Sample records for element dre-associated genes

  1. Activation of dioxin response element (DRE)-associated genes by benzo(a)pyrene 3,6-quinone and benzo(a)pyrene 1,6-quinone in MCF-10A human mammary epithelial cells

    SciTech Connect

    Burchiel, Scott W. . E-mail:; Thompson, Todd A.; Lauer, Fredine T.; Oprea, Tudor I.


    Benzo(a)pyrene (BaP) is a known human carcinogen and a suspected breast cancer complete carcinogen. BaP is metabolized by several metabolic pathways, some having bioactivation and others detoxification properties. BaP-quinones (BPQs) are formed via cytochrome P450 and peroxidase dependent pathways. Previous studies by our laboratory have shown that BPQs have significant growth promoting and anti-apoptotic activities in human MCF-10A mammary epithelial cells examined in vitro. Previous results suggest that BPQs act via redox-cycling and oxidative stress. However, because two specific BPQs (1,6-BPQ and 3,6-BPQ) differed in their ability to produce reactive oxygen species (ROS) and yet both had strong proliferative and EGF receptor activating activity, we utilized mRNA expression arrays and qRT-PCR to determine potential pathways and mechanisms of gene activation. The results of the present studies demonstrated that 1,6-BPQ and 3,6-BPQ activate dioxin response elements (DRE, also known as xenobiotic response elements, XRE) and anti-oxidant response elements (ARE, also known as electrophile response elements, EpRE). 3,6-BPQ had greater DRE activity than 1,6-BPQ, whereas the opposite was true for the activation of ARE. Both 3,6-BPQ and 1,6-BPQ induced oxidative stress-associated genes (HMOX1, GCLC, GCLM, and SLC7A11), phase 2 enzyme genes (NQO1, NQO2, ALDH3A1), PAH metabolizing genes (CYP1B1, EPHX1, AKR1C1), and certain EGF receptor-associated genes (EGFR, IER3, ING1, SQSTM1 and TRIM16). The results of these studies demonstrate that BPQs activate numerous pathways in human mammary epithelial cells associated with increased cell growth and survival that may play important roles in tumor promotion.

  2. Transposable element origins of epigenetic gene regulation.


    Lisch, Damon; Bennetzen, Jeffrey L


    Transposable elements (TEs) are massively abundant and unstable in all plant genomes, but are mostly silent because of epigenetic suppression. Because all known epigenetic pathways act on all TEs, it is likely that the specialized epigenetic regulation of regular host genes (RHGs) was co-opted from this ubiquitous need for the silencing of TEs and viruses. With their internally repetitive and rearranging structures, and the acquisition of fragments of RHGs, the expression of TEs commonly makes antisense RNAs for both TE genes and RHGs. These antisense RNAs, particularly from heterochromatic reservoirs of 'zombie' TEs that are rearranged to form variously internally repetitive structures, may be advantageous because their induction will help rapidly suppress active TEs of the same family. RHG fragments within rapidly rearranging TEs may also provide the raw material for the ongoing generation of miRNA genes. TE gene expression is regulated by both environmental and developmental signals, and insertions can place nearby RHGs under the regulation (both standard and epigenetic) of the TE. The ubiquity of TEs, their frequent preferential association with RHGs, and their ability to be programmed by epigenetic signals all indicate that RGHs have nearly unlimited access to novel regulatory cassettes to assist plant adaptation. PMID:21444239

  3. Transcription factor trapping by RNA in gene regulatory elements

    PubMed Central

    Sigova, Alla A.; Abraham, Brian J.; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M.; Eric Guo, Yang; Jangi, Mohini; Giallourakis, Cosmas C.; Sharp, Phillip A.; Young, Richard A.


    Transcription factors (TFs) bind specific sequences in promoter-proximal and distal DNA elements in order to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA-binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF YY1 binds to both gene regulatory elements and also to their associated RNA species genome-wide. Reduced transcription of regulatory elements diminishes YY1 occupancy whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive feedback loop that contributes to the stability of gene expression programs. PMID:26516199

  4. Transcription factor trapping by RNA in gene regulatory elements.


    Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A


    Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. PMID:26516199

  5. Tissue-specific control elements of the Thy-1 gene.

    PubMed Central

    Vidal, M; Morris, R; Grosveld, F; Spanopoulou, E


    We have exploited the structural homology, but different patterns of expression of the murine and human Thy-1 genes to map a number of tissue-specific enhancer elements in the genes. All of these are located downstream from the site of transcriptional initiation. The human gene contains separate elements which direct expression to the kidney or spleen epithelium. The murine gene lacks these elements but instead contains a thymocyte specific enhancer in the third intron. Developmentally-regulated expression in nerve cells is directed (at least in part) by an atypical element in the first intron. The latter is active on heterologous promoters, but is position and distance dependent. Images Fig. 2. Fig. 4. Fig. 5. Fig. 6. PMID:1968831

  6. Epigenomic elements enriched in the promoters of autoimmunity susceptibility genes.


    Dozmorov, Mikhail G; Wren, Jonathan D; Alarcón-Riquelme, Marta E


    Genome-wide association studies have identified a number of autoimmune disease-susceptibility genes. Whether or not these loci share any regulatory or functional elements, however, is an open question. Finding such common regulators is of considerable research interest in order to define systemic therapeutic targets. The growing amount of experimental genomic annotations, particularly those from the ENCODE project, provide a wealth of opportunities to search for such commonalities. We hypothesized that regulatory commonalities might not only delineate a regulatory landscape predisposing to autoimmune diseases, but also define functional elements distinguishing specific diseases. We further investigated if, and how, disease-specific epigenomic elements can identify novel genes yet to be associated with the diseases. We evaluated transcription factors, histone modifications, and chromatin state data obtained from the ENCODE project for statistically significant over- or under-representation in the promoters of genes associated with Systemic Lupus Erythematosus (SLE), Rheumatoid Arthritis (RA), and Systemic Sclerosis (SSc). We identified BATF, BCL11A, IRF4, NFkB, PAX5, and PU.1 as transcription factors over-represented in SLE- and RA-susceptibility gene promoters. H3K4me1 and H3K4me2 epigenomic marks were associated with SLE susceptibility genes, and H3K9me3 was common to both SLE and RA. In contrast to a transcriptionally active signature in SLE and RA, SSc-susceptibility genes were depleted in activating epigenomic elements. Using epigenomic elements enriched in SLE and RA, we identified additional immune and B cell signaling-related genes with the same elements in their promoters. Our analysis suggests common and disease-specific epigenomic elements that may define novel therapeutic targets for controlling aberrant activation of autoimmune susceptibility genes. PMID:24213554

  7. Transcriptional regulatory elements downstream of the JunB gene.

    PubMed Central

    Perez-Albuerne, E D; Schatteman, G; Sanders, L K; Nathans, D


    JunB is an immediate early transcription factor that is induced by a variety of extracellular signaling agents, including growth factors, phorbol esters, and agents that elevate cyclic AMP. The mechanism of activation of the gene encoding JunB by these agents is not well understood. By using the JunB gene together with flanking DNA in transfection experiments, we show that a serum response element (SRE) and/or a cAMP response element (CRE) downstream of the gene mediate the response of the gene in mouse NIH 3T3 cells to serum, platelet-derived growth factor, basic fibroblast growth factor, phorbol ester, and forskolin. In addition, a segment of DNA just upstream of the TATA box is required for optimal activation of the gene. Images Fig. 1 Fig. 5 PMID:8265655

  8. Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

    SciTech Connect

    Santini, Simona; Boore, Jeffrey L.; Meyer, Axel


    Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involved in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.

  9. Gene regulation by structured mRNA elements.


    Wachter, Andreas


    The precise temporal and spatial coordination of gene activity, based on the integration of internal and external signals, is crucial for the accurate functioning of all biological processes. Although the basic principles of gene expression were established some 60 years ago, recent research has revealed a surprising complexity in the control of gene activity. Many of these gene regulatory mechanisms occur at the level of the mRNA, including sophisticated gene control tasks mediated by structured mRNA elements. We now know that mRNA folds can serve as highly specific receptors for various types of molecules, as exemplified by metabolite-binding riboswitches, and interfere with pro- and eukaryotic gene expression at the level of transcription, translation, and RNA processing. Gene regulation by structured mRNA elements comprises versatile strategies including self-cleaving ribozymes, RNA-folding-mediated occlusion or presentation of cis-regulatory sequences, and sequestration of trans-acting factors including other RNAs and proteins. PMID:24780087

  10. Transcriptional Targeting in the Airway Using Novel Gene Regulatory Elements

    PubMed Central

    Burnight, Erin R.; Wang, Guoshun; McCray, Paul B.


    The delivery of cystic fibrosis transmembrane conductance regulator (CFTR) to airway epithelia is a goal of many gene therapy strategies to treat cystic fibrosis. Because the native regulatory elements of the CFTR are not well characterized, the development of vectors with heterologous promoters of varying strengths and specificity would aid in our selection of optimal reagents for the appropriate expression of the vector-delivered CFTR gene. Here we contrasted the performance of several novel gene-regulatory elements. Based on airway expression analysis, we selected putative regulatory elements from BPIFA1 and WDR65 to investigate. In addition, we selected a human CFTR promoter region (∼ 2 kb upstream of the human CFTR transcription start site) to study. Using feline immunodeficiency virus vectors containing the candidate elements driving firefly luciferase, we transduced murine nasal epithelia in vivo. Luciferase expression persisted for 30 weeks, which was the duration of the experiment. Furthermore, when the nasal epithelium was ablated using the detergent polidocanol, the mice showed a transient loss of luciferase expression that returned 2 weeks after administration, suggesting that our vectors transduced a progenitor cell population. Importantly, the hWDR65 element drove sufficient CFTR expression to correct the anion transport defect in CFTR-null epithelia. These results will guide the development of optimal vectors for sufficient, sustained CFTR expression in airway epithelia. PMID:22447971

  11. Harnessing mobile genetic elements to explore gene regulation.


    Shakes, Leighcraft A; Wolf, Hope M; Norford, Derek C; Grant, Delores J; Chatterjee, Pradeep K


    Sequences that regulate expression of a gene in cis but are located at large distances along the DNA from the gene, as found with most developmentally regulated genes in higher vertebrates, are difficult to identify if those sequences are not conserved across species. Mutating suspected gene-regulatory sequences to alter expression then becomes a hit-or-miss affair. The relaxed specificity of transposon insertions offers an opportunity to develop alternate strategies, to scan in an unbiased manner, pieces of chromosomal DNA cloned in BACs for transcription enhancing elements. This article illustrates how insertions of Tn10 with enhancer-traps into BAC DNA containing the gene, and its germ-line expression in zebrafish, have identified distal regulatory elements functionally. Transposition of Tn10 first introduces the enhancer-trap with a loxP site randomly into BAC DNA. Cre-recombination between the inserted loxP and the loxP endogenous to a BAC-end positions the enhancer-trap to the newly created truncated end of BAC DNA. The procedure generates a library of integration-ready enhancer-trap BACs with progressive truncations from an end in a single experiment. Individual enhancer-trap BACs from the library can be evaluated functionally in zebrafish or mice. Furthermore, the ability to readily alter sequences in a small transposon plasmid containing a regulatory domain of the gene allows re-introduction of altered parts of a BAC back into itself. It serves as a useful strategy to functionally dissect multiple discontinuous regulatory domains of a gene quickly. These methodologies have been successfully used in identifying novel regulatory domains of the Amyloid Precursor Protein (appb) gene in zebrafish, and provided important clues for regulation of the gene in humans. PMID:25054085

  12. Interaction between Conjugative and Retrotransposable Elements in Horizontal Gene Transfer

    PubMed Central

    Novikova, Olga; Smith, Dorie; Hahn, Ingrid; Beauregard, Arthur; Belfort, Marlene


    Mobile genetic elements either encode their own mobilization machineries or hijack them from other mobile elements. Multiple classes of mobile elements often coexist within genomes and it is unclear whether they have the capacity to functionally interact and even collaborate. We investigate the possibility that molecular machineries of disparate mobile elements may functionally interact, using the example of a retrotransposon, in the form of a mobile group II intron, found on a conjugative plasmid pRS01 in Lactococcus lactis. This intron resides within the pRS01 ltrB gene encoding relaxase, the enzyme required for nicking the transfer origin (oriT) for conjugal transmission of the plasmid into a recipient cell. Here, we show that relaxase stimulates both the frequency and diversity of retrotransposition events using a retromobility indicator gene (RIG), and by developing a high-throughput genomic retrotransposition detection system called RIG-Seq. We demonstrate that LtrB relaxase not only nicks ssDNA of its cognate oriT in a sequence- and strand-specific manner, but also possesses weak off-target activity. Together, the data support a model in which the two different mobile elements, one using an RNA-based mechanism, the other using DNA-based transfer, do functionally interact. Intron splicing facilitates relaxase expression required for conjugation, whereas relaxase introduces spurious nicks in recipient DNA that stimulate both the frequency of intron mobility and the density of events. We hypothesize that this functional interaction between the mobile elements would promote horizontal conjugal gene transfer while stimulating intron dissemination in the donor and recipient cells. PMID:25474706

  13. C-GATE - catalogue of genes affected by transposable elements

    PubMed Central


    Background Functional regulatory sequences are present in many transposable element (TE) copies, resulting in TEs being frequently exapted by host genes. Today, many examples of TEs impacting host gene expression can be found in the literature and we believe a new catalogue of such exaptations would be useful for the field. Findings We have established the catalogue of genes affected by transposable elements (C-GATE), which can be found at To date, it holds 221 cases of biologically verified TE exaptations and more than 10,000 in silico TE-gene partnerships. C-GATE is interactive and allows users to include missed or new TE exaptation data. C-GATE provides a graphic representation of the entire library, which may be used for future statistical analysis of TE impact on host gene expression. Conclusions We hope C-GATE will be valuable for the TE community but also for others who have realized the role that TEs may have in their research. PMID:22621612

  14. Alu Elements as Novel Regulators of Gene Expression in Type 1 Diabetes Susceptibility Genes?

    PubMed Central

    Kaur, Simranjeet; Pociot, Flemming


    Despite numerous studies implicating Alu repeat elements in various diseases, there is sparse information available with respect to the potential functional and biological roles of the repeat elements in Type 1 diabetes (T1D). Therefore, we performed a genome-wide sequence analysis of T1D candidate genes to identify embedded Alu elements within these genes. We observed significant enrichment of Alu elements within the T1D genes (p-value < 10e−16), which highlights their importance in T1D. Functional annotation of T1D genes harboring Alus revealed significant enrichment for immune-mediated processes (p-value < 10e−6). We also identified eight T1D genes harboring inverted Alus (IRAlus) within their 3' untranslated regions (UTRs) that are known to regulate the expression of host mRNAs by generating double stranded RNA duplexes. Our in silico analysis predicted the formation of duplex structures by IRAlus within the 3'UTRs of T1D genes. We propose that IRAlus might be involved in regulating the expression levels of the host T1D genes. PMID:26184322

  15. Combinatorial Gene Regulatory Functions Underlie Ultraconserved Elements in Drosophila

    PubMed Central

    Warnefors, Maria; Hartmann, Britta; Thomsen, Stefan; Alonso, Claudio R.


    Ultraconserved elements (UCEs) are discrete genomic elements conserved across large evolutionary distances. Although UCEs have been linked to multiple facets of mammalian gene regulation their extreme evolutionary conservation remains largely unexplained. Here, we apply a computational approach to investigate this question in Drosophila, exploring the molecular functions of more than 1,500 UCEs shared across the genomes of 12 Drosophila species. Our data indicate that Drosophila UCEs are hubs for gene regulatory functions and suggest that UCE sequence invariance originates from their combinatorial roles in gene control. We also note that the gene regulatory roles of intronic and intergenic UCEs (iUCEs) are distinct from those found in exonic UCEs (eUCEs). In iUCEs, transcription factor (TF) and epigenetic factor binding data strongly support iUCE roles in transcriptional and epigenetic regulation. In contrast, analyses of eUCEs indicate that they are two orders of magnitude more likely than the expected to simultaneously include protein-coding sequence, TF-binding sites, splice sites, and RNA editing sites but have reduced roles in transcriptional or epigenetic regulation. Furthermore, we use a Drosophila cell culture system and transgenic Drosophila embryos to validate the notion of UCE combinatorial regulatory roles using an eUCE within the Hox gene Ultrabithorax and show that its protein-coding region also contains alternative splicing regulatory information. Taken together our experiments indicate that UCEs emerge as a result of combinatorial gene regulatory roles and highlight common features in mammalian and insect UCEs implying that similar processes might underlie ultraconservation in diverse animal taxa. PMID:27247329

  16. Combinatorial Gene Regulatory Functions Underlie Ultraconserved Elements in Drosophila.


    Warnefors, Maria; Hartmann, Britta; Thomsen, Stefan; Alonso, Claudio R


    Ultraconserved elements (UCEs) are discrete genomic elements conserved across large evolutionary distances. Although UCEs have been linked to multiple facets of mammalian gene regulation their extreme evolutionary conservation remains largely unexplained. Here, we apply a computational approach to investigate this question in Drosophila, exploring the molecular functions of more than 1,500 UCEs shared across the genomes of 12 Drosophila species. Our data indicate that Drosophila UCEs are hubs for gene regulatory functions and suggest that UCE sequence invariance originates from their combinatorial roles in gene control. We also note that the gene regulatory roles of intronic and intergenic UCEs (iUCEs) are distinct from those found in exonic UCEs (eUCEs). In iUCEs, transcription factor (TF) and epigenetic factor binding data strongly support iUCE roles in transcriptional and epigenetic regulation. In contrast, analyses of eUCEs indicate that they are two orders of magnitude more likely than the expected to simultaneously include protein-coding sequence, TF-binding sites, splice sites, and RNA editing sites but have reduced roles in transcriptional or epigenetic regulation. Furthermore, we use a Drosophila cell culture system and transgenic Drosophila embryos to validate the notion of UCE combinatorial regulatory roles using an eUCE within the Hox gene Ultrabithorax and show that its protein-coding region also contains alternative splicing regulatory information. Taken together our experiments indicate that UCEs emerge as a result of combinatorial gene regulatory roles and highlight common features in mammalian and insect UCEs implying that similar processes might underlie ultraconservation in diverse animal taxa. PMID:27247329

  17. Epigenetic regulation of transposable element derived human gene promoters.


    Huda, Ahsan; Bowen, Nathan J; Conley, Andrew B; Jordan, I King


    It was previously thought that epigenetic histone modifications of mammalian transposable elements (TEs) serve primarily to defend the genome against deleterious effects associated with their activity. However, we recently showed that, genome-wide, human TEs can also be epigenetically modified in a manner consistent with their ability to regulate host genes. Here, we explore the ability of TE sequences to epigenetically regulate individual human genes by focusing on the histone modifications of promoter sequences derived from TEs. We found 1520 human genes that initiate transcription from within TE-derived promoter sequences. We evaluated the distributions of eight histone modifications across these TE-promoters, within and between the GM12878 and K562 cell lines, and related their modification status with the cell-type specific expression patterns of the genes that they regulate. TE-derived promoters are significantly enriched for active histone modifications, and depleted for repressive modifications, relative to the genomic background. Active histone modifications of TE-promoters peak at transcription start sites and are positively correlated with increasing expression within cell lines. Furthermore, differential modification of TE-derived promoters between cell lines is significantly correlated with differential gene expression. LTR-retrotransposon derived promoters in particular play a prominent role in mediating cell-type specific gene regulation, and a number of these LTR-promoter genes are implicated in lineage-specific cellular functions. The regulation of human genes mediated by histone modifications targeted to TE-derived promoters is consistent with the ability of TEs to contribute to the epigenomic landscape in a way that provides functional utility to the host genome. PMID:21215797

  18. p53 genes function to restrain mobile elements

    PubMed Central

    Wylie, Annika; Jones, Amanda E.; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V.; Rakheja, Dinesh; Chen, Kenneth S.; Hammer, Robert E.; Comerford, Sarah A.; Amatruda, James F.; Abrams, John M.


    Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53− germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5′ sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility. PMID:26701264

  19. p53 genes function to restrain mobile elements.


    Wylie, Annika; Jones, Amanda E; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V; Rakheja, Dinesh; Chen, Kenneth S; Hammer, Robert E; Comerford, Sarah A; Amatruda, James F; Abrams, John M


    Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53(-) germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5' sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility. PMID:26701264

  20. Sigma elements are position-specific for many different yeast tRNA genes.

    PubMed Central

    Sandmeyer, S B; Bilanchone, V W; Clark, D J; Morcos, P; Carle, G F; Brodeur, G M


    We determined the DNA sequence of seventeen sigma elements and flanking regions in order to investigate the extent of the association between the yeast repetitive element, sigma, and tRNA genes. Fifteen of seventeen sigma elements analyzed begin at position -19 to -16 with respect to the 5' end of a tRNA-coding sequence. This region is close to the initiation point of tRNA gene transcription and contains a sequence which is modestly conserved for a number of tRNA genes. Two pairs of identical sigma elements occur as the long terminal repeats of a sequence which, together with flanking sigma elements, has the structural properties of a retrotransposon; this element has been named Ty3 (manuscript submitted). Hybridization analysis of yeast chromosomal DNA separated by orthogonal field alternation gel electrophoresis (OFAGE) showed that Ty3 and isolated sigma elements are distributed over many chromosomes in the yeast genome. Images PMID:3279393

  1. Surveying DNA Elements within Functional Genes of Heterocyst-Forming Cyanobacteria

    PubMed Central

    Hilton, Jason A.; Meeks, John C.; Zehr, Jonathan P.


    Some cyanobacteria are capable of differentiating a variety of cell types in response to environmental factors. For instance, in low nitrogen conditions, some cyanobacteria form heterocysts, which are specialized for N2 fixation. Many heterocyst-forming cyanobacteria have DNA elements interrupting key N2 fixation genes, elements that are excised during heterocyst differentiation. While the mechanism for the excision of the element has been well-studied, many questions remain regarding the introduction of the elements into the cyanobacterial lineage and whether they have been retained ever since or have been lost and reintroduced. To examine the evolutionary relationships and possible function of DNA sequences that interrupt genes of heterocyst-forming cyanobacteria, we identified and compared 101 interruption element sequences within genes from 38 heterocyst-forming cyanobacterial genomes. The interruption element lengths ranged from about 1 kb (the minimum able to encode the recombinase responsible for element excision), up to nearly 1 Mb. The recombinase gene sequences served as genetic markers that were common across the interruption elements and were used to track element evolution. Elements were found that interrupted 22 different orthologs, only five of which had been previously observed to be interrupted by an element. Most of the newly identified interrupted orthologs encode proteins that have been shown to have heterocyst-specific activity. However, the presence of interruption elements within genes with no known role in N2 fixation, as well as in three non-heterocyst-forming cyanobacteria, indicates that the processes that trigger the excision of elements may not be limited to heterocyst development or that the elements move randomly within genomes. This comprehensive analysis provides the framework to study the history and behavior of these unique sequences, and offers new insight regarding the frequency and persistence of interruption elements in

  2. A mutant lectin gene is rescued from an insertion element that blocks its expression.

    PubMed Central

    Okamuro, J K; Goldberg, R B


    The soybean lectin gene Le1 encodes a prevalent seed protein and is highly regulated during the life cycle. The mutant lectin gene allele le1 is not transcribed detectably, contains a 3.5-kb Tgm1 insertion element within its coding region 0.6 kb 3' to the transcription start site, and leads to a lectinless phenotype. To determine whether the Tgm1 element or a secondary mutation was responsible for repressing le1 gene transcription, we eliminated the insertion element by constructing a chimeric lectin gene (le1/Le1) that contained the 5' half of the le1 gene and its promoter region and the 3' half of the wild-type Le1 gene. Transformed tobacco seed containing the le1/Le1 gene produced both lectin mRNA and protein, demonstrating that the mutant lectin gene control region is transcriptionally competent. By contrast, transformed seed containing the le1 gene produced no detectable lectin mRNA. We conclude that the absence of detectable transcription from the le1 gene is due to transcriptional inhibition by the Tgm1 insertion element and that this element acts at a distance to block transcription from an upstream promoter region. PMID:1327341

  3. A functional gene array for detection of bacterial virulence elements

    SciTech Connect

    Jaing, C


    We report our development of the first of a series of microarrays designed to detect pathogens with known mechanisms of virulence and antibiotic resistance. By targeting virulence gene families as well as genes unique to specific biothreat agents, these arrays will provide important data about the pathogenic potential and drug resistance profiles of unknown organisms in environmental samples. To validate our approach, we developed a first generation array targeting genes from Escherichia coli strains K12 and CFT073, Enterococcus faecalis and Staphylococcus aureus. We determined optimal probe design parameters for microorganism detection and discrimination, measured the required target concentration, and assessed tolerance for mismatches between probe and target sequences. Mismatch tolerance is a priority for this application, due to DNA sequence variability among members of gene families. Arrays were created using the NimbleGen Maskless Array Synthesizer at Lawrence Livermore National Laboratory. Purified genomic DNA from combinations of one or more of the four target organisms, pure cultures of four related organisms, and environmental aerosol samples with spiked-in genomic DNA were hybridized to the arrays. Based on the success of this prototype, we plan to design further arrays in this series, with the goal of detecting all known virulence and antibiotic resistance gene families in a greatly expanded set of organisms.

  4. Satellite DNA-like elements associated with genes within euchromatin of the beetle Tribolium castaneum.


    Brajković, Josip; Feliciello, Isidoro; Bruvo-Mađarić, Branka; Ugarković, Durđica


    In the red flour beetle Tribolium castaneum the major TCAST satellite DNA accounts for 35% of the genome and encompasses the pericentromeric regions of all chromosomes. Because of the presence of transcriptional regulatory elements and transcriptional activity in these sequences, TCAST satellite DNAs also have been proposed to be modulators of gene expression within euchromatin. Here, we analyze the distribution of TCAST homologous repeats in T. castaneum euchromatin and study their association with genes as well as their potential gene regulatory role. We identified 68 arrays composed of TCAST-like elements distributed on all chromosomes. Based on sequence characteristics the arrays were composed of two types of TCAST-like elements. The first type consists of TCAST satellite-like elements in the form of partial monomers or tandemly arranged monomers, up to tetramers, whereas the second type consists of TCAST-like elements embedded with a complex unit that resembles a DNA transposon. TCAST-like elements were also found in the 5' untranslated region (UTR) of the CR1-3_TCa retrotransposon, and therefore retrotransposition may have contributed to their dispersion throughout the genome. No significant difference in the homogenization of dispersed TCAST-like elements was found either at the level of local arrays or chromosomes nor among different chromosomes. Of 68 TCAST-like elements, 29 were located within introns, with the remaining elements flanked by genes within a 262 to 404,270 nt range. TCAST-like elements are statistically overrepresented near genes with immunoglobulin-like domains attesting to their nonrandom distribution and a possible gene regulatory role. PMID:22908042

  5. The organization structure and regulatory elements of Chlamydomonas histone genes reveal features linking plant and animal genes.


    Fabry, S; Müller, K; Lindauer, A; Park, P B; Cornelius, T; Schmitt, R


    The genome of the green alga Chlamydomonas reinhardtii contains approximately 15 gene clusters of the nucleosomal (or core) histone H2A, H2B, H3 and H4 genes and at least one histone H1 gene. Seven non-allelic histone gene loci were isolated from a genomic library, physically mapped, and the nucleotide sequences of three isotypes of each core histone gene species and one linked H1 gene determined. The core histone genes are organized in clusters of H2A-H2B and H3-H4 pairs, in which each gene pair shows outwardly divergent transcription from a short (< 300 bp) intercistronic region. These intercistronic regions contain typically conserved promoter elements, namely a TATA-box and the three motifs TGGCCAG-G(G/C)-CGAG, CGTTGACC and CGGTTG. Different from the genes of higher plants, but like those of animals and the related alga Volvox, the 3' untranslated regions contain no poly A signal, but a palindromic sequence (3' palindrome) essential for mRNA processing is present. One single H1 gene was found in close linkage to a H2A-H2B pair. The H1 upstream region contains the octameric promoter element GGTTGACC (also found upstream of the core histone genes) and two specific sequence motifs that are shared only with the Volvox H1 promoters. This suggests differential transcription of the H1 and the core histone genes. The H1 gene is interrupted by two introns. Unlike Volvox H3 genes, the three sequenced H3 isoforms are intron-free. Primer-directed PCR of genomic DNA demonstrated, however, that at least 8 of the about 15 H3 genes do contain one intron at a conserved position. In synchronized C. reinhardtii cells, H4 mRNA levels (representative of all core histone mRNAs) peak during cell division, suggesting strict replication-dependent gene control. The derived peptide sequences place C. reinhardtii core histones closer to plants than to animals, except that the H2A histones are more animal-like. The peptide sequence of histone H1 is closely related to the V. carteri VH1-II

  6. Organisation of regulatory elements in two closely spaced Drosophila genes with common expression characteristics.


    Gigliotti, S; Balz, V; Malva, C; Schäfer, M A


    Sperm tail proteins that are components of a specific structure formed late during spermatid elongation have been found to be encoded by the Mst(3)CGP gene family. These genes have been demonstrated to be regulated both at the transcriptional as well as at the translational level. We report here on the dissection of the regulatory regions for two members of the gene family, Mst84Da and Mst84Db. While high level transcription and negative translational control of Mst84Da is mediated by a short gene segment of 205 nt (-152/+53), Mst84Db expression is controlled by a number of distinct regulatory elements with different effects that all reside within the gene itself. We identify a transcriptional control element between +154 and +216, a translational repression element around +216 to +275 and an RNA stability element within the 3'UTR. Irrespective of the final common expression characteristics, correct regulation for any individual member of the gene family seems to be achieved by very different means. This confirms earlier observations that did not detect any other sequence elements in common apart from the TCE (translational control element). PMID:9431808

  7. Periodic, Quasi-periodic and Chaotic Dynamics in Simple Gene Elements with Time Delays

    PubMed Central

    Suzuki, Yoko; Lu, Mingyang; Ben-Jacob, Eshel; Onuchic, José N.


    Regulatory gene circuit motifs play crucial roles in performing and maintaining vital cellular functions. Frequently, theoretical studies of gene circuits focus on steady-state behaviors and do not include time delays. In this study, the inclusion of time delays is shown to entirely change the time-dependent dynamics for even the simplest possible circuits with one and two gene elements with self and cross regulations. These elements can give rise to rich behaviors including periodic, quasi-periodic, weak chaotic, strong chaotic and intermittent dynamics. We introduce a special power-spectrum-based method to characterize and discriminate these dynamical modes quantitatively. Our simulation results suggest that, while a single negative feedback loop of either one- or two-gene element can only have periodic dynamics, the elements with two positive/negative feedback loops are the minimalist elements to have chaotic dynamics. These elements typically have one negative feedback loop that generates oscillations, and another unit that allows frequent switches among multiple steady states or between oscillatory and non-oscillatory dynamics. Possible dynamical features of several simple one- and two-gene elements are presented in details. Discussion is presented for possible roles of the chaotic behavior in the robustness of cellular functions and diseases, for example, in the context of cancer. PMID:26876008

  8. Predictive modelling of gene expression from transcriptional regulatory elements.


    Budden, David M; Hurley, Daniel G; Crampin, Edmund J


    Predictive modelling of gene expression provides a powerful framework for exploring the regulatory logic underpinning transcriptional regulation. Recent studies have demonstrated the utility of such models in identifying dysregulation of gene and miRNA expression associated with abnormal patterns of transcription factor (TF) binding or nucleosomal histone modifications (HMs). Despite the growing popularity of such approaches, a comparative review of the various modelling algorithms and feature extraction methods is lacking. We define and compare three methods of quantifying pairwise gene-TF/HM interactions and discuss their suitability for integrating the heterogeneous chromatin immunoprecipitation (ChIP)-seq binding patterns exhibited by TFs and HMs. We then construct log-linear and ϵ-support vector regression models from various mouse embryonic stem cell (mESC) and human lymphoblastoid (GM12878) data sets, considering both ChIP-seq- and position weight matrix- (PWM)-derived in silico TF-binding. The two algorithms are evaluated both in terms of their modelling prediction accuracy and ability to identify the established regulatory roles of individual TFs and HMs. Our results demonstrate that TF-binding and HMs are highly predictive of gene expression as measured by mRNA transcript abundance, irrespective of algorithm or cell type selection and considering both ChIP-seq and PWM-derived TF-binding. As we encourage other researchers to explore and develop these results, our framework is implemented using open-source software and made available as a preconfigured bootable virtual environment. PMID:25231769

  9. Identification of genetic elements associated with EPSPS gene amplification

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Weed populations can have high genetic plasticity and rapid responses to environmental selection pressures. For example, 100-fold amplification of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene evolved to confer resistance to glyphosate, the world's most important herbicide, in the wee...

  10. Genomic instability and mobile genetic elements in regions surrounding two discoidin I genes of Dictyostelium discoideum.

    PubMed Central

    Poole, S J; Firtel, R A


    We have found that the genomic regions surrounding the linked discoidin I genes of various Dictyostelium discoideum strains have undergone rapid changes. Wild-type strain NC-4 has three complete discoidin I genes; its axenic derivative strain Ax-3L has duplicated a region starting approximately 1 kilobase upstream from the two linked genes and extending for at least 8 kilobases past the genes. A separately maintained stock, strain Ax-3K, does not have this duplication but has undergone a different rearrangement approximately 3 kilobases farther upstream. We show that there are repeat elements in these rapidly changing regions. At least two of these elements, Tdd-2 and Tdd-3, have characteristics associated with mobile genetic elements. The Tdd-3 element is found in different locations in related strains and causes a 9- to 10-base-pair duplication of the target site DNA. The Tdd-2 and Tdd-3 elements do not cross-hybridize, but they share a 22-base-pair homology near one end. At two separate sites, the Tdd-3 element has transposed into the Tdd-2 element, directly adjacent to the 22-base-pair homology. The Tdd-3 element may use this 22-base-pair region as a preferential site of insertion. Images PMID:6325889

  11. The Berkeley Drosophila Genome Project gene disruption project: Single P-element insertions mutating 25% of vital Drosophila genes.

    PubMed Central

    Spradling, A C; Stern, D; Beaton, A; Rhem, E J; Laverty, T; Mozden, N; Misra, S; Rubin, G M


    A fundamental goal of genetics and functional genomics is to identify and mutate every gene in model organisms such as Drosophila melanogaster. The Berkeley Drosophila Genome Project (BDGP) gene disruption project generates single P-element insertion strains that each mutate unique genomic open reading frames. Such strains strongly facilitate further genetic and molecular studies of the disrupted loci, but it has remained unclear if P elements can be used to mutate all Drosophila genes. We now report that the primary collection has grown to contain 1045 strains that disrupt more than 25% of the estimated 3600 Drosophila genes that are essential for adult viability. Of these P insertions, 67% have been verified by genetic tests to cause the associated recessive mutant phenotypes, and the validity of most of the remaining lines is predicted on statistical grounds. Sequences flanking >920 insertions have been determined to exactly position them in the genome and to identify 376 potentially affected transcripts from collections of EST sequences. Strains in the BDGP collection are available from the Bloomington Stock Center and have already assisted the research community in characterizing >250 Drosophila genes. The likely identity of 131 additional genes in the collection is reported here. Our results show that Drosophila genes have a wide range of sensitivity to inactivation by P elements, and provide a rationale for greatly expanding the BDGP primary collection based entirely on insertion site sequencing. We predict that this approach can bring >85% of all Drosophila open reading frames under experimental control. PMID:10471706

  12. A compilation of composite regulatory elements affecting gene transcription in vertebrates.

    PubMed Central

    Kel, O V; Romaschenko, A G; Kel, A E; Wingender, E; Kolchanov, N A


    Over the past years, evidence has been accumulating for a fundamental role of protein-protein interactions between transcription factors in gene-specific transcription regulation. Many of these interactions run within composite elements containing binding sites for several factors. We have selected 101 composite regulatory elements identified experimentally in the regulatory regions of 64 genes of vertebrates and of their viruses and briefly described them in a compilation. Of these, 82 composite elements are of the synergistic type and 19 of the antagonistic type. Within the synergistic type composite elements, transcription factors bind to the corresponding sites simultaneously, thus cooperatively activating transcription. The factors, binding to their target sites within antagonistic type composite elements, produce opposing effects on transcription. The nucleotide sequence and localization in the genes, the names and brief description of transcription factors, are provided for each composite element, including a representation of experimental data on its functioning. Most of the composite elements (3/4) fall between -250 bp and the transcription start site. The distance between the binding sites within the composite elements described varies from complete overlapping to 80 bp. The compilation of composite elements is presented in the database COMPEL which is electronically accessible by anonymous ftp via internet. PMID:7479071

  13. Regulatory elements responsible for inducible expression of the granulocyte colony-stimulating factor gene in macrophages.

    PubMed Central

    Nishizawa, M; Nagata, S


    Granulocyte colony-stimulating factor (G-CSF) plays an essential role in granulopoiesis during bacterial infection. Macrophages produce G-CSF in response to bacterial endotoxins such as lipopolysaccharide (LPS). To elucidate the mechanism of the induction of G-CSF gene in macrophages or macrophage-monocytes, we have examined regulatory cis elements in the promoter of mouse G-CSF gene. Analyses of linker-scanning and internal deletion mutants of the G-CSF promoter by the chloramphenicol acetyltransferase assay have indicated that at least three regulatory elements are indispensable for the LPS-induced expression of the G-CSF gene in macrophages. When one of the three elements was reiterated and placed upstream of the TATA box of the G-CSF promoter, it mediated inducibility as a tissue-specific and orientation-independent enhancer. Although this element contains a conserved NF-kappa B-like binding site, the gel retardation assay and DNA footprint analysis with nuclear extracts from macrophage cell lines demonstrated that nuclear proteins bind to the DNA sequence downstream of the NF-kappa B-like element, but not to the conserved element itself. The DNA sequence of the binding site was found to have some similarities to the LPS-responsive element which was recently identified in the promoter of the mouse class II major histocompatibility gene. Images PMID:1691438

  14. Identifier (ID) elements are not preferentially located to brain-specific genes: high ID element representation in other tissue-specific- and housekeeping genes of the rat.


    Goldman, Andrés; Capoano, Carlos A; González-López, Evangelina; Geisinger, Adriana


    BC1 is a short non-coding RNA from rodents, which is transcribed by RNA pol III. Its RNA is highly abundant in the brain, where it exerts a post-transcriptional regulatory role in dendrites. Upon transcription, retroposition and insertion, BC1 gives rise to a subclass of short interspersed repetitive sequences (SINEs) named identifier (ID) elements. IDs can become integrated inside non-coding regions of RNA pol II transcription units, and - although challenged by a couple of reports - their preferential location to brain-specific genes has been long proposed. Furthermore, an additional, cis-regulatory role in the control of brain-specific pol II-directed transcripts has been suggested for these sequences. In this work we used Northern blot and in silico analyses to examine IDs' location among pol II transcription units in different tissues, and in housekeeping genes. ID sequences appeared distributed in a similar fashion within tissue-specific hnRNA populations of the brain, testis and liver, and within housekeeping primary transcripts as well. Moreover, when the lengths of the unprocessed transcripts were considered, ID representation was higher in housekeeping ones. On the other hand, ID elements appeared similarly distributed among the different gene regions, with the obvious exclusion of those sequences where strict constraints for proper gene expression exist. Altogether, the widespread distribution of ID elements in all the analyzed genes - including housekeeping - and in all gene regions, suggests a random location, raising questions about the specific cis-regulatory role of those sequences. PMID:24125954

  15. Integrating Epigenomic Elements and GWASs Identifies BDNF Gene Affecting Bone Mineral Density and Osteoporotic Fracture Risk

    PubMed Central

    Guo, Yan; Dong, Shan-Shan; Chen, Xiao-Feng; Jing, Ying-Aisha; Yang, Man; Yan, Han; Shen, Hui; Chen, Xiang-Ding; Tan, Li-Jun; Tian, Qing; Deng, Hong-Wen; Yang, Tie-Lin


    To identify susceptibility genes for osteoporosis, we conducted an integrative analysis that combined epigenomic elements and previous genome-wide association studies (GWASs) data, followed by validation at population and functional levels, which could identify common regulatory elements and predict new susceptibility genes that are biologically meaningful to osteoporosis. By this approach, we found a set of distinct epigenomic elements significantly enriched or depleted in the promoters of osteoporosis-associated genes, including 4 transcription factor binding sites, 27 histone marks, and 21 chromatin states segmentation types. Using these epigenomic marks, we performed reverse prediction analysis to prioritize the discovery of new candidate genes. Functional enrichment analysis of all the prioritized genes revealed several key osteoporosis related pathways, including Wnt signaling. Genes with high priority were further subjected to validation using available GWASs datasets. Three genes were significantly associated with spine bone mineral density, including BDNF, PDE4D, and SATB2, which all closely related to bone metabolism. The most significant gene BDNF was also associated with osteoporotic fractures. RNA interference revealed that BDNF knockdown can suppress osteoblast differentiation. Our results demonstrated that epigenomic data could be used to indicate common epigenomic marks to discover additional loci with biological functions for osteoporosis. PMID:27465306

  16. The structure of the human peripherin gene (PRPH) and identification of potential regulatory elements

    SciTech Connect

    Foley, J.; Ley, C.A.; Parysek, L.M.


    The authors determined the complete nucleotide sequence of the coding region of the human peripherin gene (PRPH), as well as 742 bp 5{prime} to the cap site and 584 bp 3{prime} to the stop codon, and compared its structure and sequence to the rat and mouse genes. The overall structure of 9 exons separated by 8 introns is conserved among these three mammalian species. The nucleotide sequences of the human peripherin gene exons were 90% identical to the rat gene sequences, and the predicted human peripherin protein differed from rat peripherin at only 18 of 475 amino acid residues. Comparison of the 5{prime} flanking regions of the human peripherin gene and rodent genes revealed extensive areas of high homology. Additional conserved segments were found in introns 1 and 2. Within the 5{prime} region, potential regulatory sequences, including a nerve growth factor negative regulatory element, a Hox protein binding site, and a heat shock element, were identified in all peripherin genes. The positional conservation of each element suggests that they may be important in the tissue-specific, developmental-specific, and injury-specific expression of the peripherin gene. 24 refs., 2 figs., 1 tab.

  17. Integrating Epigenomic Elements and GWASs Identifies BDNF Gene Affecting Bone Mineral Density and Osteoporotic Fracture Risk.


    Guo, Yan; Dong, Shan-Shan; Chen, Xiao-Feng; Jing, Ying-Aisha; Yang, Man; Yan, Han; Shen, Hui; Chen, Xiang-Ding; Tan, Li-Jun; Tian, Qing; Deng, Hong-Wen; Yang, Tie-Lin


    To identify susceptibility genes for osteoporosis, we conducted an integrative analysis that combined epigenomic elements and previous genome-wide association studies (GWASs) data, followed by validation at population and functional levels, which could identify common regulatory elements and predict new susceptibility genes that are biologically meaningful to osteoporosis. By this approach, we found a set of distinct epigenomic elements significantly enriched or depleted in the promoters of osteoporosis-associated genes, including 4 transcription factor binding sites, 27 histone marks, and 21 chromatin states segmentation types. Using these epigenomic marks, we performed reverse prediction analysis to prioritize the discovery of new candidate genes. Functional enrichment analysis of all the prioritized genes revealed several key osteoporosis related pathways, including Wnt signaling. Genes with high priority were further subjected to validation using available GWASs datasets. Three genes were significantly associated with spine bone mineral density, including BDNF, PDE4D, and SATB2, which all closely related to bone metabolism. The most significant gene BDNF was also associated with osteoporotic fractures. RNA interference revealed that BDNF knockdown can suppress osteoblast differentiation. Our results demonstrated that epigenomic data could be used to indicate common epigenomic marks to discover additional loci with biological functions for osteoporosis. PMID:27465306

  18. cis-acting elements that confer lung epithelial cell expression of the CC10 gene.


    Stripp, B R; Sawaya, P L; Luse, D S; Wikenheiser, K A; Wert, S E; Huffman, J A; Lattier, D L; Singh, G; Katyal, S L; Whitsett, J A


    To define cis-acting genetic elements responsible for cell-specific transcriptional regulation of the CC10 gene, DNA sequences spanning nucleotides -2338 to +49 of the rat CC10 gene were linked to a reporter gene coding for chloramphenicol acetyltransferase (CAT). In transient expression assays, CC10 sequences were capable of restricting CAT expression to a human lung adenocarcinoma cell line similar to pulmonary Clara cells. Transgenic mice harboring the hybrid RtCC10-CAT construct expressed high levels of CAT activity specifically within protein extracts of lung and trachea. Transcripts for the CAT reporter gene colocalized with those for the endogenous murine CC10 gene within the airways of transgenic mice. Functional analysis of deletion mutants identified stimulatory, inhibitory, and cell type-specific transcriptional regulatory elements. The results of gel retention and DNaseI protection assays suggest that a transcriptional stimulatory region located between -320 and -175, and a cell type-specific regulatory element located between -175 and +49, result from a series of protein-DNA interactions occurring at -220 to -205 and -128 to -86, respectively. Lung epithelial specific transcriptional regulatory elements described herein will be useful for expression of chimeric genes within epithelial cells lining the trachea, bronchi, and bronchioles of mice. PMID:1634515

  19. Gene conversion as a secondary mechanism of short interspersed element (SINE) evolution

    SciTech Connect

    Kass, D.H.; Batzer, M.A.; Deininger, P.L. |


    The Alu repetitive family of short interspersed elements (SINEs) in primates can be subdivided into distinct subfamilies by specific diagnostic nucleotide changes. The older subfamilies are generally very abundant, while the younger subfamilies have fewer copies. Some of the youngest Alu elements are absent in the orthologous loci of nonhuman primates, indicative of recent retroposition events, the primary mode of SINE evolutions. PCR analysis of one young Alu subfamily (Sb2) member found in the low-density lipoprotein receptor gene apparently revealed the presence of this element in the green monkey, orangutan, gorilla, and chimpanzee genomes, as well as the human genome. However, sequence analysis of these genomes revealed a highly mutated, older, primate-specific Alu element was present at this position in the nonhuman primates. Comparison of the flanking DNA sequences upstream of this Alu insertion corresponded to evolution expected for standard primate phylogeny, but comparison of the Alu repeat sequences revealed that the human element departed from this phylogeny. The change in the human sequence apparently occurred by a gene conversion event only within the Alu element itself, converting it from one of the oldest to one of the youngest Alu subfamilies. Although gene conversions of Alu elements are clearly very rare, this finding shows that such events can occur and contribute to specific cases of SINE subfamily evolution.

  20. Evolution of Cis-Regulatory Elements and Regulatory Networks in Duplicated Genes of Arabidopsis1[OPEN

    PubMed Central

    Guo, Xu Qiu; Adams, Keith L.


    Plant genomes contain large numbers of duplicated genes that contribute to the evolution of new functions. Following duplication, genes can exhibit divergence in their coding sequence and their expression patterns. Changes in the cis-regulatory element landscape can result in changes in gene expression patterns. High-throughput methods developed recently can identify potential cis-regulatory elements on a genome-wide scale. Here, we use a recent comprehensive data set of DNase I sequencing-identified cis-regulatory binding sites (footprints) at single-base-pair resolution to compare binding sites and network connectivity in duplicated gene pairs in Arabidopsis (Arabidopsis thaliana). We found that duplicated gene pairs vary greatly in their cis-regulatory element architecture, resulting in changes in regulatory network connectivity. Whole-genome duplicates (WGDs) have approximately twice as many footprints in their promoters left by potential regulatory proteins than do tandem duplicates (TDs). The WGDs have a greater average number of footprint differences between paralogs than TDs. The footprints, in turn, result in more regulatory network connections between WGDs and other genes, forming denser, more complex regulatory networks than shown by TDs. When comparing regulatory connections between duplicates, WGDs had more pairs in which the two genes are either partially or fully diverged in their network connections, but fewer genes with no network connections than the TDs. There is evidence of younger TDs and WGDs having fewer unique connections compared with older duplicates. This study provides insights into cis-regulatory element evolution and network divergence in duplicated genes. PMID:26474639

  1. Identification of transcriptional regulatory elements for Ntng1 and Ntng2 genes in mice

    PubMed Central


    Background Higher brain function is supported by the precise temporal and spatial regulation of thousands of genes. The mechanisms that underlie transcriptional regulation in the brain, however, remain unclear. The Ntng1 and Ntng2 genes, encoding axonal membrane adhesion proteins netrin-G1 and netrin-G2, respectively, are paralogs that have evolved in vertebrates and are expressed in distinct neuronal subsets in a complementary manner. The characteristic expression patterns of these genes provide a part of the foundation of the cortical layer structure in mammals. Results We used gene-targeting techniques, bacterial artificial chromosome (BAC)-aided transgenesis techniques, and in vivo enhancer assays to examine transcriptional mechanisms in vivo to gain insight into how the characteristic expression patterns of these genes are acquired. Analysis of the gene expression patterns in the presence or absence of netrin-G1 and netrin-G2 functional proteins allowed us to exclude the possibility that a feedback or feedforward mechanism mediates their characteristic expression patterns. Findings from the BAC deletion series revealed that widely distributed combinations of cis-regulatory elements determine the differential gene expression patterns of these genes and that major cis-regulatory elements are located in the 85–45 kb upstream region of Ntng2 and in the 75–60 kb upstream region and intronic region of Ntng1. In vivo enhancer assays using 2-kb evolutionarily conserved regions detected enhancer activity in the distal upstream regions of both genes. Conclusions The complementary expression patterns of Ntng1 and Ntng2 are determined by transcriptional cis-regulatory elements widely scattered in these loci. The cis-regulatory elements characterized in this study will facilitate the development of novel genetic tools for functionally dissecting neural circuits to better understand vertebrate brain function. PMID:24642214

  2. Amplification of Distant Estrogen Response Elements Deregulates Target Genes Associated with Tamoxifen Resistance in Breast Cancer

    PubMed Central

    Hsu, Pei-Yin; Hsu, Hang-Kai; Lan, Xun; Juan, Liran; Yan, Pearlly S.; Labanowska, Jadwiga; Heerema, Nyla; Hsiao, Tzu-Hung; Chiu, Yu-Chiao; Chen, Yidong; Liu, Yunlong; Li, Lang; Li, Rong; Thompson, Ian M.; Nephew, Kenneth P.; Sharp, Zelton D.; Kirma, Nameer B.; Jin, Victor X.; Huang, Tim H.-M.


    SUMMARY A causal role of gene amplification in tumorigenesis is well-known, while amplification of DNA regulatory elements as an oncogenic driver remains unclear. In this study, we integrated next-generation sequencing approaches to map distant estrogen response elements (DEREs) that remotely control transcription of target genes through chromatin proximity. Two densely mapped DERE regions located on chromosomes 17q23 and 20q13 were frequently amplified in ERα-positive luminal breast cancer. These aberrantly amplified DEREs deregulated target gene expression potentially linked to cancer development and tamoxifen resistance. Progressive accumulation of DERE copies was observed in normal breast progenitor cells chronically exposed to estrogenic chemicals. These findings may extend to other DNA regulatory elements, the amplification of which can profoundly alter target transcriptome during tumorigenesis. PMID:23948299

  3. Transposable Elements Contribute to Activation of Maize Genes in Response to Abiotic Stress

    PubMed Central

    Makarevitch, Irina; Waters, Amanda J.; West, Patrick T.; Stitzer, Michelle; Hirsch, Candice N.; Ross-Ibarra, Jeffrey; Springer, Nathan M.


    Transposable elements (TEs) account for a large portion of the genome in many eukaryotic species. Despite their reputation as “junk” DNA or genomic parasites deleterious for the host, TEs have complex interactions with host genes and the potential to contribute to regulatory variation in gene expression. It has been hypothesized that TEs and genes they insert near may be transcriptionally activated in response to stress conditions. The maize genome, with many different types of TEs interspersed with genes, provides an ideal system to study the genome-wide influence of TEs on gene regulation. To analyze the magnitude of the TE effect on gene expression response to environmental changes, we profiled gene and TE transcript levels in maize seedlings exposed to a number of abiotic stresses. Many genes exhibit up- or down-regulation in response to these stress conditions. The analysis of TE families inserted within upstream regions of up-regulated genes revealed that between four and nine different TE families are associated with up-regulated gene expression in each of these stress conditions, affecting up to 20% of the genes up-regulated in response to abiotic stress, and as many as 33% of genes that are only expressed in response to stress. Expression of many of these same TE families also responds to the same stress conditions. The analysis of the stress-induced transcripts and proximity of the transposon to the gene suggests that these TEs may provide local enhancer activities that stimulate stress-responsive gene expression. Our data on allelic variation for insertions of several of these TEs show strong correlation between the presence of TE insertions and stress-responsive up-regulation of gene expression. Our findings suggest that TEs provide an important source of allelic regulatory variation in gene response to abiotic stress in maize. PMID:25569788

  4. Gene Expression Variability as a Unifying Element of the Pluripotency Network

    PubMed Central

    Mason, Elizabeth A.; Mar, Jessica C.; Laslett, Andrew L.; Pera, Martin F.; Quackenbush, John; Wolvetang, Ernst; Wells, Christine A.


    Summary Heterogeneity is a hallmark of stem cell populations, in part due to the molecular differences between cells undergoing self-renewal and those poised to differentiate. We examined phenotypic and molecular heterogeneity in pluripotent stem cell populations, using public gene expression data sets. A high degree of concordance was observed between global gene expression variability and the reported heterogeneity of different human pluripotent lines. Network analysis demonstrated that low-variability genes were the most highly connected, suggesting that these are the most stable elements of the gene regulatory network and are under the highest regulatory constraints. Known drivers of pluripotency were among these, with lowest expression variability of POU5F1 in cells with the highest capacity for self-renewal. Variability of gene expression provides a reliable measure of phenotypic and molecular heterogeneity and predicts those genes with the highest degree of regulatory constraint within the pluripotency network. PMID:25254348

  5. Multiple cis elements and GATA factors regulate a cuticle collagen gene in C. elegans

    PubMed Central

    Yin, Jianghua; Madaan, Uday; Park, Amy; Aftab, Neelum; Savage-Dunn, Cathy


    The cuticle of the nematode Caenorhabditis elegans is a specialized extracellular matrix whose major component is collagen. Cuticle collagens are encoded by a large multi-gene family consisting of more than 150 members. Cuticle collagen genes are expressed in epidermis (hypodermis) and may be stage-specific or cyclically expressed. We identified cuticle collagen genes as transcriptional targets of the DBL-1 TGF-β-related signaling pathway. These studies prompted us to investigate the cis-regulatory sequences required for transcription of one of the target genes, col-41. We generated reporter constructs that reproduce stage- and tissue-specific expression of fluorescent markers. We identify four conserved sequence elements that are required for transcription of reporters. Finally, we provide evidence that col-41 expression is controlled by a sequence element containing two GATA sites and by the epidermal GATA transcription factors ELT-1 and ELT-3. PMID:25711168

  6. Repressive BMP2 gene regulatory elements near the BMP2 promoter

    SciTech Connect

    Jiang, Shan; Chandler, Ronald L.; Fritz, David T.; Mortlock, Douglas P.; Rogers, Melissa B.


    The level of bone morphogenetic protein 2 (BMP2) profoundly influences essential cell behaviors such as proliferation, differentiation, apoptosis, and migration. The spatial and temporal pattern of BMP2 synthesis, particular in diverse embryonic cells, is highly varied and dynamic. We have identified GC-rich sequences within the BMP2 promoter region that strongly repress gene expression. These elements block the activity of a highly conserved, osteoblast enhancer in response to FGF2 treatment. Both positive and negative gene regulatory elements control BMP2 synthesis. Detecting and mapping the repressive motifs is essential because they impede the identification of developmentally regulated enhancers necessary for normal BMP2 patterns and concentration.

  7. DNA Elements Reducing Transcriptional Gene Silencing Revealed by a Novel Screening Strategy

    PubMed Central

    Ueno, Keiichiro; Ohashi, Yuko; Mitsuhara, Ichiro


    Transcriptional gene silencing (TGS)–a phenomenon observed in endogenous genes/transgenes in eukaryotes–is a huge hindrance to transgenic technology and occurs mainly when the genes involved share sequence homology in their promoter regions. TGS depends on chromosomal position, suggesting the existence of genomic elements that suppress TGS. However, no systematic approach to identify such DNA elements has yet been reported. Here, we developed a successful novel screening strategy to identify such elements (anti-silencing regions–ASRs), based on their ability to protect a flanked transgene from TGS. A silenced transgenic tobacco plant in which a subsequently introduced transgene undergoes obligatory promoter-homology dependent TGS in trans allowed the ability of DNA elements to prevent TGS to be used as the screening criterion. We also identified ASRs in a genomic library from a different plant species (Lotus japonicus: a perennial legume); the ASRs include portions of Ty1/copia retrotransposon-like and pararetrovirus-like sequences; the retrotransposon-like sequences also showed interspecies anti-TGS activity in a TGS-induction system in Arabidopsis. Anti-TGS elements could provide effective tools to reduce TGS and ensure proper regulation of transgene expression. Furthermore, the screening strategy described here will also facilitate the efficient identification of new classes of anti-TGS elements. PMID:23382937

  8. A characterization of the elements comprising the promoter of the mouse ribosomal protein gene RPS16.


    Hariharan, N; Perry, R P


    The elements comprising the mouse rpS16 promoter were characterized by transfection experiments with mutant genes in which various portions of the 5' flanking region and exon I were removed or substituted with extraneous DNA sequence. These experiments were carried out with otherwise intact rpS16 genes transfected into monkey kidney (COS) cells and also with chimeric rpS16-CAT gene constructs transfected into mouse plasmacytoma cells and COS cells. The locations of the functionally important elements were generally correlated with the locations of binding sites for specific nuclear factors, which were identified by gel-mobility shift analyses and methylation interference footprints. The most upstream element, which is located approximately 165 bp from the cap site, binds the Sp1 transcription factor and augments the promoter activity by 2 to 2.5-fold. In addition, there is a complex bipartite element in the -83 to -59 region, an element in the -37 to -12 region and an element in the +9 to +29 region of exon I, all of which are essential for rpS16 expression. The rpS16 promoter has a general architecture that resembles other mouse rp promoters; however, it also possesses some distinctive characteristics. PMID:2762128

  9. Comparative genome sequencing of Drosophila pseudoobscura: Chromosomal, gene, and cis-element evolution

    PubMed Central

    Richards, Stephen; Liu, Yue; Bettencourt, Brian R.; Hradecky, Pavel; Letovsky, Stan; Nielsen, Rasmus; Thornton, Kevin; Hubisz, Melissa J.; Chen, Rui; Meisel, Richard P.; Couronne, Olivier; Hua, Sujun; Smith, Mark A.; Zhang, Peili; Liu, Jing; Bussemaker, Harmen J.; van Batenburg, Marinus F.; Howells, Sally L.; Scherer, Steven E.; Sodergren, Erica; Matthews, Beverly B.; Crosby, Madeline A.; Schroeder, Andrew J.; Ortiz-Barrientos, Daniel; Rives, Catharine M.; Metzker, Michael L.; Muzny, Donna M.; Scott, Graham; Steffen, David; Wheeler, David A.; Worley, Kim C.; Havlak, Paul; Durbin, K. James; Egan, Amy; Gill, Rachel; Hume, Jennifer; Morgan, Margaret B.; Miner, George; Hamilton, Cerissa; Huang, Yanmei; Waldron, Lenée; Verduzco, Daniel; Clerc-Blankenburg, Kerstin P.; Dubchak, Inna; Noor, Mohamed A.F.; Anderson, Wyatt; White, Kevin P.; Clark, Andrew G.; Schaeffer, Stephen W.; Gelbart, William; Weinstock, George M.; Gibbs, Richard A.


    We have sequenced the genome of a second Drosophila species, Drosophila pseudoobscura, and compared this to the genome sequence of Drosophila melanogaster, a primary model organism. Throughout evolution the vast majority of Drosophila genes have remained on the same chromosome arm, but within each arm gene order has been extensively reshuffled, leading to a minimum of 921 syntenic blocks shared between the species. A repetitive sequence is found in the D. pseudoobscura genome at many junctions between adjacent syntenic blocks. Analysis of this novel repetitive element family suggests that recombination between offset elements may have given rise to many paracentric inversions, thereby contributing to the shuffling of gene order in the D. pseudoobscura lineage. Based on sequence similarity and synteny, 10,516 putative orthologs have been identified as a core gene set conserved over 25–55 million years (Myr) since the pseudoobscura/melanogaster divergence. Genes expressed in the testes had higher amino acid sequence divergence than the genome-wide average, consistent with the rapid evolution of sex-specific proteins. Cis-regulatory sequences are more conserved than random and nearby sequences between the species—but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible. Overall, a pattern of repeat-mediated chromosomal rearrangement, and high coadaptation of both male genes and cis-regulatory sequences emerges as important themes of genome divergence between these species of Drosophila. PMID:15632085

  10. Comparative genome sequencing of drosophila pseudoobscura: Chromosomal, gene and cis-element evolution

    SciTech Connect

    Richards, Stephen; Liu, Yue; Bettencourt, Brian R.; Hradecky, Pavel; Letovsky, Stan; Nielsen, Rasmus; Thornton, Kevin; Todd, Melissa J.; Chen, Rui; Meisel, Richard P.; Couronne, Olivier; Hua, Sujun; Smith, Mark A.; Bussemaker, Harmen J.; van Batenburg, Marinus F.; Howells, Sally L.; Scherer, Steven E.; Sodergren, Erica; Matthews, Beverly B.; Crosby, Madeline A.; Schroeder, Andrew J.; Ortiz-Barrientos, Daniel; Rives, Catherine M.; Metzker, Michael L.; Muzny, Donna M.; Scott, Graham; Steffen, David; Wheeler, David A.; Worley, Kim C.; Havlak, Paul; Durbin, K. James; Egan, Amy; Gill, Rachel; Hume, Jennifer; Morgan, Margaret B.; Miner, George; Hamilton, Cerissa; Huang, Yanmei; Waldron, Lenee; Verduzco, Daniel; Blankenburg, Kerstin P.; Dubchak, Inna; Noor, Mohamed A.F.; Anderson, Wyatt; White, Kevin P.; Clark, Andrew G.; Schaeffer, Stephen W.; Gelbart, William; Weinstock, George M.; Gibbs, Richard A.


    The genome sequence of a second fruit fly, D. pseudoobscura, presents an opportunity for comparative analysis of a primary model organism D. melanogaster. The vast majority of Drosophila genes have remained on the same arm, but within each arm gene order has been extensively reshuffled leading to the identification of approximately 1300 syntenic blocks. A repetitive sequence is found in the D. pseudoobscura genome at many junctions between adjacent syntenic blocks. Analysis of this novel repetitive element family suggests that recombination between offset elements may have given rise to many paracentric inversions, thereby contributing to the shuffling of gene order in the D. pseudoobscura lineage. Based on sequence similarity and synteny, 10,516 putative orthologs have been identified as a core gene set conserved over 35 My since divergence. Genes expressed in the testes had higher amino acid sequence divergence than the genome wide average consistent with the rapid evolution of sex-specific proteins. Cis-regulatory sequences are more conserved than control sequences between the species but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible. Overall, a picture of repeat mediated chromosomal rearrangement, and high co-adaptation of both male genes and cis-regulatory sequences emerges as important themes of genome divergence between these species of Drosophila.

  11. Deciphering RNA Regulatory Elements Involved in the Developmental and Environmental Gene Regulation of Trypanosoma brucei

    PubMed Central

    Gazestani, Vahid H.; Salavati, Reza


    Trypanosoma brucei is a vector-borne parasite with intricate life cycle that can cause serious diseases in humans and animals. This pathogen relies on fine regulation of gene expression to respond and adapt to variable environments, with implications in transmission and infectivity. However, the involved regulatory elements and their mechanisms of actions are largely unknown. Here, benefiting from a new graph-based approach for finding functional regulatory elements in RNA (GRAFFER), we have predicted 88 new RNA regulatory elements that are potentially involved in the gene regulatory network of T. brucei. We show that many of these newly predicted elements are responsive to both transcriptomic and proteomic changes during the life cycle of the parasite. Moreover, we found that 11 of predicted elements strikingly resemble previously identified regulatory elements for the parasite. Additionally, comparison with previously predicted motifs on T. brucei suggested the superior performance of our approach based on the current limited knowledge of regulatory elements in T. brucei. PMID:26529602

  12. Staphylococcal enterotoxin A gene is associated with a variable genetic element.

    PubMed Central

    Betley, M J; Löfdahl, S; Kreiswirth, B N; Bergdoll, M S; Novick, R P


    The genetic determinant of Staphylococcus aureus enterotoxin A (SEA) has been cloned in pBR322 in Escherichia coli and found to be expressed and secreted into the periplasmic space in that organism. The SEA gene (entA) is within a 2.5-kilobase-pair HindIII fragment that is part of a discrete genetic element 8-12 kilobase pairs in length. This entA element has a standard chromosomal location [between the purine (pur) and isoleucine-valine (ilv) markers] in most S. aureus strains. In some strains it is unlinked to pur-ilv. However, its internal structure is conserved at different locations. Some naturally occurring SEA-nonproducer (EntA-) strains lack the entire entA element, and one instance of its spontaneous loss is reported. Other naturally occurring strains have EntA- structural variants of the element at the same pur-ilv location at which the intact element is most commonly found. Some of these strains are EntA-, others are EntA+; the latter have a second, unlinked copy of the element containing their functional entA gene. These results suggest that entA is associated with a structurally unstable, possibly mobile, discrete genetic element. Images PMID:6089183

  13. Identification of host genes that affect acquisition of an integrative and conjugative element in Bacillus subtilis

    PubMed Central

    Johnson, Christopher M.; Grossman, Alan D.


    Summary Conjugation, a major type of horizontal gene transfer in bacteria, involves transfer of DNA from a donor to a recipient using donor-encoded conjugation machinery. Using a high throughput screen (Tn-seq), we identified genes in recipients that contribute to acquisition of the integrative and conjugative element ICEBs1 by Bacillus subtilis. We found that null mutations in some genes caused an increase, and others a decrease in conjugation efficiency. Some mutations affected conjugation only when present in recipients. Other mutations affected conjugation when present in donors or recipients. Most of the genes identified are known or predicted to affect the cell envelope. Several encode enzymes involved in phospholipid biosynthesis and one encodes a homolog of penicillin binding proteins. Two of the genes identified also affected conjugation of Tn916, indicating that their roles in conjugation may be general. We did not identify any genes in recipients that were essential for ICEBs1 conjugation, indicating that if there are such genes, then these are either essential for cell growth or redundant. Our results indicate that acquisition of ICEBs1, and perhaps other conjugative elements, is robust and not easily avoided by mutation and that several membrane-related functions affect the efficiency of conjugation. PMID:25069588

  14. Cotyledon nuclear proteins bind to DNA fragments harboring regulatory elements of phytohemagglutinin genes.

    PubMed Central

    Riggs, C D; Voelker, T A; Chrispeels, M J


    The effects of deleting DNA sequences upstream from the phytohemagglutinin-L gene of Phaseolus vulgaris have been examined with respect to the level of gene product produced in the seeds of transgenic tobacco. Our studies indicate that several upstream regions quantitatively modulate expression. Between -1000 and -675, a negative regulatory element reduces expression approximately threefold relative to shorter deletion mutants that do not contain this region. Positive regulatory elements lie between -550 and -125 and, compared with constructs containing only 125 base pairs of upstream sequences (-125), the presence of these two regions can be correlated with a 25-fold and a 200-fold enhancement of phytohemagglutinin-L levels. These experiments were complemented by gel retardation assays, which demonstrated that two of the three regions bind cotyledon nuclear proteins from mid-mature seeds. One of the binding sites maps near a DNA sequence that is highly homologous to protein binding domains located upstream from the soybean seed lectin and Kunitz trypsin inhibitor genes. Competition experiments demonstrated that the upstream regions of a bean beta-phaseolin gene, the soybean seed lectin gene, and an oligonucleotide from the upstream region of the trypsin inhibitor gene can compete differentially for factor binding. We suggest that these legume genes may be regulated in part by evolutionarily conserved protein/DNA interactions. PMID:2535513

  15. A negative element involved in Kaposi's sarcoma-associated herpesvirus-encoded ORF11 gene expression

    SciTech Connect

    Chen, Lei


    The ORF11 of the Kaposi's sarcoma-associated herpesvirus (KSHV) is a lytic viral gene with delayed-early expression kinetics. How the ORF11 gene expression is regulated in the KSHV lytic cascade is largely unknown. Here we report that the deletion of the KSHV viral IL-6 gene from the viral genome leads to deregulated ORF11 gene expression. The KSHV-encoded viral IL-6 protein was found not to be essentially involved in the regulation of ORF11, suggesting a potential transcriptional cis-regulation. A negative element was identified downstream of the ORF11 gene, which suppresses the ORF11 basal promoter activity in a position-independent manner.

  16. Identification and characterization of a cis-regulatory element for zygotic gene expression in Chlamydomonas reinhardtii


    Hamaji, Takashi; Lopez, David; Pellegrini, Matteo; Umen, James


    Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C. reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient tomore » confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. Furthermore, we predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes.« less

  17. Identification and Characterization of a cis-Regulatory Element for Zygotic Gene Expression in Chlamydomonas reinhardtii.


    Hamaji, Takashi; Lopez, David; Pellegrini, Matteo; Umen, James


    Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient to confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. We predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes. PMID:27172209

  18. Identification and Characterization of a cis-Regulatory Element for Zygotic Gene Expression in Chlamydomonas reinhardtii

    PubMed Central

    Hamaji, Takashi; Lopez, David; Pellegrini, Matteo; Umen, James


    Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C. reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient to confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. We predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes. PMID:27172209

  19. Identification, Phylogeny, and Evolution of Retroviral Elements Based on Their Envelope Genes

    PubMed Central

    Bénit, Laurence; Dessen, Philippe; Heidmann, Thierry


    Phylogenetic analyses of retroviral elements, including endogenous retroviruses, have relied essentially on the retroviral pol gene expressing the highly conserved reverse transcriptase. This enzyme is essential for the life cycle of all retroid elements, but other genes are also endowed with conserved essential functions. Among them, the transmembrane (TM) subunit of the envelope gene is involved in virus entry through membrane fusion. It has also been reported to contain a domain, named the immunosuppressive domain, that has immunosuppressive properties most probably essential for virus spread within the host. This domain is conserved among a large series of retroviral elements, and we have therefore attempted to generate phylogenetic links between retroviral elements identified from databases following tentative alignments of the immunosuppressive domain and adjacent sequences. This allowed us to unravel a conserved organization among TM domains, also found in the Ebola and Marburg filoviruses, and to identify a large number of human endogenous retroviruses (HERVs) from sequence databases. The latter elements are part of previously identified families of HERVs, and some of them define new families. A general phylogenetic analysis based on the TM proteins of retroelements, and including those with no clearly identified immunosuppressive domain, could then be derived and compared with pol-based phylogenetic trees, providing a comprehensive survey of retroelements and definitive evidence for recombination events in the generation of both the endogenous and the present-day infectious retroviruses. PMID:11689652

  20. Chromatin boundary elements organize genomic architecture and developmental gene regulation in Drosophila Hox clusters

    PubMed Central

    Ma, Zhibo; Li, Mo; Roy, Sharmila; Liu, Kevin J; Romine, Matthew L; Lane, Derrick C; Patel, Sapna K; Cai, Haini N


    The three-dimensional (3D) organization of the eukaryotic genome is critical for its proper function. Evidence suggests that extensive chromatin loops form the building blocks of the genomic architecture, separating genes and gene clusters into distinct functional domains. These loops are anchored in part by a special type of DNA elements called chromatin boundary elements (CBEs). CBEs were originally found to insulate neighboring genes by blocking influences of transcriptional enhancers or the spread of silent chromatin. However, recent results show that chromatin loops can also play a positive role in gene regulation by looping out intervening DNA and “delivering” remote enhancers to gene promoters. In addition, studies from human and model organisms indicate that the configuration of chromatin loops, many of which are tethered by CBEs, is dynamically regulated during cell differentiation. In particular, a recent work by Li et al has shown that the SF1 boundary, located in the Drosophila Hox cluster, regulates local genes by tethering different subsets of chromatin loops: One subset enclose a neighboring gene ftz, limiting its access by the surrounding Scr enhancers and restrict the spread of repressive histones during early embryogenesis; and the other loops subdivide the Scr regulatory region into independent domains of enhancer accessibility. The enhancer-blocking activity of these CBE elements varies greatly in strength and tissue distribution. Further, tandem pairing of SF1 and SF2 facilitate the bypass of distal enhancers in transgenic flies, providing a mechanism for endogenous enhancers to circumvent genomic interruptions resulting from chromosomal rearrangement. This study demonstrates how a network of chromatin boundaries, centrally organized by SF1, can remodel the 3D genome to facilitate gene regulation during development. PMID:27621770

  1. Chromatin boundary elements organize genomic architecture and developmental gene regulation in Drosophila Hox clusters.


    Ma, Zhibo; Li, Mo; Roy, Sharmila; Liu, Kevin J; Romine, Matthew L; Lane, Derrick C; Patel, Sapna K; Cai, Haini N


    The three-dimensional (3D) organization of the eukaryotic genome is critical for its proper function. Evidence suggests that extensive chromatin loops form the building blocks of the genomic architecture, separating genes and gene clusters into distinct functional domains. These loops are anchored in part by a special type of DNA elements called chromatin boundary elements (CBEs). CBEs were originally found to insulate neighboring genes by blocking influences of transcriptional enhancers or the spread of silent chromatin. However, recent results show that chromatin loops can also play a positive role in gene regulation by looping out intervening DNA and "delivering" remote enhancers to gene promoters. In addition, studies from human and model organisms indicate that the configuration of chromatin loops, many of which are tethered by CBEs, is dynamically regulated during cell differentiation. In particular, a recent work by Li et al has shown that the SF1 boundary, located in the Drosophila Hox cluster, regulates local genes by tethering different subsets of chromatin loops: One subset enclose a neighboring gene ftz, limiting its access by the surrounding Scr enhancers and restrict the spread of repressive histones during early embryogenesis; and the other loops subdivide the Scr regulatory region into independent domains of enhancer accessibility. The enhancer-blocking activity of these CBE elements varies greatly in strength and tissue distribution. Further, tandem pairing of SF1 and SF2 facilitate the bypass of distal enhancers in transgenic flies, providing a mechanism for endogenous enhancers to circumvent genomic interruptions resulting from chromosomal rearrangement. This study demonstrates how a network of chromatin boundaries, centrally organized by SF1, can remodel the 3D genome to facilitate gene regulation during development. PMID:27621770

  2. Functional characterization of transcriptional regulatory elements in the upstream region of the yeast GLK1 gene.

    PubMed Central

    Herrero, P; Flores, L; de la Cera, T; Moreno, F


    The glucokinase gene GLK1 of the yeast Saccharomyces cerevisiae is transcriptionally regulated in response to the carbon source of the growth medium. Northern-blot analysis shows that the GLK1 gene is expressed at a basal level in the presence of glucose, de-repressed more than 6-fold under conditions of sugar limitation and more than 25-fold under conditions of ethanol induction. lacZ fusions of the GLK1 gene promoter were constructed and a deletion analysis was performed in order to identify the cis-acting regulatory elements of the promoter that controls GLK1 gene expression. First, the expression seemed to be mediated mainly by one GCR1 and three stress-responsive element (STRE) activating elements. Secondly, an ethanol repression autoregulation (ERA)/twelve-fold TA repeat (TAB) repressor element was identified within the promoter region of the GLK1 gene. A specific and differential protein binding to the STRE was observed with extracts from de-repressed and repressed cells. No differential binding to the GCR1 or ERA/TAB elements was observed with extracts from de-repressed and repressed cells, but, in both cases, the binding was competed for by an excess of the unlabelled GLK1(GCR1) and GLK1(ERA) sequence. The transcription factors Msn2 and Msn4, which bind to the GLK1 upstream region through the STRE, contribute to inductive activation. The transcription factor Gcr1, which binds through the GCR1 element, contributes to constitutive activation. In order to achieve the severe glucose repression of GLK1, constitutive repressor factors acting through the ERA/TAB element must counteract constitutive activation generated by Gcr1 binding to the GCR1 element. Full expression of the GLK1 gene is produced by inductive activation of three STRE when Msn2 and Msn4 proteins are translocated to the nucleus by covalent modification. The combinatorial effect of the entire region leads to the regulated transcription of GLK1, i.e., silent in media with glucose and other

  3. A transcriptional regulatory element in the coding sequence of the human Bcl-2 gene

    PubMed Central

    Lang, Georgina; Gombert, Wendy M; Gould, Hannah J


    We investigated the protein-binding sites in a DNAse I hypersensitive site associated with bcl-2 gene expression in human B cells. We mapped this hypersensitive site to the coding sequence of exon 2 of the bcl-2 gene in the bcl-2-expressing REH B-cell line. Electrophoretic mobility shift assays (EMSAs) with extracts from REH cells revealed three previously unrecognized B-Myb-binding sites in this sequence. The protein was identified as B-Myb by using a specific antibody and EMSAs. Accordingly, the levels of B-Myb and bcl-2 proteins, and of Myb EMSA activity, were correlated over a wide range of cell lines, representing different stages of B-cell development. Transfection of REH cells with antisense B-myb down-regulated EMSA activity and the level of bcl-2, and led to the apoptosis of REH cells. Transfection of the bcl-2-non-expressing RPMI 8226 cell line with a B-Myb expression vector induced B-Myb EMSA activity and the expression of bcl-2. Reporter assays indicated that the HSS8 sequence containing the three B-Myb sites may act as an enhancer when it is linked to the bcl-2 gene promoter. Interaction of B-Myb with HSS8 may enhance bcl-2 gene expression by co-operating with positive regulatory elements (e.g. previously identified B-Myb response elements) or silencing negative response elements in the bcl-2 gene promoter. PMID:15606792

  4. Transfer of antibiotic-resistance genes via phage-related mobile elements.


    Brown-Jaque, Maryury; Calero-Cáceres, William; Muniesa, Maite


    Antibiotic resistance is a major concern for society because it threatens the effective prevention of infectious diseases. While some bacterial strains display intrinsic resistance, others achieve antibiotic resistance by mutation, by the recombination of foreign DNA into the chromosome or by horizontal gene acquisition. In many cases, these three mechanisms operate together. Several mobile genetic elements (MGEs) have been reported to mobilize different types of resistance genes and despite sharing common features, they are often considered and studied separately. Bacteriophages and phage-related particles have recently been highlighted as MGEs that transfer antibiotic resistance. This review focuses on phages, phage-related elements and on composite MGEs (phages-MGEs) involved in antibiotic resistance mobility. We review common features of these elements, rather than differences, and provide a broad overview of the antibiotic resistance transfer mechanisms observed in nature, which is a necessary first step to controlling them. PMID:25597519

  5. Identification of peroxisome-proliferator responsive element in the mouse HSL gene

    SciTech Connect

    Yajima, Hiroaki . E-mail:; Kobayashi, Yumie; Kanaya, Tomoka; Horino, Yoko


    Hormone-sensitive lipase (HSL) catalyzes the rate-limiting step of lipolysis in adipose tissue. Several studies suggest that protein phosphorylation regulates the HSL enzymatic activity. On the other hand, the precise mechanism of the transcriptional regulation of the HSL gene remains to be elucidated. Here, we identified a functional peroxisome-proliferator responsive element (PPRE) in the mouse HSL promoter by reporter assay in CV-1 cells using serial deletion and point mutants of the 5'-flanking region. Chromatin immunoprecipitation (ChIP) analysis revealed that both peroxisome-proliferator activated receptor (PPAR{gamma}) and retinoid X receptor (RXR{alpha}) interacted with the region. Binding of the PPAR{gamma}/RXR{alpha} heterodimer to the PPRE sequence was also confirmed by electrophoretic mobility shift assay. These results indicate that the HSL gene is transcriptionally regulated by PPAR{gamma}/RXR{alpha} heterodimer, and suggest that a cis-acting element regulates the HSL gene expression.

  6. Two distinct promoter elements in the human rRNA gene identified by linker scanning mutagenesis.

    PubMed Central

    Haltiner, M M; Smale, S T; Tjian, R


    A cell-free RNA polymerase I transcription system was used to evaluate the transcription efficiency of 21 linker scanning mutations that span the human rRNA gene promoter. Our analysis revealed the presence of two major control elements, designated the core and upstream elements, that affect the level of transcription initiation. The core element extends from -45 to +18 relative to the RNA start site, and transcription is severely affected (up to 100-fold) by linker scanning mutations in this region. Linker scanning and deletion mutations in the upstream element, located between nucleotides -156 and -107, cause a three- to fivefold reduction in transcription. Under certain reaction conditions, such as the presence of a high ratio of protein to template or supplementation of the reaction with partially purified protein fractions, sequences upstream of the core element can have an even greater effect (20- to 50-fold) on RNA polymerase I transcription. Primer extension analysis showed that RNA synthesized from all of these mutant templates is initiated at the correct in vivo start site. To examine the functional relationship between the core and the upstream region, mutant promoters were constructed that alter the orientation, distance, or multiplicity of these control elements relative to each other. The upstream control element appears to function in only one orientation, and its position relative to the core is constrained within a fairly narrow region. Moreover, multiple core elements in close proximity to each other have an inhibitory effect on transcription. Images PMID:3785147

  7. Transposable Element Insertions in Long Intergenic Non-Coding RNA Genes

    PubMed Central

    Kannan, Sivakumar; Chernikova, Diana; Rogozin, Igor B.; Poliakov, Eugenia; Managadze, David; Koonin, Eugene V.; Milanesi, Luciano


    Transposable elements (TEs) are abundant in mammalian genomes and appear to have contributed to the evolution of their hosts by providing novel regulatory or coding sequences. We analyzed different regions of long intergenic non-coding RNA (lincRNA) genes in human and mouse genomes to systematically assess the potential contribution of TEs to the evolution of the structure and regulation of expression of lincRNA genes. Introns of lincRNA genes contain the highest percentage of TE-derived sequences (TES), followed by exons and then promoter regions although the density of TEs is not significantly different between exons and promoters. Higher frequencies of ancient TEs in promoters and exons compared to introns implies that many lincRNA genes emerged before the split of primates and rodents. The content of TES in lincRNA genes is substantially higher than that in protein-coding genes, especially in exons and promoter regions. A significant positive correlation was detected between the content of TEs and evolutionary rate of lincRNAs indicating that inserted TEs are preferentially fixed in fast-evolving lincRNA genes. These results are consistent with the repeat insertion domains of LncRNAs hypothesis under which TEs have substantially contributed to the origin, evolution, and, in particular, fast functional diversification, of lincRNA genes. PMID:26106594

  8. Regulation of caulimovirus gene expression and the involvement of cis-acting elements on both viral transcripts.


    Scholthof, H B; Wu, F C; Gowda, S; Shepherd, R J


    In a further analysis of gene regulation of figwort mosaic virus (FMV), a caulimovirus, we studied transient gene expression with modified viral genomes in Nicotiana edwardsonii cell suspension protoplasts. The results demonstrated that the presence of the promoter for the full-length RNA interferes with expression from the separate downstream promoter for gene VI. In addition, expression of gene VI was inhibited by cis-acting sequences within gene VI itself. Both inhibitory effects could be partially relieved by coelectroporation with a plasmid that produces gene VI protein, demonstrating that expression of gene VI is transactivated by its own product. Subsequent expression studies with partially redundant FMV plasmids containing a reporter gene in frame with gene IV showed that efficient transactivation of CAT expression relies on a cis-acting element inside the downstream gene VI. Insertions of a transcriptional terminator upstream of the cis-acting element for premature termination of transcription showed that the cis-acting region is not a DNA element but is active only as a feature of the RNA transcript. We conclude that the cis-acting element, together with the transacting gene VI product, enhances expression of all major genes, including gene VI, from the polycistronic mRNA and the separate mRNA for gene VI. PMID:1529539

  9. P-element-induced control mutations at the r gene of Drosophila melanogaster.

    PubMed Central

    Tsubota, S; Ashburner, M; Schedl, P


    The P-M hybrid dysgenesis system was used to produce five putative regulatory mutations at the rudimentary locus, r. All five mutations were the result of insertions at the 5' end of the gene, upstream of the proposed start of transcription. All of the mutants displayed a leaky wing phenotype, and four of the mutants showed an uncoupling of the wing and female-sterility phenotypes, suggesting that they altered the normal spatial and temporal expression of the r gene. Four of the insertions were P elements. The fifth insertion, which was larger than an intact P element, consisted of a small P element connected to non-P-element DNA. Two of the mutants produced very little r transcript in adult females and were clustered 80 to 150 base pairs upstream of the start of transcription. The other three mutants had higher levels of r transcript in adult females and were clustered 440 to 500 base pairs upstream of the start of transcription. All of the data suggest that the insertions are in a 5' noncoding region of the r gene involved in the control of its spatial and temporal expression. Images PMID:3016507

  10. Genome-wide discovery of cis-elements in promoter sequences using gene expression.


    Troukhan, Maxim; Tatarinova, Tatiana; Bouck, John; Flavell, Richard B; Alexandrov, Nickolai N


    The availability of complete or nearly complete genome sequences, a large number of 5' expressed sequence tags, and significant public expression data allow for a more accurate identification of cis-elements regulating gene expression. We have implemented a global approach that takes advantage of available expression data, genomic sequences, and transcript information to predict cis-elements associated with specific expression patterns. The key components of our approach are: (1) precise identification of transcription start sites, (2) specific locations of cis-elements relative to the transcription start site, and (3) assessment of statistical significance for all sequence motifs. By applying our method to promoters of Arabidopsis thaliana and Mus musculus, we have identified motifs that affect gene expression under specific environmental conditions or in certain tissues. We also found that the presence of the TATA box is associated with increased variability of gene expression. Strong correlation between our results and experimentally determined motifs shows that the method is capable of predicting new functionally important cis-elements in promoter sequences. PMID:19231992

  11. Evidence of extensive non-allelic gene conversion among LTR elements in the human genome.


    Trombetta, Beniamino; Fantini, Gloria; D'Atanasio, Eugenia; Sellitto, Daniele; Cruciani, Fulvio


    Long Terminal Repeats (LTRs) are nearly identical DNA sequences found at either end of Human Endogenous Retroviruses (HERVs). The high sequence similarity that exists among different LTRs suggests they could be substrate of ectopic gene conversion events. To understand the extent to which gene conversion occurs and to gain new insights into the evolutionary history of these elements in humans, we performed an intra-species phylogenetic study of 52 LTRs on different unrelated Y chromosomes. From this analysis, we obtained direct evidence that demonstrates the occurrence of ectopic gene conversion in several LTRs, with donor sequences located on both sex chromosomes and autosomes. We also found that some of these elements are characterized by an extremely high density of polymorphisms, showing one of the highest nucleotide diversities in the human genome, as well as a complex patchwork of sequences derived from different LTRs. Finally, we highlighted the limits of current short-read NGS studies in the analysis of genetic diversity of the LTRs in the human genome. In conclusion, our comparative re-sequencing analysis revealed that ectopic gene conversion is a common event in the evolution of LTR elements, suggesting complex genetic links among LTRs from different chromosomes. PMID:27346230

  12. Evidence of extensive non-allelic gene conversion among LTR elements in the human genome

    PubMed Central

    Trombetta, Beniamino; Fantini, Gloria; D’Atanasio, Eugenia; Sellitto, Daniele; Cruciani, Fulvio


    Long Terminal Repeats (LTRs) are nearly identical DNA sequences found at either end of Human Endogenous Retroviruses (HERVs). The high sequence similarity that exists among different LTRs suggests they could be substrate of ectopic gene conversion events. To understand the extent to which gene conversion occurs and to gain new insights into the evolutionary history of these elements in humans, we performed an intra-species phylogenetic study of 52 LTRs on different unrelated Y chromosomes. From this analysis, we obtained direct evidence that demonstrates the occurrence of ectopic gene conversion in several LTRs, with donor sequences located on both sex chromosomes and autosomes. We also found that some of these elements are characterized by an extremely high density of polymorphisms, showing one of the highest nucleotide diversities in the human genome, as well as a complex patchwork of sequences derived from different LTRs. Finally, we highlighted the limits of current short-read NGS studies in the analysis of genetic diversity of the LTRs in the human genome. In conclusion, our comparative re-sequencing analysis revealed that ectopic gene conversion is a common event in the evolution of LTR elements, suggesting complex genetic links among LTRs from different chromosomes. PMID:27346230

  13. Epigenetic regulation of intragenic transposable elements impacts gene transcription in Arabidopsis thaliana

    PubMed Central

    Le, Tu N.; Miyazaki, Yuji; Takuno, Shohei; Saze, Hidetoshi


    Genomes of higher eukaryotes, including plants, contain numerous transposable elements (TEs), that are often silenced by epigenetic mechanisms, such as histone modifications and DNA methylation. Although TE silencing adversely affects expression of nearby genes, recent studies reveal the presence of intragenic TEs marked by repressive heterochromatic epigenetic marks within transcribed genes. However, even for the well-studied plant model Arabidopsis thaliana, the abundance of intragenic TEs, how they are epigenetically regulated, and their potential impacts on host gene expression, remain unexplored. In this study, we comprehensively analyzed genome-wide distribution and epigenetic regulation of intragenic TEs in A. thaliana. Our analysis revealed that about 3% of TEs are located within gene bodies, dominantly at intronic regions. Most of them are shorter and less methylated than intergenic TEs, but they are still targeted by RNA-directed DNA methylation-dependent and independent pathways. Surprisingly, the heterochromatic epigenetic marks at TEs are maintained within actively transcribed genes. Moreover, the heterochromatic state of intronic TEs is critical for proper transcription of associated genes. Our study provides the first insight into how intragenic TEs affect the transcriptional landscape of the A. thaliana genome, and suggests the importance of epigenetic mechanisms for regulation of TEs within transcriptional gene units. PMID:25813042

  14. Metagenomic Profiling of Antibiotic Resistance Genes and Mobile Genetic Elements in a Tannery Wastewater Treatment Plant

    PubMed Central

    Wang, Zhu; Zhang, Xu-Xiang; Huang, Kailong; Miao, Yu; Shi, Peng; Liu, Bo; Long, Chao; Li, Aimin


    Antibiotics are often used to prevent sickness and improve production in animal agriculture, and the residues in animal bodies may enter tannery wastewater during leather production. This study aimed to use Illumina high-throughput sequencing to investigate the occurrence, diversity and abundance of antibiotic resistance genes (ARGs) and mobile genetic elements (MGEs) in aerobic and anaerobic sludge of a full-scale tannery wastewater treatment plant (WWTP). Metagenomic analysis showed that Proteobacteria, Firmicutes, Bacteroidetes and Actinobacteria dominated in the WWTP, but the relative abundance of archaea in anaerobic sludge was higher than in aerobic sludge. Sequencing reads from aerobic and anaerobic sludge revealed differences in the abundance of functional genes between both microbial communities. Genes coding for antibiotic resistance were identified in both communities. BLAST analysis against Antibiotic Resistance Genes Database (ARDB) further revealed that aerobic and anaerobic sludge contained various ARGs with high abundance, among which sulfonamide resistance gene sul1 had the highest abundance, occupying over 20% of the total ARGs reads. Tetracycline resistance genes (tet) were highly rich in the anaerobic sludge, among which tet33 had the highest abundance, but was absent in aerobic sludge. Over 70 types of insertion sequences were detected in each sludge sample, and class 1 integrase genes were prevalent in the WWTP. The results highlighted prevalence of ARGs and MGEs in tannery WWTPs, which may deserve more public health concerns. PMID:24098424

  15. A search in the genome of Saccharomyces cerevisiae for genes regulated via stress response elements.


    Moskvina, E; Schüller, C; Maurer, C T; Mager, W H; Ruis, H


    Stress response elements (STREs, core consensus AG4 or C4T) have been demonstrated previously to occur in the upstream region of a number of genes responsive to induction by a variety of stress signals. This stress response is mediated by the homologous transcription factors Msn2p and Msn4p, which bind specifically to STREs. Double mutants (msn2 msn4) deficient in these transcription factors have been shown to be hypersensitive to severe stress conditions. To obtain a more representative overview of the set of yeast genes controlled via this regulon, a computer search of the Saccharomyces cerevisiae genome was carried out for genes, which, similar to most known STRE-controlled genes, exhibit at least two STREs in their upstream region. In addition to the great majority of genes previously known to be controlled via STREs, 69 open reading-frames were detected. Expression patterns of a set of these were examined by grid filter hybridization, and 14 genes were examined by Northern analysis. Comparison of the expression patterns of these genes demonstrates that they are all STRE-controlled although their detailed expression patterns differ considerably. PMID:9730283

  16. Identification and characterization of the retinoic acid response elements in the human RIG1 gene promoter

    SciTech Connect

    Jiang, S.-Y.; Wu, M.-S.; Chen, L.-M.; Hung, M.-W.; Lin, H.-E.; Chang, G.-G.; Chang, T.-C. . E-mail:


    The expression of retinoic acid-induced gene 1 (RIG1), a class II tumor suppressor gene, is induced in cells treated with retinoids. RIG1 has been shown to express ubiquitously and the increased expression of this gene appears to suppress cell proliferation. Recent studies also demonstrated that this gene may play an important role in cell differentiation and the progression of cancer. In spite of the remarkable regulatory role of this protein, the molecular mechanism of RIG1 expression induced by retinoids remains to be clarified. The present study was designed to study the molecular mechanism underlying the all-trans retinoic acid (atRA)-mediated induction of RIG1 gene expression. Polymerase chain reaction was used to generate a total of 10 luciferase constructs that contain various fragments of the RIG1 5'-genomic region. These constructs were then transfected into human gastric cancer SC-M1 and breast cancer T47D cells for transactivation analysis. atRA exhibited a significant induction in luciferase activity only through the -4910/-5509 fragment of the 5'-genomic region of RIG1 gene relative to the translation initiation site. Further analysis of this promoter fragment indicated that the primary atRA response region is located in between -5048 and -5403 of the RIG1 gene. Within this region, a direct repeat sequence with five nucleotide spacing, 5'-TGACCTctattTGCCCT-3' (DR5, -5243/-5259), and an inverted repeat sequence with six nucleotide spacing, 5'-AGGCCAtggtaaTGGCCT-3' (IR6, -5323/-5340), were identified. Deletion and mutation of the DR5, but not the IR6 element, abolished the atRA-mediated activity. Electrophoretic mobility shift assays with nuclear extract from atRA-treated cells indicated the binding of retinoic acid receptor (RAR) and retinoid X receptor (RXR) heterodimers specifically to this response element. In addition to the functional DR5, the region contains many other potential sequence elements that are required to maximize the at

  17. Conjugative transposons: an unusual and diverse set of integrated gene transfer elements.

    PubMed Central

    Salyers, A A; Shoemaker, N B; Stevens, A M; Li, L Y


    Conjugative transposons are integrated DNA elements that excise themselves to form a covalently closed circular intermediate. This circular intermediate can either reintegrate in the same cell (intracellular transposition) or transfer by conjugation to a recipient and integrate into the recipient's genome (intercellular transposition). Conjugative transposons were first found in gram-positive cocci but are now known to be present in a variety of gram-positive and gram-negative bacteria also. Conjugative transposons have a surprisingly broad host range, and they probably contribute as much as plasmids to the spread of antibiotic resistance genes in some genera of disease-causing bacteria. Resistance genes need not be carried on the conjugative transposon to be transferred. Many conjugative transposons can mobilize coresident plasmids, and the Bacteroides conjugative transposons can even excise and mobilize unlinked integrated elements. The Bacteroides conjugative transposons are also unusual in that their transfer activities are regulated by tetracycline via a complex regulatory network. PMID:8531886

  18. A novel hepatitis B virus (HBV) genetic element with Rev response element-like properties that is essential for expression of HBV gene products.

    PubMed Central

    Huang, J; Liang, T J


    Many viruses possess complex mechanisms involving multiple gene products and cis-regulatory elements in order to achieve a fine control of their gene expression at both transcriptional and posttranscriptional levels. Hepatitis B virus (HBV) and retroviruses share many structural and functional similarities. In this study, by genetic and biochemical analyses, we have demonstrated the existence of a novel genetic element within the HBV genome which is essential for high-level expression of viral gene products. This element is located 3' to the envelope coding region. We have shown that this genetic element is cis acting at the posttranscriptional level and that its function is exerted at the level of RNA processing as part of transcribed sequences. This RNA element is also functional in the context of a heterologous gene. Similar to the function of Rev-Rev response element interaction of human immunodeficiency virus type 1, this element appears to inhibit the splicing process and facilitate the transport and utilization of HBV transcripts. Images PMID:8246965

  19. Identification of unique cis-element pattern on simulated microgravity treated Arabidopsis by in silico and gene expression

    NASA Astrophysics Data System (ADS)

    Soh, Hyuncheol; Choi, Yongsang; Lee, Taek-Kyun; Yeo, Up-Dong; Han, Kyeongsik; Auh, Chungkyun; Lee, Sukchan


    Arabidopsis gene expression microarray (44 K) was used to detect genes highly induced under simulated microgravity stress (SMS). Ten SMS-inducible genes were selected from the microarray data and these 10 genes were found to be abundantly expressed in 3-week-old plants. Nine out of the 10 SMS-inducible genes were also expressed in response to the three abiotic stresses of drought, touch, and wounding in 3-week-old Arabidopsis plants respectively. However, WRKY46 was elevated only in response to SMS. Six other WRKY genes did not respond to SMS. To clarify the characteristics of the genes expressed at high levels in response to SMS, 20 cis-elements in the promoters of the 40 selected genes including the 10 SMS-inducible genes, the 6 WRKY genes, and abiotic stress-inducible genes were analyzed and their spatial positions on each promoter were determined. Four cis-elements (M/T-G-T-P from MYB1AT or TATABOX5, GT1CONSENSUS, TATABOX5, and POLASIG1) showed a unique spatial arrangement in most SMS-inducible genes including WRKY46. Therefore the M/T-G-T-P cis-element patterns identified in the promoter of WRKY46 may play important roles in regulating gene expression in response to SMS. The presences of the cis-element patterns suggest that the order or spatial positioning of certain groups of cis-elements is more important than the existence or numbers of specific cis-elements. Taken together, our data indicate that WRKY46 is a novel SMS inducible transcription factor and the unique spatial arrangement of cis-elements shown in WRKY46 promoter may play an important role for its response to SMS.

  20. Hoxa5 gene regulation: A gradient of binding activity to a brachial spinal cord element.


    Nowling, T; Zhou, W; Krieger, K E; Larochelle, C; Nguyen-Huu, M C; Jeannotte, L; Tuggle, C K


    The Hox genes cooperate in providing positional information needed for spatial and temporal patterning of the vertebrate body axis. However, the biological mechanisms behind spatial Hox expression are largely unknown. In transgenic mice, gene fusions between Hoxa5 (previously called Hox-1.3) 5' flanking regions and the lacZ reporter gene show tissue- and time-specific expression in the brachial spinal cord in day 11-13 embryos. A 604-bp regulatory region with enhancer properties directs this spatially specific expression. Fine-detail mapping of the enhancer has identified several elements involved in region-specific expression, including an element required for expression in the brachial spinal cord. Factors in embryonic day 12.5 nuclear extracts bind this element in electrophoretic mobility shift assays (EMSA) and protect three regions from DNase digestion. All three sites contain an AAATAA sequence and mutations at these sites reduce or abolish binding. Furthermore, this element binds specific individual embryonic proteins on a protein blot. The binding activity appears as a gradient along the anterior-posterior axis with two- to threefold higher levels observed in extracts from anterior regions than from posterior regions. In parallel with the EMSA, the proteins on the protein blot also show reduced binding to probes with mutations at the AAATAA sites. Most importantly, transgenic mice carrying Hoxa5/lacZ fusions with the three AAATAA sites mutated either do not express the transgene or have altered transgene expression. The brachial spinal cord element and its binding proteins are likely to be involved in spatial expression of Hoxa5 during development. PMID:10075847

  1. Activation of enhancer elements by the homeobox gene Cdx2 is cell line specific.

    PubMed Central

    Taylor, J K; Levy, T; Suh, E R; Traber, P G


    Cdx2 is a caudal-related homeodomain transcription factor that is expressed in complex patterns during mouse development and at high levels in the intestinal epithelium of adult mice. Cdx2 activates transcription of intestinal gene promoters containing specific binding sites. Moreover, Cdx2 has been shown to induce intestinal differentiation in cell lines. In this study, we show that Cdx2 is able to bind to two well defined enhancer elements in the HoxC8 gene. We then demonstrate that Cdx2 is able to activate transcription of heterologous promoters when its DNA binding element is placed in an enhancer context. Furthermore, the ability to activate enhancer elements is cell-line dependent. When the Cdx2 activation domain was linked to the Gal4 DNA binding domain, the chimeric protein was able to activate Gal4 enhancer constructs in an intestinal cell line, but was unable to activate transcription in NIH3T3 cells. These data suggest that there are cell-specific factors that allow the Cdx2 activation domain to function in the activation of enhancer elements. We hypothesize that either a co-activator protein or differential phosphorylation of the activation domain may be the mechanism for intestinal cell line-specific function of Cdx2 and possibly in other tissues in early development. PMID:9171078

  2. Genomic organization and evolution of immunoglobulin kappa gene enhancers and kappa deleting element in mammals

    PubMed Central

    Das, Sabyasachi; Nikolaidis, Nikolas; Nei, Masatoshi


    We have studied the genomic structure and evolutionary pattern of immunoglobulin kappa deleting element (KDE) and three kappa enhancers (KE5′, KE3′P, and KE3′D) in eleven mammalian genomic sequences. Our results show that the relative positions and the genomic organization of the KDE and the kappa enhancers are conserved in all mammals studied and have not been affected by the local rearrangements in the immunoglobulin kappa (IGK) light chain locus over a long evolutionary time (∼120 million years of mammalian evolution). Our observations suggest that the sequence motifs in these regulatory elements have been conserved by purifying selection to achieve proper regulation of the expression of the IGK light chain genes. The conservation of the three enhancers in all mammals indicates that these species may use similar mechanisms to regulate IGK gene expression. However, some activities of the IGK enhancers might have evolved in the eutherian lineage. The presence of the three IGK enhancers, KDE, and other recombining elements (REs) in all mammals (including platypus) suggest that these genomic elements were in place before the mammalian radiation. PMID:19560204

  3. Involvement of transposon-like elements in penicillin gene cluster regulation.


    Shaaban, Mona; Palmer, Jonathan M; El-Naggar, Wael A; El-Sokkary, M A; Habib, El-Sayed E; Keller, Nancy P


    Subtelomeric secondary metabolite (SM) gene clusters are frequently surrounded by DNA repeats and transposon-like elements. The Aspergillus nidulans penicillin cluster, 30kb from the telomere of chromosome VI, is bordered by such elements. Deletions of penicillin telomere proximal and distal border regions resulted in decreased penicillin production. A 3.7kb distal region called PbIa, consisting of the putative transposable element DNA-2, was examined further where its replacement by a pyrG marker presented a similar phenotype as loss of the global SM regulator LaeA, resulting in a decrease in penicillin gene expression and product formation. In contrast, placement of the pyrG marker on either side of PbIa had no effect on penicillin synthesis. A requirement for PbIa in penicillin production was also apparent in a histone deacetylase mutant, DeltahdaA, enhanced for penicillin production. Trans-complementation of the PbIa element near and within the terrequinone A cluster on chromosome V did not restore penicillin biosynthesis or increase production of terrequinone A. Taken together, this data provides evidence for transposon involvement in SM cluster regulation. PMID:20219692

  4. Regulatory Elements of the Floral Homeotic Gene AGAMOUS Identified by Phylogenetic Footprinting and ShadowingW⃞

    PubMed Central

    Hong, Ray L.; Hamaguchi, Lynn; Busch, Maximilian A.; Weigel, Detlef


    In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3-kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae species, several other motifs, but not the LFY and WUS binding sites identified previously, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally important for the activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection but also demonstrate that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites. PMID:12782724

  5. Molluscan mobile elements similar to the vertebrate recombination-activating genes

    PubMed Central

    Panchin, Yuri; Moroz, Leonid L.


    Animal genomes contain ~20,000 genes. Additionally millions of genes for antigen receptors are generated in cells of the immune system from the sets of separate gene segments by a mechanism known as the V(D)J somatic recombination. The components of the V(D)J recombination system, Recombination-Activating Gene proteins (RAG1 and RAG2) and recombination signal sequence (RSS), are thought to have “entered” the vertebrate genome as a hypothetical “RAG transposon”. Recently discovered mobile elements have terminal inverted repeats (TIRs) similar to RSS and may encode proteins with a different degree of similarity to RAG1. We describe a novel N-RAG-TP transposon identified from the sea slug Aplysia californica that encodes a protein similar to the N-terminal part of RAG1 in vertebrates. This refines the “RAG transposon” hypothesis and allows us to propose a scenario for V(D)J recombination machinery evolution from a relic transposon related to the existing mobile elements N-RAG-TP, Chapaev and Transib. PMID:18313399

  6. Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing.

    SciTech Connect

    Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D.


    OAK-B135 In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3 kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally important for activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection, but also highlight that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites.

  7. Efficient transcription of the human angiotensin II type 2 receptor gene requires intronic sequence elements.

    PubMed Central

    Warnecke, C; Willich, T; Holzmeister, J; Bottari, S P; Fleck, E; Regitz-Zagrosek, V


    To investigate mechanisms of human angiotensin II type 2 receptor (hAT2) gene regulation we functionally characterized the promoter and downstream regions of the gene. 5'-Terminal deletion mutants from -1417/+100 to -46/+100 elicited significant but low functional activity in luciferase reporter gene assays with PC12W cells. Inclusion into the promoter constructs of intron 1 and the transcribed region of the hAT2 gene up to the translation start enhanced luciferase activity 6.7+/-1.6-fold and 11.6+/-1.7-fold (means+/-S.E.M.) respectively, whereas fusion of the promoter to the spliced 5' untranslated region of hAT2 cDNA did not, which indicated an enhancement caused by intronic sequence elements. Reverse transcriptase-mediated PCR confirmed that the chimaeric hAT2-luciferase mRNA was regularly spliced in PC12W cells. A Northern blot analysis of transfected cells showed levels of luciferase mRNA expression consistent with the respective enzyme activities. Mapping of intron 1 revealed that a 12 bp sequence in the centre of the intron was required for the increase in promoter activity, whereas the 5' adjacent intronic region mediated a decrease in luciferase activity. Mutation of the 12 bp region led to altered protein binding and markedly decreased luciferase activity. Cloned into a promoterless luciferase vector, a 123 bp intron 1 fragment was able to direct reporter gene expression to the same activity as occurred in conjunction with the 5' flanking region. These results indicate that sequence elements in intron 1 are necessary for efficient transcription of hAT2. In reporter gene assays, intron 1 might by itself function as a promoter and initiate transcription from an alternative start point. PMID:10229654

  8. Mesoscale Modeling Reveals Hierarchical Looping of Chromatin Fibers Near Gene Regulatory Elements.


    Bascom, Gavin D; Sanbonmatsu, Karissa Y; Schlick, Tamar


    While it is well-recognized that chromatin loops play an important role in gene regulation, structural details regarding higher order chromatin loops are only emerging. Here we present a systematic study of restrained chromatin loops ranging from 25 to 427 nucleosomes (fibers of 5-80 Kb DNA in length), mimicking gene elements studied by 3C contact data. We find that hierarchical looping represents a stable configuration that can effectively bring distant regions of the GATA-4 gene together, satisfying connections reported by 3C experiments. Additionally, we find that restrained chromatin fibers larger than 100 nucleosomes (∼20Kb) form closed plectonemes, whereas fibers shorter than 100 nucleosomes form simple hairpin loops. By studying the dependence of loop structures on internal parameters, we show that loop features are sensitive to linker histone concentration, loop length, divalent ions, and DNA linker length. Specifically, increasing loop length, linker histone concentration, and divalent ion concentration are associated with increased persistence length (or decreased bending), while varying DNA linker length in a manner similar to experimentally observed "nucleosome free regions" (found near transcription start sites) disrupts intertwining and leads to loop opening and increased persistence length in linker histone depleted (-LH) fibers. Chromatin fiber structure sensitivity to these parameters, all of which vary throughout the cell cycle, tissue type, and species, suggests that caution is warranted when using uniform polymer models to fit chromatin conformation capture genome-wide data. Furthermore, the folding geometry we observe near the transcription initiation site of the GATA-4 gene suggests that hierarchical looping provides a structural mechanism for gene inhibition, and offers tunable parameters for design of gene regulation elements. PMID:27218881

  9. Putative cis-Regulatory Elements Associated with Heat Shock Genes Activated During Excystation of Cryptosporidium parvum

    PubMed Central

    Lara, Ana M.; Serrano, Myrna; Sheth, Nihar; Buck, Gregory


    Background Cryptosporidiosis is a ubiquitous infectious disease, caused by the protozoan parasites Cryptosporidium hominis and C. parvum, leading to acute, persistent and chronic diarrhea worldwide. Although the complications of this disease can be serious, even fatal, in immunocompromised patients of any age, they have also been found to lead to long term effects, including growth inhibition and impaired cognitive development, in infected immunocompetent children. The Cryptosporidium life cycle alternates between a dormant stage, the oocyst, and a highly replicative phase that includes both asexual vegetative stages as well as sexual stages, implying fine genetic regulatory mechanisms. The parasite is extremely difficult to study because it cannot be cultured in vitro and animal models are equally challenging. The recent publication of the genome sequence of C. hominis and C. parvum has, however, significantly advanced our understanding of the biology and pathogenesis of this parasite. Methodology/Principal Findings Herein, our goal was to identify cis-regulatory elements associated with heat shock response in Cryptosporidium using a combination of in silico and real time RT-PCR strategies. Analysis with Gibbs-Sampling algorithms of upstream non-translated regions of twelve genes annotated as heat shock proteins in the Cryptosporidium genome identified a highly conserved over-represented sequence motif in eleven of them. RT-PCR analyses, described herein and also by others, show that these eleven genes bearing the putative element are induced concurrent with excystation of parasite oocysts via heat shock. Conclusions/Significance Our analyses suggest that occurrences of a motif identified in the upstream regions of the Cryptosporidium heat shock genes represent parts of the transcriptional apparatus and function as stress response elements that activate expression of these genes during excystation, and possibly at other stages in the life cycle of the parasite

  10. Gene regulation in Drosophila spermatogenesis: analysis of protein binding at the translational control element TCE.


    Kempe, E; Muhs, B; Schäfer, M


    We have previously identified a 12 nucleotide long sequence element, the TCE, that was demonstrated to be necessary for translational control of expression in the male germ line of Drosophila melanogaster (Schäfer et al., 1990). It is conserved among all seven members of the Mst(3)CGP gene family, that encode structural proteins of the sperm tail. The TCE is invariably located in the 5' untranslated region (UTR) at position +28 relative to the transcription start site. In this paper we analyse the mode of action of this element. We show that protein binding occurs at the TCE after incubation with testis protein extracts from Drosophila melanogaster. While several proteins are associated with the translational control element in the RNA, only one of these proteins directly crosslinks to the sequence element. The binding activity is exclusively observed with testis protein extracts but can be demonstrated with testis extracts from other Drosophila species as well, indicating that regulatory proteins involved in translational regulation in the male germ line are conserved. Although binding to the TCE can occur independent of its position relative to the transcription start site of the in vitro transcripts, its function in vivo is not exerted when shifted further downstream within the 5' UTR of a fusion gene. In addition to being a translational control element the TCE also functions as a transcriptional regulator. Consequently, a DNA-protein complex is also formed at the TCE. In contrast to the RNA-protein complexes we find DNA-protein complexes with protein extracts of several tissues of Drosophila melanogaster. PMID:8111973

  11. P-element-induced interallelic gene conversion of insertions and deletions in Drosophila melanogaster.


    Johnson-Schlitz, D M; Engels, W R


    We studied the process by which whd, a P-element insertion allele of the Drosophila melanogaster white locus, is replaced by its homolog in the presence of transposase. These events are interpreted as the result of double-strand gap repair following excision of the P transposon in whd. We used a series of alleles derived from whd through P-element mobility as templates for this repair. One group of alleles, referred to collectively as whd-F, carried fragments of the P element that had lost some of the sequences needed in cis for mobility. The other group, whd-D, had lost all of the P insert and had some of the flanking DNA from white deleted. The average replacement frequencies were 43% for whd-F alleles and 7% for the whd-D alleles. Some of the former were converted at frequencies exceeding 50%. Our data suggest that the high conversion frequencies for the whd-F templates can be attributed at least in part to an elevated efficiency of repair of unexpanded gaps that is possibly caused by the closer match between whd-F sequences and the unexpanded gap endpoints. In addition, we found that the gene substitutions were almost exclusively in the direction of whd being replaced by the whd-F or whd-D allele rather than the reverse. The template alleles were usually unaltered in the process. This asymmetry implies that the conversion process is unidirectional and that the P fragments are not good substrates for P-element transposase. Our results help elucidate a highly efficient double-strand gap repair mechanism in D. melanogaster that can also be used for gene replacement procedures involving insertions and deletions. They also help explain the rapid spread of P elements in populations. PMID:8413290

  12. Evolution of cis elements in the differential expression of two Hoxa2 coparalogous genes in pufferfish (Takifugu rubripes).


    Tümpel, Stefan; Cambronero, Francisco; Wiedemann, Leanne M; Krumlauf, Robb


    Sequence divergence in cis-regulatory elements is an important mechanism contributing to functional diversity of genes during evolution. Gene duplication and divergence provide an opportunity for selectively preserving initial functions and evolving new activities. Many vertebrates have 39 Hox genes organized into four clusters (Hoxa-Hoxd); however, some ray-finned fishes have extra Hox clusters. There is a single Hoxa2 gene in most vertebrates, whereas fugu (Takifugu rubripes) and medaka (Oryzias latipes) have two coparalogous genes [Hoxa2(a) and Hoxa2(b)]. In the hindbrain, both genes are expressed in rhombomere (r) 2, but only Hoxa2(b) is expressed in r3, r4, and r5. Multiple regulatory modules directing segmental expression of chicken and mouse Hoxa2 genes have been identified, and each module is composed of a series of discrete elements. We used these modules to investigate the basis of differential expression of duplicated Hoxa2 genes, as a model for understanding the divergence of cis-regulatory elements. Therefore, we cloned putative regulatory regions of the fugu and medaka Hoxa2(a) and -(b) genes and assayed their activity. We found that these modules direct reporter expression in a chicken assay, in a manner corresponding to their endogenous expression pattern in fugu. Although sequence comparisons reveal many differences between the two coparalogous genes, specific subtle changes in seven cis elements of the Hoxa2(a) gene restore segmental regulatory activity. Therefore, drift in subsets of the elements in the regulatory modules is responsible for the differential expression of the two coparalogous genes, thus providing insight into the evolution of cis elements. PMID:16569696

  13. Identification of novel Drosophila meiotic genes recovered in a P-element screen.

    PubMed Central

    Sekelsky, J J; McKim, K S; Messina, L; French, R L; Hurley, W D; Arbel, T; Chin, G M; Deneen, B; Force, S J; Hari, K L; Jang, J K; Laurençon, A C; Madden, L D; Matthies, H J; Milliken, D B; Page, S L; Ring, A D; Wayson, S M; Zimmerman, C C; Hawley, R S


    The segregation of homologous chromosomes from one another is the essence of meiosis. In many organisms, accurate segregation is ensured by the formation of chiasmata resulting from crossing over. Drosophila melanogaster females use this type of recombination-based system, but they also have mechanisms for segregating achiasmate chromosomes with high fidelity. We describe a P-element mutagenesis and screen in a sensitized genetic background to detect mutations that impair meiotic chromosome pairing, recombination, or segregation. Our screen identified two new recombination-deficient mutations: mei-P22, which fully eliminates meiotic recombination, and mei-P26, which decreases meiotic exchange by 70% in a polar fashion. We also recovered an unusual allele of the ncd gene, whose wild-type product is required for proper structure and function of the meiotic spindle. However, the screen yielded primarily mutants specifically defective in the segregation of achiasmate chromosomes. Although most of these are alleles of previously undescribed genes, five were in the known genes alphaTubulin67C, CycE, push, and Trl. The five mutations in known genes produce novel phenotypes for those genes. PMID:10353897

  14. Codon usage biases of transposable elements and host nuclear genes in Arabidopsis thaliana and Oryza sativa.


    Jia, Jia; Xue, Qingzhong


    Transposable elements (TEs) are mobile genetic entities ubiquitously distributed in nearly all genomes. High frequency of codons ending in A/T in TEs has been previously observed in some species. In this study, the biases in nucleotide composition and codon usage of TE transposases and host nuclear genes were investigated in the AT-rich genome of Arabidopsis thaliana and the GC-rich genome of Oryza sativa. Codons ending in A/T are more frequently used by TEs compared with their host nuclear genes. A remarkable positive correlation between highly expressed nuclear genes and C/G-ending codons were detected in O. sativa (r=0.944 and 0.839, respectively, P<0.0001) but not in A. thaliana, indicating a close association between the GC content and gene expression level in monocot species. In both species, TE codon usage biases are similar to that of weakly expressed genes. The expression and activity of TEs may be strictly controlled in plant genomes. Mutation bias and selection pressure have simultaneously acted on the TE evolution in A. thaliana and O. sativa. The consistently observed biases of nucleotide composition and codon usage of TEs may also provide a useful clue to accurately detect TE sequences in different species. PMID:20172490

  15. ATTED-II: a database of co-expressed genes and cis elements for identifying co-regulated gene groups in Arabidopsis

    PubMed Central

    Obayashi, Takeshi; Kinoshita, Kengo; Nakai, Kenta; Shibaoka, Masayuki; Hayashi, Shinpei; Saeki, Motoshi; Shibata, Daisuke; Saito, Kazuki; Ohta, Hiroyuki


    Publicly available database of co-expressed gene sets would be a valuable tool for a wide variety of experimental designs, including targeting of genes for functional identification or for regulatory investigation. Here, we report the construction of an Arabidopsis thaliana trans-factor and cis-element prediction database (ATTED-II) that provides co-regulated gene relationships based on co-expressed genes deduced from microarray data and the predicted cis elements. ATTED-II () includes the following features: (i) lists and networks of co-expressed genes calculated from 58 publicly available experimental series, which are composed of 1388 GeneChip data in A.thaliana; (ii) prediction of cis-regulatory elements in the 200 bp region upstream of the transcription start site to predict co-regulated genes amongst the co-expressed genes; and (iii) visual representation of expression patterns for individual genes. ATTED-II can thus help researchers to clarify the function and regulation of particular genes and gene networks. PMID:17130150

  16. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy

    PubMed Central

    Powell, Sara Kathleen; Rivera-Soto, Ricardo; Gray, Steven James


    Over the last five years, the number of clinical trials involving AAV (adeno-associated virus) and lentiviral vectors continue to increase by about 150 trials each year. For continued success, AAV and lentiviral expression cassettes need to be designed to meet each disease's specific needs. This review discusses how viral vector expression cassettes can be engineered with elements to enhance target specificity and increase transgene expression. The key differences relating to target specificity between ubiquitous and tissue-specific promoters are discussed, as well as how endogenous miRNAs and their target sequences have been used to restrict transgene expression. Specifically, relevant studies indicating how cis-acting elements such as introns, WPRE, polyadenylation signals, and the CMV enhancer are highlighted to show their utility for enhancing transgene expression in gene therapy applications. All discussion bears in mind that expression cassettes have space constraints. In conclusion, this review can serve as a menu of vector genome design elements and their cost in terms of space to thoughtfully engineer viral vectors for gene therapy. PMID:25636961

  17. Stress induced gene expression drives transient DNA methylation changes at adjacent repetitive elements

    PubMed Central

    Secco, David; Wang, Chuang; Shou, Huixia; Schultz, Matthew D; Chiarenza, Serge; Nussaume, Laurent; Ecker, Joseph R; Whelan, James; Lister, Ryan


    Cytosine DNA methylation (mC) is a genome modification that can regulate the expression of coding and non-coding genetic elements. However, little is known about the involvement of mC in response to environmental cues. Using whole genome bisulfite sequencing to assess the spatio-temporal dynamics of mC in rice grown under phosphate starvation and recovery conditions, we identified widespread phosphate starvation-induced changes in mC, preferentially localized in transposable elements (TEs) close to highly induced genes. These changes in mC occurred after changes in nearby gene transcription, were mostly DCL3a-independent, and could partially be propagated through mitosis, however no evidence of meiotic transmission was observed. Similar analyses performed in Arabidopsis revealed a very limited effect of phosphate starvation on mC, suggesting a species-specific mechanism. Overall, this suggests that TEs in proximity to environmentally induced genes are silenced via hypermethylation, and establishes the temporal hierarchy of transcriptional and epigenomic changes in response to stress. DOI: PMID:26196146

  18. Gene expression analysis of metallothionein and mineral elements uptake in tomato (Solanum lycopersicum) exposed to cadmium.


    Kısa, Dursun; Öztürk, Lokman; Tekin, Şaban


    Heavy metals such as Cd are considered to be the most important pollutants in soil contamination. Cd is a non-essential element adversely affecting plant growth and development, and it has caused some physiological and molecular changes. Metallothioneins (MTs) are low molecular weight, cysteine-rich, and metal binding proteins. In this study, we aimed to evaluate the MT gene expression levels and minerals uptake in the tissues of Solanum lycopersicum exposed to Cd. The transcriptional expression of the MT genes was determined by real-time quantitative PCR. The MT genes were regulated by the Cd and the mineral elements uptake changed tissue type and applied doses. The MT1 and MT2 transcript levels increased in the roots, the leaves and the fruits of the tomato. The MT3 and MT4 transcript pattern changed according to the tissue types. The Cd treatment on the growth medium increased the Mg, Ca, and Fe content in both the leaves and fruits of the tomato. However, the Cd affected the mineral levels in the roots depending on the mineral types and doses. Also, the Cd content increased in the roots, the leaves, and the fruits of the tomato, respectively. The results presented in this study show that Cd has synergistic and/or antagonistic effects on minerals depending on the tissue types. These results indicate that the MT1 and MT2 expression pattern increased together with the Mg, Ca, and Fe content in both the leaves and the fruits of the tomato. PMID:27363704

  19. Mineralocorticoid receptor interaction with SP1 generates a new response element for pathophysiologically relevant gene expression

    PubMed Central

    Meinel, Sandra; Ruhs, Stefanie; Schumann, Katja; Strätz, Nicole; Trenkmann, Kay; Schreier, Barbara; Grosse, Ivo; Keilwagen, Jens; Gekle, Michael; Grossmann, Claudia


    The mineralocorticoid receptor (MR) is a ligand-induced transcription factor belonging to the steroid receptor family and involved in water-electrolyte homeostasis, blood pressure regulation, inflammation and fibrosis in the renocardiovascular system. The MR shares a common hormone-response-element with the glucocorticoid receptor but nevertheless elicits MR-specific effects including enhanced epidermal growth factor receptor (EGFR) expression via unknown mechanisms. The EGFR is a receptor tyrosine kinase that leads to activation of MAP kinases, but that can also function as a signal transducer for other signaling pathways. In the present study, we mechanistically investigate the interaction between a newly discovered MR- but not glucocorticoid receptor- responsive-element (=MRE1) of the EGFR promoter, specificity protein 1 (SP1) and MR to gain general insights into MR-specificity. Biological relevance of the interaction for EGFR expression and consequently for different signaling pathways in general is demonstrated in human, rat and murine vascular smooth muscle cells and cells of EGFR knockout mice. A genome-wide promoter search for identical binding regions followed by quantitative PCR validation suggests that the identified MR-SP1–MRE1 interaction might be applicable to other genes. Overall, a novel principle of MR-specific gene expression is explored that applies to the pathophysiologically relevant expression of the EGFR and potentially also to other genes. PMID:23821666

  20. Differential interactions of promoter elements in stress responses of the Arabidopsis Adh gene.

    PubMed Central

    Dolferus, R; Jacobs, M; Peacock, W J; Dennis, E S


    The Adh (alcohol dehydrogenase, EC gene from Arabidopsis thaliana (L.) Heynh. can be induced by dehydration and cold, as well as by hypoxia. A 1-kb promoter fragment (CADH: -964 to +53) is sufficient to confer the stress induction and tissue-specific developmental expression characteristics of the Adh gene to a beta-glucuronidase reporter gene. Deletion mapping of the 5' end and site-specific mutagenesis identified four regions of the promoter essential for expression under the three stress conditions. Some sequence elements are important for response to all three stress treatments, whereas others are stress specific. The most critical region essential for expression of the Arabidopsis Adh promoter under all three environmental stresses (region IV: -172 to -141) contains sequences homologous to the GT motif (-160 to -152) and the GC motif (-147 to -144) of the maize Adh1 anaerobic responsive element. Region III (-235 to -172) contains two regions shown by R.J. Ferl and B.H. Laughner ([1989] Plant Mol Biol 12: 357-366) to bind regulatory proteins; mutation of the G-box-1 region (5'-CCACGTGG-3', -216 to -209) does not affect expression under uninduced or hypoxic conditions, but significantly reduces induction by cold stress and, to a lesser extent, by dehydration stress. Mutation of the other G-box-like sequence (G-box-2: 5'-CCAAGTGG-3', -193 to -182) does not change hypoxic response and affects cold and dehydration stress only slightly. G-box-2 mutations also promote high levels of expression under uninduced conditions. Deletion of region I (-964 to -510) results in increased expression under uninduced and all stress conditions, suggesting that this region contains a repressor binding site. Region II (-510 to -384) contains a positive regulatory element and is necessary for high expression levels under all treatments. PMID:7972489

  1. Functional conservation of cis-regulatory elements of heat-shock genes over long evolutionary distances.


    He, Zhengying; Eichel, Kelsie; Ruvinsky, Ilya


    Transcriptional control of gene regulation is an intricate process that requires precise orchestration of a number of molecular components. Studying its evolution can serve as a useful model for understanding how complex molecular machines evolve. One way to investigate evolution of transcriptional regulation is to test the functions of cis-elements from one species in a distant relative. Previous results suggested that few, if any, tissue-specific promoters from Drosophila are faithfully expressed in C. elegans. Here we show that, in contrast, promoters of fly and human heat-shock genes are upregulated in C. elegans upon exposure to heat. Inducibility under conditions of heat shock may represent a relatively simple "on-off" response, whereas complex expression patterns require integration of multiple signals. Our results suggest that simpler aspects of regulatory logic may be retained over longer periods of evolutionary time, while more complex ones may be diverging more rapidly. PMID:21799932

  2. The Yeast Anaerobic Response Element AR1b Regulates Aerobic Antifungal Drug-dependent Sterol Gene Expression*

    PubMed Central

    Gallo-Ebert, Christina; Donigan, Melissa; Liu, Hsing-Yin; Pascual, Florencia; Manners, Melissa; Pandya, Devanshi; Swanson, Robert; Gallagher, Denise; Chen, WeiWei; Carman, George M.; Nickels, Joseph T.


    Saccharomyces cerevisiae ergosterol biosynthesis, like cholesterol biosynthesis in mammals, is regulated at the transcriptional level by a sterol feedback mechanism. Yeast studies defined a 7-bp consensus sterol-response element (SRE) common to genes involved in sterol biosynthesis and two transcription factors, Upc2 and Ecm22, which direct transcription of sterol biosynthetic genes. The 7-bp consensus SRE is identical to the anaerobic response element, AR1c. Data indicate that Upc2 and Ecm22 function through binding to this SRE site. We now show that it is two novel anaerobic AR1b elements in the UPC2 promoter that direct global ERG gene expression in response to a block in de novo ergosterol biosynthesis, brought about by antifungal drug treatment. The AR1b elements are absolutely required for auto-induction of UPC2 gene expression and protein and require Upc2 and Ecm22 for function. We further demonstrate the direct binding of recombinant expressed S. cerevisiae ScUpc2 and pathogenic Candida albicans CaUpc2 and Candida glabrata CgUpc2 to AR1b and SRE/AR1c elements. Recombinant endogenous promoter studies show that the UPC2 anaerobic AR1b elements act in trans to regulate ergosterol gene expression. Our results indicate that Upc2 must occupy UPC2 AR1b elements in order for ERG gene expression induction to take place. Thus, the two UPC2-AR1b elements drive expression of all ERG genes necessary for maintaining normal antifungal susceptibility, as wild type cells lacking these elements have increased susceptibility to azole antifungal drugs. Therefore, targeting these specific sites for antifungal therapy represents a novel approach to treat systemic fungal infections. PMID:24163365

  3. ISCR Elements: Novel Gene-Capturing Systems of the 21st Century?

    PubMed Central

    Toleman, Mark A.; Bennett, Peter M.; Walsh, Timothy R.


    “Common regions” (CRs), such as Orf513, are being increasingly linked to mega-antibiotic-resistant regions. While their overall nucleotide sequences show little identity to other mobile elements, amino acid alignments indicate that they possess the key motifs of IS91-like elements, which have been linked to the mobility ent plasmids in pathogenic Escherichia coli. Further inspection reveals that they possess an IS91-like origin of replication and termination sites (terIS), and therefore CRs probably transpose via a rolling-circle replication mechanism. Accordingly, in this review we have renamed CRs as ISCRs to give a more accurate reflection of their functional properties. The genetic context surrounding ISCRs indicates that they can procure 5′ sequences via misreading of the cognate terIS, i.e., “unchecked transposition.” Clinically, the most worrying aspect of ISCRs is that they are increasingly being linked with more potent examples of resistance, i.e., metallo-β-lactamases in Pseudomonas aeruginosa and co-trimoxazole resistance in Stenotrophomonas maltophilia. Furthermore, if ISCR elements do move via “unchecked RC transposition,” as has been speculated for ISCR1, then this mechanism provides antibiotic resistance genes with a highly mobile genetic vehicle that could greatly exceed the effects of previously reported mobile genetic mechanisms. It has been hypothesized that bacteria will surprise us by extending their “genetic construction kit” to procure and evince additional DNA and, therefore, antibiotic resistance genes. It appears that ISCR elements have now firmly established themselves within that regimen. PMID:16760305

  4. Sterol regulatory element-binding proteins are regulators of the NIS gene in thyroid cells.


    Ringseis, Robert; Rauer, Christine; Rothe, Susanne; Gessner, Denise K; Schütz, Lisa-Marie; Luci, Sebastian; Wen, Gaiping; Eder, Klaus


    The uptake of iodide into the thyroid, an essential step in thyroid hormone synthesis, is an active process mediated by the sodium-iodide symporter (NIS). Despite its strong dependence on TSH, the master regulator of the thyroid, the NIS gene was also reported to be regulated by non-TSH signaling pathways. In the present study we provide evidence that the rat NIS gene is subject to regulation by sterol regulatory element-binding proteins (SREBPs), which were initially identified as master transcriptional regulators of lipid biosynthesis and uptake. Studies in FRTL-5 thyrocytes revealed that TSH stimulates expression and maturation of SREBPs and expression of classical SREBP target genes involved in lipid biosynthesis and uptake. Almost identical effects were observed when the cAMP agonist forskolin was used instead of TSH. In TSH receptor-deficient mice, in which TSH/cAMP-dependent gene regulation is blocked, the expression of SREBP isoforms in the thyroid was markedly reduced when compared with wild-type mice. Sterol-mediated inhibition of SREBP maturation and/or RNA interference-mediated knockdown of SREBPs reduced expression of NIS and NIS-specific iodide uptake in FRTL-5 cells. Conversely, overexpression of active SREBPs caused a strong activation of the 5'-flanking region of the rat NIS gene mediated by binding to a functional SREBP binding site located in the 5'-untranslated region of the rat NIS gene. These findings show that TSH acts as a regulator of SREBP expression and maturation in thyroid epithelial cells and that SREBPs are novel transcriptional regulators of NIS. PMID:23542164

  5. Ribosomal RNA genes of Trypanosoma brucei. Cloning of a rRNA gene containing a mobile element.

    PubMed Central

    Hasan, G; Turner, M J; Cordingley, J S


    An ordered restriction map of the ribosomal RNA genes of Trypanosoma brucei brucei is presented. Bgl II fragments of T.b.brucei genomic DNA were cloned into pAT 153, and the clones containing rDNA identified. Restriction maps were established and the sense strands identified. One clone was shown by heteroduplex mapping to contain a 1.1 kb inserted sequence which was demonstrated to be widely distributed throughout the genomes of members of the subgenus Trypanozoon. However, in two other subgenera of Trypanosoma, Nannomonas and Schizotrypanum, the sequence is far less abundant. Analysis of the genomic DNA from two serodemes of T.b.brucei showed that the sequence was present in the rRNA of only one of them, implying that the sequence is a mobile element and that its appearance in rDNA is a comparitively recent occurrence. Images PMID:6294613

  6. SHOX gene and conserved noncoding element deletions/duplications in Colombian patients with idiopathic short stature

    PubMed Central

    Sandoval, Gloria Tatiana Vinasco; Jaimes, Giovanna Carola; Barrios, Mauricio Coll; Cespedes, Camila; Velasco, Harvy Mauricio


    SHOX gene mutations or haploinsufficiency cause a wide range of phenotypes such as Leri Weill dyschondrosteosis (LWD), Turner syndrome, and disproportionate short stature (DSS). However, this gene has also been found to be mutated in cases of idiopathic short stature (ISS) with a 3–15% frequency. In this study, the multiplex ligation-dependent probe amplification (MLPA) technique was employed to determine the frequency of SHOX gene mutations and their conserved noncoding elements (CNE) in Colombian patients with ISS. Patients were referred from different centers around the county. From a sample of 62 patients, 8.1% deletions and insertions in the intragenic regions and in the CNE were found. This result is similar to others published in other countries. Moreover, an isolated case of CNE 9 duplication and a new intron 6b deletion in another patient, associated with ISS, are described. This is one of the first studies of a Latin American population in which deletions/duplications of the SHOX gene and its CNE are examined in patients with ISS. PMID:24689071

  7. Characterization of Putative cis-Regulatory Elements in Genes Preferentially Expressed in Arabidopsis Male Meiocytes

    PubMed Central

    Li, Mingjun


    Meiosis is essential for plant reproduction because it is the process during which homologous chromosome pairing, synapsis, and meiotic recombination occur. The meiotic transcriptome is difficult to investigate because of the size of meiocytes and the confines of anther lobes. The recent development of isolation techniques has enabled the characterization of transcriptional profiles in male meiocytes of Arabidopsis. Gene expression in male meiocytes shows unique features. The direct interaction of transcription factors (TFs) with DNA regulatory sequences forms the basis for the specificity of transcriptional regulation. Here, we identified putative cis-regulatory elements (CREs) associated with male meiocyte-expressed genes using in silico tools. The upstream regions (1 kb) of the top 50 genes preferentially expressed in Arabidopsis meiocytes possessed conserved motifs. These motifs are putative binding sites of TFs, some of which share common functions, such as roles in cell division. In combination with cell-type-specific analysis, our findings could be a substantial aid for the identification and experimental verification of the protein-DNA interactions for the specific TFs that drive gene expression in meiocytes. PMID:25250331

  8. Genetic Analysis of Transvection Effects Involving Cis-Regulatory Elements of the Drosophila Ultrabithorax Gene

    PubMed Central

    Micol, J. L.; Castelli-Gair, J. E.; Garcia-Bellido, A.


    The Ultrabithorax (Ubx) gene of Drosophila melanogaster contains two functionally distinguishable regions: the protein-coding Ubx transcription unit and, upstream of it, the transcribed but non-protein-coding bxd region. Numerous recessive, partial loss-of-function mutations which appear to be regulatory mutations map within the bxd region and within the introns of the Ubx transcription unit. In addition, mutations within the Ubx unit exons are known and most of these behave as null alleles. Ubx(1) is one such allele. We have confirmed that, although the Ubx(1) allele does not produce detectable Ubx proteins (UBX), it does retain other genetic functions detectable by their effects on the expression of a paired, homologous Ubx allele, i.e., by transvection. We have extended previous analyses made by E. B. Lewis by mapping the critical elements of the Ubx gene which participate in transvection effects. Our results show that the Ubx(1) allele retains wild-type functions whose effectiveness can be reduced (1) by additional cis mutations in the bxd region or in introns of the Ubx transcription unit, as well as (2) by rearrangements disturbing pairing between homologous Ubx genes. Our results suggest that those remnant functions in Ubx(1) are able to modulate the activity of the allele located in the homologous chromosome. We discuss the normal cis regulatory role of these functions involved in trans interactions between homologous Ubx genes, as well as the implications of our results for the current models on transvection. PMID:2123161

  9. Identification of distal silencing elements in the murine interferon-A11 gene promoter.

    PubMed Central

    Roffet, P; Lopez, S; Navarro, S; Bandu, M T; Coulombel, C; Vignal, M; Doly, J; Vodjdani, G


    The murine interferon-A11 (Mu IFN-A11) gene is a member of the IFN-A multigenic family. In mouse L929 cells, the weak response of the gene's promoter to viral induction is due to a combination of both a point mutation in the virus responsive element (VRE) and the presence of negatively regulating sequences surrounding the VRE. In the distal part of the promoter, the negatively acting E1E2 sequence was delimited. This sequence displays an inhibitory effect in either orientation or position on the inducibility of a virus-responsive heterologous promoter. It selectively represses VRE-dependent transcription but is not able to reduce the transcriptional activity of a VRE-lacking promoter. In a transient transfection assay, an E1E2-containing DNA competitor was able to derepress the native Mu IFN-A11 promoter. Specific nuclear factors bind to this sequence; thus the binding of trans-regulators participates in the repression of the Mu IFN-A11 gene. The E1E2 sequence contains an IFN regulatory factor (IRF)-binding site. Recombinant IRF2 binds this sequence and anti-IRF2 antibodies supershift a major complex formed with nuclear extracts. The protein composing the complex is 50 kDa in size, indicating the presence of IRF2 or antigenically related proteins in the complex. The Mu IFN-A11 gene is the first example within the murine IFN-A family, in which a distal promoter element has been identified that can negatively modulate the transcriptional response to viral induction. PMID:8760352

  10. Origin of the human L1 elements: proposed progenitor genes deduced from a consensus DNA sequence.


    Scott, A F; Schmeckpeper, B J; Abdelrazik, M; Comey, C T; O'Hara, B; Rossiter, J P; Cooley, T; Heath, P; Smith, K D; Margolet, L


    A consensus sequence for the human long interspersed repeated DNA element, L1Hs (LINE or KpnI sequence), is presented. The sequence contains two open reading frames (ORFs) which are homologous to ORFs in corresponding regions of L1 elements in other species. The L1Hs ORFs are separated by a small evolutionarily nonconserved region. The 5' end of the consensus contains frequent terminators in all three reading frames and has a relatively high GC content with numerous stretches of weak homology with AluI repeats. The 5' ORF extends for a minimum of 723 bp (241 codons). The 3' ORF is 3843 bp (1281 codons) and predicts a protein of 149 kD which has regions of weak homology to the polymerase domain of various reverse transcriptases. The 3' end of the consensus has a 208-bp nonconserved region followed by an adenine-rich end. The organization of the L1Hs consensus sequence resembles the structure of eukaryotic mRNAs except for the noncoding region between ORFs. However, due to base substitutions or truncation most elements appear incapable of producing mRNA that can be translated. Our observation that individual elements cluster into subfamilies on the basis of the presence or absence of blocks of sequence, or by the linkage of alternative bases at multiple positions, suggests that most L1 sequences were derived from a small number of structural genes. An estimate of the mammalian L1 substitution rate was derived and used to predict the age of individual human elements. From this it follows that the majority of human L1 sequences have been generated within the last 30 million years. The human elements studied here differ from each other, yet overall the L1Hs sequences demonstrate a pattern of species-specificity when compared to the L1 families of other mammals. Possible mechanisms that may account for the origin and evolution of the L1 family are discussed. These include pseudogene formation (retroposition), transposition, gene conversion, and RNA recombination. PMID

  11. Coel is a LTR retrotransopson-like element, in Beta vulgaris L., and contains a Tnp2-domain transposase gene

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We describe herein the discovery of Coe1, a LTR retrotransposon-like element in Beta vulgaris, that carries a Tnp2-type transposase gene, Tbv1, and is flanked by the 8-mer sequence motif CACTATAA in or near inverted repeats. The Tbv1 transposase gene within Coe1 consists of eight exons, and the pre...

  12. Multiple single-stranded cis elements are associated with activated chromatin of the human c-myc gene in vivo.

    PubMed Central

    Michelotti, G A; Michelotti, E F; Pullner, A; Duncan, R C; Eick, D; Levens, D


    Transcription activation and repression of eukaryotic genes are associated with conformational and topological changes of the DNA and chromatin, altering the spectrum of proteins associated with an active gene. Segments of the human c-myc gene possessing non-B structure in vivo located with enzymatic and chemical probes. Sites hypertensive to cleavage with single-strand-specific S1 nuclease or the single-strand-selective agent potassium permanganate included the major promoters P1 and P2 as well as the far upstream sequence element (FUSE) and CT elements, which bind, respectively, the single-strand-specific factors FUSE-binding protein and heterogeneous nuclear ribonucleoprotein K in vitro. Active and inactive c-myc genes yielded different patterns of S1 nuclease and permanganate sensitivity, indicating alternative chromatin configurations of active and silent genes. The melting of specific cis elements of active c-myc genes in vivo suggested that transcriptionally associated torsional strain might assist strand separation and facilitate factor binding. Therefore, the interaction of FUSE-binding protein and heterogeneous nuclear ribonucleoprotein K with supercoiled DNA was studied. Remarkably, both proteins recognize their respective elements torsionally strained but not as liner duplexes. Single-strand- or supercoil-dependent gene regulatory proteins may directly link alterations in DNA conformation and topology with changes in gene expression. PMID:8649373

  13. An ant colony optimization based algorithm for identifying gene regulatory elements.


    Liu, Wei; Chen, Hanwu; Chen, Ling


    It is one of the most important tasks in bioinformatics to identify the regulatory elements in gene sequences. Most of the existing algorithms for identifying regulatory elements are inclined to converge into a local optimum, and have high time complexity. Ant Colony Optimization (ACO) is a meta-heuristic method based on swarm intelligence and is derived from a model inspired by the collective foraging behavior of real ants. Taking advantage of the ACO in traits such as self-organization and robustness, this paper designs and implements an ACO based algorithm named ACRI (ant-colony-regulatory-identification) for identifying all possible binding sites of transcription factor from the upstream of co-expressed genes. To accelerate the ants' searching process, a strategy of local optimization is presented to adjust the ants' start positions on the searched sequences. By exploiting the powerful optimization ability of ACO, the algorithm ACRI can not only improve precision of the results, but also achieve a very high speed. Experimental results on real world datasets show that ACRI can outperform other traditional algorithms in the respects of speed and quality of solutions. PMID:23746735

  14. Localisation of cis elements in the promoter of a wheat alpha-Amy2 gene.


    Huttly, A K; Phillips, A L; Tregear, J W


    A functional analysis of the promoter from the wheat alpha-amylase gene alpha-Amy2/54 is described. Mutant alpha-Amy2/54 promoters containing replacements or deletions were constructed and their ability to direct expression of the reporter gene beta-glucuronidase (GUS) in gibberellin-responsive oat aleurone protoplasts analysed. Chimaeric promoters using regions of the cauliflower mosaic virus (CaMV) 35S and alpha-Amy2/54 promoters were also analysed. The results suggest that at least three regions within the alpha-Amy2/54 promoter contain cis elements that are necessary for high-level gibberellin-regulated transcription. Fusion of 1.8 kb of promoter sequence upstream from -117 bp to a minimal (-55 CaMV 35S) promoter gave rise to hormone-independent expression implying that the region 3' to -117 bp contains an element which represses transcription in the absence of gibberellin or presence of abscisic acid. PMID:1511136

  15. Transposable elements and their KRAB-ZFP controllers regulate gene expression in adult tissues

    PubMed Central

    Ecco, Gabriela; Cassano, Marco; Kauzlaric, Annamaria; Duc, Julien; Coluccio, Andrea; Offner, Sandra; Imbeault, Michaël; Rowe, Helen M.; Turelli, Priscilla; Trono, Didier


    Summary KRAB-containing zinc finger proteins (KRAB-ZFPs) are early embryonic controllers of transposable elements (TEs), which they repress with their cofactor KAP1 through histone and DNA methylation, a process thought to result in irreversible silencing. Using a target-centered functional screen, we matched murine TEs with their cognate KRAB-ZFP. We found the paralogs ZFP932 and Gm15446 to bind overlapping but distinguishable subsets of ERVK (endogenous retrovirus K), to repress these elements in embryonic stem cells, and to regulate secondarily the expression of neighboring genes. Most importantly, we uncovered that these KRAB-ZFPs and KAP1 control TEs in adult tissues, in cell culture and in vivo, where they partner up to modulate cellular genes. Therefore, TEs and KRAB-ZFPs establish transcriptional networks that regulate not only development but probably many physiological events. Given the high degree of species-specificity of TEs and KRAB-ZFPs, these results have important implications for understanding the biology of higher vertebrates, including humans. PMID:27003935

  16. Resistance Genes and Genetic Elements Associated with Antibiotic Resistance in Clinical and Commensal Isolates of Streptococcus salivarius.


    Chaffanel, Fanny; Charron-Bourgoin, Florence; Libante, Virginie; Leblond-Bourget, Nathalie; Payot, Sophie


    The diversity of clinical (n = 92) and oral and digestive commensal (n = 120) isolates of Streptococcus salivarius was analyzed by multilocus sequence typing (MLST). No clustering of clinical or commensal strains can be observed in the phylogenetic tree. Selected strains (92 clinical and 46 commensal strains) were then examined for their susceptibilities to tetracyclines, macrolides, lincosamides, aminoglycosides, and phenicol antibiotics. The presence of resistance genes tet(M), tet(O), erm(A), erm(B), mef(A/E), and catQ and associated genetic elements was investigated by PCR, as was the genetic linkage of resistance genes. High rates of erythromycin and tetracycline resistance were observed among the strains. Clinical strains displayed either the erm(B) (macrolide-lincosamide-streptogramin B [MLSB] phenotype) or mef(A/E) (M phenotype) resistance determinant, whereas almost all the commensal strains harbored the mef(A/E) resistance gene, carried by a macrolide efflux genetic assembly (MEGA) element. A genetic linkage between a macrolide resistance gene and genes of Tn916 was detected in 23 clinical strains and 5 commensal strains, with a predominance of Tn3872 elements (n = 13), followed by Tn6002 (n = 11) and Tn2009 (n = 4) elements. Four strains harboring a mef(A/E) gene were also resistant to chloramphenicol and carried a catQ gene. Sequencing of the genome of one of these strains revealed that these genes colocalized on an IQ-like element, as already described for other viridans group streptococci. ICESt3-related elements were also detected in half of the isolates. This work highlights the potential role of S. salivarius in the spread of antibiotic resistance genes both in the oral sphere and in the gut. PMID:25862227

  17. Resistance Genes and Genetic Elements Associated with Antibiotic Resistance in Clinical and Commensal Isolates of Streptococcus salivarius

    PubMed Central

    Chaffanel, Fanny; Charron-Bourgoin, Florence; Libante, Virginie; Leblond-Bourget, Nathalie


    The diversity of clinical (n = 92) and oral and digestive commensal (n = 120) isolates of Streptococcus salivarius was analyzed by multilocus sequence typing (MLST). No clustering of clinical or commensal strains can be observed in the phylogenetic tree. Selected strains (92 clinical and 46 commensal strains) were then examined for their susceptibilities to tetracyclines, macrolides, lincosamides, aminoglycosides, and phenicol antibiotics. The presence of resistance genes tet(M), tet(O), erm(A), erm(B), mef(A/E), and catQ and associated genetic elements was investigated by PCR, as was the genetic linkage of resistance genes. High rates of erythromycin and tetracycline resistance were observed among the strains. Clinical strains displayed either the erm(B) (macrolide-lincosamide-streptogramin B [MLSB] phenotype) or mef(A/E) (M phenotype) resistance determinant, whereas almost all the commensal strains harbored the mef(A/E) resistance gene, carried by a macrolide efflux genetic assembly (MEGA) element. A genetic linkage between a macrolide resistance gene and genes of Tn916 was detected in 23 clinical strains and 5 commensal strains, with a predominance of Tn3872 elements (n = 13), followed by Tn6002 (n = 11) and Tn2009 (n = 4) elements. Four strains harboring a mef(A/E) gene were also resistant to chloramphenicol and carried a catQ gene. Sequencing of the genome of one of these strains revealed that these genes colocalized on an IQ-like element, as already described for other viridans group streptococci. ICESt3-related elements were also detected in half of the isolates. This work highlights the potential role of S. salivarius in the spread of antibiotic resistance genes both in the oral sphere and in the gut. PMID:25862227

  18. Autotetraploid rice methylome analysis reveals methylation variation of transposable elements and their effects on gene expression

    PubMed Central

    Zhang, Jie; Liu, Yuan; Xia, En-Hua; Yao, Qiu-Yang; Liu, Xiang-Dong; Gao, Li-Zhi


    Polyploidy, or whole-genome duplication (WGD), serves as a key innovation in plant evolution and is an important genomic feature for all eukaryotes. Neopolyploids have to overcome difficulties in meiosis, genomic alterations, changes of gene expression, and epigenomic reorganization. However, the underlying mechanisms for these processes are poorly understood. One of the most interesting aspects is that genome doubling events increase the dosage of all genes. Unlike allopolyploids entangled by both hybridization and polyploidization, autopolyploids, especially artificial lines, in relatively uniform genetic background offer a model system to understand mechanisms of genome-dosage effects. To investigate DNA methylation effects in response to WGD rather than hybridization, we produced autotetraploid rice with its diploid donor, Oryza sativa ssp. indica cv. Aijiaonante, both of which were independently self-pollinated over 48 generations, and generated and compared their comprehensive transcriptomes, base pair-resolution methylomes, and siRNAomes. DNA methylation variation of transposable elements (TEs) was observed as widespread in autotetraploid rice, in which hypermethylation of class II DNA transposons was predominantly noted in CHG and CHH contexts. This was accompanied by changes of 24-nt siRNA abundance, indicating the role of the RNA-directed DNA methylation pathway. Our results showed that the increased methylation state of class II TEs may suppress the expression of neighboring genes in autotetraploid rice that has obtained double alleles, leading to no significant differences in transcriptome alterations for most genes from its diploid donor. Collectively, our findings suggest that chromosome doubling induces methylation variation in TEs that affect gene expression and may become a “genome shock” response factor to help neoautopolyploids adapt to genome-dosage effects. PMID:26621743

  19. Sterol regulatory element-binding proteins are transcriptional regulators of the thyroglobulin gene in thyroid cells.


    Wen, Gaiping; Eder, Klaus; Ringseis, Robert


    The genes encoding sodium/iodide symporter (NIS) and thyroid peroxidase (TPO), both of which are essential for thyroid hormone (TH) synthesis, were shown to be regulated by sterol regulatory element-binding proteins (SREBP)-1c and -2. In the present study we tested the hypothesis that transcription of a further gene essential for TH synthesis, the thyroglobulin (TG) gene, is under the control of SREBP. To test this hypothesis, we studied the influence of inhibition of SREBP maturation and SREBP knockdown on TG expression in FRTL-5 thyrocytes and explored transcriptional regulation of the TG promoter by reporter gene experiments in FRTL-5 and HepG2 cells, gel shift assays and chromatin immunoprecipitation. Inhibition of SREBP maturation by 25-hydroxycholesterol and siRNA-mediated knockdown of either SREBP-1c or SREBP-2 decreased mRNA and protein levels of TG in FRTL-5 thyrocytes. Reporter gene assays with wild-type and mutated TG promoter reporter truncation constructs revealed that the rat TG promoter is transcriptionally activated by nSREBP-1c and nSREBP-2. DNA-binding assays and chromatin immunoprecipitation assays showed that both nSREBP-1c and nSREBP-2 bind to a SREBP binding motif with characteristics of an E-box SRE at position -63 in the rat TG promoter. In connection with recent findings that NIS and TPO are regulated by SREBP in thyrocytes the present findings support the view that SREBP are regulators of essential steps of TH synthesis in the thyroid gland such as iodide uptake, iodide oxidation and iodination of tyrosyl residues of TG. This moreover suggests that SREBP may be molecular targets for pharmacological modulation of TH synthesis. PMID:27321819

  20. Retrotransposons in the flanking regions of normal plant genes: a role for copia-like elements in the evolution of gene structure and expression.

    PubMed Central

    White, S E; Habera, L F; Wessler, S R


    The wx-K mutation results from the insertion of a copia-like retrotransposon into exon 12 of the maize waxy gene. This retrotransposon, named Hopscotch, has one long open reading frame encoding all of the domains required for transposition. Computer-assisted database searches using Hopscotch and other plant copia-like retroelements as query sequences have revealed that ancient, degenerate retrotransposon insertions are found in close proximity to 21 previously sequenced plant genes. The data suggest that these elements may be involved in gene duplication and the regulation of gene expression. Similar searches using the Drosophila retrotransposon copia did not reveal any retrotransposon-like sequences in the flanking regions of animal genes. These results, together with the recent finding that reverse-transcriptase sequences characteristic of copia-like elements are ubiquitous and diverse in plants, suggest that copia-like retrotransposons are an ancient component of plant genomes. Images PMID:7991537

  1. A distal locus element mediates IFN-γ priming of LPS-stimulated TNF gene expression

    PubMed Central

    Chow, Nancy A.; Jasenosky, Luke D.; Goldfeld, Anne E.


    SUMMARY IFN-γ priming sensitizes monocytes/macrophages to lipopolysaccharide (LPS) stimulation, resulting in augmented expression of a set of genes including TNF. Here, we demonstrate that IFN-γ priming of LPS-stimulated TNF transcription requires a distal TNF/LT locus element 8 kb upstream of the TNF transcription start site (hHS-8). IFN-γ stimulation leads to increased DNase I accessibility of hHS-8 and its recruitment of IRF1, and subsequent LPS stimulation enhances H3K27 acetylation and induces enhancer RNA synthesis at hHS-8. Ablation of IRF1 or targeting the hHS-8 IRF1 binding site in vivo with Cas9 linked to the KRAB repressive domain abolishes IFN-γ priming while LPS induction of the gene is unaffected. Thus, IFN-γ poises a distal enhancer in the TNF/LT locus by chromatin remodeling and IRF1 recruitment, which then drives enhanced TNF gene expression in response to a secondary TLR stimulus. PMID:25482561

  2. Activation of antioxidant response element (ARE)-dependent genes by roasted coffee extracts.


    Yazheng, Liu; Kitts, David D


    Coffee beans contain numerous bioactive components that exhibit antioxidant capacity when assessed using both chemical, cell free, and biological, cell-based model systems. However, the mechanisms underlying the antioxidant effects of coffee in biological systems are not totally understood and in some cases vary considerably from results obtained with simpler in vitro chemical assays. In the present study, the physicochemical characteristics and antioxidant activity of roasted and non-roasted coffee extracts were investigated in both cell free (ORAC(FL)) and cell-based systems. A profile of antioxidant gene expression in cultured human colon adenocarcinoma Caco-2 cells treated with both roasted and non-roasted coffee extracts, respectively, was investigated using Real-Time polymerase chain reaction (PCR) array technology. Results demonstrated that the mechanisms of the antioxidant activity associated with coffee constituents assessed by the ORAC(FL) assay were different to those observed using an intracellular oxidation assay with Caco-2 cells. Moreover, roasted coffee (both light and dark roasted) extracts produced both increased- and decreased-expressions of numerous genes that are involved in the management of oxidative stress via the antioxidant defence system. The selective and specific positive induction of antioxidant response element (ARE)-dependent genes, including gastrointestinal glutathione peroxidase (GPX2), sulfiredoxin (SRXN1), thioredoxin reductase 1 (TXNRD1), peroxiredoxin 1 (PRDX1), peroxiredoxin 4 (PDRX4) and peroxiredoxin 6 (PDRX6) were identified with the activation of the endogenous antioxidant defence system in Caco-2 cells. PMID:22699814

  3. Prediction and Validation of Gene Regulatory Elements Activated During Retinoic Acid Induced Embryonic Stem Cell Differentiation.


    Simandi, Zoltan; Horvath, Attila; Nagy, Peter; Nagy, Laszlo


    Embryonic development is a multistep process involving activation and repression of many genes. Enhancer elements in the genome are known to contribute to tissue and cell-type specific regulation of gene expression during the cellular differentiation. Thus, their identification and further investigation is important in order to understand how cell fate is determined. Integration of gene expression data (e.g., microarray or RNA-seq) and results of chromatin immunoprecipitation (ChIP)-based genome-wide studies (ChIP-seq) allows large-scale identification of these regulatory regions. However, functional validation of cell-type specific enhancers requires further in vitro and in vivo experimental procedures. Here we describe how active enhancers can be identified and validated experimentally. This protocol provides a step-by-step workflow that includes: 1) identification of regulatory regions by ChIP-seq data analysis, 2) cloning and experimental validation of putative regulatory potential of the identified genomic sequences in a reporter assay, and 3) determination of enhancer activity in vivo by measuring enhancer RNA transcript level. The presented protocol is detailed enough to help anyone to set up this workflow in the lab. Importantly, the protocol can be easily adapted to and used in any cellular model system. PMID:27403939

  4. Distribution of Genes and Repetitive Elements in the Diabrotica virgifera virgifera Genome Estimated Using BAC Sequencing

    PubMed Central

    Coates, Brad S.; Alves, Analiza P.; Wang, Haichuan; Walden, Kimberly K. O.; French, B. Wade; Miller, Nicholas J.; Abel, Craig A.; Robertson, Hugh M.; Sappington, Thomas W.; Siegfried, Blair D.


    Feeding damage caused by the western corn rootworm, Diabrotica virgifera virgifera, is destructive to corn plants in North America and Europe where control remains challenging due to evolution of resistance to chemical and transgenic toxins. A BAC library, DvvBAC1, containing 109,486 clones with 104 ± 34.5 kb inserts was created, which has an ~4.56X genome coverage based upon a 2.58 Gb (2.80 pg) flow cytometry-estimated haploid genome size. Paired end sequencing of 1037 BAC inserts produced 1.17 Mb of data (~0.05% genome coverage) and indicated ~9.4 and 16.0% of reads encode, respectively, endogenous genes and transposable elements (TEs). Sequencing genes within BAC full inserts demonstrated that TE densities are high within intergenic and intron regions and contribute to the increased gene size. Comparison of homologous genome regions cloned within different BAC clones indicated that TE movement may cause haplotype variation within the inbred strain. The data presented here indicate that the D. virgifera virgifera genome is large in size and contains a high proportion of repetitive sequence. These BAC sequencing methods that are applicable for characterization of genomes prior to sequencing may likely be valuable resources for genome annotation as well as scaffolding. PMID:22919272

  5. Distribution of genes and repetitive elements in the Diabrotica virgifera virgifera genome estimated using BAC sequencing.


    Coates, Brad S; Alves, Analiza P; Wang, Haichuan; Walden, Kimberly K O; French, B Wade; Miller, Nicholas J; Abel, Craig A; Robertson, Hugh M; Sappington, Thomas W; Siegfried, Blair D


    Feeding damage caused by the western corn rootworm, Diabrotica virgifera virgifera, is destructive to corn plants in North America and Europe where control remains challenging due to evolution of resistance to chemical and transgenic toxins. A BAC library, DvvBAC1, containing 109,486 clones with 104 ± 34.5 kb inserts was created, which has an ~4.56X genome coverage based upon a 2.58 Gb (2.80 pg) flow cytometry-estimated haploid genome size. Paired end sequencing of 1037 BAC inserts produced 1.17 Mb of data (~0.05% genome coverage) and indicated ~9.4 and 16.0% of reads encode, respectively, endogenous genes and transposable elements (TEs). Sequencing genes within BAC full inserts demonstrated that TE densities are high within intergenic and intron regions and contribute to the increased gene size. Comparison of homologous genome regions cloned within different BAC clones indicated that TE movement may cause haplotype variation within the inbred strain. The data presented here indicate that the D. virgifera virgifera genome is large in size and contains a high proportion of repetitive sequence. These BAC sequencing methods that are applicable for characterization of genomes prior to sequencing may likely be valuable resources for genome annotation as well as scaffolding. PMID:22919272

  6. Comparative Metagenomics Reveals Host Specific Metavirulomes and Horizontal Gene Transfer Elements in the Chicken Cecum Microbiome

    PubMed Central

    Qu, Ani; Brulc, Jennifer M.; Wilson, Melissa K.; Law, Bibiana F.; Theoret, James R.; Joens, Lynn A.; Konkel, Michael E.; Angly, Florent; Dinsdale, Elizabeth A.; Edwards, Robert A.; Nelson, Karen E.; White, Bryan A.


    mobile DNA elements are a major functional component of cecal microbiomes, thus contributing to horizontal gene transfer and functional microbiome evolution. Moreover, the metavirulomes of these microbiomes appear to associate by host environment. These data have implications for defining core and variable microbiome content in a host species. Furthermore, this suggests that the evolution of host specific metavirulomes is a contributing factor in disease resistance to zoonotic pathogens. PMID:18698407

  7. The CHR promoter element controls cell cycle-dependent gene transcription and binds the DREAM and MMB complexes

    PubMed Central

    Müller, Gerd A.; Quaas, Marianne; Schümann, Michael; Krause, Eberhard; Padi, Megha; Fischer, Martin; Litovchick, Larisa; DeCaprio, James A.; Engeland, Kurt


    Cell cycle-dependent gene expression is often controlled on the transcriptional level. Genes like cyclin B, CDC2 and CDC25C are regulated by cell cycle-dependent element (CDE) and cell cycle genes homology region (CHR) promoter elements mainly through repression in G0/G1. It had been suggested that E2F4 binding to CDE sites is central to transcriptional regulation. However, some promoters are only controlled by a CHR. We identify the DREAM complex binding to the CHR of mouse and human cyclin B2 promoters in G0. Association of DREAM and cell cycle-dependent regulation is abrogated when the CHR is mutated. Although E2f4 is part of the complex, a CDE is not essential but can enhance binding of DREAM. We show that the CHR element is not only necessary for repression of gene transcription in G0/G1, but also for activation in S, G2 and M phases. In proliferating cells, the B-myb-containing MMB complex binds the CHR of both promoters independently of the CDE. Bioinformatic analyses identify many genes which contain conserved CHR elements in promoters binding the DREAM complex. With Ube2c as an example from that screen, we show that inverse CHR sites are functional promoter elements that can bind DREAM and MMB. Our findings indicate that the CHR is central to DREAM/MMB-dependent transcriptional control during the cell cycle. PMID:22064854

  8. The CHR promoter element controls cell cycle-dependent gene transcription and binds the DREAM and MMB complexes.


    Müller, Gerd A; Quaas, Marianne; Schümann, Michael; Krause, Eberhard; Padi, Megha; Fischer, Martin; Litovchick, Larisa; DeCaprio, James A; Engeland, Kurt


    Cell cycle-dependent gene expression is often controlled on the transcriptional level. Genes like cyclin B, CDC2 and CDC25C are regulated by cell cycle-dependent element (CDE) and cell cycle genes homology region (CHR) promoter elements mainly through repression in G(0)/G(1). It had been suggested that E2F4 binding to CDE sites is central to transcriptional regulation. However, some promoters are only controlled by a CHR. We identify the DREAM complex binding to the CHR of mouse and human cyclin B2 promoters in G(0). Association of DREAM and cell cycle-dependent regulation is abrogated when the CHR is mutated. Although E2f4 is part of the complex, a CDE is not essential but can enhance binding of DREAM. We show that the CHR element is not only necessary for repression of gene transcription in G(0)/G(1), but also for activation in S, G(2) and M phases. In proliferating cells, the B-myb-containing MMB complex binds the CHR of both promoters independently of the CDE. Bioinformatic analyses identify many genes which contain conserved CHR elements in promoters binding the DREAM complex. With Ube2c as an example from that screen, we show that inverse CHR sites are functional promoter elements that can bind DREAM and MMB. Our findings indicate that the CHR is central to DREAM/MMB-dependent transcriptional control during the cell cycle. PMID:22064854

  9. Developmental activation of the lysozyme gene in chicken macrophage cells is linked to core histone acetylation at its enhancer elements.


    Myers, Fiona A; Lefevre, Pascal; Mantouvalou, Evangelia; Bruce, Kimberley; Lacroix, Claire; Bonifer, Constanze; Thorne, Alan W; Crane-Robinson, Colyn


    Native chromatin IP assays were used to define changes in core histone acetylation at the lysozyme locus during developmental maturation of chicken macrophages and stimulation to high-level expression by lipo-polysaccharide. In pluripotent precursors the lysozyme gene (Lys) is inactive and there is no acetylation of core histones at the gene, its promoter or at the upstream cis-control elements. In myeloblasts, where there is a very low level of Lys expression, H4 acetylation appears at the cis-control elements but not at the Lys gene or its promoter: neither H3 nor H2B become significantly acetylated in myeloblasts. In mature macrophages, Lys expression increases 5-fold: H4, H2B and H2A.Z are all acetylated at the cis-control elements but H3 remains unacetylated except at the -2.4 S silencer. Stimulation with LPS increases Lys expression a further 10-fold: this is accompanied by a rise in H3 acetylation throughout the cis-control elements; H4 and H2B acetylation remain substantial but acetylation at the Lys gene and its promoter remains low. Acetylation is thus concentrated at the cis-control elements, not at the Lys gene or its immediate promoter. H4 acetylation precedes H3 acetylation during development and H3 acetylation is most directly linked to high-level Lys expression. PMID:16914441

  10. Somatic variegation and germinal mutability reflect the position of transposable element dissociation within the maize R gene

    SciTech Connect

    Alleman, M.; Kermicle, J.L. )


    The R gene regulates the timing and tissue-specificity of anthocyanin deposition during maize development. The Ac/Ds system of transposable elements was used to induce insertional mutants of the R-sc:124 allele during two cycles of mutagenesis. Of 43 unstable, spotted-aleurone mutants generated, 42 contain inserts of the Ds6 transposable element differing only in the position and orientation of the element. The remaining mutant, r-sc;ml, contained an insert of a Ds element of the approximate size of the Ds1 transposable element. The patterns of somatic variegation of these mutants, resulting from excision of Ds, define a spectrum of phenotypes ranging from sparse to dense variegation. The sparsely variegated mutants produce many germinal revertants and few stable null derivatives. Molecular analysis shows that the sparsely variegated alleles are caused by Ds6 insertions in protein coding regions of R-sc:124 whereas the densely variegated mutants result from insertions in introns or in flanking regions of the gene. The excision rate of Ds6 from R, estimated as the proportion of R genomic DNA restriction fragments lacking the element, was uniform regardless of position, orientation or whether the element was inserted in R-sc:124 or another R allele. The excision rate was greater, however, for the mutable alleles involving the Ds element from r-sc:m1. These data indicate that, although the excision rates are uniform for a given Ds element, the somatic and germinal mutability patterns of alleles associated with that element vary widely and depend primarily on the position of the transposable element within coding or noncoding regions of the gene.

  11. A new family of retroviral long terminal repeat elements in the human genome identified by their homologies to an element 5{prime} to the spider monkey haptoglobin gene

    SciTech Connect

    Erickson, L.M.; Maeda, N.


    A new family of retroviral long terminal repeats that we name Spm-LTR has been identified as a result of DNA sequence comparisons between the entire Gen-Bank databank and an element, SPHP, located 5{prime} to the haptoglobin gene of spider monkeys. The 18 human Spm-LTR sequences so identified fall into three subtypes. There is no sequence similarity between Spm-LTR elements and any endogenous retroviral LTR sequences previously reported except for general features that define LTRs. However, a previously described repeated sequence (MER-4) forms a portion of the Spm-LTR sequence. 13 refs., 1 fig., 1 tab.

  12. Role of Nrf1 in antioxidant response element-mediated gene expression and beyond

    SciTech Connect

    Biswas, Madhurima; Chan, Jefferson Y.


    Oxidative stress plays an important part in the pathogenesis of a variety of diseases. The ability to mount an efficient response against the continuous threat posed by exogenous and endogenous oxidants is essential for cellular homeostasis and survival. Oxidative stress activates transcription of a variety of antioxidant genes through cis-acting sequence known as antioxidant response element (ARE). Members of the Cap-N-Collar family of transcription factors, including Nrf1 and Nrf2, that bind ARE have been identified. Nrf1 and Nrf2 are expressed in a wide range of tissues and cell types, and both bind the ARE as heterodimers with small Maf proteins. Numerous studies indicate a pivotal role of Nrf2 in ARE function. Herein, we review data derived from cell-based studies and knockout mice in an attempt to define the role and regulation of Nrf1 in oxidative stress response and other functions.

  13. Widespread contribution of transposable elements to the innovation of gene regulatory networks.


    Sundaram, Vasavi; Cheng, Yong; Ma, Zhihai; Li, Daofeng; Xing, Xiaoyun; Edge, Peter; Snyder, Michael P; Wang, Ting


    Transposable elements (TEs) have been shown to contain functional binding sites for certain transcription factors (TFs). However, the extent to which TEs contribute to the evolution of TF binding sites is not well known. We comprehensively mapped binding sites for 26 pairs of orthologous TFs in two pairs of human and mouse cell lines (representing two cell lineages), along with epigenomic profiles, including DNA methylation and six histone modifications. Overall, we found that 20% of binding sites were embedded within TEs. This number varied across different TFs, ranging from 2% to 40%. We further identified 710 TF-TE relationships in which genomic copies of a TE subfamily contributed a significant number of binding peaks for a TF, and we found that LTR elements dominated these relationships in human. Importantly, TE-derived binding peaks were strongly associated with open and active chromatin signatures, including reduced DNA methylation and increased enhancer-associated histone marks. On average, 66% of TE-derived binding events were cell type-specific with a cell type-specific epigenetic landscape. Most of the binding sites contributed by TEs were species-specific, but we also identified binding sites conserved between human and mouse, the functional relevance of which was supported by a signature of purifying selection on DNA sequences of these TEs. Interestingly, several TFs had significantly expanded binding site landscapes only in one species, which were linked to species-specific gene functions, suggesting that TEs are an important driving force for regulatory innovation. Taken together, our data suggest that TEs have significantly and continuously shaped gene regulatory networks during mammalian evolution. PMID:25319995

  14. Widespread contribution of transposable elements to the innovation of gene regulatory networks

    PubMed Central

    Sundaram, Vasavi; Cheng, Yong; Ma, Zhihai; Li, Daofeng; Xing, Xiaoyun; Edge, Peter


    Transposable elements (TEs) have been shown to contain functional binding sites for certain transcription factors (TFs). However, the extent to which TEs contribute to the evolution of TF binding sites is not well known. We comprehensively mapped binding sites for 26 pairs of orthologous TFs in two pairs of human and mouse cell lines (representing two cell lineages), along with epigenomic profiles, including DNA methylation and six histone modifications. Overall, we found that 20% of binding sites were embedded within TEs. This number varied across different TFs, ranging from 2% to 40%. We further identified 710 TF–TE relationships in which genomic copies of a TE subfamily contributed a significant number of binding peaks for a TF, and we found that LTR elements dominated these relationships in human. Importantly, TE-derived binding peaks were strongly associated with open and active chromatin signatures, including reduced DNA methylation and increased enhancer-associated histone marks. On average, 66% of TE-derived binding events were cell type-specific with a cell type-specific epigenetic landscape. Most of the binding sites contributed by TEs were species-specific, but we also identified binding sites conserved between human and mouse, the functional relevance of which was supported by a signature of purifying selection on DNA sequences of these TEs. Interestingly, several TFs had significantly expanded binding site landscapes only in one species, which were linked to species-specific gene functions, suggesting that TEs are an important driving force for regulatory innovation. Taken together, our data suggest that TEs have significantly and continuously shaped gene regulatory networks during mammalian evolution. PMID:25319995

  15. A small regulatory element from chromosome 19 enhances liver-specific gene expression

    PubMed Central

    Li, C; Hirsch, M; Carter, P; Asokan, A; Zhou, X; Wu, Z; Samulski, RJ


    Tissue-specific promoters for gene therapy are typically too big for adeno-associated virus (AAV) vectors; thus, the exploration of small effective non-viral regulatory elements is of particular interest. Wild-type AAV can specifically integrate into a region on human chromosome 19 termed AAVS1. Earlier work has determined that a 347 bp fragment (Chr19) of AAVS1 has promoter and transcriptional enhancer activities. In this study, we further characterized this genetic regulation and investigated its application to AAV gene therapy in vitro and in vivo. The Chr19 347 bp fragment was dissected into three regulatory elements in human embryonic kidney cells: (i) TATA-independent promoter activity distributed throughout the fragment regardless of orientation, (ii) an orientation-dependent insulator function near the 5′ end and (iii) a 107 bp enhancer region near the 3′ end. The small enhancer region, coupled to the mini-CMV promoter, was used to drive the expression of several reporters following transduction by AAV2. In vivo data demonstrated enhanced transgene expression from the Chr19-mini-CMV promoter cassette after tail vein injection primarily in the liver at levels comparable to the chicken β-actin promoter and higher than the liver-specific TTR promoter (>2-fold). However, we did not observe this increase after muscle injection, suggesting tissue-specific enhancement. All of the results support identification of a small DNA fragment (347 bp) from AAV Chr19 integration site capable of providing efficient and enhanced liver-specific transcription when used in recombinant AAV vectors. PMID:18701910

  16. Analysis of Saccharomyces cerevisiae genome for the distributions of stress-response elements potentially affecting gene expression by transcriptional interference.


    Liu, Yunkai; Ye, Sujuan; Erkine, Alexandre M


    Cellular stress responses are characterized by coordinated transcriptional induction of genes encoding a group of conserved proteins known as molecular chaperones, most of which are also known as heat shock proteins (HSPs). In S. cerevisiae, transcriptional responses to stress are mediated via two trans-regulatory activators: heat shock transcription factors (HSFs) that bind to heat shock elements (HSEs), and the Msn2 and Msn4 transcription factors that bind to stress response elements (STREs). Recent studies in S. cerevisiae demonstrated that a significant portion of the non-coding region in the genome is transcribed and this intergenic transcription could regulate the transcription of adjacent genes by transcription interference. The goal of this study was to analyze the genomic distribution of HSF and Msn2/4 binding sites and to study the potential for transcription interference regulated by stress response systems. Our genome-wide analysis revealed that 297 genes have STREs in their promoter region, whereas 310 genes contained HSEs. Twenty-five genes had both HSEs and STREs in their promoters. The first set of genes is potentially regulated by the Msn2/Msn4/STRE interaction. For the second set of genes, regulation by heat shock could be mediated through HSF/HSE regulatory mechanisms. The overlap between these groups suggests a co-regulation by the two pathways. Our study yielded 239 candidate genes, whose regulation could potentially be affected by heat-shock via transcription interference directed both from upstream and downstream areas relative to the native promoters. In addition we have categorized 924 genes containing HSE and/or STRE elements within the Open Reading Frames (ORFs), which may also affect normal transcription. Our study revealed a widespread possibility for the regulation of genes via transcriptional interference initiated by stress response. We provided a categorization of genes potentially affected at the transcriptional level by known

  17. Phylogenetic and Genomic Analyses Resolve the Origin of Important Plant Genes Derived from Transposable Elements

    PubMed Central

    Joly-Lopez, Zoé; Hoen, Douglas R.; Blanchette, Mathieu; Bureau, Thomas E.


    Once perceived as merely selfish, transposable elements (TEs) are now recognized as potent agents of adaptation. One way TEs contribute to evolution is through TE exaptation, a process whereby TEs, which persist by replicating in the genome, transform into novel host genes, which persist by conferring phenotypic benefits. Known exapted TEs (ETEs) contribute diverse and vital functions, and may facilitate punctuated equilibrium, yet little is known about this process. To better understand TE exaptation, we designed an approach to resolve the phylogenetic context and timing of exaptation events and subsequent patterns of ETE diversification. Starting with known ETEs, we search in diverse genomes for basal ETEs and closely related TEs, carefully curate the numerous candidate sequences, and infer detailed phylogenies. To distinguish TEs from ETEs, we also weigh several key genomic characteristics including repetitiveness, terminal repeats, pseudogenic features, and conserved domains. Applying this approach to the well-characterized plant ETEs MUG and FHY3, we show that each group is paraphyletic and we argue that this pattern demonstrates that each originated in not one but multiple exaptation events. These exaptations and subsequent ETE diversification occurred throughout angiosperm evolution including the crown group expansion, the angiosperm radiation, and the primitive evolution of angiosperms. In addition, we detect evidence of several putative novel ETE families. Our findings support the hypothesis that TE exaptation generates novel genes more frequently than is currently thought, often coinciding with key periods of evolution. PMID:27189548

  18. Phylogenetic and Genomic Analyses Resolve the Origin of Important Plant Genes Derived from Transposable Elements.


    Joly-Lopez, Zoé; Hoen, Douglas R; Blanchette, Mathieu; Bureau, Thomas E


    Once perceived as merely selfish, transposable elements (TEs) are now recognized as potent agents of adaptation. One way TEs contribute to evolution is through TE exaptation, a process whereby TEs, which persist by replicating in the genome, transform into novel host genes, which persist by conferring phenotypic benefits. Known exapted TEs (ETEs) contribute diverse and vital functions, and may facilitate punctuated equilibrium, yet little is known about this process. To better understand TE exaptation, we designed an approach to resolve the phylogenetic context and timing of exaptation events and subsequent patterns of ETE diversification. Starting with known ETEs, we search in diverse genomes for basal ETEs and closely related TEs, carefully curate the numerous candidate sequences, and infer detailed phylogenies. To distinguish TEs from ETEs, we also weigh several key genomic characteristics including repetitiveness, terminal repeats, pseudogenic features, and conserved domains. Applying this approach to the well-characterized plant ETEs MUG and FHY3, we show that each group is paraphyletic and we argue that this pattern demonstrates that each originated in not one but multiple exaptation events. These exaptations and subsequent ETE diversification occurred throughout angiosperm evolution including the crown group expansion, the angiosperm radiation, and the primitive evolution of angiosperms. In addition, we detect evidence of several putative novel ETE families. Our findings support the hypothesis that TE exaptation generates novel genes more frequently than is currently thought, often coinciding with key periods of evolution. PMID:27189548

  19. The structure and function of the regulatory elements of the Escherichia coli uvrB gene.

    PubMed Central

    van den Berg, E; Zwetsloot, J; Noordermeer, I; Pannekoek, H; Dekker, B; Dijkema, R; van Ormondt, H


    The construction and properties of recombinant plasmids carrying the Escherichia coli uvrB gene, including its transcriptional- and translational regulatory elements, is reported. The DNA sequence of the region, which governs the expression of the uvrB gene, has been determined. Within this sequence two non-overlapping DNA segments match the model sequence for Escherichia coli promoters (1). The '-10 regions' and the '-35 regions' of the proposed uvrB promoters are, respectively, 5'TAAAAT (P1), 5'TATAAT (P2) and 5'TTGGCA (P1), 5'GTGATG (P2). The existence and the position of these promoters has been established by elimination of one promoter (P2), using molecular cloning procedures, by length measurements of in vitro synthesized 'run-off' transcripts and by protection of the uvrB regulatory region for S1 nuclease digestion using in vivo made RNA. Potential sites of interaction within the uvrB regulatory region with regulatory proteins, such as the LexA protein (2) and the UvrC protein (3) are discussed. Images PMID:6273801

  20. A transposable element in a NAC gene is associated with drought tolerance in maize seedlings.


    Mao, Hude; Wang, Hongwei; Liu, Shengxue; Li, Zhigang; Yang, Xiaohong; Yan, Jianbing; Li, Jiansheng; Tran, Lam-Son Phan; Qin, Feng


    Drought represents a major constraint on maize production worldwide. Understanding the genetic basis for natural variation in drought tolerance of maize may facilitate efforts to improve this trait in cultivated germplasm. Here, using a genome-wide association study, we show that a miniature inverted-repeat transposable element (MITE) inserted in the promoter of a NAC gene (ZmNAC111) is significantly associated with natural variation in maize drought tolerance. The 82-bp MITE represses ZmNAC111 expression via RNA-directed DNA methylation and H3K9 dimethylation when heterologously expressed in Arabidopsis. Increasing ZmNAC111 expression in transgenic maize enhances drought tolerance at the seedling stage, improves water-use efficiency and induces upregulation of drought-responsive genes under water stress. The MITE insertion in the ZmNAC111 promoter appears to have occurred after maize domestication and spread among temperate germplasm. The identification of this MITE insertion provides insight into the genetic basis for natural variation in maize drought tolerance. PMID:26387805

  1. A transposable element in a NAC gene is associated with drought tolerance in maize seedlings

    PubMed Central

    Mao, Hude; Wang, Hongwei; Liu, Shengxue; Li, Zhigang; Yang, Xiaohong; Yan, Jianbing; Li, Jiansheng; Tran, Lam-Son Phan; Qin, Feng


    Drought represents a major constraint on maize production worldwide. Understanding the genetic basis for natural variation in drought tolerance of maize may facilitate efforts to improve this trait in cultivated germplasm. Here, using a genome-wide association study, we show that a miniature inverted-repeat transposable element (MITE) inserted in the promoter of a NAC gene (ZmNAC111) is significantly associated with natural variation in maize drought tolerance. The 82-bp MITE represses ZmNAC111 expression via RNA-directed DNA methylation and H3K9 dimethylation when heterologously expressed in Arabidopsis. Increasing ZmNAC111 expression in transgenic maize enhances drought tolerance at the seedling stage, improves water-use efficiency and induces upregulation of drought-responsive genes under water stress. The MITE insertion in the ZmNAC111 promoter appears to have occurred after maize domestication and spread among temperate germplasm. The identification of this MITE insertion provides insight into the genetic basis for natural variation in maize drought tolerance. PMID:26387805

  2. Long-range regulation by shared retinoic acid response elements modulates dynamic expression of posterior Hoxb genes in CNS development.


    Ahn, Youngwook; Mullan, Hillary E; Krumlauf, Robb


    Retinoic acid (RA) signaling plays an important role in determining the anterior boundary of Hox gene expression in the neural tube during embryogenesis. In particular, RA signaling is implicated in a rostral expansion of the neural expression domain of 5׳ Hoxb genes (Hoxb9-Hoxb5) in mice. However, underlying mechanisms for this gene regulation have remained elusive due to the lack of RA responsive element (RARE) in the 5׳ half of the HoxB cluster. To identify cis-regulatory elements required for the rostral expansion, we developed a recombineering technology to serially label multiple genes with different reporters in a single bacterial artificial chromosome (BAC) vector containing the mouse HoxB cluster. This allowed us to simultaneously monitor the expression of multiple genes. In contrast to plasmid-based reporters, transgenic BAC reporters faithfully recapitulated endogenous gene expression patterns of the Hoxb genes including the rostral expansion. Combined inactivation of two RAREs, DE-RARE and ENE-RARE, in the BAC completely abolished the rostral expansion of the 5׳ Hoxb genes. Knock-out of endogenous DE-RARE lead to significantly reduced expression of multiple Hoxb genes and attenuated Hox gene response to exogenous RA treatment in utero. Regulatory potential of DE-RARE was further demonstrated by its ability to anteriorize 5׳ Hoxa gene expression in the neural tube when inserted into a HoxA BAC reporter. Our data demonstrate that multiple RAREs cooperate to remotely regulate 5׳ Hoxb genes during CNS development, providing a new insight into the mechanisms for gene regulation within the Hox clusters. PMID:24525295

  3. DNase I hypersensitivity sites and nuclear protein binding on the fatty acid synthase gene: identification of an element with properties similar to known glucose-responsive elements.

    PubMed Central

    Foufelle, F; Lepetit, N; Bosc, D; Delzenne, N; Morin, J; Raymondjean, M; Ferré, P


    We have shown previously that fatty acid synthase (FAS) gene expression is positively regulated by glucose in rat adipose tissue and liver. In the present study, we have identified in the first intron of the gene a sequence closely related to known glucose-responsive elements such as in the L-pyruvate kinase and S14 genes, including a putative upstream stimulatory factor/major late transcription factor (USF/MLTF) binding site (E-box) (+ 292 nt to + 297 nt). Location of this sequence corresponds to a site of hypersensitivity to DNase I which is present in the liver but not in the spleen. Moreover, using this information from a preliminary report of the present work, others have shown that a + 283 nt to + 303 nt sequence of the FAS gene can confer glucose responsiveness to a heterologous promoter. The protein binding to this region has been investigated in vitro by a combination of DNase I footprinting and gel-retardation experiments with synthetic oligonucleotides and known nuclear proteins. DNase I footprinting experiments using a + 161 nt to + 405 nt fragment of the FAS gene demonstrate that a region from + 290 nt to + 316 nt is protected by nuclear extracts from liver and spleen. This region binds two ubiquitous nuclear factors, USF/MLTF and the CAAT-binding transcription factor/nuclear factor 1 (CTF/NF1). Binding of these factors is similar in nuclear extracts from liver which does or does not express the FAS gene as observed for glucose-responsive elements in the L-pyruvate kinase and S14 genes. This suggests a posttranslational modification of a factor of the complex after glucose stimulation. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:7772036

  4. Regulatory elements necessary for termination of transcription within the immunoglobulin heavy chain gene locus

    SciTech Connect

    Moore, B.B.


    Previous experimentation demonstrated that regulation of the IgM only phenotype in both pre-B and immature B cells was primarily at the transcriptional level. Expression of IgD mRNA involves transcription of the entire 29 kilobase rearranged [mu]-[delta] locus. Mature B cells transcribe the [beta] exons at approximately half the level that they transcribe the [delta] gene. Early B cells however, transcribe the [mu] gene with approximately 90% more efficiency than they do the [delta] gene. Specifically, early B cells show a transcription termination event occurring within a 1 kilobase region of the [mu]-[delta] intron. This dissertation analyzes the sequence elements necessary to encode the transcription termination event within the [mu]-[delta] intron. This work shows that the termination motif consists of specific sequences within the [mu]m poly(A) site as well as a region of the [mu]-[delta] intron contained within a 1200 base pair fragment. The 1200 base pair fragment extends from the Pst I site within the intron and ends just prior to the C[delta]1 exon. This fragment contains a 162 base pair unique sequence inverted repeat (USIR). Furthermore, the [mu]m site is specifically required because the [mu]s site was unable to substitute, despite extensive usage. In addition, the USIR-containing intron functions in an orientation-dependent manner. Analysis of this termination motif in a variety of lymphoid and non-lymphoid cells suggests that this motif is an intrinsic polymerase II termination motif. This implies that transcription termination in early B cells is by a default model and that active regulation of this motif involves an anti-termination event in mature B cells.

  5. Scanning of Transposable Elements and Analyzing Expression of Transposase Genes of Sweet Potato [Ipomoea batatas

    PubMed Central

    Tao, Xiang; Lai, Xian-Jun; Zhang, Yi-Zheng; Tan, Xue-Mei; Wang, Haiyan


    Background Transposable elements (TEs) are the most abundant genomic components in eukaryotes and affect the genome by their replications and movements to generate genetic plasticity. Sweet potato performs asexual reproduction generally and the TEs may be an important genetic factor for genome reorganization. Complete identification of TEs is essential for the study of genome evolution. However, the TEs of sweet potato are still poorly understood because of its complex hexaploid genome and difficulty in genome sequencing. The recent availability of the sweet potato transcriptome databases provides an opportunity for discovering and characterizing the expressed TEs. Methodology/Principal Findings We first established the integrated-transcriptome database by de novo assembling four published sweet potato transcriptome databases from three cultivars in China. Using sequence-similarity search and analysis, a total of 1,405 TEs including 883 retrotransposons and 522 DNA transposons were predicted and categorized. Depending on mapping sets of RNA-Seq raw short reads to the predicted TEs, we compared the quantities, classifications and expression activities of TEs inter- and intra-cultivars. Moreover, the differential expressions of TEs in seven tissues of Xushu 18 cultivar were analyzed by using Illumina digital gene expression (DGE) tag profiling. It was found that 417 TEs were expressed in one or more tissues and 107 in all seven tissues. Furthermore, the copy number of 11 transposase genes was determined to be 1–3 copies in the genome of sweet potato by Real-time PCR-based absolute quantification. Conclusions/Significance Our result provides a new method for TE searching on species with transcriptome sequences while lacking genome information. The searching, identification and expression analysis of TEs will provide useful TE information in sweet potato, which are valuable for the further studies of TE-mediated gene mutation and optimization in asexual reproduction

  6. Hypoxia-induced endothelial NO synthase gene transcriptional activation is mediated through the tax-responsive element in endothelial cells.


    Min, Jiho; Jin, Yoon-Mi; Moon, Je-Sung; Sung, Min-Sun; Jo, Sangmee Ahn; Jo, Inho


    Although hypoxia is known to induce upregulation of endothelial NO synthase (eNOS) gene expression, the underlying mechanism is largely unclear. In this study, we show that hypoxia increases eNOS gene expression through the binding of phosphorylated cAMP-responsive element binding (CREB) protein (pCREB) to the eNOS gene promoter. Hypoxia (1% O2) increased both eNOS expression and NO production, peaking at 24 hours, in bovine aortic endothelial cells, and these increases were accompanied by increases in pCREB. Treatment with the protein kinase A inhibitor H-89 or transfection with dominant-negative inhibitor of CREB reversed the hypoxia-induced increases in eNOS expression and NO production, with concomitant inhibition of the phosphorylation of CREB induced by hypoxia, suggesting an involvement of protein kinase A/pCREB-mediated pathway. To map the regulatory elements of the eNOS gene responsible for pCREB binding under hypoxia, we constructed an eNOS gene promoter (-1600 to +22 nucleotides) fused with a luciferase reporter gene [pGL2-eNOS(-1600)]. Hypoxia (for 24-hour incubation) increased the promoter activity by 2.36+/-0.18-fold in the bovine aortic endothelial cells transfected with pGL2-eNOS(-1600). However, progressive 5'-deletion from -1600 to -873 completely attenuated the hypoxia-induced increase in promoter activity. Electrophoretic mobility shift, anti-pCREB antibody supershift, and site-specific mutation analyses showed that pCREB is bound to the Tax-responsive element (TRE) site, a cAMP-responsive element-like site, located at -924 to -921 of the eNOS promoter. Our data demonstrate that the interaction between pCREB and the Tax-responsive element site within the eNOS promoter may represent a novel mechanism for the mediation of hypoxia-stimulated eNOS gene expression. PMID:16651461

  7. Sequence elements in the human osteocalcin gene confer basal activation and inducible response to hormonal vitamin D sub 3

    SciTech Connect

    Kerner, S.A.; Scott, R.A.; Pike, J.W. )


    Osteoblast-specific expression of the bone protein osteocalcin is controlled at the transcriptional level by the steroid hormone 1{alpha},25-dihydroxyvitamin D{sub 3}. As this protein may represent a marker for bone activity in human disease, the authors examined the regulation of its expression at the molecular level by evaluating human osteocalcin gene promoter function. They describe regions within the promoter that contribute to basal expression of the gene in osteoblast-like cells in culture. Further, they define a 21-base-pair DNA element with the sequence 5{prime}-GTGACTCACCGGGTGAACGGG-3{prime}, which acts in cis to mediate 1{alpha},25-dihydroxyvitamin D{sub 3} inducibility of the osteocalcin gene. This response element bears sequence similarity with other short DNA segments, particularly those for estrogen and thyroid hormone, which act together with their respective trans-acting receptors to modulate gene transcription.

  8. Biochemical and genetic characterization of the dominant positive element driving transcription ofthe yeast TBP-encoding gene, SPT15.


    Schroeder, S C; Weil, P A


    We previously demonstrated that a combination of both positive and negative cis -acting upstream elements control the transcription of the gene encoding TBP ( SPT15 ) in Saccharomyces cerevisiae . One of these elements found in that study, resident between 5' flanking sequences -147 and -128 , and termed PED (for positive element distal), was found to play an essential positive role in driving transcription of the gene encoding TBP. In this report, we map at nucleotide-level resolution, the critical residues which comprise PED, purify and sequence the protein that binds to it and determine that this PED binding factor is Abf1p, an abundant yeast protein previously broadly implicated in both gene regulation and DNA replication. In the case of the TBP-encoding gene, however, Abf1p works through the PED element which is a non-consensus binding site. Based upon the work of others, the PED-variant ABF1 site would be predicted to be a very poor binding site for this factor yet Abf1p binds PED and a consensus ABF1 site with comparable affinity. These results are discussed in light of the broader context of Abf1p-mediated gene regulation. PMID:9722639

  9. Epstein-Barr virus transcription factor Zta acts through distal regulatory elements to directly control cellular gene expression.


    Ramasubramanyan, Sharada; Osborn, Kay; Al-Mohammad, Rajaei; Naranjo Perez-Fernandez, Ijiel B; Zuo, Jianmin; Balan, Nicolae; Godfrey, Anja; Patel, Harshil; Peters, Gordon; Rowe, Martin; Jenner, Richard G; Sinclair, Alison J


    Lytic replication of the human gamma herpes virus Epstein-Barr virus (EBV) is an essential prerequisite for the spread of the virus. Differential regulation of a limited number of cellular genes has been reported in B-cells during the viral lytic replication cycle. We asked whether a viral bZIP transcription factor, Zta (BZLF1, ZEBRA, EB1), drives some of these changes. Using genome-wide chromatin immunoprecipitation coupled to next-generation DNA sequencing (ChIP-seq) we established a map of Zta interactions across the human genome. Using sensitive transcriptome analyses we identified 2263 cellular genes whose expression is significantly changed during the EBV lytic replication cycle. Zta binds 278 of the regulated genes and the distribution of binding sites shows that Zta binds mostly to sites that are distal to transcription start sites. This differs from the prevailing view that Zta activates viral genes by binding exclusively at promoter elements. We show that a synthetic Zta binding element confers Zta regulation at a distance and that distal Zta binding sites from cellular genes can confer Zta-mediated regulation on a heterologous promoter. This leads us to propose that Zta directly reprograms the expression of cellular genes through distal elements. PMID:25779048

  10. Regulation of expression of the stress response gene, Osp94: identification of the tonicity response element and intracellular signalling pathways.

    PubMed Central

    Kojima, Ryoji; Randall, Jeffrey D; Ito, Eri; Manshio, Hiroyuki; Suzuki, Yoshio; Gullans, Steven R


    Osp94 (osmotic stress protein of 94 kDa) is known to be up-regulated by hypertonic and heat-shock stresses in mouse renal inner medullary collecting duct (mIMCD3) cells. To investigate the molecular mechanism of transcriptional regulation of the Osp94 gene under these stresses, we cloned and characterized the 5'-flanking region of the gene. Sequence analysis of the proximal 4 kb 5'-flanking region revealed a TATA-less G/C-rich promoter region containing a cluster of Sp1 sites. We also identified upstream sequence motifs similar to the consensus TonE/ORE (tonicity-response element/osmotic response element) as well as the consensus HSE (heat-shock element). Luciferase activities in cells transfected with reporter constructs containing a TonE/ORE-like element (Osp94-TonE; 5'-TGGAAAGGACCAG-3') and HSE enhanced reporter gene expression under hypertonic stress and heat-shock stress respectively. Electrophoretic gel mobility-shift assay showed a slowly migrating band binding to the Osp94-TonE probe, probably representing binding of TonEBP (TonE binding protein) to this enhancer element. Furthermore, treatment of mIMCD3 cells with MAPK (mitogen-activated protein kinase) inhibitors (SB203580, PD98059, U0126 and SP600125) and a proteasome inhibitor (MG132) suppressed the increase in Osp94 gene expression caused by hypertonic NaCl. These results indicate that the 5'-flanking region of Osp94 gene contains a hypertonicity sensitive cis -acting element, Osp94-TonE, which is distinct from a functional HSE. Furthermore, the MAPK and proteasome systems appear to be, at least in part, involved in hypertonic-stressmediated regulation of Osp94 through Osp94-TonE. PMID:15018608

  11. Ubiquitous and neuronal DNA-binding proteins interact with a negative regulatory element of the human hypoxanthine phosphoribosyltransferase gene.

    PubMed Central

    Rincón-Limas, D E; Amaya-Manzanares, F; Niño-Rosales, M L; Yu, Y; Yang, T P; Patel, P I


    The hypoxanthine phosphoribosyltransferase (HPRT) gene is constitutively expressed at low levels in all tissues but at higher levels in the brain; the significance and mechanism of this differential expression are unknown. We previously identified a 182-bp element (hHPRT-NE) within the 5'-flanking region of the human HPRT (hHPRT) gene, which is involved not only in conferring neuronal specificity but also in repressing gene expression in nonneuronal tissues. Here we report that this element interacts with different nuclear proteins, some of which are present specifically in neuronal cells (complex I) and others of which are present in cells showing constitutive expression of the gene (complex II). In addition, we found that complex I factors are expressed in human NT2/D1 cells following induction of neuronal differentiation by retinoic acid. This finding correlates with an increase of HPRT gene transcription following neuronal differentiation. We also mapped the binding sites for both complexes to a 60-bp region (Ff; positions -510 to -451) which, when analyzed in transfection assays, functioned as a repressor element analogous to the full-length hHPRT-NE sequence. Methylation interference footprintings revealed a minimal unique DNA motif, 5'-GGAAGCC-3', as the binding site for nuclear proteins from both neuronal and nonneuronal sources. However, site-directed mutagenesis of the footprinted region indicated that different nucleotides are essential for the associations of these two complexes. Moreover, UV cross-linking experiments showed that both complexes are formed by the association of several different proteins. Taken together, these data suggest that differential interaction of DNA-binding factors with this regulatory element plays a crucial role in the brain-preferential expression of the gene, and they should lead to the isolation of transcriptional regulators important in neuronal expression of the HPRT gene. PMID:8524221

  12. Analysis of Response Elements Involved in the Regulation of the Human Neonatal Fc Receptor Gene (FCGRT)

    PubMed Central

    Mikulska, Joanna E.


    Human epithelial, endothelial and PMA-differentiated THP-1 cell lines were used as model systems to study the transcriptional regulation of the human FCGRT gene encoding the alpha chain of hFcRn. The data obtained from site-directed mutagenesis in transient transfection experiments indicate that the Sp1 sites at positions -641, -635, and -313, CF1/YY1 elements at positions -586 and -357, and the AP-1 motif at -276 within the-660/-233 fragment of the human FCGRT promoter (hFCGRT) participate in the regulation of human FCGRT in all selected cell lines. However, their individual contribution to promoter activity is not equivalent. The Sp1 binding site at -313 and the AP-1 site at -276 are critical for the activity of the hFCGRT promoter in epithelial and endothelial cells. Moreover, the CF1/YY1 site at -586 in differentiated THP-1 cells, plays an essential role in the transcriptional activity of the promoter. In addition, the C/EBPbeta binding site at -497 of the hFCGRT promoter in epithelial and endothelial cells, and the C/EBPbeta motif located at -497 and -233 within the hFCGRT promoter in differentiated THP-1 cells may function as positive regulatory sequences in response to LPS or PMA stimulation. EMSA and supershift analyses showed that the functionally identified binding motifs in the hFCGRT promoter were able to specifically interact with their corresponding (Sp1, Sp2, Sp3, c-Fos, c-Jun, YY1, and C/EBPbeta or C/EBPdelta) transcription factors (TFs), suggesting their possible involvement in the regulation of the human FCGRT gene expression. PMID:26252948

  13. Gene invasion in distant eukaryotic lineages: discovery of mutually exclusive genetic elements reveals marine biodiversity.


    Monier, Adam; Sudek, Sebastian; Fast, Naomi M; Worden, Alexandra Z


    Inteins are rare, translated genetic parasites mainly found in bacteria and archaea, while spliceosomal introns are distinctly eukaryotic features abundant in most nuclear genomes. Using targeted metagenomics, we discovered an intein in an Atlantic population of the photosynthetic eukaryote, Bathycoccus, harbored by the essential spliceosomal protein PRP8 (processing factor 8 protein). Although previously thought exclusive to fungi, we also identified PRP8 inteins in parasitic (Capsaspora) and predatory (Salpingoeca) protists. Most new PRP8 inteins were at novel insertion sites that, surprisingly, were not in the most conserved regions of the gene. Evolutionarily, Dikarya fungal inteins at PRP8 insertion site a appeared more related to the Bathycoccus intein at a unique insertion site, than to other fungal and opisthokont inteins. Strikingly, independent analyses of Pacific and Atlantic samples revealed an intron at the same codon as the Bathycoccus PRP8 intein. The two elements are mutually exclusive and neither was found in cultured Bathycoccus or other picoprasinophyte genomes. Thus, wild Bathycoccus contain one of few non-fungal eukaryotic inteins known and a rare polymorphic intron. Our data indicate at least two Bathycoccus ecotypes exist, associated respectively with oceanic or mesotrophic environments. We hypothesize that intein propagation is facilitated by marine viruses; and, while intron gain is still poorly understood, presence of a spliceosomal intron where a locus lacks an intein raises the possibility of new, intein-primed mechanisms for intron gain. The discovery of nucleus-encoded inteins and associated sequence polymorphisms in uncultivated marine eukaryotes highlights their diversity and reveals potential sexual boundaries between populations indistinguishable by common marker genes. PMID:23635865

  14. Gene invasion in distant eukaryotic lineages: discovery of mutually exclusive genetic elements reveals marine biodiversity

    PubMed Central

    Monier, Adam; Sudek, Sebastian; Fast, Naomi M; Worden, Alexandra Z


    Inteins are rare, translated genetic parasites mainly found in bacteria and archaea, while spliceosomal introns are distinctly eukaryotic features abundant in most nuclear genomes. Using targeted metagenomics, we discovered an intein in an Atlantic population of the photosynthetic eukaryote, Bathycoccus, harbored by the essential spliceosomal protein PRP8 (processing factor 8 protein). Although previously thought exclusive to fungi, we also identified PRP8 inteins in parasitic (Capsaspora) and predatory (Salpingoeca) protists. Most new PRP8 inteins were at novel insertion sites that, surprisingly, were not in the most conserved regions of the gene. Evolutionarily, Dikarya fungal inteins at PRP8 insertion site a appeared more related to the Bathycoccus intein at a unique insertion site, than to other fungal and opisthokont inteins. Strikingly, independent analyses of Pacific and Atlantic samples revealed an intron at the same codon as the Bathycoccus PRP8 intein. The two elements are mutually exclusive and neither was found in cultured Bathycoccus or other picoprasinophyte genomes. Thus, wild Bathycoccus contain one of few non-fungal eukaryotic inteins known and a rare polymorphic intron. Our data indicate at least two Bathycoccus ecotypes exist, associated respectively with oceanic or mesotrophic environments. We hypothesize that intein propagation is facilitated by marine viruses; and, while intron gain is still poorly understood, presence of a spliceosomal intron where a locus lacks an intein raises the possibility of new, intein-primed mechanisms for intron gain. The discovery of nucleus-encoded inteins and associated sequence polymorphisms in uncultivated marine eukaryotes highlights their diversity and reveals potential sexual boundaries between populations indistinguishable by common marker genes. PMID:23635865

  15. Binding of TFIIIC to SINE Elements Controls the Relocation of Activity-Dependent Neuronal Genes to Transcription Factories

    PubMed Central

    Crepaldi, Luca; Policarpi, Cristina; Coatti, Alessandro; Sherlock, William T.; Jongbloets, Bart C.; Down, Thomas A.; Riccio, Antonella


    In neurons, the timely and accurate expression of genes in response to synaptic activity relies on the interplay between epigenetic modifications of histones, recruitment of regulatory proteins to chromatin and changes to nuclear structure. To identify genes and regulatory elements responsive to synaptic activation in vivo, we performed a genome-wide ChIPseq analysis of acetylated histone H3 using somatosensory cortex of mice exposed to novel enriched environmental (NEE) conditions. We discovered that Short Interspersed Elements (SINEs) located distal to promoters of activity-dependent genes became acetylated following exposure to NEE and were bound by the general transcription factor TFIIIC. Importantly, under depolarizing conditions, inducible genes relocated to transcription factories (TFs), and this event was controlled by TFIIIC. Silencing of the TFIIIC subunit Gtf3c5 in non-stimulated neurons induced uncontrolled relocation to TFs and transcription of activity-dependent genes. Remarkably, in cortical neurons, silencing of Gtf3c5 mimicked the effects of chronic depolarization, inducing a dramatic increase of both dendritic length and branching. These findings reveal a novel and essential regulatory function of both SINEs and TFIIIC in mediating gene relocation and transcription. They also suggest that TFIIIC may regulate the rearrangement of nuclear architecture, allowing the coordinated expression of activity-dependent neuronal genes. PMID:23966877

  16. Importance of Mobile Genetic Elements and Conjugal Gene Transfer for Subsurface Microbial Community Adaptation to Biotransformation of Metals

    SciTech Connect

    Sorensen, Soren J.


    The overall goal of this project is to investigate the effect of mobile genetic elements and conjugal gene transfer on subsurface microbial community adaptation to mercury and chromium stress and biotransformation. Our studies focus on the interaction between the fate of these metals in the subsurface and the microbial community structure and activity.

  17. Transformation mapping of the regulatory elements of the ecdysone-inducible P1 gene of Drosophila melanogaster

    SciTech Connect

    Maschat, F.; Dubertret, M.L.; Lepesant, J.A. )


    The transcription of the P1 gene is induced by 20-hydroxyecdysone in fat bodies of third-instar larvae. Germ line transformation showed that sequences between {minus}138 to +276 contain elements required for a qualitatively correct developmental and hormonal regulation of P1 transcription. Sequences from {minus}138 to {minus}68 are essential for this expression.

  18. The transcription factor c-Myc enhances KIR gene transcription through direct binding to an upstream distal promoter element

    PubMed Central

    Cichocki, Frank; Hanson, Rebecca J.; Lenvik, Todd; Pitt, Michelle; McCullar, Valarie; Li, Hongchuan; Anderson, Stephen K.


    The killer cell immunoglobulin-like receptor (KIR) repertoire of natural killer (NK) cells determines their ability to detect infected or transformed target cells. Although epigenetic mechanisms play a role in KIR gene expression, work in the mouse suggests that other regulatory elements may be involved at specific stages of NK-cell development. Here we report the effects of the transcription factor c-Myc on KIR expression. c-Myc directly binds to, and promotes transcription from, a distal element identified upstream of most KIR genes. Binding of endogenous c-Myc to the distal promoter element is significantly enhanced upon interleukin-15 (IL-15) stimulation in peripheral blood NK cells and correlates with an increase in KIR transcription. In addition, the overexpression of c-Myc during NK-cell development promotes transcription from the distal promoter element and contributes to the overall transcription of multiple KIR genes. Our data demonstrate the significance of the 5′ promoter element upstream of the conventional KIR promoter region and support a model whereby IL-15 stimulates c-Myc binding at the distal KIR promoter during NK-cell development to promote KIR transcription. This finding provides a direct link between NK-cell activation signals and KIR expression required for acquisition of effector function during NK-cell education. PMID:18987359

  19. Enhancer and promoter elements directing activation and glucocorticoid repression of the. cap alpha. /sub 1/-fetoprotein gene in hepatocytes

    SciTech Connect

    Guertin, M.; La Rue, H.; Bernier, D.; Wrange, O.; Chevrette, M.; Gingras, M.C.; Belanger, L.


    Mutations were introduced in 7 kilobases of 5'-flanking rat ..cap alpha../sub 1/-fetoprotein (AFP) genomic DNA, linked to the chloramphenicol acetyltransferase gene. AFP promoter activity and its repression by a glucocorticoid hormone were assessed by stable and transient expression assays. Stable transfection assays were more sensitive and accurate than transient expression assays in a Morris 7777 rat hepatoma recipient (Hepa7.6), selected for its strong AFP repression by dexamethasone. The segment of DNA encompassing a hepatocyte-constitutive chromatin DNase I-hypersensitive site at -3.7 kilobases and a liver developmental stage-specific site at -2.5 kilobases contains interacting enhancer elements sufficient for high AFP promoter activity in Hepa7.6 or HepG2 cells. Deletions and point mutations define an upstream promoter domain of AFP gene activation, operating with at least three distinct promoter-activating elements, PEI at -65 base pairs, PEII at -120 base pairs, and DE at -160 base pairs. PEI and PEII share homologies with albumin promoter sequences, PEII is a near-consensus nuclear factor I recognition sequence, and DE overlaps a glucocorticoid receptor recognition sequence. An element conferring glucocorticoid repression of AFP gene activity is located in the upstream AFP promoter domain. Receptor-binding assays indicate that this element is the glucocorticoid receptor recognition sequence which overlaps with promoter-activating element DE.

  20. Comparative genomics reveals a functional thyroid-specific element in the far upstream region of the PAX8 gene

    PubMed Central


    Background The molecular mechanisms leading to a fully differentiated thyrocite are still object of intense study even if it is well known that thyroglobulin, thyroperoxidase, NIS and TSHr are the marker genes of thyroid differentiation. It is also well known that Pax8, TTF-1, Foxe1 and Hhex are the thyroid-enriched transcription factors responsible for the expression of the above genes, thus are responsible for the differentiated thyroid phenotype. In particular, the role of Pax8 in the fully developed thyroid gland was studied in depth and it was established that it plays a key role in thyroid development and differentiation. However, to date the bases for the thyroid-enriched expression of this transcription factor have not been unraveled yet. Here, we report the identification and characterization of a functional thyroid-specific enhancer element located far upstream of the Pax8 gene. Results We hypothesized that regulatory cis-acting elements are conserved among mammalian genes. Comparison of a genomic region extending for about 100 kb at the 5'-flanking region of the mouse and human Pax8 gene revealed several conserved regions that were tested for enhancer activity in thyroid and non-thyroid cells. Using this approach we identified one putative thyroid-specific regulatory element located 84.6 kb upstream of the Pax8 transcription start site. The in silico data were verified by promoter-reporter assays in thyroid and non-thyroid cells. Interestingly, the identified far upstream element manifested a very high transcriptional activity in the thyroid cell line PC Cl3, but showed no activity in HeLa cells. In addition, the data here reported indicate that the thyroid-enriched transcription factor TTF-1 is able to bind in vitro and in vivo the Pax8 far upstream element, and is capable to activate transcription from it. Conclusions Results of this study reveal the presence of a thyroid-specific regulatory element in the 5' upstream region of the Pax8 gene. The

  1. P-Element Insertion Alleles of Essential Genes on the Third Chromosome of Drosophila Melanogaster: Mutations Affecting Embryonic Pns Development

    PubMed Central

    Salzberg, A.; Prokopenko, S. N.; He, Y.; Tsai, P.; Pal, M.; Maroy, P.; Glover, D. M.; Deak, P.; Bellen, H. J.


    To identify novel genes and to isolate tagged mutations in known genes that are required for the development of the peripheral nervous system (PNS), we have screened a novel collection of 2460 strains carrying lethal or semilethal P-element insertions on the third chromosome. Monoclonal antibody 22C10 was used as a marker to visualize the embryonic PNS. We identified 109 mutant strains that exhibited reproducible phenotypes in the PNS. Cytological and genetic analyses of these strains indicated that 87 mutations affect previously identified genes: tramtrack (n = 18 alleles), string (n = 15), cyclin A (n = 13), single-minded (n = 13), Delta (n = 9), neuralized (n = 4), pointed (n = 4), extra macrochaetae (n = 4), prospero (n = 3), tartan (n = 2), and pebble (n = 2). In addition, 13 mutations affect genes that we identified recently in a chemical mutagenesis screen designed to isolate similar mutants: hearty (n = 3), dorsotonals (n = 2), pavarotti (n = 2), sanpodo (n = 2), dalmatian (n = 1), missensed (n = 1), senseless (n = 1), and sticky ch1 (n = 1). The remaining nine mutations define seven novel complementation groups. The data presented here demonstrate that this collection of P elements will be useful for the identification and cloning of novel genes on the third chromosome, since >70% of mutations identified in the screen are caused by the insertion of a P element. A comparison between this screen and a chemical mutagenesis screen undertaken earlier highlights the complementarity of the two types of genetic screens. PMID:9409832

  2. Identification of a functional antioxidant responsive element in the promoter of the Chinese hamster carbonyl reductase 3 (Chcr3) gene.


    Miura, Takeshi; Taketomi, Ayako; Nakabayashi, Toshikatsu; Nishinaka, Toru; Terada, Tomoyuki


    CHCR3, a member of the short-chain dehydrogenase/reductase superfamily, is a carbonyl reductase 3 enzyme in Chinese hamsters. Carbonyl reductase 3 in humans has been believed to involve the metabolism and/or pharmacokinetics of anthracycline drugs, and the mechanism underlying the gene regulation has been investigated. In this study, the nucleotide sequence of the Chcr3 promoter was originally determined, and its promoter activity was characterised. The proximal promoter region is TATA-less and GC-rich, similar to the promoter region of human carbonyl reductase 3. Cobalt stimulated the transcriptional activity of the Chcr3 gene. The results of a luciferase gene reporter assay demonstrated that cobalt-induced stimulation required an antioxidant responsive element. Forced expression of Nrf2, the transcription factor that binds to antioxidant responsive elements, enhanced the transcriptional activity of the Chcr3 gene. These results suggest that cobalt induces the expression of the Chcr3 gene via the Nrf2-antioxidant responsive element pathway. PMID:25677373

  3. Combining Hi-C data with phylogenetic correlation to predict the target genes of distal regulatory elements in human genome

    PubMed Central

    Lu, Yulan; Zhou, Yuanpeng; Tian, Weidong


    Defining the target genes of distal regulatory elements (DREs), such as enhancer, repressors and insulators, is a challenging task. The recently developed Hi-C technology is designed to capture chromosome conformation structure by high-throughput sequencing, and can be potentially used to determine the target genes of DREs. However, Hi-C data are noisy, making it difficult to directly use Hi-C data to identify DRE–target gene relationships. In this study, we show that DREs–gene pairs that are confirmed by Hi-C data are strongly phylogenetic correlated, and have thus developed a method that combines Hi-C read counts with phylogenetic correlation to predict long-range DRE–target gene relationships. Analysis of predicted DRE–target gene pairs shows that genes regulated by large number of DREs tend to have essential functions, and genes regulated by the same DREs tend to be functionally related and co-expressed. In addition, we show with a couple of examples that the predicted target genes of DREs can help explain the causal roles of disease-associated single-nucleotide polymorphisms located in the DREs. As such, these predictions will be of importance not only for our understanding of the function of DREs but also for elucidating the causal roles of disease-associated noncoding single-nucleotide polymorphisms. PMID:24003029

  4. Molecular analysis of UAS(E), a cis element containing stress response elements responsible for ethanol induction of the KlADH4 gene of Kluyveromyces lactis.


    Mazzoni, C; Santori, F; Saliola, M; Falcone, C


    KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p. PMID:10724480

  5. Myc versus USF: discrimination at the cad gene is determined by core promoter elements.

    PubMed Central

    Boyd, K E; Farnham, P J


    Carbamoyl-phosphate synthase/aspartate carbamoyltransferase/dihydroorotase, which is encoded by the cad gene, is required for the first three rate-limiting steps of de novo pyrimidine biosynthesis. It has been previously demonstrated that cad transcription increases at the G1/S-phase boundary, as quiescent cells reenter the proliferative cell cycle. The growth-responsive element has been mapped to an E box at +65 in the hamster cad promoter. Using an in vivo UV cross-linking and immunoprecipitation assay, we show that Myc, Max, and upstream stimulatory factor (USF) bind to the chromosomal cad promoter. To determine whether binding of Myc-Max or USF is critical for cad growth regulation, we analyzed promoter constructs which contain mutations in the nucleotides flanking the E box. We demonstrate that altering nucleotides which flank the cad E box to sequences which decrease Myc-Max binding in vitro correlates with a loss of cad G1/S-phase transcriptional activation. This result supports the conclusion that binding of Myc-Max, but not USF, is essential for cad regulation. Our investigations demonstrate that the endogenous cad E box can be bound by more than one transcription factor, but growth-induced cad expression is achieved only by Myc. PMID:9111322

  6. Uptake and effect of rare earth elements on gene expression in Methylosinus trichosporium OB3b.


    Gu, Wenyu; Farhan Ul Haque, Muhammad; DiSpirito, Alan A; Semrau, Jeremy D


    It is well known that Methylosinus trichosporium OB3b has two forms of methane monooxygenase (MMO) responsible for the initial conversion of methane to methanol, a cytoplasmic (soluble) methane monooxygenase and a membrane-associated (particulate) methane monooxygenase, and that copper strongly regulates expression of these alternative forms of MMO. More recently, it has been discovered that M. trichosporium OB3b has multiple types of the methanol dehydrogenase (MeDH), i.e. the Mxa-type MeDH (Mxa-MeDH) and Xox-type MeDH (Xox-MeDH), and the expression of these two forms is regulated by the availability of the rare earth element (REE), cerium. Here, we extend these studies and show that lanthanum, praseodymium, neodymium and samarium also regulate expression of alternative forms of MeDH. The effect of these REEs on MeDH expression, however, was only observed in the absence of copper. Further, a mutant of M. trichosporium OB3b, where the Mxa-MeDH was knocked out, was able to grow in the presence of lanthanum, praseodymium and neodymium, but was not able to grow in the presence of samarium. Collectively, these data suggest that multiple levels of gene regulation by metals exist in M. trichosporium OB3b, but that copper overrides the effect of other metals by an as yet unknown mechanism. PMID:27190151

  7. Transcription of gypsy elements in a Y-chromosome male fertility gene of Drosophila hydei

    SciTech Connect

    Hochstenbach, R.; Harhangi, H.; Hennig, W.


    We have found that defective gypsy retrotransposons are a major constituent of the lampbrush loop pair Nooses in the short arm of Y chromosome of Drosophila hydei. The loop pair is formed by male fertility gene Q during the primary spermatocyte stage of spermatogenesis, each loop being a single transcription unit with an estimated length of 260 kb. Using fluorescent in situ hybridization, we show that throughout the loop transcripts gypsy elements are interspersed with blocks of a tandemly repetitive Y-specific DNA sequence, ayl. Nooses transcripts containing both sequence types show a wide size range on Northern blots, do not migrate to the cytoplasm, and are degraded just before the first meiotic division. Only one strand of ayl and only the coding strand of gypsy can be detected in the loop transcripts. However, as cloned genomic DNA fragments also display opposite orientations of ayl and gypsy, such DNA sections cannot be part of the Nooses. Hence, they are most likely derived from the flanking heterochromatin. The direction of transcription of ayl and gypsy thus appears to be of a functional significance. 76 refs., 5 figs.

  8. Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

    SciTech Connect

    Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi


    Highlights: {yields} The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. {yields} The core promoter was located in the 5F-1. {yields} Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. {yields} These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

  9. [Mobile ISCR elements: structure, functions, and role in the emergence, increasing and spreading of blocks of bacterial genes of multiple antibiotic resistance].


    Il'ina, T S


    The recently discovered method of horizontal distribution of bacterial genes with atypical ISCR sequences is reviewed using an example of drug resistance genes. The adjacent DNA segment mobilization is provided by the transposition of such elements, including rolling circle replication, formation of autonomous nonreplicable circular structures, and homological recombination. The gene distribution capacity with the ISCR elements is more significant than the capacity of transposons and integrons, thereby providing formation of groups of mobile genes, including antibiotic-resistance genes of pathogenic bacteria. The structure and functions of the ISCR elements were discussed together with their similarity and dissimilarity with the group of IS91-similar elements and their role in the emergence of blocks of bacterial genes encoding of multiple antibiotic resistance and their contribution to evolution of bacterial and plasmid genes. PMID:23248846

  10. Transcriptional regulation of PRPF31 gene expression by MSR1 repeat elements causes incomplete penetrance in retinitis pigmentosa

    PubMed Central

    Rose, Anna M.; Shah, Amna Z.; Venturini, Giulia; Krishna, Abhay; Chakravarti, Aravinda; Rivolta, Carlo; Bhattacharya, Shomi S.


    PRPF31-associated retinitis pigmentosa presents a fascinating enigma: some mutation carriers are blind, while others are asymptomatic. We identify the major molecular cause of this incomplete penetrance through three cardinal features: (1) there is population variation in the number (3 or 4) of a minisatellite repeat element (MSR1) adjacent to the PRPF31 core promoter; (2) in vitro, 3-copies of the MSR1 element can repress gene transcription by 50 to 115-fold; (3) the higher-expressing 4-copy allele is not observed among symptomatic PRPF31 mutation carriers and correlates with the rate of asymptomatic carriers in different populations. Thus, a linked transcriptional modifier decreases PRPF31 gene expression that leads to haploinsufficiency. This result, taken with other identified risk alleles, allows precise genetic counseling for the first time. We also demonstrate that across the human genome, the presence of MSR1 repeats in the promoters or first introns of genes is associated with greater population variability in gene expression indicating that copy number variation of MSR1s is a generic controller of gene expression and promises to provide new insights into our understanding of gene expression regulation. PMID:26781568

  11. Transcriptional regulation of PRPF31 gene expression by MSR1 repeat elements causes incomplete penetrance in retinitis pigmentosa.


    Rose, Anna M; Shah, Amna Z; Venturini, Giulia; Krishna, Abhay; Chakravarti, Aravinda; Rivolta, Carlo; Bhattacharya, Shomi S


    PRPF31-associated retinitis pigmentosa presents a fascinating enigma: some mutation carriers are blind, while others are asymptomatic. We identify the major molecular cause of this incomplete penetrance through three cardinal features: (1) there is population variation in the number (3 or 4) of a minisatellite repeat element (MSR1) adjacent to the PRPF31 core promoter; (2) in vitro, 3-copies of the MSR1 element can repress gene transcription by 50 to 115-fold; (3) the higher-expressing 4-copy allele is not observed among symptomatic PRPF31 mutation carriers and correlates with the rate of asymptomatic carriers in different populations. Thus, a linked transcriptional modifier decreases PRPF31 gene expression that leads to haploinsufficiency. This result, taken with other identified risk alleles, allows precise genetic counseling for the first time. We also demonstrate that across the human genome, the presence of MSR1 repeats in the promoters or first introns of genes is associated with greater population variability in gene expression indicating that copy number variation of MSR1s is a generic controller of gene expression and promises to provide new insights into our understanding of gene expression regulation. PMID:26781568

  12. Aquaculture changes the profile of antibiotic resistance and mobile genetic element associated genes in Baltic Sea sediments.


    Muziasari, Windi I; Pärnänen, Katariina; Johnson, Timothy A; Lyra, Christina; Karkman, Antti; Stedtfeld, Robert D; Tamminen, Manu; Tiedje, James M; Virta, Marko


    Antibiotics are commonly used in aquaculture and they can change the environmental resistome by increasing antibiotic resistance genes (ARGs). Sediment samples were collected from two fish farms located in the Northern Baltic Sea, Finland, and from a site outside the farms (control). The sediment resistome was assessed by using a highly parallel qPCR array containing 295 primer sets to detect ARGs, mobile genetic elements and the 16S rRNA gene. The fish farm resistomes were enriched in transposon and integron associated genes and in ARGs encoding resistance to antibiotics which had been used to treat fish at the farms. Aminoglycoside resistance genes were also enriched in the farm sediments despite the farms not having used aminoglycosides. In contrast, the total relative abundance values of ARGs were higher in the control sediment resistome and they were mainly genes encoding efflux pumps followed by beta-lactam resistance genes, which are found intrinsically in many bacteria. This suggests that there is a natural Baltic sediment resistome. The resistome associated with fish farms can be from native ARGs enriched by antibiotic use at the farms and/or from ARGs and mobile elements that have been introduced by fish farming. PMID:26976842

  13. Mutation of a transcriptional motif of a distant regulatory element reduces the expression of embryonic and fetal globin genes

    PubMed Central

    Navas, Patrick A.; Swank, Richard A.; Yu, Man; Peterson, Kenneth R.; Stamatoyannopoulos, George


    High-level β-globin gene expression is dependent on the presence of the locus control region (LCR), a powerful regulatory element physically characterized by five DNase I-hypersensitive sites (HS), designated HS1–HS5. Of these, HS3 contains seven GT motifs that are essential for its activity. One of the motifs, GT6, has been shown by in vivo footprinting to display the largest difference in signal between fetal and adult globin expressing cells. We assessed the contribution of GT6 on the downstream globin gene expression by mutating this motif in a 248 kb β-globin locus yeast artificial chromosome and measuring the activity of β-globin genes in GT6m β-YAC transgenic mice. Seven transgenic lines were established, three of which contained at least one intact copy of the β-globin locus and were further investigated. The mutation of the GT6 motif reduced the expression of ε- and γ-globin genes during embryonic erythropoiesis. During definitive erythropoiesis, γ-globin gene expression was significantly reduced while β-globin gene expression was virtually indistinguishable from wild-type controls. We conclude that the GT6 motif of hypersensitive site 3 of the LCR is required for normal ε- and γ-globin gene expression during embryonic erythropoiesis and for γ-globin gene expression during definitive erythropoiesis in the fetal liver. Our results provide evidence that mutations of single transcriptional motifs of distant regulatory elements can have profound effects on gene expression. PMID:14506128

  14. Abscisic acid-induced gene expression in the liverwort Marchantia polymorpha is mediated by evolutionarily conserved promoter elements.


    Ghosh, Totan K; Kaneko, Midori; Akter, Khaleda; Murai, Shuhei; Komatsu, Kenji; Ishizaki, Kimitsune; Yamato, Katsuyuki T; Kohchi, Takayuki; Takezawa, Daisuke


    Abscisic acid (ABA) is a phytohormone widely distributed among members of the land plant lineage (Embryophyta), regulating dormancy, stomata closure and tolerance to environmental stresses. In angiosperms (Magnoliophyta), ABA-induced gene expression is mediated by promoter elements such as the G-box-like ACGT-core motifs recognized by bZIP transcription factors. In contrast, the mode of regulation by ABA of gene expression in liverworts (Marchantiophyta), representing one of the earliest diverging land plant groups, has not been elucidated. In this study, we used promoters of the liverwort Marchantia polymorpha dehydrin and the wheat Em genes fused to the β-glucuronidase (GUS) reporter gene to investigate ABA-induced gene expression in liverworts. Transient assays of cultured cells of Marchantia indicated that ACGT-core motifs proximal to the transcription initiation site play a role in the ABA-induced gene expression. The RY sequence recognized by B3 transcriptional regulators was also shown to be responsible for the ABA-induced gene expression. In transgenic Marchantia plants, ABA treatment elicited an increase in GUS expression in young gemmalings, which was abolished by simultaneous disruption of the ACGT-core and RY elements. ABA-induced GUS expression was less obvious in mature thalli than in young gemmalings, associated with reductions in sensitivity to exogenous ABA during gametophyte growth. In contrast, lunularic acid, which had been suggested to function as an ABA-like substance, had no effect on GUS expression. The results demonstrate the presence of ABA-specific response mechanisms mediated by conserved cis-regulatory elements in liverworts, implying that the mechanisms had been acquired in the common ancestors of embryophytes. PMID:26456006

  15. Functional characterization of neural-restrictive silencer element in mouse pituitary adenylate cyclase-activating polypeptide (PACAP) gene expression.


    Sugawara, Hideki; Tominaga, Aiko; Inoue, Kazuhiko; Takeda, Yasuo; Yamada, Katsushi; Miyata, Atsuro


    Pituitary adenylate cyclase-activating polypeptide (PACAP) is predominantly localized in the nervous system, but the underlying mechanism in its neuron-specific expression remains unclear. In addition to two neural-restrictive silencer-like element (NRSLE1 and 2), as reported previously, we have identified the third element in -1,601 to -1,581 bp from the translational initiation site of mouse PACAP gene and termed it as NRSLE3, of which, the sequence and location were highly conserved among mouse, rat, and human PACAP genes. In luciferase reporter assay, the deletion or site-directed mutagenesis of NRSLE3 in the reporter gene construct, driven by heterologous SV40 promoter, cancelled the repression of luciferase activity in non-neuronal Swiss-3T3 cells. Furthermore, its promoter activity was significantly repressed in Swiss-3T3 cells, but not in neuronal-differentiated PC12 cells. The electrophoretic mobility shift assay (EMSA) with nuclear extracts of Swiss-3T3 cells demonstrated a specific complex with NRSLE3 probe that exhibited the same migration with the neural-restrictive silencer element (NRSE) probe of rat type II sodium channel gene. During neuronal differentiation of PC12 cells, the increment of PACAP mRNA exhibited the correlation with that of REST4 mRNA, which is a neuron-specific variant form of neural-restrictive silencer factor (NRSF). In undifferentiated PC12 cells, trichostatin A (TSA), a histone deacetylase (HDAC) inhibitor, which indirectly inhibits NRSF-mediated gene silencing, increased PACAP mRNA level and attenuated the repression of promoter activity of 5' flanking region of mouse PACAP gene containing NRSLEs. These suggest that the NRSE-NRSF system implicates in the regulatory mechanism of neuron-specific expression of PACAP gene. PMID:24939248

  16. Lead Exposure during Early Human Development and DNA Methylation of Imprinted Gene Regulatory Elements in Adulthood

    PubMed Central

    Li, Yue; Xie, Changchun; Murphy, Susan K.; Skaar, David; Nye, Monica; Vidal, Adriana C.; Cecil, Kim M.; Dietrich, Kim N.; Puga, Alvaro; Jirtle, Randy L.; Hoyo, Cathrine


    30 to 78 months. Conclusions: Our findings provide evidence that early childhood lead exposure results in sex-dependent and gene-specific DNA methylation differences in the DMRs of PEG3, IGF2/H19, and PLAGL1/HYMAI in adulthood. Citation: Li Y, Xie C, Murphy SK, Skaar D, Nye M, Vidal AC, Cecil KM, Dietrich KN, Puga A, Jirtle RL, Hoyo C. 2016. Lead exposure during early human development and DNA methylation of imprinted gene regulatory elements in adulthood. Environ Health Perspect 124:666–673; PMID:26115033

  17. CACTA-superfamily transposable element is inserted in MYB transcription factor gene of soybean line producing variegated seeds.


    Yan, Fan; Di, Shaokang; Takahashi, Ryoji


    The R gene of soybean, presumably encoding a MYB transcription factor, controls seed coat color. The gene consists of multiple alleles, R (black), r-m (black spots and (or) concentric streaks on brown seed), and r (brown seed). This study was conducted to determine the structure of the MYB transcription factor gene in a near-isogenic line (NIL) having r-m allele. PCR amplification of a fragment of the candidate gene Glyma.09G235100 generated a fragment of about 1 kb in the soybean cultivar Clark, whereas a fragment of about 14 kb in addition to fragments of 1 and 1.4 kb were produced in L72-2040, a Clark 63 NIL with the r-m allele. Clark 63 is a NIL of Clark with the rxp and Rps1 alleles. A DNA fragment of 13 060 bp was inserted in the intron of Glyma.09G235100 in L72-2040. The fragment had the CACTA motif at both ends, imperfect terminal inverted repeats (TIR), inverse repetition of short sequence motifs close to the 5' and 3' ends, and a duplication of three nucleotides at the site of integration, indicating that it belongs to a CACTA-superfamily transposable element. We designated the element as Tgm11. Overall nucleotide sequence, motifs of TIR, and subterminal repeats were similar to those of Tgm1 and Tgs1, suggesting that these elements comprise a family. PMID:26360633

  18. Elements of lentiviral vector design toward gene therapy for treating mucopolysaccharidosis I.


    Ou, Li; Przybilla, Michael J; Koniar, Brenda L; Whitley, Chester B


    Mucopolysaccharidosis type I (MPS I) is a lysosomal disease caused by α-l-iduronidase (IDUA) deficiency and accumulation of glycosaminoglycans (GAG). Lentiviral vector encoding correct IDUA cDNA could be used for treating MPS I. To optimize the lentiviral vector design, 9 constructs were designed by combinations of various promoters, enhancers, and codon optimization. After in vitro transfection into 293FT cells, 5 constructs achieved the highest IDUA activities (5613 to 7358 nmol/h/mg protein). These 5 candidate vectors were then tested by injection (1 × 10(7) TU/g) into neonatal MPS I mice. After 30 days, one vector, CCEoIDW, achieved the highest IDUA levels: 2.6% of wildtype levels in the brain, 9.9% in the heart, 200% in the liver and 257% in the spleen. CCEoIDW achieved the most significant GAG reduction: down 49% in the brain, 98% in the heart, 100% in the liver and 95% in the spleen. Further, CCEoIDW had the lowest transgene frequency, especially in the gonads (0.03 ± 0.01 copies/100 cells), reducing the risk of insertional mutagenesis and germ-line transmission. Therefore, CCEoIDW is selected as the optimal lentiviral vector for treating MPS I disease and will be applied in large animal preclinical studies. Further, taken both in vitro and in vivo comparisons together, codon optimization, use of EF-1α promoter and woodchuck hepatitis virus posttranscriptional response element (WPRE) could enhance transgene expression. These results provided a better understanding of factors contributing efficient transgene expression in lentiviral gene therapies. PMID:27556013

  19. Regulatory elements of the EKLF gene that direct erythroid cell-specific expression during mammalian development.


    Xue, Li; Chen, Xiaoyong; Chang, Yanjie; Bieker, James J


    Erythroid Krüppel-like factor (EKLF) plays an essential role in enabling beta-globin expression during erythroid ontogeny. It is first expressed in the extraembryonic mesoderm of the yolk sac within the morphologically unique cells that give rise to the blood islands, and then later within the hepatic primordia. The BMP4/Smad pathway plays a critical role in the induction of EKLF, and transient transfection analyses demonstrate that sequences located within less than 1 kb of its transcription initiation site are sufficient for high-level erythroid-specific transcription. We have used transgenic analyses to verify that 950 bp located adjacent to the EKLF start site of transcription is sufficient to generate lacZ expression within the blood islands as well as the fetal liver during embryonic development. Of particular importance are 3 regions, 2 of which overlap endogenous erythroid-specific DNase hypersensitive sites, and 1 of which includes the proximal promoter region. The onset of transgene expression mimics that of endogenous EKLF as it begins by day 7.5 (d7.5) to d8.0. In addition, it exhibits a strict hematopoietic specificity, localized only to these cells and not to the adjacent vasculature at all stages examined. Finally, expression is heterocellular, implying that although these elements are sufficient for tissue-specific expression, they do not shield against the position effects of adjacent chromatin. These analyses demonstrate that a surprisingly small DNA segment contains all the information needed to target a linked gene to the hematopoietic compartment at both early and later stages of development, and may be a useful cassette for this purpose. PMID:14764531

  20. Aleurone nuclear proteins bind to similar elements in the promoter regions of two gibberellin-regulated alpha-amylase genes.


    Rushton, P J; Hooley, R; Lazarus, C M


    Binding of nuclear proteins from wild oat aleurone protoplasts to the promoter regions of two gibberellin-regulated wheat alpha-amylase genes (alpha-Amy1/18 and alpha-Amy2/54) has been studied by gel retardation and DNase 1 footprinting. Gel retardation studies using 300-430 bp fragments of the promoters showed similar binding characteristics with nuclear extracts from both gibberellin A1-treated and untreated protoplasts. DNase 1 footprints localised binding of nuclear proteins from gibberellin A1-treated aleurone protoplasts to regions in both promoters. Similar sequence elements in the promoter regions of both genes were protected from digestion although the location and number of footprints in each promoter region were different. Each footprint contained either a sequence similar to the cAMP and/or phorbol ester response elements, or a hyphenated palindrome sequence. The presence of cAMP and/or phorbol ester response element-like sequences in the footprints suggests that transcription factors of the bZIP type may be involved in the expression of alpha-amylase genes in aleurone cells. Footprints containing hyphenated palindrome sequences, found in the promoter regions of both genes, suggest the possible involvement of other classes of transcription factor. The conserved alpha-amylase promoter sequence TAA-CAGA was also shown to bind nuclear protein in the alpha-Amy2/54 promoter. These observations are discussed in relation to alpha-amylase gene expression in aleurone and to functional data concerning these genes. PMID:1511135

  1. Lactogenic hormonal induction of long distance interactions between beta-casein gene regulatory elements

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lactogenic hormone regulation of beta-casein gene expression in mammary epithelial cells provides, an excellent model in which to study the mechanisms by which steroid and peptide hormone signaling control gene expression. Prolactin- and glucocorticoid-mediated induction of beta-casein gene express...

  2. ZmbZIP91 regulates expression of starch synthesis-related genes by binding to ACTCAT elements in their promoters.


    Chen, Jiang; Yi, Qiang; Cao, Yao; Wei, Bin; Zheng, Lanjie; Xiao, Qianling; Xie, Ying; Gu, Yong; Li, Yangping; Huang, Huanhuan; Wang, Yongbin; Hou, Xianbin; Long, Tiandan; Zhang, Junjie; Liu, Hanmei; Liu, Yinghong; Yu, Guowu; Huang, Yubi


    Starch synthesis is a key process that influences crop yield and quality, though little is known about the regulation of this complex metabolic pathway. Here, we present the identification of ZmbZIP91 as a candidate regulator of starch synthesis via co-expression analysis in maize (Zea mays L.). ZmbZIP91 was strongly associated with the expression of starch synthesis genes. Reverse tanscription-PCR (RT-PCR) and RNA in situ hybridization indicated that ZmbZIP91 is highly expressed in maize endosperm, with less expression in leaves. Particle bombardment-mediated transient expression in maize endosperm and leaf protoplasts demonstrated that ZmbZIP91 could positively regulate the expression of starch synthesis genes in both leaves and endosperm. Additionally, the Arabidopsis mutant vip1 carried a mutation in a gene (VIP1) that is homologous to ZmbZIP91, displayed altered growth with less starch in leaves, and ZmbZIP91 was able to complement this phenotype, resulting in normal starch synthesis. A yeast one-hybrid experiment and EMSAs showed that ZmbZIP91 could directly bind to ACTCAT elements in the promoters of starch synthesis genes (pAGPS1, pSSI, pSSIIIa, and pISA1). These results demonstrate that ZmbZIP91 acts as a core regulatory factor in starch synthesis by binding to ACTCAT elements in the promoters of starch synthesis genes. PMID:26689855

  3. Regulatory elements in the first intron contribute to transcriptional control of the human. cap alpha. 1(I) collagen gene

    SciTech Connect

    Bornstein, P.; McKay, J.; Morishima, J.K.; Devarayalu, S.; Gelinas, R.E.


    Several lines of evidence have suggested that the regulation of type I collagen gene transcription is complex and that important regulatory elements reside 5' to, and within, the first intron of the ..cap alpha..1(I) gene. The authors therefore sequenced a 2.3-kilobase HindIII fragment that encompasses 804 base pairs of 5' flanking sequence, the first exon, and most of the first intron of the ..cap alpha..1(I) human collagen gene. A 274-base-pair intronic sequence, flanked by Ava I sites (A274), contained a sequence identical to a high-affinity decanucleotide binding site for transcription factor Sp1 and a viral core enhancer sequence. DNase I protection experiments indicated zones of protection that corresponded to these motifs. When A274 was cloned 5' to the chloramphenicol acetyltransferase (CAT) gene, driven by an ..cap alpha..1(I) collagen promoter sequence, and expression was assessed by transfection, significant orientation-specific inhibition of CAT activity was observed. This effect was most apparent in chicken tendon fibroblasts, which modulate their level of collagen synthesis in culture. They propose that normal regulation of ..cap alpha..1(I) collagen gene transcription results from an interplay of positive and negative elements present in the promoter region and within the first intron.

  4. Expressed repeat elements improve RT-qPCR normalization across a wide range of zebrafish gene expression studies.


    Vanhauwaert, Suzanne; Van Peer, Gert; Rihani, Ali; Janssens, Els; Rondou, Pieter; Lefever, Steve; De Paepe, Anne; Coucke, Paul J; Speleman, Frank; Vandesompele, Jo; Willaert, Andy


    The selection and validation of stably expressed reference genes is a critical issue for proper RT-qPCR data normalization. In zebrafish expression studies, many commonly used reference genes are not generally applicable given their variability in expression levels under a variety of experimental conditions. Inappropriate use of these reference genes may lead to false interpretation of expression data and unreliable conclusions. In this study, we evaluated a novel normalization method in zebrafish using expressed repetitive elements (ERE) as reference targets, instead of specific protein coding mRNA targets. We assessed and compared the expression stability of a number of EREs to that of commonly used zebrafish reference genes in a diverse set of experimental conditions including a developmental time series, a set of different organs from adult fish and different treatments of zebrafish embryos including morpholino injections and administration of chemicals. Using geNorm and rank aggregation analysis we demonstrated that EREs have a higher overall expression stability compared to the commonly used reference genes. Moreover, we propose a limited set of ERE reference targets (hatn10, dna15ta1 and loopern4), that show stable expression throughout the wide range of experiments in this study, as strong candidates for inclusion as reference targets for qPCR normalization in future zebrafish expression studies. Our applied strategy to find and evaluate candidate expressed repeat elements for RT-qPCR data normalization has high potential to be used also for other species. PMID:25310091

  5. Expressed Repeat Elements Improve RT-qPCR Normalization across a Wide Range of Zebrafish Gene Expression Studies

    PubMed Central

    Vanhauwaert, Suzanne; Van Peer, Gert; Rihani, Ali; Janssens, Els; Rondou, Pieter; Lefever, Steve; De Paepe, Anne; Coucke, Paul J.; Speleman, Frank; Vandesompele, Jo; Willaert, Andy


    The selection and validation of stably expressed reference genes is a critical issue for proper RT-qPCR data normalization. In zebrafish expression studies, many commonly used reference genes are not generally applicable given their variability in expression levels under a variety of experimental conditions. Inappropriate use of these reference genes may lead to false interpretation of expression data and unreliable conclusions. In this study, we evaluated a novel normalization method in zebrafish using expressed repetitive elements (ERE) as reference targets, instead of specific protein coding mRNA targets. We assessed and compared the expression stability of a number of EREs to that of commonly used zebrafish reference genes in a diverse set of experimental conditions including a developmental time series, a set of different organs from adult fish and different treatments of zebrafish embryos including morpholino injections and administration of chemicals. Using geNorm and rank aggregation analysis we demonstrated that EREs have a higher overall expression stability compared to the commonly used reference genes. Moreover, we propose a limited set of ERE reference targets (hatn10, dna15ta1 and loopern4), that show stable expression throughout the wide range of experiments in this study, as strong candidates for inclusion as reference targets for qPCR normalization in future zebrafish expression studies. Our applied strategy to find and evaluate candidate expressed repeat elements for RT-qPCR data normalization has high potential to be used also for other species. PMID:25310091

  6. Analysis of the chromatin domain organisation around the plastocyanin gene reveals an MAR-specific sequence element in Arabidopsis thaliana.

    PubMed Central

    van Drunen, C M; Oosterling, R W; Keultjes, G M; Weisbeek, P J; van Driel, R; Smeekens, S C


    The Arabidopsis thaliana genome is currently being sequenced, eventually leading towards the unravelling of all potential genes. We wanted to gain more insight into the way this genome might be organized at the ultrastructural level. To this extent we identified matrix attachment regions demarking potential chromatin domains, in a 16 kb region around the plastocyanin gene. The region was cloned and sequenced revealing six genes in addition to the plastocyanin gene. Using an heterologous in vitro nuclear matrix binding assay, to search for evolutionary conserved matrix attachment regions (MARs), we identified three such MARs. These three MARs divide the region into two small chromatin domains of 5 kb, each containing two genes. Comparison of the sequence of the three MARs revealed a degenerated 21 bp sequence that is shared between these MARs and that is not found elsewhere in the region. A similar sequence element is also present in four other MARs of Arabidopsis.Therefore, this sequence may constitute a landmark for the position of MARs in the genome of this plant. In a genomic sequence database of Arabidopsis the 21 bp element is found approximately once every 10 kb. The compactness of the Arabidopsis genome could account for the high incidence of MARs and MRSs we observed. PMID:9380515

  7. Cis-Regulatory Elements Determine Germline Specificity and Expression Level of an Isopentenyltransferase Gene in Sperm Cells of Arabidopsis.


    Zhang, Jinghua; Yuan, Tong; Duan, Xiaomeng; Wei, Xiaoping; Shi, Tao; Li, Jia; Russell, Scott D; Gou, Xiaoping


    Flowering plant sperm cells transcribe a divergent and complex complement of genes. To examine promoter function, we chose an isopentenyltransferase gene known as PzIPT1. This gene is highly selectively transcribed in one sperm cell morphotype of Plumbago zeylanica, which preferentially fuses with the central cell during fertilization and is thus a founding cell of the primary endosperm. In transgenic Arabidopsis (Arabidopsis thaliana), PzIPT1 promoter displays activity in both sperm cells and upon progressive promoter truncation from the 5'-end results in a progressive decrease in reporter production, consistent with occurrence of multiple enhancer sites. Cytokinin-dependent protein binding motifs are identified in the promoter sequence, which respond with stimulation by cytokinin. Expression of PzIPT1 promoter in sperm cells confers specificity independently of previously reported Germline Restrictive Silencer Factor binding sequence. Instead, a cis-acting regulatory region consisting of two duplicated 6-bp Male Gamete Selective Activation (MGSA) motifs occurs near the site of transcription initiation. Disruption of this sequence-specific site inactivates expression of a GFP reporter gene in sperm cells. Multiple copies of the MGSA motif fused with the minimal CaMV35S promoter elements confer reporter gene expression in sperm cells. Similar duplicated MGSA motifs are also identified from promoter sequences of sperm cell-expressed genes in Arabidopsis, suggesting selective activation is possibly a common mechanism for regulation of gene expression in sperm cells of flowering plants. PMID:26739233

  8. Mitochondrial Cyclic AMP Response Element-binding Protein (CREB) Mediates Mitochondrial Gene Expression and Neuronal Survival*S

    PubMed Central

    Lee, Junghee; Kim, Chun-Hyung; Simon, David K.; Aminova, Lyaylya R.; Andreyev, Alexander Y.; Kushnareva, Yulia E.; Murphy, Anne N.; Lonze, Bonnie E.; Kim, Kwang-Soo; Ginty, David D.; Ferrante, Robert J.; Ryu, Hoon; Ratan, Rajiv R.


    Cyclic AMP response element-binding protein (CREB) is a widely expressed transcription factor whose role in neuronal protection is now well established. Here we report that CREB is present in the mitochondrial matrix of neurons and that it binds directly to cyclic AMP response elements (CREs) found within the mitochondrial genome. Disruption of CREB activity in the mitochondria decreases the expression of a subset of mitochondrial genes, including the ND5 subunit of complex I, down-regulates complex I-dependent mitochondrial respiration, and increases susceptibility to 3-nitropropionic acid, a mitochondrial toxin that induces a clinical and pathological phenotype similar to Huntington disease. These results demonstrate that regulation of mitochondrial gene expression by mitochondrial CREB, in part, underlies the protective effects of CREB and raise the possibility that decreased mitochondrial CREB activity contributes to the mitochondrial dysfunction and neuronal loss associated with neurodegenerative disorders. PMID:16207717

  9. Influence of a cap site element on tissue-restricted expression of the glycoprotein hormone alpha-subunit gene.


    Cox, G S; Xiong, W


    Little is known of the transcriptional regulators important for expression of the glycoprotein hormone alpha-subunit (GPHalpha) gene in nonendocrine tumors, which secrete free alpha-subunit at an incidence of 25-80%. Consequently, attempts were made to define cis-regulatory elements and their cognate trans-acting factors that modulate promoter activity in epithelial cell types that do not normally express the glycoprotein hormones. DNA-mediated transient expression of promoter-reporter constructs was used to identify a novel negative regulatory element located at the GPHalpha gene transcription start site. Mutagenesis of this element produced a 2- to 10-fold increase in promoter activity, depending on the particular mutation and the transfected tumor cell line. Electrophoretic mobility shift analysis detected a protein that binds specifically to a DNA motif encompassing the cap site. It was present at different levels in a variety of cell types. Significantly, the degree to which activity of the wild-type promoter was suppressed relative to that of the mutant promoter was proportional to the level of cap site binding protein in the collection of cell lines examined. These results indicate that a negative regulatory element centered at the GPHalpha gene cap site and its cognate DNA-binding protein make a significant contribution to the production of alpha-subunit in a variety of tumor tissues. A detailed understanding of this cis/trans pair may further suggest a mechanism to explain, at least in part, how this gene becomes activated in nonendocrine tumors. PMID:10403838

  10. Genome-wide analysis of the effects of location and number of stress response elements on gene expression in Saccharomyces cerevisiae.


    Yoshikawa, Katsunori; Furusawa, Chikara; Hirasawa, Takashi; Shimizu, Hiroshi


    We analyzed the effects of the location and number of stress response elements (STREs) on gene expression in Saccharomyces cerevisiae. Genes containing STRE between 51 and 300 bp upstream from translational start codon tended to be up-regulated and genes with multiple STREs exhibited higher up-regulation under stress conditions. PMID:19111649

  11. Oxidative Stress Regulates CFTR Gene Expression in Human Airway Epithelial Cells through a Distal Antioxidant Response Element

    PubMed Central

    Zhang, Zhaolin; Leir, Shih-Hsing


    Cystic fibrosis transmembrane conductance regulator gene (CFTR) expression in human airway epithelial cells involves the recruitment of distal cis-regulatory elements, which are associated with airway-selective DNase hypersensitive sites at −44 kb and −35 kb from the gene. The −35-kb site encompasses an enhancer that is regulated by the immune mediators interferon regulatory factor 1 and 2 and by nuclear factor Y. Here we investigate the −44-kb element, which also has enhancer activity in vitro in airway epithelial cells but is inactive in intestinal epithelial cells. This site contains an antioxidant response element (ARE) that plays a critical role in its function in airway cell lines and primary human bronchial epithelial cells. The natural antioxidant sulforaphane (SFN) induces nuclear translocation of nuclear factor, erythroid 2-like 2 (Nrf2), a transcription factor that regulates genes with AREs in their promoters, many of which are involved in response to injury. Under normal conditions, the −44-kb ARE is occupied by the repressor BTB and CNC homology 1, basic leucine zipper transcription factor (Bach1), and v-Maf avian musculoaponeurotic fibrosarcoma oncogene homolog K (MafK) heterodimers. After 2 hours of SFN treatment, Nrf2 displaces these repressive factors and activates CFTR expression. Site-directed mutagenesis shows that both the ARE and an adjacent NF-κB binding site are required for activation of the –44-kb element in airway epithelial cells. Moreover, this element is functionally linked to the −35-kb enhancer in modulating CFTR expression in response to environmental stresses in the airway. PMID:25259561

  12. Horizontal Gene Acquisitions, Mobile Element Proliferation, and Genome Decay in the Host-Restricted Plant Pathogen Erwinia Tracheiphila.


    Shapiro, Lori R; Scully, Erin D; Straub, Timothy J; Park, Jihye; Stephenson, Andrew G; Beattie, Gwyn A; Gleason, Mark L; Kolter, Roberto; Coelho, Miguel C; De Moraes, Consuelo M; Mescher, Mark C; Zhaxybayeva, Olga


    Modern industrial agriculture depends on high-density cultivation of genetically similar crop plants, creating favorable conditions for the emergence of novel pathogens with increased fitness in managed compared with ecologically intact settings. Here, we present the genome sequence of six strains of the cucurbit bacterial wilt pathogen Erwinia tracheiphila (Enterobacteriaceae) isolated from infected squash plants in New York, Pennsylvania, Kentucky, and Michigan. These genomes exhibit a high proportion of recent horizontal gene acquisitions, invasion and remarkable amplification of mobile genetic elements, and pseudogenization of approximately 20% of the coding sequences. These genome attributes indicate that E. tracheiphila recently emerged as a host-restricted pathogen. Furthermore, chromosomal rearrangements associated with phage and transposable element proliferation contribute to substantial differences in gene content and genetic architecture between the six E. tracheiphila strains and other Erwinia species. Together, these data lead us to hypothesize that E. tracheiphila has undergone recent evolution through both genome decay (pseudogenization) and genome expansion (horizontal gene transfer and mobile element amplification). Despite evidence of dramatic genomic changes, the six strains are genetically monomorphic, suggesting a recent population bottleneck and emergence into E. tracheiphila's current ecological niche. PMID:26992913

  13. Horizontal Gene Acquisitions, Mobile Element Proliferation, and Genome Decay in the Host-Restricted Plant Pathogen Erwinia Tracheiphila

    PubMed Central

    Shapiro, Lori R.; Scully, Erin D.; Straub, Timothy J.; Park, Jihye; Stephenson, Andrew G.; Beattie, Gwyn A.; Gleason, Mark L.; Kolter, Roberto; Coelho, Miguel C.; De Moraes, Consuelo M.; Mescher, Mark C.; Zhaxybayeva, Olga


    Modern industrial agriculture depends on high-density cultivation of genetically similar crop plants, creating favorable conditions for the emergence of novel pathogens with increased fitness in managed compared with ecologically intact settings. Here, we present the genome sequence of six strains of the cucurbit bacterial wilt pathogen Erwinia tracheiphila (Enterobacteriaceae) isolated from infected squash plants in New York, Pennsylvania, Kentucky, and Michigan. These genomes exhibit a high proportion of recent horizontal gene acquisitions, invasion and remarkable amplification of mobile genetic elements, and pseudogenization of approximately 20% of the coding sequences. These genome attributes indicate that E. tracheiphila recently emerged as a host-restricted pathogen. Furthermore, chromosomal rearrangements associated with phage and transposable element proliferation contribute to substantial differences in gene content and genetic architecture between the six E. tracheiphila strains and other Erwinia species. Together, these data lead us to hypothesize that E. tracheiphila has undergone recent evolution through both genome decay (pseudogenization) and genome expansion (horizontal gene transfer and mobile element amplification). Despite evidence of dramatic genomic changes, the six strains are genetically monomorphic, suggesting a recent population bottleneck and emergence into E. tracheiphila’s current ecological niche. PMID:26992913

  14. Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.


    Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén


    To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. PMID:22389214

  15. A novel positive regulatory element for exfoliative toxin A gene expression in Staphylococcus aureus.


    Sakurai, Susumu; Suzuki, Hitoshi; Hata, Toshiaki; Yoshizawa, Yukio; Nakayama, Ritsuko; Machida, Katsuhiko; Masuda, Shogo; Tsukiyama, Takashi


    A 1.4 kb positive regulatory element (ETA(exp)) that controls staphylococcal exfoliative toxin A (sETA) transcription was cloned from Staphylococcus aureus. ETA(exp) is located upstream of the cloned 5.8 kb eta gene (etaJ1) obtained from the chomosomal DNA of S. aureus ZM, the standard ETA-producing strain. The cETA prepared from an Escherichia coli transformant into which the recombinant plasmid petaJ1 (5.8 kb eta/pUC9) had been introduced was expressed at high levels in the culture supernatant and the ammonium-sulfate-precipitated culture supernatant fraction as shown by immunoblotting and the single radial immunodiffusion test. However, cETA produced by the recombinant plasmid petaJ3 containing the 1.7 kb eta sequence (etaJ3) with a 1.45 kb ETA(exp)-deficient eta fragment (1.7 kb eta/pUC9) obtained from the 5.8 kb eta sequence by subcloning was not detected in either the culture supernatant or the ammonium-sulfate-precipitated culture supernatant fraction (167-fold concentrate of the culture supernatant) by immunoblotting or the single radial immunodiffusion test. A large amount of cETA was produced by the 1.7 kb eta sequence when it was linked to ETA(exp) amplified by PCR (1.7 kb eta-ETA(exp)/pUC9), regardless of the orientation of ETA(exp) insertion. Northern blot hybridization showed lower levels of the transcripts of the 1.7 kb eta sequence than of the 5.8 kb eta sequence. The rsETA prepared from an S. aureus transformant into which the recombinant plasmid 3.4 kb eta-ETA(exp)/pYT3 (pYT3-etaJ6) had been introduced was expressed at high levels in the culture supernatant fraction as shown by the latex agglutination test. However, the agglutination titre in the culture supernatant fraction of rsETA produced by the recombinant plasmid (1.7 kb eta/pYT3) containing the 1.7 kb eta sequence carrying the 1.4 kb ETA(exp)-deficient eta fragment (pYT3-etaJ3) was 2500-4000 times lower than that of pYT3-etaJ6. PMID:15073304

  16. Gene Network Rewiring to Study Melanoma Stage Progression and Elements Essential for Driving Melanoma

    PubMed Central

    Kaushik, Abhinav; Bhatia, Yashuma; Ali, Shakir; Gupta, Dinesh


    Metastatic melanoma patients have a poor prognosis, mainly attributable to the underlying heterogeneity in melanoma driver genes and altered gene expression profiles. These characteristics of melanoma also make the development of drugs and identification of novel drug targets for metastatic melanoma a daunting task. Systems biology offers an alternative approach to re-explore the genes or gene sets that display dysregulated behaviour without being differentially expressed. In this study, we have performed systems biology studies to enhance our knowledge about the conserved property of disease genes or gene sets among mutually exclusive datasets representing melanoma progression. We meta-analysed 642 microarray samples to generate melanoma reconstructed networks representing four different stages of melanoma progression to extract genes with altered molecular circuitry wiring as compared to a normal cellular state. Intriguingly, a majority of the melanoma network-rewired genes are not differentially expressed and the disease genes involved in melanoma progression consistently modulate its activity by rewiring network connections. We found that the shortlisted disease genes in the study show strong and abnormal network connectivity, which enhances with the disease progression. Moreover, the deviated network properties of the disease gene sets allow ranking/prioritization of different enriched, dysregulated and conserved pathway terms in metastatic melanoma, in agreement with previous findings. Our analysis also reveals presence of distinct network hubs in different stages of metastasizing tumor for the same set of pathways in the statistically conserved gene sets. The study results are also presented as a freely available database at The web-based database resource consists of results from the analysis presented here, integrated with cytoscape web and user-friendly tools for visualization, retrieval and further analysis. PMID

  17. Transposable element dynamics and PIWI regulation impacts lncRNA and gene expression diversity in Drosophila ovarian cell cultures

    PubMed Central

    Sytnikova, Yuliya A.; Rahman, Reazur; Chirn, Gung-wei; Clark, Josef P.


    Piwi proteins and Piwi-interacting RNAs (piRNAs) repress transposable elements (TEs) from mobilizing in gonadal cells. To determine the spectrum of piRNA-regulated targets that may extend beyond TEs, we conducted a genome-wide survey for transcripts associated with PIWI and for transcripts affected by PIWI knockdown in Drosophila ovarian somatic sheet (OSS) cells, a follicle cell line expressing the Piwi pathway. Despite the immense sequence diversity among OSS cell piRNAs, our analysis indicates that TE transcripts are the major transcripts associated with and directly regulated by PIWI. However, several coding genes were indirectly regulated by PIWI via an adjacent de novo TE insertion that generated a nascent TE transcript. Interestingly, we noticed that PIWI-regulated genes in OSS cells greatly differed from genes affected in a related follicle cell culture, ovarian somatic cells (OSCs). Therefore, we characterized the distinct genomic TE insertions across four OSS and OSC lines and discovered dynamic TE landscapes in gonadal cultures that were defined by a subset of active TEs. Particular de novo TEs appeared to stimulate the expression of novel candidate long noncoding RNAs (lncRNAs) in a cell lineage-specific manner, and some of these TE-associated lncRNAs were associated with PIWI and overlapped PIWI-regulated genes. Our analyses of OSCs and OSS cells demonstrate that despite having a Piwi pathway to suppress endogenous mobile elements, gonadal cell TE landscapes can still dramatically change and create transcriptome diversity. PMID:25267525

  18. Germline cell death is inhibited by P-element insertions disrupting the dcp-1/pita nested gene pair in Drosophila.

    PubMed Central

    Laundrie, Bonni; Peterson, Jeanne S; Baum, Jason S; Chang, Jeffrey C; Fileppo, Dana; Thompson, Sharona R; McCall, Kimberly


    Germline cell death in Drosophila oogenesis is controlled by distinct signals. The death of nurse cells in late oogenesis is developmentally regulated, whereas the death of egg chambers during mid-oogenesis is induced by environmental stress or developmental abnormalities. P-element insertions in the caspase gene dcp-1 disrupt both dcp-1 and the outlying gene, pita, leading to lethality and defective nurse cell death in late oogenesis. By isolating single mutations in the two genes, we have found that the loss of both genes contributes to this ovary phenotype. Mutants of pita, which encodes a C2H2 zinc-finger protein, are homozygous lethal and show dumpless egg chambers and premature nurse cell death in germline clones. Early nurse cell death is not observed in the dcp-1/pita double mutants, suggesting that dcp-1+ activity is required for the mid-oogenesis cell death seen in pita mutants. dcp-1 mutants are viable and nurse cell death in late oogenesis occurs normally. However, starvation-induced germline cell death during mid-oogenesis is blocked, leading to a reduction and inappropriate nuclear localization of the active caspase Drice. These findings suggest that the combinatorial loss of pita and dcp-1 leads to the increased survival of abnormal egg chambers in mutants bearing the P-element alleles and that dcp-1 is essential for cell death during mid-oogenesis. PMID:14704173

  19. Regulatory elements in the introns of the human HPRT gene are necessary for its expression in embryonic stem cells.

    PubMed Central

    Reid, L H; Gregg, R G; Smithies, O; Koller, B H


    We have examined the expression of transfected human hypoxanthine phosphoribosyltransferase minigenes (HPRT) in mouse embryonic stem (ES) cells. cDNA constructs of this gene that have been successfully used in somatic cell lines failed to confer hypoxanthine/aminopterin/thymidine (HAT) resistance in ES cells. In contrast, constructs containing introns 1 and 2 from the HPRT gene produced a high frequency of HAT-resistant colonies. This observation allowed us to identify two sequences in these introns that influence expression of the HPRT gene in ES cells. One element, located in intron 2, is required for effective HPRT expression in these cells; the other element, located in intron 1, acts as an enhancer of HPRT expression. Using this information, we have constructed an HPRT minigene that can be used for either positive or negative selection in ES cell experiments. This dual capability allows the design of "in-out" procedures to create subtle changes in target genes by homologous recombination with the aid of this selectable minigene. PMID:2349238

  20. Organization of multiple regulatory elements in the control region of the adenovirus type 2-specific VARNA1 gene: fine mapping with linker-scanning mutants.


    Railey, J F; Wu, G J


    The adenovirus type 2-specific virus-associated RNA 1 (VARNA1) gene is transcribed by eucaryotic RNA polymerase III. Previous studies using deletion mutants for transcription have shown that the VARNA1 gene has a large control region which is composed of several regulatory elements. Twenty-five exact linker-scanning mutations in the control region, from -33 to +77, of this gene were used for definition of the number and boundaries of these elements. The effects of these mutations on transcription and competition for transcription factors in human KB cell extracts revealed five positive regulatory elements. The essential element, which coincided with the B block, was absolutely required for both transcription and formation of stable complexes. A second element, which included the A block, was also required for both transcription and formation of stable complexes. Although this element is not as essential as the B-block element, together with the B-block element it may be necessary for formation of the most basal form of transcription machinery. Therefore, these two elements are the promoter elements in this gene. In addition, one possible element in the interblock region and two elements in the 5' flanking region were also required for efficient transcription, but they were moderately required for formation of stable complexes. Transcription of these mutants and the wild-type gene using an extract of 293 cells was stimulated at least threefold over that with the KB cell extract, as expected. Similar regulatory elements of this gene were revealed, however, when the 293 cell extract was used for transcription of these mutants, suggesting that the E1A-mediated specific transcription factors act on the transcription machinery in a sequence-nonspecific manner. PMID:3367906

  1. Organization of multiple regulatory elements in the control region of the adenovirus type 2-specific VARNA1 gene: fine mapping with linker-scanning mutants.

    PubMed Central

    Railey, J F; Wu, G J


    The adenovirus type 2-specific virus-associated RNA 1 (VARNA1) gene is transcribed by eucaryotic RNA polymerase III. Previous studies using deletion mutants for transcription have shown that the VARNA1 gene has a large control region which is composed of several regulatory elements. Twenty-five exact linker-scanning mutations in the control region, from -33 to +77, of this gene were used for definition of the number and boundaries of these elements. The effects of these mutations on transcription and competition for transcription factors in human KB cell extracts revealed five positive regulatory elements. The essential element, which coincided with the B block, was absolutely required for both transcription and formation of stable complexes. A second element, which included the A block, was also required for both transcription and formation of stable complexes. Although this element is not as essential as the B-block element, together with the B-block element it may be necessary for formation of the most basal form of transcription machinery. Therefore, these two elements are the promoter elements in this gene. In addition, one possible element in the interblock region and two elements in the 5' flanking region were also required for efficient transcription, but they were moderately required for formation of stable complexes. Transcription of these mutants and the wild-type gene using an extract of 293 cells was stimulated at least threefold over that with the KB cell extract, as expected. Similar regulatory elements of this gene were revealed, however, when the 293 cell extract was used for transcription of these mutants, suggesting that the E1A-mediated specific transcription factors act on the transcription machinery in a sequence-nonspecific manner. Images PMID:3367906

  2. Organization of multiple regulatory elements in the control region of the adenovirus type 2-specific VARNA1 gene: Fine mapping with linker-scanning mutants

    SciTech Connect

    Railey, J.F.; Wu, G.J.


    The adenovirus type 2-specific virus-associated RNA 1 (VARNA1) gene is transcribed by eucaryotic RNA polymerase III. Previous studies using deletion mutants for transcription have shown that the VARNA1 gene has a large control region which is composed of several regulatory elements. Twenty-five exact linker-scanning mutations in the control region, from -33 to +77, of this gene were used for definition of the number and boundaries of these elements. The effects of these mutations on transcription and competition for transcription factors in human KB cell extracts revealed five positive regulatory elements. The essential element, which coincided with the B block, was absolutely required for both transcription and formation of stable complexes. A second element, which included the A block, was also required for both transcription and formation of stable complexes. Although this element is not as essential as the B-block element, together with the B-block element it may be necessary for formation of the most basal form of transcription machinery. Therefore, these two elements are the promoter elements in this gene. In addition, one possible element in the interblock region and two elements in the 5' flanking region were also required for efficient transcription, but they were moderately required for formation of stable complexes. Transcription of these mutants and the wild-type genes using an extract of 293 cells was stimulated at least threefold over that with the KB cell extract, as expected. Similar regulatory elements of this gene were revealed, however, when the 292 cell extract was used for transcription of these mutants, suggesting that the E1A-mediated specific transcription factors act on the transcription machinery in a sequence-nonspecific manner.

  3. A var Gene Upstream Element Controls Protein Synthesis at the Level of Translation Initiation in Plasmodium falciparum

    PubMed Central

    Brancucci, Nicolas M. B.; Witmer, Kathrin; Schmid, Christoph; Voss, Till S.


    Clonally variant protein expression in the malaria parasite Plasmodium falciparum generates phenotypic variability and allows isogenic populations to adapt to environmental changes encountered during blood stage infection. The underlying regulatory mechanisms are best studied for the major virulence factor P. falciparum erythrocyte membrane protein 1 (PfEMP1). PfEMP1 is encoded by the multicopy var gene family and only a single variant is expressed in individual parasites, a concept known as mutual exclusion or singular gene choice. var gene activation occurs in situ and is achieved through the escape of one locus from epigenetic silencing. Singular gene choice is controlled at the level of transcription initiation and var 5′ upstream (ups) sequences harbour regulatory information essential for mutually exclusive transcription as well as for the trans-generational inheritance of the var activity profile. An additional level of control has recently been identified for the var2csa gene, where an mRNA element in the 5′ untranslated region (5′ UTR) is involved in the reversible inhibition of translation of var2csa transcripts. Here, we extend the knowledge on post-transcriptional var gene regulation to the common upsC type. We identified a 5′ UTR sequence that inhibits translation of upsC-derived mRNAs. Importantly, this 5′ UTR element efficiently inhibits translation even in the context of a heterologous upstream region. Further, we found var 5′ UTRs to be significantly enriched in uAUGs which are known to impair the efficiency of protein translation in other eukaryotes. Our findings suggest that regulation at the post-transcriptional level is a common feature in the control of PfEMP1 expression in P. falciparum. PMID:24937593

  4. A var gene upstream element controls protein synthesis at the level of translation initiation in Plasmodium falciparum.


    Brancucci, Nicolas M B; Witmer, Kathrin; Schmid, Christoph; Voss, Till S


    Clonally variant protein expression in the malaria parasite Plasmodium falciparum generates phenotypic variability and allows isogenic populations to adapt to environmental changes encountered during blood stage infection. The underlying regulatory mechanisms are best studied for the major virulence factor P. falciparum erythrocyte membrane protein 1 (PfEMP1). PfEMP1 is encoded by the multicopy var gene family and only a single variant is expressed in individual parasites, a concept known as mutual exclusion or singular gene choice. var gene activation occurs in situ and is achieved through the escape of one locus from epigenetic silencing. Singular gene choice is controlled at the level of transcription initiation and var 5' upstream (ups) sequences harbour regulatory information essential for mutually exclusive transcription as well as for the trans-generational inheritance of the var activity profile. An additional level of control has recently been identified for the var2csa gene, where an mRNA element in the 5' untranslated region (5' UTR) is involved in the reversible inhibition of translation of var2csa transcripts. Here, we extend the knowledge on post-transcriptional var gene regulation to the common upsC type. We identified a 5' UTR sequence that inhibits translation of upsC-derived mRNAs. Importantly, this 5' UTR element efficiently inhibits translation even in the context of a heterologous upstream region. Further, we found var 5' UTRs to be significantly enriched in uAUGs which are known to impair the efficiency of protein translation in other eukaryotes. Our findings suggest that regulation at the post-transcriptional level is a common feature in the control of PfEMP1 expression in P. falciparum. PMID:24937593

  5. Identification and characterization of regulatory elements in the promoter of ACVR1, the gene mutated in Fibrodysplasia Ossificans Progressiva

    PubMed Central


    Background The ACVR1 gene encodes a type I receptor for bone morphogenetic proteins (BMPs). Mutations in the ACVR1 gene are associated with Fibrodysplasia Ossificans Progressiva (FOP), a rare and extremely disabling disorder characterized by congenital malformation of the great toes and progressive heterotopic endochondral ossification in muscles and other non-skeletal tissues. Several aspects of FOP pathophysiology are still poorly understood, including mechanisms regulating ACVR1 expression. This work aimed to identify regulatory elements that control ACVR1 gene transcription. Methods and results We first characterized the structure and composition of human ACVR1 gene transcripts by identifying the transcription start site, and then characterized a 2.9 kb upstream region. This region showed strong activating activity when tested by reporter gene assays in transfected cells. We identified specific elements within the 2.9 kb region that are important for transcription factor binding using deletion constructs, co-transfection experiments with plasmids expressing selected transcription factors, site-directed mutagenesis of consensus binding-site sequences, and by protein/DNA binding assays. We also characterized a GC-rich minimal promoter region containing binding sites for the Sp1 transcription factor. Conclusions Our results showed that several transcription factors such as Egr-1, Egr-2, ZBTB7A/LRF, and Hey1, regulate the ACVR1 promoter by binding to the -762/-308 region, which is essential to confer maximal transcriptional activity. The Sp1 transcription factor acts at the most proximal promoter segment upstream of the transcription start site. We observed significant differences in different cell types suggesting tissue specificity of transcriptional regulation. These findings provide novel insights into the molecular mechanisms that regulate expression of the ACVR1 gene and that could be targets of new strategies for future therapeutic treatments. PMID:24047559

  6. Antagonistic Gene Activities Determine the Formation of Pattern Elements along the Mediolateral Axis of the Arabidopsis Fruit

    PubMed Central

    González-Reig, Santiago; Ripoll, Juan José; Vera, Antonio; Yanofsky, Martin F.; Martínez-Laborda, Antonio


    The Arabidopsis fruit mainly consists of a mature ovary that shows three well defined territories that are pattern elements along the mediolateral axis: the replum, located at the medial plane of the flower, and the valve and the valve margin, both of lateral nature. JAG/FIL activity, which includes the combined functions of JAGGED (JAG), FILAMENTOUS FLOWER (FIL), and YABBY3 (YAB3), contributes to the formation of the two lateral pattern elements, whereas the cooperating genes BREVIPEDICELLUS (BP) and REPLUMLESS (RPL) promote replum development. A recent model to explain pattern formation along the mediolateral axis hypothesizes that JAG/FIL activity and BP/RPL function as antagonistic lateral and medial factors, respectively, which tend to repress each other. In this work, we demonstrate the existence of mutual exclusion mechanisms between both kinds of factors, and how this determines the formation and size of the three territories. Medial factors autonomously constrain lateral factors so that they only express outside the replum, and lateral factors negatively regulate the medially expressed BP gene in a non-autonomous fashion to ensure correct replum development. We also have found that ASYMMETRIC LEAVES1 (AS1), previously shown to repress BP both in leaves and ovaries, collaborates with JAG/FIL activity, preventing its repression by BP and showing synergistic interactions with JAG/FIL activity genes. Therefore AS gene function (the function of the interacting genes AS1 and AS2) has been incorporated in the model as a new lateral factor. Our model of antagonistic factors provides explanation for mutant fruit phenotypes in Arabidopsis and also may help to understand natural variation of fruit shape in Brassicaceae and other species, since subtle changes in gene expression may cause conspicuous changes in the size of the different tissue types. PMID:23133401

  7. Demystifying the secret mission of enhancers: linking distal regulatory elements to target genes

    PubMed Central

    Yao, Lijing; Berman, Benjamin P.; Farnham, Peggy J.


    Abstract Enhancers are short regulatory sequences bound by sequence-specific transcription factors and play a major role in the spatiotemporal specificity of gene expression patterns in development and disease. While it is now possible to identify enhancer regions genomewide in both cultured cells and primary tissues using epigenomic approaches, it has been more challenging to develop methods to understand the function of individual enhancers because enhancers are located far from the gene(s) that they regulate. However, it is essential to identify target genes of enhancers not only so that we can understand the role of enhancers in disease but also because this information will assist in the development of future therapeutic options. After reviewing models of enhancer function, we discuss recent methods for identifying target genes of enhancers. First, we describe chromatin structure-based approaches for directly mapping interactions between enhancers and promoters. Second, we describe the use of correlation-based approaches to link enhancer state with the activity of nearby promoters and/or gene expression. Third, we describe how to test the function of specific enhancers experimentally by perturbing enhancer–target relationships using high-throughput reporter assays and genome editing. Finally, we conclude by discussing as yet unanswered questions concerning how enhancers function, how target genes can be identified, and how to distinguish direct from indirect changes in gene expression mediated by individual enhancers. PMID:26446758

  8. [Engineering and screening of artificial riboswitch as a novel gene control element].


    Yang, Huiyong; Diao, Yong; Lin, Junsheng; Xu, Rui'an


    Various artificial riboswitches have been constructed by utilization of designed aptamers or by modification of natural riboswitch systems, because they can regulate gene expression in a highly efficient, precise and fast way, and promise to supply simple cis-acting, modular, and non-immunogenic system for use in future gene therapy applications. In this review, we present an overview of currently available technologies to design and select engineered riboswitches, and discuss some possible technologies that would allow them highly responsive to non-natural ligands, and dynamic control of gene expression in mammalian cells. Though how to bring custom-designed riboswitches as a novel and versatile tool box to gene control system is still a great challenge, the combination of structure-activity relationship information, computer based molecular design, in vitro selection, and high-through screening will serve as powerful tools for further development of riboswitch based gene regulatory systems. PMID:22667116

  9. Intracisternal A-particle genes in Mus musculus: A conserved family of retrovirus-like elements

    SciTech Connect

    Kuff, E.L.; Smith, L.A.; Lueders, K.K.


    The structural organization of intracisternal A-particle genes has been studied, using isolates from a mouse gene library in lambda phage Charon 4A. The predominant gene form among the isolates was 7.3 kilobases (kb) in length. R-loops between the 7-kb (35S) A-particle genomic ribonucleic acid and several of these genes were colinear, with no visible evidence of intervening deoxyribonucleic acid sequences. Restriction endonuclease fragments encompassing the 5' and 3' regions of one 7.3b gene were separately subcloned into pBR322. Heteroduplexes between the two subclones revealed an approximately 300-base pair segment of terminally redundant sequences. The cloned 3' fragment hybridized with restriction fragments from the 5' end of several other A-particle genes, demonstrating the presence of common (though not necessarily identical) terminally repeated sequences. The relative abundance of restriction site variants was highly conserved in 12 laboratory strains of Mus musculus, in embryonic and adult tissues of a single inbred strain, and in the SC-1 cell line of feral mouse origin, but appeared to differ in a feral Japanese substrain, Mus musculus molossinus. Some evidence suggests that subsets of A-particle genes may have similar flanking sequences. The results are discussed in terms of the evolution of this multigene family.

  10. Identification and Functional Characterization of Cis-Regulatory Elements Controlling Expression of the Porcine ADRB2 Gene

    PubMed Central

    Jaeger, Alexandra; Fritschka, Stephan; Ponsuksili, Siriluck; Wimmers, Klaus; Muráni, Eduard


    The beta-2 adrenergic receptor (beta-2 AR) modulates metabolic processes in skeletal muscle, liver, and adipose tissue in response to catecholamine stimulation. We showed previously that expression of the porcine beta-2 AR gene (ADRB2) is affected by cis-regulatory polymorphisms. These are most likely responsible for the association of ADRB2 with economically relevant muscle-related traits in pigs. The present study focused on characterization of promoter elements involved in basal transcriptional regulation of the porcine ADRB2 in different cell types to aid identification of its cis-regulatory polymorphisms. Based on in silico analysis, luciferase reporter gene assays and gel shift assays were performed using COS-7, HepG2, C2C12, and 3T3-L1 cells. Deletion mapping of the 5´ flanking region (-1324 to +33) of ADRB2 revealed the region between -307 and -269 to be the minimal promoter, including regulatory elements essential for the basal transcriptional activity in all four tested cell types. Directly upstream (-400 to -323) we identified an important enhancer element required for maximal promoter activity. In silico analysis and gel shift assays revealed that this GC-rich element harbors two evolutionarily conserved binding sites of Sp1, a constitutive transcriptional activator. Significant transcriptional activation of the porcine ADRB2 promoter was demonstrated by overexpression of Sp1. Our results demonstrate, for the first time, an important role of Sp1 and of the responsive enhancer element in the regulation of ADRB2 expression. Polymorphisms located in this domain of the porcine ADRB2 promoter represent candidate causal cis-regulatory variants. PMID:26221068

  11. Pi class glutathione S-transferase genes are regulated by Nrf 2 through an evolutionarily conserved regulatory element in zebrafish

    PubMed Central

    Suzuki, Takafumi; Takagi, Yaeko; Osanai, Hitoshi; Li, Li; Takeuchi, Miki; Katoh, Yasutake; Kobayashi, Makoto; Yamamoto, Masayuki


    Pi class GSTs (glutathione S-transferases) are a member of the vertebrate GST family of proteins that catalyse the conjugation of GSH to electrophilic compounds. The expression of Pi class GST genes can be induced by exposure to electrophiles. We demonstrated previously that the transcription factor Nrf 2 (NF-E2 p45-related factor 2) mediates this induction, not only in mammals, but also in fish. In the present study, we have isolated the genomic region of zebrafish containing the genes gstp1 and gstp2. The regulatory regions of zebrafish gstp1 and gstp2 have been examined by GFP (green fluorescent protein)-reporter gene analyses using microinjection into zebrafish embryos. Deletion and point-mutation analyses of the gstp1 promoter showed that an ARE (antioxidant-responsive element)-like sequence is located 50 bp upstream of the transcription initiation site which is essential for Nrf 2 transactivation. Using EMSA (electrophoretic mobility-shift assay) analysis we showed that zebrafish Nrf 2–MafK heterodimer specifically bound to this sequence. All the vertebrate Pi class GST genes harbour a similar ARE-like sequence in their promoter regions. We propose that this sequence is a conserved target site for Nrf 2 in the Pi class GST genes. PMID:15654768

  12. Discrete spatial and temporal cis-acting elements regulate transcription of the Arabidopsis floral homeotic gene APETALA3.


    Hill, T A; Day, C D; Zondlo, S C; Thackeray, A G; Irish, V F


    The APETALA3 floral homeotic gene is required for petal and stamen development in Arabidopsis. APETALA3 transcripts are first detected in a meristematic region that will give rise to the petal and stamen primordia, and expression is maintained in this region during subsequent development of these organs. To dissect how the APETALA3 gene is expressed in this spatially and temporally restricted domain, various APETALA3 promoter fragments were fused to the uidA reporter gene encoding beta-glucuronidase and assayed for the resulting patterns of expression in transgenic Arabidopsis plants. Based on these promoter analyses, we defined cis-acting elements required for distinct phases of APETALA3 expression, as well as for petal-specific and stamen-specific expression. By crossing the petal-specific construct into different mutant backgrounds, we have shown that several floral genes, including APETALA3, PISTILLATA, UNUSUAL FLORAL ORGANS, and APETALA1, encode trans-acting factors required for second-whorl-specific APETALA3 expression. We have also shown that the products of the APETALA1, APETALA3, PISTILLATA and AGAMOUS genes bind to several conserved sequence motifs within the APETALA3 promoter. We present a model whereby spatially and temporally restricted APETALA3 transcription is controlled via interactions between proteins binding to different domains of the APETALA3 promoter. PMID:9521909

  13. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia.


    Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W


    The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium. PMID:20640386

  14. A gene expression map of the larval Xenopus laevis head reveals developmental changes underlying the evolution of new skeletal elements.


    Square, Tyler; Jandzik, David; Cattell, Maria; Coe, Alex; Doherty, Jacob; Medeiros, Daniel Meulemans


    The morphology of the vertebrate head skeleton is highly plastic, with the number, size, shape, and position of its components varying dramatically between groups. While this evolutionary flexibility has been key to vertebrate success, its developmental and genetic bases are poorly understood. The larval head skeleton of the frog Xenopus laevis possesses a unique combination of ancestral tetrapod features and anuran-specific novelties. We built a detailed gene expression map of the head mesenchyme in X. laevis during early larval development, focusing on transcription factor families with known functions in vertebrate head skeleton development. This map was then compared to homologous gene expression in zebrafish, mouse, and shark embryos to identify conserved and evolutionarily flexible aspects of vertebrate head skeleton development. While we observed broad conservation of gene expression between X. laevis and other gnathostomes, we also identified several divergent features that correlate to lineage-specific novelties. We noted a conspicuous change in dlx1/2 and emx2 expression in the second pharyngeal arch, presaging the differentiation of the reduced dorsal hyoid arch skeletal element typical of modern anamniote tetrapods. In the first pharyngeal arch we observed a shift in the expression of the joint inhibitor barx1, and new expression of the joint marker gdf5, shortly before skeletal differentiation. This suggests that the anuran-specific infrarostral cartilage evolved by partitioning of Meckel's cartilage with a new paired joint. Taken together, these comparisons support a model in which early patterning mechanisms divide the vertebrate head mesenchyme into a highly conserved set of skeletal precursor populations. While subtle changes in this early patterning system can affect skeletal element size, they do not appear to underlie the evolution of new joints or cartilages. In contrast, later expression of the genes that regulate skeletal element

  15. The role of an inverted CCAAT element in transcriptional activation of the human DNA topoisomerase IIalpha gene by heat shock.


    Furukawa, M; Uchiumi, T; Nomoto, M; Takano, H; Morimoto, R I; Naito, S; Kuwano, M; Kohno, K


    Expression of the DNA topoisomerase IIalpha (topoIIalpha) gene is highly sensitive to various environmental stimuli including heat shock. The amount of topoIIalpha mRNA was increased 1.5-3-fold 6-24 h after exposure of T24 human urinary bladder cancer cells to heat shock stress at 43 degreesC for 1 h. The effect of heat shock on the transcriptional activity of the human topoIIalpha gene promoter was investigated by transient transfection of T24 cells with luciferase reporter plasmids containing various lengths of the promoter sequence. The transcriptional activity of the full-length promoter (nucleotides (nt) -295 to +85) and of three deletion constructs (nt -197 to +85, -154 to +85, and -74 to +85) was increased approximately 3-fold 24 h after heat shock stress. In contrast, the transcriptional activity of the minimal promoter (nt -20 to +85), which lacks the first inverted CCAAT element (ICE1), the GC box, and the heat shock element located between nt -74 and -21, was not increased by heat shock. Furthermore, the transcriptional activity of promoter constructs containing mutations in the GC box or heat shock element, but not that of a construct containing mutations in ICE1, was significantly increased by heat shock. Electrophoretic mobility shift assays revealed reduced binding of a nuclear factor to an oligonucleotide containing ICE1 when nuclear extracts were derived from cells cultured for 3-24 h after heat shock. No such change in factor binding was apparent with an oligonucleotide containing the heat shock element of the topoIIalpha gene promoter. Finally, in vivo footprint analysis of the topoIIalpha gene promoter revealed that two G residues of ICE1 that were protected in control cells became sensitive to dimethyl sulfate modification after heat shock. These results suggest that transcriptional activation of the topoIIalpha gene by heat shock requires the release of a negative regulatory factor from ICE1. PMID:9553115

  16. Multitasking of the piRNA Silencing Machinery: Targeting Transposable Elements and Foreign Genes in the Bdelloid Rotifer Adineta vaga.


    Rodriguez, Fernando; Arkhipova, Irina R


    RNA-mediated silencing processes play a key role in silencing of transposable elements, especially in the germ line, where piwi-interacting RNAs (piRNAs) are responsible for suppressing transposon mobility and maintaining genome integrity. We previously reported that the genome of Adineta vaga, the first sequenced representative of the phylum Rotifera (class Bdelloidea), is characterized by massive levels of horizontal gene transfer, by unusually low transposon content, and by highly diversified RNA-mediated silencing machinery. Here, we investigate genome-wide distribution of pi-like small RNAs, which in A. vaga are 25-31 nucleotides in length and have a strong 5'-uridine bias, while lacking ping-pong amplification signatures. In agreement with expectations, 71% of mapped reads corresponded to annotated transposons, with 93% of these reads being in the antisense orientation. Unexpectedly, a significant fraction of piRNAs originate from predicted coding regions corresponding to genes of putatively foreign origin. The distribution of piRNAs across foreign genes is not biased toward 3'-UTRs, instead resembling transposons in uniform distribution pattern throughout the gene body, and in predominantly antisense orientation. We also find that genes with small RNA coverage, including a number of genes of metazoan origin, are characterized by higher occurrence of telomeric repeats in the surrounding genomic regions, and by higher density of transposons in the vicinity, which have the potential to promote antisense transcription. Our findings highlight the complex interplay between RNA-based silencing processes and acquisition of genes at the genome periphery, which can result either in their loss or eventual domestication and integration into the host genome. PMID:27017627

  17. The upstream muscle-specific enhancer of the rat muscle creatine kinase gene is composed of multiple elements.

    PubMed Central

    Horlick, R A; Benfield, P A


    A series of constructs that links the rat muscle creatine kinase promoter to the bacterial chloramphenicol acetyltransferase gene was generated. These constructs were introduced into differentiating mouse C2C12 myogenic cells to localize sequences that are important for up-regulation of the creatine kinase gene during myogenic differentiation. A muscle-specific enhancer element responsible for induction of chloramphenicol acetyltransferase expression during myogenesis was localized to a 159-base-pair region from 1,031 to 1,190 base pairs upstream of the transcription start site. Analysis of transient expression experiments using promoters mutated by deletion indicated the presence of multiple functional domains within this muscle-specific regulatory element. A DNA fragment spanning this region was used in DNase I protection experiments. Nuclear extracts derived from C2 myotubes protected three regions (designated E1, E2, and E3) on this fragment from digestion, which indicated there may be three or more trans-acting factors that interact with the creatine kinase muscle enhancer. Gel retardation assays revealed that factors able to bind specifically to E1, E2, and E3 are present in a wide variety of tissues and cell types. Transient expression assays demonstrated that elements in regions E1 and E3, but not necessarily E2, are required for full enhancer activity. Images PMID:2761536

  18. Epigenetic conservation at gene regulatory elements revealed by non-methylated DNA profiling in seven vertebrates.


    Long, Hannah K; Sims, David; Heger, Andreas; Blackledge, Neil P; Kutter, Claudia; Wright, Megan L; Grützner, Frank; Odom, Duncan T; Patient, Roger; Ponting, Chris P; Klose, Robert J


    Two-thirds of gene promoters in mammals are associated with regions of non-methylated DNA, called CpG islands (CGIs), which counteract the repressive effects of DNA methylation on chromatin. In cold-blooded vertebrates, computational CGI predictions often reside away from gene promoters, suggesting a major divergence in gene promoter architecture across vertebrates. By experimentally identifying non-methylated DNA in the genomes of seven diverse vertebrates, we instead reveal that non-methylated islands (NMIs) of DNA are a central feature of vertebrate gene promoters. Furthermore, NMIs are present at orthologous genes across vast evolutionary distances, revealing a surprising level of conservation in this epigenetic feature. By profiling NMIs in different tissues and developmental stages we uncover a unifying set of features that are central to the function of NMIs in vertebrates. Together these findings demonstrate an ancient logic for NMI usage at gene promoters and reveal an unprecedented level of epigenetic conservation across vertebrate evolution. DOI: PMID:23467541

  19. Pollen specificity elements reside in 30 bp of the proximal promoters of two pollen-expressed genes.


    Eyal, Y; Curie, C; McCormick, S


    Functional analyses previously identified minimal promoter regions required for maintaining high-level expression of the late anther tomato LAT52 and LAT59 genes in tomato pollen. Here, we now define elements that direct pollen specificity. We used a transient assay system consisting of two cell types that differentially express the LAT genes and both "loss-of-function" and "gain-of-function" approaches. Linker substitution mutants analyzed in the transient assay and in transgenic plants identified 30-bp proximal promoter regions of LAT52 and LAT59 that are essential for their expression in pollen and that confer pollen specificity when fused to the heterologous cauliflower mosaic virus 35S core promoter. In vivo competition experiments demonstrated that a common trans-acting factor interacts with the pollen specificity region of both LAT gene promoters and suggested that a common mechanism regulates their coordinate expression. Adjacent upstream elements, the 52/56 box in LAT52 and the 56/59 box in LAT59, are involved in modulating the level of expression in pollen. The 52/56 box may be a target for the binding of a member of the GT-1 transcription factor family. PMID:7734969

  20. Pollen specificity elements reside in 30 bp of the proximal promoters of two pollen-expressed genes.

    PubMed Central

    Eyal, Y; Curie, C; McCormick, S


    Functional analyses previously identified minimal promoter regions required for maintaining high-level expression of the late anther tomato LAT52 and LAT59 genes in tomato pollen. Here, we now define elements that direct pollen specificity. We used a transient assay system consisting of two cell types that differentially express the LAT genes and both "loss-of-function" and "gain-of-function" approaches. Linker substitution mutants analyzed in the transient assay and in transgenic plants identified 30-bp proximal promoter regions of LAT52 and LAT59 that are essential for their expression in pollen and that confer pollen specificity when fused to the heterologous cauliflower mosaic virus 35S core promoter. In vivo competition experiments demonstrated that a common trans-acting factor interacts with the pollen specificity region of both LAT gene promoters and suggested that a common mechanism regulates their coordinate expression. Adjacent upstream elements, the 52/56 box in LAT52 and the 56/59 box in LAT59, are involved in modulating the level of expression in pollen. The 52/56 box may be a target for the binding of a member of the GT-1 transcription factor family. PMID:7734969

  1. RNA aptamers as genetic control devices: the potential of riboswitches as synthetic elements for regulating gene expression.


    Berens, Christian; Groher, Florian; Suess, Beatrix


    RNA utilizes many different mechanisms to control gene expression. Among the regulatory elements that respond to external stimuli, riboswitches are a prominent and elegant example. They consist solely of RNA and couple binding of a small molecule ligand to the so-called "aptamer domain" with a conformational change in the downstream "expression platform" which then determines system output. The modular organization of riboswitches and the relative ease with which ligand-binding RNA aptamers can be selected in vitro against almost any molecule have led to the rapid and widespread adoption of engineered riboswitches as artificial genetic control devices in biotechnology and synthetic biology over the past decade. This review highlights proof-of-principle applications to demonstrate the versatility and robustness of engineered riboswitches in regulating gene expression in pro- and eukaryotes. It then focuses on strategies and parameters to identify aptamers that can be integrated into synthetic riboswitches that are functional in vivo, before finishing with a reflection on how to improve the regulatory properties of engineered riboswitches, so that we can not only further expand riboswitch applicability, but also finally fully exploit their potential as control elements in regulating gene expression. PMID:25676052

  2. Calspermin gene transcription is regulated by two cyclic AMP response elements contained in an alternative promoter in the calmodulin kinase IV gene.

    PubMed Central

    Sun, Z; Sassone-Corsi, P; Means, A R


    The transcript for the high-affinity Ca2+/calmodulin-binding protein calspermin is generated from the gene encoding Ca2+/calmodulin-dependent protein kinase IV only in postmeiotic germ cells during spermatogenesis. We demonstrate that this testis-specific calspermin transcript can be produced in heterologous cells by utilization of a promoter located in an intron of the calmodulin (CaM) kinase IV gene. Critical motifs within this promoter are two cyclic AMP response element (CRE)-like sequences located about -70 and -50 bp upstream of the transcriptional initiation site. Both CRE motifs are footprinted by the authentic testis-specific transcriptional activator CREM tau or by CREM tau present in adult testis nuclear extract. Whereas a 2.1-kb DNA fragment containing the calspermin promoter is inactive when transfected into NIH 3T3 cells, activity can be restored by cotransfection of CREM tau and protein kinase A or CaM kinase IV but not CaM kinase II alpha. Restoration of activity is greatly reduced by mutation of the two CRE motifs. Since CRE-like motifs have been identified in many genes uniquely expressed in postmeiotic germ cells, which contain abundant CREM tau protein, we suggest that CREM tau may function as one transcription factor responsible for the expression of postmeiotic germ cell-specific genes. PMID:7799965

  3. Alternative promoters and repetitive DNA elements define the species-dependent tissue-specific expression of the FMO1 genes of human and mouse

    PubMed Central

    Shephard, Elizabeth A.; Chandan, Pritpal; Stevanovic-Walker, Milena; Edwards, Mina; Phillips, Ian R.


    In humans, expression of the FMO1 (flavin-containing mono-oxygenase 1) gene is silenced postnatally in liver, but not kidney. In adult mouse, however, the gene is active in both tissues. We investigated the basis of this species-dependent tissue-specific transcription of FMO1. Our results indicate the use of three alternative promoters. Transcription of the gene in fetal human and adult mouse liver is exclusively from the P0 promoter, whereas in extra-hepatic tissues of both species, P1 and P2 are active. Reporter gene assays showed that the proximal P0 promoters of human (hFMO1) and mouse (mFmo1) genes are equally effective. However, sequences upstream (−2955 to −506) of the proximal P0 of mFmo1 increased reporter gene activity 3-fold, whereas hFMO1 upstream sequences (−3027 to −541) decreased reporter gene activity by 75%. Replacement of the upstream sequence of human P0 with the upstream sequence of mouse P0 increased activity of the human proximal P0 8-fold. Species-specific repetitive elements are present immediately upstream of the proximal P0 promoters. The human gene contains five LINE (long-interspersed nuclear element)-1-like elements, whereas the mouse gene contains a poly A region, an 80-bp direct repeat, an LTR (long terminal repeat), a SINE (short-interspersed nuclear element) and a poly T tract. The rat and rabbit FMO1 genes, which are expressed in adult liver, lack some (rat) or all (rabbit) of the elements upstream of mouse P0. Thus silencing of FMO1 in adult human liver is due apparently to the presence upstream of the proximal P0 of L1 (LINE-1) elements rather than the absence of retrotransposons similar to those found in the mouse gene. PMID:17547558

  4. Role of transposable elements in genomic rearrangement, evolution, gene regulation and epigenetics in primates.


    Lee, Hee-Eun; Ayarpadikannan, Selvam; Kim, Heui-Soo


    The Human Genome Project revealed that almost half of the human genome consists of transposable elements (TEs), which are also abundant in non-human primates. Various studies have confirmed the roles of different TE families in primate evolution. TEs such as endogenous retroviruses (ERVs), long terminal repeats (LTRs), long interspersed nuclear elements (LINEs) and short interspersed nuclear elements (SINEs) all have numerous effects on the primate genome, including genomic rearrangement, regulatory functions and epigenetic mechanisms. This review offers an overview of research on TEs, including our current understanding of their presence in modern primate lineages, their evolutionary origins, and their regulatory and modifying effects on primate as well as human genomes. The information provided here should be useful for the study of primate genomics. PMID:26781081

  5. Characterization of oocyte-expressed GDF9 gene in buffalo and mapping of its TSS and putative regulatory elements.


    Roy, B; Rajput, S; Raghav, S; Kumar, P; Verma, A; Jain, A; Jain, T; Singh, D; De, S; Goswami, S L; Datta, T K


    Summary In spite of emerging evidence about the vital role of GDF9 in determination of oocyte competence, there is insufficient information about its regulation of oocyte-specific expression, particularly in livestock animals. Because of the distinct prominence of buffalo as a dairy animal, the present study was undertaken to isolate and characterize GDF9 cDNA using orthologous primers based on the bovine GDF9 sequence. GDF9 transcripts were found to be expressed in oocytes irrespective of their follicular origin, and shared a single transcription start site (TSS) at -57 base pairs (bp) upstream of ATG. Assignment of the TSS is consistent with the presence of a TATA element at -23 of the TSS mapped in this study. Localization of a buffalo-specific minimal promoter within 320 bp upstream of ATG was consolidated by identification of an E-box element at -113bp. Presence of putative transcription factor binding sites and other cis regulatory elements were analyzed at ~5 kb upstream of TSS. Various germ cell-specific cis-acting regulatory elements (BNCF, BRNF, NR2F, SORY, Foxh1, OCT1, LHXF etc.) have been identified in the 5' flanking region of the buffalo GDF9 gene, including NOBOX DNA binding elements and consensuses E-boxes (CANNTG). Presence of two conserved E-boxes found on buffalo sequence at -520 and -718 positions deserves attention in view of its sequence deviation from other species. Two NOBOX binding elements (NBE) were detected at the -3471 and -203 positions. The fall of the NBE within the putative minimal promoter territory of buffalo GDF9 and its unique non-core binding sequence could have a possible role in the control of the core promoter activity. PMID:22230197

  6. G72 primate-specific gene: a still enigmatic element in psychiatric disorders.


    Sacchi, Silvia; Binelli, Giorgio; Pollegioni, Loredano


    Numerous studies have demonstrated a link between genetic markers on chromosome 13 and schizophrenia, bipolar affective disorder, and other psychiatric phenotypes. The G72/G30 genes (transcribed in opposite directions) are located on chromosome 13q33, a region demonstrating strong evidence for linkage with various neuropsychiatric disorders. G72/G30 was identified in 2002 as a schizophrenia susceptibility locus; however, subsequent association studies did not reach consensus on single SNPs within the locus. Simultaneously, a new vision for the genetic architecture of psychiatric disorders suggested that schizophrenia was a quantitative trait, therefore ascribable to potentially hundreds of genes and subjected to the vagaries of the environment. The main protein product of G72 gene is named pLG72 or D-amino acid oxidase activator DAOA (153 amino acids) and its function is still debated. Functional analyses, also showing controversial results, indicate that pLG72 contributes to N-methyl-D-aspartate receptor modulation by affecting activity of the flavoprotein D-amino acid oxidase, the enzyme responsible for degrading the neuromodulator D-serine. In this review we, for the first time, summarize findings from molecular genetic linkage and association studies concerning G72 gene, cellular and molecular studies on pLG72, and investigations performed on G72/G30 transgenic mice. This will help elucidate the role of psychosis susceptibility genes, which will have a major impact on our understanding of disease pathophysiology and thus change classification and treatment. PMID:26914235

  7. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.


    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  8. Functional elements of the promoter region of the Aspergillus oryzae glaA gene encoding glucoamylase.


    Hata, Y; Kitamoto, K; Gomi, K; Kumagai, C; Tamura, G


    Analysis was made of the promoter region of the Aspergillus oryzae glaA gene encoding glucoamylase. Northern blots using a glucoamylase cDNA as a probe indicated that the amount of mRNA corresponding to the glaA gene increased when expression was induced by starch or maltose. The promoter region of the glaA gene was fused to the Escherichia coli uidA gene, encoding beta-glucuronidase (GUS), and the resultant plasmid was introduced into A. oryzae. Expression of GUS protein in the A. oryzae transformants was induced by maltose, indicating that the glaA-GUS gene was regulated at the level of transcription in the presence of maltose. The nucleotide sequence 1.1 kb upstream of the glaA coding region was determined. A comparison of the nucleotide sequence of the A. oryzae glaA promoter with those of A. oryzae amyB, encoding alpha-amylase, and A. niger glaA showed two regions with similar sequences. Deletion and site-specific mutation analysis of these homologous regions indicated that both are essential for direct high-level expression when grown on maltose. PMID:1339327

  9. Efficient inversions and duplications of mammalian regulatory DNA elements and gene clusters by CRISPR/Cas9

    PubMed Central

    Li, Jinhuan; Shou, Jia; Guo, Ya; Tang, Yuanxiao; Wu, Yonghu; Jia, Zhilian; Zhai, Yanan; Chen, Zhifeng; Xu, Quan; Wu, Qiang


    The human genome contains millions of DNA regulatory elements and a large number of gene clusters, most of which have not been tested experimentally. The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated nuclease 9 (Cas9) programed with a synthetic single-guide RNA (sgRNA) emerges as a method for genome editing in virtually any organisms. Here we report that targeted DNA fragment inversions and duplications could easily be achieved in human and mouse genomes by CRISPR with two sgRNAs. Specifically, we found that, in cultured human cells and mice, efficient precise inversions of DNA fragments ranging in size from a few tens of bp to hundreds of kb could be generated. In addition, DNA fragment duplications and deletions could also be generated by CRISPR through trans-allelic recombination between the Cas9-induced double-strand breaks (DSBs) on two homologous chromosomes (chromatids). Moreover, junctions of combinatorial inversions and duplications of the protocadherin (Pcdh) gene clusters induced by Cas9 with four sgRNAs could be detected. In mice, we obtained founders with alleles of precise inversions, duplications, and deletions of DNA fragments of variable sizes by CRISPR. Interestingly, we found that very efficient inversions were mediated by microhomology-mediated end joining (MMEJ) through short inverted repeats. We showed for the first time that DNA fragment inversions could be transmitted through germlines in mice. Finally, we applied this CRISPR method to a regulatory element of the Pcdhα cluster and found a new role in the regulation of members of the Pcdhγ cluster. This simple and efficient method should be useful in manipulating mammalian genomes to study millions of regulatory DNA elements as well as vast numbers of gene clusters. PMID:25757625

  10. Efficient inversions and duplications of mammalian regulatory DNA elements and gene clusters by CRISPR/Cas9.


    Li, Jinhuan; Shou, Jia; Guo, Ya; Tang, Yuanxiao; Wu, Yonghu; Jia, Zhilian; Zhai, Yanan; Chen, Zhifeng; Xu, Quan; Wu, Qiang


    The human genome contains millions of DNA regulatory elements and a large number of gene clusters, most of which have not been tested experimentally. The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated nuclease 9 (Cas9) programed with a synthetic single-guide RNA (sgRNA) emerges as a method for genome editing in virtually any organisms. Here we report that targeted DNA fragment inversions and duplications could easily be achieved in human and mouse genomes by CRISPR with two sgRNAs. Specifically, we found that, in cultured human cells and mice, efficient precise inversions of DNA fragments ranging in size from a few tens of bp to hundreds of kb could be generated. In addition, DNA fragment duplications and deletions could also be generated by CRISPR through trans-allelic recombination between the Cas9-induced double-strand breaks (DSBs) on two homologous chromosomes (chromatids). Moreover, junctions of combinatorial inversions and duplications of the protocadherin (Pcdh) gene clusters induced by Cas9 with four sgRNAs could be detected. In mice, we obtained founders with alleles of precise inversions, duplications, and deletions of DNA fragments of variable sizes by CRISPR. Interestingly, we found that very efficient inversions were mediated by microhomology-mediated end joining (MMEJ) through short inverted repeats. We showed for the first time that DNA fragment inversions could be transmitted through germlines in mice. Finally, we applied this CRISPR method to a regulatory element of the Pcdhα cluster and found a new role in the regulation of members of the Pcdhγ cluster. This simple and efficient method should be useful in manipulating mammalian genomes to study millions of regulatory DNA elements as well as vast numbers of gene clusters. PMID:25757625

  11. Fins into limbs: Autopod acquisition and anterior elements reduction by modifying gene networks involving 5'Hox, Gli3, and Shh.


    Tanaka, Mikiko


    Two major morphological changes occurred during the fin-to-limb transition: the appearance of the autopod, and the reduction of anterior skeletal elements. In the past decades, numerous approaches to the study of genetic developmental systems involved in patterning of fins/limbs among different taxa have provided clues to better understand the mechanism of the fin-to-limb transition. In this article, I discuss recent progress toward elucidating the evolutionary origin of the autopod and the mechanism through which the multiple-basal bones of ancestral fins were reduced into a single bone (humerus/femur). A particular focus of this article is the patterning mechanism of the tetrapod limb and chondrichthyan fin controlled by gene networks involving the 5'Hox genes, Gli3 and Shh. These recent data provide possible scenarios that could have led to the transformation of fins into limbs. PMID:26992366

  12. Thyroid hormone-regulated gene expression in juvenile mouse liver: identification of thyroid response elements using microarray profiling and in silico analyses

    PubMed Central


    Background Disruption of thyroid hormone signalling can alter growth, development and energy metabolism. Thyroid hormones exert their effects through interactions with thyroid receptors that directly bind thyroid response elements and can alter transcriptional activity of target genes. The effects of short-term thyroid hormone perturbation on hepatic mRNA transcription in juvenile mice were evaluated, with the goal of identifying genes containing active thyroid response elements. Thyroid hormone disruption was induced from postnatal day 12 to 15 by adding goitrogens to dams' drinking water (hypothyroid). A subgroup of thyroid hormone-disrupted pups received intraperitoneal injections of replacement thyroid hormones four hours prior to sacrifice (replacement). An additional group received only thyroid hormones four hours prior to sacrifice (hyperthyroid). Hepatic mRNA was extracted and hybridized to Agilent mouse microarrays. Results Transcriptional profiling enabled the identification of 28 genes that appeared to be under direct thyroid hormone-regulation. The regulatory regions of the genome adjacent to these genes were examined for half-site sequences that resemble known thyroid response elements. A bioinformatics search identified 33 thyroid response elements in the promoter regions of 13 different genes thought to be directly regulated by thyroid hormones. Thyroid response elements found in the promoter regions of Tor1a, 2310003H01Rik, Hect3d and Slc25a45 were further validated by confirming that the thyroid receptor is associated with these sequences in vivo and that it can bind directly to these sequences in vitro. Three different arrangements of thyroid response elements were identified. Some of these thyroid response elements were located far up-stream (> 7 kb) of the transcription start site of the regulated gene. Conclusions Transcriptional profiling of thyroid hormone disrupted animals coupled with a novel bioinformatics search revealed new thyroid

  13. A Novel Peroxisome Proliferator Response Element Modulates Hepatic Low Density Lipoprotein Receptor Gene Transcription in Response to PPARδ Activation

    PubMed Central

    Shende, Vikram R.; Singh, Amar Bahadur; Liu, Jingwen


    The hepatic expression of LDLR gene is regulated primarily at the transcriptional level by a sterol-regulatory element (SRE) in its proximal promoter region which is the site of action of SRE-binding protein 2 (SREBP2). However whether additional cis-regulatory elements contribute to LDLR transcription has not been fully explored. We investigated the function of a putative PPAR-response element (PPRE) sequence motif located at −768 to −752 bases upstream of the transcription start site of human LDLR gene in response to PPARδ activation. Promoter luciferase reporter analyses showed that treating HepG2 cells with PPARδ agonist L165041 markedly increased the activity of a full-length LDLR promoter construct (pLDLR-1192) without any effects on the shorter promoter reporter pLDLR-234 that contains only the core regulatory elements SRE-1 and SP1 sites. Importantly, mutation of the PPRE sequence greatly attenuated the induction of the full-length LDLR promoter activity by L165041 without affecting rosuvastatin mediated transactivation. Electrophoretic mobility shift and chromatin immunoprecipitation assays further confirmed the binding of PPARδ to the LDLR-PPRE site. Treating HepG2 cells with L165041 elevated the mRNA and protein expressions of LDLR without affecting the LDLR mRNA decay rate. The induction of LDLR expression by PPARδ agonist was further observed in liver tissue of mice and hamsters treated with L165041. Altogether, our studies identify a novel PPRE-mediated regulatory mechanism for LDLR transcription and suggest that combined treatment of statin with PPARδ agonists may have advantageous effects on LDLR expression. PMID:26443862

  14. Multiple Herbicide Resistance in Lolium multiflorum and Identification of Conserved Regulatory Elements of Herbicide Resistance Genes.


    Mahmood, Khalid; Mathiassen, Solvejg K; Kristensen, Michael; Kudsk, Per


    Herbicide resistance is a ubiquitous challenge to herbicide sustainability and a looming threat to control weeds in crops. Recently four genes were found constituently over-expressed in herbicide resistant individuals of Lolium rigidum, a close relative of Lolium multiflorum. These include two cytochrome P450s, one nitronate monooxygenase and one glycosyl-transferase. Higher expressions of these four herbicide metabolism related (HMR) genes were also observed after herbicides exposure in the gene expression databases, indicating them as reliable markers. In order to get an overview of herbicidal resistance status of L. multiflorum L, 19 field populations were collected. Among these populations, four populations were found to be resistant to acetolactate synthase (ALS) inhibitors while three exhibited resistance to acetyl-CoA carboxylase (ACCase) inhibitors in our initial screening and dose response study. The genotyping showed the presence of mutations Trp-574-Leu and Ile-2041-Asn in ALS and ACCase, respectively, and qPCR experiments revealed the enhanced expression of HMR genes in individuals of certain resistant populations. Moreover, co-expression networks and promoter analyses of HMR genes in O. sativa and A. thaliana resulted in the identification of a cis-regulatory motif and zinc finger transcription factors. The identified transcription factors were highly expressed similar to HMR genes in response to xenobiotics whereas the identified motif is known to play a vital role in coping with environmental stresses and maintaining genome stability. Overall, our findings provide an important step forward toward a better understanding of metabolism-based herbicide resistance that can be utilized to devise novel strategies of weed management. PMID:27547209

  15. Multiple Herbicide Resistance in Lolium multiflorum and Identification of Conserved Regulatory Elements of Herbicide Resistance Genes

    PubMed Central

    Mahmood, Khalid; Mathiassen, Solvejg K.; Kristensen, Michael; Kudsk, Per


    Herbicide resistance is a ubiquitous challenge to herbicide sustainability and a looming threat to control weeds in crops. Recently four genes were found constituently over-expressed in herbicide resistant individuals of Lolium rigidum, a close relative of Lolium multiflorum. These include two cytochrome P450s, one nitronate monooxygenase and one glycosyl-transferase. Higher expressions of these four herbicide metabolism related (HMR) genes were also observed after herbicides exposure in the gene expression databases, indicating them as reliable markers. In order to get an overview of herbicidal resistance status of L. multiflorum L, 19 field populations were collected. Among these populations, four populations were found to be resistant to acetolactate synthase (ALS) inhibitors while three exhibited resistance to acetyl-CoA carboxylase (ACCase) inhibitors in our initial screening and dose response study. The genotyping showed the presence of mutations Trp-574-Leu and Ile-2041-Asn in ALS and ACCase, respectively, and qPCR experiments revealed the enhanced expression of HMR genes in individuals of certain resistant populations. Moreover, co-expression networks and promoter analyses of HMR genes in O. sativa and A. thaliana resulted in the identification of a cis-regulatory motif and zinc finger transcription factors. The identified transcription factors were highly expressed similar to HMR genes in response to xenobiotics whereas the identified motif is known to play a vital role in coping with environmental stresses and maintaining genome stability. Overall, our findings provide an important step forward toward a better understanding of metabolism-based herbicide resistance that can be utilized to devise novel strategies of weed management. PMID:27547209

  16. Modulation of Estrogen Response Element-Driven Gene Expressions and Cellular Proliferation with Polar Directions by Designer Transcription Regulators

    PubMed Central

    Muyan, Mesut; Güpür, Gizem; Yaşar, Pelin; Ayaz, Gamze; User, Sırma Damla; Kazan, Hasan Hüseyin; Huang, Yanfang


    Estrogen receptor α (ERα), as a ligand-dependent transcription factor, mediates 17β-estradiol (E2) effects. ERα is a modular protein containing a DNA binding domain (DBD) and transcription activation domains (AD) located at the amino- and carboxyl-termini. The interaction of the E2-activated ERα dimer with estrogen response elements (EREs) of genes constitutes the initial step in the ERE-dependent signaling pathway necessary for alterations of cellular features. We previously constructed monomeric transcription activators, or monotransactivators, assembled from an engineered ERE-binding module (EBM) using the ERα-DBD and constitutively active ADs from other transcription factors. Monotransactivators modulated cell proliferation by activating and repressing ERE-driven gene expressions that simulate responses observed with E2-ERα. We reasoned here that integration of potent heterologous repression domains (RDs) into EBM could generate monotransrepressors that alter ERE-bearing gene expressions and cellular proliferation in directions opposite to those observed with E2-ERα or monotransactivators. Consistent with this, monotransrepressors suppressed reporter gene expressions that emulate the ERE-dependent signaling pathway. Moreover, a model monotransrepressor regulated DNA synthesis, cell cycle progression and proliferation of recombinant adenovirus infected ER-negative cells through decreasing as well as increasing gene expressions with polar directions compared with E2-ERα or monotransactivator. Our results indicate that an ‘activator’ or a ‘repressor’ possesses both transcription activating/enhancing and repressing/decreasing abilities within a chromatin context. Offering a protein engineering platform to alter signal pathway-specific gene expressions and cell growth, our approach could also be used for the development of tools for epigenetic modifications and for clinical interventions wherein multigenic de-regulations are an issue. PMID:26295471

  17. Isolation and Functional Characterization of a Novel Gene Encoding a Dehydration Responsive Element Binding Transcription Factor from Populus euphratica.


    Wei, Li; Ma, Jiangtao; Wang, Suomin; Wu, Yanmin


    Dehydration responsive element binding (DREB) transcription factors (TFs) play a key role in regulating abiotic stress related genes. A new gene (PeDREB2b) encoding an unidentified DRE-binding protein was isolated from 20% PEG6000 treated Populus euphratica Oliv. seedlings by RT-PCR and RACE. Full length of PeDREB2b cDNA was 1110 bp, and an ORF of 870 bp, which encoded 289-amino-acids polypeptide, were included. The deduced amino acid sequence analysis revealed that this protein was a putative AP2/EREBP transcription factor with a conserved AP2/EREBP domain of 64 amino acids and a potential nuclear localization signal (NLS). Based on phylogenetic characterization, PeDREB2b was classified as a member of A-5 group belonged to the DREB family. The PeDREB2b gene is induced by salinization, low temperature, drought and phytohormones GA3, NAA and 6BA, but not by ABA treatment. The fact that the product of PeDREB2b as a DREB transcription factor was verified in our further experiment: the nuclear localization of the gene when it was expressed transiently as a GFP fusion in onion epidermal cells. In addition, PeDREB2b was capable of activating reporter gene expression. To study the salt and drought stress responses for PeDREB2b transgenic Arabidopsis thaliana in detail, integrated physiological, biochemical and genetic approach methods were used. Results indicated that the PeDREB2b gene was over-expressed under stress-inducible rd29A promotor in transgenic plants alleviates the adverse effects of environmental stresses. PMID:27001404

  18. CCAAT displacement protein (CDP/cut) binds a negative regulatory element in the human tryptophan hydroxylase gene.


    Teerawatanasuk, N; Skalnik, D G; Carr, L G


    Tryptophan hydroxylase (TPH) is the rate-limiting enzyme in the biosynthesis of serotonin, a neurotransmitter that has been implicated in many psychiatric illnesses. The mechanism of transcriptional regulation of the human TPH gene is largely unknown. We have identified a negative regulatory element located between nucleotides -310 and -220 in the human TPH (hTPH) gene. Electromobility shift analyses performed with the -310/-220 hTPH probe and nuclear extract from P815-HTR (a TPH-expressing cell line) revealed two slow migrating protein-DNA complexes, designated I and II. CCAAT displacement protein (CDP/Cut) is involved in complex I formation as shown in electromobility shift analysis, using consensus oligonucleotide competitor and antibody. Mutations in the CDP/Cut binding site not only disrupted the CDP-DNA complex but also disrupted the second complex, suggesting that the core binding sequences of the two proteins are overlapping. The functional importance of these protein-DNA interactions was assessed by transiently transfecting wild-type and mutant pTPH/luciferase reporter constructs into P815-HTR cells. Mutations in the core CDP/Cut site resulted in an approximately fourfold increase in relative luciferase activities. Because CDP/Cut has been shown to repress transcription of many target genes, we speculate that disruption of the CDP/Cut binding was responsible, at least in part, for the activation of hTPH gene. PMID:9886051

  19. The Azorhizobium caulinodans nifA gene: identification of upstream-activating sequences including a new element, the 'anaerobox'.

    PubMed Central

    Nees, D W; Stein, P A; Ludwig, R A


    From nucleotide sequencing analyses, the A. caulinodans nifA gene seems to be under dual control by the Ntr (in response to available N) and Fnr (in response to available O2) transcriptional activation/repression systems. Because it fixes N2 in two contexts, the Ntr system might regulate A. caulinodans nif gene expression ex planta, while the Fnr system might similarly regulate in planta. As nifA upstream-activating elements, we have identified: (i) a gpNifA binding site allowing autogenous nifA regulation, (ii) an Ntr-dependent transcription start, presumably the target of gpNifA activation, and (iii) an "anaerobox" tetradecameric nucleotide sequence that is precisely conserved among O2 regulated enteric bacterial genes controlled by the gpFnr transcriptional activator. Because it is precisely positioned upstream of enteric bacterial transcriptional starts, the "anaerobox" sequence may constitute the gpFnr DNA binding site. If so, then a second, Ntr-independent nifA transcription start may exist. We have also deduced the A. caulinodans nifA open reading frame and have compared the gene product (gpNifA) with those of other N2-fixing organisms. These proteins exhibit strongly conserved motifs: (i) sites conserved among ATP-binding proteins, (ii) an interdomain linker region, and (iii) a C-terminal alpha-helix-turn-alpha-helix DNA binding site. PMID:3186446

  20. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.


    Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm


    Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle. PMID:25973601

  1. Identification and characterization of methylation-dependent/independent DNA regulatory elements in the human SLC9B1 gene

    PubMed Central

    Kumar, Priya L.; James, Paul F.


    The human NHEDC1 (hNHEDC1) protein is thought to be essential for sperm motility and fertility however the mechanisms regulating its gene expression are largely unknown. In this study we have identified multiple DNA regulatory elements in the 5′ end of the gene encoding hNHEDC1 (SLC9B1) and have explored the role that DNA methylation at these elements plays in the regulation of its expression. We first show that the full-length hNHEDC1 protein is testis-specific for the tissues that we tested and that it localizes to the cells of the seminiferous tubules. In silico analysis of the SLC9B1 gene locus identified two putative promoters (P1 and P2) and two CpG islands - CpGI (overlapping with P1) and CpGII (intragenic) - at the 5′ end of the gene. By deletion analysis of P1, we show that the region from −23bp to +200bp relative to the transcription start site (TSS) is sufficient for optimal promoter activity in a germ cell line. Additionally, in vitro methylation of the P1 (the −500bp to +200bp region relative to the TSS) abolishes its activity in germ cells and somatic cells strongly suggesting that DNA methylation at this promoter could regulate SLC9B1 expression. Furthermore, bisulfite-sequencing analysis of the P1/CpGI uncovered reduced methylation in the testis vs. lung whereas CpGII displayed no differences in methylation between these two tissues. Additionally, treatment of HEK 293 cells with 5-Aza2-Deoxycytidine led to upregulation of NHEDC1 transcript and reduced methylation in the promoter CpGI. Finally, we have uncovered both enhancer and silencer functions of the intragenic SLC9B1 CpGII. In all, our data suggests that SLC9B1 gene expression could be regulated via a concerted action of DNA methylation-dependent and independent mechanisms mediated by these multiple DNA regulatory elements. PMID:25701605

  2. Transcriptional repression of the testis-specific histone H1t gene mediated by an element upstream of the H1/AC box.


    Wolfe, Steven A; Grimes, Sidney R


    The testis-specific histone H1t gene is transcribed exclusively in primary spermatocytes and may be important for chromatin structure, transcription, and DNA repair during this stage of spermatogenesis. Transcriptional repression of the gene in other cell types is mediated in part by specific proximal and distal promoter elements and in some cell types by methylation of CpG dinucleotides within the promoter. Our laboratory identified a distal promoter element located between 948 and 780 bp upstream from the transcription initiation site and another laboratory identified a GC-rich region between the TATA box and transcription initiation site that contribute to repression. In this article we address transcriptional repression of the histone H1t gene by an element within the proximal promoter. We report discovery of an element designated H1t promoter repressor element (RE) located between -130 and -106 bp that contributes to repression. The findings support the hypothesis that multiple mechanisms are involved in transcriptional repression of the H1t gene. Transcriptional repression mediated by the RE element in NIH 3T3 cells appears to differ significantly from the mechanism mediated by the GC-rich region. Furthermore, binding proteins that form the RE complex are not present in rat testis where the gene is actively transcribed. Our findings provide a molecular basis for histone H1t gene repression. PMID:12711397

  3. Identification of genomic polymorphisms in upstream elements of the bovine CYP3A28 gene

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The cytochrome P450 (CYP) enzyme family consists of a group of heme-containing monooxygenases that participate in metabolism and phase I detoxification. Previously, our group reported that the coding sequence for the CYP3A28 gene in cattle was polymorphic and related to cattle performance on toxic t...

  4. Systems genetics reveals key genetic elements of drought induced gene regulation in diploid potato.


    van Muijen, Dennis; Anithakumari, A M; Maliepaard, Chris; Visser, Richard G F; van der Linden, C Gerard


    In plants, tolerance to drought stress is a result of numerous minor effect loci in which transcriptional regulation contributes significantly to the observed phenotypes. Under severe drought conditions, a major expression quantitative trait loci hotspot was identified on chromosome five in potato. A putative Nuclear factor y subunit C4 was identified as key candidate in the regulatory cascade in response to drought. Further investigation of the eQTL hotspots suggests a role for a putative Homeobox leucine zipper protein 12 in relation to drought in potato. Genes strongly co-expressed with Homeobox leucine zipper protein 12 were plant growth regulators responsive to water deficit stress in Arabidopsis thaliana, implying a possible conserved mechanism. Integrative analysis of genetic, genomic, phenotypic and transcriptomic data provided insights in the downstream functional components of the drought response. The abscisic acid- and environmental stress-inducible protein TAS14 was highly induced by severe drought in potato and acts as a reliable biomarker for the level of stress perceived by the plant. The systems genetics approach supported a role for multiple genes responsive to severe drought stress of Solanum tuberosum. The combination of gene regulatory networks, expression quantitative trait loci mapping and phenotypic analysis proved useful for candidate gene selection. PMID:27353051

  5. The En/Spm transposable element of Zea mays contains splice sites at the termini generating a novel intron from a dSpm element in the A2 gene.

    PubMed Central

    Menssen, A; Höhmann, S; Martin, W; Schnable, P S; Peterson, P A; Saedler, H; Gierl, A


    The A2 locus of Zea mays, identified as one of the genes affecting anthocyanin biosynthesis, was cloned using the transposable elements rcy and dSpm as gene tags. The A2 gene encodes a putative protein of 395 amino acids and is devoid of introns. Two a2-m1 alleles, containing dSpm insertions of different sizes, were characterized. The dSpm element from the original state allele has perfect termini and undergoes frequent transposition. The element from the class II state allele is no longer competent to transpose. It has retained the 13 bp terminal inverted repeat but has lost all subterminal sites at the 5' end, which are recognized by tnpA protein, the most abundant product of the En/Spm transposable element system. The relatively high A2 gene expression of one a2-m1 allele is due to removal of almost all dSpm sequences by splicing. The slightly altered A2 enzyme is still functional as shown by complementation of an a2 mutant with the corresponding cDNA. The 5' and 3' splice sites are constituted by the termini of the dSpm element; it therefore represents a novel intron of the A2 gene. Images Fig. 3. Fig. 4. Fig. 6. Fig. 8. PMID:2170105

  6. Molecular Analysis of the Sequences Surrounding blaOXA-45 Reveals Acquisition of This Gene by Pseudomonas aeruginosa via a Novel ISCR Element, ISCR5▿

    PubMed Central

    Li, Hongyang; Walsh, Timothy R.; Toleman, Mark A.


    The blaOXA-45 gene of Pseudomonas aeruginosa 07-406 is driven by a promoter found within a truncated ISPme1 insertion sequence. The gene is located between nonidentical repeats of a new ISCR element, ISCR5, which is likely responsible for its acquisition. Sequence analysis indicates that ISCR5 is a chimera of ISCR3 and ISCR16. PMID:19064894

  7. Transcription of T cell receptor beta-chain genes is controlled by a downstream regulatory element.

    PubMed Central

    Krimpenfort, P; de Jong, R; Uematsu, Y; Dembic, Z; Ryser, S; von Boehmer, H; Steinmetz, M; Berns, A


    To characterize cis-acting elements controlling the expression of T cell receptor beta-chains we generated a number of transgenic mouse lines harboring a rearranged T cell receptor beta-chain with different extensions of 5' and 3' flanking sequences. Transcriptional analysis of transgenic mice carrying these clones showed that sequences located downstream of the polyadenylation signal of the C beta 2 region are indispensable for expression in transgenic mice. The sequences conferring enhancer activity in this fragment were further defined by transient CAT assays. Strong enhancer activity was found to reside in a 550 bp fragment located 5 kb downstream from C beta 2. The nucleotide sequence of this fragment revealed a number of oligonucleotide motifs characteristic for enhancer elements. Images PMID:3396541

  8. Statins Increase Plasminogen Activator Inhibitor Type 1 Gene Transcription through a Pregnane X Receptor Regulated Element

    PubMed Central

    Stanley, Frederick M.; Linder, Kathryn M.; Cardozo, Timothy J.


    Plasminogen activator inhibitor type 1 (PAI-1) is a multifunctional protein that has important roles in inflammation and wound healing. Its aberrant regulation may contribute to many disease processes such as heart disease. The PAI-1 promoter is responsive to multiple inputs including cytokines, growth factors, steroids and oxidative stress. The statin drugs, atorvastatin, mevastatin and rosuvastatin, increased basal and stimulated expression of the PAI-1 promoter 3-fold. A statin-responsive, nuclear hormone response element was previously identified in the PAI-1 promoter, but it was incompletely characterized. We characterized this direct repeat (DR) of AGGTCA with a 3-nucleotide spacer at -269/-255 using deletion and directed mutagenesis. Deletion or mutation of this element increased basal transcription from the promoter suggesting that it repressed PAI-1 transcription in the unliganded state. The half-site spacing and the ligand specificity suggested that this might be a pregnane X receptor (PXR) responsive element. Computational molecular docking showed that atorvastatin, mevastatin and rosuvastatin were structurally compatible with the PXR ligand-binding pocket in its agonist conformation. Experiments with Gal4 DNA binding domain fusion proteins showed that Gal4-PXR was activated by statins while other DR + 3 binding nuclear receptor fusions were not. Overexpression of PXR further enhanced PAI-1 transcription in response to statins. Finally, ChIP experiments using Halo-tagged PXR and RXR demonstrated that both components of the PXR-RXR heterodimer bound to this region of the PAI-1 promoter. PMID:26379245

  9. Phytophthora infestans Argonaute 1 binds microRNA and small RNAs from effector genes and transposable elements.


    Åsman, Anna K M; Fogelqvist, Johan; Vetukuri, Ramesh R; Dixelius, Christina


    Phytophthora spp. encode large sets of effector proteins and distinct populations of small RNAs (sRNAs). Recent evidence has suggested that pathogen-derived sRNAs can modulate the expression of plant defense genes. Here, we studied the sRNA classes and functions associated with Phytophthora infestans Argonaute (Ago) proteins. sRNAs were co-immunoprecipitated with three PiAgo proteins and deep sequenced. Twenty- to twenty-two-nucleotide (nt) sRNAs were identified as the main interaction partners of PiAgo1 and high enrichment of 24-26-nt sRNAs was seen in the PiAgo4-bound sample. The frequencies and sizes of transposable element (TE)-derived sRNAs in the different PiAgo libraries suggested diversified roles of the PiAgo proteins in the control of different TE classes. We further provide evidence for the involvement of PiAgo1 in the P. infestans microRNA (miRNA) pathway. Protein-coding genes are probably regulated by the shared action of PiAgo1 and PiAgo5, as demonstrated by analysis of differential expression. An abundance of sRNAs from genes encoding host cell death-inducing Crinkler (CRN) effectors was bound to PiAgo1, implicating this protein in the regulation of the expanded CRN gene family. The data suggest that PiAgo1 plays an essential role in gene regulation and that at least two RNA silencing pathways regulate TEs in the plant-pathogenic oomycete P. infestans. PMID:27010746

  10. Engineering ligand-responsive gene-control elements: lessons learned from natural riboswitches.


    Link, K H; Breaker, R R


    In the last two decades, remarkable advances have been made in the development of technologies used to engineer new aptamers and ribozymes. This has encouraged interest among researchers who seek to create new types of gene-control systems that can be made to respond specifically to small-molecule signals. Validation of the fact that RNA molecules can exhibit the characteristics needed to serve as precision genetic switches has come from the discovery of numerous classes of natural ligand-sensing RNAs called riboswitches. Although a great deal of progress has been made toward engineering useful designer riboswitches, considerable advances are needed before the performance characteristics of these RNAs match those of protein systems that have been co-opted to regulate gene expression. In this review, we will evaluate the potential for engineered RNAs to regulate gene expression and lay out possible paths to designer riboswitches based on currently available technologies. Furthermore, we will discuss some technical advances that would empower RNA engineers who seek to make routine the production of designer riboswitches that can function in eukaryotes. PMID:19587710

  11. A short, highly repetitive element in intron -1 of the human c-Ha-ras gene acts as a block to transcriptional readthrough by a viral promoter.

    PubMed Central

    Lowndes, N F; Bushel, P; Mendelsohn, L; Wu, J; Yen, M Y; Allan, M


    We have identified a short, highly repetitive element within intron -1 of the human c-Ha-ras gene. This element was found to be transcribed in both orientations and to be homologous to heterogeneous nonpolyadenylated transcripts. The repetitive element blocked transcriptional readthrough from a strong upstream viral promoter but allowed unimpaired readthrough from the c-Has-ras promoter. We suggest that it may serve to prevent excessive transcription into the coding region of the gene under such circumstances as viral insertion. Images PMID:2201911

  12. Polarity of the ecdysone receptor complex interaction with the palindromic response element from the hsp27 gene promoter.


    Niedziela-Majka, A; Kochman, M; Ozyhar, A


    The functional 20-hydroxyecdysone (20E) receptor is a heterodimer of two members of the nuclear hormone receptors superfamily; the product of the EcR (EcR) and of the ultraspiracle (Usp) genes. As most of the natural 20E-response elements are highly degenerated palindromes, we were interested in determining whether or not such asymmetric elements could dictate the defined orientation of the Usp/EcR complex. We have investigated interaction of EcR and Usp DNA-binding domains (EcRDBD and UspDBD, respectively) with the palindromic response element from the hsp27 gene promoter (hsp27pal). The hsp27pal half-sites contribute differently to the binding of the heterodimer components; the 5' half-site exhibits higher affinity for both DBDs than the 3' half-site. This observation, along with data demonstrating that UspDBD exhibits approximate fourfold higher affinity to the 5' half-site than EcRDBD, suggest that UspDBD locates the EcRDBD/UspDBD heterocomplex in the defined orientation (5'-UspDBD-EcRDBD-3') on the hsp27pal sequence. The binding polarity onto hsp27pal is accompanied by different contribution of the UspDBD and EcRDBD C-terminal sequences to the DNA-binding and heterocomplex formation. This is supported by finding that deletion of the C-terminal of EcRDBD region corresponding to the putative A-helix severely decreased binding of the EcRDBD to the hsp27pal. In contrast, UspDBD in which corresponding residues were deleted exhibited the same hsp27pal binding pattern as the wild type UspDBD. Additional truncation comprising the putative T-box, resulted in a reduced binding of the mutated UspDBD. This truncation however, still allowed effective EcRDBD/UspDBD heterodimer formation. Finally we demonstrated that perfect palindromes, composed of two hsp27pal 5' half-sites (or of the related sequence) contain all of the structural information necessary for the anisotropic UspDBD/EcRDBD heterocomplex formation. However, the perfect palindromes bind isolated homomeric DBDs

  13. Control of calcitonin/calcitonin gene-related peptide pre-mRNA processing by constitutive intron and exon elements.

    PubMed Central

    Yeakley, J M; Hedjran, F; Morfin, J P; Merillat, N; Rosenfeld, M G; Emeson, R B


    The calcitonin/calcitonin gene-related peptide (CGRP) primary transcript is alternatively spliced in thyroid C cells and neurons, resulting in the tissue-specific production of calcitonin and CGRP mRNAs. Analyses of mutated calcitonin/CGRP transcription units in permanently transfected cell lines have indicated that alternative splicing is regulated by a differential capacity to utilize the calcitonin-specific splice acceptor. The analysis of an extensive series of mutations suggests that tissue-specific regulation of calcitonin mRNA production does not depend on the presence of a single, unique cis-active element but instead appears to be a consequence of suboptimal constitutive splicing signals. While only those mutations that altered constitutive splicing signals affected splice choices, the action of multiple regulatory sequences cannot be formally excluded. Further, we have identified a 13-nucleotide purine-rich element from a constitutive exon that, when placed in exon 4, entirely switches splice site usage in CGRP-producing cells. These data suggest that specific exon recruitment sequences, in combination with other constitutive elements, serve an important function in exon recognition. These results are consistent with the hypothesis that tissue-specific alternative splicing of the calcitonin/CGRP primary transcript is mediated by cell-specific differences in components of the constitutive splicing machinery. Images PMID:8413203

  14. PGC-1alpha induces dynamic protein interactions on the ERRalpha gene multi-hormone response element nucleosome in kidney cells.


    Wang, Liangli; Li, Yin; Hu, Peng; Teng, Christina T


    ERR (oestrogen-related receptor)-alpha modulates the oestrogen signalling pathway and regulates genes participating in the physiological energy balance programme. Oestrogen and PGC-1alpha (peroxisome proliferator-activated receptor-gamma coactivator-1alpha), the master regulator of the energy homoeostasis programme, both regulate the expression of ERRalpha through the MHRE (multi-hormone response element) of the ERRalpha gene. Although the molecular mechanism of oestrogen action on ERRalpha regulation is well characterized, the mechanism of PGC-1alpha induction is unclear. In this study, we examine chromatin structural changes and protein interactions at the MHRE nucleosome in response to PGC-1alpha expression in HK2 human kidney cells. We mapped the nucleosome positions of the ERRalpha gene promoter and examined the changes of histone acetylation in response to PGC-1alpha expression. The interactions of DNA-binding proteins, ERRalpha and ERRgamma, co-activators {CBP [CREB (cAMP-response-element-binding protein)-binding protein], p300, PCAF (p300/CBP-associated factor)}, co-repressor [RIP140 (receptor-interacting protein of 140 kDa)] and RNA polymerase II at the MHRE nucleosome region were investigated over time before and after PGC-1alpha expression in the HK2 cells. We found a dynamic cyclic interaction of these proteins shortly after PGC-1alpha expression and a slower cycling interaction, with fewer proteins involved, 20 h later. By using the siRNA (small interfering RNA) knockdown approach, we discovered that ERRgamma was involved in the initial phase, but not in the later phase, of PGC-1alpha-induced ERRalpha expression. PMID:18673300

  15. Highly variable individual donor cell fates characterize robust horizontal gene transfer of an integrative and conjugative element.


    Delavat, François; Mitri, Sara; Pelet, Serge; van der Meer, Jan Roelof


    Horizontal gene transfer is an important evolutionary mechanism for bacterial adaptation. However, given the typical low transfer frequencies in a bacterial population, little is known about the fate and interplay of donor cells and the mobilized DNA during transfer. Here we study transfer of an integrative and conjugative element (ICE) among individual live bacterial cells. ICEs are widely distributed mobile DNA elements that are different than plasmids because they reside silent in the host chromosome and are maintained through vertical descent. Occasionally, ICEs become active, excise, and transmit their DNA to a new recipient, where it is reintegrated. We develop a fluorescent tool to differentiate excision, transfer, and reintegration of a model ICE named ICEclc (for carrying the clc genes for chlorocatechol metabolism) among single Pseudomonas cells by using time-lapse microscopy. We find that ICEclc activation is initiated in stationary phase cells, but excision and transfer predominantly occur only when such cells have been presented with new nutrients. Donors with activated ICE develop a number of different states, characterized by reduced cell division rates or growth arrest, persistence, or lysis, concomitant with ICE excision, and likely, ICE loss or replication. The donor cell state transitions can be described by using a stochastic model, which predicts that ICE fitness is optimal at low initiation rates in stationary phase. Despite highly variable donor cell fates, ICE transfer is remarkably robust overall, with 75% success after excision. Our results help to better understand ICE behavior and shed a new light on bacterial cellular differentiation during horizontal gene transfer. PMID:27247406

  16. Highly variable individual donor cell fates characterize robust horizontal gene transfer of an integrative and conjugative element

    PubMed Central

    Delavat, François; Mitri, Sara; Pelet, Serge; van der Meer, Jan Roelof


    Horizontal gene transfer is an important evolutionary mechanism for bacterial adaptation. However, given the typical low transfer frequencies in a bacterial population, little is known about the fate and interplay of donor cells and the mobilized DNA during transfer. Here we study transfer of an integrative and conjugative element (ICE) among individual live bacterial cells. ICEs are widely distributed mobile DNA elements that are different than plasmids because they reside silent in the host chromosome and are maintained through vertical descent. Occasionally, ICEs become active, excise, and transmit their DNA to a new recipient, where it is reintegrated. We develop a fluorescent tool to differentiate excision, transfer, and reintegration of a model ICE named ICEclc (for carrying the clc genes for chlorocatechol metabolism) among single Pseudomonas cells by using time-lapse microscopy. We find that ICEclc activation is initiated in stationary phase cells, but excision and transfer predominantly occur only when such cells have been presented with new nutrients. Donors with activated ICE develop a number of different states, characterized by reduced cell division rates or growth arrest, persistence, or lysis, concomitant with ICE excision, and likely, ICE loss or replication. The donor cell state transitions can be described by using a stochastic model, which predicts that ICE fitness is optimal at low initiation rates in stationary phase. Despite highly variable donor cell fates, ICE transfer is remarkably robust overall, with 75% success after excision. Our results help to better understand ICE behavior and shed a new light on bacterial cellular differentiation during horizontal gene transfer. PMID:27247406

  17. Eukaryotic gene invasion by a bacterial mobile insertion sequence element IS2 during cloning into a plasmid vector.


    Senejani, Alireza G; Sweasy, Joann B


    Escherichia coli (E. coli) are commonly used as hosts for DNA cloning and sequencing. Upon transformation of E. coli with recombined vector carrying a gene of interest, the bacteria multiply the gene of interest while maintaining the integrity of its content. During the subcloning of a mouse genomic fragment into a plasmid vector, we noticed that the size of the insert increased significantly upon replication in E. coli. The sequence of the insert was determined and found to contain a novel DNA sequence within the mouse genomic insert. A BLAST search of GenBank revealed the novel sequence to be that of the Insertion Sequence 2 (IS2) element from E. coli that was likely inserted during replication in that organism. Importantly, a detailed search of GenBank shows that the IS2 is present within many eukaryotic nucleotide sequences, and in many cases, has been annotated as being part of the protein. The results of this study suggest that one must perform additional careful analysis of the sequence results using BLAST comparisons, and further verification of gene annotation before submission into the GenBank. PMID:20678256

  18. A multistep bioinformatic approach detects putative regulatory elements in gene promoters

    PubMed Central

    Bortoluzzi, Stefania; Coppe, Alessandro; Bisognin, Andrea; Pizzi, Cinzia; Danieli, Gian Antonio


    Background Searching for approximate patterns in large promoter sequences frequently produces an exceedingly high numbers of results. Our aim was to exploit biological knowledge for definition of a sheltered search space and of appropriate search parameters, in order to develop a method for identification of a tractable number of sequence motifs. Results Novel software (COOP) was developed for extraction of sequence motifs, based on clustering of exact or approximate patterns according to the frequency of their overlapping occurrences. Genomic sequences of 1 Kb upstream of 91 genes differentially expressed and/or encoding proteins with relevant function in adult human retina were analyzed. Methodology and results were tested by analysing 1,000 groups of putatively unrelated sequences, randomly selected among 17,156 human gene promoters. When applied to a sample of human promoters, the method identified 279 putative motifs frequently occurring in retina promoters sequences. Most of them are localized in the proximal portion of promoters, less variable in central region than in lateral regions and similar to known regulatory sequences. COOP software and reference manual are freely available upon request to the Authors. Conclusion The approach described in this paper seems effective for identifying a tractable number of sequence motifs with putative regulatory role. PMID:15904489

  19. The Evolutionary Dynamics of Ribosomal Genes, Histone H3, and Transposable Rex Elements in the Genome of Atlantic Snappers.


    Costa, Gideão Wagner Werneck Félix da; Cioffi, Marcelo de Bello; Bertollo, Luiz Antonio Carlos; Molina, Wagner Franco


    Lutjanidae is a family of primarily marine and carnivorous fishes distributed in the Atlantic, Indian, and Pacific oceans, with enormous economic and ecological importance. In order to better clarify the conservative chromosomal evolution of Lutjanidae, we analyzed the evolutionary dynamics of 5 repetitive DNA classes in 5 Lutjanus and in 1 Ocyurus species from the Western Atlantic. The ribosomal 18S sites were generally located in a single chromosome pair, except for L. jocu and L. alexandrei where they are found in 2 pairs. In turn, the 5S rDNA sites are unique, terminal and nonsyntenic with the 18S rDNA sites. In 3 species analyzed, H3 hisDNA genes were found in 1 chromosomal pair. However, while L. jocu presented 2 H3 sites, O. chrysurus showed a noteworthy dispersion of this gene in almost all chromosomes of the karyotype. Retrotransposons Rex1 and Rex3 do not exhibit any association with the explosive distribution of H3 sequences in O. chrysurus. The low compartmentalization of Rex elements, in addition to the general nondynamic distribution of ribosomal and H3 genes, corroborate the karyotype conservatism in Lutjanidae species, also at the microstructural level. However, some "disturbing evolutionary waves" can break down this conservative scenario, as evidenced by the massive random dispersion of H3 hisDNA in the genome of O. chrysurus. The implication of the genomic expansion of H3 histone genes and their functionality remain unknown, although suggesting that they have higher evolutionary dynamics than previously thought. PMID:26792596

  20. Regulation of glutathione S-transferase Ya subunit gene expression: identification of a unique xenobiotic-responsive element controlling inducible expression by planar aromatic compounds.

    PubMed Central

    Rushmore, T H; King, R G; Paulson, K E; Pickett, C B


    We have identified a region in the 5' flanking sequence of the glutathione S-transferase (RX:glutathione R-transferase, EC Ya subunit gene that contains a unique xenobiotic-responsive element (XRE). The regulatory region spans nucleotides -722 to -682 of the 5' flanking sequence and is responsible for part of the basal level as well as inducible expression of the Ya subunit gene by planar aromatic compounds such as beta-naphthoflavone (beta-NF) and 3-methyl-cholanthrene. The DNA sequence of this region (beta-NF-responsive element) is distinct from the DNA sequence of the XRE found in the cytochrome P-450 IA1 gene. In addition to the region containing the beta-NF-responsive element, two other regulatory regions of the Ya subunit gene have been identified. One region spans nucleotides -867 to -857 and has a DNA sequence with identity to the hepatocyte nuclear factor 1 recognition motif found in several liver-specific genes. The second region spans nucleotides -908 to -899 and contains a DNA sequence with identity to the XRE found in the cytochrome P-450 IA1 gene. The XRE sequence also contributes to part of the responsiveness of the Ya subunit gene to planar aromatic compounds. Our data suggest that regulation of gene expression by planar aromatic compounds can be mediated by a DNA sequence that is distinct from the XRE sequence. Images PMID:2160079

  1. Dosage Compensation of X-Linked Muller Element F Genes but Not X-Linked Transgenes in the Australian Sheep Blowfly

    PubMed Central

    Linger, Rebecca J.; Belikoff, Esther J.; Scott, Maxwell J.


    In most animals that have X and Y sex chromosomes, chromosome-wide mechanisms are used to balance X-linked gene expression in males and females. In the fly Drosophila melanogaster, the dosage compensation mechanism also generally extends to X-linked transgenes. Over 70 transgenic lines of the Australian sheep blowfly Lucilia cuprina have been made as part of an effort to develop male-only strains for a genetic control program of this major pest of sheep. All lines carry a constitutively expressed fluorescent protein marker gene. In all 12 X-linked lines, female larvae show brighter fluorescence than male larvae, suggesting the marker gene is not dosage compensated. This has been confirmed by quantitative RT-PCR for selected lines. To determine if endogenous X-linked genes are dosage compensated, we isolated 8 genes that are orthologs of genes that are on the fourth chromosome in D. melanogaster. Recent evidence suggests that the D. melanogaster fourth chromosome, or Muller element F, is the ancestral X chromosome in Diptera that has reverted to an autosome in Drosophila species. We show by quantitative PCR of male and female DNA that 6 of the 8 linkage group F genes reside on the X chromosome in L. cuprina. The other two Muller element F genes were found to be autosomal in L. cuprina, whereas two Muller element B genes were found on the same region of the X chromosome as the L. cuprina orthologs of the D. melanogaster Ephrin and gawky genes. We find that the L. cuprina X chromosome genes are equally expressed in males and females (i.e., fully dosage compensated). Thus, unlike in Drosophila, it appears that the Lucilia dosage compensation system is specific for genes endogenous to the X chromosome and cannot be co-opted by recently arrived transgenes. PMID:26506426

  2. Dosage Compensation of X-Linked Muller Element F Genes but Not X-Linked Transgenes in the Australian Sheep Blowfly.


    Linger, Rebecca J; Belikoff, Esther J; Scott, Maxwell J


    In most animals that have X and Y sex chromosomes, chromosome-wide mechanisms are used to balance X-linked gene expression in males and females. In the fly Drosophila melanogaster, the dosage compensation mechanism also generally extends to X-linked transgenes. Over 70 transgenic lines of the Australian sheep blowfly Lucilia cuprina have been made as part of an effort to develop male-only strains for a genetic control program of this major pest of sheep. All lines carry a constitutively expressed fluorescent protein marker gene. In all 12 X-linked lines, female larvae show brighter fluorescence than male larvae, suggesting the marker gene is not dosage compensated. This has been confirmed by quantitative RT-PCR for selected lines. To determine if endogenous X-linked genes are dosage compensated, we isolated 8 genes that are orthologs of genes that are on the fourth chromosome in D. melanogaster. Recent evidence suggests that the D. melanogaster fourth chromosome, or Muller element F, is the ancestral X chromosome in Diptera that has reverted to an autosome in Drosophila species. We show by quantitative PCR of male and female DNA that 6 of the 8 linkage group F genes reside on the X chromosome in L. cuprina. The other two Muller element F genes were found to be autosomal in L. cuprina, whereas two Muller element B genes were found on the same region of the X chromosome as the L. cuprina orthologs of the D. melanogaster Ephrin and gawky genes. We find that the L. cuprina X chromosome genes are equally expressed in males and females (i.e., fully dosage compensated). Thus, unlike in Drosophila, it appears that the Lucilia dosage compensation system is specific for genes endogenous to the X chromosome and cannot be co-opted by recently arrived transgenes. PMID:26506426

  3. The Tc1/mariner transposable element family shapes genetic variation and gene expression in the protist Trichomonas vaginalis

    PubMed Central


    Background Trichomonas vaginalis is the most prevalent non-viral sexually transmitted parasite. Although the protist is presumed to reproduce asexually, 60% of its haploid genome contains transposable elements (TEs), known contributors to genome variability. The availability of a draft genome sequence and our collection of >200 global isolates of T. vaginalis facilitate the study and analysis of TE population dynamics and their contribution to genomic variability in this protist. Results We present here a pilot study of a subset of class II Tc1/mariner TEs that belong to the T. vaginalis Tvmar1 family. We report the genetic structure of 19 Tvmar1 loci, their ability to encode a full-length transposase protein, and their insertion frequencies in 94 global isolates from seven regions of the world. While most of the Tvmar1 elements studied exhibited low insertion frequencies, two of the 19 loci (locus 1 and locus 9) show high insertion frequencies of 1.00 and 0.96, respectively. The genetic structuring of the global populations identified by principal component analysis (PCA) of the Tvmar1 loci is in general agreement with published data based on genotyping, showing that Tvmar1 polymorphisms are a robust indicator of T. vaginalis genetic history. Analysis of expression of 22 genes flanking 13 Tvmar1 loci indicated significantly altered expression of six of the genes next to five Tvmar1 insertions, suggesting that the insertions have functional implications for T. vaginalis gene expression. Conclusions Our study is the first in T. vaginalis to describe Tvmar1 population dynamics and its contribution to genetic variability of the parasite. We show that a majority of our studied Tvmar1 insertion loci exist at very low frequencies in the global population, and insertions are variable between geographical isolates. In addition, we observe that low frequency insertion is related to reduced or abolished expression of flanking genes. While low insertion frequencies might be

  4. Evolutionary origin of Rosaceae-specific active non-autonomous hAT elements and their contribution to gene regulation and genomic structural variation.


    Wang, Lu; Peng, Qian; Zhao, Jianbo; Ren, Fei; Zhou, Hui; Wang, Wei; Liao, Liao; Owiti, Albert; Jiang, Quan; Han, Yuepeng


    Transposable elements account for approximately 30 % of the Prunus genome; however, their evolutionary origin and functionality remain largely unclear. In this study, we identified a hAT transposon family, termed Moshan, in Prunus. The Moshan elements consist of three types, aMoshan, tMoshan, and mMoshan. The aMoshan and tMoshan types contain intact or truncated transposase genes, respectively, while the mMoshan type is miniature inverted-repeat transposable element (MITE). The Moshan transposons are unique to Rosaceae, and the copy numbers of different Moshan types are significantly correlated. Sequence homology analysis reveals that the mMoshan MITEs are direct deletion derivatives of the tMoshan progenitors, and one kind of mMoshan containing a MuDR-derived fragment were amplified predominately in the peach genome. The mMoshan sequences contain cis-regulatory elements that can enhance gene expression up to 100-fold. The mMoshan MITEs can serve as potential sources of micro and long noncoding RNAs. Whole-genome re-sequencing analysis indicates that mMoshan elements are highly active, and an insertion into S-haplotype-specific F-box gene was reported to cause the breakdown of self-incompatibility in sour cherry. Taken together, all these results suggest that the mMoshan elements play important roles in regulating gene expression and driving genomic structural variation in Prunus. PMID:26941188

  5. CRISPR-Cas9 Genome Editing of a Single Regulatory Element Nearly Abolishes Target Gene Expression in Mice

    PubMed Central

    Han, Yu; Slivano, Orazio J.; Christie, Christine K.; Cheng, Albert W.; Miano, Joseph M.


    Objective To ascertain the importance of a single regulatory element in the control of Cnn1 expression using CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9) genome editing. Approach and Results The CRISPR/Cas9 system was used to produce 3/18 founder mice carrying point mutations in an intronic CArG box of the smooth muscle cell (SMC)-restricted Cnn1 gene. Each founder was bred for germ line transmission of the mutant CArG box and littermate interbreeding to generate homozygous mutant (Cnn1ΔCArG/ΔCArG) mice. Quantitative RT-PCR, Western blotting, and confocal immunofluorescence microscopy showed dramatic reductions in Cnn1 mRNA and CNN1 protein expression in Cnn1ΔCArG/ΔCArG mice with no change in other SMC-restricted genes and little evidence of off-target edits elsewhere in the genome. In vivo chromatin immunoprecipitation assay revealed a sharp decrease in binding of SRF to the mutant CArG box. Loss of CNN1 expression was coincident with an increase in Ki-67 positive cells in the normal vessel wall. Conclusion CRISPR/Cas9 genome editing of a single CArG box nearly abolishes Cnn1 expression in vivo and evokes increases in SMC DNA synthesis. This facile genome editing system paves the way for a new generation of studies designed to test the importance of individual regulatory elements in living animals, including regulatory variants in conserved sequence blocks linked to human disease. PMID:25538209

  6. Mechanism Profiling of Hepatotoxicity Caused by Oxidative Stress Using Antioxidant Response Element Reporter Gene Assay Models and Big Data

    PubMed Central

    Kim, Marlene Thai; Huang, Ruili; Sedykh, Alexander; Wang, Wenyi; Xia, Menghang; Zhu, Hao


    Background: Hepatotoxicity accounts for a substantial number of drugs being withdrawn from the market. Using traditional animal models to detect hepatotoxicity is expensive and time-consuming. Alternative in vitro methods, in particular cell-based high-throughput screening (HTS) studies, have provided the research community with a large amount of data from toxicity assays. Among the various assays used to screen potential toxicants is the antioxidant response element beta lactamase reporter gene assay (ARE-bla), which identifies chemicals that have the potential to induce oxidative stress and was used to test > 10,000 compounds from the Tox21 program. Objective: The ARE-bla computational model and HTS data from a big data source (PubChem) were used to profile environmental and pharmaceutical compounds with hepatotoxicity data. Methods: Quantitative structure–activity relationship (QSAR) models were developed based on ARE-bla data. The models predicted the potential oxidative stress response for known liver toxicants when no ARE-bla data were available. Liver toxicants were used as probe compounds to search PubChem Bioassay and generate a response profile, which contained thousands of bioassays (> 10 million data points). By ranking the in vitro–in vivo correlations (IVIVCs), the most relevant bioassay(s) related to hepatotoxicity were identified. Results: The liver toxicants profile contained the ARE-bla and relevant PubChem assays. Potential toxicophores for well-known toxicants were created by identifying chemical features that existed only in compounds with high IVIVCs. Conclusion: Profiling chemical IVIVCs created an opportunity to fully explore the source-to-outcome continuum of modern experimental toxicology using cheminformatics approaches and big data sources. Citation: Kim MT, Huang R, Sedykh A, Wang W, Xia M, Zhu H. 2016. Mechanism profiling of hepatotoxicity caused by oxidative stress using antioxidant response element reporter gene assay models and

  7. A novel regulatory element (E77) isolated from CHO-K1 genomic DNA enhances stable gene expression in Chinese hamster ovary cells.


    Kang, Shin-Young; Kim, Yeon-Gu; Kang, Seunghee; Lee, Hong Weon; Lee, Eun Gyo


    Vectors flanked by regulatory DNA elements have been used to generate stable cell lines with high productivity and transgene stability; however, regulatory elements in Chinese hamster ovary (CHO) cells, which are the most widely used mammalian cells in biopharmaceutical production, are still poorly understood. We isolated a novel gene regulatory element from CHO-K1 cells, designated E77, which was found to enhance the stable expression of a transgene. A genomic library was constructed by combining CHO-K1 genomic DNA fragments with a CMV promoter-driven GFP expression vector, and the E77 element was isolated by screening. The incorporation of the E77 regulatory element resulted in the generation of an increased number of clones with high expression, thereby enhancing the expression level of the transgene in the stable transfectant cell pool. Interestingly, the E77 element was found to consist of two distinct fragments derived from different locations in the CHO genome shotgun sequence. High and stable transgene expression was obtained in transfected CHO cells by combining these fragments. Additionally, the function of E77 was found to be dependent on its site of insertion and specific orientation in the vector construct. Our findings demonstrate that stable gene expression mediated by the CMV promoter in CHO cells may be improved by the isolated novel gene regulatory element E77 identified in the present study. PMID:26762773

  8. Identification of a cis-acting element in nitrogen fixation genes recognized by CnfR in the nonheterocystous nitrogen-fixing cyanobacterium Leptolyngbya boryana.


    Tsujimoto, Ryoma; Kamiya, Narumi; Fujita, Yuichi


    The filamentous cyanobacterium Leptolyngbya boryana has the ability to fix nitrogen without any heterocysts under microoxic conditions. Previously, we identified the cnfR gene for a master transcriptional activator for nitrogen fixation (nif) genes in a 50-kb gene cluster containing nif and nif-related genes in L. boryana. We showed that CnfR activates the transcription of nif genes in response to low oxygen conditions, which allows the oxygen-vulnerable enzyme nitrogenase to function. However, the regulatory mechanism that underlies regulation by CnfR remains unknown. In this study, we identified a conserved cis-acting element that is recognized by CnfR. We established a reporter system in the non-diazotrophic cyanobacterium Synechocystis sp. PCC 6803 using luciferase genes (luxAB). Reporter analysis was performed with a series of truncated and modified upstream regulatory regions of nifB and nifP. The cis-element can be divided into nine motifs I-IX, and it is located 76 bp upstream of the transcriptional start sites of nifB and nifP. Six motifs of them are essential for transcriptional activation by CnfR. This cis-acting element is conserved in the upstream regions of nif genes in all diazotrophic cyanobacteria, including Anabaena and Cyanothece, thereby suggesting that the transcriptional regulation by CnfR is widespread in nitrogen-fixing cyanobacteria. PMID:27119437

  9. Analysis of two distinct retinoic acid response elements in the homeobox gene Hoxb1 in transgenic mice.


    Huang, Danyang; Chen, Siming W; Gudas, Lorraine J


    Expression of vertebrate Hox genes is regulated by retinoids such as retinoic acid (RA) in cell culture and in early embryonic development. Retinoic acid response elements (RAREs) have been identified in Hox gene regulatory regions, suggesting that endogenous retinoids may be involved in the direct control of Hox gene patterning functions. Previously, two RAREs located 3' of the murine Hoxb1 gene, a DR(2) RARE and a DR(5) RARE, have been shown to regulate Hoxb1 mRNA expression in the neural epithelium and the foregut region, respectively; the foregut develops into the esophagus, liver, pancreas, lungs, and stomach. We have now examined the functional roles of these two types of 3' RAREs in regulating Hoxb1 expression at different stages of gestation, from embryonic day 7.5 to 13.5, in transgenic mice carrying specific RARE mutations. We demonstrate that the DR(5) RARE is required for the regulation of Hoxb-1 transgene region-specific expression in the gut and extraembryonic tissues, as well as for the RA-induced anteriorization of Hoxb-1 transgene expression in the gut. In contrast, expression of the Hoxb1 transgene in the neural epithelium requires only the DR(2) RARE. By in situ hybridization, we have identified a new site of Hoxb1 expression in the developing forelimbs at approximately day 12.5, and we show that, in transgenic embryos, expression in the forelimb buds requires that either the DR(2) or the DR(5) RARE is functional. Attainment of a high level of Hoxb1 transgene expression in other regions, such as in rhombomere 4 (r4) and in the somites, requires that both the DR(2) and DR(5) RAREs are functional. In addition, our transgenic data indicate that the Hoxb1 gene is expressed in other tissues such as the hernia gut, genital eminence, and lung. Our analysis shows that endogenous retinoids act through individual DR(2) and DR(5) RAREs to regulate Hoxb1 expression in different regions of the embryo and that functional redundancy between these DR(2) and DR(5

  10. Inducer effect on the complex formation between rat liver nuclear proteins and cytochrome P450 2B gene regulatory elements.


    Duzhak, T G; Schwartz, E I; Gulyaeva, L F; Lyakhovich, V V


    DNA gel retardation assay has been applied to the investigation of complexes between rat liver nuclear proteins and Barbie box positive regulatory element of cytochrome P450 2B (CYP2B) genes. The intensities of B1 and B2 bands detected in the absence of an inducer increased after 30 min protein incubation with phenobarbital (PB) or triphenyldioxane (TPD), but not with 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene (TCPOPOB). In addition, a new complex (B3 band) was for the first time detected under induction by PB, TPD, and TCPOPOB. Increase in the incubation time up to 2 h facilitated the formation of other new complexes (B4 and B5 bands), which were detected only in the presence of TPD. The use of [3H]TPD in hybridization experiments revealed that this inducer, capable of binding to Barbie box DNA, is also present in B4 and B5 complexes. It is probable that the investigated compounds activate the same proteins at the initial induction steps, which correlates with the formation of B1, B2, and B3 complexes. The further induction step might be inducer-specific, as indicated by the formation of B4 and B5 complexes in the presence of TPD only. Thus, the present data suggest the possibility of specific gene activation signaling pathways that are dependent on a particular inducer. PMID:12387719

  11. Transcription of the Xenopus laevis selenocysteine tRNA(Ser)Sec gene: a system that combines an internal B box and upstream elements also found in U6 snRNA genes.

    PubMed Central

    Carbon, P; Krol, A


    The transcription mode of the Xenopus tRNA(Ser)Sec gene by RNA polymerase III was deciphered by injection of mutant templates into Xenopus oocyte nuclei. tRNA(Ser)Sec represents the paradigm of a new class of RNA polymerase III genes combining tRNA and U snRNA gene regulatory elements. Its promoter is tripartite, constituted by two upstream elements, a PSE and a TATA motif that are interchangeable with those of U6 snRNA genes and an internal box B as in other tRNAs. The B box enables the transcription level dependent on the upstream promoter to be increased. Data obtained indicate that U1 snRNA (Pol II) and tRNA(Ser)Sec (Pol III) genes share at least one transcription factor, implying that the border between transcription systems is less tight than expected. Images PMID:2001675

  12. A carbon source-responsive promoter element necessary for activation of the isocitrate lyase gene ICL1 is common to genes of the gluconeogenic pathway in the yeast Saccharomyces cerevisiae.

    PubMed Central

    Schöler, A; Schüller, H J


    The expression of yeast genes encoding gluconeogenic enzymes depends strictly on the carbon source available in the growth medium. We have characterized the control region of the isocitrate lyase gene ICL1, which is derepressed more than 200-fold after transfer of cells from fermentative to nonfermentative growth conditions. Deletion analysis of the ICL1 promoter led to the identification of an upstream activating sequence element, UASICL1 (5' CATTCATCCG 3'), necessary and sufficient for conferring carbon source-dependent regulation on a heterologous reporter gene. Similar sequence motifs were also found in the upstream regions of coregulated genes involved in gluconeogenesis. This carbon source-responsive element (CSRE) interacts with a protein factor, designated Ang1 (activator of nonfermentative growth), detectable only in extracts derived from derepressed cells. Gene activation mediated by the CSRE requires the positively acting derepression genes CAT1 (= SNF1 and CCR1) and CAT3 (= SNF4). In the respective mutants, Ang1-CSRE interaction was no longer observed under repressing or derepressing conditions. Since binding of Ang1 factor to the CSRE could be competed for by an upstream sequence derived from the fructose-1,6-bisphosphatase gene FBP1, we propose that the CSRE functions as a UAS element common to genes of the gluconeogenic pathway. Images PMID:8196607

  13. Androgen response element of the glycine N-methyltransferase gene is located in the coding region of its first exon.


    Lee, Cheng-Ming; Yen, Chia-Hung; Tzeng, Tsai-Yu; Huang, Yu-Zen; Chou, Kuan-Hsien; Chang, Tai-Jay; Arthur Chen, Yi-Ming


    Androgen plays an important role in the pathogenesis of PCa (prostate cancer). Previously, we identified GNMT (glycine N-methyltransferase) as a tumour susceptibility gene and characterized its promoter region. Besides, its enzymatic product-sarcosine has been recognized as a marker for prognosis of PCa. The goals of this study were to determine whether GNMT is regulated by androgen and to map its AREs (androgen response elements). Real-time PCR analyses showed that R1881, a synthetic AR (androgen receptor) agonist induced GNMT expression in AR-positive LNCaP cells, but not in AR-negative DU145 cells. In silico prediction showed that there are four putative AREs in GNMT-ARE1, ARE2 and ARE3 are located in the intron 1 and ARE4 is in the intron 2. Consensus ARE motif deduced from published AREs was used to identify the fifth ARE-ARE5 in the coding region of exon 1. Luciferase reporter assay found that only ARE5 mediated the transcriptional activation of R1881. ARE3 overlaps with a YY1 [Yin and Yang 1 (motif (CaCCATGTT, +1118/+1126)] that was further confirmed by antibody supershift and ChIP (chromatin immunoprecipitation) assays. EMSA (electrophoretic mobility shift assay) and ChIP assay confirmed that AR interacts with ARE5 in vitro and in vivo. In summary, GNMT is an AR-targeted gene with its functional ARE located at +19/+33 of the first exon. These results are valuable for the study of the influence of androgen on the gene expression of GNMT especially in the pathogenesis of cancer. PMID:23883094

  14. Influence of far upstream element binding protein 1 gene on chemotherapy sensitivity in human U251 glioblastoma cells

    PubMed Central

    Hong, Yang; Shi, Yu; Shang, Chao; Xue, Yixue


    Introduction The aim of this study was to determine the influence of the far upstream element binding protein 1 gene (FUBP1) on chemotherapy sensitivity in human U251 glioblastoma cells. Material and methods Real-time polymerase chain reaction (PCR) was used to determine the expression of the FUBP1 gene in 43 cases of human brain gliomas. Western blot analysis was used to determine the inhibitory effect of RNA interference on FUBP1 gene expression. Methyl thiazolyl tetrazolium assay (MTT) and flow cytometry methods were used to determine the growth inhibitory rate and apoptosis rate of the U251 cells with FUBP1 silencing. The growth inhibitory rate and apoptosis rate were further determined after treatment of those U251 cells with cisplatin (DDP). Results The expression of FUBP1 mRNA was up-regulated significantly in gliomas, 177.65% as much as in peri-cancerous tissues (p < 0.05). The expression of FUBP1 protein was inhibited significantly with siRNA-FUBP1 (p < 0.05). In FUBP1-silenced cells, the growth inhibitory rate increased from 1.4% to 29.5%, and the apoptosis rate increased from 2.68% to 5.84% (p < 0.05 for both). After treating with DDP at various concentrations (1, 3, 5 µg/ml), the growth inhibitory rate of FUBP1-silenced cells increased from 14.42%, 17.46% and 23.55% to 21.69%, 27.51% and 37.57%; the apoptosis rate increased from 8.85%, 14.37% and 18.21% to 13.25%, 18.46% and 26.52%. Conclusions The up-regulation of FUBP1 relates to the carcinogenesis of gliomas. FUBP1 silencing increases the growth inhibitory rate and apoptosis rate of the U251 cells, and enhances the chemotherapy sensitivity of U251 cells to DDP. PMID:26925132

  15. Isolation of the transposable element hupfer from the entomopathogenic fungus Beauveria bassiana by insertion mutagenesis of the nitrate reductase structural gene.


    Maurer, P; Réjasse, A; Capy, P; Langin, T; Riba, G


    A transposable element has been isolated from the entomopathogenic fungus Beauveria bassiana by trapping it in the nitrate reductase structural gene, which has been cloned from this species. The element had inserted in the first exon of the nia gene and appeared to have duplicated the sequence TA at the site of insertion. It was 3336 bp long with 30-bp imperfect, inverted, terminal repeats. The element, called hupfer, contained an open reading frame encoding a 321-amino acid protein similar to the IS630- or mariner-Tcl-like transposases, and a residual sequence of about 2 kb which was not significantly similar to any published sequence. There are fewer than five copies of this transposable element present per genome in the fungus. PMID:9349711

  16. P-Element Insertion Alleles of Essential Genes on the Third Chromosome of Drosophila Melanogaster: Correlation of Physical and Cytogenetic Maps in Chromosomal Region 86e-87f

    PubMed Central

    Deak, P.; Omar, M. M.; Saunders, RDC.; Pal, M.; Komonyi, O.; Szidonya, J.; Maroy, P.; Zhang, Y.; Ashburner, M.; Benos, P.; Savakis, C.; Siden-Kiamos, I.; Louis, C.; Bolshakov, V. N.; Kafatos, F. C.; Madueno, E.; Modolell, J.; Glover, D. M.


    We have established a collection of 2460 lethal or semi-lethal mutant lines using a procedure thought to insert single P elements into vital genes on the third chromosome of Drosophila melanogaster. More than 1200 randomly selected lines were examined by in situ hybridization and 90% found to contain single insertions at sites that mark 89% of all lettered subdivisions of the Bridges' map. A set of chromosomal deficiencies that collectively uncover ~25% of the euchromatin of chromosome 3 reveal lethal mutations in 468 lines corresponding to 145 complementation groups. We undertook a detailed analysis of the cytogenetic interval 86E-87F and identified 87 P-element-induced mutations falling into 38 complementation groups, 16 of which correspond to previously known genes. Twenty-one of these 38 complementation groups have at least one allele that has a P-element insertion at a position consistent with the cytogenetics of the locus. We have rescued P elements and flanking chromosomal sequences from the 86E-87F region in 35 lines with either lethal or genetically silent P insertions, and used these as probes to identify cosmids and P1 clones from the Drosophila genome projects. This has tied together the physical and genetic maps and has linked 44 previously identified cosmid contigs into seven ``supercontigs'' that span the interval. STS data for sequences flanking one side of the P-element insertions in 49 lines has identified insertions in the αγ element at 87C, two known transposable elements, and the open reading frames of seven putative single copy genes. These correspond to five known genes in this interval, and two genes identified by the homology of their predicted products to known proteins from other organisms. PMID:9409831

  17. Cyclic AMP regulation of the human glycoprotein hormone. cap alpha. -subunit gene is mediated by an 18-base-pair element

    SciTech Connect

    Silver, B.J.; Bokar, J.A.; Virgin, J.B.; Vallen, E.A.; Milsted, A.; Nilson, J.H.


    cAMP regulates transcription of the gene encoding the ..cap alpha..-subunit of human chorionic gonadotropin (hCG) in the choriocarcinoma cells (BeWo). To define the sequences required for regulation by cAMP, the authors inserted fragments from the 5' flanking region of the ..cap alpha..-subunit gene into a test vector containing the simian virus 40 early promoter (devoid of its enhancer) linked to the bacterial chloramphenicol acetyltransferase (CAT) gene. Results from transient expression assays in BeWo cells indicated that a 1500-base-pair (bp) fragment conferred cAMP responsiveness on the CAT gene regardless of position or orientation of the insert relative to the viral promoter. A subfragment extending from position -169 to position -100 had the same effect on cAMP-induced expression. Furthermore, the entire stimulatory effect could be achieved with an 18-bp synthetic oligodeoxynucleotide corresponding to a direct repeat between position -146 and -111. In the absence of cAMP, the ..cap alpha..-subunit 5' flanking sequence also enhanced transcription from the simian virus 40 early promoter. They localized this enhancer activity to the same -169/-100 fragment containing the cAMP response element. The 18-bp element alone, however, had no effect on basal expression. Thus, this short DNA sequence serves as a cAMP response element and also functions independently of other promoter-regulatory elements located in the 5' flanking sequence of the ..cap alpha..-subunit gene.

  18. Conjugal Transfer of Polychlorinated Biphenyl/Biphenyl Degradation Genes in Acidovorax sp. Strain KKS102, Which Are Located on an Integrative and Conjugative Element

    PubMed Central

    Ishibashi, Yoko; Naganawa, Hideaki; Hirokawa, Satoshi; Atobe, Satomi; Nagata, Yuji; Tsuda, Masataka


    A polychlorinated biphenyl (PCB)/biphenyl degradation gene cluster in Acidovorax sp. strain KKS102, which is very similar to that in Tn4371 from Cupriavidus oxalaticus A5, was transferred to several proteobacterial strains by conjugation. The mobilized DNA fragment consisted of 61,807 bp and carried genes for mating-pair formation (mpf), DNA transfer (dtr), integrase (int), and replication-partition proteins (rep-parAB). In the transconjugants, transferred DNA was integrated at ATTGCATCAG or similar sequences. The circular-form integrative and conjugative element (ICE) was detected by PCR, and quantitative PCR analyses revealed that, in KKS102 cells, the ratio of the circular form to the integrated form was very low (approximately 10−5). The circular form was not detected in a mutant of the int gene, which was located at the extreme left and transcribed in the inward direction, and the level of int transcriptional activity was much higher in the circular form than in the integrated form. These findings clearly demonstrated that the genes for PCB/biphenyl degradation in KKS102 cells are located on an ICE, which was named ICEKKS1024677. Comparisons of similar ICE-like elements collected from the public database suggested that those of beta- and gammaproteobacteria were distinguishable from other ICE-like elements, including those in alphaproteobacteria, with respect to the gene composition and gene organization. PMID:22685277

  19. Studying Genes


    ... Area What are genes? Genes are sections of DNA that contain instructions for making the molecules—many ... material in an organism. This includes genes and DNA elements that control the activity of genes. Does ...

  20. A novel mutation of the GATA site in the erythroid cell-specific regulatory element of the ABO gene in a blood donor with the Am B phenotype.


    Oda, A; Isa, K; Ogasawara, K; Kameyama, K; Okuda, K; Hirashima, M; Ishii, H; Kimura, K; Matsukura, H; Hirayama, F; Kawa, K


    The Am and Bm phenotypes are characterized by weak expression of the A or B antigens, respectively, by red blood cells with a normal expression by the saliva of secretors. Deletion of the regulatory element in the first intron of the ABO gene and disruption of the GATA motif in the element were found to be responsible. In this study, we identified a novel mutation within the GATA motif (G>C substitution at position c.28 + 5830) in the regulatory element of the A allele that might diminish transcription activity causing the generation of the Am B phenotype. PMID:25557060

  1. Role of conserved cis-regulatory elements in the post-transcriptional regulation of the human MECP2 gene involved in autism

    PubMed Central


    Background The MECP2 gene codes for methyl CpG binding protein 2 which regulates activities of other genes in the early development of the brain. Mutations in this gene have been associated with Rett syndrome, a form of autism. The purpose of this study was to investigate the role of evolutionarily conserved cis-elements in regulating the post-transcriptional expression of the MECP2 gene and to explore their possible correlations with a mutation that is known to cause mental retardation. Results A bioinformatics approach was used to map evolutionarily conserved cis-regulatory elements in the transcribed regions of the human MECP2 gene and its mammalian orthologs. Cis-regulatory motifs including G-quadruplexes, microRNA target sites, and AU-rich elements have gained significant importance because of their role in key biological processes and as therapeutic targets. We discovered in the 5′-UTR (untranslated region) of MECP2 mRNA a highly conserved G-quadruplex which overlapped a known deletion in Rett syndrome patients with decreased levels of MeCP2 protein. We believe that this 5′-UTR G-quadruplex could be involved in regulating MECP2 translation. We mapped additional evolutionarily conserved G-quadruplexes, microRNA target sites, and AU-rich elements in the key sections of both untranslated regions. Our studies suggest the regulation of translation, mRNA turnover, and development-related alternative MECP2 polyadenylation, putatively involving interactions of conserved cis-regulatory elements with their respective trans factors and complex interactions among the trans factors themselves. We discovered highly conserved G-quadruplex motifs that were more prevalent near alternative splice sites as compared to the constitutive sites of the MECP2 gene. We also identified a pair of overlapping G-quadruplexes at an alternative 5′ splice site that could potentially regulate alternative splicing in a negative as well as a positive way in the MECP2 pre

  2. Transcriptional induction of the mouse metallothionein-I gene in hydrogen peroxide-treated Hepa cells involves a composite major late transcription factor/antioxidant response element and metal response promoter elements.

    PubMed Central

    Dalton, T; Palmiter, R D; Andrews, G K


    Synthesis of metallothionein-I (MT-I) and heme oxygenase mRNAs is rapidly and transiently induced by H2O2 in mouse hepatoma cells (Hepa) and this effect is blocked by catalase. Menadione, which generates free radicals, also induces these mRNAs. Deletion mutagenesis revealed that a region between -42 and -153 in the mouse MT-I promoter was essential for induction of a CAT reporter gene. A multimer of a 16 bp sequence (-101 to -86) that includes an antioxidant response element and overlapping adenovirus major late transcription factor binding site elevated basal expression and allowed induction by H2O2 when inserted upstream of a minimal promoter. However, deletion of this region (-100 to -89) from the intact MT-I promoter (-153) did not completely eliminate response. Multiple copies of a metal response element also permitted response to H2O2. These results suggest that induction of MT-I gene transcription by H2O2 is mediated by at least two different elements within the proximal MT-I gene promoter and suggest a previously undescribed function of the MRE. Induction of MT gene transcription by ROS and the subsequent scavenging of ROS by the MT peptide is reminiscent of the metal regulatory loop and is consistent with the hypothesized protective functions of MT. Images PMID:7800494

  3. Roles of fetal G gamma-globin promoter elements and the adult beta-globin 3' enhancer in the stage-specific expression of globin genes.


    Perez-Stable, C; Costantini, F


    The human fetal G gamma-globin and adult beta-globin genes are expressed in a tissue- and developmental stage-specific pattern in transgenic mice: the G gamma gene in embryonic cells and the beta gene in fetal and adult erythroid cells. Several of the cis-acting DNA sequences thought to be responsible for these patterns of expression are located 5' to the G gamma-globin gene and 3' to the beta-globin gene. To further define the locations and functional roles of these elements, we examined the effects of 5' truncations on the expression of the G gamma-globin gene, as well as the ability of G gamma-globin upstream sequences to alter the developmental regulation of a beta-globin gene, as well as the ability of G gamma-globin upstream sequences to alter the developmental regulation of a beta-globin gene. We found that sequences between -201 and -136 are essential for expression of the G gamma-globin gene, whereas those upstream of -201 have little effect on the level or tissue or stage specificity of G gamma-globin expression. The G gamma-globin upstream sequences from -201 to -136 were, furthermore, capable of activating a linked beta-globin gene in embryonic blood cells; however, a G gamma-globin fragment from -383 to -206 was similarly active in this assay, and the complete fragment from -383 to -136 was considerably more active than either of the smaller fragments, suggesting the presence of multiple cis-acting elements for embryonic blood cells. Our data also suggested the possibility of a negative regulatory element between -201 and -136. These results are discussed in relation to several DNA elements in the G gamma-globin upstream region, which have been shown to bind nuclear factors in erythroid cells. Finally, we observed that removal of the beta-globin 3'-flanking sequences, including the 3' enhancer, from the G gamma-globin upstream-beta-globin hybrid gene resulted in a 25-fold reduction in expression in embryonic blood cells. This suggests that the beta

  4. Gene therapy for hemophilia B with liver-specific element mediated by Rep-RBE site-specific integration system.


    Xu, Zhengxin; Ye, Juan; Zhang, Amin; Xie, Linjun; Shen, Qi; Xue, Jinglun; Chen, Jinzhong


    Adeno-associated virus (AAV) is a nonpathogenic virus capable of targeting human chromosome 19 for integration at AAVS1 site, and a 16 bp Rep binding element (RBE) sequence of AAV was sufficient for mediating this specific integration in the presence of AAV regulation proteins (Rep). Previously, we cotransduced 2 plasmids, pRBE-CMV-hFIX and pRC, into the AAVS1 transgenic mice by hydrodynamic injection, and a long-term expression of human coagulation Factor IX (hFIX) was observed. The corresponding AAVS1 locus site-specific integrations were verified by nested polymerase chain reaction. In this study, we established a novel hFIX expression plasmid, pRBE-HCR-hAAT-hFIX, driven by a liver-specific promoter by replacing the CMV promoter of pRBE-CMV-hFIX with a humanized promoter consisting of HCR-hAAT. The expression of hFIX in vitro was almost the same in transient transfection of pRBE-CMV-hFIX or pRBE-HCR-hAAT-hFIX. AAVS1-specific integrations were identified both in mice transfected with pRC/pRBE-CMV-hFIX cocktail and pRC/pRBE-HCR-hAAT-hFIX cocktail. However, the expression of hFIX of pRBE-HCR-hAAT-hFIX mice was higher and persisted longer. It achieved more than 1% of normal plasma hFIX concentration and maintained for 240 days. The result suggested that RBE-HCR-hAAT element could improve the expression of hFIX and present potential usage of Rep-RBE site-specific integration in gene therapy for hemophilia B. PMID:25295466

  5. Development of crop-specific transposable element (SINE) markers for studying gene flow from oilseed rape to wild radish.


    Prieto, J L; Pouilly, N; Jenczewski, E; Deragon, J M; Chèvre, A M


    The screening of wild populations for evidence of gene flow from a crop to a wild related species requires the unambiguous detection of crop genes within the genome of the wild species, taking into account the intraspecific variability of each species. If the crop and wild relatives share a common ancestor, as is the case for the Brassica crops and their wild relatives (subtribe Brassiceae), the species-specific markers needed to make this unambiguous detection are difficult to identify. In the model oilseed rape (Brassica napus, AACC, 2n = 38)-wild radish (Raphanus raphanistrum, RrRr, 2n = 18) system, we utilized the presence or absence of a short-interspersed element (SINE) at a given locus to develop oilseed rape-specific markers, as SINE insertions are irreversible. By means of sequence-specific amplified polymorphism (SINE-SSAP) reactions, we identified and cloned 67 bands specific to the oilseed rape genome and absent from that of wild radish. Forty-seven PCR-specific markers were developed from three combinations of primers anchored either in (1) the 5'- and 3'-genomic sequences flanking the SINE, (2) the 5'-flanking and SINE internal sequences or (3) the SINE internal and flanking 3'-sequences. Seventeen markers were monomorphic whatever the oilseed rape varieties tested, whereas 30 revealed polymorphism and behaved either as dominant (17) or co-dominant (13) markers. Polymorphic markers were mapped on 19 genomic regions assigned to ten linkage groups. The markers developed will be efficient tools to trace the occurrence and frequency of introgressions of oilseed rape genomic region within wild radish populations. PMID:15942756

  6. Transcriptional induction of IFN-gamma-responsive genes is modulated by DNA surrounding the interferon stimulation response element.

    PubMed Central

    Strehlow, I; Decker, T


    The 9/27 and GBP mRNAs are both inducible by Interferon-gamma (IFN-gamma). The promoters of both genes contain an Interferon Stimulation Response Element (ISRE), but while the GBP gene is strongly induced transcriptionally by IFN-gamma the response of the 9/27 promoter is very weak. We investigated the molecular basis for this difference. The different IFN-gamma-responsiveness was found to have more than one reason. First, 9/27 promoter DNA was unable to bind the Gamma Interferon Activation Factor (GAF) with a single high affinity site. It efficiently competed for the association of the GAF with the GBP promoter but this competition was due to the presence of two low affinity sites, the ISRE and an ISRE-like sequence, suggesting that the GAS and ISRE, though both having clear preferences for specific proteins, may nevertheless share a certain degree of structural homology. Second, the 9/27 and GBP ISREs differed markedly in their affinities for regulatory proteins (ISGFs 1,2,3) and the GBP ISRE was more potent in mediating IFN-gamma-induced promoter activity in transient transfection. Third and most importantly, however, the strong difference between the IFN-gamma response of the two promoters was mainly due to the sequences surrounding the ISRE: the positive-acting GAS on one side and sequences with silencing properties 5' and 3' of the 9/27 ISRE on the other side. The data thus show mechanisms to both up- and down-regulate the activity of the ISRE. Images PMID:1508672

  7. Functional characterization of transcriptional regulatory elements in the upstream region and intron 1 of the human S6 ribosomal protein gene.

    PubMed Central

    Antoine, M; Kiefer, P


    Expression of housekeeping genes involves regulation at comparable levels in a wide spectrum of cells. To define the cis-regulatory elements in the human S6 ribosomal protein (rpS6) gene, we made a series of deletions of the upstream non-transcribed region, including or excluding exon 1 or intron 1 sequences. The mutated rpS6 gene regulatory regions were fused to the chloramphenicol acetyltransferase reporter gene and transfected into HeLa and COS-1 cells. The results have identified three parts of the rpS6 gene that are required for efficient and specific transcription. The core promoter includes only a 40 bp region upstream of the transcription start site and initiation region. Both upstream and intronic elements enhance transcription from the core promoter. Furthermore, mutation of the splice donor site of intron 1 almost completely abolished the enhancing activity of the intronic transcriptional modulator. We used gel retardation assays to identify sequence-specific binding sites in the upstream region and in the proximal half of intron 1. Both common and different nuclear factors that bind the rpS6 gene promoter were identified in extracts from HeLa and COS-1 cells, suggesting that different transcription factors may bind specifically to the same binding region and might be interchangeable in their function to ensure high-level expression of housekeeping genes independently of the cell type. PMID:9820808

  8. Hypoosmotic Expression of Dunaliella bardawil ζ-Carotene Desaturase Is Attributed to a Hypoosmolarity-Responsive Element Different from Other Key Carotenogenic Genes1[C][W

    PubMed Central

    Lao, Yong-Min; Xiao, Lan; Luo, Li-Xin; Jiang, Jian-Guo


    Some key carotenogenic genes (crts) in Dunaliella bardawil are regulated in response to salt stress partly due to salt-inducible cis-acting elements in their promoters. Thus, we isolated and compared the ζ-carotene desaturase (Dbzds) promoter with other crts promoters including phytoene synthase (Dbpsy), phytoene desaturase (Dbpds), and lycopene β-cyclase1 (DblycB1) to identify salt-inducible element(s) in the Dbzds promoter. In silico analysis of the Dbzds promoter found several potential cis-acting elements, such as abscisic acid response element-like sequence, myelocytomatosis oncogene1 recognition motif, AGC box, anaerobic motif2, and activation sequence factor1 binding site. Remarkably, instead of salt-inducible elements, we found a unique regulatory sequence architecture in the Dbzds promoter: a hypoosmolarity-responsive element (HRE) candidate followed by a potential hypoosmolarity-inducible factor GBF5 binding site. Deletion experiments demonstrated that only HRE, but not the GBF5 binding site, is responsible for hypoosmotic expression of the fusion of Zeocin resistance gene (ble) to the enhanced green fluorescent protein (egfp) chimeric gene under salt stress. Dbzds transcripts were in accordance with those of ble-egfp driven by the wild-type Dbzds promoter. Consequently, Dbzds is hypoosmotically regulated by its promoter, and HRE is responsible for this hypoosmotic response. Finally, the hypoosmolarity mechanism of Dbzds was studied by comparing transcript profiles and regulatory elements of Dbzds with those of Dbpsy, Dbpds, DblycB1, and DblycB2, revealing that different induction characteristics of crts may correlate with regulatory sequence architecture. PMID:24632600

  9. Two regulatory elements of similar structure and placed in tandem account for the repressive activity of the first intron of the human apolipoprotein A-II gene.

    PubMed Central

    Bossu, J P; Chartier, F L; Fruchart, J C; Auwerx, J; Staels, B; Laine, B


    Recent reports indicate that apolipoprotein (apo) A-II, the second most abundant protein of high-density lipoproteins, plays a crucial role in counteracting the beneficial effect of apo A-I against atherogenesis. Transcription of the human apo A-II gene is controlled by an enhancer comprising 14 regulatory elements located upstream of its promoter whereas the first intron of this gene behaves as a silencer. Here we show that two sequence elements account for the repressive activity of this intron and correspond to negative regulatory elements termed NRE I and NRE II. The activity of intron I and the nuclear proteins binding to NRE I and II are encountered in hepatic cells but not in non-hepatic cells studied here. Both NREs form nucleoprotein complexes of very similar physicochemical characteristics and bind the same or closely related proteins. Site-directed mutagenesis, transient transfection and gel-shift analysis experiments indicate that both NREs exhibit similar structures, being composed of two sites required for maximal activity and optimal binding of transcription factors. Therefore two negative regulatory elements of similar structure and function, placed in tandem, account for the repressive activity of the first intron of the human apo A-II gene. These NREs do not exhibit structural similarity with known NREs of other genes. PMID:8809045

  10. TFII-I down-regulates a subset of estrogen-responsive genes through its interaction with an initiator element and estrogen receptor alpha.


    Ogura, Yuji; Azuma, Motoki; Tsuboi, Yasunori; Kabe, Yasuaki; Yamaguchi, Yuki; Wada, Tadashi; Watanabe, Hajime; Handa, Hiroshi


    TFII-I was initially identified as the general transcription factor that binds to initiator (Inr) elements in vitro. Subsequent studies have shown that TFII-I activates transcription of various genes either through Inr elements or through other upstream elements in vivo. Since, however, most studies so far on TFII-I have been limited to over-expression and reporter gene assays, we reevaluated the role of TFII-I in vivo by using stable knockdown with siRNA and by examining the expression of endogenous genes. Contrary to the widely accepted view, here we show that TFII-I is not important for cell viability in general but rather inhibits the growth of MCF-7 human breast cancer cells. MCF-7 cells are known to proliferate in an estrogen-dependent manner. Through analysis of TFII-I's cell-type specific growth inhibitory effect, we show evidence that TFII-I down-regulates a subset of estrogen-responsive genes, only those containing Inr elements, by recruiting estrogen receptor (ER) alpha and corepressors to these promoters. Thus, this study has revealed an unexpected new role of TFII-I as a negative regulator of transcription and cell proliferation. PMID:16611241

  11. Duplication of the gamma-globin gene mediated by L1 long interspersed repetitive elements in an early ancestor of simian primates.

    PubMed Central

    Fitch, D H; Bailey, W J; Tagle, D A; Goodman, M; Sieu, L; Slightom, J L


    Regions surrounding the single gamma-globin gene of galago and the duplicated gamma 1- and gamma 2-globin genes of gibbon, rhesus monkey, and spider monkey were sequenced and aligned with those from humans. Contrary to previous studies, spider monkey was found to have not one but two gamma-globin genes, only one of which (gamma 2) is functional. The reconstructed evolutionary history of the gamma-globin genes and their flanking sequences traces their origin to a tandem duplication of a DNA segment approximately 5.5 kilobases long that occurred before catarrhine primates (humans, apes, and Old World monkeys) diverged from platyrrhines (New World monkeys), much earlier than previously thought. This reconstructed molecular history also reveals that the duplication resulted from an unequal homologous crossover between two related L1 long interspersed repetitive elements, one upstream and one downstream of the single ancestral gamma-globin gene. Perhaps facilitated by the redundancy resulting from the duplication, the gamma-globin genes escaped the selective constraints of embryonically functioning genes and evolved into fetally functioning genes. This view is supported by the finding that a burst of nonsynonymous substitutions occurred in the gamma-globin genes while they became restructured for fetal expression in the common ancestor of platyrrhines and catarrhines. PMID:1908094

  12. Transcription of the Schizosaccharomyces pombe U2 gene in vivo and in vitro is directed by two essential promoter elements

    PubMed Central

    Zhou, Dewang; Lobo-Ruppert, Susan M.


    As compared to the metazoan small nuclear RNAs (snRNAs), relatively little is known about snRNA synthesis in unicellular organisms. We have analyzed the transcription of the Schizosaccharomyces pombe U2 snRNA gene in vivo and in the homologous in vitro system. Deletion and linker-scanning analyses show that the S.pombe U2 promoter contains at least two elements: the spUSE centered at –55, which functions as an activator, and a TATA box at –26, which is essential for basal transcription. These data point to a similar architecture among S.pombe, plant and invertebrate snRNA promoters. Factors recognizing the spUSE can be detected in whole cell extracts by DNase I footprinting and competition studies show that the binding of these factors correlates with transcriptional activity. Electrophoretic mobility shift assays and gel-filtration chromatography revealed a native molecular mass of ∼200 kDa for the spUSE binding activity. Two polypeptides of molecular masses 25 and 65 kDa were purified by virtue of their ability to specifically bind the spUSE. PMID:11353068

  13. A composite regulatory element in the first intron of the estrogen-responsive very low density apolipoprotein II gene.


    Shuler, F D; Chu, W W; Wang, S; Evans, M I


    During periods of egg laying in the chicken, when circulating levels of estrogen are increased, the liver-specific estrogen-dependent very low density apolipoprotein II (apoVLDLII) gene is expressed. This expression takes place primarily at the level of transcription, driven by two estrogen response elements that reside in the promoter. In transient transfection assays, expression is increased fourfold when the first intron is added to the promoter construct, indicating that 75% of the regulation comes from intron A. Using in vitro DNase I footprinting, six protein-binding sites were revealed throughout the first intron. The functional significance of these binding sites was evaluated by mutation and transient transfection. Two of the protein-binding regions were shown to increase transcription. Site-specific mutations introduced at either the +66 to +86 or +112 to +129 sites disrupted trans-factor binding and reduced the estrogen-dependent expression by 45% and 34%, respectively. A plasmid containing both mutations resulted in a 43% decrease in expression, indicating that the contributions of these regions are not additive. Competition with known sequences in electrophoretic mobility shift assays suggested that the +66 to +86 site binds a chicken member of the nuclear receptor transcription factor family. PMID:9726251

  14. Functional dissection of an enhancer-like element located within the second intron of the human U2AF1L4 gene.


    Didych, D A; Smirnov, N A; Kotova, E S; Akopov, S B; Nikolaev, L G; Sverdlov, E D


    A detailed functional and evolutionary analysis of an enhancer element of the human genome (enhancer 12) located in the second intron of the U2AF1L4 gene, which we identified earlier, is presented. Overlapping fragments of the studied genome region were analyzed for enhancer activity, and the site responsible for the activity of this element was identified using transient transfections of HeLa cells. Comparison of the enhancer 12 sequence with orthologous sequences from seven primate species revealed the existence of evolutionarily conserved sequences within this element. One of the identified conservative regions is likely responsible for the enhancer activity and is able to specifically interact in vitro with proteins of HeLa cell nuclear extract. The ability of orthologous primate sequences to compete with enhancer 12 for binding with HeLa cell nuclear extract proteins and to enhance the activity of the reporter gene in transient transfection of HeLa cells is demonstrated. PMID:22022969

  15. Transcriptional regulation of genes encoding the selenium-free [NiFe]-hydrogenases in the archaeon Methanococcus voltae involves positive and negative control elements.

    PubMed Central

    Noll, I; Müller, S; Klein, A


    Methanococcus voltae harbors genetic information for two pairs of homologous [NiFe]-hydrogenases. Two of the enzymes contain selenocysteine, while the other two gene groups encode apparent isoenzymes that carry cysteinyl residues in the homologous positions. The genes coding for the selenium-free enzymes, frc and vhc, are expressed only under selenium limitation. They are transcribed out of a common intergenic region. A series of deletions made in the intergenic region localized a common negative regulatory element for the vhc and frc promoters as well as two activator elements that are specific for each of the two transcription units. Repeated sequences, partially overlapping the frc promoter, were also detected. Mutations in these repeated heptanucleotide sequences led to a weak induction of a reporter gene under the control of the frc promoters in the presence of selenium. This result suggests that the heptamer repeats contribute to the negative regulation of the frc transcription unit. PMID:10430564

  16. Genome-Wide Identification of Regulatory Elements and Reconstruction of Gene Regulatory Networks of the Green Alga Chlamydomonas reinhardtii under Carbon Deprivation

    PubMed Central

    Vischi Winck, Flavia; Arvidsson, Samuel; Riaño-Pachón, Diego Mauricio; Hempel, Sabrina; Koseska, Aneta; Nikoloski, Zoran; Urbina Gomez, David Alejandro; Rupprecht, Jens; Mueller-Roeber, Bernd


    The unicellular green alga Chlamydomonas reinhardtii is a long-established model organism for studies on photosynthesis and carbon metabolism-related physiology. Under conditions of air-level carbon dioxide concentration [CO2], a carbon concentrating mechanism (CCM) is induced to facilitate cellular carbon uptake. CCM increases the availability of carbon dioxide at the site of cellular carbon fixation. To improve our understanding of the transcriptional control of the CCM, we employed FAIRE-seq (formaldehyde-assisted Isolation of Regulatory Elements, followed by deep sequencing) to determine nucleosome-depleted chromatin regions of algal cells subjected to carbon deprivation. Our FAIRE data recapitulated the positions of known regulatory elements in the promoter of the periplasmic carbonic anhydrase (Cah1) gene, which is upregulated during CCM induction, and revealed new candidate regulatory elements at a genome-wide scale. In addition, time series expression patterns of 130 transcription factor (TF) and transcription regulator (TR) genes were obtained for cells cultured under photoautotrophic condition and subjected to a shift from high to low [CO2]. Groups of co-expressed genes were identified and a putative directed gene-regulatory network underlying the CCM was reconstructed from the gene expression data using the recently developed IOTA (inner composition alignment) method. Among the candidate regulatory genes, two members of the MYB-related TF family, Lcr1 (Low-CO2 response regulator 1) and Lcr2 (Low-CO2 response regulator 2), may play an important role in down-regulating the expression of a particular set of TF and TR genes in response to low [CO2]. The results obtained provide new insights into the transcriptional control of the CCM and revealed more than 60 new candidate regulatory genes. Deep sequencing of nucleosome-depleted genomic regions indicated the presence of new, previously unknown regulatory elements in the C. reinhardtii genome. Our work can

  17. A strong constitutive positive element is essential for the ammonium-regulated expression of a soybean gene encoding cytosolic glutamine synthetase.


    Tercé-Laforgue, T; Carrayol, E; Cren, M; Desbrosses, G; Hecht, V; Hirel, B


    In order to identify important promoter elements controlling the ammonium-regulated expression of the soybean gene GS15 encoding cytosolic glutamine synthetase, a series of 5' promoter deletions were fused to the GUS reporter gene. To allow the detection of positive and negative regulatory elements, a series of 3' deletions were fused to a -90 CaMV 35S promoter fragment placed upstream of the GUS gene. Both types of construct were introduced into Lotus corniculatus plants and soybean roots via Agrobacterium rhizogenes-mediated transformation. Both spectrophotometric enzymatic analysis and histochemical localization of GUS activity in roots, root nodules and shoots of transgenic plants revealed that a strong constitutive positive element (SCPE) of 400 bp, located in the promoter distal region is indispensable for the ammonium-regulated expression of GS15. Interestingly, this SCPE was able to direct constitutive expression in both a legume and non-legume background to a level similar to that driven by the CaMV 35S full-length promoter. In addition, results showed that separate proximal elements, located in the first 727 bp relative to the transcription start site, are essential for root- and root nodule-specific expression. This proximal region contains an AAAGAT and two TATTTAT consensus sequences characteristic of nodulin or nodule-enhanced gene promoters. A putative silencer region containing the same TATTTAT consensus sequence was identified between the SCPE and the organ-specific elements. The presence of positive, negative and organ-specific elements together with the three TATTTAT consensus sequences within the promoter strongly suggest that these multiple promoter fragments act in a cooperative manner, depending on the spatial conformation of the DNA for trans-acting factor accessibility. PMID:10092182

  18. A G/C-rich DNA-regulatory element controls positive expression of the sea urchin Lytechinus pictus aboral ectoderm-specific LpS1 gene.


    Wang, W; Klein, W H


    The LpS1 beta gene of Lytechinus pictus is activated at the late cleavage stage about 12 hr after fertilization. LpS1 beta transcripts accumulate exclusively in aboral ectoderm lineages. LpS1 beta is thus a classic example of a gene whose expression is tightly controlled both temporally and spatially during early development. Previous studies on the LpS1 beta promoter identified two G-string DNA elements, one proximal and one distal to the LpS1 beta transcriptional start site, which bind to an ectoderm-enriched nuclear factor. In this report, we show that the ectoderm G-string factor binds to a G/C-rich region larger than the G-string itself and that the binding of the G-string factor requires sequences immediately downstream from the G-string. These downstream sequences are essential for full promoter activity. Two regions of 5'-flanking DNA are required for positive control of LpS1 beta, region I from base pairs -762 to -511, and region II, which includes the G/C-rich element, from base pairs -108 to -61. Region I also contains a mesenchyme cell repressor element. The results indicate that LpS1 beta expression is regulated positively in ectoderm cells and negatively in mesenchyme cells. Similar positive and negative control mechanisms regulate the expression of the related Spec genes of Strongylocentrotus purpuratus, but in this gene family the DNA elements are entirely different. We hypothesize that cis-regulatory elements are evolutionarily dynamic and that many different combinations of DNA elements are capable of given rise to aboral ectoderm-specific expression. PMID:8634141

  19. Cis and trans-acting elements involved in the activation of Arabidopsis thaliana A1 gene encoding the translation elongation factor EF-1 alpha.


    Curie, C; Liboz, T; Bardet, C; Gander, E; Médale, C; Axelos, M; Lescure, B


    In A. thaliana the translation elongation factor EF-1 alpha is encoded by a small multigenic family of four members (A1-A4). The A1 gene promoter has been dissected and examined in a transient expression system using the GUS reporter gene. Deletion analysis has shown that several elements are involved in the activation process. One cis-acting domain, the TEF 1 box, has been accurately mapped 100 bp upstream of the transcription initiation site. This domain is the target for trans-acting factors identified in nuclear extracts prepared from A. thaliana. Homologies are found between the TEF 1 box and sequences present at the same location within the A2, A3 and A4 promoters. This observation, together with those obtained from gel retardation assays performed using DNA fragments from the A4 promoter, suggest that the activation process mediated by the TEF 1 element is conserved among the A. thaliana EF-1 alpha genes. Analysis of nearly full length cDNA clones has shown that in addition to a single intron located within the coding region, the A1 gene contains a second intron located within the 5' non coding region. Such an intron is also present within the A2, A3 and A4 genes. This 5' intervening sequence appears to be essential to obtain a maximum GUS activity driven by the A1 gene promoter. PMID:1840652

  20. Cis and trans-acting elements involved in the activation of Arabidopsis thaliana A1 gene encoding the translation elongation factor EF-1 alpha.

    PubMed Central

    Curie, C; Liboz, T; Bardet, C; Gander, E; Médale, C; Axelos, M; Lescure, B


    In A. thaliana the translation elongation factor EF-1 alpha is encoded by a small multigenic family of four members (A1-A4). The A1 gene promoter has been dissected and examined in a transient expression system using the GUS reporter gene. Deletion analysis has shown that several elements are involved in the activation process. One cis-acting domain, the TEF 1 box, has been accurately mapped 100 bp upstream of the transcription initiation site. This domain is the target for trans-acting factors identified in nuclear extracts prepared from A. thaliana. Homologies are found between the TEF 1 box and sequences present at the same location within the A2, A3 and A4 promoters. This observation, together with those obtained from gel retardation assays performed using DNA fragments from the A4 promoter, suggest that the activation process mediated by the TEF 1 element is conserved among the A. thaliana EF-1 alpha genes. Analysis of nearly full length cDNA clones has shown that in addition to a single intron located within the coding region, the A1 gene contains a second intron located within the 5' non coding region. Such an intron is also present within the A2, A3 and A4 genes. This 5' intervening sequence appears to be essential to obtain a maximum GUS activity driven by the A1 gene promoter. Images PMID:1840652

  1. The Steroid Hormone 20-Hydroxyecdysone Enhances Gene Transcription through the cAMP Response Element-binding Protein (CREB) Signaling Pathway.


    Jing, Yu-Pu; Wang, Di; Han, Xiao-Lin; Dong, Du-Juan; Wang, Jin-Xing; Zhao, Xiao-Fan


    Animal steroid hormones regulate gene transcription through genomic pathways by binding to nuclear receptors. These steroid hormones also rapidly increase intracellular calcium and cyclic adenosine monophosphate (cAMP) levels and activate the protein kinase C (PKC) and protein kinase A (PKA) nongenomic pathways. However, the function and mechanism of the nongenomic pathways of the steroid hormones are unclear, and the relationship between the PKC and PKA pathways is also unclear. We propose that the steroid hormone 20-hydroxyecdysone (20E) activates the PKA pathway to enhance 20E-induced gene transcription in the lepidopteran insect Helicoverpa armigera The expression of the catalytic subunit 1 of PKA (PKAC1) increased during metamorphosis, and PKAC1 knockdown blocked pupation and repressed 20E-responsive gene expression. 20E regulated PKAC1 phosphorylation at threonine 200 and nuclear translocation through an ecdysone-responsive G-protein-coupled receptor 2. PKAC1 induced cAMP response element-binding protein (CREB) phosphorylation at serine 143, which bound to the cAMP response element on DNA to enhance 20E-responsive gene transcription. Through ecdysone-responsive G-protein-coupled receptor 2, 20E increased cAMP levels, which induced CREB PKA phosphorylation and 20E-responsive gene expression. This study demonstrates that the PKA/CREB pathway tightly and critically regulates 20E-induced gene transcription as well as its relationship with the 20E-induced PKC pathway. PMID:27129227

  2. Enrichment of Conserved Synaptic Activity-Responsive Element in Neuronal Genes Predicts a Coordinated Response of MEF2, CREB and SRF

    PubMed Central

    Rodríguez-Tornos, Fernanda M.; San Aniceto, Iñigo; Cubelos, Beatriz; Nieto, Marta


    A unique synaptic activity-responsive element (SARE) sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity. We hypothesize that this sequence is a broad mechanism that regulates gene expression in response to synaptic activation and during plasticity; and that analysis of SARE-containing genes could identify molecular mechanisms involved in brain disorders. To search for conserved SARE sequences in the mammalian genome, we used the SynoR in silico tool, and found the SARE cluster predominantly in the regulatory regions of genes expressed specifically in the nervous system; most were related to neural development and homeostatic maintenance. Two of these SARE sequences were tested in luciferase assays and proved to promote transcription in response to neuronal activation. Supporting the predictive capacity of our candidate list, up-regulation of several SARE containing genes in response to neuronal activity was validated using external data and also experimentally using primary cortical neurons and quantitative real time RT-PCR. The list of SARE-containing genes includes several linked to mental retardation and cognitive disorders, and is significantly enriched in genes that encode mRNA targeted by FMRP (fragile X mental retardation protein). Our study thus supports the idea that SARE sequences are relevant transcriptional regulatory elements that participate in plasticity. In addition, it offers a comprehensive view of how activity-responsive transcription factors coordinate their actions and increase the selectivity of their targets. Our data suggest that analysis of SARE-containing genes will reveal yet-undescribed pathways of synaptic plasticity and additional candidate genes disrupted in mental disease. PMID:23382855

  3. Postproliferative transcription of the rat osteocalcin gene is reflected by vitamin D-responsive developmental modifications in protein-DNA interactions at basal and enhancer promoter elements.

    PubMed Central

    Owen, T A; Bortell, R; Shalhoub, V; Heinrichs, A; Stein, J L; Stein, G S; Lian, J B


    In the osteocalcin (OC) gene promoter, both independent positive and negative regulatory elements, as well as others with contiguous [TATA/glucocorticoid-responsive elements (GRE)] or overlapping [TATA/GRE, vitamin D-responsive enhancer elements (VDRE)/AP-1, and OC box/AP-1] domains, are sites for modifications in protein-DNA interactions. In the present studies, we have examined nuclear protein extracts from fetal rat calvarial cells that undergo a developmental sequence of bone cell differentiation. Our results demonstrate modifications in protein-DNA interactions that relate to the developmental stages of the osteoblast and support developmental regulation of OC gene transcription. Basal expression of the OC gene is associated with sequence-specific protein-DNA interactions at the OC box, VDRE, and TATA/GRE box. Distinct differences are observed in proliferating osteoblasts, where the OC gene is not transcribed compared to postproliferative, differentiated osteoblasts that transcribe the OC gene. Furthermore, the protein-DNA complexes that reflect hormonal control are also developmentally regulated, mediating both the transcriptionally active and repressed states of the OC gene. For example, in proliferating osteoblasts, a vitamin D receptor-antibody-sensitive complex is formed that is different from the DNA binding complex induced by vitamin D postproliferatively when the OC gene is transcribed. Mutational analysis of the steroid hormone binding domain and the overlapping AP-1 site at the VDRE supports mutually exclusive occupancy by Fos-Jun heterodimers and vitamin D receptor. Such protein-DNA interactions at the VDRE are consistent with repression of competency for vitamin D-mediated transcriptional enhancement in proliferating osteoblasts expressing high levels of Fos and Jun. Images PMID:8381969

  4. Bladder inflammatory transcriptome in response to tachykinins: Neurokinin 1 receptor-dependent genes and transcription regulatory elements

    PubMed Central

    Saban, Ricardo; Simpson, Cindy; Vadigepalli, Rajanikanth; Memet, Sylvie; Dozmorov, Igor; Saban, Marcia R


    Background Tachykinins (TK), such as substance P, and their neurokinin receptors which are ubiquitously expressed in the human urinary tract, represent an endogenous system regulating bladder inflammatory, immune responses, and visceral hypersensitivity. Increasing evidence correlates alterations in the TK system with urinary tract diseases such as neurogenic bladders, outflow obstruction, idiopathic detrusor instability, and interstitial cystitis. However, despite promising effects in animal models, there seems to be no published clinical study showing that NK-receptor antagonists are an effective treatment of pain in general or urinary tract disorders, such as detrusor overactivity. In order to search for therapeutic targets that could block the tachykinin system, we set forth to determine the regulatory network downstream of NK1 receptor activation. First, NK1R-dependent transcripts were determined and used to query known databases for their respective transcription regulatory elements (TREs). Methods An expression analysis was performed using urinary bladders isolated from sensitized wild type (WT) and NK1R-/- mice that were stimulated with saline, LPS, or antigen to provoke inflammation. Based on cDNA array results, NK1R-dependent genes were selected. PAINT software was used to query TRANSFAC database and to retrieve upstream TREs that were confirmed by electrophoretic mobility shift assays. Results The regulatory network of TREs driving NK1R-dependent genes presented cRel in a central position driving 22% of all genes, followed by AP-1, NF-kappaB, v-Myb, CRE-BP1/c-Jun, USF, Pax-6, Efr-1, Egr-3, and AREB6. A comparison between NK1R-dependent and NK1R-independent genes revealed Nkx-2.5 as a unique discriminator. In the presence of NK1R, Nkx2-5 _01 was significantly correlated with 36 transcripts which included several candidates for mediating bladder development (FGF) and inflammation (PAR-3, IL-1R, IL-6, α-NGF, TSP2). In the absence of NK1R, the matrix Nkx2

  5. Characterization of novel promoter and enhancer elements of the mouse homologue of the Dent disease gene, CLCN5, implicated in X-linked hereditary nephrolithiasis.


    Tanaka, K; Fisher, S E; Craig, I W


    The murine homologue of the human chloride channel gene, CLCN5, defects in which are responsible for Dent disease, has been cloned and characterized. We isolated the entire coding region of mouse Clcn5 cDNA and approximately 45 kb of genomic sequence embracing the gene. To study its transcriptional control, the 5' upstream sequences of the mouse Clcn5 gene were cloned into a luciferase reporter vector. Deletion analysis of 1.5 kb of the 5' flanking sequence defined an active promoter region within 128 bp of the putative transcription start site, which is associated with a TATA motif but lacks a CAAT consensus. Within this sequence, there is a motif with homology to a purine-rich sequence responsible for the kidney-specific promoter activity of the rat CLC-K1 gene, another member of the chloride-channel gene family expressed in kidney. An enhancer element that confers a 10- to 20-fold increase in the promoter activity of the mouse Clcn5 gene was found within the first intron. The organization of the human CLCN5 and mouse Clcn5 gene structures is highly conserved, and the sequence of the murine protein is 98% similar to that of human, with its highest expression seen in the kidney. This study thus provides the first identification of the transcriptional control region of, and the basis for an understanding of the regulatory mechanism that controls, this kidney-specific, chloride-channel gene. PMID:10373326

  6. Shotgun metagenomics reveals a wide array of antibiotic resistance genes and mobile elements in a polluted lake in India

    PubMed Central

    Bengtsson-Palme, Johan; Boulund, Fredrik; Fick, Jerker; Kristiansson, Erik; Larsson, D. G. Joakim


    There is increasing evidence for an environmental origin of many antibiotic resistance genes. Consequently, it is important to identify environments of particular risk for selecting and maintaining such resistance factors. In this study, we described the diversity of antibiotic resistance genes in an Indian lake subjected to industrial pollution with fluoroquinolone antibiotics. We also assessed the genetic context of the identified resistance genes, to try to predict their genetic transferability. The lake harbored a wide range of resistance genes (81 identified gene types) against essentially every major class of antibiotics, as well as genes responsible for mobilization of genetic material. Resistance genes were estimated to be 7000 times more abundant than in a Swedish lake included for comparison, where only eight resistance genes were found. The sul2 and qnrD genes were the most common resistance genes in the Indian lake. Twenty-six known and 21 putative novel plasmids were recovered in the Indian lake metagenome, which, together with the genes found, indicate a large potential for horizontal gene transfer through conjugation. Interestingly, the microbial community of the lake still included a wide range of taxa, suggesting that, across most phyla, bacteria has adapted relatively well to this highly polluted environment. Based on the wide range and high abundance of known resistance factors we have detected, it is plausible that yet unrecognized resistance genes are also present in the lake. Thus, we conclude that environments polluted with waste from antibiotic manufacturing could be important reservoirs for mobile antibiotic resistance genes. PMID:25520706

  7. Analysis of Streptococcus agalactiae pan-genome for prevalence, diversity and functionality of integrative and conjugative or mobilizable elements integrated in the tRNA(Lys CTT) gene.


    Puymège, Aurore; Bertin, Stéphane; Guédon, Gérard; Payot, Sophie


    Streptococcus agalactiae is the first cause of invasive infections in human neonates and is also a major bovine and fish pathogen. High genomic diversity was observed in this species that hosts numerous mobile genetic elements, in particular elements transferable by conjugation. This works aims to evaluate the contribution of these elements to GBS genome diversity. Focusing on genomic islands integrated in the tRNA(Lys) (CTT) gene, a known hotspot of recombination, an extensive in silico search was performed on the sequenced genome of 303 strains of S. agalactiae isolated from different hosts. In all the isolates (except 9), whatever their origin (human, bovine, camel, dog, gray seal, dolphin, fish species or bullfrog), this locus carries highly diverse genomic islands transferable by conjugation such as integrative and conjugative elements (ICEs), integrative and mobilizable elements (IMEs), CIs-mobilizable elements (CIMEs) or composite elements. Transfer of an ICE from an ST67 bovine strain to a phylogenetically distant ST23 human isolate was obtained experimentally indicating that there was no barrier to ICE transfer between strains from different hosts. Interestingly, a novel family of putative IMEs that site-specifically integrate in the nic site of oriT of ICEs belonging to Tn916/ICESt3 superfamily was detected in silico. These elements carry an antibiotic resistance gene (lsa(C)) already described to confer cross-resistance to lincosamides, streptogramins A and pleuromutilins. Further work is needed to evaluate the impact of these IMEs on the transfer of targeted ICEs and the mobility and the dissemination of these IMEs. PMID:25832353

  8. Constitutive transcription of the osteocalcin gene in osteosarcoma cells is reflected by altered protein-DNA interactions at promoter regulatory elements.

    PubMed Central

    Bortell, R; Owen, T A; Shalhoub, V; Heinrichs, A; Aronow, M A; Rochette-Egly, C; Lutz, Y; Stein, J L; Lian, J B; Stein, G S


    The bone-specific osteocalcin (OC) gene is transcribed only after completion of proliferation in normal diploid calvarial-derived osteoblasts during extracellular matrix mineralization. In contrast, the OC gene is expressed constitutively in both proliferating and nonproliferating ROS 17/2.8 osteosarcoma cells. To address molecular mechanisms associated with these tumor-related modifications in transcriptional control, we examined sequence-specific interactions of transactivation factors at key basal and hormone-responsive elements in the OC gene promoter. In ROS 17/2.8 cells compared to normal diploid osteoblasts, the absence of a stringent requirement for cessation of proliferation to support both induction of OC transcription and steroid hormone-mediated transcriptional modulation is reflected by modifications in transcription factor binding at (i) the two primary basal regulatory elements, the OC box (which contains a CCAAT motif as a central core) and the TATA/glucocorticoid-responsive element domain, and (ii) the vitamin D-responsive element. Particularly striking are two forms of the vitamin D receptor complex that are present in proliferating osteoblasts and osteosarcoma cells. Both forms of the complex are sensitive to vitamin D receptor antibody and retinoic X receptor antibody. After the down-regulation of proliferation, only the lower molecular weight complex is found in normal diploid osteoblasts. Both forms of the complex are present in nonproliferating ROS 17/2.8 cells with increased representation of the complex exhibiting reduced electrophoretic mobility that is phosphorylation-dependent. Images Fig. 3 Fig. 5 Fig. 6 PMID:8460137

  9. The STAT3 HIES mutation is a gain-of-function mutation that activates genes via AGG-element carrying promoters.


    Xu, Li; Ji, Jin-Jun; Le, Wangping; Xu, Yan S; Dou, Dandan; Pan, Jieli; Jiao, Yifeng; Zhong, Tianfei; Wu, Dehong; Wang, Yumei; Wen, Chengping; Xie, Guan-Qun; Yao, Feng; Zhao, Heng; Fan, Yong-Sheng; Chin, Y Eugene


    Cytokine or growth factor activated STAT3 undergoes multiple post-translational modifications, dimerization and translocation into nuclei, where it binds to serum-inducible element (SIE, 'TTC(N3)GAA')-bearing promoters to activate transcription. The STAT3 DNA binding domain (DBD, 320-494) mutation in hyper immunoglobulin E syndrome (HIES), called the HIES mutation (R382Q, R382W or V463Δ), which elevates IgE synthesis, inhibits SIE binding activity and sensitizes genes such as TNF-α for expression. However, the mechanism by which the HIES mutation sensitizes STAT3 in gene induction remains elusive. Here, we report that STAT3 binds directly to the AGG-element with the consensus sequence 'AGG(N3)AGG'. Surprisingly, the helical N-terminal region (1-355), rather than the canonical STAT3 DBD, is responsible for AGG-element binding. The HIES mutation markedly enhances STAT3 AGG-element binding and AGG-promoter activation activity. Thus, STAT3 is a dual specificity transcription factor that promotes gene expression not only via SIE- but also AGG-promoter activity. PMID:26384563

  10. An extracellular matrix response element in the promoter of the LpS1 genes of the sea urchin Lytechinus pictus.


    Seid, C A; Ramachandran, R K; George, J M; Govindarajan, V; González-Rimbau, M F; Flytzanis, C N; Tomlinson, C R


    The extracellular matrix (ECM) has been shown to play an important role in development and tissue-specific gene expression, yet the mechanism by which genes receive signals from the ECM is poorly understood. The aboral ectoderm-specific LpS1-alpha and -beta genes of Lytechinus pictus , members of the Spec gene family, provide an excellent model system to study ECM- mediated gene regulation. Disruption of the ECM by preventing collagen deposition using the lathrytic agent beta-aminopropionitrile (BAPN) inhibits LpS1 gene transcription. LpS1 transcription resumes after removal of BAPN and subsequent collagen reformation. Using a chloramphenicol acetyltransferase (CAT) reporter gene assay, we show that a 125 bp region of the LpS1-beta promoter from -108 to +17 contains an ECM response element (ECM RE). Insertion of the 125 bp region into the promoter of the metallothionein gene of L. pictus, a gene unaffected by ECM disruption, caused the fused promoter to become ECM dependent. As with the endogenous LpS1 genes, CAT activity directed by the fused LpS1-beta promoter resumed in embryos recovered from ECM disruption. A mutation in a cis -acting element called the proximal G-string, which lies in the 125 bp region, caused CAT activity levels in ECM-disrupted embryos to equal that of the wild-type LpS1-bet apromoter in ECM-intact embryos. These results suggest that the intact ECM normally transmits signals to inhibit repressor activity at the proximal G-string in aboral ectoderm cells. Consistent with these results were our findings which showed that in addition to expression in the aboral ectoderm, the proximal G-string mutation caused expression of the CAT gene in oral ectoderm cells. These studies suggested that the proximal G-string serves as a binding site for negative regulation of the LpS1 genes in oral ectoderm during development. We also examined trans -acting factors binding the proximal G-string following ECM disruption. Band shift gels revealed a predominant

  11. An extracellular matrix response element in the promoter of the LpS1 genes of the sea urchin Lytechinus pictus.

    PubMed Central

    Seid, C A; Ramachandran, R K; George, J M; Govindarajan, V; González-Rimbau, M F; Flytzanis, C N; Tomlinson, C R


    The extracellular matrix (ECM) has been shown to play an important role in development and tissue-specific gene expression, yet the mechanism by which genes receive signals from the ECM is poorly understood. The aboral ectoderm-specific LpS1-alpha and -beta genes of Lytechinus pictus , members of the Spec gene family, provide an excellent model system to study ECM- mediated gene regulation. Disruption of the ECM by preventing collagen deposition using the lathrytic agent beta-aminopropionitrile (BAPN) inhibits LpS1 gene transcription. LpS1 transcription resumes after removal of BAPN and subsequent collagen reformation. Using a chloramphenicol acetyltransferase (CAT) reporter gene assay, we show that a 125 bp region of the LpS1-beta promoter from -108 to +17 contains an ECM response element (ECM RE). Insertion of the 125 bp region into the promoter of the metallothionein gene of L. pictus, a gene unaffected by ECM disruption, caused the fused promoter to become ECM dependent. As with the endogenous LpS1 genes, CAT activity directed by the fused LpS1-beta promoter resumed in embryos recovered from ECM disruption. A mutation in a cis -acting element called the proximal G-string, which lies in the 125 bp region, caused CAT activity levels in ECM-disrupted embryos to equal that of the wild-type LpS1-bet apromoter in ECM-intact embryos. These results suggest that the intact ECM normally transmits signals to inhibit repressor activity at the proximal G-string in aboral ectoderm cells. Consistent with these results were our findings which showed that in addition to expression in the aboral ectoderm, the proximal G-string mutation caused expression of the CAT gene in oral ectoderm cells. These studies suggested that the proximal G-string serves as a binding site for negative regulation of the LpS1 genes in oral ectoderm during development. We also examined trans -acting factors binding the proximal G-string following ECM disruption. Band shift gels revealed a predominant

  12. A negative cis-acting G-fer element participates in the regulation of expression of the human H-ferritin-encoding gene (FERH).


    Barresi, R; Sirito, M; Karsenty, G; Ravazzolo, R


    Ferritin (Fer) is the major iron storage protein in man. Its synthesis is regulated both at the translational and transcriptional levels. In previous studies on transcriptional regulation of the human H-ferritin-encoding gene (FERH), a 160-bp promoter segment was analyzed [Bevilacqua et al., Gene 111 (1992) 255-260]. In order to obtain a more complete view of the elements involved in the transcriptional regulation of FERH, we have studied, in a further upstream region of the human FERH promoter (pFERH), a sequence between -272 and -291, named G-fer, because it contains a stretch of ten G, which binds a nuclear factor present in different cell types. DNA-binding assays and competition experiments suggest that the factor binding to G-fer has binding properties very similar to inhibitory factor-1 (IF-1), an ubiquitous factor that interacts with G-rich elements in the promoters of the mouse type-I collagen genes. DNA transfection experiments in HeLa cells, using either a wild-type or mutated pFERH fused to a reporter gene, showed that a 3-bp substitution mutation, that abolished the binding of the specific factor to G-fer, increased the promoter activity, thus suggesting an inhibitory role for the G-fer element and its cognate trans-acting factor. PMID:8144027

  13. Separation of the PROX1 gene from upstream conserved elements in a complex inversion/translocation patient with hypoplastic left heart.


    Gill, Harinder K; Parsons, Sian R; Spalluto, Cosma; Davies, Angela F; Knorz, Victoria J; Burlinson, Clare E G; Ng, Bee Ling; Carter, Nigel P; Ogilvie, Caroline Mackie; Wilson, David I; Roberts, Roland G


    Hypoplastic left heart (HLH) occurs in at least 1 in 10 000 live births but may be more common in utero. Its causes are poorly understood but a number of affected cases are associated with chromosomal abnormalities. We set out to localize the breakpoints in a patient with sporadic HLH and a de novo translocation. Initial studies showed that the apparently simple 1q41;3q27.1 translocation was actually combined with a 4-Mb inversion, also de novo, of material within 1q41. We therefore localized all four breakpoints and found that no known transcription units were disrupted. However we present a case, based on functional considerations, synteny and position of highly conserved non-coding sequence elements, and the heterozygous Prox1(+/-) mouse phenotype (ventricular hypoplasia), for the involvement of dysregulation of the PROX1 gene in the aetiology of HLH in this case. Accordingly, we show that the spatial expression pattern of PROX1 in the developing human heart is consistent with a role in cardiac development. We suggest that dysregulation of PROX1 gene expression due to separation from its conserved upstream elements is likely to have caused the heart defects observed in this patient, and that PROX1 should be considered as a potential candidate gene for other cases of HLH. The relevance of another breakpoint separating the cardiac gene ESRRG from a conserved downstream element is also discussed. PMID:19471316

  14. Gain of a New Exon by a Lineage-Specific Alu Element-Integration Event in the BCS1L Gene during Primate Evolution

    PubMed Central

    Park, Sang-Je; Kim, Young-Hyun; Lee, Sang-Rae; Choe, Se-Hee; Kim, Myung-Jin; Kim, Sun-Uk; Kim, Ji-Su; Sim, Bo-Woong; Song, Bong-Seok; Jeong, Kang-Jin; Jin, Yeung-Bae; Lee, Youngjeon; Park, Young-Ho; Park, Young Il; Huh, Jae-Won; Chang, Kyu-Tae


    BCS1L gene encodes mitochondrial protein and is a member of conserved AAA protein family. This gene is involved in the incorporation of Rieske FeS and Qcr10p into complex III of respiratory chain. In our previous study, AluYRa2-derived alternative transcript in rhesus monkey genome was identified. However, this transcript has not been reported in human genome. In present study, we conducted evolutionary analysis of AluYRa2-exonized transcript with various primate genomic DNAs and cDNAs from humans, rhesus monkeys, and crab-eating monkeys. Remarkably, our results show that AluYRa2 element has only been integrated into genomes of Macaca species. This Macaca lineage-specific integration of AluYRa2 element led to exonization event in the first intron region of BCS1L gene by producing a conserved 3′ splice site. Intriguingly, in rhesus and crab-eating monkeys, more diverse transcript variants by alternative splicing (AS) events, including exon skipping and different 5′ splice sites from humans, were identified. Alignment of amino acid sequences revealed that AluYRa2-exonized transcript has short N-terminal peptides. Therefore, AS events play a major role in the generation of various transcripts and proteins during primate evolution. In particular, lineage-specific integration of Alu elements and species-specific Alu-derived exonization events could be important sources of gene diversification in primates. PMID:26537194

  15. cis-Acting elements that control expression of the master virulence regulatory gene atxA in Bacillus anthracis.


    Dale, Jennifer L; Raynor, Malik J; Dwivedi, Prabhat; Koehler, Theresa M


    Transcription of the Bacillus anthracis structural genes for the anthrax toxin proteins and biosynthetic operon for capsule is positively regulated by AtxA, a transcription regulator with unique properties. Consistent with the role of atxA in virulence factor expression, a B. anthracis atxA-null mutant is avirulent in a murine model for anthrax. In culture, multiple signals impact atxA transcript levels, and the timing and steady-state level of atxA expression are critical for optimal toxin and capsule synthesis. Despite the apparent complex control of atxA transcription, only one trans-acting protein, the transition state regulator AbrB, has been demonstrated to interact directly with the atxA promoter. Here we employ 5' and 3' deletion analysis and site-directed mutagenesis of the atxA control region to demonstrate that atxA transcription from the major start site P1 is dependent upon a consensus sequence for the housekeeping sigma factor SigA and an A+T-rich upstream element for RNA polymerase. We also show that an additional trans-acting protein(s) binds specifically to atxA promoter sequences located between -13 and +36 relative to P1 and negatively impacts transcription. Deletion of this region increases promoter activity up to 15-fold. Site-directed mutagenesis of a 9-bp palindromic sequence within the region prevents binding of the trans-acting protein(s), increasing promoter activity 7-fold and resulting in a corresponding increase in AtxA and anthrax toxin production. Notably, an atxA promoter mutant that produced elevated levels of AtxA and toxin proteins during culture was unaffected for virulence in a murine model for anthrax. PMID:22636778


    PubMed Central

    Echeverria, Diana; Woods, James S.; Heyer, Nicholas J.; Martin, Michael D.; Rohlman, Dianne S.; Farin, Federico M.; Li, Tingting


    A functional polymorphism in the serotonin transporter (5-HTT) gene-linked polymorphic region (5-HTTLPR) is reported to affect mood and behavior in humans. In this study, the effects of 5-HTTLPR polymorphism on neurobehavioral and mood domains that are known to be affected by elemental mercury (Hg°) exposure in human subjects were examined. The Behavioral Evaluation for Epidemiologic Studies (BEES) test battery was administered concurrently with urine and buccal-cell collections for 164 male dentists (DD) and 101 female dental assistants (DA) with occupational exposure to Hg° for an average of 19 and 10 yr, respectively. Geometric mean urinary mercury (Hg) levels in DD and DA were 2.52 (2.22) µg/L and 1.98 (1.98) µg/L, respectively. Corresponding indices of chronic occupational Hg° exposure, weighted for historical exposure, were 1212 (1877) and 316 (429). 5-HTTLPR status was 40% and 20% wild type, 40% and 56% single allelic substitution, and 20% and 24% double allelic substitution for the two genders. DD and DA were evaluated separately. Regression analyses controlled for age, premorbid intelligence, frequency of alcohol per week, and education. 5-HTTLPR polymorphism was associated with 5 behavioral measures in DD and with 12 behavioral measures in DA. Mood scores were more consistently associated with the variant in both groups. The strongest evidence for an additive effect for urinary Hg and 5-HTTLPR polymorphism in both groups was for tests of Finger TapAlternate and Hand SteadinessFactor1. Other significant additive effects that were less consistent across groups were also observed. These results add to the growing evidence of genetic determinants of mood and behavior that potentially increase susceptibility to Hg toxicity in humans. PMID:20526950

  17. Cloning and characterization of the dehydration-responsive element-binding protein 2A gene in Eruca vesicaria subsp sativa.


    Huang, B L; Zhang, X K; Li, Y Y; Li, D Y; Ma, M Y; Cai, D T; Wu, W H; Huang, B Q


    Eruca vesicaria subsp sativa is one of the most tolerant Cruciferae species to drought, and dehydration-responsive element-binding protein 2A (DREB2A) is involved in responses to salinity, heat, and particularly drought. In this study, a gene encoding EvDREB2A was cloned and characterized in E. vesicaria subsp sativa. The full-length EvDREB2A cDNA sequence contained a 388-bp 5'-untranslated region (UTR), a 348-bp 3'-UTR, and a 1002-bp open reading frame that encoded 334 amino acid residues. The theoretical isoelectric point of the EvDREB2A protein was 4.80 and the molecular weight was 37.64 kDa. The genomic sequence of EvDREB2A contained no introns. Analysis using SMART indicated that EvDREB2A contains a conserved AP2 domain, similar to other plant DREBs. Phylogenetic analysis revealed that EvDREB2A and DREB2As from Brassica rapa, Eutrema salsugineum, Arabidopsis thaliana, Arabidopsis lyrata, and Arachis hypogaea formed a small subgroup, which clustered with DREB2Bs from A. lyrata, A. thaliana, Camelina sativa, and B. rapa to form a larger subgroup. EvDREB2A is most closely related to B. rapa DREB2A, followed by DREB2As from E. salsugineum, A. thaliana, A. hypogaea, and A. lyrata. A quantitative real-time polymerase chain reaction indicated that EvDREB2A expression was highest in the leaves, followed by the roots and hypocotyls, and was lowest in the flower buds. EvDREB2A could be used to improve drought tolerance in crops. PMID:27525923

  18. Intrauterine growth restriction perturbs nucleosome depletion at a growth hormone-responsive element in the mouse IGF-1 gene.


    McKnight, Robert A; Yost, Christian C; Yu, Xing; Wiedmeier, Julia E; Callaway, Christopher W; Brown, Ashley S; Lane, Robert H; Fung, Camille M


    Intrauterine growth restriction (IUGR) is a common human pregnancy complication. IUGR offspring carry significant postnatal risk for early-onset metabolic syndrome, which is associated with persistent reduction in IGF-1 protein expression. We have previously shown that preadolescent IUGR male mice have decreased hepatic IGF-1 mRNA and circulating IGF-1 protein at postnatal day 21, the age when growth hormone (GH) normally upregulates hepatic IGF-1 expression. Here we studied nucleosome occupancy and CpG methylation at a putative growth hormone-responsive element in intron 2 (in2GHRE) of the hepatic IGF-1 gene in normal, sham-operated, and IUGR mice. Nucleosome occupancy and CpG methylation were determined in embryonic stem cells (ESCs) and in liver at postnatal days 14, 21, and 42. For CpG methylation, additional time points out to 2 yr were analyzed. We confirmed the putative mouse in2GHRE was GH-responsive, and in normal mice, a single nucleosome was displaced from the hepatic in2GHRE by postnatal day 21, which exposed two STAT5b DNA binding sites. Nucleosome displacement correlated with developmentally programmed CpG demethylation. Finally, IUGR significantly altered the nucleosome-depleted region (NDR) at the in2GHRE of IGF-1 on postnatal day 21, with either complete absence of the NDR or with a shifted NDR exposing only one of two STAT5b DNA binding sites. An NDR shift was also seen in offspring of sham-operated mothers. We conclude that prenatal insult such as IUGR or anesthesia/surgery could perturb the proper formation of a well-positioned NDR at the mouse hepatic IGF-1 in2GHRE necessary for transitioning to an open chromatin state. PMID:26487705

  19. SP1-binding elements, within the common metaxin-thrombospondin 3 intergenic region, participate in the regulation of the metaxin gene.

    PubMed Central

    Collins, M; Bornstein, P


    Metaxin (Mtx) is an essential nuclear gene which is expressed ubiquitously in mice and encodes a mitochondrial protein. The gene is located upstream and is transcribed divergently from the thrombospondin 3 (Thbs3) gene; 1352 nucleotides separate the putative translation start sites. Although the Mtx and Thbs3 genes share a common intergenic region, transient transfection experiments in rat chondro-sarcoma cells and in NIH-3T3 fibroblasts demonstrated that the elements required for expression of the Mtx gene are situated within a short proximal promoter and have no major effect on the transcription of Thbs3. The metaxin --377 bp promoter contains four clustered GC boxes between nucleotides --146 and --58 and an inverted GT box between nucleotides --152 and --161, but does not contain TATA or CCAAT boxes. Like many genes regulated by a TATA-less promoter, the transcription start site of metaxin is heterogeneous. The major start site is only 13 bp upstream from the putative translation start site. Electrophoretic mobility shift, competition and supershift assays showed that the ubiquitous transcription factor, Sp1, and, to a lesser extent, the Sp1-related protein, Sp3, bind to four of these Sp1-binding motifs. Co-transfection of metaxin promoter-luciferase constructs and an Sp1 expression vector into Schneider Drosophila cells, which do not synthesize Sp1, demonstrated that the metaxin gene is activated by Sp1. Deletion of the four upstream Sp1-binding elements, on the other hand, demonstrated that these motifs are superfluous in context of the larger Mtx promoter. Thus, despite the potential for common regulatory mechanisms, the available evidence indicates that the Mtx minimal promoter does not significantly affect Thbs3 gene expression. PMID:8871542

  20. Ty1 Integrase Interacts with RNA Polymerase III-specific Subcomplexes to Promote Insertion of Ty1 Elements Upstream of Polymerase (Pol) III-transcribed Genes.


    Cheung, Stephanie; Ma, Lina; Chan, Patrick H W; Hu, Hui-Lan; Mayor, Thibault; Chen, Hung-Ta; Measday, Vivien


    Retrotransposons are eukaryotic mobile genetic elements that transpose by reverse transcription of an RNA intermediate and are derived from retroviruses. The Ty1 retrotransposon of Saccharomyces cerevisiae belongs to the Ty1/Copia superfamily, which is present in every eukaryotic genome. Insertion of Ty1 elements into the S. cerevisiae genome, which occurs upstream of genes transcribed by RNA Pol III, requires the Ty1 element-encoded integrase (IN) protein. Here, we report that Ty1-IN interacts in vivo and in vitro with RNA Pol III-specific subunits to mediate insertion of Ty1 elements upstream of Pol III-transcribed genes. Purification of Ty1-IN from yeast cells followed by mass spectrometry (MS) analysis identified an enrichment of peptides corresponding to the Rpc82/34/31 and Rpc53/37 Pol III-specific subcomplexes. GFP-Trap purification of multiple GFP-tagged RNA Pol III subunits from yeast extracts revealed that the majority of Pol III subunits co-purify with Ty1-IN but not two other complexes required for Pol III transcription, transcription initiation factors (TF) IIIB and IIIC. In vitro binding studies with bacterially purified RNA Pol III proteins demonstrate that Rpc31, Rpc34, and Rpc53 interact directly with Ty1-IN. Deletion of the N-terminal 280 amino acids of Rpc53 abrogates insertion of Ty1 elements upstream of the hot spot SUF16 tRNA locus and abolishes the interaction of Ty1-IN with Rpc37. The Rpc53/37 complex therefore has an important role in targeting Ty1-IN to insert Ty1 elements upstream of Pol III-transcribed genes. PMID:26797132

  1. Hypoxic induction of the human erythropoietin gene: cooperation between the promoter and enhancer, each of which contains steroid receptor response elements.

    PubMed Central

    Blanchard, K L; Acquaviva, A M; Galson, D L; Bunn, H F


    Transcription of the human erythropoietin (Epo) gene is stimulated by exposure to hypoxia and/or cobalt in whole animals and in Hep3B cells. We have systematically investigated the promoter and 3' enhancer elements necessary for this induction by transient transfection of Hep3B cells. We define a promoter region of 53 bp and an enhancer region of 43 bp that confer hypoxia and cobalt inducibility. Each element gives rise to a 6- to 10-fold induction alone. In combination they produce a 50-fold induction after stimulation, similar to the 50- to 100-fold induction of the endogenous Epo gene. Two areas of DNA sequence homology are present in these regions. We demonstrate specific DNA-protein interactions in the enhancer and the ability of the promoter element to compete with these interactions in electrophoretic mobility shift assays. DNase I footprinting and methylation interference data further refine the cis-acting element in the 43-bp enhancer to a short region containing a direct repeat of a steroid/thyroid hormone receptor response element half-site separated by a 2-bp gap. Two half-site consensus sequences are also present in the 53-bp promoter. Site-specific mutation of the half-site sequences in the enhancer destroys the functional activity of the enhancer. Images PMID:1448072

  2. Tissue-specific binding of testis nuclear proteins to a sequence element within the promoter of the testis-specific histone H1t gene.


    Grimes, S R; Wolfe, S A; Koppel, D A


    The rat histone H1t gene is transcribed only in testis germinal cells. This testis-specific chromosomal protein is first synthesized during spermatogenesis in pachytene spermatocytes and the entire complement of testis histones is replaced during the midspermatid stage of spermiogenesis by positively charged transition nuclear proteins TP1 and TP2. Mobility shift assays conducted using crude nuclear protein extracts from different tissues and an 18-bp DNA sequence element within the H1t promoter as a probe reveal binding only with nuclear proteins from testis. The binding is specifically competed with an excess of the same unlabeled DNA fragment but not with heterologous competitors. A larger oligonucleotide corresponding to the same sequence element plus 18 bp of the adjacent downstream H1/CCAAT element binds nuclear proteins from all tissues tested, but a unique low mobility band is formed only with testis extracts. Protein-DNA crosslinking experiments reveal that two major polypeptides with molecular weights of approximately 13 and 30 kDa bind to the 18-bp H1t promoter sequence element. This strong correlation between the tissue where the H1t gene is transcribed and the presence of testis-specific nuclear proteins that bind to a sequence element within the testis histone H1t promoter supports the possibility that these DNA-binding proteins may participate in formation of an active transcription initiation complex with the testis H1t promoter. PMID:1632632

  3. [Preparation and primary genetic analysis of Drosophila melanogaster transformants line w'lz(b)/XXywf, containing mini-white genes, integrated in the genome during P-element-dependent transformation].


    Prokhorova, A V; Voloshina, M A; Shostak, N G; Barskiĭ, V E; Golubovskiĭ, M D


    Transformation of Drosophila melanogaster using P-element-based vectors yielded 129 sublines, which carried mini-white gene copies in the different genome regions. Dependence of mini-white gene expression on the location, gene dosage, and sex of the transformed individuals was analyzed. The mutation lzb was shown to suppress mini-white gene expression, the degree of suppression depending on the location and dosage of the mini-white gene. PMID:7958802

  4. Antisense targeting of 3' end elements involved in DUX4 mRNA processing is an efficient therapeutic strategy for facioscapulohumeral dystrophy: a new gene-silencing approach.


    Marsollier, Anne-Charlotte; Ciszewski, Lukasz; Mariot, Virginie; Popplewell, Linda; Voit, Thomas; Dickson, George; Dumonceaux, Julie


    Defects in mRNA 3'end formation have been described to alter transcription termination, transport of the mRNA from the nucleus to the cytoplasm, stability of the mRNA and translation efficiency. Therefore, inhibition of polyadenylation may lead to gene silencing. Here, we choose facioscapulohumeral dystrophy (FSHD) as a model to determine whether or not targeting key 3' end elements involved in mRNA processing using antisense oligonucleotide drugs can be used as a strategy for gene silencing within a potentially therapeutic context. FSHD is a gain-of-function disease characterized by the aberrant expression of the Double homeobox 4 (DUX4) transcription factor leading to altered pathogenic deregulation of multiple genes in muscles. Here, we demonstrate that targeting either the mRNA polyadenylation signal and/or cleavage site is an efficient strategy to down-regulate DUX4 expression and to decrease the abnormally high-pathological expression of genes downstream of DUX4. We conclude that targeting key functional 3' end elements involved in pre-mRNA to mRNA maturation with antisense drugs can lead to efficient gene silencing and is thus a potentially effective therapeutic strategy for at least FSHD. Moreover, polyadenylation is a crucial step in the maturation of almost all eukaryotic mRNAs, and thus all mRNAs are virtually eligible for this antisense-mediated knockdown strategy. PMID:26787513

  5. Control of human carnitine palmitoyltransferase II gene transcription by peroxisome proliferator-activated receptor through a partially conserved peroxisome proliferator-responsive element.

    PubMed Central

    Barrero, María J; Camarero, Nuria; Marrero, Pedro F; Haro, Diego


    The expression of several genes involved in fatty acid metabolism is regulated by peroxisome proliferator-activated receptors (PPARs). To gain more insight into the control of carnitine palmitoyltransferase (CPT) gene expression, we examined the transcriptional regulation of the human CPT II gene. We show that the 5'-flanking region of this gene is transcriptionally active and binds PPARalpha in vivo in a chromatin immunoprecipitation assay. In addition, we characterized the peroxisome proliferator-responsive element (PPRE) in the proximal promoter of the CPT II gene, which appears to be a novel PPRE. The sequence of this PPRE contains one half-site which is a perfect consensus sequence (TGACCT) but no clearly recognizable second half-site (CAGCAC); this part of the sequence contains only one match to the consensus, which seems to be irrelevant for the binding of PPARalpha. As expected, other members of the nuclear receptor superfamily also bind to this element and repress the activation mediated by PPARalpha, thus showing that the interplay between several nuclear receptors may regulate the entry of fatty acids into the mitochondria, a crucial step in their metabolism. PMID:12408750

  6. Sequence Elements Upstream of the Core Promoter Are Necessary for Full Transcription of the Capsule Gene Operon in Streptococcus pneumoniae Strain D39

    PubMed Central

    Wen, Zhensong; Sertil, Odeniel; Cheng, Yongxin; Zhang, Shanshan; Liu, Xue; Wang, Wen-Ching


    Streptococcus pneumoniae is a major bacterial pathogen in humans. Its polysaccharide capsule is a key virulence factor that promotes bacterial evasion of human phagocytic killing. While S. pneumoniae produces at least 94 antigenically different types of capsule, the genes for biosynthesis of almost all capsular types are arranged in the same locus. The transcription of the capsular polysaccharide (cps) locus is not well understood. This study determined the transcriptional features of the cps locus in the type 2 virulent strain D39. The initial analysis revealed that the cps genes are cotranscribed from a major transcription start site at the −25 nucleotide (G) upstream of cps2A, the first gene in the locus. Using unmarked chromosomal truncations and a luciferase-based transcriptional reporter, we showed that the full transcription of the cps genes not only depends on the core promoter immediately upstream of cps2A, but also requires additional elements upstream of the core promoter, particularly a 59-bp sequence immediately upstream of the core promoter. Unmarked deletions of these promoter elements in the D39 genome also led to significant reduction in CPS production and virulence in mice. Lastly, common cps gene (cps2ABCD) mutants did not show significant abnormality in cps transcription, although they produced significantly less CPS, indicating that the CpsABCD proteins are involved in the encapsulation of S. pneumoniae in a posttranscriptional manner. This study has yielded important information on the transcriptional characteristics of the cps locus in S. pneumoniae. PMID:25733517

  7. Expression of the glycoprotein hormone alpha-subunit gene in the placenta requires a functional cyclic AMP response element, whereas a different cis-acting element mediates pituitary-specific expression.

    PubMed Central

    Bokar, J A; Keri, R A; Farmerie, T A; Fenstermaker, R A; Andersen, B; Hamernik, D L; Yun, J; Wagner, T; Nilson, J H


    The single-copy gene encoding the alpha subunit of glycoprotein hormones is expressed in the pituitaries of all mammals and in the placentas of only primates and horses. We have systematically analyzed the promoter-regulatory elements of the human and bovine alpha-subunit genes to elucidate the molecular mechanisms underlying their divergent patterns of tissue-specific expression. This analysis entailed the use of transient expression assays in a chorionic gonadotropin-secreting human choriocarcinoma cell line, protein-DNA binding assays, and expression of chimeric forms of human or bovine alpha subunit genes in transgenic mice. From the results, we conclude that placental expression of the human alpha-subunit gene requires a functional cyclic AMP response element (CRE) that is present as a tandem repeat in the promoter-regulatory region. In contrast, the promoter-regulatory region of the bovine alpha-subunit gene, as well as of the rat and mouse genes, was found to contain a single CRE homolog that differed from its human counterpart by a single nucleotide. This difference substantially reduced the binding affinity of the bovine CRE homolog for the nuclear protein that bound to the human alpha CRE and thereby rendered the bovine alpha-subunit promoter inactive in human choriocarcinoma cells. However, conversion of the bovine alpha CRE homolog to an authentic alpha CRE restored activity to the bovine alpha-subunit promoter in choriocarcinoma cells. Similarly, a human but not a bovine alpha transgene was expressed in placenta in transgenic mice. Thus, placenta-specific expression of the human alpha-subunit gene may be the consequence of the recent evolution of a functional CRE. Expression of the human alpha transgene in mouse placenta further suggests that evolution of placenta-specific trans-acting factors preceded the appearance of this element. Finally, in contrast to their divergent patterns of placental expression, both the human and bovine alpha

  8. Cis-Regulatory Elements Determine Germline Specificity and Expression Level of an Isopentenyltransferase Gene in Sperm Cells of Arabidopsis1[OPEN

    PubMed Central

    Yuan, Tong; Duan, Xiaomeng; Wei, Xiaoping; Li, Jia


    Flowering plant sperm cells transcribe a divergent and complex complement of genes. To examine promoter function, we chose an isopentenyltransferase gene known as PzIPT1. This gene is highly selectively transcribed in one sperm cell morphotype of Plumbago zeylanica, which preferentially fuses with the central cell during fertilization and is thus a founding cell of the primary endosperm. In transgenic Arabidopsis (Arabidopsis thaliana), PzIPT1 promoter displays activity in both sperm cells and upon progressive promoter truncation from the 5′-end results in a progressive decrease in reporter production, consistent with occurrence of multiple enhancer sites. Cytokinin-dependent protein binding motifs are identified in the promoter sequence, which respond with stimulation by cytokinin. Expression of PzIPT1 promoter in sperm cells confers specificity independently of previously reported Germline Restrictive Silencer Factor binding sequence. Instead, a cis-acting regulatory region consisting of two duplicated 6-bp Male Gamete Selective Activation (MGSA) motifs occurs near the site of transcription initiation. Disruption of this sequence-specific site inactivates expression of a GFP reporter gene in sperm cells. Multiple copies of the MGSA motif fused with the minimal CaMV35S promoter elements confer reporter gene expression in sperm cells. Similar duplicated MGSA motifs are also identified from promoter sequences of sperm cell-expressed genes in Arabidopsis, suggesting selective activation is possibly a common mechanism for regulation of gene expression in sperm cells of flowering plants. PMID:26739233

  9. Short interspersed nuclear elements (SINEs) are abundant in Solanaceae and have a family-specific impact on gene structure and genome organization.


    Seibt, Kathrin M; Wenke, Torsten; Muders, Katja; Truberg, Bernd; Schmidt, Thomas


    Short interspersed nuclear elements (SINEs) are highly abundant non-autonomous retrotransposons that are widespread in plants. They are short in size, non-coding, show high sequence diversity, and are therefore mostly not or not correctly annotated in plant genome sequences. Hence, comparative studies on genomic SINE populations are rare. To explore the structural organization and impact of SINEs, we comparatively investigated the genome sequences of the Solanaceae species potato (Solanum tuberosum), tomato (Solanum lycopersicum), wild tomato (Solanum pennellii), and two pepper cultivars (Capsicum annuum). Based on 8.5 Gbp sequence data, we annotated 82 983 SINE copies belonging to 10 families and subfamilies on a base pair level. Solanaceae SINEs are dispersed over all chromosomes with enrichments in distal regions. Depending on the genome assemblies and gene predictions, 30% of all SINE copies are associated with genes, particularly frequent in introns and untranslated regions (UTRs). The close association with genes is family specific. More than 10% of all genes annotated in the Solanaceae species investigated contain at least one SINE insertion, and we found genes harbouring up to 16 SINE copies. We demonstrate the involvement of SINEs in gene and genome evolution including the donation of splice sites, start and stop codons and exons to genes, enlargement of introns and UTRs, generation of tandem-like duplications and transduction of adjacent sequence regions. PMID:26996788

  10. New invMED1 element cis-activates human multidrug-related MDR1 and MVP genes, involving the LRP130 protein.


    Labialle, Stéphane; Dayan, Guila; Gayet, Landry; Rigal, Dominique; Gambrelle, Joël; Baggetto, Loris G


    The MDR1 gene is a key component of the cytotoxic defense network and its overexpression results in the multidrug resistance (MDR) phenotype. However, the molecular mechanisms that regulate the MDR1 gene and coordinate multiple MDR-related genes expression are poorly understood. In a previous study, we identified a new 12 bp cis-activating region in the 5'-flanking region of the human MDR1 gene, which we called inverted MED1. In the present study, we characterized the precise binding element, which we named invMED1, and revealed the presence of the LRP130 protein as the nuclear factor. Its binding intensity increases with the endogenous MDR1 geneexpression and with the MDR level of CEM leukemia cells. Interestingly, the LRP130 level did not vary with the chemoresistance level. We observed the involvement of LRP130 in the transcriptional activity of the MDR1 gene promoter, and moreover, in that of the MDR-related, invMED1-containing, MVP gene promoter. We used siRNAs and transcriptional decoys in two unrelated human cancer cell lines to show the role of the invMED1/LRP130 couple in both MDR1 and MVP endogenous genes activities. We showed that invMED1 was localized in the -105/-100 and -148/-143 regions of the MDR1 and MVP gene promoters, respectively. In addition, since the invMED1 sequence is primarily located in the -160/-100 bp region of mammalian MDR-related genes, our results present the invMED1/LRP130 couple as a potential central regulator of the transcription of these genes. PMID:15272088

  11. Estrogen response element and the promoter context of the human and mouse lactoferrin genes influence estrogen receptor alpha-mediated transactivation activity in mammary gland cells.


    Stokes, Kenya; Alston-Mills, Brenda; Teng, Christina


    A critical step in estrogen action is the recognition of estrogen responsive elements (EREs) by liganded estrogen receptor. Our current studies were designed to determine whether an extended estrogen response element half-site (ERRE) contributes to the differential estrogen responses of the human and mouse lactoferrin overlapping chicken ovalbumin upstream promoter/ERE sequences (estrogen response modules, ERMs) in the context of their natural promoters. Transient transfections of MCF-7 cells show that liganded estrogen receptor alpha (ERalpha) activates transcription of the human lactoferrin ERM fourfold higher than the mouse lactoferrin ERM in the context of their natural promoters. Since the ERRE of the human lactoferrin gene naturally occurs 18 bp upstream from the ERM and is absent in the mouse lactoferrin gene promoter, we created a chimeric mouse lactoferrin CAT reporter, which now encodes the ERRE in the identical location as in the human lactoferrin gene. The addition of the ERRE in the mouse lactoferrin gene rendered this reporter extremely responsive to estrogen stimulation. Using limited protease digestions and electrophoretic mobility shift assays, we showed that the binding and protease sensitivity of ERalpha bound to the mouse ERM with or without the ERRE, differed. Importantly, occupancy of additional nuclear receptors at the ERRE may contribute to ERalpha binding and activation. Furthermore, the presence of ERRE influences the selectivity of coactivators in liganded ERalpha-mediated transcriptional activity. When the receptor is bound to human and mouse plus genes, which contain the ERRE, steroid receptor coactivator (SRC)-2 was preferred, while SRC-1 and SRC-3 coactivators selectively enhanced the mouse lactoferrin gene activity. Moreover, peroxisome proliferator activated receptor-gamma coactivator-1 (PGC-1alpha) and PGC-1-related estrogen receptor coactivator (PERC) robustly increase the transcriptional function of ERalpha in the presence of the

  12. Expression of the carbohydrate response element binding protein gene and related genes involved in hepatic lipogenesis during post-hatch development of broiler chickens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Carbohydrate response element binding protein (ChREBP) and sterol regulatory element binding protein-1c (SREBP-1c) are important regulators of glucose metabolism and lipid synthesis in mammals. In response to glucose (ChREBP) and insulin (SREBP-1c), these two transcription factors regulate the expre...

  13. Molecular cloning and expression of the carbohydrate response element binding protein gene and related genes involved in hepatic lipogenesis during post-hatch development of broiler chickens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Carbohydrate response element binding protein (ChREBP) and sterol regulatory element binding protein-1c (SREBP-1c) are known to be key regulators of glucose metabolism and lipid synthesis in mammals. Responding to changes in the level of glucose (ChREBP) and insulin (SREBP-1c), these two transcripti...

  14. The UAS(MAL) is a bidirectional promotor element required for the expression of both the MAL61 and MAL62 genes of the Saccharomyces MAL6 locus.


    Levine, J; Tanouye, L; Michels, C A


    Maltose fermentation in Saccharomyces yeasts requires one of five unlinked MAL loci: MAL1, 2, 3, 4, or 6. Each locus consists of three genes encoding maltose permease, maltase and the MAL activator. At MAL6 the genes are called MAL61, MAL62 and MAL63, respectively. Transcription of MAL61 and MAL62 is coordinately induced by maltose and repressed by glucose and this regulation is mediated by the MAL activator. By deletion analysis of the MAL61-MAL62 intergenic region, we show that a 68-basepair region, from base pairs -515 to -582 upstream of the MAL61 start codon, contains a sequence necessary for the maltose-induced expression of MAL61 and MAL62, the UAS(MAL). This sequence contains two copies of an 11-basepair dyad which may be the active elements of the UAS(MAL). Using heterologous gene plasmid constructs, we demonstrate that the UAS(MAL) sequence is sufficient for maltose inducibility of MAL62 and that this regulated expression requires a functional MAL activator. Our results suggest that the MAL61-MAL62 intergenic region contains additional distinct elements which function to precisely regulate MAL61 and/or MAL62 expression. Among these are repressing sequences, including a glucose-responsive element located between base pairs -583 and -638, which is partially responsible for mediating glucose-repression of MAL62 expression. PMID:1525871

  15. Developmental regulation of the human embryonic beta-like globin gene is mediated by synergistic interactions among multiple tissue- and stage-specific elements.

    PubMed Central

    Trepicchio, W L; Dyer, M A; Baron, M H


    The stage-specific regulation of mammalian embryonic globin genes has been an experimentally elusive problem, in part because of the developmentally early timing of their expression. We have carried out a systematic analysis of truncation and internal deletion mutations within the 5'-flanking region of the human embryonic beta-like globin gene (epsilon) in erythroid and nonerythroid cell lines. Within a 670-bp region upstream from the constitutive promoter are multiple positive and negative control elements. Of these, a positive regulatory element (epsilon-PRE II) which is active only in embryonic erythroid cells is of particular interest. Remarkably, although it is inactive on its own, in the presence of other sequences located further upstream, it confers tissue- and developmental stage-specific expression on a constitutive epsilon-globin or heterologous promoter. The activity of epsilon-PRE II is also modulated by another positive regulatory domain located further downstream to direct erythroid cell-specific, but little or no embryonic stage-specific, transcription. A nuclear factor highly enriched in embryonic erythroid cells binds specifically within a 19-bp region of epsilon-PRE II. Nuclei from adult erythroid cells also contain a factor that binds to this region but forms a complex of faster electrophoretic mobility. We speculate that interactions between epsilon-PRE II and other upstream control elements play an important role in the developmental regulation of the human embryonic beta-like globin gene. Images PMID:8246963

  16. Specific binding of nuclear proteins to a bifunctional promoter element upstream of the H1/AC box of the testis-specific histone H1t gene.


    Wolfe, Steven A; Grimes, Sidney R


    The testis-specific histone H1t gene is transcribed exclusively in primary spermatocytes during spermatogenesis. Studies with transgenic mice show that 141 base pairs (bp) of the H1t proximal promoter accompanied with 800 bp of downstream sequence are sufficient for tissue-specific transcription. Nuclear proteins from testis and pachytene spermatocytes produce footprints spanning the region covering the repressor element (RE) from 100 to 125 nucleotides upstream of the H1t transcriptional initiation site. Only testis nuclear proteins bind to the 5'-end of the element and produce a unique, low-mobility complex in electrophoretic mobility shift assays. This testis complex is distinct from the complex formed by a repressor protein derived from several cell lines that binds to the 3'-end of the element. The testis complex band is formed when using nuclear proteins from primary spermatocytes, where the H1t gene is transcribed, and band intensity drops 70%-80% when using nuclear proteins from early spermatids, where H1t gene transcription ceases. Protein-DNA cross-linking experiments using testis nuclear proteins produce electrophoretic bands of 59, 52, and 50 kDa on SDS/PAGE gels. PMID:12606375

  17. The first intron of the 4F2 heavy-chain gene contains a transcriptional enhancer element that binds multiple nuclear proteins

    SciTech Connect

    Karpinski, B.A.; Yang, L.H.; Cacheris, P.; Morle, G.D.; Leiden, J.M.


    The authors utilized the human 4F2 heavy-chain (4F2HC) gene as a model system to study the regulation of inducible gene expression during normal human T-cell activation. Previous studies have demonstrated that 4F2HC gene expression is induced during normal T-cell activation and that the activity of the gene is regulated, at least in part, by the interaction of a constitutively active 5'-flanking housekeeping promoter and a phorbol ester-responsive transcriptional attenuator element located in the exon 1-intron 1 region of the gene. They now report that 4F2HC intron 1 contains a transcriptional enhancer element which is active on a number of heterologous promoters in a variety of murine and human cells. This enhancer element has been mapped to a 187-base-pair RsaI-AluI fragment from 4F2HC intron 1. DNase I footprinting and gel mobility shift analyses demonstrated that this fragment contains two nuclear protein-binding sites (NF-4FA and NF-4FB) which flank a consensus binding site for the inducible AP-1 transcription factor. Deletion analysis showed that the NF-4FA, NF-4FB, and AP-1 sequences are each necessary for full enhancer activity. Murine 4F2HC intron 1 displayed enhancer activity similar to that of its human counterpart. Comparison of the sequences of human and murine 4F2HC intron 1s demonstrated that the NF-4FA, NF-4FB, and AP-1 sequence motifs have been highly conserved during mammalian evolution.

  18. Development and application of a new Silent reporter system to quantitate the activity of enhancer elements in the type II Collagen Gene.


    Ito, Kazuo; Shinomura, Tamayuki


    Type II collagen is a major component of cartilage, which provide structural stiffness to the tissue. As a sufficient amount of type II collagen is critical for maintaining the biomechanical properties of cartilage, its expression is tightly regulated in chondrocytes. Therefore, it is essential to elucidate in detail the transcriptional mechanism that controls expression of type II collagen, in particular by two enhancer elements we recently discovered. To systematically analyze and compare enhancer activities, we developed a novel reporter assay system that exploits site-specific integration of promoter and enhancer elements to activate a transcriptionally silent reporter gene. Using this system, we found that the enhancer elements have distinct characteristics, with one exhibiting additive effects and the other exhibiting synergistic effects when repeated in tandem. PMID:26992640

  19. Cellular localization of the embryo-specific hybrid PRP from Zea mays, and characterization of promoter regulatory elements of its gene.


    Jose-Estanyol, M; Puigdomènech, P


    The expression, regulation and cellular localization of ZmHyPRP, a gene marker of embryo differentiation whose expression declines after ABA induction, was studied. ZmHyPRP is a proline-rich protein with a C-terminal domain having eight cysteines in a CM8 pattern. Transient expression in onion epidermal cells, transformed with a 2x35S::ZmHyPRP-GFP construction, indicated the protein is present in vesicles lining the membrane of the cell. The ZmHyPRP gene expression is under the control of classic promoter seed-specific regulatory elements such as Sph/RY and G-boxes, suggesting regulation by B3 and b-ZIP transcription factors. Promoter deletion analysis, by particle-bombardment transient transformation of maize immature embryos with serial deletions of the promoter fused to GUS, showed the presence of two negative regulatory elements, NE1 (-2070 to -1280) and NE2 (-232 to -178), in the ZmHyPRP promoter. By selective deletion or mutation of ZmHyPRP regulatory promoter elements we conclude that the promoter expression is attenuated by the NE2 element as well as by the G-box2 and the Sph1-2 box together with the G-box2. PMID:22915319

  20. MyoD Is a Novel Activator of Porcine FIT1 Gene by Interacting with the Canonical E-Box Element during Myogenesis

    PubMed Central

    Yan, Chi; Xia, Xiaoliang; He, Junxian; Ren, Zhuqing; Xu, Dequan; Xiong, Yuanzhu; Zuo, Bo


    Fat-induced transcript 1 (FIT1/FITM1) gene is a member of the conserved gene family important for triglyceride-rich lipid droplet accumulation. FIT1 gene displays a similar muscle-specific expression across pigs, mice, and humans. Thus pigs can act as a useful model of many human diseases resulting from misexpression of FIT1 gene. Triglyceride content in skeletal muscle plays a key role in pork meat quality and flavors. An insertion/deletion mutation in porcine FIT1 coding region shows a high correlation with a series of fat traits. To gain better knowledge of the potential role of FIT1 gene in human diseases and the correlations with pork meat quality, our attention is given to the region upstream of the porcine FIT1 coding sequence. We cloned ~1 kb of the 5′-flanking region of porcine FIT1 gene to define the role of this sequence in modulating the myogenic expression. A canonical E-box element that activated porcine FIT1 promoter activity during myogenesis was identified. Further analysis demonstrated that promoter activity was induced by overexpression of MyoD1, which bound to this canonical E-box during C2C12 differentiation. This is the first evidence that FIT1 as the direct novel target of MyoD is involved in muscle development. PMID:26492245

  1. Genomic organization of the Neurospora crassa gsn gene: possible involvement of the STRE and HSE elements in the modulation of transcription during heat shock.


    Freitas, F Zanolli; Bertolini, M C


    Glycogen synthase, an enzyme involved in glycogen biosynthesis, is regulated by phosphorylation and by the allosteric ligand glucose-6-phosphate (G6P). In addition, enzyme levels can be regulated by changes in gene expression. We recently cloned a cDNA for glycogen synthase ( gsn) from Neurospora crassa, and showed that gsn transcription decreased when cells were exposed to heat shock (shifted from 30 degrees C to 45 degrees C). In order to understand the mechanisms that control gsn expression, we isolated the gene, including its 5' and 3' flanking regions, from the genome of N. crassa. An ORF of approximately 2.4 kb was identified, which is interrupted by four small introns (II-V). Intron I (482 bp) is located in the 5'UTR region. Three putative Transcription Initiation Sites (TISs) were mapped, one of which lies downstream of a canonical TATA-box sequence (5'-TGTATAAA-3'). Analysis of the 5'-flanking region revealed the presence of putative transcription factor-binding sites, including Heat Shock Elements (HSEs) and STress Responsive Elements (STREs). The possible involvement of these motifs in the negative regulation of gsn transcription was investigated using Electrophoretic Mobility Shift Assays (EMSA) with nuclear extracts of N. crassa mycelium obtained before and after heat shock, and DNA fragments encompassing HSE and STRE elements from the 5'-flanking region. While elements within the promoter region are involved in transcription under heat shock, elements in the 5'UTR intron may participate in transcription during vegetative growth. The results thus suggest that N. crassa possesses trans -acting elements that interact with the 5'-flanking region to regulate gsn transcription during heat shock and vegetative growth. PMID:15558319

  2. Identification of positively and negatively acting elements regulating expression of the E2F2 gene in response to cell growth signals.

    PubMed Central

    Sears, R; Ohtani, K; Nevins, J R


    Mammalian cell growth is governed by regulatory activities that include the products of genes such as c-myc and ras that act early in G1, as well as the E2F family of transcription factors that accumulate later in G1 to regulate the expression of genes involved in DNA replication. Previous work has shown that the expression of the E2F1, E2F2, and E2F3 gene products is tightly regulated by cell growth. To further explore the mechanisms controlling accumulation of E2F activity, we have isolated genomic sequences flanking the 5' region of the E2F2 coding sequence. Various assays demonstrate promoter activity in this sequence that reproduces the normal control of E2F2 expression during a growth stimulation. Sequence comparison reveals the presence of a variety of known transcription factor binding sites, including E-box elements that are consensus Myc binding sites, as well as E2F binding sites. We demonstrate that the E-box elements, which we show can function as Myc-responsive sites, contribute in a positive fashion to promoter function. We also find that E2F-dependent negative regulation in quiescent cells plays a significant role in the cell growth-dependent control of the promoter, similar to the regulation of the E2F1 gene promoter. PMID:9271400

  3. Gap junctional communication modulates gene transcription by altering the recruitment of Sp1 and Sp3 to connexin-response elements in osteoblast promoters

    NASA Technical Reports Server (NTRS)

    Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto


    Loss-of-function mutations of gap junction proteins, connexins, represent a mechanism of disease in a variety of tissues. We have shown that recessive (gene deletion) or dominant (connexin45 overexpression) disruption of connexin43 function results in osteoblast dysfunction and abnormal expression of osteoblast genes, including down-regulation of osteocalcin transcription. To elucidate the molecular mechanisms of gap junction-sensitive transcriptional regulation, we systematically analyzed the rat osteocalcin promoter for sensitivity to gap junctional intercellular communication. We identified an Sp1/Sp3 containing complex that assembles on a minimal element in the -70 to -57 region of the osteocalcin promoter in a gap junction-dependent manner. This CT-rich connexin-response element is necessary and sufficient to confer gap junction sensitivity to the osteocalcin proximal promoter. Repression of osteocalcin transcription occurs as a result of displacement of the stimulatory Sp1 by the inhibitory Sp3 on the promoter when gap junctional communication is perturbed. Modulation of Sp1/Sp3 recruitment also occurs on the collagen Ialpha1 promoter and translates into gap junction-sensitive transcriptional control of collagen Ialpha1 gene expression. Thus, regulation of Sp1/Sp3 recruitment to the promoter may represent a potential general mechanism for transcriptional control of target genes by signals passing through gap junctions.

  4. Cutting edge: a cis-acting DNA element targets AID-mediated sequence diversification to the chicken Ig light chain gene locus.


    Kothapalli, Nagarama; Norton, Darrell D; Fugmann, Sebastian D


    Somatic hypermutation and gene conversion are two closely related processes that increase the diversity of the primary Ig repertoire. Both processes are initiated by the activation-induced cytidine deaminase that converts cytosine residues to uracils in a transcription-dependent manner; these lesions are subsequently fixed in the genome by direct replication and error-prone DNA repair. Two alternative mechanisms were proposed to explain why this mutagenic activity is targeted almost exclusively to Ig loci: 1) specific cis-acting DNA sequences; or 2) very high levels of Ig gene transcription. In this study we now identify a novel 3' regulatory region in the chicken Ig light chain gene containing not only a classical transcriptional enhancer but also cis-acting DNA elements essential for targeting activation-induced cytidine deaminase-mediated sequence diversification to this locus. PMID:18250404

  5. Increased Variation in Adh Enzyme Activity in Drosophila Mutation-Accumulation Experiment Is Not Due to Transposable Elements at the Adh Structural Gene

    PubMed Central

    Aquadro, C. F.; Tachida, H.; Langley, C. H.; Harada, K.; Mukai, T.


    We present here a molecular analysis of the region surrounding the structural gene encoding alcohol dehydrogenase (Adh) in 47 lines of Drosophila melanogaster that have each accumulated mutations for 300 generations. While these lines show a significant increase in variation of alcohol dehydrogenase enzyme activity compared to control lines, we found no restriction map variation in a 13-kb region including the complete Adh structural gene and roughly 5 kb of both 5' and 3' sequences. Thus, the rapid accumulation of ADH activity variation after 28,200 allele generations does not appear to have been due to the mobilization of transposable elements into or out of the Adh structural gene region. PMID:1963870

  6. Selective repression of gene expression in neuropathic pain by the neuron-restrictive silencing factor/repressor element-1 silencing transcription (NRSF/REST).


    Willis, Dianna E; Wang, Meng; Brown, Elizabeth; Fones, Lilah; Cave, John W


    Neuropathic pain often develops following nerve injury as a result of maladaptive changes that occur in the injured nerve and along the nociceptive pathways of the peripheral and central nervous systems. Multiple cellular and molecular mechanisms likely account for these changes; however, the exact nature of these mechanisms remain largely unknown. A growing number of studies suggest that alteration in gene expression is an important step in the progression from acute to chronic pain states and epigenetic regulation has been proposed to drive this change in gene expression. In this review, we discuss recent evidence that the DNA-binding protein neuron-restrictive silencing factor/repressor element-1 silencing transcription factor (NRSF/REST) is an important component in the development and maintenance of neuropathic pain through its role as a transcriptional regulator for a select subset of genes that it normally represses during development. PMID:26679228

  7. Molecular cloning and expression of chicken carbohydrate response element binding protein and Max-like protein X gene homologues

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Carbohydrate response element binding protein (ChREBP) and sterol regulatory element binding protein-1c (SREBP-1c) are transcription factors that are known to be key regulators of glucose metabolism and lipid synthesis in mammals. Since ChREBP and its co-activator Max-like protein X (Mlx) have not ...

  8. Genome-wide prediction of nucleosome occupancy in maize reveals plant chromatin structural features at genes and other elements at multiple scales.


    Fincher, Justin A; Vera, Daniel L; Hughes, Diana D; McGinnis, Karen M; Dennis, Jonathan H; Bass, Hank W


    The nucleosome is a fundamental structural and functional chromatin unit that affects nearly all DNA-templated events in eukaryotic genomes. It is also a biochemical substrate for higher order, cis-acting gene expression codes and the monomeric structural unit for chromatin packaging at multiple scales. To predict the nucleosome landscape of a model plant genome, we used a support vector machine computational algorithm trained on human chromatin to predict the nucleosome occupancy likelihood (NOL) across the maize (Zea mays) genome. Experimentally validated NOL plots provide a novel genomic annotation that highlights gene structures, repetitive elements, and chromosome-scale domains likely to reflect regional gene density. We established a new genome browser ( for viewing support vector machine-based NOL scores. This annotation provides sequence-based comprehensive coverage across the entire genome, including repetitive genomic regions typically excluded from experimental genomics data. We find that transposable elements often displayed family-specific NOL profiles that included distinct regions, especially near their termini, predicted to have strong affinities for nucleosomes. We examined transcription start site consensus NOL plots for maize gene sets and discovered that most maize genes display a typical +1 nucleosome positioning signal just downstream of the start site but not upstream. This overall lack of a -1 nucleosome positioning signal was also predicted by our method for Arabidopsis (Arabidopsis thaliana) genes and verified by additional analysis of previously published Arabidopsis MNase-Seq data, revealing a general feature of plant promoters. Our study advances plant chromatin research by defining the potential contribution of the DNA sequence to observed nucleosome positioning and provides an invariant baseline annotation against which other genomic data can be compared. PMID:23572549

  9. Peroxisome proliferator activated receptor α (PPARα) and PPAR gamma coactivator (PGC-1α) induce carnitine palmitoyltransferase IA (CPT-1A) via independent gene elements

    PubMed Central

    Song, Shulan; Attia, Ramy R.; Connaughton, Sara; Niesen, Melissa I.; Ness, Gene C.; Elam, Marshall B.; Hori, Roderick T.; Cook, George A.; Park, Edwards A.


    Long chain fatty acids and pharmacologic ligands for the peroxisome proliferator activated receptor alpha (PPARα) activate expression of genes involved in fatty acid and glucose oxidation including carnitine palmitoyltransferase-1A (CPT-1A) and pyruvate dehydrogenase kinase 4 (PDK4). CPT-1A catalyzes the transfer of long chain fatty acids from acyl-CoA to carnitine for translocation across the mitochondrial membranes and is an initiating step in the mitochondrial oxidation of long chain fatty acids. PDK4 phosphorylates and inhibits the pyruvate dehydrogenase complex (PDC) which catalyzes the conversion of pyruvate to acetyl-CoA in the glucose oxidation pathway. The activity of CPT-1A is modulated both by transcriptional changes as well as by malonyl-CoA inhibition. In the liver, CPT-1A and PDK4 gene expression are induced by starvation, high fat diets and PPARα ligands. Here, we characterized a binding site for PPARα in the second intron of the rat CPT-1A gene. Our studies indicated that WY14643 and long chain fatty acids induce CPT-1A gene expression through this element. In addition, we found that mutation of the PPARα binding site reduced the expression of CPT-1A-luciferase vectors in the liver of fasted rats. We had demonstrated previously that CPT-1A was stimulated by the peroxisome proliferator activated receptor gamma coactivator (PGC-1α) via sequences in the first intron of the rat CPT-1A gene. Surprisingly, PGC-1α did not enhance CPT-1A transcription through the PPARα binding site in the second intron. Following knockdown of PGC-1α with short hairpin RNA, the CPT-1A and PDK4 genes remained responsive to WY14643. Overall, our studies indicated that PPARα and PGC-1α stimulate transcription of the CPT-1A gene through different regions of the CPT-1A gene. PMID:20638986

  10. A genome-wide analysis of open chromatin in human epididymis epithelial cells reveals candidate regulatory elements for genes coordinating epididymal function.


    Bischof, Jared M; Gillen, Austin E; Song, Lingyun; Gosalia, Nehal; London, Darin; Furey, Terrence S; Crawford, Gregory E; Harris, Ann


    The epithelium lining the epididymis has a pivotal role in ensuring a luminal environment that can support normal sperm maturation. Many of the individual genes that encode proteins involved in establishing the epididymal luminal fluid are well characterized. They include ion channels, ion exchangers, transporters, and solute carriers. However, the molecular mechanisms that coordinate expression of these genes and modulate their activities in response to biological stimuli are less well understood. To identify cis-regulatory elements for genes expressed in human epididymis epithelial cells, we generated genome-wide maps of open chromatin by DNase-seq. This analysis identified 33,542 epididymis-selective DNase I hypersensitive sites (DHS), which were not evident in five cell types of different lineages. Identification of genes with epididymis-selective DHS at their promoters revealed gene pathways that are active in immature epididymis epithelial cells. These include processes correlating with epithelial function and also others with specific roles in the epididymis, including retinol metabolism and ascorbate and aldarate metabolism. Peaks of epididymis-selective chromatin were seen in the androgen receptor gene and the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which has a critical role in regulating ion transport across the epididymis epithelium. In silico prediction of transcription factor binding sites that were overrepresented in epididymis-selective DHS identified epithelial transcription factors, including ELF5 and ELF3, the androgen receptor, Pax2, and Sox9, as components of epididymis transcriptional networks. Active genes, which are targets of each transcription factor, reveal important biological processes in the epididymis epithelium. PMID:24006278

  11. Caffeic acid phenethyl ester stimulates human antioxidant response element-mediated expression of the NAD(P)H:quinone oxidoreductase (NQO1) gene.


    Jaiswal, A K; Venugopal, R; Mucha, J; Carothers, A M; Grunberger, D


    Caffeic acid phenethyl ester (CAPE) is a phenolic antioxidant derived from the propolis of honeybee hives. CAPE was shown to inhibit the formation of intracellular hydrogen peroxide and oxidized bases in DNA of 12-O-tetradecanoylphorbol-13-acetate (TPA)-treated HeLa cells and was also found to induce a redox change that correlated with differential growth effects in transformed cells but not the nontumorigenic parental ones. Mediated via the electrophile or human antioxidant response element (hARE), induction of the expression of NAD(P)H quinone oxidoreductase (NQO1) and glutathione S-transferase Ya subunit genes by certain phenolic antioxidants has been correlated with the chemopreventive properties of these agents. Here, we determined by Northern analysis that CAPE treatment of hepatoma cells stimulates NQO1 gene expression in cultured human hepatoma cells (HepG2), and we characterized the effects of CAPE treatment on the expression of a reporter gene either containing or lacking the hARE or carrying a mutant version of this element in rodent hepatoma (Hepa-1) transfectants. A dose-dependent transactivation of human hARE-mediated chloramphenicol acetyltransferase (cat) gene expression was observed upon treatments of the Hepa-1 transfectants with TPA, a known inducer, as well as with CAPE. The combined treatments resulted in an apparent additive stimulation of the reporter expression. To learn whether this activation of cat gene expression was effected by protein kinase C in CAPE-treated cells, a comparison was made of cat gene activity after addition of calphostin, a protein kinase C inhibitor. Calphostin reduced the cat gene induction by TPA but not by CAPE, suggesting that stimulation of gene expression in this system by these agents proceeds via distinct mechanisms. Band-shift experiments to examine binding of transactivator proteins from nuclear extracts of treated and untreated cells to a hARE DNA probe showed that TPA exposure increased the binding level

  12. Complex organization of promoter and enhancer elements regulate the tissue- and developmental stage-specific expression of the Drosophila melanogaster Gld gene.

    PubMed Central

    Keplinger, B L; Guo, X; Quine, J; Feng, Y; Cavener, D R


    The Drosophila melanogaster Gld gene has multiple and diverse developmental and physiological functions. We report herein that interactions among proximal promoter elements and a cluster of intronically located enhancers and silencers specify the complex regulation of Gld that underlies its diverse functions. Gld expression in nonreproductive tissues is largely determined by proximal promoter elements with the exception of the embryonic labium where Gld is activated by an enhancer within the first intron. A nuclear protein, GPAL, has been identified that binds the Gpal elements in the proximal promoter region. Regulation of Gld in the reproductive organs is particularly complex, involving interactions among the Gpal proximal promoter elements, a unique TATA box, three distinct enhancer types, and one or more silencer elements. The three somatic reproductive organ enhancers each activate expression in male and female pairs of reproductive organs. One of these pairs, the male ejaculatory duct and female oviduct, are known to be developmentally homologous. We report evidence that the other two pairs of organs are developmentally homologous as well. A comprehensive model to explain the full developmental regulation of Gld and its evolution is presented. PMID:11156990

  13. An ethylene-responsive enhancer element is involved in the senescence-related expression of the carnation glutathione-S-transferase (GST1) gene.


    Itzhaki, H; Maxson, J M; Woodson, W R


    The increased production of ethylene during carnation petal senescence regulates the transcription of the GST1 gene encoding a subunit of glutathione-S-transferase. We have investigated the molecular basis for this ethylene-responsive transcription by examining the cis elements and trans-acting factors involved in the expression of the GST1 gene. Transient expression assays following delivery of GST1 5' flanking DNA fused to a beta-glucuronidase receptor gene were used to functionally define sequences responsible for ethylene-responsive expression. Deletion analysis of the 5' flanking sequences of GST1 identified a single positive regulatory element of 197 bp between -667 and -470 necessary for ethylene-responsive expression. The sequences within this ethylene-responsive region were further localized to 126 bp between -596 and -470. The ethylene-responsive element (ERE) within this region conferred ethylene-regulated expression upon a minimal cauliflower mosaic virus-35S TATA-box promoter in an orientation-independent manner. Gel electrophoresis mobility-shift assays and DNase I footprinting were used to identify proteins that bind to sequences within the ERE. Nuclear proteins from carnation petals were shown to specifically interact with the 126-bp ERE and the presence and binding of these proteins were independent of ethylene or petal senescence. DNase I footprinting defined DNA sequences between -510 and -488 within the ERE specifically protected by bound protein. An 8-bp sequence (ATTTCAAA) within the protected region shares significant homology with promoter sequences required for ethylene responsiveness from the tomato fruit-ripening E4 gene. PMID:8090746

  14. Human T-cell leukemia virus type 1 Tax activates transcription of the human fra-1 gene through multiple cis elements responsive to transmembrane signals.

    PubMed Central

    Tsuchiya, H; Fujii, M; Niki, T; Tokuhara, M; Matsui, M; Seiki, M


    We have shown that Tax1 of human T-cell leukemia virus type 1 stimulates the expression of several cellular immediate-early genes (M. Fujii, T. Niki, T. Mori, T. Matsuda, M. Matsui, N. Nomura, and M. Seiki, Oncogene 6:1023-1029, 1991). In this study, the 5'-flanking region of the human fra-1 gene, which is a Tax1-inducible fos-related gene, was isolated and Tax1 or serum-responsive cis elements were analyzed to obtain further insight into the mechanism of Tax1 action. The 62-bp sequence starting 46 nucleotides upstream from the translation initiation site showed 71% homology with the sequence surrounding the TATA box of the c-fos promoter. Regulatory motifs identified in the c-fos promoter, such as an Ets-binding site, E boxes, a CArG box, c-fos AP-1 sites, and two retinoblastoma control elements, were also found upstream of the c-fos homology region. A 502-bp fragment containing these motifs mediated transcriptional activation by Tax1 or by serum in a transient transfection assay. Three independent Tax1-responsive regions (TRRs) were identified, and mutations in each revealed that one of the retinoblastoma control elements in TRR1 and the c-fos AP-1 sites in TRR2 and TRR3 were essential for the activation. Although TRR2 contains a CArG box-like sequence, it was a weak binding site for p67SRF, if it bound at all, and was not required for activation. All three TRRs could also mediate the signals stimulated by serum. Thus, Tax1 appears to activate fra-1 gene expression by means of a part of the cellular machinery similar to that which mediates growth signals. Images PMID:8230424

  15. Differential Expression of the Arabidopsis Cytochrome c Genes Cytc-1 and Cytc-2. Evidence for the Involvement of TCP-Domain Protein-Binding Elements in Anther- and Meristem-Specific Expression of the Cytc-1 Gene1

    PubMed Central

    Welchen, Elina; Gonzalez, Daniel H.


    The promoters of the Arabidopsis (Arabidopsis thaliana) cytochrome c genes, Cytc-1 and Cytc-2, were analyzed using plants transformed with fusions to the β-glucuronidase coding sequence. Histochemical staining of plants indicated that the Cytc-1 promoter directs preferential expression in root and shoot meristems and in anthers. In turn, plants transformed with the Cytc-2 promoter fusions showed preferential expression in vascular tissues of cotyledons, leaves, roots, and hypocotyls, and also in anthers. Quantitative measurements in extracts prepared from different organs suggested that expression of Cytc-1 is higher in flowers, while that of Cytc-2 is higher in leaves. The analysis of a set of deletions and site-directed mutants of the Cytc-1 promoter indicated that a segment located between −147 and −156 from the translation start site is required for expression and that site II elements (TGGGCC/T) located in this region, coupled with a downstream internal telomeric repeat (AAACCCTAA), are responsible for the expression pattern of this gene. Proteins present in cauliflower nuclear extracts, as well as a recombinant protein from the TCP-domain family, were able to specifically bind to the region required for expression. We propose that expression of the Cytc-1 gene is linked to cell proliferation through the elements described above. The fact that closely located site II motifs are present in similar locations in several genes encoding proteins involved in cytochrome c-dependent respiration suggests that these elements may be the target of factors that coordinate the expression of nuclear genes encoding components of this part of the mitochondrial respiratory chain. PMID:16113211

  16. A genome-wide cis-regulatory element discovery method based on promoter sequences and gene co-expression networks

    PubMed Central


    Background Deciphering cis-regulatory networks has become an attractive yet challenging task. This paper presents a simple method for cis-regulatory network discovery which aims to avoid some of the common problems of previous approaches. Results Using promoter sequences and gene expression profiles as input, rather than clustering the genes by the expression data, our method utilizes co-expression neighborhood information for each individual gene, thereby overcoming the disadvantages of current clustering based models which may miss specific information for individual genes. In addition, rather than using a motif database as an input, it implements a simple motif count table for each enumerated k-mer for each gene promoter sequence. Thus, it can be used for species where previous knowledge of cis-regulatory motifs is unknown and has the potential to discover new transcription factor binding sites. Applications on Saccharomyces cerevisiae and Arabidopsis have shown that our method has a good prediction accuracy and outperforms a phylogenetic footprinting approach. Furthermore, the top ranked gene-motif regulatory clusters are evidently functionally co-regulated, and the regulatory relationships between the motifs and the enriched biological functions can often be confirmed by literature. Conclusions Since this method is simple and gene-specific, it can be readily utilized for insufficiently studied species or flexibly used as an additional step or data source for previous transcription regulatory networks discovery models. PMID:23368633

  17. Hypoxia-inducible nuclear factors bind to an enhancer element located 3' to the human erythropoietin gene.

    PubMed Central

    Semenza, G L; Nejfelt, M K; Chi, S M; Antonarakis, S E


    Human erythropoietin gene expression in liver and kidney is inducible by anemia or hypoxia. DNase I-hypersensitive sites were identified 3' to the human erythropoietin gene in liver nuclei. A 256-base-pair region of 3' flanking sequence was shown by DNase I protection and electrophoretic mobility-shift assays to bind four or more different nuclear factors, at least two of which are induced by anemia in both liver and kidney, and the region functioned as a hypoxia-inducible enhancer in transient expression assays. These results provide insight into the molecular basis for the regulation of gene expression by a fundamental physiologic stimulus, hypoxia. Images PMID:2062846

  18. RT-qPCR gene expression analysis in zebrafish: Preanalytical precautions and use of expressed repetitive elements for normalization.


    Vanhauwaert, S; Lefever, S; Coucke, P; Speleman, F; De Paepe, A; Vandesompele, J; Willaert, A


    Gene expression analysis is increasingly important in many fields of biological research. Understanding patterns of expressed genes is assumed to provide insight into complex regulatory networks and can lead to the identification of genes relevant to specific biological processes, including disease. Among different techniques, reverse transcription quantitative polymerase chain reaction (RT-qPCR) is currently regarded as the gold standard for targeted quantification of RNA gene expression, especially because of its high sensitivity, specificity, accuracy, and precision, and also because of its practical simplicity and processing speed. However, different critical factors can influence the outcome of RT-qPCR studies, including isolation of RNA, reverse transcription to cDNA, and data analysis. These factors need to be addressed in order to obtain biologically meaningful results. In this chapter, we describe how RT-qPCR can be used in a reliable way to successfully study differential gene expression in zebrafish. Hereby, we especially focus on how expressed repetitive elements can be employed as reference targets in zebrafish RT-qPCR studies and how they can further improve the quality of the data. PMID:27443934

  19. Analysis of Five Gene Sets in Chimpanzees Suggests Decoupling between the Action of Selection on Protein-Coding and on Noncoding Elements

    PubMed Central

    Santpere, Gabriel; Carnero-Montoro, Elena; Petit, Natalia; Serra, François; Hvilsom, Christina; Rambla, Jordi; Heredia-Genestar, Jose Maria; Halligan, Daniel L.; Dopazo, Hernan; Navarro, Arcadi; Bosch, Elena


    We set out to investigate potential differences and similarities between the selective forces acting upon the coding and noncoding regions of five different sets of genes defined according to functional and evolutionary criteria: 1) two reference gene sets presenting accelerated and slow rates of protein evolution (the Complement and Actin pathways); 2) a set of genes with evidence of accelerated evolution in at least one of their introns; and 3) two gene sets related to neurological function (Parkinson’s and Alzheimer’s diseases). To that effect, we combine human–chimpanzee divergence patterns with polymorphism data obtained from target resequencing 20 central chimpanzees, our closest relatives with largest long-term effective population size. By using the distribution of fitness effect-alpha extension of the McDonald–Kreitman test, we reproduce inferences of rates of evolution previously based only on divergence data on both coding and intronic sequences and also obtain inferences for other classes of genomic elements (untranslated regions, promoters, and conserved noncoding sequences). Our results suggest that 1) the distribution of fitness effect-alpha method successfully helps distinguishing different scenarios of accelerated divergence (adaptation or relaxed selective constraints) and 2) the adaptive history of coding and noncoding sequences within the gene sets analyzed is decoupled. PMID:25977458

  20. Analysis of Five Gene Sets in Chimpanzees Suggests Decoupling between the Action of Selection on Protein-Coding and on Noncoding Elements.


    Santpere, Gabriel; Carnero-Montoro, Elena; Petit, Natalia; Serra, François; Hvilsom, Christina; Rambla, Jordi; Heredia-Genestar, Jose Maria; Halligan, Daniel L; Dopazo, Hernan; Navarro, Arcadi; Bosch, Elena


    We set out to investigate potential differences and similarities between the selective forces acting upon the coding and noncoding regions of five different sets of genes defined according to functional and evolutionary criteria: 1) two reference gene sets presenting accelerated and slow rates of protein evolution (the Complement and Actin pathways); 2) a set of genes with evidence of accelerated evolution in at least one of their introns; and 3) two gene sets related to neurological function (Parkinson's and Alzheimer's diseases). To that effect, we combine human-chimpanzee divergence patterns with polymorphism data obtained from target resequencing 20 central chimpanzees, our closest relatives with largest long-term effective population size. By using the distribution of fitness effect-alpha extension of the McDonald-Kreitman test, we reproduce inferences of rates of evolution previously based only on divergence data on both coding and intronic sequences and also obtain inferences for other classes of genomic elements (untranslated regions, promoters, and conserved noncoding sequences). Our results suggest that 1) the distribution of fitness effect-alpha method successfully helps distinguishing different scenarios of accelerated divergence (adaptation or relaxed selective constraints) and 2) the adaptive history of coding and noncoding sequences within the gene sets analyzed is decoupled. PMID:25977458

  1. High Fractional Occupancy of a Tandem Maf Recognition Element and Its Role in Long-Range β-Globin Gene Regulation.


    Stees, Jared R; Hossain, Mir A; Sunose, Tomoki; Kudo, Yasushi; Pardo, Carolina E; Nabilsi, Nancy H; Darst, Russell P; Poudyal, Rosha; Igarashi, Kazuhiko; Huang, Suming; Kladde, Michael P; Bungert, Jörg


    Enhancers and promoters assemble protein complexes that ultimately regulate the recruitment and activity of RNA polymerases. Previous work has shown that at least some enhancers form stable protein complexes, leading to the formation of enhanceosomes. We analyzed protein-DNA interactions in the murine β-globin gene locus using the methyltransferase accessibility protocol for individual templates (MAPit). The data show that a tandem Maf recognition element (MARE) in locus control region (LCR) hypersensitive site 2 (HS2) reveals a remarkably high degree of occupancy during differentiation of mouse erythroleukemia cells. Most of the other transcription factor binding sites in LCR HS2 or in the adult β-globin gene promoter regions exhibit low fractional occupancy, suggesting highly dynamic protein-DNA interactions. Targeting of an artificial zinc finger DNA-binding domain (ZF-DBD) to the HS2 tandem MARE caused a reduction in the association of MARE-binding proteins and transcription complexes at LCR HS2 and the adult βmajor-globin gene promoter but did not affect expression of the βminor-globin gene. The data demonstrate that a stable MARE-associated footprint in LCR HS2 is important for the recruitment of transcription complexes to the adult βmajor-globin gene promoter during erythroid cell differentiation. PMID:26503787

  2. High Fractional Occupancy of a Tandem Maf Recognition Element and Its Role in Long-Range β-Globin Gene Regulation

    PubMed Central

    Stees, Jared R.; Hossain, Mir A.; Sunose, Tomoki; Kudo, Yasushi; Pardo, Carolina E.; Nabilsi, Nancy H.; Darst, Russell P.; Poudyal, Rosha; Igarashi, Kazuhiko; Kladde, Michael P.


    Enhancers and promoters assemble protein complexes that ultimately regulate the recruitment and activity of RNA polymerases. Previous work has shown that at least some enhancers form stable protein complexes, leading to the formation of enhanceosomes. We analyzed protein-DNA interactions in the murine β-globin gene locus using the methyltransferase accessibility protocol for individual templates (MAPit). The data show that a tandem Maf recognition element (MARE) in locus control region (LCR) hypersensitive site 2 (HS2) reveals a remarkably high degree of occupancy during differentiation of mouse erythroleukemia cells. Most of the other transcription factor binding sites in LCR HS2 or in the adult β-globin gene promoter regions exhibit low fractional occupancy, suggesting highly dynamic protein-DNA interactions. Targeting of an artificial zinc finger DNA-binding domain (ZF-DBD) to the HS2 tandem MARE caused a reduction in the association of MARE-binding proteins and transcription complexes at LCR HS2 and the adult βmajor-globin gene promoter but did not affect expression of the βminor-globin gene. The data demonstrate that a stable MARE-associated footprint in LCR HS2 is important for the recruitment of transcription complexes to the adult βmajor-globin gene promoter during erythroid cell differentiation. PMID:26503787

  3. LPS injection reprograms the expression and the 3' UTR of a CAP gene by alternative polyadenylation and the formation of a GAIT element in Ciona intestinalis.


    Vizzini, Aiti; Bonura, Angela; Longo, Valeria; Sanfratello, Maria Antonietta; Parrinello, Daniela; Cammarata, Matteo; Colombo, Paolo


    The diversification of cellular functions is one of the major characteristics of multicellular organisms which allow cells to modulate their gene expression, leading to the formation of transcripts and proteins with different functions and concentrations in response to different stimuli. CAP genes represent a widespread family of proteins belonging to the cysteine-rich secretory protein, antigen 5 and pathogenesis-related 1 superfamily which, it has been proposed, play key roles in the infection process and the modulation of immune responses in host animals. The ascidian Ciona intestinalis represents a group of proto-chordates with an exclusively innate immune system that has been widely studied in the field of comparative and developmental immunology. Using this biological system, we describe the identification of a novel APA mechanism by which an intronic polyadenylation signal is activated by LPS injection, leading to the formation of a shorter CAP mRNA capable of expressing the first CAP exon plus 19 amino acid residues whose sequence is contained within the first intron of the annotated gene. Furthermore, such an APA event causes the expression of a translational controlling cis-acting GAIT element which is not present in the previously isolated CAP isoform and identified in the 3'-UTR of other immune-related genes, suggesting an intriguing scenario in which both transcriptional and post-transcriptional control mechanisms are involved in the activation of the CAP gene during inflammatory response in C. intestinalis. PMID:27514009

  4. Reciprocal Loss of CArG-Boxes and Auxin Response Elements Drives Expression Divergence of MPF2-Like MADS-Box Genes Controlling Calyx Inflation

    PubMed Central

    Khan, Muhammad Ramzan; Hu, Jinyong; Ali, Ghulam Muhammad


    Expression divergence is thought to be a hallmark of functional diversification between homologs post duplication. Modification in regulatory elements has been invoked to explain expression divergence after duplication for several MADS-box genes, however, verification of reciprocal loss of cis-regulatory elements is lacking in plants. Here, we report that the evolution of MPF2-like genes has entailed degenerative mutations in a core promoter CArG-box and an auxin response factor (ARF) binding element in the large 1st intron in the coding region. Previously, MPF2-like genes were duplicated into MPF2-like-A and -B through genome duplication in Withania and Tubocapsicum (Withaninae). The calyx of Withania grows exorbitantly after pollination unlike Tubocapsicum, where it degenerates. Besides inflated calyx syndrome formation, MPF2-like transcription factors are implicated in functions both during the vegetative and reproductive development as well as in phase transition. MPF2-like-A of Withania (WSA206) is strongly expressed in sepals, while MPF2-like-B (WSB206) is not. Interestingly, their combined expression patterns seem to replicate the pattern of their closely related hypothetical progenitors from Vassobia and Physalis. Using phylogenetic shadowing, site-directed mutagenesis and motif swapping, we could show that the loss of a conserved CArG-box in MPF2-like-B of Withania is responsible for impeding its expression in sepals. Conversely, loss of an ARE in MPF2-like-A relaxed the constraint on expression in sepals. Thus, the ARE is an active suppressor of MPF2-like gene expression in sepals, which in contrast is activated via the CArG-box. The observed expression divergence in MPF2-like genes due to reciprocal loss of cis-regulatory elements has added to genetic and phenotypic variations in the Withaninae and enhanced the potential of natural selection for the adaptive evolution of ICS. Moreover, these results provide insight into the interplay of floral

  5. An interferon gamma-regulated protein that binds the interferon-inducible enhancer element of major histocompatibility complex class I genes.

    PubMed Central

    Driggers, P H; Ennist, D L; Gleason, S L; Mak, W H; Marks, M S; Levi, B Z; Flanagan, J R; Appella, E; Ozato, K


    Interferons (IFNs) induce transcription of major histocompatibility complex (MHC) class I genes through the conserved IFN consensus sequence (ICS) that contains an IFN response motif shared by many IFN-regulated genes. By screening mouse lambda ZAP expression libraries with the ICS as a probe, we isolated a cDNA clone encoding a protein that binds the ICS, designated ICSBP. Protein blot analysis with labeled oligonucleotide probes showed that ICSBP binds not only the MHC class I ICS but also IFN response motifs of many IFN-regulated genes, as well as a virus-inducible element of the IFN-beta gene. The ICSBP cDNA encodes 424 amino acids and a long 3' untranslated sequence. The N-terminal 115 amino acids correspond to a putative DNA-binding domain and show significant sequence similarity with other cloned IFN response factors (IRF-1 and IRF-2). Because of the structural similarity and shared binding specificity, we conclude that ICSBP is a third member of the IRF gene family, presumably playing a role in IFN- and virus-mediated regulation of many genes. Although IRF-1 and IRF-2 share some similarity in their C-terminal regions, ICSBP shows no similarity to IRF-1 or IRF-2 in this region, suggesting that it is more distantly related. We show that ICSBP mRNA is expressed predominantly in lymphoid tissues and is inducible preferentially by IFN-gamma. The induction by IFN-gamma appears to be predominant in lymphocytes and macrophages, implying that ICSBP plays a regulatory role in cells of the immune system. The presence of multiple factors that bind common IFN response motifs may partly account for the complexity and diversity of IFN action as well as IFN-regulated gene expression. Images PMID:2111015

  6. Miniature Inverted–Repeat Transposable Elements (MITEs) Have Been Accumulated through Amplification Bursts and Play Important Roles in Gene Expression and Species Diversity in Oryza sativa

    PubMed Central

    Lu, Chen; Chen, Jiongjiong; Zhang, Yu; Hu, Qun; Su, Wenqing; Kuang, Hanhui


    Miniature inverted–repeat transposable elements (MITEs) are predicted to play important roles on genome evolution. We developed a BLASTN-based approach for de novo identification of MITEs and systematically analyzed MITEs in rice genome. The genome of rice cultivar Nipponbare (Oryza sativa ssp. japonica) harbors 178,533 MITE-related sequences classified into 338 families. Pairwise nucleotide diversity and phylogenetic tree analysis indicated that individual MITE families were resulted from one or multiple rounds of amplification bursts. The timing of amplification burst varied considerably between different MITE families or subfamilies. MITEs are associated with 23,623 (58.2%) genes in rice genome. At least 7,887 MITEs are transcribed and more than 3,463 were transcribed with rice genes. The MITE sequences transcribed with rice coding genes form 1,130 pairs of potential natural sense/antisense transcripts. MITEs generate 23.5% (183,837 of 781,885) of all small RNAs identified from rice. Some MITE families generated small RNAs mainly from the terminals, while other families generated small RNAs predominantly from the central region. More than half (51.8%) of the MITE-derived small RNAs were generated exclusively by MITEs located away from genes. Genome-wide analysis showed that genes associated with MITEs have significantly lower expression than genes away from MITEs. Approximately 14.8% of loci with full-length MITEs have presence/absence polymorphism between rice cultivars 93-11 (O. sativa ssp. indica) and Nipponbare. Considering that different sets of genes may be regulated by MITE-derived small RNAs in different genotypes, MITEs provide considerable diversity for O. sativa. PMID:22096216

  7. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    PubMed Central


    Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement) or, less commonly, linked to 35 S rDNA units (L-type). The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6) but not all species. Two species contained major L-type and minor S-type units (termed Ls-type). The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’) is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs. PMID:22716941

  8. Deep intron elements mediate nested splicing events at consecutive AG dinucleotides to regulate alternative 3' splice site choice in vertebrate 4.1 genes.


    Parra, Marilyn K; Gallagher, Thomas L; Amacher, Sharon L; Mohandas, Narla; Conboy, John G


    Distal intraexon (iE) regulatory elements in 4.1R pre-mRNA govern 3' splice site choice at exon 2 (E2) via nested splicing events, ultimately modulating expression of N-terminal isoforms of cytoskeletal 4.1R protein. Here we explored intrasplicing in other normal and disease gene contexts and found conservation of intrasplicing through vertebrate evolution. In the paralogous 4.1B gene, we identified ∼120 kb upstream of E2 an ultradistal intraexon, iE(B), that mediates intrasplicing by promoting two intricately coupled splicing events that ensure selection of a weak distal acceptor at E2 (E2dis) by prior excision of the competing proximal acceptor (E2prox). Mutating iE(B) in minigene splicing reporters abrogated intrasplicing, as did blocking endogenous iE(B) function with antisense morpholinos in live mouse and zebrafish animal models. In a human elliptocytosis patient with a mutant 4.1R gene lacking E2 through E4, we showed that aberrant splicing is consistent with iE(R)-mediated intrasplicing at the first available exons downstream of iE(R), namely, alternative E5 and constitutive E6. Finally, analysis of heterologous acceptor contexts revealed a strong preference for nested 3' splice events at consecutive pairs of AG dinucleotides. Distal regulatory elements may control intrasplicing at a subset of alternative 3' splice sites in vertebrate pre-mRNAs to generate proteins with functional diversity. PMID:22473990

  9. First identification of Tn916-like element in industrial strains of Lactobacillus vini that spread the tet-M resistance gene.


    Mendonça, Allyson Andrade; de Lucena, Brigida Thais Luckwu; de Morais, Márcia Maria Camargo; de Morais, Marcos Antonio


    The open process used to ferment sugar cane juice or molasses to produce ethanol fuel is prone to contamination by bacterial cells of different species, in particular Lactobacilli. The situation can be exacerbated by the emergence of resistant cells to industrial antibiotics that are normally used to combat this contamination. In this work, two Lactobacillus vini isolates from ethanol distilleries were identified and found to be resistant to doxycycline, a tetracycline derivative, although sensitive to other antibiotics tested. The identification of these isolates was confirmed by sequencing the pheS gene and their clonal origin was shown by PCR-fingerprinting analysis. Moreover, the isolates were shown to carry the transposable element Tn916 that harboured the tet-M gene. Furthermore, conjugation experiments showed that both isolates were capable of transferring this element, and as a result, the tet-M gene, to Enterococcus faecalis reference strain. Finally, the identification of tetracycline resistance in the same distilleries in other Lactobacilli, suggested that inter-species transfer of antibiotic resistance may be occurring in the industrial environment, and thus impairing the efficiency of the antibiotic treatment and causing serious health concerns. PMID:26722009

  10. Retroposons do jump: a B2 element recently integrated in an 18S rDNA gene.

    PubMed Central

    Oberbäumer, I


    Several cDNA clones were isolated from cDNA libraries constructed with mRNA longer than 28S RNA from the murine cell line PYS-2/12. The plasmids have inserts containing 1-1.2 kb of the ribosomal 5' external transcribed spacer followed by nearly 700 nt of sequence for 18S rRNA and ending with a B2 element (retroposon). The cloned sequence differed in a few positions from published ribosomal sequences. The 3' adjacent genomic sequence was obtained by polymerase chain reaction (PCR) and showed that the B2 element has a poly(A) tail of about 50 nt and is surrounded by perfect direct repeats of 15 nt. Analysis of genomic DNA from several murine cell lines revealed that PYS cells contain at least one copy of 18S RNA with the B2 element which is not present in the genome of other murine cell lines derived from the same teratocarcinoma. Similarly, rRNA transcripts containing the B2 element were only detected in PYS cells. According to the publication dates of the different cell lines, the B2 element must have been integrated into an rRNA transcription unit during the years 1970 through 1974 thus proving that retroposons (SINEs) can still be inserted into the genome in our times. Images PMID:1311830

  11. Cluster of Genes That Encode Positive and Negative Elements Influencing Filament Length in a Heterocyst-Forming Cyanobacterium

    PubMed Central

    Merino-Puerto, Victoria; Herrero, Antonia


    The filamentous, heterocyst-forming cyanobacteria perform oxygenic photosynthesis in vegetative cells and nitrogen fixation in heterocysts, and their filaments can be hundreds of cells long. In the model heterocyst-forming cyanobacterium Anabaena sp. strain PCC 7120, the genes in the fraC-fraD-fraE operon are required for filament integrity mainly under conditions of nitrogen deprivation. The fraC operon transcript partially overlaps gene all2395, which lies in the opposite DNA strand and ends 1 bp beyond fraE. Gene all2395 produces transcripts of 1.35 kb (major transcript) and 2.2 kb (minor transcript) that overlap fraE and whose expression is dependent on the N-control transcription factor NtcA. Insertion of a gene cassette containing transcriptional terminators between fraE and all2395 prevented production of the antisense RNAs and resulted in an increased length of the cyanobacterial filaments. Deletion of all2395 resulted in a larger increase of filament length and in impaired growth, mainly under N2-fixing conditions and specifically on solid medium. We denote all2395 the fraF gene, which encodes a protein restricting filament length. A FraF-green fluorescent protein (GFP) fusion protein accumulated significantly in heterocysts. Similar to some heterocyst differentiation-related proteins such as HglK, HetL, and PatL, FraF is a pentapeptide repeat protein. We conclude that the fraC-fraD-fraE←fraF gene cluster (where the arrow indicates a change in orientation), in which cis antisense RNAs are produced, regulates morphology by encoding proteins that influence positively (FraC, FraD, FraE) or negatively (FraF) the length of the filament mainly under conditions of nitrogen deprivation. This gene cluster is often conserved in heterocyst-forming cyanobacteria. PMID:23813733

  12. Pilot Sequencing of Onion Genomic DNA Reveals Fragments of Transposable Elements, Low Gene Densities, and Significant Gene Enrichment After Methyl Filtration

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Onion (Allium cepa) is a diploid (2n=2x=16) monocot with one of the largest nuclear genomes among cultivated plants, over 6 and 16 times that of maize and rice, respectively. In this study, we sequenced onion BACs to estimate gene densities and investigate the nature and distribution of repetitive ...

  13. An Operon of Three Transcriptional Regulators Controls Horizontal Gene Transfer of the Integrative and Conjugative Element ICEclc in Pseudomonas knackmussii B13

    PubMed Central

    Pradervand, Nicolas; Sulser, Sandra; Delavat, François; Miyazaki, Ryo; Lamas, Iker; van der Meer, Jan Roelof


    The integrative and conjugative element ICEclc is a mobile genetic element in Pseudomonas knackmussii B13, and an experimental model for a widely distributed group of elements in Proteobacteria. ICEclc is transferred from specialized transfer competent cells, which arise at a frequency of 3-5% in a population at stationary phase. Very little is known about the different factors that control the transfer frequency of this ICE family. Here we report the discovery of a three-gene operon encoded by ICEclc, which exerts global control on transfer initiation. The operon consists of three consecutive regulatory genes, encoding a TetR-type repressor MfsR, a MarR-type regulator and a LysR-type activator TciR. We show that MfsR autoregulates expression of the operon, whereas TciR is a global activator of ICEclc gene expression, but no clear role was yet found for MarR. Deletion of mfsR increases expression of tciR and marR, causing the proportion of transfer competent cells to reach almost 100% and transfer frequencies to approach 1 per donor. mfsR deletion also caused a two orders of magnitude loss in population viability, individual cell growth arrest and loss of ICEclc. This indicates that autoregulation is an important feature maintaining ICE transfer but avoiding fitness loss. Bioinformatic analysis showed that the mfsR-marR-tciR operon is unique for ICEclc and a few highly related ICE, whereas tciR orthologues occur more widely in a large variety of suspected ICE among Proteobacteria. PMID:24945944

  14. A Rickettsia Genome Overrun by Mobile Genetic Elements Provides Insight into the Acquisition of Genes Characteristic of an Obligate Intracellular Lifestyle

    PubMed Central

    Joardar, Vinita; Williams, Kelly P.; Driscoll, Timothy; Hostetler, Jessica B.; Nordberg, Eric; Shukla, Maulik; Walenz, Brian; Hill, Catherine A.; Nene, Vishvanath M.; Azad, Abdu F.; Sobral, Bruno W.; Caler, Elisabet


    We present the draft genome for the Rickettsia endosymbiont of Ixodes scapularis (REIS), a symbiont of the deer tick vector of Lyme disease in North America. Among Rickettsia species (Alphaproteobacteria: Rickettsiales), REIS has the largest genome sequenced to date (>2 Mb) and contains 2,309 genes across the chromosome and four plasmids (pREIS1 to pREIS4). The most remarkable finding within the REIS genome is the extraordinary proliferation of mobile genetic elements (MGEs), which contributes to a limited synteny with other Rickettsia genomes. In particular, an integrative conjugative element named RAGE (for Rickettsiales amplified genetic element), previously identified in scrub typhus rickettsiae (Orientia tsutsugamushi) genomes, is present on both the REIS chromosome and plasmids. Unlike the pseudogene-laden RAGEs of O. tsutsugamushi, REIS encodes nine conserved RAGEs that include F-like type IV secretion systems similar to that of the tra genes encoded in the Rickettsia bellii and R. massiliae genomes. An unparalleled abundance of encoded transposases (>650) relative to genome size, together with the RAGEs and other MGEs, comprise ∼35% of the total genome, making REIS one of the most plastic and repetitive bacterial genomes sequenced to date. We present evidence that conserved rickettsial genes associated with an intracellular lifestyle were acquired via MGEs, especially the RAGE, through a continuum of genomic invasions. Robust phylogeny estimation suggests REIS is ancestral to the virulent spotted fever group of rickettsiae. As REIS is not known to invade vertebrate cells and has no known pathogenic effects on I. scapularis, its genome sequence provides insight on the origin of mechanisms of rickettsial pathogenicity. PMID:22056929

  15. Early transposable element insertion in intron 9 of the Hsf4 gene results in autosomal recessive cataracts in lop11 and ldis1 mice.


    Talamas, Elijah; Jackson, Lavinia; Koeberl, Matthew; Jackson, Todd; McElwee, John L; Hawes, Norman L; Chang, Bo; Jablonski, Monica M; Sidjanin, D J


    Lens opacity 11 (lop11) is an autosomal recessive mouse cataract mutation that arose spontaneously in the RIIIS/J strain. At 3 weeks of age mice exhibit total cataracts with vacuoles. The lop11 locus was mapped to mouse chromosome 8. Analysis of the mouse genome for the lop11 critical region identified Hsf4 as a candidate gene. Molecular evaluation of Hsf4 revealed an early transposable element (ETn) in intron 9 inserted 61 bp upstream of the intron/exon junction. The same mutation was also identified in a previously mapped cataract mutant, ldis1. The ETn insertion altered splicing and expression of the Hsf4 gene, resulting in the truncated Hsf4 protein. In humans, mutations in HSF4 have been associated with both autosomal dominant and recessive cataracts. The lop11 mouse is an excellent resource for evaluating the role of Hsf4 in transparency of the lens. PMID:16595169

  16. Early transposable element insertion in intron 9 of the Hsf4 gene results in autosomal recessive cataracts in lop11 and ldis1 mice

    PubMed Central

    Talamas, Elijah; Jackson, Lavinia; Koeberl, Matthew; Jackson, Todd; McElwee, John L.; Hawes, Norman L.; Chang, Bo; Jablonski, Monica M.; Sidjanin, D.J.


    Lens opacity 11 (lop11) is an autosomal recessive mouse cataract mutation that arose spontaneously in the RIIIS/J strain. At 3 weeks of age mice exhibit total cataracts with vacuoles. The lop11 locus was mapped to mouse chromosome 8. Analysis of the mouse genome for the lop11 critical region identified Hsf4 as a candidate gene. Molecular evaluation of Hsf4 revealed an early transposable element (ETn) in intron 9 inserted 61 bp upstream of the intron/exon junction. The same mutation was also identified in a previously mapped cataract mutant, ldis1. The ETn insertion altered splicing and expression of the Hsf4 gene, resulting in the truncated Hsf4 protein. In humans, mutations in HSF4 have been associated with both autosomal dominant and recessive cataracts. The lop11 mouse is an excellent resource for evaluating the role of Hsf4 in transparency of the lens. PMID:16595169

  17. Sequence Evaluation of FGF and FGFR Gene Conserved Non-Coding Elements in Non-Syndromic Cleft Lip and Palate Cases

    PubMed Central

    Riley, Bridget M.; Murray, Jeffrey C.


    Non-syndromic cleft lip and palate (NS CLP) is a complex birth defect resulting from multiple genetic and environmental factors. We have previously reported the sequencing of the coding region of genes in the fibroblast growth factor (FGF) signaling pathway, in which missense and non-sense mutations contribute to approximately 5%–6% NS CLP cases. In this article we report the sequencing of conserved non-coding elements (CNEs) in and around 11 of the FGF and FGFR genes, which identified 55 novel variants. Seven of variants are highly conserved among ≥8 species and 31 variants alter transcription factor binding sites, 8 of which are important for craniofacial development. Additionally, 15 NS CLP patients had a combination of coding mutations and CNE variants, suggesting that an accumulation of variants in the FGF signaling pathway may contribute to clefting. PMID:17963255

  18. Parallel performance of a lattice-Boltzmann/finite element cellular blood flow solver on the IBM Blue Gene/P architecture

    NASA Astrophysics Data System (ADS)

    Clausen, Jonathan R.; Reasor, Daniel A.; Aidun, Cyrus K.


    We discuss the parallel implementation and scaling results of a hybrid lattice-Boltzmann/finite element code for suspension flow simulations. This code allows the direct numerical simulation of cellular blood flow, fully resolving the two-phase nature of blood and the deformation of the suspended phase. A brief introduction to the numerical methods employed is given followed by an outline of the code structure. Scaling results obtained on Argonne National Laboratories IBM Blue Gene/P ( BG/P) are presented. Details include performance characteristics on 512 to 65,536 processor cores.

  19. Identification of a lactose-responsive element upstream of the promoter of Bacillus megaterium beta-galactosidase-encoding gene mbgA.


    Li, Jen-Ming; Chiou, Chih-Yung; Lee, Tian-Ren; Chen, Yuan-Shou; Shaw, Gwo-Chyuan


    The Bacillus megaterium mbgA gene encodes a lactose-hydrolyzing beta-galactosidase. An AraC/XylS-type activator BgaR can activate mbgA transcription in response to lactose. In this report, we show by various deletion analyses and point mutagenesis analyses that an inverted repeat centered at position -60.5 relative to the mbgA transcriptional initiation site is the cis-acting element responsible for lactose induction of mbgA expression. PMID:15971092

  20. v-src induction of the TIS10/PGS2 prostaglandin synthase gene is mediated by an ATF/CRE transcription response element.

    PubMed Central

    Xie, W; Fletcher, B S; Andersen, R D; Herschman, H R


    We recently reported the cloning of a mitogen-inducible prostaglandin synthase gene, TIS10/PGS2. In addition to growth factors and tumor promoters, the v-src oncogene induces TIS10/PGS2 expression in 3T3 cells. Deletion analysis, using luciferase reporters, identifies a region between -80 and -40 nucleotides 5' of the TIS10/PGS2 transcription start site that mediates pp60v-src induction in 3T3 cells. This region contains the sequence CGTCACGTG, which includes overlapping ATF/CRE (CGTCA) and E-box (CACGTG) sequences. Gel shift-oligonucleotide competition experiments with nuclear extracts from cells stably transfected with a temperature-sensitive v-src gene demonstrate that the CGTCACGTG sequence can bind proteins at both the ATF/CRE and E-box sequences. Dominant-negative CREB and Myc proteins that bind DNA, but do not transactivate, block v-src induction of a luciferase reporter driven by the first 80 nucleotides of the TIS10/PGS2 promoter. Mutational analysis distinguishes which TIS10/PGS2 cis-acting element mediates pp60v-src induction. E-box mutation has no effect on the fold induction in response to pp60v-src. In contrast, ATF/CRE mutation attenuates the pp60v-src response. Antibody supershift and methylation interference experiments demonstrate that CREB and at least one other ATF transcription factor in these extracts bind to the TIS10/PGS2 ATF/CRE element. Expression of a dominant-negative ras gene also blocks TIS10/PGS2 induction by v-src. Our data suggest that Ras mediates pp60v-src activation of an ATF transcription factor, leading to induced TIS10/PGS2 expression via the ATF/CRE element of the TIS10/PGS2 promoter. This is the first description of v-src activation of gene expression via an ATF/CRE element. Images PMID:7935375

  1. Expression of the yeast glycogen phosphorylase gene is regulated by stress-response elements and by the HOG MAP kinase pathway.


    Sunnarborg, S W; Miller, S P; Unnikrishnan, I; LaPorte, D C


    Yeast glycogen metabolism responds to environmental stressors such as nutrient limitation and heat shock. This response is mediated, in part, by the regulation of the glycogen metabolic genes. Environmental stressors induce a number of glycogen metabolic genes, including GPH1, which encodes glycogen phosphorylase. Primer extension analysis detected two start sites for GPH1, one of which predominated. Sequences upstream of these sites included a possible TATA element. Mutation of this sequence reduced GPH1 expression by a factor of 10 but did not affect start site selection. This mutation also did not affect the relative induction of GPH1 upon entry into stationary phase. Three candidates for stress response elements (STREs) were found upstream of the TATA sequence. Mutation of the STREs showed that they were required for regulation of GPH1 expression in early stationary phase, and in response to osmotic shock and heat shock. These elements appeared to act synergistically, since the intact promoter exhibited 30-fold more expression in stationary phase than the sum of that observed for each element acting independently. HOG1, which encodes a MAP kinase, has been implicated in control mediated by STREs. For GPH1, induction by osmotic shock depended on a functional HOG1 allele. In contrast, induction upon entry into stationary phase was only partially dependent on HOG1. Furthermore, the heat shock response, which can also be mediated by STREs, was independent of HOG1. These observations suggest that the GPH1 STREs respond to more than one pathway, only one of which requires HOG1. PMID:11748727

  2. The involvement of a LINE-1 element in a DNA rearrangement upstream of the mdr1a gene in a taxol multidrug-resistant murine cell line.


    Cohen, D; Higman, S M; Hsu, S I; Horwitz, S B


    Two closely related but functionally distinct P-glycoprotein isoforms are encoded by the murine multidrug-resistance genes mdr1a and mdr1b. In a series of independently selected multidrug-resistant (MDR) J774.2 cell lines, mdr gene amplification and/or overexpression and overproduction of either the mdr1a or mdr1b products, or both gene products, correlates with the MDR phenotype. To investigate the possibility that mutations in the promoter regions of the mdr1a or mdr1b genes could influence their differential expression, mdr promoter-specific probes were used to detect and map potential structural alterations. An unusual structural rearrangement was found in the 5'-region of the amplified mdr1a allele in J7.T1, a cell line selected with taxol. To characterize this rearrangement, the regulatory regions of the mdr1a and mdr1b genes were analyzed. Whereas no gross structural alterations were detected by Southern blot hybridization using the mdr1b promoter probe, a novel amplified EcoRI fragment was detected by the mdr1a promoter probe. To determine the precise nature of this mutation, an mdr1a 5'-genomic clone was isolated from J7.T1 cells. Sequence analysis revealed an unusual DNA rearrangement consisting of the mdr1b gene, from its fourth intron toward its 3'-end, upstream of an intact mdr1a promoter on the amplified allele. We propose that this event occurred by an unequal sister chromatid exchange that was mediated by LINE-1 repetitive elements. PMID:1356977

  3. Possible involvement of the long terminal repeat of transposable element 17.6 in regulating expression of an insecticide resistance-associated P450 gene in Drosophila.

    PubMed Central

    Waters, L C; Zelhof, A C; Shaw, B J; Ch'ang, L Y


    P450-A and P450-B are electrophoretically defined subsets of cytochrome P450 enzymes in Drosophila melanogaster. P450-A is present among all strains tested, whereas expression of P450-B is associated with resistance to insecticides. Monoclonal antibodies were used to obtain cDNA clones for an enzyme from each P450 subset (i.e., P450-A1 and P450-B1). The P450-B1 cDNA was sequenced and shown to code for a P450 of 507 amino acids. Its gene has been named CYP6A2. Comparative molecular analyses of a pair of susceptible, 91-C, and resistant, 91-R, Drosophila strains were made. There was 20-30 times more P450-B1 mRNA in 91-R than in 91-C, and the small amount of P450-B1 mRNA in 91-C was significantly larger in size than that in 91-R. The P450-B1 gene in 91-R was structurally different from that in 91-C but was not amplified. The P450-B1 gene in 91-C contained a solitary long terminal repeat of transposable element 17.6 in its 3' untranslated region. It was absent in the P450-B1 gene of 91-R. On the basis of features of the long terminal repeat and its location in the gene of the susceptible fly, we propose that a posttranscriptional mechanism involving mRNA stability could be involved in regulating P450-B1 gene expression. Images PMID:1317576

  4. Isolation of pig mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase gene promoter: characterization of a peroxisome proliferator-responsive element.

    PubMed Central

    Ortiz, J A; Mallolas, J; Nicot, C; Bofarull, J; Rodríguez, J C; Hegardt, F G; Haro, D; Marrero, P F


    Low expression of the mitochondrial 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) synthase gene during development correlates with an unusually low hepatic ketogenic capacity and lack of hyperketonaemia in piglets. Here we report the isolation and characterization of the 5' end of the pig mitochondrial HMG-CoA synthase gene. The 581 bp region proximal to the transcription start site permits transcription of a reporter gene, confirming the function of the promoter. The pig mitochondrial HMG-CoA synthase promoter is trans-activated by the peroxisomal proliferator-activated receptor (PPAR), and a functional response element for PPAR (PPRE) has been localized in the promoter region. Pig PPRE is constituted by an imperfect direct repeat (DR-1) and a downstream sequence, both of which are needed to confer PPAR-sensitivity to a thymidine kinase promoter and to form complexes with PPAR.retinoid X receptor heterodimers. A role of PPAR trans-activation in starvation-associated induction of gene expression is suggested. PMID:9882632

  5. Evaluation of IRX Genes and Conserved Noncoding Elements in a Region on 5p13.3 Linked to Families with Familial Idiopathic Scoliosis and Kyphosis

    PubMed Central

    Justice, Cristina M.; Bishop, Kevin; Carrington, Blake; Mullikin, Jim C.; Swindle, Kandice; Marosy, Beth; Sood, Raman; Miller, Nancy H.; Wilson, Alexander F.


    Because of genetic heterogeneity present in idiopathic scoliosis, we previously defined clinical subsets (a priori) from a sample of families with idiopathic scoliosis to find genes involved with spinal curvature. Previous genome-wide linkage analysis of seven families with at least two individuals with kyphoscoliosis found linkage (P-value = 0.002) in a 3.5-Mb region on 5p13.3 containing only three known genes, IRX1, IRX2, and IRX4. In this study, the exons of IRX1, IRX2, and IRX4, the conserved noncoding elements in the region, and the exons of a nonprotein coding RNA, LOC285577, were sequenced. No functional sequence variants were identified. An intrafamilial test of association found several associated noncoding single nucleotide variants. The strongest association was with rs12517904 (P = 0.00004), located 6.5 kb downstream from IRX1. In one family, the genotypes of nine variants differed from the reference allele in all individuals with kyphoscoliosis, and two of three individuals with scoliosis, but did not differ from the reference allele in all other genotyped individuals. One of these variants, rs117273909, was located in a conserved noncoding region that functions as an enhancer in mice. To test whether the variant allele at rs117273909 had an effect on enhancer activity, zebrafish transgenesis was performed with overlapping fragments of 198 and 687 bp containing either the wild type or the variant allele. Our data suggests that this region acts as a regulatory element; however, its size and target gene(s) need to be identified to determine its role in idiopathic scoliosis. PMID:27172222

  6. Evaluation of IRX Genes and Conserved Noncoding Elements in a Region on 5p13.3 Linked to Families with Familial Idiopathic Scoliosis and Kyphosis.


    Justice, Cristina M; Bishop, Kevin; Carrington, Blake; Mullikin, Jim C; Swindle, Kandice; Marosy, Beth; Sood, Raman; Miller, Nancy H; Wilson, Alexander F


    Because of genetic heterogeneity present in idiopathic scoliosis, we previously defined clinical subsets (a priori) from a sample of families with idiopathic scoliosis to find genes involved with spinal curvature. Previous genome-wide linkage analysis of seven families with at least two individuals with kyphoscoliosis found linkage (P-value = 0.002) in a 3.5-Mb region on 5p13.3 containing only three known genes, IRX1, IRX2, and IRX4 In this study, the exons of IRX1, IRX2, and IRX4, the conserved noncoding elements in the region, and the exons of a nonprotein coding RNA, LOC285577, were sequenced. No functional sequence variants were identified. An intrafamilial test of association found several associated noncoding single nucleotide variants. The strongest association was with rs12517904 (P = 0.00004), located 6.5 kb downstream from IRX1 In one family, the genotypes of nine variants differed from the reference allele in all individuals with kyphoscoliosis, and two of three individuals with scoliosis, but did not differ from the reference allele in all other genotyped individuals. One of these variants, rs117273909, was located in a conserved noncoding region that functions as an enhancer in mice. To test whether the variant allele at rs117273909 had an effect on enhancer activity, zebrafish transgenesis was performed with overlapping fragments of 198 and 687 bp containing either the wild type or the variant allele. Our data suggests that this region acts as a regulatory element; however, its size and target gene(s) need to be identified to determine its role in idiopathic scoliosis. PMID:27172222

  7. Characterization of a Disease-associated Mutation Affecting a Putative Splicing Regulatory Element in Intron 6b of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Gene*

    PubMed Central

    Faà, Valeria; Incani, Federica; Meloni, Alessandra; Corda, Denise; Masala, Maddalena; Baffico, A. Maria; Seia, Manuela; Cao, Antonio; Rosatelli, M. Cristina


    Cystic fibrosis (CF) is a common recessive disorder caused by >1600 mutations in the CF transmembrane conductance regulator (CFTR) gene. About 13% of CFTR mutations are classified as “splicing mutations,” but for almost 40% of these, their role in affecting the pre-mRNA splicing of the gene is not yet defined. In this work, we describe a new splicing mutation detected in three unrelated Italian CF patients. By DNA analyses and mRNA studies, we identified the c.1002–1110_1113delTAAG mutation localized in intron 6b of the CFTR gene. At the mRNA level, this mutation creates an aberrant inclusion of a sequence of 101 nucleotides between exons 6b and 7. This sequence corresponds to a portion of intron 6b and resembles a cryptic exon because it is characterized by an upstream ag and a downstream gt sequence, which are most probably recognized as 5′- and 3′-splice sites by the spliceosome. Through functional analysis of this splicing defect, we show that this mutation abolishes the interaction of the splicing regulatory protein heterogeneous nuclear ribonucleoprotein A2/B1 with an intronic splicing regulatory element and creates a new recognition motif for the SRp75 splicing factor, causing activation of the cryptic exon. Our results show that the c.1002–1110_1113delTAAG mutation creates a new intronic splicing regulatory element in intron 6b of the CFTR gene exclusively recognized by SRp75. PMID:19759008

  8. Characterization of a novel positive transcription regulatory element that differentially regulates the alpha-2-macroglobulin gene in replicative senescence.


    Li, Renzhong; Ma, Liwei; Huang, Yu; Zhang, Zongyu; Tong, Tanjun


    Alpha-2-macroglobulin (α2M), a protease inhibitor, is implicated in Alzheimer's disease, atherosclerosis, and other age-related diseases. The elevated level of α2M mRNA has been described in replicative senescence and it could be used as a biomarker of the aging cells. However, the mechanism responsible for the up-regulation of its expression is still unclear. This report identified a novel transcriptional regulatory element, the α2M transcription enhancement element (ATEE), within the α2M promoter. This element differentially activates α2M expression in senescent versus young fibroblasts. Electrophoretic mobility shift assays revealed abundant complexes in senescent cell nuclear extracts compared with young cell nuclear extracts. The DNase I footprint revealed the protein-binding core sequence through which the protein binds the ATEE. Mutation within ATEE selectively abolished α2M promoter activity in senescent (but not young) cells. These results indicated the ATEE, as a positive transcription regulatory element, contributes to the up-regulation of α2M during replicative senescence. PMID:21541797

  9. Closing the gaps on human chromosome 19 revealed genes with a high density of repetitive tandemly arrayed elements.

    SciTech Connect

    Leem, Sun-Hee; Kouprina, Natalay; Grimwood, Jane; Kim, Jung-Hyun; Mullokandov, Michael; Yoon, Young-Ho; Chae, Ji-Youn; Morgan, Jenna; Lucas, Susan; Richardson, Paul; Detter, Chris; Glavina, Tijana; Rubin, Eddy; Barrett, J. Carl; Larionov, Vladimir


    The reported human genome sequence includes about 400 gaps of unknown sequence that were not found in the bacterial artificial chromosome (BAC) and cosmid libraries used for sequencing of the genome. These missing sequences correspond to {approx} 1 percent of euchromatic regions of the human genome. Gap filling is a laborious process because it relies on analysis of random clones of numerous genomic BAC or cosmid libraries. In this work we demonstrate that closing the gaps can be accelerated by a selective recombinational capture of missing chromosomal segments in yeast. The use of both methodologies allowed us to close the four remaining gaps on the human chromosome 19. Analysis of the gap sequences revealed that they contain several abnormalities that could result in instability of the sequences in microbe hosts, including large blocks of micro- and minisatellites and a high density of Alu repeats. Sequencing of the gap regions, in both BAC and YAC forms, allowed us to generate a complete sequence of four genes, including the neuronal cell signaling gene SCK1/SLI. The SCK1/SLI gene contains a record number of minisatellites, most of which are polymorphic and transmitted through meiosis following a Mendelian inheritance. In conclusion, the use of the alternative recombinational cloning system in yeast may greatly accelerate work on closing the remaining gaps in the human genome (as well as in other complex genomes) to achieve the goal of annotation of all human genes.

  10. Chromatin structures of the rat tyrosine aminotransferase gene relate to the function of its cis-acting elements.

    PubMed Central

    Nitsch, D; Stewart, A F; Boshart, M; Mestril, R; Weih, F; Schütz, G


    The relationship between DNase I-hypersensitive sites (HSs) and transcriptional enhancers of the rat tyrosine aminotransferase (TAT) gene was examined by comparing HSs in and around the TAT gene with the activity of the corresponding DNA sequences in transient transfection assays. In this manner, we identified two HSs as liver-specific enhancers. Of three hepatoma cell lines examined, only one sustained TAT mRNA levels comparable to those of liver. In this cell line, both enhancers were strongly active, and strong hypersensitivity in chromatin over the enhancers was evident. The other two hepatoma cell lines had reduced levels of TAT mRNA and no or altered hypersensitivity over either the enhancers or the promoter. One of these lines carried a negative regulator of the TAT gene, the tissue specific extinguisher Tse-1. This cell line exhibited all HSs characteristic of the strongly active gene except at the promoter; however, one enhancer was inactive even though hypersensitive in chromatin. In a TAT-nonexpressing cell line, inactivity of both enhancers correlated with absence of the respective HSs. We conclude that although hypersensitivity in chromatin necessarily accompanies cell-type-specific enhancer activity, the occurrence of cell-type-specific HSs does not imply that the underlying sequences harbor enhancers active in transient transfection assays. Images PMID:1972541

  11. The Arabidopsis floral homeotic gene PISTILLATA is regulated by discrete cis-elements responsive to induction and maintenance signals.


    Honma, T; Goto, K


    PISTILLATA is a B-class floral organ identity gene required for the normal development of petals and stamens in Arabidopsis. PISTILLATA expression is induced in the stage 3 flowers (early expression) and is maintained until anthesis (late expression). To explore in more detail the developmentally regulated gene expression of PISTILLATA, we have analyzed the PISTILLATA promoter using uidA (beta)-glucuronidase gene) fusion constructs (PI::GUS) in transgenic Arabidopsis. Promoter deletion analyses suggest that early PISTILLATA expression is mediated by the distal region and that late expression is mediated by the proximal region. Based on the PI::GUS expression patterns in the loss- and gain-of-function alleles of meristem or organ identity genes, we have shown that LEAFY and UNUSUAL FLORAL ORGANS induce PISTILLATA expression in a flower-independent manner via a distal promoter, and that PISTILLATA and APETALA3 maintain PISTILLATA expression (autoregulation) in the later stages of flower development via a proximal promoter. In addition, we have demonstrated that de novo protein synthesis is required for the PISTILLATA autoregulatory circuit. PMID:10769227

  12. Different cis-acting DNA elements control expression of the human apolipoprotein AI gene in different cell types

    SciTech Connect

    Sastry, K.; Seedorf, U.; Karathanasis, S.K.


    In mammals, the gene coding for apolipoprotein AI (apoAI), a protein of the plasma lipid transport system, is expressed only in the liver and the intestine. A series of plasmids containing various lengths of sequences flanking the 5' end of the human apoAI gene were constructed and assayed for transient expression after introduction into cultured human hepatoma 9HepG2), colon carcinoma (Caco-2), and epithelial (HeLa) cells. The results showed that while most of these constructs are expressed in HepG2 and Caco-2 cells, none of them is expressed in HeLa cells. In addition, the results indicated that a DNA segment located between nucleotides -256 and -41 upstream from the transcription start site of this gene is necessary and sufficient for maximal levels of expression in HepG2 but not in Caco-2 cells, while a DNA segment located between nucleotides -2052 and -192 is required for maximal levels of expression in Caco-2 cells. Moreover, it was shown that the -256 to -41 DNA segment functions as a hepatoma cell-specific transcriptional enhancer with both homologous and heterologous promoters. These results indicate that different cis- and possibly trans-acting factors are involved in the establishment and subsequent regulation of expression of the apoAI gene in the mammalian liver and intestine.

  13. Comprehensive Genome-wide Screen for Genes with Cis-acting Regulatory Elements That Respond to Marek's Disease Virus Infection

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The comprehensive identification of genes underlying phenotypic variation of complex traits such as disease resistance remains one of the greatest challenges in biology despite having genome sequences and more powerful tools. Most genome-wide screens lack sufficient resolving power as they typically...

  14. Regulatory elements and structural features of Beta vulgaris polygalacturonase-inhibiting protein gene for fungal and pest control

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polygalacturonase-inhibiting proteins (PGIPs) are involved in plant defense. PGIPs are cell wall leucine-rich repeat (LRR) proteins that are known to inhibit pathogen and pest polygalacturonases (PGs) during the infection process. Several sugar beet (Beta vulgaris L.) PGIP genes (BvPGIP) were clon...

  15. Transcriptome Analysis of an Insecticide Resistant Housefly Strain: Insights about SNPs and Regulatory Elements in Cytochrome P450 Genes

    PubMed Central

    Asp, Torben; Kristensen, Michael


    Background Insecticide resistance in the housefly, Musca domestica, has been investigated for more than 60 years. It will enter a new era after the recent publication of the housefly genome and the development of multiple next generation sequencing technologies. The genetic background of the xenobiotic response can now be investigated in greater detail. Here, we investigate the 454-pyrosequencing transcriptome of the spinosad-resistant 791spin strain in relation to the housefly genome with focus on P450 genes. Results The de novo assembly of clean reads gave 35,834 contigs consisting of 21,780 sequences of the spinosad resistant strain. The 3,648 sequences were annotated with an enzyme code EC number and were mapped to 124 KEGG pathways with metabolic processes as most highly represented pathway. One hundred and twenty contigs were annotated as P450s covering 44 different P450 genes of housefly. Eight differentially expressed P450s genes were identified and investigated for SNPs, CpG islands and common regulatory motifs in promoter and coding regions. Functional annotation clustering of metabolic related genes and motif analysis of P450s revealed their association with epigenetic, transcription and gene expression related functions. The sequence variation analysis resulted in 12 SNPs and eight of them found in cyp6d1. There is variation in location, size and frequency of CpG islands and specific motifs were also identified in these P450s. Moreover, identified motifs were associated to GO terms and transcription factors using bioinformatic tools. Conclusion Transcriptome data of a spinosad resistant strain provide together with genome data fundamental support for future research to understand evolution of resistance in houseflies. Here, we report for the first time the SNPs, CpG islands and common regulatory motifs in differentially expressed P450s. Taken together our findings will serve as a stepping stone to advance understanding of the mechanism and role of P450s

  16. Human antioxidant-response-element-mediated regulation of type 1 NAD(P)H:quinone oxidoreductase gene expression. Effect of sulfhydryl modifying agents.


    Li, Y; Jaiswal, A K


    Human antioxidant-response element (hARE) containing two copies of the AP1/AP1-like elements arranged as inverse repeat is known to mediate basal and beta-naphthoflavone-induced transcription of the type 1 NAD(P)H:quinone oxidoreductase (NQO1) gene. Band-shift assays revealed that beta-naphthoflavone increased binding of nuclear proteins at the hARE. Super shift assays identified Jun-D and c-Fos proteins in the band-shift complexes observed with control and beta-naphthoflavone-treated Hepa-1 nuclear extracts. Hepa-1 cells stably transformed with hARE-tk-chloramphenicol acetyl transferase (CAT) recombinant plasmid were used to demonstrate that, in addition to beta-naphthoflavone, a variety of antioxidants, tumor promoters and hydrogen peroxide (H2O2) also increased expression of hARE-mediated CAT gene. beta-naphthoflavone induction of the CAT gene expression in Hepa-1 cells was found insensitive to inhibitors of protein kinase C and tyrosine kinases. However, binding of regulatory proteins at the hARE and the CAT gene expression in Hepa-1 cells were increased by dithiothreitol, 2-mercaptoethanol and diamide. Treatment of the Hepa-1 cells with N-ethylmaleimide reduced binding of proteins at the hARE and interfered with expression and beta-naphthoflavone induction of the CAT gene. These results suggested a role of sulfhydryl modification of hARE binding (Jun and Fos) proteins which mediate basal and induced expression of the NQO1 gene. We also report that in-vitro-translated products of the proto-oncogenes, Jun and Fos, bind to the hARE in band-shift assays. The incubation of Jun and Fos proteins with small amounts of nuclear extract from dimethylsulfoxide-treated (control) or beta-naphthoflavone treated Hepa-1 cells prior to band-shift assays increased the binding of Jun and Fos proteins to the hARE. Interestingly, the increase in binding of Jun and Fos proteins to the hARE was more prominent with beta-naphthoflavone-treated nuclear extract as compared to the control

  17. The Role of Crowding Forces in Juxtaposing β-Globin Gene Domain Remote Regulatory Elements in Mouse Erythroid Cells.


    Golov, Arkadiy K; Gavrilov, Alexey A; Razin, Sergey V


    The extremely high concentration of macromolecules in a eukaryotic cell nucleus indicates that the nucleoplasm is a crowded macromolecular solution in which large objects tend to gather together due to crowding forces. It has been shown experimentally that crowding forces support the integrity of various nuclear compartments. However, little is known about their role in control of chromatin dynamics in vivo. Here, we experimentally addressed the possible role of crowding forces in spatial organization of the eukaryotic genome. Using the mouse β-globin domain as a model, we demonstrated that spatial juxtaposition of the remote regulatory elements of this domain in globin-expressing cells may be lost and restored by manipulation of the level of macromolecular crowding. In addition to proving the role of crowding forces in shaping interphase chromatin, our results suggest that the folding of the chromatin fiber is a major determinant in juxtaposing remote genomic elements. PMID:26436546

  18. Dual Masking of Specific Negative Splicing Regulatory Elements Resulted in Maximal Exon 7 Inclusion of SMN2 Gene

    PubMed Central

    Pao, Peng Wen; Wee, Keng Boon; Yee, Woon Chee; DwiPramono, Zacharias Aloysius


    Spinal muscular atrophy (SMA) is a fatal autosomal recessive disease caused by survival motor neuron (SMN) protein insufficiency due to SMN1 mutations. Boosting SMN2 expression is a potential therapy for SMA. SMN2 has identical coding sequence as SMN1 except for a silent C-to-T transition at the 6th nucleotide of exon 7, converting a splicing enhancer to a silencer motif. Consequently, most SMN2 transcripts lack exon 7. More than ten putative splicing regulatory elements (SREs) were reported to regulate exon 7 splicing. To investigate the relative strength of each negative SRE in inhibiting exon 7 inclusion, antisense oligonucleotides (AONs) were used to mask each element, and the fold increase of full-length SMN transcripts containing exon 7 were compared. The most potent negative SREs are at intron 7 (in descending order): ISS-N1, 3′ splice site of exon 8 (ex8 3′ss) and ISS+100. Dual-targeting AONs were subsequently used to mask two nonadjacent SREs simultaneously. Notably, masking of both ISS-N1 and ex8 3′ss induced the highest fold increase of full-length SMN transcripts and proteins. Therefore, efforts should be directed towards the two elements simultaneously for the development of optimal AONs for SMA therapy. PMID:24317636

  19. Disruption of a novel regulatory element in the erythroid-specific promoter of the human PKLR gene causes severe pyruvate kinase deficiency.


    van Wijk, Richard; van Solinge, Wouter W; Nerlov, Claus; Beutler, Ernest; Gelbart, Terri; Rijksen, Gert; Nielsen, Finn C


    We established the molecular basis for pyruvate kinase (PK) deficiency in a white male patient with severe nonspherocytic hemolytic anemia. The paternal allele exhibited the common PKLR cDNA sequence (c.) 1529G>A mutation, known to be associated with PK deficiency. On the maternal allele, 3 in cis mutations were identified in the erythroid-specific promoter region of the gene: one deletion of thymine -248 and 2 single nucleotide substitutions, nucleotide (nt) -324T>A and nt -83G>C. Analysis of the patient's RNA demonstrated the presence of only the 1529A allele, indicating severely reduced transcription from the allele linked to the mutated promoter region. Transfection of promoter constructs into erythroleukemic K562 cells showed that the most upstream -324T>A and -248delT mutations were nonfunctional polymorphisms. In contrast, the -83G>C mutation strongly reduced promoter activity. Site-directed mutagenesis of the promoter region revealed the presence of a putative regulatory element (PKR-RE1) whose core binding motif, CTCTG, is located between nt -87 and nt -83. Electrophoretic mobility shift assay using K562 nuclear extracts indicated binding of an as-yet-unidentified trans-acting factor. This novel element mediates the effects of factors necessary for regulation of pyruvate kinase gene expression during red cell differentiation and maturation. PMID:12393511

  20. Glucocorticoids induce transactivation of tight junction genes occludin and claudin-5 in retinal endothelial cells via a novel cis-element.


    Felinski, Edward A; Cox, Amy E; Phillips, Brett E; Antonetti, David A


    Tight junctions between vascular endothelial cells help to create the blood-brain and blood-retinal barriers. Breakdown of the retinal tight junction complex is problematic in several disease states including diabetic retinopathy. Glucocorticoids can restore and/or preserve the endothelial barrier to paracellular permeability, although the mechanism remains unclear. We show that glucocorticoid treatment of primary retinal endothelial cells increases content of the tight junction proteins occludin and claudin-5, co-incident with an increase in barrier properties of endothelial monolayers. The glucocorticoid receptor antagonist RU486 reverses both the glucocorticoid-stimulated increase in occludin content and the increase in barrier properties. Transcriptional activity from the human occludin and claudin-5 promoters increases in retinal endothelial cells upon glucocorticoid treatment, and is dependent on the glucocorticoid receptor (GR) as demonstrated by siRNA. Deletion analysis of the occludin promoter reveals a 205bp sequence responsible for the glucocorticoid response. However, this region does not possess a canonical glucocorticoid response element and does not bind to the GR in a chromatin immunoprecipitation (ChIP) assay. Mutational analysis of this region revealed a novel 40bp occludin enhancer element (OEE), containing two highly conserved regions of 10 and 13 base pairs, that is both necessary and sufficient for glucocorticoid-induced gene expression in retinal endothelial cells. These data suggest a novel mechanism for glucocorticoid induction of vascular endothelial barrier properties through increased occludin and claudin-5 gene expression. PMID:18501346

  1. Transcriptional activation and repression by Fos are independent functions: the C terminus represses immediate-early gene expression via CArG elements.


    Gius, D; Cao, X M; Rauscher, F J; Cohen, D R; Curran, T; Sukhatme, V P


    The Fos-Jun complex has been shown to activate transcription through the regulatory element known as the AP-1 binding site. We show that Fos down regulates several immediate-early genes (c-fos, Egr-1, and Egr-2) after mitogenic stimulation. Specifically, we demonstrate that the target for this repression is a sequence of the form CC(A/T)6GG, also known as a CArG box. Whereas Fos bound to the AP-1 site through a domain rich in basic amino acids and associated with Jun via a leucine zipper interaction, mutant Fos proteins lacking these structures were still capable of causing repression. Furthermore, Jun neither enhanced nor inhibited down regulation by Fos. Critical residues required for repression are located within the C-terminal 27 amino acids of c-Fos, since v-Fos and C-terminal truncations of c-Fos did not down regulate. In addition, transfer of 180 c-Fos C-terminal amino acids to Jun conferred upon it the ability to repress. Finally, Fra-1, a Fos-related protein which has striking similarity to Fos in its C-terminal 40 amino acids, also down regulated Egr-1 expression. Thus, Fos is a transcriptional regulator that can activate or repress gene expression by way of two separate functional domains that act on distinct regulatory elements. PMID:2115122

  2. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    PubMed Central

    Li, Wande


    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  3. Identification and characterization of a functional retinoic acid/thyroid hormone-response element upstream of the human insulin gene enhancer.

    PubMed Central

    Clark, A R; Wilson, M E; London, N J; James, R F; Docherty, K


    A deletion analysis of the human insulin gene extending to 2 kb upstream of the transcription start site provided evidence of regulatory sequences located upstream of the insulin-linked polymorphic region (ILPR). Within this ILPR-distal region is a sequence (Ink, for insulin kilobase upstream) which contains three potential nuclear hormone-receptor half-sites, closely matching the consensus sequence AGGTCA. These sequences are arranged as a palindromic element with zero spacing over-lapping a direct repeat with 2 bp spacing. The Ink sequence was used in electrophoretic mobility-shift assays within nuclear extracts from COS-7 cells overexpressing the vitamin D, thyroid hormone or retinoic acid receptors, or from an insulin-expressing hamster cell line, HIT-T15. These studies suggest that the insulin-expressing cell line contains thyroid hormone and retinoic acid receptors at least, and that these receptors are able to recognize the Ink sequence. Three copies of the Ink sequence were placed upstream of the thymidine kinase promoter and firefly luciferase reporter gene. In COS-7 cells expressing the appropriate nuclear hormone receptor, this construct was responsive to both thyroid hormone (18-fold) and all-trans-retinoic acid (31-fold). In HIT-T15 cells the same construct responded to all-trans-retinoic acid, but not to thyroid hormone. Within the context of a 2 kb insulin gene fragment, the Ink sequence was shown to be activated by retinoic acid and by the retinoic acid receptor, but acted as a negative element in the presence of both retinoic acid and the retinoic acid receptor. Mutagenesis studies demonstrated that the palindromic sequence was important for the retinoic acid response, and for binding of complexes containing retinoic acid receptor. In human islets of Langerhans, retinoic acid was shown to stimulate insulin mRNA levels. These results demonstrate that a functional nuclear hormone-receptor-response element is located upstream of the human ILPR. As

  4. A new high-performance heterologous fungal expression system based on regulatory elements from the Aspergillus terreus terrein gene cluster.


    Gressler, Markus; Hortschansky, Peter; Geib, Elena; Brock, Matthias


    Recently, the Aspergillus terreus terrein gene cluster was identified and selected for development of a new heterologous expression system. The cluster encodes the specific transcription factor TerR that is indispensable for terrein cluster induction. To identify TerR binding sites, different recombinant versions of the TerR DNA-binding domain were analyzed for specific motif recognition. The high affinity consensus motif TCGGHHWYHCGGH was identified from genes required for terrein production and binding site mutations confirmed their essential contribution to gene expression in A. terreus. A combination of TerR with its terA target promoter was tested as recombinant expression system in the heterologous host Aspergillus niger. TerR mediated target promoter activation was directly dependent on its transcription level. Therefore, terR was expressed under control of the regulatable amylase promoter PamyB and the resulting activation of the terA target promoter was compared with activation levels obtained from direct expression of reporters from the strong gpdA control promoter. Here, the coupled system outcompeted the direct expression system. When the coupled system was used for heterologous polyketide synthase expression high metabolite levels were produced. Additionally, expression of the Aspergillus nidulans polyketide synthase gene orsA revealed lecanoric acid rather than orsellinic acid as major polyketide synthase product. Domain swapping experiments assigned this depside formation from orsellinic acid to the OrsA thioesterase domain. These experiments confirm the suitability of the expression system especially for high-level metabolite production in heterologous hosts. PMID:25852654

  5. A new high-performance heterologous fungal expression system based on regulatory elements from the Aspergillus terreus terrein gene cluster

    PubMed Central

    Gressler, Markus; Hortschansky, Peter; Geib, Elena; Brock, Matthias


    Recently, the Aspergillus terreus terrein gene cluster was identified and selected for development of a new heterologous expression system. The cluster encodes the specific transcription factor TerR that is indispensable for terrein cluster induction. To identify TerR binding sites, different recombinant versions of the TerR DNA-binding domain were analyzed for specific motif recognition. The high affinity consensus motif TCGGHHWYHCGGH was identified from genes required for terrein production and binding site mutations confirmed their essential contribution to gene expression in A. terreus. A combination of TerR with its terA target promoter was tested as recombinant expression system in the heterologous host Aspergillus niger. TerR mediated target promoter activation was directly dependent on its transcription level. Therefore, terR was expressed under control of the regulatable amylase promoter PamyB and the resulting activation of the terA target promoter was compared with activation levels obtained from direct expression of reporters from the strong gpdA control promoter. Here, the coupled system outcompeted the direct expression system. When the coupled system was used for heterologous polyketide synthase expression high metabolite levels were produced. Additionally, expression of the Aspergillus nidulans polyketide synthase gene orsA revealed lecanoric acid rather than orsellinic acid as major polyketide synthase product. Domain swapping experiments assigned this depside formation from orsellinic acid to the OrsA thioesterase domain. These experiments confirm the suitability of the expression system especially for high-level metabolite production in heterologous hosts. PMID:25852654

  6. Gene Expression in the Scleractinian Acropora microphthalma Exposed to High Solar Irradiance Reveals Elements of Photoprotection and Coral Bleaching

    PubMed Central

    Starcevic, Antonio; Dunlap, Walter C.; Cullum, John; Shick, J. Malcolm; Hranueli, Daslav; Long, Paul F.


    Background The success of tropical reef-building corals depends on the metabolic co-operation between the animal host and the photosynthetic performance of endosymbiotic algae residing within its cells. To examine the molecular response of the coral Acropora microphthalma to high levels of solar irradiance, a cDNA library was constructed by PCR-based suppression subtractive hybridisation (PCR-SSH) from mRNA obtained by transplantation of a colony from a depth of 12.7 m to near-surface solar irradiance, during which the coral became noticeably paler from loss of endosymbionts in sun-exposed tissues. Methodology/Principal Findings A novel approach to sequence annotation of the cDNA library gave genetic evidence for a hypothetical biosynthetic pathway branching from the shikimic acid pathway that leads to the formation of 4-deoxygadusol. This metabolite is a potent antioxidant and expected precursor of the UV-protective mycosporine-like amino acids (MAAs), which serve as sunscreens in coral phototrophic symbiosis. Empirical PCR based evidence further upholds the contention that the biosynthesis of these MAA sunscreens is a ‘shared metabolic adaptation’ between the symbiotic partners. Additionally, gene expression induced by enhanced solar irradiance reveals a cellular mechanism of light-induced coral bleaching that invokes a Ca2+-binding synaptotagmin-like regulator of SNARE protein assembly of phagosomal exocytosis, whereby algal partners are lost from the symbiosis. Conclusions/Significance Bioinformatics analyses of DNA sequences obtained by differential gene expression of a coral exposed to high solar irradiance has revealed the identification of putative genes encoding key steps of the MAA biosynthetic pathway. Revealed also by this treatment are genes that implicate exocytosis as a cellular process contributing to a breakdown in the metabolically essential partnership between the coral host and endosymbiotic algae, which manifests as coral bleaching. PMID

  7. The TTSMI database: a catalog of triplex target DNA sites associated with genes and regulatory elements in the human genome

    PubMed Central

    Jenjaroenpun, Piroon; Chew, Chee Siang; Yong, Tai Pang; Choowongkomon, Kiattawee; Thammasorn, Wimada; Kuznetsov, Vladimir A.


    A triplex target DNA site (TTS), a stretch of DNA that is composed of polypurines, is able to form a triple-helix (triplex) structure with triplex-forming oligonucleotides (TFOs) and is able to influence the site-specific modulation of gene expression and/or the modification of genomic DNA. The co-localization of a genomic TTS with gene regulatory signals and functional genome structures suggests that TFOs could potentially be exploited in antigene strategies for the therapy of cancers and other genetic diseases. Here, we present the TTS Mapping and Integration (TTSMI; database, which provides a catalog of unique TTS locations in the human genome and tools for analyzing the co-localization of TTSs with genomic regulatory sequences and signals that were identified using next-generation sequencing techniques and/or predicted by computational models. TTSMI was designed as a user-friendly tool that facilitates (i) fast searching/filtering of TTSs using several search terms and criteria associated with sequence stability and specificity, (ii) interactive filtering of TTSs that co-localize with gene regulatory signals and non-B DNA structures, (iii) exploration of dynamic combinations of the biological signals of specific TTSs and (iv) visualization of a TTS simultaneously with diverse annotation tracks via the UCSC genome browser. PMID:25324314

  8. The TTSMI database: a catalog of triplex target DNA sites associated with genes and regulatory elements in the human genome.


    Jenjaroenpun, Piroon; Chew, Chee Siang; Yong, Tai Pang; Choowongkomon, Kiattawee; Thammasorn, Wimada; Kuznetsov, Vladimir A


    A triplex target DNA site (TTS), a stretch of DNA that is composed of polypurines, is able to form a triple-helix (triplex) structure with triplex-forming oligonucleotides (TFOs) and is able to influence the site-specific modulation of gene expression and/or the modification of genomic DNA. The co-localization of a genomic TTS with gene regulatory signals and functional genome structures suggests that TFOs could potentially be exploited in antigene strategies for the therapy of cancers and other genetic diseases. Here, we present the TTS Mapping and Integration (TTSMI; database, which provides a catalog of unique TTS locations in the human genome and tools for analyzing the co-localization of TTSs with genomic regulatory sequences and signals that were identified using next-generation sequencing techniques and/or predicted by computational models. TTSMI was designed as a user-friendly tool that facilitates (i) fast searching/filtering of TTSs using several search terms and criteria associated with sequence stability and specificity, (ii) interactive filtering of TTSs that co-localize with gene regulatory signals and non-B DNA structures, (iii) exploration of dynamic combinations of the biological signals of specific TTSs and (iv) visualization of a TTS simultaneously with diverse annotation tracks via the UCSC genome browser. PMID:25324314

  9. csrT Represents a New Class of csrA-Like Regulatory Genes Associated with Integrative Conjugative Elements of Legionella pneumophila

    PubMed Central

    Abbott, Zachary D.; Flynn, Kaitlin J.; Byrne, Brenda G.; Mukherjee, Sampriti; Kearns, Daniel B.


    ABSTRACT Bacterial evolution is accelerated by mobile genetic elements. To spread horizontally and to benefit the recipient bacteria, genes encoded on these elements must be properly regulated. Among the legionellae are multiple integrative conjugative elements (ICEs) that each encode a paralog of the broadly conserved regulator csrA. Using bioinformatic analyses, we deduced that specific csrA paralogs are coinherited with particular lineages of the type IV secretion system that mediates horizontal spread of its ICE, suggesting a conserved regulatory interaction. As a first step to investigate the contribution of csrA regulators to this class of mobile genetic elements, we analyzed here the activity of the csrA paralog encoded on Legionella pneumophila ICE-βox. Deletion of this gene, which we name csrT, had no observed effect under laboratory conditions. However, ectopic expression of csrT abrogated the protection to hydrogen peroxide and macrophage degradation that ICE-βox confers to L. pneumophila. When ectopically expressed, csrT also repressed L. pneumophila flagellin production and motility, a function similar to the core genome's canonical csrA. Moreover, csrT restored the repression of motility to csrA mutants of Bacillus subtilis, a finding consistent with the predicted function of CsrT as an mRNA binding protein. Since all known ICEs of legionellae encode coinherited csrA-type IV secretion system pairs, we postulate that CsrA superfamily proteins regulate ICE activity to increase their horizontal spread, thereby expanding L. pneumophila versatility. IMPORTANCE ICEs are mobile DNA elements whose type IV secretion machineries mediate spread among bacterial populations. All surveyed ICEs within the Legionella genus also carry paralogs of the essential life cycle regulator csrA. It is striking that the csrA loci could be classified into distinct families based on either their sequence or the subtype of the adjacent type IV secretion system locus. To

  10. Functional analysis of the human annexin A5 gene promoter: a downstream DNA element and an upstream long terminal repeat regulate transcription.

    PubMed Central

    Carcedo, M T; Iglesias, J M; Bances, P; Morgan, R O; Fernandez, M P


    Human annexin A5 is a ubiquitous protein implicated in diverse signal transduction processes associated with cell growth and differentiation, and its gene regulation is an important component of this function. Promoter transcriptional activity was determined for a wide 5' portion of the human annexin A5 gene, from bp -1275 to +79 relative to the most 5' of several discrete transcription start points. Transfection experiments carried out in HeLa cells identified the segment from bp -202 to +79 as the minimal promoter conferring optimal transcriptional activity. Two canonical Sp1 sites in the immediate 5' flanking region of a CpG island were required for significant transcription. Strong repressive activity in the distal promoter region between bp -717 to -1153 was attributed to the presence of an endogenous retroviral long terminal repeat, homologous with long terminal repeat 47B. The downstream sequence from bp position +31 to +79 in untranslated exon 1 was also essential for transcription, as its deletion from any of the plasmid constructs abolished activity in transfection assays. Electrophoretic mobility-shift assays, Southwestern-blot analysis and affinity chromatography were used to identify a protein doublet of relative molecular mass 35 kDa that bound an octanucleotide palindromic sequence in exon 1. The DNA cis-element resembled an E-box, but did not bind higher molecular mass transcription factors, such as upstream stimulatory factor or activator protein 4. The discovery of a downstream element crucial for annexin A5 gene transcription, and its interaction with a potentially novel transcription factor or complex, may provide a clue to understanding the initiation of transcription by TATA-less, multiple start site promoters. PMID:11368787

  11. Identification of an oxygen-responsive element in the 5'-flanking sequence of the rat cytosolic phosphoenolpyruvate carboxykinase-1 gene, modulating its glucagon-dependent activation.

    PubMed Central

    Bratke, J; Kietzmann, T; Jungermann, K


    The glucagon-stimulated transcription of the cytosolic phosphoenolpyruvate carboxykinase-1 (PCK1) gene is mediated by cAMP and positively modulated by oxygen in primary hepatocytes. Rat hepatocytes were transfected with constructs containing the first 2500, 493 or 281 bp of the PCK1 5'-flanking region in front of the chloramphenicol acetyltransferase (CAT) reporter gene. With all three constructs glucagon induced CAT activity with decreasing efficiency maximally under arterial pO2 and to about 65% under venous pO2. Rat hepatocytes were then transfected with constructs containing the first 493 bp of the PCK1 5'-flanking region in front of the luciferase (LUC) reporter gene, which were block-mutated at the CRE1 (cAMP-response element-1; -93/-86), putative CRE2 (-146/-139), promoter element (P) 1 (-118/-104), P2 (-193/-181) or P4 (-291/-273) sites. Glucagon induced LUC activity strongly when the P1 and P2 sites were mutated and weakly when the P4 site was mutated; induction of the P1, P2 and P4 mutants was positively modulated by the pO2. Glucagon also induced LUC activity strongly when the putative CRE2 site was altered; however, induction of the CRE2 mutant was not modulated by the pO2. Glucagon did not induce LUC activity when the CRE1 site was modified. These experiments suggested that the CRE1 but not the putative CRE2 was an essential site necessary for the cAMP-mediated PCK1 gene activation by glucagon and that the putative CRE2 site was involved in the oxygen-dependent modulation of PCK1 gene activation. To confirm these conclusions rat hepatocytes were transfected with simian virus 40 (SV40)-promoter-driven LUC-gene constructs containing three CRE1 sequences (-95/-84), three CRE2 sequences (-148/-137) or three CRE1 sequences plus two CRE2 sequences of the PCK1 gene in front of the SV40 promoter. Glucagon induced LUC activity markedly when the CRE1, but not when the CRE2, sites were in front of the SV40-LUC gene; however, induction of the (CRE1)3SV40-LUC

  12. The HOG pathway controls osmotic regulation of transcription via the stress response element (STRE) of the Saccharomyces cerevisiae CTT1 gene.

    PubMed Central

    Schüller, C; Brewster, J L; Alexander, M R; Gustin, M C; Ruis, H


    The HOG signal pathway of the yeast Saccharomyces cerevisiae is defined by the PBS2 and HOG1 genes encoding members of the MAP kinase kinase and of the MAP kinase family, respectively. Mutations in this pathway (deletions of PBS2 or HOG1, or point mutations in HOG1) almost completely abolish the induction of transcription by osmotic stress that is mediated by stress response elements (STREs). We have demonstrated previously that STREs also mediate induction of transcription by heat shock, nitrogen starvation and oxidative stress. This study shows that they are also activated by low external pH, sorbate, benzoate or ethanol stress. Induction by these other stress signals appears to be HOG pathway independent. HOG1-dependent osmotic induction of transcription of the CTT1 gene encoding the cytosolic catalase T occurs in the presence of a protein synthesis inhibitor and can be detected rapidly after an increase of tyrosine phosphorylation of Hog1p triggered by high osmolarity. Consistent with a role of STREs in the induction of stress resistance, a number of other stress protein genes (e.g. HSP104) are regulated like CTT1. Furthermore, catalase T was shown to be important for viability under severe osmotic stress, and heat shock was demonstrated to provide cross-protection against osmotic stress. Images PMID:7523111

  13. Melanoma loss-of-function mutants in Xiphophorus caused by Xmrk-oncogene deletion and gene disruption by a transposable element.

    PubMed Central

    Schartl, M; Hornung, U; Gutbrod, H; Volff, J N; Wittbrodt, J


    The overexpression of the Xmrk oncogene (ONC-Xmrk) in pigment cells of certain Xiphophorus hybrids has been found to be the primary change that results in the formation of malignant melanoma. Spontaneous mutant stocks have been isolated that have lost the ability to induce tumor formation when crossed with Xiphophorus helleri. Two of these loss-of-function mutants were analyzed for genetic defects in ONC-Xmrk's. In the lof-1 mutant a novel transposable element, TX-1, has jumped into ONC-Xmrk, leading to a disruption of the gene and a truncated protein product lacking the carboxyterminal domain of the receptor tyrosine kinase. TX-1 is obviously an active LTR-containing retrotransposon in Xiphophorus that was not found in other fish species outside the family Poeciliidae. Surprisingly, it does not encode any protein, suggesting the existence of a helper function for this retroelement. In the lof-2 mutant the entire ONC-Xmrk gene was found to be deleted. These data show that ONC-Xmrk is indeed the tumor-inducing gene of Xiphophorus and thus the critical constituent of the tumor (Tu) locus. PMID:10545466

  14. Characterization of cis-acting elements regulating transcription of the human DF3 breast carcinoma-associated antigen (MUC1) gene.

    PubMed Central

    Abe, M; Kufe, D


    The present studies have examined the sequences responsible for regulating transcription of the human DF3 breast carcinoma-associated antigen (MUC1) gene. A region 1656 base pairs upstream to the DF3 transcription initiation site was fused to the chloramphenicol acetyltransferase gene. Transient expression assays using a series of deleted constructs demonstrated that the region from position -618 contains the regulatory sequences necessary for DF3 transcription in human MCF-7 breast cancer cells. Further analysis with internal deletion vectors and heterologous promoter constructs indicated the involvement of cis-acting elements in the fragment extending from positions -598 to -485. By gel retardation and DNA footprinting, we have identified a protein in MCF-7 cells that recognizes sequences between positions -505 and -485. The results of Southwestern studies demonstrate that this protein has an apparent molecular mass of 45 kDa. Taken together, these results suggest that DF3 gene transcription is regulated by a previously undescribed transacting factor. Images PMID:8419933

  15. Protein factors in Blastocladiella emersonii cell extracts recognize similar sequence elements in the promoters of the genes encoding cAMP-dependent protein kinase subunits.


    de Oliveira, J C; Marques, M V; Gomes, S L


    Blastocladiella emersonii contains a single cAMP-dependent protein kinase (PKA), which is similar to the mammalian type II isoforms. Its activity is regulated during development by changes in the levels of the catalytic (C) and regulatory (R) subunits, which occur in parallel with changes in levels of the corresponding mRNAs, suggesting coordinate transcriptional control of the expression of both subunits. Both R and C mRNA levels are low in vegetative cells, rise sharply during sporulation and decrease to basal levels again after germination. To investigate sequence elements common to both Blastocladiella R and C gene promoters, which might be involved in the coordinate regulation of these genes, their 5'-flanking regions were analyzed by gel mobility shift and DNase I footprinting assays. We determined that different DNA-protein complexes are generated when fragments of the R and C gene promoters are incubated with extracts from cells expressing (sporulating cells) or not expressing (vegetative cells) both subunits, and competition experiments suggested that similar protein factors bind to both promoters. DNase I footprinting experiments have indicated that a sequence common to both R and C promoters, and similar to mammalian E-boxes, binds factors present in extracts from vegetative and sporulating cells, whereas sequences flanking the E-boxes in both promoters showed a change in the pattern of DNase I digestion only when the vegetative cell extract was used. This result suggests that the composition of the protein complexes binding to these regions changes during sporulation. PMID:9294034

  16. Identification of a functional estrogen-responsive enhancer element in the promoter 2 of PRDM2 gene in breast cancer cell lines.


    Abbondanza, Ciro; De Rosa, Caterina; D'Arcangelo, Andrea; Pacifico, Marianna; Spizuoco, Clorinda; Piluso, Giulio; Di Zazzo, Erika; Gazzerro, Patrizia; Medici, Nicola; Moncharmont, Bruno; Puca, Giovanni Alfredo


    The retinoblastoma protein-interacting zinc-finger (RIZ) gene, also known as PRDM2, encodes two protein products, RIZ1 and RIZ2, differing for the presence of a 202 aa domain, called PR domain, at the N-terminus of the RIZ1 molecule. While the histone H3 K9 methyltransferase activity of RIZ1 is associated with the negative control of cell proliferation, no information is currently available on either expression regulation of the RIZ2 form or on its biological activity. RIZ proteins act as ER co-activators and promote optimal estrogen response in female reproductive tissues. In estrogen-responsive cells, 17-β estradiol modulates RIZ gene expression producing a shift in the balanced expression of the two forms. Here, we demonstrate that an estrogen-responsive element (ERE) within the RIZ promoter 2 is regulated in a ligand-specific manner by ERα, through both the AF1 and AF2 domains. The pattern of ERα binding, histone H4 acetylation, and histone H3 cyclical methylation of lysine 9 was comparable to other estrogen-regulated promoters. Association of topoisomerase IIβ with the RIZ promoter 2 confirmed the transcriptional activation induced by estrogen. We hypothesize that RIZ2, acting as a negative regulator of RIZ1 function, mediates the proliferative effect of estrogen through regulation of survival and differentiation gene expression. PMID:21503890

  17. A zinc-responsive factor interacts with a metal-regulated enhancer element (MRE) of the mouse metallothionein-I gene.

    PubMed Central

    Westin, G; Schaffner, W


    Heavy metal ions are effective inducers of metallothionein gene transcription. The metal response is dependent on short DNA motifs, so-called MREs (metal responsive elements) that occur in multiple copies in the promoter region of these genes. We have analysed an MRE of the mouse metallothionein-I gene (MREd) and we demonstrate that this can function over long distances as a bona fide metal ion-inducible enhancer. The transcription factor Sp1 and a zinc-inducible factor, designated MTF-1, bind to the MREd enhancer in vitro. The combined use of MREd mutants in a transient assay in HeLa cells and a competition band shift assay show that the zinc-inducible formation of the MTF-1/DNA complex in vitro correlates with zinc-inducible transcription in vivo. A chemical methylation interference assay revealed remarkably similar but non-identical guanine interference patterns for the MTF-1 and Sp1 complexes, which may mean that MTF-1 is related to the Sp1 factor. Images PMID:3208749

  18. The ribosomal protein L34 gene from the mosquito, Aedes albopictus: exon-intron organization, copy number, and potential regulatory elements.


    Niu, L L; Fallon, A M


    We describe the structural analysis of genomic DNA encoding ribosomal protein (rp) L34 from the mosquito, Aedes albopictus. Comparison of genomic DNA sequences encompassing approximately 8 kb with the rpL34 cDNA sequence showed that the gene contains three exons and two introns, encoding a primary transcript with a deduced size of 6196 nucleotides from the transcription start site to the polyadenylation site. Exon 1, which is not translated, measures only 45 bp, and is separated from Exon 2 by a 359 bp intron. Exon 2 measures 78 bp, and contains the AUG translation initiation codon 14 nucleotides downstream of its 5'-end. Downstream of Exon 2 is a 5270 bp intron, followed by the remainder of the coding sequence in Exon 3, which measures 444 bp including the polyadenylation signal. We used a novel PCR-based procedure to obtain 1.7 kb of DNA upstream of the rpL34 gene. Like the previously described Ae. albopictus rpL8 gene and various mammalian rp genes, the DNA immediately upstream of the rpL34 gene lacks the TATA box, and the rpL34 transcription initiation site is embedded in a characteristic polypyrimidine tract. The 5'-flanking DNA contained a number of cis-acting elements that potentially interact with transcription factors characterized by basic domains, zinc-coordinating DNA binding domains, helix-turn-helix motifs, and beta scaffold factors with minor groove contacts. Particularly striking was the conservation of an AP-4 binding site within 100 nucleotides upstream of the transcription initiation site in both Aal-rpL34 and Aal-rpL8 genes. Comparison of Southern hybridization signals using probes from the 5' and 3'-ends of the 5.3 kb second intron and the cDNA suggested that the Ae. albopictus rpL34 gene most likely occurs as a single expressed copy per haploid genome with restriction enzyme polymorphisms in the upstream flanking DNA and the likely presence of one or more pseudogenes. PMID:10612044

  19. Identification of a key regulatory element for the basal activity of the human insulin-like growth factor II gene promoter P3.

    PubMed Central

    Rietveld, L E; Holthuizen, P E; Sussenbach, J S


    Transcription of the human insulin-like growth factor II (IGF-II) gene is under the control of four promoters (P1-P4) that are differentially active during growth and development. Promoter 3 (P3) is the most active promoter during fetal development as well as in most adult tissues. P3 is also the most active promoter in tumour tissues and cell lines expressing IGF-II. Transient transfections of HeLa and Hep3B cells with truncated promoter constructs revealed that the region between -289 and -183 relative to the transcription start site supports basal promoter activity in both cell lines. Footprint experiments showed that the region between positions -192 and -172 (P3-4) is the only element bound by nuclear proteins. P3-4 is bound by five proteins, of which three proteins (proteins 3, 4 and 5) bind specifically and are expressed at the same levels in HeLa and Hep3B cells. Electrophoretic mobility shift assays and differential footprint experiments revealed the presence of two protein-binding regions within the P3-4 element. Proteins 4 and 5 bind box A (-193 to -188), whereas box B (-183 to -172) is bound by protein 3. From transcription experiments in vitro it can be concluded that Box A is essential for P3 activity. Box A is part of a region 11 dG residues long and is protected by proteins 4 and 5 that bind a contiguous set of six dG residues. DNA-binding of proteins 4 and 5 to box A requires the presence of Zn2+ ions. Thus structural and functional analysis reveals that the P3-4 element is a key regulatory element of P3 that contains two separate binding sites for proteins essential for the basal activity of IGF-II P3. PMID:9581544

  20. The imprinted SNRPN gene is associated with a polycistronic mRNA and an imprinting control element

    SciTech Connect

    Saitoh, S.; Nicholls, R.D.; Seip, J.


    The small nuclear ribonucleoprotein-associated protein SmN (SNRPN) gene is located in the Prader-Willi syndrome (PWS) critical region in chromosome 15q11-q13. We have previously shown that it is functionally imprinted in humans, being only expressed from the paternal allele and differentially methylated on parental alleles. Therefore, SNRPN may have a role in PWS, although genetic studies suggest that at least two genes may be necessary for the classical PWS phenotype. We have characterized the SNRPN genomic structure, and shown that it comprises ten exons. Surprisingly, we identified an open reading frame (ORF) in the first three exons, 190-bp 5{prime} to the SmN ORF. Notably, the majority of base substitutions bewteen human and rodents in the upstream ORF occurred in the wobble position of codons, suggesting selection for a protein coding function. This ORF, which we name SNURF (SNRPN upstream reading frame) encodes a putative polypeptide of 71 amino acids. By analogy to prokaryotic operons that encode proteins with related functions, it is possible that SNURF may have a role in pre-mRNA splicing.

  1. Regulation of the tryptophan biosynthetic genes in Bacillus halodurans: common elements but different strategies than those used by Bacillus subtilis.


    Szigeti, Reka; Milescu, Mirela; Gollnick, Paul


    In Bacillus subtilis, an RNA binding protein called TRAP regulates both transcription and translation of the tryptophan biosynthetic genes. Bacillus halodurans is an alkaliphilic Bacillus species that grows at high pHs. Previous studies of this bacterium have focused on mechanisms of adaptation for growth in alkaline environments. We have characterized the regulation of the tryptophan biosynthetic genes in B. halodurans and compared it to that in B. subtilis. B. halodurans encodes a TRAP protein with 71% sequence identity to the B. subtilis protein. Expression of anthranilate synthetase, the first enzyme in the pathway to tryptophan, is regulated significantly less in B. halodurans than in B. subtilis. Examination of the control of the B. halodurans trpEDCFBA operon both in vivo and in vitro shows that only transcription is regulated, whereas in B. subtilis both transcription of the operon and translation of trpE are controlled. The attenuation mechanism that controls transcription in B. halodurans is similar to that in B. subtilis, but there are some differences in the predicted RNA secondary structures in the B. halodurans trp leader region, including the presence of a potential anti-antiterminator structure. Translation of trpG, which is within the folate operon in both bacilli, is regulated similarly in the two species. PMID:14729709

  2. Select Prenatal Environmental Exposures and Subsequent Alterations of Gene-Specific and Repetitive Element DNA Methylation in Fetal Tissues

    PubMed Central

    Green, Benjamin B.; Marsit, Carmen J.


    Strong evidence implicates maternal environmental exposures in contributing to adverse outcomes during pregnancy and later in life through the developmental origins of health and disease hypothesis. Recent research suggests these effects are mediated through the improper regulation of DNA methylation in offspring tissues, specifically placental tissue, which plays a critical role in fetal development. This article reviews the relevant literature relating DNA methylation in multiple tissues at or near delivery to several prenatal environmental toxicants and stressors, including cigarette smoke, endocrine disruptors, heavy metals, as well as maternal diet. These human studies expand upon previously reported outcomes in animal model interventions and include effects on both imprinted and non-imprinted genes. We have also noted some of the strengths and limitations in the approaches used, and consider the appropriate interpretation of these findings in terms of their effect size and their relationship to differential gene expression and potential health outcomes. The studies suggest an important role of DNA methylation in mediating the effects of the intrauterine environment on children’s health and a need for additional research to better clarify the role of this epigenetic mechanism as well as others. PMID:26231362

  3. The peroxisomal transporter gene ANT1 is regulated by a deviant oleate response element (ORE): characterization of the signal for fatty acid induction.

    PubMed Central

    Rottensteiner, Hanspeter; Palmieri, Luigi; Hartig, Andreas; Hamilton, Barbara; Ruis, Helmut; Erdmann, Ralf; Gurvitz, Aner


    Saccharomyces cerevisiae ANT1/YPR128c encodes the peroxisomal adenine nucleotide transporter that provides ATP for intra-peroxisomal activation of medium-chain fatty acids. A lacZ reporter construct comprising the ANT1 promoter was shown to be comparatively more highly expressed in a wild-type strain grown on oleic acid, a long-chain fatty acid, than in pip2Delta(oaf1)Delta mutant cells that are defective in fatty acid induction. The ANT1 promoter was demonstrated to contain a deviant oleate response element (ORE) that could bind the Pip2p-Oaf1p transcription factor and confer activation on a basal CYC1-lacZ reporter gene. Expression of Ant1p as well as other enzymes whose genes are known to be regulated by a canonical ORE was found to be increased in cells grown on lauric acid, a medium-chain fatty acid. We concluded that the signal for induction does not differentiate between long- and medium-chain fatty acids. This signal was independent of beta-oxidation or the biogenesis of the peroxisomal compartment where this process occurs, since a pox1Delta strain blocked in the first and rate-limiting step of beta-oxidation as well as various pex mutant cells devoid of intact peroxisomes produced sufficient amounts of Pip2p-Oaf1p for binding OREs in vitro and for expressing an ORE-driven reporter gene. The signal's durability was shown to be related to the concentration of fatty acids in the medium, since a pex6Delta strain expressed an ORE-driven reporter gene at high levels for a longer period than did isogenic wild-type cells. Generation of the signal was also independent of protein synthesis, as demonstrated by cycloheximide treatment. PMID:12071844

  4. Male-Biased Aganglionic Megacolon in the TashT Mouse Line Due to Perturbation of Silencer Elements in a Large Gene Desert of Chromosome 10

    PubMed Central

    Touré, Aboubacrine M.; Béland, Mélanie; Raiwet, Diana L.; Silversides, David W.; Pilon, Nicolas


    Neural crest cells (NCC) are a transient migratory cell population that generates diverse cell types such as neurons and glia of the enteric nervous system (ENS). Via an insertional mutation screen for loci affecting NCC development in mice, we identified one line—named TashT—that displays a partially penetrant aganglionic megacolon phenotype in a strong male-biased manner. Interestingly, this phenotype is highly reminiscent of human Hirschsprung’s disease, a neurocristopathy with a still unexplained male sex bias. In contrast to the megacolon phenotype, colonic aganglionosis is almost fully penetrant in homozygous TashT animals. The sex bias in megacolon expressivity can be explained by the fact that the male ENS ends, on average, around a “tipping point” of minimal colonic ganglionosis while the female ENS ends, on average, just beyond it. Detailed analysis of embryonic intestines revealed that aganglionosis in homozygous TashT animals is due to slower migration of enteric NCC. The TashT insertional mutation is localized in a gene desert containing multiple highly conserved elements that exhibit repressive activity in reporter assays. RNAseq analyses and 3C assays revealed that the TashT insertion results, at least in part, in NCC-specific relief of repression of the uncharacterized gene Fam162b; an outcome independently confirmed via transient transgenesis. The transcriptional signature of enteric NCC from homozygous TashT embryos is also characterized by the deregulation of genes encoding members of the most important signaling pathways for ENS formation—Gdnf/Ret and Edn3/Ednrb—and, intriguingly, the downregulation of specific subsets of X-linked genes. In conclusion, this study not only allowed the identification of Fam162b coding and regulatory sequences as novel candidate loci for Hirschsprung’s disease but also provides important new insights into its male sex bias. PMID:25786024

  5. Interaction of HIF and USF signaling pathways in human genes flanked by hypoxia-response elements and E-box palindromes.


    Hu, Junmin; Stiehl, Daniel P; Setzer, Claudia; Wichmann, Daniela; Shinde, Dheeraj A; Rehrauer, Hubert; Hradecky, Pavel; Gassmann, Max; Gorr, Thomas A


    Rampant activity of the hypoxia-inducible factor (HIF)-1 in cancer is frequently associated with the malignant progression into a harder-to-treat, increasingly aggressive phenotype. Clearly, anti-HIF strategies in cancer cells are of considerable clinical interest. One way to fine-tune, or inhibit, HIF's transcriptional outflow independently of hydroxylase activities could be through competing transcription factors. A CACGTG-binding activity in human hepatoma cells was previously found to restrict HIF's access to hypoxia response cis-elements (HRE) in a Daphnia globin gene promoter construct (phb2). The CACGTG factor, and its impact on hypoxia-responsive human genes, was analyzed in this study by genome-wide computational scans as well as gene-specific quantitative PCR, reporter and DNA-binding assays in hepatoma (Hep3B), cervical carcinoma (HeLa), and breast carcinoma (MCF7) cells. Among six basic helix-loop-helix transcription factors known to target CACGTG palindromes, we identified upstream stimulatory factor (USF)-1/2 as predominant phb2 CACGTG constituents in Hep3B, HeLa, and MCF7 cells. Human genes with adjacent or overlapping HRE and CACGTG motifs included with lactate dehydrogenase A (LDHA) and Bcl-2/E1B 19 kDa interacting protein 3 (BNIP3) hypoxia-induced HIF-1 targets. Parallel recruitment of HIF-1α and USF1/2a to the respective promoter chromatin was verified for all cell lines investigated. Mutual complementing (LDHA) or moderating (BNIP3) cross-talk was seen upon overexpression or silencing of HIF-1α and USF1/2a. Distinct (LDHA) or overlapping (BNIP3) promoter-binding sites for HIF-1 and USFs were subsequently characterized. We propose that, depending on abundance or activity of its protein constituents, O(2)-independent USF signaling can function to fine-tune or interfere with HIF-mediated transcription in cancer cells. PMID:21984181

  6. The Zinc Finger Protein ZNF658 Regulates the Transcription of Genes Involved in Zinc Homeostasis and Affects Ribosome Biogenesis through the Zinc Transcriptional Regulatory Element

    PubMed Central

    Ogo, Ogo A.; Tyson, John; Cockell, Simon J.; Howard, Alison; Valentine, Ruth A.


    We previously identified the ZTRE (zinc transcriptional regulatory element) in genes involved in zinc homeostasis and showed that it mediates transcriptional repression in response to zinc. We now report that ZNF658 acts at the ZTRE. ZNF658 was identified by matrix-assisted laser desorption ionization–time of flight mass spectrometry of a band excised after electrophoretic mobility shift assay using a ZTRE probe. The protein contains a KRAB domain and 21 zinc fingers. It has similarity with ZAP1 from Saccharomyces cerevisiae, which regulates the response to zinc restriction, including a conserved DNA binding region we show to be functional also in ZNF658. Small interfering RNA (siRNA) targeted to ZNF658 abrogated the zinc-induced, ZTRE-dependent reduction in SLC30A5 (ZnT5 gene), SLC30A10 (ZnT10 gene), and CBWD transcripts in human Caco-2 cells and the ability of zinc to repress reporter gene expression from corresponding promoter-reporter constructs. Microarray analysis of the effect of reducing ZNF658 expression by siRNA uncovered a large decrease in rRNA. We find that ZTREs are clustered within the 45S rRNA precursor. We also saw effects on expression of multiple ribosomal proteins. ZNF658 thus links zinc homeostasis with ribosome biogenesis, the most active transcriptional, and hence zinc-demanding, process in the cell. ZNF658 is thus a novel transcriptional regulator that plays a fundamental role in the orchestrated cellular response to zinc availability. PMID:25582195

  7. A sugar beet chlorophyll a/b binding protein promoter void of G-box like elements confers strong and leaf specific reporter gene expression in transgenic sugar beet

    PubMed Central

    Stahl, Dietmar J; Kloos, Dorothee U; Hehl, Reinhard


    Background Modification of leaf traits in sugar beet requires a strong leaf specific promoter. With such a promoter, expression in taproots can be avoided which may otherwise take away available energy resources for sugar accumulation. Results Suppression Subtractive Hybridization (SSH) was utilized to generate an enriched and equalized cDNA library for leaf expressed genes from sugar beet. Fourteen cDNA fragments corresponding to thirteen different genes were isolated. Northern blot analysis indicates the desired tissue specificity of these genes. The promoters for two chlorophyll a/b binding protein genes (Bvcab11 and Bvcab12) were isolated, linked to reporter genes, and transformed into sugar beet using promoter reporter gene fusions. Transient and transgenic analysis indicate that both promoters direct leaf specific gene expression. A bioinformatic analysis revealed that the Bvcab11 promoter is void of G-box like regulatory elements with a palindromic ACGT core sequence. The data indicate that the presence of a G-box element is not a prerequisite for leaf specific and light induced gene expression in sugar beet. Conclusions This work shows that SSH can be successfully employed for the identification and subsequent isolation of tissue specific sugar beet promoters. These promoters are shown to drive strong leaf specific gene expression in transgenic sugar beet. The application of these promoters for expressing resistance improving genes against foliar diseases is discussed. PMID:15579211

  8. Identification of the cAMP response element that controls transcriptional activation of the insulin-like growth factor-I gene by prostaglandin E2 in osteoblasts

    NASA Technical Reports Server (NTRS)

    Thomas, M. J.; Umayahara, Y.; Shu, H.; Centrella, M.; Rotwein, P.; McCarthy, T. L.


    Insulin-like growth factor-I (IGF-I), a multifunctional growth factor, plays a key role in skeletal growth and can enhance bone cell replication and differentiation. We previously showed that prostaglandin E2 (PGE2) and other agents that increase cAMP activated IGF-I gene transcription in primary rat osteoblast cultures through promoter 1 (P1), the major IGF-I promoter, and found that transcriptional induction was mediated by protein kinase A. We now have identified a short segment of P1 that is essential for full hormonal regulation and have characterized inducible DNA-protein interactions involving this site. Transient transfections of IGF-I P1 reporter genes into primary rat osteoblasts showed that the 328-base pair untranslated region of exon 1 was required for a full 5.3-fold response to PGE2; mutation in a previously footprinted site, HS3D (base pairs +193 to +215), reduced induction by 65%. PGE2 stimulated nuclear protein binding to HS3D. Binding, as determined by gel mobility shift assay, was not seen in nuclear extracts from untreated osteoblast cultures, was detected within 2 h of PGE2 treatment, and was maximal by 4 h. This DNA-protein interaction was not observed in cytoplasmic extracts from PGE2-treated cultures, indicating nuclear localization of the protein kinase A-activated factor(s). Activation of this factor was not blocked by cycloheximide (Chx), and Chx did not impair stimulation of IGF-I gene expression by PGE2. In contrast, binding to a consensus cAMP response element (CRE; 5'-TGACGTCA-3') from the rat somatostatin gene was not modulated by PGE2 or Chx. Competition gel mobility shift analysis using mutated DNA probes identified 5'-CGCAATCG-3' as the minimal sequence needed for inducible binding. All modified IGF-I P1 promoterreporter genes with mutations within this CRE sequence also showed a diminished functional response to PGE2. These results identify the CRE within the 5'-untranslated region of IGF-I exon 1 that is required for hormonal

  9. Silencing cAMP-response element-binding protein (CREB) identifies CYR61 as a tumor suppressor gene in melanoma.


    Dobroff, Andrey S; Wang, Hua; Melnikova, Vladislava O; Villares, Gabriel J; Zigler, Maya; Huang, Li; Bar-Eli, Menashe


    Metastatic progression of melanoma is associated with overexpression and activity of cAMP-response element-binding protein (CREB). However, the mechanism by which CREB contributes to tumor progression and metastasis remains unclear. Here, we demonstrate that stably silencing CREB expression in two human metastatic melanoma cell lines, A375SM and C8161-c9, suppresses tumor growth and experimental metastasis. Analysis of cDNA microarrays revealed that CREB silencing leads to increased expression of cysteine-rich protein 61 (CCN1/CYR61) known to mediate adhesion, chemostasis, survival, and angiogenesis. Promoter analysis and chromatin immunoprecipitation assays demonstrated that CREB acts as a negative regulator of CCN1/CYR61 transcription by directly binding to its promoter. Re-expression of CREB in CREB-silenced cells rescued the low CCN1/CYR61 expression phenotype. CCN1/CYR61 overexpression resulted in reduced tumor growth and metastasis and inhibited the activity of matrix metalloproteinase-2. Furthermore, its overexpression decreased melanoma cell motility and invasion through Matrigel, which was abrogated by silencing CCN1/CYR61 in low metastatic melanoma cells. Moreover, a significant decrease in angiogenesis as well as an increase in apoptosis was seen in tumors overexpressing CCN1/CYR61. Our results demonstrate that CREB promotes melanoma growth and metastasis by down-regulating CCN1/CYR61 expression, which acts as a suppressor of melanoma cell motility, invasion and angiogenesis. PMID:19632997

  10. Silencing cAMP-response Element-binding Protein (CREB) Identifies CYR61 as a Tumor Suppressor Gene in Melanoma*

    PubMed Central

    Dobroff, Andrey S.; Wang, Hua; Melnikova, Vladislava O.; Villares, Gabriel J.; Zigler, Maya; Huang, Li; Bar-Eli, Menashe


    Metastatic progression of melanoma is associated with overexpression and activity of cAMP-response element-binding protein (CREB). However, the mechanism by which CREB contributes to tumor progression and metastasis remains unclear. Here, we demonstrate that stably silencing CREB expression in two human metastatic melanoma cell lines, A375SM and C8161-c9, suppresses tumor growth and experimental metastasis. Analysis of cDNA microarrays revealed that CREB silencing leads to increased expression of cysteine-rich protein 61 (CCN1/CYR61) known to mediate adhesion, chemostasis, survival, and angiogenesis. Promoter analysis and chromatin immunoprecipitation assays demonstrated that CREB acts as a negative regulator of CCN1/CYR61 transcription by directly binding to its promoter. Re-expression of CREB in CREB-silenced cells rescued the low CCN1/CYR61 expression phenotype. CCN1/CYR61 overexpression resulted in reduced tumor growth and metastasis and inhibited the activity of matrix metalloproteinase-2. Furthermore, its overexpression decreased melanoma cell motility and invasion through Matrigel, which was abrogated by silencing CCN1/CYR61 in low metastatic melanoma cells. Moreover, a significant decrease in angiogenesis as well as an increase in apoptosis was seen in tumors overexpressing CCN1/CYR61. Our results demonstrate that CREB promotes melanoma growth and metastasis by down-regulating CCN1/CYR61 expression, which acts as a suppressor of melanoma cell motility, invasion and angiogenesis. PMID:19632997

  11. Regulation of Gγ-Globin Gene by ATF2 and Its Associated Proteins through the cAMP-Response Element

    PubMed Central

    Dhar, Ruby; Mahajan, Milind; Choudhury, Alina; Weissman, Sherman; Pace, Betty S.


    The upstream Gγ-globin cAMP-response element (G-CRE) plays an important role in regulating Gγ-globin expression through binding of ATF2 and its DNA-binding partners defined in this study. ATF2 knockdown resulted in a significant reduction of γ-globin expression accompanied by decreased ATF2 binding to the G-CRE. By contrast, stable ATF2 expression in K562 cells increased γ-globin transcription which was reduced by ATF2 knockdown. Moreover, a similar effect of ATF2 on γ-globin expression was observed in primary erythroid progenitors. To understand the role of ATF2 in γ-globin expression, chromatographically purified G-CRE/ATF2-interacting proteins were subjected to mass spectrometry analysis; major binding partners included CREB1, cJun, Brg1, and histone deacetylases among others. Immunoprecipitation assays demonstrated interaction of these proteins with ATF2 and in vivo GCRE binding in CD34+ cells undergoing erythroid differentiation which was correlated with γ-globin expression during development. These results suggest synergism between developmental stage-specific recruitments of the ATF2 protein complex and expression of γ-globin during erythropoiesis. Microarray studies in K562 cells support ATF2 plays diverse roles in hematopoiesis and chromatin remodeling. PMID:24223142

  12. A cluster region of AP-1 responsive elements is required for transcriptional activity of mouse ODC gene by hepatocyte growth factor.


    Bianchi, Laura; Tacchini, Lorenza; Matteucci, Emanuela; Desiderio, Maria Alfonsina


    Ornithine decarboxylase (ODC) activity is regulated by a variety of mechanisms including transcription, translation, and RNA and protein half-life. Since in mouse B16-F1 melanoma cells an early and remarkable (about 6-fold) increase in steady state mRNA levels was observed after hepatocyte growth factor (HGF) treatment, we investigated the transcriptional regulation of mouse ODC promoter. Transient transfection of various ODC-luciferase promoter constructs into the B16-Fl cells in combination with electrophoretic mobility shift assays identified the HGF-responsive element as a cluster of three AP-1 binding sites (-1660 to -1572). Even if each site differs from the canonical TPA responsive element for one nucleotide, only the first two AP-1 consensus sequences seemed to be functional since allowed DNA-binding activity of nuclear proteins after HGF treatment. Comparison of the results of transfection assays with the pOD2.5-luc (2.5 kb gene fragment) and with the construct deprived of the AP-1 cluster pOD-B-luc showed that this 50 bp region was required for ODC transactivating activity in response to HGF. Since in B16-F1 cells HGF increased AP-1 activity and the mRNA expression of various AP-1 subunits, we may conclude that HGF-induced transcription of mouse ODC was largely due to triggering of AP-1 pathway. PMID:12054494

  13. Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of alpha-Amy2 genes.


    Rushton, P J; Macdonald, H; Huttly, A K; Lazarus, C M; Hooley, R


    The promoters of wheat, barley and wild oat alpha-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56-58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4-5-C-X22-23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins. PMID:8541496

  14. Microevolution of cis-regulatory elements: an example from the pair-rule segmentation gene fushi tarazu in the Drosophila melanogaster subgroup.


    Bakkali, Mohammed


    The importance of non-coding DNAs that control transcription is ever noticeable, but the characterization and analysis of the evolution of such DNAs presents challenges not found in the analysis of coding sequences. In this study of the cis-regulatory elements of the pair rule segmentation gene fushi tarazu (ftz) I report the DNA sequences of ftz's zebra element (promoter) and a region containing the proximal enhancer from a total of 45 fly lines belonging to several populations of the species Drosophila melanogaster, D. simulans, D. sechellia, D. mauritiana, D. yakuba, D. teissieri, D. orena and D. erecta. Both elements evolve at slower rate than ftz synonymous sites, thus reflecting their functional importance. The promoter evolves more slowly than the average for ftz's coding sequence while, on average, the enhancer evolves more rapidly, suggesting more functional constraint and effective purifying selection on the former. Comparative analysis of the number and nature of base substitutions failed to detect significant evidence for positive/adaptive selection in transcription-factor-binding sites. These seem to evolve at similar rates to regions not known to bind transcription factors. Although this result reflects the evolutionary flexibility of the transcription factor binding sites, it also suggests a complex and still not completely understood nature of even the characterized cis-regulatory sequences. The latter seem to contain more functional parts than those currently identified, some of which probably transcription factor binding. This study illustrates ways in which functional assignments of sequences within cis-acting sequences can be used in the search for adaptive evolution, but also highlights difficulties in how such functional assignment and analysis can be carried out. PMID:22073317

  15. Molecular basis of the recognition of the ap65-1 gene transcription promoter elements by a Myb protein from the protozoan parasite Trichomonas vaginalis.


    Jiang, Ingjye; Tsai, Chen-Kun; Chen, Sheng-Chia; Wang, Szu-Huan; Amiraslanov, Imamaddin; Chang, Chi-Fon; Wu, Wen-Jin; Tai, Jung-Hsiang; Liaw, Yen-Chywan; Huang, Tai-Huang


    Iron-inducible transcription of the ap65-1 gene in Trichomonas vaginalis involves at least three Myb-like transcriptional factors (tvMyb1, tvMyb2 and tvMyb3) that differentially bind to two closely spaced promoter sites, MRE-1/MRE-2r and MRE-2f. Here, we defined a fragment of tvMyb2 comprising residues 40-156 (tvMyb2₄₀₋₁₅₆) as the minimum structural unit that retains near full binding affinity with the promoter DNAs. Like c-Myb in vertebrates, the DNA-free tvMyb2₄₀₋₁₅₆ has a flexible and open conformation. Upon binding to the promoter DNA elements, tvMyb2₄₀₋₁₅₆ undergoes significant conformational re-arrangement and structure stabilization. Crystal structures of tvMyb2₄₀₋₁₅₆ in complex with promoter element-containing DNA oligomers showed that 5'-a/gACGAT-3' is the specific base sequence recognized by tvMyb2₄₀₋₁₅₆, which does not fully conform to that of the Myb binding site sequence. Furthermore, Lys⁴⁹, which is upstream of the R2 motif (amino acids 52-102) also participates in specific DNA sequence recognition. Intriguingly, tvMyb2₄₀₋₁₅₆ binds to the promoter elements in an orientation opposite to that proposed in the HADDOCK model of the tvMyb1₃₅₋₁₄₁/MRE-1-MRE-2r complex. These results shed new light on understanding the molecular mechanism of Myb-DNA recognition and provide a framework to study the molecular basis of transcriptional regulation of myriad Mybs in T. vaginalis. PMID:21771861

  16. A novel SNP in a vitamin D response element of the CYP24A1 promoter reduces protein binding, transactivation, and gene expression.


    Roff, Alanna; Wilson, Robin Taylor


    The active form of vitamin D (1alpha,25(OH)(2)D(3)) is known to have antiproliferative effects and has been implicated in cancers of the colon, breast, and prostate. These cancers occur more frequently among African Americans than Caucasians, and individuals with African ancestry are known to have approximately twofold lower levels of serum vitamin D (25(OH)D) compared with individuals of European ancestry. However, epidemiological studies of the vitamin D receptor (VDR) have shown inconsistent associations with cancer risk, suggesting that differences in other genes in the pathway may be important. We sought to identify functionally significant polymorphic variants in CYP24A1, a gene that is highly inducible by 1alpha,25(OH)(2)D(3) and that encodes the primary catabolic enzyme in the pathway. Here we report the identification of six novel SNPs in the human CYP24A1 promoter, including one at nucleotide -279 occurring within the distal vitamin D response element (VDRE2). Our experiments demonstrate that the VDRE2 variant results in decreased protein binding and transactivation in vitro, and reduced expression of CYP24A1 in cultured primary human lymphocytes provides evidence for an effect in vivo. This variant was only observed in our African American population, and represents a first step toward understanding differences in disease risk among racial/ethnic groups. PMID:18824104

  17. An Essential Role of cAMP Response Element Binding Protein in Ginsenoside Rg1-Mediated Inhibition of Na+/Glucose Cotransporter 1 Gene Expression.


    Wang, Chun-Wen; Su, Shih-Chieh; Huang, Shu-Fen; Huang, Yu-Chuan; Chan, Fang-Na; Kuo, Yu-Han; Hung, Mei-Whey; Lin, Hang-Chin; Chang, Wen-Liang; Chang, Tsu-Chung


    The Na(+)/glucose cotransporter 1 (SGLT1) is responsible for glucose uptake in intestinal epithelial cells. It has been shown that the intestinal SGLT1 level is significantly increased in diabetic individuals and positively correlated with the pathogenesis of diabetes. The development of targeted therapeutics that can reduce the intestinal SGLT1 expression level is, therefore, important. In this study, we showed that ginsenoside Rg1 effectively decreased intestinal glucose uptake through inhibition of SGLT1 gene expression in vivo and in vitro. Transient transfection analysis of the SGLT1 promoter revealed an essential cAMP response element (CRE) that confers the Rg1-mediated inhibition of SGLT1 gene expression. Chromatin immunoprecipitation assay and targeted CRE-binding protein (CREB) silencing demonstrated that Rg1 reduced the promoter binding of CREB and CREB binding protein associated with an inactivated chromatin status. In addition, further studies showed that the epidermal growth factor receptor (EGFR) signaling pathway also plays an essential role in the inhibitory effect of Rg1; taken together, our study demonstrates the involvement of the EGFR-CREB signaling pathway in the Rg1-mediated downregulation of SGLT1 expression, which offers a potential strategy in the development of antihyperglycemic and antidiabetic treatments. PMID:26429938

  18. Genome-wide mapping of 5-hydroxymethylcytosine in three rice cultivars reveals its preferential localization in transcriptionally silent transposable element genes.


    Wang, Xi-liang; Song, Shu-hui; Wu, Yong-Sheng; Li, Yu-Li; Chen, Ting-ting; Huang, Zhi-yuan; Liu, Shuo; Dunwell, Thomas L; Pfeifer, Gerd P; Dunwell, Jim M; Wamaedeesa, Raheema; Ullah, Ihsan; Wang, Yinsheng; Hu, Song-nian


    5-Hydroxymethylcytosine (5hmC), a modified form of cytosine that is considered the sixth nucleobase in DNA, has been detected in mammals and is believed to play an important role in gene regulation. In this study, 5hmC modification was detected in rice by employing a dot-blot assay, and its levels was further quantified in DNA from different rice tissues using liquid chromatography-multistage mass spectrometry (LC-MS/MS/MS). The results showed large intertissue variation in 5hmC levels. The genome-wide profiles of 5hmC modification in three different rice cultivars were also obtained using a sensitive chemical labelling followed by a next-generation sequencing method. Thousands of 5hmC peaks were identified, and a comparison of the distributions of 5hmC among different rice cultivars revealed the specificity and conservation of 5hmC modification. The identified 5hmC peaks were significantly enriched in heterochromatin regions, and mainly located in transposable elements (TEs), especially around retrotransposons. The correlation analysis of 5hmC and gene expression data revealed a close association between 5hmC and silent TEs. These findings provide a resource for plant DNA 5hmC epigenetic studies and expand our knowledge of 5hmC modification. PMID:26272901

  19. Overexpression of the CYP51A1 Gene and Repeated Elements are Associated with Differential Sensitivity to DMI Fungicides in Venturia inaequalis.


    Villani, Sara M; Hulvey, Jon; Hily, Jean-Michel; Cox, Kerik D


    The involvement of overexpression of the CYP51A1 gene in Venturia inaequalis was investigated for isolates exhibiting differential sensitivity to the triazole demethylation inhibitor (DMI) fungicides myclobutanil and difenoconazole. Relative expression (RE) of the CYP51A1 gene was significantly greater (P < 0.0001) for isolates with resistance to both fungicides (MRDR phenotype) or with resistance to difenoconazole only (MSDR phenotype) compared with isolates that were resistant only to myclobutanil (MRDS phenotype) or sensitive to both fungicides (MSDS phenotype). An average of 9- and 13-fold increases in CYP51A1 RE were observed in isolates resistant to difenoconazole compared with isolates with MRDS and MSDS phenotypes, respectively. Linear regression analysis between isolate relative growth on myclobutanil-amended medium and log10 RE revealed that little to no variability in sensitivity to myclobutanil could be explained by CYP51A1 overexpression (R(2) = 0.078). To investigate CYP51A1 upstream anomalies associated with CYP51A1 overexpression or resistance to difenoconazole, Illumina sequencing was conducted for three isolates with resistance to difenoconazole and one baseline isolate. A repeated element, "EL 3,1,2", with the properties of a transcriptional enhancer was identified two to four times upstream of CYP51A1 in difenoconazole-resistant isolates but was not found in isolates with the MRDS phenotype. These results suggest that different mechanisms may govern resistance to different DMI fungicides in the triazole group. PMID:26863444

  20. Functional analysis of the promoter of the mitochondrial phosphate carrier human gene: identification of activator and repressor elements and their transcription factors

    PubMed Central


    The phosphate carrier (PiC) catalyses the import of phosphate into mitochondria where it is needed for ATP synthesis. We have analysed the 5′-flanking region of the human PiC gene and found that it has a single transcriptional initiation site and lacks a TATA box. Through deletion analysis of the −1213/−25 nt region, we identified an activation domain (−223/−25) and an inhibition domain (−1017/−814). The most effective promoter activity in transfected HeLa cells corresponded to the region containing putative binding sites for Sp1 (−163/−142; where Sp1 stands for stimulating protein-1) and CREB (−138/−116; where CREB stands for cAMP-response-element-binding protein). These DNA sequences were active in gel-shift assays in the presence of HeLa cell nuclear extracts or recombinant Sp1 and CREB respectively. Forskolin increased PiC promoter activity via the CREB site. Both footprinting and transfection of deletion constructs of the inhibition region (−1017/−814) showed that PiC silencer activity extends over 25 nt (−943/−919), which specifically binds two proteins present in HeLa cell nuclear extracts. These transcription factors were purified by DNA affinity, analysed by MS and identified as p54nrb/NonO (nuclear RNA binding protein) and PSF (protein-associated splicing factor). The PiC silencer region cloned in front of the ferritin promoter conferred a strong inhibition to the heterologous promoter. These findings may provide insight into control of PiC gene expression in different cell types and under different growth conditions. To our knowledge, this is the first study to analyse the regulation of the PiC gene expression in any cell. PMID:15984930