Science.gov

Sample records for element dre-associated genes

  1. Activation of dioxin response element (DRE)-associated genes by benzo(a)pyrene 3,6-quinone and benzo(a)pyrene 1,6-quinone in MCF-10A human mammary epithelial cells

    SciTech Connect

    Burchiel, Scott W. . E-mail: SBurchiel@salud.unm.edu; Thompson, Todd A.; Lauer, Fredine T.; Oprea, Tudor I.

    2007-06-01

    Benzo(a)pyrene (BaP) is a known human carcinogen and a suspected breast cancer complete carcinogen. BaP is metabolized by several metabolic pathways, some having bioactivation and others detoxification properties. BaP-quinones (BPQs) are formed via cytochrome P450 and peroxidase dependent pathways. Previous studies by our laboratory have shown that BPQs have significant growth promoting and anti-apoptotic activities in human MCF-10A mammary epithelial cells examined in vitro. Previous results suggest that BPQs act via redox-cycling and oxidative stress. However, because two specific BPQs (1,6-BPQ and 3,6-BPQ) differed in their ability to produce reactive oxygen species (ROS) and yet both had strong proliferative and EGF receptor activating activity, we utilized mRNA expression arrays and qRT-PCR to determine potential pathways and mechanisms of gene activation. The results of the present studies demonstrated that 1,6-BPQ and 3,6-BPQ activate dioxin response elements (DRE, also known as xenobiotic response elements, XRE) and anti-oxidant response elements (ARE, also known as electrophile response elements, EpRE). 3,6-BPQ had greater DRE activity than 1,6-BPQ, whereas the opposite was true for the activation of ARE. Both 3,6-BPQ and 1,6-BPQ induced oxidative stress-associated genes (HMOX1, GCLC, GCLM, and SLC7A11), phase 2 enzyme genes (NQO1, NQO2, ALDH3A1), PAH metabolizing genes (CYP1B1, EPHX1, AKR1C1), and certain EGF receptor-associated genes (EGFR, IER3, ING1, SQSTM1 and TRIM16). The results of these studies demonstrate that BPQs activate numerous pathways in human mammary epithelial cells associated with increased cell growth and survival that may play important roles in tumor promotion.

  2. Transposable element origins of epigenetic gene regulation.

    PubMed

    Lisch, Damon; Bennetzen, Jeffrey L

    2011-04-01

    Transposable elements (TEs) are massively abundant and unstable in all plant genomes, but are mostly silent because of epigenetic suppression. Because all known epigenetic pathways act on all TEs, it is likely that the specialized epigenetic regulation of regular host genes (RHGs) was co-opted from this ubiquitous need for the silencing of TEs and viruses. With their internally repetitive and rearranging structures, and the acquisition of fragments of RHGs, the expression of TEs commonly makes antisense RNAs for both TE genes and RHGs. These antisense RNAs, particularly from heterochromatic reservoirs of 'zombie' TEs that are rearranged to form variously internally repetitive structures, may be advantageous because their induction will help rapidly suppress active TEs of the same family. RHG fragments within rapidly rearranging TEs may also provide the raw material for the ongoing generation of miRNA genes. TE gene expression is regulated by both environmental and developmental signals, and insertions can place nearby RHGs under the regulation (both standard and epigenetic) of the TE. The ubiquity of TEs, their frequent preferential association with RHGs, and their ability to be programmed by epigenetic signals all indicate that RGHs have nearly unlimited access to novel regulatory cassettes to assist plant adaptation.

  3. Transcription factor trapping by RNA in gene regulatory elements.

    PubMed

    Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A

    2015-11-20

    Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. Copyright © 2015, American Association for the Advancement of Science.

  4. An internal regulatory element controls troponin I gene expression

    SciTech Connect

    Yutzey, K.E.; Kline, R.L.; Konieczmy, S.F. . Dept. of Biological Sciences)

    1989-04-01

    During skeletal myogenesis, approximately 20 contractile proteins and related gene products temporally accumulate as the cells fuse to form multinucleated muscle fibers. In most instances, the contractile protein genes are regulated transcriptionally, which suggests that a common molecular mechanism may coordinate the expression of this diverse and evolutionarily unrelated gene set. Recent studies have examined the muscle-specific cis-acting elements associated with numerous contractile protein genes. All of the identified regulatory elements are positioned in the 5'-flanking regions, usually within 1,500 base pairs of the transcription start site. Surprisingly, a DNA consensus sequence that is common to each contractile protein gene has not been identified. In contrast to the results of these earlier studies, the authors have found that the 5'-flanking region of the quail troponin I (TnI) gene is not sufficient to permit the normal myofiber transcriptional activation of the gene. Instead, the TnI gene utilizes a unique internal regulatory element that is responsible for the correct myofiber-specific expression pattern associated with the TnI gene. This is the first example in which a contractile protein gene has been shown to rely primarily on an internal regulatory element to elicit transcriptional activation during myogenesis. The diversity of regulatory elements associated with the contractile protein genes suggests that the temporal expression of the genes may involve individual cis-trans regulatory components specific for each gene.

  5. Transposable element influences on gene expression in plants.

    PubMed

    Hirsch, Cory D; Springer, Nathan M

    2017-01-01

    Transposable elements (TEs) comprise a major portion of many plant genomes and bursts of TE movements cause novel genomic variation within species. In order to maintain proper gene function, plant genomes have evolved a variety of mechanisms to tolerate the presence of TEs within or near genes. Here, we review our understanding of the interactions between TEs and gene expression in plants by assessing three ways that transposons can influence gene expression. First, there is growing evidence that TE insertions within introns or untranslated regions of genes are often tolerated and have minimal impact on expression level or splicing. However, there are examples in which TE insertions within genes can result in aberrant or novel transcripts. Second, TEs can provide novel alternative promoters, which can lead to new expression patterns or original coding potential of an alternate transcript. Third, TE insertions near genes can influence regulation of gene expression through a variety of mechanisms. For example, TEs may provide novel cis-acting regulatory sites behaving as enhancers or insert within existing enhancers to influence transcript production. Alternatively, TEs may change chromatin modifications in regions near genes, which in turn can influence gene expression levels. Together, the interactions of genes and TEs provide abundant evidence for the role of TEs in changing basic functions within plant genomes beyond acting as latent genomic elements or as simple insertional mutagens. This article is part of a Special Issue entitled: Plant Gene Regulatory Mechanisms and Networks, edited by Dr. Erich Grotewold and Dr. Nathan Springer.

  6. An autoregulatory enhancer element of the Drosophila homeotic gene Deformed.

    PubMed

    Bergson, C; McGinnis, W

    1990-12-01

    The stable determination of different anterior-posterior regions of the Drosophila embryo is controlled by the persistent expression of homeotic selector genes. One mechanism that has been proposed to explain the persistent expression of the homeotic gene Deformed is an autoactivation circuit that would be used once Deformed expression had been established by earlier acting patterning genes. Here we show that a large cis-regulatory element mapping approximately 5 kb upstream of the Deformed transcription start has the properties predicted for a Deformed autoregulatory enhancer. This element provides late, spatially localized expression in the epidermal cells of the maxillary and mandibular segments which is wholly dependent upon endogenous Deformed function. In addition, the autoregulatory enhancer can be activated ectopically in embryos and in imaginal disc cells by ectopic expression of Deformed protein. Deletion analysis of the autoregulatory element indicates that it contains compartment specific sub-elements similar to those of other homeotic loci.

  7. A DNA element in the slo gene modulates ethanol tolerance.

    PubMed

    Krishnan, Harish R; Li, Xiaolei; Ghezzi, Alfredo; Atkinson, Nigel S

    2016-03-01

    In Drosophila, the slo gene encodes BK-type Ca(2+)-activated K(+) channels and is involved in producing rapid functional tolerance to sedation with ethanol. Drosophila are ideal for the study of functional ethanol tolerance because the adult does not acquire metabolic ethanol tolerance (Scholz, Ramond, Singh, & Heberlein, 2000). It has been shown that mutations in slo block the capacity to acquire tolerance, that sedation with ethanol vapor induces slo gene expression in the nervous system, and that transgenic induction of slo can phenocopy tolerance (Cowmeadow, Krishnan, & Atkinson, 2005; Cowmeadow et al., 2006). Here we use ethanol-induced histone acetylation to map a DNA regulatory element in the slo transcriptional control region and functionally test the element for a role in producing ethanol tolerance. Histone acetylation is commonly associated with activating transcription factors. We used the chromatin immunoprecipitation assay to map histone acetylation changes following ethanol sedation to identify an ethanol-responsive DNA element. Ethanol sedation induced an increase in histone acetylation over a 60 n DNA element called 6b, which is situated between the two ethanol-responsive neural promoters of the slo gene. Removal of the 6b element from the endogenous slo gene affected the production of functional ethanol tolerance as assayed in an ethanol-vapor recovery from sedation assay. Removal of element 6b extended the period of functional ethanol tolerance from ∼10 days to more than 21 days after a single ethanol-vapor sedation. This study demonstrates that mapping the position of ethanol-induced histone acetylation is an effective way to identify DNA regulatory elements that help to mediate the response of a gene to ethanol. Using this approach, we identified a DNA element, which is conserved among Drosophila species, and which is important for producing a behaviorally relevant ethanol response.

  8. Mobile genetic elements and cancer. From mutations to gene therapy.

    PubMed

    Kozeretska, I A; Demydov, S V; Ostapchenko, L I

    2011-12-01

    In the present review, an association between cancer and the activity of the non-LTR retroelements L1, Alu, and SVA, as well as endogenous retroviruses, in the human genome, is analyzed. Data suggesting that transposons have been involved in embryogenesis and malignization processes, are presented. Events that lead to the activation of mobile elements in mammalian somatic cells, as well as the use of mobile elements in genetic screening and cancer gene therapy, are reviewed.

  9. Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

    SciTech Connect

    Santini, Simona; Boore, Jeffrey L.; Meyer, Axel

    2003-12-31

    Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involved in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.

  10. Evolutionary conservation of regulatory elements in vertebrate Hox gene clusters.

    PubMed

    Santini, Simona; Boore, Jeffrey L; Meyer, Axel

    2003-06-01

    Comparisons of DNA sequences among evolutionarily distantly related genomes permit identification of conserved functional regions in noncoding DNA. Hox genes are highly conserved in vertebrates, occur in clusters, and are uninterrupted by other genes. We aligned (PipMaker) the nucleotide sequences of the HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human, and mouse, which are separated by approximately 500 million years of evolution. In support of our approach, several identified putative regulatory elements known to regulate the expression of Hox genes were recovered. The majority of the newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac database). The regulatory intergenic regions located between the genes that are expressed most anteriorly in the embryo are longer and apparently more evolutionarily conserved than those at the other end of Hox clusters. Different presumed regulatory sequences are retained in either the Aalpha or Abeta duplicated Hox clusters in the fish lineages. This suggests that the conserved elements are involved in different gene regulatory networks and supports the duplication-deletion-complementation model of functional divergence of duplicated genes.

  11. Gene vector and transposable element behavior in mosquitoes.

    PubMed

    O'Brochta, David A; Sethuraman, Nagaraja; Wilson, Raymond; Hice, Robert H; Pinkerton, Alexandra C; Levesque, Cynthia S; Bideshi, Dennis K; Jasinskiene, Nijole; Coates, Craig J; James, Anthony A; Lehane, Michael J; Atkinson, Peter W

    2003-11-01

    The development of efficient germ-line transformation technologies for mosquitoes has increased the ability of entomologists to find, isolate and analyze genes. The utility of the currently available systems will be determined by a number of factors including the behavior of the gene vectors during the initial integration event and their behavior after chromosomal integration. Post-integration behavior will determine whether the transposable elements being employed currently as primary gene vectors will be useful as gene-tagging and enhancer-trapping agents. The post-integration behavior of existing insect vectors has not been extensively examined. Mos1 is useful as a primary germ-line transformation vector in insects but is inefficiently remobilized in Drosophila melanogaster and Aedes aegypti. Hermes transforms D. melanogaster efficiently and can be remobilized in this species. This element is also useful for creating transgenic A. aegypti, but its mode of integration in mosquitoes results in the insertion of flanking plasmid DNA. Hermes can be remobilized in the soma of A. aegypti and transposes using a common cut-and-paste mechanism; however, the element does not remobilize in the germ line. piggyBac can be used to create transgenic mosquitoes and occasionally integrates using a mechanism other than a simple cut-and-paste mechanism. Preliminary data suggest that remobilization is infrequent. Minos also functions in mosquitoes and, like the other gene vectors, appears to remobilize inefficiently following integration. These results have implications for future gene vector development efforts and applications.

  12. Evolutionary Conservation of Regulatory Elements in Vertebrate Hox Gene Clusters

    PubMed Central

    Santini, Simona; Boore, Jeffrey L.; Meyer, Axel

    2003-01-01

    Comparisons of DNA sequences among evolutionarily distantly related genomes permit identification of conserved functional regions in noncoding DNA. Hox genes are highly conserved in vertebrates, occur in clusters, and are uninterrupted by other genes. We aligned (PipMaker) the nucleotide sequences of the HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human, and mouse, which are separated by approximately 500 million years of evolution. In support of our approach, several identified putative regulatory elements known to regulate the expression of Hox genes were recovered. The majority of the newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac database). The regulatory intergenic regions located between the genes that are expressed most anteriorly in the embryo are longer and apparently more evolutionarily conserved than those at the other end of Hox clusters. Different presumed regulatory sequences are retained in either the Aα or Aβ duplicated Hox clusters in the fish lineages. This suggests that the conserved elements are involved in different gene regulatory networks and supports the duplication-deletion-complementation model of functional divergence of duplicated genes. PMID:12799348

  13. Transcriptional Targeting in the Airway Using Novel Gene Regulatory Elements

    PubMed Central

    Burnight, Erin R.; Wang, Guoshun; McCray, Paul B.

    2012-01-01

    The delivery of cystic fibrosis transmembrane conductance regulator (CFTR) to airway epithelia is a goal of many gene therapy strategies to treat cystic fibrosis. Because the native regulatory elements of the CFTR are not well characterized, the development of vectors with heterologous promoters of varying strengths and specificity would aid in our selection of optimal reagents for the appropriate expression of the vector-delivered CFTR gene. Here we contrasted the performance of several novel gene-regulatory elements. Based on airway expression analysis, we selected putative regulatory elements from BPIFA1 and WDR65 to investigate. In addition, we selected a human CFTR promoter region (∼ 2 kb upstream of the human CFTR transcription start site) to study. Using feline immunodeficiency virus vectors containing the candidate elements driving firefly luciferase, we transduced murine nasal epithelia in vivo. Luciferase expression persisted for 30 weeks, which was the duration of the experiment. Furthermore, when the nasal epithelium was ablated using the detergent polidocanol, the mice showed a transient loss of luciferase expression that returned 2 weeks after administration, suggesting that our vectors transduced a progenitor cell population. Importantly, the hWDR65 element drove sufficient CFTR expression to correct the anion transport defect in CFTR-null epithelia. These results will guide the development of optimal vectors for sufficient, sustained CFTR expression in airway epithelia. PMID:22447971

  14. Identification of Genetic Elements Associated with EPSPS Gene Amplification

    PubMed Central

    Gaines, Todd A.; Wright, Alice A.; Molin, William T.; Lorentz, Lothar; Riggins, Chance W.; Tranel, Patrick J.; Beffa, Roland; Westra, Philip; Powles, Stephen B.

    2013-01-01

    Weed populations can have high genetic plasticity and rapid responses to environmental selection pressures. For example, 100-fold amplification of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene evolved in the weed species Amaranthus palmeri to confer resistance to glyphosate, the world’s most important herbicide. However, the gene amplification mechanism is unknown. We sequenced the EPSPS gene and genomic regions flanking EPSPS loci in A. palmeri, and searched for mobile genetic elements or repetitive sequences. The EPSPS gene was 10,229 bp, containing 8 exons and 7 introns. The gene amplification likely proceeded through a DNA-mediated mechanism, as introns exist in the amplified gene copies and the entire amplified sequence is at least 30 kb in length. Our data support the presence of two EPSPS loci in susceptible (S) A. palmeri, and that only one of these was amplified in glyphosate-resistant (R) A. palmeri. The EPSPS gene amplification event likely occurred recently, as no sequence polymorphisms were found within introns of amplified EPSPS copies from R individuals. Sequences with homology to miniature inverted-repeat transposable elements (MITEs) were identified next to EPSPS gene copies only in R individuals. Additionally, a putative Activator (Ac) transposase and a repetitive sequence region were associated with amplified EPSPS genes. The mechanism controlling this DNA-mediated amplification remains unknown. Further investigation is necessary to determine if the gene amplification may have proceeded via DNA transposon-mediated replication, and/or unequal recombination between different genomic regions resulting in replication of the EPSPS gene. PMID:23762434

  15. Specificity of simple hormone response elements in androgen regulated genes.

    PubMed

    Marschke, K B; Tan, J A; Kupfer, S R; Wilson, E M; French, F S

    1995-11-01

    Androgen (AR) and glucocorticoid (GR) receptors recognize a family of 15 base pair partial palindromic hormone response elements (HRE). We have studied receptor interactions with several HREs from androgen regulated genes to determine their potential to mediate a selective androgen response. Synthetic oligonucleotides corresponding to the elements were analysed for receptor binding and steroid dependent transcriptional enhancer activities. Each HRE contained the 3' half-site sequence (5'-TGTNCT-3') of the glucocorticoid response element (GRE) consensus sequence. HREs that countained the 5' half-site GRE consensus sequence (5'-A/GGNACA/G-3') had the strongest and-rogen response element (ARE) and GRE activities. In methylation interference assays, AR and GR interacted with identical base contact sites in the response elements. Two elements that deviated from the GRE consensus sequence by a single optimal base in the 5' half, had reduced ARE activity with no significant change in GRE activity and displayed lower binding of AR than GR in mobility shift assays using purified DNA binding domain peptides. Transfections with AR/GR and GR/AR chimeras containing the N-terminal domain of one receptor linked to the DNA-binding and C-terminal domains of the other suggested that N-terminal domain functions of GR also contributed to the greater GRE than ARE activities of the response elements.

  16. Interaction between conjugative and retrotransposable elements in horizontal gene transfer.

    PubMed

    Novikova, Olga; Smith, Dorie; Hahn, Ingrid; Beauregard, Arthur; Belfort, Marlene

    2014-12-01

    Mobile genetic elements either encode their own mobilization machineries or hijack them from other mobile elements. Multiple classes of mobile elements often coexist within genomes and it is unclear whether they have the capacity to functionally interact and even collaborate. We investigate the possibility that molecular machineries of disparate mobile elements may functionally interact, using the example of a retrotransposon, in the form of a mobile group II intron, found on a conjugative plasmid pRS01 in Lactococcus lactis. This intron resides within the pRS01 ltrB gene encoding relaxase, the enzyme required for nicking the transfer origin (oriT) for conjugal transmission of the plasmid into a recipient cell. Here, we show that relaxase stimulates both the frequency and diversity of retrotransposition events using a retromobility indicator gene (RIG), and by developing a high-throughput genomic retrotransposition detection system called RIG-Seq. We demonstrate that LtrB relaxase not only nicks ssDNA of its cognate oriT in a sequence- and strand-specific manner, but also possesses weak off-target activity. Together, the data support a model in which the two different mobile elements, one using an RNA-based mechanism, the other using DNA-based transfer, do functionally interact. Intron splicing facilitates relaxase expression required for conjugation, whereas relaxase introduces spurious nicks in recipient DNA that stimulate both the frequency of intron mobility and the density of events. We hypothesize that this functional interaction between the mobile elements would promote horizontal conjugal gene transfer while stimulating intron dissemination in the donor and recipient cells.

  17. Efficiently finding regulatory elements using correlation with gene expression.

    PubMed

    Bannai, Hideo; Inenaga, Shunsuke; Shinohara, Ayumi; Takeda, Masayuki; Miyano, Satoru

    2004-06-01

    We present an efficient algorithm for detecting putative regulatory elements in the upstream DNA sequences of genes, using gene expression information obtained from microarray experiments. Based on a generalized suffix tree, our algorithm looks for motif patterns whose appearance in the upstream region is most correlated with the expression levels of the genes. We are able to find the optimal pattern, in time linear in the total length of the upstream sequences. We implement and apply our algorithm to publicly available microarray gene expression data, and show that our method is able to discover biologically significant motifs, including various motifs which have been reported previously using the same data set. We further discuss applications for which the efficiency of the method is essential, as well as possible extensions to our algorithm.

  18. Alu Elements as Novel Regulators of Gene Expression in Type 1 Diabetes Susceptibility Genes?

    PubMed

    Kaur, Simranjeet; Pociot, Flemming

    2015-07-13

    Despite numerous studies implicating Alu repeat elements in various diseases, there is sparse information available with respect to the potential functional and biological roles of the repeat elements in Type 1 diabetes (T1D). Therefore, we performed a genome-wide sequence analysis of T1D candidate genes to identify embedded Alu elements within these genes. We observed significant enrichment of Alu elements within the T1D genes (p-value < 10e-16), which highlights their importance in T1D. Functional annotation of T1D genes harboring Alus revealed significant enrichment for immune-mediated processes (p-value < 10e-6). We also identified eight T1D genes harboring inverted Alus (IRAlus) within their 3' untranslated regions (UTRs) that are known to regulate the expression of host mRNAs by generating double stranded RNA duplexes. Our in silico analysis predicted the formation of duplex structures by IRAlus within the 3'UTRs of T1D genes. We propose that IRAlus might be involved in regulating the expression levels of the host T1D genes.

  19. Combinatorial Gene Regulatory Functions Underlie Ultraconserved Elements in Drosophila

    PubMed Central

    Warnefors, Maria; Hartmann, Britta; Thomsen, Stefan; Alonso, Claudio R.

    2016-01-01

    Ultraconserved elements (UCEs) are discrete genomic elements conserved across large evolutionary distances. Although UCEs have been linked to multiple facets of mammalian gene regulation their extreme evolutionary conservation remains largely unexplained. Here, we apply a computational approach to investigate this question in Drosophila, exploring the molecular functions of more than 1,500 UCEs shared across the genomes of 12 Drosophila species. Our data indicate that Drosophila UCEs are hubs for gene regulatory functions and suggest that UCE sequence invariance originates from their combinatorial roles in gene control. We also note that the gene regulatory roles of intronic and intergenic UCEs (iUCEs) are distinct from those found in exonic UCEs (eUCEs). In iUCEs, transcription factor (TF) and epigenetic factor binding data strongly support iUCE roles in transcriptional and epigenetic regulation. In contrast, analyses of eUCEs indicate that they are two orders of magnitude more likely than the expected to simultaneously include protein-coding sequence, TF-binding sites, splice sites, and RNA editing sites but have reduced roles in transcriptional or epigenetic regulation. Furthermore, we use a Drosophila cell culture system and transgenic Drosophila embryos to validate the notion of UCE combinatorial regulatory roles using an eUCE within the Hox gene Ultrabithorax and show that its protein-coding region also contains alternative splicing regulatory information. Taken together our experiments indicate that UCEs emerge as a result of combinatorial gene regulatory roles and highlight common features in mammalian and insect UCEs implying that similar processes might underlie ultraconservation in diverse animal taxa. PMID:27247329

  20. Combinatorial Gene Regulatory Functions Underlie Ultraconserved Elements in Drosophila.

    PubMed

    Warnefors, Maria; Hartmann, Britta; Thomsen, Stefan; Alonso, Claudio R

    2016-09-01

    Ultraconserved elements (UCEs) are discrete genomic elements conserved across large evolutionary distances. Although UCEs have been linked to multiple facets of mammalian gene regulation their extreme evolutionary conservation remains largely unexplained. Here, we apply a computational approach to investigate this question in Drosophila, exploring the molecular functions of more than 1,500 UCEs shared across the genomes of 12 Drosophila species. Our data indicate that Drosophila UCEs are hubs for gene regulatory functions and suggest that UCE sequence invariance originates from their combinatorial roles in gene control. We also note that the gene regulatory roles of intronic and intergenic UCEs (iUCEs) are distinct from those found in exonic UCEs (eUCEs). In iUCEs, transcription factor (TF) and epigenetic factor binding data strongly support iUCE roles in transcriptional and epigenetic regulation. In contrast, analyses of eUCEs indicate that they are two orders of magnitude more likely than the expected to simultaneously include protein-coding sequence, TF-binding sites, splice sites, and RNA editing sites but have reduced roles in transcriptional or epigenetic regulation. Furthermore, we use a Drosophila cell culture system and transgenic Drosophila embryos to validate the notion of UCE combinatorial regulatory roles using an eUCE within the Hox gene Ultrabithorax and show that its protein-coding region also contains alternative splicing regulatory information. Taken together our experiments indicate that UCEs emerge as a result of combinatorial gene regulatory roles and highlight common features in mammalian and insect UCEs implying that similar processes might underlie ultraconservation in diverse animal taxa.

  1. p53 genes function to restrain mobile elements

    PubMed Central

    Wylie, Annika; Jones, Amanda E.; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V.; Rakheja, Dinesh; Chen, Kenneth S.; Hammer, Robert E.; Comerford, Sarah A.; Amatruda, James F.; Abrams, John M.

    2016-01-01

    Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53− germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5′ sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility. PMID:26701264

  2. Regulation of photoreceptor gene transcription via a highly conserved transcriptional regulatory element by vsx gene products

    PubMed Central

    Pan, Yi; Comiskey, Daniel F.; Kelly, Lisa E.; Chandler, Dawn S.

    2016-01-01

    Purpose The photoreceptor conserved element-1 (PCE-1) sequence is found in the transcriptional regulatory regions of many genes expressed in photoreceptors. The retinal homeobox (Rx or Rax) gene product functions by binding to PCE-1 sites. However, other transcriptional regulators have also been reported to bind to PCE-1. One of these, vsx2, is expressed in retinal progenitor and bipolar cells. The purpose of this study is to identify Xenopus laevis vsx gene products and characterize vsx gene product expression and function with respect to the PCE-1 site. Methods X. laevis vsx gene products were amplified with PCR. Expression patterns were determined with in situ hybridization using whole or sectioned X. laevis embryos and digoxigenin- or fluorescein-labeled antisense riboprobes. DNA binding characteristics of the vsx gene products were analyzed with electrophoretic mobility shift assays (EMSAs) using in vitro translated proteins and radiolabeled oligonucleotide probes. Gene transactivation assays were performed using luciferase-based reporters and in vitro transcribed effector gene products, injected into X. laevis embryos. Results We identified one vsx1 and two vsx2 gene products. The two vsx2 gene products are generated by alternate mRNA splicing. We verified that these gene products are expressed in the developing retina and that expression resolves into distinct cell types in the mature retina. Finally, we found that vsx gene products can bind the PCE-1 site in vitro and that the two vsx2 isoforms have different gene transactivation activities. Conclusions vsx gene products are expressed in the developing and mature neural retina. vsx gene products can bind the PCE-1 site in vitro and influence the expression of a rhodopsin promoter-luciferase reporter gene. The two isoforms of vsx have different gene transactivation activities in this reporter gene system. PMID:28003732

  3. Two Maize Genes Are Each Targeted Predominantly by Distinct Classes of Mu Elements

    PubMed Central

    Hardeman, K. J.; Chandler, V. L.

    1993-01-01

    The Mutator transposable element system of maize has been used to isolate mutations at many different genes. Six different classes of Mu transposable elements have been identified. An important question is whether particular classes of Mu elements insert into different genes at equivalent frequencies. To begin to address this question, we used a small number of closely related Mutator plants to generate multiple independent mutations at two different genes. The overall mutation frequency was similar for the two genes. We then determined what types of Mu elements inserted into the genes. We found that each of the genes was preferentially targeted by a different class of Mu element, even when the two genes were mutated in the same plant. Possible explanations for these findings are discussed. These results have important implications for cloning Mu-tagged genes as other genes may also be resistant or susceptible to the insertion of particular classes of Mu elements. PMID:8307329

  4. Regulatory elements of Caenorhabditis elegans ribosomal protein genes

    PubMed Central

    2012-01-01

    Background Ribosomal protein genes (RPGs) are essential, tightly regulated, and highly expressed during embryonic development and cell growth. Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, Drosophila, and vertebrates. A recent investigation of genomic sequences conserved across both nematode species and associated with different gene groups indicated the existence of several elements in the upstream regions of C. elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. Results In this study, we performed an in-depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans RPGs using the motif discovery algorithm DME. Four motifs were partially similar to transcription factor binding sites from C. elegans, Drosophila, yeast, and human. One pair of these motifs was found to co-occur in the upstream regions of 250 transcripts including 22 RPGs. The distance between the two motifs displayed a complex frequency pattern that was related to their relative orientation. We tested the impact of three of these motifs on the expression of rpl-2 using a series of reporter gene constructs and showed that all three motifs are necessary to maintain the high natural expression level of this gene. One of the motifs was similar to the binding site of an orthologue of POP-1, and we showed that RNAi knockdown of pop-1 impacts the expression of rpl-2. We further determined the transcription start site of rpl-2 by 5’ RACE and found that the motifs lie 40–90 bases upstream of the start site. We also found evidence that a noncoding RNA, contained within the outron of rpl-2, is co-transcribed with rpl-2 and cleaved during trans-splicing. Conclusions Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily distinct from those of all other species

  5. Gene regulatory elements of the cardiac conduction system.

    PubMed

    van Duijvenboden, Karel; Ruijter, Jan M; Christoffels, Vincent M

    2014-01-01

    The coordinated contraction of the heart relies on the generation and conduction of the electrical impulse. Aberrations of the function of the cardiac conduction system have been associated with various arrhythmogenic disorders and increased risk of sudden cardiac death. The genetics underlying conduction system function have been investigated using functional studies and genome-wide association studies. Both methods point towards the involvement of ion channel genes and the transcription factors that govern their activity. A large fraction of disease- and trait-associated sequence variants lie within non-coding sequences, enriched with epigenetic marks indicative of regulatory DNA. Although sequence conservation as a result of functional constraint has been a useful property to identify transcriptional enhancers, this identification process has been advanced through the development of techniques such as ChIP-seq and chromatin conformation capture technologies. The role of variation in gene regulatory elements in the cardiac conduction system has recently been demonstrated by studies on enhancers of SCN5A/SCN10A and TBX5. In both studies, a region harbouring a functionally implicated single-nucleotide polymorphism was shown to drive reproducible cardiac expression in a reporter gene assay. Furthermore, the risk variant of the allele abrogated enhancer function in both cases. Functional studies on regulatory DNA will likely receive a boost through recent developments in genome modification technologies.

  6. Lateral Transfer of Genes and Gene Fragments in Staphylococcus Extends beyond Mobile Elements ▿ †

    PubMed Central

    Chan, Cheong Xin; Beiko, Robert G.; Ragan, Mark A.

    2011-01-01

    The widespread presence of antibiotic resistance and virulence among Staphylococcus isolates has been attributed in part to lateral genetic transfer (LGT), but little is known about the broader extent of LGT within this genus. Here we report the first systematic study of the modularity of genetic transfer among 13 Staphylococcus genomes covering four distinct named species. Using a topology-based phylogenetic approach, we found, among 1,354 sets of homologous genes examined, strong evidence of LGT in 368 (27.1%) gene sets, and weaker evidence in another 259 (19.1%). Within-gene and whole-gene transfer contribute almost equally to the topological discordance of these gene sets against a reference phylogeny. Comparing genetic transfer in single-copy and in multicopy gene sets, we observed a higher frequency of LGT in the latter, and a substantial functional bias in cases of whole-gene transfer (little such bias was observed in cases of fragmentary genetic transfer). We found evidence that lateral transfer, particularly of entire genes, impacts not only functions related to antibiotic, drug, and heavy-metal resistance, as well as membrane transport, but also core informational and metabolic functions not associated with mobile elements. Although patterns of sequence similarity support the cohesion of recognized species, LGT within S. aureus appears frequently to disrupt clonal complexes. Our results demonstrate that LGT and gene duplication play important parts in functional innovation in staphylococcal genomes. PMID:21622749

  7. Characterization and distribution of repetitive elements in association with genes in the human genome.

    PubMed

    Liang, Kai-Chiang; Tseng, Joseph T; Tsai, Shaw-Jenq; Sun, H Sunny

    2015-08-01

    Repetitive elements constitute more than 50% of the human genome. Recent studies implied that the complexity of living organisms is not just a direct outcome of a number of coding sequences; the repetitive elements, which do not encode proteins, may also play a significant role. Though scattered studies showed that repetitive elements in the regulatory regions of a gene control gene expression, no systematic survey has been done to report the characterization and distribution of various types of these repetitive elements in the human genome. Sequences from 5' and 3' untranslated regions and upstream and downstream of a gene were downloaded from the Ensembl database. The repetitive elements in the neighboring of each gene were identified and classified using cross-matching implemented in the RepeatMasker. The annotation and distribution of distinct classes of repetitive elements associated with individual gene were collected to characterize genes in association with different types of repetitive elements using systems biology program. We identified a total of 1,068,400 repetitive elements which belong to 37-class families and 1235 subclasses that are associated with 33,761 genes and 57,365 transcripts. In addition, we found that the tandem repeats preferentially locate proximal to the transcription start site (TSS) of genes and the major function of these genes are involved in developmental processes. On the other hand, interspersed repetitive elements showed a tendency to be accumulated at distal region from the TSS and the function of interspersed repeat-containing genes took part in the catabolic/metabolic processes. Results from the distribution analysis were collected and used to construct a gene-based repetitive element database (GBRED; http://www.binfo.ncku.edu.tw/GBRED/index.html). A user-friendly web interface was designed to provide the information of repetitive elements associated with any particular gene(s). This is the first study focusing on the gene

  8. Expressing genes do not forget their LINEs: transposable elements and gene expression

    PubMed Central

    Kines, Kristine J.; Belancio, Victoria P.

    2012-01-01

    1. ABSTRACT Historically the accumulated mass of mammalian transposable elements (TEs), particularly those located within gene boundaries, was viewed as a genetic burden potentially detrimental to the genomic landscape. This notion has been strengthened by the discovery that transposable sequences can alter the architecture of the transcriptome, not only through insertion, but also long after the integration process is completed. Insertions previously considered harmless are now known to impact the expression of host genes via modification of the transcript quality or quantity, transcriptional interference, or by the control of pathways that affect the mRNA life-cycle. Conversely, several examples of the evolutionary advantageous impact of TEs on the host gene structure that diversified the cellular transcriptome are reported. TE-induced changes in gene expression can be tissue-or disease-specific, raising the possibility that the impact of TE sequences may vary during development, among normal cell types, and between normal and disease-affected tissues. The understanding of the rules and abundance of TE-interference with gene expression is in its infancy, and its contribution to human disease and/or evolution remains largely unexplored. PMID:22201807

  9. Expressing genes do not forget their LINEs: transposable elements and gene expression.

    PubMed

    Kines, Kristine J; Belancio, Victoria P

    2012-01-01

    Historically the accumulated mass of mammalian transposable elements (TEs), particularly those located within gene boundaries, was viewed as a genetic burden potentially detrimental to the genomic landscape. This notion has been strengthened by the discovery that transposable sequences can alter the architecture of the transcriptome, not only through insertion, but also long after the integration process is completed. Insertions previously considered harmless are now known to impact the expression of host genes via modification of the transcript quality or quantity, transcriptional interference, or by the control of pathways that affect the mRNA life-cycle. Conversely, several examples of the evolutionary advantageous impact of TEs on the host gene structure that diversified the cellular transcriptome are reported. TE-induced changes in gene expression can be tissue- or disease-specific, raising the possibility that the impact of TE sequences may vary during development, among normal cell types, and between normal and disease-affected tissues. The understanding of the rules and abundance of TE-interference with gene expression is in its infancy, and its contribution to human disease and/or evolution remains largely unexplored.

  10. Identification of positive and negative transcriptional regulatory elements of the rabbit angiotensin-converting enzyme gene.

    PubMed Central

    Goraya, T Y; Kessler, S P; Kumar, R S; Douglas, J; Sen, G C

    1994-01-01

    The two tissue-specific mRNAs encoding the isozymes of rabbit angiotensin-converting enzyme (ACE) are generated from the same gene by alternative choice of two transcription initiation sites 5.7 kb apart. In the current study, we have characterized the regulatory sites controlling the transcription of the larger pulmonary isozyme mRNA. For this purpose, reporter genes driven by varying lengths of upstream region of the ACE gene were transfected into ACE-producing cells. Our results demonstrated that the transcription of this gene is primarily driven by positive elements within the first 274 bp DNA upstream of the transcription initiation site. The reporter gene driven by this region was expressed in two ACE-producing cells but not in two ACE-non-producing cells thereby establishing its tissue specificity. Our experiments also revealed the existence of a strong negative element located between -692 and -610 positions. This element suppressed the expression of the reporter gene in a dose-dependent and position and orientation-independent fashion thus suggesting that it is a true silencer element. It could also repress the expression of a reporter gene driven by the heterologous strong promoter of the beta-actin gene. The repressing effects of the negative element could be partially overcome by cotransfecting the isolated negative element along with the reporter gene containing the negative element. This result was possibly due to the functional removal of a limiting trans-acting factor which binds to this element. Electrophoretic mobility shift assays revealed that the negative element can form several complexes with proteins present in the nuclear extract of an ACE-producing cell line. At least part of the negative element is strongly conserved in the upstream regions of the human and mouse ACE genes. Images PMID:8165133

  11. Surveying DNA Elements within Functional Genes of Heterocyst-Forming Cyanobacteria.

    PubMed

    Hilton, Jason A; Meeks, John C; Zehr, Jonathan P

    2016-01-01

    Some cyanobacteria are capable of differentiating a variety of cell types in response to environmental factors. For instance, in low nitrogen conditions, some cyanobacteria form heterocysts, which are specialized for N2 fixation. Many heterocyst-forming cyanobacteria have DNA elements interrupting key N2 fixation genes, elements that are excised during heterocyst differentiation. While the mechanism for the excision of the element has been well-studied, many questions remain regarding the introduction of the elements into the cyanobacterial lineage and whether they have been retained ever since or have been lost and reintroduced. To examine the evolutionary relationships and possible function of DNA sequences that interrupt genes of heterocyst-forming cyanobacteria, we identified and compared 101 interruption element sequences within genes from 38 heterocyst-forming cyanobacterial genomes. The interruption element lengths ranged from about 1 kb (the minimum able to encode the recombinase responsible for element excision), up to nearly 1 Mb. The recombinase gene sequences served as genetic markers that were common across the interruption elements and were used to track element evolution. Elements were found that interrupted 22 different orthologs, only five of which had been previously observed to be interrupted by an element. Most of the newly identified interrupted orthologs encode proteins that have been shown to have heterocyst-specific activity. However, the presence of interruption elements within genes with no known role in N2 fixation, as well as in three non-heterocyst-forming cyanobacteria, indicates that the processes that trigger the excision of elements may not be limited to heterocyst development or that the elements move randomly within genomes. This comprehensive analysis provides the framework to study the history and behavior of these unique sequences, and offers new insight regarding the frequency and persistence of interruption elements in

  12. Surveying DNA Elements within Functional Genes of Heterocyst-Forming Cyanobacteria

    PubMed Central

    Hilton, Jason A.; Meeks, John C.; Zehr, Jonathan P.

    2016-01-01

    Some cyanobacteria are capable of differentiating a variety of cell types in response to environmental factors. For instance, in low nitrogen conditions, some cyanobacteria form heterocysts, which are specialized for N2 fixation. Many heterocyst-forming cyanobacteria have DNA elements interrupting key N2 fixation genes, elements that are excised during heterocyst differentiation. While the mechanism for the excision of the element has been well-studied, many questions remain regarding the introduction of the elements into the cyanobacterial lineage and whether they have been retained ever since or have been lost and reintroduced. To examine the evolutionary relationships and possible function of DNA sequences that interrupt genes of heterocyst-forming cyanobacteria, we identified and compared 101 interruption element sequences within genes from 38 heterocyst-forming cyanobacterial genomes. The interruption element lengths ranged from about 1 kb (the minimum able to encode the recombinase responsible for element excision), up to nearly 1 Mb. The recombinase gene sequences served as genetic markers that were common across the interruption elements and were used to track element evolution. Elements were found that interrupted 22 different orthologs, only five of which had been previously observed to be interrupted by an element. Most of the newly identified interrupted orthologs encode proteins that have been shown to have heterocyst-specific activity. However, the presence of interruption elements within genes with no known role in N2 fixation, as well as in three non-heterocyst-forming cyanobacteria, indicates that the processes that trigger the excision of elements may not be limited to heterocyst development or that the elements move randomly within genomes. This comprehensive analysis provides the framework to study the history and behavior of these unique sequences, and offers new insight regarding the frequency and persistence of interruption elements in

  13. Gene expression variation in Drosophila melanogaster due to rare transposable element insertion alleles of large effect.

    PubMed

    Cridland, Julie M; Thornton, Kevin R; Long, Anthony D

    2015-01-01

    Transposable elements are a common source of genetic variation that may play a substantial role in contributing to gene expression variation. However, the contribution of transposable elements to expression variation thus far consists of a handful of examples. We used previously published gene expression data from 37 inbred Drosophila melanogaster lines from the Drosophila Genetic Reference Panel to perform a genome-wide assessment of the effects of transposable elements on gene expression. We found thousands of transcripts with transposable element insertions in or near the transcript and that the presence of a transposable element in or near a transcript is significantly associated with reductions in expression. We estimate that within this example population, ∼2.2% of transcripts have a transposable element insertion, which significantly reduces expression in the line containing the transposable element. We also find that transcripts with insertions within 500 bp of the transcript show on average a 0.67 standard deviation decrease in expression level. These large decreases in expression level are most pronounced for transposable element insertions close to transcripts and the effect diminishes for more distant insertions. This work represents the first genome-wide analysis of gene expression variation due to transposable elements and suggests that transposable elements are an important class of mutation underlying expression variation in Drosophila and likely in other systems, given the ubiquity of these mobile elements in eukaryotic genomes. Copyright © 2015 by the Genetics Society of America.

  14. Functional architecture and evolution of transcriptional elements that drive gene coexpression.

    PubMed

    Brown, Christopher D; Johnson, David S; Sidow, Arend

    2007-09-14

    Transcriptional coexpression of interacting gene products is required for complex molecular processes; however, the function and evolution of cis-regulatory elements that orchestrate coexpression remain largely unexplored. We mutagenized 19 regulatory elements that drive coexpression of Ciona muscle genes and obtained quantitative estimates of the cis-regulatory activity of the 77 motifs that comprise these elements. We found that individual motif activity ranges broadly within and among elements, and among different instantiations of the same motif type. The activity of orthologous motifs is strongly constrained, although motif arrangement, type, and activity vary greatly among the elements of different co-regulated genes. Thus, the syntactical rules governing this regulatory function are flexible but become highly constrained evolutionarily once they are established in a particular element.

  15. Location and characterization of two widely separated glucocorticoid response elements in the phosphoenolpyruvate carboxykinase gene

    SciTech Connect

    Petersen, D.D.; Magnuson, M.A.; Granner, D.K.

    1988-01-01

    Chimeric genes were constructed by fusion of various regions of the 5'-flanking sequence from the phosphoenolpyruvate carboxykinase (GTP) (PEPCK) gene to the chloramphenicol acetyltransferase-coding sequence and to simian virus 40 splice and polyadenylation sequences. These were used to demonstrate that two glucocorticoid regulatory elements (GREs) combine to confer glucocorticoid responsiveness upon the PEPCK gene in H4IIE hepatoma cells. Both elements, distal one whose 5' boundary is located between -1264 and -1111 base pairs and a proximal one located between -468 and -420 base pairs relative to the transcription initiation site, act independently, in various positions and orientations, and upon the heterologous thymidine kinase promoter. Each element accounts for half of the maximal response of the chimeric genes. Therefore, two widely separated enhancerlike elements contribute equally to the response of the PEPCK gene to glucocorticoid hormones. Neither of the PEPCK GREs contains the TGTTCT consensus sequence associated with most other GREs.

  16. Location and characterization of two widely separated glucocorticoid response elements in the phosphoenolpyruvate carboxykinase gene.

    PubMed Central

    Petersen, D D; Magnuson, M A; Granner, D K

    1988-01-01

    Chimeric genes were constructed by fusion of various regions of the 5'-flanking sequence from the phosphoenolpyruvate carboxykinase (GTP) (PEPCK) gene to the chloramphenicol acetyltransferase-coding sequence and to simian virus 40 splice and polyadenylation sequences. These were used to demonstrate that two glucocorticoid regulatory elements (GREs) combine to confer glucocorticoid responsiveness upon the PEPCK gene in H4IIE hepatoma cells. Both elements, a distal one whose 5' boundary is located between -1264 and -1111 base pairs and a proximal one located between -468 and -420 base pairs relative to the transcription initiation site, act independently, in various positions and orientations, and upon the heterologous thymidine kinase promoter. Each element accounts for half of the maximal response of the chimeric genes. Therefore, two widely separated enhancerlike elements contribute equally to the response of the PEPCK gene to glucocorticoid hormones. Neither of the PEPCK GREs contains the TGTTCT consensus sequence associated with most other GREs. Images PMID:3422101

  17. Structural Relationships between Highly Conserved Elements and Genes in Vertebrate Genomes

    PubMed Central

    Sun, Hong; Skogerbø, Geir; Wang, Zhen; Liu, Wei; Li, Yixue

    2008-01-01

    Large numbers of sequence elements have been identified to be highly conserved among vertebrate genomes. These highly conserved elements (HCEs) are often located in or around genes that are involved in transcription regulation and early development. They have been shown to be involved in cis-regulatory activities through both in vivo and additional computational studies. We have investigated the structural relationships between such elements and genes in six vertebrate genomes human, mouse, rat, chicken, zebrafish and tetraodon and detected several thousand cases of conserved HCE-gene associations, and also cases of HCEs with no common target genes. A few examples underscore the potential significance of our findings about several individual genes. We found that the conserved association between HCE/HCEs and gene/genes are not restricted to elements by their absolute distance on the genome. Notably, long-range associations were identified and the molecular functions of the associated genes do not show any particular overrepresentation of the functional categories previously reported. HCEs in close proximity are found to be linked with different set of gene/genes. The results reflect the highly complex correlation between HCEs and their putative target genes. PMID:19008958

  18. Deciphering RNA Regulatory Elements Involved in the Developmental and Environmental Gene Regulation of Trypanosoma brucei.

    PubMed

    Gazestani, Vahid H; Salavati, Reza

    2015-01-01

    Trypanosoma brucei is a vector-borne parasite with intricate life cycle that can cause serious diseases in humans and animals. This pathogen relies on fine regulation of gene expression to respond and adapt to variable environments, with implications in transmission and infectivity. However, the involved regulatory elements and their mechanisms of actions are largely unknown. Here, benefiting from a new graph-based approach for finding functional regulatory elements in RNA (GRAFFER), we have predicted 88 new RNA regulatory elements that are potentially involved in the gene regulatory network of T. brucei. We show that many of these newly predicted elements are responsive to both transcriptomic and proteomic changes during the life cycle of the parasite. Moreover, we found that 11 of predicted elements strikingly resemble previously identified regulatory elements for the parasite. Additionally, comparison with previously predicted motifs on T. brucei suggested the superior performance of our approach based on the current limited knowledge of regulatory elements in T. brucei.

  19. Gene transfer agents: phage-like elements of genetic exchange

    PubMed Central

    Lang, Andrew S.; Zhaxybayeva, Olga; Beatty, J. Thomas

    2013-01-01

    Horizontal gene transfer is important in the evolution of bacterial and archaeal genomes. An interesting genetic exchange process is carried out by diverse phage-like gene transfer agents (GTAs) that are found in a wide range of prokaryotes. Although GTAs resemble phages, they lack the hallmark capabilities that define typical phages, and they package random pieces of the producing cell’s genome. In this Review, we discuss the defining characteristics of the GTAs that have been identified to date, along with potential functions for these agents and the possible evolutionary forces that act on the genes involved in their production. PMID:22683880

  20. A functional gene array for detection of bacterial virulence elements

    SciTech Connect

    Jaing, C

    2007-11-01

    We report our development of the first of a series of microarrays designed to detect pathogens with known mechanisms of virulence and antibiotic resistance. By targeting virulence gene families as well as genes unique to specific biothreat agents, these arrays will provide important data about the pathogenic potential and drug resistance profiles of unknown organisms in environmental samples. To validate our approach, we developed a first generation array targeting genes from Escherichia coli strains K12 and CFT073, Enterococcus faecalis and Staphylococcus aureus. We determined optimal probe design parameters for microorganism detection and discrimination, measured the required target concentration, and assessed tolerance for mismatches between probe and target sequences. Mismatch tolerance is a priority for this application, due to DNA sequence variability among members of gene families. Arrays were created using the NimbleGen Maskless Array Synthesizer at Lawrence Livermore National Laboratory. Purified genomic DNA from combinations of one or more of the four target organisms, pure cultures of four related organisms, and environmental aerosol samples with spiked-in genomic DNA were hybridized to the arrays. Based on the success of this prototype, we plan to design further arrays in this series, with the goal of detecting all known virulence and antibiotic resistance gene families in a greatly expanded set of organisms.

  1. Satellite DNA-Like Elements Associated With Genes Within Euchromatin of the Beetle Tribolium castaneum

    PubMed Central

    Brajković, Josip; Feliciello, Isidoro; Bruvo-Mađarić, Branka; Ugarković, Đurđica

    2012-01-01

    In the red flour beetle Tribolium castaneum the major TCAST satellite DNA accounts for 35% of the genome and encompasses the pericentromeric regions of all chromosomes. Because of the presence of transcriptional regulatory elements and transcriptional activity in these sequences, TCAST satellite DNAs also have been proposed to be modulators of gene expression within euchromatin. Here, we analyze the distribution of TCAST homologous repeats in T. castaneum euchromatin and study their association with genes as well as their potential gene regulatory role. We identified 68 arrays composed of TCAST-like elements distributed on all chromosomes. Based on sequence characteristics the arrays were composed of two types of TCAST-like elements. The first type consists of TCAST satellite-like elements in the form of partial monomers or tandemly arranged monomers, up to tetramers, whereas the second type consists of TCAST-like elements embedded with a complex unit that resembles a DNA transposon. TCAST-like elements were also found in the 5′ untranslated region (UTR) of the CR1-3_TCa retrotransposon, and therefore retrotransposition may have contributed to their dispersion throughout the genome. No significant difference in the homogenization of dispersed TCAST-like elements was found either at the level of local arrays or chromosomes nor among different chromosomes. Of 68 TCAST-like elements, 29 were located within introns, with the remaining elements flanked by genes within a 262 to 404,270 nt range. TCAST-like elements are statistically overrepresented near genes with immunoglobulin-like domains attesting to their nonrandom distribution and a possible gene regulatory role. PMID:22908042

  2. Vertebrate GAGA factor associated insulator elements demarcate homeotic genes in the HOX clusters.

    PubMed

    Srivastava, Surabhi; Puri, Deepika; Garapati, Hita Sony; Dhawan, Jyotsna; Mishra, Rakesh K

    2013-04-22

    Hox genes impart segment identity to body structures along the anterior-posterior axis and are crucial for the proper development of all organisms. Multiple regulatory elements, best defined in Drosophila melanogaster, ensure that Hox expression patterns follow the spatial and temporal colinearity reflected in their tight genomic organization. However, the precise mechanisms that regulate colinear patterns of Hox gene expression remain unclear, especially in higher vertebrates where it is not fully determined how the distinct activation domains of the tightly clustered Hox genes are defined independently of each other. Here, we report the identification of a large number of novel cis-elements at mammalian Hox clusters that can help in regulating their precise expression pattern. We have identified DNA elements at all four murine Hox clusters that show poor association with histone H3 in chromatin immunoprecipitation (ChIP)-chip tiling arrays. The majority of these elements lie in the intergenic regions segregating adjacent Hox genes; we demonstrate that they possess efficient enhancer-blocking activity in mammalian cells. Further, we find that these histone-free intergenic regions bear GA repeat motifs and associate with the vertebrate homolog of the GAGA binding boundary factor. This suggests that they can act as GAGA factor-dependent chromatin boundaries that create independent domains, insulating each Hox gene from the influence of neighboring regulatory elements. Our results reveal a large number of potential regulatory elements throughout the murine Hox clusters. We further demarcate the precise location of several novel cis-elements bearing chromatin boundary activity that appear to segregate successive Hox genes. This reflects a pattern reminiscent of the organization of homeotic genes in Drosophila, where such regulatory elements have been characterized. Our findings thus provide new insights into the regulatory processes and evolutionarily conserved

  3. What makes up plant genomes: The vanishing line between transposable elements and genes.

    PubMed

    Zhao, Dongyan; Ferguson, Ann A; Jiang, Ning

    2016-02-01

    The ultimate source of evolution is mutation. As the largest component in plant genomes, transposable elements (TEs) create numerous types of mutations that cannot be mimicked by other genetic mechanisms. When TEs insert into genomic sequences, they influence the expression of nearby genes as well as genes unlinked to the insertion. TEs can duplicate, mobilize, and recombine normal genes or gene fragments, with the potential to generate new genes or modify the structure of existing genes. TEs also donate their transposase coding regions for cellular functions in a process called TE domestication. Despite the host defense against TE activity, a subset of TEs survived and thrived through discreet selection of transposition activity, target site, element size, and the internal sequence. Finally, TEs have established strategies to reduce the efficacy of host defense system by increasing the cost of silencing TEs. This review discusses the recent progress in the area of plant TEs with a focus on the interaction between TEs and genes.

  4. Periodic, Quasi-periodic and Chaotic Dynamics in Simple Gene Elements with Time Delays.

    PubMed

    Suzuki, Yoko; Lu, Mingyang; Ben-Jacob, Eshel; Onuchic, José N

    2016-02-15

    Regulatory gene circuit motifs play crucial roles in performing and maintaining vital cellular functions. Frequently, theoretical studies of gene circuits focus on steady-state behaviors and do not include time delays. In this study, the inclusion of time delays is shown to entirely change the time-dependent dynamics for even the simplest possible circuits with one and two gene elements with self and cross regulations. These elements can give rise to rich behaviors including periodic, quasi-periodic, weak chaotic, strong chaotic and intermittent dynamics. We introduce a special power-spectrum-based method to characterize and discriminate these dynamical modes quantitatively. Our simulation results suggest that, while a single negative feedback loop of either one- or two-gene element can only have periodic dynamics, the elements with two positive/negative feedback loops are the minimalist elements to have chaotic dynamics. These elements typically have one negative feedback loop that generates oscillations, and another unit that allows frequent switches among multiple steady states or between oscillatory and non-oscillatory dynamics. Possible dynamical features of several simple one- and two-gene elements are presented in details. Discussion is presented for possible roles of the chaotic behavior in the robustness of cellular functions and diseases, for example, in the context of cancer.

  5. Periodic, Quasi-periodic and Chaotic Dynamics in Simple Gene Elements with Time Delays

    PubMed Central

    Suzuki, Yoko; Lu, Mingyang; Ben-Jacob, Eshel; Onuchic, José N.

    2016-01-01

    Regulatory gene circuit motifs play crucial roles in performing and maintaining vital cellular functions. Frequently, theoretical studies of gene circuits focus on steady-state behaviors and do not include time delays. In this study, the inclusion of time delays is shown to entirely change the time-dependent dynamics for even the simplest possible circuits with one and two gene elements with self and cross regulations. These elements can give rise to rich behaviors including periodic, quasi-periodic, weak chaotic, strong chaotic and intermittent dynamics. We introduce a special power-spectrum-based method to characterize and discriminate these dynamical modes quantitatively. Our simulation results suggest that, while a single negative feedback loop of either one- or two-gene element can only have periodic dynamics, the elements with two positive/negative feedback loops are the minimalist elements to have chaotic dynamics. These elements typically have one negative feedback loop that generates oscillations, and another unit that allows frequent switches among multiple steady states or between oscillatory and non-oscillatory dynamics. Possible dynamical features of several simple one- and two-gene elements are presented in details. Discussion is presented for possible roles of the chaotic behavior in the robustness of cellular functions and diseases, for example, in the context of cancer. PMID:26876008

  6. Sterol Regulatory Element Binding Protein Is a Principal Regulator of Anaerobic Gene Expression in Fission Yeast†

    PubMed Central

    Todd, Bridget L.; Stewart, Emerson V.; Burg, John S.; Hughes, Adam L.; Espenshade, Peter J.

    2006-01-01

    Fission yeast sterol regulatory element binding protein (SREBP), called Sre1p, functions in an oxygen-sensing pathway to allow adaptation to fluctuating oxygen concentrations. The Sre1p-Scp1p complex responds to oxygen-dependent sterol synthesis as an indirect measure of oxygen availability. To examine the role of Sre1p in anaerobic gene expression in Schizosaccharomyces pombe, we performed transcriptional profiling experiments after a shift to anaerobic conditions for 1.5 h. Of the 4,940 genes analyzed, expression levels of 521 (10.5%) and 686 (13.9%) genes were significantly increased and decreased, respectively, under anaerobic conditions. Sre1p controlled 68% of genes induced ≥2-fold. Oxygen-requiring biosynthetic pathways for ergosterol, heme, sphingolipid, and ubiquinone were primary targets of Sre1p. Induction of glycolytic genes and repression of mitochondrial oxidative phosphorylation genes largely did not require Sre1p. Using chromatin immunoprecipitation, we demonstrated that Sre1p acts directly at target gene promoters and stimulates its own transcription under anaerobic conditions. sre1+ promoter analysis identified two DNA elements that are both necessary and sufficient for oxygen-dependent, Sre1p-dependent transcription. Interestingly, these elements are homologous to sterol regulatory elements bound by mammalian SREBP, highlighting the evolutionary conservation between Sre1p and SREBP. We conclude that Sre1p is a principal activator of anaerobic gene expression, upregulating genes required for nonrespiratory oxygen consumption. PMID:16537923

  7. Horizontal transfers of transposable elements in eukaryotes: The flying genes.

    PubMed

    Panaud, Olivier

    2016-01-01

    Transposable elements (TEs) are the major components of eukaryotic genomes. Their propensity to densely populate and in some cases invade the genomes of plants and animals is in contradiction with the fact that transposition is strictly controlled by several molecular pathways acting at either transcriptional or post-transcriptional levels. Horizontal transfers, defined as the transmission of genetic material between sexually isolated species, have long been considered as rare phenomena. Here, we show that the horizontal transfers of transposable elements (HTTs) are very frequent in ecosystems. The exact mechanisms of such transfers are not well understood, but species involved in close biotic interactions, like parasitism, show a propensity to exchange genetic material horizontally. We propose that HTTs allow TEs to escape the silencing machinery of their host genome and may therefore be an important mechanism for their survival and their dissemination in eukaryotes.

  8. Identification of genetic elements associated with EPSPS gene amplification

    USDA-ARS?s Scientific Manuscript database

    Weed populations can have high genetic plasticity and rapid responses to environmental selection pressures. For example, 100-fold amplification of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene evolved to confer resistance to glyphosate, the world's most important herbicide, in the wee...

  9. Role of Conserved Non-Coding Regulatory Elements in LMW Glutenin Gene Expression

    PubMed Central

    Juhász, Angéla; Makai, Szabolcs; Sebestyén, Endre; Tamás, László; Balázs, Ervin

    2011-01-01

    Transcriptional regulation of LMW glutenin genes were investigated in-silico, using publicly available gene sequences and expression data. Genes were grouped into different LMW glutenin types and their promoter profiles were determined using cis-acting regulatory elements databases and published results. The various cis-acting elements belong to some conserved non-coding regulatory regions (CREs) and might act in two different ways. There are elements, such as GCN4 motifs found in the long endosperm box that could serve as key factors in tissue-specific expression. Some other elements, such as the AACA/TA motifs or the individual prolamin box variants, might modulate the level of expression. Based on the promoter sequences and expression characteristic LMW glutenin genes might be transcribed following two different mechanisms. Most of the s- and i-type genes show a continuously increasing expression pattern. The m-type genes, however, demonstrate normal distribution in their expression profiles. Differences observed in their expression could be related to the differences found in their promoter sequences. Polymorphisms in the number and combination of cis-acting elements in their promoter regions can be of crucial importance in the diverse levels of production of single LMW glutenin gene types. PMID:22242127

  10. Insulin Regulation of the Glucagon Gene is Mediated by an Insulin- Responsive DNA Element

    NASA Astrophysics Data System (ADS)

    Philippe, Jacques

    1991-08-01

    Diabetes mellitus is characterized by insulin deficiency and high plasma glucagon levels, which can be normalized by insulin replacement. It has previously been reported that glucagon gene expression is negatively regulated by insulin at the transcriptional level. By transfection studies, I have now localized a DNA control element that mediates insulin effects on glucagon gene transcription. This element also confers insulin responsiveness to a heterologous promoter. DNA-binding proteins that specifically interact with this insulin-responsive element are found in both glucagon- and non-glucagon-producing cells; and the pattern of binding, as assessed by the gel retardation assay, is not modified by prior insulin treatment.

  11. A versatile element for gene addition in bacterial chromosomes

    PubMed Central

    Sibley, Marion H.; Raleigh, Elisabeth A.

    2012-01-01

    The increasing interest in genetic manipulation of bacterial host metabolic pathways for protein or small molecule production has led to a need to add new genes to a chromosome quickly and easily without leaving behind a selectable marker. The present report describes a vector and four-day procedure that enable site-specific chromosomal insertion of cloned genes in a context insulated from external transcription, usable once in a construction series. The use of rhamnose-inducible transcription from rhaBp allows regulation of the inserted genes independently of the commonly used IPTG and arabinose strategies. Using lacZ as a reporter, we first show that expression from the rhamnose promoter is tightly regulatable, exhibiting very low leakage of background expression compared with background, and moderate rhamnose-induced expression compared with IPTG-induced expression from lacp. Second, the expression of a DNA methyltransferase was used to show that rhamnose regulation yielded on-off expression of this enzyme, such that a resident high-copy plasmid was either fully sensitive or fully resistant to isoschizomer restriction enzyme cleavage. In both cases, growth medium manipulation allows intermediate levels of expression. The vehicle can also be adapted as an ORF-cloning vector. PMID:22123741

  12. Pineal expression-promoting element (PIPE), a cis-acting element, directs pineal-specific gene expression in zebrafish

    PubMed Central

    Asaoka, Yoichi; Mano, Hiroaki; Kojima, Daisuke; Fukada, Yoshitaka

    2002-01-01

    The pineal gland, sharing morphological and biochemical similarities with the retina, plays a unique and central role in the photoneuroendocrine system. The unique development of the pineal gland is directed by a specific combination of the expressed genes, but little is known about the regulatory mechanism underlying the pineal-specific gene expression. We isolated a 1.1-kbp fragment upstream of the zebrafish exo-rhodopsin (exorh) gene, which is expressed specifically in the pineal gland. Transgenic analysis using an enhanced green fluorescent protein reporter gene demonstrated that the proximal 147-bp region of the exorh promoter is sufficient to direct pineal-specific expression. This region contains three copies of a putative cone rod homeobox (Crx)/Otx-binding site, which is known to be required for expression of both retina- and pineal-specific genes. Deletion and mutational analyses of the exorh promoter revealed that a previously uncharacterized sequence TGACCCCAATCT termed pineal expression-promoting element (PIPE) is required for pineal-specific promoter activity in addition to the Crx/Otx-binding sites. By using the zebrafish rhodopsin (rh) promoter that drives retina-specific expression, we created a reporter construct having ectopic PIPE in the rh promoter at a position equivalent to that in the exorh promoter by introducing five nucleotide changes. Such a slight modification in the rh promoter induced ectopic enhanced green fluorescent protein expression in the pineal gland without affecting its retinal expression. These results identify PIPE as a critical cis-element contributing to the pineal-specific gene expression, in combination with the Crx/Otx-binding site(s). PMID:12438694

  13. The Berkeley Drosophila Genome Project gene disruption project: Single P-element insertions mutating 25% of vital Drosophila genes.

    PubMed Central

    Spradling, A C; Stern, D; Beaton, A; Rhem, E J; Laverty, T; Mozden, N; Misra, S; Rubin, G M

    1999-01-01

    A fundamental goal of genetics and functional genomics is to identify and mutate every gene in model organisms such as Drosophila melanogaster. The Berkeley Drosophila Genome Project (BDGP) gene disruption project generates single P-element insertion strains that each mutate unique genomic open reading frames. Such strains strongly facilitate further genetic and molecular studies of the disrupted loci, but it has remained unclear if P elements can be used to mutate all Drosophila genes. We now report that the primary collection has grown to contain 1045 strains that disrupt more than 25% of the estimated 3600 Drosophila genes that are essential for adult viability. Of these P insertions, 67% have been verified by genetic tests to cause the associated recessive mutant phenotypes, and the validity of most of the remaining lines is predicted on statistical grounds. Sequences flanking >920 insertions have been determined to exactly position them in the genome and to identify 376 potentially affected transcripts from collections of EST sequences. Strains in the BDGP collection are available from the Bloomington Stock Center and have already assisted the research community in characterizing >250 Drosophila genes. The likely identity of 131 additional genes in the collection is reported here. Our results show that Drosophila genes have a wide range of sensitivity to inactivation by P elements, and provide a rationale for greatly expanding the BDGP primary collection based entirely on insertion site sequencing. We predict that this approach can bring >85% of all Drosophila open reading frames under experimental control. PMID:10471706

  14. Characterization of the enhancer element of the Danio rerio minor globin gene locus.

    PubMed

    Nefedochkina, Anastasia V; Petrova, Natalia V; Ioudinkova, Elena S; Kovina, Anastasia P; Iarovaia, Olga V; Razin, Sergey V

    2016-04-01

    In Danio rerio, the alpha- and beta-globin genes are present in two clusters: a major cluster located on chromosome 3 and a minor cluster located on chromosome 12. In contrast to the segregated alpha- and beta-globin gene domains of warm-blooded animals, in Danio rerio, each cluster contains both alpha- and beta-globin genes. Expression of globin genes present in the major cluster is controlled by an erythroid-specific enhancer similar to the major regulatory element of mammalian and avian alpha-globin gene domains. The enhancer controlling expression of the globin genes present in the minor locus has not been identified yet. Based on the distribution of epigenetic marks, we have selected two genomic regions that might harbor an enhancer of the minor locus. Using transient transfection of constructs with a reporter gene, we have demonstrated that a ~500-bp DNA fragment located ~1.7 Kb upstream of the αe4 gene possesses an erythroid-specific enhancer active with respect to promoters present in both the major and the minor globin gene loci of Danio rerio. The identified enhancer element harbors clustered binding sites for GATA-1, NF-E2, and EKLF similar to the enhancer of the major globin locus on chromosome 3. Both enhancers appear to have emerged as a result of independent evolution of a duplicated regulatory element present in an ancestral single alpha-/beta-globin locus that existed before teleost-specific genome duplication.

  15. Identifier (ID) elements are not preferentially located to brain-specific genes: high ID element representation in other tissue-specific- and housekeeping genes of the rat.

    PubMed

    Goldman, Andrés; Capoano, Carlos A; González-López, Evangelina; Geisinger, Adriana

    2014-01-01

    BC1 is a short non-coding RNA from rodents, which is transcribed by RNA pol III. Its RNA is highly abundant in the brain, where it exerts a post-transcriptional regulatory role in dendrites. Upon transcription, retroposition and insertion, BC1 gives rise to a subclass of short interspersed repetitive sequences (SINEs) named identifier (ID) elements. IDs can become integrated inside non-coding regions of RNA pol II transcription units, and - although challenged by a couple of reports - their preferential location to brain-specific genes has been long proposed. Furthermore, an additional, cis-regulatory role in the control of brain-specific pol II-directed transcripts has been suggested for these sequences. In this work we used Northern blot and in silico analyses to examine IDs' location among pol II transcription units in different tissues, and in housekeeping genes. ID sequences appeared distributed in a similar fashion within tissue-specific hnRNA populations of the brain, testis and liver, and within housekeeping primary transcripts as well. Moreover, when the lengths of the unprocessed transcripts were considered, ID representation was higher in housekeeping ones. On the other hand, ID elements appeared similarly distributed among the different gene regions, with the obvious exclusion of those sequences where strict constraints for proper gene expression exist. Altogether, the widespread distribution of ID elements in all the analyzed genes - including housekeeping - and in all gene regions, suggests a random location, raising questions about the specific cis-regulatory role of those sequences. © 2013 Elsevier B.V. All rights reserved.

  16. Retrotransposable elements R1 and R2 interrupt the rRNA genes of most insects.

    PubMed Central

    Jakubczak, J L; Burke, W D; Eickbush, T H

    1991-01-01

    A large number of insect species have been screened for the presence of the retrotransposable elements R1 and R2. These elements integrate independently at specific sites in the 28S rRNA genes. Genomic blots indicated that 43 of 47 insect species from nine orders contained insertions, ranging in frequency from a few percent to greater than 50% of the 28S genes. Sequence analysis of these insertions from 8 species revealed 22 elements, 21 of which corresponded to R1 or R2 elements. Surprisingly, many species appeared to contain highly divergent copies of R1 and R2 elements. For example, a parasitic wasp contained at least four families of R1 elements; the Japanese beetle contained at least five families of R2 elements. The presence of these retrotransposable elements throughout Insecta and the observation that single species can harbor divergent families within its rRNA-encoding DNA loci present interesting questions concerning the age of these elements and the possibility of cross-species transfer. Images PMID:1849649

  17. Identification of the functional elements in the promoter region of human DNA topoisomerase IIIbeta gene.

    PubMed

    Cho, Young Hoon; Park, Jee Young; Han, Sang Youp; Chung, In Kwon

    2004-09-17

    In this study, we have isolated and characterized the promoter region of the human DNA topoisomerase IIIbeta (hTOP3beta) gene. The 5' RACE assay showed a short exon 1 encoding only the 35-bp untranslated region and suggested the presence of multiple transcription initiation sites. The hTOP3beta gene promoter lacks a canonical TATA box or initiation element and is moderately high in GC content. Transient expression of a luciferase reporter gene under the control of serially deleted 5'-flanking sequence identified an activator element between -141 and -119 upstream of the transcription initiation site and a second regulatory element between -91 and -71. On the basis of scanning mutations of triple nucleotides, we demonstrated that a 5'GGAACC3' element between -117 and -112 plays a critical role in the up-regulation of the basal transcription activity. Changing the 5'GGAACC3' sequence leads to markedly reduced promoter activity. Gel mobility shift assays revealed that the 5'GGAACC3' element is required for DNA binding by the transcription factor complex. These observations lead to the conclusion that the positive regulatory region including the 5'GGAACC3' core element is essential for efficient expression of the hTOP3beta gene as well as for the binding of as yet unidentified regulatory factor(s).

  18. The structure of the human peripherin gene (PRPH) and identification of potential regulatory elements

    SciTech Connect

    Foley, J.; Ley, C.A.; Parysek, L.M.

    1994-07-15

    The authors determined the complete nucleotide sequence of the coding region of the human peripherin gene (PRPH), as well as 742 bp 5{prime} to the cap site and 584 bp 3{prime} to the stop codon, and compared its structure and sequence to the rat and mouse genes. The overall structure of 9 exons separated by 8 introns is conserved among these three mammalian species. The nucleotide sequences of the human peripherin gene exons were 90% identical to the rat gene sequences, and the predicted human peripherin protein differed from rat peripherin at only 18 of 475 amino acid residues. Comparison of the 5{prime} flanking regions of the human peripherin gene and rodent genes revealed extensive areas of high homology. Additional conserved segments were found in introns 1 and 2. Within the 5{prime} region, potential regulatory sequences, including a nerve growth factor negative regulatory element, a Hox protein binding site, and a heat shock element, were identified in all peripherin genes. The positional conservation of each element suggests that they may be important in the tissue-specific, developmental-specific, and injury-specific expression of the peripherin gene. 24 refs., 2 figs., 1 tab.

  19. Integrating Epigenomic Elements and GWASs Identifies BDNF Gene Affecting Bone Mineral Density and Osteoporotic Fracture Risk

    PubMed Central

    Guo, Yan; Dong, Shan-Shan; Chen, Xiao-Feng; Jing, Ying-Aisha; Yang, Man; Yan, Han; Shen, Hui; Chen, Xiang-Ding; Tan, Li-Jun; Tian, Qing; Deng, Hong-Wen; Yang, Tie-Lin

    2016-01-01

    To identify susceptibility genes for osteoporosis, we conducted an integrative analysis that combined epigenomic elements and previous genome-wide association studies (GWASs) data, followed by validation at population and functional levels, which could identify common regulatory elements and predict new susceptibility genes that are biologically meaningful to osteoporosis. By this approach, we found a set of distinct epigenomic elements significantly enriched or depleted in the promoters of osteoporosis-associated genes, including 4 transcription factor binding sites, 27 histone marks, and 21 chromatin states segmentation types. Using these epigenomic marks, we performed reverse prediction analysis to prioritize the discovery of new candidate genes. Functional enrichment analysis of all the prioritized genes revealed several key osteoporosis related pathways, including Wnt signaling. Genes with high priority were further subjected to validation using available GWASs datasets. Three genes were significantly associated with spine bone mineral density, including BDNF, PDE4D, and SATB2, which all closely related to bone metabolism. The most significant gene BDNF was also associated with osteoporotic fractures. RNA interference revealed that BDNF knockdown can suppress osteoblast differentiation. Our results demonstrated that epigenomic data could be used to indicate common epigenomic marks to discover additional loci with biological functions for osteoporosis. PMID:27465306

  20. Integrating Epigenomic Elements and GWASs Identifies BDNF Gene Affecting Bone Mineral Density and Osteoporotic Fracture Risk.

    PubMed

    Guo, Yan; Dong, Shan-Shan; Chen, Xiao-Feng; Jing, Ying-Aisha; Yang, Man; Yan, Han; Shen, Hui; Chen, Xiang-Ding; Tan, Li-Jun; Tian, Qing; Deng, Hong-Wen; Yang, Tie-Lin

    2016-07-28

    To identify susceptibility genes for osteoporosis, we conducted an integrative analysis that combined epigenomic elements and previous genome-wide association studies (GWASs) data, followed by validation at population and functional levels, which could identify common regulatory elements and predict new susceptibility genes that are biologically meaningful to osteoporosis. By this approach, we found a set of distinct epigenomic elements significantly enriched or depleted in the promoters of osteoporosis-associated genes, including 4 transcription factor binding sites, 27 histone marks, and 21 chromatin states segmentation types. Using these epigenomic marks, we performed reverse prediction analysis to prioritize the discovery of new candidate genes. Functional enrichment analysis of all the prioritized genes revealed several key osteoporosis related pathways, including Wnt signaling. Genes with high priority were further subjected to validation using available GWASs datasets. Three genes were significantly associated with spine bone mineral density, including BDNF, PDE4D, and SATB2, which all closely related to bone metabolism. The most significant gene BDNF was also associated with osteoporotic fractures. RNA interference revealed that BDNF knockdown can suppress osteoblast differentiation. Our results demonstrated that epigenomic data could be used to indicate common epigenomic marks to discover additional loci with biological functions for osteoporosis.

  1. Transposition of two different intracisternal A particle elements into an immunoglobulin kappa-chain gene.

    PubMed Central

    Hawley, R G; Shulman, M J; Hozumi, N

    1984-01-01

    Each of two severely defective mouse kappa-chain genes has acquired a different intracisternal A particle (IAP) element within one of its introns. One IAP element generated 6-base-pair direct repeats upon insertion. In contrast, the other IAP element was not flanked by direct repeats and was missing a single nucleotide from its 3' terminus. Sequence analysis of the latter IAP element demonstrated that its long terminal repeats were not identical. Nevertheless, the long terminal repeats were organized like proviral long terminal repeats, and this IAP element did contain two regions that were analogous to retroviral priming sites for RNA-directed DNA synthesis. The region that corresponded to a retroviral tRNA primer binding site was complementary to the 3' ends of all mammalian phenylalanine tRNAs. These findings are discussed in the context of the presumed mode of transposition of IAP elements involving the reverse transcription of IAP RNA. Images PMID:6098810

  2. Gene conversion as a secondary mechanism of short interspersed element (SINE) evolution

    SciTech Connect

    Kass, D.H.; Batzer, M.A.; Deininger, P.L. |

    1995-01-01

    The Alu repetitive family of short interspersed elements (SINEs) in primates can be subdivided into distinct subfamilies by specific diagnostic nucleotide changes. The older subfamilies are generally very abundant, while the younger subfamilies have fewer copies. Some of the youngest Alu elements are absent in the orthologous loci of nonhuman primates, indicative of recent retroposition events, the primary mode of SINE evolutions. PCR analysis of one young Alu subfamily (Sb2) member found in the low-density lipoprotein receptor gene apparently revealed the presence of this element in the green monkey, orangutan, gorilla, and chimpanzee genomes, as well as the human genome. However, sequence analysis of these genomes revealed a highly mutated, older, primate-specific Alu element was present at this position in the nonhuman primates. Comparison of the flanking DNA sequences upstream of this Alu insertion corresponded to evolution expected for standard primate phylogeny, but comparison of the Alu repeat sequences revealed that the human element departed from this phylogeny. The change in the human sequence apparently occurred by a gene conversion event only within the Alu element itself, converting it from one of the oldest to one of the youngest Alu subfamilies. Although gene conversions of Alu elements are clearly very rare, this finding shows that such events can occur and contribute to specific cases of SINE subfamily evolution.

  3. [Novel transmission element of antibiotic resistance genes ISCR and its ecological risk].

    PubMed

    Chen, Lin-lin; Li, Bao-quan

    2015-10-01

    Antibiotic resistance genes (ARGs) as emerging environmental pollutants have become the focus of attention of many disciplines. The transmission and dissemination of ARGs in various environmental media has great hazards to environment and poses serious threat to human health. ISCR (insertion sequence common regions) elements are newly discovered resistance genes transmission elements. Because of the special genetic structure, ISCR elements can move any adjacent DNA sequences by rolling-circle replication and homologous recombination, and have become the efficient transmission elements of ARGs among different DNA molecules or bacterial species. Around the world, 27 members of the ISCR family have been discovered up to now. A lot of circumstantial evidence has indicated that ISCR elements may be associated with the mobility and transmission of kinds of ARGs, especially multiple drug resistance genes (MDR). In this review, we described some aspects of ISCR elements, including the horizontal transfer of ARGs, structural characteristics of ISCRs, classification of ISCRs and their related ARGs, research methods of these elements, possible ecological risk of ISCRs and proposal of research directions, hoping to provide help for further related research in the future.

  4. Genes associated with the cis-regulatory functions of intragenic LINE-1 elements.

    PubMed

    Wanichnopparat, Wachiraporn; Suwanwongse, Kulachanya; Pin-On, Piyapat; Aporntewan, Chatchawit; Mutirangura, Apiwat

    2013-03-27

    Thousands of intragenic long interspersed element 1 sequences (LINE-1 elements or L1s) reside within genes. These intragenic L1 sequences are conserved and regulate the expression of their host genes. When L1 methylation is decreased, either through chemical induction or in cancer, the intragenic L1 transcription is increased. The resulting L1 mRNAs form RISC complexes with pre-mRNA to degrade the complementary mRNA. In this study, we screened for genes that are involved in intragenic L1 regulation networks. Genes containing L1s were obtained from L1Base (http://l1base.molgen.mpg.de). The expression profiles of 205 genes in 516 gene knockdown experiments were obtained from the Gene Expression Omnibus (GEO) (http://www.ncbi.nlm.nih.gov/geo). The expression levels of the genes with and without L1s were compared using Pearson's chi-squared test. After a permutation based statistical analysis and a multiple hypothesis testing, 73 genes were found to induce significant regulatory changes (upregulation and/or downregulation) in genes with L1s. In detail, 5 genes were found to induce both the upregulation and downregulation of genes with L1s, whereas 27 and 37 genes induced the downregulation and upregulation, respectively, of genes with L1s. These regulations sometimes differed depending on the cell type and the orientation of the intragenic L1s. Moreover, the siRNA-regulating genes containing L1s possess a variety of molecular functions, are responsible for many cellular phenotypes and are associated with a number of diseases. Cells use intragenic L1s as cis-regulatory elements within gene bodies to modulate gene expression. There may be several mechanisms by which L1s mediate gene expression. Intragenic L1s may be involved in the regulation of several biological processes, including DNA damage and repair, inflammation, immune function, embryogenesis, cell differentiation, cellular response to external stimuli and hormonal responses. Furthermore, in addition to cancer

  5. Gene Marker Loss Induced by the Transposable Element, En, in Maize

    PubMed Central

    Cormack, J.; Peterson, P. A.

    1994-01-01

    The En/Spm transposable element system in maize includes the functional element, En/Spm and the receptor element I/dSpm. An En receptor has been found that shows En-induced breakage. This En-responsive receptor (designated 1836518) is located on the short arm of chromosome 9, proximal to Wx. In the presence of En, markers distal to the receptor show a loss of gene expression. Kernels heterozygous for aleurone and endosperm marker genes have a variegated appearance. The hypothesis is advanced that this variegation represents a physical loss of the chromosome segments carrying the genes distal to the receptor position. It is the first case of an En-controlled breakage event. PMID:8005421

  6. The white gene as a marker in a new P-element vector for gene transfer in Drosophila.

    PubMed Central

    Klemenz, R; Weber, U; Gehring, W J

    1987-01-01

    We describe new vectors suitable for P-element mediated germ line transformation of Drosophila melanogaster using passenger genes whose expression does not result in a readily detectable phenotypic change of the transformed flies. The P-element vectors contain the white gene fused to the heat shock protein 70 (hsp70) gene promoter. Expression of the white gene rescues the white phenotype of recipient flies partly or completely even without heat treatment. Transformed descendents of most founder animals (GO) fall into two classes which are distinguishable by their orange and red eye colours. The different levels of white expression are presumably due to position effects associated with different chromosomal sites of insertion. Doubling of the gene dose in orange eyed fly stocks results in an easily visible darkening of the eye colour. Consequently, the generation of homozygous transformants is easily possible by simple inbreeding due to the phenotypic distinction of homo- and heterozygous transformants. Cloning into these P-element vectors is facilitated by the presence of polylinkers with 8 and 12 unique restriction sites. Images PMID:3108854

  7. Repressive BMP2 gene regulatory elements near the BMP2 promoter

    SciTech Connect

    Jiang, Shan; Chandler, Ronald L.; Fritz, David T.; Mortlock, Douglas P.; Rogers, Melissa B.

    2010-02-05

    The level of bone morphogenetic protein 2 (BMP2) profoundly influences essential cell behaviors such as proliferation, differentiation, apoptosis, and migration. The spatial and temporal pattern of BMP2 synthesis, particular in diverse embryonic cells, is highly varied and dynamic. We have identified GC-rich sequences within the BMP2 promoter region that strongly repress gene expression. These elements block the activity of a highly conserved, osteoblast enhancer in response to FGF2 treatment. Both positive and negative gene regulatory elements control BMP2 synthesis. Detecting and mapping the repressive motifs is essential because they impede the identification of developmentally regulated enhancers necessary for normal BMP2 patterns and concentration.

  8. DNA Elements Reducing Transcriptional Gene Silencing Revealed by a Novel Screening Strategy

    PubMed Central

    Ueno, Keiichiro; Ohashi, Yuko; Mitsuhara, Ichiro

    2013-01-01

    Transcriptional gene silencing (TGS)–a phenomenon observed in endogenous genes/transgenes in eukaryotes–is a huge hindrance to transgenic technology and occurs mainly when the genes involved share sequence homology in their promoter regions. TGS depends on chromosomal position, suggesting the existence of genomic elements that suppress TGS. However, no systematic approach to identify such DNA elements has yet been reported. Here, we developed a successful novel screening strategy to identify such elements (anti-silencing regions–ASRs), based on their ability to protect a flanked transgene from TGS. A silenced transgenic tobacco plant in which a subsequently introduced transgene undergoes obligatory promoter-homology dependent TGS in trans allowed the ability of DNA elements to prevent TGS to be used as the screening criterion. We also identified ASRs in a genomic library from a different plant species (Lotus japonicus: a perennial legume); the ASRs include portions of Ty1/copia retrotransposon-like and pararetrovirus-like sequences; the retrotransposon-like sequences also showed interspecies anti-TGS activity in a TGS-induction system in Arabidopsis. Anti-TGS elements could provide effective tools to reduce TGS and ensure proper regulation of transgene expression. Furthermore, the screening strategy described here will also facilitate the efficient identification of new classes of anti-TGS elements. PMID:23382937

  9. Multiple cis elements and GATA factors regulate a cuticle collagen gene in C. elegans

    PubMed Central

    Yin, Jianghua; Madaan, Uday; Park, Amy; Aftab, Neelum; Savage-Dunn, Cathy

    2015-01-01

    The cuticle of the nematode Caenorhabditis elegans is a specialized extracellular matrix whose major component is collagen. Cuticle collagens are encoded by a large multi-gene family consisting of more than 150 members. Cuticle collagen genes are expressed in epidermis (hypodermis) and may be stage-specific or cyclically expressed. We identified cuticle collagen genes as transcriptional targets of the DBL-1 TGF-β-related signaling pathway. These studies prompted us to investigate the cis-regulatory sequences required for transcription of one of the target genes, col-41. We generated reporter constructs that reproduce stage- and tissue-specific expression of fluorescent markers. We identify four conserved sequence elements that are required for transcription of reporters. Finally, we provide evidence that col-41 expression is controlled by a sequence element containing two GATA sites and by the epidermal GATA transcription factors ELT-1 and ELT-3. PMID:25711168

  10. Transposable Elements Contribute to Activation of Maize Genes in Response to Abiotic Stress

    PubMed Central

    Makarevitch, Irina; Waters, Amanda J.; West, Patrick T.; Stitzer, Michelle; Hirsch, Candice N.; Ross-Ibarra, Jeffrey; Springer, Nathan M.

    2015-01-01

    Transposable elements (TEs) account for a large portion of the genome in many eukaryotic species. Despite their reputation as “junk” DNA or genomic parasites deleterious for the host, TEs have complex interactions with host genes and the potential to contribute to regulatory variation in gene expression. It has been hypothesized that TEs and genes they insert near may be transcriptionally activated in response to stress conditions. The maize genome, with many different types of TEs interspersed with genes, provides an ideal system to study the genome-wide influence of TEs on gene regulation. To analyze the magnitude of the TE effect on gene expression response to environmental changes, we profiled gene and TE transcript levels in maize seedlings exposed to a number of abiotic stresses. Many genes exhibit up- or down-regulation in response to these stress conditions. The analysis of TE families inserted within upstream regions of up-regulated genes revealed that between four and nine different TE families are associated with up-regulated gene expression in each of these stress conditions, affecting up to 20% of the genes up-regulated in response to abiotic stress, and as many as 33% of genes that are only expressed in response to stress. Expression of many of these same TE families also responds to the same stress conditions. The analysis of the stress-induced transcripts and proximity of the transposon to the gene suggests that these TEs may provide local enhancer activities that stimulate stress-responsive gene expression. Our data on allelic variation for insertions of several of these TEs show strong correlation between the presence of TE insertions and stress-responsive up-regulation of gene expression. Our findings suggest that TEs provide an important source of allelic regulatory variation in gene response to abiotic stress in maize. PMID:25569788

  11. Comparative genome sequencing of drosophila pseudoobscura: Chromosomal, gene and cis-element evolution

    SciTech Connect

    Richards, Stephen; Liu, Yue; Bettencourt, Brian R.; Hradecky, Pavel; Letovsky, Stan; Nielsen, Rasmus; Thornton, Kevin; Todd, Melissa J.; Chen, Rui; Meisel, Richard P.; Couronne, Olivier; Hua, Sujun; Smith, Mark A.; Bussemaker, Harmen J.; van Batenburg, Marinus F.; Howells, Sally L.; Scherer, Steven E.; Sodergren, Erica; Matthews, Beverly B.; Crosby, Madeline A.; Schroeder, Andrew J.; Ortiz-Barrientos, Daniel; Rives, Catherine M.; Metzker, Michael L.; Muzny, Donna M.; Scott, Graham; Steffen, David; Wheeler, David A.; Worley, Kim C.; Havlak, Paul; Durbin, K. James; Egan, Amy; Gill, Rachel; Hume, Jennifer; Morgan, Margaret B.; Miner, George; Hamilton, Cerissa; Huang, Yanmei; Waldron, Lenee; Verduzco, Daniel; Blankenburg, Kerstin P.; Dubchak, Inna; Noor, Mohamed A.F.; Anderson, Wyatt; White, Kevin P.; Clark, Andrew G.; Schaeffer, Stephen W.; Gelbart, William; Weinstock, George M.; Gibbs, Richard A.

    2004-04-01

    The genome sequence of a second fruit fly, D. pseudoobscura, presents an opportunity for comparative analysis of a primary model organism D. melanogaster. The vast majority of Drosophila genes have remained on the same arm, but within each arm gene order has been extensively reshuffled leading to the identification of approximately 1300 syntenic blocks. A repetitive sequence is found in the D. pseudoobscura genome at many junctions between adjacent syntenic blocks. Analysis of this novel repetitive element family suggests that recombination between offset elements may have given rise to many paracentric inversions, thereby contributing to the shuffling of gene order in the D. pseudoobscura lineage. Based on sequence similarity and synteny, 10,516 putative orthologs have been identified as a core gene set conserved over 35 My since divergence. Genes expressed in the testes had higher amino acid sequence divergence than the genome wide average consistent with the rapid evolution of sex-specific proteins. Cis-regulatory sequences are more conserved than control sequences between the species but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible. Overall, a picture of repeat mediated chromosomal rearrangement, and high co-adaptation of both male genes and cis-regulatory sequences emerges as important themes of genome divergence between these species of Drosophila.

  12. Three transposed elements in the intron of a human VK immunoglobulin gene.

    PubMed

    Straubinger, B; Osterholzer, E; Zachau, H G

    1987-11-25

    Two gene segments coding for the variable region of human immunoglobulin light chains of the kappa type (VK genes, ref. 2) were found to have unusual structures. The two genes which are called A6 and A22 are located in duplicated gene clusters. Their restriction maps are very similar. About 4 kb of the A22 gene region were sequenced. It turned out that the intron contains an insert with the characteristics of a transposed element. The inserted DNA of 1.2 kb length contains imperfect direct and inverted repeats at its ends; at the insertion site a duplication of five nucleotides was found. Within the inserted DNA one copy each of an Alu element and of the simple sequence motif (T-G)17 were identified. Also these two repetitive sequences are themselves flanked by short direct repeats. The major inserted DNA has no significant homology to published human nucleic acid sequences. The whole structure is interpreted best by assuming a sequential insertion of the three elements. The coding region of the VK gene itself has several mutations which by themselves would render it a pseudogene; we assume that the insertion event(s) occurred prior to the mutations. According to mapping and hybridization data A6 is very similar to A22.

  13. Combined sense-antisense Alu elements activate the EGFP reporter gene when stable transfection.

    PubMed

    Ma, Zhihong; Kong, Xianglong; Liu, Shufeng; Yin, Shuxian; Zhao, Yuehua; Liu, Chao; Lv, Zhanjun; Wang, Xiufang

    2017-08-01

    Alu elements in the human genome are present in more than one million copies, accounting for 10% of the genome. However, the biological functions of most Alu repeats are unknown. In this present study, we detected the effects of Alu elements on EGFP gene expression using a plasmid system to find the roles of Alu elements in human genome. We inserted 5'-4TMI-Alus-CMV promoter-4TMI-Alus (or antisense Alus)-3' sequences into the pEGFP-C1 vector to construct expression vectors. We altered the copy number of Alus, the orientation of the Alus, and the presence of an enhancer (4TMI) in the inserted 5'-4TMI-Alus-CMV promoter-4TMI-Alus (or antisense Alus)-3' sequences. These expression vectors were stably transfected into HeLa cells, and EGFP reporter gene expression was determined. Our results showed that combined sense-antisense Alu elements activated the EGFP reporter gene in the presence of enhancers and stable transfection. The combined sense-antisense Alu vectors carrying four copies of Alus downstream of inserted CMV induced much stronger EGFP gene expression than two copies. Alus downstream of inserted CMV were replaced to AluJBs (having 76% homology with Alu) to construct expression vectors. We found that combined sense-antisense Alu (or antisense AluJB) vectors induced strong EGFP gene expression after stable transfection and heat shock. To further explore combined sense-antisense Alus activating EGFP gene expression, we constructed Tet-on system vectors, mini-C1-Alu-sense-sense and mini-C1-Alu-sense-antisense (EGFP gene was driven by mini-CMV). We found that combined sense-antisense Alus activated EGFP gene in the presence of reverse tetracycline repressor (rTetR) and doxycycline (Dox). Clone experiments showed that Mini-C1-Alu-sense-antisense vector had more positive cells than that of Mini-C1-Alu-sense-sense vector. The results in this paper proved that Alu repetitive sequences inhibited gene expression and combined sense-antisense Alus activated EGFP reporter

  14. Scavenger receptor A gene regulatory elements target gene expression to macrophages and to foam cells of atherosclerotic lesions.

    PubMed Central

    Horvai, A; Palinski, W; Wu, H; Moulton, K S; Kalla, K; Glass, C K

    1995-01-01

    Transcription of the macrophage scavenger receptor A gene is markedly upregulated during monocyte to macrophage differentiation. In these studies, we demonstrate that 291 bp of the proximal scavenger receptor promoter, in concert with a 400-bp upstream enhancer element, is sufficient to direct macrophage-specific expression of a human growth hormone reporter in transgenic mice. These regulatory elements, which contain binding sites for PU.1, AP-1, and cooperating ets-domain transcription factors, are also sufficient to mediate regulation of transgene expression during the in vitro differentiation of bone marrow progenitor cells in response to macrophage colony-stimulating factor. Mutation of the PU.1 binding site within the scavenger receptor promoter severely impairs transgene expression, consistent with a crucial role of PU.1 in regulating the expression of the scavenger receptor gene. The ability of the scavenger receptor promoter and enhancer to target gene expression to macrophages in vivo, including foam cells of atherosclerotic lesions, suggests that these regulatory elements will be of general utility in the study of macrophage differentiation and function by permitting specific modifications of macrophage gene expression. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:7777517

  15. Adenosine-uridine-rich element is one of the required cis-elements for epimastigote form stage-specific gene expression of the congolense epimastigote specific protein.

    PubMed

    Suganuma, Keisuke; Mochabo, Kennedy Miyoro; Hakimi, Hassan; Yamasaki, Shino; Yamagishi, Junya; Asada, Masahito; Kawazu, Shin-Ichiro; Inoue, Noboru

    2013-09-01

    It is known that gene expression in kinetoplastida is regulated post-transcriptionally. Several previous studies have shown that stage-specific gene expression in trypanosomes is regulated by cis-elements located in the 3' untranslated region (UTR) of each mRNA and also by RNA binding proteins. Our previous study revealed that gene expression of congolense epimastigote specific protein (cesp) was regulated by cis-elements located in the 3'UTR. In the present study, we identified the adenosine and uridine rich region in the cesp 3'UTR. Using transgenic trypanosome cell lines with different egfp expression cassettes, we showed that this adenosine and uridine rich region is one of the regulatory elements for epimastigote form (EMF) stage-specific gene expression via the regulatory cis-element of the eukaryotic AU rich element (ARE). Therefore this required element within the cesp 3'UTR was designated as T. congolense ARE. This required cis-element might selectively stabilize mRNA in the EMF stage and destabilize mRNA in other stages. By RNA electro mobility shift assay, unknown stage-specific RNA binding proteins (RBPs) whose sequences specifically interacted with the required cis-element were found. These results indicate that EMF stage specific cis-element and RBP complexes might specifically stabilize cesp mRNA in EMF. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. A functional analysis of the P-element gene-transfer vector in insects

    USDA-ARS?s Scientific Manuscript database

    A P-element mobility excision assay was used to determine if non-drosophilid insects could support P gene vector function. Present studies included the testing of Muscids, Sphaerocerids, and Phorids, none of which were able to support P mobility. A new excision indicator plasmid was developed allowi...

  17. Two distinct promoter elements in the human rRNA gene identified by linker scanning mutagenesis.

    PubMed Central

    Haltiner, M M; Smale, S T; Tjian, R

    1986-01-01

    A cell-free RNA polymerase I transcription system was used to evaluate the transcription efficiency of 21 linker scanning mutations that span the human rRNA gene promoter. Our analysis revealed the presence of two major control elements, designated the core and upstream elements, that affect the level of transcription initiation. The core element extends from -45 to +18 relative to the RNA start site, and transcription is severely affected (up to 100-fold) by linker scanning mutations in this region. Linker scanning and deletion mutations in the upstream element, located between nucleotides -156 and -107, cause a three- to fivefold reduction in transcription. Under certain reaction conditions, such as the presence of a high ratio of protein to template or supplementation of the reaction with partially purified protein fractions, sequences upstream of the core element can have an even greater effect (20- to 50-fold) on RNA polymerase I transcription. Primer extension analysis showed that RNA synthesized from all of these mutant templates is initiated at the correct in vivo start site. To examine the functional relationship between the core and the upstream region, mutant promoters were constructed that alter the orientation, distance, or multiplicity of these control elements relative to each other. The upstream control element appears to function in only one orientation, and its position relative to the core is constrained within a fairly narrow region. Moreover, multiple core elements in close proximity to each other have an inhibitory effect on transcription. Images PMID:3785147

  18. Comparative structure, proximal promoter elements, and chromosome location of the human eosinophil major basic protein genes.

    PubMed

    Plager, D A; Weiler, D A; Loegering, D A; Johnson, W B; Haley, L; Eddy, R L; Shows, T B; Gleich, G J

    2001-02-01

    Human eosinophil major basic protein (MBP) is strongly implicated as a mediator of disease, especially bronchial asthma. We recently isolated a highly divergent human homologue of MBP (MBPH). Given human MBP's importance in disease and the restricted expression of it and human MBPH, we isolated the 4.6-kb human MBPH gene (HGMW-approved symbol PRG3). Comparisons among the human MBP (PRG2), human MBPH, and murine MBP-1 (mMBP-1; Prg2) genes suggest that the human MBP and mMBP-1 genes are more closely related than either is to the human MBPH gene. Proximal promoters of these three genes show conservation of potential binding sites for IK2 and STAT and of a known GATA site. However, a known C/EBP site is altered in the human MBPH gene's proximal promoter. The human MBP and MBPH genes localized to chromosome 11 in the centromere to 11q12 region. Thus, the human MBP and MBPH genes have diverged considerably, probably following a gene duplication event. Furthermore, the identified conserved and distinct proximal promoter elements likely contribute to the eosinophil-restricted and relatively reduced transcription of the human MBPH gene. Copyright 2001 Academic Press.

  19. Transfer of antibiotic-resistance genes via phage-related mobile elements.

    PubMed

    Brown-Jaque, Maryury; Calero-Cáceres, William; Muniesa, Maite

    2015-05-01

    Antibiotic resistance is a major concern for society because it threatens the effective prevention of infectious diseases. While some bacterial strains display intrinsic resistance, others achieve antibiotic resistance by mutation, by the recombination of foreign DNA into the chromosome or by horizontal gene acquisition. In many cases, these three mechanisms operate together. Several mobile genetic elements (MGEs) have been reported to mobilize different types of resistance genes and despite sharing common features, they are often considered and studied separately. Bacteriophages and phage-related particles have recently been highlighted as MGEs that transfer antibiotic resistance. This review focuses on phages, phage-related elements and on composite MGEs (phages-MGEs) involved in antibiotic resistance mobility. We review common features of these elements, rather than differences, and provide a broad overview of the antibiotic resistance transfer mechanisms observed in nature, which is a necessary first step to controlling them.

  20. Multiple circadian-regulated elements contribute to cycling period gene expression in Drosophila.

    PubMed Central

    Stanewsky, R; Jamison, C F; Plautz, J D; Kay, S A; Hall, J C

    1997-01-01

    A new regulatory element necessary for the correct temporal expression of the period (per) gene was identified by monitoring real-time per expression in living individual flies carrying two different period-luciferase transgenes. luciferase RNA driven from only the per promoter was not sufficient to replicate the normal pattern of per RNA cycling; however, a per-luc fusion RNA driven from a transgene containing additional per sequences cycled identically to endogenous per. The results indicate the existence of at least two circadian-regulated elements--one within the promoter and one within the transcribed portion of the per gene. Phase and amplitude analysis of both per-luc transgenes revealed that normal per expression requires the regulation of these elements at distinct phases and suggests a mechanism by which biological clocks sustain high-amplitude feedback oscillations. PMID:9305642

  1. Plenary Lecture 2: Transcription factors, regulatory elements and nutrient-gene communication.

    PubMed

    Cousins, Robert J; Aydemir, Tolunay B; Lichten, Louis A

    2010-02-01

    Dramatic advances have been made in the understanding of the differing molecular mechanisms used by nutrients to regulate genes that are essential for their biological roles to carry out normal metabolism. Classical studies have focused on nutrients as ligands to activate specific transcription factors. New interest has focused on histone acetylation as a process for either global or limited gene activation and is the first mechanism to be discussed. Nuclear ATP-citrate lyase generates acetyl-CoA, which has been shown to have a role in the activation of specific genes via selective histone acetylation. Transcription factor acetylation may provide a second mode of control of nutrient-responsive gene transcription. The third mechanism relates to the availability of response elements within chromatin, which as well as the location of the elements in the gene may allow or prevent transcription. A fourth mechanism involves intracellular transport of Zn ions, which can orchestrate localized enzyme inhibition-activation. This process in turn influences signalling molecules that regulate gene expression. The examples provided in the present review point to a new level of complexity in understanding nutrient-gene communication.

  2. A histone modification identifies a DNA element controlling slo BK channel gene expression in muscle

    PubMed Central

    Li, Xiaolei; Ghezzi, Alfredo; Krishnan, Harish R.; Pohl, Jascha B.; Bohm, Arun Y.; Atkinson, Nigel S.

    2016-01-01

    The slo gene encodes BK type Ca2+-activated K+ channels. In Drosophila, expression of slo is induced by organic solvent sedation (benzyl alcohol and ethanol) and this increase in neural slo expression contributes to the production of functional behavioral tolerance (inducible resistance) to these drugs. Within the slo promoter region, we observed that benzyl alcohol sedation produces a localized spike of histone acetylation over a 65 n conserved DNA element called 55b. Changes in histone acetylation are commonly the consequence of transcription factor activity and previously, a localized histone acetylation spike was used to successfully map a DNA element involved in benzyl alcohol-induced slo expression. To determine whether the 55b element was also involved in benzyl alcohol-induced neural expression of slo we deleted it from the endogenous slo gene by homologous recombination. Flies lacking the 55b element were normal with respect to basal and benzyl alcohol-induced neural slo expression, the capacity to acquire and maintain functional tolerance, their threshold for electrically-induced seizures and most slo-related behaviors. Removal of the 55b element did however increase the level of basal expression from the muscle/tracheal cell-specific slo core promoter and produced a slight increase in overall locomotor activity. We conclude that the 55b element is involved in control of slo expression from the muscle and tracheal-cell promoter but is not involved in the production of functional benzyl alcohol tolerance. PMID:25967280

  3. Menin and JunD regulate gastrin gene expression through proximal DNA elements.

    PubMed

    Mensah-Osman, Edith J; Veniaminova, Natalia A; Merchant, Juanita L

    2011-11-01

    Mutations in the MEN1 gene correlate with multiple endocrine neoplasia I (MEN1). Gastrinomas are the most malignant of the neuroendocrine tumors associated with MEN1. Because menin and JunD proteins interact, we examined whether JunD binds to and regulates the gastrin gene promoter. Both menin and JunD are ubiquitous nuclear proteins that we showed colocalize in the gastrin-expressing G cells of the mouse antrum. Transfection with a JunD expression vector alone induced endogenous gastrin mRNA in AGS human gastric cells, and the induction was blocked by menin overexpression. We mapped repression by menin to both a nonconsensus AP-1 site and proximal GC-rich elements within the human gastrin promoter. Chromatin immunoprecipitation assays, EMSAs, and DNA affinity precipitation assays documented that JunD and Sp1 proteins bind these two elements and are both targets for menin regulation. Consistent with menin forming a complex with histone deacetylases, we found that repression of gastrin gene expression by menin was reversed by trichostatin A. In conclusion, proximal DNA elements within the human gastrin gene promoter mediate interactions between JunD, which induces gastrin gene expression and menin, which suppresses JunD-mediated activation.

  4. Replication protein A binds to regulatory elements in yeast DNA repair and DNA metabolism genes.

    PubMed Central

    Singh, K K; Samson, L

    1995-01-01

    Saccharomyces cerevisiae responds to DNA damage by arresting cell cycle progression (thereby preventing the replication and segregation of damaged chromosomes) and by inducing the expression of numerous genes, some of which are involved in DNA repair, DNA replication, and DNA metabolism. Induction of the S. cerevisiae 3-methyladenine DNA glycosylase repair gene (MAG) by DNA-damaging agents requires one upstream activating sequence (UAS) and two upstream repressing sequences (URS1 and URS2) in the MAG promoter. Sequences similar to the MAG URS elements are present in at least 11 other S. cerevisiae DNA repair and metabolism genes. Replication protein A (Rpa) is known as a single-stranded-DNA-binding protein that is involved in the initiation and elongation steps of DNA replication, nucleotide excision repair, and homologous recombination. We now show that the MAG URS1 and URS2 elements form similar double-stranded, sequence-specific, DNA-protein complexes and that both complexes contain Rpa. Moreover, Rpa appears to bind the MAG URS1-like elements found upstream of 11 other DNA repair and DNA metabolism genes. These results lead us to hypothesize that Rpa may be involved in the regulation of a number of DNA repair and DNA metabolism genes. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:7761422

  5. A negative element involved in Kaposi's sarcoma-associated herpesvirus-encoded ORF11 gene expression

    SciTech Connect

    Chen, Lei

    2009-01-01

    The ORF11 of the Kaposi's sarcoma-associated herpesvirus (KSHV) is a lytic viral gene with delayed-early expression kinetics. How the ORF11 gene expression is regulated in the KSHV lytic cascade is largely unknown. Here we report that the deletion of the KSHV viral IL-6 gene from the viral genome leads to deregulated ORF11 gene expression. The KSHV-encoded viral IL-6 protein was found not to be essentially involved in the regulation of ORF11, suggesting a potential transcriptional cis-regulation. A negative element was identified downstream of the ORF11 gene, which suppresses the ORF11 basal promoter activity in a position-independent manner.

  6. Identification and characterization of a cis-regulatory element for zygotic gene expression in Chlamydomonas reinhardtii

    DOE PAGES

    Hamaji, Takashi; Lopez, David; Pellegrini, Matteo; ...

    2016-03-26

    Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C. reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient tomore » confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. Furthermore, we predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes.« less

  7. Identification and Characterization of a cis-Regulatory Element for Zygotic Gene Expression in Chlamydomonas reinhardtii

    PubMed Central

    Hamaji, Takashi; Lopez, David; Pellegrini, Matteo; Umen, James

    2016-01-01

    Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C. reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient to confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. We predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes. PMID:27172209

  8. Chromatin boundary elements organize genomic architecture and developmental gene regulation in Drosophila Hox clusters

    PubMed Central

    Ma, Zhibo; Li, Mo; Roy, Sharmila; Liu, Kevin J; Romine, Matthew L; Lane, Derrick C; Patel, Sapna K; Cai, Haini N

    2016-01-01

    The three-dimensional (3D) organization of the eukaryotic genome is critical for its proper function. Evidence suggests that extensive chromatin loops form the building blocks of the genomic architecture, separating genes and gene clusters into distinct functional domains. These loops are anchored in part by a special type of DNA elements called chromatin boundary elements (CBEs). CBEs were originally found to insulate neighboring genes by blocking influences of transcriptional enhancers or the spread of silent chromatin. However, recent results show that chromatin loops can also play a positive role in gene regulation by looping out intervening DNA and “delivering” remote enhancers to gene promoters. In addition, studies from human and model organisms indicate that the configuration of chromatin loops, many of which are tethered by CBEs, is dynamically regulated during cell differentiation. In particular, a recent work by Li et al has shown that the SF1 boundary, located in the Drosophila Hox cluster, regulates local genes by tethering different subsets of chromatin loops: One subset enclose a neighboring gene ftz, limiting its access by the surrounding Scr enhancers and restrict the spread of repressive histones during early embryogenesis; and the other loops subdivide the Scr regulatory region into independent domains of enhancer accessibility. The enhancer-blocking activity of these CBE elements varies greatly in strength and tissue distribution. Further, tandem pairing of SF1 and SF2 facilitate the bypass of distal enhancers in transgenic flies, providing a mechanism for endogenous enhancers to circumvent genomic interruptions resulting from chromosomal rearrangement. This study demonstrates how a network of chromatin boundaries, centrally organized by SF1, can remodel the 3D genome to facilitate gene regulation during development. PMID:27621770

  9. Cis-regulatory elements are harbored in Intron5 of the RUNX1 gene

    PubMed Central

    2014-01-01

    Background Human RUNX1 gene is one of the most frequent target for chromosomal translocations associated with acute myeloid leukemia (AML) and acute lymphoid leukemia (ALL). The highest prevalence in AML is noted with (8; 21) translocation; which represents 12 to 15% of all AML cases. Interestingly, all the breakpoints mapped to date in t(8;21) are clustered in intron 5 of the RUNX1 gene and intron 1 of the ETO gene. No homologous sequences have been found at the recombination regions; but DNase I hypersensitive sites (DHS) have been mapped to the areas of the genes involved in t(8;21). Presence of DHS sites is commonly associated with regulatory elements such as promoters, enhancers and silencers, among others. Results In this study we used a combination of comparative genomics, cloning and transfection assays to evaluate potential regulatory elements located in intron 5 of the RUNX1 gene. Our genomic analysis identified nine conserved non-coding sequences that are evolutionarily conserved among rat, mouse and human. We cloned two of these regions in pGL-3 Promoter plasmid in order to analyze their transcriptional regulatory activity. Our results demonstrate that the identified regions can indeed regulate transcription of a reporter gene in a distance and position independent manner; moreover, their transcriptional effect is cell type specific. Conclusions We have identified nine conserved non coding sequence that are harbored in intron 5 of the RUNX1 gene. We have also demonstrated that two of these regions can regulate transcriptional activity in vitro. Taken together our results suggest that intron 5 of the RUNX1 gene contains multiple potential cis-regulatory elements. PMID:24655352

  10. Identification of peroxisome-proliferator responsive element in the mouse HSL gene

    SciTech Connect

    Yajima, Hiroaki . E-mail: hyajima@kirin.co.jp; Kobayashi, Yumie; Kanaya, Tomoka; Horino, Yoko

    2007-01-12

    Hormone-sensitive lipase (HSL) catalyzes the rate-limiting step of lipolysis in adipose tissue. Several studies suggest that protein phosphorylation regulates the HSL enzymatic activity. On the other hand, the precise mechanism of the transcriptional regulation of the HSL gene remains to be elucidated. Here, we identified a functional peroxisome-proliferator responsive element (PPRE) in the mouse HSL promoter by reporter assay in CV-1 cells using serial deletion and point mutants of the 5'-flanking region. Chromatin immunoprecipitation (ChIP) analysis revealed that both peroxisome-proliferator activated receptor (PPAR{gamma}) and retinoid X receptor (RXR{alpha}) interacted with the region. Binding of the PPAR{gamma}/RXR{alpha} heterodimer to the PPRE sequence was also confirmed by electrophoretic mobility shift assay. These results indicate that the HSL gene is transcriptionally regulated by PPAR{gamma}/RXR{alpha} heterodimer, and suggest that a cis-acting element regulates the HSL gene expression.

  11. Myelin basic protein gene transcription. Identification of proximal and distal cis-acting regulatory elements.

    PubMed

    Devine-Beach, K; Lashgari, M S; Khalili, K

    1990-08-15

    Myelin basic proteins (MBPs) represent a major component of the myelin membrane which are exclusively expressed by glial cells in the nervous system. The cell type-specific expression of MBP is controlled preferentially at the level of RNA synthesis. To investigate the mechanisms by which the MBP gene is regulated, we analyzed transcriptional regulation of this gene in glial and non-glial cells. We have demonstrated that the 320 base pairs upstream of the MBP transcriptional start site contain regulatory elements that preferentially stimulate transcription of MBPs in glial cells. Using a test vector containing the simian virus 40 (SV40) early promoter placed upstream of the bacterial chloramphenicol acetyltransferase gene, we localized three major promoter elements within the 5'-upstream sequence. These elements, designated MB1, MB4, and MB7, spanning proximal (-14 to -50) and distal (-130 to -169 and -249 to -288) positions with respect to the RNA initiation site, activated SV40 promoter transcription more than 40-fold in glial cells. The promoter distal elements, MB4 and MB7, enhanced SV40 promoter activity 2- and 8-fold, respectively, in L cells. Using the gel mobility shift assay, we have demonstrated that the MBP activators (MB1, MB4, and MB7) interact with multiple proteins derived from glial and L cell extract and result in the formation of several complexes. Comparison of band intensity of these complexes implies that these cells contain both unique and ubiquitous DNA binding proteins that recognize the DNA sequences within these activators. These studies suggest that the MBP promoter consists of several regulatory sequences in which the proximal element, MB1, and one of the distal elements, MB4, are selectively more active in glial cells than in L cells. Thus, these novel regulatory elements, in concert with other sequences, appear to stimulate MBP promoter transcription in glial cells.

  12. Characterization of Promoter Elements Regulating the Expression of the Human Neurotensin/Neuromedin N Gene*

    PubMed Central

    Wang, Xiaofu; Gulhati, Pat; Li, Jing; Dobner, Paul R.; Weiss, Heidi; Townsend, Courtney M.; Evers, B. Mark

    2011-01-01

    Expression of the gene encoding neurotensin/neuromedin N (NT/N) is mostly limited to the brain and specialized enteroendocrine N cells in the distal small intestine. We have identified key regulatory elements in the promoter region that are involved in human NT/N (hNT/N) gene expression in the novel human endocrine cell line, BON, which resembles intestinal N cells in several important aspects including NT/N precursor protein processing, ratios of different NT/N mRNA isoforms, and high levels of constitutive expression of the NT/N gene. In this study, we demonstrated multiple cis-regulatory elements including a proximal region containing a cAMP-responsive element (CRE)/AP-1-like element that binds both the AP-1 and CRE-binding protein (CREB)/ATF proteins (c-Jun, ATF-1, ATF-2, JunD, and CREB). Similar to the rat NT/N gene, this region is critical for constitutive hNT/N gene expression. Moreover, we identified a novel region that binds the orphan hormone receptor, NR2F2. We have demonstrated that the C terminus of NR2F2 strongly represses hNT/N transcription, whereas an N-terminal domain antagonizes this repressive effect. Regulation of NT/N expression by NR2F2 may have important consequences for lipid metabolism. We speculate that a complex interplay between the proximal CRE/AP-1-like motif and NR2F2 binding region exists to regulate hNT/N expression, which is critical for the high level of constitutive expression of NT/N in enteroendocrine cells. Finally, the BON cell line provides a unique model to characterize the factors regulating expression of the hNT/N gene and to better understand the mechanisms responsible for terminal differentiation of the N cell lineage in the gut. PMID:21030593

  13. Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

    PubMed

    Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

    2012-07-10

    The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

  14. DNA elements regulating alpha1-tubulin gene induction during regeneration of eukaryotic flagella.

    PubMed

    Periz, G; Keller, L R

    1997-07-01

    Eukaryotic flagella are complex organelles composed of more than 200 polypeptides. Little is known about the regulatory mechanisms governing synthesis of the flagellar protein subunits and their assembly into this complex organelle. The unicellular green alga Chlamydomonas reinhardtii is the premier experimental model system for studying such cellular processes. When acid shocked, C. reinhardtii excises its flagella, rapidly and coordinately activates transcription of a set of flagellar genes, and ultimately regenerates a new flagellar pair. To define functionally the regulatory sequences that govern induction of the set of genes after acid shock, we analyzed the alpha1-tubulin gene promoter. To simplify transcriptional analysis in vivo, we inserted the selectable marker gene ARG7 on the same plasmid with a tagged alpha1-tubulin gene and stably introduced it into C. reinhardtii cells. By deletion of various sequences, two promoter regions (-176 to -122 and -85 to -16) were identified as important for induction of the tagged alpha1-tubulin gene. Deleting the region between -176 and -122 from the transcription start site resulted in an induction level which was only 45 to 70% of that of the resident gene. Deleting the region upstream of -56 resulted in a complete loss of inducibility without affecting basal expression. The alpha1-tubulin promoter region from -85 to -16 conferred partial acid shock inducibility to an arylsulfatase (ARS) reporter gene. These results show that induction of the alpha1-tubulin gene after acid shock is a complex response that requires diverse sequence elements.

  15. Pegasus, a small terminal inverted repeat transposable element found in the white gene of Anopheles gambiae.

    PubMed

    Besansky, N J; Mukabayire, O; Bedell, J A; Lusz, H

    1996-10-01

    Pegasus, a novel transposable element, was discovered as a length polymorphism in the white gene of Anopheles gambiae. Sequence analysis revealed that this 535 bp element was flanked by 8 bp target site duplications and 8 bp perfect terminal inverted repeats similar to those found in many members of the Tc1 family. Its small size and lack of long open reading frames preclude protein coding capacity. Southern analysis and in situ hybridization to polytene chromosomes demonstrated that Pegasus occurs in approximately 30 copies in the genomes of An. gambiae and its sibling species and is homogenous in structure but polymorphic in chromosomal location. Characterization of five additional elements by sequencing revealed nucleotide identities of 95% to 99%. Of 30 Pegasus-containing phage clones examined by PCR, only one contained an element exceeding 535 bp in length, due to the insertion of another transposable element-like sequence. Thus, the majority, if not all, extant Pegasus elements may be defective copies of a complete element whose contemporary existence in An. gambiae is uncertain. No Pegasus-hybridizing sequences were detected in nine other anophelines and three culicines examined, suggesting a very limited taxonomic distribution.

  16. The dissemination of C10 cysteine protease genes in Bacteroides fragilis by mobile genetic elements

    PubMed Central

    2010-01-01

    Background The C10 family of cysteine proteases includes enzymes that contribute to the virulence of bacterial pathogens, such as SpeB in Streptococcus pyogenes. The presence of homologues of cysteine protease genes in human commensal organisms has not been examined. Bacteroides fragilis is a member of the dominant Bacteroidetes phylum of the human intestinal microbiota, and is a significant opportunistic pathogen. Results Four homologues of the streptococcal virulence factor SpeB were identified in the B. fragilis genome. These four protease genes, two were directly contiguous to open reading frames predicted to encode staphostatin-like inhibitors, with which the protease genes were co-transcribed. Two of these protease genes are unique to B. fragilis 638R and are associated with two large genomic insertions. Gene annotation indicated that one of these insertions was a conjugative Tn-like element and the other was a prophage-like element, which was shown to be capable of excision. Homologues of the B. fragilis C10 protease genes were present in a panel of clinical isolates, and in DNA extracted from normal human faecal microbiota. Conclusions This study suggests a mechanism for the evolution and dissemination of an important class of protease in major members of the normal human microbiota. PMID:20416045

  17. Nucleotide sequence of a yeast Ty element: evidence for an unusual mechanism of gene expression.

    PubMed Central

    Clare, J; Farabaugh, P

    1985-01-01

    We have determined the DNA sequence of the transposable element Ty912 of yeast. The 5918-base-pair element encodes two genes, tya912 and tyb912, which specify proteins similar to sequence-specific DNA-binding proteins of Escherichia coli and retroviral reverse transcriptases, respectively. The tyb912 gene is atypical of eukaryotic genes since (i) it begins 1336 nucleotides into the Ty912 mRNA (i.e., downstream of the tya912 gene) and (ii) the first in-frame AUG is 921 nucleotides into the coding frame. Protein blot analysis of Ty-lacZ fusions shows that the tyb912 gene is translated starting at the 5' end of the tya912 gene and that the primary translational product is a tya912::tyb912 fusion protein. We have shown that synthesis of this fusion protein probably does not occur by RNA splicing. The data are consistent with a mechanism of translational frameshifting occurring within the region of overlap between the 3' end of tya912 and the 5' end of tyb912. Images PMID:2581255

  18. Genome-wide discovery of cis-elements in promoter sequences using gene expression.

    PubMed

    Troukhan, Maxim; Tatarinova, Tatiana; Bouck, John; Flavell, Richard B; Alexandrov, Nickolai N

    2009-04-01

    The availability of complete or nearly complete genome sequences, a large number of 5' expressed sequence tags, and significant public expression data allow for a more accurate identification of cis-elements regulating gene expression. We have implemented a global approach that takes advantage of available expression data, genomic sequences, and transcript information to predict cis-elements associated with specific expression patterns. The key components of our approach are: (1) precise identification of transcription start sites, (2) specific locations of cis-elements relative to the transcription start site, and (3) assessment of statistical significance for all sequence motifs. By applying our method to promoters of Arabidopsis thaliana and Mus musculus, we have identified motifs that affect gene expression under specific environmental conditions or in certain tissues. We also found that the presence of the TATA box is associated with increased variability of gene expression. Strong correlation between our results and experimentally determined motifs shows that the method is capable of predicting new functionally important cis-elements in promoter sequences.

  19. Juvenile hormone regulation of an insect gene: a specific transcription factor and a DNA response element.

    PubMed

    Zhang, J; Saleh, D S; Wyatt, G R

    1996-08-30

    We have used locust fat body nuclear protein extracts and upstream DNA of the juvenile hormone (JH)-inducible locust gene, jhp21, to examine the regulation of specific transcription by JH. Promoter activity was assayed with G-free cassette reporter constructs. Nuclear extracts from adult female fat body, previously exposed to JH or an analog, actively transcribe from the jhp21 promoter and a control adenovirus major late (AdML) promoter, whereas extracts from JH-deprived female fat body, or other tissues, transcribe strongly from the AdML promoter but weakly or not at all from the jhp21 promoter. Transcription is enhanced by sequences between -140 and -211 nt from the jhp21 transcription start point (tsp), which include a CAAT box, and also by sequences between -1056 and -1200. A 15-nt partially palindromic sequence element found at -1152, resembling known hormone response elements, was shown to stimulate transcription when restored to truncated jhp21 DNA. Two very similar sequences occur further upstream. In electrophoretic mobility shift assays (EMSA), the same sequence element was shown to specifically bind a protein that was present in nuclear extracts from JH-exposed, but not from JH-deprived, fat body. Several lines of evidence suggest that the DNA element may be a JH response element (JHRE). The JH-induced protein that binds to it appears to be a transcription factor that activates the initiation of JH target gene (jhp21) transcription, and could be a JH receptor.

  20. Multiple promoter elements govern expression of the human ornithine decarboxylase gene in colon carcinoma cells.

    PubMed Central

    Moshier, J A; Osborne, D L; Skunca, M; Dosescu, J; Gilbert, J D; Fitzgerald, M C; Polidori, G; Wagner, R L; Friezner Degen, S J; Luk, G D

    1992-01-01

    Overexpression of the ornithine decarboxylase (ODC) gene may be important to the development and maintenance of colonic neoplasms, as well as tumors in general. In this study, we examined the promoter elements governing constitutive expression of the human ODC gene in HCT 116 human colon carcinoma cells and, for comparison, K562 human erythro-leukemia cells. It was determined by functional analysis that the promoter elements responsible reside within the 378 bp immediately upstream from the transcription start site. Within this sequence, there are at least three regions that modulate the efficiency of the ODC promoter cooperatively. Both DNA bandshift and footprint assays demonstrated all three regions to be rich in sites that bind to nuclear proteins isolated from HCT 116 and K562 cells; the protein binding pattern of non-transformed, diploid fibroblasts was found to be much less complex. Several of the protein binding sequences have little or no homology to common regulatory elements. We suggest that the constitutive activity of the ODC gene in HCT 116 colon carcinoma cells, and perhaps transformed cells in general, involves a complex interaction of multiple regulatory sequences and their associated nuclear proteins. Finally, the saturation of the promoter in these transformed cell lines suggests that high levels of protein binding in the ODC promoter may contribute to elevated constitutive expression of this gene. Images PMID:1598217

  1. Evidence of extensive non-allelic gene conversion among LTR elements in the human genome

    PubMed Central

    Trombetta, Beniamino; Fantini, Gloria; D’Atanasio, Eugenia; Sellitto, Daniele; Cruciani, Fulvio

    2016-01-01

    Long Terminal Repeats (LTRs) are nearly identical DNA sequences found at either end of Human Endogenous Retroviruses (HERVs). The high sequence similarity that exists among different LTRs suggests they could be substrate of ectopic gene conversion events. To understand the extent to which gene conversion occurs and to gain new insights into the evolutionary history of these elements in humans, we performed an intra-species phylogenetic study of 52 LTRs on different unrelated Y chromosomes. From this analysis, we obtained direct evidence that demonstrates the occurrence of ectopic gene conversion in several LTRs, with donor sequences located on both sex chromosomes and autosomes. We also found that some of these elements are characterized by an extremely high density of polymorphisms, showing one of the highest nucleotide diversities in the human genome, as well as a complex patchwork of sequences derived from different LTRs. Finally, we highlighted the limits of current short-read NGS studies in the analysis of genetic diversity of the LTRs in the human genome. In conclusion, our comparative re-sequencing analysis revealed that ectopic gene conversion is a common event in the evolution of LTR elements, suggesting complex genetic links among LTRs from different chromosomes. PMID:27346230

  2. The skeletal muscle alpha-actin gene of channel catfish (Ictalurus punctatus) and its association with piscine specific SINE elements.

    PubMed

    Kim, S; Karsi, A; Dunham, R A; Liu, Z

    2000-07-11

    The alpha-actin gene of channel catfish (Ictalurus punctatus) was cloned and sequenced. The gene has a similar organization and exhibited a high level of sequence similarity to those from other vertebrate animals. The upstream region of the alpha-actin gene included a TATA box, a CAAT box, three E-boxes, and a CArG box. Nested deletion segments containing these transcriptional motifs were fused to the reporter gene chloramphenicol acetyl transferase (CAT). Transfection of the clones into C2C12 cells indicated that all these motifs are required for transcriptional activities. The channel catfish alpha-actin gene is associated with two distinct short interspersed repetitive elements (SINEs). The first SINE element showed high levels of sequence similarity to the zebrafish Mermaid element, while the second SINE element is not similar to the Mermaid element except for an 8bp sequence CCCCGTGC suggesting their evolutionary linkage. However, the second SINE element appeared to co-exist with the Mermaid element in most cases and therefore was designated as the Merman element. Approximately 9000 copies and 1200 copies of the Mermaid and Merman elements exist per haploid channel catfish genome, respectively. BLAST searches indicated that both the Mermaid and the Merman elements were frequently associated with gene sequences, mostly those of aquatic animals, suggesting their evolutionary origin in association with aquatic organisms and their function in shaping the evolution of genomes in aquatic animals.

  3. Virus infection and interferon can activate gene expression through a single synthetic element, but endogenous genes show distinct regulation.

    PubMed

    Raj, N B; Engelhardt, J; Au, W C; Levy, D E; Pitha, P M

    1989-10-05

    Virus inducible elements (IE) in promoters of mouse alpha-interferon and human beta 1-interferon genes contain multiple copies of the hexanucleotide sequence AGT-GAA or its variants which are also found in the interferon-stimulated response element of genes transcriptionally induced by interferon. We have examined the similarities between virus and interferon induction of gene expression and the role of AGTGAA and AAT-GAA hexamers in these responses. Hybrid plasmids were constructed by inserting the IE region, the alpha 4 promoter, or the multiple copies of AGTGAA or AAT-GAA 5' to the inactive-45 human immunodeficiency-chloramphenicol acetyltransferase hybrid gene, and their inducible expression was studied in a transient expression assay. In L-cells, multiple hexamers were efficiently induced both by infection with Newcastle disease virus and by interferon treatment; while the alpha 4 promoter and the IE inducible region were induced predominantly by virus rather than by interferon. In order to dissociate the effect of virus and endogenous interferon on the induction process, we examined the gene expression in Vero cells, which have undergone homozygous deletion of type 1 interferon genes, and in VNPT-159 cells, which were derived from Vero cells by insertion of an inducible human interferon beta 1 gene. The results show that while the alpha 4 promoter was efficiently induced only by virus in both cell types, the constructs containing shorter segments of the IE were induced by both virus and interferon in Vero cells. However, the inducibility by interferon was not detected in VNPT-159 cells, suggesting that the presence of endogenous interferon suppresses interferon-induced expression of hexanucleotide repeats and the short inducible region. In contrast, virus inducibility of endogenous interferon-stimulated genes, ISG-15 and ISG-54, was about 100-fold more efficient in VNPT-159 cells than in Vero cells, suggesting that this induction is largely mediated through

  4. Transposable Element Insertions in Long Intergenic Non-Coding RNA Genes

    PubMed Central

    Kannan, Sivakumar; Chernikova, Diana; Rogozin, Igor B.; Poliakov, Eugenia; Managadze, David; Koonin, Eugene V.; Milanesi, Luciano

    2015-01-01

    Transposable elements (TEs) are abundant in mammalian genomes and appear to have contributed to the evolution of their hosts by providing novel regulatory or coding sequences. We analyzed different regions of long intergenic non-coding RNA (lincRNA) genes in human and mouse genomes to systematically assess the potential contribution of TEs to the evolution of the structure and regulation of expression of lincRNA genes. Introns of lincRNA genes contain the highest percentage of TE-derived sequences (TES), followed by exons and then promoter regions although the density of TEs is not significantly different between exons and promoters. Higher frequencies of ancient TEs in promoters and exons compared to introns implies that many lincRNA genes emerged before the split of primates and rodents. The content of TES in lincRNA genes is substantially higher than that in protein-coding genes, especially in exons and promoter regions. A significant positive correlation was detected between the content of TEs and evolutionary rate of lincRNAs indicating that inserted TEs are preferentially fixed in fast-evolving lincRNA genes. These results are consistent with the repeat insertion domains of LncRNAs hypothesis under which TEs have substantially contributed to the origin, evolution, and, in particular, fast functional diversification, of lincRNA genes. PMID:26106594

  5. Transposable elements: insertion pattern and impact on gene expression evolution in hominids.

    PubMed

    Warnefors, Maria; Pereira, Vini; Eyre-Walker, Adam

    2010-08-01

    Transposable elements (TEs) can affect the regulation of nearby genes through several mechanisms. Here, we examine to what extent recent TE insertions have contributed to the evolution of gene expression in hominids. We compare expression levels of human and chimpanzee orthologs and detect a weak increase in expression divergence (ED) for genes with species-specific TE insertions compared with unaffected genes. However, we show that genes with TE insertions predating the human-chimpanzee split also exhibit a similar increase in ED and therefore conclude that the increase is not due to the transcriptional influence of the TEs. These results are further confirmed by lineage-specific analysis of ED, using rhesus macaque as an outgroup: Human-chimpanzee ortholog pairs, where one ortholog has suffered TE insertion but not the other, do not show increased ED along the lineage where the insertion occurred, relative to the other lineage. We also show that genes with recent TE insertions tend to produce more alternative transcripts but find no evidence that the TEs themselves promote transcript diversity. Finally, we observe that TEs are enriched upstream relative to downstream of genes and show that this is due to insertional bias, rather than selection, because this bias is only observed in genes expressed in the germ line. This provides an alternative neutral explanation for the accumulation of TEs in upstream sequences.

  6. sigma, a repetitive element found adjacent to tRNA genes of yeast.

    PubMed Central

    del Rey, F J; Donahue, T F; Fink, G R

    1982-01-01

    sigma is a DNA element of about 340 base pairs (bp) that is repeated many times in the yeast genome. The element has 8-bp inverted repeats at its ends and is flanked by 5-bp direct repeats. The 5-bp repeats are different for each sigma and have no homology with the ends of the sigma sequence. sigma is located 16 or 18 bp from the 5' end of several tRNA genes. Southern analysis of different yeast strains shows that the pattern of hybridization is different even for closely related strains. Images PMID:6287468

  7. Excision of an 11-kilobase-pair DNA element from within the nifD gene in anabaena variabilis heterocysts.

    PubMed Central

    Brusca, J S; Hale, M A; Carrasco, C D; Golden, J W

    1989-01-01

    The 3' region of the Anabaena variabilis nifD gene contains an 11-kilobase-pair element which is excised from the chromosome during heterocyst differentiation. We have sequenced the recombination sites which border the element in vegetative cells and the rearranged heterocyst sequences. In vegetative cells, the element was flanked by 11-base-pair direct repeats which were identical to the repeats present at the ends of the nifD element in Anabaena sp. strain PCC 7120 (Anabaena strain 7120). Although Anabaena strain 7120 and A. variabilis are quite distinct in many ways, the overall sequence similarity between the two strains for the regions sequenced was 96%. Like the Anabaena strain 7120 element, the A. variabilis element was excised in heterocysts to produce a functional nifD gene and a free circularized element which was neither amplified nor degraded. The Anabaena strain 7120 xisA gene is located at the nifK-proximal end of the nifD element and is required for excision of the element in heterocysts. The A. variabilis element also contained an xisA gene which could complement a defective Anabaena strain 7120 xisA gene. A. variabilis did not contain the equivalent of the Anabaena strain 7120 fdxN 55-kilobase-pair element. Images PMID:2502534

  8. The DAL7 promoter consists of multiple elements that cooperatively mediate regulation of the gene's expression.

    PubMed Central

    Yoo, H S; Cooper, T G

    1989-01-01

    Expression of the allantoin system genes in Saccharomyces cerevisiae is induced by allophanate or its analog, oxalurate. This work provides evidence for the involvement of distinct types of cis-acting elements in the induction process. The first element was found to have the properties of an upstream activation sequence (UAS). This element was localized to a 16-base-pair (bp) DNA fragment containing a short 5-bp sequence that occurred repeatedly in the upstream region of DAL7. When present in two or more copies, the 16-bp fragment supported high-level beta-galactosidase production in a CYC1-lacZ expression vector; there was, however, no response to the allantoin pathway inducer. The second element had the properties of a negatively acting element or upstream repression sequence (URS). This element was localized to a 16-bp DNA fragment containing an 8-bp sequence that was repeated four times in the upstream region of DAL7. A fragment containing the 8-bp repeated sequence placed adjacent to the UAS-containing fragment mediated inhibition of the ability of the UAS to support lacZ expression regardless of whether inducer was present. A third element, designated an upstream induction sequence (UIS), was required for response to inducer. The UIS was localized to a small DNA fragment containing an approximately 10-bp sequence that was repeated twice in the upstream region of DAL7. When a fragment containing the 10-bp repeated sequence was placed adjacent to these UAS and URS elements, the construction (UIS-UAS-URS) supported normal oxalurate-mediated induction of beta-galactosidase synthesis. These data are consistent with the suggestion that multiple, cis-acting elements participate in the induction process. Images PMID:2552287

  9. Regulation of caulimovirus gene expression and the involvement of cis-acting elements on both viral transcripts.

    PubMed

    Scholthof, H B; Wu, F C; Gowda, S; Shepherd, R J

    1992-09-01

    In a further analysis of gene regulation of figwort mosaic virus (FMV), a caulimovirus, we studied transient gene expression with modified viral genomes in Nicotiana edwardsonii cell suspension protoplasts. The results demonstrated that the presence of the promoter for the full-length RNA interferes with expression from the separate downstream promoter for gene VI. In addition, expression of gene VI was inhibited by cis-acting sequences within gene VI itself. Both inhibitory effects could be partially relieved by coelectroporation with a plasmid that produces gene VI protein, demonstrating that expression of gene VI is transactivated by its own product. Subsequent expression studies with partially redundant FMV plasmids containing a reporter gene in frame with gene IV showed that efficient transactivation of CAT expression relies on a cis-acting element inside the downstream gene VI. Insertions of a transcriptional terminator upstream of the cis-acting element for premature termination of transcription showed that the cis-acting region is not a DNA element but is active only as a feature of the RNA transcript. We conclude that the cis-acting element, together with the transacting gene VI product, enhances expression of all major genes, including gene VI, from the polycistronic mRNA and the separate mRNA for gene VI.

  10. Putative cis-regulatory elements in genes highly expressed in rice sperm cells

    PubMed Central

    2011-01-01

    Background The male germ line in flowering plants is initiated within developing pollen grains via asymmetric division. The smaller cell then becomes totally encased within a much larger vegetative cell, forming a unique "cell within a cell structure". The generative cell subsequently divides to give rise to two non-motile diminutive sperm cells, which take part in double fertilization and lead to the seed set. Sperm cells are difficult to investigate because of their presence within the confines of the larger vegetative cell. However, recently developed techniques for the isolation of rice sperm cells and the fully annotated rice genome sequence have allowed for the characterization of the transcriptional repertoire of sperm cells. Microarray gene expression data has identified a subset of rice genes that show unique or highly preferential expression in sperm cells. This information has led to the identification of cis-regulatory elements (CREs), which are conserved in sperm-expressed genes and are putatively associated with the control of cell-specific expression. Findings We aimed to identify the CREs associated with rice sperm cell-specific gene expression data using in silico prediction tools. We analyzed 1-kb upstream regions of the top 40 sperm cell co-expressed genes for over-represented conserved and novel motifs. Analysis of upstream regions with the SIGNALSCAN program with the PLACE database, MEME and the Mclip tool helped to find combinatorial sets of known transcriptional factor-binding sites along with two novel motifs putatively associated with the co-expression of sperm cell-specific genes. Conclusions Our data shows the occurrence of novel motifs, which are putative CREs and are likely targets of transcriptional factors regulating sperm cell gene expression. These motifs can be used to design the experimental verification of regulatory elements and the identification of transcriptional factors that regulate sperm cell-specific gene expression. PMID

  11. Short interspersed DNA elements and miRNAs: a novel hidden gene regulation layer in zebrafish?

    PubMed

    Scarpato, Margherita; Angelini, Claudia; Cocca, Ennio; Pallotta, Maria M; Morescalchi, Maria A; Capriglione, Teresa

    2015-09-01

    In this study, we investigated by in silico analysis the possible correlation between microRNAs (miRNAs) and Anamnia V-SINEs (a superfamily of short interspersed nuclear elements), which belong to those retroposon families that have been preserved in vertebrate genomes for millions of years and are actively transcribed because they are embedded in the 3' untranslated region (UTR) of several genes. We report the results of the analysis of the genomic distribution of these mobile elements in zebrafish (Danio rerio) and discuss their involvement in generating miRNA gene loci. The computational study showed that the genes predicted to bear V-SINEs can be targeted by miRNAs with a very high hybridization E-value. Gene ontology analysis indicates that these genes are mainly involved in metabolic, membrane, and cytoplasmic signaling pathways. Nearly all the miRNAs that were predicted to target the V-SINEs of these genes, i.e., miR-338, miR-9, miR-181, miR-724, miR-735, and miR-204, have been validated in similar regulatory roles in mammals. The large number of genes bearing a V-SINE involved in metabolic and cellular processes suggests that V-SINEs may play a role in modulating cell responses to different stimuli and in preserving the metabolic balance during cell proliferation and differentiation. Although they need experimental validation, these preliminary results suggest that in the genome of D. rerio, as in other TE families in vertebrates, the preservation of V-SINE retroposons may also have been favored by their putative role in gene network modulation.

  12. IS195, an Insertion Sequence-Like Element Associated with Protease Genes in Porphyromonas gingivalis

    PubMed Central

    Lewis, Janina P.; Macrina, Francis L.

    1998-01-01

    Porphyromonas gingivalis is recognized as an important etiologic agent in adult and early-onset periodontal disease. Proteases produced by this organism contribute to its virulence in mice. Protease-encoding genes have been shown to contain multiple copies of repeated nucleotide sequences. These conserved sequences have also been found in hemagglutinin genes. In the process of studying the genetic loci containing the conserved repeated sequences, we have characterized a prtP gene homolog from P. gingivalis W83 encoding a cysteine protease with Lys-X specificity. However, this prtP gene was interrupted by an insertion sequence-like element which we designated IS195. Furthermore, IS195 and another element, IS1126, were present downstream of prtP gene homologs (kgp) found in P. gingivalis H66 and 381. IS195, a 1,068-bp insertion sequence-like element, contained 11-bp inverted repeats at its termini and was bordered by 9-bp direct repeats presumed to be a transposition-mediated target site duplication. Its central region contained one large open reading frame encoding a predicted 300-amino-acid protein which appeared to be a transposase. We isolated two naturally occurring variants of P. gingivalis W83, one carrying IS195 within the coding region of the prtP gene and another containing an intact prtP gene. Biochemical characterization revealed a lack of trypsin-like Lys-X specific proteolytic activity in the P. gingivalis W83 variant carrying the disrupted prtP gene. Studies using a mouse model revealed a reduction of virulence resulting from insertion of IS195 into the coding region of the prtP gene. An allelic-exchange mutant defective in the prtP gene also was constructed and tested in vivo. It displayed intermediate virulence compared to that of the wild-type and prtP::IS195 mutant strains. We conclude that the Lys-X cysteine protease contributes to virulence in soft tissue infections. PMID:9632563

  13. Hox11 genes establish synovial joint organization and phylogenetic characteristics in developing mouse zeugopod skeletal elements

    PubMed Central

    Koyama, Eiki; Yasuda, Tadashi; Minugh-Purvis, Nancy; Kinumatsu, Takashi; Yallowitz, Alisha R.; Wellik, Deneen M.; Pacifici, Maurizio

    2010-01-01

    Hox11 genes are essential for zeugopod skeletal element development but their roles in synovial joint formation remain largely unknown. Here, we show that the elbow and knee joints of mouse embryos lacking all Hox11 paralogous genes are specifically remodeled and reorganized. The proximal ends of developing mutant ulna and radius elements became morphologically similar and formed an anatomically distinct elbow joint. The mutant ulna lacked the olecranon that normally attaches to the triceps brachii muscle tendon and connects the humerus to the ulna. In its place, an ulnar patella-like element developed that expressed lubricin on its ventral side facing the joint and was connected to the triceps muscle tendon. In mutant knees, both tibia and fibula fully articulated with an enlarged femoral epiphyseal end that accommodated both elements, and the neo-tripartite knee joint was enclosed in a single synovial cavity and displayed an additional anterior ligament. The mutant joints also exhibited a different organization of the superficial zone of articular cartilage that normally exerts an anti-friction function. In conclusion, Hox11 genes co-regulate and coordinate the development of zeugopod skeletal elements and adjacent elbow and knee joints, and dictate joint identity, morphogenesis and anatomical and functional organization. Notably, the ulnar patella and tripartite knee joints in the mouse mutants actually characterize several lower vertebrates, including certain reptiles and amphibians. The re-emergence of such anatomical structures suggests that their genetic blueprint is still present in the mouse genome but is normally modified to the needs of the mammalian joint-formation program by distinct Hox11 function. PMID:20978074

  14. Glucocorticoids regulate the human occludin gene through a single imperfect palindromic glucocorticoid response element.

    PubMed

    Harke, Nina; Leers, Jörg; Kietz, Silke; Drenckhahn, Detlev; Förster, Carola

    2008-11-25

    The 65kDa protein occludin is an essential element of the blood-brain barrier. This integral membrane protein represents an important part of the tight junctions, which seal and protect the blood brain barrier against paracellular diffusion of solutes to the brain parenchyme and are therefore responsible for the high resistance and low permeability between cerebral capillary endothelial cells. However, the molecular basis for the regulation of occludin gene expression is only incompletely understood. In former projects we showed that treatment of a brain microvascular cell line, cEND, with glucocorticoids resulted in increased occludin expression in cell-cell-contacts [Förster, C., Silwedel, C., Golenhofen, N., Burek, M., Kietz, S., Mankertz, J., Drenckhahn, D., 2005. Occludin as direct target for glucocorticoid-induced improvement of blood-brain barrier properties in a murine in vitro system. J. Physiol. 565, Pt 2, 475-486]. Induction of occludin expression by glucocorticoids was shown to be dependent on the glucocorticoid receptor. This study aims to identify the underlying molecular mechanism of gene expression and to identify potential glucocorticoid receptor binding sites within the occludin promoter, the glucocorticoid response elements. We identified one candidate glucocorticoid response element within the distal part of the occludin promoter that differs from the consensus glucocorticoid response element by the presence of a 4-basepair instead of a 3-basepair spacer between two highly degenerate halfsites (5'-ACATGTGTTTACAAAT-3'). Chromatin immunoprecipitation assay and site-directed mutagenesis confirmed binding of the glucocorticoid receptor to this site. The need for glucocorticoid receptor dimerization to induce gene expression was further confirmed by transfection studies using wild type and glucocorticoid receptor dimerization-deficient expression vectors, indicating that transactivation of occludin occurs through the glucocorticoid response element

  15. Cytogenetic mapping of the Muller F element genes in Drosophila willistoni group.

    PubMed

    Pita, Sebastián; Panzera, Yanina; Lúcia da Silva Valente, Vera; de Melo, Zilpa das Graças Silva; Garcia, Carolina; Garcia, Ana Cristina Lauer; Montes, Martín Alejandro; Rohde, Claudia

    2014-10-01

    Comparative genomics in Drosophila began in 1940, when Muller stated that the ancestral haploid karyotype of this genus is constituted by five acrocentric chromosomes and one dot chromosome, named A to F elements. In some species of the willistoni group such as Drosophila willistoni and D. insularis, the F element, instead of a dot chromosome, has been incorporated into the E element, forming chromosome III (E + F fusion). The aim of this study was to investigate the scope of the E + F fusion in the willistoni group, evaluating six other species. Fluorescent in situ hybridization was used to locate two genes of the F element previously studied-cubitus interruptus (ci) and eyeless (ey)-in species of the willistoni and bocainensis subgroups. Moreover, polytene chromosome photomaps corresponding to the F element (basal portion of chromosome III) were constructed for each species studied. In D. willistoni, D. paulistorum and D. equinoxialis, the ci gene was located in subSectction 78B and the ey gene in 78C. In D. tropicalis, ci was located in subSection 76B and ey in 76C. In species of the bocainensis subgroup, ci and ey were localized, respectively, at subsections 76B and 76C in D. nebulosa and D. capricorni, and 76A and 76C in D. fumipennis. Despite the differences in the subsection numbers, all species showed the same position for ci and ey. The results confirm the synteny of E + F fusion in willistoni and bocainensis subgroups, and allow estimating the occurrence of this event at 15 Mya, at least.

  16. Metagenomic Profiling of Antibiotic Resistance Genes and Mobile Genetic Elements in a Tannery Wastewater Treatment Plant

    PubMed Central

    Wang, Zhu; Zhang, Xu-Xiang; Huang, Kailong; Miao, Yu; Shi, Peng; Liu, Bo; Long, Chao; Li, Aimin

    2013-01-01

    Antibiotics are often used to prevent sickness and improve production in animal agriculture, and the residues in animal bodies may enter tannery wastewater during leather production. This study aimed to use Illumina high-throughput sequencing to investigate the occurrence, diversity and abundance of antibiotic resistance genes (ARGs) and mobile genetic elements (MGEs) in aerobic and anaerobic sludge of a full-scale tannery wastewater treatment plant (WWTP). Metagenomic analysis showed that Proteobacteria, Firmicutes, Bacteroidetes and Actinobacteria dominated in the WWTP, but the relative abundance of archaea in anaerobic sludge was higher than in aerobic sludge. Sequencing reads from aerobic and anaerobic sludge revealed differences in the abundance of functional genes between both microbial communities. Genes coding for antibiotic resistance were identified in both communities. BLAST analysis against Antibiotic Resistance Genes Database (ARDB) further revealed that aerobic and anaerobic sludge contained various ARGs with high abundance, among which sulfonamide resistance gene sul1 had the highest abundance, occupying over 20% of the total ARGs reads. Tetracycline resistance genes (tet) were highly rich in the anaerobic sludge, among which tet33 had the highest abundance, but was absent in aerobic sludge. Over 70 types of insertion sequences were detected in each sludge sample, and class 1 integrase genes were prevalent in the WWTP. The results highlighted prevalence of ARGs and MGEs in tannery WWTPs, which may deserve more public health concerns. PMID:24098424

  17. Characterization of the hormone responsive element involved in the regulation of the progesterone receptor gene.

    PubMed Central

    Savouret, J F; Bailly, A; Misrahi, M; Rauch, C; Redeuilh, G; Chauchereau, A; Milgrom, E

    1991-01-01

    The transcription of the progesterone receptor gene is induced by estrogens and decreased by progestins. Studies were performed to define the regions of the gene and the molecular mechanisms involved. No hormonal regulation could be observed using 5' flanking regions of the gene up to -2762 in front of a heterologous gene. Estrogen and progestin regulation could be observed only when using fragments of the gene extending down to +788. Progressive deletions from the 5' and 3' ends, site-directed mutagenesis and DNase protection experiments with purified estrogen receptor suggested that the biologically active estrogen responsive element (ERE) is present at +698/+723, overlapping the initiation of translation. An oligonucleotide was synthesized bearing this ERE and shown to impart estrogen inducibility to a heterologous gene. Its regulation by anti-estrogens corresponded to that of the in situ progesterone receptor gene since tamoxifen was a partial agonist whereas ICI 164384 was a full antagonist. This ERE also mediated down-regulation by progestins in the presence of the progesterone receptor, even though it has no progesterone receptor binding ability. DNase footprinting showed that this effect was not due to a decrease of estrogen receptor affinity for the ERE in the presence of progesterone receptor. Finally, use of deletion mutants of the progesterone receptor showed that the steroid binding and the DNA binding domains were necessary for down-regulation whereas deletions of various parts of the N-terminal domain were without effect. Images PMID:2050123

  18. Metagenomic profiling of antibiotic resistance genes and mobile genetic elements in a tannery wastewater treatment plant.

    PubMed

    Wang, Zhu; Zhang, Xu-Xiang; Huang, Kailong; Miao, Yu; Shi, Peng; Liu, Bo; Long, Chao; Li, Aimin

    2013-01-01

    Antibiotics are often used to prevent sickness and improve production in animal agriculture, and the residues in animal bodies may enter tannery wastewater during leather production. This study aimed to use Illumina high-throughput sequencing to investigate the occurrence, diversity and abundance of antibiotic resistance genes (ARGs) and mobile genetic elements (MGEs) in aerobic and anaerobic sludge of a full-scale tannery wastewater treatment plant (WWTP). Metagenomic analysis showed that Proteobacteria, Firmicutes, Bacteroidetes and Actinobacteria dominated in the WWTP, but the relative abundance of archaea in anaerobic sludge was higher than in aerobic sludge. Sequencing reads from aerobic and anaerobic sludge revealed differences in the abundance of functional genes between both microbial communities. Genes coding for antibiotic resistance were identified in both communities. BLAST analysis against Antibiotic Resistance Genes Database (ARDB) further revealed that aerobic and anaerobic sludge contained various ARGs with high abundance, among which sulfonamide resistance gene sul1 had the highest abundance, occupying over 20% of the total ARGs reads. Tetracycline resistance genes (tet) were highly rich in the anaerobic sludge, among which tet33 had the highest abundance, but was absent in aerobic sludge. Over 70 types of insertion sequences were detected in each sludge sample, and class 1 integrase genes were prevalent in the WWTP. The results highlighted prevalence of ARGs and MGEs in tannery WWTPs, which may deserve more public health concerns.

  19. Two types of TATA elements for the CYC1 gene of the yeast Saccharomyces cerevisiae.

    PubMed Central

    Li, W Z; Sherman, F

    1991-01-01

    Functional TATA elements in the 5' untranslated region of the CYC1 gene in the yeast Saccharomyces cerevisiae have been defined by transcriptional analysis of site-directed mutations. Five sites previously suggested to contain functional TATA elements were altered individually and in all possible combinations. The results indicated that only two elements are required for transcription at the normal level and the normal start sites. The two functional TATA elements are located at sites -178 and -123, where the A of the ATG start codon is assigned nucleotide position +1. They direct initiation within windows encompassing -70 to -46 and -46 to -28, respectively. Only when both of the upstream TATA sites were rendered nonfunctional were the third and fourth downstream TATA-like sequences activated, as indicated by the presence of low levels of transcription starting at -28. The two upstream functional TATA elements differed in sequence. The sequence of the most 5' one at site 1, denoted beta-type, was ATATATATAT, whereas that of the second one at site 2, denoted alpha-type, was TATATAAAA. The following rearrangements of the beta-type and alpha-type elements at two sites (1 and 2) were examined: site1 beta-site2 alpha; site 1 alpha-site 2 beta; site1 alpha-site2 alpha; and site1 beta-site2 beta. When different types were at different sites (site1 beta-site2 alpha and site1 alpha-site2 beta), both were used equally. In contrast, when the same type was present at both sites (site1 alpha-site2 alpha and site1 beta-site2 beta), only the upstream element was used. We suggest that the two TATA elements are recognized by different factors of the transcription apparatus. Images PMID:1846668

  20. The glucose-6-phosphatase catalytic subunit gene promoter contains both positive and negative glucocorticoid response elements.

    PubMed

    Vander Kooi, Beth T; Onuma, Hiroshi; Oeser, James K; Svitek, Christina A; Allen, Shelley R; Vander Kooi, Craig W; Chazin, Walter J; O'Brien, Richard M

    2005-12-01

    Glucose-6-phosphatase catalyzes the final step in the gluconeogenic and glycogenolytic pathways. Glucocorticoids stimulate glucose-6-phosphatase catalytic subunit (G6Pase) gene transcription and studies performed in H4IIE hepatoma cells demonstrate the presence of a glucocorticoid response unit (GRU) in the proximal G6Pase promoter. In vitro deoxyribonuclease I footprinting analyses show that the glucocorticoid receptor binds to three glucocorticoid response elements (GREs) in the -231 to -129 promoter region and transfection results indicate all three contribute to glucocorticoid induction of G6Pase gene transcription. Furthermore, binding sites for hepatocyte nuclear factor-1 and -4, CRE binding factors, and FKHR (FOXO1a) are required for the full glucocorticoid response. Chromatin immunoprecipitation assays show that dexamethasone treatment stimulates glucocorticoid receptor and FKHR binding to the endogenous G6Pase promoter. Surprisingly, although glucocorticoids stimulate G6Pase gene transcription, deoxyribonuclease I footprinting and transfection analyses demonstrate the presence of a negative GRE and an associated negative accessory factor element in the -271 to -225 promoter region, which inhibit the glucocorticoid response. This appears to be the first report of a promoter that contains both positive and negative GREs, which function within the same cellular environment. We hypothesize that targeted signaling to the negative accessory element within the GRU may provide tight regulation of the glucocorticoid stimulation.

  1. Effect of Regulatory Element DNA Methylation on Tissue-Type Plasminogen Activator Gene Expression

    PubMed Central

    Rivier-Cordey, Anne-Sophie; Caetano, Carlos; Fish, Richard J.; Kruithof, Egbert K. O.

    2016-01-01

    Expression of the tissue-type plasminogen activator gene (t-PA; gene name PLAT) is regulated, in part, by epigenetic mechanisms. We investigated the relationship between PLAT methylation and PLAT expression in five primary human cell types and six transformed cell lines. CpG methylation was analyzed in the proximal PLAT gene promoter and near the multihormone responsive enhancer (MHRE) -7.3 kilobase pairs upstream of the PLAT transcriptional start site (TSS, -7.3 kb). In Bowes melanoma cells, the PLAT promoter and the MHRE were fully unmethylated and t-PA secretion was extremely high. In other cell types the region from -647 to -366 was fully methylated, whereas an unmethylated stretch of DNA from -121 to +94 was required but not sufficient for detectable t-PA mRNA and t-PA secretion. DNA methylation near the MHRE was not correlated with t-PA secretion. Specific methylation of the PLAT promoter region -151 to +151, inserted into a firefly luciferase reporter gene, abolished reporter gene activity. The region -121 to + 94 contains two well-described regulatory elements, a PMA-responsive element (CRE) near -106 and a GC-rich region containing an Sp1 binding site near +59. Methylation of double-stranded DNA oligonucleotides containing the CRE or the GC-rich region had little or no effect on transcription factor binding. Methylated CpGs may attract co-repressor complexes that contain histone deacetylases (HDAC). However, reporter gene activity of methylated plasmids was not restored by the HDAC inhibitor trichostatin. In conclusion, efficient PLAT gene expression requires a short stretch of unmethylated CpG sites in the proximal promoter. PMID:27973546

  2. Identification of Genes Underlying Hypoxia Tolerance in Drosophila by a P-element Screen

    PubMed Central

    Azad, Priti; Zhou, Dan; Zarndt, Rachel; Haddad, Gabriel G.

    2012-01-01

    Hypoxia occurs in physiologic conditions (e.g. high altitude) or during pathologic states (e.g. ischemia). Our research is focused on understanding the molecular mechanisms that lead to adaptation and survival or injury to hypoxic stress using Drosophila as a model system. To identify genes involved in hypoxia tolerance, we screened the P-SUP P-element insertion lines available for all the chromosomes of Drosophila. We screened for the eclosion rates of embryos developing under 5% O2 condition and the number of adult flies surviving one week after eclosion in the same hypoxic environment. Out of 2187 lines (covering ∼1870 genes) screened, 44 P-element lines representing 44 individual genes had significantly higher eclosion rates (i.e. >70%) than those of the controls (i.e. ∼7–8%) under hypoxia. The molecular function of these candidate genes ranged from cell cycle regulation, DNA or protein binding, GTP binding activity, and transcriptional regulators. In addition, based on pathway analysis, we found these genes are involved in multiple pathways, such as Notch, Wnt, Jnk, and Hedgehog. Particularly, we found that 20 out of the 44 candidate genes are linked to Notch signaling pathway, strongly suggesting that this pathway is essential for hypoxia tolerance in flies. By employing the UAS/RNAi-Gal4 system, we discovered that genes such as osa (linked to Wnt and Notch pathways) and lqf (Notch regulator) play an important role in survival and development under hypoxia in Drosophila. Based on these results and our previous studies, we conclude that hypoxia tolerance is a polygenic trait including the Notch pathway. PMID:23050227

  3. Cell-type-specific long-range looping interactions identify distant regulatory elements of the CFTR gene

    PubMed Central

    Gheldof, Nele; Smith, Emily M.; Tabuchi, Tomoko M.; Koch, Christoph M.; Dunham, Ian; Stamatoyannopoulos, John A.; Dekker, Job

    2010-01-01

    Identification of regulatory elements and their target genes is complicated by the fact that regulatory elements can act over large genomic distances. Identification of long-range acting elements is particularly important in the case of disease genes as mutations in these elements can result in human disease. It is becoming increasingly clear that long-range control of gene expression is facilitated by chromatin looping interactions. These interactions can be detected by chromosome conformation capture (3C). Here, we employed 3C as a discovery tool for identification of long-range regulatory elements that control the cystic fibrosis transmembrane conductance regulator gene, CFTR. We identified four elements in a 460-kb region around the locus that loop specifically to the CFTR promoter exclusively in CFTR expressing cells. The elements are located 20 and 80 kb upstream; and 109 and 203 kb downstream of the CFTR promoter. These elements contain DNase I hypersensitive sites and histone modification patterns characteristic of enhancers. The elements also interact with each other and the latter two activate the CFTR promoter synergistically in reporter assays. Our results reveal novel long-range acting elements that control expression of CFTR and suggest that 3C-based approaches can be used for discovery of novel regulatory elements. PMID:20360044

  4. Identification of unique cis-element pattern on simulated microgravity treated Arabidopsis by in silico and gene expression

    NASA Astrophysics Data System (ADS)

    Soh, Hyuncheol; Choi, Yongsang; Lee, Taek-Kyun; Yeo, Up-Dong; Han, Kyeongsik; Auh, Chungkyun; Lee, Sukchan

    2012-08-01

    Arabidopsis gene expression microarray (44 K) was used to detect genes highly induced under simulated microgravity stress (SMS). Ten SMS-inducible genes were selected from the microarray data and these 10 genes were found to be abundantly expressed in 3-week-old plants. Nine out of the 10 SMS-inducible genes were also expressed in response to the three abiotic stresses of drought, touch, and wounding in 3-week-old Arabidopsis plants respectively. However, WRKY46 was elevated only in response to SMS. Six other WRKY genes did not respond to SMS. To clarify the characteristics of the genes expressed at high levels in response to SMS, 20 cis-elements in the promoters of the 40 selected genes including the 10 SMS-inducible genes, the 6 WRKY genes, and abiotic stress-inducible genes were analyzed and their spatial positions on each promoter were determined. Four cis-elements (M/T-G-T-P from MYB1AT or TATABOX5, GT1CONSENSUS, TATABOX5, and POLASIG1) showed a unique spatial arrangement in most SMS-inducible genes including WRKY46. Therefore the M/T-G-T-P cis-element patterns identified in the promoter of WRKY46 may play important roles in regulating gene expression in response to SMS. The presences of the cis-element patterns suggest that the order or spatial positioning of certain groups of cis-elements is more important than the existence or numbers of specific cis-elements. Taken together, our data indicate that WRKY46 is a novel SMS inducible transcription factor and the unique spatial arrangement of cis-elements shown in WRKY46 promoter may play an important role for its response to SMS.

  5. Molluscan mobile elements similar to the vertebrate recombination-activating genes

    PubMed Central

    Panchin, Yuri; Moroz, Leonid L.

    2009-01-01

    Animal genomes contain ~20,000 genes. Additionally millions of genes for antigen receptors are generated in cells of the immune system from the sets of separate gene segments by a mechanism known as the V(D)J somatic recombination. The components of the V(D)J recombination system, Recombination-Activating Gene proteins (RAG1 and RAG2) and recombination signal sequence (RSS), are thought to have “entered” the vertebrate genome as a hypothetical “RAG transposon”. Recently discovered mobile elements have terminal inverted repeats (TIRs) similar to RSS and may encode proteins with a different degree of similarity to RAG1. We describe a novel N-RAG-TP transposon identified from the sea slug Aplysia californica that encodes a protein similar to the N-terminal part of RAG1 in vertebrates. This refines the “RAG transposon” hypothesis and allows us to propose a scenario for V(D)J recombination machinery evolution from a relic transposon related to the existing mobile elements N-RAG-TP, Chapaev and Transib. PMID:18313399

  6. Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing.

    SciTech Connect

    Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D.

    2003-06-01

    OAK-B135 In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3 kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally important for activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection, but also highlight that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites.

  7. Regulatory Elements of the Floral Homeotic Gene AGAMOUS Identified by Phylogenetic Footprinting and ShadowingW⃞

    PubMed Central

    Hong, Ray L.; Hamaguchi, Lynn; Busch, Maximilian A.; Weigel, Detlef

    2003-01-01

    In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3-kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae species, several other motifs, but not the LFY and WUS binding sites identified previously, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally important for the activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection but also demonstrate that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites. PMID:12782724

  8. Aberrant splicing and transcription termination caused by P element insertion into the intron of a Drosophila gene

    SciTech Connect

    Horowitz, H.; Berg, C.A.

    1995-01-01

    Insertional mutagenesis screens using the P[lacZ, rosy{sup +}] (PZ) transposable element have provided thousands of mutant lines for analyzing genes of varied function in the fruitfly, Drosophila melanogaster. As has been observed with other P elements, many of the PZ-induced mutations result from insertion of the P element into the promoter or 5{prime} untranslated regions of the affected gene. We document here a novel mechanism for mutagenesis by this element. We show that sequences present within the element direct aberrant splicing and termination events that produce an mRNA composed of 5{prime} sequences from the mutated gene (in this case, pipsqueak) and 3{prime} sequences from within the P[lacZ, rosy{sup +}] element. These truncated RNAs could yield proteins with dominant mutant effects. 43 refs., 4 figs.

  9. Precise integration of inducible transcriptional elements (PrIITE) enables absolute control of gene expression

    PubMed Central

    Pinto, Rita; Hansen, Lars; Hintze, John; Almeida, Raquel; Larsen, Sylvester; Coskun, Mehmet; Davidsen, Johanne; Mitchelmore, Cathy; David, Leonor; Troelsen, Jesper Thorvald

    2017-01-01

    Abstract Tetracycline-based inducible systems provide powerful methods for functional studies where gene expression can be controlled. However, the lack of tight control of the inducible system, leading to leakiness and adverse effects caused by undesirable tetracycline dosage requirements, has proven to be a limitation. Here, we report that the combined use of genome editing tools and last generation Tet-On systems can resolve these issues. Our principle is based on precise integration of inducible transcriptional elements (coined PrIITE) targeted to: (i) exons of an endogenous gene of interest (GOI) and (ii) a safe harbor locus. Using PrIITE cells harboring a GFP reporter or CDX2 transcription factor, we demonstrate discrete inducibility of gene expression with complete abrogation of leakiness. CDX2 PrIITE cells generated by this approach uncovered novel CDX2 downstream effector genes. Our results provide a strategy for characterization of dose-dependent effector functions of essential genes that require absence of endogenous gene expression. PMID:28472465

  10. Paired hormone response elements predict caveolin-1 as a glucocorticoid target gene.

    PubMed

    van Batenburg, Marinus F; Li, Hualing; Polman, J Annelies; Lachize, Servane; Datson, Nicole A; Bussemaker, Harmen J; Meijer, Onno C

    2010-01-21

    Glucocorticoids act in part via glucocorticoid receptor binding to hormone response elements (HREs), but their direct target genes in vivo are still largely unknown. We developed the criterion that genomic occurrence of paired HREs at an inter-HRE distance less than 200 bp predicts hormone responsiveness, based on synergy of multiple HREs, and HRE information from known target genes. This criterion predicts a substantial number of novel responsive genes, when applied to genomic regions 10 kb upstream of genes. Multiple-tissue in situ hybridization showed that mRNA expression of 6 out of 10 selected genes was induced in a tissue-specific manner in mice treated with a single dose of corticosterone, with the spleen being the most responsive organ. Caveolin-1 was strongly responsive in several organs, and the HRE pair in its upstream region showed increased occupancy by glucocorticoid receptor in response to corticosterone. Our approach allowed for discovery of novel tissue specific glucocorticoid target genes, which may exemplify responses underlying the permissive actions of glucocorticoids.

  11. Analysis of genetic elements regulating the methionine adenosyltransferase gene in Leishmania infantum.

    PubMed

    García-Estrada, Carlos; Pérez-Pertejo, Yolanda; Ordóñez, David; Balaña-Fouce, Rafael; Reguera, Rosa M

    2007-03-15

    Methionine adenosyltransferase (MAT) is an important enzyme for metabolic processes, inasmuch as its product, S-adenosylmethionine (AdoMet), plays a key role in trans-methylation, trans-sulphuration and polyamine synthesis. Our prior studies have shown that the Leishmania infantum genome contains two identical copies of the gene encoding MAT (MAT2 gene), arranged in head-to-tail configuration and alternating with another gene, called LORIEN that contains a zinc-finger motif. Both genes are constitutively expressed throughout the promastigote stage of the parasite cell cycle, and their flanking regions were detected by RT-PCR. Luciferase (luc) reporter assays indicated the presence of regulatory elements within the MAT2 3'UTR and intergenic region, and fragments responsible for such regulation were identified by deletional analysis. By site-directed mutagenesis of the wild-type -42 AG recognized in the trans-splicing of the MAT2 gene, the AG slightly downstream (position -36) was observed to be able to generate the same levels of luc expression, thus suggesting that potentially this gene has alternative spliced leader acceptor sites. The stability of MAT2 and LORIEN transcripts was very similar in both logarithmic and stationary phases. However, cycloheximide (CHX) inhibition of protein synthesis increased MAT2 and LORIEN mRNA levels in the logarithmic phase only, an indication that these genes are regulated in promastigotes at the post-transcriptional level by protein factors that targets both transcripts for degradation. However, during the stationary phase, another CHX-independent factor also led to MAT2 and LORIEN mRNAs degradation, indicating the existence of different mechanisms operating on the post-transcriptional regulation of these two genes.

  12. Expression patterns of elemental cycling genes in the Amazon River Plume.

    PubMed

    Satinsky, Brandon M; Smith, Christa B; Sharma, Shalabh; Landa, Marine; Medeiros, Patricia M; Coles, Victoria J; Yager, Patricia L; Crump, Byron C; Moran, Mary Ann

    2017-04-07

    Metatranscriptomics and metagenomics data sets benchmarked with internal standards were used to characterize the expression patterns for biogeochemically relevant bacterial and archaeal genes mediating carbon, nitrogen, phosphorus and sulfur uptake and metabolism through the salinity gradient of the Amazon River Plume. The genes were identified in 48 metatranscriptomic and metagenomic data sets summing to >500 million quality-controlled reads from six locations in the plume ecosystem. The ratio of transcripts per gene copy (a direct measure of expression made possible by internal standard additions) showed that the free-living bacteria and archaea exhibited only small changes in the expression levels of biogeochemically relevant genes through the salinity and nutrient zones of the plume. In contrast, the expression levels of genes in particle-associated cells varied over orders of magnitude among the stations, with the largest differences measured for genes mediating aspects of nitrogen cycling (nifH, amtB and amoA) and phosphorus acquisition (pstC, phoX and phoU). Taxa varied in their baseline gene expression levels and extent of regulation, and most of the spatial variation in the expression level could be attributed to changes in gene regulation after removing the effect of shifting taxonomic composition. We hypothesize that changes in microbial element cycling along the Amazon River Plume are largely driven by shifting activities of particle-associated cells, with most activities peaking in the mesohaline regions where N2 fixation rates are elevated.The ISME Journal advance online publication, 7 April 2017; doi:10.1038/ismej.2017.46.

  13. Gene Expression Profiling in Abdominal Aortic Aneurysms After Finite Element Rupture Risk Assessment.

    PubMed

    Erhart, Philipp; Schiele, Sandra; Ginsbach, Philip; Grond-Ginsbach, Caspar; Hakimi, Maani; Böckler, Dittmar; Lorenzo-Bermejo, Justo; Dihlmann, Susanne

    2017-08-01

    To investigate the association between local biomechanical rupture risk calculations from finite element analysis (FEA) and whole-genome profiling of the abdominal aortic aneurysm (AAA) wall to determine if AAA wall regions with highest and lowest estimated rupture risk show different gene expression patterns. Six patients (mean age 74 years; all men) scheduled for open surgery to treat asymptomatic AAAs (mean diameter 55.2±3.5 mm) were recruited for the study. Rupture risk profiles were estimated by FEA from preoperative computed tomography angiography data. During surgery, AAA wall samples of ~10 mm(2) were extracted from the lowest and highest rupture risk locations identified by the FEA. Twelve samples were processed for RNA extraction and subsequent whole genome expression profiling. Expression of single genes and of predefined gene groups were compared between vessel wall areas with highest and lowest predicted rupture risk. Normalized datasets comprised 15,079 gene transcripts with expression above background. In biopsies with high rupture risk, upregulation of 18 and downregulation of 18 genes was detected when compared to the low-risk counterpart. Global analysis of predefined gene groups revealed expression differences in genes associated with extracellular matrix (ECM) degradation (p<0.001), matrix metalloproteinase activity (p<0.001), and chemokine signaling (p<0.001). Increased expression of genes involved in degrading ECM components was present in AAA wall regions with highest biomechanical stress, supporting the thesis of mechanotransduction. More experimental studies with cooperation of multicenter vascular biobanks are necessary to understand AAA etiologies and identify further parameters of FEA model complementation.

  14. Viral expression cassette elements to enhance transgene target specificity and expression in gene therapy.

    PubMed

    Powell, Sara Kathleen; Rivera-Soto, Ricardo; Gray, Steven James

    2015-01-01

    Over the last five years, the number of clinical trials involving AAV (adeno-associated virus) and lentiviral vectors continue to increase by about 150 trials each year. For continued success, AAV and lentiviral expression cassettes need to be designed to meet each disease's specific needs. This review discusses how viral vector expression cassettes can be engineered with elements to enhance target specificity and increase transgene expression. The key differences relating to target specificity between ubiquitous and tissue-specific promoters are discussed, as well as how endogenous miRNAs and their target sequences have been used to restrict transgene expression. Specifically, relevant studies indicating how cis-acting elements such as introns, WPRE, polyadenylation signals, and the CMV enhancer are highlighted to show their utility for enhancing transgene expression in gene therapy applications. All discussion bears in mind that expression cassettes have space constraints. In conclusion, this review can serve as a menu of vector genome design elements and their cost in terms of space to thoughtfully engineer viral vectors for gene therapy.

  15. Analysis of Ly49 gene transcripts in mature NK cells supports a role for the Pro1 element in gene activation, not gene expression.

    PubMed

    McCullen, M V; Li, H; Cam, M; Sen, S K; McVicar, D W; Anderson, S K

    2016-09-01

    The variegated expression of murine Ly49 loci has been associated with the probabilistic behavior of an upstream promoter active in immature cells, the Pro1 element. However, recent data suggest that Pro1 may be active in mature natural killer (NK) cells and function as an enhancer element. To assess directly if Pro1 transcripts are present in mature Ly49-expressing NK cells, RNA-sequencing of the total transcript pool was performed on freshly isolated splenic NK cells sorted for expression of either Ly49G or Ly49I. No Pro1 transcripts were detected from the Ly49a, Ly49c or Ly49i genes in mature Ly49(+) NK cells that contained high levels of Pro2 transcripts. Low levels of Ly49g Pro1 transcripts were found in both Ly49G(+) and Ly49G(-) populations, consistent with the presence of a small population of mature NK cells undergoing Ly49g gene activation, as previously demonstrated by culture of splenic NK cells in interleukin-2. Ly49 gene reporter constructs containing Pro1 failed to show any enhancer activity of Pro1 on Pro2 in a mature Ly49-expressing cell line. Taken together, the results are consistent with Pro1 transcription having a role in gene activation in developing NK, and argue against a role for Pro1 in Ly49 gene transcription by mature NK cells.

  16. Identification of novel Drosophila meiotic genes recovered in a P-element screen.

    PubMed

    Sekelsky, J J; McKim, K S; Messina, L; French, R L; Hurley, W D; Arbel, T; Chin, G M; Deneen, B; Force, S J; Hari, K L; Jang, J K; Laurençon, A C; Madden, L D; Matthies, H J; Milliken, D B; Page, S L; Ring, A D; Wayson, S M; Zimmerman, C C; Hawley, R S

    1999-06-01

    The segregation of homologous chromosomes from one another is the essence of meiosis. In many organisms, accurate segregation is ensured by the formation of chiasmata resulting from crossing over. Drosophila melanogaster females use this type of recombination-based system, but they also have mechanisms for segregating achiasmate chromosomes with high fidelity. We describe a P-element mutagenesis and screen in a sensitized genetic background to detect mutations that impair meiotic chromosome pairing, recombination, or segregation. Our screen identified two new recombination-deficient mutations: mei-P22, which fully eliminates meiotic recombination, and mei-P26, which decreases meiotic exchange by 70% in a polar fashion. We also recovered an unusual allele of the ncd gene, whose wild-type product is required for proper structure and function of the meiotic spindle. However, the screen yielded primarily mutants specifically defective in the segregation of achiasmate chromosomes. Although most of these are alleles of previously undescribed genes, five were in the known genes alphaTubulin67C, CycE, push, and Trl. The five mutations in known genes produce novel phenotypes for those genes.

  17. Myosin regulatory elements as vectors for gene transfer by intramuscular injection.

    PubMed

    Skarli, M; Kiri, A; Vrbova, G; Lee, C A; Goldspink, G

    1998-04-01

    Intramuscular injection of plasmid constructs promises to be an effective way of carrying out gene therapy for muscle disorders as well as using muscle as an in vivo expression system for disorders that involve the gene product being secreted into the bloodstream. The effectiveness of this method depends on the design of the cassette used for the expression of the cDNA of the introduced gene. We tested the levels of expression achieved by a number of muscle-specific promoters and a myosin light chain enhancer when spliced to the reporter gene chloramphenicol acetyltransferase (CAT), in vitro and in vivo by injection into fast and slow muscles of the mouse. The results show that the highest levels of expression are achieved by a combination of a truncated myosin heavy chain promoter and the enhancer, and that a whole range of expression levels is obtained with the other combinations tested. The data show that a cassette based on these elements should provide efficient vectors for the introduction and expression of genes following intramuscular injection of naked DNA.

  18. Genome-wide ultraconserved elements exhibit higher phylogenetic informativeness than traditional gene markers in percomorph fishes.

    PubMed

    Gilbert, Princess S; Chang, Jonathan; Pan, Calvin; Sobel, Eric M; Sinsheimer, Janet S; Faircloth, Brant C; Alfaro, Michael E

    2015-11-01

    Ultraconserved elements (UCEs) have become popular markers in phylogenomic studies because of their cost effectiveness and their potential to resolve problematic phylogenetic relationships. Although UCE datasets typically contain a much larger number of loci and sites than more traditional datasets of PCR-amplified, single-copy, protein coding genes, a fraction of UCE sites are expected to be part of a nearly invariant core, and the relative performance of UCE datasets versus protein coding gene datasets is poorly understood. Here we use phylogenetic informativeness (PI) to compare the resolving power of multi-locus and UCE datasets in a sample of percomorph fishes with sequenced genomes (genome-enabled). We compare three data sets: UCE core regions, flanking sequence adjacent to the UCE core and a set of ten protein coding genes commonly used in fish systematics. We found the net informativeness of UCE core and flank regions to be roughly ten-fold and 100-fold more informative than that of the protein coding genes. On a per locus basis UCEs and protein coding genes exhibited similar levels of phylogenetic informativeness. Our results suggest that UCEs offer enormous potential for resolving relationships across the percomorph tree of life. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Human population-specific gene expression and transcriptional network modification with polymorphic transposable elements

    PubMed Central

    Wang, Lu; Mariño-Ramírez, Leonardo

    2017-01-01

    Abstract Transposable element (TE) derived sequences are known to contribute to the regulation of the human genome. The majority of known TE-derived regulatory sequences correspond to relatively ancient insertions, which are fixed across human populations. The extent to which human genetic variation caused by recent TE activity leads to regulatory polymorphisms among populations has yet to be thoroughly explored. In this study, we searched for associations between polymorphic TE (polyTE) loci and human gene expression levels using an expression quantitative trait loci (eQTL) approach. We compared locus-specific polyTE insertion genotypes to B cell gene expression levels among 445 individuals from 5 human populations. Numerous human polyTE loci correspond to both cis and trans eQTL, and their regulatory effects are directly related to cell type-specific function in the immune system. PolyTE loci are associated with differences in expression between European and African population groups, and a single polyTE loci is indirectly associated with the expression of numerous genes via the regulation of the B cell-specific transcription factor PAX5. The polyTE-gene expression associations we found indicate that human TE genetic variation can have important phenotypic consequences. Our results reveal that TE-eQTL are involved in population-specific gene regulation as well as transcriptional network modification. PMID:27998931

  20. Identification of novel Drosophila meiotic genes recovered in a P-element screen.

    PubMed Central

    Sekelsky, J J; McKim, K S; Messina, L; French, R L; Hurley, W D; Arbel, T; Chin, G M; Deneen, B; Force, S J; Hari, K L; Jang, J K; Laurençon, A C; Madden, L D; Matthies, H J; Milliken, D B; Page, S L; Ring, A D; Wayson, S M; Zimmerman, C C; Hawley, R S

    1999-01-01

    The segregation of homologous chromosomes from one another is the essence of meiosis. In many organisms, accurate segregation is ensured by the formation of chiasmata resulting from crossing over. Drosophila melanogaster females use this type of recombination-based system, but they also have mechanisms for segregating achiasmate chromosomes with high fidelity. We describe a P-element mutagenesis and screen in a sensitized genetic background to detect mutations that impair meiotic chromosome pairing, recombination, or segregation. Our screen identified two new recombination-deficient mutations: mei-P22, which fully eliminates meiotic recombination, and mei-P26, which decreases meiotic exchange by 70% in a polar fashion. We also recovered an unusual allele of the ncd gene, whose wild-type product is required for proper structure and function of the meiotic spindle. However, the screen yielded primarily mutants specifically defective in the segregation of achiasmate chromosomes. Although most of these are alleles of previously undescribed genes, five were in the known genes alphaTubulin67C, CycE, push, and Trl. The five mutations in known genes produce novel phenotypes for those genes. PMID:10353897

  1. Human population-specific gene expression and transcriptional network modification with polymorphic transposable elements.

    PubMed

    Wang, Lu; Rishishwar, Lavanya; Mariño-Ramírez, Leonardo; Jordan, I King

    2017-03-17

    Transposable element (TE) derived sequences are known to contribute to the regulation of the human genome. The majority of known TE-derived regulatory sequences correspond to relatively ancient insertions, which are fixed across human populations. The extent to which human genetic variation caused by recent TE activity leads to regulatory polymorphisms among populations has yet to be thoroughly explored. In this study, we searched for associations between polymorphic TE (polyTE) loci and human gene expression levels using an expression quantitative trait loci (eQTL) approach. We compared locus-specific polyTE insertion genotypes to B cell gene expression levels among 445 individuals from 5 human populations. Numerous human polyTE loci correspond to both cis and trans eQTL, and their regulatory effects are directly related to cell type-specific function in the immune system. PolyTE loci are associated with differences in expression between European and African population groups, and a single polyTE loci is indirectly associated with the expression of numerous genes via the regulation of the B cell-specific transcription factor PAX5. The polyTE-gene expression associations we found indicate that human TE genetic variation can have important phenotypic consequences. Our results reveal that TE-eQTL are involved in population-specific gene regulation as well as transcriptional network modification. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Mobile genetic elements of the human gastrointestinal tract: potential for spread of antibiotic resistance genes.

    PubMed

    Broaders, Eileen; Gahan, Cormac G M; Marchesi, Julian R

    2013-01-01

    The human intestine is an important location for horizontal gene transfer (HGT) due to the presence of a densely populated community of microorganisms which are essential to the health of the human superorganism. HGT in this niche has the potential to influence the evolution of members of this microbial community and to mediate the spread of antibiotic resistance genes from commensal organisms to potential pathogens. Recent culture-independent techniques and metagenomic studies have provided an insight into the distribution of mobile genetic elements (MGEs) and the extent of HGT in the human gastrointestinal tract. In this mini-review, we explore the current knowledge of mobile genetic elements in the gastrointestinal tract, the progress of research into the distribution of antibiotic resistance genes in the gut and the potential role of MGEs in the spread of antibiotic resistance. In the face of reduced treatment options for many clinical infections, understanding environmental and commensal antibiotic resistance and spread is critical to the future development of meaningful and long lasting anti-microbial therapies.

  3. E-cadherin intron 2 contains cis-regulatory elements essential for gene expression.

    PubMed

    Stemmler, Marc P; Hecht, Andreas; Kemler, Rolf

    2005-03-01

    Cadherin-mediated cell-cell adhesion plays important roles in mouse embryonic development, and changes in cadherin expression are often linked to morphogenetic events. For proper embryonic development and organ formation, the expression of E-cadherin must be tightly regulated. Dysregulated expression during tumorigenesis confers invasiveness and metastasis. Except for the E-box motifs in the E-cadherin promoter, little is known about the existence and location of cis-regulatory elements controlling E-cadherin gene expression. We have examined putative cis-regulatory elements in the E-cadherin gene and we show a pivotal role for intron 2 in activating transcription. Upon deleting the genomic intron 2 entirely, the E-cadherin locus becomes completely inactive in embryonic stem cells and during early embryonic development. Later in development, from E11.5 onwards, the locus is activated only weakly in the absence of intron 2 sequences. We demonstrate that in differentiated epithelia, intron 2 sequences are required both to initiate transcriptional activation and additionally to maintain E-cadherin expression. Detailed analysis also revealed that expression in the yolk sac is intron 2 independent, whereas expression in the lens and the salivary glands absolutely relies on cis-regulatory sequences of intron 2. Taken together, our findings reveal a complex mechanism of gene regulation, with a vital role for the large intron 2.

  4. Gene expression analysis of metallothionein and mineral elements uptake in tomato (Solanum lycopersicum) exposed to cadmium.

    PubMed

    Kısa, Dursun; Öztürk, Lokman; Tekin, Şaban

    2016-09-01

    Heavy metals such as Cd are considered to be the most important pollutants in soil contamination. Cd is a non-essential element adversely affecting plant growth and development, and it has caused some physiological and molecular changes. Metallothioneins (MTs) are low molecular weight, cysteine-rich, and metal binding proteins. In this study, we aimed to evaluate the MT gene expression levels and minerals uptake in the tissues of Solanum lycopersicum exposed to Cd. The transcriptional expression of the MT genes was determined by real-time quantitative PCR. The MT genes were regulated by the Cd and the mineral elements uptake changed tissue type and applied doses. The MT1 and MT2 transcript levels increased in the roots, the leaves and the fruits of the tomato. The MT3 and MT4 transcript pattern changed according to the tissue types. The Cd treatment on the growth medium increased the Mg, Ca, and Fe content in both the leaves and fruits of the tomato. However, the Cd affected the mineral levels in the roots depending on the mineral types and doses. Also, the Cd content increased in the roots, the leaves, and the fruits of the tomato, respectively. The results presented in this study show that Cd has synergistic and/or antagonistic effects on minerals depending on the tissue types. These results indicate that the MT1 and MT2 expression pattern increased together with the Mg, Ca, and Fe content in both the leaves and the fruits of the tomato.

  5. Cis-regulatory elements affecting the Nanos gene promoter in the germline stem cells.

    PubMed

    Ali, Ijaz; ur Rehman, Muti; Rashid, Farzana; Khan, Sanaullah; Iqbal, Aqib; Laixin, Xia; ud din Ahmed, Naeem; Swati, A Zahoor

    2010-02-15

    Drosophila Nanos gene plays an important role in stem cell maintenance and body patterning. With the purpose of understanding the cis-regulatory machinery involved in the transcription of the nanos gene in the germline stem cells, we examined its promoter fragment from +97 to -708 relative to the transcription start site and identified enhancer elements located between position -108 and +97. Experiments with transgenic flies revealed that the minimal promoter (from -108 to +20) is sufficient in the germline stem cells for the GFP expression in transgenic Drosophila. Moreover, the flag-tagged nanos protein blotting experiments revealed that a short promoter fragment plus some sequences of the nos 5'UTR spanning -108 to +97 could efficiently drive the expression of the flag-tagged [Nos-mRNA-nos3'UTR] transgene in transgenic flies indicating that the cis-regulatory elements located between positions -108 and +97 of the nanos promoter are sufficient to fully transcribe the nanos mRNA. Deletion of the identified cis-acting sequences from the promoter rendered it non-functional as it could no longer transcribe the nanos mRNA in transgenic flies thus revealing the importance of these sequences for the transcription of the nanos gene. Copyright 2009 Elsevier B.V. All rights reserved.

  6. Repetitive Element-Mediated Recombination as a Mechanism for New Gene Origination in Drosophila

    PubMed Central

    Li, Xin; Ding, Yun; Zhou, Qi; Chen, Ying; Zhang, Yue; Zhao, Ruoping; Brunet, Frédéric; Peng, Lixin; Long, Manyuan; Wang, Wen

    2008-01-01

    Previous studies of repetitive elements (REs) have implicated a mechanistic role in generating new chimerical genes. Such examples are consistent with the classic model for exon shuffling, which relies on non-homologous recombination. However, recent data for chromosomal aberrations in model organisms suggest that ectopic homology-dependent recombination may also be important. Lack of a dataset comprising experimentally verified young duplicates has hampered an effective examination of these models as well as an investigation of sequence features that mediate the rearrangements. Here we use ∼7,000 cDNA probes (∼112,000 primary images) to screen eight species within the Drosophila melanogaster subgroup and identify 17 duplicates that were generated through ectopic recombination within the last 12 mys. Most of these are functional and have evolved divergent expression patterns and novel chimeric structures. Examination of their flanking sequences revealed an excess of repetitive sequences, with the majority belonging to the transposable element DNAREP1 family, associated with the new genes. Our dataset strongly suggests an important role for REs in the generation of chimeric genes within these species. PMID:18208328

  7. Stress induced gene expression drives transient DNA methylation changes at adjacent repetitive elements

    PubMed Central

    Secco, David; Wang, Chuang; Shou, Huixia; Schultz, Matthew D; Chiarenza, Serge; Nussaume, Laurent; Ecker, Joseph R; Whelan, James; Lister, Ryan

    2015-01-01

    Cytosine DNA methylation (mC) is a genome modification that can regulate the expression of coding and non-coding genetic elements. However, little is known about the involvement of mC in response to environmental cues. Using whole genome bisulfite sequencing to assess the spatio-temporal dynamics of mC in rice grown under phosphate starvation and recovery conditions, we identified widespread phosphate starvation-induced changes in mC, preferentially localized in transposable elements (TEs) close to highly induced genes. These changes in mC occurred after changes in nearby gene transcription, were mostly DCL3a-independent, and could partially be propagated through mitosis, however no evidence of meiotic transmission was observed. Similar analyses performed in Arabidopsis revealed a very limited effect of phosphate starvation on mC, suggesting a species-specific mechanism. Overall, this suggests that TEs in proximity to environmentally induced genes are silenced via hypermethylation, and establishes the temporal hierarchy of transcriptional and epigenomic changes in response to stress. DOI: http://dx.doi.org/10.7554/eLife.09343.001 PMID:26196146

  8. Differential interactions of promoter elements in stress responses of the Arabidopsis Adh gene.

    PubMed Central

    Dolferus, R; Jacobs, M; Peacock, W J; Dennis, E S

    1994-01-01

    The Adh (alcohol dehydrogenase, EC 1.1.1.1.) gene from Arabidopsis thaliana (L.) Heynh. can be induced by dehydration and cold, as well as by hypoxia. A 1-kb promoter fragment (CADH: -964 to +53) is sufficient to confer the stress induction and tissue-specific developmental expression characteristics of the Adh gene to a beta-glucuronidase reporter gene. Deletion mapping of the 5' end and site-specific mutagenesis identified four regions of the promoter essential for expression under the three stress conditions. Some sequence elements are important for response to all three stress treatments, whereas others are stress specific. The most critical region essential for expression of the Arabidopsis Adh promoter under all three environmental stresses (region IV: -172 to -141) contains sequences homologous to the GT motif (-160 to -152) and the GC motif (-147 to -144) of the maize Adh1 anaerobic responsive element. Region III (-235 to -172) contains two regions shown by R.J. Ferl and B.H. Laughner ([1989] Plant Mol Biol 12: 357-366) to bind regulatory proteins; mutation of the G-box-1 region (5'-CCACGTGG-3', -216 to -209) does not affect expression under uninduced or hypoxic conditions, but significantly reduces induction by cold stress and, to a lesser extent, by dehydration stress. Mutation of the other G-box-like sequence (G-box-2: 5'-CCAAGTGG-3', -193 to -182) does not change hypoxic response and affects cold and dehydration stress only slightly. G-box-2 mutations also promote high levels of expression under uninduced conditions. Deletion of region I (-964 to -510) results in increased expression under uninduced and all stress conditions, suggesting that this region contains a repressor binding site. Region II (-510 to -384) contains a positive regulatory element and is necessary for high expression levels under all treatments. PMID:7972489

  9. The DAWGPAWS pipeline for the annotation of genes and transposable elements in plant genomes

    PubMed Central

    Estill, James C; Bennetzen, Jeffrey L

    2009-01-01

    Background High quality annotation of the genes and transposable elements in complex genomes requires a human-curated integration of multiple sources of computational evidence. These evidences include results from a diversity of ab initio prediction programs as well as homology-based searches. Most of these programs operate on a single contiguous sequence at a time, and the results are generated in a diverse array of readable formats that must be translated to a standardized file format. These translated results must then be concatenated into a single source, and then presented in an integrated form for human curation. Results We have designed, implemented, and assessed a Perl-based workflow named DAWGPAWS for the generation of computational results for human curation of the genes and transposable elements in plant genomes. The use of DAWGPAWS was found to accelerate annotation of 80–200 kb wheat DNA inserts in bacterial artificial chromosome (BAC) vectors by approximately twenty-fold and to also significantly improve the quality of the annotation in terms of completeness and accuracy. Conclusion The DAWGPAWS genome annotation pipeline fills an important need in the annotation of plant genomes by generating computational evidences in a high throughput manner, translating these results to a common file format, and facilitating the human curation of these computational results. We have verified the value of DAWGPAWS by using this pipeline to annotate the genes and transposable elements in 220 BAC insertions from the hexaploid wheat genome (Triticum aestivum L.). DAWGPAWS can be applied to annotation efforts in other plant genomes with minor modifications of program-specific configuration files, and the modular design of the workflow facilitates integration into existing pipelines. PMID:19545381

  10. Sex Steroids Regulate Expression of Genes Containing Long Interspersed Elements-1s in Breast Cancer Cells.

    PubMed

    Chaiwongwatanakul, Saichon; Yanatatsaneejit, Pattamawadee; Tongsima, Sissades; Mutirangura, Apiwat; Boonyaratanakornkit, Viroj

    2016-01-01

    Long interspersed elements-1s (LINE-1s) are dispersed all over the human genome. There is evidence that hypomethylation of LINE-1s and levels of sex steroids regulate gene expression leading to cancer development. Here, we compared mRNA levels of genes containing an intragenic LINE-1 in breast cancer cells treated with various sex steroids from Gene Expression Omnibus (GEO), with the gene expression database using chi-square analysis (http://www.ncbi.nlm.nih.gov/geo). We evaluated whether sex steroids influence expression of genes containing an intragenic LINE-1. Three sex steroids at various concentrations, 1 and 10 nM estradiol (E2), 10 nM progesterone (PG) and 10 nM androgen (AN), were assessed. In breast cancer cells treated with 1 or 10 nM E2, a significant percentage of genes containing an intragenic LINE-1 were down-regulated. A highly significant percentage of E2-regulated genes containing an intragenic LINE-1 was down-regulated in cells treated with 1 nM E2 for 3 hours (<3.70E-25; OR=1.91; 95% CI=2.16-1.69). Similarly, high percentages of PG or AN- regulated genes containing an intragenic LINE-1 were also down-regulated in cells treated with 10 nM PG or 10 nM AN for 16 hr (p=9.53E-06; OR=1.65; 95% CI=2.06-1.32 and p=3.81E-14; OR=2.01; 95% CI=2.42-1.67). Interestingly, a significant percentage of AN-regulated genes containing an intragenic LINE-1 was up-regulated in cells treated with 10 nM AN for 16 hr (p=4.03E-02; OR=1.40; 95% CI=1.95-1.01). These findings suggest that intragenic LINE-1s may play roles in sex steroid mediated gene expression in breast cancer cells, which could have significant implications for the development and progression of sex steroid-dependent cancers.

  11. Identification of a minimal promoter element of the mouse epidermal growth factor gene.

    PubMed Central

    Pascall, J C; Brown, K D

    1997-01-01

    We have previously generated a transgenic mouse line (EGF/Tag) in which simian virus 40 (SV40) T-antigen expression is directed by the mouse epidermal growth factor (EGF) gene promoter. In these mice, cellular hyperproliferation is observed in the submaxillary gland associated with SV40 T-antigen expression. In addition, SV40 T-antigen-expressing tumours of prostatic origin are seen. We have now derived immortalized cell lines from these tissues and have used the cells to perform a functional analysis of the EGF gene promoter. Cells were transfected with EGF promoter/reporter constructs, and an element located between 51 and 35 bases upstream of the EGF mRNA start site required for basal activity of the promoter was identified. Electrophoretic mobility-shift analysis suggests that three proteins bind to this region, one of which is either Sp1 or a closely related protein. PMID:9210411

  12. [Role of genes and their cis-regulatory elements during animal morphological evolution].

    PubMed

    Sun, Boyuan; Tu, Jianbo; Li, Ying; Yang, Mingyao

    2014-06-01

    Cis-regulatory hypothesis is one of the most important theories in evolutionary developmental biology (evo-devo), which claims that evolution of cis-regulatory elements (CREs) plays a key role during evolution of morphology. However, an increasing number of experimental results show that cis-regulatory hypothesis alone is not far enough to explain the complexity of evo-devo processes. Other modifications, including mutations of protein coding, gene and genome duplications, and flexibility of homeodomains and CREs, also cause the morphological changes in animals. In this review, we retrospect the recent results of evolution of CREs and genes associated with CREs and discuss new methods and trends for research in evo-devo.

  13. Role of non-coding RNA transcription around gene regulatory elements in transcription factor recruitment

    PubMed Central

    Ohta, Kunihiro

    2017-01-01

    ABSTRACT Eukaryotic cells produce a variety of non-coding RNAs (ncRNAs), many of which have been shown to play pivotal roles in biological processes such as differentiation, maintenance of pluripotency of stem cells, and cellular response to various stresses. Genome-wide analyses have revealed that many ncRNAs are transcribed around regulatory DNA elements located proximal or distal to gene promoters, but their biological functions are largely unknown. Recently, it has been demonstrated in yeast and mouse that ncRNA transcription around gene promoters and enhancers facilitates DNA binding of transcription factors to their target sites. These results suggest universal roles of promoter/enhancer-associated ncRNAs in the recruitment of transcription factors to their binding sites. PMID:27763805

  14. Transposon tagging of the sulfur gene of tobacco using engineered maize Ac/Ds elements.

    PubMed Central

    Fitzmaurice, W P; Nguyen, L V; Wernsman, E A; Thompson, W F; Conkling, M A

    1999-01-01

    The Sulfur gene of tobacco is nuclearly encoded. A Su allele at this locus acts as a dominant semilethal mutation and causes reduced accumulation of chlorophyll, resulting in a yellow color in the plant. An engineered transposon tagging system, based upon the maize element Ac/Ds, was used to mutate the gene. High frequency of transposon excision from the Su locus produced variegated sectors. Plants regenerated from the variegated sector exhibited a similar variegated phenotype. Genetic analyses showed that the variegation was always associated with the transposase construct and the transposon was linked to the Su locus. Sequences surrounding the transposon were isolated, and five revertant sectors possessed typical direct repeats following Ds excisions. These genetic and molecular data are consistent with the tagging of the Su allele by the transposon. PMID:10581296

  15. Gene-specific factors determine mitotic expression and bookmarking via alternate regulatory elements

    PubMed Central

    Arampatzi, Panagiota; Gialitakis, Manolis; Makatounakis, Takis; Papamatheakis, Joseph

    2013-01-01

    Transcriptional silencing during mitosis is caused by inactivation of critical transcriptional regulators and/or chromatin condensation. Inheritance of gene expression patterns through cell division involves various bookmarking mechanisms. In this report, we have examined the mitotic and post-mitotic expression of the DRA major histocompatibility class II (MHCII) gene in different cell types. During mitosis the constitutively MHCII-expressing B lymphoblastoid cells showed sustained occupancy of the proximal promoter by the cognate enhanceosome and general transcription factors. In contrast, although mitotic epithelial cells were depleted of these proteins irrespectively of their MHCII transcriptional activity, a distal enhancer selectively recruited the PP2A phosphatase via NFY and maintained chromatin accessibility. Based on our data, we propose a novel chromatin anti-condensation role for this element in mitotic bookmarking and timing of post-mitotic transcriptional reactivation. PMID:23303784

  16. Regional Dissemination of a Trimethoprim-Resistance Gene Cassette via a Successful Transposable Element

    PubMed Central

    Opintan, Japheth A.; Bishar, Rima A.; Aboderin, A. Oladipo; Newman, Mercy J.; Lamikanra, Adebayo; Okeke, Iruka N.

    2012-01-01

    Background Antimicrobial resistance is a growing international problem. We observed a 50% increase in the prevalence of trimethoprim resistance among fecal Escherichia coli from healthy Nigerian students between 1998 and 2005, a trend to increase that continued in 2009. Methods and Findings A PCR-based screen revealed that 131 (43.1%) of isolates obtained in Nigeria in 2005 and 2009 carried integron-borne dfrA cassettes. In the case of 67 (51.1%) of these isolates, the cassette was a class 1-integron-borne dfrA7 gene, which has been reported at high prevalence from E. coli isolates from other parts of Africa. Complete sequencing of a 27 Kb dfrA7-bearing plasmid from one isolate located the dfrA7 gene within a Tn21-type transposon. The transposon also contained an IS26-derived bla/sul/str element, encoding resistance to β-lactams, sulphonamides and streptomycin, and mercury resistance genes. Although the plasmid backbone was only found in 12 (5.8%) of trimethoprim-resistant isolates, dfrA7 and other transposon-borne genes were detected in 14 (16.3%) and 32 (26.3%) of trimethoprim resistant isolates collected in Nigeria in 2005 and 2009, respectively. Additionally, 37 (19.3%) of trimethoprim-resistant E. coli isolates collected between 2006 and 2008 from Ghana were positive for the dfrA7 and a transposon marker, but only 4 (2.1%) harbored the plasmid backbone. Conclusions Our data point to transposition as a principal mechanism for disseminating dfrA7 among E. coli from Nigeria and Ghana. On-going intensive use of the affordable broad-spectrum antibacterials is likely to promote selective success of a highly prevalent transposable element in West Africa. PMID:22666464

  17. Epigenomic Elements Analyses for Promoters Identify ESRRG as a New Susceptibility Gene for Obesity-related Traits

    PubMed Central

    Dong, Shan-Shan; Guo, Yan; Zhu, Dong-Li; Chen, Xiao-Feng; Wu, Xiao-Ming; Shen, Hui; Chen, Xiang-Ding; Tan, Li-Jun; Tian, Qing; Deng, Hong-Wen; Yang, Tie-Lin

    2016-01-01

    OBJECTIVES With ENCODE epigenomic data and results from published genome-wide association studies (GWASs), we aimed to find regulatory signatures of obesity genes and discover novel susceptibility genes. METHODS Obesity genes were obtained from public GWASs databases and their promoters were annotated based on the regulatory elements information. Significantly enriched or depleted epigenomic elements in the promoters of obesity genes were evaluated and all human genes were then prioritized according to the existence of the selected elements to predict new candidate genes. Top ranked genes were subsequently applied to validate their associations with obesity-related traits in three independent in-house GWASs samples. RESULTS We identified RAD21 and EZH2 as over-represented, STAT2 and IRF3 as depleted transcription factors. Histone modification of H3K9me3 and chromatin state segmentation of “poised promoter” and “repressed” were overrepresented. All genes were prioritized and we selected the top five genes for validation at population level. Combined results from the three GWASs samples, rs7522101 in ESRRG remained significantly associated with BMI after multiple testing corrections (P = 7.25 × 10−5). It was also associated with β-cell function (P = 1.99 × 10−3) and fasting glucose level (P < 0.05) in the meta-analyses of glucose and insulin-related traits consortium (MAGIC) dataset. CONCLUSIONS In summary, we identified epigenomic characteristics for obesity genes and suggested ESRRG as a novel obesity susceptibility gene. PMID:27113491

  18. SHOX gene and conserved noncoding element deletions/duplications in Colombian patients with idiopathic short stature

    PubMed Central

    Sandoval, Gloria Tatiana Vinasco; Jaimes, Giovanna Carola; Barrios, Mauricio Coll; Cespedes, Camila; Velasco, Harvy Mauricio

    2014-01-01

    SHOX gene mutations or haploinsufficiency cause a wide range of phenotypes such as Leri Weill dyschondrosteosis (LWD), Turner syndrome, and disproportionate short stature (DSS). However, this gene has also been found to be mutated in cases of idiopathic short stature (ISS) with a 3–15% frequency. In this study, the multiplex ligation-dependent probe amplification (MLPA) technique was employed to determine the frequency of SHOX gene mutations and their conserved noncoding elements (CNE) in Colombian patients with ISS. Patients were referred from different centers around the county. From a sample of 62 patients, 8.1% deletions and insertions in the intragenic regions and in the CNE were found. This result is similar to others published in other countries. Moreover, an isolated case of CNE 9 duplication and a new intron 6b deletion in another patient, associated with ISS, are described. This is one of the first studies of a Latin American population in which deletions/duplications of the SHOX gene and its CNE are examined in patients with ISS. PMID:24689071

  19. Genetic Analysis of Transvection Effects Involving Cis-Regulatory Elements of the Drosophila Ultrabithorax Gene

    PubMed Central

    Micol, J. L.; Castelli-Gair, J. E.; Garcia-Bellido, A.

    1990-01-01

    The Ultrabithorax (Ubx) gene of Drosophila melanogaster contains two functionally distinguishable regions: the protein-coding Ubx transcription unit and, upstream of it, the transcribed but non-protein-coding bxd region. Numerous recessive, partial loss-of-function mutations which appear to be regulatory mutations map within the bxd region and within the introns of the Ubx transcription unit. In addition, mutations within the Ubx unit exons are known and most of these behave as null alleles. Ubx(1) is one such allele. We have confirmed that, although the Ubx(1) allele does not produce detectable Ubx proteins (UBX), it does retain other genetic functions detectable by their effects on the expression of a paired, homologous Ubx allele, i.e., by transvection. We have extended previous analyses made by E. B. Lewis by mapping the critical elements of the Ubx gene which participate in transvection effects. Our results show that the Ubx(1) allele retains wild-type functions whose effectiveness can be reduced (1) by additional cis mutations in the bxd region or in introns of the Ubx transcription unit, as well as (2) by rearrangements disturbing pairing between homologous Ubx genes. Our results suggest that those remnant functions in Ubx(1) are able to modulate the activity of the allele located in the homologous chromosome. We discuss the normal cis regulatory role of these functions involved in trans interactions between homologous Ubx genes, as well as the implications of our results for the current models on transvection. PMID:2123161

  20. Silencing near tRNA genes is nucleosome-mediated and distinct from boundary element function

    PubMed Central

    Good, Paul D.; Kendall, Ann; Ignatz-Hoover, James; Miller, Erin L.; Pai, Dave A.; Rivera, Sara R.; Carrick, Brian; Engelke, David R.

    2013-01-01

    Transfer RNA (tRNA) genes and other RNA polymerase III transcription units are dispersed in high copy throughout nuclear genomes, and can antagonize RNA polymerase II transcription in their immediate chromosomal locus. Previous work in Saccharomyces cerevisiae found that this local silencing required subnuclear clustering of the tRNA genes near the nucleolus. Here we show that the silencing also requires nucleosome participation, though the nature of the nucleosome interaction appears distinct from other forms of transcriptional silencing. Analysis of an extensive library of histone amino acid substitutions finds a large number of residues that affect the silencing, both in the histone N-terminal tails and on the nucleosome disk surface. The residues on the disk surfaces involved are largely distinct from those affecting other regulatory phenomena. Consistent with the large number of histone residues affecting tgm silencing, survey of chromatin modification mutations shows that several enzymes known to affect nucleosome modification and positioning are also required. The enzymes include an Rpd3 deacetylase complex, Hos1 deacetylase, Glc7 phosphatase, and the RSC nucleosome remodeling activity, but not multiple other activities required for other silencing forms or boundary element function at tRNA gene loci. Models for communication between the tRNA gene transcription complexes and local chromatin are discussed. PMID:23707796

  1. Silencing near tRNA genes is nucleosome-mediated and distinct from boundary element function.

    PubMed

    Good, Paul D; Kendall, Ann; Ignatz-Hoover, James; Miller, Erin L; Pai, Dave A; Rivera, Sara R; Carrick, Brian; Engelke, David R

    2013-08-15

    Transfer RNA (tRNA) genes and other RNA polymerase III transcription units are dispersed in high copy throughout nuclear genomes, and can antagonize RNA polymerase II transcription in their immediate chromosomal locus. Previous work in Saccharomyces cerevisiae found that this local silencing required subnuclear clustering of the tRNA genes near the nucleolus. Here we show that the silencing also requires nucleosome participation, though the nature of the nucleosome interaction appears distinct from other forms of transcriptional silencing. Analysis of an extensive library of histone amino acid substitutions finds a large number of residues that affect the silencing, both in the histone N-terminal tails and on the nucleosome disk surface. The residues on the disk surfaces involved are largely distinct from those affecting other regulatory phenomena. Consistent with the large number of histone residues affecting tgm silencing, survey of chromatin modification mutations shows that several enzymes known to affect nucleosome modification and positioning are also required. The enzymes include an Rpd3 deacetylase complex, Hos1 deacetylase, Glc7 phosphatase, and the RSC nucleosome remodeling activity, but not multiple other activities required for other silencing forms or boundary element function at tRNA gene loci. Models for communication between the tRNA gene transcription complexes and local chromatin are discussed. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. E1A-responsive elements for repression of rat fibronectin gene transcription.

    PubMed Central

    Nakajima, T; Nakamura, T; Tsunoda, S; Nakada, S; Oda, K

    1992-01-01

    The level of fibronectin (FN) gene transcription in resting rat 3Y1 cells is very high but decreases steeply after growth stimulation by serum or by the induction of E1A expression. To study the mechanism of this E1A-mediated down-regulation, the 5' flanking regions of the FN gene with various deletions and substitutions were fused to the Escherichia coli chloramphenicol acetyltransferase (CAT) gene and introduced into resting 3Y1 cells with E1A expression plasmids. The results indicate that the G10 stretch located from nucleotide position -239 to -230 and two GC boxes from position -105 to -95 and position -54 to -44 are the primary E1A-responsive elements for repression of the FN gene. Two GC boxes also contain a G10 stretch that is interrupted by the presence of an internal C residue. These sequences overlap with the Sp1 motif GGGCGG. Substitution of the sequence GGGG with ATCC or CTTA in these G-rich sequences, leaving the Sp1 motif intact, completely abolished the E1A sensitivity of the promoter. Analysis of the E1A domains by using various E1A deletion mutants indicated that the domain for binding to the retinoblastoma susceptibility gene product (RB) is essential for efficient repression. These results suggest that the gene encoding a negative factor(s) binding to the three G-rich sequences in the FN promoter is repressed by RB in resting 3Y1 cells and derepressed by expression of E1A. PMID:1534144

  3. Ribosomal RNA genes of Trypanosoma brucei. Cloning of a rRNA gene containing a mobile element.

    PubMed Central

    Hasan, G; Turner, M J; Cordingley, J S

    1982-01-01

    An ordered restriction map of the ribosomal RNA genes of Trypanosoma brucei brucei is presented. Bgl II fragments of T.b.brucei genomic DNA were cloned into pAT 153, and the clones containing rDNA identified. Restriction maps were established and the sense strands identified. One clone was shown by heteroduplex mapping to contain a 1.1 kb inserted sequence which was demonstrated to be widely distributed throughout the genomes of members of the subgenus Trypanozoon. However, in two other subgenera of Trypanosoma, Nannomonas and Schizotrypanum, the sequence is far less abundant. Analysis of the genomic DNA from two serodemes of T.b.brucei showed that the sequence was present in the rRNA of only one of them, implying that the sequence is a mobile element and that its appearance in rDNA is a comparitively recent occurrence. Images PMID:6294613

  4. Variation in sequence and organization of splicing regulatory elements in vertebrate genes

    PubMed Central

    Yeo, Gene; Hoon, Shawn; Venkatesh, Byrappa; Burge, Christopher B.

    2004-01-01

    Although core mechanisms and machinery of premRNA splicing are conserved from yeast to human, the details of intron recognition often differ, even between closely related organisms. For example, genes from the pufferfish Fugu rubripes generally contain one or more introns that are not properly spliced in mouse cells. Exploiting available genome sequence data, a battery of sequence analysis techniques was used to reach several conclusions about the organization and evolution of splicing regulatory elements in vertebrate genes. The classical splice site and putative branch site signals are completely conserved across the vertebrates studied (human, mouse, pufferfish, and zebrafish), and exonic splicing enhancers also appear broadly conserved in vertebrates. However, another class of splicing regulatory elements, the intronic splicing enhancers, appears to differ substantially between mammals and fish, with G triples (GGG) very abundant in mammalian introns but comparatively rare in fish. Conversely, short repeats of AC and GT are predicted to function as intronic splicing enhancers in fish but are not enriched in mammalian introns. Consistent with this pattern, exonic splicing enhancer-binding SR proteins are highly conserved across all vertebrates, whereas heterogeneous nuclear ribonucleoproteins, which bind many intronic sequences, vary in domain structure and even presence/absence between mammals and fish. Exploiting differences in intronic sequence composition, a statistical model was developed to predict the splicing phenotype of Fugu introns in mammalian systems and was used to engineer the spliceability of a Fugu intron in human cells by insertion of specific sequences, thereby rescuing splicing in human cells. PMID:15505203

  5. Chordate Hox and ParaHox gene clusters differ dramatically in their repetitive element content.

    PubMed

    Osborne, Peter W; Ferrier, David E K

    2010-02-01

    The ParaHox and Hox gene clusters control aspects of animal anterior-posterior development and are related as paralogous evolutionary sisters. Despite this relationship, it is not clear if the clusters operate in similar ways, with similar constraints. To compare clusters, we examined the transposable-element (TE) content of amphioxus and mammalian ParaHox and Hox clusters. Chordate Hox clusters are known to be largely devoid of TEs, possibly due to gene regulation and constraints on clustering in these animals. Here, we describe several novel amphioxus TEs and show that the amphioxus ParaHox cluster is a hotspot for TE insertion. TE contents of mammalian ParaHox loci are at background levels, in stark contrast to chordate Hox clusters. This marks a significant difference between Hox and ParaHox clusters. The presence of so many potentially disruptive elements implies selection constrains these ParaHox clusters as they have not dispersed despite 500 My of evolution for each lineage.

  6. Stem loop sequences specific to transposable element IS605 are found linked to lipoprotein genes in Borrelia plasmids.

    PubMed

    Delihas, Nicholas

    2009-11-20

    Plasmids of Borrelia species are dynamic structures that contain a large number of repetitive genes, gene fragments, and gene fusions. In addition, the transposable element IS605/200 family, as well as degenerate forms of this IS element, are prevalent. In Helicobacter pylori, flanking regions of the IS605 transposase gene contain sequences that fold into identical small stem loops. These function in transposition at the single-stranded DNA level. In work reported here, bioinformatics techniques were used to scan Borrelia plasmid genomes for IS605 transposable element specific stem loop sequences. Two variant stem loop motifs are found in the left and right flanking regions of the transposase gene. Both motifs appear to have dispersed in plasmid genomes and are found "free-standing" and phylogenetically conserved without the associated IS605 transposase gene or the adjacent flanking sequence. Importantly, IS605 specific stem loop sequences are also found at the 3' ends of lipoprotein genes (PFam12 and PFam60), however the left and right sequences appear to develop their own evolutionary patterns. The lipoprotein gene-linked left stem loop sequences maintain the IS605 stem loop motif in orthologs but only at the RNA level. These show mutations whereby variants fold into phylogenetically conserved RNA-type stem loops that contain the wobble non-Watson-Crick G-U base-pairing. The right flanking sequence is associated with the family lipoprotein-1 genes. A comparison of homologs shows that the IS605 stem loop motif rapidly dissipates, but a more elaborate secondary structure appears to develop in its place. Stem loop sequences specific to the transposable element IS605 are present in plasmid regions devoid of a transposase gene and significantly, are found linked to lipoprotein genes in Borrelia plasmids. These sequences are evolutionarily conserved and/or structurally developed in an RNA format. The findings show that IS605 stem loop sequences are multifaceted and are

  7. Enrichment of short interspersed transposable elements to embryonic stem cell-specific hypomethylated gene regions.

    PubMed

    Muramoto, Hiroki; Yagi, Shintaro; Hirabayashi, Keiji; Sato, Shinya; Ohgane, Jun; Tanaka, Satoshi; Shiota, Kunio

    2010-08-01

    Embryonic stem cells (ESCs) have a distinctive epigenome, which includes their genome-wide DNA methylation modification status, as represented by the ESC-specific hypomethylation of tissue-dependent and differentially methylated regions (T-DMRs) of Pou5f1 and Nanog. Here, we conducted a genome-wide investigation of sequence characteristics associated with T-DMRs that were differentially methylated between ESCs and somatic cells, by focusing on transposable elements including short interspersed elements (SINEs), long interspersed elements (LINEs) and long terminal repeats (LTRs). We found that hypomethylated T-DMRs were predominantly present in SINE-rich/LINE-poor genomic loci. The enrichment for SINEs spread over 300 kb in cis and there existed SINE-rich genomic domains spreading continuously over 1 Mb, which contained multiple hypomethylated T-DMRs. The characterization of sequence information showed that the enriched SINEs were relatively CpG rich and belonged to specific subfamilies. A subset of the enriched SINEs were hypomethylated T-DMRs in ESCs at Dppa3 gene locus, although SINEs are overall methylated in both ESCs and the liver. In conclusion, we propose that SINE enrichment is the genomic property of regions harboring hypomethylated T-DMRs in ESCs, which is a novel aspect of the ESC-specific epigenomic information.

  8. Characterization of hsp70 gene promoter for cis- acting elements in Indian zebu cattle of Hariana breed.

    PubMed

    Behl, Rahul; Behl, Jyotsna; Sadana, D K; Vijh, R K; Tantia, M S; Joshi, B K

    2014-01-01

    The promoter region of hsp70 gene was characterized for cis-acting elements in zebu cattle of Hariana breed. The basal regulatory domain of CAAT box identified as CAAT/enhancer binding protein (C/EBP) and CAAT binding transcription factor (CTF) binding sites, as well as GC box identified as sp1 binding site, were localized in at least two regions in the hsp70 gene promoter. A highly conserved heat shock element was found between position -108 to -95, which exactly matched at all eight positions with the consensus sequence. These cis-acting elements were found to be conserved between Holstein-Friesian and studied zebu breed.

  9. Whorl-specific expression of the SUPERMAN gene of Arabidopsis is mediated by cis elements in the transcribed region.

    PubMed

    Ito, Toshiro; Sakai, Hajime; Meyerowitz, Elliot M

    2003-09-02

    The SUPERMAN (SUP) gene of Arabidopsis is involved in controlling cell proliferation in stamen and carpel primordia and in ovules during flower development. The SUP gene encodes a transcription factor with a C2H2-type zinc finger motif, a serine/proline-rich domain, a basic domain, and a leucine-zipper-like domain and is expressed in a very limited region in stamen primordia and in the developing ovary during flower development. The SUP gene is susceptible to methylation, resulting in epigenetic gene silencing. To understand how the SUP gene is expressed spatially and temporally in its restricted domain, and why methylation of the transcribed region affects early-stage SUP expression, we have identified the SUP cis regulatory elements by characterizing SUP gene fusions. These studies show that the SUP gene has discrete upstream promoter elements required for expression in stamen primordia in early stages and in the ovary in later stages. The promoter activity for stamen primordia is modulated by several positive and negative elements located in the transcribed and translated regions. Several regulatory elements in the transcribed region correlate with the areas of the gene that are heavily methylated in epigenetic alleles; these data provide a possible explanation of how methylation of the transcribed region represses transcription.

  10. Resistance Genes and Genetic Elements Associated with Antibiotic Resistance in Clinical and Commensal Isolates of Streptococcus salivarius

    PubMed Central

    Chaffanel, Fanny; Charron-Bourgoin, Florence; Libante, Virginie; Leblond-Bourget, Nathalie

    2015-01-01

    The diversity of clinical (n = 92) and oral and digestive commensal (n = 120) isolates of Streptococcus salivarius was analyzed by multilocus sequence typing (MLST). No clustering of clinical or commensal strains can be observed in the phylogenetic tree. Selected strains (92 clinical and 46 commensal strains) were then examined for their susceptibilities to tetracyclines, macrolides, lincosamides, aminoglycosides, and phenicol antibiotics. The presence of resistance genes tet(M), tet(O), erm(A), erm(B), mef(A/E), and catQ and associated genetic elements was investigated by PCR, as was the genetic linkage of resistance genes. High rates of erythromycin and tetracycline resistance were observed among the strains. Clinical strains displayed either the erm(B) (macrolide-lincosamide-streptogramin B [MLSB] phenotype) or mef(A/E) (M phenotype) resistance determinant, whereas almost all the commensal strains harbored the mef(A/E) resistance gene, carried by a macrolide efflux genetic assembly (MEGA) element. A genetic linkage between a macrolide resistance gene and genes of Tn916 was detected in 23 clinical strains and 5 commensal strains, with a predominance of Tn3872 elements (n = 13), followed by Tn6002 (n = 11) and Tn2009 (n = 4) elements. Four strains harboring a mef(A/E) gene were also resistant to chloramphenicol and carried a catQ gene. Sequencing of the genome of one of these strains revealed that these genes colocalized on an IQ-like element, as already described for other viridans group streptococci. ICESt3-related elements were also detected in half of the isolates. This work highlights the potential role of S. salivarius in the spread of antibiotic resistance genes both in the oral sphere and in the gut. PMID:25862227

  11. Resistance Genes and Genetic Elements Associated with Antibiotic Resistance in Clinical and Commensal Isolates of Streptococcus salivarius.

    PubMed

    Chaffanel, Fanny; Charron-Bourgoin, Florence; Libante, Virginie; Leblond-Bourget, Nathalie; Payot, Sophie

    2015-06-15

    The diversity of clinical (n = 92) and oral and digestive commensal (n = 120) isolates of Streptococcus salivarius was analyzed by multilocus sequence typing (MLST). No clustering of clinical or commensal strains can be observed in the phylogenetic tree. Selected strains (92 clinical and 46 commensal strains) were then examined for their susceptibilities to tetracyclines, macrolides, lincosamides, aminoglycosides, and phenicol antibiotics. The presence of resistance genes tet(M), tet(O), erm(A), erm(B), mef(A/E), and catQ and associated genetic elements was investigated by PCR, as was the genetic linkage of resistance genes. High rates of erythromycin and tetracycline resistance were observed among the strains. Clinical strains displayed either the erm(B) (macrolide-lincosamide-streptogramin B [MLSB] phenotype) or mef(A/E) (M phenotype) resistance determinant, whereas almost all the commensal strains harbored the mef(A/E) resistance gene, carried by a macrolide efflux genetic assembly (MEGA) element. A genetic linkage between a macrolide resistance gene and genes of Tn916 was detected in 23 clinical strains and 5 commensal strains, with a predominance of Tn3872 elements (n = 13), followed by Tn6002 (n = 11) and Tn2009 (n = 4) elements. Four strains harboring a mef(A/E) gene were also resistant to chloramphenicol and carried a catQ gene. Sequencing of the genome of one of these strains revealed that these genes colocalized on an IQ-like element, as already described for other viridans group streptococci. ICESt3-related elements were also detected in half of the isolates. This work highlights the potential role of S. salivarius in the spread of antibiotic resistance genes both in the oral sphere and in the gut. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  12. Distribution patterns and impact of transposable elements in genes of green algae.

    PubMed

    Philippsen, Gisele S; Avaca-Crusca, Juliana S; Araujo, Ana P U; DeMarco, Ricardo

    2016-12-05

    Transposable elements (TEs) are DNA sequences able to transpose in the host genome, a remarkable feature that enables them to influence evolutive trajectories of species. An investigation about the TE distribution and TE impact in different gene regions of the green algae species Chlamydomonas reinhardtii and Volvox carteri was performed. Our results indicate that TEs are very scarce near introns boundaries, suggesting that insertions in this region are negatively selected. This contrasts with previous results showing enrichment of tandem repeats in introns boundaries and suggests that different evolutionary forces are acting in these different classes of repeats. Despite the relatively low abundance of TEs in the genome of green algae when compared to mammals, the proportion of poly(A) sites derived from TEs found in C. reinhardtii was similar to that described in human and mice. This fact, associated with the enrichment of TEs in gene 5' and 3' flanks of C. reinhardtii, opens up the possibility that TEs may have considerably contributed for gene regulatory sequences evolution in this species. Moreover, it was possible identify several instances of TE exonization for C. reinhardtii, with a particularly interesting case from a gene coding for Condensin II, a protein involved in the maintenance of chromosomal structure, where the addition of a transposomal PHD finger may contribute to binding specificity of this protein. Taken together, our results suggest that the low abundance of TEs in green algae genomes is correlated with a strict negative selection process, combined with the retention of copies that contribute positively with gene structures. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Prolactin regulatory element-binding protein is involved in suppression of the adiponectin gene in vivo.

    PubMed

    Zhang, X Z; Imachi, H; Lyu, J Y; Fukunaga, K; Sato, S; Ibata, T; Kobayashi, T; Yoshimoto, T; Kikuchi, F; Dong, T; Murao, K

    2017-04-01

    Prolactin regulatory element-binding protein (PREB), a member of the WD-repeat protein family, has been recognized as a transcriptional factor that regulates prolactin promoter activity in the anterior pituitary of rats. PREB is expressed not only in the pituitary but also in various other tissues, including the adipose tissue. Previous studies have shown that PREB acts as a transcriptional regulator and suppresses the expression of the adiponectin gene in cultured 3T3L1 preadipocytes. The aim of this study was to further examine the potential role of PREB in adipose tissue in vivo. Transgenic mice that overexpressing PREB (PREB transgenic mice) were generated. Insulin resistance was evaluated in PREB transgenic mice using glucose and insulin tolerance tests. Adiponectin expression in the adipose tissue was examined by western blot analysis and quantitative polymerase chain reaction (qPCR). The expression levels of stearoyl-CoA desaturase (Scd) and adiponectin receptor 2(ADIPOR2) were quantified by qPCR. Glucose and insulin tolerance tests revealed insulin resistance in PREB transgenic mice. Serum adiponectin and leptin concentrations were decreased. Adiponectin gene expression was decreased in the adipose tissue, which was confirmed by the downregulation of the adiponectin-dependent hepatic Scd gene and upregulation of the ADIPOR2 gene in the liver of PREB transgenic mice. We also found that pioglitazone, an agonist for the peroxisome proliferator-activated receptor-r, improved the insulin resistance in the PREB transgenic mice after a 10-day feeding period. These results demonstrated that PREB might contribute to the regulation of adiponectin gene expression in vivo.

  14. Solanum lycopersicum cv. Heinz 1706 chromosome 6: distribution and abundance of genes and retrotransposable elements.

    PubMed

    Peters, Sander A; Datema, Erwin; Szinay, Dóra; van Staveren, Marjo J; Schijlen, Elio G W M; van Haarst, Jan C; Hesselink, Thamara; Abma-Henkens, Marleen H C; Bai, Yuling; de Jong, Hans; Stiekema, Willem J; Klein Lankhorst, René M; van Ham, Roeland C H J

    2009-06-01

    We studied the physical and genetic organization of chromosome 6 of tomato (Solanum lycopersicum) cv. Heinz 1706 by combining bacterial artificial chromosome (BAC) sequence analysis, high-information-content fingerprinting, genetic analysis, and BAC-fluorescent in situ hybridization (FISH) mapping data. The chromosome positions of 81 anchored seed and extension BACs corresponded in most cases with the linear marker order on the high-density EXPEN 2000 linkage map. We assembled 25 BAC contigs and eight singleton BACs spanning 2.0 Mb of the short-arm euchromatin, 1.8 Mb of the pericentromeric heterochromatin and 6.9 Mb of the long-arm euchromatin. Sequence data were combined with their corresponding genetic and pachytene chromosome positions into an integrated map that covers approximately a third of the chromosome 6 euchromatin and a small part of the pericentromeric heterochromatin. We then compared physical length (Mb), genetic (cM) and chromosome distances (microm) for determining gap sizes between contigs, revealing relative hot and cold spots of recombination. Through sequence annotation we identified several clusters of functionally related genes and an uneven distribution of both gene and repeat sequences between heterochromatin and euchromatin domains. Although a greater number of the non-transposon genes were located in the euchromatin, the highly repetitive (22.4%) pericentromeric heterochromatin displayed an unexpectedly high gene content of one gene per 36.7 kb. Surprisingly, the short-arm euchromatin was relatively rich in repeats as well, with a repeat content of 13.4%, yet the ratio of Ty3/Gypsy and Ty1/Copia retrotransposable elements across the chromosome clearly distinguished euchromatin (2:3) from heterochromatin (3:2).

  15. Autotetraploid rice methylome analysis reveals methylation variation of transposable elements and their effects on gene expression.

    PubMed

    Zhang, Jie; Liu, Yuan; Xia, En-Hua; Yao, Qiu-Yang; Liu, Xiang-Dong; Gao, Li-Zhi

    2015-12-15

    Polyploidy, or whole-genome duplication (WGD), serves as a key innovation in plant evolution and is an important genomic feature for all eukaryotes. Neopolyploids have to overcome difficulties in meiosis, genomic alterations, changes of gene expression, and epigenomic reorganization. However, the underlying mechanisms for these processes are poorly understood. One of the most interesting aspects is that genome doubling events increase the dosage of all genes. Unlike allopolyploids entangled by both hybridization and polyploidization, autopolyploids, especially artificial lines, in relatively uniform genetic background offer a model system to understand mechanisms of genome-dosage effects. To investigate DNA methylation effects in response to WGD rather than hybridization, we produced autotetraploid rice with its diploid donor, Oryza sativa ssp. indica cv. Aijiaonante, both of which were independently self-pollinated over 48 generations, and generated and compared their comprehensive transcriptomes, base pair-resolution methylomes, and siRNAomes. DNA methylation variation of transposable elements (TEs) was observed as widespread in autotetraploid rice, in which hypermethylation of class II DNA transposons was predominantly noted in CHG and CHH contexts. This was accompanied by changes of 24-nt siRNA abundance, indicating the role of the RNA-directed DNA methylation pathway. Our results showed that the increased methylation state of class II TEs may suppress the expression of neighboring genes in autotetraploid rice that has obtained double alleles, leading to no significant differences in transcriptome alterations for most genes from its diploid donor. Collectively, our findings suggest that chromosome doubling induces methylation variation in TEs that affect gene expression and may become a "genome shock" response factor to help neoautopolyploids adapt to genome-dosage effects.

  16. Characterization of transcriptional activation and inserted-into-gene preference of various transposable elements in the Brassica species.

    PubMed

    Gao, Caihua; Xiao, Meili; Jiang, Lingyan; Li, Jiana; Yin, Jiaming; Ren, Xiaodong; Qian, Wei; Oscar, Ortegón; Fu, Donghui; Tang, Zhanglin

    2012-07-01

    Transposable elements (TEs) have attracted increasing attention because of their tremendous contributions to genome reorganization and gene variation through dramatic proliferation and excision via transposition. However, less known are the transcriptional activation of various TEs and the characteristics of TE insertion into genomes at the genome-wide level. In the present study, we focused on TE genes for transposition and gene disruption by insertion of TEs in expression sequences of Brassica, to investigate the transcriptional activation of TEs, the biased insertion of TEs into genes, and their salient characteristics. Long terminal repeat (LTR-retrotransposon) accounted for the majority of these active TE genes (70.8%), suggesting that transposition activation varied with TE type. 6.1% genes were interrupted by LTR-retrotransposons, which indicated their preference for insertion into genes. TEs were preferentially inserted into cellular component-specific genes acted as "binding" elements and involved in metabolic processes. TEs have a biased insertion into some host genes that were involved with important molecular functions and TE genes exhibited spatiotemporal expression. These results suggested that various types of transposons differentially contributed to gene variation and affected gene function.

  17. Identification of cis-acting regulatory elements in the promoter region of the rat brain creatine kinase gene.

    PubMed Central

    Hobson, G M; Molloy, G R; Benfield, P A

    1990-01-01

    The functional organization of the rat brain creatine kinase (ckb) promoter was analyzed by deletion, linker scanning, and substitution mutagenesis. Mutations were introduced into the ckb promoter of hybrid ckb/neo (neomycin resistance gene) genes, and the mutant genes were expressed transiently in HeLa cells. Expression was assayed by primer extension analysis of neo RNA, which allowed the transcription start sites and the amount of transcription to be determined. Transfections and primer extension reactions were internally controlled by simultaneous analysis of transcription from the adenovirus VA gene located on the same plasmid as the hybrid ckb/neo gene. We demonstrate that 195 bp of the ckb promoter is sufficient for efficient in vivo expression in HeLa cells. A nonconsensus TTAA element at -28 bp appears to provide the TATA box function for the ckb promoter in vivo. Two CCAAT elements, one at -84 bp and the other at -54 bp, and a TATAAA TA element (a consensus TATA box sequence) at -66 bp are required for efficient transcription from the TTAA element. In addition, we present evidence that the consensus beta-globin TATA box responds to the TATAAATA element in the same way as the ckb nonconsensus TTAA element. Images PMID:2247071

  18. Evolutionary conservation of an atypical glucocorticoid-responsive element in the human tyrosine hydroxylase gene.

    PubMed

    Sheela Rani, C S; Soto-Pina, Alexandra; Iacovitti, Lorraine; Strong, Randy

    2013-07-01

    The human tyrosine hydroxylase (hTH) gene has a 42 bp evolutionarily conserved region designated (CR) II at -7.24 kb, which bears 93% homology to the region we earlier identified as containing the glucocorticoid response element, a 7 bp activator protein-1 (AP-1)-like motif in the rat TH gene. We cloned this hTH-CRII region upstream of minimal basal hTH promoter in luciferase (Luc) reporter vector, and tested glucocorticoid responsiveness in human cell lines. Dexamethasone (Dex) stimulated Luc activity of hTH-CRII in HeLa cells, while mifepristone, a glucocorticoid receptor (GR) antagonist, prevented Dex stimulation. Deletion of the 7 bp 5'-TGACTAA at -7243 bp completely abolished the Dex-stimulated Luc activity of hTH-CRII construct. The AP-1 agonist, tetradeconoyl-12,13-phorbol acetate (TPA), also stimulated hTH promoter activity, and Dex and TPA together further accentuated this response. Chromatin immunoprecipitation assays revealed the presence of both GR and AP-1 proteins, especially Jun family members, at this hTH promoter site. Dex did not stimulate hTH promoter activity in a catecholaminergic cell line, which had low endogenous GR levels, but did activate the response when GR was expressed exogenously. Thus, our studies have clearly identified a glucocorticoid-responsive element in a 7 bp AP-1-like motif in the promoter region at -7.24 kb of the human TH gene.

  19. Effects of Transposable Elements on the Expression of the Forked Gene of Drosophila Melanogaster

    PubMed Central

    Hoover, K. K.; Chien, A. J.; Corces, V. G.

    1993-01-01

    The products of the forked gene are involved in the formation and/or maintenance of a temporary fibrillar structure within the developing bristle rudiment of Drosophila melanogaster. Mutations in the forked locus alter this structure and result in aberrant development of macrochaetae, microchaetae and trichomes. The locus has been characterized at the molecular level by walking, mutant characterization and transcript analysis. Expression of the six forked transcripts is temporally restricted to midlate pupal development. At this time, RNAs of 6.4, 5.6, 5.4, 2.5, 1.9 and 1.1 kilobases (kb) are detected by Northern analysis. The coding region of these RNAs has been found to be within a 21-kb stretch of genomic DNA. The amino terminus of the proteins encoded by the 5.4- and 5.6-kb forked transcripts contain tandem copies of ankyrin-like repeats that may play an important role in the function of forked-encoded products. The profile of forked RNA expression is altered in seven spontaneous mutations characterized during this study. Three forked mutations induced by the insertion of the gypsy retrotransposon contain a copy of this element inserted into an intron of the gene. In these mutants, the 5.6-, 5.4- and 2.5-kb forked mRNAs are truncated via recognition of the polyadenylation site in the 5' long terminal repeat of the gypsy retrotransposon. These results help explain the role of the forked gene in fly development and further our understanding of the role of transposable elements in mutagenesis. PMID:8244011

  20. Activating the expression of bacterial cryptic genes by rpoB mutations in RNA polymerase or by rare earth elements.

    PubMed

    Ochi, Kozo; Tanaka, Yukinori; Tojo, Shigeo

    2014-02-01

    Since bacteria were found to contain genes encoding enzymes that synthesize a plethora of potential secondary metabolites, interest has grown in the activation of these cryptic pathways. Homologous and heterologous expression of these cryptic secondary metabolite-biosynthetic genes, often "silent" under ordinary laboratory fermentation conditions, may lead to the discovery of novel secondary metabolites. We review current progress on this topic, describing concepts for activating silent genes. We especially focus on genetic manipulation of transcription and translation, as well as the utilization of rare earth elements as a novel method to activate the silent genes. The possible roles of silent genes in bacterial physiology are also discussed.

  1. Specific combinations of boundary element and Polycomb response element are required for the regulation of the Hox genes in Drosophila melanogaster.

    PubMed

    Singh, Narendra Pratap; Mishra, Rakesh Kumar

    2015-11-01

    In the bithorax complex of Drosophila melanogaster, the chromatin boundary elements (BE) demarcate cis-regulatory domains that regulate Hox genes along the anteroposterior body axis. These elements are closely associated with the Polycomb Response Elements (PREs) and restrict the ectopic activation of cis-regulatory domains during development. The relevance of such specific genomic arrangements of regulatory elements remains unclear. Deletions of individual BE-PRE combination result in distinct homeotic phenotypes. In this study, we show that deletion of two such BE-PRE combinations in cis leads to new genetic interactions, which manifests as dorsal closure defect phenotype in adult abdominal epithelia. We further demonstrate that dorsal closure phenotype results from enhanced and ectopic expression of Hox gene Abd-B in the larval epithelial cells. This suggests a specific role of multiple BE-PRE combinations in the larval epithelial cells for regulation of Abd-B. Using chromosome conformation capture experiments, we show that genetic interactions correlate with direct physical interactions among the BE-PRE combinations. Our results demonstrate the functional relevance of the closely associated BE and PRE combinations in regulation of Hox genes.

  2. Role of Estrogen Response Element in the Human Prolactin Gene: Transcriptional Response and Timing.

    PubMed

    McNamara, Anne V; Adamson, Antony D; Dunham, Lee S S; Semprini, Sabrina; Spiller, David G; McNeilly, Alan S; Mullins, John J; Davis, Julian R E; White, Michael R H

    2016-02-01

    The use of bacterial artificial chromosome (BAC) reporter constructs in molecular physiology enables the inclusion of large sections of flanking DNA, likely to contain regulatory elements and enhancers regions that contribute to the transcriptional output of a gene. Using BAC recombineering, we have manipulated a 160-kb human prolactin luciferase (hPRL-Luc) BAC construct and mutated the previously defined proximal estrogen response element (ERE) located -1189 bp relative to the transcription start site, to assess its involvement in the estrogen responsiveness of the entire hPRL locus. We found that GH3 cell lines stably expressing Luc under control of the ERE-mutated hPRL promoter (ERE-Mut) displayed a dramatically reduced transcriptional response to 17β-estradiol (E2) treatment compared with cells expressing Luc from the wild-type (WT) ERE hPRL-Luc promoter (ERE-WT). The -1189 ERE controls not only the response to E2 treatment but also the acute transcriptional response to TNFα, which was abolished in ERE-Mut cells. ERE-WT cells displayed a biphasic transcriptional response after TNFα treatment, the acute phase of which was blocked after treatment with the estrogen receptor antagonist 4-hydroxy-tamoxifen. Unexpectedly, we show the oscillatory characteristics of hPRL promoter activity in individual living cells were unaffected by disruption of this crucial response element, real-time bioluminescence imaging showed that transcription cycles were maintained, with similar cycle lengths, in ERE-WT and ERE-Mut cells. These data suggest the -1189 ERE is the dominant response element involved in the hPRL transcriptional response to both E2 and TNFα and, crucially, that cycles of hPRL promoter activity are independent of estrogen receptor binding.

  3. Promoter elements required for developmental expression of the maize Adh1 gene in transgenic rice.

    PubMed Central

    Kyozuka, J; Olive, M; Peacock, W J; Dennis, E S; Shimamoto, K

    1994-01-01

    To define the regions of the maize alcohol dehydrogenase 1 (Adh1) promoter that confer tissue-specific expression, a series of 5' promoter deletions and substitution mutations were linked to the Escherichia coli beta-glucuronidase A (uidA) reporter gene and introduced into rice plants. A region between -140 and -99 not only conferred anaerobically inducible expression in the roots of transgenic plants but was also required for expression in the root cap, embryo, and in endosperm under aerobic conditions. GC-rich (GC-1, GC-2, and GC-3) or GT-rich (GT-1 and GT-2) sequence motifs in this region were necessary for expression in these tissues, as they were in anaerobic expression. Expression in the root cap under aerobic conditions required all the GC- and GT-rich motifs. The GT-1, GC-1, GC-2, and GC-3 motifs, and to a lesser extent the GT-2 motif, were also required for anaerobic responsiveness in rice roots. All elements except the GC-3 motif were needed for endosperm-specific expression. The GC-2 motif and perhaps the GT-1 motif appeared to be the only elements required for high-level expression in the embryos of rice seeds. Promoter regions important for shoot-, embryo-, and pollen-specific expression were proximal to -99, and nucleotides required for shoot-specific expression occurred between positions -72 and -43. Pollen-specific expression required a sequence element outside the promoter region, between +54 and +106 of the untranslated leader, as well as a silencer element in the promoter between -72 and -43. PMID:8061518

  4. Trans-acting factors and properly positioned DNA elements repress mating-type genes in fission yeast.

    PubMed

    Ekwall, K; Olsson, T; Ruusala, T

    1992-04-01

    Repression of the mating-type P genes at the silent mat2-P locus in fission yeast is dependent on four cis-acting DNA elements, two on each side of the coding sequences. The mechanism by which these elements exert their influence on the mating-type promoter is studied here by insertion of a bacterial antibiotic resistance gene at several positions in the silent region. The behavior of the resistance gene itself, and the changes its insertion causes in mating-type expression, reveal that the repressive elements have a limited range of action and that the four elements have unequal effects on gene expression. Repression of the antibiotic resistance gene inside the silent region leads to an antibiotic-sensitive phenotype and facilitates the selection of resistant mutants. These mutants can de-repress the resistance gene at other positions than the one used for their selection. Strong antibiotic resistance correlates with derepression of the plasmid-borne mating-type cassette. These data argue that mat2-P repression is dependent on trans-acting factors and the positioning of the repressive DNA elements, but less dependent on the nature of the affected promoter.

  5. Activation of antioxidant response element (ARE)-dependent genes by roasted coffee extracts.

    PubMed

    Yazheng, Liu; Kitts, David D

    2012-09-01

    Coffee beans contain numerous bioactive components that exhibit antioxidant capacity when assessed using both chemical, cell free, and biological, cell-based model systems. However, the mechanisms underlying the antioxidant effects of coffee in biological systems are not totally understood and in some cases vary considerably from results obtained with simpler in vitro chemical assays. In the present study, the physicochemical characteristics and antioxidant activity of roasted and non-roasted coffee extracts were investigated in both cell free (ORAC(FL)) and cell-based systems. A profile of antioxidant gene expression in cultured human colon adenocarcinoma Caco-2 cells treated with both roasted and non-roasted coffee extracts, respectively, was investigated using Real-Time polymerase chain reaction (PCR) array technology. Results demonstrated that the mechanisms of the antioxidant activity associated with coffee constituents assessed by the ORAC(FL) assay were different to those observed using an intracellular oxidation assay with Caco-2 cells. Moreover, roasted coffee (both light and dark roasted) extracts produced both increased- and decreased-expressions of numerous genes that are involved in the management of oxidative stress via the antioxidant defence system. The selective and specific positive induction of antioxidant response element (ARE)-dependent genes, including gastrointestinal glutathione peroxidase (GPX2), sulfiredoxin (SRXN1), thioredoxin reductase 1 (TXNRD1), peroxiredoxin 1 (PRDX1), peroxiredoxin 4 (PDRX4) and peroxiredoxin 6 (PDRX6) were identified with the activation of the endogenous antioxidant defence system in Caco-2 cells.

  6. Elements involved in S-adenosylmethionine-mediated regulation of the Saccharomyces cerevisiae MET25 gene.

    PubMed Central

    Thomas, D; Cherest, H; Surdin-Kerjan, Y

    1989-01-01

    In Saccharomyces cerevisiae, the MET25 gene encodes O-acetylhomoserine sulfhydrylase. Synthesis of this enzyme is repressed by the presence of S-adenosylmethionine (AdoMet) in the growth medium. We identified cis elements required for MET25 expression by analyzing small deletions in the MET25 promoter region. The results revealed a regulatory region, acting as an upstream activation site, that activated transcription of MET25 in the absence of methionine or AdoMet. We found that, for the most part, repression of MET25 expression was due to a lack of activation at this site, reinforced by an independent repression mechanism. The activation region contained a repeated dyad sequence that is also found in the promoter regions of other unlinked but coordinately regulated genes (MET3, MET2, and SAM2). We show that the presence of the two dyads is necessary for maximal gene expression. Moreover, we demonstrate that in addition to this transcriptional regulation, a posttranscriptional regulation, probably targeted at the 5' region of mRNA, is involved in MET25 expression. Images PMID:2552290

  7. Vitamin D3 supports osteoclastogenesis via functional vitamin D response element of human RANKL gene promoter.

    PubMed

    Kitazawa, Sohei; Kajimoto, Kazuyoshi; Kondo, Takeshi; Kitazawa, Riko

    2003-07-01

    Receptor activator of NF-kappaB ligand (RANKL) has been identified as requisite for osteoclastogenesis. To elucidate the molecular mechanism that conducts its catabolic action on bone, the effect of 1alpha,25 dihydroxyvitamin D(3) (1alpha,25(OH)(2)D(3)) on osteoclastogenesis and RANKL mRNA expression was examined by coculture, RT-PCR and nuclear run-on studies. By accelerating the transcription rate of the RANKL gene in SaOS2 osteoblastic cells, 1alpha,25(OH)(2)D(3) enhanced in vitro osteoclast formation from peripheral monocytes. Cloning and characterization of the 5'-flanking region of the human RANKL gene revealed that the basic promoter comprises inverted TATA- and CAAT-boxes flanked by RUNX2 binding sites. Both electrophoresis mobility shift assay (EMSA) and transfection studies demonstrated that 1alpha,25(OH)(2)D(3) activated human RANKL promoter through vitamin D responsive elements (VDRE) located at -1584/-1570 by binding VDR and RXRalpha heterodimers in a ligand-dependent manner. The results provide direct evidence that 1alpha,25(OH)(2)D(3) augments osteoclastogenesis by transactivating the human RANKL gene in osteoblastic cells through VDRE.

  8. Composite response elements mediate hormonal and developmental regulation of milk protein gene expression.

    PubMed

    Rosen, J M; Zahnow, C; Kazansky, A; Raught, B

    1998-01-01

    Our laboratory has been studying the mechanisms by which hormones regulate the expression of differentiated function in the normal mammary gland and how these regulatory mechanisms have deviated in breast cancer. Two rat milk protein genes, encoding beta-casein and whey acidic protein, have been employed as molecular markers of mammary epithelial cell differentiation. Composite response elements containing multiple binding sites for several transcription factors mediate the hormonal and developmental regulation of milk protein gene expression. In the whey protein gene promoters, these include binding sites for nuclear factor (NF)-I, as well as the glucocorticoid receptor (GR) and signal transducers and activators of transcription (Stat5). In the casein promoters, these include binding sites for Stat5, Yin Yang 1 (YY1), GR and the CCAAT/enhancer binding protein (C/EBP). The C/EBP family of DNA binding proteins may play a pivotal role in maintaining the balance between cell proliferation and terminal differentiation in mammary epithelial cells. During normal mammary gland development, expression of LIP (liver-enriched inhibitory protein, a dominant-negative isoform of C/EBP beta) is hormonally regulated and correlates with cell proliferation during pregnancy. LIP can form heterodimers with other C/EBP family members and suppress their transcriptional activity. In contrast, C/EBP alpha is predominantly expressed during lactation following terminal differentiation. Elevated LIP levels have been detected in mouse, rat and human breast tumours of different aetiologies. This provides a mechanism, therefore, to block terminal differentiation and facilitate continued proliferation.

  9. VIP1 response elements mediate mitogen-activated protein kinase 3-induced stress gene expression

    PubMed Central

    Pitzschke, Andrea; Djamei, Armin; Teige, Markus; Hirt, Heribert

    2009-01-01

    The plant pathogen Agrobacterium tumefaciens transforms plant cells by delivering its T-DNA into the plant cell nucleus where it integrates into the plant genome and causes tumor formation. A key role of VirE2-interacting protein 1 (VIP1) in the nuclear import of T-DNA during Agrobacterium-mediated plant transformation has been unravelled and VIP1 was shown to undergo nuclear localization upon phosphorylation by the mitogen-activated protein kinase MPK3. Here, we provide evidence that VIP1 encodes a functional bZIP transcription factor that stimulates stress-dependent gene expression by binding to VIP1 response elements (VREs), a DNA hexamer motif. VREs are overrepresented in promoters responding to activation of the MPK3 pathway such as Trxh8 and MYB44. Accordingly, plants overexpressing VIP1 accumulate high levels of Trxh8 and MYB44 transcripts, whereas stress-induced expression of these genes is impaired in mpk3 mutants. Trxh8 and MYB44 promoters are activated by VIP1 in a VRE-dependent manner. VIP1 strongly enhances expression from a synthetic promoter harboring multiple VRE copies and directly interacts with VREs in vitro and in vivo. Chromatin immunoprecipitation assays of the MYB44 promoter confirm that VIP1 binding to VREs is enhanced under conditions of MPK3 pathway stimulation. These results provide molecular insight into the cellular mechanism of target gene regulation by the MPK3 pathway. PMID:19820165

  10. Promoter elements and transcriptional control of the chicken tropomyosin gene [corrected

    PubMed Central

    Toutant, M; Gauthier-Rouviere, C; Fiszman, M Y; Lemonnier, M

    1994-01-01

    The chicken beta tropomyosin (beta TM) gene has two alternative transcription start sites (sk and nmCAP sites) which are used in muscle or non muscle tissues respectively. In order to understand the mechanisms involved in the tissue-specific and developmentally-regulated expression of the beta TM gene, we have analyzed the 5' regions associated with each CAP site. Truncated regions 5' to the nmCAP site were inserted upstream to the bacterial chloramphenicol acetyltransferase (CAT) reporter gene and these constructs were transfected into avian myogenic and non myogenic cells. The maximum transcription is driven by the CAT construct (-168/ + 216 nt) in all cell types. Previous deletion analysis of the region 5' to the beta TMskCAP site has indicated that 805 nt confer myotube-specific transcription. In this work, we characterized an enhancer element (-201/-68 nt) which contains an E box (-177), a variant CArG box (-104) and a stretch of 7Cs (-147). Mutation of any of these motifs results in a decrease of the myotube-specific transcriptional activity. Electrophoretic mobility shift assays indicate that these cis-acting sequences specifically bind nuclear proteins. This enhancer functions in an orientation-dependent manner. Images PMID:8208608

  11. cis- and trans-acting elements of the estrogen-regulated vitellogenin gene B1 of Xenopus laevis.

    PubMed

    Wahli, W; Martinez, E; Corthésy, B; Cardinaux, J R

    1989-01-01

    Vitellogenin genes are expressed under strict estrogen control in the liver of female oviparous vertebrates. Gene transfer experiments using estrogen-responsive cells have shown that the 13 bp perfect palindromic element GGTCACTGTGACC found upstream of the Xenopus laevis vitellogenin gene A2 promoter mediates hormonal stimulation and thus, was called the estrogen-responsive element (ERE). In the Xenopus vitellogenin genes B1 and B2 there are two closely adjacent EREs with one or more base substitutions when compared to the consensus ERE GGTCANNNTGACC. On their own, these degenerated elements have only a low or no regulatory capacity at all but act together synergistically to form an estrogen-responsive unit (ERU) with the same strength as the perfect palindromic 13 bp element. Analysis of estrogen receptor binding to the gene B1 ERU revealed a cooperative interaction of receptor dimers to the two adjacent imperfect EREs which most likely explains the synergistic stimulation observed in vivo. Furthermore, a promoter activator element located between positions --113 and --42 of the gene B1 and functional in the human MCF-7 and the Xenopus B3.2 cells has been identified and shown to be involved in the high level of induced transcription activity when the ERE is placed at a distance from the promoter. Finally, a hormone-controlled in vitro transcription system derived from Xenopus liver nuclear extracts was exploited to characterize two additional novel cis-acting elements within the vitellogenin gene B1 promoter. One of them, a negative regulatory element (NRE), is responsible for repression of promoter activity in the absence of hormone. The second is related to the NF-I binding site and is required, together with the ERE, to mediate hormonal induction. Moreover, we detected three trans-acting activities in Xenopus liver nuclear extracts that interact with these regions and demonstrated that they participate in the regulation of the expression of the vitellogenin

  12. The Arabidopsis thaliana MHX gene includes an intronic element that boosts translation when localized in a 5' UTR intron.

    PubMed

    Akua, Tsofit; Shaul, Orit

    2013-11-01

    The mechanisms that underlie the ability of some introns to increase gene expression, a phenomenon called intron-mediated enhancement (IME), are not fully understood. It is also not known why introns localized in the 5'-untranslated region (5' UTR) are considerably longer than downstream eukaryotic introns. It was hypothesized that this extra length results from the presence of some functional intronic elements. However, deletion analyses studies carried out thus far were unable to identify specific intronic regions necessary for IME. Using deletion analysis and a gain-of-function approach, an internal element that considerably increases translational efficiency, without affecting splicing, was identified in the 5' UTR intron of the Arabidopsis thaliana MHX gene. Moreover, the ability of this element to enhance translation was diminished by a minor downstream shift in the position of introns containing it from the 5' UTR into the coding sequence. These data suggest that some of the extra length of 5' UTR introns results from the presence of elements that enhance translation, and, moreover, from the ability of 5' UTR introns to provide preferable platforms for such elements over downstream introns. The impact of the identified intronic element on translational efficiency was augmented upon removal of neighbouring intronic elements. Interference between different intronic elements had not been reported thus far. This interference may support the bioinformatics-based idea that some of the extra sequence of 5' UTR introns is also necessary for separating different functional intronic elements.

  13. A General Approach for Identifying Distant Regulatory Elements Applied to the Gdf6 Gene

    PubMed Central

    Mortlock, Douglas P.; Guenther, Catherine; Kingsley, David M.

    2003-01-01

    Regulatory sequences in higher genomes can map large distances from gene coding regions, and cannot yet be identified by simple inspection of primary DNA sequence information. Here we describe an efficient method of surveying large genomic regions for gene regulatory information, and subdividing complex sets of distant regulatory elements into smaller intervals for detailed study. The mouse Gdf6 gene is expressed in a number of distinct embryonic locations that are involved in the patterning of skeletal and soft tissues. To identify sequences responsible for Gdf6 regulation, we first isolated a series of overlapping bacterial artificial chromosomes (BACs) that extend varying distances upstream and downstream of the gene. A LacZ reporter cassette was integrated into the Gdf6 transcription unit of each BAC using homologous recombination in bacteria. Each modified BAC was injected into fertilized mouse eggs, and founder transgenic embryos were analyzed for LacZ expression mid-gestation. The overlapping segments defined by the BAC clones revealed five separate regulatory regions that drive LacZ expression in 11 distinct anatomical locations. To further localize sequences that control expression in developing skeletal joints, we created a series of BAC constructs with precise deletions across a putative joint-control region. This approach further narrowed the critical control region to an area containing several stretches of sequence that are highly conserved between mice and humans. A distant 2.9-kilobase fragment containing the highly conserved regions is able to direct very specific expression of a minimal promoter/LacZ reporter in proximal limb joints. These results demonstrate that even distant, complex regulatory sequences can be identified using a combination of BAC scanning, BAC deletion, and comparative sequencing approaches. PMID:12915490

  14. Retrotransposons in the flanking regions of normal plant genes: a role for copia-like elements in the evolution of gene structure and expression.

    PubMed Central

    White, S E; Habera, L F; Wessler, S R

    1994-01-01

    The wx-K mutation results from the insertion of a copia-like retrotransposon into exon 12 of the maize waxy gene. This retrotransposon, named Hopscotch, has one long open reading frame encoding all of the domains required for transposition. Computer-assisted database searches using Hopscotch and other plant copia-like retroelements as query sequences have revealed that ancient, degenerate retrotransposon insertions are found in close proximity to 21 previously sequenced plant genes. The data suggest that these elements may be involved in gene duplication and the regulation of gene expression. Similar searches using the Drosophila retrotransposon copia did not reveal any retrotransposon-like sequences in the flanking regions of animal genes. These results, together with the recent finding that reverse-transcriptase sequences characteristic of copia-like elements are ubiquitous and diverse in plants, suggest that copia-like retrotransposons are an ancient component of plant genomes. Images PMID:7991537

  15. Characterization of cis-elements required for osmotic response of rat Na(+)/H(+) exchanger-2 (NHE-2) gene.

    PubMed

    Bai, L; Collins, J F; Muller, Y L; Xu, H; Kiela, P R; Ghishan, F K

    1999-10-01

    The Na(+)/H(+) exchanger (NHE-2) has been implicated in osmoregulation in the kidney, because it transports Na(+) across the cell membrane and efficiently alters intracellular osmolarity. On hyperosmotic stress, NHE-2 mRNA increases in abundance in mouse inner medullary collecting duct (mIMCD-3) cells, suggesting possible transcriptional regulation. To investigate the molecular mechanism of potential transcriptional regulation of NHE-2 by hyperosmolarity, we have functionally characterized the 5'-flanking region of the gene in mIMCD-3 cells. Transient transfection of luciferase reporter gene constructs revealed a novel cis-acting element, which we call OsmoE (osmotic-responsive element, bp -808 to -791, GGGCCAGTTGGCGCTGGG), and a TonE-like element (tonicity-responsive element, bp -1201 to -1189, GCTGGAAAACCGA), which together are shown to be responsible for hyperosmotic induction of the NHE-2 gene. Electrophoretic mobility shift assays suggest that different DNA-protein interactions occur between these two osmotic response elements. However, both DNA sequences were shown to specifically bind nuclear proteins that dramatically increase in abundance under hyperosmotic conditions. Isolation of trans-acting factors and characterization of their specific interaction with these osmotic response elements will further elucidate the transcriptional mechanisms controlling NHE-2 gene expression under hyperosmolar conditions.

  16. Histone H3 K27 acetylation marks a potent enhancer element on the adipogenic master regulator gene Pparg2

    PubMed Central

    Ramlee, Muhammad Khairul; Zhang, Qiongyi; Idris, Muhammad; Peng, Xu; Sim, Choon Kiat; Han, Weiping; Xu, Feng

    2014-01-01

    PPARγ2 is expressed almost exclusively in adipose tissue and plays a central role in adipogenesis. Despite intensive studies over the last 2 decades, the mechanism regulating the expression of the Pparg2 gene, especially the role of cis-regulatory elements, is still not completely understood. Here, we report a comprehensive investigation of the enhancer elements within the murine Pparg2 gene. Utilizing the combined techniques of sequence conservation analysis and chromatin marker examination, we identified a potent enhancer element that augmented the expression of a reporter gene under the control of the Pparg2 promoter by 20-fold. This enhancer element was first identified as highly conserved non-coding sequence 10 (CNS10) and was later shown to be enriched with the enhancer marker H3 K27 acetylation. Further studies identified a binding site for p300 as the essential enhancer element in CNS10. Moreover, p300 physically binds to CNS10 and is required for the enhancer activity of CNS10. The depletion of p300 by siRNA resulted in significantly impaired activation of Pparg2 at the early stages of 3T3-L1 adipogenesis. In summary, our study identified a novel enhancer element on the murine Pparg2 gene and suggested a novel mechanism for the regulation of Pparg2 expression by p300 in 3T3-L1 adipogenesis. PMID:25485585

  17. Histone H3 K27 acetylation marks a potent enhancer element on the adipogenic master regulator gene Pparg2.

    PubMed

    Ramlee, Muhammad Khairul; Zhang, Qiongyi; Idris, Muhammad; Peng, Xu; Sim, Choon Kiat; Han, Weiping; Xu, Feng

    2014-01-01

    PPARγ2 is expressed almost exclusively in adipose tissue and plays a central role in adipogenesis. Despite intensive studies over the last 2 decades, the mechanism regulating the expression of the Pparg2 gene, especially the role of cis-regulatory elements, is still not completely understood. Here, we report a comprehensive investigation of the enhancer elements within the murine Pparg2 gene. Utilizing the combined techniques of sequence conservation analysis and chromatin marker examination, we identified a potent enhancer element that augmented the expression of a reporter gene under the control of the Pparg2 promoter by 20-fold. This enhancer element was first identified as highly conserved non-coding sequence 10 (CNS10) and was later shown to be enriched with the enhancer marker H3 K27 acetylation. Further studies identified a binding site for p300 as the essential enhancer element in CNS10. Moreover, p300 physically binds to CNS10 and is required for the enhancer activity of CNS10. The depletion of p300 by siRNA resulted in significantly impaired activation of Pparg2 at the early stages of 3T3-L1 adipogenesis. In summary, our study identified a novel enhancer element on the murine Pparg2 gene and suggested a novel mechanism for the regulation of Pparg2 expression by p300 in 3T3-L1 adipogenesis.

  18. Developmental activation of the lysozyme gene in chicken macrophage cells is linked to core histone acetylation at its enhancer elements

    PubMed Central

    Myers, Fiona A.; Lefevre, Pascal; Mantouvalou, Evangelia; Bruce, Kimberley; Lacroix, Claire; Bonifer, Constanze; Thorne, Alan W.; Crane-Robinson, Colyn

    2006-01-01

    Native chromatin IP assays were used to define changes in core histone acetylation at the lysozyme locus during developmental maturation of chicken macrophages and stimulation to high-level expression by lipo-polysaccharide. In pluripotent precursors the lysozyme gene (Lys) is inactive and there is no acetylation of core histones at the gene, its promoter or at the upstream cis-control elements. In myeloblasts, where there is a very low level of Lys expression, H4 acetylation appears at the cis-control elements but not at the Lys gene or its promoter: neither H3 nor H2B become significantly acetylated in myeloblasts. In mature macrophages, Lys expression increases 5-fold: H4, H2B and H2A.Z are all acetylated at the cis-control elements but H3 remains unacetylated except at the −2.4 S silencer. Stimulation with LPS increases Lys expression a further 10-fold: this is accompanied by a rise in H3 acetylation throughout the cis-control elements; H4 and H2B acetylation remain substantial but acetylation at the Lys gene and its promoter remains low. Acetylation is thus concentrated at the cis-control elements, not at the Lys gene or its immediate promoter. H4 acetylation precedes H3 acetylation during development and H3 acetylation is most directly linked to high-level Lys expression. PMID:16914441

  19. The CHR promoter element controls cell cycle-dependent gene transcription and binds the DREAM and MMB complexes

    PubMed Central

    Müller, Gerd A.; Quaas, Marianne; Schümann, Michael; Krause, Eberhard; Padi, Megha; Fischer, Martin; Litovchick, Larisa; DeCaprio, James A.; Engeland, Kurt

    2012-01-01

    Cell cycle-dependent gene expression is often controlled on the transcriptional level. Genes like cyclin B, CDC2 and CDC25C are regulated by cell cycle-dependent element (CDE) and cell cycle genes homology region (CHR) promoter elements mainly through repression in G0/G1. It had been suggested that E2F4 binding to CDE sites is central to transcriptional regulation. However, some promoters are only controlled by a CHR. We identify the DREAM complex binding to the CHR of mouse and human cyclin B2 promoters in G0. Association of DREAM and cell cycle-dependent regulation is abrogated when the CHR is mutated. Although E2f4 is part of the complex, a CDE is not essential but can enhance binding of DREAM. We show that the CHR element is not only necessary for repression of gene transcription in G0/G1, but also for activation in S, G2 and M phases. In proliferating cells, the B-myb-containing MMB complex binds the CHR of both promoters independently of the CDE. Bioinformatic analyses identify many genes which contain conserved CHR elements in promoters binding the DREAM complex. With Ube2c as an example from that screen, we show that inverse CHR sites are functional promoter elements that can bind DREAM and MMB. Our findings indicate that the CHR is central to DREAM/MMB-dependent transcriptional control during the cell cycle. PMID:22064854

  20. The CHR promoter element controls cell cycle-dependent gene transcription and binds the DREAM and MMB complexes.

    PubMed

    Müller, Gerd A; Quaas, Marianne; Schümann, Michael; Krause, Eberhard; Padi, Megha; Fischer, Martin; Litovchick, Larisa; DeCaprio, James A; Engeland, Kurt

    2012-02-01

    Cell cycle-dependent gene expression is often controlled on the transcriptional level. Genes like cyclin B, CDC2 and CDC25C are regulated by cell cycle-dependent element (CDE) and cell cycle genes homology region (CHR) promoter elements mainly through repression in G(0)/G(1). It had been suggested that E2F4 binding to CDE sites is central to transcriptional regulation. However, some promoters are only controlled by a CHR. We identify the DREAM complex binding to the CHR of mouse and human cyclin B2 promoters in G(0). Association of DREAM and cell cycle-dependent regulation is abrogated when the CHR is mutated. Although E2f4 is part of the complex, a CDE is not essential but can enhance binding of DREAM. We show that the CHR element is not only necessary for repression of gene transcription in G(0)/G(1), but also for activation in S, G(2) and M phases. In proliferating cells, the B-myb-containing MMB complex binds the CHR of both promoters independently of the CDE. Bioinformatic analyses identify many genes which contain conserved CHR elements in promoters binding the DREAM complex. With Ube2c as an example from that screen, we show that inverse CHR sites are functional promoter elements that can bind DREAM and MMB. Our findings indicate that the CHR is central to DREAM/MMB-dependent transcriptional control during the cell cycle.

  1. Widespread contribution of transposable elements to the innovation of gene regulatory networks

    PubMed Central

    Sundaram, Vasavi; Cheng, Yong; Ma, Zhihai; Li, Daofeng; Xing, Xiaoyun; Edge, Peter

    2014-01-01

    Transposable elements (TEs) have been shown to contain functional binding sites for certain transcription factors (TFs). However, the extent to which TEs contribute to the evolution of TF binding sites is not well known. We comprehensively mapped binding sites for 26 pairs of orthologous TFs in two pairs of human and mouse cell lines (representing two cell lineages), along with epigenomic profiles, including DNA methylation and six histone modifications. Overall, we found that 20% of binding sites were embedded within TEs. This number varied across different TFs, ranging from 2% to 40%. We further identified 710 TF–TE relationships in which genomic copies of a TE subfamily contributed a significant number of binding peaks for a TF, and we found that LTR elements dominated these relationships in human. Importantly, TE-derived binding peaks were strongly associated with open and active chromatin signatures, including reduced DNA methylation and increased enhancer-associated histone marks. On average, 66% of TE-derived binding events were cell type-specific with a cell type-specific epigenetic landscape. Most of the binding sites contributed by TEs were species-specific, but we also identified binding sites conserved between human and mouse, the functional relevance of which was supported by a signature of purifying selection on DNA sequences of these TEs. Interestingly, several TFs had significantly expanded binding site landscapes only in one species, which were linked to species-specific gene functions, suggesting that TEs are an important driving force for regulatory innovation. Taken together, our data suggest that TEs have significantly and continuously shaped gene regulatory networks during mammalian evolution. PMID:25319995

  2. Delineation of a slow-twitch-myofiber-specific transcriptional element by using in vivo somatic gene transfer.

    PubMed Central

    Corin, S J; Levitt, L K; O'Mahoney, J V; Joya, J E; Hardeman, E C; Wade, R

    1995-01-01

    Contractile proteins are encoded by multigene families, most of whose members are differentially expressed in fast- versus slow-twitch myofibers. This fiber-type-specific gene regulation occurs by unknown mechanisms and does not occur within cultured myocytes. We have developed a transient, whole-animal assay using somatic gene transfer to study this phenomenon and have identified a fiber-type-specific regulatory element within the promoter region of a slow myofiber-specific gene. A plasmid-borne luciferase reporter gene fused to various muscle-specific contractile gene promoters was differentially expressed when injected into slow- versus fast-twitch rat muscle: the luciferase gene was preferentially expressed in slow muscle when fused to a slow troponin I promoter, and conversely, was preferentially expressed in fast muscle when fused to a fast troponin C promoter. In contrast, the luciferase gene was equally well expressed by both muscle types when fused to a nonfiber-type-specific skeletal actin promoter. Deletion analysis of the troponin I promoter region revealed that a 157-bp enhancer conferred slow-muscle-preferential activity upon a minimal thymidine kinase promoter. Transgenic analysis confirmed the role of this enhancer in restricting gene expression to slow-twitch myofibers. Hence, somatic gene transfer may be used to rapidly define elements that direct myofiber-type-specific gene expression prior to the generation of transgenic mice. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:7597099

  3. Uptake and effect of rare earth elements on gene expression in Methylosinus trichosporium OB3b

    DOE PAGES

    Gu, Wenyu; Farhan Ul Haque, Muhammad; DiSpirito, Alan A.; ...

    2016-05-12

    It is well-known that M. trichosporium OB3b has two forms of methane monooxygenase responsible for the initial conversion of methane to methanol, a cytoplasmic (soluble) methane monooxygenase (sMMO) and a membrane-associated (particulate) methane monooxygenase (pMMO) and that copper strongly regulates expression of these alternative forms of MMO. More recently, it has been discovered that M. trichosporium OB3b has multiple types of the methanol dehydrogenase (MeDH), i.e. the Mxa-MeDH and Xox-MeDH, and the expression of these two forms is regulated by the availability of the rare earth element, cerium. Here we extend these studies and show that lanthanum, praseodymium, neodymium andmore » samarium also regulate expression of alternative forms of MeDH. The effect of these rare earth elements on MeDH expression, however, was only observed in the absence of copper. Further, a mutant of M. trichosporium OB3b where the Mxa-MeDH was knocked out was able to grow in the presence of lanthanum, praseodymium and neodymium, but was not able to grow in the presence of samarium. In conclusion, collectively these data suggest that multiple levels of gene regulation by metals exist in M. trichosporium OB3b but that copper overrides the effect of other metals by an as yet unknown mechanism.« less

  4. A transposable element from Halobacterium halobium which inactivates the bacteriorhodopsin gene.

    PubMed Central

    Simsek, M; DasSarma, S; RajBhandary, U L; Khorana, H G

    1982-01-01

    We describe the characterization of a transposable element from an archaebacterium. The bacteriorhodopsin genes from the wild-type and two mutant Halobacterium halobium strains have been cloned as BamHI fragments in pBR322. The cloned DNA fragments from the two mutants both contain a 1.1-kilobase-pair insertion sequence (ISH1) near the NH2 terminus of the bacteriorhodopsin coding sequence. ISH1 is present in the two mutants in an identical palindromic site but in opposite orientations. The complete sequence of ISH1 has been determined; it is 1,118 nucleotides long, it has 8-base-pair interrupted inverted repeats at the ends, and it duplicates an 8-base-pair (A-G-T-T-A-T-T-G) target sequence upon insertion. As for most eukaryotic and some prokaryotic transposable elements, the sequence of the ISH1 begins with T-G and ends in C-A. ISH1 contains an open reading frame 810 nucleotides long and codes for an RNA approximately 900 nucleotides long. The copy number of ISH1 ranges from one to five or more in different H. halobium strains. In at least one of the strains, one copy of ISH1 is present also on a plasmid DNA. Images PMID:6296826

  5. Population scale mapping of transposable element diversity reveals links to gene regulation and epigenomic variation

    PubMed Central

    Stuart, Tim; Eichten, Steven R; Cahn, Jonathan; Karpievitch, Yuliya V; Borevitz, Justin O; Lister, Ryan

    2016-01-01

    Variation in the presence or absence of transposable elements (TEs) is a major source of genetic variation between individuals. Here, we identified 23,095 TE presence/absence variants between 216 Arabidopsis accessions. Most TE variants were rare, and we find these rare variants associated with local extremes of gene expression and DNA methylation levels within the population. Of the common alleles identified, two thirds were not in linkage disequilibrium with nearby SNPs, implicating these variants as a source of novel genetic diversity. Many common TE variants were associated with significantly altered expression of nearby genes, and a major fraction of inter-accession DNA methylation differences were associated with nearby TE insertions. Overall, this demonstrates that TE variants are a rich source of genetic diversity that likely plays an important role in facilitating epigenomic and transcriptional differences between individuals, and indicates a strong genetic basis for epigenetic variation. DOI: http://dx.doi.org/10.7554/eLife.20777.001 PMID:27911260

  6. Identification of an intronic cis-acting element in the human dopamine transporter gene

    PubMed Central

    Zhao, Ying; Zhou, Yanhong; Lin, Zhicheng

    2017-01-01

    The human dopamine transporter gene (hDAT) encodes the dopamine transporter in dopamine (DA) neurons to regulate DA transmission. hDAT expression varies significantly from neuron to neuron, and from individual to individual so that dysregulation of hDAT is related to many neuropsychiatric disorders. It is critical to identify hDAT-specific cis-acting elements that regulate the hDAT expression. Previous studies showed that hDAT Intron 1 displayed inhibitory activity for reporter gene expression. Here we report that the hDAT Intron 1 contains a 121-bp fragment that down-regulated both SV40 and hDAT promoter activities by 80% in vitro. Subfragments of 121-bp still down-regulated the SV40 promoter but not the hDAT promoter, as supported by nuclear protein-binding activities. Collectively, 121-bp is a silencer in vitro that might coordinate with transcriptional activities both inside and outside 121-bp in regulation of hDAT. PMID:22160470

  7. Phylogenetic and Genomic Analyses Resolve the Origin of Important Plant Genes Derived from Transposable Elements

    PubMed Central

    Joly-Lopez, Zoé; Hoen, Douglas R.; Blanchette, Mathieu; Bureau, Thomas E.

    2016-01-01

    Once perceived as merely selfish, transposable elements (TEs) are now recognized as potent agents of adaptation. One way TEs contribute to evolution is through TE exaptation, a process whereby TEs, which persist by replicating in the genome, transform into novel host genes, which persist by conferring phenotypic benefits. Known exapted TEs (ETEs) contribute diverse and vital functions, and may facilitate punctuated equilibrium, yet little is known about this process. To better understand TE exaptation, we designed an approach to resolve the phylogenetic context and timing of exaptation events and subsequent patterns of ETE diversification. Starting with known ETEs, we search in diverse genomes for basal ETEs and closely related TEs, carefully curate the numerous candidate sequences, and infer detailed phylogenies. To distinguish TEs from ETEs, we also weigh several key genomic characteristics including repetitiveness, terminal repeats, pseudogenic features, and conserved domains. Applying this approach to the well-characterized plant ETEs MUG and FHY3, we show that each group is paraphyletic and we argue that this pattern demonstrates that each originated in not one but multiple exaptation events. These exaptations and subsequent ETE diversification occurred throughout angiosperm evolution including the crown group expansion, the angiosperm radiation, and the primitive evolution of angiosperms. In addition, we detect evidence of several putative novel ETE families. Our findings support the hypothesis that TE exaptation generates novel genes more frequently than is currently thought, often coinciding with key periods of evolution. PMID:27189548

  8. Identification of previously unrecognized common elements in eukaryotic promoters. A ribosomal RNA gene initiator element for RNA polymerase I.

    PubMed

    Radebaugh, C A; Gong, X; Bartholomew, B; Paule, M R

    1997-02-07

    A new ribosomal RNA promoter element with a functional role similar to the RNA polymerase II initiator (Inr) was identified. This sequence, which we dub the ribosomal Inr (rInr) is unusually conserved, even in normally divergent RNA polymerase I promoters. It functions in the recruitment of the fundamental, TATA-binding protein (TBP)-containing transcription factor, TIF-IB. All upstream elements of the exceptionally strong Acanthamoeba castellanii ribosomal RNA core promoter, to within 6 base pairs of the transcription initiation site (tis), can be deleted without loss of specific transcription initiation. Thus, the A. castellanii promoter can function in a manner similar to RNA polymerase II TATA-less promoters. Sequence-specific photo-cross-linking localizes a 96-kDa subunit of TIF-IB and the second largest RNA polymerase I subunit (A133) to the rInr sequence. A185 also photo-cross-links when polymerase is stalled at +7.

  9. Scanning of Transposable Elements and Analyzing Expression of Transposase Genes of Sweet Potato [Ipomoea batatas

    PubMed Central

    Tao, Xiang; Lai, Xian-Jun; Zhang, Yi-Zheng; Tan, Xue-Mei; Wang, Haiyan

    2014-01-01

    Background Transposable elements (TEs) are the most abundant genomic components in eukaryotes and affect the genome by their replications and movements to generate genetic plasticity. Sweet potato performs asexual reproduction generally and the TEs may be an important genetic factor for genome reorganization. Complete identification of TEs is essential for the study of genome evolution. However, the TEs of sweet potato are still poorly understood because of its complex hexaploid genome and difficulty in genome sequencing. The recent availability of the sweet potato transcriptome databases provides an opportunity for discovering and characterizing the expressed TEs. Methodology/Principal Findings We first established the integrated-transcriptome database by de novo assembling four published sweet potato transcriptome databases from three cultivars in China. Using sequence-similarity search and analysis, a total of 1,405 TEs including 883 retrotransposons and 522 DNA transposons were predicted and categorized. Depending on mapping sets of RNA-Seq raw short reads to the predicted TEs, we compared the quantities, classifications and expression activities of TEs inter- and intra-cultivars. Moreover, the differential expressions of TEs in seven tissues of Xushu 18 cultivar were analyzed by using Illumina digital gene expression (DGE) tag profiling. It was found that 417 TEs were expressed in one or more tissues and 107 in all seven tissues. Furthermore, the copy number of 11 transposase genes was determined to be 1–3 copies in the genome of sweet potato by Real-time PCR-based absolute quantification. Conclusions/Significance Our result provides a new method for TE searching on species with transcriptome sequences while lacking genome information. The searching, identification and expression analysis of TEs will provide useful TE information in sweet potato, which are valuable for the further studies of TE-mediated gene mutation and optimization in asexual reproduction

  10. Regulatory elements necessary for termination of transcription within the immunoglobulin heavy chain gene locus

    SciTech Connect

    Moore, B.B.

    1992-01-01

    Previous experimentation demonstrated that regulation of the IgM only phenotype in both pre-B and immature B cells was primarily at the transcriptional level. Expression of IgD mRNA involves transcription of the entire 29 kilobase rearranged [mu]-[delta] locus. Mature B cells transcribe the [beta] exons at approximately half the level that they transcribe the [delta] gene. Early B cells however, transcribe the [mu] gene with approximately 90% more efficiency than they do the [delta] gene. Specifically, early B cells show a transcription termination event occurring within a 1 kilobase region of the [mu]-[delta] intron. This dissertation analyzes the sequence elements necessary to encode the transcription termination event within the [mu]-[delta] intron. This work shows that the termination motif consists of specific sequences within the [mu]m poly(A) site as well as a region of the [mu]-[delta] intron contained within a 1200 base pair fragment. The 1200 base pair fragment extends from the Pst I site within the intron and ends just prior to the C[delta]1 exon. This fragment contains a 162 base pair unique sequence inverted repeat (USIR). Furthermore, the [mu]m site is specifically required because the [mu]s site was unable to substitute, despite extensive usage. In addition, the USIR-containing intron functions in an orientation-dependent manner. Analysis of this termination motif in a variety of lymphoid and non-lymphoid cells suggests that this motif is an intrinsic polymerase II termination motif. This implies that transcription termination in early B cells is by a default model and that active regulation of this motif involves an anti-termination event in mature B cells.

  11. Novel mutations in the GH gene (GH1) uncover putative splicing regulatory elements.

    PubMed

    Babu, Deepak; Mellone, Simona; Fusco, Ileana; Petri, Antonella; Walker, Gillian E; Bellone, Simonetta; Prodam, Flavia; Momigliano-Richiardi, Patricia; Bona, Gianni; Giordano, Mara

    2014-05-01

    Mutations affecting exon 3 splicing are the main cause of autosomal dominant Isolated GH Deficiency II (IGHDII) by increasing the level of exon 3-skipped mRNA encoding the functionally inactive dominant-negative 17.5-kDa isoform. The exons and introns of the gene encoding GH (GH1) were screened for the presence of mutations in 103 sporadic isolated GH deficiency cases. Four different variations within exon 3 were identified in 3 patients. One carried c.261C>T (p.Pro87Pro) and c.272A>T (p.Glu91Val), the second c.255G>A (p.Pro85Pro) and c.261 C>T, and the third c.246G>C (p.Glu82Asp). All the variants were likely generated by gene conversion from an homologous gene in the GH1 cluster. In silico analysis predicted that positions c.255 and c.272 were included within 2 putative novel exon splicing enhancers (ESEs). Their effect on splicing was confirmed in vitro. Constructs bearing these 2 variants induced consistently higher levels both of transcript and protein corresponding to the 17.5-kDa isoform. When c.255 and c.272 were combined in cis with the c.261 variant, as in our patients, their effect was weaker. In conclusion, we identified 2 variations, c.255G>A and c.272A>T, located in 2 novel putative exon splicing enhancers and affecting GH1 splicing in vitro by increasing the production of alternatively spliced isoforms. The amount of aberrant isoforms is further regulated by the presence in cis of the c.261 variant. Thus, our results evidenced novel putative splicing regulatory elements within exon 3, confirming the crucial role of this exon in mRNA processing.

  12. Identification of gene expression elements in Histomonas meleagridis using splinkerette PCR, a variation of ligated adaptor PCR.

    PubMed

    Lynn, Elizabeth C; Beckstead, Robert B

    2012-02-01

    Histomonas meleagridis is the causative agent of blackhead disease in gallinaceous birds. Limited genetic information exists for this organism, with the majority of sequence information coming from the coding regions of genes. No information is available for intergenic regions that contain DNA elements required for the regulation of gene expression. In this study, we demonstrate that splinkerette PCR, a variation of ligated adaptor PCR, can be used to identify regions of unknown sequence that lie upstream and downstream of known genomic sequences. Using this technique, we identified upstream sequences of 2 β-tubulin genes. Sequence analysis identified the 5' coding portions of the β-tubulin genes, the intergenic regions, and 2 different open reading frames encoding for a putative serine/threonine phosphatase and a putative ras-related protein, racG. We predict that these intergenic regions contain polyadenylation and cleavage signals for the 2 open reading frames and initiator elements for the β-tubulin genes. Our research demonstrates the use of splinkerette PCR as a valuable tool to identify unknown DNA sequences. In addition, the identification of the regulatory elements necessary for gene transcription in H. meleagridis will provide tools for future studies on its gene expression.

  13. Conservation of position and sequence of a novel, widely expressed gene containing the major human {alpha}-globin regulatory element

    SciTech Connect

    Vyas, P.; Vickers, M.A.; Picketts, D.J.; Higgs, D.R.

    1995-10-10

    We have determined the cDNA and genomic structure of a gene (-14 gene) that lies adjacent to the human {alpha}-globin cluster. Although it is expressed in a wide range of cell lines and tissues, a previously described erythroid-specific regulatory element that controls expression of the {alpha}-globin genes lies within intron 5 of this gene. Analysis of the -14 gene promoter shows that it is GC rich and associated with a constitutively expressed DNase 1 hypersensitive site; unlike the {alpha}-globin promoter, it does not contain a TATA or CCAAT box. These and other differences in promoter structure may explain why the erythroid regulatory element interacts specifically with the {alpha}-globin promoters and not the -14 gene promoter, which lies between the {alpha} promoters and their regulatory element. Interspecies comparisons demonstrate that the sequence and location of the -14 gene adjacent to the a cluster have been maintained since the bird/mammal divergence, 270 million years ago. 38 refs., 6 figs.

  14. Renal Anemia Model Mouse Established by Transgenic Rescue with an Erythropoietin Gene Lacking Kidney-Specific Regulatory Elements

    PubMed Central

    Hirano, Ikuo; Suzuki, Norio; Yamazaki, Shun; Sekine, Hiroki; Minegishi, Naoko

    2016-01-01

    ABSTRACT The erythropoietin (Epo) gene is under tissue-specific inducible regulation. Because the kidney is the primary EPO-producing tissue in adults, impaired EPO production in chronic kidney disorders results in serious renal anemia. The Epo gene contains a liver-specific enhancer in the 3′ region, but the kidney-specific enhancer for gene expression in renal EPO-producing (REP) cells remains elusive. Here, we examined a conserved upstream element for renal Epo regulation (CURE) region that spans 17.4 kb to 3.6 kb upstream of the Epo gene and harbors several phylogenetically conserved elements. We prepared various Epo gene-reporter constructs utilizing a bacterial artificial chromosome and generated a number of transgenic-mouse lines. We observed that deletion of the CURE region (δCURE) abrogated Epo gene expression in REP cells. Although transgenic expression of the δCURE construct rescued Epo-deficient mice from embryonic lethality, the rescued mice had severe EPO-dependent anemia. These mouse lines serve as an elaborate model for the search for erythroid stimulatory activity and are referred to as AnRED (anemic model with renal EPO deficiency) mice. We also dissected the CURE region by exploiting a minigene harboring four phylogenetically conserved elements in reporter transgenic-mouse analyses. Our analyses revealed that Epo gene regulation in REP cells is a complex process that utilizes multiple regulatory influences. PMID:27920250

  15. Renal Anemia Model Mouse Established by Transgenic Rescue with an Erythropoietin Gene Lacking Kidney-Specific Regulatory Elements.

    PubMed

    Hirano, Ikuo; Suzuki, Norio; Yamazaki, Shun; Sekine, Hiroki; Minegishi, Naoko; Shimizu, Ritsuko; Yamamoto, Masayuki

    2017-02-15

    The erythropoietin (Epo) gene is under tissue-specific inducible regulation. Because the kidney is the primary EPO-producing tissue in adults, impaired EPO production in chronic kidney disorders results in serious renal anemia. The Epo gene contains a liver-specific enhancer in the 3' region, but the kidney-specific enhancer for gene expression in renal EPO-producing (REP) cells remains elusive. Here, we examined a conserved upstream element for renal Epo regulation (CURE) region that spans 17.4 kb to 3.6 kb upstream of the Epo gene and harbors several phylogenetically conserved elements. We prepared various Epo gene-reporter constructs utilizing a bacterial artificial chromosome and generated a number of transgenic-mouse lines. We observed that deletion of the CURE region (δCURE) abrogated Epo gene expression in REP cells. Although transgenic expression of the δCURE construct rescued Epo-deficient mice from embryonic lethality, the rescued mice had severe EPO-dependent anemia. These mouse lines serve as an elaborate model for the search for erythroid stimulatory activity and are referred to as AnRED (anemic model with renal EPO deficiency) mice. We also dissected the CURE region by exploiting a minigene harboring four phylogenetically conserved elements in reporter transgenic-mouse analyses. Our analyses revealed that Epo gene regulation in REP cells is a complex process that utilizes multiple regulatory influences.

  16. A Leader Intron of a Soybean Elongation Factor 1A (eEF1A) Gene Interacts with Proximal Promoter Elements to Regulate Gene Expression in Synthetic Promoters

    PubMed Central

    Zhang, Ning; McHale, Leah K.; Finer, John J.

    2016-01-01

    Introns, especially the first intron in the 5’ untranslated region (5’UTR), can significantly impact gene expression via intron-mediated enhancement (IME). In this study, we demonstrate the leader intron of a soybean elongation factor 1A (eEF1A) gene (GmScreamM8) was essential for the high activity of the native promoter. Furthermore, the interaction of the GmScreamM8 leader intron with regulatory element sequences from several soybean eEF1A promoters was studied using synthetic promoters, which consisted of element tetramers upstream of a core promoter used to regulate a green fluorescent protein (gfp) reporter gene. Element tetramers, placed upstream of a GmScreamM8 core promoter, showed very high activity using both transient expression in lima bean cotyledons and stable expression in soybean hairy roots, only if the native leader intron was included, suggesting an interaction between intronic sequences and promoter elements. Partial deletions of the leader intron showed that a 222 bp intronic sequence significantly contributed to very high levels of GFP expression. Generation of synthetic intron variants with a monomeric or trimeric repeat of the 222 bp intronic sequence, yielded almost two-fold higher expression compared to the original intron, while partial deletion of the 222 bp intronic repeated sequence significantly decreased gene expression, indicating that this intronic sequence was essential for the intron-element interaction enhancement. PMID:27806110

  17. A Leader Intron of a Soybean Elongation Factor 1A (eEF1A) Gene Interacts with Proximal Promoter Elements to Regulate Gene Expression in Synthetic Promoters.

    PubMed

    Zhang, Ning; McHale, Leah K; Finer, John J

    2016-01-01

    Introns, especially the first intron in the 5' untranslated region (5'UTR), can significantly impact gene expression via intron-mediated enhancement (IME). In this study, we demonstrate the leader intron of a soybean elongation factor 1A (eEF1A) gene (GmScreamM8) was essential for the high activity of the native promoter. Furthermore, the interaction of the GmScreamM8 leader intron with regulatory element sequences from several soybean eEF1A promoters was studied using synthetic promoters, which consisted of element tetramers upstream of a core promoter used to regulate a green fluorescent protein (gfp) reporter gene. Element tetramers, placed upstream of a GmScreamM8 core promoter, showed very high activity using both transient expression in lima bean cotyledons and stable expression in soybean hairy roots, only if the native leader intron was included, suggesting an interaction between intronic sequences and promoter elements. Partial deletions of the leader intron showed that a 222 bp intronic sequence significantly contributed to very high levels of GFP expression. Generation of synthetic intron variants with a monomeric or trimeric repeat of the 222 bp intronic sequence, yielded almost two-fold higher expression compared to the original intron, while partial deletion of the 222 bp intronic repeated sequence significantly decreased gene expression, indicating that this intronic sequence was essential for the intron-element interaction enhancement.

  18. Detection and Visualization of Compositionally Similar cis-Regulatory Element Clusters in Orthologous and Coordinately Controlled Genes

    PubMed Central

    Jegga, Anil G.; Sherwood, Shawn P.; Carman, James W.; Pinski, Andrew T.; Phillips, Jerry L.; Pestian, John P.; Aronow, Bruce J.

    2002-01-01

    Evolutionarily conserved noncoding genomic sequences represent a potentially rich source for the discovery of gene regulatory regions. However, detecting and visualizing compositionally similar cis-element clusters in the context of conserved sequences is challenging. We have explored potential solutions and developed an algorithm and visualization method that combines the results of conserved sequence analyses (BLASTZ) with those of transcription factor binding site analyses (MatInspector) (http://trafac.chmcc.org). We define hits as the density of co-occurring cis-element transcription factor (TF)-binding sites measured within a 200-bp moving average window through phylogenetically conserved regions. The results are depicted as a Regulogram, in which the hit count is plotted as a function of position within each of the two genomic regions of the aligned orthologs. Within a high-scoring region, the relative arrangement of shared cis-elements within compositionally similar TF-binding site clusters is depicted in a Trafacgram. On the basis of analyses of several training data sets, the approach also allows for the detection of similarities in composition and relative arrangement of cis-element clusters within nonorthologous genes, promoters, and enhancers that exhibit coordinate regulatory properties. Known functional regulatory regions of nonorthologous and less-conserved orthologous genes frequently showed cis-element shuffling, demonstrating that compositional similarity can be more sensitive than sequence similarity. These results show that combining sequence similarity with cis-element compositional similarity provides a powerful aid for the identification of potential control regions. PMID:12213778

  19. Detection and visualization of compositionally similar cis-regulatory element clusters in orthologous and coordinately controlled genes.

    PubMed

    Jegga, Anil G; Sherwood, Shawn P; Carman, James W; Pinski, Andrew T; Phillips, Jerry L; Pestian, John P; Aronow, Bruce J

    2002-09-01

    Evolutionarily conserved noncoding genomic sequences represent a potentially rich source for the discovery of gene regulatory regions. However, detecting and visualizing compositionally similar cis-element clusters in the context of conserved sequences is challenging. We have explored potential solutions and developed an algorithm and visualization method that combines the results of conserved sequence analyses (BLASTZ) with those of transcription factor binding site analyses (MatInspector) (http://trafac.chmcc.org). We define hits as the density of co-occurring cis-element transcription factor (TF)-binding sites measured within a 200-bp moving average window through phylogenetically conserved regions. The results are depicted as a Regulogram, in which the hit count is plotted as a function of position within each of the two genomic regions of the aligned orthologs. Within a high-scoring region, the relative arrangement of shared cis-elements within compositionally similar TF-binding site clusters is depicted in a Trafacgram. On the basis of analyses of several training data sets, the approach also allows for the detection of similarities in composition and relative arrangement of cis-element clusters within nonorthologous genes, promoters, and enhancers that exhibit coordinate regulatory properties. Known functional regulatory regions of nonorthologous and less-conserved orthologous genes frequently showed cis-element shuffling, demonstrating that compositional similarity can be more sensitive than sequence similarity. These results show that combining sequence similarity with cis-element compositional similarity provides a powerful aid for the identification of potential control regions.

  20. Hypoxia-induced endothelial NO synthase gene transcriptional activation is mediated through the tax-responsive element in endothelial cells.

    PubMed

    Min, Jiho; Jin, Yoon-Mi; Moon, Je-Sung; Sung, Min-Sun; Jo, Sangmee Ahn; Jo, Inho

    2006-06-01

    Although hypoxia is known to induce upregulation of endothelial NO synthase (eNOS) gene expression, the underlying mechanism is largely unclear. In this study, we show that hypoxia increases eNOS gene expression through the binding of phosphorylated cAMP-responsive element binding (CREB) protein (pCREB) to the eNOS gene promoter. Hypoxia (1% O2) increased both eNOS expression and NO production, peaking at 24 hours, in bovine aortic endothelial cells, and these increases were accompanied by increases in pCREB. Treatment with the protein kinase A inhibitor H-89 or transfection with dominant-negative inhibitor of CREB reversed the hypoxia-induced increases in eNOS expression and NO production, with concomitant inhibition of the phosphorylation of CREB induced by hypoxia, suggesting an involvement of protein kinase A/pCREB-mediated pathway. To map the regulatory elements of the eNOS gene responsible for pCREB binding under hypoxia, we constructed an eNOS gene promoter (-1600 to +22 nucleotides) fused with a luciferase reporter gene [pGL2-eNOS(-1600)]. Hypoxia (for 24-hour incubation) increased the promoter activity by 2.36+/-0.18-fold in the bovine aortic endothelial cells transfected with pGL2-eNOS(-1600). However, progressive 5'-deletion from -1600 to -873 completely attenuated the hypoxia-induced increase in promoter activity. Electrophoretic mobility shift, anti-pCREB antibody supershift, and site-specific mutation analyses showed that pCREB is bound to the Tax-responsive element (TRE) site, a cAMP-responsive element-like site, located at -924 to -921 of the eNOS promoter. Our data demonstrate that the interaction between pCREB and the Tax-responsive element site within the eNOS promoter may represent a novel mechanism for the mediation of hypoxia-stimulated eNOS gene expression.

  1. In and out of the rRNA genes: characterization of Pokey elements in the sequenced Daphnia genome

    PubMed Central

    2013-01-01

    Background Only a few transposable elements are known to exhibit site-specific insertion patterns, including the well-studied R-element retrotransposons that insert into specific sites within the multigene rDNA. The only known rDNA-specific DNA transposon, Pokey (superfamily: piggyBac) is found in the freshwater microcrustacean, Daphnia pulex. Here, we present a genome-wide analysis of Pokey based on the recently completed whole genome sequencing project for D. pulex. Results Phylogenetic analysis of Pokey elements recovered from the genome sequence revealed the presence of four lineages corresponding to two divergent autonomous families and two related lineages of non-autonomous miniature inverted repeat transposable elements (MITEs). The MITEs are also found at the same 28S rRNA gene insertion site as the Pokey elements, and appear to have arisen as deletion derivatives of autonomous elements. Several copies of the full-length Pokey elements may be capable of producing an active transposase. Surprisingly, both families of Pokey possess a series of 200 bp repeats upstream of the transposase that is derived from the rDNA intergenic spacer (IGS). The IGS sequences within the Pokey elements appear to be evolving in concert with the rDNA units. Finally, analysis of the insertion sites of Pokey elements outside of rDNA showed a target preference for sites similar to the specific sequence that is targeted within rDNA. Conclusions Based on the target site preference of Pokey elements and the concerted evolution of a segment of the element with the rDNA unit, we propose an evolutionary path by which the ancestors of Pokey elements have invaded the rDNA niche. We discuss how specificity for the rDNA unit may have evolved and how this specificity has played a role in the long-term survival of these elements in the subgenus Daphnia. PMID:24059783

  2. Androgen receptor stimulates bone sialoprotein (BSP) gene transcription via cAMP response element and activator protein 1/glucocorticoid response elements.

    PubMed

    Takai, Hideki; Nakayama, Youhei; Kim, Dong-Soon; Arai, Masato; Araki, Shouta; Mezawa, Masaru; Nakajima, Yu; Kato, Naoko; Masunaga, Hiroshi; Ogata, Yorimasa

    2007-09-01

    Bone sialoprotein (BSP) is an early marker of osteoblast differentiation. Androgens are steroid hormones that are essential for skeletal development. The androgen receptor (AR) is a transcription factor and a member of the steroid receptor superfamily that plays an important role in male sexual differentiation and prostate cell proliferation. To determine the molecular mechanism involved in the stimulation of bone formation, we have analyzed the effects of androgens and AR effects on BSP gene transcription. AR protein levels were increased after AR overexpression in ROS17/2.8 cells. BSP mRNA levels were increased by AR overexpression. However, the endogenous and overexpressed BSP mRNA levels were not changed by DHT (10(-8) M, 24 h). Whereas luciferase (LUC) activities in all constructs, including a short construct (nts -116 to +60), were increased by AR overexpression, the basal and LUC activities enhanced by AR overexpression were not induced by DHT (10(-8)M, 24 h). The effect of AR overexpression was abrogated by 2 bp mutations in either the cAMP response element (CRE) or activator protein 1 (AP1)/glucocorticoid response element (GRE). Gel shift analyses showed that AR overexpression increased binding to the CRE and AP1/GRE elements. Notably, the CRE-protein complexes were supershifted by phospho-CREB antibody, and CREB, c-Fos, c-Jun, and AR antibodies disrupted the complexes formation. The AP1/GRE-protein complexes were supershifted by c-Fos antibody and c-Jun, and AR antibodies disrupted the complexes formation. These studies demonstrate that AR stimulates BSP gene transcription by targeting the CRE and AP1/GRE elements in the promoter of the rat BSP gene.

  3. Sequence elements in the human osteocalcin gene confer basal activation and inducible response to hormonal vitamin D3.

    PubMed

    Kerner, S A; Scott, R A; Pike, J W

    1989-06-01

    Osteoblast-specific expression of the bone protein osteocalcin is controlled at the transcriptional level by the steroid hormone 1 alpha,25-dihydroxyvitamin D3. As this protein may represent a marker for bone activity in human disease, we examined the regulation of its expression at the molecular level by evaluating human osteocalcin gene promoter function. We describe regions within the promoter that contribute to basal expression of the gene in osteoblast-like cells in culture. Further, we define a 21-base-pair DNA element with the sequence 5'-GTGACTCACCGGGTGAACGGG-3', which acts in cis to mediate 1 alpha,25-dihydroxyvitamin D3 inducibility of the osteocalcin gene. This response element bears sequence similarity with other short DNA segments, particularly those for estrogen and thyroid hormone, which act together with their respective trans-acting receptors to modulate gene transcription.

  4. Positive and negative functional interactions between promoter elements from different classes of RNA polymerase III-transcribed genes.

    PubMed Central

    Parry, H D; Mattaj, I W

    1990-01-01

    Consensus tRNA gene promoter elements, A and B boxes, were introduced into the coding sequence of a Xenopus U6 gene. Combinations in which A and B boxes were coupled to wild-type or mutant U6 promoters were made. In this way information about both the functions of individual promoter elements and functional relationships between different classes of RNA polymerase III promoter element were obtained. Mutants in which the U6 PSE was non-functional were rescued by the presence of a B box, indicating a degree of functional relationship between these two elements. Moreover, the B box acted to increase the transcriptional activity and competitive strength of the wild-type U6 promoter. In contrast, no evidence was obtained to suggest that a tRNA A box can interact productively with U6 promoter elements in the absence of a B box. Data obtained suggest that the U6 PSE functions as an 'adaptor', being necessary to enable the basal U6 promoter to respond to upstream enhancement. Certain combinations of U6 and tRNA promoter elements are shown to be mutually antagonistic by a mechanism which is likely to involve blockage of transcription initiation. In summary, the U6 and tRNA promoters are shown to consist of functionally related, but distinct, promoter elements whose interactions shed new light on their normal roles in transcription. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. Fig. 8. PMID:2323333

  5. Modular Utilization of Distal cis-Regulatory Elements Controls Ifng Gene Expression in T Cells Activated by Distinct Stimuli

    PubMed Central

    Balasubramani, Anand; Shibata, Yoichiro; Crawford, Gregory E.; Baldwin, Albert S.; Hatton, Robin D.; Weaver, Casey T.

    2010-01-01

    SUMMARY Distal cis-regulatory elements play essential roles in the T lineage-specific expression of cytokine genes. We have mapped interactions of three transacting factors – NF-κB, STAT4 and T-bet – with cis elements in the Ifng locus. We find that RelA is critical for optimal Ifng expression and is differentially recruited to multiple elements contingent upon T cell receptor (TCR) or interleukin-12 (IL-12) plus IL-18 signaling. RelA recruitment to at least four elements is dependent on T-bet-dependent remodeling of the Ifng locus and co-recruitment of STAT4. STAT4 and NF-κB therefore cooperate at multiple cis elements to enable NF-κB–dependent enhancement of Ifng expression. RelA recruitment to distal elements was similar in Th1 and Tc1 effector cells, although T-bet was dispensable in CD8 effectors. These results support a model of Ifng regulation in which distal cis-regulatory elements differentially recruit key transcription factors in a modular fashion to initiate gene transcription induced by distinct activation signals. PMID:20643337

  6. Megabase Level Sequencing Reveals Contrasted Organization and Evolution Patterns of the Wheat Gene and Transposable Element Spaces[W

    PubMed Central

    Choulet, Frédéric; Wicker, Thomas; Rustenholz, Camille; Paux, Etienne; Salse, Jérome; Leroy, Philippe; Schlub, Stéphane; Le Paslier, Marie-Christine; Magdelenat, Ghislaine; Gonthier, Catherine; Couloux, Arnaud; Budak, Hikmet; Breen, James; Pumphrey, Michael; Liu, Sixin; Kong, Xiuying; Jia, Jizeng; Gut, Marta; Brunel, Dominique; Anderson, James A.; Gill, Bikram S.; Appels, Rudi; Keller, Beat; Feuillet, Catherine

    2010-01-01

    To improve our understanding of the organization and evolution of the wheat (Triticum aestivum) genome, we sequenced and annotated 13-Mb contigs (18.2 Mb) originating from different regions of its largest chromosome, 3B (1 Gb), and produced a 2x chromosome survey by shotgun Illumina/Solexa sequencing. All regions carried genes irrespective of their chromosomal location. However, gene distribution was not random, with 75% of them clustered into small islands containing three genes on average. A twofold increase of gene density was observed toward the telomeres likely due to high tandem and interchromosomal duplication events. A total of 3222 transposable elements were identified, including 800 new families. Most of them are complete but showed a highly nested structure spread over distances as large as 200 kb. A succession of amplification waves involving different transposable element families led to contrasted sequence compositions between the proximal and distal regions. Finally, with an estimate of 50,000 genes per diploid genome, our data suggest that wheat may have a higher gene number than other cereals. Indeed, comparisons with rice (Oryza sativa) and Brachypodium revealed that a high number of additional noncollinear genes are interspersed within a highly conserved ancestral grass gene backbone, supporting the idea of an accelerated evolution in the Triticeae lineages. PMID:20581307

  7. An H3-H4 histone gene pair in the marine copepod Tigriopus californicus, contains an intergenic dyad symmetry element.

    PubMed

    Porter, D; Brown, D; Wells, D

    1991-01-01

    Histone genes are one of the most widely studied multigene families in eucaryotes. Over 200 histone genes have been sequenced, primarily in vertebrates, echinoderms, fungi and plants. We present here the structure and genomic orientation of an H3-H4 histone gene pair from the marine copepod, Tigriopus californicus. These histone gene sequences are the first to be determined for the class Crustacea and among the first to be determined for protostomes. The H4 and H3 genes in Tigriopus are shown to be adjacent, to have opposite polarity, and to contain a 26 bp region of dyad symmetry centrally located within the spacer region between the two genes. A similarly located dyad element has been found in yeast which contributes to the coordinated cell cycle control of the adjacent histone genes. The Tigriopus H3-H4 histone gene pair is clustered with one H2A and two H2B histone genes on a 15 kb genomic Bam H1 fragment. The H4 gene sequence predicts an H4 protein with an unusual serine to threonine substitution at the amino terminal residue. The H3 gene sequence predicts an H3 protein which is identical to the vertebrate H3.2 histone.

  8. Epstein–Barr virus transcription factor Zta acts through distal regulatory elements to directly control cellular gene expression

    PubMed Central

    Ramasubramanyan, Sharada; Osborn, Kay; Al-Mohammad, Rajaei; Naranjo Perez-Fernandez, Ijiel B.; Zuo, Jianmin; Balan, Nicolae; Godfrey, Anja; Patel, Harshil; Peters, Gordon; Rowe, Martin; Jenner, Richard G.; Sinclair, Alison J.

    2015-01-01

    Lytic replication of the human gamma herpes virus Epstein-Barr virus (EBV) is an essential prerequisite for the spread of the virus. Differential regulation of a limited number of cellular genes has been reported in B-cells during the viral lytic replication cycle. We asked whether a viral bZIP transcription factor, Zta (BZLF1, ZEBRA, EB1), drives some of these changes. Using genome-wide chromatin immunoprecipitation coupled to next-generation DNA sequencing (ChIP-seq) we established a map of Zta interactions across the human genome. Using sensitive transcriptome analyses we identified 2263 cellular genes whose expression is significantly changed during the EBV lytic replication cycle. Zta binds 278 of the regulated genes and the distribution of binding sites shows that Zta binds mostly to sites that are distal to transcription start sites. This differs from the prevailing view that Zta activates viral genes by binding exclusively at promoter elements. We show that a synthetic Zta binding element confers Zta regulation at a distance and that distal Zta binding sites from cellular genes can confer Zta-mediated regulation on a heterologous promoter. This leads us to propose that Zta directly reprograms the expression of cellular genes through distal elements. PMID:25779048

  9. Identification of a signal transduction response sequence element necessary for induction of a Dictyostelium discoideum gene by extracellular cyclic AMP.

    PubMed Central

    Pavlovic, J; Haribabu, B; Dottin, R P

    1989-01-01

    The signal transduction pathways that lead to gene induction are being intensively investigated in Dictyostelium discoideum. We have identified by deletion and transformation analysis a sequence element necessary for induction of a gene coding for uridine diphosphoglucose pyrophosphorylase (UDPGP1) of D. discoideum in response to extracellular cyclic AMP (cAMP). This regulatory element is located 380 base pairs upstream of the transcription start site and contains a G+C-rich partially palindromic sequence. It is not required for transcription per se but is required for induction of the gene in response to the stimulus of extracellular cAMP. The cAMP response sequence is also required for induction of the gene during normal development. A second A+T-rich cis-acting region located immediately downstream of the cAMP response sequence appears to be essential for the basal level of expression of the UDPGP1 gene. The position of the cAMP response element coincides with a DNase I-hypersensitive site that is observed when the UDPGP1 gene is actively transcribed. Images PMID:2557538

  10. Regulation of expression of the stress response gene, Osp94: identification of the tonicity response element and intracellular signalling pathways.

    PubMed

    Kojima, Ryoji; Randall, Jeffrey D; Ito, Eri; Manshio, Hiroyuki; Suzuki, Yoshio; Gullans, Steven R

    2004-06-15

    Osp94 (osmotic stress protein of 94 kDa) is known to be up-regulated by hypertonic and heat-shock stresses in mouse renal inner medullary collecting duct (mIMCD3) cells. To investigate the molecular mechanism of transcriptional regulation of the Osp94 gene under these stresses, we cloned and characterized the 5'-flanking region of the gene. Sequence analysis of the proximal 4 kb 5'-flanking region revealed a TATA-less G/C-rich promoter region containing a cluster of Sp1 sites. We also identified upstream sequence motifs similar to the consensus TonE/ORE (tonicity-response element/osmotic response element) as well as the consensus HSE (heat-shock element). Luciferase activities in cells transfected with reporter constructs containing a TonE/ORE-like element (Osp94-TonE; 5'-TGGAAAGGACCAG-3') and HSE enhanced reporter gene expression under hypertonic stress and heat-shock stress respectively. Electrophoretic gel mobility-shift assay showed a slowly migrating band binding to the Osp94-TonE probe, probably representing binding of TonEBP (TonE binding protein) to this enhancer element. Furthermore, treatment of mIMCD3 cells with MAPK (mitogen-activated protein kinase) inhibitors (SB203580, PD98059, U0126 and SP600125) and a proteasome inhibitor (MG132) suppressed the increase in Osp94 gene expression caused by hypertonic NaCl. These results indicate that the 5'-flanking region of Osp94 gene contains a hypertonicity sensitive cis -acting element, Osp94-TonE, which is distinct from a functional HSE. Furthermore, the MAPK and proteasome systems appear to be, at least in part, involved in hypertonic-stressmediated regulation of Osp94 through Osp94-TonE.

  11. Identification of a cis-acting regulatory element conferring inducibility of the atrial natriuretic factor gene in acute pressure overload.

    PubMed Central

    von Harsdorf, R; Edwards, J G; Shen, Y T; Kudej, R K; Dietz, R; Leinwand, L A; Nadal-Ginard, B; Vatner, S F

    1997-01-01

    To identify the cis-acting regulatory element(s) which control the induction of the atrial natriuretic factor (ANF) gene in acute pressure overload, DNA constructs consisting of promoter elements linked to a reporter gene were injected into the myocardium of dogs, which underwent aortic banding or were sham-operated. Expression of a reporter gene construct harboring the ANF promoter (-3400ANF) was induced 6-12-fold after 7 d of pressure overload. An internal deletion of 556 bp (nucleotide sequence -693 to -137) completely abrogated the inducibility of the ANF reporter gene construct. An activator protein-1 (AP1)-like site (-496 to -489) and a cAMP regulatory element (CRE) (-602 to -596) are located within the deleted sequence. Site-directed mutagenesis of the AP1-like site but not the CRE completely prevented the induction of this construct to acute pressure overload. Further, the AP1-like site was able to confer inducibility of a heterologous promoter (beta-myosin heavy chain) to higher values than controls. Gel mobility shift assay (GMSA) supershift analysis was performed using a radiolabeled probe of the ANF promoter (-506/-483) that included the AP1-like site (ATGAATCA) sequence, as well as a probe converted to contain an AP1 consensus sequence (ATGACTCA). GMSA analysis demonstrated that the ANF AP1-like element could bind both a constitutively expressed factor and the AP1 proteins, and conversion to a true AP1 site increased its affinity for AP1. However, 7 d after the onset of pressure overload, the AP1 proteins were present only at low levels, and the major complex formed by the ANF AP1-like probe was not supershifted by a jun antibody. Using a large animal model of pressure overload, we have demonstrated that a unique cis-acting element was primarily responsible for the overload induction of the ANF gene. PMID:9276748

  12. Hormone withdrawal triggers a premature and sustained gene activation from delayed secondary glucocorticoid response elements.

    PubMed

    Hess, P; Payvar, F

    1992-02-15

    Glucocorticoid regulatory elements, denoted GREs and delayed secondary GREs (sGREs), bind the purified glucocorticoid receptors via distinctive sequence motifs and confer a primary and delayed secondary hormone inducibility, respectively, upon a linked reporter construct in stably transfected mammalian cells. The delayed secondary responses, but not the primary responses, are preceded by a time lag of several hours and blocked by protein synthesis inhibitors. In this report, we further characterized and distinguished these hormonal inductions. A 206-base pair DNA fragment from the hepatic rat alpha 2u-globulin (RUG) gene, containing at least two delayed sGREs, was specifically activated by glucocorticoids in a dose-dependent manner via a process which is sensitive to receptor antagonist RU486. Delayed sGRE-stimulated production of correctly initiated transcripts was preceded by a time lag of 2 h, a time when the GRE-mediated induction had reached maximal levels. A pulse of glucocorticoids sustained maximal activation of the delayed secondary response but not the primary response. In fact, hormone withdrawal triggered a premature induction of this delayed secondary response, suggesting that delayed sGREs are under both negative and positive control of the hormone receptor. Two separable elements of the 206-base pair fragment, including the 29-base pair sequence of a single receptor binding site, activated the reporter expression as effectively with transient, pulsatile exposure to hormone as with continuous exposure. Our results suggest that the information content of a hormonal pulse is retained, or "memorized," more persistently by a receptor binding site of delayed sGREs than those of the prototypical GREs.

  13. Identification of cis elements necessary for glucocorticoid induction of growth hormone gene expression in chicken embryonic pituitary cells.

    PubMed

    Heuck-Knubel, Kristina; Proszkowiec-Weglarz, Monika; Narayana, Jyoti; Ellestad, Laura E; Prakobsaeng, Nattiya; Porter, Tom E

    2012-03-01

    Glucocorticoid (GC) treatment of rat or chicken embryonic pituitary (CEP) cells induces premature production of growth hormone (GH). GC induction of the GH gene requires ongoing protein synthesis, and the GH genes lack a canonical GC response element (GRE). To characterize cis-acting elements and identify trans-acting proteins involved in this process, we characterized the regulation of a luciferase reporter containing a fragment of the chicken GH gene (-1727/+48) in embryonic day 11 CEP cells. Corticosterone (Cort) increased luciferase activity and mRNA expression, and mRNA induction was blocked by protein synthesis inhibition. Through deletion analysis, we identified a GC-responsive region (GCRR) at -1045 to -954. The GCRR includes an ETS-1 binding site and a degenerate GRE (dGRE) half site. Nuclear proteins, including ETS-1, bound to a GCRR probe in electrophoretic mobility shift assays, and Cort regulated protein binding. Using chromatin immunoprecipitation, we found that ETS-1 and GC receptor (GR) were associated with the GCRR in CEP cells, and Cort increased GR recruitment to the GCRR. Mutation of the ETS-1 site or dGRE site in the -1045/+48 GH reporter abolished Cort responsiveness. We conclude that GC regulation of the GH gene during development requires cis-acting elements in the GCRR and involves ETS-1 and GR binding to these elements. Similar ETS-1 elements/dGREs are located in the 5'-flanking regions of GH genes in mammals, including rodents and humans. This is the first study to demonstrate involvement of ETS-1 in GC regulation of the GH gene during embryonic development in any species, enhancing our understanding of GH regulation in vertebrates.

  14. Regulation of mouse thymidylate synthase gene expression in growth-stimulated cells: upstream S phase control elements are indistinguishable from the essential promoter elements.

    PubMed Central

    Ash, J; Liao, W C; Ke, Y; Johnson, L F

    1995-01-01

    Expression of the mammalian thymidylate synthase (TS) gene in growth-stimulated cells is closely coordinated with entry into S phase. Previous studies with transfected TS minigenes have shown that sequences upstream of the coding region as well as an intron in the transcribed region are both necessary for proper regulation of TS mRNA content in growth-stimulated cells. The goal of the present study was to identify the upstream regulatory elements. Minigenes consisting of TS 5' flanking sequences linked to the TS coding region (interrupted by introns 1 and 2) were stably transfected into mouse 3T6 cells. Deletion and site-directed mutagenesis of the 5' flanking region revealed that there is a close correspondence between the upstream sequences that are necessary for S phase regulation and the 30 nucleotide region that is essential for promoter activity. These observations raised the possibility that regulation of the TS gene occurs at the transcriptional level. However, nuclear run-on assays showed that the rate of transcription of the TS gene changed very little during the G1-S phase transition. Furthermore, when the TS promoter was linked to an intron-less luciferase indicator gene, there was no change in expression following growth-stimulation. Therefore it appears that the TS gene is controlled primarily at the posttranscriptional level, and that the TS essential promoter region is necessary (although not sufficient) for proper S phase regulation. Images PMID:8524656

  15. Analysis of Response Elements Involved in the Regulation of the Human Neonatal Fc Receptor Gene (FCGRT)

    PubMed Central

    Mikulska, Joanna E.

    2015-01-01

    Human epithelial, endothelial and PMA-differentiated THP-1 cell lines were used as model systems to study the transcriptional regulation of the human FCGRT gene encoding the alpha chain of hFcRn. The data obtained from site-directed mutagenesis in transient transfection experiments indicate that the Sp1 sites at positions -641, -635, and -313, CF1/YY1 elements at positions -586 and -357, and the AP-1 motif at -276 within the-660/-233 fragment of the human FCGRT promoter (hFCGRT) participate in the regulation of human FCGRT in all selected cell lines. However, their individual contribution to promoter activity is not equivalent. The Sp1 binding site at -313 and the AP-1 site at -276 are critical for the activity of the hFCGRT promoter in epithelial and endothelial cells. Moreover, the CF1/YY1 site at -586 in differentiated THP-1 cells, plays an essential role in the transcriptional activity of the promoter. In addition, the C/EBPbeta binding site at -497 of the hFCGRT promoter in epithelial and endothelial cells, and the C/EBPbeta motif located at -497 and -233 within the hFCGRT promoter in differentiated THP-1 cells may function as positive regulatory sequences in response to LPS or PMA stimulation. EMSA and supershift analyses showed that the functionally identified binding motifs in the hFCGRT promoter were able to specifically interact with their corresponding (Sp1, Sp2, Sp3, c-Fos, c-Jun, YY1, and C/EBPbeta or C/EBPdelta) transcription factors (TFs), suggesting their possible involvement in the regulation of the human FCGRT gene expression. PMID:26252948

  16. Phylogenetic and Genomic Analyses Resolve the Origin of Important Plant Genes Derived from Transposable Elements.

    PubMed

    Joly-Lopez, Zoé; Hoen, Douglas R; Blanchette, Mathieu; Bureau, Thomas E

    2016-08-01

    Once perceived as merely selfish, transposable elements (TEs) are now recognized as potent agents of adaptation. One way TEs contribute to evolution is through TE exaptation, a process whereby TEs, which persist by replicating in the genome, transform into novel host genes, which persist by conferring phenotypic benefits. Known exapted TEs (ETEs) contribute diverse and vital functions, and may facilitate punctuated equilibrium, yet little is known about this process. To better understand TE exaptation, we designed an approach to resolve the phylogenetic context and timing of exaptation events and subsequent patterns of ETE diversification. Starting with known ETEs, we search in diverse genomes for basal ETEs and closely related TEs, carefully curate the numerous candidate sequences, and infer detailed phylogenies. To distinguish TEs from ETEs, we also weigh several key genomic characteristics including repetitiveness, terminal repeats, pseudogenic features, and conserved domains. Applying this approach to the well-characterized plant ETEs MUG and FHY3, we show that each group is paraphyletic and we argue that this pattern demonstrates that each originated in not one but multiple exaptation events. These exaptations and subsequent ETE diversification occurred throughout angiosperm evolution including the crown group expansion, the angiosperm radiation, and the primitive evolution of angiosperms. In addition, we detect evidence of several putative novel ETE families. Our findings support the hypothesis that TE exaptation generates novel genes more frequently than is currently thought, often coinciding with key periods of evolution. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  17. The mobile dso-gene-sso element in rolling-circle plasmids of staphylococci reflects the evolutionary history of its resistance gene.

    PubMed

    Wassenaar, T M; Cabal, A

    2017-09-01

    The qacC and lnuA genes of Staphylococcus species were recently proposed to comprise a mobile element when residing on rolling-circle plasmids. Here we present other examples of resistance genes on staphylococcal rolling-circle plasmids, including fosB producing resistance to fosfomycin, cat resulting in resistance to chloramphenicol and cadB for resistance to the toxic heavy metal cadmium. For three of these genes (qacC, lnuA and fosB), evidence was obtained that the genes have spread between different plasmid backgrounds. The lack of mutations in qacC suggests that the spread occurred relatively recently, while the build up of mutations in lnuA and fosB suggests their mobilization occurred in the more distant past. These observations can be explained by the use of the respective antibiotics over time. However, the cat and cadB genes sequences analysed had not collected any mutations, an observation that is not completely understood but possible explanations are discussed. We have analysed five resistance genes in Staphylococcus aureus that are positioned between the replication elements of rolling-circle plasmids. For three of these genes, evidence was obtained indicative of recent mobilization. The historical use of the antibiotics to which the genes produce resistance could be related to the number of mutations collected in these genes. However, two other resistance genes have not collected any mutations over time, and the reasons for this are discussed. The analyses presented provide insights into the spread and evolution of antibiotic resistance genes. © 2017 The Authors. Letters in Applied Microbiology published by John Wiley & Sons Ltd on behalf of The Society for Applied Microbiology.

  18. Identification of a peroxisome proliferator responsive element (PPRE)-like cis-element in mouse plasminogen activator inhibitor-1 gene promoter

    SciTech Connect

    Chen Jiegen; Li Xi; Huang Haiyan; Liu Honglei; Liu Deguo; Song Tanjing; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun . E-mail: qqtang@shmu.edu.cn

    2006-09-01

    PAI-1 is expressed and secreted by adipose tissue which may mediate the pathogenesis of obesity-associated cardiovascular complications. Evidence is presented in this report that PAI-1 is not expressed by preadipocyte, but significantly induced during 3T3-L1 adipocyte differentiation and the PAI-1 expression correlates with the induction of peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}). A peroxisome proliferator responsive element (PPRE)-like cis-element (-206TCCCCCATGCCCT-194) is identified in the mouse PAI-1 gene promoter by electrophoretic mobility shift assay (EMSA) combined with transient transfection experiments; the PPRE-like cis-element forms a specific DNA-protein complex only with adipocyte nuclear extracts, not with preadipocyte nuclear extracts; the DNA-protein complex can be totally competed away by non-labeled consensus PPRE, and can be supershifted with PPAR{gamma} antibody. Mutation of this PPRE-like cis-element can abolish the transactivation of mouse PAI-1 promoter mediated by PPAR{gamma}. Specific PPAR{gamma} ligand Pioglitazone can significantly induce the PAI-1 expression, and stimulate the secretion of PAI-1 into medium.

  19. Structure of DRE, a retrotransposable element which integrates with position specificity upstream of Dictyostelium discoideum tRNA genes.

    PubMed Central

    Marschalek, R; Hofmann, J; Schumann, G; Gösseringer, R; Dingermann, T

    1992-01-01

    Different Dictyostelium discoideum strains contain between 2 and 200 copies of a retrotransposable element termed DRE (Dictyostelium repetitive element). From the analysis of more than 50 elements, it can be concluded that DRE elements always occur 50 +/- 3 nucleotides upstream of tRNA genes. All analyzed clones contain DRE in a constant orientation relative to the tRNA gene, implying orientation specificity as well as position specificity. DRE contains two open reading frames which are flanked by nonidentical terminal repeats. Long terminal repeats (LTRs) are composed of three distinct modules, called A, B, and C. The tRNA gene-proximal LTR is characterized by one or multiple A modules followed by a single B module (AnB). With respect to the distal LTR, two different subforms of DRE have been isolated. The majority of isolated clones contains a distal LTR composed of a B module followed by a C module (BC), whereas the distal LTR of the other subform contains a consecutive array of a B module, a C module, a slightly altered A module, another B module, and another C module (BC.ABC). Full-length as well as smaller transcripts from DRE elements have been detected, but in comparison with the high copy number in D. discoideum strains derived from the wild-type strain NC4, transcription is rather poor. Images PMID:1309589

  20. Enhancer and promoter elements directing activation and glucocorticoid repression of the. cap alpha. /sub 1/-fetoprotein gene in hepatocytes

    SciTech Connect

    Guertin, M.; La Rue, H.; Bernier, D.; Wrange, O.; Chevrette, M.; Gingras, M.C.; Belanger, L.

    1988-04-01

    Mutations were introduced in 7 kilobases of 5'-flanking rat ..cap alpha../sub 1/-fetoprotein (AFP) genomic DNA, linked to the chloramphenicol acetyltransferase gene. AFP promoter activity and its repression by a glucocorticoid hormone were assessed by stable and transient expression assays. Stable transfection assays were more sensitive and accurate than transient expression assays in a Morris 7777 rat hepatoma recipient (Hepa7.6), selected for its strong AFP repression by dexamethasone. The segment of DNA encompassing a hepatocyte-constitutive chromatin DNase I-hypersensitive site at -3.7 kilobases and a liver developmental stage-specific site at -2.5 kilobases contains interacting enhancer elements sufficient for high AFP promoter activity in Hepa7.6 or HepG2 cells. Deletions and point mutations define an upstream promoter domain of AFP gene activation, operating with at least three distinct promoter-activating elements, PEI at -65 base pairs, PEII at -120 base pairs, and DE at -160 base pairs. PEI and PEII share homologies with albumin promoter sequences, PEII is a near-consensus nuclear factor I recognition sequence, and DE overlaps a glucocorticoid receptor recognition sequence. An element conferring glucocorticoid repression of AFP gene activity is located in the upstream AFP promoter domain. Receptor-binding assays indicate that this element is the glucocorticoid receptor recognition sequence which overlaps with promoter-activating element DE.

  1. The transcription factor c-Myc enhances KIR gene transcription through direct binding to an upstream distal promoter element

    PubMed Central

    Cichocki, Frank; Hanson, Rebecca J.; Lenvik, Todd; Pitt, Michelle; McCullar, Valarie; Li, Hongchuan; Anderson, Stephen K.

    2009-01-01

    The killer cell immunoglobulin-like receptor (KIR) repertoire of natural killer (NK) cells determines their ability to detect infected or transformed target cells. Although epigenetic mechanisms play a role in KIR gene expression, work in the mouse suggests that other regulatory elements may be involved at specific stages of NK-cell development. Here we report the effects of the transcription factor c-Myc on KIR expression. c-Myc directly binds to, and promotes transcription from, a distal element identified upstream of most KIR genes. Binding of endogenous c-Myc to the distal promoter element is significantly enhanced upon interleukin-15 (IL-15) stimulation in peripheral blood NK cells and correlates with an increase in KIR transcription. In addition, the overexpression of c-Myc during NK-cell development promotes transcription from the distal promoter element and contributes to the overall transcription of multiple KIR genes. Our data demonstrate the significance of the 5′ promoter element upstream of the conventional KIR promoter region and support a model whereby IL-15 stimulates c-Myc binding at the distal KIR promoter during NK-cell development to promote KIR transcription. This finding provides a direct link between NK-cell activation signals and KIR expression required for acquisition of effector function during NK-cell education. PMID:18987359

  2. Transformation mapping of the regulatory elements of the ecdysone-inducible P1 gene of Drosophila melanogaster

    SciTech Connect

    Maschat, F.; Dubertret, M.L.; Lepesant, J.A. )

    1991-05-01

    The transcription of the P1 gene is induced by 20-hydroxyecdysone in fat bodies of third-instar larvae. Germ line transformation showed that sequences between {minus}138 to +276 contain elements required for a qualitatively correct developmental and hormonal regulation of P1 transcription. Sequences from {minus}138 to {minus}68 are essential for this expression.

  3. Tandem insertion sequence-like elements define the expression site for variable antigen genes of Borrelia hermsii.

    PubMed Central

    Barbour, A G; Carter, C J; Burman, N; Freitag, C S; Garon, C F; Bergström, S

    1991-01-01

    The spirochete Borrelia hermsii avoids the immune response of its mammalian host through multiphasic antigenic variation. Serotype specificity is determined by variable antigens, Vmp proteins, in the outer membrane. Through nonreciprocal recombination between linear plasmids, a formerly silent vmp gene replaces another vmp gene downstream from a common expression site. To further characterize this activating site, we determined the nucleotide sequence of 6.9 kb of the common upstream expression region of strain HS1 of B. hermsii. Preceding the vmp gene promoter and a poly(dT.dA) run were three imperfectly repeated segments of 2 kb. Each of the 2-kb segments contained 1-kb elements with inverted repeats of approximately 0.2 kb each at their termini. The potential of the 1-kb elements to form stem-and-loop structures was demonstrated by heteroduplex analysis. There was no evidence of the presence of the elements elsewhere in the genome of B. hermsii. One or more of these elements may confer the unidirectionality that characterizes vmp gene switches. Images PMID:1987053

  4. A tale of two dead ends: origin of a potential new gene and a potential new transposable element.

    PubMed

    Clutterbuck, A John

    2007-03-01

    An article in this issue of Molecular Microbiology by Cultrone et al. describes how a non-autonomous helitron element could arise from its autonomous parent transposon by deletion followed by readthrough into an adjacent gene and its promoter, thus providing a mechanism for distribution of a specifically regulated promoter sequence around the genome, where it would have the potential to evolve new functions.

  5. Importance of Mobile Genetic Elements and Conjugal Gene Transfer for Subsurface Microbial Community Adaptation to Biotransformation of Metals

    SciTech Connect

    Sorensen, Soren J.

    2005-06-01

    The overall goal of this project is to investigate the effect of mobile genetic elements and conjugal gene transfer on subsurface microbial community adaptation to mercury and chromium stress and biotransformation. Our studies focus on the interaction between the fate of these metals in the subsurface and the microbial community structure and activity.

  6. Transcription of gypsy elements in a Y-chromosome male fertility gene of Drosophila hydei

    SciTech Connect

    Hochstenbach, R.; Harhangi, H.; Hennig, W.

    1996-02-01

    We have found that defective gypsy retrotransposons are a major constituent of the lampbrush loop pair Nooses in the short arm of Y chromosome of Drosophila hydei. The loop pair is formed by male fertility gene Q during the primary spermatocyte stage of spermatogenesis, each loop being a single transcription unit with an estimated length of 260 kb. Using fluorescent in situ hybridization, we show that throughout the loop transcripts gypsy elements are interspersed with blocks of a tandemly repetitive Y-specific DNA sequence, ayl. Nooses transcripts containing both sequence types show a wide size range on Northern blots, do not migrate to the cytoplasm, and are degraded just before the first meiotic division. Only one strand of ayl and only the coding strand of gypsy can be detected in the loop transcripts. However, as cloned genomic DNA fragments also display opposite orientations of ayl and gypsy, such DNA sections cannot be part of the Nooses. Hence, they are most likely derived from the flanking heterochromatin. The direction of transcription of ayl and gypsy thus appears to be of a functional significance. 76 refs., 5 figs.

  7. Sludge bio-drying: Effective to reduce both antibiotic resistance genes and mobile genetic elements.

    PubMed

    Zhang, Junya; Sui, Qianwen; Tong, Juan; Buhe, Chulu; Wang, Rui; Chen, Meixue; Wei, Yuansong

    2016-12-01

    Sewage sludge is considered as one of major contributors to the increased environmental burden of ARGs. Sludge bio-drying was increasingly adopted due to its faster sludge reduction compared with composting. The fate of ARGs during full-scale sludge bio-drying was investigated to determine whether it could effectively reduce ARGs, and the contributions of bacterial community, horizontal gene transfer (HGT) through mobile genetic elements (MGEs) and co-selection from heavy metals to ARGs profiles were discussed in detail. Two piles with different aeration strategies (Pile I, the improved and Pile II, the control) were operated to elucidate effects of aeration strategy on ARGs profiles. Results showed that sludge bio-drying could effectively reduce both most of targeted ARGs (0.4-3.1 logs) and MGEs (0.8-3.3 logs) by the improved aeration strategy, which also enhanced both the sludge bio-drying performance and ARGs reduction. The enrichment of ARGs including ermF, tetX and sulII could be well explained by the evolution of bioavailable heavy metals, not HGT through MGEs, and their potential host bacteria mainly existed in Bacteroidetes. Although changes of bacterial community contributed the most to ARGs profiles, HGT through MGEs should be paid more attention especially in the thermophilic stage of sludge bio-drying.

  8. Comparative genomics reveals a functional thyroid-specific element in the far upstream region of the PAX8 gene

    PubMed Central

    2010-01-01

    Background The molecular mechanisms leading to a fully differentiated thyrocite are still object of intense study even if it is well known that thyroglobulin, thyroperoxidase, NIS and TSHr are the marker genes of thyroid differentiation. It is also well known that Pax8, TTF-1, Foxe1 and Hhex are the thyroid-enriched transcription factors responsible for the expression of the above genes, thus are responsible for the differentiated thyroid phenotype. In particular, the role of Pax8 in the fully developed thyroid gland was studied in depth and it was established that it plays a key role in thyroid development and differentiation. However, to date the bases for the thyroid-enriched expression of this transcription factor have not been unraveled yet. Here, we report the identification and characterization of a functional thyroid-specific enhancer element located far upstream of the Pax8 gene. Results We hypothesized that regulatory cis-acting elements are conserved among mammalian genes. Comparison of a genomic region extending for about 100 kb at the 5'-flanking region of the mouse and human Pax8 gene revealed several conserved regions that were tested for enhancer activity in thyroid and non-thyroid cells. Using this approach we identified one putative thyroid-specific regulatory element located 84.6 kb upstream of the Pax8 transcription start site. The in silico data were verified by promoter-reporter assays in thyroid and non-thyroid cells. Interestingly, the identified far upstream element manifested a very high transcriptional activity in the thyroid cell line PC Cl3, but showed no activity in HeLa cells. In addition, the data here reported indicate that the thyroid-enriched transcription factor TTF-1 is able to bind in vitro and in vivo the Pax8 far upstream element, and is capable to activate transcription from it. Conclusions Results of this study reveal the presence of a thyroid-specific regulatory element in the 5' upstream region of the Pax8 gene. The

  9. The human involucrin gene is transcriptionally repressed through a tissue-specific silencer element recognized by Oct-2.

    PubMed

    Azuara-Liceaga, Elisa; Sandoval, Marisol; Corona, Matilde; Gariglio, Patricio; López-Bayghen, Esther

    2004-05-28

    Involucrin is an important marker of epithelial differentiation which expression is upregulated just after basal cells are pushed into the suprabasal layer in stratified epithelia. Several transcription factors and regulatory elements had been described as responsible for turning on the gene. However, it is evident that in basal cell layer, additional mechanisms are involved in keeping the gene silent before the differentiation process starts. In this work, we located a potential transcriptional silencer in a 52bp sequence whose integrity is necessary for silencing the proximal enhancer promoter element (PEP) in multiplying keratinocytes. Octamer-binding sites were noticed in this fragment and the specific binding of Oct-2 transcription factor was detected. Oct-2 appears to be implicated in an epithelial-specific repression activity recorded only in keratinocytes and C33-A cell line. Overexpression of Oct-2 repressed the involucrin promoter activity in epithelial cells and in the presence of the silencer element.

  10. Segregation of cardiac and skeletal muscle-specific regulatory elements of the beta-myosin heavy chain gene.

    PubMed Central

    Rindt, H; Knotts, S; Robbins, J

    1995-01-01

    The beta-myosin heavy chain (beta-MyHC) gene is expressed in cardiac and slow skeletal muscles. To examine the regulatory sequences that are required for the gene's expression in the two compartments in vivo, we analyzed the expression pattern of a transgene consisting of the beta-MyHC gene 5' upstream region linked to the chloramphenicol acetyltransferase reporter gene. By using 5600 bp of 5' upstream region, the transgene was expressed at high levels in the slow skeletal muscles. Decreased levels of thyroid hormone led to the up-regulation of the transgene in both cardiac and skeletal muscles, mimicking the behavior of the endogenous beta-MyHC gene. After deleting the distal 5000 bp, the level of reporter gene expression was strongly reduced. However, decreased levels of thyroid hormone led to an 80-fold skeletal muscle-specific increase in transgene expression, even upon the ablation of a conserved cis-regulatory element termed MCAT, which under normal (euthyroid) conditions abolishes muscle-specific expression. In contrast, cardiac-specific induction was not detected with the deletion construct. These observations indicate that the cardiac and skeletal muscle regulatory elements can be functionally segregated on the beta-MyHC gene promoter. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:7878016

  11. Segregation of cardiac and skeletal muscle-specific regulatory elements of the beta-myosin heavy chain gene.

    PubMed

    Rindt, H; Knotts, S; Robbins, J

    1995-02-28

    The beta-myosin heavy chain (beta-MyHC) gene is expressed in cardiac and slow skeletal muscles. To examine the regulatory sequences that are required for the gene's expression in the two compartments in vivo, we analyzed the expression pattern of a transgene consisting of the beta-MyHC gene 5' upstream region linked to the chloramphenicol acetyltransferase reporter gene. By using 5600 bp of 5' upstream region, the transgene was expressed at high levels in the slow skeletal muscles. Decreased levels of thyroid hormone led to the up-regulation of the transgene in both cardiac and skeletal muscles, mimicking the behavior of the endogenous beta-MyHC gene. After deleting the distal 5000 bp, the level of reporter gene expression was strongly reduced. However, decreased levels of thyroid hormone led to an 80-fold skeletal muscle-specific increase in transgene expression, even upon the ablation of a conserved cis-regulatory element termed MCAT, which under normal (euthyroid) conditions abolishes muscle-specific expression. In contrast, cardiac-specific induction was not detected with the deletion construct. These observations indicate that the cardiac and skeletal muscle regulatory elements can be functionally segregated on the beta-MyHC gene promoter.

  12. Binding of TFIIIC to sine elements controls the relocation of activity-dependent neuronal genes to transcription factories.

    PubMed

    Crepaldi, Luca; Policarpi, Cristina; Coatti, Alessandro; Sherlock, William T; Jongbloets, Bart C; Down, Thomas A; Riccio, Antonella

    2013-01-01

    In neurons, the timely and accurate expression of genes in response to synaptic activity relies on the interplay between epigenetic modifications of histones, recruitment of regulatory proteins to chromatin and changes to nuclear structure. To identify genes and regulatory elements responsive to synaptic activation in vivo, we performed a genome-wide ChIPseq analysis of acetylated histone H3 using somatosensory cortex of mice exposed to novel enriched environmental (NEE) conditions. We discovered that Short Interspersed Elements (SINEs) located distal to promoters of activity-dependent genes became acetylated following exposure to NEE and were bound by the general transcription factor TFIIIC. Importantly, under depolarizing conditions, inducible genes relocated to transcription factories (TFs), and this event was controlled by TFIIIC. Silencing of the TFIIIC subunit Gtf3c5 in non-stimulated neurons induced uncontrolled relocation to TFs and transcription of activity-dependent genes. Remarkably, in cortical neurons, silencing of Gtf3c5 mimicked the effects of chronic depolarization, inducing a dramatic increase of both dendritic length and branching. These findings reveal a novel and essential regulatory function of both SINEs and TFIIIC in mediating gene relocation and transcription. They also suggest that TFIIIC may regulate the rearrangement of nuclear architecture, allowing the coordinated expression of activity-dependent neuronal genes.

  13. Binding of TFIIIC to SINE Elements Controls the Relocation of Activity-Dependent Neuronal Genes to Transcription Factories

    PubMed Central

    Crepaldi, Luca; Policarpi, Cristina; Coatti, Alessandro; Sherlock, William T.; Jongbloets, Bart C.; Down, Thomas A.; Riccio, Antonella

    2013-01-01

    In neurons, the timely and accurate expression of genes in response to synaptic activity relies on the interplay between epigenetic modifications of histones, recruitment of regulatory proteins to chromatin and changes to nuclear structure. To identify genes and regulatory elements responsive to synaptic activation in vivo, we performed a genome-wide ChIPseq analysis of acetylated histone H3 using somatosensory cortex of mice exposed to novel enriched environmental (NEE) conditions. We discovered that Short Interspersed Elements (SINEs) located distal to promoters of activity-dependent genes became acetylated following exposure to NEE and were bound by the general transcription factor TFIIIC. Importantly, under depolarizing conditions, inducible genes relocated to transcription factories (TFs), and this event was controlled by TFIIIC. Silencing of the TFIIIC subunit Gtf3c5 in non-stimulated neurons induced uncontrolled relocation to TFs and transcription of activity-dependent genes. Remarkably, in cortical neurons, silencing of Gtf3c5 mimicked the effects of chronic depolarization, inducing a dramatic increase of both dendritic length and branching. These findings reveal a novel and essential regulatory function of both SINEs and TFIIIC in mediating gene relocation and transcription. They also suggest that TFIIIC may regulate the rearrangement of nuclear architecture, allowing the coordinated expression of activity-dependent neuronal genes. PMID:23966877

  14. Identification of the mismatch repair genes PMS2 and MLH1 as p53 target genes by using serial analysis of binding elements

    PubMed Central

    Chen, Jiguo; Sadowski, Ivan

    2005-01-01

    The ability to determine the global location of transcription factor binding sites in vivo is important for a comprehensive understanding of gene regulation in human cells. We have developed a technology, called serial analysis of binding elements (SABE), involving subtractive hybridization of chromatin immunoprecipitation-enriched DNA fragments followed by the generation and analysis of concatamerized sequence tags. We applied the SABE technology to search for p53 target genes in the human genome, and have identified several previously described p53 targets in addition to numerous potentially novel targets, including the DNA mismatch repair genes MLH1 and PMS2. Both of these genes were determined to be responsive to DNA damage and p53 activation in normal human fibroblasts, and have p53-response elements within their first intron. These two genes may serve as a sensor in DNA repair mechanisms and a critical determinant for the decision between cell-cycle arrest and apoptosis. These results also demonstrate the potential for use of SABE as a broadly applicable means to globally identify regulatory elements for human transcription factors in vivo. PMID:15781865

  15. Insertions of IS256-like element flanking the chromosomal beta-lactamase gene of Enterococcus faecalis CX19.

    PubMed Central

    Rice, L B; Marshall, S H

    1994-01-01

    We have previously identified an inverted repeat characteristic of staphylococcal beta-lactamase transposons adjacent to the chromosomal beta-lactamase genes of Enterococcus faecalis CH19 and its beta-lactamase-producing transconjugant CX19. Nucleotide sequence analysis of the CH19 beta-lactamase structural gene (blaZ) reveals it to be identical to the blaZ gene from E. faecalis HH22 and to the blaZ gene from the staphylococcal beta-lactamase transposon Tn552. We also report the presence of nucleotide sequence identical to a 317-bp region of the staphylococcal insertion sequence IS256 upstream of the blaZ gene in both CH19 and CX19. The identical segment of IS256 is present downstream of the blaZ gene of CX19, suggesting a second insertion of the element (in the inverted orientation) accompanying transfer to the recipient strain. Restriction analysis of the areas beyond the ClaI sites used to clone these regions suggests that full copies of the IS256-like element (designated IS256E) are present in all positions but that these elements were not directly involved in the transfer of the beta-lactamase gene to the recipient strain. We have also identified a region downstream of the second IS256E insertion site which exhibits substantial homology to ISSIW, an iso-ISSI insertion originally identified in Lactococcus lactis subsp. cremoris. These data suggest that the two enterococcal blaZ genes sequenced to date evolved from a common ancestor and may at one time have been incorporated into a transposon similar to Tn552. They also suggest that IS256-like elements are mobile in E. faecalis and capable of inserting in a manner consistent with the formation of novel composite transposons. Finally, they provide the first confirmation of the presence of an ISSI-like element in enterococci, raising the possibility that these elements play a role in the exchange of chromosomal antimicrobial resistance determinants. Images PMID:8031032

  16. Transcriptional Regulation of the Gene Encoding an Alcohol Dehydrogenase in the Archaeon Sulfolobus solfataricus Involves Multiple Factors and Control Elements

    PubMed Central

    Fiorentino, Gabriella; Cannio, Raffaele; Rossi, Mosè; Bartolucci, Simonetta

    2003-01-01

    A transcriptionally active region has been identified in the 5′ flanking region of the alcohol dehydrogenase gene of the crenarchaeon Sulfolobus solfataricus through the evaluation of the activity of putative transcriptional regulators and the role of the region upstream of the gene under specific metabolic circumstances. Electrophoretic mobility shift assays with crude extracts revealed protein complexes that most likely contain TATA box-associated factors. When the TATA element was deleted from the region, binding sites for both DNA binding proteins, such as the small chromatin structure-modeling Sso7d and Sso10b (Alba), and transcription factors, such as the repressor Lrs14, were revealed. To understand the molecular mechanisms underlying the substrate-induced expression of the adh gene, the promoter was analyzed for the presence of cis-acting elements recognized by specific transcription factors upon exposure of the cell to benzaldehyde. Progressive dissection of the identified promoter region restricted the analysis to a minimal responsive element (PAL) located immediately upstream of the transcription factor B-responsive element-TATA element, resembling typical bacterial regulatory sequences. A benzaldehyde-activated transcription factor (Bald) that specifically binds to the PAL cis-acting element was also identified. This protein was purified from heparin-fractionated extracts of benzaldehyde-induced cells and was shown to have a molecular mass of ∼16 kDa. The correlation between S. solfataricus adh gene activation and benzaldehyde-inducible occupation of a specific DNA sequence in its promoter suggests that a molecular signaling mechanism is responsible for the switch of the aromatic aldehyde metabolism as a response to environmental changes. PMID:12813087

  17. A common element involved in transcriptional regulation of two DNA alkylation repair genes (MAG and MGT1) of Saccharomyces cerevisiae.

    PubMed Central

    Xiao, W; Singh, K K; Chen, B; Samson, L

    1993-01-01

    The Saccharomyces cerevisiae MAG gene encodes a 3-methyladenine DNA glycosylase that protects cells from killing by alkylating agents. MAG mRNA levels are induced not only by alkylating agents but also by DNA-damaging agents that do not produce alkylated DNA. We constructed a MAG-lacZ gene fusion to help identify the cis-acting promoter elements involved in regulating MAG expression. Deletion analysis defined the presence of one upstream activating sequence and one upstream repressing sequence (URS) and suggested the presence of a second URS. One of the MAG URS elements matches a decamer consensus sequence present in the promoters of 11 other S. cerevisiae DNA repair and metabolism genes, including the MGT1 gene, which encodes an O6-methylguanine DNA repair methyltransferase. Two proteins of 26 and 39 kDa bind specifically to the MAG and MGT1 URS elements. We suggest that the URS-binding proteins may play an important role in the coordinate regulation of these S. cerevisiae DNA repair genes. Images PMID:8246943

  18. Identification of a functional antioxidant responsive element in the promoter of the Chinese hamster carbonyl reductase 3 (Chcr3) gene.

    PubMed

    Miura, Takeshi; Taketomi, Ayako; Nakabayashi, Toshikatsu; Nishinaka, Toru; Terada, Tomoyuki

    2015-07-01

    CHCR3, a member of the short-chain dehydrogenase/reductase superfamily, is a carbonyl reductase 3 enzyme in Chinese hamsters. Carbonyl reductase 3 in humans has been believed to involve the metabolism and/or pharmacokinetics of anthracycline drugs, and the mechanism underlying the gene regulation has been investigated. In this study, the nucleotide sequence of the Chcr3 promoter was originally determined, and its promoter activity was characterised. The proximal promoter region is TATA-less and GC-rich, similar to the promoter region of human carbonyl reductase 3. Cobalt stimulated the transcriptional activity of the Chcr3 gene. The results of a luciferase gene reporter assay demonstrated that cobalt-induced stimulation required an antioxidant responsive element. Forced expression of Nrf2, the transcription factor that binds to antioxidant responsive elements, enhanced the transcriptional activity of the Chcr3 gene. These results suggest that cobalt induces the expression of the Chcr3 gene via the Nrf2-antioxidant responsive element pathway.

  19. Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

    SciTech Connect

    Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi

    2011-07-01

    Highlights: {yields} The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. {yields} The core promoter was located in the 5F-1. {yields} Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. {yields} These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

  20. Identification of evolutionarily conserved, functional noncoding elements in the promoter region of the sodium channel gene SCN8A.

    PubMed

    Drews, Valerie L; Shi, Kehui; de Haan, Georgius; Meisler, Miriam H

    2007-10-01

    SCN8A is a major neuronal sodium channel gene expressed throughout the central and peripheral nervous systems. Mutations of SCN8A result in movement disorders and impaired cognition. To investigate the basis for the tissue-specific expression of SCN8A, we located conserved, potentially regulatory sequences in the human, mouse, chicken, and fish genes by 5' RACE of brain RNA and genomic sequence comparison. A highly conserved 5' noncoding exon, exon 1c, is present in vertebrates from fish to mammals and appears to define the ancestral promoter region. The distance from exon 1c to the first coding exon increased tenfold during vertebrate evolution, largely by insertion of repetitive elements. The mammalian gene acquired three novel, mutually exclusive noncoding exons that are not represented in the lower vertebrates. Within the shared exon 1c, we identified four short sequence elements of 10-20 bp with an unusually high level of evolutionary conservation. The conserved elements are most similar to consensus sites for the transcription factors Pou6f1/Brn5, YY1, and REST/NRSF. Introduction of mutations into the predicted Pou6f1 and REST sites reduced promoter activity in transfected neuronal cells. A 470-bp promoter fragment containing all of the conserved elements directed brain-specific expression of the LacZ reporter in transgenic mice. Transgene expression was highest in hippocampal neurons and cerebellar Purkinje cells, consistent with the expression of the endogenous gene. The compact cluster of conserved regulatory elements in SCN8A provides a useful target for molecular analysis of neuronal gene expression.

  1. Screening in silico predicted remotely acting NF1 gene regulatory elements for mutations in patients with neurofibromatosis type 1.

    PubMed

    Hamby, Stephen E; Reviriego, Pablo; Cooper, David N; Upadhyaya, Meena; Chuzhanova, Nadia

    2013-08-15

    Neurofibromatosis type 1 (NF1), a neuroectodermal disorder, is caused by germline mutations in the NF1 gene. NF1 affects approximately 1/3,000 individuals worldwide, with about 50% of cases representing de novo mutations. Although the NF1 gene was identified in 1990, the underlying gene mutations still remain undetected in a small but obdurate minority of NF1 patients. We postulated that in these patients, hitherto undetected pathogenic mutations might occur in regulatory elements far upstream of the NF1 gene. In an attempt to identify such remotely acting regulatory elements, we reasoned that some of them might reside within DNA sequences that (1) have the potential to interact at distance with the NF1 gene and (2) lie within a histone H3K27ac-enriched region, a characteristic of active enhancers. Combining Hi-C data, obtained by means of the chromosome conformation capture technique, with data on the location and level of histone H3K27ac enrichment upstream of the NF1 gene, we predicted in silico the presence of two remotely acting regulatory regions, located, respectively, approximately 600 kb and approximately 42 kb upstream of the NF1 gene. These regions were then sequenced in 47 NF1 patients in whom no mutations had been found in either the NF1 or SPRED1 gene regions. Five patients were found to harbour DNA sequence variants in the distal H3K27ac-enriched region. Although these variants are of uncertain pathological significance and still remain to be functionally characterized, this approach promises to be of general utility for the detection of mutations underlying other inherited disorders that may be caused by mutations in remotely acting regulatory elements.

  2. BLG-e1 - a novel regulatory element in the distal region of the beta-lactoglobulin gene promoter.

    PubMed

    Reichenstein, Moshe; German, Tania; Barash, Itamar

    2005-04-11

    beta-Lactoglobulin (BLG) is a major ruminant milk protein. A regulatory element, termed BLG-e1, was defined in the distal region of the ovine BLG gene promoter. This 299-bp element lacks the established cis-regulatory sequences that affect milk-protein gene expression. Nevertheless, it alters the binding of downstream BLG sequences to histone H4 and the sensitivity of the histone-DNA complexes to trichostatin A treatment. In mammary cells cultured under favorable lactogenic conditions, BLG-e1 acts as a potent, position-independent silencer of BLG/luciferase expression, and similarly affects the promoter activity of the mouse whey acidic protein gene. Intragenic sequences upstream of BLG exon 2 reverse the silencing effect of BLG-e1 in vitro and in transgenic mice.

  3. DNA methylation of stress-related genes and LINE-1 repetitive elements across the healthy human placenta

    PubMed Central

    Non, Amy L.; Binder, Alexandra M.; Barault, Ludovic; Rancourt, Rebecca C.; Kubzansky, Laura D.; Michels, Karin B.

    2012-01-01

    Objectives DNA methylation is known to play a critical role in regulating development of placental morphology and physiology. The methylation of genes mediated by glucocorticoid hormones may be particularly vulnerable to intrauterine stress in the placenta. However little is known about DNA methylation of stress-related genes within a healthy placenta, and particularly whether methylation occurs uniformly across different regions of the placenta, which is a critical question for researchers seeking to analyze methylation patterns. We examined DNA methylation across four regions of the placenta to evaluate methylation levels of stress-related genes within a healthy placenta, and to evaluate whether methylation patterns vary by sampling location. Study Design We evaluated levels of DNA methylation of three stress-related genes: NR3C1, BDNF, and 11B-HSD2 and of the repetitive element, LINE-1, in four different sample locations of 20 healthy placentas. Main Outcome Measures Pyrosequencing was used to quantify levels of methylation at CpG sites within the promoter regions of each of the three stress-related genes, and global methylation of LINE-1. Results Very low levels of methylation were found across all three stress-related genes; no gene showed a median methylation level greater than 4.20% across placental regions. Variation in methylation between placental regions for stress-related genes and for LINE-1 was minimal. Conclusions Our data suggest that these frequently studied stress-related genes have low levels of methylation in healthy placenta tissue. Minimal variation between sites suggests that sampling location does not affect DNA methylation analyses of these genes or of LINE-1 repetitive elements. PMID:22222044

  4. DNA methylation of stress-related genes and LINE-1 repetitive elements across the healthy human placenta.

    PubMed

    Non, A L; Binder, A M; Barault, L; Rancourt, R C; Kubzansky, L D; Michels, K B

    2012-03-01

    DNA methylation is known to play a critical role in regulating development of placental morphology and physiology. The methylation of genes mediated by glucocorticoid hormones may be particularly vulnerable to intrauterine stress in the placenta. However little is known about DNA methylation of stress-related genes within a healthy placenta, and particularly whether methylation occurs uniformly across different regions of the placenta, which is a critical question for researchers seeking to analyze methylation patterns. We examined DNA methylation across four regions of the placenta to evaluate methylation levels of stress-related genes within a healthy placenta, and to evaluate whether methylation patterns vary by sampling location. We evaluated levels of DNA methylation of three stress-related genes: NR3C1, BDNF, and 11B-HSD2 and of the repetitive element, LINE-1, in four different sample locations of 20 healthy placentas. Pyrosequencing was used to quantify levels of methylation at CpG sites within the promoter regions of each of the three stress-related genes, and global methylation of LINE-1. Very low levels of methylation were found across all three stress-related genes; no gene showed a median methylation level greater than 4.20% across placental regions. Variation in methylation between placental regions for stress-related genes and for LINE-1 was minimal. Our data suggest that these frequently studied stress-related genes have low levels of methylation in healthy placenta tissue. Minimal variation between sites suggests that sampling location does not affect DNA methylation analyses of these genes or of LINE-1 repetitive elements. Copyright © 2011 Elsevier Ltd. All rights reserved.

  5. Gapless genome assembly of Colletotrichum higginsianum reveals chromosome structure and association of transposable elements with secondary metabolite gene clusters.

    PubMed

    Dallery, Jean-Félix; Lapalu, Nicolas; Zampounis, Antonios; Pigné, Sandrine; Luyten, Isabelle; Amselem, Joëlle; Wittenberg, Alexander H J; Zhou, Shiguo; de Queiroz, Marisa V; Robin, Guillaume P; Auger, Annie; Hainaut, Matthieu; Henrissat, Bernard; Kim, Ki-Tae; Lee, Yong-Hwan; Lespinet, Olivier; Schwartz, David C; Thon, Michael R; O'Connell, Richard J

    2017-08-29

    The ascomycete fungus Colletotrichum higginsianum causes anthracnose disease of brassica crops and the model plant Arabidopsis thaliana. Previous versions of the genome sequence were highly fragmented, causing errors in the prediction of protein-coding genes and preventing the analysis of repetitive sequences and genome architecture. Here, we re-sequenced the genome using single-molecule real-time (SMRT) sequencing technology and, in combination with optical map data, this provided a gapless assembly of all twelve chromosomes except for the ribosomal DNA repeat cluster on chromosome 7. The more accurate gene annotation made possible by this new assembly revealed a large repertoire of secondary metabolism (SM) key genes (89) and putative biosynthetic pathways (77 SM gene clusters). The two mini-chromosomes differed from the ten core chromosomes in being repeat- and AT-rich and gene-poor but were significantly enriched with genes encoding putative secreted effector proteins. Transposable elements (TEs) were found to occupy 7% of the genome by length. Certain TE families showed a statistically significant association with effector genes and SM cluster genes and were transcriptionally active at particular stages of fungal development. All 24 subtelomeres were found to contain one of three highly-conserved repeat elements which, by providing sites for homologous recombination, were probably instrumental in four segmental duplications. The gapless genome of C. higginsianum provides access to repeat-rich regions that were previously poorly assembled, notably the mini-chromosomes and subtelomeres, and allowed prediction of the complete SM gene repertoire. It also provides insights into the potential role of TEs in gene and genome evolution and host adaptation in this asexual pathogen.

  6. Combining Hi-C data with phylogenetic correlation to predict the target genes of distal regulatory elements in human genome.

    PubMed

    Lu, Yulan; Zhou, Yuanpeng; Tian, Weidong

    2013-12-01

    Defining the target genes of distal regulatory elements (DREs), such as enhancer, repressors and insulators, is a challenging task. The recently developed Hi-C technology is designed to capture chromosome conformation structure by high-throughput sequencing, and can be potentially used to determine the target genes of DREs. However, Hi-C data are noisy, making it difficult to directly use Hi-C data to identify DRE-target gene relationships. In this study, we show that DREs-gene pairs that are confirmed by Hi-C data are strongly phylogenetic correlated, and have thus developed a method that combines Hi-C read counts with phylogenetic correlation to predict long-range DRE-target gene relationships. Analysis of predicted DRE-target gene pairs shows that genes regulated by large number of DREs tend to have essential functions, and genes regulated by the same DREs tend to be functionally related and co-expressed. In addition, we show with a couple of examples that the predicted target genes of DREs can help explain the causal roles of disease-associated single-nucleotide polymorphisms located in the DREs. As such, these predictions will be of importance not only for our understanding of the function of DREs but also for elucidating the causal roles of disease-associated noncoding single-nucleotide polymorphisms.

  7. SIRT1 gene expression upon genotoxic damage is regulated by APE1 through nCaRE-promoter elements

    PubMed Central

    Antoniali, Giulia; Lirussi, Lisa; D'Ambrosio, Chiara; Dal Piaz, Fabrizio; Vascotto, Carlo; Casarano, Elena; Marasco, Daniela; Scaloni, Andrea; Fogolari, Federico; Tell, Gianluca

    2014-01-01

    Apurinic/apyrimidinic endonuclease 1 (APE1) is a multifunctional protein contributing to genome stability via repair of DNA lesions via the base excision repair pathway. It also plays a role in gene expression regulation and RNA metabolism. Another, poorly characterized function is its ability to bind to negative calcium responsive elements (nCaRE) of some gene promoters. The presence of many functional nCaRE sequences regulating gene transcription can be envisioned, given their conservation within ALU repeats. To look for functional nCaRE sequences within the human genome, we performed bioinformatic analyses and identified 57 genes potentially regulated by APE1. We focused on sirtuin-1 (SIRT1) deacetylase due to its involvement in cell stress, including senescence, apoptosis, and tumorigenesis, and its role in the deacetylation of APE1 after genotoxic stress. The human SIRT1 promoter presents two nCaRE elements stably bound by APE1 through its N-terminus. We demonstrate that APE1 is part of a multiprotein complex including hOGG1, Ku70, and RNA Pol II, which is recruited on SIRT1 promoter to regulate SIRT1 gene functions during early response to oxidative stress. These findings provide new insights into the role of nCaRE sequences in the transcriptional regulation of mammalian genes. PMID:24356447

  8. Transcriptional regulation of PRPF31 gene expression by MSR1 repeat elements causes incomplete penetrance in retinitis pigmentosa

    PubMed Central

    Rose, Anna M.; Shah, Amna Z.; Venturini, Giulia; Krishna, Abhay; Chakravarti, Aravinda; Rivolta, Carlo; Bhattacharya, Shomi S.

    2016-01-01

    PRPF31-associated retinitis pigmentosa presents a fascinating enigma: some mutation carriers are blind, while others are asymptomatic. We identify the major molecular cause of this incomplete penetrance through three cardinal features: (1) there is population variation in the number (3 or 4) of a minisatellite repeat element (MSR1) adjacent to the PRPF31 core promoter; (2) in vitro, 3-copies of the MSR1 element can repress gene transcription by 50 to 115-fold; (3) the higher-expressing 4-copy allele is not observed among symptomatic PRPF31 mutation carriers and correlates with the rate of asymptomatic carriers in different populations. Thus, a linked transcriptional modifier decreases PRPF31 gene expression that leads to haploinsufficiency. This result, taken with other identified risk alleles, allows precise genetic counseling for the first time. We also demonstrate that across the human genome, the presence of MSR1 repeats in the promoters or first introns of genes is associated with greater population variability in gene expression indicating that copy number variation of MSR1s is a generic controller of gene expression and promises to provide new insights into our understanding of gene expression regulation. PMID:26781568

  9. Aquaculture changes the profile of antibiotic resistance and mobile genetic element associated genes in Baltic Sea sediments.

    PubMed

    Muziasari, Windi I; Pärnänen, Katariina; Johnson, Timothy A; Lyra, Christina; Karkman, Antti; Stedtfeld, Robert D; Tamminen, Manu; Tiedje, James M; Virta, Marko

    2016-04-01

    Antibiotics are commonly used in aquaculture and they can change the environmental resistome by increasing antibiotic resistance genes (ARGs). Sediment samples were collected from two fish farms located in the Northern Baltic Sea, Finland, and from a site outside the farms (control). The sediment resistome was assessed by using a highly parallel qPCR array containing 295 primer sets to detect ARGs, mobile genetic elements and the 16S rRNA gene. The fish farm resistomes were enriched in transposon and integron associated genes and in ARGs encoding resistance to antibiotics which had been used to treat fish at the farms. Aminoglycoside resistance genes were also enriched in the farm sediments despite the farms not having used aminoglycosides. In contrast, the total relative abundance values of ARGs were higher in the control sediment resistome and they were mainly genes encoding efflux pumps followed by beta-lactam resistance genes, which are found intrinsically in many bacteria. This suggests that there is a natural Baltic sediment resistome. The resistome associated with fish farms can be from native ARGs enriched by antibiotic use at the farms and/or from ARGs and mobile elements that have been introduced by fish farming.

  10. [Mobile ISCR elements: structure, functions, and role in the emergence, increasing and spreading of blocks of bacterial genes of multiple antibiotic resistance].

    PubMed

    Il'ina, T S

    2012-01-01

    The recently discovered method of horizontal distribution of bacterial genes with atypical ISCR sequences is reviewed using an example of drug resistance genes. The adjacent DNA segment mobilization is provided by the transposition of such elements, including rolling circle replication, formation of autonomous nonreplicable circular structures, and homological recombination. The gene distribution capacity with the ISCR elements is more significant than the capacity of transposons and integrons, thereby providing formation of groups of mobile genes, including antibiotic-resistance genes of pathogenic bacteria. The structure and functions of the ISCR elements were discussed together with their similarity and dissimilarity with the group of IS91-similar elements and their role in the emergence of blocks of bacterial genes encoding of multiple antibiotic resistance and their contribution to evolution of bacterial and plasmid genes.

  11. Abscisic acid-induced gene expression in the liverwort Marchantia polymorpha is mediated by evolutionarily conserved promoter elements.

    PubMed

    Ghosh, Totan K; Kaneko, Midori; Akter, Khaleda; Murai, Shuhei; Komatsu, Kenji; Ishizaki, Kimitsune; Yamato, Katsuyuki T; Kohchi, Takayuki; Takezawa, Daisuke

    2016-04-01

    Abscisic acid (ABA) is a phytohormone widely distributed among members of the land plant lineage (Embryophyta), regulating dormancy, stomata closure and tolerance to environmental stresses. In angiosperms (Magnoliophyta), ABA-induced gene expression is mediated by promoter elements such as the G-box-like ACGT-core motifs recognized by bZIP transcription factors. In contrast, the mode of regulation by ABA of gene expression in liverworts (Marchantiophyta), representing one of the earliest diverging land plant groups, has not been elucidated. In this study, we used promoters of the liverwort Marchantia polymorpha dehydrin and the wheat Em genes fused to the β-glucuronidase (GUS) reporter gene to investigate ABA-induced gene expression in liverworts. Transient assays of cultured cells of Marchantia indicated that ACGT-core motifs proximal to the transcription initiation site play a role in the ABA-induced gene expression. The RY sequence recognized by B3 transcriptional regulators was also shown to be responsible for the ABA-induced gene expression. In transgenic Marchantia plants, ABA treatment elicited an increase in GUS expression in young gemmalings, which was abolished by simultaneous disruption of the ACGT-core and RY elements. ABA-induced GUS expression was less obvious in mature thalli than in young gemmalings, associated with reductions in sensitivity to exogenous ABA during gametophyte growth. In contrast, lunularic acid, which had been suggested to function as an ABA-like substance, had no effect on GUS expression. The results demonstrate the presence of ABA-specific response mechanisms mediated by conserved cis-regulatory elements in liverworts, implying that the mechanisms had been acquired in the common ancestors of embryophytes. © 2015 Scandinavian Plant Physiology Society.

  12. The muscle creatine kinase gene is regulated by multiple upstream elements, including a muscle-specific enhancer

    SciTech Connect

    Jaynes, J.B.; Johnson, J.E.; Buskin, J.N.; Gartside, C.L.; Hauschka, S.D.

    1988-01-01

    Muscle creatine kinase (MCK) is induced to high levels during skeletal muscle differentiation. The authors examined the upstream regulatory elements of the mouse MCK gene which specify its activation during myogenesis in culture. Fusion genes containing up to 3,300 nucleotides (nt) of MCK 5' flanking DNA in various positions and orientations relative to the bacterial chloramphenicol acetyltransferase (CAT) structural gene were transfected into cultured cells. Transient expression of CAT was compared between proliferating and differentiated MM14 mouse myoblasts and with nonmyogenic mouse L cells. The major effector of high-level expression was found to have the properties of a transcriptional enhancer. This element, located between 1,050 and 1,256 nt upstream of the transcription start site, was also found to have a major influence on the tissue and differentiation specificity of MCK expression; it activated either the MCK promoter or heterologous promoters only in differentiated muscle cells. Comparisons of viral and cellular enhancer sequences with the MCK enhancer revealed some similarities to essential regions of the simian virus 40 enhancer as well as to a region of the immunoglobulin heavy-chain enhancer, which has been implicated in tissue-specific protein binding. Even in the absence of the enhancer, low-level expression from a 776-nt MCK promoter retained differentiation specificity. In addition to positive regulatory elements, our data provide some evidence for negative regulatory elements with activity in myoblasts. These may contribute to the cell type and differentiation specificity of MCK expression.

  13. The expression of human H2A-H2B histone gene pairs is regulated by multiple sequence elements in their joint promoters.

    PubMed

    Trappe, R; Doenecke, D; Albig, W

    1999-09-03

    The majority of human H2A and H2B histone genes are organized as gene pairs: 14 H2A-H2B gene pairs, one solitary H2A gene and three solitary H2B genes have been described. Two of the H2A genes and two of the H2B genes arranged within gene pairs are pseudogenes. The gene pairs are organized with divergent transcriptional orientation, and the coding regions of the respective H2A and H2B genes are separated by about 320 nucleotide pairs that form overlapping promoter regions. Comparison of promoters of H2A-H2B gene pairs has previously shown that these belong to two different groups (groups I and II) which are characterized by specific patterns of conserved sequence elements. We have constructed a reporter gene vector that allows the simultaneous analysis of both genes regulated by the divergent promoters belonging to group I or II, respectively. Firefly-luciferase and beta-galactosidase genes were taken as reporter genes. Site directed mutagenesis performed at individual promoter elements revealed that individual sequence elements within both groups of promoters functionally depend on each other and may contribute to a coordinate expression of paired H2A and H2B genes through assembly of their joint promoter into a mutually dependent promoter complex. Group II promoters are characterized by the presence of an E2F binding site upstream of the H2A gene-proximal TATA box. Immediately upstream of the E2F element, we have identified a highly conserved octanucleotide CACAGCTT (RT-1) that exists in all human group II H2A-H2B gene promoters. Protein binding studies at the RT-1 element indicate factor binding to this sequence. Site directed mutagenesis indicates that both the E2F element and the RT-1 motif are essential for full promoter activity.

  14. Nrf1 and Nrf2 Play Distinct Roles in Activation of Antioxidant Response Element-dependent Genes*S⃞

    PubMed Central

    Ohtsuji, Makiko; Katsuoka, Fumiki; Kobayashi, Akira; Aburatani, Hiroyuki; Hayes, John D.; Yamamoto, Masayuki

    2008-01-01

    Nrf1 is a member of the vertebrate Cap`n'Collar (CNC) transcription factor family that commonly contains a unique basic-leucine zipper domain. Among CNC family members, Nrf2 is known to regulate a battery of antioxidant and xenobiotic-metabolizing enzyme genes through the antioxidant response element (ARE). Although Nrf1 has also been shown to bind the ARE, it is unclear whether it plays a distinct role from Nrf2 in regulating genes with this element. To address this issue in vivo, we generated mice bearing a hepatocyte-specific disruption of the Nrf1 gene. AlthoughNrf2 knock-out mice did not exhibit liver damage when they were maintained in an unstressed condition, hepatocyte-specific deletion of Nrf1 caused liver damage resembling the human disease non-alcoholic steatohepatitis. Gene expression analysis revealed that the disruption of Nrf1 causes stress that activates a number of ARE-driven genes in an Nrf2-dependent manner, indicating that Nrf2 cannot compensate completely for loss of Nrf1 function in the liver. In contrast, expression of metallothionein-1 and -2 (MT1 and MT2) genes, each of which harbors at least one ARE in its regulatory region, was decreased in the Nrf1-null mutant mice. Whereas Nrf1 and Nrf2 bound the MT1 ARE with comparable affinity, Nrf1 preferentially activated the reporter gene expression through the MT1 ARE. This study has, thus, identified the first ARE-dependent gene that relies exclusively on Nrf1, suggesting that it plays a distinct functional role in regulating ARE-driven genes. PMID:18826952

  15. The activator/dissociation transposable elements comprise a two-component gene regulatory switch that controls endogenous gene expression in maize.

    PubMed

    Bai, Ling; Brutnell, Thomas P

    2011-03-01

    The maize Activator/Dissociation (Ac/Ds) elements are able to replicate and transpose throughout the maize genome. Both elements preferentially insert into gene-rich regions altering the maize genome by creating unstable insertion alleles, stable derivative or excision alleles, or by altering the spatial or temporal regulation of gene expression. Here, we characterize an Ac insertion in the 5'-UTR of the Pink Scutellum1 (Ps1) gene and five Ds derivatives generated through abortive transposition events. Characterization of Ps1 transcription initiation sites in this allelic series revealed several that began within the terminus of the Ac and Ds elements. Transcripts originating within Ds or Ac accumulated to lower levels than the wild-type Ps1 allele, but were often sufficient to rescue the seedling lethal phenotype associated with severe loss-of-function alleles. Transcription initiation sites were similar in Ac and Ds derivatives, suggesting that Ac transposase does not influence transcript initiation site selection. However, we show that Ac transposase can negatively regulate Ps1 transcript accumulation in a subset of Ds-insertion alleles resulting in a severe mutant phenotype. The role of maize transposons in gene evolution is discussed. © 2011 by the Genetics Society of America

  16. Cruciform-extruding regulatory element controls cell-specific activity of the tyrosine hydroxylase gene promoter.

    PubMed Central

    Kim, E L; Peng, H; Esparza, F M; Maltchenko, S Z; Stachowiak, M K

    1998-01-01

    Tyrosine hydroxylase (TH) is expressed specifically in catecholaminergic cells. We have identified a novel regulatory sequence in the upstream region of the bovine TH gene promoter formed by a dyad symmetry element (DSE1;-352/-307 bp). DSE1 supports TH promoter activity in TH-expressing bovine adrenal medulla chromaffin (BAMC) cells and inhibits promoter activity in non-expressing TE671 cells. DNase I footprinting of relaxed TH promoter DNA showed weak binding of nuclear BAMC cell proteins to a short sequence in the right DSE1 arm. In BAMC cells, deletion of the right arm markedly reduced the expression of luciferase from the TH promoter. However, deletion of the left DSE1 arm or its reversed orientation (RevL) also inactivated the TH promoter. In supercoiled TH promoter, DSE1 assumes a cruciform-like conformation i.e., it binds cruciform-specific 2D3 antibody, and S1 nuclease-cleavage and OsO4-modification assays have identified an imperfect cruciform extruded by the DSE1. DNase I footprinting of supercoiled plasmid showed that cruciformed DSE1 is targeted by nuclear proteins more efficiently than the linear duplex isomer and that the protected site encompasses the left arm and center of DSE1. Our results suggest that the disruption of intrastrand base-pairing preventing cruciform formation and protein binding to DSE1 is responsible for its inactivation in DSE1 mutants. DSE1 cruciform may act as a target site for activator (BAMC cells) and repressor (TE671) proteins. Its extrusion emerges as a novel mechanism that controls cell-specific promoter activity. PMID:9512554

  17. Not all predicted CRISPR-Cas systems are equal: isolated cas genes and classes of CRISPR like elements.

    PubMed

    Zhang, Quan; Ye, Yuzhen

    2017-02-06

    The CRISPR-Cas systems in prokaryotes are RNA-guided immune systems that target and deactivate foreign nucleic acids. A typical CRISPR-Cas system consists of a CRISPR array of repeat and spacer units, and a locus of cas genes. The CRISPR and the cas locus are often located next to each other in the genomes. However, there is no quantitative estimate of the co-location. In addition, ad-hoc studies have shown that some non-CRISPR genomic elements contain repeat-spacer-like structures and are mistaken as CRISPRs. Using available genome sequences, we observed that a significant number of genomes have isolated cas loci and/or CRISPRs. We found that 11%, 22% and 28% of the type I, II and III cas loci are isolated (without CRISPRs in the same genomes at all or with CRISPRs distant in the genomes), respectively. We identified a large number of genomic elements that superficially reassemble CRISPRs but don't contain diverse spacers and have no companion cas genes. We called these elements false-CRISPRs and further classified them into groups, including tandem repeats and Staphylococcus aureus repeat (STAR)-like elements. This is the first systematic study to collect and characterize false-CRISPR elements. We demonstrated that false-CRISPRs could be used to reduce the false annotation of CRISPRs, therefore showing them to be useful for improving the annotation of CRISPR-Cas systems.

  18. CACTA-superfamily transposable element is inserted in MYB transcription factor gene of soybean line producing variegated seeds.

    PubMed

    Yan, Fan; Di, Shaokang; Takahashi, Ryoji

    2015-08-01

    The R gene of soybean, presumably encoding a MYB transcription factor, controls seed coat color. The gene consists of multiple alleles, R (black), r-m (black spots and (or) concentric streaks on brown seed), and r (brown seed). This study was conducted to determine the structure of the MYB transcription factor gene in a near-isogenic line (NIL) having r-m allele. PCR amplification of a fragment of the candidate gene Glyma.09G235100 generated a fragment of about 1 kb in the soybean cultivar Clark, whereas a fragment of about 14 kb in addition to fragments of 1 and 1.4 kb were produced in L72-2040, a Clark 63 NIL with the r-m allele. Clark 63 is a NIL of Clark with the rxp and Rps1 alleles. A DNA fragment of 13 060 bp was inserted in the intron of Glyma.09G235100 in L72-2040. The fragment had the CACTA motif at both ends, imperfect terminal inverted repeats (TIR), inverse repetition of short sequence motifs close to the 5' and 3' ends, and a duplication of three nucleotides at the site of integration, indicating that it belongs to a CACTA-superfamily transposable element. We designated the element as Tgm11. Overall nucleotide sequence, motifs of TIR, and subterminal repeats were similar to those of Tgm1 and Tgs1, suggesting that these elements comprise a family.

  19. Transgenic analysis of the thyroid-responsive elements in the alpha-cardiac myosin heavy chain gene promoter.

    PubMed

    Subramaniam, A; Gulick, J; Neumann, J; Knotts, S; Robbins, J

    1993-02-25

    The role of two putative, cis-acting thyroid hormone-responsive elements, TRE1 and TRE2, located at -129 to -149 and -102 to -120, respectively, on the murine alpha-myosin heavy chain (MHC) gene, has been investigated in transgenic mice. These motifs are present in a 4.5-kilobase fragment lying upstream of the transcriptional start site of the mouse alpha-MHC gene: this fragment directs appropriate expression of a reporter gene in transgenic mice (Subramaniam, A., Jones, W. K., Gulick, J., Wert, S., Neumann, J., and Robbins, J. (1991) J. Biol. Chem. 266, 24613-24620). Here, we independently mutate the TRE1 and TRE2 elements by base substitution. The mice were analyzed for transgene expression in different muscle and non-muscle tissues including the atria and ventricles. Normal levels of transgene expression were observed in euthyroid mice carrying a mutation in TRE1. In contrast to these results, mice in which TRE2 was mutated showed reduced levels of CAT activity in both the atria and ventricles, suggesting a previously undefined role for this element in the constitutive up-regulation of the alpha-MHC gene. In hypothyroid mice carrying either of these mutations, the complete cessation of ventricular expression of the chloramphenicol acetyltransferase transcripts that takes place in the alpha-5.5 (wild type) animals did not occur.

  20. The Heat-Shock Element Is a Functional Component of the Arabidopsis APX1 Gene Promoter1

    PubMed Central

    Storozhenko, Sergei; De Pauw, Pascal; Van Montagu, Marc; Inzé, Dirk; Kushnir, Sergei

    1998-01-01

    Ascorbate peroxidases are important enzymes that detoxify hydrogen peroxide within the cytosol and chloroplasts of plant cells. To better understand their role in oxidative stress tolerance, the transcriptional regulation of the apx1 gene from Arabidopsis was studied. The apx1 gene was expressed in all tested organs of Arabidopsis; mRNA levels were low in roots, leaves, and stems and high in flowers. Steady-state mRNA levels in leaves or cell suspensions increased after treatment with methyl viologen, ethephon, high temperature, and illumination of etiolated seedlings. A putative heat-shock cis element found in the apx1 promoter was shown to be recognized by the tomato (Lycopersicon esculentum) heat-shock factor in vitro and to be responsible for the in vivo heat-shock induction of the gene. The heat-shock cis element also contributed partially to the induction of the gene by oxidative stress. By using in vivo dimethyl sulfate footprinting, we showed that proteins interacted with a G/C-rich element found in the apx1 promoter. PMID:9808745

  1. Extensive Evolutionary Changes in Regulatory Element Activity during Human Origins Are Associated with Altered Gene Expression and Positive Selection

    PubMed Central

    Fedrigo, Olivier; Babbitt, Courtney C.; Wortham, Matthew; Tewari, Alok K.; London, Darin; Song, Lingyun; Lee, Bum-Kyu; Iyer, Vishwanath R.; Parker, Stephen C. J.; Margulies, Elliott H.; Wray, Gregory A.; Furey, Terrence S.; Crawford, Gregory E.

    2012-01-01

    Understanding the molecular basis for phenotypic differences between humans and other primates remains an outstanding challenge. Mutations in non-coding regulatory DNA that alter gene expression have been hypothesized as a key driver of these phenotypic differences. This has been supported by differential gene expression analyses in general, but not by the identification of specific regulatory elements responsible for changes in transcription and phenotype. To identify the genetic source of regulatory differences, we mapped DNaseI hypersensitive (DHS) sites, which mark all types of active gene regulatory elements, genome-wide in the same cell type isolated from human, chimpanzee, and macaque. Most DHS sites were conserved among all three species, as expected based on their central role in regulating transcription. However, we found evidence that several hundred DHS sites were gained or lost on the lineages leading to modern human and chimpanzee. Species-specific DHS site gains are enriched near differentially expressed genes, are positively correlated with increased transcription, show evidence of branch-specific positive selection, and overlap with active chromatin marks. Species-specific sequence differences in transcription factor motifs found within these DHS sites are linked with species-specific changes in chromatin accessibility. Together, these indicate that the regulatory elements identified here are genetic contributors to transcriptional and phenotypic differences among primate species. PMID:22761590

  2. Transposable elements are enriched within or in close proximity to xenobiotic-metabolizing cytochrome P450 genes

    PubMed Central

    Chen, Song; Li, Xianchun

    2007-01-01

    Background Transposons, i.e. transposable elements (TEs), are the major internal spontaneous mutation agents for the variability of eukaryotic genomes. To address the general issue of whether transposons mediate genomic changes in environment-adaptation genes, we scanned two alleles per each of the six xenobiotic-metabolizing Helicoverpa zea cytochrome P450 loci, including CYP6B8, CYP6B27, CYP321A1, CYP321A2, CYP9A12v3 and CYP9A14, for the presence of transposon insertions by genome walking and sequence analysis. We also scanned thirteen Drosophila melanogaster P450s genes for TE insertions by in silico mapping and literature search. Results Twelve novel transposons, including LINEs (long interspersed nuclear elements), SINEs (short interspersed nuclear elements), MITEs (miniature inverted-repeat transposable elements), one full-length transib-like transposon, and one full-length Tcl-like DNA transpson, are identified from the alleles of the six H. zea P450 genes. The twelve transposons are inserted into the 5'flanking region, 3'flanking region, exon, or intron of the six environment-adaptation P450 genes. In D. melanogaster, seven out of the eight Drosophila P450s (CYP4E2, CYP6A2, CYP6A8, CYP6A9, CYP6G1, CYP6W1, CYP12A4, CYP12D1) implicated in insecticide resistance are associated with a variety of transposons. By contrast, all the five Drosophila P450s (CYP302A1, CYP306A1, CYP307A1, CYP314A1 and CYP315A1) involved in ecdysone biosynthesis and developmental regulation are free of TE insertions. Conclusion These results indicate that TEs are selectively retained within or in close proximity to xenobiotic-metabolizing P450 genes. PMID:17381843

  3. An in silico strategy identified the target gene candidates regulated by dehydration responsive element binding proteins (DREBs) in Arabidopsis genome.

    PubMed

    Wang, Shichen; Yang, Shuo; Yin, Yuejia; Guo, Xiaosen; Wang, Shan; Hao, Dongyun

    2009-01-01

    Identification of downstream target genes of stress-relating transcription factors (TFs) is desirable in understanding cellular responses to various environmental stimuli. However, this has long been a difficult work for both experimental and computational practices. In this research, we presented a novel computational strategy which combined the analysis of the transcription factor binding site (TFBS) contexts and machine learning approach. Using this strategy, we conducted a genome-wide investigation into novel direct target genes of dehydration responsive element binding proteins (DREBs), the members of AP2-EREBPs transcription factor super family which is reported to be responsive to various abiotic stresses in Arabidopsis. The genome-wide searching yielded in total 474 target gene candidates. With reference to the microarray data for abiotic stresses-inducible gene expression profile, 268 target gene candidates out of the total 474 genes predicted, were induced during the 24-h exposure to abiotic stresses. This takes about 57% of total predicted targets. Furthermore, GO annotations revealed that these target genes are likely involved in protein amino acid phosphorylation, protein binding and Endomembrane sorting system. The results suggested that the predicted target gene candidates were adequate to meet the essential biological principle of stress-resistance in plants.

  4. A positive regulatory element is involved in the induction of the beta-galactosidase gene from Kluyveromyces lactis.

    PubMed Central

    Das, S; Breunig, K D; Hollenberg, C P

    1985-01-01

    The regulation of the LAC4 gene encoding beta-galactosidase in the yeast Kluyveromyces lactis has been studied. The expression of cloned LAC4 gene present on autonomously replicating plasmids was normally regulated by lactose or galactose as inducers. The LAC4 transcription initiation sites were mapped on two plasmids, PTY75-LAC4 and pKL2. The sites were found to be dependent on the level of gene expression and on the plasmid used. Under induced conditions, the normal cluster of initiation sites was used on both plasmids, whereas under non-induced conditions LAC4 on pKL2 showed additional sites. Deletion mapping of the 5' regulatory region of the LAC4 gene revealed a DNA element required for induction, presumably for the binding of a positive regulator. Images Fig. 2. Fig. 3. Fig. 6. PMID:3924596

  5. Characterization of new bacterial catabolic genes and mobile genetic elements by high throughput genetic screening of a soil metagenomic library.

    PubMed

    Jacquiod, Samuel; Demanèche, Sandrine; Franqueville, Laure; Ausec, Luka; Xu, Zhuofei; Delmont, Tom O; Dunon, Vincent; Cagnon, Christine; Mandic-Mulec, Ines; Vogel, Timothy M; Simonet, Pascal

    2014-11-20

    A mix of oligonucleotide probes was used to hybridize soil metagenomic DNA from a fosmid clone library spotted on high density membranes. The pooled radio-labeled probes were designed to target genes encoding glycoside hydrolases GH18, dehalogenases, bacterial laccases and mobile genetic elements (integrases from integrons and insertion sequences). Positive hybridizing spots were affiliated to the corresponding clones in the library and the metagenomic inserts were sequenced. After assembly and annotation, new coding DNA sequences related to genes of interest were identified with low protein similarity against the closest hits in databases. This work highlights the sensitivity of DNA/DNA hybridization techniques as an effective and complementary way to recover novel genes from large metagenomic clone libraries. This study also supports that some of the identified catabolic genes might be associated with horizontal transfer events.

  6. Different Genetic Elements Carrying the tet(W) Gene in Two Human Clinical Isolates of Streptococcus suis▿ †

    PubMed Central

    Palmieri, Claudio; Princivalli, Maria Stella; Brenciani, Andrea; Varaldo, Pietro E.; Facinelli, Bruna

    2011-01-01

    The genetic support for tet(W), an emerging tetracycline resistance determinant, was studied in two strains of Streptococcus suis, SsCA and SsUD, both isolated in Italy from patients with meningitis. Two completely different tet(W)-carrying genetic elements, sharing only a tet(W)-containing segment barely larger than the gene, were found in the two strains. The one from strain SsCA was nontransferable, and aside from an erm(B)-containing insertion, it closely resembled a genomic island recently described in an S. suis Chinese human isolate in sequence, organization, and chromosomal location. The tet(W)-carrying genetic element from strain SsUD was transferable (at a low frequency) and, though apparently noninducible following mitomycin C treatment, displayed a typical phage organization and was named ΦSsUD.1. Its full sequence was determined (60,711 bp), the highest BLASTN score being Streptococcus pyogenes Φm46.1. ΦSsUD.1 exhibited a unique combination of antibiotic and heavy metal resistance genes. Besides tet(W), it contained a MAS (macrolide-aminoglycoside-streptothricin) fragment with an erm(B) gene having a deleted leader peptide and a cadC/cadA cadmium efflux cassette. The MAS fragment closely resembled the one recently described in pneumococcal transposons Tn6003 and Tn1545. These resistance genes found in the ΦSsUD.1 phage scaffold differed from, but were in the same position as, cargo genes carried by other streptococcal phages. The chromosome integration site of ΦSsUD.1 was at the 3′ end of a conserved tRNA uracil methyltransferase (rum) gene. This site, known to be an insertional hot spot for mobile elements in S. pyogenes, might play a similar role in S. suis. PMID:21115784

  7. Characterization of five subgroups of the sieve element occlusion gene family in Glycine max reveals genes encoding non-forisome P-proteins, forisomes and forisome tails.

    PubMed

    Zielonka, Sascia; Ernst, Antonia M; Hawat, Susan; Twyman, Richard M; Prüfer, Dirk; Noll, Gundula A

    2014-09-01

    P-proteins are structural phloem proteins discussed to be involved in the rapid sealing of injured sieve elements. P-proteins are found in all dicotyledonous and some monocotyledonous plants, but additional crystalloid P-proteins, known as forisomes, have evolved solely in the Fabaceae. Both types are encoded by members of the sieve element occlusion (SEO) gene family, which comprises seven phylogenetic subgroups. The Fabaceae-specific subgroup 1 contains genes encoding forisome subunits in e.g. Medicago truncatula, Vicia faba, Dipteryx panamensis and Canavalia gladiata whereas basal subgroup 5 encodes P-proteins in Nicotiana tabacum (tobacco) and Arabidopsis thaliana. The function of remaining subgroups is still unknown. We chose Glycine max (soybean) as a model to investigate SEO proteins representing different subgroups in one species. We isolated native P-proteins to determine the SEO protein composition and analyzed the expression pattern, localization and structure of the G. max SEO proteins representing five of the subgroups. We found that subgroup 1 GmSEO genes encode forisome subunits, a member of subgroup 5 encodes a non-forisome P-protein and subgroup 2 GmSEO genes encode the components of forisome tails, which are present in a restricted selection of Fabaceaen species. We therefore present the first molecular characterization of a Fabaceae non-forisome P-protein and the first evidence that forisome tails are encoded by a phylogenetically-distinct branch of the SEO gene family.

  8. A novel nerve growth factor-responsive element in the stromelysin-1 (transin) gene that is necessary and sufficient for gene expression in PC12 cells.

    PubMed

    deSouza, S; Lochner, J; Machida, C M; Matrisian, L M; Ciment, G

    1995-04-21

    Stromelysin-1 (ST-1) is an extracellular matrix metalloproteinase whose expression is transcriptionally regulated by nerve growth factor (NGF) in the PC12 rat pheochromocytoma cell line. In this paper, we define sequences in the proximal ST-1 promoter that contain a novel NGF-responsive element(s). We show that this cis-acting promoter element can bind nuclear proteins from both untreated and NGF-treated PC12 cells in a specific and saturable manner and is sufficient to confer NGF-inducibility to a heterologous promoter. At least a portion of this NGF-responsive element lies within a 12-base pair region between positions -241 and -229 of the ST-1 promoter and bears no sequence homology to other known transcriptional elements. In contrast to what has been reported for fibroblasts, an AP1 site centered around position -68 does not seem to be involved in the growth factor regulation of ST-1 in PC12 cells. These results suggest that the NGF regulation of ST-1 gene expression involves different promoter elements, and possibly different transcription factors, from that described for ST-1 induction by other growth factors.

  9. ZmbZIP91 regulates expression of starch synthesis-related genes by binding to ACTCAT elements in their promoters.

    PubMed

    Chen, Jiang; Yi, Qiang; Cao, Yao; Wei, Bin; Zheng, Lanjie; Xiao, Qianling; Xie, Ying; Gu, Yong; Li, Yangping; Huang, Huanhuan; Wang, Yongbin; Hou, Xianbin; Long, Tiandan; Zhang, Junjie; Liu, Hanmei; Liu, Yinghong; Yu, Guowu; Huang, Yubi

    2016-03-01

    Starch synthesis is a key process that influences crop yield and quality, though little is known about the regulation of this complex metabolic pathway. Here, we present the identification of ZmbZIP91 as a candidate regulator of starch synthesis via co-expression analysis in maize (Zea mays L.). ZmbZIP91 was strongly associated with the expression of starch synthesis genes. Reverse tanscription-PCR (RT-PCR) and RNA in situ hybridization indicated that ZmbZIP91 is highly expressed in maize endosperm, with less expression in leaves. Particle bombardment-mediated transient expression in maize endosperm and leaf protoplasts demonstrated that ZmbZIP91 could positively regulate the expression of starch synthesis genes in both leaves and endosperm. Additionally, the Arabidopsis mutant vip1 carried a mutation in a gene (VIP1) that is homologous to ZmbZIP91, displayed altered growth with less starch in leaves, and ZmbZIP91 was able to complement this phenotype, resulting in normal starch synthesis. A yeast one-hybrid experiment and EMSAs showed that ZmbZIP91 could directly bind to ACTCAT elements in the promoters of starch synthesis genes (pAGPS1, pSSI, pSSIIIa, and pISA1). These results demonstrate that ZmbZIP91 acts as a core regulatory factor in starch synthesis by binding to ACTCAT elements in the promoters of starch synthesis genes.

  10. Hepatitis B Virus Induces Expression of Antioxidant Response Element-regulated Genes by Activation of Nrf2*

    PubMed Central

    Schaedler, Stephanie; Krause, Janis; Himmelsbach, Kiyoshi; Carvajal-Yepes, Monica; Lieder, Franziska; Klingel, Karin; Nassal, Michael; Weiss, Thomas S.; Werner, Sabine; Hildt, Eberhard

    2010-01-01

    The expression of a variety of cytoprotective genes is regulated by short cis-acting elements in their promoters, called antioxidant response elements (AREs). A central regulator of ARE-mediated gene expression is the NF-E2-related factor 2 (Nrf2). Human hepatitis B virus (HBV) induces a strong activation of Nrf2/ARE-regulated genes in vitro and in vivo. This is triggered by the HBV-regulatory proteins (HBx and LHBs) via c-Raf and MEK. The Nrf2/ARE-mediated induction of cytoprotective genes by HBV results in a better protection of HBV-positive cells against oxidative damage as compared with control cells. Furthermore, there is a significantly increased expression of the Nrf2/ARE-regulated proteasomal subunit PSMB5 in HBV-positive cells that is associated with a decreased level of the immunoproteasome subunit PSMB5i. In accordance with this finding, HBV-positive cells display a higher constitutive proteasome activity and a decreased activity of the immunoproteasome as compared with control cells even after interferon α/γ treatment. The HBV-dependent induction of Nrf2/ARE-regulated genes might ensure survival of the infected cell, shape the immune response to HBV, and thereby promote establishment of the infection. PMID:20956535

  11. A novel target-specific gene delivery system combining baculovirus and sequence-specific long interspersed nuclear elements.

    PubMed

    Kawashima, Tomoko; Osanai, Mizuko; Futahashi, Ryo; Kojima, Tetsuya; Fujiwara, Haruhiko

    2007-07-01

    Transposable elements are valuable for somatic and germ-line transformation. However, long interspersed nuclear elements (LINEs) have not been used because of poor information on the transposition mechanism. We have developed a novel gene delivery system combining baculovirus AcNPV and two silkworm LINEs, SART1 and R1, which integrate into specific sequences of telomeric repeats and 28S ribosomal DNA, respectively. When two LINEs containing the enhanced green fluorescent protein gene recombined into AcNPV were infected into fifth instar larvae of the silkworm, we observed target-specific retrotransposition of LINEs at 72h post-infection, using polymerase chain reaction amplification and sequencing. Telomere- and 28S rDNA-specific transposition occurred in all nine tissues tested, including the ovary and testis. This is the first demonstration of site-specific gene delivery in living larvae. Insertion efficiencies were dependent on the virus titer for injection and the host strains of Bombyx mori. Using this system, we successfully detected the intergeneration transmission of retrotransposed sequences. In addition, AcNPV-mediated SART1 also transposed into telomere of another lepidopteran, Orgyia recens, suggesting that this system is useful for a wide variety of AcNPV-infectious insects. Site-specific gene delivery by virus-mediated LINE will be a potential gene therapy tool to avoid harmful unexpected insertions.

  12. Dissecting the cis and trans Elements That Regulate Adjacent-Gene Coregulation in Saccharomyces cerevisiae

    PubMed Central

    Arnone, James T.; Arace, Jeffrey R.; Soorneedi, Anand R.; Citino, Teryn T.; Kamitaki, Tadashi L.

    2014-01-01

    The relative positions that genes occupy on their respective chromosomes can play a critical role in determining how they are regulated at the transcriptional level. For example, a significant fraction of the genes from a variety of coregulated gene sets, including the ribosomal protein (RP) and the rRNA and ribosome biogenesis (RRB) regulons, exist as immediate, adjacent gene pairs. These gene pairs occur in all possible divergent, tandem, and convergent orientations. Adjacent-gene pairing in these regulons is associated with a tighter transcriptional coregulation than is observed for nonpaired genes of the same regulons. In order to define the cis and trans factors that regulate adjacent-gene coregulation (AGC), we conducted a mutational analysis of the convergently oriented RRB gene pair MPP10-YJR003C. We observed that coupled corepression of the gene pair under heat shock was abrogated when the two genes were separated by an actively expressed RNA polymerase (Pol) II transcription unit (the LEU2 gene) but not when the inserted LEU2 gene was repressed. In contrast, the insertion of an RNA Pol III-transcribed tRNA (Thr) gene did not disrupt the coregulated repression of MPP10 and YJR003C. A targeted screen of mutants defective in regulating chromosome architecture revealed that the Spt20, Snf2, and Chd1 proteins were required for coupling the repression of YJR003C to that of MPP10. Nucleosome occupancy assays performed across the MPP10 and YJR003C promoter regions revealed that the mechanism of corepression of the gene pair was not related to the repositioning of nucleosomes across the respective gene promoters. PMID:24706020

  13. An active hAT transposable element causing bud mutation of carnation by insertion into the flavonoid 3'-hydroxylase gene.

    PubMed

    Momose, Masaki; Nakayama, Masayoshi; Itoh, Yoshio; Umemoto, Naoyuki; Toguri, Toshihiro; Ozeki, Yoshihiro

    2013-04-01

    The molecular mechanisms underlying spontaneous bud mutations, which provide an important breeding tool in carnation, are poorly understood. Here we describe a new active hAT type transposable element, designated Tdic101, the movement of which caused a bud mutation in carnation that led to a change of flower color from purple to deep pink. The color change was attributed to Tdic101 insertion into the second intron of F3'H, the gene for flavonoid 3'-hydroxylase responsible for purple pigment production. Regions on the deep pink flowers of the mutant can revert to purple, a visible phenotype of, as we show, excision of the transposable element. Sequence analysis revealed that Tdic101 has the characteristics of an autonomous element encoding a transposase. A related, but non-autonomous element dTdic102 was found to move in the genome of the bud mutant as well. Its mobilization might be the result of transposase activities provided by other elements such as Tdic101. In carnation, therefore, the movement of transposable elements plays an important role in the emergence of a bud mutation.

  14. Lactogenic hormonal induction of long distance interactions between beta-casein gene regulatory elements

    USDA-ARS?s Scientific Manuscript database

    Lactogenic hormone regulation of beta-casein gene expression in mammary epithelial cells provides, an excellent model in which to study the mechanisms by which steroid and peptide hormone signaling control gene expression. Prolactin- and glucocorticoid-mediated induction of beta-casein gene express...

  15. Regulatory elements in the first intron contribute to transcriptional regulation of the beta 3 tubulin gene by 20-hydroxyecdysone in Drosophila Kc cells.

    PubMed Central

    Bruhat, A; Tourmente, S; Chapel, S; Sobrier, M L; Couderc, J L; Dastugue, B

    1990-01-01

    We have studied the transcriptional regulation of the beta 3 tubulin gene by the steroid hormone 20-hydroxyecdysone (20-OH-E) in Drosophila Kc cells. A series of hybrid genes with varying tubulin gene lengths driving the bacterial chloramphenicol acetyl transferase (CAT) gene were constructed. The promoter activity was assayed after transient expression in Kc cells, in the presence or absence of 20-OH-E. We find that 0.91Kb upstream from the transcription start site contain one or several hormone independent positive cis-acting elements, responsible for the constitutive expression of the beta 3 tubulin gene. In the large (4.5 Kb) first intron of this gene, we identified additional hormone dependent negative and positive regulatory elements, which can act in both directions and in a position-independence manner. Then, the negative intron element(s), which repress the transcription in the absence of 20-OH-E has characteristics of silencer. Images PMID:2349088

  16. The Autographa californica Multiple Nucleopolyhedrovirus ac83 Gene Contains a cis-Acting Element That Is Essential for Nucleocapsid Assembly.

    PubMed

    Huang, Zhihong; Pan, Mengjia; Zhu, Silei; Zhang, Hao; Wu, Wenbi; Yuan, Meijin; Yang, Kai

    2017-03-01

    Baculoviridae is a family of insect-specific viruses that have a circular double-stranded DNA genome packaged within a rod-shaped capsid. The mechanism of baculovirus nucleocapsid assembly remains unclear. Previous studies have shown that deletion of the ac83 gene of Autographa californica multiple nucleopolyhedrovirus (AcMNPV) blocks viral nucleocapsid assembly. Interestingly, the ac83-encoded protein Ac83 is not a component of the nucleocapsid, implying a particular role for ac83 in nucleocapsid assembly that may be independent of its protein product. To examine this possibility, Ac83 synthesis was disrupted by insertion of a chloramphenicol resistance gene into its coding sequence or by deleting its promoter and translation start codon. Both mutants produced progeny viruses normally, indicating that the Ac83 protein is not required for nucleocapsid assembly. Subsequently, complementation assays showed that the production of progeny viruses required the presence of ac83 in the AcMNPV genome instead of its presence in trans Therefore, we reasoned that ac83 is involved in nucleocapsid assembly via an internal cis-acting element, which we named the nucleocapsid assembly-essential element (NAE). The NAE was identified to lie within nucleotides 1651 to 1850 of ac83 and had 8 conserved A/T-rich regions. Sequences homologous to the NAE were found only in alphabaculoviruses and have a conserved positional relationship with another essential cis-acting element that was recently identified. The identification of the NAE may help to connect the data of viral cis-acting elements and related proteins in the baculovirus nucleocapsid assembly, which is important for elucidating DNA-protein interaction events during this process.IMPORTANCE Virus nucleocapsid assembly usually requires specific cis-acting elements in the viral genome for various processes, such as the selection of the viral genome from the cellular nucleic acids, the cleavage of concatemeric viral genome

  17. Comparative genomics and experimental promoter analysis reveal functional liver-specific elements in mammalian hepatic lipase genes

    PubMed Central

    van Deursen, Diederik; Botma, Gert-Jan; Jansen, Hans; Verhoeven, Adrie JM

    2007-01-01

    Background Mammalian hepatic lipase (HL) genes are transcribed almost exclusively in hepatocytes. The basis for this liver-restricted expression is not completely understood. We hypothesized that the responsible cis-acting elements are conserved among mammalian HL genes. To identify these elements, we made a genomic comparison of 30 kb of 5'-flanking region of the rat, mouse, rhesus monkey, and human HL genes. The in silico data were verified by promoter-reporter assays in transfected hepatoma HepG2 and non-hepatoma HeLa cells using serial 5'-deletions of the rat HL (-2287/+9) and human HL (-685/+13) promoter region. Results Highly conserved elements were present at the proximal promoter region, and at 14 and 22 kb upstream of the transcriptional start site. Both of these upstream elements increased transcriptional activity of the human HL (-685/+13) promoter region 2–3 fold. Within the proximal HL promoter region, conserved clusters of transcription factor binding sites (TFBS) were identified at -240/-200 (module A), -80/-40 (module B), and -25/+5 (module C) by the rVista software. In HepG2 cells, modules B and C, but not module A, were important for basal transcription. Module B contains putative binding sites for hepatocyte nuclear factors HNF1α. In the presence of module B, transcription from the minimal HL promoter was increased 1.5–2 fold in HepG2 cells, but inhibited 2–4 fold in HeLa cells. Conclusion Our data demonstrate that searching for conserved non-coding sequences by comparative genomics is a valuable tool in identifying candidate enhancer elements. With this approach, we found two putative enhancer elements in the far upstream region of the HL gene. In addition, we obtained evidence that the -80/-40 region of the HL gene is responsible for enhanced HL promoter activity in hepatoma cells, and for silencing HL promoter activity in non-liver cells. PMID:17428321

  18. Oxidative Stress Regulates CFTR Gene Expression in Human Airway Epithelial Cells through a Distal Antioxidant Response Element

    PubMed Central

    Zhang, Zhaolin; Leir, Shih-Hsing

    2015-01-01

    Cystic fibrosis transmembrane conductance regulator gene (CFTR) expression in human airway epithelial cells involves the recruitment of distal cis-regulatory elements, which are associated with airway-selective DNase hypersensitive sites at −44 kb and −35 kb from the gene. The −35-kb site encompasses an enhancer that is regulated by the immune mediators interferon regulatory factor 1 and 2 and by nuclear factor Y. Here we investigate the −44-kb element, which also has enhancer activity in vitro in airway epithelial cells but is inactive in intestinal epithelial cells. This site contains an antioxidant response element (ARE) that plays a critical role in its function in airway cell lines and primary human bronchial epithelial cells. The natural antioxidant sulforaphane (SFN) induces nuclear translocation of nuclear factor, erythroid 2-like 2 (Nrf2), a transcription factor that regulates genes with AREs in their promoters, many of which are involved in response to injury. Under normal conditions, the −44-kb ARE is occupied by the repressor BTB and CNC homology 1, basic leucine zipper transcription factor (Bach1), and v-Maf avian musculoaponeurotic fibrosarcoma oncogene homolog K (MafK) heterodimers. After 2 hours of SFN treatment, Nrf2 displaces these repressive factors and activates CFTR expression. Site-directed mutagenesis shows that both the ARE and an adjacent NF-κB binding site are required for activation of the –44-kb element in airway epithelial cells. Moreover, this element is functionally linked to the −35-kb enhancer in modulating CFTR expression in response to environmental stresses in the airway. PMID:25259561

  19. Structure and transcriptional impact of divergent repetitive elements inserted within Phanerochaete chrysosporium strain RP-78 genes

    Treesearch

    Luis F. Larrondo; Paulo Canessa; Rafael Vicuna; Philip Stewart; Amber Vanden Wymelenberg; Dan Cullen

    2007-01-01

    We describe the structure, organization, and transcriptional impact of repetitive elements within the lignin-degrading basidiomycete, Phanerochaete chrysosporium. Searches of the P. chrysosporium genome revealed five copies of pce1, a 1,750-nt non-autonomous, class II element. Alleles encoding a putative glucosyltransferase and a cytochrome P450 harbor pce insertions...

  20. A novel positive regulatory element for exfoliative toxin A gene expression in Staphylococcus aureus.

    PubMed

    Sakurai, Susumu; Suzuki, Hitoshi; Hata, Toshiaki; Yoshizawa, Yukio; Nakayama, Ritsuko; Machida, Katsuhiko; Masuda, Shogo; Tsukiyama, Takashi

    2004-04-01

    A 1.4 kb positive regulatory element (ETA(exp)) that controls staphylococcal exfoliative toxin A (sETA) transcription was cloned from Staphylococcus aureus. ETA(exp) is located upstream of the cloned 5.8 kb eta gene (etaJ1) obtained from the chomosomal DNA of S. aureus ZM, the standard ETA-producing strain. The cETA prepared from an Escherichia coli transformant into which the recombinant plasmid petaJ1 (5.8 kb eta/pUC9) had been introduced was expressed at high levels in the culture supernatant and the ammonium-sulfate-precipitated culture supernatant fraction as shown by immunoblotting and the single radial immunodiffusion test. However, cETA produced by the recombinant plasmid petaJ3 containing the 1.7 kb eta sequence (etaJ3) with a 1.45 kb ETA(exp)-deficient eta fragment (1.7 kb eta/pUC9) obtained from the 5.8 kb eta sequence by subcloning was not detected in either the culture supernatant or the ammonium-sulfate-precipitated culture supernatant fraction (167-fold concentrate of the culture supernatant) by immunoblotting or the single radial immunodiffusion test. A large amount of cETA was produced by the 1.7 kb eta sequence when it was linked to ETA(exp) amplified by PCR (1.7 kb eta-ETA(exp)/pUC9), regardless of the orientation of ETA(exp) insertion. Northern blot hybridization showed lower levels of the transcripts of the 1.7 kb eta sequence than of the 5.8 kb eta sequence. The rsETA prepared from an S. aureus transformant into which the recombinant plasmid 3.4 kb eta-ETA(exp)/pYT3 (pYT3-etaJ6) had been introduced was expressed at high levels in the culture supernatant fraction as shown by the latex agglutination test. However, the agglutination titre in the culture supernatant fraction of rsETA produced by the recombinant plasmid (1.7 kb eta/pYT3) containing the 1.7 kb eta sequence carrying the 1.4 kb ETA(exp)-deficient eta fragment (pYT3-etaJ3) was 2500-4000 times lower than that of pYT3-etaJ6.

  1. Horizontal Gene Acquisitions, Mobile Element Proliferation, and Genome Decay in the Host-Restricted Plant Pathogen Erwinia Tracheiphila.

    PubMed

    Shapiro, Lori R; Scully, Erin D; Straub, Timothy J; Park, Jihye; Stephenson, Andrew G; Beattie, Gwyn A; Gleason, Mark L; Kolter, Roberto; Coelho, Miguel C; De Moraes, Consuelo M; Mescher, Mark C; Zhaxybayeva, Olga

    2016-03-18

    Modern industrial agriculture depends on high-density cultivation of genetically similar crop plants, creating favorable conditions for the emergence of novel pathogens with increased fitness in managed compared with ecologically intact settings. Here, we present the genome sequence of six strains of the cucurbit bacterial wilt pathogen Erwinia tracheiphila (Enterobacteriaceae) isolated from infected squash plants in New York, Pennsylvania, Kentucky, and Michigan. These genomes exhibit a high proportion of recent horizontal gene acquisitions, invasion and remarkable amplification of mobile genetic elements, and pseudogenization of approximately 20% of the coding sequences. These genome attributes indicate that E. tracheiphila recently emerged as a host-restricted pathogen. Furthermore, chromosomal rearrangements associated with phage and transposable element proliferation contribute to substantial differences in gene content and genetic architecture between the six E. tracheiphila strains and other Erwinia species. Together, these data lead us to hypothesize that E. tracheiphila has undergone recent evolution through both genome decay (pseudogenization) and genome expansion (horizontal gene transfer and mobile element amplification). Despite evidence of dramatic genomic changes, the six strains are genetically monomorphic, suggesting a recent population bottleneck and emergence into E. tracheiphila's current ecological niche. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  2. Horizontal Gene Acquisitions, Mobile Element Proliferation, and Genome Decay in the Host-Restricted Plant Pathogen Erwinia Tracheiphila

    PubMed Central

    Shapiro, Lori R.; Scully, Erin D.; Straub, Timothy J.; Park, Jihye; Stephenson, Andrew G.; Beattie, Gwyn A.; Gleason, Mark L.; Kolter, Roberto; Coelho, Miguel C.; De Moraes, Consuelo M.; Mescher, Mark C.; Zhaxybayeva, Olga

    2016-01-01

    Modern industrial agriculture depends on high-density cultivation of genetically similar crop plants, creating favorable conditions for the emergence of novel pathogens with increased fitness in managed compared with ecologically intact settings. Here, we present the genome sequence of six strains of the cucurbit bacterial wilt pathogen Erwinia tracheiphila (Enterobacteriaceae) isolated from infected squash plants in New York, Pennsylvania, Kentucky, and Michigan. These genomes exhibit a high proportion of recent horizontal gene acquisitions, invasion and remarkable amplification of mobile genetic elements, and pseudogenization of approximately 20% of the coding sequences. These genome attributes indicate that E. tracheiphila recently emerged as a host-restricted pathogen. Furthermore, chromosomal rearrangements associated with phage and transposable element proliferation contribute to substantial differences in gene content and genetic architecture between the six E. tracheiphila strains and other Erwinia species. Together, these data lead us to hypothesize that E. tracheiphila has undergone recent evolution through both genome decay (pseudogenization) and genome expansion (horizontal gene transfer and mobile element amplification). Despite evidence of dramatic genomic changes, the six strains are genetically monomorphic, suggesting a recent population bottleneck and emergence into E. tracheiphila’s current ecological niche. PMID:26992913

  3. Cloning the uteroglobin gene promoter from the relic volcano rabbit (Romerolagus diazi) reveals an ancient estrogen-response element.

    PubMed

    Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén

    2012-05-01

    To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE.

  4. Expression of Genes for Si Uptake, Accumulation, and Correlation of Si with Other Elements in Ionome of Maize Kernel.

    PubMed

    Bokor, Boris; Ondoš, Slavomír; Vaculík, Marek; Bokorová, Silvia; Weidinger, Marieluise; Lichtscheidl, Irene; Turňa, Ján; Lux, Alexander

    2017-01-01

    The mineral composition of cells, tissues, and organs is decisive for the functioning of the organisms, and is at the same time an indicator for understanding of physiological processes. We measured the composition of the ionome in the different tissues of maize kernels by element microanalysis, with special emphasis on silicon (Si). We therefore also measured the expression levels of the Si transporter genes ZmLsi1, ZmLsi2 and ZmLsi6, responsible for Si uptake and accumulation. Two weeks after pollination ZmLsi1 and ZmLsi6 genes were expressed, and expression continued until the final developmental stage of the kernels, while ZmLsi2 was not expressed. These results suggest that exclusively ZmLsi1 and ZmLsi6 are responsible for Si transport in various stages of kernel development. Expression level of ZmLsi genes was consistent with Si accumulation within kernel tissues. Silicon was mainly accumulated in pericarp and embryo proper and the lowest Si content was detected in soft endosperm and the scutellum. Correlation linkages between the distribution of Si and some other elements (macroelements Mg, P, S, N, P, and Ca and microelements Cl, Zn, and Fe) were found. The relation of Si with Mg was detected in all kernel tissues. The Si linkage with other elements was rather specific and found only in certain kernel tissues of maize. These relations may have effect on nutrient uptake and accumulation.

  5. Expression of Genes for Si Uptake, Accumulation, and Correlation of Si with Other Elements in Ionome of Maize Kernel

    PubMed Central

    Bokor, Boris; Ondoš, Slavomír; Vaculík, Marek; Bokorová, Silvia; Weidinger, Marieluise; Lichtscheidl, Irene; Turňa, Ján; Lux, Alexander

    2017-01-01

    The mineral composition of cells, tissues, and organs is decisive for the functioning of the organisms, and is at the same time an indicator for understanding of physiological processes. We measured the composition of the ionome in the different tissues of maize kernels by element microanalysis, with special emphasis on silicon (Si). We therefore also measured the expression levels of the Si transporter genes ZmLsi1, ZmLsi2 and ZmLsi6, responsible for Si uptake and accumulation. Two weeks after pollination ZmLsi1 and ZmLsi6 genes were expressed, and expression continued until the final developmental stage of the kernels, while ZmLsi2 was not expressed. These results suggest that exclusively ZmLsi1 and ZmLsi6 are responsible for Si transport in various stages of kernel development. Expression level of ZmLsi genes was consistent with Si accumulation within kernel tissues. Silicon was mainly accumulated in pericarp and embryo proper and the lowest Si content was detected in soft endosperm and the scutellum. Correlation linkages between the distribution of Si and some other elements (macroelements Mg, P, S, N, P, and Ca and microelements Cl, Zn, and Fe) were found. The relation of Si with Mg was detected in all kernel tissues. The Si linkage with other elements was rather specific and found only in certain kernel tissues of maize. These relations may have effect on nutrient uptake and accumulation. PMID:28674553

  6. Transcriptional response elements in the promoter of CYP6B1, an insect P450 gene regulated by plant chemicals.

    PubMed

    Petersen, Rebecca A; Niamsup, Hataichanoke; Berenbaum, May R; Schuler, Mary A

    2003-02-17

    Papilio polyxenes, a lepidopteran continually exposed to toxic furanocoumarins in its hostplants, owes its tolerance to these compounds to the transcriptional induction of the CYP6B1 gene encoding a P450 capable of metabolizing linear furanocoumarins, such as xanthotoxin, at high rates. Transient expression of various lengths of wild-type and mutant CYP6B1v3 promoter in lepidopteran Sf9 cells defines a positive element (XRE-xan) from -136 to -119 required for both basal and xanthotoxin-inducible transcription and a negative element from -228 to -146 that represses basal transcription. Fusion of the CYP6B1v3 XRE-xan element to the Drosophila melanogaster Eip28/29 core promoter indicates that the XRE-xan functions in conjunction with its own core promoter but not with a heterologous core promoter. Sequence searches of the CYP6B1v3 proximal promoter region revealed a number of putative elements (XRE-AhR, ARE, OCT-1, EcRE, C/EBP, Inr) sharing sequence similarity with those in other regulated vertebrate and insect promoters. Mutation of TGAC nucleotides shared by the overlapping EcRE/ARE/XRE-xan indicates that this sequence is essential for basal and regulated transcription of this gene. Mutagenesis in the non-overlapping region of the EcRE indicates it modulates basal transcription. These findings are incorporated into a working model for regulation of this toxin-inducible promoter.

  7. Negative Glucocorticoid Response-Like Element from the First Intron of the Chicken Growth Hormone Gene Represses Gene Expression in the Rat Pituitary Tumor Cell Line.

    PubMed

    Ma, Jing-E; Lang, Qian-Qian; Qiu, Feng-Fang; Zhang, Li; Li, Xiang-Guang; Luo, Wen; Wang, Juan; Wang, Xing; Lin, Xi-Ran; Liu, Wen-Sheng; Nie, Qing-Hua; Zhang, Xi-Quan

    2016-11-09

    The effects of introns, especially the first intron, on the regulation of gene expression remains unclear. Therefore, the objective of the present study was to investigate the transcriptional regulatory function of intron 1 on the chicken growth hormone (cGH) gene in the rat pituitary tumor cell line (GH4-C1). Transient transfection using first-intron-inserted cGH complete coding sequences (CDSs) and non-intron-inserted cGH CDS plasmids, quantitative RT-PCR (qRT-PCR) and western blot assays were used to detect the expression of cGH. The reporter gene assay was also used to investigate the effect of a series of fragments in the first intron of cGH on gene expression in GH4-C1. All of the results revealed that a 200-bp fragment located in the +485/+684 region of intron 1 was essential for repressing the expression of cGH. Further informatics analysis showed that there was a cluster of 13 transcriptional factor binding sites (TFBSs) in the +485/+684 region of the cGH intron 1. Disruption of a glucocorticoid response-like element (the 19-nucleotide sequence 5'-AGGCTTGACAGTGACCTCC-3') containing a T-box motif (TGACCT) located within this DNA fragment increased the expression of the reporter gene in GH4-C1. In addition, an electrophoretic mobility shift assay (EMSA) revealed a glucocorticoid receptor (GR) protein of rat binding to the glucocorticoid response-like element. Together, these results indicate that there is a negative glucocorticoid response-like element (nGRE) located in the +591/+609 region within the first intron of cGH, which is essential for the down-regulation of cGH expression.

  8. Negative Glucocorticoid Response-Like Element from the First Intron of the Chicken Growth Hormone Gene Represses Gene Expression in the Rat Pituitary Tumor Cell Line

    PubMed Central

    Ma, Jing-E.; Lang, Qian-Qian; Qiu, Feng-Fang; Zhang, Li; Li, Xiang-Guang; Luo, Wen; Wang, Juan; Wang, Xing; Lin, Xi-Ran; Liu, Wen-Sheng; Nie, Qing-Hua; Zhang, Xi-Quan

    2016-01-01

    The effects of introns, especially the first intron, on the regulation of gene expression remains unclear. Therefore, the objective of the present study was to investigate the transcriptional regulatory function of intron 1 on the chicken growth hormone (cGH) gene in the rat pituitary tumor cell line (GH4-C1). Transient transfection using first-intron-inserted cGH complete coding sequences (CDSs) and non-intron-inserted cGH CDS plasmids, quantitative RT-PCR (qRT-PCR) and western blot assays were used to detect the expression of cGH. The reporter gene assay was also used to investigate the effect of a series of fragments in the first intron of cGH on gene expression in GH4-C1. All of the results revealed that a 200-bp fragment located in the +485/+684 region of intron 1 was essential for repressing the expression of cGH. Further informatics analysis showed that there was a cluster of 13 transcriptional factor binding sites (TFBSs) in the +485/+684 region of the cGH intron 1. Disruption of a glucocorticoid response-like element (the 19-nucleotide sequence 5′-AGGCTTGACAGTGACCTCC-3′) containing a T-box motif (TGACCT) located within this DNA fragment increased the expression of the reporter gene in GH4-C1. In addition, an electrophoretic mobility shift assay (EMSA) revealed a glucocorticoid receptor (GR) protein of rat binding to the glucocorticoid response-like element. Together, these results indicate that there is a negative glucocorticoid response-like element (nGRE) located in the +591/+609 region within the first intron of cGH, which is essential for the down-regulation of cGH expression. PMID:27834851

  9. DG-CST (Disease Gene Conserved Sequence Tags), a database of human–mouse conserved elements associated to disease genes

    PubMed Central

    Boccia, Angelo; Petrillo, Mauro; di Bernardo, Diego; Guffanti, Alessandro; Mignone, Flavio; Confalonieri, Stefano; Luzi, Lucilla; Pesole, Graziano; Paolella, Giovanni; Ballabio, Andrea; Banfi, Sandro

    2005-01-01

    The identification and study of evolutionarily conserved genomic sequences that surround disease-related genes is a valuable tool to gain insight into the functional role of these genes and to better elucidate the pathogenetic mechanisms of disease. We created the DG-CST (Disease Gene Conserved Sequence Tags) database for the identification and detailed annotation of human–mouse conserved genomic sequences that are localized within or in the vicinity of human disease-related genes. CSTs are defined as sequences that show at least 70% identity between human and mouse over a length of at least 100 bp. The database contains CST data relative to over 1088 genes responsible for monogenetic human genetic diseases or involved in the susceptibility to multifactorial/polygenic diseases. DG-CST is accessible via the internet at http://dgcst.ceinge.unina.it/ and may be searched using both simple and complex queries. A graphic browser allows direct visualization of the CSTs and related annotations within the context of the relative gene and its transcripts. PMID:15608249

  10. Elements of style: consent form language and the therapeutic misconception in phase 1 gene transfer trials.

    PubMed

    Kimmelman, Jonathan; Levenstadt, Aaron

    2005-04-01

    The therapeutic misconception arises wherever human subjects misinterpret the primary purpose of a clinical trial as therapeutic. Such misconceptions are particularly prevalent in trials involving severely ill subjects or novel and well-publicized investigational agents. In order to identify possible sources of the therapeutic misconception in gene transfer trials, 286 phase 1 human gene transfer consent documents were analyzed for their description of purpose, alternatives, and their use of the term gene transfer. We report that 20% of trials fail to explain their purpose as safety and dosage, only 41% of oncology trials identify comfort care as an alternative to participation, and that the term gene therapy is used with twice the frequency of the term gene transfer. Trends and coherence in consent form language were analyzed as well. Our results indicate that consent forms used in gene transfer phase 1 trials often contain language that promotes, or does little to deter, therapeutic misconceptions.

  11. Characterization of calcineurin-dependent response element binding protein and its involvement in copper-metallothionein gene expression in Neurospora

    SciTech Connect

    Kumar, Kalari Satish; Ravi Kumar, B.; Siddavattam, Dayananda; Subramanyam, Chivukula . E-mail: csubramanyam@hotmail.com

    2006-07-07

    In continuation of our recent observations indicating the presence of a lone calcineurin-dependent response element (CDRE) in the -3730 bp upstream region of copper-induced metallothionein (CuMT) gene of Neurospora [K.S. Kumar, S. Dayananda, C. Subramanyam, Copper alone, but not oxidative stress, induces copper-metallothionein gene in Neurospora crassa, FEMS Microbiol. Lett. 242 (2005) 45-50], we isolated and characterized the CDRE-binding protein. The cloned upstream region of CuMT gene was used as the template to specifically amplify CDRE element, which was immobilized on CNBr-activated Sepharose 4B for use as the affinity matrix to purify the CDRE binding protein from nuclear extracts obtained from Neurospora cultures grown in presence of copper. Two-dimensional gel electrophoresis of the affinity purified protein revealed the presence of a single 17 kDa protein, which was identified and characterized by MALDI-TOF. Peptide mass finger printing of tryptic digests and analysis of the 17 kDa protein matched with the regulatory {beta}-subunit of calcineurin (Ca{sup 2+}-calmodulin dependent protein phosphatase). Parallel identification of nuclear localization signals in this protein by in silico analysis suggests a putative role for calcineurin in the regulation of CuMT gene expression.

  12. Tissue-specific gene expression in medullary thyroid carcinoma cells employing calcitonin regulatory elements and AAV vectors.

    PubMed

    Jiang, S; Altmann, A; Grimm, D; Kleinschmidt, J A; Schilling, T; Germann, C; Haberkorn, U

    2001-07-01

    Calcitonin (CT), the major secretory product of the C cell, is also expressed in C-cell-derived neoplasia. To investigate the role of the CT gene regulatory sequence in tissue-specific gene expression, the genes coding for the herpes simplex virus thymidine kinase (HSVtk) and for the enhanced green fluorescent protein (EGFP) regulated by the CT promoter (rAAV/CT266tkneo), the CT promoter/enhancer element (rAAV/CTenhtkneo), or the cytomegalovirus (CMV) promoter (rAAV/CMVtkneo) were transduced by recombinant adenoassociated viral (AAV) vectors into the medullary thyroid carcinoma (MTC) cell lines TT and hMTC and into HeLa cells as controls. In TT cell lines and hMTC cell lines transiently infected by the rAAV/CT266tkneo viruses, a significant increase in (3)H ganciclovir uptake was observed. Upon ganciclovir treatment, TT cells infected by rAAV/CT266tkneo revealed a significant growth inhibition, which was less tissue-specific because HeLa cells were also affected by these particles (74.5%). In contrast, a minor but more tissue-specific growth inhibition (33.6%) was observed for TT cells after transient infection with the rAAV/CTenhtkneo particles. Employing EGFP controlled by CMV promoter and the individual CT regulatory sequences for transduction by rAAV particles, similar results were obtained indicating that both the CT promoter and enhancer element are required for tissue-specific gene expression in MTC.

  13. Transposable element dynamics and PIWI regulation impacts lncRNA and gene expression diversity in Drosophila ovarian cell cultures

    PubMed Central

    Sytnikova, Yuliya A.; Rahman, Reazur; Chirn, Gung-wei; Clark, Josef P.

    2014-01-01

    Piwi proteins and Piwi-interacting RNAs (piRNAs) repress transposable elements (TEs) from mobilizing in gonadal cells. To determine the spectrum of piRNA-regulated targets that may extend beyond TEs, we conducted a genome-wide survey for transcripts associated with PIWI and for transcripts affected by PIWI knockdown in Drosophila ovarian somatic sheet (OSS) cells, a follicle cell line expressing the Piwi pathway. Despite the immense sequence diversity among OSS cell piRNAs, our analysis indicates that TE transcripts are the major transcripts associated with and directly regulated by PIWI. However, several coding genes were indirectly regulated by PIWI via an adjacent de novo TE insertion that generated a nascent TE transcript. Interestingly, we noticed that PIWI-regulated genes in OSS cells greatly differed from genes affected in a related follicle cell culture, ovarian somatic cells (OSCs). Therefore, we characterized the distinct genomic TE insertions across four OSS and OSC lines and discovered dynamic TE landscapes in gonadal cultures that were defined by a subset of active TEs. Particular de novo TEs appeared to stimulate the expression of novel candidate long noncoding RNAs (lncRNAs) in a cell lineage-specific manner, and some of these TE-associated lncRNAs were associated with PIWI and overlapped PIWI-regulated genes. Our analyses of OSCs and OSS cells demonstrate that despite having a Piwi pathway to suppress endogenous mobile elements, gonadal cell TE landscapes can still dramatically change and create transcriptome diversity. PMID:25267525

  14. Gene Network Rewiring to Study Melanoma Stage Progression and Elements Essential for Driving Melanoma

    PubMed Central

    Kaushik, Abhinav; Bhatia, Yashuma; Ali, Shakir; Gupta, Dinesh

    2015-01-01

    Metastatic melanoma patients have a poor prognosis, mainly attributable to the underlying heterogeneity in melanoma driver genes and altered gene expression profiles. These characteristics of melanoma also make the development of drugs and identification of novel drug targets for metastatic melanoma a daunting task. Systems biology offers an alternative approach to re-explore the genes or gene sets that display dysregulated behaviour without being differentially expressed. In this study, we have performed systems biology studies to enhance our knowledge about the conserved property of disease genes or gene sets among mutually exclusive datasets representing melanoma progression. We meta-analysed 642 microarray samples to generate melanoma reconstructed networks representing four different stages of melanoma progression to extract genes with altered molecular circuitry wiring as compared to a normal cellular state. Intriguingly, a majority of the melanoma network-rewired genes are not differentially expressed and the disease genes involved in melanoma progression consistently modulate its activity by rewiring network connections. We found that the shortlisted disease genes in the study show strong and abnormal network connectivity, which enhances with the disease progression. Moreover, the deviated network properties of the disease gene sets allow ranking/prioritization of different enriched, dysregulated and conserved pathway terms in metastatic melanoma, in agreement with previous findings. Our analysis also reveals presence of distinct network hubs in different stages of metastasizing tumor for the same set of pathways in the statistically conserved gene sets. The study results are also presented as a freely available database at http://bioinfo.icgeb.res.in/m3db/. The web-based database resource consists of results from the analysis presented here, integrated with cytoscape web and user-friendly tools for visualization, retrieval and further analysis. PMID

  15. A novel tumor necrosis factor-responsive transcription factor which recognizes a regulatory element in hemopoietic growth factor genes

    SciTech Connect

    Shannon, M.F.; Pell, L.M.; Kuczek, E.S.; Occhiodoro, F.S.; Dunn, S.M.; Vadas, M.A. ); Lenardo, M.J. )

    1990-06-01

    A conserved DNA sequence element, termed cytokine 1 (CK-1), is found in the promoter regions of many hemopoietic growth factor (HGF) genes. Mutational analyses and modification interference experiments show that this sequence specifically binds a nuclear transcription factor, NF-GMa, which is a protein with a molecular mass of 43 kilodaltons. It interacts with different affinities with the CK-1-like sequence from a number of HGF genes, including granulocyte macrophage colony-stimulating factor (GM-CSF), granulocyte (G)-CSF, interleukin 3 (IL-3), and IL-5. The authors show that the level of NF-GMa binding is induced in embryonic fibroblasts by tumor necrosis factor {alpha} (TNF-{alpha}) treatment and that the CK-1 sequence from the G-CSF gene is a TNF-{alpha}-responsive enhancer in these cells.

  16. Identification of differentially expressed genes in Sulfobacillus sp. TPY grown on either elemental sulphur or Fe(2+).

    PubMed

    Qi, Huizhou; Chen, Hong; Ao, Jingqun; Zhou, Hongbo; Chen, Xinhua

    2010-10-01

    Sulfobacillus sp. TPY is a moderately thermophilic and acidophilic bacterium found in hydrothermal vents in the Pacific Ocean. This bacterium can oxidize ferrous sulfate (Fe(2+)) and elemental sulfur (S(0)) under separate conditions. We used random arbitrarily primed polymerase chain reaction (RAP-PCR) to screen and identify differentially expressed genes from bacteria grown on Fe(2+) or S(0) as the energy source. Fifty-five differential cDNA fragments were isolated and subjected to single-pass sequencing. Thirty-five fragments were identified as orthologs of known genes in the GenBank databases, of which 19 were confirmed to be differentially expressed at the transcriptional level by Northern blot analysis. Among these 19 genes, 14 genes, including isocitrate dehydrogenase, formyltetrahydrofolate deformylase, 3-hydroxybutyryl-CoA dehydrogenase, and GTP-binding protein, were upregulated in TPY grown on Fe(2+) or downregulated in TPY grown on S(0), while five genes such as the outer membrane adhesion-like protein, phosphomannomutase, and cysteine desulfurase sufS were upregulated in TPY strain grown on S(0) or downregulated in TPY grown on Fe(2+). These altered genes are involved in metabolism, osmotic stress, cell membrane alterations, oxidative stress, and the regulatory adaptive response. These results will aid our understanding of the molecular basis of Fe(2+) or S(0) oxidation by the moderately thermophilic and acidophilic bacteria.

  17. Selected translocation of plasmid genes: frequency and regional specificity of translocation of the Tn3 element.

    PubMed

    Kretschmer, P J; Cohen, S N

    1977-05-01

    A procedure is described that selects for the insertion of transposable antibiotic resistance elements in a variety of recipient replicons. The selected translocation procedure, which employs a plasmid having a temperature-sensitive defect in replication as a donor of transposable genetic elements, was used to investigate certain characteristics of the translocation process. Our results indicate that translocation of the Tn3 element from plasmid to plasmid occurs at a 10(3)- to 10(4)-times-higher frequency than from plasmid to chromosome. In both cases, continued accumulation of Tn3 on recipient genomes is prevented by development of an apparent equilibrium when only a small fraction of molecules in the recipient population contain Tn3. An alternative method for estimation of translocation frequency has shown that the translocation process is temperature sensitive and that its frequency is unaffected by the presence of host recA mutation. Insertions of Tn3 onto the 65 X 10(6)-dalton R6-5 plasmid in Escherichia coli are clustered on EcoRI fragments 3 (8 of 23 insertions) and 9 (7 of 23 insertions), which contain 12 and 5%, respectively, of the R6-5 genome. The occurrence of multiple insertions of Tn3 within EcoRI fragment 9, which contains the IS1 element and a terminus of the Tn4 element, is consistent with earlier evidence indicating that terminal deoxyribonucleic acid sequences of already present transposable elements may provide recognition sequences for subsequent illegitimate recombinational events.

  18. Identification and characterization of a neuroretina-specific enhancer element in the quail Pax-6 (Pax-QNR) gene.

    PubMed Central

    Plaza, S; Dozier, C; Langlois, M C; Saule, S

    1995-01-01

    Using nuclear run-on assays, we showed that the tissue-specific expression of quail Pax-6 (Pax-QNR) P0-initiated mRNAs is due in part to regulation of the gene at the transcriptional level. Regulatory sequences governing neuroretina-specific expression of the P0-initiated mRNAs were investigated. By using reporter-based expression assays, we characterized a region within the Pax-QNR gene, located 7.5 kbp downstream from the P0 promoter, that functions as an enhancer in neuroretina cells but not in nonexpressing P0-initiated mRNA cells (quail embryo cells and quail retinal pigment epithelial cells). This enhancer element functioned in a position- and orientation-independent manner both on the Pax-QNR P0 promoter and the heterologous thymidine kinase promoter. Moreover, this enhancer element exhibited a developmental stage-specific activity during embryonic neuroretina development: in contrast to activity at day E7, the enhancer activity was very weak at day E5. This paralleled the level of expression of P0-initiated mRNAs observed at the same stages. Using footprinting, gel retardation, and Southwestern (DNA-protein) analysis, we demonstrated the existence of four neuroretina-specific nuclear protein-binding sites, involving multiple unknown factors. In addition we showed that the quail enhancer element is structurally and functionally conserved in mice. All of these results strongly suggest that this enhancer element may contribute to the neuroretina-specific transcriptional regulation of the Pax-6 gene in vivo. PMID:7529875

  19. Isolation of Sparus auratus prolactin gene and activity of the cis-acting regulatory elements.

    PubMed

    Astola, Antonio; Ortiz, Manuela; Calduch-Giner, Josep A; Pérez-Sánchez, Jaume; Valdivia, Manuel M

    2003-10-15

    A sea bream prolactin (sbPRL) gene was isolated using a prolactin cDNA fragment, generated by PCR as a probe. The gene analyzed comprises 3.5 kb of DNA containing five exons as described previously for other fish PRL genes. Analysis of 1.0 kb of the proximal promoter sequence reveals a consensus TATAA box, up to seven (A/T)3NCAT consensus motifs for binding of the pituitary-specific factor Pit-1 and putative CREB and GATA binding sites. CHO culture cells co-transfected with a sbPRL promoter sequence and a sea bream Pit-1 cDNA expression plasmid showed expression of a linked luciferase reporter gene. Transient expression experiments with 5'-delection mutants reveals at least three regulatory regions on the sbPRL gene, two with a stimulatory effect on transcription and one with apparent inhibitory effect. From a comparative point of view, this study of PRL gene in Sparus auratus, correlates well with those previously published on tilapia and rainbow trout. The molecular data reported will be useful for comparative analysis of gene regulation in the GH/PRL gene family in teleosts.

  20. Demystifying the secret mission of enhancers: linking distal regulatory elements to target genes

    PubMed Central

    Yao, Lijing; Berman, Benjamin P.; Farnham, Peggy J.

    2015-01-01

    Abstract Enhancers are short regulatory sequences bound by sequence-specific transcription factors and play a major role in the spatiotemporal specificity of gene expression patterns in development and disease. While it is now possible to identify enhancer regions genomewide in both cultured cells and primary tissues using epigenomic approaches, it has been more challenging to develop methods to understand the function of individual enhancers because enhancers are located far from the gene(s) that they regulate. However, it is essential to identify target genes of enhancers not only so that we can understand the role of enhancers in disease but also because this information will assist in the development of future therapeutic options. After reviewing models of enhancer function, we discuss recent methods for identifying target genes of enhancers. First, we describe chromatin structure-based approaches for directly mapping interactions between enhancers and promoters. Second, we describe the use of correlation-based approaches to link enhancer state with the activity of nearby promoters and/or gene expression. Third, we describe how to test the function of specific enhancers experimentally by perturbing enhancer–target relationships using high-throughput reporter assays and genome editing. Finally, we conclude by discussing as yet unanswered questions concerning how enhancers function, how target genes can be identified, and how to distinguish direct from indirect changes in gene expression mediated by individual enhancers. PMID:26446758

  1. Cis-acting elements in the pyruvate, orthophosphate dikinase gene from maize.

    PubMed

    Matsuoka, M; Numazawa, T

    1991-08-01

    To investigate the mechanisms that control expression of the gene for pyruvate, orthophosphate dikinase (PPDK) in maize, the 5' flanking region of the gene was analyzed for interactions with nuclear extracts. Gel retardation assays showed that there are several sites in the promoter region which bind to protein factors. In this report we describe further study of one of these sites, designated the PPD-1 binding site. The nuclear binding factor, PPD-1, is restricted to nuclear extracts from green leaves where the PPDK gene is expressed. No binding of PPD-1 was detected in tissues such as roots or etiolated leaves where the gene is not expressed in vivo. Gel retardation assays using deletion fragments from the promoter region and synthetic oligonucleotides, as well as exonuclease III protection assays, revealed that the site of PPD-1 binding lies between positions -301 and -296. To identify the functional role of the interaction between PPD-1 and its binding site, a deletion series of the promoter region was joined to a reporter gene, beta-glucuronidase. These constructs were introduced into green leaves of maize by microprojectile bombardment. Expression of the reporter gene occurred if the PPD-1 binding site remained in the promoter region of the chimeric genes but deletion of the binding site caused a drastic reduction in expression levels. These data indicate that interaction between PPD-1 and its binding site is essential for active transcription of the PPDK gene.

  2. Intracisternal A-particle genes in Mus musculus: a conserved family of retrovirus-like elements.

    PubMed

    Kuff, E L; Smith, L A; Lueders, K K

    1981-03-01

    The structural organization of intracisternal A-particle genes has been studied, using isolates from a mouse gene library in lambda phage Charon 4A. The predominant gene form among the isolates was 7.3 kilobases (kb) in length. R-loops between the 7-kb (35S) A-particle genomic ribonucleic acid and several of these genes were colinear, with no visible evidence of intervening deoxyribonucleic acid sequences. One recombinant was found with an A-particle gene that contained a 1.7-kb deletion. Using the deletion as a reference, the deoxyribonucleic acid and ribonucleic acid homology regions were localized with respect to one another and to the restriction map: the 5' terminus of the ribonucleic acid was several hundred base pairs within the 5' end of the deoxyribonucleic acid homology region. Restriction endonuclease fragments encompassing the 5' and 3' regions of one 7.3-kb gene were separately subcloned into pBR322. Heteroduplexes between the two subclones revealed an approximately 300-base pair segment of terminally redundant sequences. The cloned 3' fragment hybridized with restriction fragments from the 5' end of several other A-particle genes, demonstrating the presence of common (though not necessarily identical) terminally repeated sequences. A-particle genes varied in the occurrence of specific restriction sites at characteristic internal loci. However, heteroduplexes between several variant 7.3-kb genes showed continuous homology regions even when spread under stringent hybridization conditions. The relative abundance of restriction site variants was highly conserved in 12 laboratory strains of Mus musculus, in embryonic and adult tissues of a single inbred strain, and in the SC-1 cell line of feral mouse origin, but appeared to differ in a feral Japanese substrain, Mus musculus molossinus. Some evidence suggests that subsets of A-particle genes may have similar flanking sequences. The results are discussed in terms of the evolution of this multigene family.

  3. Molecular and phylogenetic characterization of the sieve element occlusion gene family in Fabaceae and non-Fabaceae plants.

    PubMed

    Rüping, Boris; Ernst, Antonia M; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A

    2010-10-08

    The phloem of dicotyledonous plants contains specialized P-proteins (phloem proteins) that accumulate during sieve element differentiation and remain parietally associated with the cisternae of the endoplasmic reticulum in mature sieve elements. Wounding causes P-protein filaments to accumulate at the sieve plates and block the translocation of photosynthate. Specialized, spindle-shaped P-proteins known as forisomes that undergo reversible calcium-dependent conformational changes have evolved exclusively in the Fabaceae. Recently, the molecular characterization of three genes encoding forisome components in the model legume Medicago truncatula (MtSEO1, MtSEO2 and MtSEO3; SEO = sieve element occlusion) was reported, but little is known about the molecular characteristics of P-proteins in non-Fabaceae. We performed a comprehensive genome-wide comparative analysis by screening the M. truncatula, Glycine max, Arabidopsis thaliana, Vitis vinifera and Solanum phureja genomes, and a Malus domestica EST library for homologs of MtSEO1, MtSEO2 and MtSEO3 and identified numerous novel SEO genes in Fabaceae and even non-Fabaceae plants, which do not possess forisomes. Even in Fabaceae some SEO genes appear to not encode forisome components. All SEO genes have a similar exon-intron structure and are expressed predominantly in the phloem. Phylogenetic analysis revealed the presence of several subgroups with Fabaceae-specific subgroups containing all of the known as well as newly identified forisome component proteins. We constructed Hidden Markov Models that identified three conserved protein domains, which characterize SEO proteins when present in combination. In addition, one common and three subgroup specific protein motifs were found in the amino acid sequences of SEO proteins. SEO genes are organized in genomic clusters and the conserved synteny allowed us to identify several M. truncatula vs G. max orthologs as well as paralogs within the G. max genome. The unexpected

  4. Molecular and phylogenetic characterization of the sieve element occlusion gene family in Fabaceae and non-Fabaceae plants

    PubMed Central

    2010-01-01

    Background The phloem of dicotyledonous plants contains specialized P-proteins (phloem proteins) that accumulate during sieve element differentiation and remain parietally associated with the cisternae of the endoplasmic reticulum in mature sieve elements. Wounding causes P-protein filaments to accumulate at the sieve plates and block the translocation of photosynthate. Specialized, spindle-shaped P-proteins known as forisomes that undergo reversible calcium-dependent conformational changes have evolved exclusively in the Fabaceae. Recently, the molecular characterization of three genes encoding forisome components in the model legume Medicago truncatula (MtSEO1, MtSEO2 and MtSEO3; SEO = sieve element occlusion) was reported, but little is known about the molecular characteristics of P-proteins in non-Fabaceae. Results We performed a comprehensive genome-wide comparative analysis by screening the M. truncatula, Glycine max, Arabidopsis thaliana, Vitis vinifera and Solanum phureja genomes, and a Malus domestica EST library for homologs of MtSEO1, MtSEO2 and MtSEO3 and identified numerous novel SEO genes in Fabaceae and even non-Fabaceae plants, which do not possess forisomes. Even in Fabaceae some SEO genes appear to not encode forisome components. All SEO genes have a similar exon-intron structure and are expressed predominantly in the phloem. Phylogenetic analysis revealed the presence of several subgroups with Fabaceae-specific subgroups containing all of the known as well as newly identified forisome component proteins. We constructed Hidden Markov Models that identified three conserved protein domains, which characterize SEO proteins when present in combination. In addition, one common and three subgroup specific protein motifs were found in the amino acid sequences of SEO proteins. SEO genes are organized in genomic clusters and the conserved synteny allowed us to identify several M. truncatula vs G. max orthologs as well as paralogs within the G. max genome

  5. Bacteriophages of Staphylococcus aureus efficiently package various bacterial genes and mobile genetic elements including SCCmec with different frequencies.

    PubMed

    Mašlaňová, Ivana; Doškař, Jiří; Varga, Marian; Kuntová, Lucie; Mužík, Jan; Malúšková, Denisa; Růžičková, Vladislava; Pantůček, Roman

    2013-02-01

    Staphylococcus aureus is a serious human and veterinary pathogen in which new strains with increasing virulence and antimicrobial resistance occur due to acquiring new genes by horizontal transfer. It is generally accepted that temperate bacteriophages play a major role in gene transfer. In this study, we proved the presence of various bacterial genes of the S. aureus COL strain directly within the phage particles via qPCR and quantified their packaging frequency. Non-parametric statistical analysis showed that transducing bacteriophages φ11, φ80 and φ80α of serogroup B, in contrast to serogroup A bacteriophage φ81, efficiently package selected chromosomal genes localized in 4 various loci of the chromosome and 8 genes carried on variable elements, such as staphylococcal cassette chromosome SCCmec, staphylococcal pathogenicity island SaPI1, genomic islands vSaα and vSaβ, and plasmids with various frequency. Bacterial gene copy number per ng of DNA isolated from phage particles ranged between 1.05 × 10(2) for the tetK plasmid gene and 3.86 × 10(5) for the SaPI1 integrase gene. The new and crucial finding that serogroup B bacteriophages can package concurrently ccrA1 (1.16 × 10(4)) and mecA (1.26 × 10(4)) located at SCCmec type I into their capsids indicates that generalized transduction plays an important role in the evolution and emergence of new methicillin-resistant clones.

  6. Linking polymorphic p53 response elements with gene expression in airway epithelial cells of smokers and cancer risk.

    PubMed

    Wang, Xuting; Pittman, Gary S; Bandele, Omari J; Bischof, Jason J; Liu, Gang; Brothers, John F; Spira, Avrum; Bell, Douglas A

    2014-12-01

    Chronic cigarette smoking exposes airway epithelial cells to thousands of carcinogens, oxidants and DNA-damaging agents, creating a field of molecular injury in the airway and altering gene expression. Studies of cytologically normal bronchial epithelial cells from smokers have identified transcription-based biomarkers that may prove useful in early diagnosis of lung cancer, including a number of p53-regulated genes. The ability of p53 to regulate transcription is critical for tumor suppression, and this suggests that single-nucleotide polymorphisms (SNPs) in functional p53 binding sites (p53 response elements, or p53REs) that affect gene expression could influence susceptibility to cancer. To connect p53RE SNP genotype with gene expression and cancer risk, we identified a set of 204 SNPs in putative p53REs, and performed cis expression quantitative trait loci (eQTL) analysis, assessing associations between SNP genotypes and mRNA levels of adjacent genes in bronchial epithelial cells obtained from 44 cigarette smokers. To further test and validate these genotype-expression associations, we searched published eQTL studies from independent populations and determined that 53% (39/74) of the bronchial epithelial eQTLs were observed in at least one of other studies. SNPs in p53REs were also evaluated for effects on p53-DNA binding using a quantitative in vitro protein-DNA binding assay. Last, based on linkage disequilibrium, we found 6 p53RE SNPs associated with gene expression were identified as cancer risk SNPs by either genome-wide association studies or candidate gene studies. We provide an approach for identifying and evaluating potentially functional SNPs that may modulate the airway gene expression response to smoking and may influence susceptibility to cancers.

  7. A gene expression map of the larval Xenopus laevis head reveals developmental changes underlying the evolution of new skeletal elements.

    PubMed

    Square, Tyler; Jandzik, David; Cattell, Maria; Coe, Alex; Doherty, Jacob; Medeiros, Daniel Meulemans

    2015-01-15

    The morphology of the vertebrate head skeleton is highly plastic, with the number, size, shape, and position of its components varying dramatically between groups. While this evolutionary flexibility has been key to vertebrate success, its developmental and genetic bases are poorly understood. The larval head skeleton of the frog Xenopus laevis possesses a unique combination of ancestral tetrapod features and anuran-specific novelties. We built a detailed gene expression map of the head mesenchyme in X. laevis during early larval development, focusing on transcription factor families with known functions in vertebrate head skeleton development. This map was then compared to homologous gene expression in zebrafish, mouse, and shark embryos to identify conserved and evolutionarily flexible aspects of vertebrate head skeleton development. While we observed broad conservation of gene expression between X. laevis and other gnathostomes, we also identified several divergent features that correlate to lineage-specific novelties. We noted a conspicuous change in dlx1/2 and emx2 expression in the second pharyngeal arch, presaging the differentiation of the reduced dorsal hyoid arch skeletal element typical of modern anamniote tetrapods. In the first pharyngeal arch we observed a shift in the expression of the joint inhibitor barx1, and new expression of the joint marker gdf5, shortly before skeletal differentiation. This suggests that the anuran-specific infrarostral cartilage evolved by partitioning of Meckel's cartilage with a new paired joint. Taken together, these comparisons support a model in which early patterning mechanisms divide the vertebrate head mesenchyme into a highly conserved set of skeletal precursor populations. While subtle changes in this early patterning system can affect skeletal element size, they do not appear to underlie the evolution of new joints or cartilages. In contrast, later expression of the genes that regulate skeletal element

  8. Enhancer connectome in primary human cells identifies target genes of disease-associated DNA elements.

    PubMed

    Mumbach, Maxwell R; Satpathy, Ansuman T; Boyle, Evan A; Dai, Chao; Gowen, Benjamin G; Cho, Seung Woo; Nguyen, Michelle L; Rubin, Adam J; Granja, Jeffrey M; Kazane, Katelynn R; Wei, Yuning; Nguyen, Trieu; Greenside, Peyton G; Corces, M Ryan; Tycko, Josh; Simeonov, Dimitre R; Suliman, Nabeela; Li, Rui; Xu, Jin; Flynn, Ryan A; Kundaje, Anshul; Khavari, Paul A; Marson, Alexander; Corn, Jacob E; Quertermous, Thomas; Greenleaf, William J; Chang, Howard Y

    2017-09-25

    The challenge of linking intergenic mutations to target genes has limited molecular understanding of human diseases. Here we show that H3K27ac HiChIP generates high-resolution contact maps of active enhancers and target genes in rare primary human T cell subtypes and coronary artery smooth muscle cells. Differentiation of naive T cells into T helper 17 cells or regulatory T cells creates subtype-specific enhancer-promoter interactions, specifically at regions of shared DNA accessibility. These data provide a principled means of assigning molecular functions to autoimmune and cardiovascular disease risk variants, linking hundreds of noncoding variants to putative gene targets. Target genes identified with HiChIP are further supported by CRISPR interference and activation at linked enhancers, by the presence of expression quantitative trait loci, and by allele-specific enhancer loops in patient-derived primary cells. The majority of disease-associated enhancers contact genes beyond the nearest gene in the linear genome, leading to a fourfold increase in the number of potential target genes for autoimmune and cardiovascular diseases.

  9. YY1 and a unique DNA repeat element regulates the transcription of mouse CS1 (CD319, SLAMF7) gene.

    PubMed

    Dongre, Prachi; Mathew, Stephen; Akopova, Irina; Gryczynski, Ignacy; Mathew, Porunelloor

    2013-07-01

    CS1 (CD319, CRACC, SLAMF7, novel Ly9) activates NK cell-mediated cytotoxicity and proliferation of B lymphocytes during immune responses. The expression of CS1 is up regulated on B cells in multiple myeloma and systemic lupus erythematosus. In this study we describe the transcriptional regulation of mouse CS1 (mCS1) gene. We show that mCS1 gene transcription is regulated by YY1 (Ying Yang 1) and a unique (AG)n=36 DNA repeat element. YY1 is known to play a significant role in B cell development by regulating the pro B cell to pre B cell transition. The consensus DNA binding site for YY1 was detected using TRANSFAQ on the mCS1 promoter region. Mutations in the YY1 site led to a significant increase in mCS1 promoter activity indicating that YY1 represses mCS1 transcription. YY1 binds to the mCS1 promoter at the expected site in vivo and in vitro as tested by chromatin immunoprecipitation assays and super-shift EMSA assays respectively. Unique (CT)n=24 and (AG)n=36 DNA repeat elements are present on mCS1 promoter that are sensitive to S1 nuclease and engage in DNA triplex structure as confirmed by AFM (atomic force microscopy) imaging. Interestingly, the (AG)n=36 repeat element enhances mCS1 promoter activity. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. The upstream muscle-specific enhancer of the rat muscle creatine kinase gene is composed of multiple elements.

    PubMed Central

    Horlick, R A; Benfield, P A

    1989-01-01

    A series of constructs that links the rat muscle creatine kinase promoter to the bacterial chloramphenicol acetyltransferase gene was generated. These constructs were introduced into differentiating mouse C2C12 myogenic cells to localize sequences that are important for up-regulation of the creatine kinase gene during myogenic differentiation. A muscle-specific enhancer element responsible for induction of chloramphenicol acetyltransferase expression during myogenesis was localized to a 159-base-pair region from 1,031 to 1,190 base pairs upstream of the transcription start site. Analysis of transient expression experiments using promoters mutated by deletion indicated the presence of multiple functional domains within this muscle-specific regulatory element. A DNA fragment spanning this region was used in DNase I protection experiments. Nuclear extracts derived from C2 myotubes protected three regions (designated E1, E2, and E3) on this fragment from digestion, which indicated there may be three or more trans-acting factors that interact with the creatine kinase muscle enhancer. Gel retardation assays revealed that factors able to bind specifically to E1, E2, and E3 are present in a wide variety of tissues and cell types. Transient expression assays demonstrated that elements in regions E1 and E3, but not necessarily E2, are required for full enhancer activity. Images PMID:2761536

  11. T cell receptor gene usage in the response to lambda repressor cI protein. An apparent bias in the usage of a V alpha gene element

    PubMed Central

    1988-01-01

    The T cell response to the lambda repressor cI protein is directed to the same region of the protein (residues 12-26) in both BALB/c and A/J mice. A panel of T cell hybridomas specific for P12-26 in the context of either I-Ek or I-Ad have been isolated To further understand the molecular interaction between the TCR and the Ia-P12-26 complex, the primary structures of the TCR of five T cell hybridomas have been determined. Southern and Northern analyses indicate that two members of the V alpha 3 gene family are used by 13 out of 14 I-Ek-restricted T cells. Four different V beta genes are used by these T cell hybridomas, while the majority (8 out of 13) express V beta 1 in combination with the J beta 2.1 element. No clear correlation can be seen in this system between gene usage and MHC restriction. In addition, the fine specificity of I-Ek-restricted T cells to a single amino acid substitution [Phe22/His22]P12-26 is not attributed to the usage of particular V alpha and V beta elements. The V alpha 3 family gene is also used by a few I-Ad-restricted T cells. Interestingly, these I-Ad T cells share a reactivity pattern more similar to that of I-Ek- restricted T cells than other I-Ad-restricted T cells. The nonrandom selection V alpha 3 is also demonstrated by the fact that V alpha 3 is used by P12-26-specific, but not by cytochrome c- or staphylococcal nucleus-specific, I-Ek-restricted T cells. This suggests that although antigen specificity may not be accounted for by either chain of the TCR, the members of V alpha 3 genes may be selected by the antigen (P12- 26). PMID:2971753

  12. Identification of a novel distal regulatory element of the human Neuroglobin gene by the chromosome conformation capture approach.

    PubMed

    Tam, Kin Tung; Chan, Ping Kei; Zhang, Wei; Law, Pui Pik; Tian, Zhipeng; Fung Chan, Godfrey Chi; Philipsen, Sjaak; Festenstein, Richard; Tan-Un, Kian Cheng

    2017-01-09

    Neuroglobin (NGB) is predominantly expressed in the brain and retina. Studies suggest that NGB exerts protective effects to neuronal cells and is implicated in reducing the severity of stroke and Alzheimer's disease. However, little is known about the mechanisms which regulate the cell type-specific expression of the gene. In this study, we hypothesized that distal regulatory elements (DREs) are involved in optimal expression of the NGB gene. By chromosome conformation capture we identified two novel DREs located -70 kb upstream and +100 kb downstream from the NGB gene. ENCODE database showed the presence of DNaseI hypersensitive and transcription factors binding sites in these regions. Further analyses using luciferase reporters and chromatin immunoprecipitation suggested that the -70 kb region upstream of the NGB gene contained a neuronal-specific enhancer and GATA transcription factor binding sites. Knockdown of GATA-2 caused NGB expression to drop dramatically, indicating GATA-2 as an essential transcription factor for the activation of NGB expression. The crucial role of the DRE in NGB expression activation was further confirmed by the drop in NGB level after CRISPR-mediated deletion of the DRE. Taken together, we show that the NGB gene is regulated by a cell type-specific loop formed between its promoter and the novel DRE.

  13. Identification of a novel distal regulatory element of the human Neuroglobin gene by the chromosome conformation capture approach

    PubMed Central

    Tam, Kin Tung; Chan, Ping Kei; Zhang, Wei; Law, Pui Pik; Tian, Zhipeng; Fung Chan, Godfrey Chi; Philipsen, Sjaak; Festenstein, Richard; Tan-Un, Kian Cheng

    2017-01-01

    Neuroglobin (NGB) is predominantly expressed in the brain and retina. Studies suggest that NGB exerts protective effects to neuronal cells and is implicated in reducing the severity of stroke and Alzheimer's disease. However, little is known about the mechanisms which regulate the cell type-specific expression of the gene. In this study, we hypothesized that distal regulatory elements (DREs) are involved in optimal expression of the NGB gene. By chromosome conformation capture we identified two novel DREs located −70 kb upstream and +100 kb downstream from the NGB gene. ENCODE database showed the presence of DNaseI hypersensitive and transcription factors binding sites in these regions. Further analyses using luciferase reporters and chromatin immunoprecipitation suggested that the −70 kb region upstream of the NGB gene contained a neuronal-specific enhancer and GATA transcription factor binding sites. Knockdown of GATA-2 caused NGB expression to drop dramatically, indicating GATA-2 as an essential transcription factor for the activation of NGB expression. The crucial role of the DRE in NGB expression activation was further confirmed by the drop in NGB level after CRISPR-mediated deletion of the DRE. Taken together, we show that the NGB gene is regulated by a cell type-specific loop formed between its promoter and the novel DRE. PMID:27651453

  14. Pi class glutathione S-transferase genes are regulated by Nrf 2 through an evolutionarily conserved regulatory element in zebrafish

    PubMed Central

    Suzuki, Takafumi; Takagi, Yaeko; Osanai, Hitoshi; Li, Li; Takeuchi, Miki; Katoh, Yasutake; Kobayashi, Makoto; Yamamoto, Masayuki

    2005-01-01

    Pi class GSTs (glutathione S-transferases) are a member of the vertebrate GST family of proteins that catalyse the conjugation of GSH to electrophilic compounds. The expression of Pi class GST genes can be induced by exposure to electrophiles. We demonstrated previously that the transcription factor Nrf 2 (NF-E2 p45-related factor 2) mediates this induction, not only in mammals, but also in fish. In the present study, we have isolated the genomic region of zebrafish containing the genes gstp1 and gstp2. The regulatory regions of zebrafish gstp1 and gstp2 have been examined by GFP (green fluorescent protein)-reporter gene analyses using microinjection into zebrafish embryos. Deletion and point-mutation analyses of the gstp1 promoter showed that an ARE (antioxidant-responsive element)-like sequence is located 50 bp upstream of the transcription initiation site which is essential for Nrf 2 transactivation. Using EMSA (electrophoretic mobility-shift assay) analysis we showed that zebrafish Nrf 2–MafK heterodimer specifically bound to this sequence. All the vertebrate Pi class GST genes harbour a similar ARE-like sequence in their promoter regions. We propose that this sequence is a conserved target site for Nrf 2 in the Pi class GST genes. PMID:15654768

  15. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia.

    PubMed

    Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W

    2010-08-01

    The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  16. Differential nuclease sensitivity profiling of chromatin reveals biochemical footprints coupled to gene expression and functional DNA elements in maize.

    PubMed

    Vera, Daniel L; Madzima, Thelma F; Labonne, Jonathan D; Alam, Mohammad P; Hoffman, Gregg G; Girimurugan, S B; Zhang, Jinfeng; McGinnis, Karen M; Dennis, Jonathan H; Bass, Hank W

    2014-10-01

    The eukaryotic genome is organized into nucleosomes, the fundamental units of chromatin. The positions of nucleosomes on DNA regulate protein-DNA interactions and in turn influence DNA-templated events. Despite the increasing number of genome-wide maps of nucleosome position, how global changes in gene expression relate to changes in nucleosome position is poorly understood. We show that in nucleosome occupancy mapping experiments in maize (Zea mays), particular genomic regions are highly susceptible to variation introduced by differences in the extent to which chromatin is digested with micrococcal nuclease (MNase). We exploited this digestion-linked variation to identify protein footprints that are hypersensitive to MNase digestion, an approach we term differential nuclease sensitivity profiling (DNS-chip). Hypersensitive footprints were enriched at the 5' and 3' ends of genes, associated with gene expression levels, and significantly overlapped with conserved noncoding sequences and the binding sites of the transcription factor KNOTTED1. We also found that the tissue-specific regulation of gene expression was linked to tissue-specific hypersensitive footprints. These results reveal biochemical features of nucleosome organization that correlate with gene expression levels and colocalize with functional DNA elements. This approach to chromatin profiling should be broadly applicable to other species and should shed light on the relationships among chromatin organization, protein-DNA interactions, and genome regulation.

  17. Interactions between WHITE Genes Carried by a Large Transposing Element and the ZESTE1 Allele in DROSOPHILA MELANOGASTER

    PubMed Central

    Gubb, D.; Roote, J.; McGill, S.; Shelton, M.; Ashburner, M.

    1986-01-01

    TE146, a large transposing element of Drosophila melanogaster, carries two copies of the white and roughest genes in tandem. In consequence, z1 w 11E4; TE146(Z)/+ flies have a zeste (lemon-yellow) eye color. However, one in 103 TE146 chromosomes mutates to a red-eyed form. The majority of these "spontaneous red" (SR) derivatives of TE146 have only one copy of the white gene and are, cytologically, two- to three-banded elements, rather than six-banded as their progenitor. The SR forms of TE146 are also unstable and give zeste-colored forms with a frequency of about one in 104. One such "spontaneous zeste" (SZ) derivative carries duplicated white genes as an inverted, rather than a tandem, repeat. The genetic instability of this inverted repeat form of TE146 is different from that of the original tandem repeat form. In particular, the inverted repeat form frequently produces derivatives with internal rearrangements of the TE and gives a much lower frequency of SR forms. In addition, two novel features of the interaction between w+ alleles in a zeste background have been found. First, copies of w + can become insensitive to suppression by zeste even when paired. Second, an inversion breakpoint may disrupt the pairing between two adjacent w+ alleles, necessary for their suppression by zeste, without physically separating them. PMID:17246318

  18. Retinal Expression of the Drosophila eyes absent Gene Is Controlled by Several Cooperatively Acting Cis-regulatory Elements.

    PubMed

    Weasner, Bonnie M; Weasner, Brandon P; Neuman, Sarah D; Bashirullah, Arash; Kumar, Justin P

    2016-12-01

    The eyes absent (eya) gene of the fruit fly, Drosophila melanogaster, is a member of an evolutionarily conserved gene regulatory network that controls eye formation in all seeing animals. The loss of eya leads to the complete elimination of the compound eye while forced expression of eya in non-retinal tissues is sufficient to induce ectopic eye formation. Within the developing retina eya is expressed in a dynamic pattern and is involved in tissue specification/determination, cell proliferation, apoptosis, and cell fate choice. In this report we explore the mechanisms by which eya expression is spatially and temporally governed in the developing eye. We demonstrate that multiple cis-regulatory elements function cooperatively to control eya transcription and that spacing between a pair of enhancer elements is important for maintaining correct gene expression. Lastly, we show that the loss of eya expression in sine oculis (so) mutants is the result of massive cell death and a progressive homeotic transformation of retinal progenitor cells into head epidermis.

  19. Retinal Expression of the Drosophila eyes absent Gene Is Controlled by Several Cooperatively Acting Cis-regulatory Elements

    PubMed Central

    Neuman, Sarah D.; Bashirullah, Arash; Kumar, Justin P.

    2016-01-01

    The eyes absent (eya) gene of the fruit fly, Drosophila melanogaster, is a member of an evolutionarily conserved gene regulatory network that controls eye formation in all seeing animals. The loss of eya leads to the complete elimination of the compound eye while forced expression of eya in non-retinal tissues is sufficient to induce ectopic eye formation. Within the developing retina eya is expressed in a dynamic pattern and is involved in tissue specification/determination, cell proliferation, apoptosis, and cell fate choice. In this report we explore the mechanisms by which eya expression is spatially and temporally governed in the developing eye. We demonstrate that multiple cis-regulatory elements function cooperatively to control eya transcription and that spacing between a pair of enhancer elements is important for maintaining correct gene expression. Lastly, we show that the loss of eya expression in sine oculis (so) mutants is the result of massive cell death and a progressive homeotic transformation of retinal progenitor cells into head epidermis. PMID:27930646

  20. Identification and characterization of promoters and cis-regulatory elements of genes involved in secondary metabolites production in hop (Humulus lupulus. L).

    PubMed

    Duraisamy, Ganesh Selvaraj; Mishra, Ajay Kumar; Kocabek, Tomas; Matoušek, Jaroslav

    2016-10-01

    Molecular and biochemical studies have shown that gene contains single or combination of different cis-acting regulatory elements are actively controlling the transcriptional regulation of associated genes, downstream effects of these result in the modulation of various biological pathways such as biotic/abiotic stress responses, hormonal responses to growth and development processes and secondary metabolite production. Therefore, the identification of promoters and their cis-regulatory elements is one of intriguing area to study the dynamic complex regulatory network of genes activities by integrating computational, comparative, structural and functional genomics. Several bioinformatics servers or database have been established to predict the cis-acting elements present in the promoter region of target gene and their association with the expression profiles in the TFs. The aim of this study is to predict possible cis-acting regulatory elements that have putative role in the transcriptional regulation of a dynamic network of metabolite gene activities controlling prenylflavonoid and bitter acids biosynthesis in hop (Humulus lupulus). Recent release of hop draft genome enabled us to predict the possible cis-acting regulatory elements by extracting 2kbp of 5' regulatory regions of genes important for lupulin metabolome biosynthesis, using Plant CARE, PLACE and Genomatix Matinspector professional databases. The result reveals the plausible role of cis-acting regulatory elements in the regulation of gene expression primarily involved in lupulin metabolome biosynthesis including under various stress conditions.

  1. Neuronal development genes are key elements mediating the reinforcing effects of methamphetamine, amphetamine, and methylphenidate.

    PubMed

    Dela Peña, Ike; Jeon, Se Jin; Lee, Eunyoung; Ryu, Jong Hoon; Shin, Chan Young; Noh, Minsoo; Cheong, Jae Hoon

    2013-12-01

    The molecular mechanisms underlying susceptibility to psychostimulant addiction remain unclear. Searching for commonalities in the effects of addictive drugs on brain gene expression is a prolific approach to determine transcriptional signatures influencing drug abuse. We explored the common transcriptional responses to the reinforcing effects of psychostimulants methamphetamine, amphetamine, and methylphenidate. We also aimed to identify transcriptional changes that may subserve abuse of these drugs. Genome-wide transcriptome profiling analyses were performed to identify common prefrontal cortical (PFC) and striatal gene expression profiles in drug-naïve (cohort 1) and stimulant-pretreated (cohort 2) rats, which showed a conditioned place preference to and self-administration of methamphetamine, amphetamine, and methylphenidate. In behavioral studies, stimulant-pretreated rats showed behavioral sensitization characterized by enhanced behavioral response to the rewarding or reinforcing effects of psychostimulants. Inflammation-associated genes (e.g., Alas1, S100a8 and S100a9) were identified as the primary differentially expressed genes (DEGs) in both the PFC and the striatum of cohort 1 rats, while neuronal plasticity (Sgk1)- and brain development (e.g., Bhlhe22, Neurod1, Nr4a2, and Msx1)-associated genes comprised the major upregulated DEGs in the striatum of cohort 2 rats. Furthermore, a meta-analysis of the common striatal DEGs in this study along with morphine-regulated striatal transcriptomes in mice (National Center for Biotechnology Information-Gene Expression Omnibus Database Accession Code GSE7762) suggested similar expression profiles of genes involved in neuronal development (e.g., Bhlhe22, Nr4a2). This study provides evidence that brain development-associated genes mediate the reinforcing effects of methamphetamine, amphetamine, and methylphenidate and that these transcripts may underlie susceptibility to psychostimulant addiction.

  2. Robust cancer-specific gene expression by a novel cassette with hTERT and CMV promoter elements.

    PubMed

    Sakaguchi, Masakiyo; Sadahira, Takuya; Ueki, Hideo; Kinoshita, Rie; Murata, Hitoshi; Yamamoto, Ken-Ichi; Futami, Junichiro; Nasu, Yasutomo; Ochiai, Kazuhiko; Kumon, Hiromi; Huh, Nam-Ho; Watanabe, Masami

    2017-08-01

    We developed and validated a novel hTERT/CMV promoter element-driven gene expression cassette that can robustly enhance cancer-specific gene expression. The following gene expressional elements were located in tandem within the plasmid construct: [hTERT core promoter, cytomegalovirus (CMV) minimized promoter, RU5' sequence, an inserted gene, BGH polyA, hTERT enhancer]; this is hereafter referred to as the hT/Cm-R-hT construct. Using various human cancer cell lines and normal cells, the cancer-specific transcription of the green fluorescent protein (GFP) gene was examined by western blotting and fluorescence microscopy. Cancer-specific gene expression was robustly achieved in the hT/Cm-R-hT plasmid in comparison to the other control hT/Cm-driven construct. Notably, the expression level of GFP observed in the hT/Cm-R-hT-driven construct was superior to that of the control plasmid with the conventional CMV promoter in HEK293 cells, which are known to possess higher hTERT activity than normal cells. We next examined the availability of hT/Cm-R-hT in detecting the target GFP expressing cancer cells from human peripheral blood mononuclear cells (PBMCs). The hT/Cm-R-hT plasmid successfully induced cancer-specific gene expression; the robust expression of GFP was observed in target HeLa cancer cells, whereas GFP was not visibly expressed in normal PBMCs. The plasmid allowed for the selective visualization of viable HeLa cancer cells in mixed cell cultures containing up to 10000-fold more PBMCs. These findings indicate that the hT/Cm-R-hT expressional system is a valuable tool for detecting viable cancer cells mixed with normal cells. The current system can therefore be applied to the in vitro detection of cancer cells that are disseminated in the blood and other types of body fluid in vivo. Since the current system can also be applied to other types of vectors, including virus vectors, this approach using the hTERT promoter-based construct is expected to become a

  3. Identification of gene co-regulatory modules and associated cis-elements involved in degenerative heart disease

    PubMed Central

    2009-01-01

    Background Cardiomyopathies, degenerative diseases of cardiac muscle, are among the leading causes of death in the developed world. Microarray studies of cardiomyopathies have identified up to several hundred genes that significantly alter their expression patterns as the disease progresses. However, the regulatory mechanisms driving these changes, in particular the networks of transcription factors involved, remain poorly understood. Our goals are (A) to identify modules of co-regulated genes that undergo similar changes in expression in various types of cardiomyopathies, and (B) to reveal the specific pattern of transcription factor binding sites, cis-elements, in the proximal promoter region of genes comprising such modules. Methods We analyzed 149 microarray samples from human hypertrophic and dilated cardiomyopathies of various etiologies. Hierarchical clustering and Gene Ontology annotations were applied to identify modules enriched in genes with highly correlated expression and a similar physiological function. To discover motifs that may underly changes in expression, we used the promoter regions for genes in three of the most interesting modules as input to motif discovery algorithms. The resulting motifs were used to construct a probabilistic model predictive of changes in expression across different cardiomyopathies. Results We found that three modules with the highest degree of functional enrichment contain genes involved in myocardial contraction (n = 9), energy generation (n = 20), or protein translation (n = 20). Using motif discovery tools revealed that genes in the contractile module were found to contain a TATA-box followed by a CACC-box, and are depleted in other GC-rich motifs; whereas genes in the translation module contain a pyrimidine-rich initiator, Elk-1, SP-1, and a novel motif with a GCGC core. Using a naïve Bayes classifier revealed that patterns of motifs are statistically predictive of expression patterns, with odds ratios of 2

  4. A 15-base-pair element activates the SPS4 gene midway through sporulation in Saccharomyces cerevisiae.

    PubMed Central

    Hepworth, S R; Ebisuzaki, L K; Segall, J

    1995-01-01

    Sporulation of the yeast Saccharomyces cerevisiae represents a simple developmental process in which the events of meiosis and spore wall formation are accompanied by the sequential activation of temporally distinct classes of genes. In this study, we have examined expression of the SPS4 gene, which belongs to a group of genes that is activated midway through sporulation. We mapped the upstream boundary of the regulatory region of SPS4 by monitoring the effect of sequential deletions of 5'-flanking sequence on expression of plasmid-borne versions of SPS4 introduced into a MATa/MAT alpha delta sps4/delta sps4 strain. This analysis indicated that the 5' boundary of the regulatory region was within 50 bp of the putative TATA box of the gene. By testing various oligonucleotides that spanned this boundary and the downstream sequence for their ability to activate expression of a heterologous promoter, we found that a 15-bp sequence sufficed to act as a sporulation-specific upstream activation sequence. This 15-bp fragment, designated UASSPS4, activated expression of a CYC1-lacZ reporter gene midway through sporulation and was equally active in both orientations. Extending the UAS fragment to include the adjacent 14-bp enhanced its activity 10-fold. We show that expression of SPS4 is regulated in a manner distinct from that of early meiotic genes: mutation of UME6 did not lead to vegetative expression of SPS4, and sporulation-specific expression was delayed by mutation of IME2. In vivo and in vitro assays suggested that a factor present in vegetative cells bind to the UASSPS4 element. We speculate that during sporulation this factor is modified to serve as an activator of the SPS4 gene or, alternatively, that it recruits an activator to the promoter. PMID:7791799

  5. Multitasking of the piRNA Silencing Machinery: Targeting Transposable Elements and Foreign Genes in the Bdelloid Rotifer Adineta vaga

    PubMed Central

    Rodriguez, Fernando; Arkhipova, Irina R.

    2016-01-01

    RNA-mediated silencing processes play a key role in silencing of transposable elements, especially in the germ line, where piwi-interacting RNAs (piRNAs) are responsible for suppressing transposon mobility and maintaining genome integrity. We previously reported that the genome of Adineta vaga, the first sequenced representative of the phylum Rotifera (class Bdelloidea), is characterized by massive levels of horizontal gene transfer, by unusually low transposon content, and by highly diversified RNA-mediated silencing machinery. Here, we investigate genome-wide distribution of pi-like small RNAs, which in A. vaga are 25–31 nucleotides in length and have a strong 5′-uridine bias, while lacking ping-pong amplification signatures. In agreement with expectations, 71% of mapped reads corresponded to annotated transposons, with 93% of these reads being in the antisense orientation. Unexpectedly, a significant fraction of piRNAs originate from predicted coding regions corresponding to genes of putatively foreign origin. The distribution of piRNAs across foreign genes is not biased toward 3′-UTRs, instead resembling transposons in uniform distribution pattern throughout the gene body, and in predominantly antisense orientation. We also find that genes with small RNA coverage, including a number of genes of metazoan origin, are characterized by higher occurrence of telomeric repeats in the surrounding genomic regions, and by higher density of transposons in the vicinity, which have the potential to promote antisense transcription. Our findings highlight the complex interplay between RNA-based silencing processes and acquisition of genes at the genome periphery, which can result either in their loss or eventual domestication and integration into the host genome. PMID:27017627

  6. Multitasking of the piRNA Silencing Machinery: Targeting Transposable Elements and Foreign Genes in the Bdelloid Rotifer Adineta vaga.

    PubMed

    Rodriguez, Fernando; Arkhipova, Irina R

    2016-05-01

    RNA-mediated silencing processes play a key role in silencing of transposable elements, especially in the germ line, where piwi-interacting RNAs (piRNAs) are responsible for suppressing transposon mobility and maintaining genome integrity. We previously reported that the genome of Adineta vaga, the first sequenced representative of the phylum Rotifera (class Bdelloidea), is characterized by massive levels of horizontal gene transfer, by unusually low transposon content, and by highly diversified RNA-mediated silencing machinery. Here, we investigate genome-wide distribution of pi-like small RNAs, which in A. vaga are 25-31 nucleotides in length and have a strong 5'-uridine bias, while lacking ping-pong amplification signatures. In agreement with expectations, 71% of mapped reads corresponded to annotated transposons, with 93% of these reads being in the antisense orientation. Unexpectedly, a significant fraction of piRNAs originate from predicted coding regions corresponding to genes of putatively foreign origin. The distribution of piRNAs across foreign genes is not biased toward 3'-UTRs, instead resembling transposons in uniform distribution pattern throughout the gene body, and in predominantly antisense orientation. We also find that genes with small RNA coverage, including a number of genes of metazoan origin, are characterized by higher occurrence of telomeric repeats in the surrounding genomic regions, and by higher density of transposons in the vicinity, which have the potential to promote antisense transcription. Our findings highlight the complex interplay between RNA-based silencing processes and acquisition of genes at the genome periphery, which can result either in their loss or eventual domestication and integration into the host genome. Copyright © 2016 by the Genetics Society of America.

  7. Evidence for Small RNAs Homologous to Effector-Encoding Genes and Transposable Elements in the Oomycete Phytophthora infestans

    PubMed Central

    Vetukuri, Ramesh R.; Åsman, Anna K. M.; Tellgren-Roth, Christian; Jahan, Sultana N.; Reimegård, Johan; Fogelqvist, Johan; Savenkov, Eugene; Söderbom, Fredrik; Avrova, Anna O.; Whisson, Stephen C.; Dixelius, Christina

    2012-01-01

    Phytophthora infestans is the oomycete pathogen responsible for the devastating late blight disease on potato and tomato. There is presently an intense research focus on the role(s) of effectors in promoting late blight disease development. However, little is known about how they are regulated, or how diversity in their expression may be generated among different isolates. Here we present data from investigation of RNA silencing processes, characterized by non-coding small RNA molecules (sRNA) of 19–40 nt. From deep sequencing of sRNAs we have identified sRNAs matching numerous RxLR and Crinkler (CRN) effector protein genes in two isolates differing in pathogenicity. Effector gene-derived sRNAs were present in both isolates, but exhibited marked differences in abundance, especially for CRN effectors. Small RNAs in P. infestans grouped into three clear size classes of 21, 25/26 and 32 nt. Small RNAs from all size classes mapped to RxLR effector genes, but notably 21 nt sRNAs were the predominant size class mapping to CRN effector genes. Some effector genes, such as PiAvr3a, to which sRNAs were found, also exhibited differences in transcript accumulation between the two isolates. The P. infestans genome is rich in transposable elements, and the majority of sRNAs of all size classes mapped to these sequences, predominantly to long terminal repeat (LTR) retrotransposons. RNA silencing of Dicer and Argonaute genes provided evidence that generation of 21 nt sRNAs is Dicer-dependent, while accumulation of longer sRNAs was impacted by silencing of Argonaute genes. Additionally, we identified six microRNA (miRNA) candidates from our sequencing data, their precursor sequences from the genome sequence, and target mRNAs. These miRNA candidates have features characteristic of both plant and metazoan miRNAs. PMID:23272103

  8. Role of the initiator element in the regulation of the melanoma cell adhesion molecule gene.

    PubMed

    Karlen, S; Braathen, L R

    2000-10-01

    The melanoma cell adhesion molecule is a membrane glycoprotein whose expression is associated with tumor progression and the development of metastatic potential. The mechanisms for upregulation of the melanoma cell adhesion molecule during melanoma progression are still poorly understood. In this study, we show further evidence that melanoma cell adhesion molecule expression is tightly regulated at the transcriptional level. Using a combination of chloramphenicol acetyl transferase reporter assays and DNA mobility shift experiments, we investigated the role played by three putative melanoma cell adhesion molecule regulatory elements, namely the initiator sequence, the SCA element, and the ASp element. The SCA and the ASp boxes can potentially interact with the transcription factors Sp1 and AP-2. Sp1 binding to both sites was confirmed, but only the SCA sequence could form a complex with AP-2. AP-2-driven downregulation of the melanoma cell adhesion molecule promoter, however, did not depend only on a functional SCA element. The pyrimidine-rich CTCACTTG initiator, which overlaps the RNA start site, was essential for promoter function and was shown to interact with proteins related to basic helix-loop-helix transcription factors. Binding in nonmetastatic melanoma cells was induced by cAMP. In metastatic cells, however, binding was constitutive, but could be markedly decreased upon treatment with phorbol esters. As melanoma cell adhesion molecule expression is modulated by cAMP and phorbol ester signaling, these results suggest that the initiator is the central element that mediates cAMP and phorbol ester sensitivity and initiates melanoma cell adhesion molecule overexpression in melanomas.

  9. Efficient inversions and duplications of mammalian regulatory DNA elements and gene clusters by CRISPR/Cas9.

    PubMed

    Li, Jinhuan; Shou, Jia; Guo, Ya; Tang, Yuanxiao; Wu, Yonghu; Jia, Zhilian; Zhai, Yanan; Chen, Zhifeng; Xu, Quan; Wu, Qiang

    2015-08-01

    The human genome contains millions of DNA regulatory elements and a large number of gene clusters, most of which have not been tested experimentally. The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated nuclease 9 (Cas9) programed with a synthetic single-guide RNA (sgRNA) emerges as a method for genome editing in virtually any organisms. Here we report that targeted DNA fragment inversions and duplications could easily be achieved in human and mouse genomes by CRISPR with two sgRNAs. Specifically, we found that, in cultured human cells and mice, efficient precise inversions of DNA fragments ranging in size from a few tens of bp to hundreds of kb could be generated. In addition, DNA fragment duplications and deletions could also be generated by CRISPR through trans-allelic recombination between the Cas9-induced double-strand breaks (DSBs) on two homologous chromosomes (chromatids). Moreover, junctions of combinatorial inversions and duplications of the protocadherin (Pcdh) gene clusters induced by Cas9 with four sgRNAs could be detected. In mice, we obtained founders with alleles of precise inversions, duplications, and deletions of DNA fragments of variable sizes by CRISPR. Interestingly, we found that very efficient inversions were mediated by microhomology-mediated end joining (MMEJ) through short inverted repeats. We showed for the first time that DNA fragment inversions could be transmitted through germlines in mice. Finally, we applied this CRISPR method to a regulatory element of the Pcdhα cluster and found a new role in the regulation of members of the Pcdhγ cluster. This simple and efficient method should be useful in manipulating mammalian genomes to study millions of regulatory DNA elements as well as vast numbers of gene clusters. © The Author (2015). Published by Oxford University Press on behalf of Journal of Molecular Cell Biology, IBCB, SIBS, CAS.

  10. Efficient inversions and duplications of mammalian regulatory DNA elements and gene clusters by CRISPR/Cas9

    PubMed Central

    Li, Jinhuan; Shou, Jia; Guo, Ya; Tang, Yuanxiao; Wu, Yonghu; Jia, Zhilian; Zhai, Yanan; Chen, Zhifeng; Xu, Quan; Wu, Qiang

    2015-01-01

    The human genome contains millions of DNA regulatory elements and a large number of gene clusters, most of which have not been tested experimentally. The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated nuclease 9 (Cas9) programed with a synthetic single-guide RNA (sgRNA) emerges as a method for genome editing in virtually any organisms. Here we report that targeted DNA fragment inversions and duplications could easily be achieved in human and mouse genomes by CRISPR with two sgRNAs. Specifically, we found that, in cultured human cells and mice, efficient precise inversions of DNA fragments ranging in size from a few tens of bp to hundreds of kb could be generated. In addition, DNA fragment duplications and deletions could also be generated by CRISPR through trans-allelic recombination between the Cas9-induced double-strand breaks (DSBs) on two homologous chromosomes (chromatids). Moreover, junctions of combinatorial inversions and duplications of the protocadherin (Pcdh) gene clusters induced by Cas9 with four sgRNAs could be detected. In mice, we obtained founders with alleles of precise inversions, duplications, and deletions of DNA fragments of variable sizes by CRISPR. Interestingly, we found that very efficient inversions were mediated by microhomology-mediated end joining (MMEJ) through short inverted repeats. We showed for the first time that DNA fragment inversions could be transmitted through germlines in mice. Finally, we applied this CRISPR method to a regulatory element of the Pcdhα cluster and found a new role in the regulation of members of the Pcdhγ cluster. This simple and efficient method should be useful in manipulating mammalian genomes to study millions of regulatory DNA elements as well as vast numbers of gene clusters. PMID:25757625

  11. An insulator element located at the cyclin B1 interacting protein 1 gene locus is highly conserved among mammalian species.

    PubMed

    Yoshida, Wataru; Tomikawa, Junko; Inaki, Makoto; Kimura, Hiroshi; Onodera, Masafumi; Hata, Kenichiro; Nakabayashi, Kazuhiko

    2015-01-01

    Insulators are cis-elements that control the direction of enhancer and silencer activities (enhancer-blocking) and protect genes from silencing by heterochromatinization (barrier activity). Understanding insulators is critical to elucidate gene regulatory mechanisms at chromosomal domain levels. Here, we focused on a genomic region upstream of the mouse Ccnb1ip1 (cyclin B1 interacting protein 1) gene that was methylated in E9.5 embryos of the C57BL/6 strain, but unmethylated in those of the 129X1/SvJ and JF1/Ms strains. We hypothesized the existence of an insulator-type element that prevents the spread of DNA methylation within the 1.8 kbp segment, and actually identified a 242-bp and a 185-bp fragments that were located adjacent to each other and showed insulator and enhancer activities, respectively, in reporter assays. We designated these genomic regions as the Ccnb1ip1 insulator and the Ccnb1ip1 enhancer. The Ccnb1ip1 insulator showed enhancer-blocking activity in the luciferase assays and barrier activity in the colony formation assays. Further examination of the Ccnb1ip1 locus in other mammalian species revealed that the insulator and enhancer are highly conserved among a wide variety of species, and are located immediately upstream of the transcriptional start site of Ccnb1ip1. These newly identified cis-elements may be involved in transcriptional regulation of Ccnb1ip1, which is important in meiotic crossing-over and G2/M transition of the mitotic cell cycle.

  12. An Insulator Element Located at the Cyclin B1 Interacting Protein 1 Gene Locus Is Highly Conserved among Mammalian Species

    PubMed Central

    Yoshida, Wataru; Tomikawa, Junko; Inaki, Makoto; Kimura, Hiroshi; Onodera, Masafumi; Hata, Kenichiro; Nakabayashi, Kazuhiko

    2015-01-01

    Insulators are cis-elements that control the direction of enhancer and silencer activities (enhancer-blocking) and protect genes from silencing by heterochromatinization (barrier activity). Understanding insulators is critical to elucidate gene regulatory mechanisms at chromosomal domain levels. Here, we focused on a genomic region upstream of the mouse Ccnb1ip1 (cyclin B1 interacting protein 1) gene that was methylated in E9.5 embryos of the C57BL/6 strain, but unmethylated in those of the 129X1/SvJ and JF1/Ms strains. We hypothesized the existence of an insulator-type element that prevents the spread of DNA methylation within the 1.8 kbp segment, and actually identified a 242-bp and a 185-bp fragments that were located adjacent to each other and showed insulator and enhancer activities, respectively, in reporter assays. We designated these genomic regions as the Ccnb1ip1 insulator and the Ccnb1ip1 enhancer. The Ccnb1ip1 insulator showed enhancer-blocking activity in the luciferase assays and barrier activity in the colony formation assays. Further examination of the Ccnb1ip1 locus in other mammalian species revealed that the insulator and enhancer are highly conserved among a wide variety of species, and are located immediately upstream of the transcriptional start site of Ccnb1ip1. These newly identified cis-elements may be involved in transcriptional regulation of Ccnb1ip1, which is important in meiotic crossing-over and G2/M transition of the mitotic cell cycle. PMID:26110280

  13. Endothelin-1 expression is strongly repressed by AU-rich elements in the 3'-untranslated region of the gene.

    PubMed

    Reimunde, Francisco M; Castañares, Cristina; Redondo-Horcajo, Mariano; Lamas, Santiago; Rodríguez-Pascual, Fernando

    2005-05-01

    The regulation of the synthesis of the endothelial-derived vasoconstrictor ET-1 (endothelin-1) is a complex process that occurs mainly at the mRNA level. Transcription of the gene accounts for an important part of the regulation of expression, as already described for different modulators such as the cytokine TGF-beta (transforming growth factor-beta). However, very little is known about mechanisms governing ET-1 expression at the post-transcriptional level. The aim of the present study was to investigate the regulation of the ET-1 expression at this level. Since the 3'-UTR (3'-untranslated region) of mRNAs commonly contains genetic determinants for the post-transcriptional control of gene expression, we focused on the potential role of the 3'-UTR of ET-1 mRNA. Experiments performed with luciferase reporter constructs containing the 3'-UTR showed that this region exerts a potent destabilizing effect. Deletional analyses allowed us to locate this activity within a region at positions 924-1127. Some (but not all) of the AREs (AU-rich elements) present in this region were found to be essential for this mRNA-destabilizing activity. We also present evidence that cytosolic proteins from endothelial cells interact specifically with these RNA elements, and that a close correlation exists between the ability of the AREs to destabilize ET-1 mRNA and the binding of proteins to these elements. Our results are compatible with the existence of a strong repressional control of ET-1 expression mediated by destabilization of the mRNA exerted through the interaction of specific cytosolic proteins with AREs present in the 3'-UTR of the gene.

  14. Macrolide efflux genes mef(A) and mef(E) are carried by different genetic elements in Streptococcus pneumoniae.

    PubMed

    Del Grosso, M; Iannelli, F; Messina, C; Santagati, M; Petrosillo, N; Stefani, S; Pozzi, G; Pantosti, A

    2002-03-01

    Susceptibilities to macrolides were evaluated in 267 Streptococcus pneumoniae isolates, of which 182 were from patients with invasive diseases and 85 were from healthy carriers. Of the 98 resistant isolates, 20 strains showed an M phenotype and carried mef. Strains that carried both mef(A) and mef(E) were found: 17 strains carried mef(A) and 3 carried mef(E). The characteristics of the strains carrying the mef genes and the properties of the mef-containing elements were studied. Strains carrying mef(A) belonged to serotype 14, were susceptible to all the antibiotics tested except erythromycin, and appeared to be clonally related by pulsed-field gel electrophoresis (PFGE). The three mef(E) strains belonged to different serotypes, showed different susceptibility profiles, and did not appear to be related by PFGE. The sequences of a fragment of the mef-containing element, which encompassed mef and the msr(A) homolog, were identical among the three mef(E)-positive strains and among the three mef(A)-positive strains, although there were differences between the sequences for the two variants at 168 positions. In all mef(A)-positive strains, the mef element was inserted in celB, which led to impairment of the competence of the strains. In line with insertion of the mef(E) element at a different site, the competence of the mef(E)-positive strains was maintained. Transfer of erythromycin resistance by conjugation was obtained from two of three mef(A) strains but from none of three mef(E) strains. Due to the important different characteristics of the strains carrying mef(A) or mef(E), we suggest that the distinction between the two genes be maintained.

  15. A Novel Peroxisome Proliferator Response Element Modulates Hepatic Low Density Lipoprotein Receptor Gene Transcription in Response to PPARδ Activation

    PubMed Central

    Shende, Vikram R.; Singh, Amar Bahadur; Liu, Jingwen

    2016-01-01

    The hepatic expression of LDLR gene is regulated primarily at the transcriptional level by a sterol-regulatory element (SRE) in its proximal promoter region which is the site of action of SRE-binding protein 2 (SREBP2). However whether additional cis-regulatory elements contribute to LDLR transcription has not been fully explored. We investigated the function of a putative PPAR-response element (PPRE) sequence motif located at −768 to −752 bases upstream of the transcription start site of human LDLR gene in response to PPARδ activation. Promoter luciferase reporter analyses showed that treating HepG2 cells with PPARδ agonist L165041 markedly increased the activity of a full-length LDLR promoter construct (pLDLR-1192) without any effects on the shorter promoter reporter pLDLR-234 that contains only the core regulatory elements SRE-1 and SP1 sites. Importantly, mutation of the PPRE sequence greatly attenuated the induction of the full-length LDLR promoter activity by L165041 without affecting rosuvastatin mediated transactivation. Electrophoretic mobility shift and chromatin immunoprecipitation assays further confirmed the binding of PPARδ to the LDLR-PPRE site. Treating HepG2 cells with L165041 elevated the mRNA and protein expressions of LDLR without affecting the LDLR mRNA decay rate. The induction of LDLR expression by PPARδ agonist was further observed in liver tissue of mice and hamsters treated with L165041. Altogether, our studies identify a novel PPRE-mediated regulatory mechanism for LDLR transcription and suggest that combined treatment of statin with PPARδ agonists may have advantageous effects on LDLR expression. PMID:26443862

  16. A novel peroxisome proliferator response element modulates hepatic low-density lipoprotein receptor gene transcription in response to PPARδ activation.

    PubMed

    Shende, Vikram R; Singh, Amar Bahadur; Liu, Jingwen

    2015-12-15

    The hepatic expression of low-density lipoprotein (LDL) receptor (LDLR) gene is regulated primarily at the transcriptional level by a sterol-regulatory element (SRE) in its proximal promoter region which is the site of action of SRE-binding protein 2 (SREBP2). However whether additional cis-regulatory elements contribute to LDLR transcription has not been fully explored. We investigated the function of a putative peroxisome proliferator-activated receptor (PPAR)-response element (PPRE) sequence motif located at -768 to -752 bases upstream of the transcription start site of human LDLR gene in response to PPARδ activation. Promoter luciferase reporter analyses showed that treating HepG2 cells with PPARδ agonist L165041 markedly increased the activity of a full-length LDLR promoter construct (pLDLR-1192) without any effects on the shorter promoter reporter pLDLR-234 that contains only the core regulatory elements SRE-1 and SP1 sites. Importantly, mutation of the PPRE sequence greatly attenuated the induction of the full-length LDLR promoter activity by L165041 without affecting rosuvastatin (RSV)-mediated transactivation. EMSA and ChIP assay further confirmed the binding of PPARδ to the LDLR-PPRE site. Treating HepG2 cells with L165041 elevated the mRNA and protein expressions of LDLR without affecting the LDLR mRNA decay rate. The induction of LDLR expression by PPARδ agonist was further observed in liver tissue of mice and hamsters treated with L165041. Altogether, our studies identify a novel PPRE-mediated regulatory mechanism for LDLR transcription and suggest that combined treatment of statin with PPARδ agonists may have advantageous effects on LDLR expression.

  17. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  18. Multiple Herbicide Resistance in Lolium multiflorum and Identification of Conserved Regulatory Elements of Herbicide Resistance Genes

    PubMed Central

    Mahmood, Khalid; Mathiassen, Solvejg K.; Kristensen, Michael; Kudsk, Per

    2016-01-01

    Herbicide resistance is a ubiquitous challenge to herbicide sustainability and a looming threat to control weeds in crops. Recently four genes were found constituently over-expressed in herbicide resistant individuals of Lolium rigidum, a close relative of Lolium multiflorum. These include two cytochrome P450s, one nitronate monooxygenase and one glycosyl-transferase. Higher expressions of these four herbicide metabolism related (HMR) genes were also observed after herbicides exposure in the gene expression databases, indicating them as reliable markers. In order to get an overview of herbicidal resistance status of L. multiflorum L, 19 field populations were collected. Among these populations, four populations were found to be resistant to acetolactate synthase (ALS) inhibitors while three exhibited resistance to acetyl-CoA carboxylase (ACCase) inhibitors in our initial screening and dose response study. The genotyping showed the presence of mutations Trp-574-Leu and Ile-2041-Asn in ALS and ACCase, respectively, and qPCR experiments revealed the enhanced expression of HMR genes in individuals of certain resistant populations. Moreover, co-expression networks and promoter analyses of HMR genes in O. sativa and A. thaliana resulted in the identification of a cis-regulatory motif and zinc finger transcription factors. The identified transcription factors were highly expressed similar to HMR genes in response to xenobiotics whereas the identified motif is known to play a vital role in coping with environmental stresses and maintaining genome stability. Overall, our findings provide an important step forward toward a better understanding of metabolism-based herbicide resistance that can be utilized to devise novel strategies of weed management. PMID:27547209

  19. The En/Spm transposable element of Zea mays contains splice sites at the termini generating a novel intron from a dSpm element in the A2 gene.

    PubMed Central

    Menssen, A; Höhmann, S; Martin, W; Schnable, P S; Peterson, P A; Saedler, H; Gierl, A

    1990-01-01

    The A2 locus of Zea mays, identified as one of the genes affecting anthocyanin biosynthesis, was cloned using the transposable elements rcy and dSpm as gene tags. The A2 gene encodes a putative protein of 395 amino acids and is devoid of introns. Two a2-m1 alleles, containing dSpm insertions of different sizes, were characterized. The dSpm element from the original state allele has perfect termini and undergoes frequent transposition. The element from the class II state allele is no longer competent to transpose. It has retained the 13 bp terminal inverted repeat but has lost all subterminal sites at the 5' end, which are recognized by tnpA protein, the most abundant product of the En/Spm transposable element system. The relatively high A2 gene expression of one a2-m1 allele is due to removal of almost all dSpm sequences by splicing. The slightly altered A2 enzyme is still functional as shown by complementation of an a2 mutant with the corresponding cDNA. The 5' and 3' splice sites are constituted by the termini of the dSpm element; it therefore represents a novel intron of the A2 gene. Images Fig. 3. Fig. 4. Fig. 6. Fig. 8. PMID:2170105

  20. Expression of the Anabaena sp. strain PCC 7120 xisA gene from a heterologous promoter results in excision of the nifD element.

    PubMed Central

    Brusca, J S; Chastain, C J; Golden, J W

    1990-01-01

    An 11-kilobase-pair element interrupts the nifD gene in vegetative cells of Anabaena sp. strain PCC 7120. The nifD element normally excises only from the chromosomes of cells that differentiate into nitrogen-fixing heterocysts. The xisA gene contained within the element is required for the excision. Shuttle vectors containing the Escherichia coli tac consensus promoter fused to various 5' deletions of the xisA gene were constructed and conjugated into Anabaena sp. strain PCC 7120 cells. Some of the expression plasmids resulted in excision of the nifD element in a high proportion of vegetative cells. Excision of the element required deletion of an xisA 5' regulatory region which presumably blocks expression in Anabaena sp. strain PCC 7120 vegetative cells but not in E. coli. Strains lacking the nifD element grew normally in medium containing a source of combined nitrogen and showed normal growth and heterocyst development in medium lacking combined nitrogen. The xisA gene was shown to be the only Anabaena gene required for the proper rearrangement in E. coli of a plasmid containing the borders of the nifD element. Images PMID:2113913

  1. Identification of an activator protein-1-like sequence as the glucocorticoid response element in the rat tyrosine hydroxylase gene.

    PubMed

    Rani, C S Sheela; Elango, Narayanasamy; Wang, Shou-Shu; Kobayashi, Kazuto; Strong, Randy

    2009-03-01

    Glucocorticoids (GCs) generally stimulate gene transcription via consensus glucocorticoid response elements (GREs) located in the promoter region. To identify the GRE in the rat tyrosine hydroxylase (TH) gene promoter, we transiently transfected PC12 cells with a 9-kilobase (kb) TH promoter-luciferase (Luc) construct. Dexamethasone (Dex) stimulated Luc activity, which was abolished by mifepristone (RU486). Serial deletion mutations revealed a Dex-responsive 7-base pair (bp) sequence, TGACTAA, located at -5734 to -5728. Deletion of just these seven nucleotides from the 9-kb promoter completely abolished the Dex response and partially reduced the response to phorbol ester but not to forskolin. The Dex response was fully retained in a construct in which most of the 9-kb promoter was deleted, except for 100 bp around the -5.7-kb region, clearly identifying this 7-bp sequence as solely responsible for GC responsiveness. Conversely, deletion of the proximal cAMP-response element (-45/-38) or activator protein-1 (AP-1) (-207/-201) sites in the 9-kb promoter did not affect Dex and phorbol ester responses. A radiolabeled 25-bp promoter fragment bearing the 7-bp TH-GRE/AP-1 showed specific binding to PC12 nuclear proteins. Using antibodies against the glucocorticoid receptors and AP-1 family of proteins and primers for the TH-GRE/AP-1 region, we detected a specific DNA amplicon in a chromatin immunoprecipitation assay. This 7-bp TH-GRE/AP-1 sequence (TGACTAA) does not bear similarity to any known GRE but closely resembles the consensus AP-1 binding site, TGACTCA. Our studies describe for the first time a novel GRE/AP-1 site present in the TH gene promoter that is critical for glucocorticoid regulation of the TH gene.

  2. cis-Element- and Transcriptome-Based Screening of Root Hair-Specific Genes and Their Functional Characterization in Arabidopsis1[C][W][OA

    PubMed Central

    Won, Su-Kyung; Lee, Yong-Ju; Lee, Ha-Yeon; Heo, Yoon-Kyung; Cho, Misuk; Cho, Hyung-Taeg

    2009-01-01

    Understanding the cellular differentiation of multicellular organisms requires the characterization of genes whose expression is modulated in a cell type-specific manner. The Arabidopsis (Arabidopsis thaliana) root hair cell is one model for studying cellular differentiation. In this study, root hair cell-specific genes were screened by a series of in silico and experimental filtration procedures. This process included genome-wide screening for genes with a root hair-specific cis-element in their promoters, filtering root-specific genes from the root hair-specific cis-element-containing genes, further filtering of genes that were suppressed in root hair-defective plant lines, and experimental confirmation by promoter assay. These procedures revealed 19 root hair-specific genes, including many protein kinases and cell wall-related genes, most of which have not been characterized thus far. Functional analyses of these root hair-specific genes with loss-of-function mutants and overexpressing transformants revealed that they play roles in hair growth and morphogenesis. This study demonstrates that a defined cis-element can serve as a filter to screen certain cell type-specific genes and implicates many new root hair-specific genes in root hair development. PMID:19448035

  3. Regulation of glutathione S-transferase Ya subunit gene expression: Identification of a unique xenobiotic-responsive element controlling inducible expression by planar aromatic compounds

    SciTech Connect

    Rushmore, T.H.; King, R.G.; Pickett, C.B. ); Paulson, K.E. )

    1990-05-01

    The authors have identified a region in the 5{prime} flanking sequence of the glutathione S-transferase Ya subunit gene that contains a unique xenobiotic-responsive element (XRE). The regulatory region spans nucleotides {minus}722 to {minus}682 of the 5{prime} flanking sequence and is responsible for part of the basal level as well as inducible expression of the Ya subunit gene by planar aromatic compounds such as {beta}-naphthoflavone ({beta}-NF) and 3-methylcholanthrene. The DNA sequence of this region ({beta}-NF-responsive element) is distinct from the DNA sequence of the XRE found in the cytochrome P-450 IA1 gene. In addition to the region containing the {beta}-NF-responsive element, two other regulatory regions of the Ya subunit gene have been identified. The data suggest that regulation of gene expression by planar aromatic compounds can be mediated by a DNA sequence this is distinct from the XRE sequence.

  4. An AP-2 element acts synergistically with the cyclic AMP- and Phorbol ester-inducible enhancer of the human proenkephalin gene

    SciTech Connect

    Hyman, S.E.; Comb, M.; Pearlberg, J.; Goodman, H.M.

    1989-01-01

    An enhancer with two DNA elements, one containing the sequence CGTCA, is required for cyclic AMP-and phorbol ester-inducible transcription of the human proenkephalin gene. The authors report that an AP-2 element located adjacent to the enhancer acts synergistically with it to confer maximal response to cyclic AMP and phorbol esters.

  5. Differentiation-specific element binding protein (DSEB) binds to a defined element in the promoter of the angiotensinogen gene required for the irreversible induction of gene expression during differentiation of 3T3-L1 adipoblasts to adipocytes.

    PubMed

    McGehee, R E; Habener, J F

    1995-04-01

    The differentiation-specific element (DSE) is a cis-acting transcriptional element located at nucleotide--1000 in the 5'-flanking promoter of the angiotensinogen gene. It is required for the irreversible and sustained increase in transcription of the angiotensinogen gene that occurs during differentiation of 3T3-L1 adipoblasts into adipocytes induced by a 3-day hormonal pulse. We report here the cloning of 3T3-L1 adipocyte cDNA encoding a 150 kilodalton protein designated Differentiation Specific Element Binding Protein (DSEB) that exhibits sequence-specific binding to a DSE oligonucleotide. Two DSEB mRNAs (3.6 and 4.2 kilobases) are observed in adipose, brain, kidney, testis, liver, and lung. Both DSEB mRNA and protein are induced during, and remain elevated after, 3T3-L1 cell adipogenesis. Analysis of adipoblasts by immunocytochemistry with an antiserum directed to bacterial expressed DSEB reveals that DSEB is localized to the nucleus and is induced during differentiation. DNA-binding assays show that binding is specific and exhibits high affinity and specificity for the DSE. Deletional analyses of bacterial expressed recombinant DSEB identifies a DNA-binding domain of 120 amino acids that contains two predicted helical regions. A sequence of 72 amino acids within the DNA-binding domain of DSEB is 60% identical to domains found in the sequences of several bacterial ligases. Further, DSEB is homologous to several proteins reported recently that are proposed to be a component(s) of the DNA replication-C complex raising the possibility that DSEB may be both a transcription factor and a DNA-replication factor.

  6. Identification of a novel cyclosporin-sensitive element in the human tumor necrosis factor alpha gene promoter

    PubMed Central

    1993-01-01

    Tumor necrosis factor alpha (TNF-alpha), a cytokine with pleiotropic biological effects, is produced by a variety of cell types in response to induction by diverse stimuli. In this paper, TNF-alpha mRNA is shown to be highly induced in a murine T cell clone by stimulation with T cell receptor (TCR) ligands or by calcium ionophores alone. Induction is rapid, does not require de novo protein synthesis, and is completely blocked by the immunosuppressant cyclosporin A (CsA). We have identified a human TNF-alpha promoter element, kappa 3, which plays a key role in the calcium-mediated inducibility and CsA sensitivity of the gene. In electrophoretic mobility shift assays, an oligonucleotide containing kappa 3 forms two DNA protein complexes with proteins that are present in extracts from unstimulated T cells. These complexes appear in nuclear extracts only after T cell stimulation. Induction of the inducible nuclear complexes is rapid, independent of protein synthesis, and blocked by CsA, and thus, exactly parallels the induction of TNF-alpha mRNA by TCR ligands or by calcium ionophore. Our studies indicate that the kappa 3 binding factor resembles the preexisting component of nuclear factor of activated T cells. Thus, the TNF-alpha gene is an immediate early gene in activated T cells and provides a new model system in which to study CsA-sensitive gene induction in activated T cells. PMID:8376940

  7. Tissue-specific transcription of the cardiac myosin light-chain 2 gene is regulated by an upstream repressor element.

    PubMed

    Shen, R A; Goswami, S K; Mascareno, E; Kumar, A; Siddiqui, M A

    1991-03-01

    Physiological expression of the cardiac muscle myosin light-chain 2 (MLC-2) gene in chickens is restricted to cardiac muscle tissue only, at least during the late embryonic to adult stages of development. The mechanism by which cardiac MLC-2 gene expression is repressed in differentiated noncardiac muscle tissues is unknown. Using sequential 5'-deletion mutants of the cardiac MLC-2 promoter introduced into primary skeletal muscle cells in culture, we have demonstrated that a 89-bp region, designated the cardiac-specific sequence (CSS), is essential for repression of cardiac MLC-2 expression in skeletal muscle. Removal of the CSS sequence alone allows transcription in skeletal muscle cells without affecting the transcriptional activity of the promoter in cardiac muscle cells. DNase I footprinting and gel shift assays indicate that protein binding to sequences in the CSS domain occurs readily in nuclear extracts obtained from skeletal muscle but not in extracts isolated under identical conditions from cardiac muscle. Thus, it appears that a negative regulatory mechanism accounts for the lack of expression of the cardiac MLC-2 gene in skeletal muscle and that the CSS element and its binding proteins are important functional components of the regulatory apparatus which ensures the developmental program for cardiac tissue-specific gene expression.

  8. Negative regulatory elements upstream of a novel exon of the neuronal nicotinic acetylcholine receptor alpha 2 subunit gene.

    PubMed Central

    Bessis, A; Savatier, N; Devillers-Thiéry, A; Bejanin, S; Changeux, J P

    1993-01-01

    The expression of the nicotinic acetylcholine receptor alpha 2 subunit gene is highly restricted to the Spiriform lateralis nucleus of the Chick diencephalon. As a first step toward understanding the molecular mechanism underlying this regulation, we have investigated the structural and regulatory properties of the 5' sequence of this gene. A strategy based on the ligation of an oligonucleotide to the first strand of the cDNA (SLIC) followed by PCR amplification was used. A new exon was found approximately 3kb upstream from the first coding exon, and multiple transcription start sites of the gene were mapped. Analysis of the flanking region shows many consensus sequences for the binding of nuclear proteins, suggesting that the 1 kb flanking region contains at least a portion of the promoter of the gene. We have analysed the negative regulatory elements present within this region and found that a silencer region located between nucleotide -144 and +76 is active in fibroblasts as well as in neurons. This silencer is composed of six tandem repeat Oct-like motifs (CCCCATGCAAT), but does not bind any member of the Oct family. Moreover these motifs were found to act as a silencer only when they were tandemly repeated. When two, four or five motifs were deleted, the silencer activity of the motifs unexpectedly became an enhancer activity in all cells we have tested. Images PMID:8502560

  9. Characterization of pra, a gene for replication control in pSAM2, the integrating element of Streptomyces ambofaciens.

    PubMed

    Sezonov, G; Hagège, J; Pernodet, J L; Friedmann, A; Guérineau, M

    1995-08-01

    pSAM2 is a genetic element found integrated in Streptomyces ambofaciens (B2) and additionally in a replicating form in two mutants B3 and B4. The presence of the pSAM2 replicating form in these mutants was the result of mutations located on pSAM2 in the pra locus, named pra3 and pra4, respectively. The pra gene is not directly involved in replication, but its inactivation led to the disappearance of the pSAM2 free form; therefore, it was considered as a replication regulator. The pra3 and pra4 mutations were located in the pra promoter and were shown to be point substitutions that increase the promoter strength. The replication regulator role of pra was demonstrated by the fact that its constitutive expression in cells harbouring pSAM2B2, which is normally only integrated, led to the appearance of the pSAM2 replicating form. Northern analysis showed that the pra gene transcript can be detected only for the replicating mutants B3 and B4 and that the three adjacent genes korSA, pra and traSA were transcribed separately. As replication of pSAM2 is not needed for its maintenance but is an indispensable stage of its transfer, the pra gene, described formally as an activator of pSAM2 replication, is patently involved in pSAM2 transfer.

  10. Evidence for redundancy but not trans factor-cis element coevolution in the regulation of Drosophila Yp genes.

    PubMed Central

    Piano, F; Parisi, M J; Karess, R; Kambysellis, M P

    1999-01-01

    In Drosophila melanogaster and the endemic Hawaiian species D. grimshawi three Yolk protein (Yp) genes are expressed in a similar sex- and tissue-specific pattern. In contrast, DNA sequence comparisons of promoter/enhancer regions show low levels of similarity. We tested the functional significance of these observations by transforming D. melanogaster with the genomic region that includes the divergently transcribed D. grimshawi DgYp1 and DgYp2 genes; we found that the introduced genes were expressed in female fat body and in ovaries but not in males. Moreover, we found D. grimshawi proteins in the hemolymph and accumulating in ovaries. Using reporter constructs we showed that the intergenic region from D. grimshawi was sufficient to drive accurate expression, but some low level of ectopic expression was seen in males. Transforming D. melanogaster with constructs bearing deletions within the D. grimshawi intergenic region revealed only subtle effects in the overall level of expression, suggesting a high level of redundancy. Testing mutants in the sex-specific regulator doublesex revealed that it is capable of repressing the DgYp genes in males. Together, these data show that D. melanogaster trans-acting factors can regulate the in vivo pattern of DgYp expression and support the notion of a redundant and complex system of cis-acting elements. PMID:10353903

  11. Increasing prevalence of ciprofloxacin-resistant food-borne Salmonella strains harboring multiple PMQR elements but not target gene mutations

    PubMed Central

    Lin, Dachuan; Chen, Kaichao; Wai-Chi Chan, Edward; Chen, Sheng

    2015-01-01

    Fluoroquinolone resistance in Salmonella has become increasingly prevalent in recent years. To probe the molecular basis of this phenomenon, the genetic and phenotypic features of fluoroquinolone resistant Salmonella strains isolated from food samples were characterized. Among the 82 Salmonella strains tested, resistance rate of the three front line antibiotics of ceftriaxone, ciprofloxacin and azithromycin was 10%, 39% and 25% respectively, which is significantly higher than that reported in other countries. Ciprofloxacin resistant strains typically exhibited cross-resistance to multiple antibiotics including ceftriaxone, primarily due to the presence of multiple PMQR genes and the blaCTX-M-65, blaCTX-M-55 blaCMY-2 and blaCMY-72 elements. The prevalence rate of the oqxAB and aac(6’)-Ib-cr genes were 91% and 75% respectively, followed by qnrS (66%), qnrB (16%) and qnrD (3%). The most common PMQR combination observable was aac(6’)-Ib-cr-oqxAB-qnrS2, which accounted for 50% of the ciprofloxacin resistant strains. Interestingly, such isolates contained either no target mutations or only a single gyrA mutation. Conjugation and hybridization experiments suggested that most PMQR genes were located either in the chromosome or a non-transferrable plasmid. To summarize, findings in this work suggested that PMQRs greatly facilitate development of fluoroquinolone resistance in Salmonella by abolishing the requirement of target gene mutations. PMID:26435519

  12. Tissue-specific transcription of the cardiac myosin light-chain 2 gene is regulated by an upstream repressor element.

    PubMed Central

    Shen, R A; Goswami, S K; Mascareno, E; Kumar, A; Siddiqui, M A

    1991-01-01

    Physiological expression of the cardiac muscle myosin light-chain 2 (MLC-2) gene in chickens is restricted to cardiac muscle tissue only, at least during the late embryonic to adult stages of development. The mechanism by which cardiac MLC-2 gene expression is repressed in differentiated noncardiac muscle tissues is unknown. Using sequential 5'-deletion mutants of the cardiac MLC-2 promoter introduced into primary skeletal muscle cells in culture, we have demonstrated that a 89-bp region, designated the cardiac-specific sequence (CSS), is essential for repression of cardiac MLC-2 expression in skeletal muscle. Removal of the CSS sequence alone allows transcription in skeletal muscle cells without affecting the transcriptional activity of the promoter in cardiac muscle cells. DNase I footprinting and gel shift assays indicate that protein binding to sequences in the CSS domain occurs readily in nuclear extracts obtained from skeletal muscle but not in extracts isolated under identical conditions from cardiac muscle. Thus, it appears that a negative regulatory mechanism accounts for the lack of expression of the cardiac MLC-2 gene in skeletal muscle and that the CSS element and its binding proteins are important functional components of the regulatory apparatus which ensures the developmental program for cardiac tissue-specific gene expression. Images PMID:1996116

  13. Modulation of Estrogen Response Element-Driven Gene Expressions and Cellular Proliferation with Polar Directions by Designer Transcription Regulators

    PubMed Central

    Muyan, Mesut; Güpür, Gizem; Yaşar, Pelin; Ayaz, Gamze; User, Sırma Damla; Kazan, Hasan Hüseyin; Huang, Yanfang

    2015-01-01

    Estrogen receptor α (ERα), as a ligand-dependent transcription factor, mediates 17β-estradiol (E2) effects. ERα is a modular protein containing a DNA binding domain (DBD) and transcription activation domains (AD) located at the amino- and carboxyl-termini. The interaction of the E2-activated ERα dimer with estrogen response elements (EREs) of genes constitutes the initial step in the ERE-dependent signaling pathway necessary for alterations of cellular features. We previously constructed monomeric transcription activators, or monotransactivators, assembled from an engineered ERE-binding module (EBM) using the ERα-DBD and constitutively active ADs from other transcription factors. Monotransactivators modulated cell proliferation by activating and repressing ERE-driven gene expressions that simulate responses observed with E2-ERα. We reasoned here that integration of potent heterologous repression domains (RDs) into EBM could generate monotransrepressors that alter ERE-bearing gene expressions and cellular proliferation in directions opposite to those observed with E2-ERα or monotransactivators. Consistent with this, monotransrepressors suppressed reporter gene expressions that emulate the ERE-dependent signaling pathway. Moreover, a model monotransrepressor regulated DNA synthesis, cell cycle progression and proliferation of recombinant adenovirus infected ER-negative cells through decreasing as well as increasing gene expressions with polar directions compared with E2-ERα or monotransactivator. Our results indicate that an ‘activator’ or a ‘repressor’ possesses both transcription activating/enhancing and repressing/decreasing abilities within a chromatin context. Offering a protein engineering platform to alter signal pathway-specific gene expressions and cell growth, our approach could also be used for the development of tools for epigenetic modifications and for clinical interventions wherein multigenic de-regulations are an issue. PMID:26295471

  14. Statins Increase Plasminogen Activator Inhibitor Type 1 Gene Transcription through a Pregnane X Receptor Regulated Element.

    PubMed

    Stanley, Frederick M; Linder, Kathryn M; Cardozo, Timothy J

    2015-01-01

    Plasminogen activator inhibitor type 1 (PAI-1) is a multifunctional protein that has important roles in inflammation and wound healing. Its aberrant regulation may contribute to many disease processes such as heart disease. The PAI-1 promoter is responsive to multiple inputs including cytokines, growth factors, steroids and oxidative stress. The statin drugs, atorvastatin, mevastatin and rosuvastatin, increased basal and stimulated expression of the PAI-1 promoter 3-fold. A statin-responsive, nuclear hormone response element was previously identified in the PAI-1 promoter, but it was incompletely characterized. We characterized this direct repeat (DR) of AGGTCA with a 3-nucleotide spacer at -269/-255 using deletion and directed mutagenesis. Deletion or mutation of this element increased basal transcription from the promoter suggesting that it repressed PAI-1 transcription in the unliganded state. The half-site spacing and the ligand specificity suggested that this might be a pregnane X receptor (PXR) responsive element. Computational molecular docking showed that atorvastatin, mevastatin and rosuvastatin were structurally compatible with the PXR ligand-binding pocket in its agonist conformation. Experiments with Gal4 DNA binding domain fusion proteins showed that Gal4-PXR was activated by statins while other DR + 3 binding nuclear receptor fusions were not. Overexpression of PXR further enhanced PAI-1 transcription in response to statins. Finally, ChIP experiments using Halo-tagged PXR and RXR demonstrated that both components of the PXR-RXR heterodimer bound to this region of the PAI-1 promoter.

  15. Statins Increase Plasminogen Activator Inhibitor Type 1 Gene Transcription through a Pregnane X Receptor Regulated Element

    PubMed Central

    Stanley, Frederick M.; Linder, Kathryn M.; Cardozo, Timothy J.

    2015-01-01

    Plasminogen activator inhibitor type 1 (PAI-1) is a multifunctional protein that has important roles in inflammation and wound healing. Its aberrant regulation may contribute to many disease processes such as heart disease. The PAI-1 promoter is responsive to multiple inputs including cytokines, growth factors, steroids and oxidative stress. The statin drugs, atorvastatin, mevastatin and rosuvastatin, increased basal and stimulated expression of the PAI-1 promoter 3-fold. A statin-responsive, nuclear hormone response element was previously identified in the PAI-1 promoter, but it was incompletely characterized. We characterized this direct repeat (DR) of AGGTCA with a 3-nucleotide spacer at -269/-255 using deletion and directed mutagenesis. Deletion or mutation of this element increased basal transcription from the promoter suggesting that it repressed PAI-1 transcription in the unliganded state. The half-site spacing and the ligand specificity suggested that this might be a pregnane X receptor (PXR) responsive element. Computational molecular docking showed that atorvastatin, mevastatin and rosuvastatin were structurally compatible with the PXR ligand-binding pocket in its agonist conformation. Experiments with Gal4 DNA binding domain fusion proteins showed that Gal4-PXR was activated by statins while other DR + 3 binding nuclear receptor fusions were not. Overexpression of PXR further enhanced PAI-1 transcription in response to statins. Finally, ChIP experiments using Halo-tagged PXR and RXR demonstrated that both components of the PXR-RXR heterodimer bound to this region of the PAI-1 promoter. PMID:26379245

  16. A recent evolutionary change affects a regulatory element in the human FOXP2 gene.

    PubMed

    Maricic, Tomislav; Günther, Viola; Georgiev, Oleg; Gehre, Sabine; Curlin, Marija; Schreiweis, Christiane; Naumann, Ronald; Burbano, Hernán A; Meyer, Matthias; Lalueza-Fox, Carles; de la Rasilla, Marco; Rosas, Antonio; Gajovic, Srecko; Kelso, Janet; Enard, Wolfgang; Schaffner, Walter; Pääbo, Svante

    2013-04-01

    The FOXP2 gene is required for normal development of speech and language. By isolating and sequencing FOXP2 genomic DNA fragments from a 49,000-year-old Iberian Neandertal and 50 present-day humans, we have identified substitutions in the gene shared by all or nearly all present-day humans but absent or polymorphic in Neandertals. One such substitution is localized in intron 8 and affects a binding site for the transcription factor POU3F2, which is highly conserved among vertebrates. We find that the derived allele of this site is less efficient than the ancestral allele in activating transcription from a reporter construct. The derived allele also binds less POU3F2 dimers than POU3F2 monomers compared with the ancestral allele. Because the substitution in the POU3F2 binding site is likely to alter the regulation of FOXP2 expression, and because it is localized in a region of the gene associated with a previously described signal of positive selection, it is a plausible candidate for having caused a recent selective sweep in the FOXP2 gene.

  17. Regulatory elements controlling pituitary-specific expression of the human prolactin gene.

    PubMed Central

    Peers, B; Voz, M L; Monget, P; Mathy-Hartert, M; Berwaer, M; Belayew, A; Martial, J A

    1990-01-01

    We have performed transfection and DNase I footprinting experiments to investigate pituitary-specific expression of the human prolactin (hPRL) gene. When fused to the chloramphenicol acetyltransferase (CAT) reporter gene, 5,000 base pairs of the 5'-flanking sequences of the hPRL gene were able to drive high cat gene expression in prolactin-expressing GH3B6 cells specifically. Deletion analysis indicated that this pituitary-specific expression was controlled by three main positive regulatory regions. The first was located just upstream from the TATA box between coordinates -40 and -250 (proximal region). We have previously shown that three motifs of this region bind the pituitary-specific Pit-1 factor. The second positive region was located in the vicinity of coordinates -1300 to -1750 (distal region). DNase I footprinting assays revealed that eight DNA motifs of this distal region bound protein Pit-1 and that two other motifs were recognized by ubiquitous factors, one of which seems to belong to the AP-1 (jun) family. The third positive region was located further upstream, between -3500 and -5000 (superdistal region). This region appears to enhance transcription only in the presence of the distal region. Images PMID:2388622

  18. Regulatory elements controlling pituitary-specific expression of the human prolactin gene.

    PubMed

    Peers, B; Voz, M L; Monget, P; Mathy-Hartert, M; Berwaer, M; Belayew, A; Martial, J A

    1990-09-01

    We have performed transfection and DNase I footprinting experiments to investigate pituitary-specific expression of the human prolactin (hPRL) gene. When fused to the chloramphenicol acetyltransferase (CAT) reporter gene, 5,000 base pairs of the 5'-flanking sequences of the hPRL gene were able to drive high cat gene expression in prolactin-expressing GH3B6 cells specifically. Deletion analysis indicated that this pituitary-specific expression was controlled by three main positive regulatory regions. The first was located just upstream from the TATA box between coordinates -40 and -250 (proximal region). We have previously shown that three motifs of this region bind the pituitary-specific Pit-1 factor. The second positive region was located in the vicinity of coordinates -1300 to -1750 (distal region). DNase I footprinting assays revealed that eight DNA motifs of this distal region bound protein Pit-1 and that two other motifs were recognized by ubiquitous factors, one of which seems to belong to the AP-1 (jun) family. The third positive region was located further upstream, between -3500 and -5000 (superdistal region). This region appears to enhance transcription only in the presence of the distal region.

  19. The identification of hematopoietic-specific regulatory elements for WASp gene expression

    PubMed Central

    Zhan, Jun; Johnson, Irudayam Maria; Wielgosz, Matthew; Nienhuis, Arthur W

    2016-01-01

    Chromosome Conformation Capture (3C) technology was used to identify physical interactions between the proximal Wiskott-Aldrich Syndrome protein (WASp) promoter and its distant DNA segments in Jurkat-T cells. We found that two hematopoietic specific DNase I hypersensitive (DHS) sites (proximal DHS-A, and distal DHS-B) which had high interaction frequencies with the proximal WASp promoter indicating potential regulatory activity for these DHS sites. Subsequently, we cloned several DNA fragments around the proximal DHS-A site into a luciferase reporter vector. Interestingly, no fragments showed enhancer activity, but two fragments exhibited strong silencing activity in Jurkat-T cells. After aligning the chromatin state profiling for hematopoietic and nonhematopoietic cells using the human genome browser (UCSC), we found a 5 kb putative hematopoietic specific enhancer region located 250 kb downstream of the WAS gene. This putative enhancer region contains two hematopoietic cell specific DHS sites. Subsequently, the hematopoietic specific DHS sites enhanced luciferase expression from the proximal WASp promoter in all hematopoietic cells we tested. Finally, using a lentiviral vector stable expression system, the hematopoietic specific-enhancer(s) increased GFP reporter gene expression in hematopoietic cells, and increased WASp gene expression in WASp deficient cells. This enhancer may have the potential to be used in gene therapy for hematological diseases. PMID:28035317

  20. The Popeye domain containing genes: essential elements in heart rate control

    PubMed Central

    Schindler, Roland F.; Poon, Kar Lai; Simrick, Subreena

    2012-01-01

    The Popeye domain containing (Popdc) gene family displays preferential expression in skeletal muscle and heart. Only recently a significant gain in the understanding of the function of Popdc genes in the heart has been obtained. The Popdc genes encode membrane proteins harboring an evolutionary conserved Popeye domain, which functions as a binding domain for cyclic adenosine monophosphate (cAMP). Popdc proteins interact with the two-pore channel TREK-1 and enhance its current. This protein interaction is modulated by cAMP. Null mutations of members of the Popdc gene family in zebrafish and mouse are associated with severe cardiac arrhythmia phenotypes. While in zebrafish an atrioventricular block was prevalent, in mouse a stress-induced sinus bradycardia was observed, which was due to the presence of sinus pauses. Moreover, the phenotype develops in an age-dependent manner, being absent in the young animal and becoming increasingly severe, as the animals grow older. This phenotype is reminiscent of the sick sinus syndrome (SSS), which affects mostly the elderly and is characterized by the poor ability of the cardiac pacemaker to adapt the heart rate to the physiological demand. While being a prevalent disease, which is responsible for a large fraction of pacemaker implantations in Western countries, SSS is poorly understood at the molecular level. It is therefore expected that the study of the molecular basis of the stress-induced bradycardia in Popdc mice will shed new light on the etiology of pacemaker disease. PMID:24282731

  1. A yeast-based rapid prototype platform for gene control elements in mammalian cells.

    PubMed

    Wei, Kathy Y; Chen, Yvonne Y; Smolke, Christina D

    2013-04-01

    Programming genetic circuits in mammalian cells requires flexible, tunable, and user-tailored gene-control systems. However, most existing control systems are either mechanistically specific for microbial organisms or must be laboriously re-engineered to function in mammalian cells. Here, we demonstrate a ribozyme-based device platform that can be directly transported from yeast to mammalian cells in a "plug-and-play" manner. Ribozyme switches previously prototyped in yeast are shown to regulate gene expression in a predictable, ligand-responsive manner in human HEK 293, HeLa, and U2OS cell lines without any change to device sequence nor further optimization. The ribozyme-based devices, which exhibit activation ratios comparable to the best RNA-based regulatory devices demonstrated in mammalian cells to-date, retain their prescribed functions (ON or OFF switch), tunability of regulatory stringency, and responsiveness to different small-molecule inputs in mammalian hosts. Furthermore, we observe strong correlations of device performance between yeast and all mammalian cell lines tested (R(2)  = 0.63-0.97). Our unique device architecture can therefore act as a rapid prototyping platform (RPP) based on a yeast chassis, providing a well-developed and genetically tractable system that supports rapid and high-throughput screens for generating gene-controllers with a broad range of functions in mammalian cells. This platform will accelerate development of mammalian gene-controllers for diverse applications, including cell-based therapeutics and cell-fate reprogramming.

  2. DNA sequence analysis of a mouse pro alpha 1 (I) procollagen gene: evidence for a mouse B1 element within the gene.

    PubMed Central

    Monson, J M; Friedman, J; McCarthy, B J

    1982-01-01

    In a 3.8-kilobase mouse DNA sequence encoding amino acid sequences for the pro alpha 1(I) chain of type I procollagen, 14 coding sequences were identified which specify a sequence 95% homologous to amino acid residues 568 to 963 of the bovine alpha 1(I) chain. All of these coding sequences were flanked by appropriate splice junctions following the GT/AG rule. These observations suggest, but do not prove, that this pro alpha 1(I) gene is transcriptionally active. Of the 14 coding sequences, 7 were 54 base pairs in length, whereas the remainder were higher multiples of 54 base pairs. Nonrandom utilization of codons pertained throughout all of the coding sequences showing a preference (56%) for U in the wobble position. Two of the intervening sequences encoded imperfect vestiges of coding sequences which exhibited a codon preference different from that of the pro alpha 1(I) gene proper and were not flanked by splice junctions. One intervening sequence encoded a member of the mouse B1 family of middle repetitive sequences. It was flanked by 8-base-pair direct repeats and had a truncated A-rich region, suggesting that it may be a mobile element. Within this element were sequences which could function as a RNA polymerase III split promoter. Images PMID:6298597

  3. A nuclear factor that binds purine-rich, single-stranded oligonucleotides derived from S1-sensitive elements upstream of the CFTR gene and the MUC1 gene.

    PubMed Central

    Hollingsworth, M A; Closken, C; Harris, A; McDonald, C D; Pahwa, G S; Maher, L J

    1994-01-01

    We have identified two regions of non-random purine/pyrimidine strand asymmetry that were nearly identical in sequence in the 5' flanking (promoter) regions of the human cystic fibrosis transmembrane conductance regulator (CFTR) gene and the human MUC1 gene. These regions contain perfect mirror repeat elements, a sequence motif previously found to be associated with the formation of H-DNA conformations. In this report we demonstrate that a single-stranded non-B DNA conformation exists at low pH in supercoiled plasmids containing the similar mirror repeat elements, and that S1 nuclease digestion maps the single-stranded region to the position of the mirror repeats. In addition, we identify a nuclear protein of approximately 27 kD that binds to single-stranded oligonucleotides corresponding to the purine-rich strand of this region, but not to the pyrimidine-rich strands or to double-stranded oligonucleotides with corresponding purine/pyrimidine strand asymmetry. Images PMID:7513081

  4. Exonization of an Intronic LINE-1 Element Causing Becker Muscular Dystrophy as a Novel Mutational Mechanism in Dystrophin Gene.

    PubMed

    Gonçalves, Ana; Oliveira, Jorge; Coelho, Teresa; Taipa, Ricardo; Melo-Pires, Manuel; Sousa, Mário; Santos, Rosário

    2017-10-03

    A broad mutational spectrum in the dystrophin (DMD) gene, from large deletions/duplications to point mutations, causes Duchenne/Becker muscular dystrophy (D/BMD). Comprehensive genotyping is particularly relevant considering the mutation-centered therapies for dystrophinopathies. We report the genetic characterization of a patient with disease onset at age 13 years, elevated creatine kinase levels and reduced dystrophin labeling, where multiplex-ligation probe amplification (MLPA) and genomic sequencing failed to detect pathogenic variants. Bioinformatic, transcriptomic (real time PCR, RT-PCR), and genomic approaches (Southern blot, long-range PCR, and single molecule real-time sequencing) were used to characterize the mutation. An aberrant transcript was identified, containing a 103-nucleotide insertion between exons 51 and 52, with no similarity with the DMD gene. This corresponded to the partial exonization of a long interspersed nuclear element (LINE-1), disrupting the open reading frame. Further characterization identified a complete LINE-1 (~6 kb with typical hallmarks) deeply inserted in intron 51. Haplotyping and segregation analysis demonstrated that the mutation had a de novo origin. Besides underscoring the importance of mRNA studies in genetically unsolved cases, this is the first report of a disease-causing fully intronic LINE-1 element in DMD, adding to the diversity of mutational events that give rise to D/BMD.

  5. Ethanol activates cAMP response element-mediated gene expression in select regions of the mouse brain.

    PubMed

    Asyyed, Asma; Storm, Daniel; Diamond, Ivan

    2006-08-23

    The specific brain regions that contribute to behavioral changes produced by ethanol are not clearly understood. We know that cAMP-PKA signaling has been strongly implicated in the CNS effects of ethanol. Ethanol promotes activation and translocation of the PKA catalytic subunit (Calpha) into the nucleus in cell lines and primary neuronal cultures. PKA Calpha translocation to the nucleus is followed by cAMP Response Element protein phosphorylation (pCREB) and cAMP Response Element (CRE)-mediated gene expression. Here, we use X-gal histochemistry to map CRE-mediated gene transcription in the brain of CRE-lacZ transgenic mice following ethanol injection. 3 h after i.p. ethanol injection (3.2 g/kg, 16% wt/vol.), the number of X-gal positive cells was increased in the nucleus accumbens (202 +/- 63 cells/field compared to 71 +/- 47 cells/field in saline injected controls, P < 0.05 by paired t-test, n = 10). Similar increases were found in other mesolimbic areas and brain regions associated with rewarding and addictive responses. These include: prefrontal cortex, lateral and medial septum, basolateral amygdala, paraventricular and anterior hypothalamus, centromedial thalamus, CA1 region of hippocampus and dentate gyrus, substantia nigra pars compacta, ventral tegmental area, geniculate nucleus and the superior colliculus. these results confirm and extend current concepts that ethanol stimulates cAMP-PKA signaling in brain regions involved in CNS responses to ethanol.

  6. Intronic elements in the Na+/I- symporter gene (NIS) interact with retinoic acid receptors and mediate initiation of transcription

    PubMed Central

    Alotaibi, Hani; Yaman, Elif; Salvatore, Domenico; Di Dato, Valeria; Telkoparan, Pelin; Di Lauro, Roberto; Tazebay, Uygar H.

    2010-01-01

    Activity of the sodium/iodide symporter (NIS) in lactating breast is essential for iodide (I–) accumulation in milk. Significant NIS upregulation was also reported in breast cancer, indicating a potential use of radioiodide treatment. All-trans-retinoic acid (tRA) is a potent ligand that enhances NIS expression in a subset of breast cancer cell lines and in experimental breast cancer models. Indirect tRA stimulation of NIS in breast cancer cells is very well documented; however, direct upregulation by tRA-activated nuclear receptors has not been identified yet. Aiming to uncover cis-acting elements directly regulating NIS expression, we screened evolutionary-conserved non-coding genomic sequences for responsiveness to tRA in MCF-7. Here, we report that a potent enhancer in the first intron of NIS mediates direct regulation by tRA-stimulated nuclear receptors. In vitro as well as in vivo DNA–protein interaction assays revealed direct association between retinoic acid receptor-α (RARα) and retinoid-X-receptor (RXR) with this enhancer. Moreover, using chromatin immunoprecipitation (ChIP) we uncovered early events of NIS transcription in response to tRA, which require the interaction of several novel intronic tRA responsive elements. These findings indicate a complex interplay between nuclear receptors, RNA Pol-II and multiple intronic RAREs in NIS gene, and they establish a novel mechanistic model for tRA-induced gene transcription. PMID:20123735

  7. Intronic elements in the Na+/I- symporter gene (NIS) interact with retinoic acid receptors and mediate initiation of transcription.

    PubMed

    Alotaibi, Hani; Yaman, Elif; Salvatore, Domenico; Di Dato, Valeria; Telkoparan, Pelin; Di Lauro, Roberto; Tazebay, Uygar H

    2010-06-01

    Activity of the sodium/iodide symporter (NIS) in lactating breast is essential for iodide (I(-)) accumulation in milk. Significant NIS upregulation was also reported in breast cancer, indicating a potential use of radioiodide treatment. All-trans-retinoic acid (tRA) is a potent ligand that enhances NIS expression in a subset of breast cancer cell lines and in experimental breast cancer models. Indirect tRA stimulation of NIS in breast cancer cells is very well documented; however, direct upregulation by tRA-activated nuclear receptors has not been identified yet. Aiming to uncover cis-acting elements directly regulating NIS expression, we screened evolutionary-conserved non-coding genomic sequences for responsiveness to tRA in MCF-7. Here, we report that a potent enhancer in the first intron of NIS mediates direct regulation by tRA-stimulated nuclear receptors. In vitro as well as in vivo DNA-protein interaction assays revealed direct association between retinoic acid receptor-alpha (RARalpha) and retinoid-X-receptor (RXR) with this enhancer. Moreover, using chromatin immunoprecipitation (ChIP) we uncovered early events of NIS transcription in response to tRA, which require the interaction of several novel intronic tRA responsive elements. These findings indicate a complex interplay between nuclear receptors, RNA Pol-II and multiple intronic RAREs in NIS gene, and they establish a novel mechanistic model for tRA-induced gene transcription.

  8. A comparative analysis of the evolution, expression, and cis-regulatory element of polygalacturonase genes in grasses and dicots.

    PubMed

    Liang, Ying; Yu, Youjian; Cui, Jinlong; Lyu, Meiling; Xu, Liai; Cao, Jiashu

    2016-11-01

    Cell walls are a distinguishing characteristic of plants essential to their survival. The pectin content of primary cell walls in grasses and dicots is distinctly different. Polygalacturonases (PGs) can degrade pectins and participate in multiple developmental processes of plants. This study comprehensively compared the evolution, expression, and cis-regulatory element of PGs in grasses and dicots. A total of 577 PGs identified from five grasses and five dicots fell into seven clades. Evolutionary analysis demonstrated the distinct differences between grasses and dicots in patterns of gene duplication and loss, and evolutionary rates. Grasses generally contained much fewer clade C and F members than dicots. We found that this disparity was the result of less duplication and more gene losses in grasses. More duplications occurred in clades D and E, and expression analysis showed that most of clade E members were expressed ubiquitously at a high overall level and clade D members were closely related to male reproduction in both grasses and dicots, suggesting their biological functions were highly conserved across species. In addition to the general role in reproductive development, PGs of clades C and F specifically played roles in root development in dicots, shedding light on organ differentiation between the two groups of plants. A regulatory element analysis of clade C and F members implied that possible functions of PGs in specific biological responses contributed to their expansion and preservation. This work can improve the knowledge of PGs in plants generally and in grasses specifically and is beneficial to functional studies.

  9. Promoter elements of the PHR1 gene of Saccharomyces cerevisiae and their roles in the response to DNA damage.

    PubMed Central

    Sancar, G B; Ferris, R; Smith, F W; Vandeberg, B

    1995-01-01

    The PHR1 gene of Saccharomyces cerevisiae encodes the apoenzyme for the DNA repair enzyme photolyase. PHR1 transcription is induced in response to 254 nm radiation and a variety of chemical damaging agents. We report here the identification of promoter elements required for PHR1 expression. Transcription is regulated primarily through three sequence elements clustered within a 120 bp region immediately upstream of the translational start site. A 20 bp interrupted palindrome comprises UASPHR1 and is responsible for 80-90% of basal and induced expression. UASPHR1 alone can activate transcription of a CYC1 minimal promoter but does not confer damage responsiveness. In the intact PHR1 promoter UAS function is dependent upon an upstream essential sequence (UES). URSPHR1 contains a binding site for the damage-responsive repressor Prp; consistent with this role, deletion or specific mutations of the URS increase basal level expression and decrease the induction ratio. Deletion of URSPHR1 also eliminates the requirement for UESPHR1 for promoter activation, indicating that the UES attenuates Prp-mediated repression. Sequences within UASPHR1 are similar to regulatory sequences found upstream of both damage responsive and nonresponsive genes involved in DNA repair and metabolism. PMID:7501452

  10. Characterization of the cheetah serum amyloid A1 gene: critical role and functional polymorphism of a cis-acting element.

    PubMed

    Zhang, Beiru; Une, Yumi; Ge, Fengxia; Fu, Xiaoying; Qian, Jinze; Zhang, Pengyao; Sawashita, Jinko; Higuchi, Keiichi; Mori, Masayuki

    2008-01-01

    Amyloid A (AA) amyloidosis is one of the principal causes of morbidity and mortality in captive cheetahs (Acinonyx jubatus), which are in danger of extinction. For practical conservation of this species, therefore, it is critical to elucidate the etiology of AA amyloidosis, especially to understand the mechanisms of transcriptional regulation of serum amyloid A (SAA), a precursor protein of the AA protein. In this study, the structure and nucleotide sequence of the cheetah SAA1 gene including the 5'-flanking promoter/enhancer region was determined. Putative nuclear factor kappa-B (NF-kappaB) and CCAAT/enhancer binding protein beta (C/EBPbeta) cis-acting elements, which play key roles in SAA1 transcriptional induction in response to inflammation, were identified in the 5'-flanking region of the cheetah SAA1 gene. Fortuitously, a single nucleotide polymorphism was identified in the captive cheetah cohort in the putative NF-kappaB cis-acting element and had a remarkable effect on SAA1 transcriptional induction. These results provide a foundation not only for clarifying the etiology of AA amyloidosis in the cheetah but also for contriving a strategy for conservation of this species.

  11. Novel Role of 3'UTR-Embedded Alu Elements as Facilitators of Processed Pseudogene Genesis and Host Gene Capture by Viral Genomes.

    PubMed

    Farré, Domènec; Engel, Pablo; Angulo, Ana

    2016-01-01

    Since the discovery of the high abundance of Alu elements in the human genome, the interest for the functional significance of these retrotransposons has been increasing. Primate Alu and rodent Alu-like elements are retrotransposed by a mechanism driven by the LINE1 (L1) encoded proteins, the same machinery that generates the L1 repeats, the processed pseudogenes (PPs), and other retroelements. Apart from free Alu RNAs, Alus are also transcribed and retrotranscribed as part of cellular gene transcripts, generally embedded inside 3' untranslated regions (UTRs). Despite different proposed hypotheses, the functional implication of the presence of Alus inside 3'UTRs remains elusive. In this study we hypothesized that Alu elements in 3'UTRs could be involved in the genesis of PPs. By analyzing human genome data we discovered that the existence of 3'UTR-embedded Alu elements is overrepresented in genes source of PPs. In contrast, the presence of other retrotransposable elements in 3'UTRs does not show this PP linked overrepresentation. This research was extended to mouse and rat genomes and the results accordingly reveal overrepresentation of 3'UTR-embedded B1 (Alu-like) elements in PP parent genes. Interestingly, we also demonstrated that the overrepresentation of 3'UTR-embedded Alus is particularly significant in PP parent genes with low germline gene expression level. Finally, we provide data that support the hypothesis that the L1 machinery is also the system that herpesviruses, and possibly other large DNA viruses, use to capture host genes expressed in germline or somatic cells. Altogether our results suggest a novel role for Alu or Alu-like elements inside 3'UTRs as facilitators of the genesis of PPs, particularly in lowly expressed genes. Moreover, we propose that this L1-driven mechanism, aided by the presence of 3'UTR-embedded Alus, may also be exploited by DNA viruses to incorporate host genes to their viral genomes.

  12. A short, highly repetitive element in intron -1 of the human c-Ha-ras gene acts as a block to transcriptional readthrough by a viral promoter.

    PubMed Central

    Lowndes, N F; Bushel, P; Mendelsohn, L; Wu, J; Yen, M Y; Allan, M

    1990-01-01

    We have identified a short, highly repetitive element within intron -1 of the human c-Ha-ras gene. This element was found to be transcribed in both orientations and to be homologous to heterogeneous nonpolyadenylated transcripts. The repetitive element blocked transcriptional readthrough from a strong upstream viral promoter but allowed unimpaired readthrough from the c-Has-ras promoter. We suggest that it may serve to prevent excessive transcription into the coding region of the gene under such circumstances as viral insertion. Images PMID:2201911

  13. Engineering ligand-responsive gene control elements: Lessons learned from natural riboswitches

    PubMed Central

    Link, Kristian H.; Breaker, Ronald R.

    2017-01-01

    In the past two decades, remarkable advances have been made in the development of technologies used to engineer new aptamers and ribozymes. This has encouraged interest among researchers who seek to create new types of gene control systems that can be made to respond specifically to small molecule signals. Validation that RNA molecules can exhibit the characteristics needed to serve as precision genetic switches has come from the discovery of numerous classes of natural ligand-sensing RNAs called riboswitches. While a great deal of progress has been made towards engineering useful designer riboswitches, considerable advances are needed before the performance characteristics of these RNAs match those of protein systems that have been co-opted to regulate gene expression. In this review, we will evaluate the potential for engineered RNAs to regulate gene expression and lay out possible paths to designer riboswitches based upon currently available technologies. Furthermore, we will discuss some technical advances that would empower RNA engineers who seek to make routine the production of designer riboswitches that can function in eukaryotes. PMID:19587710

  14. Phytophthora infestans Argonaute 1 binds microRNA and small RNAs from effector genes and transposable elements.

    PubMed

    Åsman, Anna K M; Fogelqvist, Johan; Vetukuri, Ramesh R; Dixelius, Christina

    2016-08-01

    Phytophthora spp. encode large sets of effector proteins and distinct populations of small RNAs (sRNAs). Recent evidence has suggested that pathogen-derived sRNAs can modulate the expression of plant defense genes. Here, we studied the sRNA classes and functions associated with Phytophthora infestans Argonaute (Ago) proteins. sRNAs were co-immunoprecipitated with three PiAgo proteins and deep sequenced. Twenty- to twenty-two-nucleotide (nt) sRNAs were identified as the main interaction partners of PiAgo1 and high enrichment of 24-26-nt sRNAs was seen in the PiAgo4-bound sample. The frequencies and sizes of transposable element (TE)-derived sRNAs in the different PiAgo libraries suggested diversified roles of the PiAgo proteins in the control of different TE classes. We further provide evidence for the involvement of PiAgo1 in the P. infestans microRNA (miRNA) pathway. Protein-coding genes are probably regulated by the shared action of PiAgo1 and PiAgo5, as demonstrated by analysis of differential expression. An abundance of sRNAs from genes encoding host cell death-inducing Crinkler (CRN) effectors was bound to PiAgo1, implicating this protein in the regulation of the expanded CRN gene family. The data suggest that PiAgo1 plays an essential role in gene regulation and that at least two RNA silencing pathways regulate TEs in the plant-pathogenic oomycete P. infestans.

  15. An adaptive transposable element insertion in the regulatory region of the EO gene in the domesticated silkworm, Bombyx mori.

    PubMed

    Sun, Wei; Shen, Yi-Hong; Han, Min-Jin; Cao, Yun-Feng; Zhang, Ze

    2014-12-01

    Although there are many studies to show a key role of transposable elements (TEs) in adaptive evolution of higher organisms, little is known about the molecular mechanisms. In this study, we found that a partial TE (Taguchi) inserted in the cis-regulatory region of the silkworm ecdysone oxidase (EO) gene, which encodes a crucial enzyme to reduce the titer of molting hormone (20-hydroxyecdysone, 20E). The TE insertion occurred during domestication of silkworm and the frequency of the TE insertion in the domesticated silkworm (Bombyx mori) is high, 54.24%. The linkage disequilibrium in the TE inserted strains of the domesticated silkworm was elevated. Molecular population genetics analyses suggest that this TE insertion is adaptive for the domesticated silkworm. Luminescent reporter assay shows that the TE inserted in the cis-regulatory region of the EO gene functions as a 20E-induced enhancer of the gene expression. Further, phenotypic bioassay indicates that the silkworm with the TE insertion exhibited more stable developmental phenotype than the silkworm without the TE insertion when suffering from food shortage. Thus, the inserted TE in the cis-regulatory region of the EO gene increased developmental uniformity of silkworm individuals through regulating 20E metabolism, partially explaining transformation of a domestication developmental trait in the domesticated silkworm. Our results emphasize the exceptional role of gene expression regulation in developmental transition of domesticated animals. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  16. Induction of the mammalian stress response gene GADD153 by oxidative stress: role of AP-1 element.

    PubMed Central

    Guyton, K Z; Xu, Q; Holbrook, N J

    1996-01-01

    GADD153 is a CCAAT/enhancer-binding-protein-related gene that may function to control cellular growth in response to stress signals. In this study, a variety of oxidant treatments were shown to stimulate endogenous GADD153 mRNA expression and to transcriptionally activate a GADD153 promoter-reporter gene construct in transfected HeLa cells. Both commonalities and distinctions in the induction of GADD153 by H2O2 and the thiol-reactive compound arsenite were demonstrated. GADD153 mRNA induction by both H2O2 and arsenite was potentiated by GSH depletion, and completely inhibited by N-acetyl-cysteine. o-Phenanthroline and mannitol blocked GADD153 induction by H2O2, indicating that iron-generated hydroxyl radical mediates this induction. Concordantly, GSH peroxidase overexpression in WI38 cells attenuated GADD153 mRNA induction by H2O2. However, GADD153 induction by arsenite was only modestly reduced in the same cells, suggesting a lesser contribution of peroxides to gene activation by arsenite. We also demonstrated that oxidative stress participates in the induction of GADD153 by UVC (254 nm) irradiation. Finally, both promoter-deletion analysis and point mutation of the AP-1 site in an otherwise intact promoter support a significant role for AP-1 in transcriptional activation of GADD153 by UVC or oxidant treatment. Indeed, exposure of cells to oxidants or UVC stimulated binding of Fos and Jun to the GADD153 AP-1 element. Together, these results demonstrate that both free-radical generation and thiol modification can transcriptionally activate GADD153, and that AP-1 is critical to oxidative regulation of this gene. This study further supports a role for the GADD153 gene product in the cellular response to oxidant injury. PMID:8670069

  17. Identification of polycomb and trithorax group responsive elements in the regulatory region of the Drosophila homeotic gene Sex combs reduced

    SciTech Connect

    Gindhart, J.G. Jr.; Kaufman, T.C.

    1995-02-01

    The Drosophilia homeotic gene Sex combs reduced (Scr) is necessary for the establishment and maintenance of the morphological identity of the labial and prothoracic segments. In the early embryo, its expression pattern is established through the activity of several gap and segmentation gene products, as well as other transcription factors. Once established, the Polycomb group (Pc-G) and trithorax group (trx-G) gene products maintain the spatial pattern of Scr expression for the remainder of development. We report the identification of DNA fragments in the Scr regulatory region that may be important for its regulation by Polycomb and trithorax group gene products. When DNA fragments containing these regulatory sequences are subcloned into P-element vectors containing a white minigene, transformants containing these constructs exhibit mosaic patterns of pigmentation in the adult eye, indicating that white minigene expression is repressed in a clonally heritable manner. The size of pigmented and nonpigmented clones in the adult eye suggests that the event determining whether a cell in the eye anlagen will express white occurs at least as early as the first larval instar. The amount of white minigene repression is reduced in some Polycomb group mutants, whereas repression is enhanced in flies mutant for a subset of trithorax group loci. The repressor activity of one fragment, normally located in Scr Intron 2, is increased when it is able to homologously pair, a property consistent with genetic data suggesting that Scr exhibits transvection. Another Scr regulatory fragment, normally located 40 kb upstream of the Scr promoter, silences ectopic expression of an Scr-lacZ fusion gene in the embryo and does so in a Polycomb-dependent manner. We propose that the regulatory sequences located within these DNA fragments may normally mediate the regulation of Scr by proteins encoded by members of Polycomb and trithorax group loci. 98 refs., 6 figs., 4 tabs.

  18. Validation of an interferon stimulatory response element reporter gene assay for quantifying type I interferons.

    PubMed

    McCoski, S R; Xie, M; Hall, E B; Mercadante, P M; Spencer, T E; Lonergan, P; Ealy, A D

    2014-04-01

    The goal of this work was to develop a virus-free, cell-based interferon (IFN) bioassay and determine the utility of this assay on biological samples that contained IFN-τ, the trophoblast-secreted maternal recognition of pregnancy factor in ruminants. Madin-Darby bovine kidney cells were transduced with lentiviral particles that contained a firefly luciferase reporter construct driven by an IFN stimulatory response element (ISRE). Stably transduced cells were selected with the use of puromycin resistance. A linear, dose-responsive response was detected with human IFN-α and ovine IFN-τ. Interferon activity was detected in conditioned media from bovine trophoblast cells and uterine flushes collected from sheep and cattle. Activity also was detected in media collected after individual or small group culture of in vitro-produced bovine blastocysts at day 8 to 10 after fertilization. In summary, this IFN stimulatory response element-reporter assay may be used as an alternative to virus-dependent, cytopathic assays. It contains a similar sensitivity to IFNs and can be completed in a shorter time than cytopathic assays and does not require heightened biosafety conditions after cell transduction. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Distal regulatory element of the STAT1 gene potentially mediates positive feedback control of STAT1 expression.

    PubMed

    Yuasa, Katsutoshi; Hijikata, Takao

    2016-01-01

    We previously identified a distal regulatory element located approximately 5.5-kb upstream of the signal transducer and activator of transcription 1 (STAT1) gene, thereafter designating it as 5.5-kb upstream regulatory region (5.5URR). In this study, we investigated the functional roles of 5.5URR in the transcriptional regulation of STAT1 gene. A chromosome conformation capture assay indicated physical interaction of 5.5URR with the STAT1 core promoter. In luciferase reporter assays, 5.5URR-combined STAT1 core promoter exhibited significant increase in reporter activity enhanced by forced STAT1 expression or interferon (IFN) treatment, but STAT1 core promoter alone did not. The 5.5URR contained IFN-stimulated response element and GAS sites, which bound STAT1 complexes in electrophoretic mobility shift assays. Consistently, chromatin immunoprecipitation (ChIP) assays of HEK293 cells with Halo-tagged STAT1 expression indicated the association of Halo-tagged STAT1 with 5.5URR. ChIP assays with IFN treatment demonstrated that IFNs promoted the recruitment of Halo-tagged STAT1 to 5.5URR. Forced STAT1 expression or IFN treatment increased the expression of endogenous STAT1 and other IFN signaling pathway components, such as STAT2, IRF9 and IRF1, besides IFN-responsive genes. Collectively, the results suggest that 5.5URR may provide a regulatory platform for positive feedback control of STAT1 expression possibly to amplify or sustain the intracellular IFN signals.

  20. Prevalence and genetic profiling of tetracycline resistance (Tet-R) genes and transposable element (Tn916) in environmental Enterococcus species.

    PubMed

    Zahid, Sindhu; Bin-Asif, Hassan; Hasan, Khwaja Ali; Rehman, Marium; Ali, Syed Abid

    2017-10-01

    Resistance against antimicrobial agents in enterococci is a global concern that not only challenges infection therapy but also make them reservoir of antibiotic resistance in human and animal alike. This study was conducted to establish tetracycline resistance profiles, prevalence of tet genes and transposable element (Tn916) in enterococcal soil and clinical isolates. Enterococci (n = 1210) from different environmental niche were collected and subjected to molecular identification. In total, 361 isolates showed tetracycline resistance at the breakpoint of 32 μg ml(-1). MICs (32-512 μg ml(-1)) were established by both agar and micro-broth dilution methods. Soil isolates (n = 76) were further investigated for Tet genes (tet-A, C, K, L, M, S, O) and Tn916. Major resistance was observed in E. faecium 67% followed by E. faecalis 22%, E. hirae 8% and E. casseliflavus 2.6%. Results revealed that tet(L) was more frequently found in E. faecium 74.5%, while tet(M) was in high prevalence in E. faecalis 82.3%. Tn916 was detected in both clinical and soil isolates (i.e. 43.3% and 19.7%, respectively). RAPD-PCR analysis showed high diversity among the investigated isolates. Cumulatively, our results revealed high-level tetracycline resistance and the presence of multiple Tet genes and transposable element Tn916 in enterococci. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. OptSSeq: High-throughput sequencing readout of growth enrichment defines optimal gene expression elements for homoethanologenesis

    DOE PAGES

    Ghosh, Indro Neil; Landick, Robert

    2016-07-16

    The optimization of synthetic pathways is a central challenge in metabolic engineering. OptSSeq (Optimization by Selection and Sequencing) is one approach to this challenge. OptSSeq couples selection of optimal enzyme expression levels linked to cell growth rate with high-throughput sequencing to track enrichment of gene expression elements (promoters and ribosomebinding sites) from a combinatorial library. OptSSeq yields information on both optimal and suboptimal enzyme levels, and helps identify constraints that limit maximal product formation. Here we report a proof-of-concept implementation of OptSSeq using homoethanologenesis, a two-step pathway consisting of pyruvate decarboxylase (Pdc) and alcohol dehydrogenase (Adh) that converts pyruvate tomore » ethanol and is naturally optimized in the bacterium Zymomonas mobilis. We used OptSSeq to determine optimal gene expression elements and enzyme levels for Z. mobilis Pdc, AdhA, and AdhB expressed in Escherichia coli. By varying both expression signals and gene order, we identified an optimal solution using only Pdc and AdhB. We resolved current uncertainty about the functions of the Fe2+-dependent AdhB and Zn2+- dependent AdhA by showing that AdhB is preferred over AdhA for rapid growth in both E. coli and Z. mobilis. Finally, by comparing predictions of growth-linked metabolic flux to enzyme synthesis costs, we established that optimal E. coli homoethanologenesis was achieved by our best pdc-adhB expression cassette and that the remaining constraints lie in the E. coli metabolic network or inefficient Pdc or AdhB function in E. coli. Furthermore, OptSSeq is a general tool for synthetic biology to tune enzyme levels in any pathway whose optimal function can be linked to cell growth or survival.« less

  2. Latheo, a New Gene Involved in Associative Learning and Memory in Drosophila Melanogaster, Identified from P Element Mutagenesis

    PubMed Central

    Boynton, S.; Tully, T.

    1992-01-01

    Genetic dissection of learning and memory in Drosophila has been limited by the existence of ethyl methanesulfonate (EMS)-induced mutations in only a small number of X-linked genes. To remedy this shortcoming, we have begun a P element mutagenesis to screen for autosomal mutations that disrupt associative learning and/or memory. The generation of ``P-tagged'' mutant alleles will expedite molecular cloning of these new genes. Here, we describe a behavior-genetic characterization of latheo(P1), a recessive, hypomorphic mutation of an essential gene. latheo(P1) flies perform poorly in olfactory avoidance conditioning experiments. This performance deficit could not be attributed to abnormal olfactory acuity or shock reactivity-two task-relevant ``peripheral'' behaviors which are used during classical conditioning. Thus, the latheo(P1) mutation appears to affect learning/memory specifically. Consistent with chromosomal in situ localization of the P element insertion, deficiencies of the 49F region of the second chromosome failed to complement the behavioral effect of the latheo(P1) mutation. Further complementation analyses between latheo(P1) and lethal alleles, produced by excision of the latheo(P1) insert or by EMS or γ-rays, in the 49F region mapped the latheo mutation to one vital complementation group. Flies heterozygous for latheo(P1) and one of two EMS lethal alleles or one lethal excision allele also show the behavioral deficits, thereby demonstrating that the behavioral and lethal phenotypes co-map to the same locus. PMID:1321066

  3. A new regulatory element mediates ethanol repression of KlADH3, a Kluyveromyces lactis gene coding for a mitochondrial alcohol dehydrogenase.

    PubMed

    Saliola, Michele; Getuli, Claudia; Mazzoni, Cristina; Fantozzi, Ivana; Falcone, Claudio

    2007-08-01

    KlADH3 is a Kluyveromyces lactis alcohol dehydrogenase gene induced in the presence of all respiratory carbon sources except ethanol, which specifically represses this gene. Deletion analysis of the KlADH3 promoter revealed the presence of both positive and negative elements. However, by site-directed mutagenesis and gel retardation experiments, we identified a 15-bp element responsible for the transcriptional repression of this gene by ethanol. In particular, this element showed putative sites required for the sequential binding of ethanol-induced factors responsible for the repressed conditions, and the binding of additional factors relieved repression. In addition, we showed that the ethanol element was required for in vivo repression of KlAdh3 activity.

  4. Variation of B1 gene and AF146527 repeat element copy numbers according to Toxoplasma gondii strains assessed using real-time quantitative PCR.

    PubMed

    Costa, Jean-Marc; Bretagne, Stéphane

    2012-04-01

    Using the multicopy B1 gene and AF146527 element for the amplification of Toxoplasma gondii DNA raises the issue of reliable quantification for clinical diagnosis. We applied relative quantification to reference strains using the single-copy P30 gene as a reference. According to the parasite type, the copy numbers for the B1 gene and AF146527 element were found to be 5 to 12 and 4 to 8 times lower than the previous estimations of 35 and 230 copies, respectively.

  5. Targeted Deletion of the Antisilencer/Enhancer (ASE) Element from Intron 1 of the Myelin Proteolipid Protein Gene (Plp1) in Mouse Reveals that the Element Is Dispensable for Plp1 Expression in Brain during Development and Remyelination

    PubMed Central

    Pereira, Glauber B.; Meng, Fanxue; Kockara, Neriman T.; Yang, Baoli; Wight, Patricia A.

    2012-01-01

    Myelin proteolipid protein gene (Plp1) expression is temporally regulated in brain, which peaks during the active myelination period of CNS development. Previous studies with Plp1-lacZ transgenic mice demonstrated that (mouse) Plp1 intron 1 DNA is required for high levels of expression in oligodendrocytes. Deletion-transfection analysis revealed the intron contains a single positive regulatory element operative in the N20.1 oligodendroglial cell line, which was named ASE (antisilencer/enhancer) based on its functional properties in these cells. To investigate the role of the ASE in vivo, the element was deleted from the native gene in mouse using a Cre/lox strategy. While removal of the ASE from Plp1-lacZ constructs profoundly decreased expression in transfected oligodendroglial cell lines (N20.1 and Oli-neu), the element was dispensable to achieve normal levels of Plp1 gene expression in mouse during development (except perhaps at postnatal day 15) and throughout the remyelination period following cuprizone-induced (acute) demyelination. Thus, it is possible that the ASE is nonfunctional in vivo, or that loss of the ASE from the native gene in mouse can be compensated for by the presence of other regulatory elements within the Plp1 gene. PMID:23157328

  6. Replicase, excisionase, and integrase genes of the Streptomyces element pSAM2 constitute an operon positively regulated by the pra gene.

    PubMed

    Sezonov, G; Duchêne, A M; Friedmann, A; Guérineau, M; Pernodet, J L

    1998-06-01

    pSAM2 is a site-specific integrative element from Streptomyces ambofaciens. The pra gene described earlier as an activator of pSAM2 replication is shown here to be also involved in the activation of its integration and excision. This was evidenced with derivatives of pSAM2 mutant B3 in which the pra gene was placed under the control of the inducible tipAp promoter. Transformation of Streptomyces lividans by these derivatives was efficient only when pra expression was induced, indicating its involvement in pSAM2 integration activation. Once established, these constructions remained integrated in the chromosome under noninduced conditions. Activation of the pra expression provoked strong activation of their excision, leading to the appearance of free forms. The results of functional, transcriptional, and sequence analyses allowed to conclude that the three genes repSA, xis, and int coding for the pSAM2 replicase, excisionase, and integrase, respectively, constitute an operon directly or indirectly activated by pra.

  7. Replicase, Excisionase, and Integrase Genes of the Streptomyces Element pSAM2 Constitute an Operon Positively Regulated by the pra Gene

    PubMed Central

    Sezonov, Guennadi; Duchêne, Anne-Marie; Friedmann, Annick; Guérineau, Michel; Pernodet, Jean-Luc

    1998-01-01

    pSAM2 is a site-specific integrative element from Streptomyces ambofaciens. The pra gene described earlier as an activator of pSAM2 replication is shown here to be also involved in the activation of its integration and excision. This was evidenced with derivatives of pSAM2 mutant B3 in which the pra gene was placed under the control of the inducible tipAp promoter. Transformation of Streptomyces lividans by these derivatives was efficient only when pra expression was induced, indicating its involvement in pSAM2 integration activation. Once established, these constructions remained integrated in the chromosome under noninduced conditions. Activation of the pra expression provoked strong activation of their excision, leading to the appearance of free forms. The results of functional, transcriptional, and sequence analyses allowed to conclude that the three genes repSA, xis, and int coding for the pSAM2 replicase, excisionase, and integrase, respectively, constitute an operon directly or indirectly activated by pra. PMID:9620953

  8. A gene-type-specific enhancer regulates the carbamyl phosphate synthetase I promoter by cooperating with the proximal GAG activating element.

    PubMed Central

    Goping, I S; Lamontagne, S; Shore, G C; Nguyen, M

    1995-01-01

    The rat carbamyl phosphate synthetase I gene is expressed in two cell types: hepatocytes and epithelial cells of the intestinal mucosa. The proximal promoter contains a single activating element, GAG, two repressor elements (sites I and III) and an anti-repressor element (site II). Although these elements together exhibit the potential for complex regulation, they are unable to confer tissue-specific promoter activity. Here we have identified a cell-type-specific enhancer that lies 10 kilobases upstream of the promoter. Unexpectedly, the enhancer also functioned in a gene-type-specific manner. The enhancer stimulated promoter activity exclusively through the proximal GAG element. Abrogation of GAG, either directly by mutation of GAG or indirectly by sites I and III repressors, abolished enhancer activation. Conversely, activation of the heterologous thymidine kinase promoter by the enhancer required the introduction of GAG. The requirement for GAG, therefore, functions to constrain the enhancer to a specific target promoter. PMID:7784176

  9. Lactogenic hormonal induction of long distance interactions between beta-casein gene regulatory elements.

    PubMed

    Kabotyanski, Elena B; Rijnkels, Monique; Freeman-Zadrowski, Courtneay; Buser, Adam C; Edwards, Dean P; Rosen, Jeffrey M

    2009-08-21

    Lactogenic hormone regulation of beta-casein gene expression in mammary epithelial cells provides an excellent model in which to study the mechanisms by which steroid and peptide hormone signaling control gene expression. Prolactin- and glucocorticoid-mediated induction of beta-casein gene expression involves two principal regulatory regions, a proximal promoter and a distal enhancer located in the mouse approximately -6 kb upstream of the transcription start site. Using a chromosome conformation capture assay and quantitative real time PCR, we demonstrate that a chromatin loop is created in conjunction with the recruitment of specific transcription factors and p300 in HC11 mammary epithelial cells. Stimulation with both prolactin and hydrocortisone is required for the induction of these long range interactions between the promoter and enhancer, and no DNA looping was observed in nontreated cells or cells treated with each of the hormones separately. The lactogenic hormone-induced interaction between the proximal promoter and distal enhancer was confirmed in hormone-treated primary three-dimensional mammary acini cultures. In addition, the developmental regulation of DNA looping between the beta-casein regulatory regions was observed in lactating but not in virgin mouse mammary glands. Furthermore, beta-casein mRNA induction and long range interactions between these regulatory regions were inhibited in a progestin-dependent manner following stimulation with prolactin and hydrocortisone in HC11 cells expressing human PR-B. Collectively, these data suggest that the communication between these regulatory regions with intervening DNA looping is a crucial step required to both create and maintain active chromatin domains and regulate transcription.

  10. Characterization of cis-acting elements required for autorepression of the equine herpesvirus 1 IE gene

    PubMed Central

    Kim, Seongman; Dai, Gan; O’Callaghan, Dennis J.; Kim, Seong Kee

    2012-01-01

    The immediate-early protein (IEP), the major regulatory protein encoded by the IE gene of equine herpesvirus 1 (EHV-1), plays a crucial role as both transcription activator and repressor during a productive lytic infection. To investigate the mechanism by which the EHV-1 IEP inhibits its own promoter, IE promoter-luciferase reporter plasmids containing wild-type and mutant IEP-binding site (IEBS) were constructed and used for luciferase reporter assays. The IEP inhibited transcription from its own promoter in the presence of a consensus IEBS (5’-ATCGT-3’) located near the transcription initiation site but did not inhibit when the consensus sequence was deleted. To determine whether the distance between the TATA box and the IEBS affects transcriptional repression, the IEBS was displaced from the original site by the insertion of synthetic DNA sequences. Luciferase reporter assays revealed that the IEP is able to repress its own promoter when the IEBS is located within 26-bp from the TATA box. We also found that the proper orientation and position of the IEBS were required for the repression by the IEP. Interestingly, the level of repression was significantly reduced when a consensus TATA sequence was deleted from the promoter region, indicating that the IEP efficiently inhibits its own promoter in a TATA box-dependent manner. Taken together, these results suggest that the EHV-1 IEP delicately modulates autoregulation of its gene through the consensus IEBS that is near the transcription initiation site and the TATA box. PMID:22265772

  11. Lead Exposure during Early Human Development and DNA Methylation of Imprinted Gene Regulatory Elements in Adulthood

    SciTech Connect

    Li, Yue; Xie, Changchun; Murphy, Susan K.; Skaar, David; Nye, Monica; Vidal, Adriana C.; Cecil, Kim M.; Dietrich, Kim N.; Puga, Alvaro; Jirtle, Randy L.; Hoyo, Cathrine

    2015-06-26

    Here, lead exposure during early development causes neurodevelopmental disorders by unknown mechanisms. Epidemiologic studies have focused recently on determining associations between lead exposure and global DNA methylation; however, such approaches preclude the identification of loci that may alter human disease risk. The objective of this study was to determine whether maternal, postnatal, and early childhood lead exposure can alter the differentially methylated regions (DMRs) that control the monoallelic expression of imprinted genes involved in metabolism, growth, and development. Questionnaire data and serial blood lead levels were obtained from 105 participants (64 females, 41 males) of the Cincinnati Lead Study from birth to 78 months. When participants were adults, we used Sequenom EpiTYPER assays to test peripheral blood DNA to quantify CpG methylation in peripheral blood leukocytes at DMRs of 22 human imprinted genes. Statistical analyses were conducted using linear regression. Mean blood lead concentration from birth to 78 months was associated with a significant decrease in PEG3 DMR methylation (β = –0.0014; 95% CI: –0.0023, –0.0005, p = 0.002), stronger in males (β = –0.0024; 95% CI: –0.0038, –0.0009, p = 0.003) than in females (β = –0.0009; 95% CI: –0.0020, 0.0003, p = 0.1). Elevated mean childhood blood lead concentration was also associated with a significant decrease in IGF2/H19 (β = –0.0013; 95% CI: –0.0023, –0.0003, p = 0.01) DMR methylation, but primarily in females, (β = –0.0017; 95% CI: –0.0029, –0.0006, p = 0.005) rather than in males, (β = –0.0004; 95% CI: –0.0023, 0.0015, p = 0.7). Elevated blood lead concentration during the neonatal period was associated with higher PLAGL1/HYMAI DMR methylation regardless of sex (β = 0.0075; 95% CI: 0.0018, 0.0132, p = 0.01). The magnitude of associations between cumulative lead exposure and CpG methylation remained unaltered from 30 to 78 months. Our findings

  12. Lead Exposure during Early Human Development and DNA Methylation of Imprinted Gene Regulatory Elements in Adulthood

    DOE PAGES

    Li, Yue; Xie, Changchun; Murphy, Susan K.; ...

    2015-06-26

    Here, lead exposure during early development causes neurodevelopmental disorders by unknown mechanisms. Epidemiologic studies have focused recently on determining associations between lead exposure and global DNA methylation; however, such approaches preclude the identification of loci that may alter human disease risk. The objective of this study was to determine whether maternal, postnatal, and early childhood lead exposure can alter the differentially methylated regions (DMRs) that control the monoallelic expression of imprinted genes involved in metabolism, growth, and development. Questionnaire data and serial blood lead levels were obtained from 105 participants (64 females, 41 males) of the Cincinnati Lead Study frommore » birth to 78 months. When participants were adults, we used Sequenom EpiTYPER assays to test peripheral blood DNA to quantify CpG methylation in peripheral blood leukocytes at DMRs of 22 human imprinted genes. Statistical analyses were conducted using linear regression. Mean blood lead concentration from birth to 78 months was associated with a significant decrease in PEG3 DMR methylation (β = –0.0014; 95% CI: –0.0023, –0.0005, p = 0.002), stronger in males (β = –0.0024; 95% CI: –0.0038, –0.0009, p = 0.003) than in females (β = –0.0009; 95% CI: –0.0020, 0.0003, p = 0.1). Elevated mean childhood blood lead concentration was also associated with a significant decrease in IGF2/H19 (β = –0.0013; 95% CI: –0.0023, –0.0003, p = 0.01) DMR methylation, but primarily in females, (β = –0.0017; 95% CI: –0.0029, –0.0006, p = 0.005) rather than in males, (β = –0.0004; 95% CI: –0.0023, 0.0015, p = 0.7). Elevated blood lead concentration during the neonatal period was associated with higher PLAGL1/HYMAI DMR methylation regardless of sex (β = 0.0075; 95% CI: 0.0018, 0.0132, p = 0.01). The magnitude of associations between cumulative lead exposure and CpG methylation remained unaltered from 30 to 78 months. Our

  13. c-Myc activates BRCA1 gene expression through distal promoter elements in breast cancer cells

    PubMed Central

    2011-01-01

    Background The BRCA1 gene plays an important role in the maintenance of genomic stability. BRCA1 inactivation contributes to breast cancer tumorigenesis. An increasing number of transcription factors have been shown to regulate BRCA1 expression. c-Myc can act as a transcriptional activator, regulating up to 15% of all genes in the human genome and results from a high throughput screen suggest that BRCA1 is one of its targets. In this report, we used cultured breast cancer cells to examine the mechanisms of transcriptional activation of BRCA1 by c-Myc. Methods c-Myc was depleted using c-Myc-specific siRNAs in cultured breast cancer cells. BRCA1 mRNA expression and BRCA1 protein expression were determined by quantitative RT-PCR and western blot, respectively and BRCA1 promoter activities were examined under these conditions. DNA sequence analysis was conducted to search for high similarity to E boxes in the BRCA1 promoter region. The association of c-Myc with the BRCA1 promoter in vivo was tested by a chromatin immunoprecipitation assay. We investigated the function of the c-Myc binding site in the BRCA1 promoter region by a promoter assay with nucleotide substitutions in the putative E boxes. BRCA1-dependent DNA repair activities were measured by a GFP-reporter assay. Results Depletion of c-Myc was found to be correlated with reduced expression levels of BRCA1 mRNA and BRCA1 protein. Depletion of c-Myc decreased BRCA1 promoter activity, while ectopically expressed c-Myc increased BRCA1 promoter activity. In the distal BRCA1 promoter, DNA sequence analysis revealed two tandem clusters with high similarity, and each cluster contained a possible c-Myc binding site. c-Myc bound to these regions in vivo. Nucleotide substitutions in the c-Myc binding sites in these regions abrogated c-Myc-dependent promoter activation. Furthermore, breast cancer cells with reduced BRCA1 expression due to depletion of c-Myc exhibited impaired DNA repair activity. Conclusions The distal

  14. Myocyte-specific M-CAT and MEF-1 elements regulate G-protein gamma 3 gene (gamma3) expression in cardiac myocytes.

    PubMed

    McWhinney, Charlene; Robishaw, Janet D

    2008-07-01

    Little is known regarding the mechanisms that control the expression of G-protein alpha, beta, and gamma subtypes. We have previously shown that the G-protein gamma(3) gene is expressed in the heart, brain, lung, spleen, kidney, muscle, and testis in mice. We have also reported that the G-protein gamma(3) subunit is expressed in rat cardiac myocytes, but not in cardiac fibroblasts. Other studies have shown that the gamma(3) subunit couples to the angiotensin A1A receptor in portal vein myocytes, and has been shown to mediate beta-adrenergic desensitization in cardiac myocytes treated with atorvastatin. In the present study, we evaluated G-protein gamma(3) promoter-luciferase reporter constructs in primary myocytes to identify key regulatory promoter regions. We identified two important regions of the promoter (upstream promoter region [UPR] and downstream promoter region [DPR]), which are required for expression in cardiac myocytes. We observed that removal of 48 bp in the UPR diminished gene transcription by 75%, and that the UPR contains consensus elements for myocyte-specific M-CAT and myocyte enhancer factor 1 (MEF-1) elements. The UPR and DPR share transcription factor elements for myocyte-specific M-CAT element. We observed that cardiac myocyte proteins bind to gamma(3) oligonucleotides containing transcription factor elements for myocyte-specific M-CAT and MEF-1. Myocyte-specific M-CAT proteins were supershifted with transcriptional enhancer factor-1 (TEF-1) antibodies binding to the gamma(3) M-CAT element, which is in agreement with reports showing that the M-CAT element binds the TEF-1 family of transcription factors. The 150 bp DPR contains three M-CAT elements, an INR element, an upstream stimulatory factor 1 element, and the transcription start site. We have shown that myocyte gamma(3) gene expression is regulated by myocyte-specific M-CAT and MEF-1 elements.

  15. Genome-wide identification of regulatory elements and reconstruction of gene regulatory networks of the green alga Chlamydomonas reinhardtii under carbon deprivation.

    PubMed

    Winck, Flavia Vischi; Vischi Winck, Flavia; Arvidsson, Samuel; Riaño-Pachón, Diego Mauricio; Hempel, Sabrina; Koseska, Aneta; Nikoloski, Zoran; Urbina Gomez, David Alejandro; Rupprecht, Jens; Mueller-Roeber, Bernd

    2013-01-01

    The unicellular green alga Chlamydomonas reinhardtii is a long-established model organism for studies on photosynthesis and carbon metabolism-related physiology. Under conditions of air-level carbon dioxide concentration [CO2], a carbon concentrating mechanism (CCM) is induced to facilitate cellular carbon uptake. CCM increases the availability of carbon dioxide at the site of cellular carbon fixation. To improve our understanding of the transcriptional control of the CCM, we employed FAIRE-seq (formaldehyde-assisted Isolation of Regulatory Elements, followed by deep sequencing) to determine nucleosome-depleted chromatin regions of algal cells subjected to carbon deprivation. Our FAIRE data recapitulated the positions of known regulatory elements in the promoter of the periplasmic carbonic anhydrase (Cah1) gene, which is upregulated during CCM induction, and revealed new candidate regulatory elements at a genome-wide scale. In addition, time series expression patterns of 130 transcription factor (TF) and transcription regulator (TR) genes were obtained for cells cultured under photoautotrophic condition and subjected to a shift from high to low [CO2]. Groups of co-expressed genes were identified and a putative directed gene-regulatory network underlying the CCM was reconstructed from the gene expression data using the recently developed IOTA (inner composition alignment) method. Among the candidate regulatory genes, two members of the MYB-related TF family, Lcr1 (Low-CO 2 response regulator 1) and Lcr2 (Low-CO2 response regulator 2), may play an important role in down-regulating the expression of a particular set of TF and TR genes in response to low [CO2]. The results obtained provide new insights into the transcriptional control of the CCM and revealed more than 60 new candidate regulatory genes. Deep sequencing of nucleosome-depleted genomic regions indicated the presence of new, previously unknown regulatory elements in the C. reinhardtii genome. Our work can

  16. Marsupial anti-Mullerian hormone gene structure, regulatory elements, and expression.

    PubMed

    Pask, Andrew J; Whitworth, Deanne J; Mao, Chai-An; Wei, Ke-Jun; Sankovic, Natasha; Graves, Jennifer A M; Shaw, Geoffrey; Renfree, Marilyn B; Behringer, Richard R

    2004-01-01

    During male sexual development in reptiles, birds, and mammals, anti-Müllerian hormone (AMH) induces the regression of the Müllerian ducts that normally form the primordia of the female reproductive tract. Whereas Müllerian duct regression occurs during fetal development in eutherian mammals, in marsupial mammals this process occurs after birth. To investigate AMH in a marsupial, we isolated an orthologue from the tammar wallaby (Macropus eugenii) and characterized its expression in the testes and ovaries during development. The wallaby AMH gene is highly conserved with the eutherian orthologues that have been studied, particularly within the encoded C-terminal mature domain. The N-terminus of marsupial AMH is divergent and larger than that of eutherian species. It is located on chromosome 3/4, consistent with its autosomal localization in other species. The wallaby 5' regulatory region, like eutherian AMH genes, contains binding sites for SF1, SOX9, and GATA factors but also contains a putative SRY-binding site. AMH expression in the developing testis begins at the time of seminiferous cord formation at 2 days post partum, and Müllerian duct regression begins shortly afterward. In the developing testis, AMH is localized in the cytoplasm of the Sertoli cells but is lost by adulthood. In the developing ovary, there is no detectable AMH expression, but in adults it is produced by the granulosa cells of primary and secondary follicles. It is not detectable in atretic follicles. Collectively, these studies suggest that AMH expression has been conserved during mammalian evolution and is intimately linked to upstream sex determination mechanisms.

  17. Characterization of cis-acting elements required for autorepression of the equine herpesvirus 1 IE gene.

    PubMed

    Kim, Seongman; Dai, Gan; O'Callaghan, Dennis J; Kim, Seong Kee

    2012-04-01

    The immediate-early protein (IEP), the major regulatory protein encoded by the IE gene of equine herpesvirus 1 (EHV-1), plays a crucial role as both transcription activator and repressor during a productive lytic infection. To investigate the mechanism by which the EHV-1 IEP inhibits its own promoter, IE promoter-luciferase reporter plasmids containing wild-type and mutant IEP-binding site (IEBS) were constructed and used for luciferase reporter assays. The IEP inhibited transcription from its own promoter in the presence of a consensus IEBS (5'-ATCGT-3') located near the transcription initiation site but did not inhibit when the consensus sequence was deleted. To determine whether the distance between the TATA box and the IEBS affects transcriptional repression, the IEBS was displaced from the original site by the insertion of synthetic DNA sequences. Luciferase reporter assays revealed that the IEP is able to repress its own promoter when the IEBS is located within 26-bp from the TATA box. We also found that the proper orientation and position of the IEBS were required for the repression by the IEP. Interestingly, the level of repression was significantly reduced when a consensus TATA sequence was deleted from the promoter region, indicating that the IEP efficiently inhibits its own promoter in a TATA box-dependent manner. Taken together, these results suggest that the EHV-1 IEP delicately modulates autoregulation of its gene through the consensus IEBS that is near the transcription initiation site and the TATA box. Copyright © 2012. Published by Elsevier B.V.

  18. Identification of fungus-responsive cis-acting element in the promoter of Brassica juncea chitinase gene, BjCHI1.

    PubMed

    Gao, Ying; Zan, Xin-Li; Wu, Xue-Feng; Yao, Lei; Chen, Yu-Ling; Jia, Shuang-Wei; Zhao, Kai-Jun

    2014-02-01

    Chitinases are a group of pathogenesis-related proteins. The Brassica juncea chitinase gene BjCHI1 is highly inducible by pathogenic fungal infection, suggesting that the promoter of BjCHI1 might contain specific cis-acting element responsive to fungal attack. To identify the fungus-responsive element in BjCHI1 promoter (BjC-P), a series of binary plant transformation vectors were constructed by fusing the BjC-P or its deletion-derivatives to β-glucuronidase (GUS) reporter gene. Expression of the GUS reporter gene was systematically assayed by a transient gene expression system in Nicotiana benthamiana leaves treated with fungal elicitor Hexa-N-Acetyl-Chitohexaose, as well as in transgenic Arabidopsis plants inoculated with fungus Botrytis cinerea. The histochemical and quantitative GUS assays showed that the W-box-like element (GTAGTGACTCAT) in the region (-668 to -657) was necessary for the fungus-response, although there were another five W-box-like elements in BjC-P. In addition, gain-of-function analysis demonstrated that the fragment (-409 to -337) coupled to the W-box-like element was needed for full magnitude of the fungal induction. These results revealed the existence of a novel regulation mechanism of W-box-like element involved in plant pathogenic resistance, and will benefit the potential application of BjC-P in engineering crops.

  19. Evolutionary origin of Rosaceae-specific active non-autonomous hAT elements and their contribution to gene regulation and genomic structural variation.

    PubMed

    Wang, Lu; Peng, Qian; Zhao, Jianbo; Ren, Fei; Zhou, Hui; Wang, Wei; Liao, Liao; Owiti, Albert; Jiang, Quan; Han, Yuepeng

    2016-05-01

    Transposable elements account for approximately 30 % of the Prunus genome; however, their evolutionary origin and functionality remain largely unclear. In this study, we identified a hAT transposon family, termed Moshan, in Prunus. The Moshan elements consist of three types, aMoshan, tMoshan, and mMoshan. The aMoshan and tMoshan types contain intact or truncated transposase genes, respectively, while the mMoshan type is miniature inverted-repeat transposable element (MITE). The Moshan transposons are unique to Rosaceae, and the copy numbers of different Moshan types are significantly correlated. Sequence homology analysis reveals that the mMoshan MITEs are direct deletion derivatives of the tMoshan progenitors, and one kind of mMoshan containing a MuDR-derived fragment were amplified predominately in the peach genome. The mMoshan sequences contain cis-regulatory elements that can enhance gene expression up to 100-fold. The mMoshan MITEs can serve as potential sources of micro and long noncoding RNAs. Whole-genome re-sequencing analysis indicates that mMoshan elements are highly active, and an insertion into S-haplotype-specific F-box gene was reported to cause the breakdown of self-incompatibility in sour cherry. Taken together, all these results suggest that the mMoshan elements play important roles in regulating gene expression and driving genomic structural variation in Prunus.

  20. Aldosterone-induced osteopontin gene transcription in vascular smooth muscle cells involves glucocorticoid response element.

    PubMed

    Kiyosue, Arihiro; Nagata, Daisuke; Myojo, Masahiro; Sato, Tomohiko; Takahashi, Masao; Satonaka, Hiroshi; Nagai, Ryozo; Hirata, Yasunobu

    2011-12-01

    Osteopontin (OPN) is known to be one of the cytokines that is involved in the vascular inflammation caused by aldosterone (Aldo). Previous reports have shown that Aldo increases OPN transcripts, and the mechanisms for this remain to be clarified. In this study, we investigated how Aldo increases OPN transcripts in the vascular smooth muscle cells of rats. Aldosterone increased OPN transcripts time-dependently as well as dose-dependently. This increase was diminished by eplerenone, a mineralocorticoid receptor (MR) antagonist. Luciferase promoter assays showed that the OPN promoter deleted to the -1599 site retained the same promoting ability as the full-length OPN promoter when stimulated by 10(-7) M Aldo, but the promoter deleted to the -1300 site lost the promoting ability. A glucocorticoid response element (GRE) is located in that deleted region. Luciferase assays of a mutated promoter without the GRE lost the luciferase upregulation, although mutated promoters with the deletion of other consensus sites maintained the promoter activity. The binding of the Aldo-MR complex to the GRE fragment was confirmed by an electrophoretic-mobility shift assay. This is the first report showing that Aldo regulates the transcriptional levels of OPN and inflammatory responses in the vasculature through a specific GRE site in the OPN promoter region.

  1. Transposable element insertion location bias and the dynamics of gene drive in mosquito populations.

    PubMed

    Rasgon, J L; Gould, F

    2005-10-01

    Some vector-borne disease control strategies using transgenic mosquitoes require transgene spread to high frequency in populations. Transposable elements (TEs) are DNA sequences that replicate and transpose within the genomes of other organisms and may therefore be represented in the next generation in higher frequencies than predicted by Mendelian segregation. This over-representation has allowed some TEs to spread through natural populations. Transgenes incorporated within a TE sequence are expected to be driven into populations as long as there is a positive balance between fitness costs and over-representation. Models have been used to examine parameters that affect this balance but did not take into account biased insertion of TEs to linked sites in the genome. A simulation model was created to examine the impact of insertion bias on TE spread in mosquito populations. TEs that induce no fitness costs are predicted to increase in frequency over a wide range of parameter values but spread is slower for lower levels of transposition and non-local movement. If TEs are costly, high proportions of local movement can slow or halt spread. To function as a robust transgene drive mechanism a TE should replicate and transpose > 10%/insert/generation, induce < 1% fitness cost/insert, and move preferentially to unlinked sites in the genome.

  2. Cell-specific activity of cis-acting regulatory elements in the promoter of the mouse multidrug resistance gene mdr1.

    PubMed

    Raymond, M; Gros, P

    1990-11-01

    To define cis-acting elements implicated in transcriptional regulation of the mouse multidrug resistance gene mdr1, we have cloned and characterized the 5' end of the gene. Nucleotide sequence analysis identified TATA, GGGCGG, and CCAAT consensus sequence elements at positions -27, -47, and -83, respectively. The transcriptional activities of 5' deletion fragments from the promoter linked to a reporter gene were tested in mouse cell lines of different tissue origins shown to express different levels of endogenous mdr1 RNA. Sequences located between nucleotides -93 and +84 were able to confer basal promoter activity and cell specificity to the reporter gene. The addition to the basal promoter of sequences upstream of position -141 was found to up or down regulate the basal level of expression of the reporter gene in a cell-specific manner.

  3. Genetic polymorphisms in the promoter region of catalase gene, creates new potential PAX-6 and STAT4 response elements.

    PubMed

    Saify, Khyber

    2016-06-01

    Catalase (CAT, OMIM: 115500) is an endogenous antioxidant enzyme and genetic variations in the regulatory regions of the CAT gene may alter the CAT enzyme activity and subsequently may alter the risk of oxidative stress related disease. In this study, potential influence(s) of the A-21T (rs7943316) and C-262T (rs1001179) genetic polymorphisms in the CAT promoter region, using the ALGGEN-PROMO.v8.3 online software were analyzed. Our findings show that the A allele at the -21 position creates a new potential binding site for PAX-6 and the T allele at the -262 position changes the TFII-I binding site into STAT4 response element. The PAX-6 and STAT4 are the multifunctional and enhancing transcription factors.