NASA Technical Reports Server (NTRS)
Kunze, M. E.
1985-01-01
A systematic investigation was undertaken to characterize population shifts that occur in cultured human embryonic kidney cells as a function of passage number in vitro after original explantation. This approach to cell population shift analysis follows the suggestion of Mehreshi, Klein and Revesz that perturbed cell populations can be characterized by electrophoretic mobility distributions if they contain subpopulations with different electrophoretic mobilities. It was shown that this is the case with early passage cultured human embryo cells.
ERIC Educational Resources Information Center
Heffler, Michael A.; Walters, Ryan D.; Kugel, Jennifer F.
2012-01-01
An undergraduate biochemistry laboratory experiment is described that will teach students the practical and theoretical considerations for measuring the equilibrium dissociation constant (K[subscript D]) for a protein/DNA interaction using electrophoretic mobility shift assays (EMSAs). An EMSA monitors the migration of DNA through a native gel;…
Yousaf, Nasim; Gould, David
2017-01-01
Confirming the binding of a transcription factor with a particular DNA sequence may be important in characterizing interactions with a synthetic promoter. Electrophoretic mobility shift assay is a powerful approach to demonstrate the specific DNA sequence that is bound by a transcription factor and also to confirm the specific transcription factor involved in the interaction. In this chapter we describe a method we have successfully used to demonstrate interactions of endogenous transcription factors with sequences derived from endogenous and synthetic promoters.
Electrophoretic Mobility Shift Assay (EMSA) for Detecting Protein-Nucleic Acid Interactions
Hellman, Lance M.; Fried, Michael G.
2009-01-01
The gel electrophoresis mobility shift assay (EMSA) is used to detect protein complexes with nucleic acids. It is the core technology underlying a wide range of qualitative and quantitative analyses for the characterization of interacting systems. In the classical assay, solutions of protein and nucleic acid are combined and the resulting mixtures are subjected to electrophoresis under native conditions through polyacrylamide or agarose gel. After electrophoresis, the distribution of species containing nucleic acid is determined, usually by autoradiography of 32P-labeled nucleic acid. In general, protein-nucleic acid complexes migrate more slowly than the corresponding free nucleic acid. In this article, we identify the most important factors that determine the stabilities and electrophoretic mobilities of complexes under assay conditions. A representative protocol is provided and commonly used variants are discussed. Expected outcomes are briefly described. References to extensions of the method and a troubleshooting guide are provided. PMID:17703195
Viviano, Jeffrey; Krishnan, Anuradha; Scully, Jenna; Wu, Hao; Venkataraman, Venkat
2016-06-01
In this data article we show the specificity of the Ca(2+)-induced mobility shift in three proteins that belong to the neuronal calcium sensor (NCS) protein family: Hippocalcin, GCAP1 and GCAP2. These proteins did not display a shift in mobility in native gels when incubated with divalent cations other than Ca(2+) - such as Mg(2+), Ba(2+), and Sr(2+), even at 10× concentrations. The data is similar to that obtained with another NCS protein, neurocalcin delta (Viviano et al., 2016, "Electrophoretic Mobility Shift in Native Gels Indicates Calcium-dependent Structural Changes of Neuronal Calcium Sensor Proteins", [1]).
Electrophoretic mobility shift scanning using an automated infrared DNA sequencer.
Sano, M; Ohyama, A; Takase, K; Yamamoto, M; Machida, M
2001-11-01
Electrophoretic mobility shift assay (EMSA) is widely used in the study of sequence-specific DNA-binding proteins, including transcription factors and mismatch binding proteins. We have established a non-radioisotope-based protocol for EMSA that features an automated DNA sequencer with an infrared fluorescent dye (IRDye) detection unit. Our modification of the elec- trophoresis unit, which includes cooling the gel plates with a reduced well-to-read length, has made it possible to detect shifted bands within 1 h. Further, we have developed a rapid ligation-based method for generating IRDye-labeled probes with an approximately 60% cost reduction. This method has the advantages of real-time scanning, stability of labeled probes, and better safety associated with nonradioactive methods of detection. Analysis of a promoter from an industrially important filamentous fungus, Aspergillus oryzae, in a prototype experiment revealed that the method we describe has potential for use in systematic scanning and identification of the functionally important elements to which cellular factors bind in a sequence-specific manner.
Kim, Jong-Yeob; Kim, Hyung-Bae; Jang, Du-Jeon
2013-03-01
Gold nanospheres modified with bifunctional molecules have been separated and characterized by using agarose gel electrophoresis as well as optical spectroscopy and electron microscopy. The electrophoretic mobility of a gold nanosphere capped with 11-mercaptoundecanoic acid (MUA) has been found to depend on the number of MUA molecules per gold nanosphere, indicating that it increases with the surface charge of the nanoparticle. The extinction spectrum of gold nanospheres capped with MUA at an MUA molecules per gold nanosphere value of 1000 and connected via 1,6-hexanedithiol (HDT) decreases by 33% in magnitude and shifts to the red as largely as 22 nm with the increase of the molar ratio of HDT to MUA (R(HM)). Gold nanospheres capped with MUA and connected via HDT have been separated successfully using gel electrophoresis and characterized by measuring reflectance spectra of discrete electrophoretic bands directly in the gel and by monitoring transmission electron microscope images of gold nanoparticles collected from the discrete bands. Electrophoretic mobility has been found to decrease substantially with the increment of HDT to MUA, indicating that the size of aggregated gold nanoparticles increases with the concentration of HDT. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
USDA-ARS?s Scientific Manuscript database
Selenite Se(IV) and selenate Se(VI) selenium adsorption behavior was investigated on gibbsite as a function of solution pH and solution ionic strength. Adsorption of both Se redox states decreased with increasing solution pH. Electrophoretic mobility measurements showed downward shifts in point of...
USDA-ARS?s Scientific Manuscript database
Selenite Se(IV) and selenate Se(VI) adsorption behavior was investigated on gibbsite as a function of solution pH and solution ionic strength. Adsorption of both Se redox states decreased with increasing solution pH. Electrophoretic mobility measurements showed downward shifts in point of zero cha...
Hsieh, Yi-Wen; Alqadah, Amel; Chuang, Chiou-Fen
2016-11-29
Electrophoretic Mobility Shift Assays (EMSA) are an instrumental tool to characterize the interactions between proteins and their target DNA sequences. Radioactivity has been the predominant method of DNA labeling in EMSAs. However, recent advances in fluorescent dyes and scanning methods have prompted the use of fluorescent tagging of DNA as an alternative to radioactivity for the advantages of easy handling, saving time, reducing cost, and improving safety. We have recently used fluorescent EMSA (fEMSA) to successfully address an important biological question. Our fEMSA analysis provides mechanistic insight into the effect of a missense mutation, G73E, in the highly conserved HMG transcription factor SOX-2 on olfactory neuron type diversification. We found that mutant SOX-2 G73E protein alters specific DNA binding activity, thereby causing olfactory neuron identity transformation. Here, we present an optimized and cost-effective step-by-step protocol for fEMSA using infrared fluorescent dye-labeled oligonucleotides containing the LIM-4/SOX-2 adjacent target sites and purified SOX-2 proteins (WT and mutant SOX-2 G73E proteins) as a biological example.
Hisanaga, S; Yasugawa, S; Yamakawa, T; Miyamoto, E; Ikebe, M; Uchiyama, M; Kishimoto, T
1993-06-01
The dephosphorylation-induced interaction of neurofilaments (NFs) with microtubules (MTs) was investigated by using several phosphatases. Escherichia coli alkaline and wheat germ acid phosphatases increased the electrophoretic mobility of NF-H and NF-M by dephosphorylation, and induced the binding of NF-H to MTs. The binding of NFs to MTs was observed only after the electrophoretic mobility of NF-H approached the exhaustively dephosphorylated level when alkaline phosphatase was used. The number of phosphate remaining when NF-H began to bind to MTs was estimated by measuring phosphate bound to NF-H. NF-H did not bind to MTs even when about 40 phosphates from the total of 51 had been removed by alkaline phosphatase. The removal of 6 further phosphates finally resulted in the association of NF-H with MTs. A similar finding, that the restricted phosphorylation sites in the NF-H tail domain, but not the total amount of phosphates, were important for binding to MTs, was also obtained with acid phosphatases. In contrast to alkaline and acid phosphatases, four classes of protein phosphatases (protein phosphatases 1, 2A, 2B, and 2C) were ineffective for shifting the electrophoretic mobility of NF proteins and for inducing the association of NFs to MTs.
2013-01-01
Background Sex presents evolutionary costs and benefits, leading to the expectation that the amount of genetic exchange should vary in conditions with contrasting cost-benefit equations. Like eukaryotes, viruses also engage in sex, but the rate of genetic exchange is often assumed to be a relatively invariant property of a particular virus. However, the rates of genetic exchange can vary within one type of virus according to geography, as highlighted by phylogeographic studies of cystoviruses. Here we merge environmental microbiology with experimental evolution to examine sex in a diverse set of cystoviruses, consisting of the bacteriophage ϕ6 and its relatives. To quantify reassortment we manipulated – by experimental evolution – electrophoretic mobility of intact virus particles for use as a phenotypic marker to estimate genetic exchange. Results We generated descendants of ϕ6 that exhibited fast and slow mobility during gel electrophoresis. We identified mutations associated with slow and fast phenotypes using whole genome sequencing and used crosses to establish the production of hybrids of intermediate mobility. We documented natural variation in electrophoretic mobility among environmental isolates of cystoviruses and used crosses against a common fast mobility ϕ6 strain to monitor the production of hybrids with intermediate mobility, thus estimating the amount of genetic exchange. Cystoviruses from different geographic locations have very different reassortment rates when measured against ϕ6, with viruses isolated from California showing higher reassortment rates than those from the Northeastern US. Conclusions The results confirm that cystoviruses from different geographic locations have remarkably different reassortment rates –despite similar genome structure and replication mechanisms– and that these differences are in large part due to sexual reproduction. This suggests that particular viruses may indeed exhibit diverse sexual behavior, but wide geographic sampling, across varying environmental conditions may be necessary to characterize the full repertoire. Variation in reassortment rates can assist in the delineation of viral populations and is likely to provide insight into important viral evolutionary dynamics including the rate of coinfection, virulence, and host range shifts. Electrophoretic mobility may be an indicator of important determinants of fitness and the techniques herein can be applied to the study of other viruses. PMID:24059872
Siderosomal ferritin. The missing link between ferritin and haemosiderin?
Andrews, S C; Treffry, A; Harrison, P M
1987-01-01
A minor electrophoretically fast component was found in ferritin from iron-loaded rat liver in addition to a major electrophoretically slow ferritin similar to that observed in control rats. The electrophoretically fast ferritin showed immunological identity with the slow component, but on electrophoresis in SDS it gave a peptide of 17.3 kDa, in contrast with the electrophoretically slow ferritin, which gave a major band corresponding to the L-subunit (20.7 kDa). Thus the electrophoretically fast ferritin resembles that reported by Massover [(1985) Biochim. Biophys. Acta 829, 377-386] in livers of mice with short-term parenteral iron overload. The electrophoretically fast ferritin had a lower iron content (2000 Fe atoms/molecule) than the electrophoretically slow ferritin (3000 Fe atoms/molecule). Removal and re-incorporation of iron was possible without effect on the electrophoretic mobility of either ferritin species. On subcellular fractionation the electrophoretically fast ferritin was enriched in pellet fractions and was the sole soluble ferritin isolated from iron-laden secondary lysosomes (siderosomes). The amount and relative proportion of the electrophoretically fast species increased with iron loading. Haemosiderin isolated from siderosomes was found to contain a peptide reactive to anti-ferritin serum and corresponding to the 17.3 kDa peptide of the electrophoretically fast ferritin species. Unlike the electrophoretically slow ferritin, the electrophoretically fast ferritin did not become significantly radioactive in a 1 h biosynthetic labelling experiment. We conclude that the minor ferritin is not, as has been suggested for mouse liver ferritin, 'a completely new species of smaller holoferritin that represents a shift in the ferritin phenotype' in response to siderosis, but a precursor of haemosiderin, in agreement with the proposal by Richter [(1984) Lab. Invest. 50, 26-35] concerning siderosomal ferritin. Images Fig. 1. Fig. 2. Fig. 4. Fig. 5. PMID:3663170
Viviano, Jeffrey; Krishnan, Anuradha; Wu, Hao; Venkataraman, Venkat
2016-02-01
In proteins of the neuronal calcium sensor (NCS) family, changes in structure as well as function are brought about by the binding of calcium. In this article, we demonstrate that these structural changes, solely due to calcium binding, can be assessed through electrophoresis in native gels. The results demonstrate that the NCS proteins undergo ligand-dependent conformational changes that are detectable in native gels as a gradual decrease in mobility with increasing calcium but not other tested divalent cations such as magnesium, strontium, and barium. Surprisingly, such a gradual change over the entire tested range is exhibited only by the NCS proteins but not by other tested calcium-binding proteins such as calmodulin and S100B, indicating that the change in mobility may be linked to a unique NCS family feature--the calcium-myristoyl switch. Even within the NCS family, the changes in mobility are characteristic of the protein, indicating that the technique is sensitive to the individual features of the protein. Thus, electrophoretic mobility on native gels provides a simple and elegant method to investigate calcium (small ligand)-induced structural changes at least in the superfamily of NCS proteins. Copyright © 2015 Elsevier Inc. All rights reserved.
Verrier, C S; Roodi, N; Yee, C J; Bailey, L R; Jensen, R A; Bustin, M; Parl, F F
1997-07-01
The estrogen receptor (ER) belongs to a family of ligand-inducible nuclear receptors that exert their effects by binding to cis-acting DNA elements in the regulatory region of target genes. The detailed mechanisms by which ER interacts with the estrogen response element (ERE) and affects transcription still remain to be elucidated. To study the ER-ERE interaction and transcription initiation, we employed purified recombinant ER expressed in both the baculovirus-Sf9 and his-tagged bacterial systems. The effect of high-mobility group (HMG) protein HMG-1 and purified recombinant TATA-binding protein-associated factor TAF(II)30 on ER-ERE binding and transcription initiation were assessed by electrophoretic mobility shift assay and in vitro transcription from an ERE-containing template (pERE2LovTATA), respectively. We find that purified, recombinant ER fails to bind to ERE in spite of high ligand-binding activity and electrophoretic and immunological properties identical to ER in MCF-7 breast cancer cells. HMG-1 interacts with ER and promotes ER-ERE binding in a concentration- and time-dependent manner. The effectiveness of HMG-1 to stimulate ER-ERE binding in the electrophoretic mobility shift assay depends on the sequence flanking the ERE consensus as well as the position of the latter in the oligonucleotide. We find that TAF(II)30 has no effect on ER-ERE binding either alone or in combination with ER and HMG-1. Although HMG-1 promotes ER-ERE binding, it fails to stimulate transcription initiation either in the presence or absence of hormone. In contrast, TAF(II)30, while not affecting ER-ERE binding, stimulates transcription initiation 20-fold in the presence of HMG-1. These results indicate that HMG-1 and TAF(II)30 act in sequence, the former acting to promote ER-ERE binding followed by the latter to stimulate transcription initiation.
Electrophoretic mobilities of erythrocytes in various buffers
NASA Technical Reports Server (NTRS)
Plank, L. D.; Kunze, M. E.; Todd, P. W.
1985-01-01
The calibration of space flight equipment depends on a source of standard test particles, this test particle of choice is the fixed erythrocyte. Erythrocytes from different species have different electrophoretic mobilities. Electrophoretic mobility depends upon zeta potential, which, in turn depends upon ionic strength. Zeta potential decreases with increasing ionic strength, so cells have high electrophoretic mobility in space electrophoresis buffers than in typical physiological buffers. The electrophoretic mobilities of fixed human, rat, and rabbit erythrocytes in 0.145 M salt and buffers of varying ionic strength, temperature, and composition, to assess the effects of some of the unique combinations used in space buffers were characterized. Several effects were assessed: glycerol or DMSO (dimethylsulfoxide) were considered for use as cryoprotectants. The effect of these substances on erythrocyte electrophoretic mobility was examined. The choice of buffer depended upon cell mobility. Primary experiments with kidney cells established the choice of buffer and cryoprotectant. A nonstandard temperature of EPM in the suitable buffer was determined. A loss of ionic strength control occurs in the course of preparing columns for flight, the effects of small increases in ionic strength over the expected low values need to be evaluated.
NASA Astrophysics Data System (ADS)
Shaparenko, N. O.; Beketova, D. I.; Demidova, M. G.; Bulavchenko, A. I.
2018-05-01
The hydrodynamic diameter and electrophoretic mobility of titania nanoparticles in AOT microemulsions are studied depending on their water content (from 0 to 1.5 vol %), chloroform content in n-decane-chloroform mixture (from 0 to 30 vol %) and temperature (from 0 to 60°C). Considerable changes in diameter (from 20 to 400 nm) are detected upon adding water to the microemulsion. The electrophoretic mobility grows by 2-3 times upon adding chloroform, or as the temperature falls. The observed features allow us to halve the time of electrophoretic concentration for 140 nm TiO2 nanoparticles, and to concentrate 14 nm nanoparticles that do not exhibit electrophoretic mobility in the absence of chloroform.
Electrophoretic cell separation by means of microspheres
NASA Technical Reports Server (NTRS)
Smolka, A. J. K.; Nerren, B. H.; Margel, S.; Rembaum, A.
1979-01-01
The electrophoretic mobility of fixed human erythrocytes immunologically labeled with poly(vinylpyridine) or poly(glutaraldehyde) microspheres was reduced by approximately 40%. This observation was utilized in preparative scale electrophoretic separations of fixed human and turkey erythrocytes, the mobilities of which under normal physiological conditions do not differ sufficiently to allow their separation by continuous flow electrophoresis. We suggest that resolution in the electrophoretic separation of cell subpopulations, currently limited by finite and often overlapping mobility distributions, may be significantly enhanced by immunospecific labeling of target populations using microspheres.
Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S; Prasad, Manoj
2011-10-01
The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncations of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T][T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein.
Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S
2011-01-01
The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncation of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T] [T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein. PMID:21918373
Wangsa-Wirawan, N D; O'Neill, B K; Middelberg, A P
2001-01-01
A knowledge of the physicochemical properties of inclusion bodies is important for the rational design of potential recovery processes such as flotation and precipitation. In this study, measurement of the size and electrophoretic mobility of protein inclusion bodies and cell debris was undertaken. SDS-PAGE analysis of protein inclusion bodies subjected to different cleaning regimes suggested that electrophoretic mobility provides a qualitative measure of protein inclusion body purity. Electrophoretic mobility as a function of electrolyte type and ionic strength was investigated. The presence of divalent ions produced a stronger effect on electrophoretic mobility compared with monovalent ions. The isoelectric point of cell debris was significantly lower than that for the inclusion bodies. Hence, the contaminating cell debris may be separated from inclusion bodies using flotation by exploiting this difference in isoelectric points. Separation by this method is simple, convenient, and a possible alternative to the conventional route of centrifugation.
Affinity Electrophoresis Using Ligands Attached To Polymers
NASA Technical Reports Server (NTRS)
Van Alstine, James M.; Snyder, Robert S.; Harris, J. M.; Brooks, D. E.
1990-01-01
In new technique, reduction of electrophoretic mobilities by addition of polyethylene glycol to ligands increases electrophoretic separabilities. In immuno-affinity electrophoresis, modification of ligands extends specificity of electrophoretic separation to particles having surface electric-charge structures otherwise making them electrophoretically inseparable. Modification of antibodies by polyethylene glycol greatly reduces ability to aggregate while enhancing ability to affect electrophoretic mobilities of cells. In hydrophobic-affinity electrophoresis, addition of polyethylene glycol reduces tendency toward aggregation of cells or macromolecules.
Electrophoretic cell separation by means of immunomicrospheres
NASA Technical Reports Server (NTRS)
Rembaum, A.; Smolka, A. J. K.
1980-01-01
The electrophoretic mobility of fixed human red blood cells immunologically labeled with polymeric (4-vinyl)pyridine or polyglutaraldehyde microspheres was altered to a considerable extent. This observation was utilized in the preparative scale electrophoretic separation of human and turkey fixed red blood cells, whose mobilities under normal physiological conditions do not differ sufficiently to allow their separation by continuous flow electrophoresis. It is suggested that resolution in the electrophoretic separation of cell subpopulations, currently limited by finite and often overlapping mobility distributions, may be significantly enhanced by immuno-specific labeling of target populations using microspheres.
Density gradient electrophoresis of cultured human embryonic kidney cells
NASA Technical Reports Server (NTRS)
Plank, L. D.; Kunze, M. E.; Giranda, V.; Todd, P. W.
1985-01-01
Ground based confirmation of the electrophoretic heterogeneity of human embryonic kidney cell cultures, the general characterization of their electrophoretic migration, and observations on the general properties of cultures derived from electrophoretic subpopulations were studied. Cell migration in a density gradient electrophoresis column and cell electrophoretic mobility was determined. The mobility and heterogeneity of cultured human embryonic kidney cells with those of fixed rat erythrocytes as model test particle was compared. Electrophoretically separated cell subpopulations with respect to size, viability, and culture characteristics were examined.
Electrophoretic mobilities of cultured human embryonic kidney cells in various buffers
NASA Technical Reports Server (NTRS)
1985-01-01
Data on the electrophoretic mobility distributions of cells in the new D-1 buffer and the interlaboratory standardization of urokinase assay methods are presented. A table of cell strains and recent data on cell dispersal methods are also included. It was decided that glycerol in A-1 electrophoretic mobility data on cultured human embryonic kidney cells subjected to electrophoresis in this buffer. The buffer composition is presented.
Wooten, Dennis C; Starr, Clarise R; Lyon, Wanda J
2016-01-01
Different forms of heavy metals affect biochemical systems in characteristic ways that cannot be detected with typical metal analysis methods like atomic absorption spectrometry. Further, using living systems to analyze interaction of heavy metals with biochemical systems can be laborious and unreliable. To generate a reliable easy-to-use biologically-based biosensor system, the entire human metallothionein-II (MT-II) gene was incorporated into a plasmid (pUC57-MT) easily replicated in Escherichia coli. In this system, a commercial polyclonal antibody raised against human metal-responsive transcription factor-1 protein (MTF-1 protein) could modify the electrophoretic migration patterns (i.e. cause specific decreases in agarose gel electrophoretic mobility) of the plasmid in the presence or absence of heavy metals other than zinc (Zn). In the study here, heavy metals, MTF-1 protein, and polyclonal anti-MTF-1 antibody were used to assess pUC57-MT plasmid antibody-assisted electrophoretic mobility. Anti-MTF-1 antibody bound both MTF-1 protein and pUC57-MT plasmid in a non-competitive fashion such that it could be used to differentiate specific heavy metal binding. The results showed that antibody-inhibited plasmid migration was heavy metal level-dependent. Zinc caused a unique mobility shift pattern opposite to that of other metals tested, i.e. Zn blocked the antibody ability to inhibit plasmid migration, despite a greatly increased affinity for DNA by the antibody when Zn was present. The Zn effect was reversed/modified by adding MTF-1 protein. Additionally, antibody inhibition of plasmid mobility was resistant to heat pre-treatment and trypsinization, indicating absence of residual DNA extraction-resistant bacterial DNA binding proteins. DNA binding by anti-DNA antibodies may be commonly enhanced by xenobiotic heavy metals and elevated levels of Zn, thus making them potentially effective tools for assessment of heavy metal bioavailability in aqueous solutions and fluid obtained from metal implant sites.
NASA Astrophysics Data System (ADS)
Karam, Pascal; Pennathur, Sumita
2016-11-01
Characterization of the electrophoretic mobility and zeta potential of micro and nanoparticles is important for assessing properties such as stability, charge and size. In electrophoretic techniques for such characterization, the bulk fluid motion due to the interaction between the fluid and the charged surface must be accounted for. Unlike current industrial systems which rely on DLS and oscillating potentials to mitigate electroosmotic flow (EOF), we propose a simple alternative electrophoretic method for optically determining electrophoretic mobility using a DC electric fields. Specifically, we create a system where an adverse pressure gradient counters EOF, and design the geometry of the channel so that the flow profile of the pressure driven flow matches that of the EOF in large regions of the channel (ie. where we observe particle flow). Our specific COMSOL-optimized geometry is two large cross sectional areas adjacent to a central, high aspect ratio channel. We show that this effectively removes EOF from a large region of the channel and allows for the accurate optical characterization of electrophoretic particle mobility, no matter the wall charge or particle size.
Electrophoretic kinetics of concentrated TiO2 nanoparticle suspensions in aprotic solvent
NASA Astrophysics Data System (ADS)
Lee, So-Yeon; Yim, Jung-Ryoul; Lee, Se-Hee; Choi, In-Suk; Nam, Ki Tae; Joo, Young-Chang
2018-01-01
We studied the dependences of the concentration of additive and particle size on the electrophoretic mobility of TiO2 nanoparticles. A high concentration of TiO2 nanoparticles was dispersed in aprotic solvent, which is similar to the operating conditions of electrophoretic applications. Because spectroscopy has limits to measuring the electrophoretic mobility of concentrated suspensions in aprotic solvents, we developed a new measurement to determine the electrophoretic mobility of particles using the reflectance change according to the motion of the particles. TiO2 nanoparticles with sizes of 31 nm to 164 nm were synthesized by hydrolysis and were dispersed in cyclohexanone with a dye (Sudan Black B) for use in the new measurement method. In a concentrated suspension in aprotic solvent, the mobility of the particles was proportional to the dye concentration and was inversely proportional to the size of the particles. This infers that the particle size influences the drag force rather than the surface charge, and therefore, to increase the mobility by changing the surface charge, an additive is effective. [Figure not available: see fulltext.
Kidney cell electrophoresis, continuing task
NASA Technical Reports Server (NTRS)
Todd, P. W.
1985-01-01
Materials and procedures for microgravity electrophoresis of living human embryonic kidney cells were evaluated to provide ground support in the form of analytical cell electrophoresis and flow cytometry. Preflight culture media, electrophoresis buffer, fraction collection media, temperature profiles, and urokinase assay procedures were tested prior to flight. Electrophoretic mobility distributions of aliquots of the cell population to be fractionated in flight were obtained. Cells were prepared in suspension prior to flight in electrophoresis buffer and 10% calf serum. Electrophoretic separation proceeded in electrophoresis buffer without serum in the Continuous Flow Electrophoretic Separator, and fractions were collected into sample bags containing culture medium and concentrated serum. Fractions that yielded enough progeny cells were analyzed for morphology and electrophoretic mobility distributions. It is noted that the lowest mobility fraction studied produced higher mobility progeny while the other fractions produced progeny cells with mobilities related to the fractions from which they were collected.
Controlled method of reducing electrophoretic mobility of macromolecules, particles, or cells
NASA Technical Reports Server (NTRS)
Vanalstine, James M. (Inventor)
1992-01-01
A method of reducing electrophoretic mobility of macromolecules, particles, cells, and other substances is provided which comprises interacting in a conventional electrophoretic separating procedure, the substances with a polymer-linked affinity compound comprised of a hydrophilic neutral polymer such as polyethylene glycol bound to a second component such as a hydrophobic compound, an immunocompound such as an antibody or antibody active fragment, or a ligand such as a hormone, drug, antigen, or a hapten. The reduction of electrophoretic mobility achieved is directly proportional to the concentration of the polymer-linked affinity compound employed, and such reduction can comprise up to 100 percent for particular particles and cells. The present invention is advantageous in that electrophoretic separation can now be achieved for substances whose native surface charge structure had prevented them from being separated by normal electrophoretic means. Depending on the affinity component utilized, separation can be achieved on the basis of the specific/irreversible, specific/reversible, semi-specific/reversible, relatively nonspecific/reversible, or relatively nonspecific/irreversible ligand-substance interactions.
The surface characteristics of microbial cells directly influence their mobility and behavior within aqueous environments. The cell surface hydrophobicity (CSH) and electrophoretic mobility (EPM) of microbial cells impact a number of interactions and processes including aggregati...
Genomic Instability and Breast Cancer
2011-06-01
Survival Assay—Atotal of 1 103 cells were seeded onto a 60-mm dish in triplicate. Twenty-four hours after seeding, cells were irradiated by using a JL...ShepherdMark I-68A 137Cs- irradiator at indicated doses and incubated for 14 days. Result- ing colonies were fixed and stainedwithCoomassie Blue. Num...antibodies, cell culture, transfection and siRNAs, DNA substrates protein purification in insect cells, electrophoretic mobility shift assay and the ATPase
Harraghy, Niamh; Homerova, Dagmar; Herrmann, Mathias; Kormanec, Jan
2008-01-01
Mapping the transcription start points of the eap, emp, and vwb promoters revealed a conserved octanucleotide sequence (COS). Deleting this sequence abolished the expression of eap, emp, and vwb. However, electrophoretic mobility shift assays gave no evidence that this sequence was a binding site for SarA or SaeR, known regulators of eap and emp.
Oddy, M H; Santiago, J G
2004-01-01
We have developed a method for measuring the electrophoretic mobility of submicrometer, fluorescently labeled particles and the electroosmotic mobility of a microchannel. We derive explicit expressions for the unknown electrophoretic and the electroosmotic mobilities as a function of particle displacements resulting from alternating current (AC) and direct current (DC) applied electric fields. Images of particle displacements are captured using an epifluorescent microscope and a CCD camera. A custom image-processing code was developed to determine image streak lengths associated with AC measurements, and a custom particle tracking velocimetry (PTV) code was devised to determine DC particle displacements. Statistical analysis was applied to relate mobility estimates to measured particle displacement distributions.
Solvent-mediated nonelectrostatic ion-ion interactions predicting anomalies in electrophoresis.
Goswami, Prakash; Dhar, Jayabrata; Ghosh, Uddipta; Chakraborty, Suman
2017-03-01
We study the effects of solvent-mediated nonelectrostatic ion-ion interactions on electrophoretic mobility of a charged spherical particle. To this end, we consider the case of low surface electrostatic potential resulting in the linearization of the governing equations, which enables us to deduce a closed-form analytical solution to the electrophoretic mobility. We subsequently compare our results to the standard model using Henry's approach and report the changes brought about by the nonelectrostatic potential. The classical approach to determine the electrophoretic mobility underpredicts the particle velocity when compared with experiments. We show that this issue can be resolved by taking into account nonelectrostatic interactions. Our analysis further reveals the phenomenon of electrophoretic mobility reversal that has been experimentally observed in numerous previous studies. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Mohamad, Saharuddin Bin; Nagasawa, Hideko; Sasaki, Hideyuki; Uto, Yoshihiro; Nakagawa, Yoshinori; Kawashima, Ken; Hori, Hitoshi
2003-01-01
Gc protein is the precursor for Gc protein-derived macrophage activating factor (GcMAF), with three phenotypes: Gc1f, Gc1s and Gc2, based on its electrophoretic mobility. The difference in electrophoretic mobility is because of the difference in its posttranslational sugar moiety composition. We compared the difference between Gc protein and GcMAF electrophoretic mobility using the isoelectric focusing (IEF) method. The tumoricidal activity of GcMAF-treated macrophage was evaluated after coculture with L-929 cell. The tumoricidal mechanism was investigated using TNF bioassay and nitric oxide (NO) release. The difference in Gc protein and GcMAF electrophoretic mobility was detected. The tumoricidal activity of GcMAF-treated macrophage was detected, but no release of TNF and NO was detected. The difference of isoelectric focusing mobility in Gc protein and GcMAF would be useful to develop a GcMAF detection method. GcMAF increased macrophage tumoricidal activity but TNF and NO release were not involved in the mechanism.
Controlled method of reducing electrophoretic mobility of various substances
NASA Technical Reports Server (NTRS)
Vanalstine, James M. (Inventor)
1989-01-01
A method of reducing electrophoretic mobility of macromolecules, particles, cells, and the like is provided. The method comprises interacting the particles or cells with a polymer-linked affinity compound composed of: a hydrophilic neutral polymer such as polyethylene glycol, and an affinity component consisting of a hydrophobic compound such as a fatty acid ester, an immunocompound such as an antibody or active fragment thereof or simular macromolecule, or other ligands. The reduction of electrophoretic mobility achieved is directly proportional to the concentration of the polymer-linked affinity compound employed, and the mobility reduction obtainable is up to 100 percent for particular particles and cells. The present invention is advantageous in that analytical electrophoretic separation can not be achieved for macromolecules, particles, and cells whose native surface charge structure had prevented them from being separated by normal electrophoretic means. Depending on the affinity component utilized, separation can be achieved on the basis of specific/irreversible, specific/reversible, semi-specific/reversible, relatively nonspecific/reversible, or relatively nonspecific/irreversible ligand-substance interactions. The present method is also advantageous in that it can be used in a variety of standard laboratory electrophoresis equipment.
NASA Technical Reports Server (NTRS)
Williams, K. B.; Kunze, M. E.; Todd, P. W.
1985-01-01
Four major cell types were identified by phase microscopy in early passage human embryonic kidney cell cultures. They are small and large epithelioid, domed, and fenestrated cells. Fibroblasts are also present in some explants. The percent of each cell type changes with passage number as any given culture grows. As a general rule, the fraction of small epithelioid cells increases, while the fraction of fenestrated cells, always small, decreases further. When fibroblasts are present, they always increase in percentage of the total cell population. Electrophoretic separation of early passage cells showed that the domed cells have the highest electrophoretic mobility, fibroblasts have an intermediate high mobility, small epithelioid cells have a low mobility, broadly distributed, and fenestrated cells have the lowest mobility. All cell types were broadly distributed among electrophoretic subfractions, which were never pure but only enriched with respect to a given cell type.
Kovacs, A; Kandala, J C; Weber, K T; Guntaka, R V
1996-01-19
Type I and III fibrillar collagens are the major structural proteins of the extracellular matrix found in various organs including the myocardium. Abnormal and progressive accumulation of fibrillar type I collagen in the interstitial spaces compromises organ function and therefore, the study of transcriptional regulation of this gene and specific targeting of its expression is of major interest. Transient transfection of adult cardiac fibroblasts indicate that the polypurine-polypyrimidine sequence of alpha 1(I) collagen promoter between nucleotides - 200 and -140 represents an overall positive regulatory element. DNase I footprinting and electrophoretic mobility shift assays suggest that multiple factors bind to different elements of this promoter region. We further demonstrate that the unique polypyrimidine sequence between -172 and -138 of the promoter represents a suitable target for a single-stranded polypurine oligonucleotide (TFO) to form a triple helix DNA structure. Modified electrophoretic mobility shift assays show that this TFO specifically inhibits the protein-DNA interaction within the target region. In vitro transcription assays and transient transfection experiments demonstrate that the transcriptional activity of the promoter is inhibited by this oligonucleotide. We propose that TFOs represent a therapeutic potential to specifically influence the expression of alpha 1(I) collagen gene in various disease states where abnormal type I collagen accumulation is known to occur.
1998-06-29
Curcumin DFX Desferrioxamine DNA Deoxyribonucleic Acid DPI Diphenyliodinium DPPD Diphenylphenylenediamine DTH Dithionite EMSA Electrophoretic mobility shift... neuroprotective effects (Fern et al., 1996, Morishita et al., 1 1997). The identification of a hypoxia inducible transcription factor known as HIF-1 (Semenza...derived EPO in the eNS neuroprotective response to hypoxia. Cloning of the human and murine EPO gene, the availability of a convenient EPa producing
Huhn, Carolin; Pyell, Ute
2008-07-11
It is investigated whether those relationships derived within an optimization scheme developed previously to optimize separations in micellar electrokinetic chromatography can be used to model effective electrophoretic mobilities of analytes strongly differing in their properties (polarity and type of interaction with the pseudostationary phase). The modeling is based on two parameter sets: (i) carbon number equivalents or octanol-water partition coefficients as analyte descriptors and (ii) four coefficients describing properties of the separation electrolyte (based on retention data for a homologous series of alkyl phenyl ketones used as reference analytes). The applicability of the proposed model is validated comparing experimental and calculated effective electrophoretic mobilities. The results demonstrate that the model can effectively be used to predict effective electrophoretic mobilities of neutral analytes from the determined carbon number equivalents or from octanol-water partition coefficients provided that the solvation parameters of the analytes of interest are similar to those of the reference analytes.
Application of partition technology to particle electrophoresis
NASA Technical Reports Server (NTRS)
Van Alstine, James M.; Harris, J. Milton; Karr, Laurel J.; Bamberger, Stephan; Matsos, Helen C.; Snyder, Robert S.
1989-01-01
The effects of polymer-ligand concentration on particle electrophoretic mobility and partition in aqueous polymer two-phase systems are investigated. Polymer coating chemistry and affinity ligand synthesis, purification, and analysis are conducted. It is observed that poly (ethylene glycol)-ligands are effective for controlling particle electrophoretic mobility.
ELECTROPHORETIC MOBILITY OF MYCOBACTERIUM AVIUM COMPLEX ORGANISMS
The electrophoretic mobilities (EPMs) of thirty Mycobacterium avium Complex (MAC) organisms isolated from clinical and environmental sources were measured in 9.15 mM KH2PO4 buffered water. The EPMs of fifteen clinical isolates ranged from -1.9 to -5.0 µm cm V-1 ...
ELECTROPHORETIC MOBILITY OF MYCOBACTERIUM AVIUM COMPLEX ORGANISMS
The electrophoretic mobilities (EPMs) of thirty Mycobacterium avium Complex (MAC) organisms were measured. The EPMs of fifteen clinical isolates ranged from -1.9 to -5.0 µm cm V-1s-1, and the EPMs of fifteen environmental isolates ranged from -1...
ELECTROPHORETIC MOBILITIES OF ESCHERICHIA COLI 0157:H7 AND WILD-TYPE ESCHERICHIA COLI STRAINS
The electrophoretic mobility (EPM) of a number of human-virulent and "wild-type" Escherichia coli strains in phosphate buffered water was measured. The impact of pH, ionic strength, cation type (valence) and concentration, and bacterial strain on the EPM was investigated. Resul...
Yamazaki, Yuji; Kubota, Hiroshi; Nozaki, Masami; Nagata, Kazuhiro
2003-08-15
The chaperonin-containing t-complex polypeptide 1 (CCT) is a molecular chaperone that facilitates protein folding in eukaryotic cytosol, and the expression of CCT is highly dependent on cell growth. We show here that transcription of the gene encoding the theta subunit of mouse CCT, Cctq, is regulated by the ternary complex factors (TCFs), Elk-1, Sap-1a, and Net (Sap-2). Reporter gene assay using HeLa cells indicated that the Cctq gene promoter contains a cis-acting element of the CCGGAAGT sequence (CQE1) at -36 bp. The major CQE1-binding proteins in HeLa cell nuclear extract was recognized by anti-Elk-1 or anti-Sap-1a antibodies in electrophoretic mobility shift assay, and recombinant Elk-1, Sap-1a, or Net specifically recognized CQE1. The CQE1-dependent transcriptional activity in HeLa cells was virtually abolished by overexpression of the DNA binding domains of TCFs. Overexpression of full-length TCFs with Ras indicated that exogenous TCFs can regulate the CQE1-dependent transcription in a Ras-dependent manner. PD98059, an inhibitor of MAPK, significantly repressed the CQE1-dependent transcription. However, no serum response factor was detected by electrophoretic mobility shift assay using the CQE1 element. These results indicate that transcription of the Cctq gene is regulated by TCFs under the control of the Ras/MAPK pathway, probably independently of serum response factor.
Molecular-sieve chromatography and electrophoresis in polyacrylamide gels
Morris, C. J. O. R.; Morris, Peggy
1971-01-01
1. The absolute electrophoretic mobilities of eight proteins have been measured at pH8.76, I 0.05, in polyacrylamide gels of 20 different compositions at 10°C. 2. The partition coefficients of these proteins have been determined chromatographically under the same conditions by using columns of granulated polyacrylamide gel prepared simultaneously. 3. The electrophoretic mobilities are an exponential function of the gel concentrations when the latter are corrected for water uptake. The constants of this function have been determined by curvefitting methods. They have been shown to be related to the free solution mobility and to the mean molecular radius respectively. 4. The reduced mobilities have been shown to be a linear function of the partition coefficients by statistical analyses. 5. The physical significance of the relation between electrophoretic mobility and chromatographic phase distribution in gel media is discussed in the context of these results. PMID:5135238
Free-Flow Open-Chamber Electrophoresis
NASA Technical Reports Server (NTRS)
Sharnez, Rizwan; Sammons, David W.
1994-01-01
Free-flow open-chamber electrophoresis variant of free-flow electrophoresis performed in chamber with open ends and in which velocity of electro-osmotic flow adjusted equal to and opposite mean electrophoretic velocity of sample. Particles having electrophoretic mobilities greater than mean mobility of sample particles move toward cathode, those with mobilities less move toward anode. Technique applied to separation of components of mixtures of biologically important substances. Sensitivity enhanced by use of tapered chamber.
Electrophoretic mobility (EPM) of endospores of Bacillus anthracis and surrogates were measured in aqueous solution across a broad pH range and several ionic strengths. EPM values trended around phylogenetic clustering based on the 16S rRNA gene. Measurements reported here prov...
Matsukuma, Shoichi; Yoshihara, Mitsuyo; Kasai, Fumio; Kato, Akinori; Yoshida, Akira; Akaike, Makoto; Kobayashi, Osamu; Nakayama, Haruhiko; Sakuma, Yuji; Yoshida, Tsutomu; Kameda, Yoichi; Tsuchiya, Eiju; Miyagi, Yohei
2006-01-01
A simple and rapid method to detect the epidermal growth factor receptor hot spot mutation L858R in lung adenocarcinoma was developed based on principles similar to the universal heteroduplex generator technology. A single-stranded oligonucleotide with an internal deletion was used to generate heteroduplexes (loop-hybrids) bearing a loop in the complementary strand derived from the polymerase chain reaction product of the normal or mutant allele. By placing deletion in the oligonucleotide adjacent to the mutational site, difference in electrophoretic mobility between loop-hybrids with normal and mutated DNA was distinguishable in a native polyacrylamide gel. The method was also modified to detect in-frame deletion mutations of epidermal growth factor receptor in lung adenocarcinomas. In addition, the method was adapted to detect hot spot mutations in the B-type Raf kinase (BRAF) at V600 and in a Ras-oncogene (NRAS) at Q61, the mutations commonly found in thyroid carcinomas. Our mutation detection system, designated the loop-hybrid mobility shift assay was sensitive enough to detect mutant DNA comprising 7.5% of the total DNA. As a simple and straightforward mutation detection technique, loop-hybrid mobility shift assay may be useful for the molecular diagnosis of certain types of clinical cancers. Other applications are also discussed. PMID:16931592
Malina, Jaroslav; Hannon, Michael J; Brabec, Viktor
2016-07-12
The interaction between the HIV-1 transactivator protein Tat and TAR (transactivation responsive region) RNA, plays a critical role in HIV-1 transcription. Iron(II) supramolecular helicates were evaluated for their in vitro activity to inhibit Tat-TAR RNA interaction using UV melting studies, electrophoretic mobility shift assay, and RNase A footprinting. The results demonstrate that iron(II) supramolecular helicates inhibit Tat-TAR interaction at nanomolar concentrations by binding to TAR RNA. These studies provide a new insight into the biological potential of metallosupramolecular helicates.
Principles of Micellar Electrokinetic Capillary Chromatography Applied in Pharmaceutical Analysis
Hancu, Gabriel; Simon, Brigitta; Rusu, Aura; Mircia, Eleonora; Gyéresi, Árpád
2013-01-01
Since its introduction capillary electrophoresis has shown great potential in areas where electrophoretic techniques have rarely been used before, including here the analysis of pharmaceutical substances. The large majority of pharmaceutical substances are neutral from electrophoretic point of view, consequently separations by the classic capillary zone electrophoresis; where separation is based on the differences between the own electrophoretic mobilities of the analytes; are hard to achieve. Micellar electrokinetic capillary chromatography, a hybrid method that combines chromatographic and electrophoretic separation principles, extends the applicability of capillary electrophoretic methods to neutral analytes. In micellar electrokinetic capillary chromatography, surfactants are added to the buffer solution in concentration above their critical micellar concentrations, consequently micelles are formed; micelles that undergo electrophoretic migration like any other charged particle. The separation is based on the differential partitioning of an analyte between the two-phase system: the mobile aqueous phase and micellar pseudostationary phase. The present paper aims to summarize the basic aspects regarding separation principles and practical applications of micellar electrokinetic capillary chromatography, with particular attention to those relevant in pharmaceutical analysis. PMID:24312804
Palanisami, Akilan; Miller, John H.
2011-01-01
The size and surface chemistry of micron scale particles are of fundamental importance in studies of biology and air particulate pollution. However, typical electrophoretic measurements of these and other sub-micron scale particles (300 nm – 1 μm) cannot resolve size information within heterogeneous mixtures unambiguously. Using optical microscopy, we monitor electrophoretic motion together with the Brownian velocity fluctuations—using the latter to measure size by either the Green-Kubo relation or by calibration from known size standards. Particle diameters are resolved to ±12% with 95% confidence. Strikingly, the size resolution improves as particle size decreases due to the increased Brownian motion. The sizing ability of the Brownian assessed electrophoresis method described here complements the electrophoretic mobility resolution of traditional capillary electrophoresis. PMID:20882556
Lakshmi, G. Girija; Ghosh, Sushmita; Jones, Gabriel P.; Parikh, Roshni; Rawlins, Bridgette A.; Vaughn, Jack C.
2014-01-01
Alternative splicing greatly enhances the diversity of proteins encoded by eukaryotic genomes, and is also important in gene expression control. In contrast to the great depth of knowledge as to molecular mechanisms in the splicing pathway itself, relatively little is known about the regulatory events behind this process. The 5′-UTR and 3′-UTR in pre-mRNAs play a variety of roles in controlling eukaryotic gene expression, including translational modulation, and nearly 4,000 of the roughly 14,000 protein coding genes in Drosophila contain introns of unknown functional significance in their 5′-UTR. Here we report the results of an RNA electrophoretic mobility shift analysis of Drosophila rnp-4f 5′-UTR intron 0 splicing regulatory proteins. The pre-mRNA potential regulatory element consists of an evolutionarily-conserved 177-nt stem-loop arising from pairing of intron 0 with part of adjacent exon 2. Incubation of in vitro transcribed probe with embryo protein extract is shown to result in two shifted RNA-protein bands, and protein extract from a dADAR null mutant fly line results in only one shifted band. A mutated stem-loop in which the conserved exon 2 primary sequence is changed but secondary structure maintained by introducing compensatory base changes results in diminished band shifts. To test the hypothesis that dADAR plays a role in intron splicing regulation in vivo, levels of unspliced rnp-4f mRNA in dADAR mutant were compared to wild-type via real-time qRT-PCR. The results show that during embryogenesis unspliced rnp-4f mRNA levels fall by up to 85% in the mutant, in support of the hypothesis. Taken together, these results demonstrate a novel role for dADAR protein in rnp-4f 5′-UTR alternative intron splicing regulation which is consistent with a previously proposed model. PMID:23026215
Regulation of the aceI multidrug efflux pump gene in Acinetobacter baumannii.
Liu, Qi; Hassan, Karl A; Ashwood, Heather E; Gamage, Hasinika K A H; Li, Liping; Mabbutt, Bridget C; Paulsen, Ian T
2018-06-01
To investigate the function of AceR, a putative transcriptional regulator of the chlorhexidine efflux pump gene aceI in Acinetobacter baumannii. Chlorhexidine susceptibility and chlorhexidine induction of aceI gene expression were determined by MIC and quantitative real-time PCR, respectively, in A. baumannii WT and ΔaceR mutant strains. Recombinant AceR was prepared as both a full-length protein and as a truncated protein, AceR (86-299), i.e. AceRt, which has the DNA-binding domain deleted. The binding interaction of the purified AceR protein and its putative operator region was investigated by electrophoretic mobility shift assays and DNase I footprinting assays. The binding of AceRt with its putative ligand chlorhexidine was examined using surface plasmon resonance and tryptophan fluorescence quenching assays. MIC determination assays indicated that the ΔaceI and ΔaceR mutant strains both showed lower resistance to chlorhexidine than the parental strain. Chlorhexidine-induced expression of aceI was abolished in a ΔaceR background. Electrophoretic mobility shift assays and DNase I footprinting assays demonstrated chlorhexidine-stimulated binding of AceR with two sites upstream of the putative aceI promoter. Surface plasmon resonance and tryptophan fluorescence quenching assays suggested that the purified ligand-binding domain of the AceR protein was able to bind with chlorhexidine with high affinity. This study provides strong evidence that AceR is an activator of aceI gene expression when challenged with chlorhexidine. This study is the first characterization, to our knowledge, of a regulator controlling expression of a PACE family multidrug efflux pump.
Cobalt ferrite nanoparticles with improved aqueous colloidal stability and electrophoretic mobility
DOE Office of Scientific and Technical Information (OSTI.GOV)
Munjal, Sandeep, E-mail: drsandeepmunjal@gmail.com; Khare, Neeraj, E-mail: nkhare@physics.iitd.ernet.in
We have synthesized CoFe{sub 2}O{sub 4} (CFO) nanoparticles of size ∼ 12.2 nm by hydrothermal synthesis method. To control the size of these CFO nanoparticles, oleic acid was used as a surfactant. The inverse spinel phase of the synthesized nanoparticles was confirmed by X-ray diffraction method. As synthesized oleic acid coated CFO (OA@CFO) nanoparticles has very less electrophoretic mobility in the water and are not water dispersible. These OA@CFO nanoparticles were successfully turned into water soluble phase with a better colloidal aqueous stability, through a chemical treatment using citric acid. The modified citric acid coated CFO (CA@CFO) nanoparticles were dispersible inmore » water and form a stable aqueous solution with high electrophoretic mobility.« less
Leung, Jacqueline M.; Tran, Fanny; Pathak, Ravindra B.; Poupart, Séverine; Heaslip, Aoife T.; Ballif, Bryan A.; Westwood, Nicholas J.; Ward, Gary E.
2014-01-01
Motility of the protozoan parasite Toxoplasma gondii plays an important role in the parasite’s life cycle and virulence within animal and human hosts. Motility is driven by a myosin motor complex that is highly conserved across the Phylum Apicomplexa. Two key components of this complex are the class XIV unconventional myosin, TgMyoA, and its associated light chain, TgMLC1. We previously showed that treatment of parasites with a small-molecule inhibitor of T. gondii invasion and motility, tachypleginA, induces an electrophoretic mobility shift of TgMLC1 that is associated with decreased myosin motor activity. However, the direct target(s) of tachypleginA and the molecular basis of the compound-induced TgMLC1 modification were unknown. We show here by “click” chemistry labelling that TgMLC1 is a direct and covalent target of an alkyne-derivatized analogue of tachypleginA. We also show that this analogue can covalently bind to model thiol substrates. The electrophoretic mobility shift induced by another structural analogue, tachypleginA-2, was associated with the formation of a 225.118 Da adduct on S57 and/or C58, and treatment with deuterated tachypleginA-2 confirmed that the adduct was derived from the compound itself. Recombinant TgMLC1 containing a C58S mutation (but not S57A) was refractory to click labelling and no longer exhibited a mobility shift in response to compound treatment, identifying C58 as the site of compound binding on TgMLC1. Finally, a knock-in parasite line expressing the C58S mutation showed decreased sensitivity to compound treatment in a quantitative 3D motility assay. These data strongly support a model in which tachypleginA and its analogues inhibit the motility of T. gondii by binding directly and covalently to C58 of TgMLC1, thereby causing a decrease in the activity of the parasite’s myosin motor. PMID:24892871
Piaggio, Maria V; Peirotti, Marta B; Deiber, Julio A
2007-10-01
Effective electrophoretic mobility data of 20 amino acids reported in the literature are analyzed and interpreted through simple physicochemical models, which are able to provide estimates of coupled quantities like hydrodynamic shape factor, equivalent hydrodynamic radius (size), net charge, actual pK values of ionizing groups, partial charges of ionizing groups, hydration number, and pH near molecule (microenvironment-pH of the BGE). It is concluded that the modeling of the electrophoretic mobility of these analytes requires a careful consideration of hydrodynamic shape coupled to hydration. In the low range of pH studied here, distinctive hydrodynamic behaviors of amino acids are found. For instance, amino acids with basic polar and ionizing side chain remain with prolate shape for pH values varying from 1.99 to 3.2. It is evident that as the pH increases from low values, amino acids get higher hydrations as a consequence each analyte total charge also increases. This result is consistent with the monotonic increase of the hydrodynamic radius, which accounts for both the analyte and the quite immobilized water molecules defining the electrophoretic kinematical unit. It is also found that the actual or effective pK value of the alpha-carboxylic ionizing group of amino acids increases when the pH is changed from 1.99 to 3.2. Several limitations concerning the simple modeling of the electrophoretic mobility of amino acids are presented for further research.
Electrophoretic manipulation of multiple-emulsion droplets
NASA Astrophysics Data System (ADS)
Schoeler, Andreas M.; Josephides, Dimitris N.; Chaurasia, Ankur S.; Sajjadi, Shahriar; Mesquida, Patrick
2014-02-01
Electrophoretic manipulation of multiple-emulsion oil-in-water-in-oil (O/W)/O and water-in-oil-in-water-in-oil (W/O/W)/O core-shell droplets is shown. It was found that the electrophoretic mobility of the droplets is determined solely by the outer water shell, regardless of size or composition of the inner droplets. It was observed that the surface charge of the outer water shell can be changed and the polarity can be reversed through contact with a biased electrode in a similar way as with simple W/O droplets. Furthermore, addition of the anionic surfactant, sodium dodecyl sulfate to the outer water shell reverses the initial polarity and hence, electrophoretic mobility of the core-shell droplets before contact with an electrode. The results have practical implications for the manipulation of oil droplets in a continuous oil phase.
The Cutting Edge of Affinity Electrophoresis Technology
Kinoshita, Eiji; Kinoshita-Kikuta, Emiko; Koike, Tohru
2015-01-01
Affinity electrophoresis is an important technique that is widely used to separate and analyze biomolecules in the fields of biology and medicine. Both quantitative and qualitative information can be gained through affinity electrophoresis. Affinity electrophoresis can be applied through a variety of strategies, such as mobility shift electrophoresis, charge shift electrophoresis or capillary affinity electrophoresis. These strategies are based on changes in the electrophoretic patterns of biological macromolecules that result from interactions or complex-formation processes that induce changes in the size or total charge of the molecules. Nucleic acid fragments can be characterized through their affinity to other molecules, for example transcriptional factor proteins. Hydrophobic membrane proteins can be identified by means of a shift in the mobility induced by a charged detergent. The various strategies have also been used in the estimation of association/disassociation constants. Some of these strategies have similarities to affinity chromatography, in that they use a probe or ligand immobilized on a supported matrix for electrophoresis. Such methods have recently contributed to profiling of major posttranslational modifications of proteins, such as glycosylation or phosphorylation. Here, we describe advances in analytical techniques involving affinity electrophoresis that have appeared during the last five years. PMID:28248262
Kellenberger, Colleen A; Sales-Lee, Jade; Pan, Yuchen; Gassaway, Madalee M; Herr, Amy E; Hammond, Ming C
2015-01-01
Cyclic di-GMP (c-di-GMP) is a second messenger that is important in regulating bacterial physiology and behavior, including motility and virulence. Many questions remain about the role and regulation of this signaling molecule, but current methods of detection are limited by either modest sensitivity or requirements for extensive sample purification. We have taken advantage of a natural, high affinity receptor of c-di-GMP, the Vc2 riboswitch aptamer, to develop a sensitive and rapid electrophoretic mobility shift assay (EMSA) for c-di-GMP quantitation that required minimal engineering of the RNA.
Malina, Jaroslav; Hannon, Michael J.; Brabec, Viktor
2016-01-01
The interaction between the HIV-1 transactivator protein Tat and TAR (transactivation responsive region) RNA, plays a critical role in HIV-1 transcription. Iron(II) supramolecular helicates were evaluated for their in vitro activity to inhibit Tat–TAR RNA interaction using UV melting studies, electrophoretic mobility shift assay, and RNase A footprinting. The results demonstrate that iron(II) supramolecular helicates inhibit Tat-TAR interaction at nanomolar concentrations by binding to TAR RNA. These studies provide a new insight into the biological potential of metallosupramolecular helicates. PMID:27405089
Neu, T R; Verkerke, G J; Herrmann, I F; Schutte, H K; Van der Mei, H C; Busscher, H J
1994-05-01
Silicone rubber voice prostheses are implants which are inserted in a non-sterile environment and therefore become quickly colonized by micro-organisms. The micro-organisms exist on the medical grade silicone rubber as mixed biofilms of bacteria and yeasts. A total of 79 bacterial and 39 yeast strains were isolated from these biofilms by soft ultrasonic treatment. Gram-positive/catalase-negative and Gram-positive/catalase-positive cocci represented the dominant bacterial strains. The yeasts were mainly Candida species. Further characterization of cell surface properties such as hydrophobicity by microbial adhesion to hexadecane and electrophoretic mobility showed a distinct difference when the bacterial strains were compared with the yeasts. The bacterial hydrophobicities ranged from 0 to 100% adhesion to hexadecane, whereas the yeast strains, especially the Candida albicans strains, all had markedly hydrophilic cell surfaces. A comparison of the electrophoretic mobilities showed also differences between bacteria and yeast. The values for the bacteria were found to be between -2.5 to -0.5 (10(-8) m2 V-1 s-1), whereas for the yeasts electrophoretic mobilities were more positive. Based on the adhesive properties of the isolated micro-organisms, strategies can now be developed to modify the properties of the silicone rubber to reduce biofilm formation on such prostheses.
Vega, Juan F.; Vicente-Alique, Ernesto; Núñez-Ramírez, Rafael; Wang, Yang; Martínez-Salazar, Javier
2016-01-01
The stabilization of human papillomavirus type 16 virus-like particles has been examined by means of different techniques including dynamic and static light scattering, transmission electron microscopy and electrophoretic mobility. All these techniques provide different and often complementary perspectives about the aggregation process and generation of stabilized virus-like particles after a period of time of 48 hours at a temperature of 298 K. Interestingly, static light scattering results point towards a clear colloidal instability in the initial systems, as suggested by a negative value of the second virial coefficient. This is likely related to small repulsive electrostatic interactions among the particles, and in agreement with relatively small absolute values of the electrophoretic mobility and, hence, of the net surface charges. At this initial stage the small repulsive interactions are not able to compensate binding interactions, which tend to aggregate the particles. As time proceeds, an increase of the size of the particles is accompanied by strong increases, in absolute values, of the electrophoretic mobility and net surface charge, suggesting enhanced repulsive electrostatic interactions and, consequently, a stabilized colloidal system. These results show that electrophoretic mobility is a useful methodology that can be applied to screen the stabilization factors for virus-like particles during vaccine development. PMID:26885635
Sursyakova, Viktoria V; Burmakina, Galina V; Rubaylo, Anatoly I
2016-08-01
The influence of analyte concentration when compared with the concentration of a charged ligand in background electrolyte (BGE) on the measured values of electrophoretic mobilities and stability constants (association, binding or formation constants) is studied using capillary electrophoresis (CE) and a dynamic mathematical simulator of CE. The study is performed using labile complexes (with fast kinetics) of iron (III) and 5-sulfosalicylate ions (ISC) as an example. It is shown that because the ligand concentration in the analyte zone is not equal to that in BGE, considerable changes in the migration times and electrophoretic mobilities are observed, resulting in systematic errors in the stability constant values. Of crucial significance is the slope of the dependence of the electrophoretic mobility decrease on the ligand equilibrium concentration. Without prior information on this dependence to accurately evaluate the stability constants for similar systems, the total ligand concentration must be at least >50-100 times higher than the total concentration of analyte. Experimental ISC peak fronting and the difference between the direction of the experimental pH dependence of the electrophoretic mobility decrease and the mathematical simulation allow assuming the presence of capillary wall interaction. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Liu, Rongfeng; Liu, Yu-Chih; Meng, Junwei; Zhu, Haiyan; Zhang, Xuehong
2017-11-01
The β-secretase (BACE1) initiates the generation of toxic amyloid-β peptide (Aβ) from amyloid-β precursor protein (APP), which was widely considered to play a key role in the pathogenesis of Alzheimer's disease (AD). Here, a novel microfluidics-based mobility shift assay (MMSA) was developed, validated, and applied for the screening of BACE1 inhibitors for AD. First, the BACE1 activity assay was established with a new fluorescent peptide substrate (FAM-EVNLDAEF) derived from the Swedish mutant APP, and high-quality ratiometric data were generated in both endpoint and kinetic modes by electrophoretic separation of peptide substrate from the BACE1 cleaved product (FAM-EVNL) before fluorescence quantification. To validate the assay, the inhibition and kinetic parameter values of two known inhibitors (AZD3839 and AZD3293) were evaluated, and the results were in good agreement with those reported by other methods. Finally, the assay was applied to screen for new inhibitors from a 900-compound library in a 384-well format, and one novel hit (IC 50 = 26.5 ± 1.5 μM) was identified. Compared with the common fluorescence-based assays, the primary advantage of the direct MMSA was to discover novel BACE1 inhibitors with lower auto-fluorescence interference, and its superb capability for kinetic study. Graphical abstract Microfluidics-based mobility shift assay for BACE1.
Methods for separating particles and/or nucleic acids using isotachophoresis
Jung, Byoungsok; Ness, Kevin; Rose, Klint A.
2016-03-15
According to one embodiment, a method includes co-feeding fluids comprising a leading electrolyte, a trailing electrolyte, and at least one of DNA and RNA to a channel, and applying an electric field to the fluids in a direction perpendicular to an axis of the channel for inducing transverse isotachophoresis. In another embodiment, a method includes co-feeding fluids to a channel. The fluids include a leading electrolyte, a trailing electrolyte, biological objects, at least one of DNA and RNA, and a spacer electrolyte having an electrophoretic mobility that is between an electrophoretic mobility of at least some of the biological objects and an electrophoretic mobility of the at least one of the DNA and the RNA. The method also includes applying an electric field to the fluids in a direction perpendicular to an axis of the channel for inducing transverse isotachophoresis. Other methods of isotachophoresis are disclosed in addition to these.
Nano-colloid electrophoretic transport: Fully explicit modelling via dissipative particle dynamics
NASA Astrophysics Data System (ADS)
Hassanzadeh Afrouzi, Hamid; Farhadi, Mousa; Sedighi, Kurosh; Moshfegh, Abouzar
2018-02-01
In present study, a novel fully explicit approach using dissipative particle dynamics (DPD) method is introduced for modelling electrophoretic transport of nano-colloids in an electrolyte solution. Slater type charge smearing function included in 3D Ewald summation method is employed to treat electrostatic interaction. Moreover, capability of different thermostats are challenged to control the system temperature and study the dynamic response of colloidal electrophoretic mobility under practical ranges of external electric field in nano scale application (0.072 < E < 0.361 v / nm) covering non-linear response regime, and ionic salt concentration (0.049 < SC < 0.69 [M]) covering weak to strong Debye screening of the colloid. The effect of different colloidal repulsions are then studied on temperature, reduced mobility and zeta potential which is computed based on charge distribution within the spherical colloidal EDL. System temperature and electrophoretic mobility both show a direct and inverse relationship respectively with electric field and colloidal repulsion. Mobility declining with colloidal repulsion reaches a plateau which is a relatively constant value at each electrolyte salinity for Aii > 600 in DPD units regardless of electric field intensity. Nosé-Hoover-Lowe-Andersen and Lowe-Andersen thermostats are found to function more effectively under high electric fields (E > 0.145 [ v / nm ]) while thermal equilibrium is maintained. Reasonable agreements are achieved by benchmarking the radial distribution function with available electrolyte structure modellings, as well as comparing reduced mobility against conventional Smoluchowski and Hückel theories, and numerical solution of Poisson-Boltzmann equation.
Han, S H; Yea, S S; Jeon, Y J; Yang, K H; Kaminski, N E
1998-12-01
Transforming growth factor beta1 (TGF-beta1) has been previously shown to modulate interleukin 2 (IL-2) secretion by activated T-cells. In the present studies, we determined that TGF-beta1 induced IL-2 mRNA expression in the murine T-cell line EL4, in the absence of other stimuli. IL-2 mRNA expression was significantly induced by TGF-beta1 (0.1-1 ng/ml) over a relatively narrow concentration range, which led to the induction of IL-2 secretion. Under identical condition, we examined the effect of TGF-beta1 on the activity of nuclear factor AT (NF-AT), nuclear factor kappaB (NF-kappaB), activator protein-1 (AP-1) and octamer, all of which contribute to the regulation of IL-2 gene expression. Electrophoretic mobility shift assays showed that TGF-beta1 markedly increased NF-AT, NF-kappaB and AP-1 binding to their respective cognate DNA binding sites, whereas octamer binding remained constant, as compared with untreated cells. Employing a reporter gene expression system with p(NF-kappaB)3-CAT, p(NF-AT)3-CAT and p(AP-1)3-CAT, TGF-beta1 treatment of transfected EL4 cells induced a dose-related increase in chloramphenicol acetyltransferase activity that correlated well with the DNA binding profile found in the electrophoretic mobility shift assay studies. These results show that TGF-beta1, in the absence of any additional stimuli, up-regulates the activity of key transcription factors involved in IL-2 gene expression, including NF-AT, NF-kappaB and AP-1, to help promote IL-2 mRNA expression by EL4 cells.
Peak capacity and peak capacity per unit time in capillary and microchip zone electrophoresis.
Foley, Joe P; Blackney, Donna M; Ennis, Erin J
2017-11-10
The origins of the peak capacity concept are described and the important contributions to the development of that concept in chromatography and electrophoresis are reviewed. Whereas numerous quantitative expressions have been reported for one- and two-dimensional separations, most are focused on chromatographic separations and few, if any, quantitative unbiased expressions have been developed for capillary or microchip zone electrophoresis. Making the common assumption that longitudinal diffusion is the predominant source of zone broadening in capillary electrophoresis, analytical expressions for the peak capacity are derived, first in terms of migration time, diffusion coefficient, migration distance, and desired resolution, and then in terms of the remaining underlying fundamental parameters (electric field, electroosmotic and electrophoretic mobilities) that determine the migration time. The latter expressions clearly illustrate the direct square root dependence of peak capacity on electric field and migration distance and the inverse square root dependence on solute diffusion coefficient. Conditions that result in a high peak capacity will result in a low peak capacity per unit time and vice-versa. For a given symmetrical range of relative electrophoretic mobilities for co- and counter-electroosmotic species (cations and anions), the peak capacity increases with the square root of the electric field even as the temporal window narrows considerably, resulting in a significant reduction in analysis time. Over a broad relative electrophoretic mobility interval [-0.9, 0.9], an approximately two-fold greater amount of peak capacity can be generated for counter-electroosmotic species although it takes about five-fold longer to do so, consistent with the well-known bias in migration time and resolving power for co- and counter-electroosmotic species. The optimum lower bound of the relative electrophoretic mobility interval [μ r,Z , μ r,A ] that provides the maximum peak capacity per unit time is a simple function of the upper bound, but its direct application is limited to samples with analytes whose electrophoretic mobilities can be varied independently of electroosmotic flow. For samples containing both co- and counter-electroosmotic ions whose electrophoretic mobilities cannot be easily manipulated, comparable levels of peak capacity and peak capacity per unit time for all ions can be obtained by adjusting the EOF to devote the same amount of time to the separation of each class of ions; this corresponds to μ r,Z =-0.5. Copyright © 2017 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Pandey, Harsh; Underhill, Patrick T.
2015-11-01
The electrophoretic mobility of molecules such as λ -DNA depends on the conformation of the molecule. It has been shown that electrohydrodynamic interactions between parts of the molecule lead to a mobility that depends on conformation and can explain some experimental observations. We have developed a new coarse-grained model that incorporates these changes of mobility into a bead-spring chain model. Brownian dynamics simulations have been performed using this model. The model reproduces the cross-stream migration that occurs in capillary electrophoresis when pressure-driven flow is applied parallel or antiparallel to the electric field. The model also reproduces the change of mobility when the molecule is stretched significantly in an extensional field. We find that the conformation-dependent mobility can lead to a new type of unraveling of the molecule in strong fields. This occurs when different parts of the molecule have different mobilities and the electric field is large.
Wahl, Joachim; Furuishi, Takayuki; Yonemochi, Etsuo; Meinel, Lorenz; Holzgrabe, Ulrike
2017-04-01
To optimize chiral separation conditions and to improve the knowledge of enantioseparation, it is important to know the binding constants K between analytes and cyclodextrins and the electrophoretic mobilities of the temporarily formed analyte-cyclodextrin-complexes. K values for complexes between eight phenethylamine enantiomers, namely ephedrine, pseudoephedrine, methylephedrine and norephedrine, and four different β-cyclodextrin derivatives were determined by affinity capillary electrophoresis. The binding constants were calculated from the electrophoretic mobility values of the phenethylamine enantiomers at increasing concentrations of cyclodextrins in running buffer. Three different linear plotting methods (x-reciprocal, y-reciprocal, double reciprocal) and nonlinear regression were used for the determination of binding constants with β-cyclodextrin, (2-hydroxypropyl)-β-cyclodextrin, methyl-β-cyclodextrin and 6-O-α-maltosyl-β-cyclodextrin. The cyclodextrin concentration in a 50 mM phosphate buffer pH 3.0 was varied from 0 to 12 mM. To investigate the influence of the binding constant values on the enantioseparation the observed electrophoretic selectivities were compared with the obtained K values and the calculated enantiomer-cyclodextrin-complex mobilities. The different electrophoretic mobilities of the temporarily formed complexes were crucial factors for the migration order and enantioseparation of ephedrine derivatives. To verify the apparent binding constants determined by capillary electrophoresis, a titration process using ephedrine enantiomers and β-cyclodextrin was carried out. Furthermore, the isothermal titration calorimetry measurements gave information about the thermal properties of the complexes. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Eichmann, Klaus; Braun, Dietmar G.; Feizi, Ten; Krause, Richard M.
1970-01-01
Electrophoretically monodisperse antibody components in rabbit antisera to the carbohydrates of the Groups A and C streptococci have been examined for their individual antigenic specificity. In these antibody components which were isolated by preparative electrophoresis, individual antigenic specificity was confined to the specific antibody and was absent in the nonantibody γ-globulin. Radioprecipitation experiments and the use of immune absorbent columns constructed from goat anti-antisera, which had been absorbed with fraction II, revealed that all the specific antibody in an electrophoretically monodisperse component was reactive with the homologous anti-antibody. Antibodies with either identical or distinct individual antigenic specificities may occur in the same rabbit with repeated immunizations. Antibodies with identical antigenic specificity had identical electrophoretic mobility, whereas antibodies with unrelated antigenic specificities had distinct electrophoretic mobilities. In the interval between immunizations, if antibody to the carbohydrate antigen was absent, there was no detectable antibody with individual antigenic specificity. PMID:4192569
Sherman, M Y; Goldberg, A L
1993-01-01
The "molecular chaperone", dnaK, is induced in Escherichia coli upon heat shock and promotes ATP-dependent refolding or degradation of damaged proteins. When cells were grown at 25 degrees C and disrupted, a small fraction of the dnaK bound to affinity columns containing unfolded polypeptides (e.g., a fusion protein named CRAG or casein) and could be dissociated by ATP-Mg2+. After shifting cells to 42 degrees C for 30 min, up to 5-fold more dnaK bound to these columns than after growth at 25 degrees C. This enhanced binding capacity was reversed after shifting cells back to 25 degrees C. It resulted from a covalent modification, which decreases dnaK's electrophoretic mobility and isoelectric point. This modification appears to be phosphorylation; after treatment with phosphatases, the ATP-eluted dnaK resembled the predominant form in electrophoretic and binding properties. In addition, after incubating cells with [32P]orthophosphate at 42 degrees C, the 32P-labeled dnaK bound quantitatively to the CRAG column, unlike the nonlabeled protein. Thus, the phosphorylated dnaK is a special form of the chaperone with enhanced affinity for unfolded proteins. Its accumulation at high temperatures may account for dnaK's function as the "cellular thermometer." Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 Fig. 7 PMID:8378342
NASA Technical Reports Server (NTRS)
Todd, P.; Morrison, Dennis R.; Barlow, Grant H.; Lewis, Marian L.; Lanham, J. W.; Cleveland, C.; Williams, K.; Kunze, M. E.; Goolsby, C. L.
1988-01-01
Cultures of human embryonic kidney cells consistently contain an electrophoretically separable subpopulation of cells that produce high levels of urokinase and have an electrophoretic mobility about 85 percent as high as that of the most mobile human embryonic kidney cells. This subpopulation is rich in large epithelioid cells that have relatively little internal structure. When resolution and throughput are adequate, free fluid electrophoresis can be used to isolate a broad band of low mobility cells which also produces high levels of plasminogen activators (PAs). In the course of performing this, it was discovered that all electrophoretic subpopulations of cultured human embryonic kidney cells produce some PAs and that separate subpopulations produce high quantities of different types of PA's. This information and the development of sensitive assays for this project have provided new insights into cell secretion mechanisms related to fibrinolysis. These advances would probably not have been made without the NASA program to explore fundamental questions of free fluid electrophoresis in space.
The influence of tetrahydroxyborate ions on the electrophoretic mobility of humic acids was evaluated by capillary electrophoresis (CE). Depending on the molarity of borate ions in the separation buffer, the humic acids exhibit electropherograms with sharp peaks consistently exte...
Electrophoretic purification of cells in space - Evaluation of results from STS-3
NASA Technical Reports Server (NTRS)
Sarnoff, B. E.; Kunze, M. E.; Todd, P.
1983-01-01
The procedure and results of Electrophoresis Equipment Verification Test, designed to examine electrophoretic behavior of animal cells is suspension more concentrated than possible on earth and flown on the Shuttle flight STS-3, were discussed. Ground-based laboratory values of electrophoretic mobilities of a mixture of human and rabbit aldehyde-fixed red blood cells (RBC) were compared with those recorded at 11 minute intervals on the Shuttle STS-3. RBC migration and separation observed through photographic records were not as expected. However, cell mobilities and migrating band profiles were consistent with the results of laboratory simulation experiments. It was concluded that zero G electrophoresis of very high concentrations (1 x 10 to the 9th) is possible and similar to electrophoresis of normal cell concentrations on earth.
Time-dependent electrophoresis of a dielectric spherical particle embedded in Brinkman medium
NASA Astrophysics Data System (ADS)
Saad, E. I.; Faltas, M. S.
2018-04-01
An expression for electrophoretic apparent velocity slip in the time-dependent flow of an electrolyte solution saturated in a charged porous medium within an electric double layer adjacent to a dielectric plate under the influence of a tangential uniform electric field is derived. The velocity slip is used as a boundary condition to solve the electrophoretic motion of an impermeable dielectric spherical particle embedded in an electrolyte solution saturated in porous medium under the unsteady Darcy-Brinkman model. Throughout the system, a uniform electric field is applied and maintains with constant strength. Two cases are considered, when the electric double layer enclosing the particle is thin, but finite and when of a particle with a thick double layer. Expressions for the electrophoretic mobility of the particle as functions of the relevant parameters are found. Our results indicate that the time scale for the growth of mobility is significant and small for high permeability. Generally, the effect of the relaxation time for starting electrophoresis is negligible, irrespective of the thickness of the double layer and permeability of the medium. The effects of the elapsed time, permeability, mass density and Debye length parameters on the fluid velocity, the electrophoretic mobility and the acceleration are shown graphically.
DOE Office of Scientific and Technical Information (OSTI.GOV)
D'Orlye, Fanny; Reiller, Pascal E.
2014-02-15
The physicochemical properties of three different humic substances (HS) are probed using capillary zone electrophoresis in alkaline carbonate buffers, pH 10. Special attention is drawn to the impact of the electrolyte ionic strength and counter-ion nature, chosen within the alkali-metal series, on HS electrophoretic mobility. Taylor-Aris dispersion analysis provides insights into the hydrodynamic radius (R-H) distributions of HS. The smallest characterized entities are of nano-metric dimensions, showing neither ionic strength- nor alkali-metal-induced aggregation. These results are compared with the entities evidenced in dynamic light scattering measurements, the size of which is two order of magnitude higher, ca. 100 nm. Themore » extended Onsager model provides a reasonable description of measured electrophoretic mobilities in the ionic strength range 1-50 mM, thus allowing the estimation of limiting mobilities and ionic charge numbers for the different HS samples. An unexpected HS electrophoretic mobility increase (in absolute value) is observed in the order Li{sup +} ≤ Na{sup +} ≤ K{sup +} ≤ Cs{sup +} and discussed either in terms of retarding forces or in terms of ion-ion interactions. (authors)« less
Rosner, A; Maslenin, L; Spiegel, S
1998-09-01
A method based on differences in electrophoretic mobility of RNA transcripts made from polymerase chain reaction (PCR) products was used for differentiation among virus isolates. A T7 RNA polymerase promoter was attached to amplified prunus necrotic ringspot virus (PNRSV) sequences by PCR. The PCR products then served as a template for transcription. Single-stranded transcripts originated from different PNRSV isolates varied in electrophoretic mobility in polyacrylamide gels, presumably because of transcript conformation polymorphism (TCP). This procedure was applied for the differentiation of PNRSV isolates.
Importance of pH-regulated charge density on the electrophoresis of soft particles
NASA Astrophysics Data System (ADS)
Gopmandal, Partha P.; Ohshima, H.
2017-02-01
The present study deals with the electrophoresis of spherical soft particles consisting of an ion and liquid-penetrable but liquid-flow-impenetrable inner core surrounded by an ion and fluid-penetrable polyelectrolyte layer. The inner core is considered to be dielectric and bearing basic functional group coated with polyelectrolyte layer containing acidic functional group. An approximate expression for the electrophoretic mobility of such a particle is obtained under a low potential limit. The electrophoretic behaviour of the undertaken particle is investigated for a wide range of bulk pH values and electrolyte concentrations. Our study also indicates some remarkable features of the electrophoresis e.g., occurrence of zero mobility, mobility reversal etc.
Apparent electric charge of protein molecules. Human thyroxine - binding proteins.
Hocman, G; Sadlon, J
1977-01-01
1. By comparison of electrophoretic mobilities of two different charged particles under the same conditions the net elementary electrostatic charge of one particle could be calculated when the charge of the other is known. 2. The electrophoretic mobility of human thyroxine - binding globulin does not depend upon the concentration of Tris - HCl buffer in the range 0.05 to 0.20 molar. The value of this mobility is 0.078 and 0.083 cm2 vol(-1) hour(-1) at pH 7.0 and 8.6, respectively. 3. The net elementary electrostatic charge of the human thyroxine - binding globulin appears to be approximately 22 negative elementary electrostatic units in mild alkaline solutions.
Galson, D L; Tsuchiya, T; Tendler, D S; Huang, L E; Ren, Y; Ogura, T; Bunn, H F
1995-04-01
The erythropoietin (Epo) gene is regulated by hypoxia-inducible cis-acting elements in the promoter and in a 3' enhancer, both of which contain consensus hexanucleotide hormone receptor response elements which are important for function. A group of 11 orphan nuclear receptors, transcribed and translated in vitro, were screened by the electrophoretic mobility shift assay. Of these, hepatic nuclear factor 4 (HNF-4), TR2-11, ROR alpha 1, and EAR3/COUP-TF1 bound specifically to the response elements in the Epo promoter and enhancer and, except for ROR alpha 1, formed DNA-protein complexes that had mobilities similar to those observed in nuclear extracts of the Epo-producing cell line Hep3B. Moreover, both anti-HNF-4 and anti-COUP antibodies were able to supershift complexes in Hep3B nuclear extracts. Like Epo, HNF-4 is expressed in kidney, liver, and Hep3B cells but not in HeLa cells. Transfection of a plasmid expressing HNF-4 into HeLa cells enabled an eightfold increase in the hypoxic induction of a luciferase reporter construct which contains the minimal Epo enhancer and Epo promoter, provided that the nuclear hormone receptor consensus DNA elements in both the promoter and the enhancer were intact. The augmentation by HNF-4 in HeLa cells could be abrogated by cotransfection with HNF-4 delta C, which retains the DNA binding domain of HNF-4 but lacks the C-terminal activation domain. Moreover, the hypoxia-induced expression of the endogenous Epo gene was significantly inhibited in Hep3B cells stably transfected with HNF-4 delta C. On the other hand, cotransfection of EAR3/COUP-TF1 and the Epo reporter either with HNF-4 into HeLa cells or alone into Hep3B cells suppressed the hypoxia induction of the Epo reporter. These electrophoretic mobility shift assay and functional experiments indicate that HNF-4 plays a critical positive role in the tissue-specific and hypoxia-inducible expression of the Epo gene, whereas the COUP family has a negative modulatory role.
Electrophoretic properties of BSA-coated quantum dots.
Bücking, Wendelin; Massadeh, Salam; Merkulov, Alexei; Xu, Shu; Nann, Thomas
2010-02-01
Low toxic InP/ZnS quantum dots (QDs), ZnS:Mn(2+)/ZnS nanocrystals and CdSe/ZnS nanoparticles were rendered water-dispersible by different ligand-exchange methods. Eventually, they were coated with bovine serum albumin (BSA) as a model protein. All particles were characterised by isotachophoresis (ITP), laser Doppler velocimetry (LDV) and agarose gel electrophoresis. It was found that the electrophoretic mobility and colloidal stability of ZnS:Mn(2+)/ZnS and CdSe/ZnS nanoparticles, which bore short-chain surface ligands, was primarily governed by charges on the nanoparticles, whereas InP/ZnS nanocrystals were not charged per se. BSA-coated nanoparticles showed lower electrophoretic mobility, which was attributed to their larger size and smaller overall charge. However, these particles were colloidally stable. This stability was probably caused by steric stabilisation of the BSA coating.
Analysis of the regulation of viral transcription.
Gloss, Bernd; Kalantari, Mina; Bernard, Hans-Ulrich
2005-01-01
Despite the small genomes and number of genes of papillomaviruses, regulation of their transcription is very complex and governed by numerous transcription factors, cis-responsive elements, and epigenetic phenomena. This chapter describes the strategies of how one can approach a systematic analysis of these factors, elements, and mechanisms. From the numerous different techniques useful for studying transcription, we describe in detail three selected protocols of approaches that have been relevant in shaping our knowledge of human papillomavirus transcription. These are DNAse I protection ("footprinting") for location of transcription-factor binding sites, electrophoretic mobility shifts ("gelshifts") for analysis of bound transcription factors, and bisulfite sequencing for analysis of DNA methylation as a prerequisite for epigenetic transcriptional regulation.
Usrey, Monica L; Nair, Nitish; Agnew, Daniel E; Pina, Cesar F; Strano, Michael S
2007-07-03
The electrophoretic mobilities of single-walled carbon nanotubes (SWNTs) in agarose gels subjected to negatively charged covalent functionalization and noncovalent anionic surfactant adsorption are compared using a simplified hydrodynamic model. Net charges are calculated on the basis of estimated friction coefficients for cylindrical rodlike particles. The effects of functionalization with negatively charged 4-hydroxybenzene diazonium and anionic sodium cholate are quantified and compared with model predictions. The adsorption of Na+ counterions into the nonionic surfactant layer adsorbed on SWNTs (Triton-X-405) is shown to induce a positive charge and reverse the mobility under select conditions. This effect has not been identified or quantified for nanoparticle systems and may be important in the processing of these systems.
A study of cell electrophoresis as a means of purifying growth hormone secreting cells
NASA Technical Reports Server (NTRS)
Plank, Lindsay D.; Hymer, W. C.; Kunze, M. Elaine; Marks, Gary M.; Lanham, J. Wayne
1983-01-01
Growth hormone secreting cells of the rat anterior pituitary are heavily laden with granules of growth hormone and can be partialy purified on the basis of their resulting high density. Two methods of preparative cell electrophoresis were investigated as methods of enhancing the purification of growth hormone producing cells: density gradient electrophoresis and continuous flow electrophoresis. Both methods provided a two- to four-fold enrichment in growth hormone production per cell relative to that achieved by previous methods. Measurements of electrophoretic mobilities by two analytical methods, microscopic electrophoresis and laser-tracking electrophoresis, revealed very little distinction between unpurified anterior pituitary cell suspensions and somatotroph-enriched cell suspensions. Predictions calculated on the basis of analytical electrophoretic data are consistent with the hypothesis that sedimentation plays a significant role in both types of preparative electrophoresis and the electrophoretic mobility of the growth hormone secreting subpopulation of cells remains unknown.
Rim, Jong S; Kozak, Leslie P
2002-09-13
Thermogenesis against cold exposure in mammals occurs in brown adipose tissue (BAT) through mitochondrial uncoupling protein (UCP1). Expression of the Ucp1 gene is unique in brown adipocytes and is regulated tightly. The 5'-flanking region of the mouse Ucp1 gene contains cis-acting elements including PPRE, TRE, and four half-site cAMP-responsive elements (CRE) with BAT-specific enhancer elements. In the course of analyzing how these half-site CREs are involved in Ucp1 expression, we found that a DNA regulatory element for NF-E2 overlaps CRE2. Electrophoretic mobility shift assay and competition assays with the CRE2 element indicates that nuclear proteins from BAT, inguinal fat, and retroperitoneal fat tissue interact with the CRE2 motif (CGTCA) in a specific manner. A supershift assay using an antibody against the CRE-binding protein (CREB) shows specific affinity to the complex from CRE2 and nuclear extract of BAT. Additionally, Western blot analysis for phospho-CREB/ATF1 shows an increase in phosphorylation of CREB/ATF1 in HIB-1B cells after norepinephrine treatment. Transient transfection assay using luciferase reporter constructs also indicates that the two half-site CREs are involved in transcriptional regulation of Ucp1 in response to norepinephrine and cAMP. We also show that a second DNA regulatory element for NF-E2 is located upstream of the CRE2 region. This element, which is found in a similar location in the 5'-flanking region of the human and rodent Ucp1 genes, shows specific binding to rat and human NF-E2 by electrophoretic mobility shift assay with nuclear extracts from brown fat. Co-transfections with an Nfe2l2 expression vector and a luciferase reporter construct of the Ucp1 enhancer region provide additional evidence that Nfe2l2 is involved in the regulation of Ucp1 by cAMP-mediated signaling.
On-chip Micro- and Nanofluidic Electrokinetic Injection and Separation for PEGylation Analysis
NASA Astrophysics Data System (ADS)
Shelton, Elijah; Baum, Mary; Morse, Dan; Pennathur, Sumita; Pennathur Nanofluidics Laboratory Collaboration; Morse Laboratory Collaboration
2012-11-01
We present an experimental study of micro- and nanofluidic electrokinetic injection and separation in borosilcate channels as a method for characterizing size and zeta potential of biomolecules-specifically polyethlylene glycol (PEG), keyhole limpet hemocyanine (KLH), and pegylated KLH. While pegylation (the conjugation of proteins with PEG) is an established technique for enhancing a protein's therapeutic properties, reliable characterization of these conjugations by traditional analysis techniques (i.e. gel-electrophoresis, zetasizer) remains a challenge. Using a three-step electrokinetic sequence (load, gate, and inject), FITC labeled species and a fluorescein tracer dye are injected into a channel where they separate according to differences in electrophoretic mobility. We find the average absolute mobility of pegylated subunit KLH in 1 micron channels to be 56% that of unpegylated subunit KLH. In a 250 nm channel, we measure a 33% shift in the average absolute mobility of PEG dendrimers as compared to measurements in a 1 micron channel. These results begin to demonstrate how a micro- and nanofluidic-based approach might address the demand for effective and accessible nanoparticle characterization platforms. Supported by the Institute for Collaborative Biotechnologies.
Biochemical analysis of NSs from different tospoviruses.
Hedil, Marcio; de Ronde, Dryas; Kormelink, Richard
2017-10-15
Tospoviruses suppress antiviral RNA interference by coding for an RNA silencing suppressor (NSs) protein. Previously, using NSs-containing crude plant and insect cell extracts, the affinity of NSs for double-stranded (ds)RNA molecules was demonstrated by electrophoretic mobility shifts assays (EMSAs). While NSs from tomato spotted wilt virus (TSWV) and groundnut ringspot virus (GRSV) were able to bind small and long dsRNA molecules, the one from tomato yellow ring virus (TYRV), a distinct Asian tospovirus, only bound small dsRNA. Here, using bacterially expressed and purified NSs from GRSV and TYRV, it is shown that they are both able to bind to small and long dsRNA. Binding of siRNAs by NSs revealed two consecutive shifts, i.e. a first shift at low NSs concentrations followed by a second larger one at higher concentrations. When NSs of TSWV resistance inducing (RI) and resistance breaking (RB) isolates were analyzed using extracts from infected plants only a major siRNA shift was observed. In contrast, plant extracts containing the respective transiently expressed NSs proteins showed only the lower shift with NSs RI but no shift with NSs RB . The observed affinity for RNA duplexes, as well as the two-stepwise shift pattern, is discussed in light of NSs as a suppressor of silencing and its importance for tospovirus infection. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Electrophoretic mobilities of counterions and a polymer in cylindrical pores
Singh, Sunil P.; Muthukumar, M.
2014-01-01
We have simulated the transport properties of a uniformly charged flexible polymer chain and its counterions confined inside cylindrical nanopores under an external electric field. The hydrodynamic interaction is treated by describing the solvent molecules explicitly with the multiparticle collision dynamics method. The chain consisting of charged monomers and the counterions interact electrostatically with themselves and with the external electric field. We find rich behavior of the counterions around the polymer under confinement in the presence of the external electric field. The mobility of the counterions is heterogeneous depending on their location relative to the polymer. The adsorption isotherm of the counterions on the polymer depends nonlinearly on the electric field. As a result, the effective charge of the polymer exhibits a sigmoidal dependence on the electric field. This in turn leads to a nascent nonlinearity in the chain stretching and electrophoretic mobility of the polymer in terms of their dependence on the electric field. The product of the electric field and the effective polymer charge is found to be the key variable to unify our simulation data for various polymer lengths. Chain extension and the electrophoretic mobility show sigmoidal dependence on the electric field, with crossovers from the linear response regime to the nonlinear regime and then to the saturation regime. The mobility of adsorbed counterions is nonmonotonic with the electric field. For weaker and moderate fields, the adsorbed counterions move with the polymer and at higher fields they move opposite to the polymer's direction. We find that the effective charge and the mobility of the polymer decrease with a decrease in the pore radius. PMID:25240366
Probing size-dependent electrokinetics of hematite aggregates
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kedra-Królik, Karolina; Rosso, Kevin M.; Zarzycki, Piotr
Aqueous particle suspensions of many kinds are stabilized by the electrostatic potential developed at their surfaces from reaction with water and ions. An important and less well understood aspect of this stabilization is the dependence of the electrostatic surface potential on particle size. Surface electrostatics are typically probed by measuring particle electrophoretic mobilities and quantified in the electrokinetic potential (f), using commercially available Zeta Potential Analyzers (ZPA). Even though ZPAs provide frequency-spectra (histograms) of electrophoretic mobility and hydrodynamic diameter, typically only the maximal-intensity values are reported, despite the information in the remainder of the spectra. Here we propose a mappingmore » procedure that inter-correlates these histograms to extract additional insight, in this case to probe particle size-dependent electrokinetics. Our method is illustrated for a suspension of prototypical iron (III) oxide (hematite, a-Fe2O3). We found that the electrophoretic mobility and f-potential are a linear function of the aggregate size. By analyzing the distribution of surface site types as a function of aggregate size we show that site coordination increases with increasing aggregate diameter. This observation explains why the acidity of the iron oxide particles decreases with increasing particle size.« less
Makino, K
1997-01-01
The electrical surface properties of biological cells have been studied, which provided us with the fundamental knowledge about the cell surface. The change in shape or biological functions of cells may affect the surface properties and can be detected by electrokinetic measurements. Biological cell surfaces are covered with polysaccharide chains, some are charged and some are not. Some polysaccharides produce a hydrogel matrixes under a proper condition. We thus consider it reasonable that cell surface is approximated by a hydrogel surface. Electrophoretic mobility measurements are useful for studying the surface properties of biological cells suspended as colloidal particles in an electrolyte solution. The electro-osmotic velocity measurements on the other hand are advantageous to the study of the surface properties of slab-shaped biological systems such as membranes. This work was started with a hydrogel, as a model material. As a hydrogel, poly(N-isopropylacrylamide) poly(NIPAAm), abbreviated as hereafter, was chosen, because this hydrogel changes its volume depending on temperature. The dependence of the electrophoretic mobility of latex particles covered with poly(NIPAAm) hydrogel layer or of the electro-osmotic mobility on poly(NIPAAm) plate upon temperature and ionic strength of the dispersing medium was well explained with an electrophoretic mobility formula for "soft particles" developed by Ohshima. The electrokinetic measurements and the explanation of data with an electrophoretic mobility formula for "soft particles" give us information about the surface charge density and the "softness" of soft surfaces. On the basis of the findings with hydrogels, we have discussed the relationship between the changes in shape or function of the biological cells and the change in physicochemical surface properties using these measurements. To study the change in physicochemical properties of the cell surface caused by apoptosis, we have measured the electrophoretic mobilities of intact and apoptotic human promyelocytic leukemia cell lines, HL-60RG cells. We have also studied the differences observed in surface properties of malignant lymphosarcoma cell line, RAW117-P, and its variant, RAW117-H10, with a high metastatic property to the liver. In both cases, the cell surfaces became softer by the changes of biological functions. We have applied electrophoresis and electro-osmosis measurements to the study of the electrokinetic surface properties of rat basophilic leukemia cells, RBL cells. It was also found that the surface of Human umbilical vein endothelial cells, HUVEC, is considerably soft as compared with those of other biological cells we have studied before.
Potential of capillary zone electrophoresis for estimation of humate acid-base properties.
Vanifatova, Natalia G; Zavarzina, Anna G; Spivakov, Boris Ya
2008-03-07
Capillary zone electrophoresis (CZE) has been applied for fractionation and characterization of soil-derived humic acids (HAs). Humic acids from soddy-podzolic (HA(s)) and chernozem (HA(ch)) soils were studied as well as hydrophobic high-molecular-weight (HMW) and hydrophilic low-molecular-weight (LMW) HA(s) fractions obtained by salting-out with ammonium sulfate at a saturation of 0-40% and >70%, respectively. The possibility of CZE partial fractionation of HAs has been demonstrated. The shape of "humic hump" was shown to depend on the pH of running electrolyte. Almost the whole peak overlapping occurred if alkaline solutions were used for fractionation, but the peak resolution was improved at pH 5-7. Under appropriate fractionation conditions (pH 7), at least three humic acid subfractions with different electrophoretic mobilities were distinguished in the electropherograms of initial HA and HA(s) fractions. Such a high peak resolution has never been achieved for humic acids before. The presence of three subfractions in the HA is in agreement with gel-filtration analysis and was confirmed by comparison of the electrophoretic behavior of HA(s) with those of its HMW (hydrophobic) and the LMW (hydrophilic) fractions. The potentiometric titration of HA and its fractions was performed and the pK(a) of the functional groups were calculated. An attempt was made for the first time to relate the variation of electrophoretic mobility values with acid-base properties of humic acids. It was shown that changes in the humate charge resulting from the variation of the ionization degree of its functional groups as a function of pH can be estimated on the basis of electrophoretic mobility values. Potential of CZE in estimation of HA isoelectric point was demonstrated. The pH value corresponding to the lowest absolute electrophoretic mobility value of about 20 x 10(-5) cm(2) V(-1) s(-1) can be used for approximate estimation of HA isoelectric point. The data were discussed and agreement with the random coil structural model has been shown.
Optimal MEMS device for mobility and zeta potential measurements using DC electrophoresis.
Karam, Pascal R; Dukhin, Andrei; Pennathur, Sumita
2017-05-01
We have developed a novel microchannel geometry that allows us to perform simple DC electrophoresis to measure the electrophoretic mobility and zeta potential of analytes and particles. In standard capillary geometries, mobility measurements using DC fields are difficult to perform. Specifically, measurements in open capillaries require knowledge of the hard to measure and often dynamic wall surface potential. Although measurements in closed capillaries eliminate this requirement, the measurements must be performed at infinitesimally small regions of zero flow where the pressure driven-flow completely cancels the electroosmotic flow (Komagata Planes). Furthermore, applied DC fields lead to electrode polarization, further questioning the reliability and accuracy of the measurement. In contrast, our geometry expands and moves the Komagata planes to where velocity gradients are at a minimum, and thus knowledge of the precise location of a Komagata plane is not necessary. Additionally, our microfluidic device prevents electrode polarization because of fluid recirculation around the electrodes. We fabricated our device using standard MEMS fabrication techniques and performed electrophoretic mobility measurements on 500 nm fluorescently tagged polystyrene particles at various buffer concentrations. Results are comparable to two different commercial dynamic light scattering based particle sizing instruments. We conclude with guidelines to further develop this robust electrophoretic tool that allows for facile and efficient particle characterization. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Free-zone electrophoresis of animal cells. 1: Experiments on cell-cell interactions
NASA Technical Reports Server (NTRS)
Todd, P. W.; Hjerten, S.
1985-01-01
The electrophoretically migrating zones wasa monitored. The absence of fluid flows in the direction of migration permits direct measurement of electrophoretic velocities of any material. Sedimentation is orthogonal to electrokinetic motion and the effects of particle-particle interaction on electrophoretic mobility is studied by free zone electrophoresis. Fixed erythrocytes at high concentrations, mixtures of fixed erythrocytes from different animal species, and mixtures of cultured human cells were studied in low ionic strength buffers. The electrophoretic velocity of fixed erythrocytes was not altered by increasing cell concentration or by the mixing of erythrocytes from different species. When zones containing cultured human glial cells and neuroblastoma cells are permitted to interact during electrophoresis, altered migration patterns occur. It is found that cell-cell interactions depends upon cell type.
Kerékgyártó, Márta; Járvás, Gábor; Novák, Levente; Guttman, András
2016-02-01
The activation energy related to the electromigration of oligosaccharides can be determined from their measured electrophoretic mobilities at different temperatures. The effects of a viscosity modifier (ethylene glycol) and a polymeric additive (linear polyacrylamide) on the electrophoretic mobility of linear sugar oligomers with α1-4 linked glucose units (maltooligosaccharides) were studied in CE using the activation energy concept. The electrophoretic separations of 8-aminopyrene-1,3,6-trisulfonate-labeled maltooligosaccharides were monitored by LIF detection in the temperature range of 20-50°C, using either 0-60% ethylene glycol (viscosity modifier) or 0-3% linear polyacrylamide (polymeric additive) containing BGEs. Activation energy curves were constructed based on the slopes of the Arrhenius plots. With the use of linear polyacrylamide additive, solute size-dependent activation energy variations were found for the maltooligosaccharides with polymerization degrees below and above maltoheptaose (DP 7), probably due to molecular conformation changes and possible matrix interaction effects. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Singh, Narendra P; Singh, Udai P; Nagarkatti, Prakash S; Nagarkatti, Mitzi
2012-11-01
Prenatal exposure to diethylstilbestrol (DES) is known to cause altered immune functions and increased susceptibility to autoimmune disease in humans. In the current study, we investigated the effect of prenatal exposure to DES on thymocyte differentiation involving apoptotic pathways. Prenatal DES exposure caused thymic atrophy, apoptosis, and up-regulation of Fas and Fas ligand (FasL) expression in thymocytes. To examine the mechanism underlying DES-mediated regulation of Fas and FasL, we performed luciferase assays using T cells transfected with luciferase reporter constructs containing full-length Fas or FasL promoters. There was significant luciferase induction in the presence of Fas or FasL promoters after DES exposure. Further analysis demonstrated the presence of several cis-regulatory motifs on both Fas and FasL promoters. When DES-induced transcription factors were analyzed, estrogen receptor element (ERE), nuclear factor κB (NF-κB), nuclear factor of activated T cells (NF-AT), and activator protein-1 motifs on the Fas promoter, as well as ERE, NF-κB, and NF-AT motifs on the FasL promoter, showed binding affinity with the transcription factors. Electrophoretic mobility-shift assays were performed to verify the binding affinity of cis-regulatory motifs of Fas or FasL promoters with transcription factors. There was shift in mobility of probes (ERE or NF-κB2) of both Fas and FasL in the presence of nuclear proteins from DES-treated cells, and the shift was specific to DES because these probes failed to shift their mobility in the presence of nuclear proteins from vehicle-treated cells. Together, the current study demonstrates that prenatal exposure to DES triggers significant alterations in apoptotic molecules expressed on thymocytes, which may affect T-cell differentiation and cause long-term effects on the immune functions.
Singh, Narendra P.; Singh, Udai P.; Nagarkatti, Prakash S.
2012-01-01
Prenatal exposure to diethylstilbestrol (DES) is known to cause altered immune functions and increased susceptibility to autoimmune disease in humans. In the current study, we investigated the effect of prenatal exposure to DES on thymocyte differentiation involving apoptotic pathways. Prenatal DES exposure caused thymic atrophy, apoptosis, and up-regulation of Fas and Fas ligand (FasL) expression in thymocytes. To examine the mechanism underlying DES-mediated regulation of Fas and FasL, we performed luciferase assays using T cells transfected with luciferase reporter constructs containing full-length Fas or FasL promoters. There was significant luciferase induction in the presence of Fas or FasL promoters after DES exposure. Further analysis demonstrated the presence of several cis-regulatory motifs on both Fas and FasL promoters. When DES-induced transcription factors were analyzed, estrogen receptor element (ERE), nuclear factor κB (NF-κB), nuclear factor of activated T cells (NF-AT), and activator protein-1 motifs on the Fas promoter, as well as ERE, NF-κB, and NF-AT motifs on the FasL promoter, showed binding affinity with the transcription factors. Electrophoretic mobility-shift assays were performed to verify the binding affinity of cis-regulatory motifs of Fas or FasL promoters with transcription factors. There was shift in mobility of probes (ERE or NF-κB2) of both Fas and FasL in the presence of nuclear proteins from DES-treated cells, and the shift was specific to DES because these probes failed to shift their mobility in the presence of nuclear proteins from vehicle-treated cells. Together, the current study demonstrates that prenatal exposure to DES triggers significant alterations in apoptotic molecules expressed on thymocytes, which may affect T-cell differentiation and cause long-term effects on the immune functions. PMID:22888145
The influence of hydrodynamic slip on the electrophoretic mobility of a spherical colloidal particle
NASA Astrophysics Data System (ADS)
Khair, Aditya S.; Squires, Todd M.
2009-04-01
Recent theoretical studies have suggested a significant enhancement in electro-osmotic flows over hydrodynamically slipping surfaces, and experiments have indeed measured O(1) enhancements. In this paper, we investigate whether an equivalent effect occurs in the electrophoretic motion of a colloidal particle whose surface exhibits hydrodynamic slip. To this end, we compute the electrophoretic mobility of a uniformly charged spherical particle with slip length λ as a function of the zeta (or surface) potential of the particle ζ and diffuse-layer thickness κ-1. In the case of a thick diffuse layer, κa ≪1 (where a is the particle size), simple arguments show that slip does lead to an O(1) enhancement in the mobility, owing to the reduced viscous drag on the particle. On the other hand, for a thin-diffuse layer κa ≫1, the situation is more complicated. A detailed asymptotic analysis, following the method of O'Brien [J. Colloid Interface Sci. 92, 204 (1983)], reveals that an O(κλ) increase in the mobility occurs at low-to-moderate zeta potentials (with ζ measured on the scale of thermal voltage kBT /e≈25 mV). However, as ζ is further increased, the mobility decreases and ultimately becomes independent of the slip length—the enhancement is lost—which is due to the importance of nonuniform surface conduction within the thin-diffuse layer, at large ζ and large, but finite, κa. Our asymptotic calculations for thick and thin-diffuse layers are corroborated and bridged by computation of the mobility from the numerical solution of the full electrokinetic equations (using the method of O'Brien and White [J. Chem. Soc., Faraday Trans. 2 74, 1607 (1978)]). In summary, then, we demonstrate that hydrodynamic slip can indeed produce an enhancement in the electrophoretic mobility; however, such enhancements will not be as dramatic as the previously studied κa →∞ limit would suggest. Importantly, this conclusion applies not only to electrophoresis but also to electro-osmosis over highly charged surfaces, wherein any inhomogeneities (e.g., due to curvature, roughness, charge patterning, or a variation in slip length) will drive nonuniform surface conduction, which prevents the significant slip-driven flow enhancements predicted for a uniform highly charged surface.
Startup of electrophoresis in a suspension of colloidal spheres.
Chiang, Chia C; Keh, Huan J
2015-12-01
The transient electrophoretic response of a homogeneous suspension of spherical particles to the step application of an electric field is analyzed. The electric double layer encompassing each particle is assumed to be thin but finite, and the effect of dynamic electroosmosis within it is incorporated. The momentum equation for the fluid outside the double layers is solved through the use of a unit cell model. Closed-form formulas for the time-evolving electrophoretic and settling velocities of the particles in the Laplace transform are obtained in terms of the electrokinetic radius, relative mass density, and volume fraction of the particles. The time scale for the development of electrophoresis and sedimentation is significantly smaller for a suspension with a higher particle volume fraction or a smaller particle-to-fluid density ratio, and the electrophoretic mobility at any instant increases with an increase in the electrokinetic particle radius. The transient electrophoretic mobility is a decreasing function of the particle volume fraction if the particle-to-fluid density ratio is relatively small, but it may increase with an increase in the particle volume fraction if this density ratio is relatively large. The particle interaction effect in a suspension on the transient electrophoresis is much weaker than that on the transient sedimentation of the particles. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Nanolaminate microfluidic device for mobility selection of particles
Surh, Michael P [Livermore, CA; Wilson, William D [Pleasanton, CA; Barbee, Jr., Troy W.; Lane, Stephen M [Oakland, CA
2006-10-10
A microfluidic device made from nanolaminate materials that are capable of electrophoretic selection of particles on the basis of their mobility. Nanolaminate materials are generally alternating layers of two materials (one conducting, one insulating) that are made by sputter coating a flat substrate with a large number of layers. Specific subsets of the conducting layers are coupled together to form a single, extended electrode, interleaved with other similar electrodes. Thereby, the subsets of conducting layers may be dynamically charged to create time-dependent potential fields that can trap or transport charge colloidal particles. The addition of time-dependence is applicable to all geometries of nanolaminate electrophoretic and electrochemical designs from sinusoidal to nearly step-like.
Buitenhuis, Johan
2012-09-18
The electrophoretic mobility of rodlike fd viruses is measured and compared to theory, with the theoretical calculations performed according to Stigter (Stigter, D. Charged Colloidal Cylinder with a Gouy Double-Layer. J. Colloid Interface Sci. 1975, 53, 296-306. Stigter, D. Electrophoresis of Highly Charged Colloidal Cylinders in Univalent Salt- Solutions. 1. Mobility in Transverse Field. J. Phys. Chem. 1978, 82, 1417-1423. Stigter, D. Electrophoresis of Highly Charged Colloidal Cylinders in Univalent Salt Solutions. 2. Random Orientation in External Field and Application to Polyelectrolytes. J. Phys. Chem. 1978, 82, 1424-1429. Stigter, D. Theory of Conductance of Colloidal Electrolytes in Univalent Salt Solutions. J. Phys. Chem. 1979, 83, 1663-1670), who describes the electrophoretic mobility of infinite cylinders including relaxation effects. Using the dissociation constants of the ionizable groups on the surfaces of the fd viruses, we can calculate the mobility without any adjustable parameter (apart from the possible Stern layer thickness). In addition, the approximation in the theoretical description of Stigter (and others) of using a model of infinitely long cylinders, which consequently is independent of the aspect ratio, is examined by performing more elaborate numerical calculations for finite cylinders. It is shown that, although the electrophoretic mobility of cylindrical particles in the limit of low ionic strength depends on the aspect ratio much more than "end effects", at moderate and high ionic strengths the finite and infinite cylinder models differ only to a degree that can be attributed to end effects. Furthermore, the range of validity of the Stokes regime is systematically calculated.
Analysis of E2F factors during epidermal differentiation.
Chang, Wing Y; Dagnino, Lina
2005-01-01
The multigene E2F family of transcription factors is central in the control of cell cycle progression. The expression and activity of E2F proteins is tightly regulated transcriptionally and posttranslationally as a function of the proliferation and differentiation status of the cell. In this chapter, we review protocols designed to determine E2F mRNA abundance in tissues by in situ hybridization techniques. The ability to culture primary epidermal keratinocytes and maintain them as either undifferentiated or terminally differentiated cells allows the biochemical and molecular characterization of changes in E2F expression and activity. Thus, we also discuss in detail methods to analyze E2F protein abundance by immunoblot and their ability to bind DNA in cultured cells using electrophoretic mobility shift assays.
High-concentration zeta potential measurements using light-scattering techniques
Kaszuba, Michael; Corbett, Jason; Watson, Fraser Mcneil; Jones, Andrew
2010-01-01
Zeta potential is the key parameter that controls electrostatic interactions in particle dispersions. Laser Doppler electrophoresis is an accepted method for the measurement of particle electrophoretic mobility and hence zeta potential of dispersions of colloidal size materials. Traditionally, samples measured by this technique have to be optically transparent. Therefore, depending upon the size and optical properties of the particles, many samples will be too concentrated and will require dilution. The ability to measure samples at or close to their neat concentration would be desirable as it would minimize any changes in the zeta potential of the sample owing to dilution. However, the ability to measure turbid samples using light-scattering techniques presents a number of challenges. This paper discusses electrophoretic mobility measurements made on turbid samples at high concentration using a novel cell with reduced path length. Results are presented on two different sample types, titanium dioxide and a polyurethane dispersion, as a function of sample concentration. For both of the sample types studied, the electrophoretic mobility results show a gradual decrease as the sample concentration increases and the possible reasons for these observations are discussed. Further, a comparison of the data against theoretical models is presented and discussed. Conclusions and recommendations are made from the zeta potential values obtained at high concentrations. PMID:20732896
Dissipative particle dynamics: Effects of thermostating schemes on nano-colloid electrophoresis
NASA Astrophysics Data System (ADS)
Hassanzadeh Afrouzi, Hamid; Moshfegh, Abouzar; Farhadi, Mousa; Sedighi, Kurosh
2018-05-01
A novel fully explicit approach using dissipative particle dynamics (DPD) method is introduced in the present study to model the electrophoretic transport of nano-colloids in an electrolyte solution. Slater type charge smearing function included in 3D Ewald summation method is employed to treat electrostatic interaction. Performance of various thermostats are challenged to control the system temperature and study the dynamic response of colloidal electrophoretic mobility under practical ranges of external electric field (0 . 072 < E < 0 . 361 v/nm) covering linear to non-linear response regime, and ionic salt concentration (0.049 < SC < 0 . 69 [M]) covering weak to strong Debye screening of the colloid. System temperature and electrophoretic mobility both show a direct and inverse relationships respectively with electric field and colloidal repulsion; although they each respectively behave direct and inverse trends with salt concentration under various thermostats. Nosé-Hoover-Lowe-Andersen and Lowe-Andersen thermostats are found to function more effectively under high electric fields (E > 0 . 145[v/nm ]) while thermal equilibrium is maintained. Reasonable agreements are achieved by benchmarking the system radial distribution function with available EW3D modellings, as well as comparing reduced mobility against conventional Smoluchowski and Hückel theories, and numerical solution of Poisson-Boltzmann equation.
Asensi-Bernardi, Lucía; Escuder-Gilabert, Laura; Martín-Biosca, Yolanda; Sagrado, Salvador; Medina-Hernández, María José
2014-01-01
The estimation of apparent binding constants and limit mobilities of the complexes of the enantiomers that characterize the interaction of enantiomers with chiral selectors, in this case highly sulfated β-cyclodextrin, was approached using a simple and economic electrophoretic modality, the complete filling technique (CFT) in counter-current mode. The enantiomers of eight psychoactive drugs, four antihistamines (dimethindene, promethazine, orphenadrine and terfenadine) and four antidepressants (bupropion, fluoxetine, nomifensine and viloxazine) were separated for the first time for this cyclodextrin (CD). Estimations of thermodynamic and electrophoretic enantioselectivies were also performed. Results indicate that, in general, thermodynamic enantioselectivity is the main component explaining the high resolution found, but also one case suggests that electrophoretic enantioselectivity itself is enough to obtain a satisfactory resolution. CFT results advantageous compared with conventional capillary electrophoresis (CE) and partial filling technique (PFT) for the study of the interaction between drugs and chiral selectors. It combines the use of a simple fitting model (as in CE), when the enantiomers do not exit the chiral selector plug during the separation (i.e. mobility of electroosmotic flow larger than mobility of CD), and drastic reduction of the consumption (and cost; ~99.7%) of the CD reagent (as in PFT) compared with the conventional CE. Copyright © 2013 John Wiley & Sons, Ltd.
NASA Technical Reports Server (NTRS)
Morrison, D. R.; Lewis, M. L.; Barlow, G. H.; Todd, P. W.; Kunze, M. E.; Sarnoff, B. E.; Li, Z. K.
1985-01-01
Suspensions of cultured primary human embryonic kidney cells were subjected to continuous flow electrophoresis on Space Shuttle flight STS-8. The objectives of the experiments were to obtain electrophoretically separated fractions of the original cell populations and to test these fractions for the amount and kind of urokinase (a kidney plasminogen activator that is used medically for digesting blood clots), the morphologies of cells in the individual fractions, and their cellular electrophoretic mobilities after separation and subsequent proliferation. Individual fractions were successfully cultured after return from orbit, and they were found to differ substantially from one another and from the starting sample with respect to all of these properties.
Electrokinetic properties of polymer colloids
NASA Technical Reports Server (NTRS)
Micale, F. J.; Fuenmayor, D. Y.
1986-01-01
The surface of polymer colloids, especially polystyrene latexes, were modified for the purpose of controlling the electrokinetic properties of the resulting colloids. Achievement required a knowledge of electrical double layer charging mechanism, as a function of the electrolyte conditions, at the polymer/water interface. The experimental approach is to control the recipe formulation in the emulsion polymerization process so as to systematically vary the strong acid group concentration on the surface of the polymer particles. The electrophoretic mobility of these model particles will then be measured as a function of surface group concentration and as a function of electrolyte concentration and type. An effort was also made to evaluate the electrophoretic mobility of polystyrene latexes made in space and to compare the results with latexes made on the ground.
Elimination of cdc2 phosphorylation sites in the cdc25 phosphatase blocks initiation of M-phase.
Izumi, T; Maller, J L
1993-01-01
The cdc25 phosphatase is a mitotic inducer that activates p34cdc2 at the G2/M transition by dephosphorylation of Tyr15 in p34cdc2. cdc25 itself is also regulated through periodic changes in its phosphorylation state. To elucidate the mechanism for induction of mitosis, phosphorylation of cdc25 has been investigated using recombinant proteins. cdc25 is phosphorylated by both cyclin A/p34cdc2 and cyclin B/p34cdc2 at similar sets of multiple sites in vitro. This phosphorylation retards its electrophoretical mobility and activates its ability to increase cyclin B/p34cdc2 kinase activity three- to fourfold in vitro, as found for endogenous Xenopus cdc25 in M-phase extracts. The threonine and serine residues followed by proline that are conserved between Xenopus and human cdc25 have been mutated. Both the triple mutation of Thr48, Thr67, and Thr138 and the quintuple mutation of these three threonine residues plus Ser205 and Ser285, almost completely abolish the shift in electrophoretic mobility of cdc25 after incubation with M-phase extracts or phosphorylation by p34cdc2. These mutations inhibit the activation of cdc25 by phosphorylation with p34cdc2 by 70 and 90%, respectively. At physiological concentrations these mutants cannot activate cyclin B/p34cdc2 in cdc25-immunodepleted oocyte extracts, suggesting that a positive feed-back loop between cdc2 and cdc25 is necessary for the full activation of cyclin B/p34cdc2 that induces abrupt entry into mitosis in vivo. Images PMID:7513216
NASA Astrophysics Data System (ADS)
Sun, Cui; Feng, Ya-Qing; Zhang, Bao; Li, Xiang-Gao; Shao, Ji-Zhou; Han, Jing-Jing; Chen, Xu
2013-05-01
The use of Isopar M as a liquid suspending fluid for electrophoretic display was studied. The dispersion stability and chargeability of pigments suspended in Isopar M were investigated. Polyisobutylene monosuccinimide (T-151) as the charge control additive in Isopar M electrophoretic fluid can provide a good electrophoretic mobility to the particles. The wall materials of a series of blue-white, red-white and yellow-white dual-particle microcapsules were prepared by in situ polymerization of urea and formaldehyde. The mass ratio of wall/core material was a key factor in influencing the yield of microcapsules. The concentration of resorcinol has an impact on the surface morphology and mechanical strength of microcapsule wall. Microcapsules' surface morphologies were characterized by optical microscopy and scanning electron microscopy. The performance of the microcapsules with different binder materials and adhesive layers were investigated. Contrast ratio of microcapsules display device were tested every 10 days for a period of 90 days. The compatibility of Isopar M with both the electrophoretic particles and bounding capsule was studied.
NASA Astrophysics Data System (ADS)
Brans, Toon; Strubbe, Filip; Schreuer, Caspar; Neyts, Kristiaan; Beunis, Filip
2015-06-01
We present a novel approach for label-free concentration measurement of a specific protein in a solution. The technique combines optical tweezers and microelectrophoresis to establish the electrophoretic mobility of a single microparticle suspended in the solution. From this mobility measurement, the amount of adsorbed protein on the particle is derived. Using this method, we determine the concentration of avidin in a buffer solution. After calibration of the setup, which accounts for electro-osmotic flow in the measurement device, the mobilities of both bare and biotinylated microspheres are measured as a function of the avidin concentration in the mixture. Two types of surface adsorption are identified: the biotinylated particles show specific adsorption, resulting from the binding of avidin molecules with biotin, at low avidin concentrations (below 0.04 μg/ml) while at concentrations of several μg/ml non-specific on both types of particles is observed. These two adsorption mechanisms are incorporated in a theoretical model describing the relation between the measured mobility and the avidin concentration in the mixture. This model describes the electrophoretic mobility of these particles accurately over four orders of magnitude of the avidin concentration.
Bayoumi, R A; Nur-E-Kamal, M S; Tadayyon, M; Mohamed, K K; Mahboob, B H; Qureshi, M M; Lakhani, M S; Awaad, M O; Kaeda, J; Vulliamy, T J; Luzzatto, L
1996-01-01
In a cross-sectional study, the activity, electrophoretic mobility and genotypes of glucose-6-phosphate dehydrogenase (G6PD) were determined among healthy, UAE national school boys from Al-Ain District in the United Arab Emirates, The prevalence of G6PD deficiency in this population sample was 11%. The majority of G6PD-deficient subjects were descendants of Omani, Baluchi or Yemeni migrants. Of 18 deficient subjects, 16 had an enzyme activity of < 10% of normal while 2 had an activity of just above 10%. Electrophoresis was performed on 166 samples and showed that, apart from deficient samples, all had the normal mobility of G6PD type B. Of the 18 deficient subjects, 14 had the B type mobility of G6PD Mediterranean and 4 had the A type mobility of G6PD A-. Genotyping demonstrated that 10 had the Mediterranean mutation while 3 had the A- mutation, consistent with their electrophoretic mobility. Another 3 had the G6PD Aures mutation, recently described as polymorphic in Algeria and Spain. The mutations in the remaining 2 subjects have not yet been identified.
Vedantam, Gayatri; Knopf, Sarah; Hecht, David W
2006-01-01
Tn5520 is the smallest known bacterial mobilizable transposon and was isolated from an antibiotic resistant Bacteroides fragilis clinical isolate. When a conjugation apparatus is provided in trans, Tn5520 is mobilized (transferred) efficiently within, and from, both Bacteroides spp. and Escherichia coli. Only two genes are present on Tn5520; one encodes an integrase, and the other a multifunctional mobilization (Mob) protein BmpH. BmpH is essential for Tn5520 mobility. The focus of this study was to identify the Tn5520 origin of conjugative transfer (oriT) and to study BmpH-oriT binding. We delimited the functional Tn5520 oriT to a 71 bp sequence upstream of the bmpH gene. A plasmid vector harbouring this minimal 71 bp oriT was mobilized at the same frequency as that of intact Tn5520. The minimal oriT contains one 17 bp inverted repeat (IR) sequence. We constructed and tested multiple IR mutants and showed that the IR was essential in its entirety for mobilization. A nick site sequence (5'-GCTAC-3') was also identified within the minimal oriT; this sequence resembled nick sites found in plasmids of Gram positive origin. We further showed that mutation of a highly conserved GC dinucleotide in the nick site sequence completely abolished mobilization. We also purified BmpH and showed that it specifically bound a Tn5520 oriT fragment in electrophoretic mobility shift assays. We also identified non-nick site sequences within the minimal oriT that were essential for mobilization. We hypothesize that transposon-based single Mob protein systems may contribute to efficient gene dissemination from Bacteroides spp., because fewer DNA processing proteins are required for relaxosome formation.
NASA Astrophysics Data System (ADS)
Bakhmet, E. I.; Nazarov, I. B.; Artamonova, T. O.; Khodorkovsky, M. A.; Tomilin, A. N.
2017-11-01
Transcription factor Oct4 is a marker of pluripotent stem cells and has a significant role in their self-renewal. Oct4 gene is controlled by three cis-regulatory elements - proximal promoter, proximal enhancer and distal enhancer. All of these elements are targets for binding of regulatory proteins. Distal enhancer is in our research focus because of its activity in early stages of embryonic development. There are two main sequences called site 2A and site 2B that are presented in distal enhancer. For this moment proteins which bind to a site 2A (CCCCTCCCCCC) remain unknown. Using combination of in vitro method electrophoretic mobility shift assay (EMSA) and mass spectromery we identified several candidates that can regulate Oct4 gene expression through site 2A.
In vivo phosphorylation of a peptide tag for protein purification.
Goux, Marine; Fateh, Amina; Defontaine, Alain; Cinier, Mathieu; Tellier, Charles
2016-05-01
To design a new system for the in vivo phosphorylation of proteins in Escherichia coli using the co-expression of the α-subunit of casein kinase II (CKIIα) and a target protein, (Nanofitin) fused with a phosphorylatable tag. The level of the co-expressed CKIIα was controlled by the arabinose promoter and optimal phosphorylation was obtained with 2 % (w/v) arabinose as inductor. The effectiveness of the phosphorylation system was demonstrated by electrophoretic mobility shift assay (NUT-PAGE) and staining with a specific phosphoprotein-staining gel. The resulting phosphorylated tag was also used to purify the phosphoprotein by immobilized metal affinity chromatography, which relies on the specific interaction of phosphate moieties with Fe(III). The use of a single tag for both the purification and protein array anchoring provides a simple and straightforward system for protein analysis.
Genetic and developmental variation of hemoglobin in the deermouse, Peromyscus maniculatus.
Maybank, K M; Dawson, W D
1976-04-01
A genetic investigation of electrophoretic hemoglobin variants of the deermouse, Peromyscus maniculatus, shows three alleles, Hblf, Hblr, and Hblo, at a duplicated site controlling the six adult phenotypes. The Hblf allele has not been described previously. The hemoglobin locus is not closely linked to the albino locus. Fetal hemoglobin is distinct from any of the adult components and has a slower electrophoretic mobility. The fetal phenotype changes to the adult type between the days 15 and 18 of prenatal life.
A review of light-scattering techniques for the study of colloids in natural waters
Rees, T.F.
1987-01-01
In order to understand the movement of colloidal materials in natural waters, we first need to have a means of quantifying their physical characteristics. This paper reviews three techniques which utilize light-scattering phenomena to measure the translational diffusion coefficient, the rotational diffusion coefficient, and the electrophoretic mobility of colloids suspended in water. Primary emphasis is to provide sufficient theoretical detail so that hydrologists can evaluate the utility of photon correlation spectrometry, electrophoretic light scattering, and electric birefringence analysis. ?? 1987.
Silica-coated titania and zirconia colloids for subsurface transport field experiments
Ryan, Joseph N.; Elimelech, Menachem; Baeseman, Jenny L.; Magelky, Robin D.
2000-01-01
Silica-coated titania (TiO2) and zirconia (ZrO2) colloids were synthesized in two sizes to provide easily traced mineral colloids for subsurface transport experiments. Electrophoretic mobility measurements showed that coating with silica imparted surface properties similar to pure silica to the titania and zirconia colloids. Measurements of steady electrophoretic mobility and size (by dynamic light scattering) over a 90-day period showed that the silica-coated colloids were stable to aggregation and loss of coating. A natural gradient field experiment conducted in an iron oxide-coated sand and gravel aquifer also showed that the surface properties of the silica-coated colloids were similar. Colloid transport was traced at μg L-1 concentrations by inductively coupled plasma-atomic emission spectroscopy measurement of Ti and Zr in acidified samples.
Separability of electrostatic and hydrodynamic forces in particle electrophoresis
NASA Astrophysics Data System (ADS)
Todd, Brian A.; Cohen, Joel A.
2011-09-01
By use of optical tweezers we explicitly measure the electrostatic and hydrodynamic forces that determine the electrophoretic mobility of a charged colloidal particle. We test the ansatz of O'Brien and White [J. Chem. Soc. Faraday IIJCFTBS0300-923810.1039/f29787401607 74, 1607 (1978)] that the electrostatically and hydrodynamically coupled electrophoresis problem is separable into two simpler problems: (1) a particle held fixed in an applied electric field with no flow field and (2) a particle held fixed in a flow field with no applied electric field. For a system in the Helmholtz-Smoluchowski and Debye-Hückel regimes, we find that the electrostatic and hydrodynamic forces measured independently accurately predict the electrophoretic mobility within our measurement precision of 7%; the O'Brien and White ansatz holds under the conditions of our experiment.
Piaggio, Maria V; Peirotti, Marta B; Deiber, Julio A
2009-07-01
Electrophoretic mobility data of four proteins are analyzed and interpreted through a physicochemical CZE model, which provides estimates of quantities like equivalent hydrodynamic radius (size), effective charge number, shape orientation factor, hydration, actual pK values of ionizing groups, and pH near molecule, among others. Protein friction coefficients are simulated through the creeping flow theory of prolate spheroidal particles. The modeling of the effective electrophoretic mobility of proteins requires consideration of hydrodynamic size and shape coupled to hydration and effective charge. The model proposed predicts native protein hydration within the range of values obtained experimentally from other techniques. Therefore, this model provides consistently other physicochemical properties such as average friction and diffusion coefficients and packing fractal dimension. As the pH varies from native conditions to those that are denaturing the protein, hydration and packing fractal dimension change substantially. Needs for further research are also discussed and proposed.
Sadek, Samir H.; Pimenta, Francisco; Pinho, Fernando T.
2017-01-01
In this work, we explore two methods to simultaneously measure the electroosmotic mobility in microchannels and the electrophoretic mobility of micron‐sized tracer particles. The first method is based on imposing a pulsed electric field, which allows to isolate electrophoresis and electroosmosis at the startup and shutdown of the pulse, respectively. In the second method, a sinusoidal electric field is generated and the mobilities are found by minimizing the difference between the measured velocity of tracer particles and the velocity computed from an analytical expression. Both methods produced consistent results using polydimethylsiloxane microchannels and polystyrene micro‐particles, provided that the temporal resolution of the particle tracking velocimetry technique used to compute the velocity of the tracer particles is fast enough to resolve the diffusion time‐scale based on the characteristic channel length scale. Additionally, we present results with the pulse method for viscoelastic fluids, which show a more complex transient response with significant velocity overshoots and undershoots after the start and the end of the applied electric pulse, respectively. PMID:27990654
Kumar, Krishan; Singal, Ankita; Rizvi, M Moshahid A; Chauhan, Virander S
2008-06-01
High mobility group box chromosomal protein 1 (HMGB1), known as an abundant, non-histone architectural chromosomal protein, is highly conserved across different species. Homologues of HMGB1 were identified and cloned from malaria parasite, Plasmodium falciparum. Sequence analyses showed that the P. falciparum HMGB1 (PfHMGB1) exhibits 45, 23 and 18%, while PfHMGB2 shares 42, 21 and 17% homology with Saccharomyces cerevisiae, human and mouse HMG box proteins respectively. Parasite PfHMGB1and PfHMGB2 proteins contain one HMG Box domain similar to B-Box of mammalian HMGB1. Electrophoretic Mobility Shift Assay (EMSA) showed that recombinant PfHMGB1 and PfHMGB2 bind to DNA. Immunofluorescence Assay using specific antibodies revealed that these proteins are expressed abundantly in the ring stage nuclei. Significant levels of PfHMGB1 and PfHMGB2 were also present in the parasite cytosol at trophozoite and schizont stages. Both, PfHMGB1 and PfHMGB2 were found to be potent inducers of pro-inflammatory cytokines such as TNFalpha from mouse peritoneal macrophages as analyzed by both reverse transcription PCR and by ELISA. These results suggest that secreted PfHMGB1 and PfHMGB2 may be responsible for eliciting/ triggering host inflammatory immune responses associated with malaria infection.
NASA Astrophysics Data System (ADS)
Noel, Amélie; Mirbel, Déborah; Cloutet, Eric; Fleury, Guillaume; Schatz, Christophe; Navarro, Christophe; Hadziioannou, Georges; CyrilBrochon
2018-01-01
In order to obtain efficient electrophoretic inks, Tridodecylamine (Dod3N), has been studied as charge control agent (CCA) in a non-polar paraffin solvent (Isopar G) for various inorganic pigments (TiO2 and Fe2O3). All hydrophobic mineral oxides, i.e. treated with octyltrimethoxysilane (C8) or dodecyltrimethoxysilane (C12), were found to be negatively charged in presence of Dod3N. The electrophoretic mobilities of inorganic pigments seemed to be strongly dependent of their isoelectric point (IEP) and also of the concentration of dod3N with an optimum range between 10 and 20 mM depending on the pigments. Finally, an electrophoretic ink constituted of hydrophobic mineral oxides in presence of Dod3N was tested in a device. Its efficiency as charge control agent to negatively charge hydrophobic particles was confirmed through good optical properties and fast response time (220 ms at 200 kV m-1).
NASA Technical Reports Server (NTRS)
Plank, L. D.; Kunze, M. E.; Todd, P. W.
1985-01-01
Cultured mouse leukemia cells line L5178Y were subjected to upward electrophoresis in a density gradient and the slower migrating cell populations were enriched in G2 cells. It is indicated that this cell line does not change electrophoretic mobility through the cell cycle. The possibility that increased sedimentation downward on the part of the larger G2 cells caused this separation was explored. Two different cell populations were investigated. The log phase population was found to migrate upward faster than the G2 population, and a similar difference between their velocities and calculated on the basis of a 1 um diameter difference between the two cell populations. The G2 and G1 enriched populations were isolated by Ficoll density gradient sedimentation. The bottom fraction was enriched in G2 cells and the top fraction was enriched with G1 cells, especially when compared with starting materials. The electrophoretic mobilities of these two cell populations did not differ significantly from one another. Cell diameter dependent migration curves were calculated and were found to be different. Families of migration curves that differ when cell size is considered as a parameter are predicted.
NASA Technical Reports Server (NTRS)
Pevzner, L. Z.; Venkov, L.; Cheresharov, L.
1980-01-01
Albino rats were kept for a year under conditions of daily motor load or constant hypokinesia. An increase in motor activity results in a rise in the acetylcholinesterase activity determined in the synaptosomal and purified mitochondrial fractions while hypokinesia induces a pronounced decrease in this enzyme activity. The butyrylcholinesterase activity somewhat decreases in the synaptosomal fraction after hypokinesia but does not change under the motor load pattern. Motor load causes an increase in the amount of synaptosomal water-soluble proteins possessing an intermediate electrophoretic mobility and seem to correspond to the brain-specific protein 14-3-2. In the synaptosomal fraction the amount of membrane proteins with a low electrophoretic mobility and with the cholinesterase activity rises. Hypokinesia, on the contrary, decreases the amount of these membrane proteins.
Pyell, Ute; Jalil, Alaa H; Pfeiffer, Christian; Pelaz, Beatriz; Parak, Wolfgang J
2015-07-15
Taking gold nanoparticles with different hydrophilic coatings as an example, it is investigated whether capillary electrophoresis in combination with Taylor dispersion analysis allows for the precise determination of mean electrophoretic mobilities, electrophoretic mobility distributions, and zeta potentials in a matrix of exactly known composition and the calibration-free determination of number-weighted mean hydrodynamic radii. Our experimental data confirm that the calculation of the zeta potential for colloidal nanoparticles with ζ>25 mV requires to take the relaxation effect into account. Because of the requirement to avoid particle-wall interactions, a solution of disodiumtetraborate decahydrate (borax) in deionized water had been selected as suitable electrolyte. Measurements of the electrophoretic mobility at different ionic strength and application of the analytic approximation developed by Ohshima show that in the present case of a buffered solution with a weak electrolyte co-ion and a strong electrolyte counterion, the effective ionic drag coefficient should be approximated with the ionic drag coefficient of the counterion. The obtained results are in good agreement with theoretical expectations regarding the dependence of the zeta potential and the electrokinetic surface charge density on the ionic strength. We also show that Taylor dispersion analysis (besides estimation of the number-weighted mean hydrodynamic radius) provides additional information on the type and width of the number-weighted particle distribution. Copyright © 2015 Elsevier Inc. All rights reserved.
Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.
2012-01-01
DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820
Ion size effects on the electrokinetics of spherical particles in salt-free concentrated suspensions
NASA Astrophysics Data System (ADS)
Roa, Rafael; Carrique, Felix; Ruiz-Reina, Emilio
2012-02-01
In this work we study the influence of the counterion size on the electrophoretic mobility and on the dynamic mobility of a suspended spherical particle in a salt-free concentrated colloidal suspension. Salt-free suspensions contain charged particles and the added counterions that counterbalance their surface charge. A spherical cell model approach is used to take into account particle-particle electro-hydrodynamic interactions in concentrated suspensions. The finite size of the counterions is considered including an entropic contribution, related with the excluded volume of the ions, in the free energy of the suspension, giving rise to a modified counterion concentration profile. We are interested in studying the linear response of the system to an electric field, thus we solve the different electrokinetic equations by using a linear perturbation scheme. We find that the ionic size effect is quite important for moderate to high particles charges at a given particle volume fraction. In addition for such particle surface charges, both the electrophoretic mobility and the dynamic mobility suffer more important changes the larger the particle volume fraction for each ion size. The latter effects are more relevant the larger the ionic size.
Nuclear factor I-A represses expression of the cell adhesion molecule L1
2009-01-01
Background The neural cell adhesion molecule L1 plays a crucial role in development and plasticity of the nervous system. Neural cells thus require precise control of L1 expression. Results We identified a full binding site for nuclear factor I (NFI) transcription factors in the regulatory region of the mouse L1 gene. Electrophoretic mobility shift assay (EMSA) showed binding of nuclear factor I-A (NFI-A) to this site. Moreover, for a brain-specific isoform of NFI-A (NFI-A bs), we confirmed the interaction in vivo using chromatin immunoprecipitation (ChIP). Reporter gene assays showed that in neuroblastoma cells, overexpression of NFI-A bs repressed L1 expression threefold. Conclusion Our findings suggest that NFI-A, in particular its brain-specific isoform, represses L1 gene expression, and might act as a second silencer of L1 in addition to the neural restrictive silencer factor (NRSF). PMID:20003413
Ohuchi, Shoji J; Sagawa, Fumihiko; Sakamoto, Taiichi; Inoue, Tan
2015-10-23
RNA-protein complexes (RNPs) are useful for constructing functional nano-objects because a variety of functional proteins can be displayed on a designed RNA scaffold. Here, we report circular permutations of an RNA-binding protein L7Ae based on the three-dimensional structure information to alter the orientation of the displayed proteins on the RNA scaffold. An electrophoretic mobility shift assay and atomic force microscopy (AFM) analysis revealed that most of the designed circular permutants formed an RNP nano-object. Moreover, the alteration of the enhanced green fluorescent protein (EGFP) orientation was confirmed with AFM by employing EGFP on the L7Ae permutant on the RNA. The results demonstrate that targeted fine-tuning of the stereo-specific fixation of a protein on a protein-binding RNA is feasible by using the circular permutation technique. Copyright © 2015 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Akter, Mst. Hasina; Yamaguchi, Tomohiro; Hirose, Fumiko
2008-04-11
Perilipin is a protein localized on lipid droplet surfaces in adipocytes and steroidogenic cells, playing a central role in regulated lipolysis. Expression of the perilipin gene is markedly induced during adipogenesis. We found that transcription from the perilipin gene promoter is activated by an orphan nuclear receptor, estrogen receptor-related receptor (ERR){alpha}. A response element to this receptor was identified in the promoter region by a gene reporter assay, the electrophoretic-gel mobility-shift assay and the chromatin immunoprecipitation assay. Peroxisome proliferator-activated receptor {gamma} coactivator (PGC)-1{alpha} enhanced, whereas small heterodimer partner (SHP) repressed, the transactivating function of ERR{alpha} on the promoter. Thus, themore » perilipin gene expression is regulated by a transcriptional network controlling energy metabolism, substantiating the functional importance of perilipin in the maintenance of body energy balance.« less
EMSA Analysis of DNA Binding By Rgg Proteins
LaSarre, Breah; Federle, Michael J.
2016-01-01
In bacteria, interaction of various proteins with DNA is essential for the regulation of specific target gene expression. Electrophoretic mobility shift assay (EMSA) is an in vitro approach allowing for the visualization of these protein-DNA interactions. Rgg proteins comprise a family of transcriptional regulators widespread among the Firmicutes. Some of these proteins function independently to regulate target gene expression, while others have now been demonstrated to function as effectors of cell-to-cell communication, having regulatory activities that are modulated via direct interaction with small signaling peptides. EMSA analysis can be used to assess DNA binding of either type of Rgg protein. EMSA analysis of Rgg protein activity has facilitated in vitro confirmation of regulatory targets, identification of precise DNA binding sites via DNA probe mutagenesis, and characterization of the mechanism by which some cognate signaling peptides modulate Rgg protein function (e.g. interruption of DNA-binding in some cases). PMID:27430004
EMSA Analysis of DNA Binding By Rgg Proteins.
LaSarre, Breah; Federle, Michael J
2013-08-20
In bacteria, interaction of various proteins with DNA is essential for the regulation of specific target gene expression. Electrophoretic mobility shift assay (EMSA) is an in vitro approach allowing for the visualization of these protein-DNA interactions. Rgg proteins comprise a family of transcriptional regulators widespread among the Firmicutes. Some of these proteins function independently to regulate target gene expression, while others have now been demonstrated to function as effectors of cell-to-cell communication, having regulatory activities that are modulated via direct interaction with small signaling peptides. EMSA analysis can be used to assess DNA binding of either type of Rgg protein. EMSA analysis of Rgg protein activity has facilitated in vitro confirmation of regulatory targets, identification of precise DNA binding sites via DNA probe mutagenesis, and characterization of the mechanism by which some cognate signaling peptides modulate Rgg protein function ( e.g. interruption of DNA-binding in some cases).
GAS6 is an estrogen-inducible gene in mammary epithelial cells
Mo, Rigen; Zhu, Yiwei Tony; Zhang, Zhongyi; Rao, Sambasiva M.; Zhu, Yi-Jun
2007-01-01
To identify estrogen responsive genes in mammary glands, microarray assays were performed. Twenty genes were found to be up-regulated while 16 genes were repressed in the 9h estrogen treated glands. The induction of GAS6, one of the genes up-regulated by estrogen, was confirmed by RNase protection assay. Furthermore, GAS6 was also demonstrated to be induced by estrogen in ER positive breast cancer cells. Analysis of GAS6 promoter revealed that GAS6 promoter was regulated by estrogen. An estrogen response element (ERE) was identified in the GAS6 promoter. Electrophoretic mobility shift assay revealed that ERα interacted with the ERE in the GAS6 promoter. Chromatin immunoprecipitation demonstrated that ERα was recruited to the GAS6 promoter upon estrogen stimulation. These results suggested that GAS6 is an estrogen target gene in mammary epithelial cells. PMID:17174935
Shao, Guo; Zhou, Wei-Hua; Gao, Cui-Ying; Zhang, Ran; Lu, Guo-Wei
2007-02-01
To observe change of binding activity of HIF-1 with erythropoietin (EPO) hypoxia response element (HRE) in the hippocampus of mice preconditioned to hypoxia and explore relationship between the changes and the preconditioning. The hippocampus was removed from mice exposed to hypoxia for 0 run (control group), 1 run (H1 group) and 4 runs(H4 group). Electrophoretic mobility shift assays (EMSA), chromatin immunoprecipitation (ChIP)and real time PCR were used to detect the change of activity of HIF-1 on HRE of EPO. Both in vitro and in vivo binding tests showed that the HIF-1 DNA-binding activities were increased in group H1 and markedly increased in group H4. The increase of HIF-1 and HRE of EPO binding activities is thought be involved in hypoxic preconditioning.
Zhao, Yan-Yan; Sun, Kai-Lai; Ashok, Kumar
1998-01-01
The work was aimed to identify the estrogen responsive element in the human angiotensinogen gene. The nucleotide sequence between the transcription initiation site and TATA box in angiotensinogen gene promoter was found to be strongly homologous with the consensus estrogen responsive element. This sequence was confirmed as the estrogen responsive element (HAG ERE) by electrophoretic mobility shift assay. The recombinant expression vectors were constructed in which chloramphenicol acetyltransferase (CAT) reporter gene was driven by angiotensinogen core promoter with HAG ERE of by TK core promoter with multiplied HAG ERE, and were used in cotransfection with the human estrogen receptor expression vector into HepG(2) cells; CAT assays showed an increase of the CAT activity on 17beta-estradiol treatment in those transfectants. These results suggest that the human angiotensinogen gene is transcriptionally up-regulated by estrogen through the estrogen responsive element near TATA box of the promoter.
Identification of insulin as a novel retinoic acid receptor-related orphan receptor α target gene.
Kuang, Jiangying; Hou, Xiaoming; Zhang, Jinlong; Chen, Yulong; Su, Zhiguang
2014-03-18
Insulin plays an important role in regulation of lipid and glucose metabolism. Retinoic acid receptor-related orphan receptor α (RORα) modulates physiopathological processes such as dyslipidemia and diabetes. In this study, we found overexpression of RORα in INS1 cells resulted in increased expression and secretion of insulin. Suppression of endogenous RORα caused a decrease of insulin expression. Luciferase and electrophoretic mobility shift assay (EMSA) assays demonstrated that RORα activated insulin transcription via direct binding to its promoter. RORα was also observed to regulate BETA2 expression, which is one of the insulin active transfactors. In vivo analyses showed that the insulin transcription is increased by the synthetic RORα agonist SR1078. These findings identify RORα as a transcriptional activator of insulin and suggest novel therapeutic opportunities for management of the disease. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Surtees, Jennifer A; Alani, Eric
2006-07-14
Genetic studies in Saccharomyces cerevisiae predict that the mismatch repair (MMR) factor MSH2-MSH3 binds and stabilizes branched recombination intermediates that form during single strand annealing and gene conversion. To test this model, we constructed a series of DNA substrates that are predicted to form during these recombination events. We show in an electrophoretic mobility shift assay that S. cerevisiae MSH2-MSH3 specifically binds branched DNA substrates containing 3' single-stranded DNA and that ATP stimulates its release from these substrates. Chemical footprinting analyses indicate that MSH2-MSH3 specifically binds at the double-strand/single-strand junction of branched substrates, alters its conformation and opens up the junction. Therefore, MSH2-MSH3 binding to its substrates creates a unique nucleoprotein structure that may signal downstream steps in repair that include interactions with MMR and nucleotide excision repair factors.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ohuchi, Shoji J.; Sagawa, Fumihiko; Sakamoto, Taiichi
RNA-protein complexes (RNPs) are useful for constructing functional nano-objects because a variety of functional proteins can be displayed on a designed RNA scaffold. Here, we report circular permutations of an RNA-binding protein L7Ae based on the three-dimensional structure information to alter the orientation of the displayed proteins on the RNA scaffold. An electrophoretic mobility shift assay and atomic force microscopy (AFM) analysis revealed that most of the designed circular permutants formed an RNP nano-object. Moreover, the alteration of the enhanced green fluorescent protein (EGFP) orientation was confirmed with AFM by employing EGFP on the L7Ae permutant on the RNA. Themore » results demonstrate that targeted fine-tuning of the stereo-specific fixation of a protein on a protein-binding RNA is feasible by using the circular permutation technique.« less
Chen, M; Hieng, S; Qian, X; Costa, R; Ou, J H
1994-11-15
Hepatitis B virus (HBV) ENI enhancer can activate the expression of HBV and non-HBV genes in a liver-specific manner. By performing the electrophoretic mobility-shift assays, we demonstrated that the three related, liver-enriched, transcription factors, HNF3 alpha, HNF3 beta, and HNF3 gamma could all bind to the 2c site of HBV ENI enhancer. Mutations introduced in the 2c site to abolish the binding by HNF3 reduced the enhancer activity approximately 15-fold. Moreover, expression of HNF3 antisense sequences to suppress the expression of HNF3 in Huh-7 hepatoma cells led to reduction of the ENI enhancer activity. These results indicate that HNF3 positively regulates the ENI enhancer activity and this regulation is most likely mediated through the 2c site. The requirement of HNF3 for the ENI enhancer activity could explain the liver specificity of this enhancer element.
Nakayama, Shizuka; Zhou, Jie; Zheng, Yue; Szmacinski, Henryk; Sintim, Herman O
2016-01-01
Background: Cyclic dinucleotides form supramolecular aggregates with intercalators, and this property could be utilized in nanotechnology and medicine. Methods & results: Atomic force microscopy and electrophoretic mobility shift assays were used to show that cyclic diguanylic acid (c-di-GMP) forms G-wires in the presence of intercalators. The average fluorescence lifetime of thiazole orange, when bound to c-di-GMP was greater than when bound to DNA G-quadruplexes or dsDNA. The stability of c-di-GMP supramolecular polymers is dependent on both the nature of the cation present and the intercalator. C-di-GMP or cyclic diadenylic acid/intercalator complexes are more resistant to cleavage by YybT, a phosphodiesterase, than the uncomplexed nucleotides. Conclusion: Cleavage of bacterial cyclic dinucleotides could be slowed down via complexation with small molecules and that this could be utilized for diverse applications in nanotechnology and medicine. PMID:28031943
NASA Technical Reports Server (NTRS)
Todd, P.
1980-01-01
The following aspects of kidney cell electrophoresis are discussed: (1) the development and testing of electrophoresis solutions; (2) optimization of freezing and thawing; (3) procedures for evaluation of separated kidney cells; and (4) electrophoretic mobility characterization of kidney cells.
NASA Technical Reports Server (NTRS)
Todd, P.
1979-01-01
A kidney cell electrophoresis technique is described in four parts: (1) the development and testing of electrophoresis solutions; (2) optimization of freezing and thawing; (3) procedures for evaluation of separated kidney cells; and (4) electrophoretic mobility characteristics of kidney cells.
Morphology of human embryonic kidney cells in culture after space flight
NASA Technical Reports Server (NTRS)
Todd, P.; Kunze, M. E.; Williams, K.; Morrison, D. R.; Lewis, M. L.; Barlow, G. H.
1985-01-01
The ability of human embyronic kidney cells to differentiate into small epithelioid, large epithelioid, domed, and fenestrated morphological cell types following space flight is examined. Kidney cells exposed to 1 day at 1 g, then 1 day in orbit, and a 12 minute passage through the electrophoretic separator are compared with control cultures. The data reveal that 70 percent of small epithelioid, 16 percent of large epithelioid, 9 percent of dome-forming, and 5 percent of fenestrated cells formed in the space exposed cells; the distributions correlate well with control data. The formation of domed cells from cells cultured from low electrophoretic mobility fractions and small epithelioid cells from high mobility fractions is unaffected by space flight conditions. It is concluded that storage under microgravity conditions does not influence the morphological differentiation of human embryonic kidney cells in low-passage culture.
Saha, N; Hong, S H; Wong, H A; Jeyaseelan, K; Tay, J S
1991-12-01
Biochemical characteristics of one non-deficient fast G6PD variant (GdSingapore) and six different deficient variants (three new, two Mahidol, one each of Indonesian and Mediterranean) were studied among the Malays of Singapore. The GdSingapore variant had normal enzyme activity (82%) and fast electrophoretic mobilities (140% in TEB buffer, 160% in phosphate and 140% in Tris-HCl buffer systems respectively). This variant is further characterized by normal Km for G6P; utilization of analogues (Gal6P, 2dG6P; dAmNADP), heat stability and pH optimum. The other six deficient G6PD variants had normal electrophoretic mobility in TEB buffer with enzyme activities ranging from 1 to 12% of GdB+. The biochemical characteristics identity them to be 2 Mahidol, 1 Indonesian and 1 Mediterranean variants and three new deficient variants.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thornton, Michelle
Capillary electrophoresis (CE) is an effective method for separating ionic species according to differences in their electrophoretic mobilities. CE separations of amino acids by direct detection are difficult due to their similar electrophoretic mobilities and low absorbances. However, native amino acids can be separated by CE as cations at a low pH by adding an alkanesulfonic acid to the electrolyte carrier which imparts selectivity to the system. Derivatization is unnecessary when direct UV detection is used at 185 nm. Simultaneous speciation of metal cations such as vanadium (IV) and vanadium (V) can easily be performed without complexation prior to analysis.more » An indirect UV detection scheme for acidic conditions was also developed using guanidine as the background carrier electrolyte (BCE) for the indirect detection of metal cations. Three chapters have been removed for separate processing. This report contains introductory material, references, and general conclusions. 80 refs.« less
Murata, H; Hattori, T; Maeda, H; Takashiba, S; Takigawa, M; Kido, J; Nagata, T
2015-08-01
Tumor necrosis factor alpha (TNF-α) is a major cytokine implicated in various inflammatory diseases. The nature of the nuclear factors associated with human TNF-α gene regulation is not well elucidated. We previously identified a novel region located from -550 to -487 in human TNF-α promoter that did not contain the reported binding sites for nuclear factor kappa B (NF-κB) but showed lipopolysaccharide (LPS)-induced transcriptional activity. The purpose of this study is to identify novel factors that bind to the promoter region and regulate TNF-α expression. To identify DNA-binding proteins that bound to the target region of TNF-α promoter, a cDNA library from LPS-stimulated human monocytic cell line THP-1 was screened using a yeast one-hybrid system. Cellular localizations of the DNA-binding protein in the cells were examined by subcellular immunocytochemistry. Nuclear amounts of the protein in LPS-stimulated THP-1 cells were identified by western blot analysis. Expression of mRNA of the protein in the cells was quantified by real-time polymerase chain reaction. Electrophoretic mobility shift assays were performed to confirm the DNA-binding profile. Overexpression of the protein and knockdown of the gene were also performed to investigate the role for TNF-α expression. Several candidates were identified from the cDNA library and transactivation-responsive DNA-binding protein 43 (TARDBP43; TDP-43) was focused on. Western blot analysis revealed that nuclear TDP-43 protein was increased in the LPS-stimulated THP-1 cells. Expression of TDP-43 mRNA was already enhanced before TNF-α induction by LPS. Electrophoretic mobility shift assay analysis showed that nuclear extracts obtained by overexpressing FLAG-tagged TDP-43 bound to the -550 to -487 TNF-α promoter fragments. Overexpression of TDP-43 in THP-1 cells resulted in an increase of TNF-α expression. Knockdown of TDP-43 in THP-1 cells downregulated TNF-α expression. We identified TDP-43 as one of the novel TNF-α factors and found that it bound to the LPS-responsive element in the TNF-α promoter to increase TNF-α expression. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Electrokinetic transport phenomena: Mobility measurement and electrokinetic instability
NASA Astrophysics Data System (ADS)
Oddy, Michael Huson
Miniaturization and integration of traditional bioassay procedures into microfabricated on-chip assay systems, commonly referred to as "Micro Total Analysis" (muTAS) systems, may have a significant impact on the fields of genomics, proteomics, and clinical analysis. These bioanalytical microsystems leverage electroosmosis and electrophoresis for sample transport, mixing, manipulation, and separation. This dissertation addresses the following three topics relevant to such systems: a new diagnostic for measuring the electrophoretic mobility of sub-micron, fluorescently-labeled particles and the electroosmotic mobility of a microchannel; a novel method and device for rapidly stirring micro- and nanoliter volume solutions for microfluidic bioanalytical applications; and a multiple-species electrokinetic instability model. Accurate measurement of the electrophoretic particle mobility and the electroosmotic mobility of microchannel surfaces is crucial to understanding the stability of colloidal suspensions, obtaining particle tracking-based velocimetry measurements of electroosmotic flow fields, and the quantification of electrokinetic bioanalytical device performance. A method for determining these mobilities from alternating and direct current electrokinetic particle tracking measurements is presented. The ability to rapidly mix fluids at low Reynolds numbers is important to the functionality of many bioanalytical, microfluidic devices. We present an electrokinetic process for rapidly stirring microflow streams by initiating an electrokinetic flow instability. The design, fabrication and performance analysis of two micromixing devices capable of rapidly stirring two low Reynolds number fluid streams are presented. Electroosmotic and electrophoretic transport in the presence of conductivity mismatches between reagent streams and the background electrolytes, can lead to an unstable flow field generating significant sample dispersion. In the multiple-species electrokinetic instability model, we consider a high aspect ratio microchannel geometry, a conductivity gradient orthogonal to the applied electric field, and a four-species chemistry model. A linear stability analysis of the depth-averaged governing equations shows unstable eigenmodes for conductivity ratios as close to unity as 1.01. Experiments and full nonlinear simulations of the governing equations were conducted for a conductivity ratio of 1.05. Images of the disturbance dye field from the nonlinear simulations show good qualitative and quantitative agreement with experiment. Species electromigration is shown to a have significant influence on the development of the conductivity field and instability dynamics in multi-ion configurations.
The pig CYP2E1 promoter is activated by COUP-TF1 and HNF-1 and is inhibited by androstenone.
Tambyrajah, Winston S; Doran, Elena; Wood, Jeffrey D; McGivan, John D
2004-11-15
Functional analysis of the pig cytochrome P4502E1 (CYP2E1) promoter identified two major activating elements. One corresponded to the hepatic nuclear factor 1 (HNF-1) consensus binding sequence at nucleotides -128/-98 and the other was located in the region -292/-266. The binding of proteins in pig liver nuclear extracts to a synthetic double-stranded oligonucleotide corresponding to this more distal activating sequence was studied by electrophoretic mobility shift assay. The minimum protein binding sequence was identified as TGTTCTGACCTCTGGG. Gel super-shift assays identified the protein binding to this site as chick ovalbumin upstream promoter transcription factor 1 (COUP-TF1). Androstenone inhibited promoter activity in transfection experiments only with constructs which included the COUP-TF1 binding site. Androstenone inhibited COUP-TF1 binding to synthetic oligonucleotides but did not affect HNF-1 binding. The results offer an explanation for the inhibition of CYP2E1 protein expression by androstenone in isolated pig hepatocytes and may be relevant to the low expression of hepatic CYP2E1 in those pigs which accumulate high levels of androstenone in vivo.
Deiber, Julio A; Piaggio, Maria V; Peirotti, Marta B
2014-03-01
Several global chain properties of relatively long peptides composed of 20 amino acid residues are estimated through the modeling of their experimental effective electrophoretic mobilities determined by CZE for 2 < pH < 6. In this regard, an all l-α-eicosapeptide, including a secondary α-helix (Peptide 1) and its all retro d-inverso-α-eicosapeptide (Peptide 2), are considered. Despite Peptides 1 and 2 are isomeric chains, they do not present similar global conformations in the whole range of pH studied. These peptides may also differ in the quality of BGE components chain interactions depending on the pH value. Three Peptide 1 fragments (Peptides 3, 4, and 5) are also analyzed in this framework with the following purposes: (i) visualization of the effects of initial and final strands at each side of the α-helix on the global chain conformations of Peptide 1 at different pHs and (ii) analysis of global chain conformations of Peptides 1 and 2, and Peptide 1 fragments in relation to their pI values. Also, the peptide maximum and minimum hydrations predicted by the model, compatible with experimental effective electrophoretic mobilities at different pHs, are quantified and discussed, and needs for further research concerning chain hydration are proposed. It is shown that CZE is a useful analytical tool for peptidomimetic designs and purposes. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Major immunoglobulin classes of the echidna (Tachyglossus aculeatus)
Atwell, J. L.; Marchalonis, J. J.; Ealey, E. H. M.
1973-01-01
The Australian echidna responds to the antigen Salmonella adelaide flagella by producing antibodies characterized by mol. wt of 900,000 and 150,000. After cleavage of interchain disulphide bonds, both the high and low mol. wt immunoglobulins can be resolved into light and heavy polypeptide chains. In both cases, the light chains resemble those of other vertebrate immunoglobulins in size (22,500 Daltons) and electrophoretic mobility. The 900,000 Dalton immunoglobulin contains heavy chains similar to human μ chains in size (70,000 Daltons) and electrophoretic mobility. The 150,000 Dalton immunoglobulin contains a different class of heavy chain, similar in size (50,000 Daltons) and electrophoretic mobility to human γ chains. Proportional mass contributions of the light and heavy chains to the intact molecule suggest the structure of the intact molecules could be represented by (L2, μ2)5 and (L2, γ2) for the high and low mol. wt immunoglobulins respectively. These configurations are similar to those described for human γM and γG immunoglobulins. The results are relevant to theories of the evolution of the different classes of immunoglobulins. While the echidna is distinctly more primitive than eutherian mammals and still retains structural features characteristic of reptiles, its major immunoglobulin classes are very similar to human IgM and IgG. The striking similarities between the γ-like heavy chain of the echnidna and human IgG heavy chains suggest that the echidna may be the first species in which a γ chain gene directly homologous to mammalian γ chain genes is expressed. ImagesFIG. 4 PMID:4761634
Analysis of NCAM helps identify unusual phenotypes of hereditary inclusion-body myopathy.
Broccolini, A; Gidaro, T; Tasca, G; Morosetti, R; Rodolico, C; Ricci, E; Mirabella, M
2010-07-20
Hereditary inclusion-body myopathy or distal myopathy with rimmed vacuoles (h-IBM/DMRV) is due to mutations of the UDP-N-acetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE) gene, which codes for an enzyme of the sialic acid biosynthetic pathway. By Western blot (WB) analysis, we have previously shown that in h-IBM/DMRV muscle, the neural cell adhesion molecule (NCAM) has increased electrophoretic mobility that reflects reduced sialylation of the protein. To identify patients with h-IBM/DMRV with atypical clinical or pathologic phenotype using NCAM analysis and the possible cellular mechanism associated with the overall abnormal sialylation of NCAM observed in this disorder. WB analysis of NCAM was performed on muscle biopsies of 84 patients with an uncharacterized muscle disorder who were divided in the following 2 groups: 1) 46 patients with a proximal muscle weakness in whom the main limb-girdle muscular dystrophy syndromes had been ruled out; and 2) 38 patients with a distal distribution of weakness in whom a neurogenic affection had been excluded. Patients in whom a reduced sialylation of NCAM was suspected were studied for the presence of GNE mutations. In 3 patients, we found that NCAM had increased electrophoretic mobility, thus suggesting an abnormal sialylation of the protein. The genetic study demonstrated that they all carried pathogenic GNE mutations. Further studies demonstrated that hyposialylated NCAM, showing increased electrophoretic mobility on WB, is expressed by nonregenerating fibers in h-IBM/DMRV muscle. WB analysis of NCAM may be instrumental in the identification of h-IBM/DMRV with atypical clinical or pathologic features.
Lee, Myung W.; Song, C.K.
2012-01-01
In this study, solution processes were developed for backplane using an organic thin film transistor (OTFT) as a driving device for an electrophoretic display (EPD) panel. The processes covered not only the key device of OTFTs but also interlayer and pixel electrodes. The various materials and printing processes were adopted to achieve the requirements of devices and functioning layers. The performance of OTFT of the backplane was sufficient to drive EPD sheet by producing a mobility of 0.12 cm2/v x sec and on/off current ratio of 10(5).
ALTERATIONS OF PROPERTIES OF RED BLOOD CELLS MEMBRANES PROTEINS OF DIFFERENT AGE AND SEX VOLUNTEERS.
Pruidze, N; Khetsuriani, R; Sujashvili, R; Ioramashvili, I; Arabuli, M; Sanikidze, T
2015-01-01
Considering the age and sex-dependent trend in the manifestation of various diseases, as well as an important pathogenic role of circulatory disorders, we decided to study the age-dependent changes in the physical properties of RBCs membrane proteins (their electric charge and molecular weight) in healthy people of different sex (males and females) and age. Blood of 56 healthy volunteers (Tbilisi, Georgia) of different sex and gender was studied (the patients were divided in 8 groups (7 patients in each groups): 1 - 18-25 years old male, 2 - 18-25 years old female, 3 - 25-44 years old male, 4 - 25-44 years old female, 5 - 44-60 years old male, 6 - 44-60 years old female; 7 - 60-80 years old male, 8 - 70-80 years old female). In groups 6 and 8 were women in menopause was determined according 12 months of amenorrhea. Individuals often consume alcohol addicts, pregnant women and patients with chronic diseases were excluded from the study. The study protocol was approved by Ethical Committee of the Tbilisi State Medical University. RBCs membrane proteins have been extracted from human heparinized blood and their mobility was studied by electrophoretic method. The electrophoretic mobility of RBCs membrane proteins decreases with age of healthy volunteers, that indicates decrease of total charge of proteins, depending on the electrically charged amino acids content. In female patients the electrophoretic mobility of the RBCs membrane proteins especially intensively decreases in period of menopause. Increase of molecular weight of proteins (100-200 kDa) from RBCs' membranes of alder age group was manifested. Intensively decrease electrophoretic mobility of erythrocytes membrane proteins from female patients in period of menopause indicates on estrogen related mechanism of the regulation of membrane protein conformation and composition in females. Increased content of high molecular weight proteins in the RBCs membranes from patients of older age groups may be caused to disorders of protein-protein interaction mechanisms, their ubiquitinylation or oligomerisation and formation of high molecular weight complexes of inactivated proteins in aged RBCs. These processes play important role in regulation of the RBCs shape and stability. Identified sex- and age-related alterations in RBCs membranes proteins affect the rheological properties of blood and can be considered as the etiologic and pathogenic markers of various diseases.
Gwarda, Radosław Ł; Dzido, Tadeusz H
2018-07-13
In our previous papers we have investigated the influence of the mobile phase composition on mechanism of retention, selectivity and efficiency of peptide separation in various high-performance thin-layer chromatography (HPTLC) systems with commercially available silica-based adsorbents. We have also investigated the influence of pH of the mobile phase buffer on migration and separation of peptides in pressurized planar electrochromatography (PPEC). Here we investigate the influence of concentration of ion-pairing additive, and concentration and type of organic modifier of the mobile phase on migration of peptides in PPEC system with octadecyl silica-based adsorbent, and with the same set of the solutes as before. We compare our current results with the results obtained before for similar HPTLC and PPEC systems, and discuss the influence of particular variables on retention, electrophoretic mobility of solutes and electroosmotic flow of the mobile phase. We show, that the final selectivity of peptide separation results from co-influence of all the three factors mentioned. Concentration of organic modifier of the mobile phase, as well as concentration of ion-pairing additive, affect the retention, the electrophoretic mobility, and the electroosmotic flow simultaneously. This makes independent optimization of these factors rather difficult. Anyway PPEC offers much faster separation of peptides with quite different selectivity, in comparison to HPTLC, with similar adsorbents and similar mobile phase composition. However, we also present and discuss the issue of extensive tailing of peptide zones in the PPEC in comparison to similar HPTLC systems. Copyright © 2018 Elsevier B.V. All rights reserved.
Aboobakar, Eanas F.; Wang, Xuying; Heitman, Joseph; Kozubowski, Lukasz
2011-01-01
Calcineurin is a conserved calcium/calmodulin-dependent serine/threonine-specific protein phosphatase that acts in cell stress responses. Calcineurin is essential for growth at 37°C and for virulence of the human fungal pathogen Cryptococcus neoformans, but its substrates remain unknown. The C2 domain-containing, phospholipid-binding protein Cts1 was previously identified as a multicopy suppressor of a calcineurin mutation in C. neoformans. Here we further characterize the function of Cts1 and the links between Cts1 and calcineurin. GFP-Cts1 localizes to cytoplasmic puncta and colocalizes with the endosomal marker FM4-64. The cts1Δ mutant shows a distinct FM4-64 staining pattern, suggesting involvement of Cts1 in endocytic trafficking. In large budded cells, GFP-Cts1 localizes transiently at the mother bud neck, as a single ring that undergoes contraction. mCherry-Cts1 colocalizes with the GFP-tagged calcineurin catalytic subunit Cna1 at sites of mRNA processing at 37°C, suggesting that Cts1 and calcineurin function coordinately during thermal stress. GFP-Cts1 exhibits slower electrophoretic mobility for cells grown at 37°C than for cells grown at 24°C, and the shift to a higher molecular weight is more pronounced in the presence of the calcineurin inhibitor FK506. In vitro treatment with calf intestinal alkaline phosphatase (CIP) restores faster electrophoretic mobility to GFP-Cts1, suggesting that Cts1 is phosphorylated at 37°C and may be dephosphorylated in a calcineurin-dependent manner. mCherry-Cts1 also coimmunoprecipitates with GFP-Cna1, with greater complex formation at 37°C than at 24°C. Taken together, these findings support potential roles for Cts1 in endocytic trafficking, mRNA processing, and cytokinesis and suggest that Cts1 is a substrate of calcineurin during high-temperature stress responses. PMID:22002655
United States Air Force Summer Faculty Research Program. Management Report. Volume 4
1988-12-01
Anderson, N.L. et al (1986). Effects of Aroclor 1254 on proteins of mouse liver: Aplication of two-dimensional electrophoretic protein mapping...transferability of job skill, has surfaced in the context of civilian occupational mobility (Byrne, 1975; Fine, 1957a, 1957b) transitions from military to...considerations from concept through deployment. Defense Management Journal, 16(2), 12-19. Byrne, J. J. (1975). Occupational mobility of workers. Monthly
Discrimination between closed and open forms of lipases using electrophoretic techniques.
Miled, N; Riviere, M; Cavalier, J F; Buono, G; Berti, L; Verger, R
2005-03-15
The enhanced catalytic activity of lipases is often associated with structural changes. The three-dimensional (3D) structures showed that the covalently inhibited lipases exist under their open conformations, in contrast to their native closed forms. We studied the inhibition of various lipases--human and dog gastric lipases, human pancreatic lipase, and Humicola lanuginosa lipase--by the octyl-undecyl phosphonate inhibitor, and we measured the subsequent modifications of their respective electrophoretic mobility. Furthermore, the experimental values of the isoelectric points found for the native (closed) and inhibited (open) lipases are in agreement with theoretical calculations based on the electrostatic potential. We concluded that there is a significant difference in the isoelectric points between the closed (native) and open (inhibited) conformations of the four lipases investigated. Thus, analysis of the electrophoretic pattern is proposed as an easy experimental tool to differentiate between a closed and an open form of a given lipase.
Pedersen-Bjergaard, S; Rasmussen, K E; Sannes, E
1998-01-01
While the hallucinogenic mushrooms Psilocybe semilanceata have previously been analyzed for the indole alkaloids psilocybin and baeocystin by capillary zone electrophoresis (CZE) at pH 11.5, the present work focused on the development of an alternative and complementary capillary electrophoretic method for their identification. Owing to their structural similarity and zwitterionic nature, the compounds were difficult to resolve based on different interactions with cationic or anionic micelles. However, while the attempts with micellar electrokinetic chromatography (MEKC) were unsuccessful, rapid derivatization with propyl chloroformate and reanalysis by CZE at pH 11.5 was effective to support identification of the two indole alkaloids. Psilocin was difficult to analyze by CZE at pH 11.5 owing to comigration with the electroosmotic flow. For this compound, the pH of the running buffer was reduced to 7.2 to effectively enhance the electrophoretic mobility.
hnRNP L binds to CA repeats in the 3'UTR of bcl-2 mRNA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Dong-Hyoung; Lim, Mi-Hyun; Youn, Dong-Ye
We previously reported that the CA-repeat sequence in the 3'-untranslated region (3'UTR) of bcl-2 mRNA is involved in the decay of bcl-2 mRNA. However, the trans-acting factor for the CA element in bcl-2 mRNA remains unidentified. The heterogeneous nuclear ribonucleoprotein L (hnRNP L), an intron splicing factor, has been reported to bind to CA repeats and CA clusters in the 3'UTR of several genes. We reported herein that the CA repeats of bcl-2 mRNA have the potential to form a distinct ribonuclear protein complex in cytoplasmic extracts of MCF-7 cells, as evidenced by RNA electrophoretic mobility shift assays (REMSA). Amore » super-shift assay using the hnRNP L antibody completely shifted the complex. Immunoprecipitation with the hnRNP L antibody and MCF-7 cells followed by RT-PCR revealed that hnRNP L interacts with endogenous bcl-2 mRNA in vivo. Furthermore, the suppression of hnRNP L in MCF-7 cells by the transfection of siRNA for hnRNP L resulted in a delay in the degradation of RNA transcripts including CA repeats of bcl-2 mRNA in vitro, suggesting that the interaction between hnRNPL and CA repeats of bcl-2 mRNA participates in destabilizing bcl-2 mRNA.« less
Endospore surface properties of commonly used Bacillus anthracis surrogates vary in aqueous solution
The hydrophobic character and electrophoretic mobility of microorganisms are vital aspects of understanding their interactions with the environment. These properties are fundamental in fate-and-transport, physiological, and virulence studies, and thus integral in surrogate select...
Determination of ionization constants by paper electrophoresis.
Tate, M E
1981-01-01
Dimensionless apparent ionization constants of charged low-molecular-weight species may be obtained from paper-electrophoretic data at 20-25 degrees C with buffers (I0.1-0.5) of measured pH (1.5-12.5) containing oxalate ions. Relative mobilities rather than absolute mobilities were measured by using glycerol and m-nitrobenzenesulphonate respectively as standards of zero and unit mobility. Application of the procedure to ionizations of adenine, adenosine, 2'-deoxyadenosine, 3'-deoxyadenosine, 3':5'-cyclic AMP, ADP, ADP-glucose-agrocin 84 and ATP is described. PMID:6976169
Takahashi, T; Guron, C; Shetty, S; Matsui, H; Raghow, R
1997-09-05
To dissect the cis-regulatory elements of the murine Msx-1 promoter, which lacks a conventional TATA element, a putative Msx-1 promoter DNA fragment (from -1282 to +106 base pairs (bp)) or its congeners containing site-specific alterations were fused to luciferase reporter and introduced into NIH3T3 and C2C12 cells, and the expression of luciferase was assessed in transient expression assays. The functional consequences of the sequential 5' deletions of the promotor revealed that multiple positive and negative regulatory elements participate in regulating transcription of the Msx-1 gene. Surprisingly, however, the optimal expression of Msx-1 promoter in either NIH3T3 or C2C12 cells required only 165 bp of the upstream sequence to warrant detailed examination of its structure. Therefore, the functional consequences of site-specific deletions and point mutations of the cis-acting elements of the minimal Msx-1 promoter were systematically examined. Concomitantly, potential transcriptional factor(s) interacting with the cis-acting elements of the minimal promoter were also studied by gel electrophoretic mobility shift assays and DNase I footprinting. Combined analyses of the minimal promoter by DNase I footprinting, electrophoretic mobility shift assays, and super shift assays with specific antibodies revealed that 5'-flanking regions from -161 to -154 and from -26 to -13 of the Msx-1 promoter contains an authentic E box (proximal E box), capable of binding a protein immunologically related to the upstream stimulating factor 1 (USF-1) and a GC-rich sequence motif which can bind to Sp1 (proximal Sp1), respectively. Additionally, we observed that the promoter activation was seriously hampered if the proximal E box was removed or mutated, and the promoter activity was eliminated completely if the proximal Sp1 site was similarly altered. Absolute dependence of the Msx-1 minimal promoter on Sp1 could be demonstrated by transient expression assays in the Sp1-deficient Drosophila cell line cotransfected with Msx-1-luciferase and an Sp1 expression vector pPacSp1. The transgenic mice embryos containing -165/106-bp Msx-1 promoter-LacZ DNA in their genomes abundantly expressed beta-galactosidase in maxillae and mandibles and in the cellular primordia involved in the formation of the meninges and the bones of the skull. Thus, the truncated murine Msx-1 promoter can target expression of a heterologous gene in the craniofacial tissues of transgenic embryos known for high level of expression of the endogenous Msx-1 gene and found to be severely defective in the Msx-1 knock-out mice.
Henke, Sarah K; Cronan, John E
2016-11-01
Group II biotin protein ligases (BPLs) are characterized by the presence of an N-terminal DNA binding domain that functions in transcriptional regulation of the genes of biotin biosynthesis and transport. The Staphylococcus aureus Group II BPL which is called BirA has been reported to bind an imperfect inverted repeat located upstream of the biotin synthesis operon. DNA binding by other Group II BPLs requires dimerization of the protein which is triggered by synthesis of biotinoyl-AMP (biotinoyl-adenylate), the intermediate in the ligation of biotin to its cognate target proteins. However, the S. aureus BirA was reported to dimerize and bind DNA in the absence of biotin or biotinoyl-AMP (Soares da Costa et al. (2014) Mol Microbiol 91: 110-120). These in vitro results argued that the protein would be unable to respond to the levels of biotin or acceptor proteins and thus would lack the regulatory properties of the other characterized BirA proteins. We tested the regulatory function of the protein using an in vivo model system and examined its DNA binding properties in vitro using electrophoretic mobility shift and fluorescence anisotropy analyses. We report that the S. aureus BirA is an effective regulator of biotin operon transcription and that the prior data can be attributed to artifacts of mobility shift analyses. We also report that deletion of the DNA binding domain of the S. aureus BirA results in loss of virtually all of its ligation activity. © 2016 John Wiley & Sons Ltd.
High temperature microelectrophoresis studies of the solid oxide/water interface
NASA Astrophysics Data System (ADS)
Fedkin, Mark Valentinovich
Metal oxides are abundant components of geo-environmental systems and are widely used materials in industry. Many practical applications of oxide materials require the knowledge of their surface properties at both ambient and elevated temperatures. Due to substantial technical challenges associated with experimental studies of solid/water interfaces at elevated temperatures, consistent data on adsorption, surface charge, and zeta potential for most oxide materials are limited to temperatures less than 100°C. A high temperature microelectrophoresis technique, developed in this study, made it possible to extend the zeta potential measurements at the solid oxide/water interface to 200°C. The design of the high temperature electrophoresis cell allowed for the visual microscopic observation of the electrophoretic movement of suspended particles through pressure-tight sapphire windows. The electrophoretic mobilities of metal oxide particles suspended in aqueous solutions were measured in a DC electric field as a function of pH, ionic strength, and temperature. The experimental procedure and methods for evaluation of the main experimental parameters (electrophoretic mobility, electric field strength, high temperature pH, and cell constant) have been developed. Zeta potentials were calculated from the experimental data using O'Brien and White's (1978) numerical solution for electrophoretic mobility equation. Zeta potentials and isoelectric points (IEP) of the metal oxide/aqueous solution interface were experimentally determined for ZrO2, TiO 2(rutile), and alphaAl2O3 at 25, 120, and 200°C. The background solutions used for the preparation of suspensions were pure H2O, NaCl(aq) (10-4--10-2 mol.kg-1), and SrCl2 (10-4 mol.kg, for TiO2). For all studied materials, the IEPs were found to regularly decrease with increasing temperature, which agrees with available theoretical predictions. Thermodynamic functions, including Gibbs energy, enthalpy, and heat capacity, were estimated for the H +/OH- adsorption from the experimental IEP data using the 1-pK model of the oxide/water interface. The experimental information obtained in this study combined with data from potentiometric titration and other experimental methods form the basis for future theoretical studies of the electrical double layer at the oxide/water interface.
The surface properties of microorganisms play an important role in their behavior within the environment. Electrophoretic mobility and cell surface hydrophobicity of bacterial cells influence their initial interaction with surfaces and mediate their stability within an aqueous su...
CONDUCTOMETRIC CHARACTERIZATION OF DISSOLVED HUMIC MATERIALS. (R828158)
Conductometric replacement titrations of humic and fulvic acids dissolved in a slight excess of hydroxide were carried out with standard acid. The slope of the titration curve corresponding to the protonation of humate/fulvate was related to the electrophoretic mobility of the...
Wang, Nan-Hsuan; Lee, Wan-Li; Her, Guor-Rong
2011-08-15
A strategy based on postcolumn electrophoretic mobility control (EMC) was developed to alleviate the adverse effect of trifluoroacetic acid (TFA) on the liquid chromatography-mass spectrometry (LC-MS) analysis of peptides. The device created to achieve this goal consisted of a poly(dimethylsiloxane) (PDMS)-based junction reservoir, a short connecting capillary, and an electrospray ionization (ESI) sprayer connected to the outlet of the high-performance liquid chromatography (HPLC) column. By apply different voltages to the junction reservoir and the ESI emitter, an electric field was created across the connecting capillary. Due to the electric field, positively charged peptides migrated toward the ESI sprayer, whereas TFA anions remained in the junction reservoir and were removed from the ionization process. Because TFA did not enter the ESI source, ion suppression from TFA was alleviated. Operation of the postcolumn device was optimized using a peptide standard mixture. Under optimized conditions, signals for the peptides were enhanced 9-35-fold without a compromise in separation efficiency. The optimized conditions were also applied to the LC-MS analysis of a tryptic digest of bovine serum albumin.
Capillary Electrophoresis Sensitivity Enhancement Based on Adaptive Moving Average Method.
Drevinskas, Tomas; Telksnys, Laimutis; Maruška, Audrius; Gorbatsova, Jelena; Kaljurand, Mihkel
2018-06-05
In the present work, we demonstrate a novel approach to improve the sensitivity of the "out of lab" portable capillary electrophoretic measurements. Nowadays, many signal enhancement methods are (i) underused (nonoptimal), (ii) overused (distorts the data), or (iii) inapplicable in field-portable instrumentation because of a lack of computational power. The described innovative migration velocity-adaptive moving average method uses an optimal averaging window size and can be easily implemented with a microcontroller. The contactless conductivity detection was used as a model for the development of a signal processing method and the demonstration of its impact on the sensitivity. The frequency characteristics of the recorded electropherograms and peaks were clarified. Higher electrophoretic mobility analytes exhibit higher-frequency peaks, whereas lower electrophoretic mobility analytes exhibit lower-frequency peaks. On the basis of the obtained data, a migration velocity-adaptive moving average algorithm was created, adapted, and programmed into capillary electrophoresis data-processing software. Employing the developed algorithm, each data point is processed depending on a certain migration time of the analyte. Because of the implemented migration velocity-adaptive moving average method, the signal-to-noise ratio improved up to 11 times for sampling frequency of 4.6 Hz and up to 22 times for sampling frequency of 25 Hz. This paper could potentially be used as a methodological guideline for the development of new smoothing algorithms that require adaptive conditions in capillary electrophoresis and other separation methods.
Urokinase production by electrophoretically separated cultured human embryonic kidney cells
NASA Technical Reports Server (NTRS)
Kunze, M. E.; Plank, L. D.; Giranda, V.; Sedor, K.; Todd, P. W.
1985-01-01
Urokinase is a plasminogen activator found in urine. Relatively pure preparations have been tested in Europe, Japan and the United States for the treatment of deep vein thrombosis and other dangerous blood clots. Human embryonic kidney cell cultures have been found to produce urokinase at much higher concentrations, but less than 5% of the cells in typical cultures are producers. Since human diploid cells become senescent in culture the selection of clones derived from single cells will not provide enough material to be useful, so a bulk purification method is needed for the isolation of urokinase producing cell populations. Preparative cell electrophoresis was chosen as the method, since evidence exists that human embryonic cell cultures are richly heterogeneous with respect to electrophoretic mobility, and preliminary electrophoretic separations on the Apollo-Soyuz space flight produced cell populations that were rich in urokinase production. Similarly, erythropoietin is useful in the treatment of certain anemias and is a kidney cell duct, and electrophoretically enriched cell populations producing this product have been reported. Thus, there is a clear need for diploid human cells that produce these products, and there is evidence that such cells should be separable by free-flow cell electrophoresis.
LABELING WITH 14C AMINO ACIDS OF ALBUMIN-LIKE PROTEIN BY RAT LIVER RIBONUCLEOPROTEIN PARTICLES
von der Decken, Alexandra
1963-01-01
Ribonucleoprotein particles were prepared by treatment of rat liver microsomes with detergents and high concentrations of KCl. They were active in incorporating 14C amino acids into protein when incubated with cell sap together with ATP, GTP, and a system to regenerate the triphosphates. The albumin of the incubation mixture, soluble at 105,000 g, and that of the fraction released by ultrasonication of the particles were studied by immunoelectrophoresis in agar gel. When the ribonucleoprotein particles were incubated with cell sap the immunological precipitation lines formed with antiserum to rat serum albumin were highly radioactive as tested by autoradiography. After zone electrophoresis on cellulose acetate, two immunologically reactive albumins were obtained which differed in their electrophoretic mobility from rat serum albumin. Labeled albumin, when purified on DEAE-cellulose columns, retained its radioactivity as tested by autoradiography following immunoelectrophoresis. On cellulose acetate this purified albumin showed an electrophoretic mobility higher than that of rat serum albumin. PMID:14026307
Electrokinetic Particle Aggregation and Flow Instabilities in Non-Dilute Colloidal Suspensions
NASA Astrophysics Data System (ADS)
Navaneetham, Guru; Posner, Jonathan
2007-11-01
An experimental investigation of electrokinetic particle aggregation and flow instabilities of non-dilute colloidal suspensions in microfabricated channels is presented. The addition of charged colloidal particles can alter the solution's conductivity, permittivity as well as the average particle electrophoretic mobility. In this work, a colloid volume fraction gradient is achieved at the intersection of a Y-shaped PDMS microchannel. The solution conductivity and the particle mobility as a function of the particle (500 nm polystyrene) volume fraction are presented. The critical conditions required for particle aggregation and flow instability are given along with a scaling analysis which shows that the flow becomes unstable at a critical electric Rayleigh number for a wide range of applied electric fields and colloid volume fractions. Electrokinetic particle aggregation and instabilities of non-dilute colloidal suspensions may be important for applications such as the electrophoretic deposition of particles to form micropatterned colloidal assemblies, electrorheological devices, and on-chip, electrokinetic manipulation of colloids.
Le Cerf, Didier; Pepin, Anne Sophie; Niang, Pape Momar; Cristea, Mariana; Karakasyan-Dia, Carole; Picton, Luc
2014-11-26
The formation of polyelectrolyte complexes (PECs) between carboxymethyl pullulan and DEAE Dextran, was investigated, in dilute solution, with emphasis on the effect of charge density (molar ratio or pH) and molar masses. Electrophoretic mobility measurements have evidenced that insoluble PECs (neutral electrophoretic mobility) occurs for charge ratio between 0.6 (excess of polycation) and 1 (stoichiometry usual value) according to the pH. This atypical result is explained by the inaccessibility of some permanent cationic charge when screened by pH dependant cationic ones (due to the Hoffman alkylation). Isothermal titration calorimetry (ITC) indicates an endothermic formation of PEC with a binding constant around 10(5) L mol(-1). Finally asymmetrical flow field flow fractionation coupled on line with static multi angle light scattering (AF4/MALS) evidences soluble PECs with very large average molar masses and size around 100 nm, in agreement with scrambled eggs multi-association between various polyelectrolyte chains. Copyright © 2014 Elsevier Ltd. All rights reserved.
Influence of phosphate on the transport properties of lead in sand.
Butkus, Michael A; Johnson, Marie C
2011-01-15
Temporal moment analysis was used to examine the transport of lead species in sand columns. The influence of sodium phosphate (PO(4(aq))) and hydroxyapatite (HA) on lead transport was also evaluated. Transport properties of lead microparticles (diameter>0.45 μm) were a function of electrophoretic mobility: those particles with electrophoretic mobility less than -1 × 10(-8)m(2)/Vs exhibited significantly lower dimensionless first temporal moment (θ) and second temporal moment (σ(θ)(2)). The forms of lead investigated in this work had a tendency to move in sand over a wide pH range. Although the PO(4(aq)) amendment substantially reduced lead mass recoveries in the sand column effluent, lead microparticles were formed that had a tendency to move rapidly and with minimal dispersion when compared with controls. Treatments with HA provided limited reduction in lead mass recovery and minimal changes in lead transport properties. A colloid stability model was used to predict attachment of lead particles in sand. Published by Elsevier B.V.
Wilson, Emma L; Garton, Mark; Fuller, Heidi R
2016-05-01
Phenytoin is an antiepileptic drug used in the management of partial and tonic-clonic seizures. In previous studies we have shown that valproate, another antiepileptic drug, reduced the amount of two key bone proteins, pro-collagen I and osteonectin (SPARC, BM-40), in both skin fibroblasts and cultured osteoblast-like cells. Here we show that phenytoin also reduces pro-collagen I production in osteoblast-like cells, but does not appear to cause a decrease in osteonectin message or protein production. Instead, a 24h exposure to a clinically relevant concentration of phenytoin resulted in a dose-dependent change in electrophoretic mobility of osteonectin, which was suggestive of a change in post-translational modification status. The perturbation of these important bone proteins could be one of the mechanisms to explain the bone loss that has been reported following long-term treatment with phenytoin. Copyright © 2016 Elsevier B.V. All rights reserved.
Serine/Threonine kinase dependent transcription from the polyhedrin promoter of SpltNPV-I
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mishra, Gourav; Gautam, Hemant K.; Das, Rakha H.
2007-07-06
Polyhedrin (polh) and p10 are the two hyper-expressed very late genes of nucleopolyhedroviruses. Alpha amanitin resistant transcription from Spodoptera litura nucleopolyhedrovirus (SpltNPV-I) polyhedrin promoter was observed with virus infected nuclear extract of NIV-HA-197 cells but not with that from uninfected nuclear extract. Anti-protein kinase-1 (pk1) antibody inhibited the transcription and the inhibition reversed on addition of pk1, however, pk1 mutant protein, K50M having no phosphorylation activity did not overcome the transcription inhibition. Chromatin immuno-precipitation assays with viral anti-pk1 antibody showed the interaction of pk1 with the polh while electrophoretic mobility shift assays indicated the strong binding affinity (K {sub d}more » {approx} 5.5 x 10{sup -11}) of purified pk1 with the polh promoter. These results suggested that the viral coded pk1 acts as a transcription factor in transcribing baculovirus very late genes.« less
GATA-1 directly regulates Nanog in mouse embryonic stem cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Wen-Zhong; Ai, Zhi-Ying; Key Laboratory of Animal Biotechnology, Ministry of Agriculture, Northwest A&F University, Yangling 712100
2015-09-25
Nanog safeguards pluripotency in mouse embryonic stem cells (mESCs). Insight into the regulation of Nanog is important for a better understanding of the molecular mechanisms that control pluripotency of mESCs. In a silico analysis, we identify four GATA-1 putative binding sites in Nanog proximal promoter. The Nanog promoter activity can be significantly repressed by ectopic expression of GATA-1 evidenced by a promoter reporter assay. Mutation studies reveal that one of the four putative binding sites counts for GATA-1 repressing Nanog promoter activity. Direct binding of GATA-1 on Nanog proximal promoter is confirmed by electrophoretic mobility shift assay and chromatin immunoprecipitation.more » Our data provide new insights into the expanded regulatory circuitry that coordinates Nanog expression. - Highlights: • The Nanog proximal promoter conceives functional element for GATA-1. • GATA-1 occupies the Nanog proximal promoter in vitro and in vivo. • GATA-1 transcriptionally suppresses Nanog.« less
Saroj, Sunil D.; Holmer, Linda; Berengueras, Júlia M.; Jonsson, Ann-Beth
2017-01-01
Streptococcus pyogenes an adapted human pathogen asymptomatically colonizes the nasopharynx, among other polymicrobial communities. However, information on the events leading to the colonization and expression of virulence markers subject to interspecies and host-bacteria interactions are limited. The interference of acyl homoserine lactones (AHLs) with the hemolytic activity and viability of S. pyogenes M6 S165 was examined. AHLs, with fatty acid side chains ≥12 carbon atoms, inhibited hemolytic activity by downregulating the expression of the sag operon involved in the production of streptolysin S. Inhibitory AHLs upregulated the expression of transcriptional regulator LuxR. Electrophoretic mobility shift assays revealed the interaction of LuxR with the region upstream of sagA. AHL-mediated bactericidal activity observed at higher concentrations (mM range) was an energy-dependent process, constrained by the requirement of glucose and iron. Ferrichrome transporter FtsABCD facilitated transport of AHLs across the streptococcal membrane. The study demonstrates a previously unreported role for AHLs in S. pyogenes virulence. PMID:28303956
Saroj, Sunil D; Holmer, Linda; Berengueras, Júlia M; Jonsson, Ann-Beth
2017-03-17
Streptococcus pyogenes an adapted human pathogen asymptomatically colonizes the nasopharynx, among other polymicrobial communities. However, information on the events leading to the colonization and expression of virulence markers subject to interspecies and host-bacteria interactions are limited. The interference of acyl homoserine lactones (AHLs) with the hemolytic activity and viability of S. pyogenes M6 S165 was examined. AHLs, with fatty acid side chains ≥12 carbon atoms, inhibited hemolytic activity by downregulating the expression of the sag operon involved in the production of streptolysin S. Inhibitory AHLs upregulated the expression of transcriptional regulator LuxR. Electrophoretic mobility shift assays revealed the interaction of LuxR with the region upstream of sagA. AHL-mediated bactericidal activity observed at higher concentrations (mM range) was an energy-dependent process, constrained by the requirement of glucose and iron. Ferrichrome transporter FtsABCD facilitated transport of AHLs across the streptococcal membrane. The study demonstrates a previously unreported role for AHLs in S. pyogenes virulence.
Wen, Bi-Qing; Xing, Mei-Qing; Zhang, Hua; Dai, Cheng; Xue, Hong-Wei
2011-11-01
Homeobox transcription factors are involved in various aspects of plant development, including maintenance of the biosynthesis and signaling pathways of different hormones. However, few direct targets of homeobox proteins have been identified. We here show that overexpression of rice homeobox gene HOX1a resulted in enhanced gibberellin (GA) response, indicating a positive effect of HOX1a in GA signaling. HOX1a is induced by GA and encodes a homeobox transcription factor with transcription repression activity. In addition, HOX1a suppresses the transcription of early flowering1 (EL1), a negative regulator of GA signaling, and further electrophoretic mobility shift assay and chromatin immunoprecipitation analysis revealed that HOX1a directly bound to the promoter region of EL1 to suppress its expression and stimulate GA signaling. These results demonstrate that HOX1a functions as a positive regulator of GA signaling by suppressing EL1, providing informative hints on the study of GA signaling. © 2011 Institute of Botany, Chinese Academy of Sciences.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Danno, Hirosuke; Ishii, Kiyo-aki; Nakagawa, Yoshimi
To elucidate the physiological role of CREBH, the hepatic mRNA and protein levels of CREBH were estimated in various feeding states of wild and obesity mice. In the fast state, the expression of CREBH mRNA and nuclear protein were high and profoundly suppressed by refeeding in the wild-type mice. In ob/ob mice, the refeeding suppression was impaired. The diet studies suggested that CREBH expression was activated by fatty acids. CREBH mRNA levels in the mouse primary hepatocytes were elevated by addition of the palmitate, oleate and eicosapenonate. It was also induced by PPAR{alpha} agonist and repressed by PPAR{alpha} antagonist. Luciferasemore » reporter gene assays indicated that the CREBH promoter activity was induced by fatty acids and co-expression of PPAR{alpha}. Deletion studies identified the PPRE for PPAR{alpha} activation. Electrophoretic mobility shift assay and chromatin immunoprecipitation (ChIP) assay confirmed that PPAR{alpha} directly binds to the PPRE. Activation of CREBH at fasting through fatty acids and PPAR{alpha} suggest that CREBH is involved in nutritional regulation.« less
Changes in Expression of Signal Transduction Proteins in T Lymphocytes of Patients with Leprosy
Zea, Arnold H.; Ochoa, Maria T.; Ghosh, Paritosh; Longo, Dan L.; Alvord, W. Gregory; Valderrama, Liliana; Falabella, Rafael; Harvey, Linda K.; Saravia, Nancy; Moreno, Luis H.; Ochoa, Augusto C.
1998-01-01
Advanced stages of mycobacterial diseases such as leprosy and tuberculosis are characterized by a loss of T-cell function. The basis of this T-cell dysfunction is not well understood. The present report demonstrates major alterations in the expression of signal transduction molecules in T cells of leprosy patients. These alterations were most frequently observed in lepromatous leprosy (LL) patients. Of 29 LL patients, 69% had decreased T-cell receptor ζ-chain expression, 48% had decreased p56lck tyrosine kinase, and 63% had a loss of nuclear transcription factor NF-κB p65. An electrophoretic mobility shift assay with the gamma interferon core promoter region revealed a loss of the Th1 DNA-binding pattern in LL patients. In contrast, tuberculoid leprosy patients had only minor signal transduction alterations. These novel findings might improve our understanding of the T-cell dysfunction observed in leprosy and other infectious diseases and consequently might lead to better immunologic evaluation of patients. PMID:9453602
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ward, G.E.
When intact Arbacia punctulata spermatozoa are exposed to solubilized egg jelly, the electrophoretic mobility of an abundant sperm flagellar membrane protein changes from an apparent molecular mass of 160 kDa to 150 kDa. A. punctulata spermatozoa can be labeled in vivo with /sup 32/P-labeled cells it was demonstrated that the mobility shift of the 160-kDa protein is due to dephosphorylation. The peptide resact (Cys-Val-Thr-Gly-Ala-Pro-Gly-Cys-Val-Gly-Gly-Gly-Arg-Leu-NH/sub 2/) is the component of egg jelly which is responsible for inducing the dephosphorylation. The 160/150-kdal sperm membrane protein has been purified to homogeneity by affinity chromatography on concanavalin A-agarose, and identified as sperm guanylate cyclase.more » The enzymatic activity of the guanylate cyclase is tightly coupled to its phosphorylation state. Resact has been shown to act as a potent chemoattractant for A. punctulata spermatozoa. The chemotactic response is concentration-dependent, is abolished by pretreatment of the spermatozoa with resact, and shows an absolute requirement for external calcium. This work represents the first demonstration of animal sperm chemotaxis in response to a precisely-defined molecule of egg origin. The results established a new, biologically meaningful function for resact, and may implicate sperm guanylate cyclase and cGMP in flagellar function and the chemotactic response.« less
USDA-ARS?s Scientific Manuscript database
Surface macromolecule cleavage experiments were conducted on enterohaemorrhagic Escherichia coli O157:H7 cells to investigate the influence of these macromolecules on cell surface properties. Electrophoretic mobility, hydrophobicity, and titration experiments were carried out on proteinase K treate...
Rodgers, K K; Villey, I J; Ptaszek, L; Corbett, E; Schatz, D G; Coleman, J E
1999-07-15
RAG1 and RAG2 are the two lymphoid-specific proteins required for the cleavage of DNA sequences known as the recombination signal sequences (RSSs) flanking V, D or J regions of the antigen-binding genes. Previous studies have shown that RAG1 alone is capable of binding to the RSS, whereas RAG2 only binds as a RAG1/RAG2 complex. We have expressed recombinant core RAG1 (amino acids 384-1008) in Escherichia coli and demonstrated catalytic activity when combined with RAG2. This protein was then used to determine its oligomeric forms and the dissociation constant of binding to the RSS. Electrophoretic mobility shift assays show that up to three oligomeric complexes of core RAG1 form with a single RSS. Core RAG1 was found to exist as a dimer both when free in solution and as the minimal species bound to the RSS. Competition assays show that RAG1 recognizes both the conserved nonamer and heptamer sequences of the RSS. Zinc analysis shows the core to contain two zinc ions. The purified RAG1 protein overexpressed in E.coli exhibited the expected cleavage activity when combined with RAG2 purified from transfected 293T cells. The high mobility group protein HMG2 is stably incorporated into the recombinant RAG1/RSS complex and can increase the affinity of RAG1 for the RSS in the absence of RAG2.
Hemoglobin Brigham (α2Aβ2100 Pro→Leu). HEMOGLOBIN VARIANT ASSOCIATED WITH FAMILIAL ERYTHROCYTOSIS
Lokich, Jacob J.; Moloney, William C.; Bunn, H. Franklin; Bruckheimer, Sally M.; Ranney, Helen M.
1973-01-01
Erythrocytosis associated with the presence of a hemoglobin with increased oxygen affinity has been reported for 10 hemoglobin variants, most of which demonstrate altered electrophoretic mobility. Several members of a family were found to have erythrocytosis, and both the whole blood and the hemoglobin exhibited increased oxygen affinity. Phosphate-free hemoglobin solutions had a normal Bohr effect and reactivity to 2,3-diphosphoglycerate. The electrophoretic properties of the hemoglobin were normal, but on peptide mapping of a tryptic digest of the isolated β-chains, a normal βT11 peptide and an abnormal βT11 with greater Rf were seen. Analysis of the abnormal peptide showed the substitution of leucine for the normal proline at β100 (helical residue G2). The hemoglobin variant, designated Hb Brigham, serves to emphasize the necessity for detailed evaluation of the structure and function of hemoglobin in familial erythrocytosis even with electrophoretically “normal” hemoglobin. PMID:4719677
Cathodic electrodeposition of ceramic and organoceramic materials. Fundamental aspects.
Zhitomirsky, I
2002-03-29
Electrodeposition of ceramic materials can be performed by electrophoretic (EPD) or electrolytic (ELD) deposition. Electrophoretic deposition is achieved via motion of charged particles towards an electrode under an applied electric field. Electrolytic deposition produces colloidal particles in cathodic reactions for subsequent deposition. Various electrochemical strategies and deposition mechanisms have been developed for electrodeposition of ceramic and organoceramic films, and are discussed in the present article. Electrode-position of ceramic and organoceramic materials includes mass transport, accumulation of particles near the electrode and their coagulation to form a cathodic deposit. Various types of interparticle forces that govern colloidal stability in the absence and presence of processing additives are discussed. Novel theoretical contributions towards an interpretation of particle coagulation near the electrode surface are reviewed. Background information is given on the methods of particle charging, stabilization of colloids in aqueous and non-aqueous media, electrophoretic mobility of ceramic particles and polyelectrolytes, and electrode reactions. This review also covers recent developments in the electrodeposition of ceramic and organoceramic materials.
Electrophoretic separation of kidney and pituitary cells on STS-8
NASA Technical Reports Server (NTRS)
Morrison, D. R.; Nachtwey, D. S.; Barlow, G. H.; Cleveland, C.; Lanham, J. W.; Farrington, M. A.; Hatfield, J. M.; Hymer, W. C.; Grindeland, R.; Lewis, M. L.
1984-01-01
Specific secretory cells were separated from suspensions of cultured primary human embryonic cells and rat pituitary cells in microgravity conditions, with an objective of isolating the subfractions of kidney cells that produce the largest amount of urakinase, and the subfractions of rat pituitary cells that secrete growth hormones (GH), prolactin (PRL), and other hormones. It is inferred from the experimental observations that the surface charge distributions of the GH-containing cells differ from those of the PRL-containing cells, which is explained by the presence of secretory products on the surface of pituitary cells. For kidney cells, the electrophoretic mobility distributions in flight experiments were spread more than the ground controls.
Zugel, S A; Burke, B J; Regnier, F E; Lytle, F E
2000-11-15
Two-photon excited fluorescence detection was performed on a microfabricated electrophoresis chip. A calibration curve of the fluorescent tag beta-naphthylamine was performed, resulting in a sensitivity of 2.5 x 10(9) counts M(-1) corresponding to a detection limit of 60 nM. Additionally, leucine aminopeptidase was assayed on the chip using electrophoretically mediated microanalysis. The differential electroosmotic mobilities of the enzyme and substrate, L-leucine beta-naphthylamide, allowed for efficient mixing in an open channel, resulting in the detection of a 30 nM enzyme solution under constant potential. A zero potential incubation for 1 min yielded a calculated detection limit of 4 nM enzyme.
Biophysical studies of spermatozoa
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pistenma, David Andrew
1970-12-01
The objectives of this thesis include characterization of spermatozoa according to several physical properties (morphology, size, electrophoretic mobility, sedimentation rate and specific gravity), correlation of these properties with several biological properties (viability, intrinsic motility, fertilizing capacity, antigenicity and genetic composition) and an evaluation of interrelationships among these properties and with selected experimental variables.
Isoelectric focusing of red blood cells in a density gradient stabilized column
NASA Technical Reports Server (NTRS)
Smolka, A. J. K.; Miller, T. Y.
1980-01-01
The effects of Ficoll and cell application pH on red blood cell electrophoretic mobility and focusing pH were investigated by focusing cells in a density gradient stabilized column. Sample loading, cell dispersion, column conductivity, resolution of separation, and the effect of Ampholines were examined.
Start-up of electrophoresis of an arbitrarily oriented dielectric cylinder.
Chen, Guan Y; Keh, Huan J
2014-09-01
An analytical study is presented for the transient electrophoretic response of a circular cylindrical particle to the step application of an electric field. The electric double layer adjacent to the particle surface is thin but finite compared with the radius of the particle. The time-evolving electroosmotic velocity at the outer boundary of the double layer is utilized as a slip condition so that the transient momentum conservation equation for the bulk fluid flow is solved. Explicit formulas for the unsteady electrophoretic velocity of the particle are obtained for both axially and transversely applied electric fields, and can be linearly superimposed for an arbitrarily-oriented applied field. If the cylindrical particle is neutrally buoyant in the suspending fluid, the transient electrophoretic velocity is independent of the orientation of the particle relative to the applied electric field and will be in the direction of the applied field. If the particle is different in density from the fluid, then the direction of electrophoresis will not coincide with that of the applied field until the steady state is attained. The growth of the electrophoretic mobility with the elapsed time for a cylindrical particle is substantially slower than for a spherical particle. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
1994-01-01
Elevation of cAMP can cause gene-specific inhibition of interleukin 2 (IL-2) expression. To investigate the mechanism of this effect, we have combined electrophoretic mobility shift assays and in vivo genomic footprinting to assess both the availability of putative IL-2 transcription factors in forskolin-treated cells and the functional capacity of these factors to engage their sites in vivo. All observed effects of forskolin depended upon protein kinase A, for they were blocked by introduction of a dominant negative mutant subunit of protein kinase A. In the EL4.E1 cell line, we report specific inhibitory effects of cAMP elevation both on NF-kappa B/Rel family factors binding at -200 bp, and on a novel, biochemically distinct "TGGGC" factor binding at -225 bp with respect to the IL-2 transcriptional start site. Neither NF-AT nor AP-1 binding activities are detectably inhibited in gel mobility shift assays. Elevation of cAMP inhibits NF-kappa B activity with delayed kinetics in association with a delayed inhibition of IL-2 RNA accumulation. Activation of cells in the presence of forskolin prevents the maintenance of stable protein- DNA interactions in vivo, not only at the NF-kappa B and TGGGC sites of the IL-2 enhancer, but also at the NF-AT, AP-1, and other sites. This result, and similar results in cyclosporin A-treated cells, imply that individual IL-2 transcription factors cannot stably bind their target sequences in vivo without coengagement of all other distinct factors at neighboring sites. It is proposed that nonhierarchical, cooperative enhancement of binding is a structural basis of combinatorial transcription factor action at the IL-2 locus. PMID:8113685
Piaggio, Maria V; Peirotti, Marta B; Deiber, Julio A
2010-08-01
Peptide electrophoretic mobility data are interpreted through a physicochemical CZE model, providing estimates of the equivalent hydrodynamic radius, hydration, effective and total charge numbers, actual ionizing pK, pH-near molecule and electrical permittivity of peptide domain, among other basic properties. In this study, they are used to estimate some peptide global structural properties proposed, providing thus a distinction among different peptides. Therefore, the solvent drag on the peptide is obtained through a characteristic friction power coefficient of the number of amino acid residues, defined from the global chain conformation in solution. As modeling of the effective electrophoretic mobility of peptides is carried out in terms of particle hydrodynamic size and shape coupled to hydration and effective charge, a packing dimension related to chain conformation within the peptide domain may be defined. In addition, the effective and total charge number fractions of peptides provide some clues on the interpretation of chain conformations within the framework of scaling laws. Furthermore, the model estimates transport properties, such as sedimentation, friction and diffusion coefficients. As the relative numbers of ionizing, polar and non-polar amino acid residues vary in peptides, their global structural properties defined here change appreciably. Needs for further research are also discussed.
Popovici, Jonathan; White, Colin P; Hoelle, Jill; Kinkle, Brian K; Lytle, Darren A
2014-06-01
The surface characteristics of microbial cells directly influence their mobility and behavior within aqueous environments. The cell surface hydrophobicity (CSH) and electrophoretic mobility (EPM) of microbial cells impact a number of interactions and processes including aggregation, adhesion to surfaces, and stability of the cells within the aqueous environments. These cell characteristics are unique to the bacterial species and are a reflection of the large diversity of surface structures, proteins, and appendages of microorganisms. CSH and EPM of bacterial cells contribute substantially to the effectiveness of drinking water treatment to remove them, and therefore an investigation of these properties will be useful in predicting their removal through drinking water treatment processes and transport through drinking water distribution systems. EPM and CSH measurements of six microbiological pathogen or surrogate species suspended in phosphate-buffered water are reported in this work. Two strains of Vibrio cholerae were hydrophobic, while three strains of Escherichia coli were hydrophilic. Bacillus cereus was categorized as moderately hydrophobic. The strains of E. coli had the highest (most negative) EPM. Based on the measurements, E. coli species is predicted to be most difficult to remove from water while V. cholerae will be the easiest to remove. Copyright © 2014 Elsevier B.V. All rights reserved.
Interfacial development of electrophoretically deposited graphene oxide films on Al alloys
Jin, Sumin; Dickerson, James H.; Pham, Viet Hung; ...
2015-07-28
Adhesion between film and substrate is critical for electronic device and coating applications. Interfacial development between electrophoretically deposited graphene oxide films on Al 1100 and Al 5052 alloys were investigated using FT-IR and XPS depth profiling techniques. Obtained results suggest metal ion permeation from the substrates into deposited graphene oxide films. The interface between the films and the substrates were primarily composed of Al-O-C bonds from oxygenated defects on graphene oxide plane rather than expected Al-C formation. Films heat treated at 150 °C had change in microstructure and peak shifts in XPS spectra suggesting change in chemical structure of bondsmore » between the films and the substrates.« less
Stability and transport of graphene oxide nanoparticles in groundwater and surface water
USDA-ARS?s Scientific Manuscript database
A transport study investigating the effects of natural organic matter (NOM) in the presence of monovalent (KCl) and divalent (CaCl2) salts was performed in a packed bed column. The electrophoretic mobility (EPM) and effective diameter of the graphene oxide nanoparticles (GONPs) were measured as a fu...
Protein markers for discrimination of meat species in raw beef, pork and poultry and their mixtures.
Kim, Gap-Don; Seo, Jin-Kyu; Yum, Hyeon-Woong; Jeong, Jin-Yeon; Yang, Han-Sul
2017-02-15
The purpose of this study was to find discrimination markers for four major meat species such as beef, pork, chicken and duck. Myofibrillar and sarcoplasmic proteins isolated from each meat type were analyzed by one-dimensional gel electrophoresis and some proteins were identified through LC-MS/MS analysis. We confirmed that troponin I (TnI), enolase 3, l-lactate dehydrogenase (LDH) and triose-phosphate isomerase (TPI) could be useful markers for discrimination of mammals from poultry due to their different electrophoretic mobility. Tropomyosin 1 and carbonic anhydrase 3 were observed as muscle fiber type-related proteins and these could also be markers to distinguish mammals from poultry. Species-specific peptides identified by LC-MS/MS spectra allow the identification of each species regardless of the same protein. Therefore, it is easy to discriminate between mammals and poultry by comparing the electrophoretic mobility of TnI, enolase 3, LDH, TPI and CA3, and each species could be identified through LC-MS/MS analysis. Copyright © 2016 Elsevier Ltd. All rights reserved.
Sant, Himanshu J; Chakravarty, Siddharth; Merugu, Srinivas; Ferguson, Colin G; Gale, Bruce K
2012-10-02
Characterization of polymerized liposomes (PolyPIPosomes) was carried out using a combination of normal dc electrical field-flow fractionation and cyclical electrical field-flow fractionation (CyElFFF) as an analytical technique. The constant nature of the carrier fluid and channel configuration for this technique eliminates many variables associated with multidimensional analysis. CyElFFF uses an oscillating field to induce separation and is performed in the same channel as standard dc electrical field-flow fractionation separation. Theory and experimental methods to characterize nanoparticles in terms of their sizes and electrophoretic mobilities are discussed in this paper. Polystyrene nanoparticles are used for system calibration and characterization of the separation performance, whereas polymerized liposomes are used to demonstrate the applicability of the system to biomedical samples. This paper is also the first to report separation and a higher effective field when CyElFFF is operated at very low applied voltages. The technique is shown to have the ability to quantify both particle size and electrophoretic mobility distributions for colloidal polystyrene nanoparticles and PolyPIPosomes.
Preparative electrophoresis of cultured human cells: Effect of cell cycle phase
NASA Technical Reports Server (NTRS)
Kunze, M. E.; Todd, P. W.; Goolsby, C. L.; Walker, J. T.
1985-01-01
Human epithelioid T-1E cells were cultured in suspension and subjected to density gradient electrophoresis upward in a vertical column. It is indicated that the most rapidly migrating cells were at the beginning of the cell cycle and the most slowly migrating cells were at the end of the cell cycle. The fastest migrating cells divided 24 hr later than the slowest migrating cells. Colonies developing from slowly migrating cells had twice as many cells during exponential growth as did the most rapidly migrating cells, and the numbers of cells per colony at any time was inversely related to the electrophoretic migration rate. The DNA measurements by fluorescence flow cytometry indicates that the slowest migrating cell populations are enriched in cells that have twice as much DNA as the fastest migrating cells. It is concluded that electrophoretic mobility of these cultured human cells declines steadily through the cell cycle and that the mobility is lowest at the end of G sub 2 phase and highest at the beginning of G sub 1 phase.
Shaw, C F; Schaeffer-Memmel, N; Krawczak, D
1986-03-01
The metabolites of gold in the urine of rats given the antiarthritic drug aurothiomalate were investigated by gel permeation chromatography, electrophoresis, and chemical studies. Following a single dose of aurtothiomalate, the excreted gold was protein-bound in the high-molecular-weight (greater than or equal to 150,000 dalton) and serum albumin fractions. Electrophoresis confirmed the presence of albumin, but showed that the other proteins present differ from those in normal or in vitro aurothiomalate-incubated rat sera. The pattern of the proteins establishes that the proteinuria was of the glomerular type. The alterations in the gold distribution produced by incubation of the urine with the low-molecular-weight thiol penicillamine and with exogenously added aurothiomalate indicated the existence of a labile equilibrium of gold among protein binding sites in the urine. Incubation of rat and human sera and commercially prepared serum albumins with aurothiomalate increased the electrophoretic mobility of the albumin. The significance of this change in electrophoretic mobility with respect to two models of gold binding by serum albumin is discussed.
Investigation of the free flow electrophoretic process. Volume 2: Technical analysis
NASA Technical Reports Server (NTRS)
Weiss, R. A.; Lanham, J. W.; Richman, D. W.; Walker, C. D.
1979-01-01
The effect of gravity on the free flow electrophoretic process was investigated. The demonstrated effects were then compared with predictions made by mathematical models. Results show that the carrier buffer flow was affected by gravity induced thermal convection and that the movement of the separating particle streams was affected by gravity induced buoyant forces. It was determined that if gravity induced buoyant forces were included in the mathematical models, then effective predictions of electrophoresis chamber separation performance were possible. The results of tests performed using various methods of electrophoresis using supportive media show that the mobility and the ability to separate were essentially independent of concentration, providing promise of being able to perform electrophoresis with higher inlet concentrations in space.
Cranberry Proanthocyanidins - Protein complexes for macrophage activation.
Carballo, Sergio M; Haas, Linda; Krueger, Christian G; Reed, Jess D
2017-09-20
In this work we characterize the interaction of cranberry (Vaccinium macrocarpon) proanthocyanidins (PAC) with bovine serum albumin (BSA) and hen egg-white lysozyme (HEL) and determine the effects of these complexes on macrophage activation and antigen presentation. We isolated PAC from cranberry and complexed the isolated PAC with BSA and HEL. The properties of the PAC-protein complexes were studied by matrix assisted laser desorption ionization time of flight mass spectrometry (MALDI-TOF MS), gel electrophoresis and zeta-potential. The effects of PAC-BSA complexes on macrophage activation were studied in RAW 264.7 macrophage like cells after treatment with lipopolysaccharide (LPS). Fluorescence microscopy was used to study the endocytosis of PAC-BSA complexes. The effects of the PAC complexes on macrophage antigen presentation were studied in an in vitro model of HEL antigen presentation by mouse peritoneal mononuclear cells to a T-cell hybridoma. The mass spectra of the PAC complexes with BSA and HEL differed from the spectra of the proteins alone by the presence of broad shoulders on the singly and doubly charged protein peaks. Complexation with PAC altered the electrophoretic mobility shift assay in native agarose gel and the electrophoretic mobility (ζ-potential) values. These results indicate that the PAC-protein complexes are stable and alter the protein structure without precipitating the protein. Fluorescence microscopy showed that the RAW 264.7 macrophages endocytosed BSA and PAC-BSA complexes in discrete vesicles that surrounded the nucleus. Macrophages treated with increasing amounts of PAC-BSA complexes had significantly reduced COX-2 and iNOS expression in response to treatment with lipopolysaccharide (LPS) in comparison to the controls. The PAC-HEL complexes modulated antigen uptake, processing and presentation in murine peritoneal macrophages. After 4 h of pre-incubation, only trace amounts of IL-2 were detected in the co-cultures treated with HEL alone, whereas the PAC-HEL complex had already reached the maximum IL-2 expression. Cranberry PAC may increase the rate of endocytosis of HEL and subsequent expression of IL-2 by the T-cell hybridomas. These results suggest that PAC-protein complexes modulate aspects of innate and acquired immune responses in macrophages.
Fundamentals of capillary electrochromatography: migration behavior of ionized sample components.
Xiang, Rong; Horváth, Csaba
2002-02-15
The mechanism of separating charged species by capillary electrochromatography (CEC) was modeled with the conditions of ideal/linear chromatography by using a simple random walk. The most novel aspect of the work rests with the assumption that in sufficiently high electric field ionized sample components can also migrate in the adsorbed state on the ionized surface of the stationary phase. This feature of CEC leads to the introduction of three dimensionless parameters: alpha, reduced mobility of a sample component with the electrosmotic mobility as the reference; beta, the CEC retention factor; and gamma, the ratio of the electrophoretic migration velocity and the velocity of surface electrodiffusion. Since the interplay of retentive and electrophoretic forces determines the overall migration velocity, the separation mechanism in CEC is governed by the relative importance of the above parameters. The model predicts conditions under which the features of the CEC system engender migration behavior that manifests itself in a relatively narrow elution window and in a gradient like elution pattern in the separation of peptides and proteins by using pro forma isocratic CEC. It is believed that such elution patterns, which resemble those obtained by the use of external gradient of the eluent, are brought about by the formation of an internal gradient in the CEC system that gave rise to concomitant peak compression. The peculiarities of CEC are discussed in the three operational modalities of the technique: co-current, countercurrent, and co-counter CEC. The results suggest that CEC, which is often called "liquid chromatography on electrophoretic platform" is an analytical tool with great potential in the separation of peptides and proteins.
Jauch, Ralf; Ng, Calista K L; Narasimhan, Kamesh; Kolatkar, Prasanna R
2012-04-01
It has recently been proposed that the sequence preferences of DNA-binding TFs (transcription factors) can be well described by models that include the positional interdependence of the nucleotides of the target sites. Such binding models allow for multiple motifs to be invoked, such as principal and secondary motifs differing at two or more nucleotide positions. However, the structural mechanisms underlying the accommodation of such variant motifs by TFs remain elusive. In the present study we examine the crystal structure of the HMG (high-mobility group) domain of Sox4 [Sry (sex-determining region on the Y chromosome)-related HMG box 4] bound to DNA. By comparing this structure with previously solved structures of Sox17 and Sox2, we observed subtle conformational differences at the DNA-binding interface. Furthermore, using quantitative electrophoretic mobility-shift assays we validated the positional interdependence of two nucleotides and the presence of a secondary Sox motif in the affinity landscape of Sox4. These results suggest that a concerted rearrangement of two interface amino acids enables Sox4 to accommodate primary and secondary motifs. The structural adaptations lead to altered dinucleotide preferences that mutually reinforce each other. These analyses underline the complexity of the DNA recognition by TFs and provide an experimental validation for the conceptual framework of positional interdependence and secondary binding motifs.
Majeed, S Abdul; Nambi, K S N; Taju, G; Vimal, S; Venkatesan, C; Hameed, A S Sahul
2014-12-01
The cytotoxicity, genotoxicity and oxidative stress of malachite green (MG) was investigated using the fish Channa striata kidney (CSK) and Channa striata gill (CSG) cell lines. Five concentrations ranging from 0.001 to 10 μg mL(-1) were tested in three independent experiments. Cytotoxicity was assessed by 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay, Rhodamine 123 and Alamar Blue. The mitochondrial changes and apoptosis of MG-exposed cells were observed by Rhodamine 123 and acridine orange/ethidium bromide (AO/EB) staining, respectively. In vitro potential DNA damaging effect of MG was tested using comet assay. Mitochondrial damage, apoptosis and DNA fragmentation increased in a concentration-dependent manner. Additionally, DNA electrophoretic mobility experiments were carried out to study the binding effect of MG to double-stranded DNA (dsDNA) of cells. DNA shift mobility experiments showed that MG is capable of strongly binding to linear dsDNA causing its degradation. Biochemical parameters such as lipid peroxidation (MDA), catalase (CAT) activity and reduced glutathione (GSH) levels were evaluated after exposure to MG. In CSK and CSG cell lines exposed to MG for 48 h, a significant increase in lipid peroxidation, which might be associated with decreased levels of reduced glutathione and catalase activity in these cell lines (p < 0.001), was observed.
Effects of high intensity exercise on isoelectric profiles and SDS-PAGE mobility of erythropoietin.
Voss, S; Lüdke, A; Romberg, S; Schänzer, E; Flenker, U; deMarees, M; Achtzehn, S; Mester, J; Schänzer, W
2010-06-01
Exercise induced proteinuria is a common phenomenon in high performance sports. Based on the appearance of so called "effort urines" in routine doping analysis the purpose of this study was to investigate the influence of exercise induced proteinuria on IEF profiles and SDS-PAGE relative mobility values (rMVs) of endogenous human erythropoietin (EPO). Twenty healthy subjects performed cycle-ergometer exercise until exhaustion. VO (2)max, blood lactate, urinary proteins and urinary creatinine were analysed to evaluate the exercise performance and proteinuria. IEF and SDS-PAGE analyses were performed to test for differences in electrophoretic behaviour of the endogenous EPO before and after exercise. All subjects showed increased levels of protein/creatinine ratio after performance (8.8+/-5.2-26.1+/-14.4). IEF analysis demonstrated an elevation of the relative amount of basic band areas (13.9+/-11.3-36.4+/-12.6). Using SDS-PAGE analysis we observed a decrease in rMVs after exercise and no shift in direction of the recombinant human EPO (rhEPO) region (0.543+/-0.013-0.535+/-0.012). Following identification criteria of the World Anti Doping Agency (WADA) all samples were negative. The implementation of the SDS-PAGE method represents a good solution to distinguish between results influenced by so called effort urines and results of rhEPO abuse. Thus this method can be used to confirm adverse analytical findings.
Bhilocha, Shardul; Amin, Ripal; Pandya, Monika; Yuan, Han; Tank, Mihir; LoBello, Jaclyn; Shytuhina, Anastasia; Wang, Wenlan; Wisniewski, Hans-Georg; de la Motte, Carol; Cowman, Mary K.
2011-01-01
Agarose and polyacrylamide gel electrophoresis systems for the molecular mass-dependent separation of hyaluronan (HA) in the size range of approximately 5–500 kDa have been investigated. For agarose-based systems, the suitability of different agarose types, agarose concentrations, and buffers systems were determined. Using chemoenzymatically synthesized HA standards of low polydispersity, the molecular mass range was determined for each gel composition, over which the relationship between HA mobility and logarithm of the molecular mass was linear. Excellent linear calibration was obtained for HA molecular mass as low as approximately 9 kDa in agarose gels. For higher resolution separation, and for extension to molecular masses as low as approximately 5 kDa, gradient polyacrylamide gels were superior. Densitometric scanning of stained gels allowed analysis of the range of molecular masses present in a sample, and calculation of weight-average and number-average values. The methods were validated for polydisperse HA samples with viscosity-average molecular masses of 112, 59, 37, and 22 kDa, at sample loads of 0.5 µg (for polyacrylamide) to 2.5 µg (for agarose). Use of the methods for electrophoretic mobility shift assays was demonstrated for binding of the HA-binding region of aggrecan (recombinant human aggrecan G1-IGD-G2 domains) to a 150 kDa HA standard. PMID:21684248
Candidate space processing techniques for biomaterials other than preparative electrophoresis
NASA Technical Reports Server (NTRS)
Brooks, D. E.
1976-01-01
The advantages of performing the partition and countercurrent distribution (CCD) of cells in phase separated aqueous polymer systems under reduced gravity were assessed. Other possible applications considered for the space processing program include the freezing front separation of cells, adsorption of cells at the air-water interface, and the macrophage electrophoretic mobility test for cancer.
Effect of extremely low frequency electromagnetic fields on bacterial membrane.
Oncul, Sule; Cuce, Esra M; Aksu, Burak; Inhan Garip, Ayse
2016-01-01
The effect of extremely low frequency electromagnetic fields (ELF-EMF) on bacteria has attracted attention due to its potential for beneficial uses. This research aimed to determine the effect of ELF-EMF on bacterial membrane namely the membrane potential, surface potential, hydrophobicity, respiratory activity and growth. Gram-positive Staphylococcus aureus and Gram-negative Escherichia coli were subjected to ELF-EMF, 50 Hz, 1 mT for 2 h. Membrane potential was determined by fluorescence spectroscopy with or without EDTA (Ethylenediaminetetraacetic acid) with DisC3(5) (3,3-dipropylthiacarbocyanine iodide), zeta potential measurements were performed by electrophoretic mobility, hydrophobicity of the membrane was measured with MATH (Microbial Adhesion to Hydrocarbons) test, respiratory activity was determined with CTC (5-Cyano-2,3-ditolyl tetrazolium chloride), colony forming unit (CFU) and DAPI (4',6-diamidino-2-phenylindole, dihydrochloride) was used for growth determinations. ELF-EMF caused changes in physicochemical properties of both Gram-positive and Gram-negative bacteria. Hyperpolarization was seen in S. aureus and EDTA-treated E. coli. Surface potential showed a positive shift in S. aureus contrariwise to the negative shift seen in EDTA-untreated E. coli. Respiratory activity increased in both bacteria. A slight decrease in growth was observed. These results show that ELF-EMF affects the crucial physicochemical processes in both Gram-positive and Gram-negative bacteria which need further research.
Electrophoretic mobility patterns of collagen following laser welding
NASA Astrophysics Data System (ADS)
Bass, Lawrence S.; Moazami, Nader; Pocsidio, Joanne O.; Oz, Mehmet C.; LoGerfo, Paul; Treat, Michael R.
1991-06-01
Clinical application of laser vascular anastomosis in inhibited by a lack of understanding of its mechanism. Whether tissue fusion results from covalent or non-covalent bonding of collagen and other structural proteins is unknown. We compared electrophoretic mobility of collagen in laser treated and untreated specimens of rat tail tendon (>90% type I collagen) and rabbit aorta. Welding was performed, using tissue shrinkage as the clinical endpoint, using the 808 nm diode laser (power density 14 watts/cm2) and topical indocyanine green dye (max absorption 805 nm). Collagen was extracted with 8 M urea (denaturing), 0.5 M acetic acid (non-denaturing) and acetic acid/pepsin (cleaves non- helical protein). Mobility patterns on gel electrophoresis (SDS-PAGE) after urea or acetic acid extraction were identical in the lasered and control tendon and vessel (confirmed by optical densitometry), revealing no evidence of formation of novel covalent bonds. Alpha and beta band intensity was diminished in pepsin incubated lasered specimens compared with controls (optical density ratio 0.00 +/- 9 tendon, 0.65 +/- 0.12 aorta), indicating the presence of denatured collagen. With the laser parameters used, collagen is denatured without formation of covalent bonds, suggesting that non-covalent interaction between denatured collagen molecules may be responsible for the weld. Based on this mechanism, welding parameters can be chosen which produce collagen denaturation without cell death.
Orphan nuclear receptor TLX regulates astrogenesis by modulating BMP signaling
Qin, Song; Niu, Wenze; Iqbal, Nida; Smith, Derek K.; Zhang, Chun-Li
2014-01-01
Neural stem cells (NSCs) are self-renewing multipotent progenitors that generate both neurons and glia. The precise control of NSC behavior is fundamental to the architecture and function of the central nervous system. We previously demonstrated that the orphan nuclear receptor TLX is required for postnatal NSC activation and neurogenesis in the neurogenic niche. Here, we show that TLX modulates bone morphogenetic protein (BMP)-SMAD signaling to control the timing of postnatal astrogenesis. Genes involved in the BMP signaling pathway, such as Bmp4, Hes1, and Id3, are upregulated in postnatal brains lacking Tlx. Chromatin immunoprecipitation and electrophoretic mobility shift assays reveal that TLX can directly bind the enhancer region of Bmp4. In accordance with elevated BMP signaling, the downstream effectors SMAD1/5/8 are activated by phosphorylation in Tlx mutant mice. Consequently, Tlx mutant brains exhibit an early appearance and increased number of astrocytes with marker expression of glial fibrillary acidic protein (GFAP) and S100B. Taken together, these results suggest that TLX tightly controls postnatal astrogenesis through the modulation of BMP-SMAD signaling pathway activity. PMID:24782704
Orphan nuclear receptor TLX regulates astrogenesis by modulating BMP signaling.
Qin, Song; Niu, Wenze; Iqbal, Nida; Smith, Derek K; Zhang, Chun-Li
2014-01-01
Neural stem cells (NSCs) are self-renewing multipotent progenitors that generate both neurons and glia. The precise control of NSC behavior is fundamental to the architecture and function of the central nervous system. We previously demonstrated that the orphan nuclear receptor TLX is required for postnatal NSC activation and neurogenesis in the neurogenic niche. Here, we show that TLX modulates bone morphogenetic protein (BMP)-SMAD signaling to control the timing of postnatal astrogenesis. Genes involved in the BMP signaling pathway, such as Bmp4, Hes1, and Id3, are upregulated in postnatal brains lacking Tlx. Chromatin immunoprecipitation and electrophoretic mobility shift assays reveal that TLX can directly bind the enhancer region of Bmp4. In accordance with elevated BMP signaling, the downstream effectors SMAD1/5/8 are activated by phosphorylation in Tlx mutant mice. Consequently, Tlx mutant brains exhibit an early appearance and increased number of astrocytes with marker expression of glial fibrillary acidic protein (GFAP) and S100B. Taken together, these results suggest that TLX tightly controls postnatal astrogenesis through the modulation of BMP-SMAD signaling pathway activity.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xiao, Xiao; Gang, Yi; Department of Infectious Diseases, Tangdu Hospital, Fourth Military Medical University, Xi’an 710038, Shaanxi Province
2015-02-06
Highlights: • A shRNA vector based transcription factor decoy, VB-ODN, was designed. • VB-ODN for NF-κB inhibited cell viability in HEK293 cells. • VB-ODN inhibited expression of downstream genes of target transcription factors. • VB-ODN may enhance nuclear entry ratio for its feasibility of virus production. - Abstract: In this study, we designed a short hairpin RNA vector-based oligodeoxynucleotide (VB-ODN) carrying transcription factor (TF) consensus sequence which could function as a decoy to block TF activity. Specifically, VB-ODN for Nuclear factor-κB (NF-κB) could inhibit cell viability and decrease downstream gene expression in HEK293 cells without affecting expression of NF-κB itself.more » The specific binding between VB-ODN produced double-stranded RNA and NF-κB was evidenced by electrophoretic mobility shift assay. Moreover, similar VB-ODNs designed for three other TFs also inhibit their downstream gene expression but not that of themselves. Our study provides a new design of decoy for blocking TF activity.« less
Interactions between the nuclear matrix and an enhancer of the tryptophan oxygenase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kaneoka, Hidenori; Miyake, Katsuhide, E-mail: miyake@nubio.nagoya-u.ac.jp; Iijima, Shinji
2009-10-02
The gene for tryptophan oxygenase (TO) is expressed in adult hepatocytes in a tissue- and differentiation-specific manner. The TO promoter has two glucocorticoid-responsive elements (GREs), and its expression is regulated by glucocorticoid hormone in the liver. We found a novel GRE in close proximity to a scaffold/matrix attachment region (S/MAR) that was located around -8.5 kb from the transcriptional start site of the TO gene by electrophoretic mobility shift and chromatin immunoprecipitation (ChIP) assays. A combination of nuclear fractionation and quantitative PCR analysis showed that the S/MAR was tethered to the nuclear matrix in both fetal and adult hepatocytes. ChIPmore » assay showed that, in adult hepatocytes, the S/MAR-GRE and the promoter proximal regions interacted with lamin and heterogeneous nuclear ribonucleoprotein U in a dexamethasone dependent manner, but this was not the case in fetal cells, suggesting that developmental stage-specific expression of the TO gene might rely on the binding of the enhancer (the -8.5 kb S/MAR-GRE) and the promoter to the inner nuclear matrix.« less
Affinity Pulldown of Biotinylated RNA for Detection of Protein-RNA Complexes.
Panda, Amaresh C; Martindale, Jennifer L; Gorospe, Myriam
2016-12-20
RNA-binding proteins (RBPs) have recently emerged as crucial players in the regulation of gene expression. The interactions of RBPs with target mRNAs control the levels of gene products by altering different regulatory steps, including pre-mRNA splicing and maturation, nuclear mRNA export, and mRNA stability and translation (Glisovic et al. , 2008). There are several methodologies available today to identify RNAs bound to specific RBPs; some detect only recombinant molecules in vitro , others detect recombinant and endogenous molecules, while others detect only endogenous molecules. Examples include systematic evolution of ligands by exponential enrichment (SELEX), biotinylated RNA pulldown assay, RNA immunoprecipitation (RIP) assay, electrophoretic mobility shift assay (EMSA), RNA footprinting analysis, and various UV crosslinking and immunoprecipitation (CLIP) methods such as CLIP, PAR-CLIP, and iCLIP (Popova et al. , 2015). Here, we describe a simple and informative method to study and identify the RNA region of interaction between an RBP and its target transcript (Panda et al. , 2014 and 2016). Its reproducibility and ease of use make this protocol a fast and useful method to identify interactions between RBPs and specific RNAs.
Ko, Tzu-Ping; Liao, Yi-Ting; Hsu, Kai-Cheng
2017-01-01
DNA mimicry is a direct and effective strategy by which the mimic competes with DNA for the DNA binding sites on other proteins. Until now, only about a dozen proteins have been shown to function via this strategy, including the DNA mimic protein DMP19 from Neisseria meningitides. We have shown previously that DMP19 dimer prevents the operator DNA from binding to the transcription factor NHTF. Here, we provide new evidence that DMP19 monomer can also interact with the Neisseria nucleoid-associated protein HU. Using BS3 crosslinking, gel filtration and isothermal titration calorimetry assays, we found that DMP19 uses its monomeric form to interact with the Neisseria HU dimer. Crosslinking conjugated mass spectrometry was used to investigate the binding mode of DMP19 monomer and HU dimer. Finally, an electrophoretic mobility shift assay (EMSA) confirmed that the DNA binding affinity of HU is affected by DMP19. These results showed that DMP19 is bifunctional in the gene regulation of Neisseria through its variable oligomeric forms. PMID:29220372
Ho, Chun-Han; Wang, Hao-Ching; Ko, Tzu-Ping; Chang, Yuan-Chih; Wang, Andrew H.-J.
2014-01-01
The T4 phage protein Arn (Anti restriction nuclease) was identified as an inhibitor of the restriction enzyme McrBC. However, until now its molecular mechanism remained unclear. In the present study we used structural approaches to investigate biological properties of Arn. A structural analysis of Arn revealed that its shape and negative charge distribution are similar to dsDNA, suggesting that this protein could act as a DNA mimic. In a subsequent proteomic analysis, we found that the bacterial histone-like protein H-NS interacts with Arn, implying a new function. An electrophoretic mobility shift assay showed that Arn prevents H-NS from binding to the Escherichia coli hns and T4 p8.1 promoters. In vitro gene expression and electron microscopy analyses also indicated that Arn counteracts the gene-silencing effect of H-NS on a reporter gene. Because McrBC and H-NS both participate in the host defense system, our findings suggest that T4 Arn might knock down these mechanisms using its DNA mimicking properties. PMID:25118281
Presnell, Steven R.; Zhang, Lei; Chlebowy, Corrin N.; Al-Attar, Ahmad; Lutz, Charles T.
2012-01-01
KIR2DL4 is unique among human KIR genes in expression, cellular localization, structure, and function, yet the transcription factors required for its expression have not been identified. Using mutagenesis, electrophoretic mobility shift assay, and co-transfection assays, we identified two redundant Runx binding sites in the 2DL4 promoter as essential for constitutive 2DL4 transcription, with contributions by a CRE site and initiator elements. IL-2-and IL-15-stimulated human NK cell lines increased 2DL4 promoter activity, which required functional Runx, CRE, and Ets sites. Chromatin immunoprecipitation experiments show that Runx3 and Ets1 bind the 2DL4 promoter in situ. 2DL4 promoter activity had similar transcription factor requirements in T cells. Runx, CRE, and Ets binding motifs are present in 2DL4 promoters from across primate species, but other postulated transcription factor binding sites are not preserved. Differences between 2DL4 and clonally-restricted KIR promoters suggest a model that explains the unique 2DL4 expression pattern in human NK cells. PMID:22467658
Identification and characterization of cell-specific enhancer elements for the mouse ETF/Tead2 gene.
Tanoue, Y; Yasunami, M; Suzuki, K; Ohkubo, H
2001-12-21
We have identified and characterized by transient transfection assays the cell-specific 117-bp enhancer sequence in the first intron of the mouse ETF (Embryonic TEA domain-containing factor)/Tead2 gene required for transcriptional activation in ETF/Tead2 gene-expressing cells, such as P19 cells. The 117-bp enhancer contains one GC-rich sequence (5'-GGGGCGGGG-3'), termed the GC box, and two tandemly repeated GA-rich sequences (5'-GGGGGAGGGG-3'), termed the proximal and distal GA elements. Further analyses, including transfection studies and electrophoretic mobility shift assays using a series of deletion and mutation constructs, indicated that Sp1, a putative activator, may be required to predominate over its competition with another unknown putative repressor, termed the GA element-binding factor, for binding to both the GC box, which overlapped with the proximal GA element, and the distal GA element in the 117-bp sequence in order to achieve a full enhancer activity. We also discuss a possible mechanism underlying the cell-specific enhancer activity of the 117-bp sequence.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Syng-Ook; Jeong, Yun-Jeong; Yu, Mi Hee
2006-12-08
Matrix metalloproteinase-9 (MMP-9) plays a major role in the pathogenesis of atherosclerosis and restenosis by regulating both migration and proliferation of vascular smooth muscle cells (VSMC) after an arterial injury. In this study, we examined the inhibitory effect of three major flavonoids in Scutellariae Radix, baicalin, baicalein, and wogonin, on TNF-{alpha}-induced MMP-9 expression in human aortic smooth muscle cells (HASMC). Wogonin, but not baicalin and baicalein, significantly and selectively suppressed TNF-{alpha}-induced MMP-9 expression in HASMC. Reporter gene, electrophoretic mobility shift, and Western blotting assays showed that wogonin inhibits MMP-9 gene transcriptional activity by blocking the activation of NF-{kappa}B via MAPKmore » signaling pathways. Moreover, the Matrigel migration assay showed that wogonin reduced TNF-{alpha}-induced HASMC migration. These results suggest that wogonin effectively suppresses TNF-{alpha}-induced HASMC migration through the selective inhibition of MMP-9 expression and represents a potential agent for the prevention of vascular disorders related to the migration of VSMC.« less
NF-kappaB mediates FGF signal regulation of msx-1 expression.
Bushdid, P B; Chen, C L; Brantley, D M; Yull, F; Raghow, R; Kerr, L D; Barnett, J V
2001-09-01
The nuclear factor-kappaB (NF-kappaB) family of transcription factors is involved in proliferation, differentiation, and apoptosis in a stage- and cell-dependent manner. Recent evidence has shown that NF-kappaB activity is necessary for both chicken and mouse limb development. We report here that the NF-kappaB family member c-rel and the homeodomain gene msx-1 have partially overlapping expression patterns in the developing chick limb. In addition, inhibition of NF-kappaB activity resulted in a decrease in msx-1 mRNA expression. Sequence analysis of the msx-1 promoter revealed three potential kappaB-binding sites similar to the interferon-gamma (IFN-gamma) kappaB-binding site. These sites bound to c-Rel, as shown by electrophoretic mobility shift assay (EMSA). Furthermore, inhibition of NF-kappaB activity significantly reduced transactivation of the msx-1 promoter in response to FGF-2/-4, known stimulators of msx-1 expression. These results suggest that NF-kappaB mediates the FGF-2/-4 signal regulation of msx-1 gene expression. Copyright 2001 Academic Press.
Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi
2014-01-01
We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5' flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster.
Bisphenol A induces corticotropin-releasing hormone expression in the placental cells JEG-3.
Huang, Hui; Tan, Wenjuan; Wang, C C; Leung, Lai K
2012-11-01
Bisphenol A is utilized to make polycarbonate plastics and is an environmental pollutant. Recent research has indicated that it is an endocrine disruptor and may interfere with reproduction. Placental corticotrophin-releasing hormone (CRH) is a peptide hormone which is involved in fetal development. Increased plasma CRH is associated with elevated risk of premature delivery. In the present study, we demonstrated that bisphenol A increased CRH mRNA expression in the placental JEG-3 cells at or above 25μM. Reporter gene assay also demonstrated that bisphenol A could induce CRH gene transactivity. Since cyclic AMP response element (CRE) is a major regulatory element located in CRH promoter, the sequence-specific binding activity was investigated by using electrophoretic mobility shift assay. Our data indicated that bisphenol A increased the CRE binding activity. Western analysis further illustrated that PKA could be the signal triggering the CRE binding and CRH gene transactivation. In summary, the present study demonstrated that bisphenol A could induce CRH expression in placental cells and the underlying signal transduction pathway was also described. Copyright © 2012 Elsevier Inc. All rights reserved.
Crystal Structure of the GRAS Domain of SCARECROW-LIKE7 in Oryza sativa
Li, Shengping; Zhao, Yanhe; Zhao, Zheng; Wu, Xiuling; Sun, Lifang; Liu, Qingsong; Wu, Yunkun
2016-01-01
GRAS proteins belong to a plant-specific protein family with many members and play essential roles in plant growth and development, functioning primarily in transcriptional regulation. Proteins in the family are minimally defined as containing the conserved GRAS domain. Here, we determined the structure of the GRAS domain of Os-SCL7 from rice (Oryza sativa) to 1.82 Å. The structure includes cap and core subdomains and elucidates the features of the conserved GRAS LRI, VHIID, LRII, PFYRE, and SAW motifs. The structure is a dimer, with a clear groove to accommodate double-stranded DNA. Docking a DNA segment into the groove to generate an Os-SCL7/DNA complex provides insight into the DNA binding mechanism of GRAS proteins. Furthermore, the in vitro DNA binding property of Os-SCL7 and model-defined recognition residues are assessed by electrophoretic mobility shift analysis and mutagenesis assays. These studies reveal the structure and preliminary DNA interaction mechanisms of GRAS proteins and open the door to in-depth investigation and understanding of the individual pathways in which they play important roles. PMID:27081181
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Chimeric RNase H–Competent Oligonucleotides Directed to the HIV-1 Rev Response Element
Prater, Chrissy E.; Saleh, Anthony D.; Wear, Maggie P.; Miller, Paul S.
2007-01-01
Chimeric oligo-2′-O-methylribonucleotides containing centrally located patches of contiguous 2′-deoxyribonucleotides and terminating in a nuclease resistant 3′-methylphosphonate internucleotide linkage were prepared. The oligonucleotides were targeted to the 3′-side of HIV Rev response element (RRE) stem-loop IIB RNA, which is adjacent to the high affinity Rev protein binding site and is critical to virus function. Thermal denaturation experiments showed that chimeric oligonucleotides form very stable duplexes with a complementary single-stranded RNA, and gel electrophoretic mobility shift assays (EMSA) showed that they bind with high affinity and specificity to RRE stem-loop II RNA (KD approximately 200 nM). The chimeric oligonucleotides promote RNase H-mediated hydrolysis of RRE stem-loop II RNA and have half lives exceeding 24 h when incubated in cell culture medium containing 10% fetal calf serum. One of the chimeric oligonucleotides inhibited RRE mediated expression of chloramphenicol acetyl transferase (CAT) approximately 60% at a concentration of 300 nM in HEK 293T cells co-transfected with p-RRE/CAT and p-Rev mammalian expression vectors. PMID:17566743
Kook, Insun; Henley, Caitlin; Meyer, Florencia; Hoffmann, Federico G; Jones, Clinton
2015-10-01
The primary site for life-long latency of bovine herpesvirus 1 (BHV-1) is sensory neurons. The synthetic corticosteroid dexamethasone consistently induces reactivation from latency; however the mechanism by which corticosteroids mediate reactivation is unclear. In this study, we demonstrate for the first time that dexamethasone stimulates productive infection, in part, because the BHV-1 genome contains more than 100 potential glucocorticoid receptor (GR) response elements (GREs). Immediate early transcription unit 1 (IEtu1) promoter activity, but not IEtu2 or VP16 promoter activity, was stimulated by dexamethasone. Two near perfect consensus GREs located within the IEtu1 promoter were necessary for dexamethasone-mediated stimulation. Electrophoretic mobility shift assays and chromatin immunoprecipitation studies demonstrated that the GR interacts with IEtu1 promoter sequences containing the GREs. Although we hypothesize that DEX-mediated stimulation of IEtu1 promoter activity is important during productive infection and perhaps reactivation from latency, stress likely has pleiotropic effects on virus-infected cells. Copyright © 2015 Elsevier Inc. All rights reserved.
Ho, Yu-Hsuan; Sung, Tzu-Cheng; Chen, Chien-Sheng
2012-01-01
Natural antimicrobial peptides provide fundamental protection for multicellular organisms from microbes, such as Lactoferricin B (Lfcin B). Many studies have shown that Lfcin B penetrates the cell membrane and has intracellular activities. To elucidate the intracellular behavior of Lfcin B, we first used Escherichia coli K12 proteome chips to identify the intracellular targets of Lfcin B. The results showed that Lfcin B binds to two response regulators, BasR and CreB, of the two-component system. For further analysis, we conducted several in vitro and in vivo experiments and utilized bioinformatics methods. The electrophoretic mobility shift assays and kinase assays indicate that Lfcin B inhibits the phosphorylation of the response regulators (BasR and CreB) and their cognate sensor kinases (BasS and CreC). Antibacterial assays showed that Lfcin B reduced E. coli's tolerance to environmental stimuli, such as excessive ferric ions and minimal medium conditions. This is the first study to show that an antimicrobial peptide inhibits the growth of bacteria by influencing the phosphorylation of a two-component system directly. PMID:22138548
Ho, Yu-Hsuan; Sung, Tzu-Cheng; Chen, Chien-Sheng
2012-04-01
Natural antimicrobial peptides provide fundamental protection for multicellular organisms from microbes, such as Lactoferricin B (Lfcin B). Many studies have shown that Lfcin B penetrates the cell membrane and has intracellular activities. To elucidate the intracellular behavior of Lfcin B, we first used Escherichia coli K12 proteome chips to identify the intracellular targets of Lfcin B. The results showed that Lfcin B binds to two response regulators, BasR and CreB, of the two-component system. For further analysis, we conducted several in vitro and in vivo experiments and utilized bioinformatics methods. The electrophoretic mobility shift assays and kinase assays indicate that Lfcin B inhibits the phosphorylation of the response regulators (BasR and CreB) and their cognate sensor kinases (BasS and CreC). Antibacterial assays showed that Lfcin B reduced E. coli's tolerance to environmental stimuli, such as excessive ferric ions and minimal medium conditions. This is the first study to show that an antimicrobial peptide inhibits the growth of bacteria by influencing the phosphorylation of a two-component system directly.
Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi
2014-01-01
We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5′ flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster. PMID:25099698
DIGE Analysis of Human Tissues.
Gelfi, Cecilia; Capitanio, Daniele
2018-01-01
Two-dimensional difference gel electrophoresis (2-D DIGE) is an advanced and elegant gel electrophoretic analytical tool for comparative protein assessment. It is based on two-dimensional gel electrophoresis (2-DE) separation of fluorescently labeled protein extracts. The tagging procedures are designed to not interfere with the chemical properties of proteins with respect to their pI and electrophoretic mobility, once a proper labeling protocol is followed. The two-dye or three-dye systems can be adopted and their choice depends on specific applications. Furthermore, the use of an internal pooled standard makes 2-D DIGE a highly accurate quantitative method enabling multiple protein samples to be separated on the same two-dimensional gel. The image matching and cross-gel statistical analysis generates robust quantitative results making data validation by independent technologies successful.
NASA Technical Reports Server (NTRS)
Tsai, Amos; Mosher, Richard A.; Bier, Milan
1986-01-01
Computer simulation is used to analyze a system of two electrophoretic columns coupled by mixing the anolyte of one with the catholyte of the other. A mathematical model is presented which is used to predict the pH gradients formed by monovalent buffers in this system, when the currents in the columns are unequal. In the column with the higher current a pH gradient is created which increases from anode to cathode and is potentially useful for isoelectric focusing. The breadth of this gradient is dependent upon the ratio of the currents. The function of the second column is the compensation of buffer migration which occurs in the first column, thereby maintaining constant electrolyte composition. The effects of buffer pKs and mobilities are evaluated.
Combined electrophoretic-separation and electrospray method and system
Smith, Richard D.; Olivares, Jose A.
1989-01-01
A system and method for analyzing molecular constituents of a composition sample includes: forming a solution of the sample, separating the solution by capillary zone electrophoresis into an eluent of constituents longitudinally separated according to their relative electrophoretic mobilities, electrospraying the eluent to form a charged spray in which the molecular constituents have a temporal distribution; and detecting or collecting the separated constituents in accordance with the temporal distribution in the spray. A first high-voltage (e.g., 5-100 KVDC) is applied to the solution. The spray is charged by applying a second high voltage (e.g., .+-.2-8 KVDC) between the eluent at the capillary exit and a cathode spaced in front of the exit. A complete electrical circuit is formed by a conductor which directly contacts the eluent at the capillary exit.
Lokajová, Jana; Railila, Annika; King, Alistair W T; Wiedmer, Susanne K
2013-09-20
The distribution constants of some analytes, closely connected to the petrochemical industry, between an aqueous phase and a phosphonium ionic liquid phase, were determined by ionic liquid micellar electrokinetic chromatography (MEKC). The phosphonium ionic liquids studied were the water-soluble tributyl(tetradecyl)phosphonium with chloride or acetate as the counter ion. The retention factors were calculated and used for determination of the distribution constants. For calculating the retention factors the electrophoretic mobilities of the ionic liquids were required, thus, we adopted the iterative process, based on a homologous series of alkyl benzoates. Calculation of the distribution constants required information on the phase-ratio of the systems. For this the critical micelle concentrations (CMC) of the ionic liquids were needed. The CMCs were calculated using a method based on PeakMaster simulations, using the electrophoretic mobilities of system peaks. The resulting distribution constants for the neutral analytes between the ionic liquid and the aqueous (buffer) phase were compared with octanol-water partitioning coefficients. The results indicate that there are other factors affecting the distribution of analytes between phases, than just simple hydrophobic interactions. Copyright © 2013 Elsevier B.V. All rights reserved.
NASA Technical Reports Server (NTRS)
Todd, P. W.; Sarnoff, B. E.; Li, Z. K.
1985-01-01
Studies of the physical properties of continuous-flow zero-G electrophoretic separator (CFES) buffer, the electrokinetic properties of human erythrocytes in the CFES buffer, the electrokinetic properties of human embryonic kidney cells in the CFES buffer, and the viability and yield of human embryonc kidney cells subjected to flight handling procedures are discussed. In general, the procedure for cell handling and electrophoresis of HEK-8514 cells in 1st or 2nd passage on STS-8 is acceptable if executed properly. The CFES buffer has ionic strength that is barely compatible with cell viability and membrane stability, as seen in experiments with human erythrocytes and trypan-blue staining of human kidney cells. Cells suspended in 10% dialysed horse serum for 3 days in the cold appear to be more stable than freshly trypsinized cells. 10% horse serum appears to be superior to 5% horse serum for this purpose. The mean absolute raw mobility of HEK-8514 cells in CFES buffer at 6 degrees, conductivity 0.055 mmho/cm, is 1.1 to 1.4 um-cm/V-sec, with a range of nearly a whole mobility unit.
NASA Technical Reports Server (NTRS)
Hymer, W. C.; Salada, T.; Cenci, R.; Krishnan, K.; Seaman, G. V. F.; Snyder, R.; Matsumiya, H.; Nagaoka, S.
1996-01-01
In this report we describe the results of a continuous flow electrophoresis (CFE) experiment done on STS-65 in which we tested the idea that intracellular growth hormone (GH) particles contained in a cell lysate prepared from cultured rat anterior pituitary cells in microgravity might have different electrophoretic mobilities from those in a synchronous ground control cell lysate. Collectively, the results suggested that CFE processing in microgravity was better than on earth; more samples could be processed at a time (6 x) and more variant forms of GH molecules could be resolved as well. We had also hoped to carry out a pituitary cell CFE experiment, but failure of the hardware required that the actual cell electrophoresis trials be done on earth shortly after Shuttle landing. Data from these experiments showed that space-flown cells possessed a higher electrophoretic mobility than ground control cells, thereby offering evidence for the idea that exposure of cultured cells to microgravity can change their net surface charge-density especially when the cells are fed. Collectively, the results from this pituitary cell experiment document the advantage of using coupled cell culture and CFE techniques in the microgravity environment.
Assessing the scalability of dynamic field gradient focusing by linear modeling
Tracy, Noah I.; Ivory, Cornelius F.
2010-01-01
Dynamic field gradient focusing (DFGF) separates and concentrates proteins in native buffers, where proteins are most soluble, using a computer-controlled electric field gradient which lets the operator adjust the pace and resolution of the separation in real-time. The work in this paper assessed whether DFGF could be scaled up from microgram analytical-scale protein loads to milligram preparative-scale loads. Linear modeling of the electric potential, protein transport, and heat transfer simulated the performance of a preparative-scale DFGF instrument. The electric potential model showed where the electrodes should be placed to optimize the shape and strength of the electric field gradient. Results from the protein transport model suggested that in 10 min the device should separate 10 mg each of two proteins whose electrophoretic mobilities differ by 5 ×. Proteins with electrophoretic mobilities differing by only 5% should separate in 3 h. The heat transfer model showed that the preparative DFGF design could dissipate 1 kW of Joule heat while keeping the separation chamber at 25°C. Model results pointed to DFGF successfully scaling up by 1000 × using the proposed instrument design. PMID:18196522
van Leeuwen, Lucie A G; Hinchy, Elizabeth C; Murphy, Michael P; Robb, Ellen L; Cochemé, Helena M
2017-07-01
The redox state of cysteine thiols is critical for protein function. Whereas cysteines play an important role in the maintenance of protein structure through the formation of internal disulfides, their nucleophilic thiol groups can become oxidatively modified in response to diverse redox challenges and thereby function in signalling and antioxidant defences. These oxidative modifications occur in response to a range of agents and stimuli, and can lead to the existence of multiple redox states for a given protein. To assess the role(s) of a protein in redox signalling and antioxidant defence, it is thus vital to be able to assess which of the multiple thiol redox states are present and to investigate how these alter under different conditions. While this can be done by a range of mass spectrometric-based methods, these are time-consuming, costly, and best suited to study abundant proteins or to perform an unbiased proteomic screen. One approach that can facilitate a targeted assessment of candidate proteins, as well as proteins that are low in abundance or proteomically challenging, is by electrophoretic mobility shift assays. Redox-modified cysteine residues are selectively tagged with a large group, such as a polyethylene glycol (PEG) polymer, and then the proteins are separated by electrophoresis followed by immunoblotting, which allows the inference of redox changes based on band shifts. However, the applicability of this method has been impaired by the difficulty of cleanly modifying protein thiols by large PEG reagents. To establish a more robust method for redox-selective PEGylation, we have utilised a Click chemistry approach, where free thiol groups are first labelled with a reagent modified to contain an alkyne moiety, which is subsequently Click-reacted with a PEG molecule containing a complementary azide function. This strategy can be adapted to study reversibly reduced or oxidised cysteines. Separation of the thiol labelling step from the PEG conjugation greatly facilitates the fidelity and flexibility of this approach. Here we show how the Click-PEGylation technique can be used to interrogate the redox state of proteins. Copyright © 2017. Published by Elsevier Inc.
Biochemical analysis with microfluidic systems.
Bilitewski, Ursula; Genrich, Meike; Kadow, Sabine; Mersal, Gaber
2003-10-01
Microfluidic systems are capillary networks of varying complexity fabricated originally in silicon, but nowadays in glass and polymeric substrates. Flow of liquid is mainly controlled by use of electroosmotic effects, i.e. application of electric fields, in addition to pressurized flow, i.e. application of pressure or vacuum. Because electroosmotic flow rates depend on the charge densities on the walls of capillaries, they are influenced by substrate material, fabrication processes, surface pretreatment procedures, and buffer additives. Microfluidic systems combine the properties of capillary electrophoretic systems and flow-through analytical systems, and thus biochemical analytical assays have been developed utilizing and integrating both aspects. Proteins, peptides, and nucleic acids can be separated because of their different electrophoretic mobility; detection is achieved with fluorescence detectors. For protein analysis, in particular, interfaces between microfluidic chips and mass spectrometers were developed. Further levels of integration of required sample-treatment steps were achieved by integration of protein digestion by immobilized trypsin and amplification of nucleic acids by the polymerase chain reaction. Kinetic constants of enzyme reactions were determined by adjusting different degrees of dilution of enzyme substrates or inhibitors within a single chip utilizing mainly the properties of controlled dosing and mixing liquids within a chip. For analysis of kinase reactions, however, a combination of a reaction step (enzyme with substrate and inhibitor) and a separation step (enzyme substrate and reaction product) was required. Microfluidic chips also enable separation of analytes from sample matrix constituents, which can interfere with quantitative determination, if they have different electrophoretic mobilities. In addition to analysis of nucleic acids and enzymes, immunoassays are the third group of analytical assays performed in microfluidic chips. They utilize either affinity capillary electrophoresis as a homogeneous assay format, or immobilized antigens or antibodies in heterogeneous assays with serial supply of reagents and washing solutions.
An agarose gel electrophoretic method for analysis of hyaluronan molecular weight distribution.
Lee, H G; Cowman, M K
1994-06-01
An electrophoretic method is described for determining the molecular weight distribution of hyaluronan (HA). The method involves separation of HA by electrophoresis on a 0.5% agarose gel, followed by detection of HA using the cationic dye Stains-All (3,3'-dimethyl-9-methyl-4,5,4'5'-dibenzothiacarbocyanine). The recommended sample load is 7 micrograms. Calibration of the method with HA standards of known molecular weight has established a linear relationship between electrophoretic mobility and the logarithm of the weight-average molecular weight over the range of approximately 0.2-6 x 10(6). The separated HA pattern may also be visualized after electrotransfer of HA from the agarose gel to a nylon membrane. The membrane may be stained with the dye alcian blue. Alternatively, specific detection of HA from impure samples can be achieved by probing the nylon membrane with biotin-labeled HA-binding protein and subsequent interaction with a streptavidin-linked gold reagent and silver staining for amplification. The electrophoretic method was used to analyze HA in two different liquid connective tissues. Normal human knee joint synovial fluid showed a narrow HA molecular weight distribution, with a peak at 6-7 x 10(6). Owl monkey vitreous HA also showed a narrow molecular weight distribution, with a peak at 5-6 x 10(6). These results agree well with available published data and indicate the applicability of the method to the analysis of impure HA samples which may be available in limited amounts.
Caugant, D A; Zollinger, W D; Mocca, L F; Frasch, C E; Whittam, T S; Frøholm, L O; Selander, R K
1987-01-01
Two hundred and thirty-four strains of Neisseria meningitidis, including 94 serotype 2a, 111 serotype 2b, and 19 serotype 2c isolates, together with 10 isolates that were serotyped as 2 with polyvalent antiserum but did not react with monoclonal antibodies, were characterized by the electrophoretic mobilities of 15 metabolic enzymes. Of these enzymes, 14 were polymorphic, and 56 distinctive combinations of alleles at the enzyme loci (electrophoretic types) were identified, among which the mean genetic diversity per locus was 0.413, or about 75% of that recorded for the species N. meningitidis as a whole. Mean genetic diversity among electrophoretic types of the same serotype (2a, 2b, or 2c) was, however, on average, less than half the total species diversity, and no multilocus genotypes were shared between isolates of the different serotypes, which belong to distinctive clonal lineages. Recent temporal changes in the frequencies of recovery of pathogenic strains of serotypes 2a and 2b in South Africa and North America resulted from clone replacement in these populations rather than evolutionary modification of the serotype protein of the initially dominant clones. PMID:3106223
High Molecular Weight Forms of Mammalian Respiratory Chain Complex II
Nůsková, Hana; Holzerová, Eliška; Vrbacký, Marek; Pecina, Petr; Hejzlarová, Kateřina; Kľučková, Katarína; Rohlena, Jakub; Neuzil, Jiri; Houštěk, Josef
2013-01-01
Mitochondrial respiratory chain is organised into supramolecular structures that can be preserved in mild detergent solubilisates and resolved by native electrophoretic systems. Supercomplexes of respiratory complexes I, III and IV as well as multimeric forms of ATP synthase are well established. However, the involvement of complex II, linking respiratory chain with tricarboxylic acid cycle, in mitochondrial supercomplexes is questionable. Here we show that digitonin-solubilised complex II quantitatively forms high molecular weight structures (CIIhmw) that can be resolved by clear native electrophoresis. CIIhmw structures are enzymatically active and differ in electrophoretic mobility between tissues (500 – over 1000 kDa) and cultured cells (400–670 kDa). While their formation is unaffected by isolated defects in other respiratory chain complexes, they are destabilised in mtDNA-depleted, rho0 cells. Molecular interactions responsible for the assembly of CIIhmw are rather weak with the complexes being more stable in tissues than in cultured cells. While electrophoretic studies and immunoprecipitation experiments of CIIhmw do not indicate specific interactions with the respiratory chain complexes I, III or IV or enzymes of the tricarboxylic acid cycle, they point out to a specific interaction between CII and ATP synthase. PMID:23967256
Optical tweezers with 2.5 kHz bandwidth video detection for single-colloid electrophoresis
NASA Astrophysics Data System (ADS)
Otto, Oliver; Gutsche, Christof; Kremer, Friedrich; Keyser, Ulrich F.
2008-02-01
We developed an optical tweezers setup to study the electrophoretic motion of colloids in an external electric field. The setup is based on standard components for illumination and video detection. Our video based optical tracking of the colloid motion has a time resolution of 0.2ms, resulting in a bandwidth of 2.5kHz. This enables calibration of the optical tweezers by Brownian motion without applying a quadrant photodetector. We demonstrate that our system has a spatial resolution of 0.5nm and a force sensitivity of 20fN using a Fourier algorithm to detect periodic oscillations of the trapped colloid caused by an external ac field. The electrophoretic mobility and zeta potential of a single colloid can be extracted in aqueous solution avoiding screening effects common for usual bulk measurements.
Preparation of guinea pig macrophage for electrophoretic experiments in space
NASA Technical Reports Server (NTRS)
1979-01-01
Methods of storage and cultivation of macrophage cells in preparation for space experiments were investigated. Results show that freezing and thawing immediately after extraction did not cause any change in viability or electrophoretic mobility of the cells. A prolonged storage at -80 C did cause cell damage as indicated by a 95% reduction in variable cells. Cell damage was decreased when Glycerol or Dimethyl Sulfoxide (DMSO) was added as a cryogenic protective agent. A 100% viability was observed in cultivation experiments after two weeks due to the additional serum. Results from gamma-glutamyl transpeptidase study showed a zero activity rate. It is suggested that a flat stationary field be used for the collection and use of macrophage. It was found that a 24-hour delay in obtaining macrophage cells helps to maintain a pure culture.
Combined electrophoretic-separation and electrospray method and system
Smith, R.D.; Olivares, J.A.
1989-06-27
A system and method for analyzing molecular constituents of a composition sample includes: forming a solution of the sample, separating the solution by capillary zone electrophoresis into an eluent of constituents longitudinally separated according to their relative electrophoretic mobilities, electrospraying the eluent to form a charged spray in which the molecular constituents have a temporal distribution; and detecting or collecting the separated constituents in accordance with the temporal distribution in the spray. A first high-voltage (e.g., 5--100 kVDC) is applied to the solution. The spray is charged by applying a second high voltage (e.g., [+-]2--8 kVDC) between the eluent at the capillary exit and a cathode spaced in front of the exit. A complete electrical circuit is formed by a conductor which directly contacts the eluent at the capillary exit. 10 figs.
Boulton, A P; Pascall, J C; Craig, R K
1984-01-01
Golgi and endoplasmic-reticulum fractions were prepared from the lactating guinea-pig mammary gland. The endoplasmic-reticulum fraction was highly active in the processing and sequestration of milk-protein primary translation products. Explants from the lactating gland in organ culture were used to identify milk-protein intermediates present in the secretory pathway, and the timing of the events leading to their post-translational modification. With [35S]methionine, the milk proteins labelled after a short pulse (3 min) were represented by the partially processed (but not phosphorylated) caseins and alpha-lactalbumin sequestered within membrane-bound vesicles. After a 30 min labelling period, higher-Mr caseins with electrophoretic mobilities identical with those of the phosphorylated caseins isolated from milk were identified in the incubation medium, and sequestered within membrane-bound vesicles. Pulse-chase experiments established a precursor-product relationship between these forms. Secretion is apparent approx. 30 min after sequestration. Caseins are highly phosphorylated; removal of the phosphate residues with acid phosphatase results in proteins with increased electrophoretic mobility, similar to those of the partially processed early casein intermediates found sequestered in explants after a 3 min pulse with [35S]methionine, and those sequestered within microsomal membranes after mRNA-directed cell-free protein synthesis. A comparison of the proteins labelled during both short (5 min) and long (30 min) pulses with [35S]methionine and [32P]Pi shows that, in contrast with the 35S-labelled caseins, those labelled with [32P]Pi exhibit only electrophoretic mobilities identical with those of the mature caseins isolated from milk and those identified after long labelling periods with [35S]methionine. No phosphorylated early intermediate forms of caseins were identified. We conclude that the synthesis and post-translational modification of guinea-pig caseins occurs in two stages, (i) an early event involving synthesis and sequestration within the endoplasmic reticulum, an event that involves signal-peptide removal, followed (ii) 10-20 min later by phosphorylation at a different point in the secretory pathway, probably in the Golgi complex. Secretion of the phosphorylated caseins occurs 10-20 min later. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:6477529
Palanisamy, Arun P.; Suryakumar, Geetha; Panneerselvam, Kavin; Willey, Christopher D.; Kuppuswamy, Dhandapani
2017-01-01
Early work in pressure overloaded (PO) myocardium shows that integrins mediate focal adhesion complex formation by recruiting the adaptor protein p130Cas (Cas) and nonreceptor tyrosine kinase c-Src. To explore c-Src role in Cas-associated changes during PO, we used a feline right ventricular in vivo PO model and a three-dimensional (3D) collagen-embedded adult cardiomyocyte in vitro model that utilizes a Gly-Arg-Gly-Asp-Ser (RGD) peptide for integrin stimulation. Cas showed slow electrophoretic mobility (band-shifting), recruitment to the cytoskeleton, and tyrosine phosphorylation at 165, 249, and 410 sites in both 48 h PO myocardium and 1 h RGD-stimulated cardiomyocytes. Adenoviral mediated expression of kinase inactive (negative) c-Src mutant with intact scaffold domains (KN-Src) in cardiomyocytes did not block the RGD stimulated changes in Cas. Furthermore, expression of KN-Src or kinase active c-Src mutant with intact scaffold function (A-Src) in two-dimensionally (2D) cultured cardiomyocytes was sufficient to cause Cas band-shifting, although tyrosine phosphorylation required A-Src. These data indicate that c-Src’s adaptor function, but not its kinase function, is required for a serine/threonine specific phosphorylation(s) responsible for Cas band-shifting. To explore this possibility, Chinese hamster ovary cells that stably express Cas were infected with either β-gal or KN-Src adenoviruses and used for Cas immunoprecipitation combined with mass spectrometry analysis. In the KN-Src expressing cells, Cas showed phosphorylation at the serine-639 (human numbering) site. A polyclonal antibody raised against phospho-serine-639 detected Cas phosphorylation in 24–48 h PO myocardium. Our studies indicate that c-Src’s adaptor function mediates serine-639 phosphorylation of Cas during integrin activation in PO myocardium. PMID:25976166
Affinity capillary electrophoresis for studying interactions in life sciences.
Olabi, Mais; Stein, Matthias; Wätzig, Hermann
2018-05-10
Affinity capillary electrophoresis (ACE) analyzes noncovalent interactions between ligands and analytes based on changes in their electrophoretic mobility. This technique has been widely used to investigate various biomolecules, mainly proteins, polysaccharides and hormones. ACE is becoming a technique of choice to validate high throughput screening results, since it is very predictively working in realistic and relevant media, e.g. in body fluids. It is highly recommended to incorporate ACE as a powerful analytical tool to properly prepare animal testing and preclinical studies. The interacting molecules can be found free in solution or can be immobilized to a solid support. Thus, ACE is classified in two modes, free solution ACE and immobilized ACE. Every ACE mode has advantages and disadvantages. Each can be used for a variety of applications. This review covers literature of scopus and SciFinder data base in the period from 2016 until beginning 2018, including the keywords "affinity capillary electrophoresis", "immunoaffinity capillary electrophoresis", "immunoassay capillary electrophoresis" and "immunosorbent capillary electrophoresis". More than 200 articles have been found and 112 have been selected and thoroughly discussed. During this period, the data processing and the underlying calculations in mobility shift ACE (ms ACE), frontal analysis ACE (FA ACE) and plug-plug kinetic capillary electrophoresis (ppKCE) as mostly applied free solution techniques have substantially improved. The range of applications in diverse free solution and immobilized ACE techniques has been considerably broadened. Copyright © 2018. Published by Elsevier Inc.
ANKRD1 Acts as a Transcriptional Repressor of MMP13 via the AP-1 Site
Almodóvar-García, Karinna; Kwon, Minjae; Samaras, Susan E.
2014-01-01
The transcriptional cofactor ANKRD1 is sharply induced during wound repair, and its overexpression enhances healing. We recently found that global deletion of murine Ankrd1 impairs wound contraction and enhances necrosis of ischemic wounds. A quantitative PCR array of Ankrd1−/− (KO) fibroblasts indicated that ANKRD1 regulates MMP genes. Yeast two-hybrid and coimmunoprecipitation analyses associated ANKRD1 with nucleolin, which represses AP-1 activation of MMP13. Ankrd1 deletion enhanced both basal and phorbol 12-myristate 13-acetate (PMA)-induced MMP13 promoter activity; conversely, Ankrd1 overexpression in control cells decreased PMA-induced MMP13 promoter activity. Ankrd1 reconstitution in KO fibroblasts decreased MMP13 mRNA, while Ankrd1 knockdown increased these levels. MMP13 mRNA and protein were elevated in intact skin and wounds of KO versus Ankrd1fl/fl (FLOX) mice. Electrophoretic mobility shift assay gel shift patterns suggested that additional transcription factors bind to the MMP13 AP-1 site in the absence of Ankrd1, and this concept was reinforced by chromatin immunoprecipitation analysis as greater binding of c-Jun to the AP-1 site in extracts from FLOX versus KO fibroblasts. We propose that ANKRD1, in association with factors such as nucleolin, represses MMP13 transcription. Ankrd1 deletion additionally relieved MMP10 transcriptional repression. Nuclear ANKRD1 appears to modulate extracellular matrix remodeling by MMPs. PMID:24515436
Nadai, Matteo; Palù, Giorgio; Palumbo, Manlio; Richter, Sara N.
2012-01-01
Non-canonical DNA structures have been postulated to mediate protein-nucleic acid interactions and to function as intermediates in the generation of frame-shift mutations when errors in DNA replication occur, which result in a variety of diseases and cancers. Compounds capable of binding to non-canonical DNA conformations may thus have significant diagnostic and therapeutic potential. Clerocidin is a natural diterpenoid which has been shown to selectively react with single-stranded bases without targeting the double helix. Here we performed a comprehensive analysis on several non-canonical DNA secondary structures, namely mismatches, nicks, bulges, hairpins, with sequence variations in both the single-stranded region and the double-stranded flanking segment. By analysis of clerocidin reactivity, we were able to identify the exposed reactive residues which provided information on both the secondary structure and the accessibility of the non-paired sites. Mismatches longer than 1 base were necessary to be reached by clerocidin reactive groups, while 1-base nicks were promptly targeted by clerocidin; in hairpins, clerocidin reactivity increased with the length of the hairpin loop, while, interestingly, reactivity towards bulges reached a maximum in 3-base-long bulges and declined in longer bulges. Electrophoretic mobility shift analysis demonstrated that bulges longer than 3 bases (i.e. 5- and 7-bases) folded or stacked on the duplex region therefore being less accessible by the compound. Clerocidin thus represents a new valuable diagnostic tool to dissect DNA secondary structures. PMID:23285245
Nadai, Matteo; Palù, Giorgio; Palumbo, Manlio; Richter, Sara N
2012-01-01
Non-canonical DNA structures have been postulated to mediate protein-nucleic acid interactions and to function as intermediates in the generation of frame-shift mutations when errors in DNA replication occur, which result in a variety of diseases and cancers. Compounds capable of binding to non-canonical DNA conformations may thus have significant diagnostic and therapeutic potential. Clerocidin is a natural diterpenoid which has been shown to selectively react with single-stranded bases without targeting the double helix. Here we performed a comprehensive analysis on several non-canonical DNA secondary structures, namely mismatches, nicks, bulges, hairpins, with sequence variations in both the single-stranded region and the double-stranded flanking segment. By analysis of clerocidin reactivity, we were able to identify the exposed reactive residues which provided information on both the secondary structure and the accessibility of the non-paired sites. Mismatches longer than 1 base were necessary to be reached by clerocidin reactive groups, while 1-base nicks were promptly targeted by clerocidin; in hairpins, clerocidin reactivity increased with the length of the hairpin loop, while, interestingly, reactivity towards bulges reached a maximum in 3-base-long bulges and declined in longer bulges. Electrophoretic mobility shift analysis demonstrated that bulges longer than 3 bases (i.e. 5- and 7-bases) folded or stacked on the duplex region therefore being less accessible by the compound. Clerocidin thus represents a new valuable diagnostic tool to dissect DNA secondary structures.
Hickey, Owen A; Shendruk, Tyler N; Harden, James L; Slater, Gary W
2012-08-31
We introduce a mesoscale simulation method based on multiparticle collision dynamics (MPCD) for the electrohydrodynamics of polyelectrolytes with finite Debye lengths. By applying the Debye-Hückel approximation to assign an effective charge to MPCD particles near charged monomers, our simulations are able to reproduce the rapid rise in the electrophoretic mobility with respect to the degree of polymerization for the shortest polymer lengths followed by a small decrease for longer polymers due to charge condensation. Moreover, these simulations demonstrate the importance of a finite Debye length in accurately determining the mobility of uniformly charged polyelectrolytes and net neutral polyampholytes.
Dilshara, Matharage Gayani; Jayasooriya, Rajapaksha Gedara Prasad Tharanga; Kang, Chang-Hee; Choi, Yung-Hyun; Kim, Gi-Young
2016-06-01
To evaluate whether the methanol extract of Codium fragile (MECF) regulates tumor necrosis factor-α (TNF-α)-induced invasion of human breast cancer MDA-MB-231 cells by suppressing matrix metalloproteinase-9 (MMP-9). Reverse transcription-polymerase chain reaction (RT-PCR) and western blot analysis were performed to analyze the expression of MMP-9 and nuclear factor-κB (NF-κB) subunits, p65 and p50, and IκB in MDA-MB-231 cells. 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay was used for cell viability. MMP-9 activity and invasion were measured by gelatin zymography and a matrigel invasion assay, respectively. NF-κB activity was measured by an electrophoretic mobility shift assay and luciferase activity. MECF had no effect on cell viability up to a concentration of 100 μg/mL in human breast cancer MDA-MB-231 cells regardless of the presence of TNF-α. MDA-MB-231 cells that were stimulated with TNF-α showed a marked increase of invasion compared to the untreated control, whereas pretreatment with MECF downregulated the TNF-α-induced invasion of MDA-MB-231 cells. Additionally, zymography, western blot analysis, and RT-PCR confirmed that MECF decreased TNF-α-induced MMP-9 expression and activity which is a key regulator for cancer invasion. According to an electrophoretic morbidity shift assay, pretreatment with MECF in MDA-MB-231 cells significantly decreased the TNF-α-induced DNA-binding activity of NF-κB, which is an important transcription factor for regulating cancer invasion-related genes such as MMP-9. Furthermore, treatment with MECF sustained the expression of p65 and p50 in response to TNF-α in the cytosolic compartment. The luciferase assay demonstrated that MECF attenuated TNF-α-induced NF-κB luciferase activity. MECF exhibited its anti-invasive capability by downregulating TNF-α-induced MMP-9 expression, resulting from the suppression of NF-κB activity in the human breast cancer cell line MDA-MB-231. Copyright © 2016 Hainan Medical College. Production and hosting by Elsevier B.V. All rights reserved.
Deno, D C; McCafferty, M H; Saba, T M; Blumenstock, F A
1984-01-01
Plasma fibronectin was depleted within 15 min following sublethal burn, followed by partial recovery at 8 h and complete restoration by 24 h in anesthetized rats. Radiolabeled 75Se-plasma fibronectin, injected intravenously before burn, was rapidly sequestered in burn skin as well as the liver. Fibronectin levels at 2 h postburn as detected by immunoassay vs. 75Se-plasma fibronectin indicated that more fibronectin was in the plasma than detected by electroimmunoassay. Crossed immunoelectrophoretic analysis of fibronectin in early postburn plasma demonstrated a reduced electrophoretic mobility of the fibronectin antigen. Addition of heparin or fibrin, both of which have affinity for fibronectin, to normal plasma was unable to reproduce this altered fibronectin electrophoretic pattern. In contrast, addition of gelatin or native collagen to normal plasma reproduced the abnormal electrophoretic pattern of fibronectin seen in burn plasma. Extracts of burned skin, but not extracts of normal skin, when added to normal plasma, elicited a similar altered electrophoretic pattern for fibronectin. By gel filtration, fibronectin in burn plasma had an apparent molecular weight approximately 40% greater than that observed in normal plasma. These data suggest the release into the blood of a gelatinlike ligand from burned skin, which complexes with plasma fibronectin. Thus, fibronectin deficiency acutely postburn appears mediated by (a) its accumulation at the site of burn injury; (b) its removal from the circulation by the liver; and (c) its presence in the plasma in a form that is less detectable by immunoassay. Images PMID:6690478
Duffy, Ciarán F; MacCraith, Brian; Diamond, Dermot; O'Kennedy, Richard; Arriaga, Edgar A
2006-08-01
The analysis of mitochondria by capillary electrophoresis usually takes longer than 20 min per replicate which may compromise the quality of the mitochondria due to degradation. In addition, low sample consumption may be beneficial in the analysis of rare or difficult samples. In this report, we demonstrate the ability to analyze individual mitochondrial events in picoliter-volume samples (approximately 80 pL) taken from a bovine liver preparation using microchip capillary electrophoresis with laser-induced fluorescence detection (micro-chip CE-LIF). Using a commercial "double-T" glass microchip, the sample was electrokinetically loaded in the "double-T" intersection and then subjected to electrophoretic separation along the main separation channel. In order to decrease interactions of mitochondria with channel walls during the analysis, poly(vinyl alcohol) was used as a dynamic coating. This procedure eliminates the need for complicated covalent surface modifications within the channels that were previously used in capillary electrophoresis methods. For analysis, mitochondria, isolated from bovine liver tissue, were selectively labelled using 10-nonyl acridine orange (NAO). The results consist of electropherograms where each mitochondrial event is a narrow spike (240 +/- 44 ms). While the spike intensity is representative of its NAO content, its migration time is used to calculate and describe its electrophoretic mobility, which is a property still largely unexplored for intracellular organelles. The five-fold decrease in separation time (4 min for microchip versus 20 min for capillary electrophoresis) makes microchip electrophoretic separations of organelles a faster, sensitive, low-sample volume alternative for the characterization of individual organelle properties and for investigations of subcellular heterogeneity.
Electro-Optical Platform for the Manipulation of Live Cells
2002-10-02
system, other physical forces may play a significant role. In particular, electroosmotic forces that cause fluid movement relative to a surface can...occur due to the mobility of ions in solution. Electroosmotic forces are commonly utilized in capillary electrophoretic separa- tion, where the capillary...fluid motion that acts to entrain particles to be separated.46 Thus, in the chamber presented here, the patterned anode can induce electroosmotic flow
2009-08-01
tubular mode driven by electroosmotic flow and the inherent electrophoretic mobility of the analytes under the influence of an applied electric field...could be due to unlabeled beads. Figure 3 (C and D) also shows electropherogram of a neutral electroosmotic flow (EOF) marker dye BODIPY and...internal turbulent mixing . The current microfabricated electromagnets cannot produce sufficient fields to trap the NPs against a large flow forces
Pérez-Pérez, María Esther; Andrés-Garrido, Ascensión; Crespo, José L
2016-01-01
Identification of specific autophagy markers has been fundamental to investigate autophagy as catabolic process. Among them, the ATG8 protein turned out to be one of the most widely used and specific molecular markers of autophagy both in higher and lower eukaryotes. Here, we describe how ATG8 can be used to monitor autophagy in Chlamydomonas and Arabidopsis by western blot analysis.
NASA Technical Reports Server (NTRS)
Rubin, A. L.; Stenzel, K. H.; Cheigh, J. S.; Seaman, G. V. F.; Novogrodsky, A.
1977-01-01
Electrophoretic mobilities (EPM) of peripheral lymphocytes were studied from normal subjects, chronic hemodialysis patients and kidney transplant recipients. A technique to separate B lymphocytes and null cells from non-T lymphocyte preparation was developed. The experiments were designed to determine which subpopulation of the non-T lymphocytes is primarily affected and shows a decreased EPM in chronic hemodialysis patients and kidney transplant recipients.
Electrophoresis experiment for space
NASA Technical Reports Server (NTRS)
Vanderhoff, J. W.; Micale, F. J.
1976-01-01
The Apollo 16 electrophoresis experiment was analyzed, demonstrating that the separation of the two different-size monodisperse latexes did indeed take place, but that the separation was obscured by the pronounced electroosmotic flow of the liquid medium. The results of this experiment, however, were dramatic since it is impossible to carry out a similar separation on earth. It can be stated unequivocally from this experiment that any electrophoretic separation will be enhanced under microgravity conditions. The only question is the degree of this enhancement, which can be expected to vary from one experimental technique to another. The low-electroosmotic-mobility coating (Z6040-MC) developed under this program was found to be suitable for a free-fluid electrophoretic separation such as the experiment designed for the ASTP flight. The problem with this coating, however, is that its permanency is limited because of the slow desorption of the methylcellulose from the coated surface.
Hormone purification by isoelectric focusing in space
NASA Technical Reports Server (NTRS)
Bier, M.
1988-01-01
The objective of the program was the definition and development of optimal methods for electrophoretic separations in microgravity. The approach is based on a triad consisting of ground based experiments, mathematical modeling and experiments in microgravity. Zone electrophoresis is a rate process, where separation is achieved in uniform buffers on the basis of differences in electrophoretic mobilities. Optimization and modeling of continuous flow electrophoresis mainly concern the hydrodynamics of the flow process, including gravity dependent fluid convection due to density gradients and gravity independent electroosmosis. Optimization of focusing requires a more complex model describing the molecular transport processes involved in electrophoresis of interacting systems. Three different focusing instruments were designed, embodying novel principles of fluid stabilization. Fluid stability was achieved by: (1) flow streamlining by means of membrane elements in combination with rapid fluid recycling; (2) apparatus rotation in combination with said membrane elements; and (3) shear stress induced by rapid recycling through a narrow gap channel.
Jeon, Hyungkook; Kim, Youngkyu; Lim, Geunbae
2016-01-28
In this paper, we introduce pressure-driven flow-induced miniaturizing free-flow electrophoresis (PDF-induced μ-FFE), a novel continuous separation method. In our separation system, the external flow and electric field are applied to particles, such that particle movement is affected by pressure-driven flow, electroosmosis, and electrophoresis. We then analyzed the hydrodynamic drag force and electrophoretic force applied to the particles in opposite directions. Based on this analysis, micro- and nano-sized particles were separated according to their electrophoretic mobilities with high separation efficiency. Because the separation can be achieved in a simple T-shaped microchannel, without the use of internal electrodes, it offers the advantages of low-cost, simple device fabrication and bubble-free operation, compared with conventional μ-FFE methods. Therefore, we expect the proposed separation method to have a wide range of filtering/separation applications in biochemical analysis.
Jeon, Hyungkook; Kim, Youngkyu; Lim, Geunbae
2016-01-01
In this paper, we introduce pressure-driven flow-induced miniaturizing free-flow electrophoresis (PDF-induced μ-FFE), a novel continuous separation method. In our separation system, the external flow and electric field are applied to particles, such that particle movement is affected by pressure-driven flow, electroosmosis, and electrophoresis. We then analyzed the hydrodynamic drag force and electrophoretic force applied to the particles in opposite directions. Based on this analysis, micro- and nano-sized particles were separated according to their electrophoretic mobilities with high separation efficiency. Because the separation can be achieved in a simple T-shaped microchannel, without the use of internal electrodes, it offers the advantages of low-cost, simple device fabrication and bubble-free operation, compared with conventional μ-FFE methods. Therefore, we expect the proposed separation method to have a wide range of filtering/separation applications in biochemical analysis. PMID:26819221
He, Liping; Sato, Kae; Abo, Mitsuru; Okubo, Akira; Yamazaki, Sunao
2003-03-01
Saccharides including mono- and disaccharides were quantitatively derivatized with 2-aminobenzoic acid (2-AA). These derivatives were then separated by capillary zone electrophoresis with UV detection using 50mM sodium phosphate buffer as the running electrolyte solution. In particular, the saccharide derivatives with the same molecular weight as 2-AA aldohexoses (mannose and glucose) and 2-AA aldopentoses (ribose and xylose) were well separated. The underlying reasons for separation were explored by studying their structural data using 1H and 13C NMR. It was found that the configurational difference between their hydroxyl group at C2 or C3 could cause the difference in Stokes' radii between their molecules and thus lead to different electrophoretic mobilities. The correlation between the electrophoretic behavior of these carbohydrate derivatives and their structures was studied utilizing the calculated molecular models of the 2-AA-labeled mannose, glucose, ribose, and xylose.
Use of hydrophilic polymer coatings for control of electroosmosis and protein adsorption
NASA Technical Reports Server (NTRS)
Harris, J. Milton
1987-01-01
The purpose of this project was to examine the utility of polyethylene glycol (PEG) and dextran coatings for control of electroosmosis and protein adsorption; electroosmosis is an important, deleterious process affecting electrophoretic separations, and protein adsorption is a factor which needs to be controlled during protein crystal growth to avoid multiple nucleation sites. Performance of the project required use of X-ray photoelectron spectroscopy to refine previously developed synthetic methods. The results of this spectroscopic examination are reported. Measurements of electroosmotic mobility of charged particles in appropriately coated capillaries reveals that a new, one-step route to coating capillaries gives a surface in which electroosmosis is dramatically reduced. Similarly, both PEG and dextran coatings were shown by protein adsorption measurements to be highly effective at reducing protein adsorption on solid surfaces. These results should have impact on future low-g electrophoretic and protein crystal growth experiments.
Duval, Jérôme F L; Slaveykova, Vera I; Hosse, Monika; Buffle, Jacques; Wilkinson, Kevin J
2006-10-01
The electrostatic, hydrodynamic and conformational properties of aqueous solutions of succinoglycan have been analyzed by fluorescence correlation spectroscopy (FCS), proton titration, and capillary electrophoresis (CE) over a large range of pH values and electrolyte (NaCl) concentrations. Using the theoretical formalism developed previously for the electrokinetic properties of soft, permeable particles, a quantitative analysis for the electro-hydrodynamics of succinoglycan is performed by taking into account, in a self-consistent manner, the measured values of the diffusion coefficients, electric charge densities, and electrophoretic mobilities. For that purpose, two limiting conformations for the polysaccharide in solution are tested, i.e. succinoglycan behaves as (i) a spherical, random coil polymer or (ii) a rodlike particle with charged lateral chains. The results show that satisfactory modeling of the titration data for ionic strengths larger than 50 mM can be accomplished using both geometries over the entire range of pH values. Electrophoretic mobilities measured for sufficiently large pH values (pH > 5-6) are in line with predictions based on either model. The best manner to discriminate between these two conceptual models is briefly discussed. For low pH values (pH < 5), both models indicate aggregation, resulting in an increase of the hydrodynamic permeability and a decrease of the diffusion coefficient.
Structure of allelic variants of subtype 5 of histone H1 in pea Pisum sativum L.
Bogdanova, V S; Lester, D R; Berdnikov, V A; Andersson, I
2005-06-01
The pea genome contains seven histone H1 genes encoding different subtypes. Previously, the DNA sequence of only one gene, His1, coding for the subtype H1-1, had been identified. We isolated a histone H1 allele from a pea genomic DNA library. Data from the electrophoretic mobility of the pea H1 subtypes and their N-bromosuccinimide cleavage products indicated that the newly isolated gene corresponded to the H1-5 subtype encoded by His5. We confirmed this result by sequencing the gene from three pea lines with H1-5 allelic variants of altered electrophoretic mobility. The allele of the slow H1-5 variant differed from the standard allele by a nucleotide substitution that caused the replacement of the positively charged lysine with asparagine in the DNA-interacting domain of the histone molecule. A temperature-related occurrence had previously been demonstrated for this H1-5 variant in a study on a worldwide collection of pea germplasm. The variant tended to occur at higher frequencies in geographic regions with a cold climate. The fast allelic variant of H1-5 displayed a deletion resulting in the loss of a duplicated pentapeptide in the C-terminal domain.
Mammalian transcription factor LSF is a target of ERK signaling
Pagon, Zrinka; Volker, Janet; Cooper, Geoffrey M.; Hansen, Ulla
2012-01-01
LSF is a mammalian transcription factor that is rapidly and quantitatively phosphorylated upon growth induction of resting, peripheral human T cells, as assayed by a reduction in its electrophoretic mobility. The DNA-binding activity of LSF in primary T cells is greatly increased after this phosphorylation event [Volker et al., 1997]. We demonstrate here that LSF is also rapidly and quantitatively phosphorylated upon growth induction in NIH 3T3 cells, although its DNA-binding activity is not significantly altered. Three lines of experimentation established that ERK is responsible for phosphorylating LSF upon growth induction in both cell types. First, phosphorylation of LSF by ERK is sufficient to cause the reduced electrophoretic mobility of LSF. Second, the amount of ERK activity correlates with the extent of LSF phosphorylation in both primary human T cells and NIH 3T3 cells. Finally, specific inhibitors of the Ras/Raf/MEK/ERK pathway inhibit LSF modification in vivo. This phosphorylation by ERK is not sufficient for activation of LSF DNA-binding activity, as evidenced both in vitro and in mouse fibroblasts. Nonetheless, activation of ERK is a prerequisite for the substantial increase in LSF DNA-binding activity upon activation of resting T cells, indicating that ERK phosphorylation is necessary but not sufficient for activation of LSF in this cell type. PMID:12858339
Biased Cyclical Electrical Field-Flow Fractionation for Separation of Submicron Particles
Ornthai, Mathuros; Siripinyanond, Atitaya; Gale, Bruce K.
2015-01-01
The potential of biased cyclical electrical field flow fractionation (BCyElFFF), which applies the positive cycle voltage longer than the negative cycle voltage, for characterization of submicron particles, was investigated. Parameters affecting separation and retention such as voltage, frequency, and duty cycle were examined. The results suggest that the separation mechanism in BCyElFFF in many cases is more related to the size of particles, as is the case with normal ElFFF, in the studied conditions, than the electrophoretic mobility, which is what the theory predicts for CyElFFF. However, better resolution was obtained when separating using BCyElFFF mode than when using normal CyElFFF. BCyElFFF was able to demonstrate simultaneous baseline separations of a mixture of 0.04, 0.1, and 0.2 μm particles and near separation of 0.5 μm particles. This study has shown the applicability of the BCyElFFF for separation and characterization of submicron particles greater than 0.1 μm in size, which had not been demonstrated previously. The separation and retention results suggest that for particles of this size, retention is based more on particle size than on electrophoretic mobility, which is contrary to existing theory for CyElFFF. PMID:26612733
Biased cyclical electrical field-flow fractionation for separation of submicron particles.
Ornthai, Mathuros; Siripinyanond, Atitaya; Gale, Bruce K
2016-01-01
The potential of biased cyclical electrical field-flow fractionation (BCyElFFF), which applies the positive cycle voltage longer than the negative cycle voltage, for characterization of submicron particles, was investigated. Parameters affecting separation and retention such as voltage, frequency, and duty cycle were examined. The results suggest that the separation mechanism in BCyElFFF in many cases is more related to the size of particles, as is the case with normal ElFFF, in the studied conditions, than the electrophoretic mobility, which is what the theory predicts for CyElFFF. However, better resolution was obtained when separating using BCyElFFF mode than when using normal CyElFFF. BCyElFFF was able to demonstrate simultaneous baseline separations of a mixture of 0.04-, 0.1-, and 0.2-μm particles and near separation of 0.5-μm particles. This study has shown the applicability of BCyElFFF for separation and characterization of submicron particles greater than 0.1-μm in size, which had not been demonstrated previously. The separation and retention results suggest that for particles of this size, retention is based more on particle size than on electrophoretic mobility, which is contrary to existing theory for CyElFFF.
NASA Astrophysics Data System (ADS)
Aung, Khin Moh Moh; Lim, Michelle Gek Liang; Hong, Shuzhen; Cheung, Edwin; Su, Xiaodi
Forkhead box protein 1 (FoxA1) is a member of the forkhead family of winged-helix transcription factors. It plays crucial roles in the development and differentiation of multiple organs and in the regulation of estrogen-stimulated genes. In this study, in order to determine the regions of FoxA1 necessary for efficient Deoxyribonucleic Acid (DNA) binding, we cloned, expressed and purified a series of FoxA1 constructs that contain either the DNA Binding Domain (DBD), the Transcription Activation Domain (TAD), or both. We determined the DNA binding behavior of these constructs using traditional electrophoretic mobility shift assay (EMSA) and a recently developed gold nanoparticles (AuNPs)-based fast screening method. We conclude that just the DBD region alone is not sufficient for protein-DNA binding activity. Amino acids flanking the upstream of the DBD region are required for maximal DNA binding activity. Through this study, we have also further validated the AuNPs assay for its generality and expanded the existing protocol for comparing the DNA binding behavior of multiple proteins of different charge properties and molecular weights.
Fan, Zhong-Qi; Tan, Xiao-Li; Shan, Wei; Kuang, Jian-Fei; Lu, Wang-Jin; Chen, Jian-Ye
2017-06-08
Plant-specific WRKY transcription factors (TFs) have been implicated to function as regulators of leaf senescence, but their association with postharvest leaf senescence of economically important leafy vegetables, is poorly understood. In this work, the characterization of a Group IIe WRKY TF, BrWRKY65, from Chinese flowering cabbage ( Brassica rapa var. parachinensis) is reported. The expression of BrWRKY65 was up-regulated following leaf chlorophyll degradation and yellowing during postharvest senescence. Subcellular localization and transcriptional activation assays showed that BrWRKY65 was localized in the nucleus and exhibited trans-activation ability. Further electrophoretic mobility shift assay (EMSA) and transient expression analysis clearly revealed that BrWRKY65 directly bound to the W-box motifs in the promoters of three senescence-associated genes ( SAGs ) such as BrNYC1 and BrSGR1 associated with chlorophyll degradation, and BrDIN1 , and subsequently activated their expressions. These findings demonstrate that BrWRKY65 may be positively associated with postharvest leaf senescence, at least partially, by the direct activation of SAGs . Taken together, these findings provide new insights into the transcriptional regulatory mechanism of postharvest leaf senescence in Chinese flowering cabbage.
Cloning and functional analysis of 5'-upstream region of the Pokemon gene.
Yang, Yutao; Zhou, Xiaowei; Zhu, Xudong; Zhang, Chuanfu; Yang, Zhixin; Xu, Long; Huang, Peitang
2008-04-01
Pokemon, the POK erythroid myeloid ontogenic factor, not only regulates the expression of many genes, but also plays an important role in cell tumorigenesis. To investigate the molecular mechanism regulating expression of the Pokemon gene in humans, its 5'-upstream region was cloned and analyzed. Transient analysis revealed that the Pokemon promoter is constitutive. Deletion analysis and a DNA decoy assay indicated that the NEG-U and NEG-D elements were involved in negative regulation of the Pokemon promoter, whereas the POS-D element was mainly responsible for its strong activity. Electrophoretic mobility shift assays suggested that the NEG-U, NEG-D and POS-D elements were specifically bound by the nuclear extract from A549 cells in vitro. Mutation analysis demonstrated that cooperation of the NEG-U and NEG-D elements led to negative regulation of the Pokemon promoter. Moreover, the NEG-U and NEG-D elements needed to be an appropriate distance apart in the Pokemon promoter in order to cooperate. Taken together, our results elucidate the mechanism underlying the regulation of Pokemon gene transcription, and also define a novel regulatory sequence that may be used to decrease expression of the Pokemon gene in cancer gene therapy.
Hartmann, Torsten; Baronian, Grégory; Nippe, Nadine; Voss, Meike; Schulthess, Bettina; Wolz, Christiane; Eisenbeis, Janina; Schmidt-Hohagen, Kerstin; Gaupp, Rosmarie; Sunderkötter, Cord; Beisswenger, Christoph; Bals, Robert; Somerville, Greg A.; Herrmann, Mathias; Molle, Virginie; Bischoff, Markus
2014-01-01
Carbon metabolism and virulence determinant production are often linked in pathogenic bacteria, and several regulatory elements have been reported to mediate this linkage in Staphylococcus aureus. Previously, we described a novel protein, catabolite control protein E (CcpE) that functions as a regulator of the tricarboxylic acid cycle. Here we demonstrate that CcpE also regulates virulence determinant biosynthesis and pathogenesis. Specifically, deletion of ccpE in S. aureus strain Newman revealed that CcpE affects transcription of virulence factors such as capA, the first gene in the capsule biosynthetic operon; hla, encoding α-toxin; and psmα, encoding the phenol-soluble modulin cluster α. Electrophoretic mobility shift assays demonstrated that CcpE binds to the hla promoter. Mice challenged with S. aureus strain Newman or its isogenic ΔccpE derivative revealed increased disease severity in the ΔccpE mutant using two animal models; an acute lung infection model and a skin infection model. Complementation of the mutant with the ccpE wild-type allele restored all phenotypes, demonstrating that CcpE is negative regulator of virulence in S. aureus. PMID:25193664
Han, Kyu Yeon; Kwon, Taek Hwan; Lee, Tae Hoon; Lee, Sung-Joon; Kim, Sung-Hoon; Kim, Jiyoung
2008-04-30
A variety of anti-inflammatory agents have been shown to exert chemopreventive activity via targeting of transcription factors such as NF-kappaB and AP-1. Lithospermum erythrorhizon (LE) has long been used in traditional oriental medicine. In this study, we demonstrated the inhibitory effects of LE extracts on lipopolysaccharide (LPS)-stimulated production of inflammatory cytokines. As an underlying mechanism of inhibition, LE extracts reduced LPS-induced transactivation of AP-1 as well as NF-kappaB in mouse macrophage cells. Electrophoretic mobility shift assays indicated that LE extracts inhibited the DNA binding activities of AP-1 and NF-kappaB. In addition, phosphorylation of IkappaB-alpha protein was suppressed by LE extracts. Moreover, LE extracts inhibited c-Jun N-terminal kinase and extracellular signal-regulated signaling pathways. Our results suggest that the anti-inflammatory activity of LE extracts may be mediated by the inhibition of signal transduction pathways that normally lead to the activation of AP-1and NF-kappaB. These inhibitory effects may be useful for chemoprevention of cancer or other chronic inflammatory diseases.
Orlowska, Karina; Molcan, Tomasz; Swigonska, Sylwia; Sadowska, Agnieszka; Jablonska, Monika; Nynca, Anna; Jastrzebski, Jan P; Ciereszko, Renata E
2016-06-01
The aryl hydrocarbon receptor (AhR) is a ligand-dependent transcription factor that can be activated by structurally diverse synthetic and natural chemicals, including toxic environmental contaminant 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). In the present study, homology models of the porcine AhR-ligand binding domain (LBD) and the porcine aryl hydrocarbon receptor nuclear translocator-ligand binding domain (ARNT-LBD) were created on the basis of structures of closely related respective proteins i.e., human Hif-2α and ARNT. Molecular docking of TCDD to the porcine AhR-LBD model revealed high binding affinity (-8.8kcal/mol) between TCDD and the receptor. Moreover, formation of the TCDD/AhR-LBD complex was confirmed experimentally with the use of electrophoretic mobility shift assay (EMSA). It was found that TCDD (10nM, 2h of incubation) not only bound to the AhR in the porcine granulosa cells but also activated the receptor. The current study provides a framework for examining the key events involved in the ligand-dependent activation of the AhR. Copyright © 2016 Elsevier Inc. All rights reserved.
Kim, Younghoon; Kim, Sung Hoon; Ferracane, Dean; Katzenellenbogen, John A; Schroeder, Charles M
2012-09-19
Zinc finger proteins (ZFPs) play a key role in transcriptional regulation and serve as invaluable tools for gene modification and genetic engineering. Development of efficient strategies for labeling metalloproteins such as ZFPs is essential for understanding and controlling biological processes. In this work, we engineered ZFPs containing cysteine-histidine (Cys2-His2) motifs by metabolic incorporation of the unnatural amino acid azidohomoalanine (AHA), followed by specific protein labeling via click chemistry. We show that cyclooctyne promoted [3 + 2] dipolar cycloaddition with azides, known as copper-free click chemistry, provides rapid and specific labeling of ZFPs at high yields as determined by mass spectrometry analysis. We observe that the DNA-binding activity of ZFPs labeled by conventional copper-mediated click chemistry was completely abolished, whereas ZFPs labeled by copper-free click chemistry retain their sequence-specific DNA-binding activity under native conditions, as determined by electrophoretic mobility shift assays, protein microarrays, and kinetic binding assays based on Förster resonance energy transfer (FRET). Our work provides a general framework to label metalloproteins such as ZFPs by metabolic incorporation of unnatural amino acids followed by copper-free click chemistry.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Feng-Wei; Wu, Xian-Rui; Liu, Wen-Ju
Epstein-Barr virus (EBV) nuclear antigen 1 (EBNA1) is essential for maintenance of the episome and establishment of latency. In this study, we observed that heat treatment effectively induced EBNA1 transcription in EBV-transformed B95-8 and human LCL cell lines. Although Cp is considered as the sole promoter used for the expression of EBNA1 transcripts in the lymphoblastoid cell lines, the RT-PCR results showed that the EBNA1 transcripts induced by heat treatment arise from Qp-initiated transcripts. Using bioinformatics, a high affinity and functional heat shock factor 1 (HSF1)-binding element within the - 17/+4 oligonucleotide of the Qp was found, and was determinedmore » by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. Moreover, heat shock and exogenous HSF1 expression induced Qp activity in reporter assays. Further, RNA interference-mediated HSF1 gene silencing attenuated heat-induced EBNA1 expression in B95-8 cells. These results provide evidence that EBNA1 is a new target for the transcription factor HSF1.« less
Kim, Younghoon; Kim, Sung Hoon; Ferracane, Dean; Katzenellenbogen, John A.
2012-01-01
Zinc finger proteins (ZFPs) play a key role in transcriptional regulation and serve as invaluable tools for gene modification and genetic engineering. Development of efficient strategies for labeling metalloproteins such as ZFPs is essential for understanding and controlling biological processes. In this work, we engineered ZFPs containing cysteine-histidine (Cys2-His2) motifs by metabolic incorporation of the unnatural amino acid azidohomoalanine (AHA), followed by specific protein labeling via click chemistry. We show that cyclooctyne promoted [3 + 2] dipolar cycloaddition with azides, known as copper-free click chemistry, provides rapid and specific labeling of ZFPs at high yields as determined by mass spectrometry analysis. We observe that the DNA-binding activity of ZFPs labeled by conventional copper-mediated click chemistry was completely abolished, whereas ZFPs labeled by copper-free click chemistry retain their sequence-specific DNA-binding activity under native conditions, as determined by electrophoretic mobility shift assays, protein microarrays and kinetic binding assays based on Förster resonance energy transfer (FRET). Our work provides a general framework to label metalloproteins such as ZFPs by metabolic incorporation of unnatural amino acids followed by copper-free click chemistry. PMID:22871171
Sandmann, Michael; Talbert, Paul; Demidov, Dmitri; Kuhlmann, Markus; Rutten, Twan; Conrad, Udo; Lermontova, Inna
2017-01-01
KINETOCHORE NULL2 (KNL2) is involved in recognition of centromeres and in centromeric localization of the centromere-specific histone cenH3. Our study revealed a cenH3 nucleosome binding CENPC-k motif at the C terminus of Arabidopsis thaliana KNL2, which is conserved among a wide spectrum of eukaryotes. Centromeric localization of KNL2 is abolished by deletion of the CENPC-k motif and by mutating single conserved amino acids, but can be restored by insertion of the corresponding motif of Arabidopsis CENP-C. We showed by electrophoretic mobility shift assay that the C terminus of KNL2 binds DNA sequence-independently and interacts with the centromeric transcripts in vitro. Chromatin immunoprecipitation with anti-KNL2 antibodies indicated that in vivo KNL2 is preferentially associated with the centromeric repeat pAL1 Complete deletion of the CENPC-k motif did not influence its ability to interact with DNA in vitro. Therefore, we suggest that KNL2 recognizes centromeric nucleosomes, similar to CENP-C, via the CENPC-k motif and binds adjoining DNA. © 2017 American Society of Plant Biologists. All rights reserved.
Pan, Yuchen; Sackmann, Eric K; Wypisniak, Karolina; Hornsby, Michael; Datwani, Sammy S; Herr, Amy E
2016-12-23
High-quality immunoreagents enhance the performance and reproducibility of immunoassays and, in turn, the quality of both biological and clinical measurements. High quality recombinant immunoreagents are generated using antibody-phage display. One metric of antibody quality - the binding affinity - is quantified through the dissociation constant (K D ) of each recombinant antibody and the target antigen. To characterize the K D of recombinant antibodies and target antigen, we introduce affinity electrophoretic mobility shift assays (EMSAs) in a high-throughput format suitable for small volume samples. A microfluidic card comprised of free-standing polyacrylamide gel (fsPAG) separation lanes supports 384 concurrent EMSAs in 30 s using a single power source. Sample is dispensed onto the microfluidic EMSA card by acoustic droplet ejection (ADE), which reduces EMSA variability compared to sample dispensing using manual or pin tools. The K D for each of a six-member fragment antigen-binding fragment library is reported using ~25-fold less sample mass and ~5-fold less time than conventional heterogeneous assays. Given the form factor and performance of this micro- and mesofluidic workflow, we have developed a sample-sparing, high-throughput, solution-phase alternative for biomolecular affinity characterization.
Pan, Yuchen; Sackmann, Eric K.; Wypisniak, Karolina; Hornsby, Michael; Datwani, Sammy S.; Herr, Amy E.
2016-01-01
High-quality immunoreagents enhance the performance and reproducibility of immunoassays and, in turn, the quality of both biological and clinical measurements. High quality recombinant immunoreagents are generated using antibody-phage display. One metric of antibody quality – the binding affinity – is quantified through the dissociation constant (KD) of each recombinant antibody and the target antigen. To characterize the KD of recombinant antibodies and target antigen, we introduce affinity electrophoretic mobility shift assays (EMSAs) in a high-throughput format suitable for small volume samples. A microfluidic card comprised of free-standing polyacrylamide gel (fsPAG) separation lanes supports 384 concurrent EMSAs in 30 s using a single power source. Sample is dispensed onto the microfluidic EMSA card by acoustic droplet ejection (ADE), which reduces EMSA variability compared to sample dispensing using manual or pin tools. The KD for each of a six-member fragment antigen-binding fragment library is reported using ~25-fold less sample mass and ~5-fold less time than conventional heterogeneous assays. Given the form factor and performance of this micro- and mesofluidic workflow, we have developed a sample-sparing, high-throughput, solution-phase alternative for biomolecular affinity characterization. PMID:28008969
Goldman, Johnathan M; Zhang, Li Ang; Manna, Arunava; Armitage, Bruce A; Ly, Danith H; Schneider, James W
2013-07-08
Hybridization analysis of short DNA and RNA targets presents many challenges for detection. The commonly employed sandwich hybridization approach cannot be implemented for these short targets due to insufficient probe-target binding strengths for unmodified DNA probes. Here, we present a method capable of rapid and stable sandwich hybridization detection for 22 nucleotide DNA and RNA targets. Stable hybridization is achieved using an n-alkylated, polyethylene glycol γ-carbon modified peptide nucleic acid (γPNA) amphiphile. The γPNA's exceptionally high affinity enables stable hybridization of a second DNA-based probe to the remaining bases of the short target. Upon hybridization of both probes, an electrophoretic mobility shift is measured via interaction of the n-alkane modification on the γPNA with capillary electrophoresis running buffer containing nonionic surfactant micelles. We find that sandwich hybridization of both probes is stable under multiple binding configurations and demonstrate single base mismatch discrimination. The binding strength of both probes is also stabilized via coaxial stacking on adjacent hybridization to targets. We conclude with a discussion on the implementation of the proposed sandwich hybridization assay as a high-throughput microRNA detection method.
Chang, P K; Ehrlich, K C; Yu, J; Bhatnagar, D; Cleveland, T E
1995-01-01
The aflR gene from Aspergillus parasiticus and Aspergillus flavus may be involved in the regulation of aflatoxin biosynthesis. The aflR gene product, AFLR, possesses a GAL4-type binuclear zinc finger DNA-binding domain. A transformant, SU1-N3 (pHSP), containing an additional copy of aflR, showed increased transcription of aflR and the aflatoxin pathway structural genes, nor-1, ver-1, and omt-1, when cells were grown in nitrate medium, which normally suppresses aflatoxin production. Electrophoretic mobility shift assays showed that the recombinant protein containing the DNA-binding domain, AFLR1, bound specifically to the palindromic sequence, TTAGGCCTAA, 120 bp upstream of the AFLR translation start site. Expression of aflR thus appears to be autoregulated. Increased expression of aflatoxin biosynthetic genes in the transformant might result from an elevated basal level of AFLR, allowing it to overcome nitrate inhibition and to bind to the aflR promotor region, thereby initiating aflatoxin biosynthesis. Results further suggest that aflR is involved in the regulation of multiple parts of the aflatoxin biosynthetic pathway. PMID:7793958
Seo, Mitsunori; Kanno, Yuri; Frey, Anne; North, Helen M; Marion-Poll, Annie
2016-05-01
Nine-cis-epoxycarotenoid dioxygenase (NCED) catalyzes the key step of abscisic acid (ABA) biosynthesis. There are five genes encoding NCED in Arabidopsis, which differentially regulate ABA biosynthesis in a spatiotemporal manner in response to endogenous and environmental stimuli. Previous studies have shown that NCED9 is expressed in testa and embryos during seed development. In the present study, we have identified promoter regions required for the expression of NCED9 in testa and embryos, respectively. Electrophoretic mobility shift assays (EMSA) and yeast one-hybrid (Y1H) assays showed that several homeodomain-leucine zipper (HD-Zip) proteins, namely ATHBs, bound to the sequence required for expression of NCED9 in testa, suggesting that they redundantly regulate NCED9 expression. By expressing the NCED9 gene under the control of a deleted NCED9 promoter in an nced9 mutant expression was limited to embryos. Transformants were complemented for the paclobutrazol resistant germination phenotype of the mutant, suggesting that the ABA synthesis mediated by NCED9 in embryos plays an important role in the regulation of gibberellin (GA)-dependent seed germination. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Fejerman, Laura; Ahmadiyeh, Nasim; Hu, Donglei; Huntsman, Scott; Beckman, Kenneth B; Caswell, Jennifer L; Tsung, Karen; John, Esther M; Torres-Mejia, Gabriela; Carvajal-Carmona, Luis; Echeverry, María Magdalena; Tuazon, Anna Marie D; Ramirez, Carolina; Gignoux, Christopher R; Eng, Celeste; Gonzalez-Burchard, Esteban; Henderson, Brian; Le Marchand, Loic; Kooperberg, Charles; Hou, Lifang; Agalliu, Ilir; Kraft, Peter; Lindström, Sara; Perez-Stable, Eliseo J; Haiman, Christopher A; Ziv, Elad
2014-10-20
The genetic contributions to breast cancer development among Latinas are not well understood. Here we carry out a genome-wide association study of breast cancer in Latinas and identify a genome-wide significant risk variant, located 5' of the Estrogen Receptor 1 gene (ESR1; 6q25 region). The minor allele for this variant is strongly protective (rs140068132: odds ratio (OR) 0.60, 95% confidence interval (CI) 0.53-0.67, P=9 × 10(-18)), originates from Indigenous Americans and is uncorrelated with previously reported risk variants at 6q25. The association is stronger for oestrogen receptor-negative disease (OR 0.34, 95% CI 0.21-0.54) than oestrogen receptor-positive disease (OR 0.63, 95% CI 0.49-0.80; P heterogeneity=0.01) and is also associated with mammographic breast density, a strong risk factor for breast cancer (P=0.001). rs140068132 is located within several transcription factor-binding sites and electrophoretic mobility shift assays with MCF-7 nuclear protein demonstrate differential binding of the G/A alleles at this locus. These results highlight the importance of conducting research in diverse populations.
Characterization of monomeric DNA-binding protein Histone H1 in Leishmania braziliensis.
Carmelo, Emma; González, Gloria; Cruz, Teresa; Osuna, Antonio; Hernández, Mariano; Valladares, Basilio
2011-08-01
Histone H1 in Leishmania presents relevant differences compared to higher eukaryote counterparts, such as the lack of a DNA-binding central globular domain. Despite that, it is apparently fully functional since its differential expression levels have been related to changes in chromatin condensation and infectivity, among other features. The localization and the aggregation state of L. braziliensis H1 has been determined by immunolocalization, mass spectrometry, cross-linking and electrophoretic mobility shift assays. Analysis of H1 sequences from the Leishmania Genome Database revealed that our protein is included in a very divergent group of histones H1 that is present only in L. braziliensis. An antibody raised against recombinant L. braziliensis H1 recognized specifically that protein by immunoblot in L. braziliensis extracts, but not in other Leishmania species, a consequence of the sequence divergences observed among Leishmania species. Mass spectrometry analysis and in vitro DNA-binding experiments have also proven that L. braziliensis H1 is monomeric in solution, but oligomerizes upon binding to DNA. Finally, despite the lack of a globular domain, L. braziliensis H1 is able to form complexes with DNA in vitro, with higher affinity for supercoiled compared to linear DNA.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Priyadarshini, C.G. Poornima; Savithri, H.S., E-mail: bchss@biochem.iisc.ernet.i
Gemini viral assembly and transport of viral DNA into nucleus for replication, essentially involve DNA-coat protein interactions. The kinetics of interaction of Cotton Leaf Curl Kokhran Virus-Dabawali recombinant coat protein (rCP) with DNA was studied by electrophoretic mobility shift assay (EMSA) and surface plasmon resonance (SPR). The rCP interacted with ssDNA with a K{sub A}, of 2.6 +- 0.29 x 10{sup 8} M{sup -1} in a sequence non-specific manner. The CP has a conserved C2H2 type zinc finger motif composed of residues C68, C72, H81 and H85. Mutation of these residues to alanine resulted in reduced binding to DNA probes.more » The H85A mutant rCP showed the least binding with approximately 756 fold loss in the association rate and a three order magnitude decrease in the binding affinity as compared to rCP. The CP-DNA interactions via the zinc finger motif could play a crucial role in virus assembly and in nuclear transport.« less
Cao, Yanli; Zheng, Fanglin; Wang, Lei; Zhao, Guolei; Chen, Guanjun; Zhang, Weixin; Liu, Weifeng
2017-07-01
Cellulase gene expression in the model cellulolytic fungus Trichoderma reesei is supposed to be controlled by an intricate regulatory network involving multiple transcription factors. Here, we identified a novel transcriptional repressor of cellulase gene expression, Rce1. Disruption of the rce1 gene not only facilitated the induced expression of cellulase genes but also led to a significant delay in terminating the induction process. However, Rce1 did not participate in Cre1-mediated catabolite repression. Electrophoretic mobility shift (EMSA) and DNase I footprinting assays in combination with chromatin immunoprecipitation (ChIP) demonstrated that Rce1 could bind directly to a cbh1 (cellobiohydrolase 1-encoding) gene promoter region containing a cluster of Xyr1 binding sites. Furthermore, competitive binding assays revealed that Rce1 antagonized Xyr1 from binding to the cbh1 promoter. These results indicate that intricate interactions exist between a variety of transcription factors to ensure tight and energy-efficient regulation of cellulase gene expression in T. reesei. This study also provides important clues regarding increased cellulase production in T. reesei. © 2017 John Wiley & Sons Ltd.
Beltzer, J P; Spiess, M
1991-01-01
The asialoglycoprotein (ASGP) receptor was used to probe total clathrin-coated vesicle proteins and purified adaptor proteins (APs) which had been fractionated by gel electrophoresis and transferred to nitrocellulose. The receptor was found to interact with proteins of approximately 100 kDa. The cytoplasmic domain of the ASGP receptor subunit H1 fused to dihydrofolate reductase competed for receptor binding to the 100 kDa polypeptide in the plasma membrane-type AP complexes (AP-2). A fusion protein containing the cytoplasmic domain of the endocytic mutant haemagglutinin HA-Y543 also competed, but a protein with the wild-type haemagglutinin sequence did not. This indicates that the observed interaction is specific for the cytoplasmic domain of the receptor and involves the tyrosine signal for endocytosis. When fractionated by gel electrophoresis in the presence of urea, the ASGP receptor binding polypeptide displayed a characteristic shift in electrophoretic mobility identifying it as the beta adaptin. Partial proteolysis of the AP-2 preparation followed by the receptor binding assay revealed that the aminoterminal domain of the beta adaptin contains the binding site for receptors. Images PMID:1935897
Mallory, Michael J.; Law, Michael J.; Buckingham, Lela E.; Strich, Randy
2010-01-01
Meiotic genes in budding yeast are repressed during vegetative growth but are transiently induced during specific stages of meiosis. Sin3p represses the early meiotic gene (EMG) by bridging the DNA binding protein Ume6p to the histone deacetylase Rpd3p. Sin3p contains four paired amphipathic helix (PAH) domains, one of which (PAH3) is required for repressing several genes expressed during mitotic cell division. This report examines the roles of the PAH domains in mediating EMG repression during mitotic cell division and following meiotic induction. PAH2 and PAH3 are required for mitotic EMG repression, while electrophoretic mobility shift assays indicate that only PAH2 is required for stable Ume6p-promoter interaction. Unlike mitotic repression, reestablishing EMG repression following transient meiotic induction requires PAH3 and PAH4. In addition, the role of Sin3p in reestablishing repression is expanded to include additional loci that it does not control during vegetative growth. These findings indicate that mitotic and postinduction EMG repressions are mediated by two separate systems that utilize different Sin3p domains. PMID:20971827
Leptin rapidly activates PPARs in C2C12 muscle cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bendinelli, Paola; Piccoletti, Roberta; Maroni, Paola
2005-07-08
Experimental evidence suggests that leptin operates on the tissues, including skeletal muscle, also by modulating gene expression. Using electrophoretic mobility shift assays, we have shown that physiological doses of leptin promptly increase the binding of C2C12 cell nuclear extracts to peroxisome proliferator-activated receptor (PPAR) response elements in oligonucleotide probes and that all three PPAR isoforms participate in DNA-binding complexes. We pre-treated C2C12 cells with AACOCF{sub 3}, a specific inhibitor of cytosolic phospholipase A{sub 2} (cPLA{sub 2}), an enzyme that supplies ligands to PPARs, and found that it abrogates leptin-induced PPAR DNA-binding activity. Leptin treatment significantly increased cPLA{sub 2} activity, evaluatedmore » as the release of [{sup 3}H]arachidonic acid from pre-labelled C2C12 cells, as well as phosphorylation. Further, using MEK1 inhibitor PD-98059 we showed that leptin activates cPLA{sub 2} through ERK induction. These results support a direct effect of leptin on skeletal muscle cells, and suggest that the hormone may modulate muscle transcription also by precocious activation of PPARs through ERK-cPLA{sub 2} pathway.« less
Alvarez-Martin, Pablo; O'Connell Motherway, Mary; Turroni, Francesca; Foroni, Elena; Ventura, Marco; van Sinderen, Douwe
2012-10-01
This work reports on the identification and molecular characterization of a two-component regulatory system (2CRS), encoded by serRK, which is believed to control the expression of the ser(2003) locus in Bifidobacterium breve UCC2003. The ser(2003) locus consists of two genes, Bbr_1319 (sagA) and Bbr_1320 (serU), which are predicted to encode a hypothetical membrane-associated protein and a serpin-like protein, respectively. The response regulator SerR was shown to bind to the promoter region of ser(2003), and the probable recognition sequence of SerR was determined by a combinatorial approach of in vitro site-directed mutagenesis coupled to transcriptional fusion and electrophoretic mobility shift assays (EMSAs). The importance of the serRK 2CRS in the response of B. breve to protease-mediated induction was confirmed by generating a B. breve serR insertion mutant, which was shown to exhibit altered ser(2003) transcriptional induction patterns compared to the parent strain, UCC2003. Interestingly, the analysis of a B. breve serU mutant revealed that the SerRK signaling pathway appears to include a SerU-dependent autoregulatory loop.
Alvarez-Martin, Pablo; O'Connell Motherway, Mary; Turroni, Francesca; Foroni, Elena; Ventura, Marco
2012-01-01
This work reports on the identification and molecular characterization of a two-component regulatory system (2CRS), encoded by serRK, which is believed to control the expression of the ser2003 locus in Bifidobacterium breve UCC2003. The ser2003 locus consists of two genes, Bbr_1319 (sagA) and Bbr_1320 (serU), which are predicted to encode a hypothetical membrane-associated protein and a serpin-like protein, respectively. The response regulator SerR was shown to bind to the promoter region of ser2003, and the probable recognition sequence of SerR was determined by a combinatorial approach of in vitro site-directed mutagenesis coupled to transcriptional fusion and electrophoretic mobility shift assays (EMSAs). The importance of the serRK 2CRS in the response of B. breve to protease-mediated induction was confirmed by generating a B. breve serR insertion mutant, which was shown to exhibit altered ser2003 transcriptional induction patterns compared to the parent strain, UCC2003. Interestingly, the analysis of a B. breve serU mutant revealed that the SerRK signaling pathway appears to include a SerU-dependent autoregulatory loop. PMID:22843530
Transcriptional regulation of the Borrelia burgdorferi antigenically variable VlsE surface protein.
Bykowski, Tomasz; Babb, Kelly; von Lackum, Kate; Riley, Sean P; Norris, Steven J; Stevenson, Brian
2006-07-01
The Lyme disease agent Borrelia burgdorferi can persistently infect humans and other animals despite host active immune responses. This is facilitated, in part, by the vls locus, a complex system consisting of the vlsE expression site and an adjacent set of 11 to 15 silent vls cassettes. Segments of nonexpressed cassettes recombine with the vlsE region during infection of mammalian hosts, resulting in combinatorial antigenic variation of the VlsE outer surface protein. We now demonstrate that synthesis of VlsE is regulated during the natural mammal-tick infectious cycle, being activated in mammals but repressed during tick colonization. Examination of cultured B. burgdorferi cells indicated that the spirochete controls vlsE transcription levels in response to environmental cues. Analysis of PvlsE::gfp fusions in B. burgdorferi indicated that VlsE production is controlled at the level of transcriptional initiation, and regions of 5' DNA involved in the regulation were identified. Electrophoretic mobility shift assays detected qualitative and quantitative changes in patterns of protein-DNA complexes formed between the vlsE promoter and cytoplasmic proteins, suggesting the involvement of DNA-binding proteins in the regulation of vlsE, with at least one protein acting as a transcriptional activator.
Buono, P; Conciliis, L D; Izzo, P; Salvatore, F
1997-01-01
A DNA region located at around -200 bp in the 5' flanking region (region D) of the human brain-type fructose-bisphosphate aldolase (aldolase C) gene has been analysed. We show by transient transfection assay and electrophoretic-mobility-shift assay (EMSA) that the binding of transcriptional activators to region D is much more efficient (80% versus 30%) in human neuroblastoma cells (SKNBE) than in the non-neuronal cell line A1251, which contains low levels of aldolase C mRNA. The sequence of region D, CAAGGTCA, is very similar to the AAAGGTCA motif present in the mouse steroid 21-hydroxylase gene; the latter motif binds nerve-growth-factor-induced B factor (NGFI-B), which is a member of the thyroid/steroid/retinoid nuclear receptor gene family. Competition experiments in EMSA and antibody-directed supershift experiments showed that NGFI-B is involved in the binding to region D of the human aldolase C gene. Furthermore, the regulation of the aldolase C gene (which is the second known target of NGFI-B) expression during development parallels that of NGFI-B. PMID:9173889
Herrera, M. Carmen; Daddaoua, Abdelali; Fernández-Escamilla, Ana
2012-01-01
The phhAB operon encodes a phenylalanine hydroxylase involved in the conversion of l-phenylalanine into l-tyrosine in Pseudomonas putida. The phhAB promoter is transcribed by RNA polymerase sigma-70 and is unusual in that the specific regulator PhhR acts as an enhancer protein that binds to two distant upstream sites (−75 to −92 and −132 to −149). There is an integration host factor (IHF) binding site that overlaps the proximal PhhR box, and, consequently, IHF acts as an inhibitor of transcription. Use of l-phenylalanine is compromised in a crp-deficient background due to reduced expression from the phhAB promoter. Electrophoretic mobility shift assays and DNase I footprinting assays reveal that Crp binds at a site centered at −109 only in the presence of cyclic AMP (cAMP). We show, using circular permutation analysis, that the simultaneous binding of Crp/cAMP and PhhR bends DNA to bring positive regulators and RNA polymerase into close proximity. This nucleoprotein complex promotes transcription from phhA only in response to l-phenylalanine. PMID:22081386
Blangy, A; Léopold, P; Vidal, F; Rassoulzadegan, M; Cuzin, F
1991-01-01
We have reported previously (1) two unexpected consequences of the microinjection into fertilized mouse eggs of a recombinant plasmid designated p12B1, carrying a 343 bp insert of non-repetitive mouse DNA. Injected at very low concentrations, this plasmid could be established as an extrachromosomal genetic element. When injected in greater concentration, an early arrest of embryonic development resulted. In the present work, we have studied this toxic effect in more detail by microinjecting short synthetic oligonucleotides with sequences from the mouse insert. Lethality was associated with the nucleotide sequence GTCACATG, identical with the CDEl element of yeast centromeres. Development of injected embryos was arrested between the one-cell and the early morula stages, with abnormal structures and DNA contents. Electrophoretic mobility shift and DNAse foot-printing assays demonstrated the binding of mouse nuclear protein(s) to the CDEl-like box. Base changes within the CDEl sequence prevented both the toxic effects in embryos and the formation of protein complex in vitro, suggesting that protein binding at such sites in chromosomal DNA plays an important role in early development. Images PMID:1766880
The LacI family protein GlyR3 co-regulates the celC operon and manB in Clostridium thermocellum
Choi, Jinlyung; Klingeman, Dawn M.; Brown, Steven D.; ...
2017-06-24
In this paper, we demonstrate that the GlyR3 protein mediates the regulation of manB. We first identify putative GlyR3 binding sites within or just upstream of the coding regions of manB and celT. Using an electrophoretic mobility shift assay (EMSA), we determined that a higher concentration of GlyR3 is required to effectively bind to the putative manB site in comparison to the celC site. Neither the putative celT site nor random DNA significantly binds GlyR3. While laminaribiose interfered with GlyR3 binding to the celC binding site, binding to the manB site was unaffected. In the presence of laminaribiose, in vivomore » transcription of the celC–glyR3–licA gene cluster increases, while manB expression is repressed, compared to in the absence of laminaribiose, consistent with the results from the EMSA. An in vitro transcription assay demonstrated that GlyR3 and laminaribiose interactions were responsible for the observed patters of in vivo transcription.« less
Choong, Oi Kuan; Tejo, Bimo Ario; Omar, Abdul Rahman
2014-01-01
Feline Infectious Peritonitis (FIP) is a severe fatal immune-augmented disease in cat population. It is caused by FIP virus (FIPV), a virulent mutant strain of Feline Enteric Coronavirus (FECV). Current treatments and prophylactics are not effective. The in vitro antiviral properties of five circular Triple-Helix Forming Oligonucleotide (TFO) RNAs (TFO1 to TFO5), which target the different regions of virulent feline coronavirus (FCoV) strain FIPV WSU 79-1146 genome, were tested in FIPV-infected Crandell-Rees Feline Kidney (CRFK) cells. RT-qPCR results showed that the circular TFO RNAs, except TFO2, inhibit FIPV replication, where the viral genome copy numbers decreased significantly by 5-fold log10 from 1014 in the virus-inoculated cells to 109 in the circular TFO RNAs-transfected cells. Furthermore, the binding of the circular TFO RNA with the targeted viral genome segment was also confirmed using electrophoretic mobility shift assay. The strength of binding kinetics between the TFO RNAs and their target regions was demonstrated by NanoITC assay. In conclusion, the circular TFOs have the potential to be further developed as antiviral agents against FIPV infection. PMID:24707494
Fejerman, Laura; Ahmadiyeh, Nasim; Hu, Donglei; Huntsman, Scott; Beckman, Kenneth B.; Caswell, Jennifer L.; Tsung, Karen; John, Esther M.; Torres-Mejia, Gabriela; Carvajal-Carmona, Luis; Echeverry, María Magdalena; Tuazon, Anna Marie D.; Ramirez, Carolina; Carvajal-Carmona, Luis; Echeverry, María Magdalena; Bohórquez, Mabel Elena; Prieto, Rodrigo; Criollo, Ángel; Ramírez, Carolina; Estrada, Ana Patricia; Suáres, John Jairo; Mateus, Gilbert; Castro, Jorge Mario; Sánchez, Yesid; Murillo, Raúl; Lucia Serrano, Martha; Sanabria, Carolina; Olaya, Justo Germán; Bolaños, Fernando; Vélez, Alejandro; Carmona, Jenny Andrea; Vélez, Alejandro; Rodríguez, Nancy Guerrero; Serón Sousa, Cristina; Mendez, Cesar Eduardo Alvarez; Galviz, Ana Isabel Orduz; Gignoux, Christopher R.; Eng, Celeste; Gonzalez-Burchard, Esteban; Henderson, Brian; Marchand, Loic Le; Kooperberg, Charles; Hou, Lifang; Agalliu, Ilir; Kraft, Peter; Lindström, Sara; Perez-Stable, Eliseo J.; Haiman, Christopher A.; Ziv, Elad
2014-01-01
The genetic contributions to breast cancer development among Latinas are not well understood. Here we carry out a genome-wide association study of breast cancer in Latinas and identify a genome-wide significant risk variant, located 5′ of the Estrogen Receptor 1 gene (ESR1; 6q25 region). The minor allele for this variant is strongly protective (rs140068132: odds ratio (OR) 0.60, 95% confidence interval (CI) 0.53–0.67, P=9 × 10−18), originates from Indigenous Americans and is uncorrelated with previously reported risk variants at 6q25. The association is stronger for oestrogen receptor-negative disease (OR 0.34, 95% CI 0.21–0.54) than oestrogen receptor-positive disease (OR 0.63, 95% CI 0.49–0.80; P heterogeneity=0.01) and is also associated with mammographic breast density, a strong risk factor for breast cancer (P=0.001). rs140068132 is located within several transcription factor-binding sites and electrophoretic mobility shift assays with MCF-7 nuclear protein demonstrate differential binding of the G/A alleles at this locus. These results highlight the importance of conducting research in diverse populations. PMID:25327703
Yu, Xuefei; Zheng, Wei; Bhat, Somanath; Aquilina, J. Andrew
2015-01-01
Bacillus sp. CDB3 possesses a novel eight-gene ars cluster (ars1, arsRYCDATorf7orf8) with some unusual features in regard to expression regulation. This study demonstrated that the cluster is a single operon but can also produce a short three-gene arsRYC transcript. A hairpin structure formed by internal inverted repeats between arsC and arsD was shown to diminish the expression of the full operon, thereby probably acting as a transcription attenuator. A degradation product of the arsRYC transcript was also identified. Electrophoretic mobility shift analysis demonstrated that ArsR interacts with the ars1 promoter forming a protein-DNA complex that could be impaired by arsenite. However, no interaction was detected between ArsD and the ars1 promoter, suggesting that the CDB3 ArsD protein may not play a regulatory role. Compared to other ars gene clusters, regulation of the Bacillus sp. CDB3 ars1 operon is more complex. It represents another example of specific mRNA degradation in the transporter gene region and possibly the first case of attenuator-mediated regulation of ars operons. PMID:26355338
Regulation of the scp Genes in the Cyanobacterium Synechocystis sp. PCC 6803--What is New?
Cheregi, Otilia; Funk, Christiane
2015-08-12
In the cyanobacterium Synechocystis sp. PCC 6803 there are five genes encoding small CAB-like (SCP) proteins, which have been shown to be up-regulated under stress. Analyses of the promoter sequences of the scp genes revealed the existence of an NtcA binding motif in two scp genes, scpB and scpE. Binding of NtcA, the key transcriptional regulator during nitrogen stress, to the promoter regions was shown by electrophoretic mobility shift assay. The metabolite 2-oxoglutarate did not increase the affinity of NtcA for binding to the promoters of scpB and scpE. A second motif, the HIP1 palindrome 5' GGCGATCGCC 3', was detected in the upstream regions of scpB and scpC. The transcription factor encoded by sll1130 has been suggested to recognize this motif to regulate heat-responsive genes. Our data suggest that HIP1 is not a regulatory element within the scp genes. Further, the presence of the high light regulatory (HLR1) motif was confirmed in scpB-E, in accordance to their induced transcriptions in cells exposed to high light. The HLR1 motif was newly discovered in eight additional genes.
Pip, a Novel Activator of Phenazine Biosynthesis in Pseudomonas chlororaphis PCL1391▿ †
Girard, Geneviève; Barends, Sharief; Rigali, Sébastien; van Rij, E. Tjeerd; Lugtenberg, Ben J. J.; Bloemberg, Guido V.
2006-01-01
Secondary metabolites are important factors for interactions between bacteria and other organisms. Pseudomonas chlororaphis PCL1391 produces the antifungal secondary metabolite phenazine-1-carboxamide (PCN) that inhibits growth of Fusarium oxysporum f. sp. radius lycopersici the causative agent of tomato foot and root rot. Our previous work unraveled a cascade of genes regulating the PCN biosynthesis operon, phzABCDEFGH. Via a genetic screen, we identify in this study a novel TetR/AcrR regulator, named Pip (phenazine inducing protein), which is essential for PCN biosynthesis. A combination of a phenotypical characterization of a pip mutant, in trans complementation assays of various mutant strains, and electrophoretic mobility shift assays identified Pip as the fifth DNA-binding protein so far involved in regulation of PCN biosynthesis. In this regulatory pathway, Pip is positioned downstream of PsrA (Pseudomonas sigma factor regulator) and the stationary-phase sigma factor RpoS, while it is upstream of the quorum-sensing system PhzI/PhzR. These findings provide further evidence that the path leading to the expression of secondary metabolism gene clusters in Pseudomonas species is highly complex. PMID:16997957
Balani, Valério Américo; de Lima Neto, Quirino Alves; Takeda, Karen Izumi; Gimenes, Fabrícia; Fiorini, Adriana; Debatisse, Michelle; Fernandez, Maria Aparecida
2010-11-01
The aim of this work was to determine whether intrinsically bent DNA sites are present at, or close to, the mammalian replication origins oriGNAI3 and oriB in the Chinese hamster AMPD2 locus. Using an electrophoretic mobility shift assay and in silico analysis, we located four intrinsically bent DNA sites (b1 to b4) in a fragment that contains the oriGNAI3 and one site (b5) proximal to oriB. The helical parameters show that each bent DNA site is curved in a left-handed superhelical writhe. A 2D projection of 3D fragment trajectories revealed that oriGNAI3 is located in a relatively straight segment flanked by bent sites b1 and b2, which map in previously identified Scaffold/Matrix Attachment Region. Sites b3 and b4 are located approximately 2 kb downstream and force the fragment into a strong closed loop structure. The b5 site is also located in an S/MAR that is found just downstream of oriB.
Population genetic analysis of oral treponemes by multilocus enzyme electrophoresis.
Dahle, U R; Olsen, I; Tronstad, L; Caugant, D A
1995-10-01
Seventeen treponemes recently isolated from necrotic pulps, periodontal and periapical infections and 17 previously well characterized oral treponemal strains were analyzed by multilocus enzyme electrophoresis. Ten genetic loci were characterized on the basis of the electrophoretic mobilities of their enzymatic products. All loci were polymorphic. The average number of alleles per locus was 7.8. The genetic diversity among the electrophoretic types at each locus ranged from 0.624 to 0.836 with a mean genetic diversity per locus of 0.751. The 34 strains represented 34 electrophoretic types, constituting 6 main divisions (I-VI) separated at genetic distances greater than 0.75. Several of the previously characterized treponemes revealed multiple bands of enzyme activity at several loci, indicating that they were not pure. The characterized strains usually clustered within established species, whereas fresh clinical isolates overlapped species borders. There was a large genetic difference between some reference and clinical strains, indicating that the latter may contain undescribed species. Treponema socranskii and Treponema denticola strains clustered in distinct divisions (IV and V, respectively), with the exception of T. denticola strain FDC 51B2 and T. socranskii subsp. paredis strain VPI D46CPE1, both previously well described. This indicated that the taxonomic assignment of these 2 strains should be reconsidered.
Miwa, S; Ono, J; Nakashima, K; Abe, S; Kageoka, T
1976-01-01
Two new variants of glucose 6-phosphate dehydrogenase (G6PD) deficiency associated with chronic nonspherocytic hemolytic anemia were discovered in Japan. Gd(-) Tokushima was found in a 17-years-old male whose erythrocytes contained 4.4% of normal enzyme activity. Partially purified enzyme revealed a main band of normal electrophoretic mobility with additional two minor bands of different mobility; normal Km G6P, and Km NADP five-to sixfold higher than normal; normal utilization of 2-deoxy-G6P, galactose-6P, and deamino-NADP; marked thermal instability; a normal pH curve; and normal Ki NADPH. The hemolytic anemia was moderate to severe. Gd(-) Tokyo was characterized from a 15-year-old male who had chronic nonspherocytic hemolytic anemia of mild degree. The erythrocytes contained 3% of normal enzyme activity, and partially purified enzyme revealed slow electrophoretic mobility (90% of normal for both a tris-hydrochloride buffer system and a tris-EDTA-borate buffer system, and 70% of normal for a phosphate buffer system); normal Km G6P and Km NADP; normal utilization of 2-deoxy-G6P, galactose-6P, and deamino-NADP; greatly increased thermal instability; a normal pH curve; and normal Ki NADPH. These two variants are clearly different from hitherto described G6PD variants, including the Japanese variants Gd(-) Heian and Gd(-) Kyoto. The mothers of both Gd(-) Tokushima and Gd(-) Tokoyo were found to be heterozygote by an ascorbate-cyanide test.
Saban, Ricardo; Simpson, Cindy; Vadigepalli, Rajanikanth; Memet, Sylvie; Dozmorov, Igor; Saban, Marcia R
2007-01-01
Background Tachykinins (TK), such as substance P, and their neurokinin receptors which are ubiquitously expressed in the human urinary tract, represent an endogenous system regulating bladder inflammatory, immune responses, and visceral hypersensitivity. Increasing evidence correlates alterations in the TK system with urinary tract diseases such as neurogenic bladders, outflow obstruction, idiopathic detrusor instability, and interstitial cystitis. However, despite promising effects in animal models, there seems to be no published clinical study showing that NK-receptor antagonists are an effective treatment of pain in general or urinary tract disorders, such as detrusor overactivity. In order to search for therapeutic targets that could block the tachykinin system, we set forth to determine the regulatory network downstream of NK1 receptor activation. First, NK1R-dependent transcripts were determined and used to query known databases for their respective transcription regulatory elements (TREs). Methods An expression analysis was performed using urinary bladders isolated from sensitized wild type (WT) and NK1R-/- mice that were stimulated with saline, LPS, or antigen to provoke inflammation. Based on cDNA array results, NK1R-dependent genes were selected. PAINT software was used to query TRANSFAC database and to retrieve upstream TREs that were confirmed by electrophoretic mobility shift assays. Results The regulatory network of TREs driving NK1R-dependent genes presented cRel in a central position driving 22% of all genes, followed by AP-1, NF-kappaB, v-Myb, CRE-BP1/c-Jun, USF, Pax-6, Efr-1, Egr-3, and AREB6. A comparison between NK1R-dependent and NK1R-independent genes revealed Nkx-2.5 as a unique discriminator. In the presence of NK1R, Nkx2-5 _01 was significantly correlated with 36 transcripts which included several candidates for mediating bladder development (FGF) and inflammation (PAR-3, IL-1R, IL-6, α-NGF, TSP2). In the absence of NK1R, the matrix Nkx2-5_02 had a predominant participation driving 8 transcripts, which includes those involved in cancer (EYA1, Trail, HSF1, and ELK-1), smooth-to-skeletal muscle trans-differentiation, and Z01, a tight-junction protein, expression. Electrophoretic mobility shift assays confirmed that, in the mouse urinary bladder, activation of NK1R by substance P (SP) induces both NKx-2.5 and NF-kappaB translocations. Conclusion This is the first report describing a role for Nkx2.5 in the urinary tract. As Nkx2.5 is the unique discriminator of NK1R-modulated inflammation, it can be imagined that in the near future, new based therapies selective for controlling Nkx2.5 activity in the urinary tract may be used in the treatment in a number of bladder disorders. PMID:17519035
NASA Technical Reports Server (NTRS)
Todd, P.
1985-01-01
Materials and procedures for microgravity electrophoresis of living human embryonic kidney cells were evaluated, ground support in the form of analytical cell electrophoresis and flow cytometry was provided and cells returned from space flight were analyzed. Preflight culture media, electrophoresis buffer, fraction collection media, temperature profiles, and urokinase assay procedures were tested prior to flight. Electrophoretic mobility distributions of aliquots of the cell population to be fractionated in flight were obtained. The protocol established and utilized is given.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Neumann, H.; Moran, E.M.; Russell, R.M.
1974-10-11
A distinct alkaline phosphatase (phosphatase N) was demonstrated in the serum of patients with acute lymphatic leukemia, chronic lymphatic leukemia, and infectious mononucleosis. This enzyme closely resembles that extracted from the thymus of mice with lymphoma or lymphatic leukemia, both in its electrophoretic mobility and its substrate specificity. The phosphatase N activity was related to the clinical state of patients with lymphatic leukemia and disappeared with recovery from infectious mononucleosis.
Liquid and gel electrodes for transverse free flow electrophoresis
Jung, Byoungsok; Rose, Klint A; Shusteff, Maxim; Persat, Alexandre; Santiago, Juan
2015-04-07
The present invention provides a mechanism for separating or isolating charged particles under the influence of an electric field without metal electrodes being in direct contact with the sample solution. The metal electrodes normally in contact with the sample are replaced with high conductivity fluid electrodes situated parallel and adjacent to the sample. When the fluid electrodes transmit the electric field across the sample, particles within the sample migrate according to their electrophoretic mobility.
Yu, W; Sanders, B G; Kline, K
1997-01-01
RRR-alpha-tocopheryl succinate (vitamin E succinate, VES) treatment of murine EL4 T lymphoma cells induced the cells to undergo apoptosis. After 48 hours of VES treatment at 20 micrograms/ml, 95% of cells were apoptotic. Evidence for the induction of apoptosis by VES treatments is based on staining of DNA for detection of chromatin condensation/fragmentation, two-color flow-cytometric analyses of DNA content, and end-labeled DNA and electrophoretic analyses for detection of DNA ladder formation. VES-treated EL4 cells were blocked in the G1 cell cycle phase; however, apoptotic cells came from all cell cycle phases. Analyses of mRNA expression of genes involved in apoptosis revealed decreased c-myc and increased bcl-2, c-fos, and c-jun mRNAs within three to six hours after treatment. Western analyses showed increased c-Jun, c-Fos, and Bcl-2 protein levels. Electrophoretic mobility shift assays showed increased AP-1 binding at 6, 12, and 24 hours after treatment and decreased c-Myc binding after 12 and 24 hours of VES treatment. Treatments of EL4 cells with VES+RRR-alpha-to-copherol reduced apoptosis without effecting DNA synthesis arrest. Treatments of EL4 cells with VES+rac-6-hydroxyl-2, 5,7,8-tetramethyl-chroman-2-carboxylic acid, butylated hydroxytoluene, or butylated hydroxyanisole had no effect on apoptosis or DNA synthesis arrest caused by VES treatments. Analyses of bcl-2, c-myc, c-jun, and c-fos mRNA levels in cells receiving VES + RRR-alpha-tocopherol treatments showed no change from cells receiving VES treatments alone, implying that these changes are correlated with VES treatments but are not causal for apoptosis. However, treatments with VES + RRR-alpha-tocopherol decreased AP-1 binding to consensus DNA oligomer, suggesting AP-1 involvement in apoptosis induced by VES treatments.
Triazine herbicide imprinted monolithic column for capillary electrochromatography.
Aşır, Süleyman; Derazshamshir, Ali; Yılmaz, Fatma; Denizli, Adil
2015-12-01
Trietazine was selectively separated from aqueous solution containing the competitor molecule cyanazine, which is similar in size and shape to the template molecule. Structural features of the molecularly imprinted column were figured out by SEM. The influence of the mobile-phase composition, applied electrical field, and pH of the mobile phase on the recognition of trietazine by the imprinted monolithic polymer has been evaluated, and the imprint effect in the trietazine-imprinted monolithic polymer was demonstrated by an imprinting factor. The optimized monolithic column resulted in separation of trietazine from a structurally related competitor molecule, cyanazine. In addition, fast separation was obtained within 6 min by applying higher electrical field, with the electrophoretic mobility of 2.97 × 10(-8) m(2) V(-1) s(-1) at pH 11.0. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Liu, Xuyang; Chen, Gexin; Su, Chunming
2012-06-19
The deposition behavior of cerium dioxide (CeO(2)) nanoparticles (NPs) in dilute NaCl solutions was investigated as a function of collector surface composition, pH, ionic strength, and organic matter (OM). Sensors coated separately with silica, iron oxide, and alumina were applied in quartz crystal microbalance with dissipation (QCM-D) to examine the effect of these mineral phases on CeO(2) deposition in NaCl solution (1-200 mM). Frequency and dissipation shift followed the order: silica > iron oxide > alumina in 10 mM NaCl at pH 4.0. No significant deposition was observed at pH 6.0 and 8.5 on any of the tested sensors. However, ≥ 94.3% of CeO(2) NPs deposited onto Ottawa sand in columns in 10 mM NaCl at pH 6.0 and 8.5. The inconsistency in the different experimental approaches can be mainly attributed to NP aggregation, surface heterogeneity of Ottawa sand, and flow geometry. In QCM-D experiments, the deposition kinetics was found to be qualitatively consistent with the predictions based on the classical colloidal stability theory. The presence of low levels (1-6 mg/L) of Suwannee River humic acid, fulvic acid, alginate, citric acid, and carboxymethyl cellulose greatly enhanced the stability and mobility of CeO(2) NPs in 1 mM NaCl at pH 6.5. The poor correlation between the transport behavior and electrophoretic mobility of CeO(2) NPs implies that the electrosteric effect of OM was involved.
Enhanced separation of membranes during free flow zonal electrophoresis in plants.
Barkla, Bronwyn J; Vera-Estrella, Rosario; Pantoja, Omar
2007-07-15
Free flow zonal electrophoresis (FFZE) is a versatile technique that allows for the separation of cells, organelles, membranes, and proteins based on net surface charge during laminar flow through a thin aqueous layer. We have been optimizing the FFZE technique to enhance separation of plant vacuolar membranes (tonoplast) from other endomembranes to pursue a directed proteomics approach to identify novel tonoplast transporters. Addition of ATP to a mixture of endomembranes selectively enhanced electrophoretic mobility of acidic vesicular compartments during FFZE toward the positive electrode. This has been attributed to activation of the V-ATPase generating a more negative membrane potential outside the vesicles, resulting in enhanced migration of acidic vesicles, including tonoplast, to the anode (Morré, D. J.; Lawrence, J.; Safranski, K.; Hammond, T.; Morré, D. M. J. Chromatogr., A 1994, 668, 201-213). We confirm that ATP does induce a redistribution of membranes during FFZE of microsomal membranes isolated from several plant species, including Arabidopsis thaliana, Thellungiella halophila, Mesembryanthemum crystallinum, and Ananas comosus. However, we demonstrate, using V-ATPase-specific inhibitors, nonhydrolyzable ATP analogs, and ionophores to dissipate membrane potential, that the ATP-dependent migrational shift of membranes under FFZE is not due to activation of the V-ATPase. Addition of EDTA to chelate Mg2+, leading to the production of the tetravalent anionic form of ATP, resulted in a further enhancement of membrane migration toward the anode, and manipulation of cell surface charge by addition of polycations also influenced the ATP-dependent migration of membranes. We propose that ATP enhances the mobility of endomembranes by screening positive surface charges on the membrane surface.
González-Ruiz, Víctor; Gagnebin, Yoric; Drouin, Nicolas; Codesido, Santiago; Rudaz, Serge; Schappler, Julie
2018-05-01
The use of capillary electrophoresis coupled to mass spectrometry (CE-MS) in metabolomics remains an oddity compared to the widely adopted use of liquid chromatography. This technique is traditionally regarded as lacking the reproducibility to adequately identify metabolites by their migration times. The major reason is the variability of the velocity of the background electrolyte, mainly coming from shifts in the magnitude of the electroosmotic flow and from the suction caused by electrospray interfaces. The use of the effective electrophoretic mobility is one solution to overcome this issue as it is a characteristic feature of each compound. To date, such an approach has not been applied to metabolomics due to the complexity and size of CE-MS data obtained in such studies. In this paper, ROMANCE (RObust Metabolomic Analysis with Normalized CE) is introduced as a new software for CE-MS-based metabolomics. It allows the automated conversion of batches of CE-MS files with minimal user intervention. ROMANCE converts the x-axis of each MS file from the time into the effective mobility scale and the resulting files are already pseudo-aligned, present normalized peak areas and improved reproducibility, and can eventually follow existing metabolomic workflows. The software was developed in Scala, so it is multi-platform and computationally-efficient. It is available for download under a CC license. In this work, the versatility of ROMANCE was demonstrated by using data obtained in the same and in different laboratories, as well as its application to the analysis of human plasma samples. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Vertical ascending electrophoresis of cells with a minimal stabilizing medium
NASA Technical Reports Server (NTRS)
Omenyi, S. N.; Snyder, R. S.
1983-01-01
Vertical fractionation of a mixture of fixed horse and human red blood cells layered over a stabilizing support medium was done to give a valid comparison with proposed space experiments. In particular, the effects of sample thickness and concentration on zone migration rate were investigated. Electrophoretic mobilities of horse and human cells calculated from zone migration rates were compatible with those obtained by microelectrophoresis. Complete cell separation was observed when low power and effective cooling were employed.
The surface charge of trypanosomatids.
Souto-Padrón, Thaïs
2002-12-01
The surface charge of trypanosomatids was evaluated by means of the binding of cationic particles, as visualized by electron microscopy and by direct measurements of the electrophoretic mobility of cells. The results obtained indicate that most of the trypanosomatids exhibit a negatively charged surface whose value is species specific and varies according to the developmental stages. Sialic acids associated with glycoproteins, glycolipids and phosphate groups are the major components responsible for the net negative surface charge of the trypanosomatids.
Recombinant albumin monolayers on latex particles.
Sofińska, Kamila; Adamczyk, Zbigniew; Kujda, Marta; Nattich-Rak, Małgorzata
2014-01-14
The adsorption of recombinant human serum albumin (rHSA) on negatively charged polystyrene latex micro-particles was studied at pH 3.5 and the NaCl concentration range of 10(-3) to 0.15 M. The electrophoretic mobility of latex monotonically increased with the albumin concentration in the suspension. The coverage of adsorbed albumin was quantitatively determined using the depletion method, where the residual protein concentration was determined by electrokinetic measurements and AFM imaging. It was shown that albumin adsorption was irreversible. Its maximum coverage on latex varied between 0.7 mg m(-2) for 10(-3) M NaCl to 1.3 mg m(-2) for 0.15 M NaCl. The latter value matches the maximum coverage previously determined for human serum albumin on mica using the streaming potential method. The increase in the maximum coverage was interpreted in terms of reduced electrostatic repulsion among adsorbed molecules. These facts confirm that albumin adsorption at pH 3.5 is governed by electrostatic interactions and proceeds analogously to colloid particle deposition. The stability of albumin monolayers was measured in additional experiments where changes in the latex electrophoretic mobility and the concentration of free albumin in solutions were monitored over prolonged time periods. Based on these experimental data, a robust procedure of preparing albumin monolayers on latex particles of well-controlled coverage and molecule distribution was proposed.
Batz, Nicholas G; Mellors, J Scott; Alarie, Jean Pierre; Ramsey, J Michael
2014-04-01
We describe a chemical vapor deposition (CVD) method for the surface modification of glass microfluidic devices designed to perform electrophoretic separations of cationic species. The microfluidic channel surfaces were modified using aminopropyl silane reagents. Coating homogeneity was inferred by precise measurement of the separation efficiency and electroosmotic mobility for multiple microfluidic devices. Devices coated with (3-aminopropyl)di-isopropylethoxysilane (APDIPES) yielded near diffusion-limited separations and exhibited little change in electroosmotic mobility between pH 2.8 and pH 7.5. We further evaluated the temporal stability of both APDIPES and (3-aminopropyl)triethoxysilane (APTES) coatings when stored for a total of 1 week under vacuum at 4 °C or filled with pH 2.8 background electrolyte at room temperature. Measurements of electroosmotic flow (EOF) and separation efficiency during this time confirmed that both coatings were stable under both conditions. Microfluidic devices with a 23 cm long, serpentine electrophoretic separation channel and integrated nanoelectrospray ionization emitter were CVD coated with APDIPES and used for capillary electrophoresis (CE)-electrospray ionization (ESI)-mass spectrometry (MS) of peptides and proteins. Peptide separations were fast and highly efficient, yielding theoretical plate counts over 600,000 and a peak capacity of 64 in less than 90 s. Intact protein separations using these devices yielded Gaussian peak profiles with separation efficiencies between 100,000 and 400,000 theoretical plates.
Quantification of Cysteinyl-S-Nitrosylation by Fluorescence in Unbiased Proteomic Studies*
Wiktorowicz, John E.; Stafford, Susan; Rea, Harriet; Urvil, Petri; Soman, Kizhake; Kurosky, Alexander; Perez-Polo, J. Regino; Savidge, Tor C.
2011-01-01
Cysteinyl-S-nitrosylation has emerged as an important post-translational modification affecting protein function in health and disease. Great emphasis has been placed on global, unbiased quantification of S-nitrosylated proteins due to physiologic and oxidative stimuli. However, current strategies have been hampered by sample loss and altered protein electrophoretic mobility. Here, we describe a novel quantitative approach that combines accurate, sensitive fluorescence modification of cysteine S-nitrosylation that leaves electrophoretic mobility unaffected (SNOFlo), and introduce unique concepts for measuring changes in S-nitrosylation status relative to protein abundance. Its efficacy in defining the functional S-nitrosoproteome is demonstrated in two diverse biological applications: an in vivo rat hypoxia-ischemia reperfusion model, and antimicrobial S-nitrosoglutathione-driven transnitrosylation of an enteric microbial pathogen. The suitability of this approach for investigating endogenous S-nitrosylation is further demonstrated using Ingenuity Pathways analysis that identified nervous system and cellular development networks as the top two networks. Functional analysis of differentially S-nitrosylated proteins indicated their involvement in apoptosis, branching morphogenesis of axons, cortical neurons, and sympathetic neurites, neurogenesis, and calcium signaling. Major abundance changes were also observed for fibrillar proteins known to be stress-responsive in neurons and glia. Thus, both examples demonstrate the technique’s power in confirming the widespread involvement of S-nitrosylation in hypoxia-ischemia/reperfusion injury and in antimicrobial host responses. PMID:21615140
Leach, S D; Modlin, I M; Scheele, G A; Gorelick, F S
1991-01-01
The mechanism by which digestive zymogens become activated during acute pancreatitis remains poorly understood. Given the ability for cholecystokinin (CCK) to induce pancreatitis in vivo, the effects of high dose CCK on preparations of isolated pancreatic acini were examined. Using an immunologic technique for the detection of zymogen activation, CCK was found to stimulate the conversion of procarboxypeptidase A1 to a 35-kD form having the same net charge and electrophoretic mobility as purified recombinant carboxypeptidase A1. This enhanced conversion was proportional to the dose of CCK (maximal at 100 nM), and time dependent. CCK also produced changes in the electrophoretic mobility of procarboxypeptidase B and chymotrypsinogen 2 immunoreactivity, consistent with activation of these zymogens. These events were detectable only within acinar cell pellets and not in the incubation medium, suggesting an intracellular site of conversion. The conversion of procarboxypeptidase A1 to its active form was inhibited by pretreatment with the weak base chloroquine (40 microM) and the protonophore monensin (10 microM). This conversion was also inhibited by pretreatment with the serine protease inhibitor benzamidine (10 mM) but not the cysteine protease inhibitor E64 (100 microM). The results suggest that high dose CCK stimulates the intracellular activation of digestive zymogens within isolated pancreatic acini. This event appears to require an acidic subcellular compartment and serine protease activity. Images PMID:1985109
Gondikas, Andreas; von der Kammer, Frank; Hofmann, Thilo; Marchetti-Deschmann, Martina; Allmaier, Günter; Marko-Varga, György; Andersson, Roland
2017-01-01
For drug delivery, characterization of liposomes regarding size, particle number concentrations, occurrence of low-sized liposome artefacts and drug encapsulation are of importance to understand their pharmacodynamic properties. In our study, we aimed to demonstrate the applicability of nano Electrospray Gas-Phase Electrophoretic Mobility Molecular Analyser (nES GEMMA) as a suitable technique for analyzing these parameters. We measured number-based particle concentrations, identified differences in size between nominally identical liposomal samples, and detected the presence of low-diameter material which yielded bimodal particle size distributions. Subsequently, we compared these findings to dynamic light scattering (DLS) data and results from light scattering experiments coupled to Asymmetric Flow-Field Flow Fractionation (AF4), the latter improving the detectability of smaller particles in polydisperse samples due to a size separation step prior detection. However, the bimodal size distribution could not be detected due to method inherent limitations. In contrast, cryo transmission electron microscopy corroborated nES GEMMA results. Hence, gas-phase electrophoresis proved to be a versatile tool for liposome characterization as it could analyze both vesicle size and size distribution. Finally, a correlation of nES GEMMA results with cell viability experiments was carried out to demonstrate the importance of liposome batch-to-batch control as low-sized sample components possibly impact cell viability. PMID:27639623
Mathematical models of continuous flow electrophoresis: Electrophoresis technology
NASA Technical Reports Server (NTRS)
Saville, Dudley A.
1986-01-01
Two aspects of continuous flow electrophoresis were studied: (1) the structure of the flow field in continuous flow devices; and (2) the electrokinetic properties of suspended particles relevant to electrophoretic separations. Mathematical models were developed to describe flow structure and stability, with particular emphasis on effects due to buoyancy. To describe the fractionation of an arbitrary particulate sample by continuous flow electrophoresis, a general mathematical model was constructed. In this model, chamber dimensions, field strength, buffer composition, and other design variables can be altered at will to study their effects on resolution and throughput. All these mathematical models were implemented on a digital computer and the codes are available for general use. Experimental and theoretical work with particulate samples probed how particle mobility is related to buffer composition. It was found that ions on the surface of small particles are mobile, contrary to the widely accepted view. This influences particle mobility and suspension conductivity. A novel technique was used to measure the mobility of particles in concentrated suspensions.
Nowak, Paweł Mateusz; Woźniakiewicz, Michał; Mitoraj, Mariusz; Sagan, Filip; Kościelniak, Paweł
2018-03-02
Capillary electrophoresis is often used to the determination of the acid-base dissociation/deprotonation constant (pK a ), and the more advanced thermodynamic quantities describing this process (ΔH°, -TΔS°). Remarkably, it is commonly overlooked that due to insufficient dissipation of Joule heating the accuracy of parameters determined using a standard approach may be questionable. In this work we show an effective method allowing to enhance reliability of these parameters, and to estimate the magnitude of errors. It relies on finding a relationship between electrophoretic mobility and actual temperature, and performing pK a determination with the corrected mobility values. It has been employed to accurately examine the thermodynamics of acid-base dissociation of several amine compounds - known for their strong dependency of pK a on temperature: six cathinones (2-methylmethcathinone, 3-methylmethcathinone, 4-methylmethcathinone, α-pyrrolidinovalerophenone, methylenedioxypyrovalerone, and ephedrone); and structurally similar 1-phenylethylamine. The average pK a error caused by Joule heating noted at 25 °C was relatively small - 0.04-0.05 pH unit, however, a more significant inaccuracy was observed in the enthalpic and, in particular, entropic terms. An alternative correction method has also been proposed, simpler and faster, but not such effective in correcting ΔH°/-TΔS° terms. The corrected thermodynamic data have been interpreted with the aid of theoretical calculations, on a ground of the enthalpy-entropy relationships and the most probable structural effects accounting for them. Finally, we have demonstrated that the thermal dependencies of electrophoretic mobility, modelled during the correction procedure, may be directly used to find optimal temperature providing a maximal separation efficiency. Copyright © 2018 Elsevier B.V. All rights reserved.
Chemical and immunochemical characterization of caseins and the major whey proteins of rabbit milk.
Dayal, R; Hurlimann, J; Suard, Y M; Kraehenbuhl, J P
1982-01-01
Caseins were separated from whey proteins by acid precipitation of skimmed rabbit milk. Whole casein was resolved by sodium dodecyl sulphate/polyacrylamide-gel electrophoresis into three major bands with apparent relative molecular masses (Mr of 31 000, 29 000 and 25 000. On agarose/urea-gel electrophoresis whole casein gave three bands with electrophoretic mobilities alpha, beta and gamma. The three components were purified by DEAE-cellulose chromatography under denaturing and reducing conditions. Each was shown to have a different amino acid, hexose and phosphorus content, as well as non-identical peptide fragments after proteinase digestion. The 31 000 Da (dalton) protein, of alpha-electrophoretic mobility, had a high phosphorus content (4.38%, w/w); the 29 000 Da peptide, of gamma-mobility, had the highest hexose content (2.2%, w/w), contained 0.8 cysteine residue per 100 amino acid residues and was susceptible to chymosin digestion corresponding thus to kappa-casein; the 25 000 Da protein migrated to the beta-position. The rabbit casein complex is composed of at least three caseins, two of which (alpha- and kappa-caseins) are analogous to the caseins from ruminants. Although caseins are poor immunogens, specific antibodies were raised against total and purified polypeptides. The antiserum directed against whole casein recognized each polypeptide, each casein corresponding to a distinct precipitation line. The antisera directed against each casein polypeptide reacted exclusively with the corresponding casein and no antiserum cross-reaction occurred between the three polypeptides. From whey, several proteins were isolated, characterized and used as antigens to raise specific antibodies. An iron-binding protein with an apparent Mr of 80 000 was shown to be immunologically and structurally identical with serum transferrin. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:6177316
Analysis of results of ASTP experiment in electrophoresis
NASA Technical Reports Server (NTRS)
Vanderhoff, J. W.; Micale, F. J.; Krumrine, P. H.
1977-01-01
The Apollo-Soyuz Test Project (ASTP) included an electrophoretic separation experiment of biological cells. The nature separation results of aldehyde-fixed rabbit, human and horse red blood cells, which were taken in the form of photographs taken at three-minute intervals, are the subject of this report. The electrophoretic separation was successful in that fractionation according to mobility did occur and was found in the sliced samples. Photographic evidence indicates that the low electroosmotic methylcellulose coating was successful in reducing the electroosmosis to a near zero value. Also, the flight film shows that the bands migrated down the column as theory would predict, producing two bands of high cell concentration separated and surrounded by regions of lower cell concentration. However, most likely some clumping of cells occurred to cause the trailing band to be larger than expected from theory. Overall, the experiment was a success in demonstrating a static electrophoresis separation under microgravity conditions with a resolution not possible on earth.
Erol, Özge Ö; Erdoğan, Behice Y; Onar, Atiye N
2017-03-01
Simultaneous determination of nitrate and nitrite in gunshot residue has been conducted by capillary electrophoresis using an acidic run buffer (pH 3.5). In previously developed capillary electrophoretic methods, alkaline pH separation buffers were used where nitrite and nitrate possess similar electrophoretic mobility. In this study, the electroosmotic flow has been reversed by using low pH running buffer without any additives. As a result of reversing the electroosmotic flow, very fast analysis has been actualized, well-defined and separated ion peaks emerge in less than 4 min. Besides, the limit of detection was improved by employing large volume sample stacking. Limit of detection values were 6.7 and 4.3 μM for nitrate and nitrite, respectively. In traditional procedure, mechanical agitation is employed for extraction, while in this work the extraction efficiency of ultrasound mixing for 30 min was found sufficient. The proposed method was successfully applied to authentic gunshot residue samples. © 2016 American Academy of Forensic Sciences.
Shashoua, V E; Nolan, P M; Shea, T B; Milinazzo, B
1992-06-01
Northern blot, immunoprecipitation, and gel electrophoretic data demonstrate that the mouse neuroblastoma NB2a/d1 cells express ependymin mRNA and synthesize and release into the culture medium a protein with immunoreactivity and electrophoretic mobility properties identical to ependymin. This is a brain extracellular glycoprotein that has been implicated in the consolidation process of memory formation and neuronal regeneration. In labeling experiments with 35S-methionine, dibutyrylcyclic3',5'-adenosine-monophosphate (dbcAMP) was found to stimulate the expression of ependymin mRNA and the enhanced synthesis and release of ependymin into the culture medium at the same time that dbcAMP stimulation of neurite outgrowth takes place. These results are consistent with the proposed role of the protein in the mechanism of neuronal regeneration and synaptogenesis. The data indicate that the NB2a/d1 cell line is a good model system for studies of the functional properties of ependymin.
Loxdale, H D; Rhodes, J A; Fox, J S
1985-07-01
A study of variation in three peptidases (PEP-3 to -5) in a parthenogenetic S. avenae field population at Rothamsted using serial one-dimensional polyacrylamide gel electrophoresis (involving changes of gel concentration and electrophoretic run-time) increased the overall number of "allozymes" (mobility variants) detected from 10 under standard conditions (6% gels, 2 h run-time) to 22, as well as revealing putative heterozygous banding patterns under some test conditions. However, an examination of another enzyme, 6-phosphogluconate dehydrogenase (6-PGD) in a sample collected at Rothamsted the following year failed, using a combination of serial methods (changes of gel concentration) and isoelectric focusing, to increase the total number of 6-PGD bands separated (seven, none of which appeared to be allelic in origin). Nevertheless, some major bands were split into several bands, whilst other infrequent bands were either gained or lost. The findings are briefly discussed.
Womack, J E; Cramer, D V
1980-10-01
Starch gel electrophoresis and histochemical staining with L-leucyl-L-tyrosine have revealed genetic variation for dipeptidase in Rattus norvegicus. The tissue distribution, substrate specificity, and heterozygous expression as a monmeric protein suggest homology of the variant peptidase to human PEP-C and mouse Pep-3 (Dip-1). We propose Peptidase-3 (Pep-3) as a name for this autosomal locus in the rat. The allele responsible for slower (less anodal) electrophoretic migration is designated Pep-3a and is characteristic of strain ACI/Pit. A faster (more anodal) electrophoretic mobility is the product of the Pep-3b allele in strain F344/Pit. Twenty-five additional inbred strains carry Pep-3a and 16 others carry Pep-3b. Wild rats trapped in Pittsburgh were polymorphic for this locus. Alleles at Pep-3 segregated independently of c (linkage group I), a (linkage group IV), RT2 and Es-1 (linkage group V), h (linkage group VI), and RTI (linkage group VIII).
Purification and protein composition of endogenous rat viruses.
Hlubinová, K; Prachar, J; Vrbenská, A; Matoska, J; Simkovic, D
1984-01-01
Endogenous retroviruses are not in the majority of cases the cause of any neoplasia, except for the laboratory conditions. As far as they might serve for the evolution of pathogenic retroviruses more attention should have been paid to them. In this paper we introduce some approaches to the purification of rat endogenous retroviruses to such a degree of purity that enabled satisfactory SDS-PAGE analysis of its structural proteins. Purities of samples obtained by usual purification methods, long-term isopycnic centrifugation at a high gravity force and velocity centrifugation are compared. Protein profile of rat endogenous virus in SDS-PAGE is compared with the ones of other retroviruses. For the first time the evidence was obtained for the striking similarity between electrophoretic protein profile of rat endogenous virus WERC and feline leukemia virus. The major structural proteins of rat endogenous retrovirus and feline leukemia virus cannot be distinguished even when resolution long gradient PAGE had been employed. The accordance of electrophoretic mobilities of major structural proteins in SDS-PAGE can indicate the relatedness of retroviruses.
Kenndler, Ernst
2014-03-28
This two-part review critically gives an overview on the theoretical and practical advances in non-aqueous capillary electrophoresis (NACE) achieved over the recent five years. Part I starts out by reviewing the aspects relevant to electromigration in organic solvents and evaluates potential advantages of the latter in comparison to aqueous solvent systems. The crucial role of solubility for the species involved in CE - analytes and back ground electrolyte constituents - is discussed both for ionic and neutral compounds. The impact of organic solvents on the electrophoretic and electroosmotic mobility and on the ionization (pKa values) of weak acids and bases is highlighted. Special emphasis is placed on methanol, acetonitrile and mixtures of these solvents, being the most frequent employed media for NACE applications. In addition, also solvents less commonly used in NACE will be covered, including other alcohols, amides (formamide, N-methylformamide, N,N-dimethylformamide, N,N-dimethylacetamide), propylene carbonate, dimethylsulphoxide, and nitromethane. The discussions address the consequences of dramatic pKa shifts frequently seen for weak acids and bases, and the important contributions of medium-specific electroosmotic flow (EOF) to electromigration in nonaqueous media. Important for NACE, the role of the water content on pKa and mobility is analyzed. Finally, association phenomena rather specific to nonaqueous solvents (ion pairing, homo- and heteroconjugation) will be addressed, along with their potential advantages for the development of NACE separation protocols. It is pointed out that this review is not intended as a listing of all papers that have been published on NACE in the period mentioned above. It rather deals with general aspects of migration and selectivity in organic solvent systems, and discusses - critically - examples from the literature with particular interest to the topic. An analog discussion about the role of the solvent on efficiency will be presented in Part II. Copyright © 2014 Elsevier B.V. All rights reserved.
Lee, Jin; Lim, Kye-Taek
2011-08-01
Di(2-ethylhexyl)phthalate (DEHP) is one of the many environmental chemicals that are widely used in polyvinyl chloride products, vinyl flooring, food packaging and infant toys. They cause cell proliferation or dysfunction of human liver. The purpose of this study is to investigate the inhibitory effect of a glycoprotein (24 kDa) isolated from Zanthoxylum piperitum DC (ZPDC) on proliferation of liver cell in the DEHP-induced BNL CL. 2 cells. [³H]-thymidine incorporation, intracellular reactive oxygen species (ROS), intracellular Ca²⁺ mobilization and activity of protein kinase C (PKC) were measured using radioactivity and fluorescence method respectively. The expression of mitogen-activated protein kinases [extracellular signal-regulated kinase (ERK) and c-Jun N-terminal kinase (JNK)], activator protein (AP)-1 (c-Jun and c-Fos), proliferating cell nuclear antigen (PCNA) and cell cycle-related factors (cyclin D1/cyclin-dependent kinase [CDK] 4) were evaluated using Western blotting or electrophoretic mobility shift assay. The results in this study showed that the levels of [³H]-thymidine incorporation, intracellular ROS, intracellular Ca²⁺ mobilization and activity of PKCα were inhibited by ZPDC glycoprotein (100 µg/ml) in the DEHP-induced BNL CL. 2 cells. Also, activities of ERK, JNK and AP-1 were reduced by ZPDC glycoprotein (100 µg/ml). With regard to cell proliferation, activities of PCNA and cyclin D1/CDK4 were significantly suppressed at treatment with ZPDC glycoprotein (100 µg/ml) in the presence of DEHP. Taken together, these findings suggest that ZPDC glycoprotein significantly normalized activities of PCNA and cyclin D1/CDK4, which relate to cell proliferation factors. Thus, ZPDC glycoprotein appears to be one of the compounds derived from natural products that are able to inhibit cell proliferation in the phthalate-induced BNL CL. 2 cells. Copyright © 2011 John Wiley & Sons, Ltd.
Zeng, Nina; D'Souza, Randall F; Mitchell, Cameron J; Cameron-Smith, David
2018-05-08
A gradual loss of skeletal muscle mass is a common feature of aging, leading to impaired insulin sensitivity and mobility. Sestrin1, 2, 3 are multifunctional proteins that regulate the mammalian target of rapamycin complex (mTORC1), autophagy and redox homeostasis. It is unclear how aging affects Sestrins and their downstream targets in human, therefore this study examined the basal expression of Sestrins in three age groups, young, middle-aged and older men and explored the mTORC1 pathway, autophagy markers and antioxidant regulation. Older men had less Sestrin1 and 3 protein and a different pattern of Sestrin2 electrophoretic mobility. The mRNA expression of SESN1 was highly upregulated in older men, but the discrepancy was not by microRNA expression. Although protein expressions of Sestrins were downregulated with aging, phosphorylation of AMP-dependent protein kinase (AMPKα Thr172 ) and read-outs of mTORC1 activation, ribosomal protein S6 kinase 1 (p70S6K1 Thr421/Ser424 ) and 4E-binding protein 1 (4E-BP1) mobility shift were unaltered. However, total p70S6K1 and 4E-BP1 were reduced in middle-age and older men. The mRNA expressions of autophagic markers including microtubule-associated protein 1 light chain 3 (LC3) and BCL2 interacting protein 3 (BNIP3) were upregulated in middle-age and older men. Although nuclear factor (erythroid-derived 2)-like 2 (Nrf2) was upregulated in older men, the protein and mRNA expressions of its downstream antioxidants were either increased, decreased or unaltered. No clear relationship was observed between Sestrins and their downstream targets, yet it can be concluded that Sestrins proteins are clearly downregulated with aging. Copyright © 2017. Published by Elsevier Inc.
Hoffmann, W.; Kaufmann, R.; Steiner, R.; Werner, W.
1981-01-01
Determination of the electrophoretic mobility of test cells has been widely used in an attempt to detect so-called lymphokines in a laboratory test for cancer, but operational difficulties are inherent in conventional cytopherometers. This study therefore investigates the technical and operational aspects of cell electrophoresis, using the Zeiss cytopherometer; e.g. influence of electro-osmosis, focus uncertainty, movement due to convection and other sources of error. Implications and possible improvements in the test are discussed. PMID:7248145
Biochemical identification of the mallard, Anas platyrhynchos, and black duck, A. rubripes
Morgan, R.P.; Noe, L.A.; Henny, C.J.
1976-01-01
1. Eleven tissue systems from mallards and black ducks were examined for soluble proteins, lactate dehydrogenases and non-specific esterases through discontinuous polyacrylamide techniques.2. Biochemical relationships between the black duck and mallard are extremely similar.3. Hemoglobins and lactate dehydrogenase appear to be common in electrophoretic mobility between the two species.4. Approximately 89% of the soluble proteins and 58% of the non-specific esterases are common among the two species, indicating both biochemical similarity at the genus level and species-specificity.
1993-01-01
One Colonized and Several Field Populations of Phlebotomus papatasi (Diptera: Psychodidae) HALA A. KASSEM ,1. 2 DAVID J. FRYAUFF,1., MAGDI G, SHEHATA...were found to erations, and that selection for refractoriness to have atypical genitalia ( Kassem et al. 1988), and infection is associated with a shift... females and has been main- tained for 34 successive generations using the allndt(96) SINAI methods described by Schmid(16) Electrophoretic Techniques
Structural and biophysical properties of h-FANCI ARM repeat protein.
Siddiqui, Mohd Quadir; Choudhary, Rajan Kumar; Thapa, Pankaj; Kulkarni, Neha; Rajpurohit, Yogendra S; Misra, Hari S; Gadewal, Nikhil; Kumar, Satish; Hasan, Syed K; Varma, Ashok K
2017-11-01
Fanconi anemia complementation groups - I (FANCI) protein facilitates DNA ICL (Inter-Cross-link) repair and plays a crucial role in genomic integrity. FANCI is a 1328 amino acids protein which contains armadillo (ARM) repeats and EDGE motif at the C-terminus. ARM repeats are functionally diverse and evolutionarily conserved domain that plays a pivotal role in protein-protein and protein-DNA interactions. Considering the importance of ARM repeats, we have explored comprehensive in silico and in vitro approach to examine folding pattern. Size exclusion chromatography, dynamic light scattering (DLS) and glutaraldehyde crosslinking studies suggest that FANCI ARM repeat exist as monomer as well as in oligomeric forms. Circular dichroism (CD) and fluorescence spectroscopy results demonstrate that protein has predominantly α- helices and well-folded tertiary structure. DNA binding was analysed using electrophoretic mobility shift assay by autoradiography. Temperature-dependent CD, Fluorescence spectroscopy and DLS studies concluded that protein unfolds and start forming oligomer from 30°C. The existence of stable portion within FANCI ARM repeat was examined using limited proteolysis and mass spectrometry. The normal mode analysis, molecular dynamics and principal component analysis demonstrated that helix-turn-helix (HTH) motif present in ARM repeat is highly dynamic and has anti-correlated motion. Furthermore, FANCI ARM repeat has HTH structural motif which binds to double-stranded DNA.
Salomäki, T; Karonen, T; Siljamäki, P; Savijoki, K; Nyman, T A; Varmanen, P; Iivanainen, A
2015-01-01
The environmental pathogen Streptococcus uberis causes intramammary infections in dairy cows. Because biofilm growth might contribute to Strep. uberis mastitis, we conducted a biological screen to identify genes potentially involved in the regulation of biofilm growth. By screening a transposon mutant library of Strep. uberis, we determined that the disruption of 13 genes (including hasA, coaC, clpP, miaA, nox and uidA) led to increased biofilm formation. One of the genes (SUB1382) encoded a homologue of the LiaR response regulator (RR) of the Bacillus subtilis two-component signalling system (TCS). Electrophoretic mobility shift assays revealed that DNA binding by LiaR was greatly enhanced by phosphorylation. Two-dimensional differential in-gel electrophoresis analyses of the liaR mutant and the parental Strep. uberis strain revealed five differentially produced proteins with at least a 1·5-fold change in relative abundance (P < 0·05). The DNA-binding protein LiaR is a potential regulator of biofilm formation by Strep. uberis. Several molecular primary and downstream targets involved in biofilm formation by Strep. uberis were identified. This provides a solid foundation for further studies on the regulation of biofilm formation in this important pathogen. © 2014 The Society for Applied Microbiology.
Ekenäs, Catarina; Zebrowska, Anna; Schuler, Barbara; Vrede, Tobias; Andreasen, Katarina; Backlund, Anders; Merfort, Irmgard; Bohlin, Lars
2008-12-01
Several species in the genus Arnica have been used in traditional medicine to treat inflammatory-related disorders. Extracts of twelve Arnica species and two species closely related to arnica ( Layia hieracioides and Madia sativa) were investigated for inhibition of human neutrophil elastase release and inhibition of transcription factor NF-kappaB. Statistical analyses reveal significant differences in inhibitory capacities between extracts. Sesquiterpene lactones of the helenanolide type, of which some are known inhibitors of human neutrophil elastase release and NF-kappaB, are present in large amounts in the very active extracts of A. montana and A. chamissonis. Furthermore, A. longifolia, which has previously not been investigated, shows a high activity similar to that of A. montana and A. chamissonis in both bioassays. Sesquiterpene lactones of the xanthalongin type are present in large amounts in A. longifolia and other active extracts and would be interesting to evaluate further. COX-2:cyclooxygenase 2 EMSA:electrophoretic mobility shift assay fMLP: N-formyl-methionyl-leucyl-phenylalanine HaCaT:human keratinocyte HNE:human neutrophil elastase IkappaB:inhibitory subunit of kappaB iNOS:inducible nitric oxide synthase NF-kappaB:nuclear factor kappaB PAF:platelet activating factor STL:sesquiterpene lactone TNF-alpha:tumor necrosis factor alpha.
Scholz, Anica; Stahl, Julia; de Berardinis, Veronique; Müller, Volker; Averhoff, Beate
2016-04-01
Acinetobacter baylyi, a ubiquitous soil bacterium, can cope with high salinity by uptake of choline as precursor of the compatible solute glycine betaine. Here, we report on the identification of a choline dehydrogenase (BetA) and a glycine betaine aldehyde dehydrogenase (BetB) mediating the oxidation of choline to glycine betaine. The betAB genes were found to form an operon together with the potential transcriptional regulator betI. The transcription of the betIBA operon and the two recently identified choline transporters was upregulated in response to choline and choline plus salt. The finding that the osmo-independent transporter BetT1 undergoes a higher upregulation in response to choline alone than betT2 suggests that BetT1 does not primarily function in osmoadaptation. Electrophoretic mobility shift assays led to the conclusion that BetI mediates transcriptional regulation of both, the betIBA gene operon and the choline transporters. BetI was released from the DNA in response to choline which together with the transcriptional upregulation of the bet genes in the presence of choline suggests that BetI is a choline sensing transcriptional repressor. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.
Bond, Thomas E H; Sorenson, Alanna E; Schaeffer, Patrick M
2017-06-01
Burkholderia pseudomallei (Bp) is the causative agent of melioidosis. The bacterium is responsible for 20% of community-acquired sepsis cases and 40% of sepsis-related mortalities in northeast Thailand, and is intrinsically resistant to aminoglycosides, macrolides, rifamycins, cephalosporins, and nonureidopenicillins. There is no vaccine and its diagnosis is problematic. Biotin protein ligase (BirA) which is essential for fatty acid synthesis has been proposed as a drug target in bacteria. Very few bacterial BirA have been characterized, and a better understanding of these enzymes is necessary to further assess their value as drug targets. BirA within the Burkholderia genus have not yet been investigated. We present for the first time the cloning, expression, purification and functional characterisation of the putative Bp BirA and orthologous B. thailandensis (Bt) biotin carboxyl carrier protein (BCCP) substrate. A GFP-tagged Bp BirA was produced and applied for the development of a high-throughput (HT) assay based on our differential scanning fluorimetry of GFP-tagged proteins (DSF-GTP) principle as well as an electrophoretic mobility shift assay. Our biochemical data in combination with the new HT DSF-GTP and biotinylation activity assay could facilitate future drug screening efforts against this drug-resistant organism. Copyright © 2017 Elsevier GmbH. All rights reserved.
AUXIN RESPONSE FACTOR17 Is Essential for Pollen Wall Pattern Formation in Arabidopsis1[C][W][OA
Yang, Jun; Tian, Lei; Sun, Ming-Xi; Huang, Xue-Yong; Zhu, Jun; Guan, Yue-Feng; Jia, Qi-Shi; Yang, Zhong-Nan
2013-01-01
In angiosperms, pollen wall pattern formation is determined by primexine deposition on the microspores. Here, we show that AUXIN RESPONSE FACTOR17 (ARF17) is essential for primexine formation and pollen development in Arabidopsis (Arabidopsis thaliana). The arf17 mutant exhibited a male-sterile phenotype with normal vegetative growth. ARF17 was expressed in microsporocytes and microgametophytes from meiosis to the bicellular microspore stage. Transmission electron microscopy analysis showed that primexine was absent in the arf17 mutant, which leads to pollen wall-patterning defects and pollen degradation. Callose deposition was also significantly reduced in the arf17 mutant, and the expression of CALLOSE SYNTHASE5 (CalS5), the major gene for callose biosynthesis, was approximately 10% that of the wild type. Chromatin immunoprecipitation and electrophoretic mobility shift assays showed that ARF17 can directly bind to the CalS5 promoter. As indicated by the expression of DR5-driven green fluorescent protein, which is an synthetic auxin response reporter, auxin signaling appeared to be specifically impaired in arf17 anthers. Taken together, our results suggest that ARF17 is essential for pollen wall patterning in Arabidopsis by modulating primexine formation at least partially through direct regulation of CalS5 gene expression. PMID:23580594
Woo, Kyung Jin; Kwon, Taeg Kyu
2007-12-15
Sulforaphane is a natural, biologically active compound extracted from cruciferous vegetables such as broccoli and cabbage. It possesses potent anti-inflammation and anti-cancer properties. The mechanism by which sulforaphane suppresses COX-2 expression remains poorly understood. In the present report, we investigated the effect of sulforaphane on the expression of COX-2 in lipopolysaccharide (LPS)-activated Raw 264.7 cells. Sulforaphane significantly suppressed the LPS-induced COX-2 protein and mRNA expression in a dose-dependent manner. The ability of sulforaphane to suppress the expression of the COX-2 was investigated using luciferase reporters controlled by various cis-elements in COX-2 promoter region. Electrophoretic mobility shift assay (EMSA) verified that NF-kappaB, C/EBP, CREB and AP-1 were identified as responsible for the sulforaphane-mediated COX-2 down-regulation. In addition, we demonstrated the signal transduction pathway of mitogen-activated protein kinase (MAP kinase) in LPS-induced COX-2 expression. Taken together, these results demonstrate that sulforaphane effectively suppressed the LPS-induced COX-2 protein via modulation of multiple core promoter elements (NF-kappaB, C/EBP, CREB and AP-1) in the COX-2 transcriptional regulation. These results will provide new insights into the anti-inflammatory and anti-carcinogenic properties of sulforaphane.
Yaghi, Layale; Poras, Isabelle; Simoes, Renata T; Donadi, Eduardo A; Tost, Jörg; Daunay, Antoine; de Almeida, Bibiana Sgorla; Carosella, Edgardo D; Moreau, Philippe
2016-09-27
HLA-G is an immune checkpoint molecule with specific relevance in cancer immunotherapy. It was first identified in cytotrophoblasts, protecting the fetus from maternal rejection. HLA-G tissue expression is very restricted but induced in numerous malignant tumors such as glioblastoma, contributing to their immune escape. Hypoxia occurs during placenta and tumor development and was shown to activate HLA-G. We aimed to elucidate the mechanisms of HLA-G activation under conditions combining hypoxia-mimicking treatment and 5-aza-2'deoxycytidine, a DNA demethylating agent used in anti-cancer therapy which also induces HLA-G. Both treatments enhanced the amount of HLA-G mRNA and protein in HLA-G negative U251MG glioma cells. Electrophoretic Mobility Shift Assays and luciferase reporter gene assays revealed that HLA-G upregulation depends on Hypoxia Inducible Factor-1 (HIF-1) and a hypoxia responsive element (HRE) located in exon 2. A polymorphic HRE at -966 bp in the 5'UT region may modulate the magnitude of the response mediated by the exon 2 HRE. We suggest that therapeutic strategies should take into account that HLA-G expression in response to hypoxic tumor environment is dependent on HLA-G gene polymorphism and DNA methylation state at the HLA-G locus.
Inoue, D; Santiago, P; Horne, W C; Baron, R
1997-10-03
Transgenic mice expressing human T cell leukemia virus type I (HTLV-I)-tax under the control of HTLV-I-long terminal repeat (LTR) promoter develop skeletal abnormalities with high bone turnover and myelofibrosis. In these animals, Tax is highly expressed in bone with a pattern of expression restricted to osteoclasts and spindle-shaped cells within the endosteal myelofibrosis. To test the hypothesis that lineage-specific transcription factors promote transgene expression from the HTLV-I-LTR in osteoclasts, we first examined tax expression in transgenic bone marrow cultures. Expression was dependent on 1alpha,25-dihydroxycholecalciferol and coincided with tartrate-resistant acid phosphatase (TRAP) expression, a marker of osteoclast differentiation. Furthermore, Tax was expressed in vitronectin receptor-positive mononuclear precursors as well as in mature osteoclast-like cells (OCLs). Consistent with our hypothesis, electrophoretic mobility shift assays revealed the presence of an OCL nuclear factor (NFOC-1) that binds to the LTR 21-base pair direct repeat, a region critical for the promoter activity. This binding is further enhanced by Tax. Since NFOC-1 is absent in macrophages and conserved in osteoclasts among species including human, such a factor may play a role in lineage determination and/or in expression of the differentiated osteoclast phenotype.
Wang, Guohao; Xu, Yuquan
2012-01-01
Pseudomonas aeruginosa M18, a rhizosphere-isolated bacterial strain showing strong antifungal activity, can produce secondary metabolites such as phenazine-1-carboxylic acid and pyoluteorin (Plt). The LysR-type transcriptional regulator PltR activates the Plt biosynthesis operon pltLABCDEFG, the expression of which is induced by Plt. Here, we identified and characterized the non-conserved pltL promoter (pltLp) specifically activated by PltR and its upstream neighboring lys box from the complicated pltR–pltL intergenic sequence. The 22 bp palindromic lys box, which consists of two 9 bp complementary inverted repeats interrupted by 4 bp, was found to contain the conserved, GC-rich LysR-binding motif (T-N11-A). Evidence obtained in vivo from mutational and lacZ report analyses and in vitro from electrophoretic mobility shift assays reveals that the PltR protein directly bound to the pltLp region as the indispensable binding motif “lys box”, thereby transcriptionally activating the pltLp-driven plt operon expression. Plt, as a potential non-essential coinducer of PltR, specifically induced the pltLp expression and thus strengthened its biosynthetic plt operon expression. PMID:22761817
Arabidopsis DREB2C modulates ABA biosynthesis during germination.
Je, Jihyun; Chen, Huan; Song, Chieun; Lim, Chae Oh
2014-09-12
Plant dehydration-responsive element binding factors (DREBs) are transcriptional regulators of the APETELA2/Ethylene Responsive element-binding Factor (AP2/ERF) family that control expression of abiotic stress-related genes. We show here that under conditions of mild heat stress, constitutive overexpression seeds of transgenic DREB2C overexpression Arabidopsis exhibit delayed germination and increased abscisic acid (ABA) content compared to untransformed wild-type (WT). Treatment with fluridone, an inhibitor of the ABA biosynthesis abrogated these effects. Expression of an ABA biosynthesis-related gene, 9-cis-epoxycarotenoid dioxygenase 9 (NCED9) was up-regulated in the DREB2C overexpression lines compared to WT. DREB2C was able to trans-activate expression of NCED9 in Arabidopsis leaf protoplasts in vitro. Direct and specific binding of DREB2C to a complete DRE on the NCED9 promoter was observed in electrophoretic mobility shift assays. Exogenous ABA treatment induced DREB2C expression in germinating seeds of WT. Vegetative growth of transgenic DREB2C overexpression lines was more strongly inhibited by exogenous ABA compared to WT. These results suggest that DREB2C is a stress- and ABA-inducible gene that acts as a positive regulator of ABA biosynthesis in germinating seeds through activating NCED9 expression. Copyright © 2014 Elsevier Inc. All rights reserved.
The Role of HuR in the Post-Transcriptional Regulation of Interleukin-3 in T Cells
González-Feliciano, José A.; Hernández-Pérez, Marimar; Estrella, Luis A.; Colón-López, Daisy D.; López, Armando; Martínez, Marina; Maurás-Rivera, Kirla R.; Lasalde, Clarivel; Martínez, Daviana; Araujo-Pérez, Félix; González, Carlos I.
2014-01-01
Human Interleukin-3 (IL-3) is a lymphokine member of a class of transiently expressed mRNAs harboring Adenosine/Uridine-Rich Elements (ARE) in their 3' untranslated regions (3'-UTRs). The regulatory effects of AREs are often mediated by specific ARE-binding proteins (ARE-BPs). In this report, we show that the human IL-3 3'-UTR plays a post-transcriptional regulation role in two human transformed cell lines. More specifically, we demonstrate that the hIL-3 3'-UTR represses the translation of a luciferase reporter both in HeLa and Jurkat T-cells. These results also revealed that the hIL-3 3'-UTR-mediated translational repression is exerted by an 83 nt region comprised mainly by AREs and some non-ARE sequences. Moreover, electrophoretic mobility shift assays (EMSAs) and UV-crosslinking analysis show that this hIL-3 ARE-rich region recruits five specific protein complexes, including the ARE-BPs HuR and TIA-1. HuR binding to this ARE-rich region appears to be spatially modulated during T-cell activation. Together, these results suggest that HuR recognizes the ARE-rich region and plays a role in the IL-3 3'-UTR-mediated post-transcriptional control in T-cells. PMID:24658545
Le-Bel, Gaëtan; Ghio, Sergio Cortez; Larouche, Danielle; Germain, Lucie; Guérin, Sylvain L
2018-05-27
Electrophoretic mobility shift assays and Western blots are simple, efficient, and rapid methods to study DNA-protein interactions and protein expression, respectively. Primary cultures and subcultures of epithelial cells are widely used for the production of tissue-engineered substitutes and are gaining popularity as a model for gene expression studies. The preservation of stem cells through the culture process is essential to produce high quality substitutes. However, the increase in the number of cell passages is associated with a decrease in their ability to proliferate until senescence is reached. This process is likely to be mediated by the altered expression of nuclear-located transcription factors such as Sp1 and NFI, whose expression has been documented to be required for cell adhesion, migration, and differentiation. In some of our recent studies, we observed a correlation between reconstructed tissues exhibiting poor histological and structural characteristics and a low expression of Sp1 in their constituting epithelial cells. Therefore, monitoring both the expression and DNA binding of these transcription factors in human skin and corneal epithelial cells is a useful tool for characterizing the quality of primary cultured epithelial cells.
Zhang, Leying; Handel, Michelle Van; Schartner, Jill M; Hagar, Aaron; Allen, Grant; Curet, Marjorie; Badie, Behnam
2007-03-01
Understanding the local CNS immune response to neoplasms is essential in the development of immune-based treatments for malignant brain tumors. Using rodent glioma models, we have recently found tumor-associated microglia/macrophages (MG/MP) to be less responsive to known MG/MP activators such as CpG, LPS and IFN-gamma. To understand the mechanism of MG/MP suppression, nuclear extracts from rodent intracranial C6 gliomas, C6 glioma-associated MG/MP, normal brain, and normal MG/MP were obtained and studied using Electrophoretic Mobility Shift Assay (EMSA). Among the nuclear factors studied (AP-1, IRF, USF-1 and Stat-1) only USF-1, which is constitutively expressed in most cells, was down-regulated in tumor-associated MG/MP, but not normal MG/MP. Because tumor-associated MG/MP had higher expression of IL-10 (but not TNF-alpha or TGF-beta), we evaluated the role of USF-1 on IL-10 expression. siRNA mediated inhibition of USF-1 expression in primary MG/MP cultures resulted in up-regulation of IL-10 mRNA but not TNF-alpha or TGF-beta. These findings suggest that USF-1 may play a role in IL-10 regulation in MG/MP in brain tumors.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Sangmin, E-mail: taeinlee2011@kangwon.ac.kr; Chung, Jeong Min; Yun, Hyung Joong
Bacterioferritin comigratory protein (BCP) is a monomeric conformer acting as a putative thiol-dependent bacterial peroxidase, however molecular basis of DNA-protection via DNA-binding has not been clearly understood. In this study, we characterized the DNA binding properties of BCP using various lengths and differently shaped architectures of DNA. An electrophoretic mobility shift assay and electron microscopy analysis showed that recombinant TkBCP bound to DNA of a circular shape (double-stranded DNA and single-stranded DNA) and a linear shape (16–1000 bp) as well as various architectures of DNA. In addition, DNA protection experiments indicated that TkBCP can protect DNA against hyperthermal and oxidative stressmore » by removing highly reactive oxygen species (ROS) or by protecting DNA from thermal degradation. Based on these results, we suggest that TkBCP is a multi-functional DNA-binding protein which has DNA chaperon and antioxidant functions. - Highlights: • Bacterioferritin comigratory protein (BCP) protects DNA from oxidative stress by reducing ROS. • TkBCP does not only scavenge ROS, but also protect DNA from hyperthermal stress. • BCP potentially adopts the multi-functional role in DNA binding activities and anti-oxidant functions.« less
Martínez de Alba, Angel Emilio; Sägesser, Rudolf; Tabler, Martin; Tsagris, Mina
2003-01-01
For the identification of RNA-binding proteins that specifically interact with potato spindle tuber viroid (PSTVd), we subjected a tomato cDNA expression library prepared from viroid-infected leaves to an RNA ligand screening procedure. We repeatedly identified cDNA clones that expressed a protein of 602 amino acids. The protein contains a bromodomain and was termed viroid RNA-binding protein 1 (VIRP1). The specificity of interaction of VIRP1 with viroid RNA was studied by different methodologies, which included Northwestern blotting, plaque lift, and electrophoretic mobility shift assays. VIRP1 interacted strongly and specifically with monomeric and oligomeric PSTVd positive-strand RNA transcripts. Other RNAs, for example, U1 RNA, did not bind to VIRP1. Further, we could immunoprecipitate complexes from infected tomato leaves that contained VIRP1 and viroid RNA in vivo. Analysis of the protein sequence revealed that VIRP1 is a member of a newly identified family of transcriptional regulators associated with chromatin remodeling. VIRP1 is the first member of this family of proteins, for which a specific RNA-binding activity is shown. A possible role of VIRP1 in viroid replication and in RNA mediated chromatin remodeling is discussed. PMID:12915580
Cicconi, Alessandro; Micheli, Emanuela; Vernì, Fiammetta; Jackson, Alison; Gradilla, Ana Citlali; Cipressa, Francesca; Raimondo, Domenico; Bosso, Giuseppe; Wakefield, James G.; Ciapponi, Laura; Cenci, Giovanni; Gatti, Maurizio
2017-01-01
Abstract Drosophila telomeres are sequence-independent structures maintained by transposition to chromosome ends of three specialized retroelements rather than by telomerase activity. Fly telomeres are protected by the terminin complex that includes the HOAP, HipHop, Moi and Ver proteins. These are fast evolving, non-conserved proteins that localize and function exclusively at telomeres, protecting them from fusion events. We have previously suggested that terminin is the functional analogue of shelterin, the multi-protein complex that protects human telomeres. Here, we use electrophoretic mobility shift assay (EMSA) and atomic force microscopy (AFM) to show that Ver preferentially binds single-stranded DNA (ssDNA) with no sequence specificity. We also show that Moi and Ver form a complex in vivo. Although these two proteins are mutually dependent for their localization at telomeres, Moi neither binds ssDNA nor facilitates Ver binding to ssDNA. Consistent with these results, we found that Ver-depleted telomeres form RPA and γH2AX foci, like the human telomeres lacking the ssDNA-binding POT1 protein. Collectively, our findings suggest that Drosophila telomeres possess a ssDNA overhang like the other eukaryotes, and that the terminin complex is architecturally and functionally similar to shelterin. PMID:27940556
Lattka, E.; Eggers, S.; Moeller, G.; Heim, K.; Weber, M.; Mehta, D.; Prokisch, H.; Illig, T.; Adamski, J.
2010-01-01
Fatty acid desaturases (FADS) play an important role in the formation of omega-6 and omega-3 highly unsaturated fatty acids (HUFAs). The composition of HUFAs in the human metabolome is important for membrane fluidity and for the modulation of essential physiological functions such as inflammation processes and brain development. Several recent studies reported significant associations of single nucleotide polymorphisms (SNPs) in the human FADS gene cluster with HUFA levels and composition. The presence of the minor allele correlated with a decrease of desaturase reaction products and an accumulation of substrates. We performed functional studies with two of the associated polymorphisms (rs3834458 and rs968567) and showed an influence of polymorphism rs968567 on FADS2 promoter activity by luciferase reporter gene assays. Electrophoretic mobility shift assays proved allele-dependent DNA-binding ability of at least two protein complexes to the region containing SNP rs968567. One of the proteins binding to this region in an allele-specific manner was shown to be the transcription factor ELK1 (a member of ETS domain transcription factor family). These results indicate that rs968567 influences FADS2 transcription and offer first insights into the modulation of complex regulation mechanisms of FADS2 gene transcription by SNPs. PMID:19546342
Lattka, E; Eggers, S; Moeller, G; Heim, K; Weber, M; Mehta, D; Prokisch, H; Illig, T; Adamski, J
2010-01-01
Fatty acid desaturases (FADS) play an important role in the formation of omega-6 and omega-3 highly unsaturated fatty acids (HUFAs). The composition of HUFAs in the human metabolome is important for membrane fluidity and for the modulation of essential physiological functions such as inflammation processes and brain development. Several recent studies reported significant associations of single nucleotide polymorphisms (SNPs) in the human FADS gene cluster with HUFA levels and composition. The presence of the minor allele correlated with a decrease of desaturase reaction products and an accumulation of substrates. We performed functional studies with two of the associated polymorphisms (rs3834458 and rs968567) and showed an influence of polymorphism rs968567 on FADS2 promoter activity by luciferase reporter gene assays. Electrophoretic mobility shift assays proved allele-dependent DNA-binding ability of at least two protein complexes to the region containing SNP rs968567. One of the proteins binding to this region in an allele-specific manner was shown to be the transcription factor ELK1 (a member of ETS domain transcription factor family). These results indicate that rs968567 influences FADS2 transcription and offer first insights into the modulation of complex regulation mechanisms of FADS2 gene transcription by SNPs.
Kumar, Hitesh; Kumar, Sanjay
2013-09-15
The leaves of stevia [Stevia rebaudiana (Bertoni)] are a rich source of steviol glycosides that are used as non-calorific sweetener in many countries around the world. Steviol moiety of steviol glycosides is synthesized via plastidial 2C-methyl-D-erythritol 4-phosphate pathway, where (E)-4-hydroxy-3-methylbut-2-enyl diphosphate reductase (HDR) is the key enzyme. HDR catalyzes the simultaneous conversion of (E)-4-hydroxy-3-methylbut-2-enyl diphosphate into five carbon isoprenoid units, isopentenyl diphosphate and dimethylallyl diphosphate. Stevia HDR (SrHDR) successfully rescued HDR lethal mutant strain MG1655 ara<>ispH upon genetic complementation, suggesting SrHDR to encode a functional protein. The gene exhibited diurnal variation in expression. To identify the possible regulatory elements, upstream region of the gene was cloned and putative cis-acting elements were detected by in silico analysis. Electrophoretic mobility shift assay, using a putative light responsive element GATA showed the binding of nuclear proteins (NP) isolated from leaves during light period of the day, but not with the NP from leaves during the dark period. Data suggested the involvement of GATA box in light mediated gene regulation of SrHDR in stevia. Copyright © 2013 Elsevier B.V. All rights reserved.
Saravanakumar, Kandasamy; Fan, Lili; Fu, Kehe; Yu, Chuanjin; Wang, Meng; Xia, Hai; Sun, Jianan; Li, Yaqian; Chen, Jie
2016-01-01
Trichoderma harzianum is well known to exhibit induced systemic resistance (ISR) to Curvularia leaf spot. We previously reported that a C6 zinc finger protein (Thc6) is responsible for a major contribution to the ISR to the leaf disease, but the types of effectors and the signals mediated by Thc6 from Trichoderma are unclear. In this work, we demonstrated that two hydrolases, Thph1 and Thph2, from T. harzianum were regulated by Thc6. Furthermore, an electrophoretic mobility shift assay (EMSA) study revealed that Thc6 regulated mRNA expression by binding to GGCTAA and GGCTAAA in the promoters of the Thph1 and Thph2 genes, respectively. Moreover, the Thph1 and Thph2 proteins triggered the transient production of reactive oxygen species (ROS) and elevated the free cytosolic calcium levels in maize leaf. Furthermore, the genes related to the jasmonate/ethylene signaling pathway were up-regulated in the wild-type maize strain. However, the ΔThph1- or ΔThph2-deletion mutants could not activate the immune defense-related genes in maize to protect against leaf disease. Therefore, we conclude that functional Thph1 and Thph2 may be required in T. harzianum to activate ISR in maize. PMID:27830829
Lee, Dong-Kee; Suh, Dongchul; Edenberg, Howard J; Hur, Man-Wook
2002-07-26
The POZ domain is a protein-protein interaction motif that is found in many transcription factors, which are important for development, oncogenesis, apoptosis, and transcription repression. We cloned the POZ domain transcription factor, FBI-1, that recognizes the cis-element (bp -38 to -22) located just upstream of the core Sp1 binding sites (bp -22 to +22) of the ADH5/FDH minimal promoter (bp -38 to +61) in vitro and in vivo, as revealed by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. The ADH5/FDH minimal promoter is potently repressed by the FBI-1. Glutathione S-transferase fusion protein pull-down showed that the POZ domains of FBI-1, Plzf, and Bcl-6 directly interact with the zinc finger DNA binding domain of Sp1. DNase I footprinting assays showed that the interaction prevents binding of Sp1 to the GC boxes of the ADH5/FDH promoter. Gal4-POZ domain fusions targeted proximal to the GC boxes repress transcription of the Gal4 upstream activator sequence-Sp1-adenovirus major late promoter. Our data suggest that POZ domain represses transcription by interacting with Sp1 zinc fingers and by interfering with the DNA binding activity of Sp1.
1990-01-01
Lipopolysaccharide (LPS) potently stimulates human immunodeficiency virus type 1-long terminal repeat (HIV-1-LTR) CAT constructs transfected into monocyte/macrophage-like cell lines but not a T cell line. This effect appears to be mediated through the induction of nuclear factor kappa B (NF-kappa B). Electrophoretic mobility shift assays demonstrate that LPS induces a DNA binding activity indistinguishable from NF-kappa B in U937 and THP-1 cells. LPS is also shown to dramatically increase HIV-1 production from a chronically infected monocyte/macrophage-like cloned cell line, U1, which produces very low levels of HIV-1 at baseline. The stimulation of viral production from this cell line occurs only if these cells are treated with granulocyte/macrophage colony-stimulating factor (GM-CSF) before treatment with LPS. This stimulation of HIV-1 production is correlated with an increase in the level of HIV-1 RNA and and activation of NF- kappa B. LPS is not able to induce HIV-1 production in a cloned T cell line. The effect of LPS on HIV-1 replication occurs at picogram per milliliter concentrations and may be clinically significant in understanding the variability of the natural history of HIV-1 infection. PMID:2193097
Ouabain Modulates Zymosan-Induced Peritonitis in Mice
Leite, Jacqueline Alves; Alves, Anne Kaliery De Abreu; Galvão, José Guilherme Marques; Teixeira, Mariana Pires; Rumjanek, Vivian Mary; Rodrigues-Mascarenhas, Sandra
2015-01-01
Ouabain, a potent inhibitor of the Na+, K+-ATPase, was identified as an endogenous substance. Recently, ouabain was shown to affect various immunological processes. We have previously demonstrated the ability of ouabain to modulate inflammation, but little is known about the mechanisms involved. Thus, the aim of the present work is to evaluate the immune modulatory role of ouabain on zymosan-induced peritonitis in mice. Our results show that ouabain decreased plasma exudation (33%). After induction of inflammation, OUA treatment led to a 46% reduction in the total number of cells, as a reflex of a decrease of polymorphonuclear leukocytes, which does not appear to be due to cell death. Furthermore, OUA decreased TNF-α (57%) and IL-1β (58%) levels, without interfering with IL-6 and IL-10. Also, in vitro experiments show that ouabain did not affect endocytic capacity. Moreover, electrophoretic mobility shift assay (EMSA) shows that zymosan treatment increased (85%) NF-κB binding activity and that ouabain reduced (30%) NF-κB binding activity induced by zymosan. Therefore, our data suggest that ouabain modulated acute inflammatory response, reducing the number of cells and cytokines levels in the peritoneal cavity, as well as NFκB activation, suggesting a new mode of action of this substance. PMID:26078492
Li, Weijuan; Li, Zhi; Chen, Yaoqi; Li, Songhai; Lv, Yuanyuan; Zhou, Wenping; Liao, Mengyang; Zhu, Feng; Zhou, Zihua; Cheng, Xiang; Zeng, Qiutang; Liao, Yuhua; Wei, Yumiao
2014-01-01
Our study intended to prove whether agonistic autoantibodies to angiotensin II type 1 receptor (AT1-AAs) exist in patients with coronary heart disease (CHD) and affect the human endothelial cell (HEC) by upregulating proinflammatory cytokines expression involved in NF-κB pathway. Antibodies were determined by chronotropic responses of cultured neonatal rat cardiomyocytes coupled with receptor-specific antagonists (valsartan and AT1-EC2) as described previously. Interleukin-6 (IL-6), vascular cell adhesion molecule-1 (VCAM-1), and monocyte chemotactic protein-1 (MCP-1) expression were improved at both mRNA and protein levels in HEC, while NF-κB in the DNA level was improved detected by electrophoretic mobility shift assays (EMSA). These improvements could be inhibited by specific AT1 receptor blocker valsartan, NF-κB blocker pyrrolidine dithiocarbamate (PDTC), and specific short peptides from the second extracellular loop of AT1 receptor. These results suggested that AT1-AAs, via the AT1 receptor, induce expression of proinflammatory cytokines involved in the activation of NF-κB. AT1-AAs may play a great role in the pathogenesis of the acute coronary syndrome by mediating vascular inflammatory effects involved in the NF-κB pathway. PMID:25762441
Li, Weijuan; Li, Zhi; Chen, Yaoqi; Li, Songhai; Lv, Yuanyuan; Zhou, Wenping; Liao, Mengyang; Zhu, Feng; Zhou, Zihua; Cheng, Xiang; Zeng, Qiutang; Liao, Yuhua; Wei, Yumiao
2014-01-01
Our study intended to prove whether agonistic autoantibodies to angiotensin II type 1 receptor (AT1-AAs) exist in patients with coronary heart disease (CHD) and affect the human endothelial cell (HEC) by upregulating proinflammatory cytokines expression involved in NF-κB pathway. Antibodies were determined by chronotropic responses of cultured neonatal rat cardiomyocytes coupled with receptor-specific antagonists (valsartan and AT1-EC2) as described previously. Interleukin-6 (IL-6), vascular cell adhesion molecule-1 (VCAM-1), and monocyte chemotactic protein-1 (MCP-1) expression were improved at both mRNA and protein levels in HEC, while NF-κB in the DNA level was improved detected by electrophoretic mobility shift assays (EMSA). These improvements could be inhibited by specific AT1 receptor blocker valsartan, NF-κB blocker pyrrolidine dithiocarbamate (PDTC), and specific short peptides from the second extracellular loop of AT1 receptor. These results suggested that AT1-AAs, via the AT1 receptor, induce expression of proinflammatory cytokines involved in the activation of NF-κB. AT1-AAs may play a great role in the pathogenesis of the acute coronary syndrome by mediating vascular inflammatory effects involved in the NF-κB pathway.
Isolation and characterization of target sequences of the chicken CdxA homeobox gene.
Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A
1993-01-01
The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943
Shashoua, V E; Adams, D; Boyer-Boiteau, A
2001-10-19
An 8-amino acid peptide fragment (CMX-8933) of Ependymin, a glycoprotein component of the extracellular fluid and cerebrospinal fluid of goldfish brain, was synthesized and tested for its capacity to activate AP-1 transcription factor in cell cultures. Dose-response and time-course studies of AP-1's binding to DNA were carried out in neuroblastoma (NB2a/dl) and primary rat brain cortical cultures using an electrophoretic mobility shift assay (EMSA). A 13-14-fold increase in AP-1's DNA binding was obtained when NB2a cells were incubated for 4 h with 6-10 microg/ml CMX-8933. Primary rat brain cortical cultures were much more sensitive to the effects of CMX-8933 than transformed (NB2a) cultures; here a 26.7+/-5.2-fold increase in binding was observed following a 3-h treatment with as little as 10 ng/ml peptide. These findings are consistent with an activation of this transcription factor, a characteristic that has been previously correlated with functional aspects of full-sized neurotrophic factors (nerve growth factor and brain-derived nerve growth factor) in neuronal differentiation and regeneration. Such data suggest a role for Ependymin in transcriptional control.
Gorkhali, Neena Amatya; Dong, Kunzhe; Yang, Min; Song, Shen; Kader, Adiljian; Shrestha, Bhola Shankar; He, Xiaohong; Zhao, Qianjun; Pu, Yabin; Li, Xiangchen; Kijas, James; Guan, Weijun; Han, Jianlin; Jiang, Lin; Ma, Yuehui
2016-07-22
Sheep has successfully adapted to the extreme high-altitude Himalayan region. To identify genes underlying such adaptation, we genotyped genome-wide single nucleotide polymorphisms (SNPs) of four major sheep breeds living at different altitudes in Nepal and downloaded SNP array data from additional Asian and Middle East breeds. Using a di value-based genomic comparison between four high-altitude and eight lowland Asian breeds, we discovered the most differentiated variants at the locus of FGF-7 (Keratinocyte growth factor-7), which was previously reported as a good protective candidate for pulmonary injuries. We further found a SNP upstream of FGF-7 that appears to contribute to the divergence signature. First, the SNP occurred at an extremely conserved site. Second, the SNP showed an increasing allele frequency with the elevated altitude in Nepalese sheep. Third, the electrophoretic mobility shift assays (EMSA) analysis using human lung cancer cells revealed the allele-specific DNA-protein interactions. We thus hypothesized that FGF-7 gene potentially enhances lung function by regulating its expression level in high-altitude sheep through altering its binding of specific transcription factors. Especially, FGF-7 gene was not implicated in previous studies of other high-altitude species, suggesting a potential novel adaptive mechanism to high altitude in sheep at the Himalayas.
Transcriptional regulation of fatty acid biosynthesis in mycobacteria
Mondino, S.; Gago, G.; Gramajo, H.
2013-01-01
SUMMARY The main purpose of our study is to understand how mycobacteria exert control over the biosynthesis of their membrane lipids and find out the key components of the regulatory network that control fatty acid biosynthesis at the transcriptional level. In this paper we describe the identification and purification of FasR, a transcriptional regulator from Mycobacterium sp. that controls the expression of the fatty acid synthase (fas) and the 4-phosphopantetheinyl transferase (acpS) encoding genes, whose products are involved in the fatty acid and mycolic acid biosynthesis pathways. In vitro studies demonstrated that fas and acpS genes are part of the same transcriptional unit and that FasR specifically binds to three conserved operator sequences present in the fas-acpS promoter region (Pfas). The construction and further characterization of a fasR conditional mutant confirmed that FasR is a transcriptional activator of the fas-acpS operon and that this protein is essential for mycobacteria viability. Furthermore, the combined used of Pfas-lacZ fusions in different fasR backgrounds and electrophoretic mobility shift assays experiments, strongly suggested that long-chain acyl-CoAs are the effector molecules that modulate the affinity of FasR for its DNA binding sequences and therefore the expression of the essential fas-acpS operon. PMID:23721164
Glucose Regulates the Expression of the Apolipoprotein A5 Gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fruchart, Jamila; Nowak, Maxime; Helleboid-Chapman, Audrey
2008-04-07
The apolipoprotein A5 gene (APOA5) is a key player in determining triglyceride concentrations in humans and mice. Since diabetes is often associated with hypertriglyceridemia, this study explores whether APOA5 gene expression is regulated by alteration in glucose homeostasis and the related pathways. D-glucose activates APOA5 gene expression in a time- and dose-dependent manner in hepatocytes, and the glycolytic pathway involved was determined using D-glucose analogs and metabolites. Together, transient transfections, electrophoretic mobility shift assays and chromatin immunoprecipitation assays show that this regulation occurs at the transcriptional level through an increase of USF1/2 binding to an E-box in the APOA5 promoter.more » We show that this phenomenon is not due to an increase of mRNA or protein expression levels of USF. Using protein phosphatases 1 and 2A inhibitor, we demonstrate that D-glucose regulates APOA5 gene via a dephosphorylation mechanism, thereby resulting in an enhanced USF1/2-promoter binding. Last, subsequent suppressions of USF1/2 and phosphatases mRNA through siRNA gene silencing abolished the regulation. We demonstrate that APOA5 gene is up regulated by D-glucose and USF through phosphatase activation. These findings may provide a new cross talk between glucose and lipid metabolism.« less
Galasinski, Shelly K.; Lively, Tricia N.; Grebe de Barron, Alexandra; Goodrich, James A.
2000-01-01
Protein acetylation has emerged as a means of controlling levels of mRNA synthesis in eukaryotic cells. Here we report that acetyl coenzyme A (acetyl-CoA) stimulates RNA polymerase II transcription in vitro in the absence of histones. The effect of acetyl-CoA on basal and activated transcription was studied in a human RNA polymerase II transcription system reconstituted from recombinant and highly purified transcription factors. Both basal and activated transcription were stimulated by the addition of acetyl-CoA to transcription reaction mixtures. By varying the concentrations of general transcription factors in the reaction mixtures, we found that acetyl-CoA decreased the concentration of TFIID required to observe transcription. Electrophoretic mobility shift assays and DNase I footprinting revealed that acetyl-CoA increased the affinity of the general transcription factor TFIID for promoter DNA in a TBP-associated factor (TAF)-dependent manner. Interestingly, acetyl-CoA also caused a conformational change in the TFIID-TFIIA-promoter complex as assessed by DNase I footprinting. These results show that acetyl-CoA alters the DNA binding activity of TFIID and indicate that this biologically important cofactor functions at multiple levels to control gene expression. PMID:10688640
Galasinski, S K; Lively, T N; Grebe De Barron, A; Goodrich, J A
2000-03-01
Protein acetylation has emerged as a means of controlling levels of mRNA synthesis in eukaryotic cells. Here we report that acetyl coenzyme A (acetyl-CoA) stimulates RNA polymerase II transcription in vitro in the absence of histones. The effect of acetyl-CoA on basal and activated transcription was studied in a human RNA polymerase II transcription system reconstituted from recombinant and highly purified transcription factors. Both basal and activated transcription were stimulated by the addition of acetyl-CoA to transcription reaction mixtures. By varying the concentrations of general transcription factors in the reaction mixtures, we found that acetyl-CoA decreased the concentration of TFIID required to observe transcription. Electrophoretic mobility shift assays and DNase I footprinting revealed that acetyl-CoA increased the affinity of the general transcription factor TFIID for promoter DNA in a TBP-associated factor (TAF)-dependent manner. Interestingly, acetyl-CoA also caused a conformational change in the TFIID-TFIIA-promoter complex as assessed by DNase I footprinting. These results show that acetyl-CoA alters the DNA binding activity of TFIID and indicate that this biologically important cofactor functions at multiple levels to control gene expression.
Quantitative analysis of TALE-DNA interactions suggests polarity effects.
Meckler, Joshua F; Bhakta, Mital S; Kim, Moon-Soo; Ovadia, Robert; Habrian, Chris H; Zykovich, Artem; Yu, Abigail; Lockwood, Sarah H; Morbitzer, Robert; Elsäesser, Janett; Lahaye, Thomas; Segal, David J; Baldwin, Enoch P
2013-04-01
Transcription activator-like effectors (TALEs) have revolutionized the field of genome engineering. We present here a systematic assessment of TALE DNA recognition, using quantitative electrophoretic mobility shift assays and reporter gene activation assays. Within TALE proteins, tandem 34-amino acid repeats recognize one base pair each and direct sequence-specific DNA binding through repeat variable di-residues (RVDs). We found that RVD choice can affect affinity by four orders of magnitude, with the relative RVD contribution in the order NG > HD ≈ NN > NI > NK. The NN repeat preferred the base G over A, whereas the NK repeat bound G with 10(3)-fold lower affinity. We compared AvrBs3, a naturally occurring TALE that recognizes its target using some atypical RVD-base combinations, with a designed TALE that precisely matches 'standard' RVDs with the target bases. This comparison revealed unexpected differences in sensitivity to substitutions of the invariant 5'-T. Another surprising observation was that base mismatches at the 5' end of the target site had more disruptive effects on affinity than those at the 3' end, particularly in designed TALEs. These results provide evidence that TALE-DNA recognition exhibits a hitherto un-described polarity effect, in which the N-terminal repeats contribute more to affinity than C-terminal ones.
An, Jian-Ping; Qu, Feng-Jia; Yao, Ji-Fang; Wang, Xiao-Na; You, Chun-Xiang; Wang, Xiao-Fei; Hao, Yu-Jin
2017-01-01
The basic leucine zipper (bZIP) transcription factor HY5 plays a multifaceted role in plant growth and development. Here the apple MdHY5 gene was cloned based on its homology with Arabidopsis HY5 . Expression analysis demonstrated that MdHY5 transcription was induced by light and abscisic acid treatments. Electrophoretic mobility shift assays and transient expression assays subsequently showed that MdHY5 positively regulated both its own transcription and that of MdMYB10 by binding to E-box and G-box motifs, respectively. Furthermore, we obtained transgenic apple calli that overexpressed the MdHY5 gene, and apple calli coloration assays showed that MdHY5 promoted anthocyanin accumulation by regulating expression of the MdMYB10 gene and downstream anthocyanin biosynthesis genes. In addition, the transcript levels of a series of nitrate reductase genes and nitrate uptake genes in both wild-type and transgenic apple calli were detected. In association with increased nitrate reductase activities and nitrate contents, the results indicated that MdHY5 might be an important regulator in nutrient assimilation. Taken together, these results indicate that MdHY5 plays a vital role in anthocyanin accumulation and nitrate assimilation in apple.
Autoregulation and Virulence Control by the Toxin-Antitoxin System SavRS in Staphylococcus aureus
Wen, Wen; Liu, Banghui; Xue, Lu; Zhu, Zhongliang; Niu, Liwen
2018-01-01
ABSTRACT Toxin-antitoxin (TA) systems play diverse physiological roles, such as plasmid maintenance, growth control, and persister cell formation, but their involvement in bacterial pathogenicity remains largely unknown. Here, we have identified a novel type II toxin-antitoxin system, SavRS, and revealed the molecular mechanisms of its autoregulation and virulence control in Staphylococcus aureus. Electrophoretic mobility shift assay and isothermal titration calorimetry data indicated that the antitoxin SavR acted as the primary repressor bound to its own promoter, while the toxin SavS formed a complex with SavR to enhance the ability to bind to the operator site. DNase I footprinting assay identified the SavRS-binding site containing a short and long palindrome in the promoter region. Further, mutation and DNase I footprinting assay demonstrated that the two palindromes were crucial for DNA binding and transcriptional repression. More interestingly, genetic deletion of the savRS system led to the increased hemolytic activity and pathogenicity in a mouse subcutaneous abscess model. We further identified two virulence genes, hla and efb, by real-time quantitative reverse transcription-PCR and demonstrated that SavR and SavRS could directly bind to their promoter regions to repress virulence gene expression. PMID:29440365
Wang, Yong-Sheng; Gao, Wei; Li, Hong-Fen; Wang, Ze-Mu; Zhu, Jun; Zhao, Huan; Yan, Jian-Jun; Jia, En-Zhi; Yang, Zhi-Jian; Wang, Lian-Sheng
2012-04-01
Visfatin, a pro-inflammatory cytokine predominantly released from leucocytes, is correlated with coronary artery disease (CAD). We have previously reported that the -1535C>T polymorphism (rs1330082), which located on the promoter region of visfatin, was associated with decreased risk of CAD. Here, we investigated the underlying mechanism by which this polymorphism affects the genetic susceptibility to CAD. The difference of the promoter activities between -1535T variant and -1535C allele was tested by luciferase reporter gene assay. The difference of transcription factor binding activities between T and C allele was evaluated by electrophoretic mobility shift assay. In reporter gene assay, we showed that the T variant had a significantly reduced transcriptional activity compared with the C allele. The T-variant significantly attenuated the promoter binding affinity to nuclear transcription factors and this effect became much obvious after treatment with TNF-α. Moreover, competition experiment revealed that the retarded complex formed by T-1535- or C-1535-probe binding to nuclear extracts was nearly completely inhibited by unlabeled activator protein-1 (AP-1) specific probe, indicating that AP-1 might be the target nuclear effector. Taken together, our data provided potential mechanistic link between the visfatin -1535C>T polymorphism and reduced CAD risk.
Dhar, Shilpa S; Liang, Huan Ling; Wong-Riley, Margaret T T
2009-10-01
Neuronal activity is highly dependent on energy metabolism; yet, the two processes have traditionally been regarded as independently regulated at the transcriptional level. Recently, we found that the same transcription factor, nuclear respiratory factor 1 (NRF-1) co-regulates an important energy-generating enzyme, cytochrome c oxidase, as well as critical subunits of glutamatergic receptors. The present study tests our hypothesis that the co-regulation extends to the next level of glutamatergic synapses, namely, neuronal nitric oxide synthase, which generates nitric oxide as a downstream signaling molecule. Using in silico analysis, electrophoretic mobility shift assay, chromatin immunoprecipitation, promoter mutations, and NRF-1 silencing, we documented that NRF-1 functionally bound to Nos1, but not Nos2 (inducible) and Nos3 (endothelial) gene promoters. Both COX and Nos1 transcripts were up-regulated by depolarizing KCl treatment and down-regulated by TTX-mediated impulse blockade in neurons. However, NRF-1 silencing blocked the up-regulation of both Nos1 and COX induced by KCl depolarization, and over-expression of NRF-1 rescued both Nos1 and COX transcripts down-regulated by TTX. These findings are consistent with our hypothesis that synaptic neuronal transmission and energy metabolism are tightly coupled at the molecular level.
Saravanakumar, Kandasamy; Fan, Lili; Fu, Kehe; Yu, Chuanjin; Wang, Meng; Xia, Hai; Sun, Jianan; Li, Yaqian; Chen, Jie
2016-11-10
Trichoderma harzianum is well known to exhibit induced systemic resistance (ISR) to Curvularia leaf spot. We previously reported that a C6 zinc finger protein (Thc6) is responsible for a major contribution to the ISR to the leaf disease, but the types of effectors and the signals mediated by Thc6 from Trichoderma are unclear. In this work, we demonstrated that two hydrolases, Thph1 and Thph2, from T. harzianum were regulated by Thc6. Furthermore, an electrophoretic mobility shift assay (EMSA) study revealed that Thc6 regulated mRNA expression by binding to GGCTAA and GGCTAAA in the promoters of the Thph1 and Thph2 genes, respectively. Moreover, the Thph1 and Thph2 proteins triggered the transient production of reactive oxygen species (ROS) and elevated the free cytosolic calcium levels in maize leaf. Furthermore, the genes related to the jasmonate/ethylene signaling pathway were up-regulated in the wild-type maize strain. However, the ΔThph1- or ΔThph2-deletion mutants could not activate the immune defense-related genes in maize to protect against leaf disease. Therefore, we conclude that functional Thph1 and Thph2 may be required in T. harzianum to activate ISR in maize.
Liang, Zhi-Kun; Pang, Rui; Dong, Yi; Sun, Zhong-Xiang; Ling, Yan; Zhang, Wen-Qing
2017-04-29
Cytochrome P450-mediated metabolic resistance is one of the major mechanisms involved in insecticide resistance. Although the up-regulation of cytochrome P450 plays a vital role in insecticide metabolism, the molecular basis for the transcriptional regulation of cytochrome P450 remains largely unknown. The P450 gene CYP6ER1, has been reported to confer imidacloprid resistance to the brown planthopper, Nilaparvata lugens. Here, we identified a novel alternative transcript of CYP6ER1 (transcript A2) that had different expression patterns between resistant and susceptible populations, and was more stable after insecticide induction. The promoter of this transcript was sequenced and multiple single nucleotide polymorphisms (SNPs) were detected in individuals from susceptible and resistant field-collected populations. Resistant alleles of four SNPs were found to significantly enhance the promoter activity of the CYP6ER1 transcript A2. Electrophoretic mobility shift assays (EMSAs) revealed that these SNPs might regulate the binding of transcription factors to the promoter. Our findings provide novel evidence regarding the transcriptional regulation of a metabolic resistance-related gene and may be useful to understand the resistance mechanism of N. lugens in the field. © 2017 Institute of Zoology, Chinese Academy of Sciences.
Park, Bum-Chan; Park, Yun-Hee; Yi, Soohyun; Choi, Yu Kyung; Kang, Eun-Hye; Park, Hee-Moon
2014-11-01
The temporal and spatial regulation of β-1,3-glucan synthesis plays an important role in morphogenesis during fungal growth and development. Northern blot analysis showed that the transcription of fksA, the gene encoding β-1,3-glucan synthase in Aspergillus nidulans, was cell-cycle-dependent and increased steadily over the duration of the vegetative period, but its overall expression during the asexual and sexual stages was fairly constant up until the time of transcription cessation. In an A. nidulans strain mutated in the eukaryotic bHLH-like APSES transcription factor stuA1, the transcriptional level of fksA, and consequently the content of alkali-insoluble cell wall β-glucan, significantly increased at the conidial chain formation and maturation stage. Electrophoretic mobility shift assays revealed that StuA was bound to StREs (StuA Response Elements) on the fksA promoter region. Promoter analysis with sGFP-fusion constructs also indicated the negative regulation of fksA expression by StuA, especially during asexual development. Taken together, these data suggest that StuA plays an important role in cell wall biogenesis during the development of A. nidulans, by controlling the transcription level of fksA.
Herranz, M Carmen; Pallás, Vicente
2004-03-01
The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is involved in intercellular virus transport. In this study, putative RNA-binding properties of the PNRSV MP were studied. The PNRSV MP was produced in Escherichia coli using an expression vector. Electrophoretic mobility shift assays (EMSAs) using DIG-labelled riboprobes demonstrated that PNRSV MP bound ssRNA cooperatively without sequence specificity. Two different ribonucleoprotein complexes were found to be formed depending on the molar MP : PNRSV RNA ratio. The different responses of the complexes to urea treatment strongly suggested that they have different structural properties. Deletion mutagenesis followed by Northwestern analysis allowed location of a nucleic acid binding domain to aa 56-88. This 33 aa RNA-binding motif is the smallest region delineated among members of the family Bromoviridae for which RNA-binding properties have been demonstrated. This domain is highly conserved within all phylogenetic subgroups previously described for PNRSV isolates. Interestingly, the RNA-binding domain described here and the one described for Alfamovirus are located at the N terminus of their corresponding MPs, whereas similar domains previously characterized in members of the genera Bromovirus and Cucumovirus are present at the C terminus, strongly reflecting their corresponding phylogenetic relationships. The evolutionary implications of this observation are discussed.
Pohl, Elena E; Voltchenko, Anna M; Rupprecht, Anne
2008-05-01
Hydroxyl group-containing fatty acids play an important role in anti-inflammatory action, neuroprotection, bactericide and anti-cancer defense. However, the mechanism of long-chain hydroxy fatty acids (HFA) transport across plasma membranes is still disputed. Two main hypotheses have been suggested: firstly, that protonated HFAs traverse across the membranes spontaneously and, secondly, that the transport is facilitated by proteinaceous carriers. Here, we demonstrate that the protonated HFA are able to move across planar lipid bilayers without protein assistance. This transport step is accompanied by the acidification of the buffer in receiving compartment and the pH augmentation in the donating compartment. The latter contained liposomes doped with HFA. As revealed by scanning pH-sensitive microelectrodes, the pH shift occurred only in the immediate vicinity of the membrane, while bulk pH remained unchanged. In concurrence with the theoretical model of weak acid transport, the pH value at maximum proton flux was almost equal to the pK of the studied HFA. Intrinsic pKi values were calculated from the electrophoretic mobilities of HFA-containing liposomes and were 5.4, 6.5, 6.9 and 6.3 for 2-hydroxyhexadecanoic, 16-hydroxyhexadecanoic, 12-hydroxydodecanoic and 9,10,16-trihydroxyhexadecanoic acids, respectively.
Okino, Nozomu; Ito, Makoto
2016-01-01
Pseudomonas aeruginosa, an opportunistic, but serious multidrug-resistant pathogen, secretes a ceramidase capable of cleaving the N-acyl linkage of ceramide to generate fatty acids and sphingosine. We previously reported that the secretion of P. aeruginosa ceramidase was induced by host-derived sphingolipids, through which phospholipase C-induced hemolysis was significantly enhanced. We herein investigated the gene(s) regulating sphingolipid-induced ceramidase expression and identified SphR, which encodes a putative AraC family transcriptional regulator. Disruption of the sphR gene in P. aeruginosa markedly decreased the sphingomyelin-induced secretion of ceramidase, reduced hemolytic activity, and resulted in the loss of sphingomyelin-induced ceramidase expression. A microarray analysis confirmed that sphingomyelin significantly induced ceramidase expression in P. aeruginosa. Furthermore, an electrophoretic mobility shift assay revealed that SphR specifically bound free sphingoid bases such as sphingosine, dihydrosphingosine, and phytosphingosine, but not sphingomyelin or ceramide. A β-galactosidase-assisted promoter assay showed that sphingosine activated ceramidase expression through SphR at a concentration of 100 nM. Collectively, these results demonstrated that sphingosine induces the secretion of ceramidase by promoting the mRNA expression of ceramidase through SphR, thereby enhancing hemolytic phospholipase C-induced cytotoxicity. These results facilitate understanding of the physiological role of bacterial ceramidase in host cells. PMID:27941831
Henriksson-Peltola, Petri; Sehlén, Wilhelmina; Haggård-Ljungquist, Elisabeth
2007-01-01
Bacteriophages P2, P2 Hy dis and WΦ are very similar but heteroimmune Escherichia coli phages. The structural genes show over 96% identity, but the repressors show between 43 and 63% identities. Furthermore, the operators, which contain two directly repeated sequences, vary in sequence, length, location relative to the promoter and spacing between the direct repeats. We have compared the in vivo effects of the wild type and mutated operators on gene expression with the complexes formed between the repressors and their wild type or mutated operators using electrophoretic mobility shift assay (EMSA), and real-time kinetics of the protein–DNA interactions using surface plasmon resonance (SPR) analysis. Using EMSA, the repressors formed different protein–DNA complexes, and only WΦ was significantly affected by point mutations. However, SPR analysis showed a reduced association rate constant and an increased dissociation rate constant for P2 and WΦ operator mutants. The association rate constants of P2 Hy dis was too fast to be determined. The P2 Hy dis dissociation response curves were shown to be triphasic, while both P2 and WΦ C were biphasic. Thus, the kinetics of complex formation and the nature of the complexes formed differ extensively between these very closely related phages. PMID:17412705
Palanisamy, Arun P; Suryakumar, Geetha; Panneerselvam, Kavin; Willey, Christopher D; Kuppuswamy, Dhandapani
2015-12-01
Early work in pressure overloaded (PO) myocardium shows that integrins mediate focal adhesion complex formation by recruiting the adaptor protein p130Cas (Cas) and nonreceptor tyrosine kinase c-Src. To explore c-Src role in Cas-associated changes during PO, we used a feline right ventricular in vivo PO model and a three-dimensional (3D) collagen-embedded adult cardiomyocyte in vitro model that utilizes a Gly-Arg-Gly-Asp-Ser (RGD) peptide for integrin stimulation. Cas showed slow electrophoretic mobility (band-shifting), recruitment to the cytoskeleton, and tyrosine phosphorylation at 165, 249, and 410 sites in both 48 h PO myocardium and 1 h RGD-stimulated cardiomyocytes. Adenoviral mediated expression of kinase inactive (negative) c-Src mutant with intact scaffold domains (KN-Src) in cardiomyocytes did not block the RGD stimulated changes in Cas. Furthermore, expression of KN-Src or kinase active c-Src mutant with intact scaffold function (A-Src) in two-dimensionally (2D) cultured cardiomyocytes was sufficient to cause Cas band-shifting, although tyrosine phosphorylation required A-Src. These data indicate that c-Src's adaptor function, but not its kinase function, is required for a serine/threonine specific phosphorylation(s) responsible for Cas band-shifting. To explore this possibility, Chinese hamster ovary cells that stably express Cas were infected with either β-gal or KN-Src adenoviruses and used for Cas immunoprecipitation combined with mass spectrometry analysis. In the KN-Src expressing cells, Cas showed phosphorylation at the serine-639 (human numbering) site. A polyclonal antibody raised against phospho-serine-639 detected Cas phosphorylation in 24-48 h PO myocardium. Our studies indicate that c-Src's adaptor function mediates serine-639 phosphorylation of Cas during integrin activation in PO myocardium. © 2015 Wiley Periodicals, Inc.
Flexible active-matrix displays and shift registers based on solution-processed organic transistors.
Gelinck, Gerwin H; Huitema, H Edzer A; van Veenendaal, Erik; Cantatore, Eugenio; Schrijnemakers, Laurens; van der Putten, Jan B P H; Geuns, Tom C T; Beenhakkers, Monique; Giesbers, Jacobus B; Huisman, Bart-Hendrik; Meijer, Eduard J; Benito, Estrella Mena; Touwslager, Fred J; Marsman, Albert W; van Rens, Bas J E; de Leeuw, Dago M
2004-02-01
At present, flexible displays are an important focus of research. Further development of large, flexible displays requires a cost-effective manufacturing process for the active-matrix backplane, which contains one transistor per pixel. One way to further reduce costs is to integrate (part of) the display drive circuitry, such as row shift registers, directly on the display substrate. Here, we demonstrate flexible active-matrix monochrome electrophoretic displays based on solution-processed organic transistors on 25-microm-thick polyimide substrates. The displays can be bent to a radius of 1 cm without significant loss in performance. Using the same process flow we prepared row shift registers. With 1,888 transistors, these are the largest organic integrated circuits reported to date. More importantly, the operating frequency of 5 kHz is sufficiently high to allow integration with the display operating at video speed. This work therefore represents a major step towards 'system-on-plastic'.
ERIC Educational Resources Information Center
Philip, Thomas M.; Garcia, Antero
2015-01-01
Mobile devices are increasingly upheld as powerful tools for learning and school reform. In this article, we prioritize youth voices to critically examine assumptions about student interest in mobile devices that often drive the incorporation of new technologies into schools. By demonstrating how the very meaning of mobile phones shift as they are…
Zinc adsorption effects on arsenite oxidation kinetics at the birnessite-water interface
Power, L.E.; Arai, Y.; Sparks, D.L.
2005-01-01
Arsenite is more toxic and mobile than As(V) in soil and sediment environments, and thus it is advantageous to explore factors that enhance oxidation of As(III) to As(V). Previous studies showed that manganese oxides, such as birnessite (??-MnO2), directly oxidized As(III). However, these studies did not explore the role that cation adsorption has on As(III) oxidation. Accordingly, the effects of adsorbed and nonadsorbed Zn on arsenite (As(III)) oxidation kinetics at the birnessite-water interface were investigated using batch adsorption experiments (0.1 g L-1; pH 4.5 and 6.0; I = 0.01 M NaCl). Divalent Zn adsorption on synthetic ??-MnO 2 in the absence of As(III) increased with increasing pH and caused positive shifts in electrophoretic mobility values at pH 4-6, indirectly suggesting inner-sphere Zn adsorption mechanisms. Arsenite was readily oxidized on birnessite in the absence of Zn. The initial As(III) oxidation rate constant decreased with increasing pH from 4.5 to 6.0 and initial As(III) concentrations from 100 to 300 ??M. Similar pH and initial As(III) concentration effects were observed in systems when Zn was present (i.e., presorbed Zn prior to As(III) addition and simultaneously added Zn-As(III) systems), but As(III) oxidation reactions were suppressed compared to the respective control systems. The suppression was more pronounced when Zn was presorbed on the ??-MnO 2 surfaces as opposed to added simultaneously with As(III). This study provides further understanding of As(III) oxidation reactions on manganese oxide surfaces under environmentally applicable conditions where metals compete for reactive sites.
Castro, Felipe D; Sedman, Jacqueline; Ismail, Ashraf A; Asadishad, Bahareh; Tufenkji, Nathalie
2010-06-01
The effects of dissolved oxygen tension during bacterial growth and acclimation on the cell surface properties and biochemical composition of the bacterial pathogens Escherichia coli O157:H7 and Yersinia enterocolitica are characterized. Three experimental techniques are used in an effort to understand the influence of bacterial growth and acclimation conditions on cell surface charge and the composition of the bacterial cell: (i) electrophoretic mobility measurements; (ii) potentiometric titration; and (iii) ATR-FTIR spectroscopy. Potentiometric titration data analyzed using chemical speciation software are related to measured electrophoretic mobilities at the pH of interest. Titration of bacterial cells is used to identify the major proton-active functional groups and the overall concentration of these cell surface ligands at the cell membrane. Analysis of titration data shows notable differences between strains and conditions, confirming the appropriateness of this tool for an overall charge characterization. ATR-FTIR spectroscopy of whole cells is used to further characterize the bacterial biochemical composition and macromolecular structures that might be involved in the development of the net surficial charge of the organisms examined. The evaluation of the integrated intensities of HPO(2)(-) and carbohydrate absorption bands in the IR spectra reveals clear differences between growth protocols. Taken together, the three techniques seem to indicate that the dissolved oxygen tension during cell growth or acclimation can noticeably influence the expression of cell surface molecules and the measurable cell surface charge, though in a strain-dependent fashion.
Ashikhmin, Aleksandr; Makhneva, Zoya; Bolshakov, Maksim; Moskalenko, Andrey
2017-05-01
Spheroidene and spheroidenone from the non-sulfur bacterium Rhodobacter (Rba.) sphaeroides were incorporated into diphenylamine (DPA) LH1-RC and LH2 complexes from sulfur bacteria Allochromatium (Alc.) minutissimum and Ectothiorhodospira (Ect.) haloalkaliphila in which carotenoid (Car) biosynthesis was inhibited by ~95%. A series of biochemical characteristics of the modified LH2 complexes was studied (electrophoretic mobility, absorption and CD spectra, Car composition, Car-to-BChl energy transfer and thermal stability). It was found that the electrophoretic mobility of the complexes with incorporated Cars did not change compared to that of the control and DPA-complexes, indicating the absence of any significant change in the structure of LH complexes upon DPA-treatment and subsequent incorporation of Cars. The analysis of fluorescence excitation spectra of the spheroidene-incorporated LH2 complex (LH2:sph) and the spheroidenone-incorporated LH2 complex (LH2:sph-ne) showed that spheroidene and spheroidenone exhibited relatively low efficiencies of energy transfer to BChl, when incorporated into the LH2 DPA-complexes from Alc. minutissimum and Ect. haloalkaliphila, although, they showed high efficiencies, being in their natural state in the LH2 complexes from Rba. sphaeroides. A significant increase in thermostability observed for the LH2:sph and LH2:sph-ne complexes with respect to the LH2 DPA-complexes indicated that the two incorporated Cars stabilized the structure of the LH2 complexes. Copyright © 2017 Elsevier B.V. All rights reserved.
Lazarus, Geraldine Genevive; Revaprasadu, Neerish; López-Viota, Julián; Singh, Moganavelli
2014-09-01
Gold nanoparticles have attracted strong biomedical interest for drug delivery due to their low toxic nature, surface plasmon resonance and capability of increasing the stability of the payload. However, gene transfection represents another important biological application. Considering that cellular barriers keep enclosed their secret to deliver genes using nanoparticles, an important step can be achieved by studying the functionalization of nanoparticles with DNA. In the present contribution the synthesis of nanoparticles consisting of a gold core coated with one or more layers of amino acid (l-lysine), and cationic polyelectrolytes (poly-ethyleneimine and poly-l-lysine) is reported. All nanoparticles were subjected to dynamic light scattering, electrophoretic mobility measurements, UV-vis optical spectrophotometry analysis and transmission electron microscopy imaging. In addition, the adsorption of DNA plasmid (pSGS) with linear and supercoiled configurations was studied for those gold nanoparticles under the most suitable surface modifications. Preliminary results showed that the gold nanoparticles functionalized with poly-ethyleneimine and poly-l-lysine, respectively, and bound to linear DNA configurations, present in absolute value a higher electrophoretic mobility irrespective of the pH of the media, compared to the supercoiled and nicked configuration. The findings from this study suggest that poly-ethyleneimine and poly-l-lysine functionalized gold nanoparticles are biocompatible and may be promising in the chemical design and future optimization of nanostructures for biomedical applications such as gene and drug delivery. Copyright © 2014 Elsevier B.V. All rights reserved.
d'Orlyé, Fanny; Varenne, Anne; Georgelin, Thomas; Siaugue, Jean-Michel; Teste, Bruno; Descroix, Stéphanie; Gareil, Pierre
2009-07-01
In view of employing functionalized nanoparticles (NPs) in the context of an immunodiagnostic, aminated maghemite/silica core/shell particles were synthesized so as to be further coated with an antibody or an antigen via the amino groups at their surface. Different functionalization rates were obtained by coating these maghemite/silica core/shell particles with 3-(aminopropyl)triethoxysilane and 2-[methoxy(polyethyleneoxy)propyl]-trimethoxysilane at different molar ratios. Adequate analytical performances with CE coupled with UV-visible detection were obtained through semi-permanent capillary coating with didodecyldimethyl-ammonium bromide, thus preventing particle adsorption. First, the influence of experimental conditions such as electric field strength, injected particle amount as well as electrolyte ionic strength and pH, was evaluated. A charge-dependent electrophoretic mobility was evidenced and the separation selectivity was tuned according to electrolyte ionic strength and pH. The best resolutions were obtained at pH 8.0, high ionic strength (ca. 100 mM), and low total particle volume fraction (ca. 0.055%), thus eliminating interference effects between different particle populations in mixtures. A protocol derived from Kaiser's original description was performed for quantitation of the primary amino groups attached onto the NP surface. Thereafter a correlation between particle electrophoretic mobility and the density of amino groups at their surface was established. Eventually, CE proved to be an easy, fast, and reliable method for the determination of NP effective surface charge density.
NASA Astrophysics Data System (ADS)
Engel, Nicole Y.; Weiss, Victor U.; Marchetti-Deschmann, Martina; Allmaier, Günter
2017-01-01
In order to better understand biological events, lectin-glycoprotein interactions are of interest. The possibility to gather more information than the mere positive or negative response for interactions brought mass spectrometry into the center of many research fields. The presented work shows the potential of a nano-electrospray gas-phase electrophoretic mobility molecular analyzer (nES GEMMA) to detect weak, noncovalent, biospecific interactions besides still unbound glycoproteins and unreacted lectins without prior liquid phase separation. First results for Sambucus nigra agglutinin, concanavalin A, and wheat germ agglutinin and their retained noncovalent interactions with glycoproteins in the gas phase are presented. Electrophoretic mobility diameters (EMDs) were obtained by nES GEMMA for all interaction partners correlating very well with molecular masses determined by matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS) of the individual molecules. Moreover, EMDs measured for the lectin-glycoprotein complexes were in good accordance with theoretically calculated mass values. Special focus was laid on complex formation for different lectin concentrations and binding specificities to evaluate the method with respect to results obtained in the liquid phase. The latter was addressed by capillary electrophoresis on-a-chip (CE-on-a-chip). Of exceptional interest was the fact that the formed complexes could be sampled according to their size onto nitrocellulose membranes after gas-phase separation. Subsequent immunological investigation further proved that the collected complex actually retained its native structure throughout nES GEMMA analysis and sampling.
Urey, Carlos; Weiss, Victor U; Gondikas, Andreas; von der Kammer, Frank; Hofmann, Thilo; Marchetti-Deschmann, Martina; Allmaier, Günter; Marko-Varga, György; Andersson, Roland
2016-11-20
For drug delivery, characterization of liposomes regarding size, particle number concentrations, occurrence of low-sized liposome artefacts and drug encapsulation are of importance to understand their pharmacodynamic properties. In our study, we aimed to demonstrate the applicability of nano Electrospray Gas-Phase Electrophoretic Mobility Molecular Analyser (nES GEMMA) as a suitable technique for analyzing these parameters. We measured number-based particle concentrations, identified differences in size between nominally identical liposomal samples, and detected the presence of low-diameter material which yielded bimodal particle size distributions. Subsequently, we compared these findings to dynamic light scattering (DLS) data and results from light scattering experiments coupled to Asymmetric Flow-Field Flow Fractionation (AF4), the latter improving the detectability of smaller particles in polydisperse samples due to a size separation step prior detection. However, the bimodal size distribution could not be detected due to method inherent limitations. In contrast, cryo transmission electron microscopy corroborated nES GEMMA results. Hence, gas-phase electrophoresis proved to be a versatile tool for liposome characterization as it could analyze both vesicle size and size distribution. Finally, a correlation of nES GEMMA results with cell viability experiments was carried out to demonstrate the importance of liposome batch-to-batch control as low-sized sample components possibly impact cell viability. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Physician satisfaction with a multi-platform digital scheduling system
Rocha, Leonardo Lima; Lima, Alex Heitor; Santiago, Caroline Reis Maia; Terra, Jose Cláudio Cyrineu; Dagan, Alon; Celi, Leo Anthony
2017-01-01
Objective Physician shift schedules are regularly created manually, using paper or a shared online spreadsheet. Mistakes are not unusual, leading to last minute scrambles to cover a shift. We developed a web-based shift scheduling system and a mobile application tool to facilitate both the monthly scheduling and shift exchanges between physicians. The primary objective was to compare physician satisfaction before and after the mobile application implementation. Methods Over a 9-month period, three surveys, using the 4-point Likert type scale were performed to assess the physician satisfaction. The first survey was conducted three months prior mobile application release, a second survey three months after implementation and the last survey six months after. Results 51 (77%) of the physicians answered the baseline survey. Of those, 32 (63%) were males with a mean age of 37.8 ± 5.5 years. Prior to the mobile application implementation, 36 (70%) of the responders were using more than one method to carry out shift exchanges and only 20 (40%) were using the official department report sheet to document shift exchanges. The second and third survey were answered by 48 (73%) physicians. Forty-eight (98%) of them found the mobile application easy or very easy to install and 47 (96%) did not want to go back to the previous method. Regarding physician satisfaction, at baseline 37% of the physicians were unsatisfied or very unsatisfied with shift scheduling. After the mobile application was implementation, only 4% reported being unsatisfied (OR = 0.11, p < 0.001). The satisfaction level improved from 63% to 96% between the first and the last survey. Satisfaction levels significantly increased between the three time points (OR = 13.33, p < 0.001). Conclusion Our web and mobile phone-based scheduling system resulted in better physician satisfaction. PMID:28328958
Physician satisfaction with a multi-platform digital scheduling system.
Deliberato, Rodrigo Octávio; Rocha, Leonardo Lima; Lima, Alex Heitor; Santiago, Caroline Reis Maia; Terra, Jose Cláudio Cyrineu; Dagan, Alon; Celi, Leo Anthony
2017-01-01
Physician shift schedules are regularly created manually, using paper or a shared online spreadsheet. Mistakes are not unusual, leading to last minute scrambles to cover a shift. We developed a web-based shift scheduling system and a mobile application tool to facilitate both the monthly scheduling and shift exchanges between physicians. The primary objective was to compare physician satisfaction before and after the mobile application implementation. Over a 9-month period, three surveys, using the 4-point Likert type scale were performed to assess the physician satisfaction. The first survey was conducted three months prior mobile application release, a second survey three months after implementation and the last survey six months after. 51 (77%) of the physicians answered the baseline survey. Of those, 32 (63%) were males with a mean age of 37.8 ± 5.5 years. Prior to the mobile application implementation, 36 (70%) of the responders were using more than one method to carry out shift exchanges and only 20 (40%) were using the official department report sheet to document shift exchanges. The second and third survey were answered by 48 (73%) physicians. Forty-eight (98%) of them found the mobile application easy or very easy to install and 47 (96%) did not want to go back to the previous method. Regarding physician satisfaction, at baseline 37% of the physicians were unsatisfied or very unsatisfied with shift scheduling. After the mobile application was implementation, only 4% reported being unsatisfied (OR = 0.11, p < 0.001). The satisfaction level improved from 63% to 96% between the first and the last survey. Satisfaction levels significantly increased between the three time points (OR = 13.33, p < 0.001). Our web and mobile phone-based scheduling system resulted in better physician satisfaction.
Yeh, Li-Hsien; Fang, Kuo-Ying; Hsu, Jyh-Ping; Tseng, Shiojenn
2011-12-01
The electrophoresis of a soft particle comprising a rigid core and a charged porous membrane layer in a narrow space is modeled. This simulates, for example, the capillary electrophoresis of biocolloids such as cells and microorganisms, and biosensor types of device. We show that, in addition to the boundary effect, the effects of double-layer polarization (DLP) and the electroosmotic retardation flow can be significant, yielding interesting electrophoretic behaviors. For example, if the friction coefficient of the membrane layer and/or the boundary is large, then the DLP effect can be offset by the electroosmotic retardation flow, making the particle mobility to decrease with increasing double layer thickness, which is qualitatively consistent with many experimental observations in the literature, but has not been explained clearly in previous analyses. In addition, depending upon the thickness of double layer, the friction of the membrane layer of a particle can either retard or accelerate its movement, an interesting result which has not been reported previously. This work is the first attempt to show solid evidence for the influence of a boundary on the effect of DLP and the electrophoretic behavior of soft particles. The model proposed is verified by the experimental data in the literature. The results of numerical simulation provide valuable information for the design of bio-analytical apparatus such as nanopore-based sensing applications and for the interpretation of relevant experimental data. Copyright © 2011 Elsevier B.V. All rights reserved.
Feltus, F A; Groner, B; Melner, M H
1999-07-01
Altered PRL levels are associated with infertility in women. Molecular targets at which PRL elicits these effects have yet to be determined. These studies demonstrate transcriptional regulation by PRL of the gene encoding the final enzymatic step in progesterone biosynthesis: 3beta-hydroxysteroid dehydrogenase/delta5-delta4 isomerase (3beta-HSD). A 9/9 match with the consensus Stat5 response element was identified at -110 to -118 in the human Type II 3beta-HSD promoter. 3beta-HSD chloramphenicol acetyltransferase (CAT) reporter constructs containing either an intact or mutated Stat5 element were tested for PRL activation. Expression vectors for Stat5 and the PRL receptor were cotransfected with a -300 --> +45 3beta-HSD CAT reporter construct into HeLa cells, which resulted in a 21-fold increase in reporter activity in the presence of PRL. Promoter activity showed an increased response with a stepwise elevation of transfected Stat5 expression or by treatment with increasing concentrations of PRL (max, 250 ng/ml). This effect was dramatically reduced when the putative Stat5 response element was removed by 5'-deletion of the promoter or by the introduction of a 3-bp mutation into critical nucleotides in the element. Furthermore, 32P-labeled promoter fragments containing the Stat5 element were shifted in electrophoretic mobility shift assay experiments using nuclear extracts from cells treated with PRL, and this complex was supershifted with antibodies to Stat5. These results demonstrate that PRL has the ability to regulate expression of a key human enzyme gene (type II 3beta-HSD) in the progesterone biosynthetic pathway, which is essential for maintaining pregnancy.
Ordovás, Laura; Roy, Rosa; Pampín, Sandra; Zaragoza, Pilar; Osta, Rosario; Rodríguez-Rey, Jose Carlos; Rodellar, Clementina
2008-07-15
Fatty acid synthase (FASN) is an enzyme that catalyzes de novo synthesis of fatty acids in cells. The bovine FASN gene maps to BTA 19, where several quantitative trait loci for fat-related traits have been described. Our group recently reported the identification of a single nucleotide polymorphism (SNP), g.763G>C, in the bovine FASN 5' flanking region that was significantly associated with milk fat content in dairy cattle. The g.763G>C SNP was part of a GC-rich region that may constitute a cis element for members of the Sp transcription factor family. Thus the SNP could alter the transcription factor binding ability of the FASN promoter and consequently affect the promoter activity of the gene. However, the functional consequences of the SNP on FASN gene expression are unknown. The present study was therefore directed at elucidating the underlying molecular mechanism that could explain the association of the SNP with milk fat content. Three cellular lines (3T3L1, HepG2, and MCF-7) were used to test the promoter and the transcription factor binding activities by luciferase reporter assays and electrophoretic mobility shift assays, respectively. Band shift assays were also carried out with nuclear extracts from lactating mammary gland (LMG) to further investigate the role of the SNP in this tissue. Our results demonstrate that the SNP alters the bovine FASN promoter activity in vitro and the Sp1/Sp3 binding ability of the sequence. In bovine LMG, the specific binding of Sp3 may account for the association with milk fat content.
De Castro-Orós, Isabel; Pampín, Sandra; Cofán, Montserrat; Mozas, Pilar; Pintó, Xavier; Salas-Salvadó, Jordi; Rodríguez-Rey, Jose C; Ros, Emilio; Civeira, Fernando; Pocoví, Miguel
2011-04-01
The bile acid pool influences intestinal cholesterol absorption because this process is strictly dependent on micellar solubilization, which is disrupted by plant sterols (PS). Plasma lipid variation relates to promoter variant -204A > C (rs3808607) of the CYP7A1 gene encoding for 7α-hydroxylase, an enzyme for bile acid synthesis. We hypothesized that this polymorphism would be associated with variability in lipid responses to PS. We investigated 67 subjects (31 AA and 36 AC + CC) with lipid responses to PS documented in two studies. To assess the functionality of the -204A > C variant, electrophoretic mobility gel shift assays were performed and luciferase reporter plasmids containing the promoter were transfected into HepG2 cells. Compared to AA-subjects, C-carriers showed significantly higher adjusted mean reductions in total cholesterol (0.14 versus 0.43 mmol/L, P = 0.042) and increases in lathosterol-to-cholesterol ratios (0.10 versus 0.75, P = 0.013). The C-construct caused a 78% promoter activity increase and gel-shift assays showed lower affinity for nuclear transcription factors, while in silico experiments predicted a binding site for inhibitory nuclear factors RXR-CAR. Results suggest that promoter -204A > C variant is associated with enhanced CYP7A1 activity. Increased intestinal bile acids and ensuing more efficient cholesterol absorption might explain why C-allele carriers show enhanced cholesterol lowering and increased feedback cholesterol synthesis to PS intervention. Copyright © 2010 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.
Freitas, F Zanolli; Bertolini, M C
2004-12-01
Glycogen synthase, an enzyme involved in glycogen biosynthesis, is regulated by phosphorylation and by the allosteric ligand glucose-6-phosphate (G6P). In addition, enzyme levels can be regulated by changes in gene expression. We recently cloned a cDNA for glycogen synthase ( gsn) from Neurospora crassa, and showed that gsn transcription decreased when cells were exposed to heat shock (shifted from 30 degrees C to 45 degrees C). In order to understand the mechanisms that control gsn expression, we isolated the gene, including its 5' and 3' flanking regions, from the genome of N. crassa. An ORF of approximately 2.4 kb was identified, which is interrupted by four small introns (II-V). Intron I (482 bp) is located in the 5'UTR region. Three putative Transcription Initiation Sites (TISs) were mapped, one of which lies downstream of a canonical TATA-box sequence (5'-TGTATAAA-3'). Analysis of the 5'-flanking region revealed the presence of putative transcription factor-binding sites, including Heat Shock Elements (HSEs) and STress Responsive Elements (STREs). The possible involvement of these motifs in the negative regulation of gsn transcription was investigated using Electrophoretic Mobility Shift Assays (EMSA) with nuclear extracts of N. crassa mycelium obtained before and after heat shock, and DNA fragments encompassing HSE and STRE elements from the 5'-flanking region. While elements within the promoter region are involved in transcription under heat shock, elements in the 5'UTR intron may participate in transcription during vegetative growth. The results thus suggest that N. crassa possesses trans -acting elements that interact with the 5'-flanking region to regulate gsn transcription during heat shock and vegetative growth.
Beckenbach, Andrew T.; Prakash, Satya
1977-01-01
Recently a number of electrophoretic techniques have been applied to reveal the presence of additional genetic variation among the electrophoretic mobility classes of the highly polymorphic xanthine dehydrogenase (XDH ) and esterase-5 (est-5) loci. We examined the hexokinase loci of Drosophila pseudoobscura and D. persimilis using a variety of techniques to determine whether further allelic variation could be revealed for these much less polymorphic loci and to analyze the nature of the known variation at the hexokinase-1 (hex-1) locus. The following studies were conducted: 135 strains of the two species from six localities were examined with buffer pH ranging from 5.5 to 10.0; 40 strains of D. pseudoobscura and 9 strains of D. persimilis from Mather were studied using starch gel concentrations ranging from 8.5 to 15.5% and were examined for differences in heat stability and reactivity to the thiol reagent pCMSA; strains were also tested for susceptibility to urea denaturation and differences in relative activities. Major findings of the work are: (1) No additional allelic variation could be detected at any of the hexokinase loci by applying these techniques. The finding of abundant hidden genetic variation in XDH and est-5 does not extend to all enzyme loci. (2) Evidence from studies using pCMSA indicates that the hex-1 alleles 0.6, 0.8, 1.0 and 1.2 of the two species form a series of unit charge steps. Since the 0.94 allele of D. persimilis has mobility intermediate between 0.8 and 1.0, it is argued that routine electrophoretic techniques are sensitive to at least some conservative amino acid substitutions. (3) Strong correlations were found at the hex-1 locus between low allelic frequency, reduced relative activity and reduced stability to heat and urea denaturation. Since the three sibling species, D. pseudoobscura, D. persimilis and D. miranda, all appear to share a common high frequency allele (1.0) at that locus, these findings are taken as evidence that the observed allelic frequencies are a result of directional selection and mutation, rather than any form of balancing selection. PMID:17248785
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wirth, Mary J
Solar energy conversion through biology would provide a renewable and nonpolluting abundance of energy. The bacterium Halobacterium salinarum converts solar to electrical energy by virtue of a transmembrane protein, bacteriorhodopsin. This transmembrane protein pumps protons across a nonconducting bilayer upon irradiation with green light. The bacterium evolved to perform this function inefficiently. If we were able to understand this process to engineer this protein for efficiency, then inexpensive energy production could be achieved. There are tens of thousands of different types of halobacteria, giving the opportunity to study different efficiencies and relating these to the protein structures. Technology does notmore » yet exist to perform such screening. The goal of this research is to generate new separation technology that can ultimately enable such screening. This involves creating a method for separating oriented and functional transmembrane proteins that remain in an electrically insulating lipid bilayer, with aqueous solutions on either side of the bilayer. A pH change across the lipid bilayer upon irradiation of a known concentration of proteins would probe function. Differences in proton pumping efficiency for different proteins variants would provide structure-function information for engineering the proteins. A schematic diagram from the original proposal is shown here. The idea is that (a) a lipid bilayer supported on a hydrophilic polymer film will make the bilayer fluid, and (b) applying an electric field will cause electrophoretic migration of the transmembrane proteins. We demonstrated this concept experimentally in a paper that was published just after this new grant period started (Lipid Bilayers on Polyacrylamide Brushes for Inclusion of Membrane Proteins, Emily A. Smith, Jason W. Coym, Scott M. Cowell, Victor J. Hruby, Henry I. Yamamura, Mary J. Wirth, Langmuir, 21, 9644-9650, 2005). The electrophoretic mobility was slow (10{sup -8} cm{sup 2}/Vs), and we project that a two order of magnitude increase would make this a practical tool. We are investigating two ways of improving electrophoretic mobility: better polymer supports, and a novel nanoporous medium that suspends the bilayer over free solution.« less
An Investigation of Traveling-Wave Electrophoresis using a Trigonometric Potential
NASA Astrophysics Data System (ADS)
Vopal, James
Traveling-wave electrophoresis, a technique for microfluidic separations in lab-on-achip devices, is investigated using a trigonometric model that naturally incorporates the spatial periodicity of the device. Traveling-wave electrophoresis can be used to separate high-mobility ions from low-mobility ions in forensic and medical applications, with a separation threshold that can be tuned for specific applications by simply choosing the traveling wave frequency. Our simulations predict plateaus in the average ion velocity verses the mobility, plateaus that correspond to Farey fractions and yield Devil's staircases for non-zero discreteness values. The plateaus indicate that ions with different mobilities can travel with the same average velocity. To determine the conditions for chaos, Lyapunov exponents and contact maps are employed. Through the use of contact maps, the chaotic trajectories are determined to be either narrowband or broadband. Narrowband chaotic trajectories are exhibited in the plateaus of the average velocity, while broadband chaotic trajectories are exhibited where the average velocity varies nonmonotonically with the mobility. Narrowband chaos will be investigated in future work incorporating the role of diffusion. The results of this and future work can be used to develop new tools for electrophoretic separation.
Qian, Cheng; Kovalchik, Kevin A; MacLennan, Matthew S; Huang, Xiaohua; Chen, David D Y
2017-06-01
Capillary electrophoresis frontal analysis (CE-FA) can be used to determine binding affinity of molecular interactions. However, its current data processing method mandate specific requirement on the mobilities of the binding pair in order to obtain accurate binding constants. This work shows that significant errors are resulted when the mobilities of the interacting species do not meet these requirements. Therefore, the applicability of CE-FA in many real word applications becomes questionable. An electrophoretic mobility-based correction method is developed in this work based on the flux of each species. A simulation program and a pair of model compounds are used to verify the new equations and evaluate the effectiveness of this method. Ibuprofen and hydroxypropyl-β-cyclodextrinare used to demonstrate the differences in the obtained binding constant by CE-FA when different calculation methods are used, and the results are compared with those obtained by affinity capillary electrophoresis (ACE). The results suggest that CE-FA, with the mobility-based correction method, can be a generally applicable method for a much wider range of applications. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
de la Fuente-Gonzalo, Félix; Nieto, Jorge M; Velasco, Diego; Cela, Elena; Pérez, Germán; Fernández-Teijeiro, Ana; Escudero, Antonio; Villegas, Ana; González-Fernández, Fernando A; Ropero, Paloma
2016-04-01
Structural hemoglobinopathies do not usually have a clinical impact, but they can interfere with the analytical determination of some parameters, such as the glycated hemoglobin in diabetic patients. Thalassemias represent a serious health problem in areas where their incidence is high. The defects in the post-translational modifications produce hyper-unstable hemoglobin that is not detected by most of electrophoretic or chromatographic methods that are available so far. We studied seven patients who belong to six unrelated families. The first two families were studied because they had peak abnormal hemoglobin (Hb) during routine analytical assays. The other four families were studied because they had microcytosis and hypochromia with normal HbA2 and HbF without iron deficiency. HbA2 and F quantification and abnormal Hb separation were performed by chromatographic and electrophoretic methods. The molecular characterization was performed using specific sequencing. The Hb Puerta del Sol presents electrophoretic mobility and elution in HPLC that is different from HbA and similar to HbS. The electrophoretic and chromatographic profiles of the four other variants are normal and do not show any anomalies, and their identification was only possible with sequencing. Some variants, such as Hb Valdecilla, Hb Gran Vía, Hb Macarena and Hb El Retiro, have significant clinical impact when they are associated with other forms of α-thalassemia, which could lead to more serious forms of this group of pathologies as for HbH disease. Therefore, it is important to maintain an adequate program for screening these diseases in countries where the prevalence is high to prevent the occurrence of severe forms.
Using a Smart City IoT to Incentivise and Target Shifts in Mobility Behaviour—Is It a Piece of Pie?
Poslad, Stefan; Ma, Athen; Wang, Zhenchen; Mei, Haibo
2015-01-01
Whilst there is an increasing capability to instrument smart cities using fixed and mobile sensors to produce the big data to better understand and manage transportation use, there still exists a wide gap between the sustainability goals of smart cities, e.g., to promote less private car use at peak times, with respect to their ability to more dynamically support individualised shifts in multi-modal transportation use to help achieve such goals. We describe the development of the tripzoom system developed as part of the SUNSET—SUstainable social Network SErvices for Transport—project to research and develop a mobile and fixed traffic sensor system to help facilitate individual mobility shifts. Its main novelty was its ability to use mobile sensors to classify common multiple urban transportation modes, to generate information-rich individual and group mobility profiles and to couple this with the use of a targeted incentivised marketplace to gamify travel. This helps to promote mobility shifts towards achieving sustainability goals. This system was trialled in three European country cities operated as Living Labs over six months. Our main findings were that we were able to accomplish a level of behavioural shifts in travel behaviour. Hence, we have provided a proof-of-concept system that uses positive incentives to change individual travel behaviour. PMID:26053752
Using a Smart City IoT to Incentivise and Target Shifts in Mobility Behaviour--Is It a Piece of Pie?
Poslad, Stefan; Ma, Athen; Wang, Zhenchen; Mei, Haibo
2015-06-04
Whilst there is an increasing capability to instrument smart cities using fixed and mobile sensors to produce the big data to better understand and manage transportation use, there still exists a wide gap between the sustainability goals of smart cities, e.g., to promote less private car use at peak times, with respect to their ability to more dynamically support individualised shifts in multi-modal transportation use to help achieve such goals. We describe the development of the tripzoom system developed as part of the SUNSET-SUstainable social Network SErvices for Transport-project to research and develop a mobile and fixed traffic sensor system to help facilitate individual mobility shifts. Its main novelty was its ability to use mobile sensors to classify common multiple urban transportation modes, to generate information-rich individual and group mobility profiles and to couple this with the use of a targeted incentivised marketplace to gamify travel. This helps to promote mobility shifts towards achieving sustainability goals. This system was trialled in three European country cities operated as Living Labs over six months. Our main findings were that we were able to accomplish a level of behavioural shifts in travel behaviour. Hence, we have provided a proof-of-concept system that uses positive incentives to change individual travel behaviour.
Method for Single-Cell Mass and Electrophoretic Mobility Measurement
2010-02-01
Staphylococcus Aureus . The species of the contaminant was determined by catalase test and visual comparison with cultured S. Epidermidis. In this experiment...mnicron’crtrVs)) Corrected EPM Hatogam for teratior 2 d) p 0.3 10 I EPM ((rii n*cmy(V**)) CO, ?rz A ) WO Buoyart Mass vs. EPM forSuspected S. Aureus . 583 V...2 -1 E PM ((n cror*crnYC*) Cxnected EPM His-ograrr for Suspected S. Aureus at - - 332 V/cm EPM ((rnicron*cmY(V’s)) Figure 5-3: Integrated measurements
Failure to Confirm the Macrophage Electrophoretic Mobility Test in Cancer
Forrester, J. A.; Dando, P. M.; Smith, W. J.; Turberville, C.
1977-01-01
A series of patients with a variety of histopathologically confirmed cancers have been examined using the MOD-MEM test as described by Pritchard et al. (1973). Despite the closest possible adherence to the experimental protocols recommended by these authors, no positive reactions to the test were observed in this series: neither were we able to demonstrate the release of a “macrophage-slowing factor” by a panel of normal donors when challenged with tubercle PPD. We conclude that the test has no present application to the diagnosis of cancer.
Barron, Annelise
2002-01-01
Polyamides comprising at least one hydrophilic C.sub.1 -C.sub.10 hydrocarbyl substituent on an amide nitrogen atom, and methods for producing and using the same is provided. In particular, polyamides of the formula: ##STR1## and methods for using the same for altering the ratio of charge/translational frictional drag of binding polymers to allow electrophoretic separation of polynucleotides or analogs thereof in a non-sieving liquid medium is provided, where a, q, L.sup.1, P.sup.1, Q.sup.1, R, R.sup.1, R.sup.10 and R.sup.11 are those described herein.
Barron, Annelise E.
2004-04-20
Polyamides comprising at least one hydrophilic C.sub.1 -C.sub.10 hydrocarbyl substituent on an amide nitrogen atom, and methods for producing and using the same is provided. In particular, polyamides of the formula: ##STR1## and methods for using the same for altering the ratio of charge/translational frictional drag of binding polymers to allow electrophoretic separation of polynucleotides or analogs thereof in a non-sieving liquid medium is provided, where a, q, L.sup.1, P.sup.1, Q.sup.1, R, R.sup.1, R.sup.10 and R.sup.11 are those described herein.
Volkova, P Yu; Geras'kin, S A; Horemans, N; Makarenko, E S; Saenen, E; Duarte, G T; Nauts, R; Bondarenko, V S; Jacobs, G; Voorspoels, S; Kudin, M
2018-01-01
Genetic and epigenetic changes were investigated in chronically irradiated Scots pine (Pinus sylvestris L.) populations from territories that were heavily contaminated by radionuclides as result of the Chernobyl Nuclear Power Plant accident. In comparison to the reference site, the genetic diversity revealed by electrophoretic mobility of AFLPs was found to be significantly higher at the radioactively contaminated areas. In addition, the genome of pine trees was significantly hypermethylated at 4 of the 7 affected sites. Copyright © 2017 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rayas-Solis, P.
Great Northern bean (Phaseolus vulgaris L.) drum dried flours at native pH of 6.54, pH 6 and 7 showed reduced activities of trypsin inhibitor, ..cap alpha..-amylase inhibitor, hemagglutinating titer, and nitrogen solubility. Electrophoretic analyses showed a slight modification of the native bean proteins, and the presence of at least four trypsin inhibitors. The study of the effect of 2.5-20 kGy irradiation doses on Great Northern beans showed essentially no modification of the electrophoretic mobility of the storage proteins or the trypsin inhibitors. Nitrogen solubility and hemagglutinating activity were essentially unchanged. With the 20 kGy dose, decrease in ..cap alpha..-amylase inhibitormore » activity, decrease reactive/available lysine content, and decrease cooking time of the irradiated beans after 11 months of storage were observed. Taste panel results indicated that the control and 20 kGy irradiated bean were significantly different at 5% level. At 20 kGy dose, the beans developed a partially water soluble brown color.« less
Simulating Electrophoresis with Discrete Charge and Drag
NASA Astrophysics Data System (ADS)
Mowitz, Aaron J.; Witten, Thomas A.
A charged asymmetric rigid cluster of colloidal particles in saline solution can respond in exotic ways to an electric field: it may spin or move transversely. These distinctive motions arise from the drag force of the neutralizing countercharge surrounding the cluster. Because of this drag, calculating the motion of arbitrary asymmetric objects with nonuniform charge is impractical by conventional methods. Here we present a new method of simulating electrophoresis, in which we replace the continuous object and the surrounding countercharge with discrete point-draggers, called Stokeslets. The balance of forces imposes a linear, self-consistent relation among the drag and Coulomb forces on the Stokeslets, which allows us to easily determine the object's motion via matrix inversion. By explicitly enforcing charge+countercharge neutrality, the simulation recovers the distinctive features of electrophoretic motion to few-percent accuracy using as few as 1000 Stokeslets. In particular, for uniformly charged objects, we observe the characteristic Smoluchowski independence of mobility on object size and shape. We then discuss electrophoretic motion of asymmetric objects, where our simulation method is particularly advantageous. This work is supported by a Grant from the US-Israel Binational Science Foundation.
On-chip isothermal, chemical cycling polymerase chain reaction (ccPCR)
NASA Astrophysics Data System (ADS)
Persat, Alexandre; Santiago, Juan
2008-11-01
We demonstrate a novel ccPCR technique for microfluidic DNA amplification where temperature is held constant in space and time. The polymerase chain reaction is a platform of choice for biological assays and typically based on a three-step thermal cycling: DNA denaturation, primers annealing and extension by an enzyme. We here demonstrate a novel technique where high concentration chemical denaturants (solvents) denature DNA. We leverage the high electrophoretic mobility of DNA and the electrical neutrality of denaturants to achieve chemical cycling. We focus DNA with isotachophoresis (ITP); a robust electrophoretic preconcentration technique which generates strong electric field gradients and protects the sample from dispersion. We apply a pressure-driven flow to balance electromigration velocity and keep the DNA sample stationary in a microchannel. We drive the DNA through a series of high denaturant concentration zones. DNA denatures at high denaturant concentration. At low denaturant concentration, the enzyme creates complementary strands. DNA reaction kinetics are slower than buffer reactions involved in ITP. We demonstrate successful ccPCR amplification for detection of E. Coli. The ccPCR has the potential for simpler chemistry than traditional PCR.
NASA Astrophysics Data System (ADS)
Frants, E. A.; Ganchenko, G. S.; Shelistov, V. S.; Amiroudine, S.; Demekhin, E. A.
2018-02-01
Electrokinetics and the movement of charge-selective micro-granules in an electrolyte solution under the influence of an external electric field are investigated theoretically. Straightforward perturbation analysis is applied to a thin electric double layer and a weak external field, while a numerical solution is used for moderate electric fields. The asymptotic solution enables the determination of the salt concentration, electric charge distribution, and electro-osmotic velocity fields. It may also be used to obtain a simple analytical formula for the electrophoretic velocity in the case of quasi-equilibrium electrophoresis (electrophoresis of the first kind). This formula differs from the famous Helmholtz-Smoluchowski relation, which applies to dielectric microparticles, but not to ion-selective granules. Numerical calculations are used to validate the derived formula for weak external electric fields, but for moderate fields, nonlinear effects lead to a significant increase in electrophoretic mobility and to a transition from quasi-equilibrium electrophoresis of the first kind to nonequilibrium electrophoresis of the second kind. Theoretical results are successfully compared with experimental data.
Gel electrophoresis of linear and star-branched DNA
NASA Astrophysics Data System (ADS)
Lau, Henry W.; Archer, Lynden A.
2011-12-01
The electrophoretic mobility of double-stranded DNA in polyacrylamide gel is investigated using an activated hopping model for the transport of a charged object within a heterogeneous medium. The model is premised upon a representation of the DNA path through the gel matrix as a series of traps with alternating large and small cross sections. Calculations of the trap dimensions from gel data show that the path imposes varying degrees of confinement upon migrating analytes, which retard their forward motion in a size-dependent manner. An expression derived for DNA mobility is shown to provide accurate predictions for the dynamics of linear DNA (67-622 bp) in gels of multiple concentrations. For star-branched DNA, the incorporation within the model of a length scale previously proposed to account for analyte architecture [Yuan , Anal. Chem.ANCHAM0003-270010.1021/ac060414w 78, 6179 (2006)] leads to mobility predictions that compare well with experimental results for a wide range of DNA shapes and molecular weights.
Dopamine-imprinted monolithic column for capillary electrochromatography.
Aşır, Süleyman; Sarı, Duygu; Derazshamshir, Ali; Yılmaz, Fatma; Şarkaya, Koray; Denizli, Adil
2017-11-01
A dopamine-imprinted monolithic column was prepared and used in capillary electrochromatography as stationary phase for the first time. Dopamine was selectively separated from aqueous solution containing the competitor molecule norepinephrine, which is similar in size and shape to the template molecule. Morphology of the dopamine-imprinted column was observed by scanning electron microscopy. The influence of the organic solvent content of mobile phase, applied pressure and pH of the mobile phase on the recognition of dopamine by the imprinted monolithic column has been evaluated, and the imprinting effect in the dopamine-imprinted monolithic polymer was verified. Developed dopamine-imprinted monolithic column resulted in excellent separation of dopamine from structurally related competitor molecule, norepinephrine. Separation was achieved in a short period of 10 min, with the electrophoretic mobility of 5.81 × 10 -5 m 2 V -1 s -1 at pH 5.0 and 500 mbar pressure. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Cell Partition in Two Polymer Aqueous Phases
NASA Technical Reports Server (NTRS)
Brooks, D. E.
1985-01-01
In a reduced gravity environment the two polymer phases will not separate via density driven settling in an acceptably short length of time. It is to be expected that a certain amount of phase separation will take place, however, driven by the reduction in free energy gained when the interfacial area is reduced. This stage of separation process will therefore depend directly on the magnitude of the interfacial tension between the phases. In order to induce complete phase separation in a short time, electric field-induced separation which occurs because the droplets of one phase in the other have high electrophoretic mobilities which increase with droplet size was investigated. These mobilities are significant only in the presence of certain salts, particularly phosphates. The presence of such salts, in turn has a strong effect on the cell partition behavior in dextran-poly (ethylene glycol) (PEG) systems. The addition of the salts necessary to produce phase drop mobilities has a large effect on the interfacial tensions in the systems.
Influence of ion sterics on diffusiophoresis and electrophoresis in concentrated electrolytes
NASA Astrophysics Data System (ADS)
Stout, Robert F.; Khair, Aditya S.
2017-01-01
We quantify the diffusiophoresis and electrophoresis of a uniformly charged, spherical colloid in a binary electrolyte using modified Poisson-Nernst-Planck equations that account for steric repulsion between finite sized ions. Specifically, we utilize the Bikerman (Bik) lattice gas model and the Carnahan-Starling (CS) and Boublik-Mansoori-Carnahan-Starling-Leland (BMCSL) equations of state for monodisperse and polydisperse, respectively, hard spheres. We compute the phoretic mobility for weak applied fields using an asymptotic approach for thin diffuse layers, where ion steric effects are expected to be most prevalent. The thin diffuse layer limit requires λD/R →0 , where λD is the Debye screening length and R is the particle radius; this limit is readily attained for micron-sized colloids in concentrated electrolytic solutions. It is well known that the classic Poisson-Boltzmann (PB) model for pointlike, noninteracting ions leads to a prediction of a maximum in both the diffusiophoretic and electrophoretic mobilities with increasing particle zeta potential (at fixed λD/R ). In contrast, we find that ion sterics essentially eliminate this maximum (for reasonably attainable zeta potentials) and increase the mobility relative to PB. Next, we consider the more experimentally relevant case of a particle with a constant surface charge density and vary the electrolyte concentration, neglecting charge regulation on surface active sites. Rather surprisingly, there is little difference between the predictions of the four models (PB, Bik, CS, and BMCSL) for electrophoretic mobility in concentrated solutions, at reasonable surface charge densities (˜1 -10 μ C /cm2 ). This is because as the concentration increases, the zeta potential is reduced (to below the thermal voltage for concentrations above about 1 M) and therefore the diffuse layer structure is largely unaffected by ion sterics. For gradients of symmetric electrolytes (equal diffusivities, charge, and size) diffusiophoresis is also essentially unaffected by ion sterics, with a mobility that approaches zero with increasing concentration, just as in electrophoresis. For gradients of asymmetric electrolytes, the difference in diffusivities of the cation and anions leads to an induced electric field that acts on the charged particle. Importantly, we show that ion sterics leads to an excess contribution to the induced electric field, which increases rapidly with concentration. This increase overwhelms the accompanying decrease in zeta potential. The result is the diffusiophoretic mobility increases with concentration, rather than approaching zero. Therefore, diffusiophoresis could be an appealing alternative transport mechanism to electrophoresis in concentrated electrolyte solutions.
Ai, Ye; Joo, Sang W; Jiang, Yingtao; Xuan, Xiangchun; Qian, Shizhi
2009-07-01
Transient electrophoretic motion of a charged particle through a converging-diverging microchannel is studied by solving the coupled system of the Navier-Stokes equations for fluid flow and the Laplace equation for electrical field with an arbitrary Lagrangian-Eulerian finite-element method. A spatially non-uniform electric field is induced in the converging-diverging section, which gives rise to a direct current dielectrophoretic (DEP) force in addition to the electrostatic force acting on the charged particle. As a sequence, the symmetry of the particle velocity and trajectory with respect to the throat is broken. We demonstrate that the predicted particle trajectory shifts due to DEP show quantitative agreements with the existing experimental data. Although converging-diverging microchannels can be used for super fast electrophoresis due to the enhancement of the local electric field, it is shown that large particles may be blocked due to the induced DEP force, which thus must be taken into account in the study of electrophoresis in microfluidic devices where non-uniform electric fields are present.
HMGB1 in Cancer: Good, Bad, or Both?
Kang, Rui; Zhang, Qiuhong; Zeh, Herbert J.; Lotze, Michael T.; Tang, Daolin
2013-01-01
Forty years ago, high mobility group box 1 (HMGB1) was discovered in calf thymus and named according to its electrophoretic mobility in polyacrylamide gels. Now, we know that HMGB1 performs dual functions. Inside the cell, HMGB1 is a highly conserved chromosomal protein acting as a DNA chaperone. Outside of the cell, HMGB1 is a prototypical damage-associated molecular pattern, acting with cytokine, chemokine, and growth factor. During tumor development and in cancer therapy, HMGB1 has been reported to play paradoxical roles in promoting both cell survival and death by regulating multiple signaling pathways, including inflammation, immunity, genome stability, proliferation, metastasis, metabolism, apoptosis, and autophagy. Here, we review the current knowledge of both HMGB1’s oncogenic and tumor suppressive roles and the potential strategies that target HMGB1 for the prevention and treatment of cancer. PMID:23723299
Burns, J W; Chen, D; Estes, M K; Ramig, R F
1989-04-01
We have studied a variant virus isolated from a stock of SA11 virus (H. G. Pereira, R. S. Azeredo, A. M. Fialho, and M. N. P. Vidal, 1984, J. Gen. Virol. 65, 815-818). This virus, designated 4F, was initially identified by its faster electrophoretic mobility for genome segment 4. The variant was analyzed to determine if the altered electrophoretic mobility of genome segment 4 could be correlated with phenotypic changes. Comparison of our standard laboratory SA11 virus (clone 3) with the 4F variant showed the following: (i) The 4F variant possesses a viral hemagglutinin (VP4) with a higher apparent molecular weight than clone 3. (ii) The 4F variant produces large plaques when assayed in vitro, as compared to clone 3. (iii) The 4F variant produces plaques in the absence of proteolytic enzymes, whereas clone 3 does not. (iv) The 4F variant reacts with serotype-specific neutralizing monoclonal antibodies to VP7, but fails to react with several neutralizing anti-VP4 monoclonal antibodies generated to SA11 clone 3. (v) The 4F variant grows to a higher titer and is more stable than clone 3. (vi) The 4F variant produces a VP4 that appears to be more susceptible to cleavage by trypsin than is the VP4 of clone 3. Further analyses with the 4F variant may lead to an understanding of the molecular basis for these altered phenotypes that appear to be related, at least in part, to the product of genome segment 4.
Riesová, Martina; Svobodová, Jana; Ušelová, Kateřina; Tošner, Zdeněk; Zusková, Iva; Gaš, Bohuslav
2014-10-17
In this paper we determine acid dissociation constants, limiting ionic mobilities, complexation constants with β-cyclodextrin or heptakis(2,3,6-tri-O-methyl)-β-cyclodextrin, and mobilities of resulting complexes of profens, using capillary zone electrophoresis and affinity capillary electrophoresis. Complexation parameters are determined for both neutral and fully charged forms of profens and further corrected for actual ionic strength and variable viscosity in order to obtain thermodynamic values of complexation constants. The accuracy of obtained complexation parameters is verified by multidimensional nonlinear regression of affinity capillary electrophoretic data, which provides the acid dissociation and complexation parameters within one set of measurements, and by NMR technique. A good agreement among all discussed methods was obtained. Determined complexation parameters were used as input parameters for simulations of electrophoretic separation of profens by Simul 5 Complex. An excellent agreement of experimental and simulated results was achieved in terms of positions, shapes, and amplitudes of analyte peaks, confirming the applicability of Simul 5 Complex to complex systems, and accuracy of obtained physical-chemical constants. Simultaneously, we were able to demonstrate the influence of electromigration dispersion on the separation efficiency, which is not possible using the common theoretical approaches, and predict the electromigration order reversals of profen peaks. We have shown that determined acid dissociation and complexation parameters in combination with tool Simul 5 Complex software can be used for optimization of separation conditions in capillary electrophoresis. Copyright © 2014 Elsevier B.V. All rights reserved.
Low-power bacteriorhodopsin-silicon n-channel metal-oxide field-effect transistor photoreceiver.
Shin, Jonghyun; Bhattacharya, Pallab; Yuan, Hao-Chih; Ma, Zhenqiang; Váró, György
2007-03-01
A bacteriorhodopsin (bR)-silicon n-channel metal-oxide field-effect transistor (NMOSFET) monolithically integrated photoreceiver is demonstrated. The bR film is selectively formed on an external gate electrode of the transistor by electrophoretic deposition. A modified biasing circuit is incorporated, which helps to match the resistance of the bR film to the input impedance of the NMOSFET and to shift the operating point of the transistor to coincide with the maximum gain. The photoreceiver exhibits a responsivity of 4.7 mA/W.
[Mechanisms for effect of osthole on inhibiting the growth and invasion of bladder cancer cells].
Liu, Jun; Xu, Ran; Zhao, Xiaokun
2016-04-01
To investigate the effect of osthole on epidermal growth factor receptor tyrosine kinase (EGFR-TPK), matrix-metalloproteinase-2 (MMP-2), aminopeptidase N (APN) in bladder cancer cell and the underlying mechanism. The T24 cell lines were cultured. The inhibitory effects of osthole on EGFR-TPK, APN and MMP-2 were evaluated by spectrophotometric and MTT assay. The caspase-3 activity and the expression COX-2 and VEGF in T24 were examined. The activity of NF-κB was determined by electrophoretic mobility shift assay. The half inhibition concentrations (IC50) of osthole on EGFR-TPK, APN and MMP-2 were (45.33±3.98), (28.21±3.23) and (8.11±0.54) µmol/L, respectively. The growth inhibitory rates for T24 cells were increased in a dose-dependent manner (P<0.05). The caspase-3 activities were significantly increased in T24 cells in the osthole group compared with control group, while the expression of angiogenesis related-protein COX-2, VEGF, and NF-κB in T24 cells were decreased. Through the inhibitory effect on EGFR-TPK, APN and MMP-2, osthole can decrease COX-2, VEGF and NF-κB expression while increase the activity of caspase-3, eventually blocking the growth and invasion of bladder cancer cell.
Maier, Holly; Colbert, Jeff; Fitzsimmons, Daniel; Clark, Dawn R.; Hagman, James
2003-01-01
Methylation of cytosine in CpG dinucleotides promotes transcriptional repression in mammals by blocking transcription factor binding and recruiting methyl-binding proteins that initiate chromatin remodeling. Here, we use a novel cell-based system to show that retrovirally expressed Pax-5 protein activates endogenous early B-cell-specific mb-1 genes in plasmacytoma cells, but only when the promoter is hypomethylated. CpG methylation does not directly affect binding of the promoter by Pax-5. Instead, methylation of an adjacent CpG interferes with assembly of ternary complexes comprising Pax-5 and Ets proteins. In electrophoretic mobility shift assays, recruitment of Ets-1 is blocked by methylation of the Ets site (5′CCGGAG) on the antisense strand. In transfection assays, selective methylation of a single CpG within the Pax-5-dependent Ets site greatly reduces mb-1 promoter activity. Prior demethylation of the endogenous mb-1 promoter is required for its activation by Pax-5 in transduced cells. Although B-lineage cells have only unmethylated mb-1 genes and do not modulate methylation of the mb-1 promoter during development, other tissues feature high percentages of methylated alleles. Together, these studies demonstrate a novel DNA methylation-dependent mechanism for regulating transcriptional activity through the inhibition of DNA-dependent protein-protein interactions. PMID:12612069
Han, Yuanji; Wu, Miao; Cao, Liya; Yuan, Wangjun; Dong, Meifang; Wang, Xiaohui; Chen, Weicai; Shang, Fude
2016-07-01
The sweet osmanthus carotenoid cleavage dioxygenase 4 (OfCCD4) cleaves carotenoids such as β-carotene and zeaxanthin to yield β-ionone. OfCCD4 is a member of the CCD gene family, and its promoter contains a W-box palindrome with two reversely oriented TGAC repeats, which are the proposed binding sites of WRKY transcription factors. We isolated three WRKY cDNAs from the petal of Osmanthus fragrans. One of them, OfWRKY3, encodes a protein containing two WRKY domains and two zinc finger motifs. OfWRKY3 and OfCCD4 had nearly identical expression profile in petals of 'Dangui' and 'Yingui' at different flowering stages and showed similar expression patterns in petals treated by salicylic acid, jasmonic acid and abscisic acid. Activation of OfCCD4pro:GUS by OfWRKY3 was detected in coinfiltrated tobacco leaves and very weak GUS activity was detected in control tissues, indicating that OfWRKY3 can interact with the OfCCD4 promoter. Yeast one-hybrid and electrophoretic mobility shift assay showed that OfWRKY3 was able to bind to the W-box palindrome motif present in the OfCCD4 promoter. These results suggest that OfWRKY3 is a positive regulator of the OfCCD4 gene, and might partly account for the biosynthesis of β-ionone in sweet osmanthus.
Yuan, Fenghua; Qian, Liangyue; Zhao, Xinliang; Liu, Jesse Y.; Song, Limin; D'Urso, Gennaro; Jain, Chaitanya; Zhang, Yanbin
2012-01-01
The Fanconi anemia complementation group A (FANCA) gene is one of 15 disease-causing genes and has been found to be mutated in ∼60% of Fanconi anemia patients. Using purified protein, we report that human FANCA has intrinsic affinity for nucleic acids. FANCA binds to both single-stranded (ssDNA) and double-stranded (dsDNA) DNAs; however, its affinity for ssDNA is significantly higher than for dsDNA in an electrophoretic mobility shift assay. FANCA also binds to RNA with an intriguingly higher affinity than its DNA counterpart. FANCA requires a certain length of nucleic acids for optimal binding. Using DNA and RNA ladders, we determined that the minimum number of nucleotides required for FANCA recognition is ∼30 for both DNA and RNA. By testing the affinity between FANCA and a variety of DNA structures, we found that a 5′-flap or 5′-tail on DNA facilitates its interaction with FANCA. A patient-derived FANCA truncation mutant (Q772X) has diminished affinity for both DNA and RNA. In contrast, the complementing C-terminal fragment of Q772X, C772–1455, retains the differentiated nucleic acid-binding activity (RNA > ssDNA > dsDNA), indicating that the nucleic acid-binding domain of FANCA is located primarily at its C terminus, where most disease-causing mutations are found. PMID:22194614
Yuan, Fenghua; Qian, Liangyue; Zhao, Xinliang; Liu, Jesse Y; Song, Limin; D'Urso, Gennaro; Jain, Chaitanya; Zhang, Yanbin
2012-02-10
The Fanconi anemia complementation group A (FANCA) gene is one of 15 disease-causing genes and has been found to be mutated in ∼60% of Fanconi anemia patients. Using purified protein, we report that human FANCA has intrinsic affinity for nucleic acids. FANCA binds to both single-stranded (ssDNA) and double-stranded (dsDNA) DNAs; however, its affinity for ssDNA is significantly higher than for dsDNA in an electrophoretic mobility shift assay. FANCA also binds to RNA with an intriguingly higher affinity than its DNA counterpart. FANCA requires a certain length of nucleic acids for optimal binding. Using DNA and RNA ladders, we determined that the minimum number of nucleotides required for FANCA recognition is ∼30 for both DNA and RNA. By testing the affinity between FANCA and a variety of DNA structures, we found that a 5'-flap or 5'-tail on DNA facilitates its interaction with FANCA. A patient-derived FANCA truncation mutant (Q772X) has diminished affinity for both DNA and RNA. In contrast, the complementing C-terminal fragment of Q772X, C772-1455, retains the differentiated nucleic acid-binding activity (RNA > ssDNA > dsDNA), indicating that the nucleic acid-binding domain of FANCA is located primarily at its C terminus, where most disease-causing mutations are found.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Greenberg, J.; Goliath, R.; Shugart, Y.Y.
1994-09-01
A new gene locus for autosomal dominant retinitis pigmentosa (ADRP) on 17p has been identified in a large South African (SA) family consisting of 28 living affected individuals in 4 successive generations. This is the first ADRP gene to be reported from SA. The human recoverin (RCVN) gene, which codes for a retinal-specific protein important in recovery to the dark state after visual excitation, has been mapped to 17p13.1 and was considered as a prime candidate gene for the disorder in this family. Mutation screening (using 8 different electrophoretic conditions to resolve heteroduplexes and SSCPs) did not produce any evidencemore » of RCVN being involved in the pathogenesis of ADRP in this SA family. In addition, a mobility shift detected within exon 1 of the RCVN gene did not track with the ADRP phenotype. RP patients from 77 SA families and 30 normal individuals are being examined to establish the frequency of this polymorphism in the SA population. Highly polymorphic markers from 17p13 are now being sought in order to establish the minimum region containing this novel ADRP-SA gene. Two additional recently described retinal-expressed cDNAs, guanylyl cyclase and pigment epithelium-derived factor, which map to 17p13.1, will be tested for tight linkage to ADRP-SA.« less
Lii, Chong-Kuei; Chen, Haw-Wen; Yun, Wen-Tzu; Liu, Kai-Li
2009-03-18
Bitter gourd (Momordica charantia) is used to treat various diseases including inflammation. A wild species of bitter gourd, Momordica charantia Linn. var. abbreviata ser. (WBG), is considered to be more potent in disease prevention than is bitter gourd; however, little is known about the biological and physiological characteristics of WBG. The present study investigated the anti-inflammatory effect of WBG on lipopolysaccharide (LPS)-stimulated RAW264.7 macrophages. Among the hot water, 95% ethanol, and ethyl acetate extracts of WBG, the ethanol extract showed the greatest reduction of LPS-induced nitric oxide (NO) and prostaglandin E2 (PGE2) production and inducible nitric oxide synthase (iNOS) and pro-interleukin-1beta expression. LPS-induced cyclooxygenase-2 expression was not affected byWBGextracts. Compared with WBG, extracts from bitter gourd showed a lesser inhibition of LPS-induced events. Electrophoretic mobility shift assay further showed that both the hot water and the ethanol extracts of WBG inhibited NF-kappaB activation. Although information is lacking on the bioactive components of WBG, the phenolic compound contents of each extract significantly paralleled its anti-inflammatory ability (r = 0.74, 0.88 and 0.65 for NO, PGE2 and iNOS expression, respectively, P < 0.05). These results suggest that WBG is beneficial for reducing LPS-induced inflammatory responses by modulating NF-kappaB activation.
Majer, Christine; Xu, Changzheng; Berendzen, Kenneth W.; Hochholdinger, Frank
2012-01-01
Rootless concerning crown and seminal roots (Rtcs) encodes a LATERAL ORGAN BOUNDARIES domain (LBD) protein that regulates shoot-borne root initiation in maize (Zea mays L.). GREEN FLUORESCENT PROTEIN (GFP)-fusions revealed RTCS localization in the nucleus while its paralogue RTCS-LIKE (RTCL) was detected in the nucleus and cytoplasm probably owing to an amino acid exchange in a nuclear localization signal. Moreover, enzyme-linked immunosorbent assay (ELISA) experiments demonstrated that RTCS primarily binds to LBD DNA motifs. RTCS binding to an LBD motif in the promoter of the auxin response factor (ARF) ZmArf34 and reciprocally, reciprocal ZmARF34 binding to an auxin responsive element motif in the promoter of Rtcs was shown by electrophoretic mobility shift assay experiments. In addition, comparative qRT-PCR of wild-type versus rtcs coleoptilar nodes suggested RTCS-dependent activation of ZmArf34 expression. Consistently, luciferase reporter assays illustrated the capacity of RTCS, RTCL and ZmARF34 to activate downstream gene expression. Finally, RTCL homo- and RTCS/RTCL hetero-interaction were demonstrated in yeast-two-hybrid and bimolecular fluorescence complementation experiments, suggesting a role of these complexes in downstream gene regulation. In summary, the data provide novel insights into the molecular interactions resulting in crown root initiation in maize. PMID:22527397
CDRI-08 Attenuates REST/NRSF-Mediated Expression of NMDAR1 Gene in PBDE-209-Exposed Mice Brain.
Verma, Priya; Gupta, Rajaneesh K; Gandhi, Behrose S; Singh, Poonam
2015-01-01
CDRI-08 is a standardized bacoside enriched ethanolic extract of Bacopa monnieri, a nootropic plant. We reported that CDRI-08 attenuated oxidative stress and memory impairment in mice, induced by a flame retardant, PBDE-209. In order to explore the mechanism, present study was designed to examine the role of CDRI-08 on the expression of NMDAR1 (NR1) and the binding of REST/NRSF to NR1 promoter against postnatal exposure of PBDE-209. Male mice pups were orally supplemented with CDRI-08 at the doses of 40, 80, or 120 mg/kg along with PBDE-209 (20 mg/kg) during PND 3-10 and frontal cortex and hippocampus were collected at PND 11 and 60 to study the expression and regulation of NR1 by RT-PCR and electrophoretic mobility shift assay, respectively. The findings showed upregulated expression of NR1 and decreased binding of REST/NRSF to NR1 promoter after postnatal exposure of PBDE-209. Interestingly, supplementation with CDRI-08 significantly restored the expression of NR1 and binding of REST/NRSF to NR1 promoter near to the control value at the dose of 120 mg/kg. In conclusion, the results suggest that CDRI-08 possibly acts on glutamatergic system through expression and regulation of NR1 and may restore memory, impaired by PBDE-209 as reported in our previous study.
De Clercq, Inge; Vermeirssen, Vanessa; Van Aken, Olivier; Vandepoele, Klaas; Murcha, Monika W.; Law, Simon R.; Inzé, Annelies; Ng, Sophia; Ivanova, Aneta; Rombaut, Debbie; van de Cotte, Brigitte; Jaspers, Pinja; Van de Peer, Yves; Kangasjärvi, Jaakko; Whelan, James; Van Breusegem, Frank
2013-01-01
Upon disturbance of their function by stress, mitochondria can signal to the nucleus to steer the expression of responsive genes. This mitochondria-to-nucleus communication is often referred to as mitochondrial retrograde regulation (MRR). Although reactive oxygen species and calcium are likely candidate signaling molecules for MRR, the protein signaling components in plants remain largely unknown. Through meta-analysis of transcriptome data, we detected a set of genes that are common and robust targets of MRR and used them as a bait to identify its transcriptional regulators. In the upstream regions of these mitochondrial dysfunction stimulon (MDS) genes, we found a cis-regulatory element, the mitochondrial dysfunction motif (MDM), which is necessary and sufficient for gene expression under various mitochondrial perturbation conditions. Yeast one-hybrid analysis and electrophoretic mobility shift assays revealed that the transmembrane domain–containing NO APICAL MERISTEM/ARABIDOPSIS TRANSCRIPTION ACTIVATION FACTOR/CUP-SHAPED COTYLEDON transcription factors (ANAC013, ANAC016, ANAC017, ANAC053, and ANAC078) bound to the MDM cis-regulatory element. We demonstrate that ANAC013 mediates MRR-induced expression of the MDS genes by direct interaction with the MDM cis-regulatory element and triggers increased oxidative stress tolerance. In conclusion, we characterized ANAC013 as a regulator of MRR upon stress in Arabidopsis thaliana. PMID:24045019
Hu, Donghua; Wang, Yuguang; Chen, Zhiwu; Ma, Zengchun; You, Qing; Zhang, Xianxie; Zhou, Tao; Xiao, Yong; Liang, Qiande; Tan, Hongling; Xiao, Chengrong; Tang, Xianglin; Zhang, Boli; Gao, Yue
2014-09-05
Artemisinin has been used to treat malaria for centuries in the context of traditional Chinese medicine. In the present study, the effects of artemisinin on pregnane X receptor (PXR)-mediated CYP3A expression and its therapeutic role in inflammatory bowel disease were investigated. LS174T cells exposed to artemisinin at various concentrations and for different periods of time were examined with respect to the specific induction of CYP3A4 and PXR mRNA expression. Transient transfection experiments showed transcriptional activation of the CYP3A4 gene through artemisinin to be PXR-dependent. An electrophoretic-mobility shift assay (EMSA) showed that artemisinin activates the DNA-binding capacity of the PXR for the CYP3A4 element. These results indicate that the induction of CYP3A4 by artemisinin is mediated through the activation of PXR. Using animal models, it was demonstrated that artemisinin abrogates dextran sulfate sodium (DDS)-induced intestinal inflammation. Preadministration of artemisinin ameliorated the clinical hallmarks of colitis in DSS-treated mice as determined by body weight loss and assessment of diarrhea, rectal bleeding, colon length, and histology. Artemisinin was found to prevent or reduce the severity of colonic inflammation by inducing CYP3A expression by activation of PXR. Copyright © 2014 Elsevier B.V. All rights reserved.
Wu, Wei-Hua; Chen, Yi-Fang
2016-01-01
The phytohormone abscisic acid (ABA) plays important roles during seed germination and early seedling development. Here, we characterized the function of the Arabidopsis WRKY6 transcription factor in ABA signaling. The transcript of WRKY6 was repressed during seed germination and early seedling development, and induced by exogenous ABA. The wrky6-1 and wrky6-2 mutants were ABA insensitive, whereas WRKY6-overexpressing lines showed ABA-hypersensitive phenotypes during seed germination and early seedling development. The expression of RAV1 was suppressed in the WRKY6-overexpressing lines and elevated in the wrky6 mutants, and the expression of ABI3, ABI4, and ABI5, which was directly down-regulated by RAV1, was enhanced in the WRKY6-overexpressing lines and repressed in the wrky6 mutants. Electrophoretic mobility shift and chromatin immunoprecipitation assays showed that WRKY6 could bind to the RAV1 promoter in vitro and in vivo. Overexpression of RAV1 in WRKY6-overexpressing lines abolished their ABA-hypersensitive phenotypes, and the rav1 wrky6-2 double mutant showed an ABA-hypersensitive phenotype, similar to rav1 mutant. Together, the results demonstrated that the Arabidopsis WRKY6 transcription factor played important roles in ABA signaling by directly down-regulating RAV1 expression. PMID:26829043
Takagi, Masaki; Takahashi, Mai; Ohtsu, Yoshiaki; Sato, Takeshi; Narumi, Satoshi; Arakawa, Hirokazu; Hasegawa, Tomonobu
2016-04-25
Heterozygous and/or homozygous HESX1 mutations have been reported to cause isolated growth hormone deficiency (IGHD) or combined pituitary hormone deficiency (CPHD), in association with septo optic dysplasia (SOD). We report a novel heterozygous HESX1 mutation in a CPHD patient without SOD phenotypes. The propositus was a one-year-old Japanese girl. Shortly after birth, she was found to be hypoglycemic. She was diagnosed with central adrenal insufficiency based on low cortisol and ACTH at a time of severe hypoglycemia. Further endocrine studies indicated that the patient also had central hypothyroidism and growth hormone deficiency. Using a next-generation sequencing strategy, we identified a novel heterozygous HESX1 mutation, c.326G>A (p.Arg109Gln). Western blotting and subcellular localization revealed no significant difference between wild type and mutant HESX1. Electrophoretic mobility shift assays showed that the mutant HESX1 abrogated DNA-binding ability. Mutant HESX1 was unable to repress PROP1-mediated activation. In conclusion, this study identified Arg109 as a critical residue in the HESX1 protein and extends our understanding of the phenotypic features, molecular mechanism, and developmental course associated with mutations in HESX1. When multiple genes need to be analyzed for mutations simultaneously, targeted sequence analysis of interesting genomic regions is an attractive approach.
Teng, Allen C T; Adamo, Kristi; Tesson, Frédérique; Stewart, Alexandre F R
2009-06-01
Diet-induced weight loss is affected by a wide range of factors, including genetic variation. Identifying functional polymorphisms will help to elucidate mechanisms that account for variation in dietary metabolism. Previously, we reported a strong association between a common single nucleotide polymorphism (SNP) rs2419621 (C>T) in the promoter of acyl-CoA synthetase long chain 5 (ACSL5), rapid weight loss in obese Caucasian females, and elevated ACSL5 mRNA levels in skeletal muscle biopsies. Here, we showed by electrophoretic mobility shift assay (EMSA) that the T allele creates a functional cis-regulatory E-box element (CANNTG) that is recognized by the myogenic regulatory factor MyoD. The T allele promoted MyoD-dependent activation of a 1089-base pair ACSL5 promoter fragment in nonmuscle CV1 cells. Differentiation of skeletal myoblasts significantly elevated expression of the ACSL5 promoter. The T allele sustained promoter activity 48 h after differentiation, whereas the C allele showed a significant decline. These results reveal a mechanism for elevated transcription of ACSL5 in skeletal muscle of carriers of the rs2419621(T) allele, associated with more rapid diet-induced weight loss. Natural selection favoring promoter polymorphisms that reduced expression of catabolic genes in skeletal muscle likely accounts for the resistance of obese individuals to dietary intervention.
Siednienko, Jakub; Nowak, Joanna; Moynagh, Paul N; Gorczyca, Wojciech A
2011-06-01
Interleukin 6 (IL-6) and nitric oxide (NO) are important mediators of the inflammatory response. We report that in human peripheral blood mononuclear cells (PBMCs), NO exerts a biphasic effect on the expression of IL-6. Using sodium nitroprusside (SNP) and S-nitrosoglutathione (GSNO) as NO-donating compounds, we observed that both mRNA and protein levels of IL-6 increased at lower (≤10μM) and decreased at higher (>100μM) concentrations of NO donors. Changes in the expression of IL-6 correlated with changes in the activity of NF-κB, which increased at lower and decreased at higher concentrations of both NO donors as shown by the electrophoretic mobility shift assay (EMSA). The effects of NO on NF-κB activity were cGMP-dependent because they were reversed in the presence of ODQ, the inhibitor of soluble guanylyl cyclase (sGC), and KT5823, the inhibitor of cGMP-dependent protein kinase (PKG). Moreover, the membrane permeable analog of cGMP (8-Br-cGMP) mimicked the effect of the NO donors. These observations show that NO, depending on its concentration, may act in human PBMCs as a stimulator of IL-6 expression involving the sGC/cGMP/PKG pathway. Copyright © 2011 Elsevier Ltd. All rights reserved.
In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M
1997-01-01
Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation. PMID:9062372
In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M
1997-03-01
Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation.
The human insulin receptor mRNA contains a functional internal ribosome entry segment
Spriggs, Keith A.; Cobbold, Laura C.; Ridley, Simon H.; Coldwell, Mark; Bottley, Andrew; Bushell, Martin; Willis, Anne E.; Siddle, Kenneth
2009-01-01
Regulation of mRNA translation is an important mechanism determining the level of expression of proteins in eukaryotic cells. Translation is most commonly initiated by cap-dependent scanning, but many eukaryotic mRNAs contain internal ribosome entry segments (IRESs), providing an alternative means of initiation capable of independent regulation. Here, we show by using dicistronic luciferase reporter vectors that the 5′-UTR of the mRNA encoding human insulin receptor (hIR) contains a functional IRES. RNAi-mediated knockdown showed that the protein PTB was required for maximum IRES activity. Electrophoretic mobility shift assays confirmed that PTB1, PTB2 and nPTB, but not unr or PTB4, bound to hIR mRNA, and deletion mapping implicated a CCU motif 448 nt upstream of the initiator AUG in PTB binding. The IR-IRES was functional in a number of cell lines, and most active in cells of neuronal origin, as assessed by luciferase reporter assays. The IRES was more active in confluent than sub-confluent cells, but activity did not change during differentiation of 3T3-L1 fibroblasts to adipocytes. IRES activity was stimulated by insulin in sub-confluent cells. The IRES may function to maintain expression of IR protein in tissues such as the brain where mRNA translation by cap-dependent scanning is less effective. PMID:19654240
Advanced purification strategy for CueR, a cysteine containing copper(I) and DNA binding protein.
Balogh, Ria K; Gyurcsik, Béla; Hunyadi-Gulyás, Éva; Christensen, Hans E M; Jancsó, Attila
2016-07-01
Metal ion regulation is essential for living organisms. In prokaryotes metal ion dependent transcriptional factors, the so-called metalloregulatory proteins play a fundamental role in controlling the concentration of metal ions. These proteins recognize metal ions with an outstanding selectivity. A detailed understanding of their function may be exploited in potential health, environmental and analytical applications. Members of the MerR protein family sense a broad range of mostly late transition and heavy metal ions through their cysteine thiolates. The air sensitivity of latter groups makes the expression and purification of such proteins challenging. Here we describe a method for the purification of the copper-regulatory CueR protein under optimized conditions. In order to avoid protein precipitation and/or eventual aggregation and to get rid of the co-purifying Escherichia coli elongation factor, our procedure consisted of four steps supplemented by DNA digestion. Subsequent anion exchange on Sepharose FF Q 16/10, affinity chromatography on Heparin FF 16/10, second anion exchange on Source 30 Q 16/13 and gel filtration on Superdex 75 26/60 resulted in large amounts of pure CueR protein without any affinity tag. Structure and functionality tests performed with mass spectrometry, circular dichroism spectroscopy and electrophoretic gel mobility shift assays approved the success of the purification procedure. Copyright © 2016 Elsevier Inc. All rights reserved.
Nguyen, Tinh T.; Martí-Arbona, Ricardo; Hall, Richard S.; ...
2013-05-21
Transcriptional regulators (TRs) are an important and versatile group of proteins, yet very little progress has been achieved towards the discovery and annotation of their biological functions. We have characterized a previously unknown organic hydroperoxide resistance regulator from Burkholderia xenovoransLB400, Bxe_B2842, which is homologous to E. coli’s OhrR. Bxe_B2842 regulates the expression of an organic hydroperoxide resistance protein (OsmC). We utilized frontal affinity chromatography coupled with mass spectrometry (FAC-MS) and electrophoretic mobility gel shift assays (EMSA) to identify and characterize the possible effectors of the regulation by Bxe_B2842. Without an effector, Bxe_B2842 binds a DNA operator sequence (DOS) upstream ofmore » osmC. FAC-MS results suggest that 2-aminophenol binds to the protein and is potentially an effector molecule. EMSA analysis shows that 2-aminophenol also attenuates the Bxe_B2842’s affinity for its DOS. EMSA analysis also shows that organic peroxides attenuate Bxe_B2842/DOS affinity, suggesting that binding of the TR to its DOS is regulated by the two-cysteine mechanism, common to TRs in this family. Bxe_B2842 is the first OhrR TR to have both oxidative and effector-binding mechanisms of regulation. Our paper reveals further mechanistic diversity TR mediated gene regulation and provides insights into methods for function discovery of TRs.« less
Core-binding factor beta interacts with Runx2 and is required for skeletal development.
Yoshida, Carolina A; Furuichi, Tatsuya; Fujita, Takashi; Fukuyama, Ryo; Kanatani, Naoko; Kobayashi, Shinji; Satake, Masanobu; Takada, Kenji; Komori, Toshihisa
2002-12-01
Core-binding factor beta (CBFbeta, also called polyomavirus enhancer binding protein 2beta (PEBP2B)) is associated with an inversion of chromosome 16 and is associated with acute myeloid leukemia in humans. CBFbeta forms a heterodimer with RUNX1 (runt-related transcription factor 1), which has a DNA binding domain homologous to the pair-rule protein runt in Drosophila melanogaster. Both RUNX1 and CBFbeta are essential for hematopoiesis. Haploinsufficiency of another runt-related protein, RUNX2 (also called CBFA1), causes cleidocranial dysplasia in humans and is essential in skeletal development by regulating osteoblast differentiation and chondrocyte maturation. Mice deficient in Cbfb (Cbfb(-/-)) die at midgestation, so the function of Cbfbeta in skeletal development has yet to be ascertained. To investigate this issue, we rescued hematopoiesis of Cbfb(-/-) mice by introducing Cbfb using the Gata1 promoter. The rescued Cbfb(-/-) mice recapitulated fetal liver hematopoiesis in erythroid and megakaryocytic lineages and survived until birth, but showed severely delayed bone formation. Although mesenchymal cells differentiated into immature osteoblasts, intramembranous bones were poorly formed. The maturation of chondrocytes into hypertrophic cells was markedly delayed, and no endochondral bones were formed. Electrophoretic mobility shift assays and reporter assays showed that Cbfbeta was necessary for the efficient DNA binding of Runx2 and for Runx2-dependent transcriptional activation. These findings indicate that Cbfbeta is required for the function of Runx2 in skeletal development.
Yea, S S; Yang, K H; Kaminski, N E
2000-02-01
We previously reported that immunosuppressive cannabinoids inhibited interleukin (IL)-2 steady-state mRNA expression and secretion by phorbol-12-myristate-13-acetate plus ionomycin-activated mouse splenocytes and EL4 murine T-cells. Here we show that inhibition of IL-2 production by cannabinol, a modest central nervous system-active cannabinoid, is mediated through the inhibition of IL-2 gene transcription. Moreover, electrophoretic mobility shift assays demonstrated that cannabinol markedly inhibited the DNA binding activity of nuclear factor of activated T-cells (NF-AT) and activator protein-1 (AP-1) in a time- and concentration-dependent manner in activated EL4 cells. The inhibitory effects produced by cannabinol on AP-1 DNA binding were quite transient, showing partial recovery by 240 min after cell activation and no effect on the activity of a reporter gene under the control of AP-1. Conversely, cannabinol-mediated inhibition of NF-AT was robust and sustained as demonstrated by an NF-AT-regulated reporter gene. Collectively, these results suggest that decreased IL-2 production by cannabinol in EL4 cells is due to the inhibition of transcriptional activation of the IL-2 gene and is mediated, at least in part, through a transient inhibition of AP-1 and a sustained inhibition of NF-AT.
Alfonso, Pilar; Pampín, Sandra; García-Rodríguez, Beatriz; Tejedor, Teresa; Domínguez, Carmen; Rodríguez-Rey, Jose C; Giraldo, Pilar; Pocoví, Miguel
2011-01-30
Gaucher disease (GD) is a rare autosomal recessive disorder caused mainly by mutations in the glucocerebrosidase (GBA) gene. Great phenotypic variability has been observed among patients with the same genotype, suggesting other factors, such as polymorphic variants, might influence GD phenotypes. We previously reported the c.(-203)A>G (g.1256A>G) variant in exon 1 of the GBA gene in Spanish GD patients. We analyzed the frequency and transcriptional activity of the promoter carrying the G-allele using restriction isotyping, electrophoretic mobility shift assay, cell culture, transfection, and luciferase assays. We found the variant is present at a similar frequency to the control group. In our patients, the G-allele was always found in combination with another mutation in the same allele, and patients carrying the c.(-203)A>G variant showed a more severe GD phenotype. The promoter containing the G-allele showed a 35% reduction in promoter activity when transfected into HepG2 cells. The c.(-203)A>G variant seems to be a polymorphism resulting in a decrease in activity of the GBA promoter. The change, per se, is not enough to elicit a GD phenotype, but it may produce a more severe phenotype in GD patients when combined with an already defective GBA protein. Copyright © 2010 Elsevier B.V. All rights reserved.
Lampronti, Ilaria; Khan, Mahmud T.H.; Borgatti, Monica; Bianchi, Nicoletta
2008-01-01
Several transcription factors (TFs) play crucial roles in governing the expression of different genes involved in the immune response, embryo or cell lineage development, cell apoptosis, cell cycle progression, oncogenesis, repair and fibrosis processes and inflammation. As far as inflammation, TFs playing pivotal roles are nuclear factor kappa B (NF-kB), activator protein (AP-1), signal transducer and activator of transcription (STATs), cAMP response element binding protein (CREB) and GATA-1 factors. All these TFs regulate the expression of pro-inflammatory cytokines and are involved in the pathogenesis of a number of human disorders, particularly those with an inflammatory component. Since several medicinal plants can be employed to produce extracts exhibiting biological effects and because alteration of gene transcription represents a very interesting approach to control the expression of selected genes, this study sought to verify the ability of several extracts derived from Bangladeshi medicinal plants in interfering with molecular interactions between different TFs and specific DNA sequences. We first analyzed the antiproliferative activity of 19 medicinal plants on different human cell lines, including erythroleukemia K562, B lymphoid Raji and T lymphoid Jurkat cell lines. Secondly, we employed the electrophoretic mobility shift assay as a suitable technique for a fast screening of plant extracts altering the binding between NF-kB, AP-1, GATA-1, STAT-3, CREB and the relative target DNA elements. PMID:18830455
DNA cross-linking by dehydromonocrotaline lacks apparent base sequence preference.
Rieben, W Kurt; Coulombe, Roger A
2004-12-01
Pyrrolizidine alkaloids (PAs) are ubiquitous plant toxins, many of which, upon oxidation by hepatic mixed-function oxidases, become reactive bifunctional pyrrolic electrophiles that form DNA-DNA and DNA-protein cross-links. The anti-mitotic, toxic, and carcinogenic action of PAs is thought to be caused, at least in part, by these cross-links. We wished to determine whether the activated PA pyrrole dehydromonocrotaline (DHMO) exhibits base sequence preferences when cross-linked to a set of model duplex poly A-T 14-mer oligonucleotides with varying internal and/or end 5'-d(CG), 5'-d(GC), 5'-d(TA), 5'-d(CGCG), or 5'-d(GCGC) sequences. DHMO-DNA cross-links were assessed by electrophoretic mobility shift assay (EMSA) of 32P endlabeled oligonucleotides and by HPLC analysis of cross-linked DNAs enzymatically digested to their constituent deoxynucleosides. The degree of DNA cross-links depended upon the concentration of the pyrrole, but not on the base sequence of the oligonucleotide target. Likewise, HPLC chromatograms of cross-linked and digested DNAs showed no discernible sequence preference for any nucleotide. Added glutathione, tyrosine, cysteine, and aspartic acid, but not phenylalanine, threonine, serine, lysine, or methionine competed with DNA as alternate nucleophiles for cross-linking by DHMO. From these data it appears that DHMO exhibits no strong base preference when forming cross-links with DNA, and that some cellular nucleophiles can inhibit DNA cross-link formation.
Zhang, Jing-Jing; Zhu, Yi; Zhang, Xiong-Fei; Liang, Wen-Biao; Xie, Kun-Ling; Tao, Jin-Qiu; Peng, Yun-Peng; Xu, Ze-Kuan; Miao, Yi
2013-08-01
The human mucin 4 (MUC4) is aberrantly expressed in pancreatic adenocarcinoma and tumor cell lines, while remaining undetectable in normal pancreas, indicating its important role in pancreatic cancer development. Although its transcriptional regulation has been investigated in considerable detail, some important elements remain unknown. The aim of the present study was to demonstrate the existence of a novel inhibitory element in the MUC4 promoter and characterize some of its binding proteins. By luciferase reporter assay, we located the inhibitory element between nucleotides -2530 and -2521 in the MUC4 promoter using a series of deletion and mutant reporter constructs. Electrophoretic mobility shift assay (EMSA) with Bxpc-3 cell nuclear extracts revealed that one protein or protein complex bind to this element. The proteins binding to this element were purified and identified as Yin Yang 1 (YY1) by mass spectrometry. Supershift assay and chromatin immunoprecipitation (ChIP) assay confirmed that YY1 binds to this element in vitro and in vivo. Moreover, transient YY1 overexpression significantly inhibited MUC4 promoter activity and endogenous MUC4 protein expression. In conclusion, we reported here a novel inhibitory element in the human MUC4 promoter. This provides additional data on MUC4 gene regulation and indicates that YY1 may be a potential target for abnormal MUC4 expression.
Nuclear factors that bind to the enhancer region of nondefective Friend murine leukemia virus.
Manley, N R; O'Connell, M A; Sharp, P A; Hopkins, N
1989-01-01
Nondefective Friend murine leukemia virus (MuLV) causes erythroleukemia when injected into newborn NFS mice, while Moloney MuLV causes T-cell lymphoma. Exchange of the Friend virus enhancer region, a sequence of about 180 nucleotides including the direct repeat and a short 3'-adjacent segment, for the corresponding region in Moloney MuLV confers the ability to cause erythroid disease on Moloney MuLV. We have used the electrophoretic mobility shift assay and methylation interference analysis to identify cellular factors which bind to the Friend virus enhancer region and compared these with factors, previously identified, that bind to the Moloney virus direct repeat (N. A. Speck and D. Baltimore, Mol. Cell. Biol. 7:1101-1110, 1987). We identified five binding sites for sequence-specific DNA-binding proteins in the Friend virus enhancer region. While some binding sites are present in both the Moloney and Friend virus enhancers, both viruses contain unique sites not present in the other. Although none of the factors identified in this report which bind to these unique sites are present exclusively in T cells or erythroid cells, they bind to three regions of the enhancer shown by genetic analysis to encode disease specificity and thus are candidates to mediate the tissue-specific expression and distinct disease specificities encoded by these virus enhancer elements. Images PMID:2778872
Yoshino, M; Tsutsumi, K; Kanazawa, A
2015-01-01
β-Conglycinin, a major component of seed storage protein in soybean, comprises three subunits: α, α' and β. The expression of genes for these subunits is strictly controlled during embryogenesis. The proximal promoter region up to 245 bp upstream of the transcription start site of the α subunit gene sufficiently confers spatial and temporal control of transcription in embryos. Here, the binding profile of nuclear proteins in the proximal promoter region of the α subunit gene was analysed. DNase I footprinting analysis indicated binding of proteins to the RY element and DNA regions including box I, a region conserved in cognate gene promoters. An electrophoretic mobility shift assay (EMSA) using different portions of box I as a probe revealed that multiple portions of box I bind to nuclear proteins. In addition, an EMSA using nuclear proteins extracted from embryos at different developmental stages indicated that the levels of major DNA-protein complexes on box I increased during embryo maturation. These results are consistent with the notion that box I is important for the transcriptional control of seed storage protein genes. Furthermore, the present data suggest that nuclear proteins bind to novel motifs in box I including 5'-TCAATT-3' rather than to predicted cis-regulatory elements. © 2014 German Botanical Society and The Royal Botanical Society of the Netherlands.
Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi
2008-10-01
Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.
Willenborg, Jörg; de Greeff, Astrid; Jarek, Michael; Valentin-Weigand, Peter; Goethe, Ralph
2014-04-01
Streptococcus suis (S. suis) is a neglected zoonotic streptococcus causing fatal diseases in humans and in pigs. The transcriptional regulator CcpA (catabolite control protein A) is involved in the metabolic adaptation to different carbohydrate sources and virulence of S. suis and other pathogenic streptococci. In this study, we determined the DNA binding characteristics of CcpA and identified the CcpA regulon during growth of S. suis. Electrophoretic mobility shift analyses showed promiscuous DNA binding of CcpA to cognate cre sites in vitro. In contrast, sequencing of immunoprecipitated chromatin revealed two specific consensus motifs, a pseudo-palindromic cre motif (WWGAAARCGYTTTCWW) and a novel cre2 motif (TTTTYHWDHHWWTTTY), within the regulatory elements of the genes directly controlled by CcpA. Via these elements CcpA regulates expression of genes involved in carbohydrate uptake and conversion, and in addition in important metabolic pathways of the central carbon metabolism, like glycolysis, mixed-acid fermentation, and the fragmentary TCA cycle. Furthermore, our analyses provide evidence that CcpA regulates the genes of the central carbon metabolism by binding either the pseudo-palindromic cre motif or the cre2 motif in a HPr(Ser)∼P independent conformation. © 2014 John Wiley & Sons Ltd.
Eklund, E A; Kakar, R
1997-04-04
The CYBB gene encodes gp91(phox), the heavy chain of the phagocyte-specific NADPH oxidase. CYBB is transcriptionally inactive until the promyelocyte stage of myelopoiesis, and in mature phagocytes, expression of gp91(phox) is further increased by interferon-gamma (IFN-gamma) and other inflammatory mediators. The CYBB promoter region contains several lineage-specific cis-elements involved in the IFN-gamma response. We screened a leukocyte cDNA expression library for proteins able to bind to one of these cis-elements (-214 to -262 base pairs) and identified TF1(phox), a protein with sequence-specific binding to the CYBB promoter. Electrophoretic mobility shift assay with nuclear proteins from a variety of cell lines demonstrated binding of a protein to the CYBB promoter that was cross-immunoreactive with TF1(phox). DNA binding of this protein was increased by IFN-gamma treatment in the myeloid cell line PLB985, but not in the non-myeloid cell line HeLa. Overexpression of recombinant TF1(phox) in PLB985 cells increased endogenous gp91(phox) message abundance, but did not lead to cellular differentiation. Overexpression of TF1(phox) in myeloid leukemia cell lines increased reporter gene expression from artificial promoter constructs containing CYBB promoter sequence. These data suggested that TF1(phox) increased expression of gp91(phox).
Dietrich, Christoph G; Martin, Ina V; Porn, Anne C; Voigt, Sebastian; Gartung, Carsten; Trautwein, Christian; Geier, Andreas
2007-09-01
Fasting induces numerous adaptive changes in metabolism by several central signaling pathways, the most important represented by the HNF4alpha/PGC-1alpha-pathway. Because HNF4alpha has been identified as central regulator of basolateral bile acid transporters and a previous study reports increased basolateral bile acid uptake into the liver during fasting, we hypothesized that HNF4alpha is involved in fasting-induced bile acid uptake via upregulation of basolateral bile acid transporters. In rats, mRNA of Ntcp, Oatp1, and Oatp2 were significantly increased after 48 h of fasting. Protein expression as determined by Western blot showed significant increases for all three transporters 72 h after the onset of fasting. Whereas binding activity of HNF1alpha in electrophoretic mobility shift assays remained unchanged, HNF4alpha binding activity to the Ntcp promoter was increased significantly. In line with this result, we found significantly increased mRNA expression of HNF4alpha and PGC-1alpha. Functional studies in HepG2 cells revealed an increased endogenous NTCP mRNA expression upon cotransfection with either HNF4alpha, PGC-1alpha, or a combination of both. We conclude that upregulation of the basolateral bile acid transporters Ntcp, Oatp1, and Oatp2 in fasted rats is mediated via the HNF4alpha/PGC-1alpha pathway.
Wang, Qinglian; Yang, Xiaowei; Xu, Ying; Shen, Zhenwei; Cheng, Hongxia; Cheng, Fajuan; Liu, Xiang; Wang, Rong
2018-01-01
Peritoneal fibrosis (PF) with associated peritoneal dysfunction is almost invariably observed in long-term peritoneal dialysis (PD) patients. Advanced glycation end products (AGEs) are pro-oxidant compounds produced in excess during the metabolism of glucose and are present in high levels in standard PD solutions. The GTPase RhoA has been implicated in PF, but its specific role remains poorly understood. Here, we studied the effects of RhoA/Rho-kinase signaling in AGEs-induced epithelial-mesenchymal transition (EMT) in human peritoneal mesothelial cells (HPMCs), and evaluated morphological and molecular changes in a rat model of PD-related PF. Activation of RhoA/Rho-kinase and activating protein-1 (AP-1) was assessed in HPMCs using pull-down and electrophoretic mobility shift assays, respectively, while expression of transforming growth factor-β, fibronectin, α-smooth muscle actin, vimentin, N-cadherin, and E-cadherin expression was assessed using immunohistochemistry and western blot. AGEs exposure activated Rho/Rho-kinase in HPMCs and upregulated EMT-related genes via AP-1. These changes were prevented by the Rho-kinase inhibitors fasudil and Y-27632, and by the AP-1 inhibitor curcumin. Importantly, fasudil normalized histopathological and molecular alterations and preserved peritoneal function in rats. These data support the therapeutic potential of Rho-kinase inhibitors in PD-related PF. PMID:29581852
Shao, Guo; Gao, Cui-Ying; Lu, Guo-Wei
2005-01-01
This work aims at investigating the effects of hypoxic preconditioning on hypoxia-inducible factor-1 alpha (HIF-1alpha) expression in the hippocampus of mice during acute and repeated hypoxic exposures. The mice were randomly divided into three groups and exposed, respectively, to hypoxia for 4 runs (group H4), 1 run (group H1), and 0 run (group H0). Reverse transcription-polymerase chain reaction (RT-PCR), Western blot, electrophoretic mobility shift assay (EMSA), and chromatin immunoprecipitation were used to examine the HIF-1alpha responses in the mouse hippocampus following exposure to hypoxia. The tolerance of mice to hypoxia increased significantly following acute and repetitive exposure to autoprogressive hypoxia. Total mRNA, total protein, and nuclear protein were extracted from the hippocampus for RT-PCR, Western blot, and EMSA, respectively. The HIF-1alpha mRNA levels were found to be increased in group H1 and decreased in group H4. The HIF-1alpha protein levels and HIF-1 DNA-binding activities were increased in group H1 and markedly increased in group H4. One of the HIF-1 target genes, vascular endothelial growth factor, increased in group H4. HIF-1 activation is thought to be involved in the protection of the brain of hypoxic preconditioned mice. Copyright 2005 S. Karger AG, Basel
Domínguez-Martín, María A; López-Lozano, Antonio; Clavería-Gimeno, Rafael; Velázquez-Campoy, Adrián; Seidel, Gerald; Burkovski, Andreas; Díez, Jesús; García-Fernández, José M
2017-01-01
Previous studies showed differences in the regulatory response to C/N balance in Prochlorococcus with respect to other cyanobacteria, but no information was available about its causes, or the ecological advantages conferred to thrive in oligotrophic environments. We addressed the changes in key enzymes (glutamine synthetase, isocitrate dehydrogenase) and the ntcA gene (the global nitrogen regulator) involved in C/N metabolism and its regulation, in three model Prochlorococcus strains: MED4, SS120, and MIT9313. We observed a remarkable level of diversity in their response to azaserine, a glutamate synthase inhibitor which increases the concentration of the key metabolite 2-oxoglutarate, used to sense the C/N balance by cyanobacteria. Besides, we studied the binding between the global nitrogen regulator (NtcA) and the promoter of the glnA gene in the same Prochlorococcus strains, and its dependence on the 2-oxoglutarate concentration, by using isothermal titration calorimetry, surface plasmon resonance, and electrophoretic mobility shift. Our results show a reduction in the responsiveness of NtcA to 2-oxoglutarate in Prochlorococcus , especially in the MED4 and SS120 strains. This suggests a trend to streamline the regulation of C/N metabolism in late-branching Prochlorococcus strains (MED4 and SS120), in adaptation to the rather stable conditions found in the oligotrophic ocean gyres where this microorganism is most abundant.
Yilmaz, Gulden; Biswas-Fiss, Esther E; Biswas, Subhasis B
2018-04-01
Human papillomaviruses (HPVs) encompass a large family of viruses that range from benign to highly carcinogenic. The crucial differences between benign and carcinogenic types of HPV remain unknown, except that the two HPV types differ in the frequency of DNA replication. We have systematically analyzed the mechanism of HPV DNA replication initiation in low-risk and high-risk HPVs. Our results demonstrate that HPV-encoded E2 initiator protein and its four binding sites in the replication origin play pivotal roles in determining the destiny of the HPV-infected cell. We have identified strain-specific single nucleotide variations in E2 binding sites found only in the high-risk HPVs. We have demonstrated that these variations result in attenuated formation of the E2-DNA complex. E2 binding to these sites is linked to the activation of the DNA replication origin as well as initiation of DNA replication. Both electrophoretic mobility shift assay and atomic force microscopy studies demonstrated that binding of E2 from either low- or high-risk HPVs with variant binding sequences lacked multimeric E2-DNA complex formation in vitro. These results provided a molecular basis of differential DNA replication in the two types of HPVs and pointed to a correlation with the development of cancer. Copyright © 2017. Published by Elsevier B.V.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chiles, T.C.; Liu, J.L.; Rothstein, T.L.
1991-03-15
Cross-linking of sIg on primary B lymphocytes leads to increased nuclear DNA-binding activity specific for the tetradecanoyl phorbol acetate-response element (TRE), as judged by gel mobility shift assays. Stimulation of B cells to enter S phase of the cell cycle by treatment with the combination of phorbol ester plus calcium ionophore also stimulated nuclear TRE-binding activity within 2 h, with maximal expression at 4 h; however, phorbol ester and calcium ionophore were not as effective in stimulating binding activity when examined separately. Stimulated nuclear expression of TRE-binding activity appears to require protein synthesis. Fos- and Jun/AP-1-related proteins participate directly inmore » the identified nucleoprotein complex, as shown by the ability of c-fos- and c-jun-specific antisera to either alter or completely abolish electrophoretic migration of the complex in native gels. Further, UV photo-cross-linking studies identified two major TRE-binding protein species, whose sizes correspond to TRE-binding proteins derived from HeLa cell nuclear extracts. The results suggest that in primary B cells nuclear TRE-binding activity represents a downstream signaling event that occurs subsequent to changes in protein kinase C activity and intracellular Ca2+ but that can be triggered physiologically through sIg.« less
Wu, Kaifeng; Xu, Hongmei; Zheng, Yuqiang; Wang, Libin; Zhang, Xuemei; Yin, Yibing
2016-07-08
Transcriptional regulation of capsule expression is critical for pneumococcal transition from carriage to infection, yet the underlying mechanism remains incompletely understood. Here, we describe the regulation of capsular polysaccharide, one of the most important pneumococcal virulence factor by a GntR family regulator, CpsR. Electrophoretic mobility-shift assays have shown the direct interaction between CpsR and the cps promoter (cpsp), and their interaction could be competitively interfered by glucose. DNase I footprinting assays localized the binding site to a region -146 to -114 base pairs relative to the transcriptional start site of the cps locus in S. pneumoniae D39. We found that CpsR negatively controlled the transcription of the cps locus and hence CPS production, which was confirmed by fine-tuning expression of CpsR in a ΔcpsR complemented strain. Increased expression of CpsR in complemented strain led to a decreased resistance to the whole-blood-mediated killing, suggesting a protective role for CpsR-cpsp interaction in the establishment of invasive infection. Finally, animal experiments showed that CpsR-cpsp interaction was necessary for both pneumococcal colonization and invasive infection. Taken together, our results provide a thorough insight into the regulation of capsule production mediated by CpsR and its important roles in pneumococcal pathogenesis.
Okada, Y; Sawa, H; Tanaka, S; Takada, A; Suzuki, S; Hasegawa, H; Umemura, T; Fujisawa, J; Tanaka, Y; Hall, W W; Nagashima, K
2000-06-02
Polyomavirus JC (JCV) causes the human demyelinating disease, progressive multifocal leukoencephalopathy (PML). The recent demonstration of cases of PML in association with human T-lymphotropic virus type I (HTLV-I) infection prompted us to examine whether the HTLV-I-encoded regulatory protein Tax activates JCV transcription. By employing a dual luciferase assay, we initially found that the expression of Tax activated the transcriptional potential of both early and late promoters of JCV in human neuronal but not in non-neuronal cells. We subsequently analyzed the mechanism of Tax-induced activation of the JCV promoter in neuronal cells with the following results: 1) the JCV promoter that lacks the NF-kappaB-binding motif could not be activated by Tax; 2) the overexpression of IkappaBalpha abolished Tax-induced transcriptional activation of the JCV promoter; 3) a Tax mutant (M22) lacking the potential for activation via the NF-kappaB pathway did not activate the JCV promoter. Furthermore, Tax enhances the gene expression of JCV T antigen and VP1. We examined mechanisms of the cell-specific activation of the JCV promoter by Tax. Electrophoretic mobility shift assay demonstrated the presence of Tax-bound protein(s) that were specifically present in non-neuronal cells. This study is the first demonstration of the activation of JCV promoter by HTLV-I Tax in an NF-kappaB-dependent manner.
SUMO-Modification of the La Protein Facilitates Binding to mRNA In Vitro and in Cells.
Kota, Venkatesh; Sommer, Gunhild; Durette, Chantal; Thibault, Pierre; van Niekerk, Erna A; Twiss, Jeffery L; Heise, Tilman
2016-01-01
The RNA-binding protein La is involved in several aspects of RNA metabolism including the translational regulation of mRNAs and processing of pre-tRNAs. Besides its well-described phosphorylation by Casein kinase 2, the La protein is also posttranslationally modified by the Small Ubiquitin-like MOdifier (SUMO), but the functional outcome of this modification has not been defined. The objective of this study was to test whether sumoylation changes the RNA-binding activity of La. Therefore, we established an in vitro sumoylation assay for recombinant human La and analyzed its RNA-binding activity by electrophoretic mobility shift assays. We identified two novel SUMO-acceptor sites within the La protein located between the RNA recognition motif 1 and 2 and we demonstrate for the first time that sumoylation facilitates the RNA-binding of La to small RNA oligonucleotides representing the oligopyrimidine tract (TOP) elements from the 5' untranslated regions (UTR) of mRNAs encoding ribosomal protein L22 and L37 and to a longer RNA element from the 5' UTR of cyclin D1 (CCND1) mRNA in vitro. Furthermore, we show by RNA immunoprecipitation experiments that a La mutant deficient in sumoylation has impaired RNA-binding activity in cells. These data suggest that modulating the RNA-binding activity of La by sumoylation has important consequences on its functionality.
SUMO-Modification of the La Protein Facilitates Binding to mRNA In Vitro and in Cells
Kota, Venkatesh; Sommer, Gunhild; Durette, Chantal; Thibault, Pierre; van Niekerk, Erna A.; Twiss, Jeffery L.
2016-01-01
The RNA-binding protein La is involved in several aspects of RNA metabolism including the translational regulation of mRNAs and processing of pre-tRNAs. Besides its well-described phosphorylation by Casein kinase 2, the La protein is also posttranslationally modified by the Small Ubiquitin-like MOdifier (SUMO), but the functional outcome of this modification has not been defined. The objective of this study was to test whether sumoylation changes the RNA-binding activity of La. Therefore, we established an in vitro sumoylation assay for recombinant human La and analyzed its RNA-binding activity by electrophoretic mobility shift assays. We identified two novel SUMO-acceptor sites within the La protein located between the RNA recognition motif 1 and 2 and we demonstrate for the first time that sumoylation facilitates the RNA-binding of La to small RNA oligonucleotides representing the oligopyrimidine tract (TOP) elements from the 5’ untranslated regions (UTR) of mRNAs encoding ribosomal protein L22 and L37 and to a longer RNA element from the 5’ UTR of cyclin D1 (CCND1) mRNA in vitro. Furthermore, we show by RNA immunoprecipitation experiments that a La mutant deficient in sumoylation has impaired RNA-binding activity in cells. These data suggest that modulating the RNA-binding activity of La by sumoylation has important consequences on its functionality. PMID:27224031
Matsuo, Noritaka; Yu-Hua, Wang; Sumiyoshi, Hideaki; Sakata-Takatani, Keiko; Nagato, Hitoshi; Sakai, Kumiko; Sakurai, Mami; Yoshioka, Hidekatsu
2003-08-29
We have characterized the proximal promoter region of the human COL11A1 gene. Transient transfection assays indicate that the segment from -199 to +1 is necessary for the activation of basal transcription. Electrophoretic mobility shift assays (EMSAs) demonstrated that the ATTGG sequence, within the -147 to -121 fragment, is critical to bind nuclear proteins in the proximal COL11A1 promoter. We demonstrated that the CCAAT binding factor (CBF/NF-Y) bound to this region using an interference assay with consensus oligonucleotides and a supershift assay with specific antibodies in an EMSA. In a chromatin immunoprecipitation assay and EMSA using DNA-affinity-purified proteins, CBF/NF-Y proteins directly bound this region in vitro and in vivo. We also showed that four tandem copies of the CBF/NF-Y-binding fragment produced higher transcriptional activity than one or two copies, whereas the absence of a CBF/NF-Y-binding fragment suppressed the COL11A1 promoter activity. Furthermore, overexpression of a dominant-negative CBF-B/NF-YA subunit significantly inhibited promoter activity in both transient and stable cells. These results indicate that the CBF/NF-Y proteins regulate the transcription of COL11A1 by directly binding to the ATTGG sequence in the proximal promoter region.
STAT3-activated CD36 facilitates fatty acid uptake in chronic lymphocytic leukemia cells
Rozovski, Uri; Harris, David M.; Li, Ping; Liu, Zhiming; Jain, Preetesh; Ferrajoli, Alessandra; Burger, Jan; Thompson, Phillip; Jain, Nitin; Wierda, William; Keating, Michael J.; Estrov, Zeev
2018-01-01
Although several studies established that unlike normal B cells chronic lymphocytic leukemia (CLL) cells metabolize fatty acids (FA), how CLL cells internalize FA is poorly understood. Because in various cell types CD36 facilitates FA uptake, we wondered whether a similar mechanism is operative CLL. We found that CD36 levels are higher in CLL cells than in normal B cells, and that small interfering RNA, CD36 neutralizing antibodies or sulfosuccinimidyl oleate (SSO) that inhibits CD36 significantly reduced the oxygen consumption of CLL cells incubated with FA. Because CD36 is oeverexpressed and STAT3 is constitutively activated in CLL cells, we wondered whether STAT3 induces CD36 expression. Sequence analysis identified putative STAT3 binding sites in the CD36 gene promoter. Chromatin immunoprecipitation and an electrophoretic mobility shift assay revealed that STAT3 binds to the CD36 gene promoter. A luciferase assay and STAT3-small hairpin RNA, that significantly decreased the levels of CD36 in CLL cells, established that STAT3 activates the transcription of the CD36 gene. Furthermore, SSO induced a dose-dependent apoptosis of CLL cells. Taken together, our data suggest that STAT3 activates CD36 and that CD36 facilitates FA uptake in CLL cells. Whether CD36 inhibition would provide clinical benefits in CLL remains to be determined. PMID:29765537
Huang, Deqi; Jokela, Maarit; Tuusa, Jussi; Skog, Sven; Poikonen, Kari; Syväoja, Juhani E.
2001-01-01
The B-subunits of replicative DNA polymerases from Archaea to humans belong to the same protein family, suggesting that they share a common fundamental function. We report here the gene structure for the B-subunit of human DNA polymerase ɛ (POLE2), whose expression and transcriptional regulation is typical for replication proteins with some unique features. The 75 bp core promoter region, located within exon 1, contains an Sp1 element that is a critical determinant of promoter activity as shown by the luciferase reporter, electrophoretic mobility shift and DNase I footprinting assays. Two overlapping E2F elements adjacent to the Sp1 element are essential for full promoter activity and serum response. Binding sites for E2F1 and NF-1 reside immediately downstream from the core promoter region. Our results suggest that human POLE2 is regulated by two E2F–pocket protein complexes, one associated with Sp1 and the other with NF-1. So far, only one replicative DNA polymerase B-subunit gene promoter, POLA2 encoding the B-subunit of DNA polymerase α, has been characterized. Mitogenic activation of the POLE2 promoter by an E2F-mediated mechanism resembles that of POLA2, but the regulation of basal promoter activity is different between these two genes. PMID:11433027
Jiang, Chunfang; Zheng, Hai; Liu, Sunan; Fang, Kaifeng
2008-02-01
The relationship between intracellular trypsinogen activation and NF-kappa B activation in rat pancreatic acinar cells induced by M3 cholinergic receptor agonist (carbachol) hyperstimulation was studied. Rat pancreatic acinar cells were isolated, cultured and treated with carbachol, the active protease inhibitor (pefabloc) and NF-kappa B inhibitor (PDTC) in vitro. Intracellular trypsin activity was measured by using a fluorogenic substrate. The activity of NF-kappa B was monitored by using electrophoretic mobility shift assay. The results showed that after pretreatment with 2 mmol/L pefabloc, the activities of trypsin and NF-kappa B in pancreatic acinar cells treated with high concentrations of carbachol (10(-3) mol/L) in vitro was significantly decreased as compared with control group (P<0.01). The addition of 10(-2) mol/L PDTC resulted in a significant decrease of NF-kappa B activities in pancreatic acinar cells after treated with high concentrations of carbachol (10(-3) mol/L) in vitro, but the intracellular trypsinogen activity was not obviously inhibited (P>0.05). It was concluded that intracellular trypsinogen activation is likely involved in the regulation of high concentrations of carbachol-induced NF-kappa B activation in pancreatic acinar cells in vitro. NF-kappa B activation is likely not necessary for high concentrations of carbachol-induced trypsinogen activation in pancreatic acinar cells in vitro.
Li, Yuhua; Fan, Lei; Sun, Yang; Zhang, Dian; Yue, Zhenggang; Niu, Yinbo; Meng, Jin; Yang, Tiehong; Liu, Wenchao; Mei, Qibing
2013-10-01
Colorectal cancer (CRC) is one of the most common cancers and a leading cause of cancer-related mortality in developed countries. Many ingredients of apples have been proven to have anti-inflammatory and anti-carcinogenic characteristics, and show benefits for CRC prevention. The aim of this study, therefore, was to evaluate inhibitory effect of an apple oligogalactan (AOG) on pro-inflammatory endotoxin lipopolysaccharide (LPS)-activated human colon carcinoma cells HT-29 and SW-620 and investigate the possible mechanisms. The two cell lines were pretreated with AOG (0.1-1 g/L) for 30 min and then treated with 10 μg/mL LPS. Real time PCR, Western blot, electrophoretic mobility shift assay (EMSA), and ELISA were used to detect the expression and activity of cyclooxygenase-2 (COX-2), NF-κB and MAPKs pathways. AOG significantly inhibited the expression and activity of COX-2 in LPS-activated human colon carcinoma cells HT-29 and SW-620. The mechanisms of AOG-suppressed COX-2 expression may be through inhibiting the phosphorylation of MAPKs and the activation of NF-κB and AP-1. These data may provide another molecular basis for understanding how apples act to prevent CRC and indicate that AOG may be useful for treatment of colitis and prevention of carcinogenesis. Copyright © 2013 Elsevier B.V. All rights reserved.
Huda, Kamrul A S M; Guo, Lei; Haga, Sanae; Murata, Hiroshi; Ogino, Tetsuya; Fukai, Moto; Yagi, Takahito; Iwagaki, Hiromi; Tanaka, Noriaki; Ozaki, Michitaka
2006-05-01
Signal transducer and activator of transcription-3 (STAT3) is one of the most important transcription factors for liver regeneration. This study was designed to examine the effects of constitutively activated STAT3 (STAT3-C) on post-transplant liver injury and regeneration in a rat 20% partial liver transplant (PLTx) model by ex vivo adenoviral gene transfer. Adenovirus encoding the STAT3-C gene was introduced intraportally into liver grafts and clamped for 30 min during cold preservation. After orthotopic PLTx, liver graft/body weights and serum biochemistry were monitored, and both a histological study and DNA binding assay were performed. STAT3-C protein expression and its binding to DNA in the liver graft were confirmed by Western blotting and electrophoretic mobility shift assay (EMSA), respectively. This treatment modality promoted post-Tx liver regeneration effectively and rapidly. The serum levels of alanine aminotransferase/aspartate aminotransferase (AST/ALT) and bilirubin decreased in rats with STAT3-C. However, albumin (a marker of liver function) did not. Ex vivo gene transfer of STAT3-C to liver grafts reduced post-Tx injury and promoted liver regeneration. Thus, the activation of STAT3 in the liver graft may be a potentially effective clinical strategy for improving the outcome of small-for-size liver transplantation.
Zhuge, Xiangkai; Tang, Fang; Zhu, Hongfei; Mao, Xiang; Wang, Shaohui; Wu, Zongfu; Lu, Chengping; Dai, Jianjun; Fan, Hongjie
2016-04-26
Bacteria can change its lifestyle during inhabiting in host niches where they survive and replicate by rapidly altering gene expression pattern to accommodate the new environment. In this study, two novel regulators in avian pathogenic Escherichia coli (APEC) were identified and designated as AutA and AutR. RT-PCR and β-galactosidase assay results showed that AutA and AutR co-regulated the expression of adhesin UpaB in APEC strain DE205B. Electrophoretic mobility shift assay showed that AutA and AutR could directly bind the upaB promoter DNA. In vitro transcription assay indicated that AutA could activate the upaB transcription, while AutR inhibited the upaB transcription due to directly suppressing the activating effect of AutA on UpaB expression. Transcriptome analysis showed that AutA and AutR coherently affected the expression of hundreds of genes. Our study confirmed that AutA and AutR co-regulated the expression of DE205B K1 capsule and acid resistance systems in E. coli acid fitness island (AFI). Moreover, phenotypic heterogeneity in expression of K1 capsule and acid resistance systems in AFI during host-pathogen interaction was associated with the regulation of AutA and AutR. Collectively speaking, our studies presented that AutA and AutR are involved in APEC adaptive lifestyle change to facilitate its infection.
Hubmann, Rainer; Hilgarth, Martin; Schnabl, Susanne; Ponath, Elena; Reiter, Marlies; Demirtas, Dita; Sieghart, Wolfgang; Valent, Peter; Zielinski, Christoph; Jäger, Ulrich; Shehata, Medhat
2013-03-01
Chronic lymphocytic leukaemia (CLL) cells express constitutively activated NOTCH2 in a protein kinase C (PKC)- dependent manner. The transcriptional activity of NOTCH2 correlates not only with the expression of its target gene FCER2 (CD23) but is also functionally linked with CLL cell viability. In the majority of CLL cases, DNA-bound NOTCH2 complexes are less sensitive to the γ-secretase inhibitor (GSI) DAPT. Therefore, we searched for compounds that interfere with NOTCH2 signalling at the transcription factor level. Using electrophoretic mobility shift assays (EMSA), we identified the Aspergillum-derived secondary metabolite gliotoxin as a potent NOTCH2 transactivation inhibitor. Gliotoxin completely blocked the formation of DNA-bound NOTCH2 complexes in CLL cells independent of their sensitivity to DAPT. The inhibition of NOTCH2 signalling by gliotoxin was associated with down regulation of CD23 (FCER) expression and induction of apoptosis. Short time exposure of CLL cells indicated that the early apoptotic effect of gliotoxin is independent of proteasome regulated nuclear factor κB activity, and is associated with up regulation of NOTCH3 and NR4A1 expression. Gliotoxin could overcome the supportive effect of primary bone marrow stromal cells in an ex vivo CLL microenvironment model. In conclusion, we identified gliotoxin as a potent NOTCH2 inhibitor with a promising therapeutic potential in CLL. © 2012 Blackwell Publishing Ltd.
Arora, Sanjeevani; Heyza, Joshua; Zhang, Hao; Kalman-Maltese, Vivian; Tillison, Kristin; Floyd, Ashley M.; Chalfin, Elaine M.; Bepler, Gerold; Patrick, Steve M.
2016-01-01
ERCC1-XPF heterodimer is a 5′-3′ structure-specific endonuclease which is essential in multiple DNA repair pathways in mammalian cells. ERCC1-XPF (ERCC1-ERCC4) repairs cisplatin-DNA intrastrand adducts and interstrand crosslinks and its specific inhibition has been shown to enhance cisplatin cytotoxicity in cancer cells. In this study, we describe a high throughput screen (HTS) used to identify small molecules that inhibit the endonuclease activity of ERCC1-XPF. Primary screens identified two compounds that inhibit ERCC1-XPF activity in the nanomolar range. These compounds were validated in secondary screens against two other non-related endonucleases to ensure specificity. Results from these screens were validated using an in vitro gel-based nuclease assay. Electrophoretic mobility shift assays (EMSAs) further show that these compounds do not inhibit the binding of purified ERCC1-XPF to DNA. Next, in lung cancer cells these compounds potentiated cisplatin cytotoxicity and inhibited DNA repair. Structure activity relationship (SAR) studies identified related compounds for one of the original Hits, which also potentiated cisplatin cytotoxicity in cancer cells. Excitingly, dosing with NSC16168 compound potentiated cisplatin antitumor activity in a lung cancer xenograft model. Further development of ERCC1-XPF DNA repair inhibitors is expected to sensitize cancer cells to DNA damage-based chemotherapy. PMID:27650543
Gao, Shaopei; Fang, Jun; Xu, Fan; Wang, Wei
2016-01-01
Bioactive gibberellins (GAs) are key endogenous regulators of plant growth. Previous work identified ELONGATED UPPERMOST INTERNODE1 (EUI1) as a GA-deactivating enzyme that plays an important role in panicle exsertion from the flag leaf sheath in rice (Oryza sativa). However, the mechanism that regulates EUI1 activity during development is still largely unexplored. In this study, we identified the dominant panicle enclosure mutant regulator of eui1 (ree1-D), whose phenotype is caused by the activation of the homeodomain-leucine zipper transcription factor HOX12. Diminished HOX12 expression by RNA interference enhanced panicle exsertion, mimicking the eui1 phenotype. HOX12 knockdown plants contain higher levels of the major biologically active GAs (such as GA1 and GA4) than the wild type. The expression of EUI1 is elevated in the ree1-D mutant but reduced in HOX12 knockdown plants. Interestingly, both HOX12 and EUI1 are predominantly expressed in panicles, where GA4 is highly accumulated. Yeast one-hybrid, electrophoretic mobility shift assay, and chromatin immunoprecipitation analyses showed that HOX12 physically interacts with the EUI1 promoter both in vitro and in vivo. Furthermore, plants overexpressing HOX12 in the eui1 mutant background retained the elongated uppermost internode phenotype. These results indicate that HOX12 acts directly through EUI1 to regulate panicle exsertion in rice. PMID:26977084
Majer, Christine; Xu, Changzheng; Berendzen, Kenneth W; Hochholdinger, Frank
2012-06-05
Rootless concerning crown and seminal roots (Rtcs) encodes a LATERAL ORGAN BOUNDARIES domain (LBD) protein that regulates shoot-borne root initiation in maize (Zea mays L.). GREEN FLUORESCENT PROTEIN (GFP)-fusions revealed RTCS localization in the nucleus while its paralogue RTCS-LIKE (RTCL) was detected in the nucleus and cytoplasm probably owing to an amino acid exchange in a nuclear localization signal. Moreover, enzyme-linked immunosorbent assay (ELISA) experiments demonstrated that RTCS primarily binds to LBD DNA motifs. RTCS binding to an LBD motif in the promoter of the auxin response factor (ARF) ZmArf34 and reciprocally, reciprocal ZmARF34 binding to an auxin responsive element motif in the promoter of Rtcs was shown by electrophoretic mobility shift assay experiments. In addition, comparative qRT-PCR of wild-type versus rtcs coleoptilar nodes suggested RTCS-dependent activation of ZmArf34 expression. Consistently, luciferase reporter assays illustrated the capacity of RTCS, RTCL and ZmARF34 to activate downstream gene expression. Finally, RTCL homo- and RTCS/RTCL hetero-interaction were demonstrated in yeast-two-hybrid and bimolecular fluorescence complementation experiments, suggesting a role of these complexes in downstream gene regulation. In summary, the data provide novel insights into the molecular interactions resulting in crown root initiation in maize.
Expression Profile of Cationic Amino Acid Transporters in Rats with Endotoxin-Induced Uveitis
Chang, Shu-Wen; Lee, Yi-An; Kao, Tzu-Yun
2016-01-01
Purpose. The transcellular arginine transportation via cationic amino acid transporter (CAT) is the rate-limiting step in nitric oxide (NO) synthesis, which is crucial in intraocular inflammation. In this study, CAT isoforms and inducible nitric oxide synthase (iNOS) expression was investigated in endotoxin-induced uveitis (EIU). Methods. EIU was induced in Lewis rats by lipopolysaccharide (LPS) injection. In the treatment group, the rats were injected intraperitoneally with the proteasome inhibitor bortezomib before EIU induction. After 24 hours, leukocyte quantification, NO measurement of the aqueous humor, and histopathological examination were evaluated. The expression of CAT isoforms and iNOS was determined by reverse transcription-polymerase chain reaction, western blotting, and immunofluorescence staining. Nuclear factor-kappa B (NF-κB) binding activity was evaluated by electrophoretic mobility shift assay. The mouse macrophage cell line RAW 264.7 was used to validate the in vivo findings. Results. LPS significantly stimulated iNOS, CAT-2A, and CAT-2B mRNA and protein expression but did not affect CAT-1 in EIU rats and RAW 264.7 cells. Bortezomib attenuated inflammation and inhibited iNOS, CAT-2A, and CAT-2B expression through NF-κB inhibition. Conclusions. CAT-2 and iNOS, but not CAT-1, are specifically involved in EIU. NF-κB is essential in the induction of CAT-2 and iNOS in EIU. PMID:27413255
Watchorn, Tammy M; Dowidar, Nabil; Dejong, Cornelis H C; Waddell, Ian D; Garden, O James; Ross, James A
2005-10-01
A novel proteoglycan, proteolysis inducing factor (PIF), is capable of inducing muscle proteolysis during the process of cancer cachexia, and of inducing an acute phase response in human hepatocytes. We investigated whether PIF is able to activate pro-inflammatory pathways in human Kupffer cells, the resident macrophages of the liver, and in monocytes, resulting in the production of pro-inflammatory cytokines. Normal liver tissue was obtained from patients undergoing partial hepatectomy and Kupffer cells were isolated. Monocytes were isolated from peripheral blood. Following exposure to native PIF, pro-inflammatory cytokine production from Kupffer cells and monocytes was measured and the NF-kappaB and STAT3 transcriptional pathways were investigated using electrophoretic mobility shift assays. We demonstrate that PIF is able to activate the transcription factor NF-kappaB and NF-kappaB-inducible genes in human Kupffer cells, and in monocytes, resulting in the production of pro-inflammatory cytokines such as TNF-alpha, IL-8 and IL-6. PIF enhances the expression of the cell surface molecules LFA-1 and CD14 on macrophages. PIF also activates the transcription factor STAT3 in Kupffer cells. The pro-inflammatory effects of PIF, mediated via NF-kappaB and STAT3, are important in macrophage behaviour and may contribute to the inflammatory pro-cachectic process in the liver.
KIM, J. Y.; YENARI, M. A.; LEE, J. E.
2018-01-01
Inflammation is an important event in ischemic injury. These immune responses begin with the expression of pro-inflammatory genes modulating transcription factors, such as nuclear factor-κB (NF-κB), activator protein-1 (AP-1), and signal transducers and activator of transcription-1 (STAT-1). The 70-kDa heat shock protein (Hsp70) can both induce and arrest inflammatory reactions and lead to improved neurological outcome in experimental brain injury and ischemia. Since Hsp70 are induced under heat stress, we investigated the link between Hsp70 neuroprotection and phosphorylation of inhibitor of κB (IκB), c-Jun N-terminal kinases (JNK) and p38 through co-immunoprecipitation and enzyme-linked immunosorbent assay (ELISA) assay. Transcription factors and pro-inflammatory genes were quantified by immunoblotting, electrophoretic-mobility shift assay and reverse transcription-polymerase chain reaction assays. The results showed that heat stress led to Hsp70 overexpression which rendered neuroprotection after ischemia-like injury. Overexpression Hsp70 also interrupts the phosphorylation of IκB, JNK and p38 and bluntsDNA binding of their transcription factors (NF-κB, AP-1 and STAT-1), effectively downregulating the expression of pro-inflammatory genes inheat-pretreatedastrocytes. Takentogether, these results suggest that overexpression of Hsp70 may protect against brain ischemia via an anti-inflammatory mechanism by interrupting the phosphorylation of upstream of transcription factors. PMID:25485480
Probing the interaction of the phytochemical 6-gingerol from the spice ginger with DNA.
Haris, Poovvathingal; Mary, Varughese; Sudarsanakumar, Chellappanpillai
2018-07-01
6-Gingerol [5-hydroxy-1-(4-hydroxy-3-methoxyphenyl) decan-3-one], the bio-active ingredient of the popular Indian spice ginger (Zingiber officinale Roscoe), is well-known for its pharmacological and physiological actions. The potent antioxidant, antiemetic, antiulcer, antimicrobial, analgesic, hypoglycemic, antihypertensive, antihyperlipidemic, immunostimulant, anti-inflammatory, cardiotonic, and cancer prevention activities of 6-Gingerol has been investigated and explored. 6-Gingerol is a good candidate for the treatment of various cancers including prostrate, pancreatic, breast, skin, gastrointestinal, pulmonary, and renal cancer. In this study we report for the first time the molecular recognition of 6-Gingerol with calf thymus DNA (ctDNA) through experimental and molecular modeling techniques confirming a minor groove binding mode of 6-Gingerol with ctDNA. Fluorescence and UV-vis spectroscopic studies confirm the complex formation of 6-gingerol with ctDNA. The energetics and thermodynamics of the interaction of 6-Gingerol with ctDNA was explored by Isothermal Titration Calorimetry (ITC) and Differential Scanning Calorimetry (DSC). The ctDNA helix melting upon 6-Gingerol binding was examined by melting temperature T m analysis. Further the electrophoretic mobility shift assay confirms a possible groove binding of 6-Gingerol with ctDNA. Molecular docking and Molecular dynamics (MD) studies provide a detailed understanding on the interaction of 6-Gingerol binding in the minor groove of DNA which supports experimental results. Copyright © 2018. Published by Elsevier B.V.
LmaPA2G4, a Homolog of Human Ebp1, Is an Essential Gene and Inhibits Cell Proliferation in L. major
Joyce, Michelle V.; Morales, Miguel A.
2014-01-01
We have identified LmaPA2G4, a homolog of the human proliferation-associated 2G4 protein (also termed Ebp1), in a phosphoproteomic screening. Multiple sequence alignment and cluster analysis revealed that LmaPA2G4 is a non-peptidase member of the M24 family of metallopeptidases. This pseudoenzyme is structurally related to methionine aminopeptidases. A null mutant system based on negative selection allowed us to demonstrate that LmaPA2G4 is an essential gene in Leishmania major. Over-expression of LmaPA2G4 did not alter cell morphology or the ability to differentiate into metacyclic and amastigote stages. Interestingly, the over-expression affected cell proliferation and virulence in mouse footpad analysis. LmaPA2G4 binds a synthetic double-stranded RNA polyriboinosinic polyribocytidylic acid [poly(I∶C)] as shown in an electrophoretic mobility shift assay (EMSA). Quantitative proteomics revealed that the over-expression of LmaPA2G4 led to accumulation of factors involved in translation initiation and elongation. Significantly, we found a strong reduction of de novo protein biosynthesis in transgenic parasites using a non-radioactive metabolic labeling assay. In conclusion, LmaPA2G4 is an essential gene and is potentially implicated in fundamental biological mechanisms, such as translation, making it an attractive target for therapeutic intervention. PMID:24421916
Yaghi, Layale; Poras, Isabelle; Simoes, Renata T.; Donadi, Eduardo A.; Tost, Jörg; Daunay, Antoine; de Almeida, Bibiana Sgorla; Carosella, Edgardo D.; Moreau, Philippe
2016-01-01
HLA-G is an immune checkpoint molecule with specific relevance in cancer immunotherapy. It was first identified in cytotrophoblasts, protecting the fetus from maternal rejection. HLA-G tissue expression is very restricted but induced in numerous malignant tumors such as glioblastoma, contributing to their immune escape. Hypoxia occurs during placenta and tumor development and was shown to activate HLA-G. We aimed to elucidate the mechanisms of HLA-G activation under conditions combining hypoxia-mimicking treatment and 5-aza-2′deoxycytidine, a DNA demethylating agent used in anti-cancer therapy which also induces HLA-G. Both treatments enhanced the amount of HLA-G mRNA and protein in HLA-G negative U251MG glioma cells. Electrophoretic Mobility Shift Assays and luciferase reporter gene assays revealed that HLA-G upregulation depends on Hypoxia Inducible Factor-1 (HIF-1) and a hypoxia responsive element (HRE) located in exon 2. A polymorphic HRE at −966 bp in the 5′UT region may modulate the magnitude of the response mediated by the exon 2 HRE. We suggest that therapeutic strategies should take into account that HLA-G expression in response to hypoxic tumor environment is dependent on HLA-G gene polymorphism and DNA methylation state at the HLA-G locus. PMID:27577073
21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.
Code of Federal Regulations, 2012 CFR
2012-04-01
... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Electrophoretic hemoglobin analysis system. 864.7440 Section 864.7440 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN....7440 Electrophoretic hemoglobin analysis system. (a) Identification. An electrophoretic hemoglobin...
21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.
Code of Federal Regulations, 2013 CFR
2013-04-01
... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Electrophoretic hemoglobin analysis system. 864.7440 Section 864.7440 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN....7440 Electrophoretic hemoglobin analysis system. (a) Identification. An electrophoretic hemoglobin...
21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.
Code of Federal Regulations, 2011 CFR
2011-04-01
... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Electrophoretic hemoglobin analysis system. 864.7440 Section 864.7440 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN....7440 Electrophoretic hemoglobin analysis system. (a) Identification. An electrophoretic hemoglobin...
21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.
Code of Federal Regulations, 2014 CFR
2014-04-01
... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Electrophoretic hemoglobin analysis system. 864.7440 Section 864.7440 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN....7440 Electrophoretic hemoglobin analysis system. (a) Identification. An electrophoretic hemoglobin...
21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.
Code of Federal Regulations, 2010 CFR
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Electrophoretic hemoglobin analysis system. 864.7440 Section 864.7440 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN....7440 Electrophoretic hemoglobin analysis system. (a) Identification. An electrophoretic hemoglobin...
Ryu, Gi Seong; Lee, Myung Won; Jeong, Seung Hyeon; Song, Chung Kun
2012-01-01
In this study we developed a simple ink-jet process for 6,13-bis(triisopropylsilylethynyl)-pentacene (TIPS-pentacene), which is known as a high-mobility soluble organic semiconductor, to achieve relatively high-mobility and high-uniformity performance for large-area applications. We analyzed the behavior of fluorescent particles in droplets and applied the results to determining a method of controlling the behavior of TIPS-pentacene molecules. The grain morphology of TIPS-pentacene varied depending on the temperature applied to the droplets during drying. We were able to obtain large and uniform grains at 46 degrees C without any "coffee stain". The process was applied to a large-size organic thin-film transistor (OTFT) backplane for an electrophoretic display panel containing 192 x 150 pixels on a 6-in.-sized substrate. The average of mobilities of 36 OTFTs, which were taken from different locations of the backplane, was 0.44 +/- 0.08 cm2.V-1.s-1, with a small deviation of 20%, over a 6-in.-size area comprising 28,800 OTFTs. This process providing high mobility and high uniformity can be achieved by simply maintaining the whole area of the substrate at a specific temperature (46 degrees C in this case) during drying of the droplets.
Rill, Randolph L; Beheshti, Afshin; Van Winkle, David H
2002-08-01
Electrophoretic mobilities of DNA molecules ranging in length from 200 to 48 502 base pairs (bp) were measured in agarose gels with concentrations T = 0.5% to 1.3% at electric fields from E = 0.71 to 5.0 V/cm. This broad data set determines a range of conditions over which the new interpolation equation nu(L) = (beta+alpha(1+exp(-L/gamma))(-1) can be used to relate mobility to length with high accuracy. Mobility data were fit with chi(2) > 0.999 for all gel concentrations and fields ranging from 2.5 to 5 V/cm, and for lower fields at low gel concentrations. Analyses using so-called reptation plots (Rousseau, J., Drouin, G., Slater, G. W., Phys. Rev. Lett. 1997, 79, 1945-1948) indicate that this simple exponential relation is obeyed well when there is a smooth transition from the Ogston sieving regime to the reptation regime with increasing DNA length. Deviations from this equation occur when DNA migration is hindered, apparently by entropic-trapping, which is favored at low fields and high gel concentrations in the ranges examined.
Ludewig, Ronny; Nietzsche, Sandor; Scriba, Gerhard K E
2011-01-01
A CEC weak cation-exchange monolith has been prepared by in situ polymerization of acrylamide, methylenebisacrylamide and 4-acrylamidobutyric acid in a decanol-dimethylsulfoxide mixture as porogen. The columns were evaluated by SEM and characterized with regard to the separation of diastereomers and α/β-isomers of aspartyl peptides. Column preparation was reproducible as evidenced by comparison of the analyte retention times of several columns prepared simultaneously. Analyte separation was achieved using mobile phases consisting of acidic phosphate buffer and ACN. Under these conditions the peptides migrated due to their electrophoretic mobility but the EOF also contributed as driving force as a function of the pH of the mobile phase due to increasing dissociation of the carboxyl groups of the polymer. Raising the pH of the mobile phase also resulted in deprotonation of the peptides reducing analyte mobility. Due to these mechanisms each pair of diastereomeric peptides displayed the highest resolution at a different pH of the buffer component of the mobile phase. Comparing the weak-cation exchange monolith to an RP monolith and a strong cation-exchange monolith different elution order of some peptide diastereomers was observed, clearly illustrating that interactions with the stationary phase contribute to the CEC separations. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Sim, H H; Kim, Y J; Choi, H J
2012-12-01
Black inorganic pigment modified with poly(styrene-co-acrylonitrile) was fabricated via dispersion polymerization, and then the synthesized hybrid nanoparticles were examined by SEM to confirm their morphology, while their density and size were studied using a gas pycnometer and electrophoretic light scattering apparatus, respectively. We also confirmed their chemical structure and coated state via FT-IR and TGA. Electrophoretic characteristics including the zeta potential were examined via an electrophoretic light scattering apparatus, while the movement of particles was directly observed by an optical microscopy under an electric field applied. The hybrid nanoparticles were confirmed to possess an electrophoretic property as a potential candidate for the microcapsule-type electrophoretic display.
Molecular evidence of stereo-specific lactoferrin dimers in solution.
Persson, Björn A; Lund, Mikael; Forsman, Jan; Chatterton, Dereck E W; Akesson, Torbjörn
2010-10-01
Gathering experimental evidence suggests that bovine as well as human lactoferrin self-associate in aqueous solution. Still, a molecular level explanation is unavailable. Using force field based molecular modeling of the protein-protein interaction free energy we demonstrate (1) that lactoferrin forms highly stereo-specific dimers at neutral pH and (2) that the self-association is driven by a high charge complementarity across the contact surface of the proteins. Our theoretical predictions of dimer formation are verified by electrophoretic mobility and N-terminal sequence analysis on bovine lactoferrin. 2010 Elsevier B.V. All rights reserved.
NASA Technical Reports Server (NTRS)
Davis, Robert H.; Loewenberg, Michael
1997-01-01
The primary objective of this research was to develop a fundamental understanding of aggregation and coalescence processes during electrically-driven migration of cells, particles and droplets. The process by which charged cells, particles, molecules, or drops migrate in a weak electric field is known as electrophoresis. If the migrating species have different charges or surface potentials, they will migrate at different speeds and thus may collide and aggregate or coalesce. Aggregation and coalescence are undesirable, if the goal is to separate the different species on the basis of their different electrophoretic mobilities.
Binary Oscillatory Crossflow Electrophoresis
NASA Technical Reports Server (NTRS)
Molloy, Richard F.; Gallagher, Christopher T.; Leighton, David T., Jr.
1996-01-01
We present preliminary results of our implementation of a novel electrophoresis separation technique: Binary Oscillatory Cross flow Electrophoresis (BOCE). The technique utilizes the interaction of two driving forces, an oscillatory electric field and an oscillatory shear flow, to create an active binary filter for the separation of charged species. Analytical and numerical studies have indicated that this technique is capable of separating proteins with electrophoretic mobilities differing by less than 10%. With an experimental device containing a separation chamber 20 cm long, 5 cm wide, and 1 mm thick, an order of magnitude increase in throughput over commercially available electrophoresis devices is theoretically possible.
Chiang, Howard Hsueh-hao
2009-01-01
Preparative and analytical methods developed by separation scientists have played an important role in the history of molecular biology. One such early method is gel electrophoresis, a technique that uses various types of gel as its supporting medium to separate charged molecules based on size and other properties. Historians of science, however, have only recently begun to pay closer attention to this material epistemological dimension of biomolecular science. This paper substantiates the historiographical thread that explores the relationship between modern laboratory practice and the production of scientific knowledge. It traces the historical development of gel electrophoresis from the mid-1940s to the mid-1960s, with careful attention to the interplay between technical developments and disciplinary shifts, especially the rise of molecular biology in this time-frame. Claiming that the early 1950s marked a decisive shift in the evolution of electrophoretic methods from moving boundary to zone electrophoresis, I reconstruct various trajectories in which scientists such as Oliver Smithies sought out the most desirable solid supporting medium for electrophoretic instrumentation. Biomolecular knowledge, I argue, emerged in part from this process of seeking the most appropriate supporting medium that allowed for discrete molecular separation and visualization. The early 1950s, therefore, marked not only an important turning point in the history of separation science, but also a transformative moment in the history of the life sciences as the growth of molecular biology depended in part on the epistemological access to the molecular realm available through these evolving technologies.
Thermoplastic microchannel fabrication using carbon dioxide laser ablation.
Wang, Shau-Chun; Lee, Chia-Yu; Chen, Hsiao-Ping
2006-04-14
We report the procedures of machining microchannels on Vivak co-polyester thermoplastic substrates using a simple industrial CO(2) laser marker. To avoid overheating the substrates, we develop low-power marking techniques in nearly anaerobic environment. These procedures are able to machine microchannels at various aspect ratios. Either straight or serpent channel can be easily marked. Like the wire-embossed channel walls, the ablated channel surfaces become charged after alkaline hydrolysis treatment. Stable electroosmotic flow in the charged conduit is observed to be of the same order of magnitude as that in fused silica capillary. Typical dynamic coating protocols to alter the conduit surface properties are transferable to the ablated channels. The effects of buffer acidity on electroosmotic mobility in both bare and coated channels are similar to those in fused silica capillaries. Using video microscopy we also demonstrate that this device is useful in distinguishing the electrophoretic mobility of bare and latex particles from that of functionalized ones.
Electric field-induced reversible trapping of microtubules along metallic glass microwire electrodes
NASA Astrophysics Data System (ADS)
Kim, Kyongwan; Sikora, Aurélien; Nakayama, Koji S.; Umetsu, Mitsuo; Hwang, Wonmuk; Teizer, Winfried
2015-04-01
Microtubules are among bio-polymers providing vital functions in dynamic cellular processes. Artificial organization of these bio-polymers is a requirement for transferring their native functions into device applications. Using electrophoresis, we achieve an accumulation of microtubules along a metallic glass (Pd42.5Cu30Ni7.5P20) microwire in solution. According to an estimate based on migration velocities of microtubules approaching the wire, the electrophoretic mobility of microtubules is around 10-12 m2/Vs. This value is four orders of magnitude smaller than the typical mobility reported previously. Fluorescence microscopy at the individual-microtubule level shows microtubules aligning along the wire axis during the electric field-induced migration. Casein-treated electrodes are effective to reversibly release trapped microtubules upon removal of the external field. An additional result is the condensation of secondary filamentous structures from oriented microtubules.