DOS exhibits narrow maxima near the energy of the molecular excited state. Overall, we conclude that the present fourth-order rate formula constitutes a rigorous and intuitive framework for understanding photoinduced electron transfer dynamics that occur on the 100-fs time scale.
Marsili, Enrico; Rollefson, Janet B.; Baron, Daniel B.; Hozalski, Raymond M.; Bond, Daniel R.
2008-01-01
While electrochemical characterization of enzymes immobilized on electrodes has become common, there is still a need for reliable quantitative methods for study of electron transfer between living cells and conductive surfaces. This work describes growth of thin (<20 μm) Geobacter sulfurreducens biofilms on polished glassy carbon electrodes, using stirred three-electrode anaerobic bioreactors controlled by potentiostats and nondestructive voltammetry techniques for characterization of viable biofilms. Routine in vivo analysis of electron transfer between bacterial cells and electrodes was performed, providing insight into the main redox-active species participating in electron transfer to electrodes. At low scan rates, cyclic voltammetry revealed catalytic electron transfer between cells and the electrode, similar to what has been observed for pure enzymes attached to electrodes under continuous turnover conditions. Differential pulse voltammetry and electrochemical impedance spectroscopy also revealed features that were consistent with electron transfer being mediated by an adsorbed catalyst. Multiple redox-active species were detected, revealing complexity at the outer surfaces of this bacterium. These techniques provide the basis for cataloging quantifiable, defined electron transfer phenotypes as a function of potential, electrode material, growth phase, and culture conditions and provide a framework for comparisons with other species or communities. PMID:18849456
Characterizing Peptide Neutral Losses Induced by Negative Electron-Transfer Dissociation (NETD)
Rumachik, Neil G.; McAlister, Graeme C.; Russell, Jason D.; Bailey, Derek J.; Wenger, Craig D.; Coon, Joshua J.
2012-01-01
We implemented negative electron-transfer dissociation (NETD) on a hybrid ion trap/Orbitrap mass spectrometer to conduct ion/ion reactions using peptide anions and radical reagent cations. In addition to sequence-informative ladders of a•- and x-type fragment ions, NETD generated intense neutral loss peaks corresponding to the entire or partial side-chain cleavage from amino acids constituting a given peptide. Thus, a critical step towards the characterization of this recently introduced fragmentation technique is a systematic study of synthetic peptides to identify common neutral losses and preferential fragmentation pathways. Examining 46 synthetic peptides with high mass accuracy and high resolution analysis permitted facile determination of the chemical composition of each neutral loss. We identified 19 unique neutral losses from 14 amino acids and three modified amino acids, and assessed the specificity and sensitivity of each neutral loss using a database of 1542 confidently identified peptides generated from NETD shotgun experiments employing high-pH separations and negative electrospray ionization. As residue-specific neutral losses indicate the presence of certain amino acids, we determined that many neutral losses have potential diagnostic utility. We envision this catalogue of neutral losses being incorporated into database search algorithms to improve peptide identification specificity and to further advance characterization of the acidic proteome. PMID:22290482
O'Brien, Frances G.; Yui Eto, Karina; Murphy, Riley J. T.; Fairhurst, Heather M.; Coombs, Geoffrey W.; Grubb, Warren B.; Ramsay, Joshua P.
2015-01-01
Staphylococcus aureus is a common cause of hospital, community and livestock-associated infections and is increasingly resistant to multiple antimicrobials. A significant proportion of antimicrobial-resistance genes are plasmid-borne, but only a minority of S. aureus plasmids encode proteins required for conjugative transfer or Mob relaxase proteins required for mobilisation. The pWBG749 family of S. aureus conjugative plasmids can facilitate the horizontal transfer of diverse antimicrobial-resistance plasmids that lack Mob genes. Here we reveal that these mobilisable plasmids carry copies of the pWBG749 origin-of-transfer (oriT) sequence and that these oriT sequences facilitate mobilisation by pWBG749. Sequences resembling the pWBG749 oriT were identified on half of all sequenced S. aureus plasmids, including the most prevalent large antimicrobial-resistance/virulence-gene plasmids, pIB485, pMW2 and pUSA300HOUMR. oriT sequences formed five subfamilies with distinct inverted-repeat-2 (IR2) sequences. pWBG749-family plasmids encoding each IR2 were identified and pWBG749 mobilisation was found to be specific for plasmids carrying matching IR2 sequences. Specificity of mobilisation was conferred by a putative ribbon-helix-helix-protein gene smpO. Several plasmids carried 2–3 oriT variants and pWBG749-mediated recombination occurred between distinct oriT sites during mobilisation. These observations suggest this relaxase-in trans mechanism of mobilisation by pWBG749-family plasmids is a common mechanism of plasmid dissemination in S. aureus. PMID:26243776
Characterization of circulating transfer RNA-derived RNA fragments in cattle
Casas, Eduardo; Cai, Guohong; Neill, John D.
2015-01-01
The objective was to characterize naturally occurring circulating transfer RNA-derived RNA fragments (tRFs) in cattle1. Serum from eight clinically normal adult dairy cows was collected, and small non-coding RNAs were extracted immediately after collection and sequenced by Illumina MiSeq. Sequences aligned to transfer RNA (tRNA) genes or their flanking sequences were characterized. Sequences aligned to the beginning of 5′ end of the mature tRNA were classified as tRF5; those aligned to the 3′ end of mature tRNA were classified as tRF3; and those aligned to the beginning of the 3′ end flanking sequences were classified as tRF1. There were 3,190,962 sequences that mapped to transfer RNA and small non-coding RNAs in the bovine genome. Of these, 2,323,520 were identified as tRF5s, 562 were tRF3s, and 81 were tRF1s. There were 866,799 sequences identified as other small non-coding RNAs (microRNA, rRNA, snoRNA, etc.) and were excluded from the study. The tRF5s ranged from 28 to 40 nucleotides; and 98.7% ranged from 30 to 34 nucleotides in length. The tRFs with the greatest number of sequences were derived from tRNA of histidine, glutamic acid, lysine, glycine, and valine. There was no association between number of codons for each amino acid and number of tRFs in the samples. The reason for tRF5s being the most abundant can only be explained if these sequences are associated with function within the animal. PMID:26379699
Dexter energy transfer pathways
Skourtis, Spiros S.; Liu, Chaoren; Antoniou, Panayiotis; Virshup, Aaron M.; Beratan, David N.
2016-01-01
Energy transfer with an associated spin change of the donor and acceptor, Dexter energy transfer, is critically important in solar energy harvesting assemblies, damage protection schemes of photobiology, and organometallic opto-electronic materials. Dexter transfer between chemically linked donors and acceptors is bridge mediated, presenting an enticing analogy with bridge-mediated electron and hole transfer. However, Dexter coupling pathways must convey both an electron and a hole from donor to acceptor, and this adds considerable richness to the mediation process. We dissect the bridge-mediated Dexter coupling mechanisms and formulate a theory for triplet energy transfer coupling pathways. Virtual donor–acceptor charge-transfer exciton intermediates dominate at shorter distances or higher tunneling energy gaps, whereas virtual intermediates with an electron and a hole both on the bridge (virtual bridge excitons) dominate for longer distances or lower energy gaps. The effects of virtual bridge excitons were neglected in earlier treatments. The two-particle pathway framework developed here shows how Dexter energy-transfer rates depend on donor, bridge, and acceptor energetics, as well as on orbital symmetry and quantum interference among pathways. PMID:27382185
Dexter energy transfer pathways.
Skourtis, Spiros S; Liu, Chaoren; Antoniou, Panayiotis; Virshup, Aaron M; Beratan, David N
2016-07-19
Energy transfer with an associated spin change of the donor and acceptor, Dexter energy transfer, is critically important in solar energy harvesting assemblies, damage protection schemes of photobiology, and organometallic opto-electronic materials. Dexter transfer between chemically linked donors and acceptors is bridge mediated, presenting an enticing analogy with bridge-mediated electron and hole transfer. However, Dexter coupling pathways must convey both an electron and a hole from donor to acceptor, and this adds considerable richness to the mediation process. We dissect the bridge-mediated Dexter coupling mechanisms and formulate a theory for triplet energy transfer coupling pathways. Virtual donor-acceptor charge-transfer exciton intermediates dominate at shorter distances or higher tunneling energy gaps, whereas virtual intermediates with an electron and a hole both on the bridge (virtual bridge excitons) dominate for longer distances or lower energy gaps. The effects of virtual bridge excitons were neglected in earlier treatments. The two-particle pathway framework developed here shows how Dexter energy-transfer rates depend on donor, bridge, and acceptor energetics, as well as on orbital symmetry and quantum interference among pathways.
Effect of proton transfer on the electronic coupling in DNA
NASA Astrophysics Data System (ADS)
Rak, Janusz; Makowska, Joanna; Voityuk, Alexander A.
2006-06-01
The effects of single and double proton transfer within Watson-Crick base pairs on donor-acceptor electronic couplings, Vda, in DNA are studied on the bases of quantum chemical calculations. Four dimers [AT,AT], [GC,GC], [GC,AT] and [GC,TA)] are considered. Three techniques - the generalized Mulliken-Hush scheme, the fragment charge method and the diabatic states method - are employed to estimate Vda for hole transfer between base pairs. We show that both single- and double proton transfer (PT) reactions may substantially affect the electronic coupling in DNA. The electronic coupling in [AT,AT] is predicted to be most sensitive to PT. Single PT within the first base pair in the dimer leads to increase in the hole transfer efficiency by a factor of 4, while proton transfer within the second pair should substantially, by 2.7 times, decrease the rate of charge transfer. Thus, directional asymmetry of the PT effects on the electronic coupling is predicted. The changes in the Vda matrix elements correlate with the topological properties of orbitals of donor and acceptor and can be qualitatively rationalized in terms of resonance structures of donor and acceptor. Atomic pair contributions to the Vda matrix elements are also analyzed.
Scholz, Mirko; Flender, Oliver; Boschloo, Gerrit; Oum, Kawon; Lenzer, Thomas
2017-03-08
The stability of dye cations against recombination with conduction band electrons in mesoporous TiO 2 electrodes is a key property for improving light harvesting in dye-sensitised solar cells. Using ultrafast transient broadband absorption spectroscopy, we monitor efficient intramolecular hole transfer in the solar cell dye E6 having two peripheral triarylamine acceptors. After photoexcitation, two hole transfer mechanisms are identified: a concerted mechanism for electron injection and hole transfer (2.4 ps) and a sequential mechanism with time constants of 3.9 ps and 30 ps. This way the dye retards unwanted recombination with a TiO 2 conduction band electron by quickly moving the hole further away from the surface. Contact of the E6/TiO 2 surface with the solvent acetonitrile has almost no influence on the electron injection and hole transfer kinetics. Fast hole transfer (2.8 ps) is also observed on a "non-injecting" Al 2 O 3 surface generating a radical cation-radical anion species with a lifetime of 530 ps. The findings confirm the good intramolecular hole transfer properties of this dye on both thin films. In contrast, intramolecular hole transfer does not occur in the mid-polar organic solvent methyl acetate. This is confirmed by TDDFT calculations suggesting a polarity-induced reduction of the driving force for hole transfer. In methyl acetate, only the relaxation of the initially photoexcited core chromophore is observed including solvent relaxation processes of the electronically excited state S 1 /ICT.
Electronic Data Interchange: Using Technology to Exchange Transcripts.
ERIC Educational Resources Information Center
Stewart, John T.
1994-01-01
Describes the Florida Automated System for Transferring Educational Records (FASTER) project, which permits the electronic exchange of student transcripts; uses of similar electronic data interchange (EDI) programs in other states; and the national SPEEDE/ExPRESS project, which uses a standard format for transferring electronic transcripts.…
Electronic coupling in long-range electron transfer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Newton, M.D.
1996-12-31
One of the quantities crucial in controlling electron transfer (et) kinetics is the donor/acceptor electronic coupling integral (HDA). Recent theoretical models for HDA will be presented, and the results of ab initio computational implementation will be reported and analyzed for several metal-to-metal ligand charge transfer processes in complex molecular aggregates. New procedures for defining diabatic states, including a generalization of the Mulliken-Hush model, allow applications to optical and excited state as well as ground state et in a many-state framework.
Occurrence and expression of gene transfer agent genes in marine bacterioplankton.
Biers, Erin J; Wang, Kui; Pennington, Catherine; Belas, Robert; Chen, Feng; Moran, Mary Ann
2008-05-01
Genes with homology to the transduction-like gene transfer agent (GTA) were observed in genome sequences of three cultured members of the marine Roseobacter clade. A broader search for homologs for this host-controlled virus-like gene transfer system identified likely GTA systems in cultured Alphaproteobacteria, and particularly in marine bacterioplankton representatives. Expression of GTA genes and extracellular release of GTA particles ( approximately 50 to 70 nm) was demonstrated experimentally for the Roseobacter clade member Silicibacter pomeroyi DSS-3, and intraspecific gene transfer was documented. GTA homologs are surprisingly infrequent in marine metagenomic sequence data, however, and the role of this lateral gene transfer mechanism in ocean bacterioplankton communities remains unclear.
Occurrence and Expression of Gene Transfer Agent Genes in Marine Bacterioplankton▿
Biers, Erin J.; Wang, Kui; Pennington, Catherine; Belas, Robert; Chen, Feng; Moran, Mary Ann
2008-01-01
Genes with homology to the transduction-like gene transfer agent (GTA) were observed in genome sequences of three cultured members of the marine Roseobacter clade. A broader search for homologs for this host-controlled virus-like gene transfer system identified likely GTA systems in cultured Alphaproteobacteria, and particularly in marine bacterioplankton representatives. Expression of GTA genes and extracellular release of GTA particles (∼50 to 70 nm) was demonstrated experimentally for the Roseobacter clade member Silicibacter pomeroyi DSS-3, and intraspecific gene transfer was documented. GTA homologs are surprisingly infrequent in marine metagenomic sequence data, however, and the role of this lateral gene transfer mechanism in ocean bacterioplankton communities remains unclear. PMID:18359833
Li, Haiyin; Chang, Jiafu; Hou, Ting; Ge, Lei; Li, Feng
2016-11-01
Reliable, selective and sensitive approaches for trinitrophenol (TNP) detection are highly desirable with respect to national security and environmental protection. Herein, a simple and novel fluorescent strategy for highly sensitive and specific TNP assay has been successfully developed, which is based on the quenching of the fluorescent poly(thymine)-templated copper nanoclusters (DNA-CuNCs), through the synergetic effects of acid induction and electron transfer. Upon the addition of TNP, donor-acceptor complexes between the electron-deficient nitro-groups in TNP and the electron-donating DNA templates are formed, resulting in the close proximity between TNP and CuNCs. Moreover, the acidity of TNP contributes to the pH decrease of the system. These factors combine to dramatically quench the fluorescence of DNA-CuNCs, providing a "signal-off" strategy for TNP sensing. The as-proposed strategy demonstrates high sensitivity for TNP assay, and a detection limit of 0.03μM is obtained, which is lower than those reported by using organic fluorescent materials. More significantly, this approach shows outstanding selectivity over a number of TNP analogues, such as 2,4,6-trinitrotoluene (TNT), 2,4-dinitrotoluene (DNT), 2,4-dinitrophenol (DNP), 3-nitrophenol (NP), nitrobenzene (NB), phenol (BP), and toluene (BT). Compared with previous studies, this method does not need complex DNA sequence design, fluorescent dye labeling, or sophisticated organic reactions, rendering the strategy with additional advantages of simplicity and cost-effectiveness. In addition, the as-proposed strategy has been adopted for the detection of TNP in natural water samples, indicating its great potential to be applied in the fields of public safety and environmental monitoring. Copyright © 2016 Elsevier B.V. All rights reserved.
Electron transfer statistics and thermal fluctuations in molecular junctions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Goswami, Himangshu Prabal; Harbola, Upendra
2015-02-28
We derive analytical expressions for probability distribution function (PDF) for electron transport in a simple model of quantum junction in presence of thermal fluctuations. Our approach is based on the large deviation theory combined with the generating function method. For large number of electrons transferred, the PDF is found to decay exponentially in the tails with different rates due to applied bias. This asymmetry in the PDF is related to the fluctuation theorem. Statistics of fluctuations are analyzed in terms of the Fano factor. Thermal fluctuations play a quantitative role in determining the statistics of electron transfer; they tend tomore » suppress the average current while enhancing the fluctuations in particle transfer. This gives rise to both bunching and antibunching phenomena as determined by the Fano factor. The thermal fluctuations and shot noise compete with each other and determine the net (effective) statistics of particle transfer. Exact analytical expression is obtained for delay time distribution. The optimal values of the delay time between successive electron transfers can be lowered below the corresponding shot noise values by tuning the thermal effects.« less
Case A and B evolution towards electron capture supernova
NASA Astrophysics Data System (ADS)
Siess, L.; Lebreuilly, U.
2018-06-01
Context. Most super-asymptotic giant branch (SAGB) stars are expected to end their life as oxygen-neon white dwarfs rather than electron capture supernovae (ECSN). The reason is ascribed to the ability of the second dredge-up to significantly reduce the mass of the He core and of the efficient AGB winds to remove the stellar envelope before the degenerate core reaches the critical mass for the activation of electron capture reactions. Aims: In this study, we investigate the formation of ECSN through case A and case B mass transfer. In these scenarios, when Roche lobe overflow stops, the primary has become a helium star. With a small envelope left, the second dredge-up is prevented, potentially opening new paths to ECSN. Methods: We compute binary models using our stellar evolution code BINSTAR. We consider three different secondary masses of 8, 9, and 10 M⊙ and explore the parameter space, varying the companion mass, orbital period, and input physics. Results: Assuming conservative mass transfer, with our choice of secondary masses all case A systems enter contact either during the main sequence or as a consequence of reversed mass transfer when the secondary overtakes its companion during core helium burning. Case B systems are able to produce ECSN progenitors in a relatively small range of periods (3 ≲ P(d) ≤ 30) and primary masses (10.9 ≤ M/M⊙≤ 11.5). Changing the companion mass has little impact on the primary's fate as long as the mass ratio M1/M2 remains less than 1.4-1.5, above which evolution to contact becomes unavoidable. We also find that allowing for systemic mass loss substantially increases the period interval over which ECSN can occur. This change in the binary physics does not however affect the primary mass range. We finally stress that the formation of ECSN progenitors through case A and B mass transfer is very sensitive to adopted binary and stellar physics. Conclusions: Close binaries provide additional channels for ECSN but the parameter space is rather constrained likely making ECSN a rare event.
Extracellular electron transfer mechanisms between microorganisms and minerals.
Shi, Liang; Dong, Hailiang; Reguera, Gemma; Beyenal, Haluk; Lu, Anhuai; Liu, Juan; Yu, Han-Qing; Fredrickson, James K
2016-10-01
Electrons can be transferred from microorganisms to multivalent metal ions that are associated with minerals and vice versa. As the microbial cell envelope is neither physically permeable to minerals nor electrically conductive, microorganisms have evolved strategies to exchange electrons with extracellular minerals. In this Review, we discuss the molecular mechanisms that underlie the ability of microorganisms to exchange electrons, such as c-type cytochromes and microbial nanowires, with extracellular minerals and with microorganisms of the same or different species. Microorganisms that have extracellular electron transfer capability can be used for biotechnological applications, including bioremediation, biomining and the production of biofuels and nanomaterials.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bose, A; Gardel, EJ; Vidoudez, C
Oxidation-reduction reactions underlie energy generation in nearly all life forms. Although most organisms use soluble oxidants and reductants, some microbes can access solid-phase materials as electron-acceptors or -donors via extracellular electron transfer. Many studies have focused on the reduction of solid-phase oxidants. Far less is known about electron uptake via microbial extracellular electron transfer, and almost nothing is known about the associated mechanisms. Here we show that the iron-oxidizing photoautotroph Rhodopseudomonas palustris TIE-1 accepts electrons from a poised electrode, with carbon dioxide as the sole carbon source/electron acceptor. Both electron uptake and ruBisCo form I expression are stimulated by light.more » Electron uptake also occurs in the dark, uncoupled from photosynthesis. Notably, the pioABC operon, which encodes a protein system essential for photoautotrophic growth by ferrous iron oxidation, influences electron uptake. These data reveal a previously unknown metabolic versatility of photoferrotrophs to use extracellular electron transfer for electron uptake.« less
Federal Register 2010, 2011, 2012, 2013, 2014
2012-02-22
... Greenhouse Gas Reporting Program: Electronics Manufacturing: Revisions to Heat Transfer Fluid Provisions... technical revisions to the electronics manufacturing source category of the Greenhouse Gas Reporting Rule... related to the electronics manufacturing source category. DATES: This rule will be effective on March 23...
12 CFR 1005.9 - Receipts at electronic terminals; periodic statements.
Code of Federal Regulations, 2014 CFR
2014-01-01
... TRANSFERS (REGULATION E) General § 1005.9 Receipts at electronic terminals; periodic statements. (a... institution shall make a receipt available to a consumer at the time the consumer initiates an electronic fund transfer at an electronic terminal. The receipt shall set forth the following information, as applicable...
12 CFR 1005.9 - Receipts at electronic terminals; periodic statements.
Code of Federal Regulations, 2013 CFR
2013-01-01
... TRANSFERS (REGULATION E) General § 1005.9 Receipts at electronic terminals; periodic statements. (a... institution shall make a receipt available to a consumer at the time the consumer initiates an electronic fund transfer at an electronic terminal. The receipt shall set forth the following information, as applicable...
12 CFR 1005.9 - Receipts at electronic terminals; periodic statements.
Code of Federal Regulations, 2012 CFR
2012-01-01
... TRANSFERS (REGULATION E) § 1005.9 Receipts at electronic terminals; periodic statements. (a) Receipts at... shall make a receipt available to a consumer at the time the consumer initiates an electronic fund transfer at an electronic terminal. The receipt shall set forth the following information, as applicable...
Federal Register 2010, 2011, 2012, 2013, 2014
2013-08-12
... electronic funds transfer information to maintain its vendor (credit union) records to make electronic... maintain current electronic funds transfer data for its vendor (credit union) electronic routing and... the information on the respondents such as through the use of automated collection techniques or other...
Rapid electron transfer by the carbon matrix in natural pyrogenic carbon
Sun, Tianran; Levin, Barnaby D. A.; Guzman, Juan J. L.; Enders, Akio; Muller, David A.; Angenent, Largus T.; Lehmann, Johannes
2017-01-01
Surface functional groups constitute major electroactive components in pyrogenic carbon. However, the electrochemical properties of pyrogenic carbon matrices and the kinetic preference of functional groups or carbon matrices for electron transfer remain unknown. Here we show that environmentally relevant pyrogenic carbon with average H/C and O/C ratios of less than 0.35 and 0.09 can directly transfer electrons more than three times faster than the charging and discharging cycles of surface functional groups and have a 1.5 V potential range for biogeochemical reactions that invoke electron transfer processes. Surface functional groups contribute to the overall electron flux of pyrogenic carbon to a lesser extent with greater pyrolysis temperature due to lower charging and discharging capacities, although the charging and discharging kinetics remain unchanged. This study could spur the development of a new generation of biogeochemical electron flux models that focus on the bacteria–carbon–mineral conductive network. PMID:28361882
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ekiert, Robert; Czapla, Monika; Sarewicz, Marcin
2014-08-22
Highlights: • We used hybrid fusion bc{sub 1} complex to test inter-monomer electron transfer in vivo. • Cross-inactivated complexes were able to sustain photoheterotrophic growth. • Inter-monomer electron transfer supports catalytic cycle in vivo. • bc{sub 1} dimer is functional even when cytochrome b subunits come from different species. - Abstract: Electronic connection between Q{sub o} and Q{sub i} quinone catalytic sites of dimeric cytochrome bc{sub 1} is a central feature of the energy-conserving Q cycle. While both the intra- and inter-monomer electron transfers were shown to connect the sites in the enzyme, mechanistic and physiological significance of the lattermore » remains unclear. Here, using a series of mutated hybrid cytochrome bc{sub 1}-like complexes, we show that inter-monomer electron transfer robustly sustains the function of the enzyme in vivo, even when the two subunits in a dimer come from different species. This indicates that minimal requirement for bioenergetic efficiency is to provide a chain of cofactors for uncompromised electron flux between the catalytic sites, while the details of protein scaffold are secondary.« less
Distal [FeS]-Cluster Coordination in [NiFe]-Hydrogenase Facilitates Intermolecular Electron Transfer
Petrenko, Alexander; Stein, Matthias
2017-01-01
Biohydrogen is a versatile energy carrier for the generation of electric energy from renewable sources. Hydrogenases can be used in enzymatic fuel cells to oxidize dihydrogen. The rate of electron transfer (ET) at the anodic side between the [NiFe]-hydrogenase enzyme distal iron–sulfur cluster and the electrode surface can be described by the Marcus equation. All parameters for the Marcus equation are accessible from Density Functional Theory (DFT) calculations. The distal cubane FeS-cluster has a three-cysteine and one-histidine coordination [Fe4S4](His)(Cys)3 first ligation sphere. The reorganization energy (inner- and outer-sphere) is almost unchanged upon a histidine-to-cysteine substitution. Differences in rates of electron transfer between the wild-type enzyme and an all-cysteine mutant can be rationalized by a diminished electronic coupling between the donor and acceptor molecules in the [Fe4S4](Cys)4 case. The fast and efficient electron transfer from the distal iron–sulfur cluster is realized by a fine-tuned protein environment, which facilitates the flow of electrons. This study enables the design and control of electron transfer rates and pathways by protein engineering. PMID:28067774
Jia, Ru; Yang, Dongqing; Xu, Dake; Gu, Tingyue
2017-12-01
Electron transfer is a rate-limiting step in microbiologically influenced corrosion (MIC) caused by microbes that utilize extracellular electrons. Cross-cell wall electron transfer is necessary to transport the electrons released from extracellular iron oxidation into the cytoplasm of cells. Electron transfer mediators were found to accelerate the MIC caused by sulfate reducing bacteria. However, there is no publication in the literature showing the effect of electron transfer mediators on MIC caused by nitrate reducing bacteria (NRB). This work demonstrated that the corrosion of anaerobic Pseudomonas aeruginosa (PAO1) grown as a nitrate reducing bacterium biofilm on C1018 carbon steel was enhanced by two electron transfer mediators, riboflavin and flavin adenine dinucleotide (FAD) separately during a 7-day incubation period. The addition of either 10ppm (w/w) (26.6μM) riboflavin or 10ppm (12.7μM) FAD did not increase planktonic cell counts, but they increased the maximum pit depth on carbon steel coupons considerably from 17.5μm to 24.4μm and 25.0μm, respectively. Riboflavin and FAD also increased the specific weight loss of carbon steel from 2.06mg/cm 2 to 2.34mg/cm 2 and 2.61mg/cm 2 , respectively. Linear polarization resistance, electrochemical impedance spectroscopy and potentiodynamic polarization curves all corroborated the pitting and weight loss data. Copyright © 2017 Elsevier B.V. All rights reserved.
Cytochromes and iron sulfur proteins in sulfur metabolism of phototrophic bacteria
NASA Technical Reports Server (NTRS)
Fischer, U.
1985-01-01
Dissimilatory sulfur metabolism in phototrophic sulfur bacteria provides the bacteria with electrons for photosynthetic electron transport chain and, with energy. Assimilatory sulfate reduction is necessary for the biosynthesis of sulfur-containing cell components. Sulfide, thiosulfate, and elemental sulfur are the sulfur compounds most commonly used by phototrophic bacteria as electron donors for anoxygenic photosynthesis. Cytochromes or other electron transfer proteins, like high-potential-iron-sulfur protein (HIPIP) function as electron acceptors or donors for most enzymatic steps during the oxidation pathways of sulfide or thiosulfate. Yet, heme- or siroheme-containing proteins themselves undergo enzymatic activities in sulfur metabolism. Sirohemes comprise a porphyrin-like prosthetic group of sulfate reductase. eenzymatic reactions involve electron transfer. Electron donors or acceptors are necessary for each reaction. Cytochromes and iron sulfur problems, are able to transfer electrons.
Frenkel versus charge-transfer exciton dispersion in molecular crystals
NASA Astrophysics Data System (ADS)
Cudazzo, Pierluigi; Gatti, Matteo; Rubio, Angel; Sottile, Francesco
2013-11-01
By solving the many-body Bethe-Salpeter equation at finite momentum transfer, we characterize the exciton dispersion in two prototypical molecular crystals, picene and pentacene, in which localized Frenkel excitons compete with delocalized charge-transfer excitons. We explain the exciton dispersion on the basis of the interplay between electron and hole hopping and electron-hole exchange interaction, unraveling a simple microscopic description to distinguish Frenkel and charge-transfer excitons. This analysis is general and can be applied to other systems in which the electron wave functions are strongly localized, as in strongly correlated insulators.
Extracellular Electron Uptake: Among Autotrophs and Mediated by Surfaces.
Tremblay, Pier-Luc; Angenent, Largus T; Zhang, Tian
2017-04-01
Autotrophic microbes can acquire electrons from solid donors such as steel, other microbial cells, or electrodes. Based on this feature, bioprocesses are being developed for the microbial electrosynthesis (MES) of useful products from the greenhouse gas CO 2 . Extracellular electron-transfer mechanisms involved in the acquisition of electrons from metals by electrical microbially influenced corrosion (EMIC), from other living cells by interspecies electron transfer (IET), or from an electrode during MES rely on: (i) mediators such as H 2 ; (ii) physical contact through electron-transfer proteins; or (iii) mediator-generating enzymes detached from cells. This review explores the interactions of autotrophs with solid electron donors and their importance in nature and for biosustainable technologies. Copyright © 2016 Elsevier Ltd. All rights reserved.
The Electronic Flux in Chemical Reactions. Insights on the Mechanism of the Maillard Reaction
NASA Astrophysics Data System (ADS)
Flores, Patricio; Gutiérrez-Oliva, Soledad; Herrera, Bárbara; Silva, Eduardo; Toro-Labbé, Alejandro
2007-11-01
The electronic transfer that occurs during a chemical process is analysed in term of a new concept, the electronic flux, that allows characterizing the regions along the reaction coordinate where electron transfer is actually taking place. The electron flux is quantified through the variation of the electronic chemical potential with respect to the reaction coordinate and is used, together with the reaction force, to shed light on reaction mechanism of the Schiff base formation in the Maillard reaction. By partitioning the reaction coordinate in regions in which different process might be taking place, electronic reordering associated to polarization and transfer has been identified and found to be localized at specific transition state regions where most bond forming and breaking occur.
Zhou, Huihui; Liu, Bingfeng; Wang, Qisong; Sun, Jianmin; Xie, Guojun; Ren, Nanqi; Ren, Zhiyong Jason; Xing, Defeng
2017-01-01
Microbial extracellular electron transfer (EET) is essential in driving the microbial interspecies interaction and redox reactions in bioelectrochemical systems (BESs). Magnetite (Fe 3 O 4 ) and magnetic fields (MFs) were recently reported to promote microbial EET, but the mechanisms of MFs stimulation of EET and current generation in BESs are not known. This study investigates the behavior of current generation and EET in a state-of-the-art pulse electromagnetic field (PEMF)-assisted magnetic BES (PEMF-MBES), which was equipped with magnetic carbon particle (Fe 3 O 4 @N-mC)-coated electrodes. Illumina Miseq sequencing of 16S rRNA gene amplicons was also conducted to reveal the changes of microbial communities and interactions on the anode in response to magnetic field. PEMF had significant influences on current generation. When reactors were operated in microbial fuel cell (MFC) mode with pulse electromagnetic field (PEMF-MMFCs), power densities increased by 25.3-36.0% compared with no PEMF control MFCs (PEMF-OFF-MMFCs). More interestingly, when PEMF was removed, the power density dropped by 25.7%, while when PEMF was reintroduced, the value was restored to the previous level. Illumina sequencing of 16S rRNA gene amplicon and principal component analysis (PCA) based on operational taxonomic units (OTUs) indicate that PEMFs led to the shifts in microbial community and changes in species evenness that decreased biofilm microbial diversity. Geobacter spp. were found dominant in all anode biofilms, but the relative abundance in PEMF-MMFCs (86.1-90.0%) was higher than in PEMF-OFF-MMFCs (82.5-82.7%), indicating that the magnetic field enriched Geobacter on the anode. The current generation of Geobacter -inoculated microbial electrolysis cells (MECs) presented the same change regularity, the accordingly increase or decrease corresponding with switch of PEMF, which confirmed the reversible stimulation of PEMFs on microbial electron transfer. The pulse electromagnetic field (PEMF) showed significant influence on state-of-the-art pulse magnetic bioelectrochemical systems (PEMF-MBES) in terms of current generation and microbial ecology. EET was instantaneously and reversibly enhanced in MBESs inoculated with either mixed-culture or Geobacter . PEMF notably decreased bacterial and archaeal diversities of the anode biofilms in MMFCs via changing species evenness rather than species richness, and facilitated specific enrichment of exoelectrogenic bacteria ( Geobacter ) on the anode surface. This study demonstrates a new magnetic approach for understanding and facilitating microbial electrochemical activities.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xiao, Tiejun; Department of Chemistry, Iowa State University, Ames, Iowa 50011; Song, Xueyu
2014-10-07
Electron transfer near an electrode immersed in ionic fluids is studied using the linear response approximation, namely, mean value of the vertical energy gap can be used to evaluate the reorganization energy, and hence any linear response model that can treat Coulomb interactions successfully can be used for the reorganization energy calculation. Specifically, a molecular Debye-Hückel theory is used to calculate the reorganization energy of electron transfer reactions in an electric cell. Applications to electron transfer near an electrode in molten salts show that the reorganization energies from our molecular Debye-Hückel theory agree well with the results from MD simulations.
Cohen-Atiya, Meirav; Mandler, Daniel
2006-10-14
A new approach based on measuring the change of the open-circuit potential (OCP) of a hanging mercury drop electrode (HMDE), modified with alkanethiols of different chain length conducted in a solution containing a mixture of Ru(NH3)6(2+) and Ru(NH3)6(3+) is used for studying electron transfer across the monolayer. Following the time dependence of the OCP allowed the extraction of the kinetic parameters, such as the charge transfer resistance (R(ct)) and the electron transfer rate constant (k(et)), for different alkanethiol monolayers. An electron tunneling coefficient, beta, of 0.9 A(-1) was calculated for the monolayers on Hg.
Photoinduced Bimolecular Electron Transfer in Ionic Liquids: Cationic Electron Donors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Boning; Liang, Min; Zmich, Nicole
Recently, we have reported a systematic study of photoinduced electron-transfer reactions in ionic liquid solvents using neutral and anionic electron donors and a series of cyano-substituted anthracene acceptors [Wu, B.; Maroncelli, M.; Castner, E. W., Jr.Photoinduced Bimolecular Electron Transfer in Ionic Liquids. J. Am. Chem. Soc.139, 2017, 14568]. In this paper, we report complementary results for a cationic class of 1-alkyl-4-dimethylaminopyridinium electron donors. Reductive quenching of cyano-substituted anthracene fluorophores by these cationic quenchers is studied in solutions of acetonitrile and the ionic liquid 1-ethyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide. Varying the length of the alkyl chain permits tuning of the quencher diffusivities in solution.more » The observed quenching kinetics are interpreted using a diffusion-reaction analysis. Finally, together with results from the prior study, these results show that the intrinsic electron-transfer rate constant does not depend on the quencher charge in this family of reactions.« less
Photoinduced Bimolecular Electron Transfer in Ionic Liquids: Cationic Electron Donors
Wu, Boning; Liang, Min; Zmich, Nicole; ...
2018-01-29
Recently, we have reported a systematic study of photoinduced electron-transfer reactions in ionic liquid solvents using neutral and anionic electron donors and a series of cyano-substituted anthracene acceptors [Wu, B.; Maroncelli, M.; Castner, E. W., Jr.Photoinduced Bimolecular Electron Transfer in Ionic Liquids. J. Am. Chem. Soc.139, 2017, 14568]. In this paper, we report complementary results for a cationic class of 1-alkyl-4-dimethylaminopyridinium electron donors. Reductive quenching of cyano-substituted anthracene fluorophores by these cationic quenchers is studied in solutions of acetonitrile and the ionic liquid 1-ethyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide. Varying the length of the alkyl chain permits tuning of the quencher diffusivities in solution.more » The observed quenching kinetics are interpreted using a diffusion-reaction analysis. Finally, together with results from the prior study, these results show that the intrinsic electron-transfer rate constant does not depend on the quencher charge in this family of reactions.« less
Electronic Properties of Synthetic Shrimp Pathogens-derived DNA Schottky Diodes.
Rizan, Nastaran; Yew, Chan Yen; Niknam, Maryam Rajabpour; Krishnasamy, Jegenathan; Bhassu, Subha; Hong, Goh Zee; Devadas, Sridevi; Din, Mohamed Shariff Mohd; Tajuddin, Hairul Anuar; Othman, Rofina Yasmin; Phang, Siew Moi; Iwamoto, Mitsumasa; Periasamy, Vengadesh
2018-01-17
The exciting discovery of the semiconducting-like properties of deoxyribonucleic acid (DNA) and its potential applications in molecular genetics and diagnostics in recent times has resulted in a paradigm shift in biophysics research. Recent studies in our laboratory provide a platform towards detecting charge transfer mechanism and understanding the electronic properties of DNA based on the sequence-specific electronic response, which can be applied as an alternative to identify or detect DNA. In this study, we demonstrate a novel method for identification of DNA from different shrimp viruses and bacteria using electronic properties of DNA obtained from both negative and positive bias regions in current-voltage (I-V) profiles. Characteristic electronic properties were calculated and used for quantification and further understanding in the identification process. Aquaculture in shrimp industry is a fast-growing food sector throughout the world. However, shrimp culture in many Asian countries faced a huge economic loss due to disease outbreaks. Scientists have been using specific established methods for detecting shrimp infection, but those methods do have their significant drawbacks due to many inherent factors. As such, we believe that this simple, rapid, sensitive and cost-effective tool can be used for detection and identification of DNA from different shrimp viruses and bacteria.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jolley, Greg; Dehdashti Akhavan, Nima; Umana-Membreno, Gilberto
An electron transfer quantum well infrared photodetector (QWIP) consisting of repeating units of two coupled quantum wells (QWs) is capable of exhibiting a two color voltage dependent spectral response. However, significant electron transfer between the coupled QWs is required for spectral tuning, which may require the application of relatively high electric fields. Also, the band structure of coupled quantum wells is more complicated in comparison to a regular quantum well and, therefore, it is not always obvious if an electron transfer QWIP can be designed such that it meets specific performance characteristics. This paper presents a feasibility study of themore » electron transfer QWIP and its suitability for spectral tuning. Self consistent calculations have been performed of the bandstructure and the electric field that results from electron population within the quantum wells, from which the optical characteristics have been obtained. The band structure, spectral response, and the resonant final state energy locations have been compared with standard QWIPs. It is shown that spectral tuning in the long-wave infrared band can be achieved over a wide wavelength range of several microns while maintaining a relatively narrow spectral response FWHM. However, the total absorption strength is more limited in comparison to a standard QWIP, since the higher QW doping densities require much higher electric fields for electron transfer.« less
Toddlers' word learning and transfer from electronic and print books.
Strouse, Gabrielle A; Ganea, Patricia A
2017-04-01
Transfer from symbolic media to the real world can be difficult for young children. A sample of 73 toddlers aged 17 to 23months were read either an electronic book displayed on a touchscreen device or a traditional print book in which a novel object was paired with a novel label. Toddlers in both conditions learned the label within the context of the book. However, only those who read the traditional format book generalized and transferred the label to other contexts. An older group of 28 toddlers aged 24 to 30months did generalize and transfer from the electronic book. Across ages, those children who primarily used screens to watch prerecorded video at home transferred less from the electronic book than those with more diverse home media experiences. Copyright © 2016 Elsevier Inc. All rights reserved.
A novel alignment-free method for detection of lateral genetic transfer based on TF-IDF.
Cong, Yingnan; Chan, Yao-Ban; Ragan, Mark A
2016-07-25
Lateral genetic transfer (LGT) plays an important role in the evolution of microbes. Existing computational methods for detecting genomic regions of putative lateral origin scale poorly to large data. Here, we propose a novel method based on TF-IDF (Term Frequency-Inverse Document Frequency) statistics to detect not only regions of lateral origin, but also their origin and direction of transfer, in sets of hierarchically structured nucleotide or protein sequences. This approach is based on the frequency distributions of k-mers in the sequences. If a set of contiguous k-mers appears sufficiently more frequently in another phyletic group than in its own, we infer that they have been transferred from the first group to the second. We performed rigorous tests of TF-IDF using simulated and empirical datasets. With the simulated data, we tested our method under different parameter settings for sequence length, substitution rate between and within groups and post-LGT, deletion rate, length of transferred region and k size, and found that we can detect LGT events with high precision and recall. Our method performs better than an established method, ALFY, which has high recall but low precision. Our method is efficient, with runtime increasing approximately linearly with sequence length.
The role of Shewanella oneidensis MR-1 outer surface structures in extracellular electron transfer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bouhenni, Rachida; Vora, Gary J.; Biffinger, Justin C.
2010-04-20
Shewanella oneidensis is a facultative anaerobe that uses more than 14 different terminal electron acceptors for respiration. These include metal oxides and hydroxyoxides, and toxic metals such as uranium and chromium. Mutants deficient in metal reduction were isolated using the mariner transposon derivative, minihimar RB1. These included mutants with transposon insertions in the prepilin peptidase and type II secretion system genes. All mutants were deficient in Fe(III) and Mn(IV) reduction, and exhibited slow growth when DMSO was used as the electron acceptor. The genome sequence of S. oneidensis contains one prepilin peptidase gene, pilD. A similar prepilin peptidase that maymore » function in the processing of type II secretion prepilins was not found. Single and multiple chromosomal deletions of four putative type IV pilin genes did not affect Fe(III) and Mn(IV) reduction. These results indicate that PilD in S. oneidensis is responsible for processing both type IV and type II secretion prepilin proteins. Type IV pili do not appear to be required for Fe(III) and Mn(IV) reduction.« less
Pettersson, Karin; Wiberg, Joanna; Ljungdahl, Thomas; Mårtensson, Jerker; Albinsson, Bo
2006-01-12
The rate of electron tunneling in molecular donor-bridge-acceptor (D-B-A) systems is determined both by the tunneling barrier width and height, that is, both by the distance between the donor and acceptor as well as by the energy gap between the donor and bridge moieties. These factors are therefore important to control when designing functional electron transfer systems, such as constructs for photovoltaics, artificial photosynthesis, and molecular scale electronics. In this paper we have investigated a set of D-B-A systems in which the distance and the energy difference between the donor and bridge states (DeltaEDB) are systematically varied. Zinc(II) and gold(III) porphyrins were chosen as electron donor and acceptor because of their suitable driving force for photoinduced electron transfer (-0.9 eV in butyronitrile) and well-characterized photophysics. We have previously shown, in accordance with the superexchange mechanism for electron transfer, that the electron transfer rate is proportional to the inverse of DeltaEDB in a series of zinc/gold porphyrin D-B-A systems with bridges of constant edge to edge distance (19.6 A) and varying DeltaEDB (3900-17 600 cm(-1)). Here, we use the same donor and acceptor but the bridge is shortened or extended giving a set of oligo-p-phenyleneethynylene bridges (OPE) with four different edge to edge distances ranging from 12.7 to 33.4 A. These two sets of D-B-A systems-ZnP-RB-AuP+ and ZnP-nB-AuP+-have one bridge in common, and hence, for the first time both the distance and DeltaEDB dependence of electron transfer can be studied simultaneously in a systematic way.
NASA Astrophysics Data System (ADS)
Du, L. C.; Xi, W. D.; Zhang, J. B.; Matsuzaki, H.; Furube, A.
2018-06-01
Photoinduced electron transfer from gold nanoparticles (NPs) to semiconductor under plasmon excitation is an important phenomenon in photocatalysis and solar cell applications. Femtosecond plasmon-induced electron transfer from gold NPs to the conduction band of different semiconductor like TiO2, SnO2, and ZnO was monitored at 3440 nm upon optical excitation of the surface plasmon band of gold NPs. It was found that electron injection was completed within 240 fs and the electron injection yield reached 10-30% under 570 nm excitation. It means TiO2 is not the only proper semiconductor as electron acceptors in such gold/semiconductor nanoparticle systems.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Andersen, Mikael R.; Salazar, Margarita; Schaap, Peter
2011-06-01
The filamentous fungus Aspergillus niger exhibits great diversity in its phenotype. It is found globally, both as marine and terrestrial strains, produces both organic acids and hydrolytic enzymes in high amounts, and some isolates exhibit pathogenicity. Although the genome of an industrial enzyme-producing A. niger strain (CBS 513.88) has already been sequenced, the versatility and diversity of this species compels additional exploration. We therefore undertook whole genome sequencing of the acidogenic A. niger wild type strain (ATCC 1015), and produced a genome sequence of very high quality. Only 15 gaps are present in the sequence and half the telomeric regionsmore » have been elucidated. Moreover, sequence information from ATCC 1015 was utilized to improve the genome sequence of CBS 513.88. Chromosome-level comparisons uncovered several genome rearrangements, deletions, a clear case of strain-specific horizontal gene transfer, and identification of 0.8 megabase of novel sequence. Single nucleotide polymorphisms per kilobase (SNPs/kb) between the two strains were found to be exceptionally high (average: 7.8, maximum: 160 SNPs/kb). High variation within the species was confirmed with exo-metabolite profiling and phylogenetics. Detailed lists of alleles were generated, and genotypic differences were observed to accumulate in metabolic pathways essential to acid production and protein synthesis. A transcriptome analysis revealed up-regulation of the electron transport chain, specifically the alternative oxidative pathway in ATCC 1015, while CBS 513.88 showed significant up regulation of genes associated with biosynthesis of amino acids that are abundant in glucoamylase A, tRNA-synthases and protein transporters.« less
Rappaport, Fabrice; Boussac, Alain; Force, Dee Ann; Peloquin, Jeffrey; Brynda, Marcin; Sugiura, Miwa; Un, Sun; Britt, R. David; Diner, Bruce A.
2009-01-01
The catalytic cycle of numerous enzymes involves the coupling between proton transfer and electron transfer. Yet, the understanding of this coordinated transfer in biological systems remains limited, likely because its characterization relies on the controlled but experimentally challenging modifications of the free energy changes associated with either the electron or proton transfer. We have performed such a study here in Photosystem II. The driving force for electron transfer from TyrZ to P680•+ has been decreased by ~ 80 meV by mutating the axial ligand of P680, and that for proton transfer upon oxidation of TyrZ by substituting a 3-fluorotyrosine (3F-TyrZ) for TyrZ. In Mn-depleted Photosystem II, the dependence upon pH of the oxidation rates of TyrZ and 3F-TyrZ were found to be similar. However, in the pH range where the phenolic hydroxyl of TyrZ is involved in a H-bond with a proton acceptor, the activation energy of the oxidation of 3F-TyrZ is decreased by 110 meV, a value which correlates with the in vitro finding of a 90 meV stabilization energy to the phenolate form of 3F-Tyr when compared to Tyr (Seyedsayamdost et al., 2006, JACS 128:1569–79). Thus, when the phenol of YZ acts as a H-bond-donor, its oxidation by P680•+ is controlled by its prior deprotonation. This contrasts with the situation prevailing at lower pH, where the proton acceptor is protonated and therefore unavailable, in which the oxidation-induced proton transfer from the phenolic hydroxyl of TyrZ has been proposed to occur concertedly with the electron transfer to P680•+. This suggests a switch between a concerted proton/electron transfer at pHs < 7.5 to a sequential one at pHs > 7.5 and illustrates the roles of the H-bond and of the likely salt-bridge existing between the phenolate and the nearby proton acceptor in determining the coupling between proton and electron transfer. PMID:19265377
ZnO-nanorods/graphene heterostructure: a direct electron transfer glucose biosensor
NASA Astrophysics Data System (ADS)
Zhao, Yu; Li, Wenbo; Pan, Lijia; Zhai, Dongyuan; Wang, Yu; Li, Lanlan; Cheng, Wen; Yin, Wei; Wang, Xinran; Xu, Jian-Bin; Shi, Yi
2016-08-01
ZnO-nanorods/graphene heterostructure was synthesized by hydrothermal growth of ZnO nanorods on chemically reduced graphene (CRG) film. The hybrid structure was demonstrated as a biosensor, where direct electron transfer between glucose oxidase (GOD) and electrode was observed. The charge transfer was attributed to the ZnO nanorod wiring between the redox center of GOD and electrode, and the ZnO/graphene heterostructure facilitated the transport of electrons on the hybride electrode. The glucose sensor based on the GOD-ZnO/CRG/Pt electrode had a high sensitivity of 17.64 μA mM-1, which is higher than most of the previously reported values for direct electron transfer based glucose biosensors. Moreover, this biosensor is linearly proportional to the concentration of glucose in the range of 0.2-1.6 mM. The study revealed that the band structure of electrode could affect the detection of direct electron transfer of GOD, which would be helpful for the design of the biosensor electrodes in the future.
Bediako, D. Kwabena; Solis, Brian H.; Dogutan, Dilek K.; ...
2014-10-08
Here, the hangman motif provides mechanistic insights into the role of pendant proton relays in governing proton-coupled electron transfer (PCET) involved in the hydrogen evolution reaction (HER). We now show improved HER activity of Ni compared with Co hangman porphyrins. Cyclic voltammogram data and simulations, together with computational studies using density functional theory, implicate a shift in electrokinetic zone between Co and Ni hangman porphyrins due to a change in the PCET mechanism. Unlike the Co hangman porphyrin, the Ni hangman porphyrin does not require reduction to the formally metal(0) species before protonation by weak acids in acetonitrile. We concludemore » that protonation likely occurs at the Ni(I) state followed by reduction, in a stepwise proton transfer–electron transfer pathway. Spectroelectrochemical and computational studies reveal that upon reduction of the Ni(II) compound, the first electron is transferred to a metal-based orbital, whereas the second electron is transferred to a molecular orbital on the porphyrin ring.« less
Bediako, D. Kwabena; Solis, Brian H.; Dogutan, Dilek K.; Roubelakis, Manolis M.; Maher, Andrew G.; Lee, Chang Hoon; Chambers, Matthew B.; Hammes-Schiffer, Sharon; Nocera, Daniel G.
2014-01-01
The hangman motif provides mechanistic insights into the role of pendant proton relays in governing proton-coupled electron transfer (PCET) involved in the hydrogen evolution reaction (HER). We now show improved HER activity of Ni compared with Co hangman porphyrins. Cyclic voltammogram data and simulations, together with computational studies using density functional theory, implicate a shift in electrokinetic zone between Co and Ni hangman porphyrins due to a change in the PCET mechanism. Unlike the Co hangman porphyrin, the Ni hangman porphyrin does not require reduction to the formally metal(0) species before protonation by weak acids in acetonitrile. We conclude that protonation likely occurs at the Ni(I) state followed by reduction, in a stepwise proton transfer–electron transfer pathway. Spectroelectrochemical and computational studies reveal that upon reduction of the Ni(II) compound, the first electron is transferred to a metal-based orbital, whereas the second electron is transferred to a molecular orbital on the porphyrin ring. PMID:25298534
Energy gap law of electron transfer in nonpolar solvents.
Tachiya, M; Seki, Kazuhiko
2007-09-27
We investigate the energy gap law of electron transfer in nonpolar solvents for charge separation and charge recombination reactions. In polar solvents, the reaction coordinate is given in terms of the electrostatic potentials from solvent permanent dipoles at solutes. In nonpolar solvents, the energy fluctuation due to solvent polarization is absent, but the energy of the ion pair state changes significantly with the distance between the ions as a result of the unscreened strong Coulomb potential. The electron transfer occurs when the final state energy coincides with the initial state energy. For charge separation reactions, the initial state is a neutral pair state, and its energy changes little with the distance between the reactants, whereas the final state is an ion pair state and its energy changes significantly with the mutual distance; for charge recombination reactions, vice versa. We show that the energy gap law of electron-transfer rates in nonpolar solvents significantly depends on the type of electron transfer.
Simulation-Based Approach to Determining Electron Transfer Rates Using Square-Wave Voltammetry.
Dauphin-Ducharme, Philippe; Arroyo-Currás, Netzahualcóyotl; Kurnik, Martin; Ortega, Gabriel; Li, Hui; Plaxco, Kevin W
2017-05-09
The efficiency with which square-wave voltammetry differentiates faradic and charging currents makes it a particularly sensitive electroanalytical approach, as evidenced by its ability to measure nanomolar or even picomolar concentrations of electroactive analytes. Because of the relative complexity of the potential sweep it uses, however, the extraction of detailed kinetic and mechanistic information from square-wave data remains challenging. In response, we demonstrate here a numerical approach by which square-wave data can be used to determine electron transfer rates. Specifically, we have developed a numerical approach in which we model the height and the shape of voltammograms collected over a range of square-wave frequencies and amplitudes to simulated voltammograms as functions of the heterogeneous rate constant and the electron transfer coefficient. As validation of the approach, we have used it to determine electron transfer kinetics in both freely diffusing and diffusionless surface-tethered species, obtaining electron transfer kinetics in all cases in good agreement with values derived using non-square-wave methods.
Chemical dynamics of the first proton-coupled electron transfer of water oxidation on TiO2 anatase.
Chen, Jia; Li, Ye-Fei; Sit, Patrick; Selloni, Annabella
2013-12-18
Titanium dioxide (TiO2) is a prototype, water-splitting (photo)catalyst, but its performance is limited by the large overpotential for the oxygen evolution reaction (OER). We report here a first-principles density functional theory study of the chemical dynamics of the first proton-coupled electron transfer (PCET), which is considered responsible for the large OER overpotential on TiO2. We use a periodic model of the TiO2/water interface that includes a slab of anatase TiO2 and explicit water molecules, sample the solvent configurations by first principles molecular dynamics, and determine the energy profiles of the two electronic states involved in the electron transfer (ET) by hybrid functional calculations. Our results suggest that the first PCET is sequential, with the ET following the proton transfer. The ET occurs via an inner sphere process, which is facilitated by a state in which one electronic hole is shared by the two oxygen ions involved in the transfer.
Extracellular enzymes facilitate electron uptake in biocorrosion and bioelectrosynthesis.
Deutzmann, Jörg S; Sahin, Merve; Spormann, Alfred M
2015-04-21
Direct, mediator-free transfer of electrons between a microbial cell and a solid phase in its surrounding environment has been suggested to be a widespread and ecologically significant process. The high rates of microbial electron uptake observed during microbially influenced corrosion of iron [Fe(0)] and during microbial electrosynthesis have been considered support for a direct electron uptake in these microbial processes. However, the underlying molecular mechanisms of direct electron uptake are unknown. We investigated the electron uptake characteristics of the Fe(0)-corroding and electromethanogenic archaeon Methanococcus maripaludis and discovered that free, surface-associated redox enzymes, such as hydrogenases and presumably formate dehydrogenases, are sufficient to mediate an apparent direct electron uptake. In genetic and biochemical experiments, we showed that these enzymes, which are released from cells during routine culturing, catalyze the formation of H2 or formate when sorbed to an appropriate redox-active surface. These low-molecular-weight products are rapidly consumed by M. maripaludis cells when present, thereby preventing their accumulation to any appreciable or even detectable level. Rates of H2 and formate formation by cell-free spent culture medium were sufficient to explain the observed rates of methane formation from Fe(0) and cathode-derived electrons by wild-type M. maripaludis as well as by a mutant strain carrying deletions in all catabolic hydrogenases. Our data collectively show that cell-derived free enzymes can mimic direct extracellular electron transfer during Fe(0) corrosion and microbial electrosynthesis and may represent an ecologically important but so far overlooked mechanism in biological electron transfer. The intriguing trait of some microbial organisms to engage in direct electron transfer is thought to be widespread in nature. Consequently, direct uptake of electrons into microbial cells from solid surfaces is assumed to have a significant impact not only on fundamental microbial and biogeochemical processes but also on applied bioelectrochemical systems, such as microbial electrosynthesis and biocorrosion. This study provides a simple mechanistic explanation for frequently observed fast electron uptake kinetics in microbiological systems without a direct transfer: free, cell-derived enzymes can interact with cathodic surfaces and catalyze the formation of intermediates that are rapidly consumed by microbial cells. This electron transfer mechanism likely plays a significant role in various microbial electron transfer reactions in the environment. Copyright © 2015 Deutzmann et al.
Morin-Moncet, Olivier; Beaumont, Vincent; de Beaumont, Louis; Lepage, Jean-Francois; Théoret, Hugo
2014-05-01
Recent data suggest that the Val66Met polymorphism of the brain-derived neurotrophic factor (BDNF) gene can alter cortical plasticity within the motor cortex of carriers, which exhibits abnormally low rates of cortical reorganization after repetitive motor tasks. To verify whether long-term retention of a motor skill is also modulated by the presence of the polymorphism, 20 participants (10 Val66Val, 10 Val66Met) were tested twice at a 1-wk interval. During each visit, excitability of the motor cortex was measured by transcranial magnetic stimulations (TMS) before and after performance of a procedural motor learning task (serial reaction time task) designed to study sequence-specific learning of the right hand and sequence-specific transfer from the right to the left hand. Behavioral results showed a motor learning effect that persisted for at least a week and task-related increases in corticospinal excitability identical for both sessions and without distinction for genetic group. Sequence-specific transfer of the motor skill from the right hand to the left hand was greater in session 2 than in session 1 only in the Val66Met genetic group. Further analysis revealed that the sequence-specific transfer occurred equally at both sessions in the Val66Val genotype group. In the Val66Met genotype group, sequence-specific transfer did not occur at session 1 but did at session 2. These data suggest a limited impact of Val66Met polymorphism on the learning and retention of a complex motor skill and its associated changes in corticospinal excitability over time, and a possible modulation of the interhemispheric transfer of procedural learning. Copyright © 2014 the American Physiological Society.
Ultrafast Spectroscopy of Proton-Coupled Electron Transfer (PCET) in Photocatalysis
2016-07-08
AFRL-AFOSR-VA-TR-2016-0244 Ultrafast Spectroscopy of Proton-Coupled Electron Transfer (PCET) in Photocatalysis Jahan Dawlaty UNIVERSITY OF SOUTHERN...TITLE AND SUBTITLE Ultrafast Spectroscopy of Proton-Coupled Electron Transfer (PCET) in Photocatalysis 5a. CONTRACT NUMBER 5b. GRANT NUMBER FA9550...298 Back (Rev. 8/98) DISTRIBUTION A: Distribution approved for public release. Final Report: AFOSR YIP Grant FA9550-13-1-0128: Ultrafast Spectroscopy
2010-02-11
purchase a new gun. Mr. Mike Ackeret ( Transfer Engineering Inc.) Transfer Engineering’s expertise in specialty UHV work and machining propelled...modifications they helped design for the test stand. With UNLV guidance, Transfer Engineering designed and built the original UNLV SEE Test Stand...Staib electron gun, an isolated beam drift tube, a hexanode delay line with a chevron microchannel plate (MCP) stack, an isolated grid, an isolated
Zhang, Min; E, Wenbo; Ohkubo, Kei; Sanchez-Garcia, David; Yoon, Dae-Wi; Sessler, Jonathan L; Fukuzumi, Shunichi; Kadish, Karl M
2008-02-21
Electron-transfer interconversion between the four-electron oxidized form of a quaterpyrrole (abbreviated as P4 for four pyrroles) and the two-electron oxidized form (P4H2) as well as between P4H2 and its fully reduced form (P4H4) bearing analogous substituents in the alpha- and beta-pyrrolic positions was studied by means of cyclic voltammetry and UV-visible spectroelectrochemistry combined with ESR and laser flash photolysis measurements. The two-electron oxidized form, P4H2, acts as both an electron donor and an electron acceptor. The radical cation (P4H2*+) and radical anion (P4H2*-) are both produced by photoinduced electron transfer from dimeric 1-benzyl-1,4-dihydronicotinamide to P4H2, whereas the cation radical form of the compound is also produced by electron-transfer oxidation of P4H2 with [Ru(bpy)3]3+. The ESR spectra of P4H2*+ and P4H2*- were recorded at low temperature and exhibit spin delocalization over all four pyrrole units. Thus, the two-electron oxidized form of the quaterpyrrole (P4H2) displays redox and electronic features analogous to those seen in the case of porphyrins and may be considered as a simple, open-chain model of this well-studied tetrapyrrolic macrocycle. The dynamics of deprotonation from P4H2*+ and disproportionation of P4H2 were examined by laser flash photolysis measurements of photoinduced electron-transfer oxidation and reduction of P4H2, respectively.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wishart, J.F.; Sun, J.; Su, C.
1997-01-23
Several ruthenium ammine complexes were used to modify horse-heart cytochrome c at histidine-33, creating a series of (NH{sub 3}){sub 4}(L)Ru-Cyt c derivatives (L = H{sub 2}O/OH{sup -}, ammonia, 4-ethylpyridine, 3,5-lutidine, pyridine, isonicotinamide, N-methylpyrazinium) with a wide range of driving forces for Fe-to-Ru electron transfer (-{Delta}G{degree} = -0.125 to +0.46 eV). Electron-transfer rates and activation parameters were measured by pulse radiolysis using azide or carbonate radicals. The driving-force dependence of electron-transfer rates between redox centers of the same charge types obeys Marcus-Hush theory. The activationless rate limit for all of the ruthenium derivatives except the N-methylpyrazinium complex is 3.9x10{sup 5} s{supmore » -1}. Thermodynamic parameters obtained from nonisothermal differential pulse voltammetry show that the electron-transfer reactions are entropy-driven. The thermodynamic and kinetic effects of phosphate ion binding to the ruthenium center are examined. The rate of intramolecular electron transfer in (NH{sub 3}){sub 4}(isn)Ru{sup III}-Cyt c{sup II} decreases at high pH, with a midpoint at pH 9.1. 28 refs., 4 figs., 3 tabs.« less
Excitation energy transfer in the photosystem I
DOE Office of Scientific and Technical Information (OSTI.GOV)
Webber, Andrew N
2012-09-25
Photosystem I is a multimeric pigment protein complex in plants, green alage and cyanobacteria that functions in series with Photosystem II to use light energy to oxidize water and reduce carbon dioxide. The Photosystem I core complex contains 96 chlorophyll a molecules and 22 carotenoids that are involved in light harvesting and electron transfer. In eucaryotes, PSI also has a peripheral light harvesting complex I (LHCI). The role of specific chlorophylls in excitation and electron transfer are still unresolved. In particular, the role of so-called bridging chlorophylls, located between the bulk antenna and the core electron transfer chain, in themore » transfer of excitation energy to the reaction center are unknown. During the past funding period, site directed mutagenesis has been used to create mutants that effect the physical properties of these key chlorophylls, and to explore how this alters the function of the photosystem. Studying these mutants using ultrafast absorption spectroscopy has led to a better understanding of the process by which excitation energy is transferred from the antenna chlorophylls to the electron transfer chain chlorophylls, and what the role of connecting chlorophylls and A_0 chlorophylls is in this process. We have also used these mutants to investigate whch of the central group of six chlorophylls are involved in the primary steps of charge separation and electron transfer.« less
Dynamics of charge-transfer excitons in type-II semiconductor heterostructures
NASA Astrophysics Data System (ADS)
Stein, M.; Lammers, C.; Richter, P.-H.; Fuchs, C.; Stolz, W.; Koch, M.; Vänskä, O.; Weseloh, M. J.; Kira, M.; Koch, S. W.
2018-03-01
The formation, decay, and coherence properties of charge-transfer excitons in semiconductor heterostructures are investigated by applying four-wave-mixing and terahertz spectroscopy in combination with a predictive microscopic theory. A charge-transfer process is identified where the optically induced coherences decay directly into a charge-transfer electron-hole plasma and exciton states. It is shown that charge-transfer excitons are more sensitive to the fermionic electron-hole substructure than regular excitons.
36 CFR § 1235.44 - What general transfer requirements apply to electronic records?
Code of Federal Regulations, 2013 CFR
2013-07-01
... requirements apply to electronic records? § 1235.44 Section § 1235.44 Parks, Forests, and Public Property NATIONAL ARCHIVES AND RECORDS ADMINISTRATION RECORDS MANAGEMENT TRANSFER OF RECORDS TO THE NATIONAL... requirements apply to electronic records? (a) Each agency must retain a copy of permanent electronic records...
NASA Astrophysics Data System (ADS)
Perlík, Václav; Seibt, Joachim; Cranston, Laura J.; Cogdell, Richard J.; Lincoln, Craig N.; Savolainen, Janne; Šanda, František; Mančal, Tomáš; Hauer, Jürgen
2015-06-01
The initial energy transfer steps in photosynthesis occur on ultrafast timescales. We analyze the carotenoid to bacteriochlorophyll energy transfer in LH2 Marichromatium purpuratum as well as in an artificial light-harvesting dyad system by using transient grating and two-dimensional electronic spectroscopy with 10 fs time resolution. We find that Förster-type models reproduce the experimentally observed 60 fs transfer times, but overestimate coupling constants, which lead to a disagreement with both linear absorption and electronic 2D-spectra. We show that a vibronic model, which treats carotenoid vibrations on both electronic ground and excited states as part of the system's Hamiltonian, reproduces all measured quantities. Importantly, the vibronic model presented here can explain the fast energy transfer rates with only moderate coupling constants, which are in agreement with structure based calculations. Counterintuitively, the vibrational levels on the carotenoid electronic ground state play the central role in the excited state population transfer to bacteriochlorophyll; resonance between the donor-acceptor energy gap and the vibrational ground state energies is the physical basis of the ultrafast energy transfer rates in these systems.
Electron transfer from plastocyanin to photosystem I.
Haehnel, W; Jansen, T; Gause, K; Klösgen, R B; Stahl, B; Michl, D; Huvermann, B; Karas, M; Herrmann, R G
1994-01-01
Mutant plastocyanins with Leu at position 10, 90 or 83 (Gly, Ala and Tyr respectively in wildtype) were constructed by site-specific mutagenesis of the spinach gene, and expressed in transgenic potato plants under the control of the authentic plastocyanin promoter, as well as in Escherichia coli as truncated precursor intermediates carrying the C-terminal 22 amino acid residues of the transit peptide, i.e. the thylakoid-targeting domain that acts as a bacterial export signal. The identity of the purified plastocyanins was verified by matrix-assisted laser desorption/ionization mass spectrometry. The formation of a complex between authentic or mutant spinach plastocyanin and isolated photosystem I and the electron transfer has been studied from the biphasic reduction kinetics of P700+ after excitation with laser flashes. The formation of the complex was abolished by the bulky hydrophobic group of Leu at the respective position of G10 or A90 which are part of the conserved flat hydrophobic surface around the copper ligand H87. The rate of electron transfer decreased by both mutations to < 20% of that found with wildtype plastocyanin. We conclude that the conserved flat surface of plastocyanin represents one of two crucial structural elements for both the docking at photosystem I and the efficient electron transfer via H87 to P700+. The Y83L mutant exhibited faster electron transfer to P700+ than did authentic plastocyanin. This proves that Y83 is not involved in electron transfer to P700 and suggests that electron transfer from cytochrome f and to P700 follows different routes in the plastocyanin molecule. Plastocyanin (Y83L) expressed in either E. coli or potato exhibited different isoelectric points and binding constants to photosystem I indicative of differences in the folding of the protein. The structure of the binding site at photosystem I and the mechanism of electron transfer are discussed. Images PMID:8131737
Phage Conversion for β-Lactam Antibiotic Resistance of Staphylococcus aureus from Foods.
Lee, Young-Duck; Park, Jong-Hyun
2016-02-01
Temperate phages have been suggested to carry virulence factors and other lysogenic conversion genes that play important roles in pathogenicity. In this study, phage TEM123 in wild-type Staphylococcus aureus from food sources was analyzed with respect to its morphology, genome sequence, and antibiotic resistance conversion ability. Phage TEM123 from a mitomycin C-induced lysate of S. aureus was isolated from foods. Morphological analysis under a transmission electron microscope revealed that it belonged to the family Siphoviridae. The genome of phage TEM123 consisted of a double-stranded DNA of 43,786 bp with a G+C content of 34.06%. A bioinformatics analysis of the phage genome identified 43 putative open reading frames (ORFs). ORF1 encoded a protein that was nearly identical to the metallo-β-lactamase enzymes that degrade β-lactam antibiotics. After transduction to S. aureus with phage TEM123, the metallo-β-lactamase gene was confirmed in the transductant by PCR and sequencing analyses. In a β-lactam antibiotic susceptibility test, the transductant was more highly resistant to β-lactam antibiotics than S. aureus S133. Phage TEM123 might play a role in the transfer of β-lactam antibiotic resistance determinants in S. aureus. Therefore, we suggest that the prophage of S. aureus with its exotoxin is a risk factor for food safety in the food chain through lateral gene transfer.
12 CFR 205.7 - Initial disclosures.
Code of Federal Regulations, 2014 CFR
2014-01-01
... TRANSFERS (REGULATION E) § 205.7 Initial disclosures. (a) Timing of disclosures. A financial institution shall make the disclosures required by this section at the time a consumer contracts for an electronic fund transfer service or before the first electronic fund transfer is made involving the consumer's...
12 CFR 205.7 - Initial disclosures.
Code of Federal Regulations, 2010 CFR
2010-01-01
... TRANSFERS (REGULATION E) § 205.7 Initial disclosures. (a) Timing of disclosures. A financial institution shall make the disclosures required by this section at the time a consumer contracts for an electronic fund transfer service or before the first electronic fund transfer is made involving the consumer's...
Genomic analyses of bacterial porin-cytochrome gene clusters
Shi, Liang; Fredrickson, James K.; Zachara, John M.
2014-11-26
In this study, the porin-cytochrome (Pcc) protein complex is responsible for trans-outer membrane electron transfer during extracellular reduction of Fe(III) by the dissimilatory metal-reducing bacterium Geobacter sulfurreducens PCA. The identified and characterized Pcc complex of G. sulfurreducens PCA consists of a porin-like outer-membrane protein, a periplasmic 8-heme c type cytochrome (c-Cyt) and an outer-membrane 12-heme c-Cyt, and the genes encoding the Pcc proteins are clustered in the same regions of genome (i.e., the pcc gene clusters) of G. sulfurreducens PCA. A survey of additionally microbial genomes has identified the pcc gene clusters in all sequenced Geobacter spp. and other bacteriamore » from six different phyla, including Anaeromyxobacter dehalogenans 2CP-1, A. dehalogenans 2CP-C, Anaeromyxobacter sp. K, Candidatus Kuenenia stuttgartiensis, Denitrovibrio acetiphilus DSM 12809, Desulfurispirillum indicum S5, Desulfurivibrio alkaliphilus AHT2, Desulfurobacterium thermolithotrophum DSM 11699, Desulfuromonas acetoxidans DSM 684, Ignavibacterium album JCM 16511, and Thermovibrio ammonificans HB-1. The numbers of genes in the pcc gene clusters vary, ranging from two to nine. Similar to the metal-reducing (Mtr) gene clusters of other Fe(III)-reducing bacteria, such as Shewanella spp., additional genes that encode putative c-Cyts with predicted cellular localizations at the cytoplasmic membrane, periplasm and outer membrane often associate with the pcc gene clusters. This suggests that the Pcc-associated c-Cyts may be part of the pathways for extracellular electron transfer reactions. The presence of pcc gene clusters in the microorganisms that do not reduce solid-phase Fe(III) and Mn(IV) oxides, such as D. alkaliphilus AHT2 and I. album JCM 16511, also suggests that some of the pcc gene clusters may be involved in extracellular electron transfer reactions with the substrates other than Fe(III) and Mn(IV) oxides.« less
Feltus, Frank A; Breen, Joseph R; Deng, Juan; Izard, Ryan S; Konger, Christopher A; Ligon, Walter B; Preuss, Don; Wang, Kuang-Ching
2015-01-01
In the last decade, high-throughput DNA sequencing has become a disruptive technology and pushed the life sciences into a distributed ecosystem of sequence data producers and consumers. Given the power of genomics and declining sequencing costs, biology is an emerging "Big Data" discipline that will soon enter the exabyte data range when all subdisciplines are combined. These datasets must be transferred across commercial and research networks in creative ways since sending data without thought can have serious consequences on data processing time frames. Thus, it is imperative that biologists, bioinformaticians, and information technology engineers recalibrate data processing paradigms to fit this emerging reality. This review attempts to provide a snapshot of Big Data transfer across networks, which is often overlooked by many biologists. Specifically, we discuss four key areas: 1) data transfer networks, protocols, and applications; 2) data transfer security including encryption, access, firewalls, and the Science DMZ; 3) data flow control with software-defined networking; and 4) data storage, staging, archiving and access. A primary intention of this article is to orient the biologist in key aspects of the data transfer process in order to frame their genomics-oriented needs to enterprise IT professionals.
Do pattern recognition skills transfer across sports? A preliminary analysis.
Smeeton, Nicholas J; Ward, Paul; Williams, A Mark
2004-02-01
The ability to recognize patterns of play is fundamental to performance in team sports. While typically assumed to be domain-specific, pattern recognition skills may transfer from one sport to another if similarities exist in the perceptual features and their relations and/or the strategies used to encode and retrieve relevant information. A transfer paradigm was employed to compare skilled and less skilled soccer, field hockey and volleyball players' pattern recognition skills. Participants viewed structured and unstructured action sequences from each sport, half of which were randomly represented with clips not previously seen. The task was to identify previously viewed action sequences quickly and accurately. Transfer of pattern recognition skill was dependent on the participant's skill, sport practised, nature of the task and degree of structure. The skilled soccer and hockey players were quicker than the skilled volleyball players at recognizing structured soccer and hockey action sequences. Performance differences were not observed on the structured volleyball trials between the skilled soccer, field hockey and volleyball players. The skilled field hockey and soccer players were able to transfer perceptual information or strategies between their respective sports. The less skilled participants' results were less clear. Implications for domain-specific expertise, transfer and diversity across domains are discussed.
Extracellular electron transfer mechanisms between microorganisms and minerals
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shi, Liang; Dong, Hailiang; Reguera, Gemma
Electrons can be transferred from microorganisms to multivalent metal ions that are associated with minerals and vice versa. As the microbial cell envelope is neither physically permeable to minerals nor electrically conductive, microorganisms have evolved strategies to exchange electrons with extracellular minerals. In this Review, we discuss the molecular mechanisms that underlie the ability of microorganisms to exchange electrons, such as c-type cytochromes and microbial nanowires, with extracellular minerals and with microorganisms of the same or different species. Microorganisms that have extracellular electron transfer capability can be used for biotechnological applications, including bioremediation, biomining and the production of biofuels andmore » nanomaterials.« less
Li, Jingrui; Kondov, Ivan; Wang, Haobin; Thoss, Michael
2015-04-10
A recently developed methodology to simulate photoinduced electron transfer processes at dye-semiconductor interfaces is outlined. The methodology employs a first-principles-based model Hamiltonian and accurate quantum dynamics simulations using the multilayer multiconfiguration time-dependent Hartree approach. This method is applied to study electron injection in the dye-semiconductor system coumarin 343-TiO2. Specifically, the influence of electronic-vibrational coupling is analyzed. Extending previous work, we consider the influence of Dushinsky rotation of the normal modes as well as anharmonicities of the potential energy surfaces on the electron transfer dynamics.
Tâme Parreira, Renato Luis; Galembeck, Sérgio Emanuel; Hobza, Pavel
2007-01-08
Complexes between formic acid or formate anion and various proton donors (HF, H(2)O, NH(3), and CH(4)) are studied by the MP2 and B3LYP methods with the 6-311++G(3df,3pd) basis set. Formation of a complex is characterized by electron-density transfer from electron donor to ligands. This transfer is much larger with the formate anion, for which it exceeds 0.1 e. Electron-density transfer from electron lone pairs of the electron donor is directed into sigma* antibonding orbitals of X--H bonds of the electron acceptor and leads to elongation of the bond and a red shift of the X--H stretching frequency (standard H-bonding). However, pronounced electron-density transfer from electron lone pairs of the electron donor also leads to reorganization of the electron density in the electron donor, which results in changes in geometry and vibrational frequency. These changes are largest for the C--H bonds of formic acid and formate anion, which do not participate in H-bonding. The resulting blue shift of this stretching frequency is substantial and amounts to almost 35 and 170 cm(-1), respectively.
Other notable protein blotting methods: a brief review.
Kurien, Biji T; Scofield, R Hal
2015-01-01
Proteins have been transferred from the gel to the membrane by a variety of methods. These include vacuum blotting, centrifuge blotting, electroblotting of proteins to Teflon tape and membranes for N- and C-terminal sequence analysis, multiple tissue blotting, a two-step transfer of low- and high-molecular-weight proteins, acid electroblotting onto activated glass, membrane-array method for the detection of human intestinal bacteria in fecal samples, protein microarray using a new black cellulose nitrate support, electrotransfer using square wave alternating voltage for enhanced protein recovery, polyethylene glycol-mediated significant enhancement of the immunoblotting transfer, parallel protein chemical processing before and during western blot and the molecular scanner concept, electronic western blot of matrix-assisted laser desorption/ionization mass spectrometric-identified polypeptides from parallel processed gel-separated proteins, semidry electroblotting of peptides and proteins from acid-urea polyacrylamide gels, transfer of silver-stained proteins from polyacrylamide gels to polyvinylidene difluoride (PVDF) membranes, and the display of K(+) channel proteins on a solid nitrocellulose support for assaying toxin binding. The quantification of proteins bound to PVDF membranes by elution of CBB, clarification of immunoblots on PVDF for transmission densitometry, gold coating of nonconductive membranes before matrix-assisted laser desorption/ionization tandem mass spectrometric analysis to prevent charging effect for analysis of peptides from PVDF membranes, and a simple method for coating native polysaccharides onto nitrocellulose are some of the methods involving either the manipulation of membranes with transferred proteins or just a passive transfer of antigens to membranes. All these methods are briefly reviewed in this chapter.
A brief review of other notable protein blotting methods.
Kurien, Biji T; Scofield, R Hal
2009-01-01
A plethora of methods have been used for transferring proteins from the gel to the membrane. These include centrifuge blotting, electroblotting of proteins to Teflon tape and membranes for N- and C-terminal sequence analysis, multiple tissue blotting, a two-step transfer of low and high molecular weight proteins, blotting of Coomassie Brilliant Blue (CBB)-stained proteins from polyacrylamide gels to transparencies, acid electroblotting onto activated glass, membrane-array method for the detection of human intestinal bacteria in fecal samples, protein microarray using a new black cellulose nitrate support, electrotransfer using square wave alternating voltage for enhanced protein recovery, polyethylene glycol-mediated significant enhancement of the immunoblotting transfer, parallel protein chemical processing before and during western blot and the molecular scanner concept, electronic western blot of matrix-assisted laser desorption/ionization (MALDI) mass spectrometry-identified polypeptides from parallel processed gel-separated proteins, semidry electroblotting of peptides and proteins from acid-urea polyacrylamide gels, transfer of silver-stained proteins from polyacrylamide gels to polyvinylidene difluoride (PVDF) membranes, and the display of K(+) channel proteins on a solid nitrocellulose support for assaying toxin binding. The quantification of proteins bound to PVDF membranes by elution of CBB, clarification of immunoblots on PVDF for transmission densitometry, gold coating of nonconductive membranes before MALDI tandem mass spectrometric analysis to prevent charging effect for analysis of peptides from PVDF membranes, and a simple method for coating native polysaccharides onto nitrocellulose are some of the methods involving either the manipulation of membranes with transferred proteins or just a passive transfer of antigens to membranes. All these methods are briefly reviewed in this chapter.
Iterative learning control with applications in energy generation, lasers and health care
Tutty, O. R.
2016-01-01
Many physical systems make repeated executions of the same finite time duration task. One example is a robot in a factory or warehouse whose task is to collect an object in sequence from a location, transfer it over a finite duration, place it at a specified location or on a moving conveyor and then return for the next one and so on. Iterative learning control was especially developed for systems with this mode of operation and this paper gives an overview of this control design method using relatively recent relevant applications in wind turbines, free-electron lasers and health care, as exemplars to demonstrate its applicability. PMID:27713654
NASA Technical Reports Server (NTRS)
Dietrich, F. J.; Koloboff, G. J.; Martel, R. J.; Johnson, C. C. (Inventor)
1974-01-01
A spin stabilized satellite has an electronically despun antenna array comprising a multiplicity of peripheral antenna elements. A high gain energy beam is established by connecting a suitable fraction or array of the elements in phase. The beam is steered or caused to scan by switching elements in sequence into one end of the array as elements at the other end of the array are switched out. The switching transients normally associated with such steering are avoided by an amplitude control system. Instead of abruptly switching from one element to the next, a fixed value of power is gradually transferred from the element at the trailing edge of the array to the element next to the leading edge.
NASA Technical Reports Server (NTRS)
Endal, A. S.
1975-01-01
The evolution of a star with mass 15 times that of the sun from the zero-age main sequence to neon ignition has been computed by the Henyey method. The hydrogen-rich envelope and all shell sources were explicitly included in the models. An algorithm has been developed for approximating the results of carbon burning, including the branching ratio for the C-12 + C-12 reaction and taking some secondary reactions into account. Penetration of the convective envelope into the core is found to be unimportant during the stages covered by the models. Energy transfer from the carbon-burning shell to the core by degenerate electron conduction becomes important after the core carbon-burning stage. Neon ignition will occur in a semidegenerate core and will lead to a mild 'flash.' Detailed numerical results are given in an appendix. Continuation of the calculations into later stages and variations with the total mass of the star will be discussed in later papers.
Motility and Flagellar Glycosylation in Clostridium difficile▿ †
Twine, Susan M.; Reid, Christopher W.; Aubry, Annie; McMullin, David R.; Fulton, Kelly M.; Austin, John; Logan, Susan M.
2009-01-01
In this study, intact flagellin proteins were purified from strains of Clostridium difficile and analyzed using quadrupole time of flight and linear ion trap mass spectrometers. Top-down studies showed the flagellin proteins to have a mass greater than that predicted from the corresponding gene sequence. These top-down studies revealed marker ions characteristic of glycan modifications. Additionally, diversity in the observed masses of glycan modifications was seen between strains. Electron transfer dissociation mass spectrometry was used to demonstrate that the glycan was attached to the flagellin protein backbone in O linkage via a HexNAc residue in all strains examined. Bioinformatic analysis of C. difficile genomes revealed diversity with respect to glycan biosynthesis gene content within the flagellar biosynthesis locus, likely reflected by the observed flagellar glycan diversity. In C. difficile strain 630, insertional inactivation of a glycosyltransferase gene (CD0240) present in all sequenced genomes resulted in an inability to produce flagellar filaments at the cell surface and only minor amounts of unmodified flagellin protein. PMID:19749038
Domain Evolution and Functional Diversification of Sulfite Reductases
NASA Astrophysics Data System (ADS)
Dhillon, Ashita; Goswami, Sulip; Riley, Monica; Teske, Andreas; Sogin, Mitchell
2005-02-01
Sulfite reductases are key enzymes of assimilatory and dissimilatory sulfur metabolism, which occur in diverse bacterial and archaeal lineages. They share a highly conserved domain "C-X5-C-n-C-X3-C" for binding siroheme and iron-sulfur clusters that facilitate electron transfer to the substrate. For each sulfite reductase cluster, the siroheme-binding domain is positioned slightly differently at the N-terminus of dsrA and dsrB, while in the assimilatory proteins the siroheme domain is located at the C-terminus. Our sequence and phylogenetic analysis of the siroheme-binding domain shows that sulfite reductase sequences diverged from a common ancestor into four separate clusters (aSir, alSir, dsr, and asrC) that are biochemically distinct; each serves a different assimilatory or dissimilatory role in sulfur metabolism. The phylogenetic distribution and functional grouping in sulfite reductase clusters (dsrA and dsrB vs. aSiR, asrC, and alSir) suggest that their functional diversification during evolution may have preceded the bacterial/archaeal divergence.
USING MOLECULAR PROBES TO STUDY INTERFACIAL REDOX REACTION AT FE-BEARING SMECTITES
The interfacial electron transfer of clay-water systems has a wide range of significance in geochemical and biogeochernical environments. However the mechanism of interfacial electron transport is poorly understood. The electron transfer mechanism at the solid-water interfaces of...
Mathes, Tilo; van Stokkum, Ivo H. M.; Stierl, Manuela; Kennis, John T. M.
2012-01-01
Photoinduced electron transfer in biological systems, especially in proteins, is a highly intriguing matter. Its mechanistic details cannot be addressed by structural data obtained by crystallography alone because this provides only static information on a given redox system. In combination with transient spectroscopy and site-directed manipulation of the protein, however, a dynamic molecular picture of the ET process may be obtained. In BLUF (blue light sensors using FAD) photoreceptors, proton-coupled electron transfer between a tyrosine and the flavin cofactor is the key reaction to switch from a dark-adapted to a light-adapted state, which corresponds to the biological signaling state. Particularly puzzling is the fact that, although the various naturally occurring BLUF domains show little difference in the amino acid composition of the flavin binding pocket, the reaction rates of the forward reaction differ quite largely from a few ps up to several hundred ps. In this study, we modified the redox potential of the flavin/tyrosine redox pair by site-directed mutagenesis close to the flavin C2 carbonyl and fluorination of the tyrosine, respectively. We provide information on how changes in the redox potential of either reaction partner significantly influence photoinduced proton-coupled electron transfer. The altered redox potentials allowed us furthermore to experimentally describe an excited state charge transfer intermediately prior to electron transfer in the BLUF photocycle. Additionally, we show that the electron transfer rate directly correlates with the quantum yield of signaling state formation. PMID:22833672
12 CFR 205.11 - Procedures for resolving errors.
Code of Federal Regulations, 2010 CFR
2010-01-01
... institution's findings and shall note the consumer's right to request the documents that the institution... transfer; (ii) An incorrect electronic fund transfer to or from the consumer's account; (iii) The omission... made by the financial institution relating to an electronic fund transfer; (v) The consumer's receipt...
Photoinduced electron transfer in a molecular dyad by nanosecond pump-pump-probe spectroscopy.
Ha-Thi, M-H; Pham, V-T; Pino, T; Maslova, V; Quaranta, A; Lefumeux, C; Leibl, W; Aukauloo, A
2018-06-01
The design of robust and inexpensive molecular photocatalysts for the conversion of abundant stable molecules like H2O and CO2 into an energetic carrier is one of the major fundamental questions for scientists nowadays. The outstanding challenge is to couple single photoinduced charge separation events with the sequential accumulation of redox equivalents at the catalytic unit for performing multielectronic catalytic reactions. Herein, double excitation by nanosecond pump-pump-probe experiments was used to interrogate the photoinduced charge transfer and charge accumulation on a molecular dyad composed of a porphyrin chromophore and a ruthenium-based catalyst in the presence of a reversible electron acceptor. An accumulative charge transfer state is unattainable because of rapid reverse electron transfer to the photosensitizer upon the second excitation and the low driving force of the forward photodriven electron transfer reaction. Such a method allows the fundamental understanding of the relaxation mechanism after two sequential photon absorptions, deciphering the undesired electron transfer reactions that limit the charge accumulation efficiency. This study is a step toward the improvement of synthetic strategies of molecular photocatalysts for light-induced charge accumulation and more generally, for solar energy conversion.
Excited state electron transfer in systems with a well-defined geometry. [cyclophane
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kaufmann, K.J.
1980-12-01
The effect of temperature, dielectric strength and ligand on the structure of the mesopyropheophorbide cyclophanes will be studied. ESR, NMR, emission and absorption spectroscopy, as well as circular dichroism will be used. The changes in structure will be correlated with changes in the photochemical activity. Electron acceptors such as benzoquinone will be utilized to stabilize the charge separation. Charge separation in porphyrin quinone dimers will also be studied. It was found that electron transfer in the cyclophane system is relatively slow. This is presumably due to an orientation requirement for fast electron transfer. Solvent dielectric also is important in producingmore » a charge separation. Decreasing the temperature effects the yield of charge transfer, but not the kinetics.« less
Organohalide Respiration with Chlorinated Ethenes under Low pH Conditions
Yang, Yi; Cápiro, Natalie L.; Marcet, Tyler F.; ...
2017-06-30
Bioremediation at chlorinated solvent sites often leads to groundwater acidification due to electron donor fermentation and enhanced dechlorination activity. The microbial reductive dechlorination process is robust at circumneutral pH, but activity declines at groundwater pH values below 6.0. Consistent with this observation, the activity of tetrachloroethene (PCE) dechlorinating cultures declined at pH 6.0 and was not sustained in pH 5.5 medium, with one notable exception. Sulf urospirillum multivorans dechlorinated PCE to cis-1,2-dichloroethene (cDCE) in pH 5.5 medium and maintained this activity upon repeated transfers. Microcosms established with soil and aquifer materials from five distinct locations dechlorinated PCE-to-ethene at pH 5.5more » and pH 7.2. Dechlorination to ethene was maintained following repeated transfers at pH 7.2, but no ethene was produced at pH 5.5, and only the transfer cultures derived from the Axton Cross Superfund (ACS) microcosms sustained PCE dechlorination to cDCE as a final product. 16S rRNA gene amplicon sequencing of pH 7.2 and pH 5.5 ACS enrichments revealed distinct microbial communities, with the dominant dechlorinator being Dehalococcoides in pH 7.2 and Sulf urospirillum in pH 5.5 cultures. PCE-to-trichloroethene- (TCE-) and PCE-to-cDCEdechlorinating isolates obtained from the ACS pH 5.5 enrichment shared 98.6%, and 98.5% 16S rRNA gene sequence similarities to Sulf urospirillum multivorans. Lastly, these findings imply that sustained Dehalococcoides activity cannot be expected in low pH (i.e., ≤ 5.5) groundwater, and organohalide-respiring Sulf urospirillum spp. are key contributors to in situ PCE reductive dechlorination under low pH conditions.« less
Organohalide Respiration with Chlorinated Ethenes under Low pH Conditions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Yi; Cápiro, Natalie L.; Marcet, Tyler F.
Bioremediation at chlorinated solvent sites often leads to groundwater acidification due to electron donor fermentation and enhanced dechlorination activity. The microbial reductive dechlorination process is robust at circumneutral pH, but activity declines at groundwater pH values below 6.0. Consistent with this observation, the activity of tetrachloroethene (PCE) dechlorinating cultures declined at pH 6.0 and was not sustained in pH 5.5 medium, with one notable exception. Sulf urospirillum multivorans dechlorinated PCE to cis-1,2-dichloroethene (cDCE) in pH 5.5 medium and maintained this activity upon repeated transfers. Microcosms established with soil and aquifer materials from five distinct locations dechlorinated PCE-to-ethene at pH 5.5more » and pH 7.2. Dechlorination to ethene was maintained following repeated transfers at pH 7.2, but no ethene was produced at pH 5.5, and only the transfer cultures derived from the Axton Cross Superfund (ACS) microcosms sustained PCE dechlorination to cDCE as a final product. 16S rRNA gene amplicon sequencing of pH 7.2 and pH 5.5 ACS enrichments revealed distinct microbial communities, with the dominant dechlorinator being Dehalococcoides in pH 7.2 and Sulf urospirillum in pH 5.5 cultures. PCE-to-trichloroethene- (TCE-) and PCE-to-cDCEdechlorinating isolates obtained from the ACS pH 5.5 enrichment shared 98.6%, and 98.5% 16S rRNA gene sequence similarities to Sulf urospirillum multivorans. Lastly, these findings imply that sustained Dehalococcoides activity cannot be expected in low pH (i.e., ≤ 5.5) groundwater, and organohalide-respiring Sulf urospirillum spp. are key contributors to in situ PCE reductive dechlorination under low pH conditions.« less
Microbial evolution of sulphate reduction when lateral gene transfer is geographically restricted.
Chi Fru, E
2011-07-01
Lateral gene transfer (LGT) is an important mechanism by which micro-organisms acquire new functions. This process has been suggested to be central to prokaryotic evolution in various environments. However, the influence of geographical constraints on the evolution of laterally acquired genes in microbial metabolic evolution is not yet well understood. In this study, the influence of geographical isolation on the evolution of laterally acquired dissimilatory sulphite reductase (dsr) gene sequences in the sulphate-reducing micro-organisms (SRM) was investigated. Sequences on four continental blocks related to SRM known to have received dsr by LGT were analysed using standard phylogenetic and multidimensional statistical methods. Sequences related to lineages with large genetic diversity correlated positively with habitat divergence. Those affiliated to Thermodesulfobacterium indicated strong biogeographical delineation; hydrothermal-vent sequences clustered independently from hot-spring sequences. Some of the hydrothermal-vent and hot-spring sequences suggested to have been acquired from a common ancestral source may have diverged upon isolation within distinct habitats. In contrast, analysis of some Desulfotomaculum sequences indicated they could have been transferred from different ancestral sources but converged upon isolation within the same niche. These results hint that, after lateral acquisition of dsr genes, barriers to gene flow probably play a strong role in their subsequent evolution.
Investigating molecule-semiconductor interfaces with nonlinear spectroscopies
NASA Astrophysics Data System (ADS)
Giokas, Paul George
Knowledge of electronic structures and transport mechanisms at molecule-semiconductor interfaces is motivated by their ubiquity in photoelectrochemical cells. In this dissertation, optical spectroscopies are used uncover the influence of electronic coupling, coherent vibrational motion, and molecular geometry, and other factors on dynamics initiated by light absorption at such interfaces. These are explored for a family of ruthenium bipyridyl chromophores bound to titanium dioxide. Transient absorption measurements show molecular singlet state electron injection in 100 fs or less. Resonance Raman intensity analysis suggests the electronic excitations possess very little charge transfer character. The connections drawn in this work between molecular structure and photophysical behavior contribute to the general understanding of photoelectrochemical cells. Knowledge of binding geometry in nanocrystalline films is challenged by heterogeneity of semiconductor surfaces. Polarized resonance Raman spectroscopy is used to characterize the ruthenium chromophore family on single crystal titanium dioxide . Chromophores display a broad distribution of molecular geometries at the interface, with increased variation in binding angle due to the presence of a methylene bridge, as well as additional phosphonate anchors. This result implies multiple binding configurations for chromophores which incorporate multiple phosphonate ligands, and indicates the need for careful consideration when developing surface-assembled chromophore-catalyst cells. Electron transfer transitions occurring on the 100 fs time scale challenge conventional second-order approximations made when modeling these reactions. A fourth-order perturbative model which includes the relationship between coincident electron transfer and nuclear relaxation processes is presented. Insights provided by the model are illustrated for a two-level donor molecule. The presented fourth-order rate formula constitutes a rigorous and intuitive framework for understanding sub-picosecond photoinduced electron transfer dynamics. Charge transfer systems fit by this model include catechol-sensitized titanium dioxide nanoparticles and a closely-related molecular complex. These systems exhibit vibrational coherence coincident with back-electron transfer in the first picosecond after excitation, which suggests that intramolecular nuclear motion strongly influences the electronic transfer process and plays an important role in the dynamics of interfacial systems following light absorption.
Effect of the reflectional symmetry on the coherent hole transport across DNA hairpins
NASA Astrophysics Data System (ADS)
Zarea, Mehdi; Berlin, Yuri; Ratner, Mark A.
2017-03-01
The coherent hole transfer in three types of DNA hairpins containing strands with adenine (A) and guanine (G) nucleobases has been studied. The investigated hairpins involve An+1GGAn, AnGAGAn, or (AG)2nA strands that connect the hole donor and hole acceptor located on opposite ends of hairpins. The positive charge transfer from the photo-excited donor to the acceptor is shown to be slower for An+1GGAn in comparison with AnGAGAn and (AG)2nA sequences. We have revealed that this is due to the reflectional symmetry of the last two sequences with respect to the axis passing through the middle base. As has been demonstrated, the symmetry of the sequence structure manifests itself in the reflectional symmetry of the energy eigenstates. In addition, it has been shown that (AG)2nA is the only symmetric sequence with a zero energy state in the middle of the LUMO tight-binding energy band. Based on our theoretical findings, we predict that the hairpin with this sequence should have the fastest coherent hole transfer rate among the class of base sequences studied.
A Versatile High-Vacuum Cryo-transfer System for Cryo-microscopy and Analytics
Tacke, Sebastian; Krzyzanek, Vladislav; Nüsse, Harald; Wepf, Roger Albert; Klingauf, Jürgen; Reichelt, Rudolf
2016-01-01
Cryogenic microscopy methods have gained increasing popularity, as they offer an unaltered view on the architecture of biological specimens. As a prerequisite, samples must be handled under cryogenic conditions below their recrystallization temperature, and contamination during sample transfer and handling must be prevented. We present a high-vacuum cryo-transfer system that streamlines the entire handling of frozen-hydrated samples from the vitrification process to low temperature imaging for scanning transmission electron microscopy and transmission electron microscopy. A template for cryo-electron microscopy and multimodal cryo-imaging approaches with numerous sample transfer steps is presented. PMID:26910419
NASA Astrophysics Data System (ADS)
Jeong, Hae Jin; Jang, Se Hyeon; Kang, Nam Seon; Yoo, Yeong Du; Kim, Min Jeong; Lee, Kyung Ha; Yoon, Eun Young; Potvin, Éric; Hwang, Yeong Jong; Kim, Jong Im; Seong, Kyeong Ah
2012-03-01
Species belonging to the genus Bysmatrum are peridinoid, thecate, photosynthetic dinoflagellates. The plate formula of Bysmatrum spp., arranged in a Kofoidian series, is almost identical to that of Scrippsiella spp. Bysmatrum spp., which were originally classified as Scrippsiella spp., but were transferred to the genus Bysmatrum spp. because of separation of the intercalary plates 2a and 3a by plate 3'. Whether this transfer from Scrippsiella spp. to Bysmatrum spp. is reasonable should be genetically confirmed. Dinoflagellates were isolated from 2 solar saltons located in western Korea in 2009-2010 and 3 clonal cultures from Sooseong solar saltons and 2 clonal cultures from Garolim solar saltons were successfully established. All of these dinoflagellates were identified as Bysmatrum caponii based on morphology analysis by light and electron microscopy. The plates of all Korean strains of B. caponii were arranged in a Kofoidian series of Po, X, 4', 3a, 7″, 6c, 4s, 5‴, 0 (p), and 24'. When properly aligned, the ribosomal DNA (rDNA) sequences of the 3 Sooseong strains of B. caponii were identical, as were those of the 2 Garolim strains. Furthermore, the sequences of the 3 Sooseong strains were 0.01% different from those of the Garolim strains. However, the sequences of SSU rDNA of these Korean B. caponii strains were 9% different from that of Bysmatrum subsalsum and > 10% from that of any other dinoflagellate thus far reported. In the phylogenetic trees generated using SSU and LSU rDNA sequences, these Korean B. caponii strains formed a clade with B. subsalsum which was clearly divergent from the Scrippsiella clade. However, this Bysmatrum clade was phylogenetically close to the Protoperidinium and/or Peridinium clades. The results of the present study suggest that Bysmatrum spp. are markedly different genetically from Scrippsiella spp..
Prasad, Saumya; Mandal, Imon; Singh, Shubham; Paul, Ashim; Mandal, Bhubaneswar
2017-01-01
Electronic absorption spectra of proteins are primarily characterized over the ultraviolet region (185–320 nm) of the electromagnetic spectrum. While recent studies on peptide aggregates have revealed absorption beyond 350 nm, monomeric proteins lacking aromatic amino acids, disulphide bonds, and active site prosthetic groups are expected to remain optically silent beyond 250 nm. Here, in a joint theoretical and experimental investigation, we report the distinctive UV-Vis absorption spectrum between 250 nm [ε = 7338 M–1 cm–1] and 800 nm [ε = 501 M–1 cm–1] in a synthetic 67 residue protein (α3C), in monomeric form, devoid of aromatic amino acids. Systematic control studies with high concentration non-aromatic amino acid solutions revealed significant absorption beyond 250 nm for charged amino acids which constitute over 50% of the sequence composition in α3C. Classical atomistic molecular dynamics (MD) simulations of α3C reveal dynamic interactions between multiple charged sidechains of Lys and Glu residues present in α3C. Time-dependent density functional theory calculations on charged amino acid residues sampled from the MD trajectories of α3C reveal that the distinctive absorption features of α3C may arise from two different types of charge transfer (CT) transitions involving spatially proximal Lys/Glu amino acids. Specifically, we show that the charged amino (NH3+)/carboxylate (COO–) groups of Lys/Glu sidechains act as electronic charge acceptors/donors for photoinduced electron transfer either from/to the polypeptide backbone or to each other. Further, the sensitivity of the CT spectra to close/far/intermediate range of encounters between sidechains of Lys/Glu owing to the three dimensional protein fold can create the long tail in the α3C absorption profile between 300 and 800 nm. Finally, we experimentally demonstrate the sensitivity of α3C absorption spectrum to temperature and pH-induced changes in protein structure. Taken together, our investigation significantly expands the pool of spectroscopically active biomolecular chromophores and adds an optical 250–800 nm spectral window, which we term ProCharTS (Protein Charge Transfer Spectra), for label free probes of biomolecular structure and dynamics. PMID:28970921
Impact of fulvic acids on bio-methanogenic treatment of municipal solid waste incineration leachate.
Dang, Yan; Lei, Yuqing; Liu, Zhao; Xue, Yiting; Sun, Dezhi; Wang, Li-Ying; Holmes, Dawn E
2016-12-01
A considerable amount of leachate with high fulvic acid (FA) content is generated during the municipal solid waste (MSW) incineration process. This incineration leachate is usually processed by downstream bio-methanogenic treatment. However, few studies have examined the impact that these compounds have on methanogenesis and how they are degraded and transformed during the treatment process. In this study, a laboratory-scale expanded granular sludge bed (EGSB) reactor was operated with MSW incineration leachate containing various concentrations of FA (1500 mg/L to 8000 mg/L) provided as the influent. We found that FA degradation rates decreased from 86% to 72% when FA concentrations in the reactor were increased, and that molecular size, level of humification and aromatization of the residual FA macromolecules all increased after bio-methanogenic treatment. Increasing FA influent concentrations also inhibited growth of hydrogenotrophic methanogens from the genus Methanobacterium and syntrophic bacteria from the genus Syntrophomonas, which resulted in a decrease in methane production and a concomitant increase in CO 2 content in the biogas. Sequences most similar to species from the genus Anaerolinea went up as FA concentrations increased. Bacteria from this genus are capable of extracellular electron transfer and may be using FA as an electron acceptor for growth or as a shuttle for syntrophic exchange with other microorganisms in the reactor. In order to determine whether FA could serve as an electron shuttle to promote syntrophy in an anaerobic digester, co-cultures of Geobacter metallireducens and G. sulfurreducens were grown in the presence of FA from raw leachate or from residual bioreactor effluent. While raw FA stimulated electron transfer between these two bacteria, residual FA did not have any electron shuttling abilities, indicating that FA underwent a significant transformation during the bio-methanogenic treatment process. These results are significant and should be taken into consideration when optimizing anaerobic bioreactors used to treat MSW incineration leachate high in FA content. Copyright © 2016 Elsevier Ltd. All rights reserved.
Wilker, Molly B.; Utterback, James K.; Greene, Sophie; ...
2017-12-08
Complexes of CdS nanorods and [FeFe] hydrogenase from Clostridium acetobutylicum have been shown to photochemically produce H 2. This study examines the role of the ligands that passivate the nanocrystal surfaces in the electron transfer from photoexcited CdS to hydrogenase and the H 2 generation that follows. We functionalized CdS nanorods with a series of mercaptocarboxylate surface-capping ligands of varying lengths and measured their photoexcited electron relaxation by transient absorption (TA) spectroscopy before and after hydrogenase adsorption. Rate constants for electron transfer from the nanocrystals to the enzyme, extracted by modeling of TA kinetics, decrease exponentially with ligand length, suggestingmore » that the ligand layer acts as a barrier to charge transfer and controls the degree of electronic coupling. Relative light-driven H 2 production efficiencies follow the relative quantum efficiencies of electron transfer, revealing the critical role of surface-capping ligands in determining the photochemical activity of these nanocrystal-enzyme complexes. Our results suggest that the H 2 production in this system could be maximized with a choice of a surface-capping ligand that decreases the distance between the nanocrystal surface and the electron injection site of the enzyme.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wilker, Molly B.; Utterback, James K.; Greene, Sophie
Complexes of CdS nanorods and [FeFe] hydrogenase from Clostridium acetobutylicum have been shown to photochemically produce H 2. This study examines the role of the ligands that passivate the nanocrystal surfaces in the electron transfer from photoexcited CdS to hydrogenase and the H 2 generation that follows. We functionalized CdS nanorods with a series of mercaptocarboxylate surface-capping ligands of varying lengths and measured their photoexcited electron relaxation by transient absorption (TA) spectroscopy before and after hydrogenase adsorption. Rate constants for electron transfer from the nanocrystals to the enzyme, extracted by modeling of TA kinetics, decrease exponentially with ligand length, suggestingmore » that the ligand layer acts as a barrier to charge transfer and controls the degree of electronic coupling. Relative light-driven H 2 production efficiencies follow the relative quantum efficiencies of electron transfer, revealing the critical role of surface-capping ligands in determining the photochemical activity of these nanocrystal-enzyme complexes. Our results suggest that the H 2 production in this system could be maximized with a choice of a surface-capping ligand that decreases the distance between the nanocrystal surface and the electron injection site of the enzyme.« less
Electron transfer between colloidal ZnO nanocrystals.
Hayoun, Rebecca; Whitaker, Kelly M; Gamelin, Daniel R; Mayer, James M
2011-03-30
Colloidal ZnO nanocrystals capped with dodecylamine and dissolved in toluene can be charged photochemically to give stable solutions in which electrons are present in the conduction bands of the nanocrystals. These conduction-band electrons are readily monitored by EPR spectroscopy, with g* values that correlate with the nanocrystal sizes. Mixing a solution of charged small nanocrystals (e(-)(CB):ZnO-S) with a solution of uncharged large nanocrystals (ZnO-L) caused changes in the EPR spectrum indicative of quantitative electron transfer from small to large nanocrystals. EPR spectra of the reverse reaction, e(-)(CB):ZnO-L + ZnO-S, showed that electrons do not transfer from large to small nanocrystals. Stopped-flow kinetics studies monitoring the change in the UV band-edge absorption showed that reactions of 50 μM nanocrystals were complete within the 5 ms mixing time of the instrument. Similar results were obtained for the reaction of charged nanocrystals with methyl viologen (MV(2+)). These and related results indicate that the electron-transfer reactions of these colloidal nanocrystals are quantitative and very rapid, despite the presence of ~1.5 nm long dodecylamine capping ligands. These soluble ZnO nanocrystals are thus well-defined redox reagents suitable for studies of electron transfer involving semiconductor nanostructures.
Mukherjee, Puspal; Biswas, Somnath; Sen, Pratik
2015-08-27
Fluorescence quenching studies through steady-state and time-resolved measurements are inadequate to quantify the bimolecular electron transfer rate in bulk homogeneous solution due to constraints from diffusion. To nullify the effect of diffusion, direct evaluation of the rate of formation of a transient intermediate produced upon the electron transfer is essential. Methyl viologen, a well-known electron acceptor, produces a radical cation after accepting an electron, which has a characteristic strong and broad absorption band centered at 600 nm. Hence it is a good choice to evaluate the rate of photoinduced electron transfer reaction employing femtosecond broadband transient absorption spectroscopy. The time constant of the aforementioned process between pyrene and methyl viologen in methanol has been estimated to be 2.5 ± 0.4 ps using the same technique. The time constant for the backward reaction was found to be 14 ± 1 ps. These values did not change with variation of concentration of quencher, i.e., methyl viologen. Hence, we can infer that diffusion has no contribution in the estimation of rate constants. However, on changing the solvent from methanol to ethanol, the time constant of the electron transfer reaction has been found to increase and has accounted for the change in solvent reorganization energy.
Supramolecular networks with electron transfer in two dimensions
Stupp, Samuel I.; Stoddart, J. Fraser; Shveyd, Alexander K.; Tayi, Alok S.; Sue, Chi-Hau; Narayanan, Ashwin
2016-09-13
Organic charge-transfer (CT) co-crystals in a crossed stack system are disclosed. The co-crystals exhibit bidirectional charge transfer interactions where one donor molecule shares electrons with two different acceptors, one acceptor face-to-face and the other edge-to-face. The assembly and charge transfer interaction results in a pleochroic material whereby the optical absorption continuously changes depending on the polarization angle of incident light.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Takeda, Kouta; Matsumura, Hirotoshi; Ishida, Takuya
A pyranose dehydrogenase from Coprinopsis cinerea (CcPDH) is an extracellular quinohemoeprotein, which consists a b-type cytochrome domain, a pyrroloquinoline-quinone (PQQ) domain, and a family 1-type carbohydrate-binding module. The electron transfer reaction of CcPDH was studied using some electron acceptors and a carbon electrode at various pH levels. Phenazine methosulfate (PMS) reacted directly at the PQQ domain, whereas cytochrome c (cyt c) reacted via the cytochrome domain of intact CcPDH. Thus, electrons are transferred from reduced PQQ in the catalytic domain of CcPDH to heme b in the N-terminal cytochrome domain, which acts as a built-in mediator and transfers electron tomore » a heterogenous electron transfer protein. The optimal pH values of the PMS reduction (pH 6.5) and the cyt c reduction (pH 8.5) differ. The catalytic currents for the oxidation of L-fucose were observed within a range of pH 4.5 to 11. Bioelectrocatalysis of CcPDH based on direct electron transfer demonstrated that the pH profile of the biocatalytic current was similar to the reduction activity of cyt c characters. - Highlights: • pH dependencies of activity were different for the reduction of cyt c and DCPIP. • DET-based bioelectrocatalysis of CcPDH was observed. • The similar pH-dependent profile was found with cyt c and electrode. • The present results suggested that IET reaction of CcPDH shows pH dependence.« less
Electron Transfer Strategies Regulate Carbonate Mineral and Micropore Formation.
Zeng, Zhirui; Tice, Michael M
2018-01-01
Some microbial carbonates are robust biosignatures due to their distinct morphologies and compositions. However, whether carbonates induced by microbial iron reduction have such features is unknown. Iron-reducing bacteria use various strategies to transfer electrons to iron oxide minerals (e.g., membrane-bound enzymes, soluble electron shuttles, nanowires, as well as different mechanisms for moving over or attaching to mineral surfaces). This diversity has the potential to create mineral biosignatures through manipulating the microenvironments in which carbonate precipitation occurs. We used Shewanella oneidensis MR-1, Geothrix fermentans, and Geobacter metallireducens GS-15, representing three different strategies, to reduce solid ferric hydroxide in order to evaluate their influence on carbonate and micropore formation (micro-size porosity in mineral rocks). Our results indicate that electron transfer strategies determined the morphology (rhombohedral, spherical, or long-chained) of precipitated calcium-rich siderite by controlling the level of carbonate saturation and the location of carbonate formation. Remarkably, electron transfer strategies also produced distinctive cell-shaped micropores in both carbonate and hydroxide minerals, thus producing suites of features that could potentially serve as biosignatures recording information about the sizes, shapes, and physiologies of iron-reducing organisms. Key Words: Microbial iron reduction-Micropore-Electron transfer strategies-Microbial carbonate. Astrobiology 18, 28-36.
36 CFR § 1235.50 - What specifications and standards for transfer apply to electronic records?
Code of Federal Regulations, 2013 CFR
2013-07-01
... Property NATIONAL ARCHIVES AND RECORDS ADMINISTRATION RECORDS MANAGEMENT TRANSFER OF RECORDS TO THE... Records Administration, Electronic/Special Media Records Services Division (NWME), 8601 Adelphi Road... and Records Administration, Electronic/Special Media Records Services Division (NWME), 8601 Adelphi...
36 CFR 1235.50 - What specifications and standards for transfer apply to electronic records?
Code of Federal Regulations, 2014 CFR
2014-07-01
... Property NATIONAL ARCHIVES AND RECORDS ADMINISTRATION RECORDS MANAGEMENT TRANSFER OF REC- ORDS TO THE... Records Administration, Electronic/Special Media Records Services Division (NWME), 8601 Adelphi Road... and Records Administration, Electronic/Special Media Records Services Division (NWME), 8601 Adelphi...
Liu, Baoshun
2016-04-28
In photocatalysis, it is known that light intensity, organic concentration, and temperature affect the photocatalytic activity by changing the microscopic kinetics of holes and electrons. However, how the microscopic kinetics of holes and electrons relates to the photocatalytic activity was not well known. In the present research, we developed a Monte-Carlo random walking model that involved all of the charge kinetics, including the photo-generation, the recombination, the transport, and the interfacial transfer of holes and electrons, to simulate the overall photocatalytic reaction, which we called a "computer experiment" of photocatalysis. By using this model, we simulated the effect of light intensity, temperature, and organic surface coverage on the photocatalytic activity and the density of the free electrons that accumulate in the simulated system. It was seen that the increase of light intensity increases the electron density and its mobility, which increases the probability for a hole/electron to find an electron/hole for recombination, and consequently led to an apparent kinetics that the quantum yield (QY) decreases with the increase of light intensity. It was also seen that the increase of organic surface coverage could increase the rate of hole interfacial transfer and result in the decrease of the probability for an electron to recombine with a hole. Moreover, the increase of organic coverage on the nano-material surface can also increase the accumulation of electrons, which enhances the mobility for electrons to undergo interfacial transfer, and finally leads to the increase of photocatalytic activity. The simulation showed that the temperature had a more complicated effect, as it can simultaneously change the activation of electrons, the interfacial transfer of holes, and the interfacial transfer of electrons. It was shown that the interfacial transfer of holes might play a main role at low temperature, with the temperature-dependence of QY conforming to the Arrhenius model. The activation of electrons from the traps to the conduction band might become important at high temperature, which accelerates the electron movement for recombination and leads to a temperature dependence of QY that deviates from the Arrhenius model.
Code of Federal Regulations, 2014 CFR
2014-01-01
... to initiate a one-time electronic fund transfer from a consumer's account. The consumer must...-time electronic fund transfer (in providing a check to a merchant or other payee for the MICR encoding... information for the transfer shall also provide a notice to the consumer at the same time it provides the...
Code of Federal Regulations, 2011 CFR
2011-01-01
... to initiate a one-time electronic fund transfer from a consumer's account. The consumer must...-time electronic fund transfer (in providing a check to a merchant or other payee for the MICR encoding... information for the transfer shall also provide a notice to the consumer at the same time it provides the...
Code of Federal Regulations, 2013 CFR
2013-01-01
... to initiate a one-time electronic fund transfer from a consumer's account. The consumer must...-time electronic fund transfer (in providing a check to a merchant or other payee for the MICR encoding... information for the transfer shall also provide a notice to the consumer at the same time it provides the...
Charge-transfer complexes and their role in exciplex emission and near-infrared photovoltaics.
Ng, Tsz-Wai; Lo, Ming-Fai; Fung, Man-Keung; Zhang, Wen-Jun; Lee, Chun-Sing
2014-08-20
Charge transfer and interactions at organic heterojunctions (OHJs) are known to have critical influences on various properties of organic electronic devices. In this Research News article, a short review is given from the electronic viewpoint on how the local molecular interactions and interfacial energetics at P/N OHJs contribute to the recombination/dissociation of electron-hole pairs. Very often, the P-type materials donate electrons to the N-type materials, giving rise to charge-transfer complexes (CTCs) with a P(δ+) -N(δ-) configuration. A recently observed opposite charge-transfer direction in OHJs is also discussed (i.e., N-type material donates electrons to P-type material to form P(δ-) -N(δ+) ). Recent studies on the electronic structures of CTC-forming material pairs are also summarized. The formation of P(δ-) -N(δ+) -type CTCs and their correlations with exciplex emission are examined. Furthermore, the potential applications of CTCs in NIR photovoltaic devices are reviewed. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Canton, Sophie E.; Kjær, Kasper S.; Vankó, György; van Driel, Tim B.; Adachi, Shin-ichi; Bordage, Amélie; Bressler, Christian; Chabera, Pavel; Christensen, Morten; Dohn, Asmus O.; Galler, Andreas; Gawelda, Wojciech; Gosztola, David; Haldrup, Kristoffer; Harlang, Tobias; Liu, Yizhu; Møller, Klaus B.; Németh, Zoltán; Nozawa, Shunsuke; Pápai, Mátyás; Sato, Tokushi; Sato, Takahiro; Suarez-Alcantara, Karina; Togashi, Tadashi; Tono, Kensuke; Uhlig, Jens; Vithanage, Dimali A.; Wärnmark, Kenneth; Yabashi, Makina; Zhang, Jianxin; Sundström, Villy; Nielsen, Martin M.
2015-01-01
Ultrafast photoinduced electron transfer preceding energy equilibration still poses many experimental and conceptual challenges to the optimization of photoconversion since an atomic-scale description has so far been beyond reach. Here we combine femtosecond transient optical absorption spectroscopy with ultrafast X-ray emission spectroscopy and diffuse X-ray scattering at the SACLA facility to track the non-equilibrated electronic and structural dynamics within a bimetallic donor–acceptor complex that contains an optically dark centre. Exploiting the 100-fold increase in temporal resolution as compared with storage ring facilities, these measurements constitute the first X-ray-based visualization of a non-equilibrated intramolecular electron transfer process over large interatomic distances. Experimental and theoretical results establish that mediation through electronically excited molecular states is a key mechanistic feature. The present study demonstrates the extensive potential of femtosecond X-ray techniques as diagnostics of non-adiabatic electron transfer processes in synthetic and biological systems, and some directions for future studies, are outlined. PMID:25727920