Science.gov

Sample records for element dre-associated genes

  1. Activation of dioxin response element (DRE)-associated genes by benzo(a)pyrene 3,6-quinone and benzo(a)pyrene 1,6-quinone in MCF-10A human mammary epithelial cells

    SciTech Connect

    Burchiel, Scott W. . E-mail: SBurchiel@salud.unm.edu; Thompson, Todd A.; Lauer, Fredine T.; Oprea, Tudor I.

    2007-06-01

    Benzo(a)pyrene (BaP) is a known human carcinogen and a suspected breast cancer complete carcinogen. BaP is metabolized by several metabolic pathways, some having bioactivation and others detoxification properties. BaP-quinones (BPQs) are formed via cytochrome P450 and peroxidase dependent pathways. Previous studies by our laboratory have shown that BPQs have significant growth promoting and anti-apoptotic activities in human MCF-10A mammary epithelial cells examined in vitro. Previous results suggest that BPQs act via redox-cycling and oxidative stress. However, because two specific BPQs (1,6-BPQ and 3,6-BPQ) differed in their ability to produce reactive oxygen species (ROS) and yet both had strong proliferative and EGF receptor activating activity, we utilized mRNA expression arrays and qRT-PCR to determine potential pathways and mechanisms of gene activation. The results of the present studies demonstrated that 1,6-BPQ and 3,6-BPQ activate dioxin response elements (DRE, also known as xenobiotic response elements, XRE) and anti-oxidant response elements (ARE, also known as electrophile response elements, EpRE). 3,6-BPQ had greater DRE activity than 1,6-BPQ, whereas the opposite was true for the activation of ARE. Both 3,6-BPQ and 1,6-BPQ induced oxidative stress-associated genes (HMOX1, GCLC, GCLM, and SLC7A11), phase 2 enzyme genes (NQO1, NQO2, ALDH3A1), PAH metabolizing genes (CYP1B1, EPHX1, AKR1C1), and certain EGF receptor-associated genes (EGFR, IER3, ING1, SQSTM1 and TRIM16). The results of these studies demonstrate that BPQs activate numerous pathways in human mammary epithelial cells associated with increased cell growth and survival that may play important roles in tumor promotion.

  2. ACTIVATION OF DIOXIN RESPONSE ELEMENT (DRE)-ASSOCIATED GENES BY BENZO(A)PYRENE 3,6-QUINONE AND BENZO(A)PYRENE 1,6-QUINONE IN MCF-10A HUMAN MAMMARY EPITHELIAL CELLS

    PubMed Central

    Burchiel, Scott W.; Thompson, Todd A.; Lauer, Fredine T.; Oprea, Tudor I.

    2007-01-01

    Benzo(a)pyrene (BaP) is a known human carcinogen and a suspected breast cancer complete carcinogen. BaP is metabolized by several metabolic pathways, some having bioactivation and others detoxification properties. BaP-quinones (BPQs) are formed via cytochrome P450 and peroxidase dependent pathways. Previous studies by our laboratory have shown that BPQs have significant growth promoting and anti-apoptotic activities in human MCF-10A mammary epithelial cells examined in vitro. Previous results suggest that BPQs act via redox-cycling and oxidative stress. However, because two specific BPQs (1,6-BPQ and 3,6-BPQ) differed in their ability to produce reactive oxygen species (ROS) and yet both had strong proliferative and EGF receptor activating activity, we utilized mRNA expression arrays and qRT-PCR to determine potential pathways and mechanisms of gene activation. The results of the present studies demonstrated that 1,6-BPQ and 3,6-BPQ activate dioxin response elements (DRE, also known as xenobiotic response elements, XRE) and anti-oxidant response elements (ARE, also known and electrophile response elements, EpRE). 3,6-BPQ had greater DRE activity than 1,6-BPQ, whereas the opposite was true for the activation of ARE. Both 3,6-BPQ and 1,6-BPQ induced oxidative stress associated genes (HMOX1, GCLC, GCLM, and SLC7A11), phase 2 enzyme genes (NQO1, NQO2, ALDH3A1) PAH metabolizing genes (CYP1B1, EPHX1, AKR1C1), and certain EGF receptor associated genes (EGFR, IER3, ING1, SQSTM1 and TRIM16). The results of these studies demonstrate that BPQs activate numerous pathways in human mammary epithelial cells associated with increased cell growth and survival that may play important roles in tumor promotion. PMID:17466351

  3. Transposable element origins of epigenetic gene regulation.

    PubMed

    Lisch, Damon; Bennetzen, Jeffrey L

    2011-04-01

    Transposable elements (TEs) are massively abundant and unstable in all plant genomes, but are mostly silent because of epigenetic suppression. Because all known epigenetic pathways act on all TEs, it is likely that the specialized epigenetic regulation of regular host genes (RHGs) was co-opted from this ubiquitous need for the silencing of TEs and viruses. With their internally repetitive and rearranging structures, and the acquisition of fragments of RHGs, the expression of TEs commonly makes antisense RNAs for both TE genes and RHGs. These antisense RNAs, particularly from heterochromatic reservoirs of 'zombie' TEs that are rearranged to form variously internally repetitive structures, may be advantageous because their induction will help rapidly suppress active TEs of the same family. RHG fragments within rapidly rearranging TEs may also provide the raw material for the ongoing generation of miRNA genes. TE gene expression is regulated by both environmental and developmental signals, and insertions can place nearby RHGs under the regulation (both standard and epigenetic) of the TE. The ubiquity of TEs, their frequent preferential association with RHGs, and their ability to be programmed by epigenetic signals all indicate that RGHs have nearly unlimited access to novel regulatory cassettes to assist plant adaptation. PMID:21444239

  4. Transcription factor trapping by RNA in gene regulatory elements.

    PubMed

    Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A

    2015-11-20

    Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs.

  5. Tissue-specific control elements of the Thy-1 gene.

    PubMed Central

    Vidal, M; Morris, R; Grosveld, F; Spanopoulou, E

    1990-01-01

    We have exploited the structural homology, but different patterns of expression of the murine and human Thy-1 genes to map a number of tissue-specific enhancer elements in the genes. All of these are located downstream from the site of transcriptional initiation. The human gene contains separate elements which direct expression to the kidney or spleen epithelium. The murine gene lacks these elements but instead contains a thymocyte specific enhancer in the third intron. Developmentally-regulated expression in nerve cells is directed (at least in part) by an atypical element in the first intron. The latter is active on heterologous promoters, but is position and distance dependent. Images Fig. 2. Fig. 4. Fig. 5. Fig. 6. PMID:1968831

  6. Mobile genetic elements and cancer. From mutations to gene therapy.

    PubMed

    Kozeretska, I A; Demydov, S V; Ostapchenko, L I

    2011-12-01

    In the present review, an association between cancer and the activity of the non-LTR retroelements L1, Alu, and SVA, as well as endogenous retroviruses, in the human genome, is analyzed. Data suggesting that transposons have been involved in embryogenesis and malignization processes, are presented. Events that lead to the activation of mobile elements in mammalian somatic cells, as well as the use of mobile elements in genetic screening and cancer gene therapy, are reviewed.

  7. Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

    SciTech Connect

    Santini, Simona; Boore, Jeffrey L.; Meyer, Axel

    2003-12-31

    Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involved in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.

  8. A negative element involved in vimentin gene expression.

    PubMed Central

    Farrell, F X; Sax, C M; Zehner, Z E

    1990-01-01

    Vimentin is one member of the intermediate filament multigene family which exhibits both tissue- and developmental stage-specific expression. In vivo, vimentin is expressed in cells of mesenchymal origin. Previously, we identified both enhancer and promoter elements in the chicken vimentin gene which regulate gene expression in a positive manner. In this report, we have identified a 40-base-pair region at -568 base pairs between the proximal and distal enhancer elements which represses transcriptional activity. This silencer region can also repress the heterologous herpes simplex virus thymidine kinase promoter, which is comparable to the vimentin promoter. In addition, the element is able to function in a position- and orientation-independent manner, and the amount of repression is increased by multiple copies. Here we show by gel retardation assays and DNase I footprinting that this region binds a protein in nuclear extracts from HeLa cells. Southwestern (DNA-protein) blot analysis indicates this protein is approximately 95 kilodaltons in size. Moreover, protein distribution and activity mimic the expression pattern of vimentin during myogenesis, i.e., protein binding increases as vimentin gene expression decreases. The silencer region shares strong sequence similarity with 5'-flanking sequences found in both the human and hamster vimentin genes and with other characterized silencer elements, including the human immunodeficiency virus long terminal repeat, rat growth hormone, chicken lysozyme, and rat insulin genes. Thus, a negative element appears to bind a 95-kilodalton protein involved in regulating the tissue-specific expression of the chicken vimentin gene. Images PMID:2325656

  9. Transcriptional Targeting in the Airway Using Novel Gene Regulatory Elements

    PubMed Central

    Burnight, Erin R.; Wang, Guoshun; McCray, Paul B.

    2012-01-01

    The delivery of cystic fibrosis transmembrane conductance regulator (CFTR) to airway epithelia is a goal of many gene therapy strategies to treat cystic fibrosis. Because the native regulatory elements of the CFTR are not well characterized, the development of vectors with heterologous promoters of varying strengths and specificity would aid in our selection of optimal reagents for the appropriate expression of the vector-delivered CFTR gene. Here we contrasted the performance of several novel gene-regulatory elements. Based on airway expression analysis, we selected putative regulatory elements from BPIFA1 and WDR65 to investigate. In addition, we selected a human CFTR promoter region (∼ 2 kb upstream of the human CFTR transcription start site) to study. Using feline immunodeficiency virus vectors containing the candidate elements driving firefly luciferase, we transduced murine nasal epithelia in vivo. Luciferase expression persisted for 30 weeks, which was the duration of the experiment. Furthermore, when the nasal epithelium was ablated using the detergent polidocanol, the mice showed a transient loss of luciferase expression that returned 2 weeks after administration, suggesting that our vectors transduced a progenitor cell population. Importantly, the hWDR65 element drove sufficient CFTR expression to correct the anion transport defect in CFTR-null epithelia. These results will guide the development of optimal vectors for sufficient, sustained CFTR expression in airway epithelia. PMID:22447971

  10. Interaction between Conjugative and Retrotransposable Elements in Horizontal Gene Transfer

    PubMed Central

    Novikova, Olga; Smith, Dorie; Hahn, Ingrid; Beauregard, Arthur; Belfort, Marlene

    2014-01-01

    Mobile genetic elements either encode their own mobilization machineries or hijack them from other mobile elements. Multiple classes of mobile elements often coexist within genomes and it is unclear whether they have the capacity to functionally interact and even collaborate. We investigate the possibility that molecular machineries of disparate mobile elements may functionally interact, using the example of a retrotransposon, in the form of a mobile group II intron, found on a conjugative plasmid pRS01 in Lactococcus lactis. This intron resides within the pRS01 ltrB gene encoding relaxase, the enzyme required for nicking the transfer origin (oriT) for conjugal transmission of the plasmid into a recipient cell. Here, we show that relaxase stimulates both the frequency and diversity of retrotransposition events using a retromobility indicator gene (RIG), and by developing a high-throughput genomic retrotransposition detection system called RIG-Seq. We demonstrate that LtrB relaxase not only nicks ssDNA of its cognate oriT in a sequence- and strand-specific manner, but also possesses weak off-target activity. Together, the data support a model in which the two different mobile elements, one using an RNA-based mechanism, the other using DNA-based transfer, do functionally interact. Intron splicing facilitates relaxase expression required for conjugation, whereas relaxase introduces spurious nicks in recipient DNA that stimulate both the frequency of intron mobility and the density of events. We hypothesize that this functional interaction between the mobile elements would promote horizontal conjugal gene transfer while stimulating intron dissemination in the donor and recipient cells. PMID:25474706

  11. Alu Elements as Novel Regulators of Gene Expression in Type 1 Diabetes Susceptibility Genes?

    PubMed Central

    Kaur, Simranjeet; Pociot, Flemming

    2015-01-01

    Despite numerous studies implicating Alu repeat elements in various diseases, there is sparse information available with respect to the potential functional and biological roles of the repeat elements in Type 1 diabetes (T1D). Therefore, we performed a genome-wide sequence analysis of T1D candidate genes to identify embedded Alu elements within these genes. We observed significant enrichment of Alu elements within the T1D genes (p-value < 10e−16), which highlights their importance in T1D. Functional annotation of T1D genes harboring Alus revealed significant enrichment for immune-mediated processes (p-value < 10e−6). We also identified eight T1D genes harboring inverted Alus (IRAlus) within their 3' untranslated regions (UTRs) that are known to regulate the expression of host mRNAs by generating double stranded RNA duplexes. Our in silico analysis predicted the formation of duplex structures by IRAlus within the 3'UTRs of T1D genes. We propose that IRAlus might be involved in regulating the expression levels of the host T1D genes. PMID:26184322

  12. Alu Elements as Novel Regulators of Gene Expression in Type 1 Diabetes Susceptibility Genes?

    PubMed

    Kaur, Simranjeet; Pociot, Flemming

    2015-07-13

    Despite numerous studies implicating Alu repeat elements in various diseases, there is sparse information available with respect to the potential functional and biological roles of the repeat elements in Type 1 diabetes (T1D). Therefore, we performed a genome-wide sequence analysis of T1D candidate genes to identify embedded Alu elements within these genes. We observed significant enrichment of Alu elements within the T1D genes (p-value < 10e-16), which highlights their importance in T1D. Functional annotation of T1D genes harboring Alus revealed significant enrichment for immune-mediated processes (p-value < 10e-6). We also identified eight T1D genes harboring inverted Alus (IRAlus) within their 3' untranslated regions (UTRs) that are known to regulate the expression of host mRNAs by generating double stranded RNA duplexes. Our in silico analysis predicted the formation of duplex structures by IRAlus within the 3'UTRs of T1D genes. We propose that IRAlus might be involved in regulating the expression levels of the host T1D genes.

  13. Combinatorial Gene Regulatory Functions Underlie Ultraconserved Elements in Drosophila

    PubMed Central

    Warnefors, Maria; Hartmann, Britta; Thomsen, Stefan; Alonso, Claudio R.

    2016-01-01

    Ultraconserved elements (UCEs) are discrete genomic elements conserved across large evolutionary distances. Although UCEs have been linked to multiple facets of mammalian gene regulation their extreme evolutionary conservation remains largely unexplained. Here, we apply a computational approach to investigate this question in Drosophila, exploring the molecular functions of more than 1,500 UCEs shared across the genomes of 12 Drosophila species. Our data indicate that Drosophila UCEs are hubs for gene regulatory functions and suggest that UCE sequence invariance originates from their combinatorial roles in gene control. We also note that the gene regulatory roles of intronic and intergenic UCEs (iUCEs) are distinct from those found in exonic UCEs (eUCEs). In iUCEs, transcription factor (TF) and epigenetic factor binding data strongly support iUCE roles in transcriptional and epigenetic regulation. In contrast, analyses of eUCEs indicate that they are two orders of magnitude more likely than the expected to simultaneously include protein-coding sequence, TF-binding sites, splice sites, and RNA editing sites but have reduced roles in transcriptional or epigenetic regulation. Furthermore, we use a Drosophila cell culture system and transgenic Drosophila embryos to validate the notion of UCE combinatorial regulatory roles using an eUCE within the Hox gene Ultrabithorax and show that its protein-coding region also contains alternative splicing regulatory information. Taken together our experiments indicate that UCEs emerge as a result of combinatorial gene regulatory roles and highlight common features in mammalian and insect UCEs implying that similar processes might underlie ultraconservation in diverse animal taxa. PMID:27247329

  14. Combinatorial Gene Regulatory Functions Underlie Ultraconserved Elements in Drosophila.

    PubMed

    Warnefors, Maria; Hartmann, Britta; Thomsen, Stefan; Alonso, Claudio R

    2016-09-01

    Ultraconserved elements (UCEs) are discrete genomic elements conserved across large evolutionary distances. Although UCEs have been linked to multiple facets of mammalian gene regulation their extreme evolutionary conservation remains largely unexplained. Here, we apply a computational approach to investigate this question in Drosophila, exploring the molecular functions of more than 1,500 UCEs shared across the genomes of 12 Drosophila species. Our data indicate that Drosophila UCEs are hubs for gene regulatory functions and suggest that UCE sequence invariance originates from their combinatorial roles in gene control. We also note that the gene regulatory roles of intronic and intergenic UCEs (iUCEs) are distinct from those found in exonic UCEs (eUCEs). In iUCEs, transcription factor (TF) and epigenetic factor binding data strongly support iUCE roles in transcriptional and epigenetic regulation. In contrast, analyses of eUCEs indicate that they are two orders of magnitude more likely than the expected to simultaneously include protein-coding sequence, TF-binding sites, splice sites, and RNA editing sites but have reduced roles in transcriptional or epigenetic regulation. Furthermore, we use a Drosophila cell culture system and transgenic Drosophila embryos to validate the notion of UCE combinatorial regulatory roles using an eUCE within the Hox gene Ultrabithorax and show that its protein-coding region also contains alternative splicing regulatory information. Taken together our experiments indicate that UCEs emerge as a result of combinatorial gene regulatory roles and highlight common features in mammalian and insect UCEs implying that similar processes might underlie ultraconservation in diverse animal taxa. PMID:27247329

  15. p53 genes function to restrain mobile elements.

    PubMed

    Wylie, Annika; Jones, Amanda E; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V; Rakheja, Dinesh; Chen, Kenneth S; Hammer, Robert E; Comerford, Sarah A; Amatruda, James F; Abrams, John M

    2016-01-01

    Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53(-) germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5' sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility.

  16. p53 genes function to restrain mobile elements.

    PubMed

    Wylie, Annika; Jones, Amanda E; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V; Rakheja, Dinesh; Chen, Kenneth S; Hammer, Robert E; Comerford, Sarah A; Amatruda, James F; Abrams, John M

    2016-01-01

    Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53(-) germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5' sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility. PMID:26701264

  17. p53 genes function to restrain mobile elements

    PubMed Central

    Wylie, Annika; Jones, Amanda E.; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V.; Rakheja, Dinesh; Chen, Kenneth S.; Hammer, Robert E.; Comerford, Sarah A.; Amatruda, James F.; Abrams, John M.

    2016-01-01

    Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53− germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5′ sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility. PMID:26701264

  18. Horizontal gene transfer and mobile genetic elements in marine systems.

    PubMed

    Sobecky, Patricia A; Hazen, Tracy H

    2009-01-01

    The pool of mobile genetic elements (MGE) in microbial communities consists of viruses, plasmids, and associated elements (insertion sequences, transposons, and integrons) that are either self-transmissible or use mobile plasmids and viruses as vehicles for their dissemination. This mobilome facilitates the horizontal transfer of genes that promote the evolution and adaptation of microbial communities. Efforts to characterize MGEs from microbial populations resident in a variety of ecological habitats have revealed a surprisingly novel and seemingly untapped biodiversity. To better understand the impact of horizontal gene transfer (HGT), as well as the agents that promote HGT in marine ecosystems and to determine whether or not environmental parameters can effect the composition and structure of the mobilome in marine microbial communities, information on the distribution, diversity, and ecological traits of the marine mobilome is presented. In this chapter we discuss recent insights gained from different methodological approaches used to characterize the biodiversity and ecology of MGE in marine environments and their contributions to HGT. In addition, we present case studies that highlight specific HGT examples in coastal, open-ocean, and deep-sea marine ecosystems.

  19. Lateral Transfer of Genes and Gene Fragments in Staphylococcus Extends beyond Mobile Elements ▿ †

    PubMed Central

    Chan, Cheong Xin; Beiko, Robert G.; Ragan, Mark A.

    2011-01-01

    The widespread presence of antibiotic resistance and virulence among Staphylococcus isolates has been attributed in part to lateral genetic transfer (LGT), but little is known about the broader extent of LGT within this genus. Here we report the first systematic study of the modularity of genetic transfer among 13 Staphylococcus genomes covering four distinct named species. Using a topology-based phylogenetic approach, we found, among 1,354 sets of homologous genes examined, strong evidence of LGT in 368 (27.1%) gene sets, and weaker evidence in another 259 (19.1%). Within-gene and whole-gene transfer contribute almost equally to the topological discordance of these gene sets against a reference phylogeny. Comparing genetic transfer in single-copy and in multicopy gene sets, we observed a higher frequency of LGT in the latter, and a substantial functional bias in cases of whole-gene transfer (little such bias was observed in cases of fragmentary genetic transfer). We found evidence that lateral transfer, particularly of entire genes, impacts not only functions related to antibiotic, drug, and heavy-metal resistance, as well as membrane transport, but also core informational and metabolic functions not associated with mobile elements. Although patterns of sequence similarity support the cohesion of recognized species, LGT within S. aureus appears frequently to disrupt clonal complexes. Our results demonstrate that LGT and gene duplication play important parts in functional innovation in staphylococcal genomes. PMID:21622749

  20. Birth of a chimeric primate gene by capture of the transposase gene from a mobile element.

    PubMed

    Cordaux, Richard; Udit, Swalpa; Batzer, Mark A; Feschotte, Cédric

    2006-05-23

    The emergence of new genes and functions is of central importance to the evolution of species. The contribution of various types of duplications to genetic innovation has been extensively investigated. Less understood is the creation of new genes by recycling of coding material from selfish mobile genetic elements. To investigate this process, we reconstructed the evolutionary history of SETMAR, a new primate chimeric gene resulting from fusion of a SET histone methyltransferase gene to the transposase gene of a mobile element. We show that the transposase gene was recruited as part of SETMAR 40-58 million years ago, after the insertion of an Hsmar1 transposon downstream of a preexisting SET gene, followed by the de novo exonization of previously noncoding sequence and the creation of a new intron. The original structure of the fusion gene is conserved in all anthropoid lineages, but only the N-terminal half of the transposase is evolving under strong purifying selection. In vitro assays show that this region contains a DNA-binding domain that has preserved its ancestral binding specificity for a 19-bp motif located within the terminal-inverted repeats of Hsmar1 transposons and their derivatives. The presence of these transposons in the human genome constitutes a potential reservoir of approximately 1,500 perfect or nearly perfect SETMAR-binding sites. Our results not only provide insight into the conditions required for a successful gene fusion, but they also suggest a mechanism by which the circuitry underlying complex regulatory networks may be rapidly established. PMID:16672366

  1. Characterization and distribution of repetitive elements in association with genes in the human genome.

    PubMed

    Liang, Kai-Chiang; Tseng, Joseph T; Tsai, Shaw-Jenq; Sun, H Sunny

    2015-08-01

    Repetitive elements constitute more than 50% of the human genome. Recent studies implied that the complexity of living organisms is not just a direct outcome of a number of coding sequences; the repetitive elements, which do not encode proteins, may also play a significant role. Though scattered studies showed that repetitive elements in the regulatory regions of a gene control gene expression, no systematic survey has been done to report the characterization and distribution of various types of these repetitive elements in the human genome. Sequences from 5' and 3' untranslated regions and upstream and downstream of a gene were downloaded from the Ensembl database. The repetitive elements in the neighboring of each gene were identified and classified using cross-matching implemented in the RepeatMasker. The annotation and distribution of distinct classes of repetitive elements associated with individual gene were collected to characterize genes in association with different types of repetitive elements using systems biology program. We identified a total of 1,068,400 repetitive elements which belong to 37-class families and 1235 subclasses that are associated with 33,761 genes and 57,365 transcripts. In addition, we found that the tandem repeats preferentially locate proximal to the transcription start site (TSS) of genes and the major function of these genes are involved in developmental processes. On the other hand, interspersed repetitive elements showed a tendency to be accumulated at distal region from the TSS and the function of interspersed repeat-containing genes took part in the catabolic/metabolic processes. Results from the distribution analysis were collected and used to construct a gene-based repetitive element database (GBRED; http://www.binfo.ncku.edu.tw/GBRED/index.html). A user-friendly web interface was designed to provide the information of repetitive elements associated with any particular gene(s). This is the first study focusing on the gene

  2. Identification of a cis-acting DNA antisilencer element which modulates vimentin gene expression.

    PubMed Central

    Stover, D M; Zehner, Z E

    1992-01-01

    Vimentin is a tissue-specific, developmentally regulated member of the intermediate filament protein family normally expressed in cells of mesenchymal origin. Transcription factors which recognize specific cis-acting elements of the chicken gene include Sp-1 and the 95-kDa silencer protein which binds to a 40-bp silencer element at -608 (F. X. Farrell, C. M. Sax, and Z. E. Zehner, Mol. Cell. Biol. 10:2349-2358, 1990). In this study, we have identified a region upstream of the silencer element which restores gene activity. This region has been further delineated into two functional subelements of 75 and 260 bp. In transient transfection assays, the 75-bp element overrides the silencer effect of pStkCAT by 100%, while the 260-bp element is about half as active. Neither element affects gene activity when the silencer element is absent. Therefore, these elements do not function as enhancers, but they may serve only to override the silencer element and therefore can be viewed as antisilencers. In addition, the 75-bp element binds a specific 140-kDa protein, as determined by gel mobility shift assays and Southwestern (DNA-protein) blots, the binding site of which has been delineated to a 10- to 17-bp element by DNase I protection experiments. During myogenesis, a direct correlation can be made between the binding efficiency of the 140-kDa protein, the silencer protein, and gene activity in vivo. Genes known to contain a functional silencer element also contain at least one antisilencer element, as determined by sequence identity. Therefore, we have identified an antisilencer element and protein important in the developmental regulation of vimentin gene expression which may be involved in the regulation of other genes. Images PMID:1569950

  3. Competition between transposable elements and mutator genes in bacteria.

    PubMed

    Fehér, Tamás; Bogos, Balázs; Méhi, Orsolya; Fekete, Gergely; Csörgo, Bálint; Kovács, Károly; Pósfai, György; Papp, Balázs; Hurst, Laurence D; Pál, Csaba

    2012-10-01

    Although both genotypes with elevated mutation rate (mutators) and mobilization of insertion sequence (IS) elements have substantial impact on genome diversification, their potential interactions are unknown. Moreover, the evolutionary forces driving gradual accumulation of these elements are unclear: Do these elements spread in an initially transposon-free bacterial genome as they enable rapid adaptive evolution? To address these issues, we inserted an active IS1 element into a reduced Escherichia coli genome devoid of all other mobile DNA. Evolutionary laboratory experiments revealed that IS elements increase mutational supply and occasionally generate variants with especially large phenotypic effects. However, their impact on adaptive evolution is small compared with mismatch repair mutator alleles, and hence, the latter impede the spread of IS-carrying strains. Given their ubiquity in natural populations, such mutator alleles could limit early phase of IS element evolution in a new bacterial host. More generally, our work demonstrates the existence of an evolutionary conflict between mutation-promoting mechanisms.

  4. Surveying DNA Elements within Functional Genes of Heterocyst-Forming Cyanobacteria

    PubMed Central

    Hilton, Jason A.; Meeks, John C.; Zehr, Jonathan P.

    2016-01-01

    Some cyanobacteria are capable of differentiating a variety of cell types in response to environmental factors. For instance, in low nitrogen conditions, some cyanobacteria form heterocysts, which are specialized for N2 fixation. Many heterocyst-forming cyanobacteria have DNA elements interrupting key N2 fixation genes, elements that are excised during heterocyst differentiation. While the mechanism for the excision of the element has been well-studied, many questions remain regarding the introduction of the elements into the cyanobacterial lineage and whether they have been retained ever since or have been lost and reintroduced. To examine the evolutionary relationships and possible function of DNA sequences that interrupt genes of heterocyst-forming cyanobacteria, we identified and compared 101 interruption element sequences within genes from 38 heterocyst-forming cyanobacterial genomes. The interruption element lengths ranged from about 1 kb (the minimum able to encode the recombinase responsible for element excision), up to nearly 1 Mb. The recombinase gene sequences served as genetic markers that were common across the interruption elements and were used to track element evolution. Elements were found that interrupted 22 different orthologs, only five of which had been previously observed to be interrupted by an element. Most of the newly identified interrupted orthologs encode proteins that have been shown to have heterocyst-specific activity. However, the presence of interruption elements within genes with no known role in N2 fixation, as well as in three non-heterocyst-forming cyanobacteria, indicates that the processes that trigger the excision of elements may not be limited to heterocyst development or that the elements move randomly within genomes. This comprehensive analysis provides the framework to study the history and behavior of these unique sequences, and offers new insight regarding the frequency and persistence of interruption elements in

  5. Surveying DNA Elements within Functional Genes of Heterocyst-Forming Cyanobacteria.

    PubMed

    Hilton, Jason A; Meeks, John C; Zehr, Jonathan P

    2016-01-01

    Some cyanobacteria are capable of differentiating a variety of cell types in response to environmental factors. For instance, in low nitrogen conditions, some cyanobacteria form heterocysts, which are specialized for N2 fixation. Many heterocyst-forming cyanobacteria have DNA elements interrupting key N2 fixation genes, elements that are excised during heterocyst differentiation. While the mechanism for the excision of the element has been well-studied, many questions remain regarding the introduction of the elements into the cyanobacterial lineage and whether they have been retained ever since or have been lost and reintroduced. To examine the evolutionary relationships and possible function of DNA sequences that interrupt genes of heterocyst-forming cyanobacteria, we identified and compared 101 interruption element sequences within genes from 38 heterocyst-forming cyanobacterial genomes. The interruption element lengths ranged from about 1 kb (the minimum able to encode the recombinase responsible for element excision), up to nearly 1 Mb. The recombinase gene sequences served as genetic markers that were common across the interruption elements and were used to track element evolution. Elements were found that interrupted 22 different orthologs, only five of which had been previously observed to be interrupted by an element. Most of the newly identified interrupted orthologs encode proteins that have been shown to have heterocyst-specific activity. However, the presence of interruption elements within genes with no known role in N2 fixation, as well as in three non-heterocyst-forming cyanobacteria, indicates that the processes that trigger the excision of elements may not be limited to heterocyst development or that the elements move randomly within genomes. This comprehensive analysis provides the framework to study the history and behavior of these unique sequences, and offers new insight regarding the frequency and persistence of interruption elements in

  6. Gene Expression Variation in Drosophila melanogaster Due to Rare Transposable Element Insertion Alleles of Large Effect

    PubMed Central

    Cridland, Julie M.; Thornton, Kevin R.; Long, Anthony D.

    2015-01-01

    Transposable elements are a common source of genetic variation that may play a substantial role in contributing to gene expression variation. However, the contribution of transposable elements to expression variation thus far consists of a handful of examples. We used previously published gene expression data from 37 inbred Drosophila melanogaster lines from the Drosophila Genetic Reference Panel to perform a genome-wide assessment of the effects of transposable elements on gene expression. We found thousands of transcripts with transposable element insertions in or near the transcript and that the presence of a transposable element in or near a transcript is significantly associated with reductions in expression. We estimate that within this example population, ∼2.2% of transcripts have a transposable element insertion, which significantly reduces expression in the line containing the transposable element. We also find that transcripts with insertions within 500 bp of the transcript show on average a 0.67 standard deviation decrease in expression level. These large decreases in expression level are most pronounced for transposable element insertions close to transcripts and the effect diminishes for more distant insertions. This work represents the first genome-wide analysis of gene expression variation due to transposable elements and suggests that transposable elements are an important class of mutation underlying expression variation in Drosophila and likely in other systems, given the ubiquity of these mobile elements in eukaryotic genomes. PMID:25335504

  7. Mitotic and Meiotic Gene Conversion of Ty Elements and Other Insertions in Saccharomyces Cerevisiae

    PubMed Central

    Vincent, A.; Petes, T. D.

    1989-01-01

    We examined meiotic and mitotic gene conversion events involved in deletion of Ty elements and other insertions from the genome of the yeast Saccharomyces cerevisiae. We found that Ty elements and one other insertion were deleted by mitotic gene conversion less frequently than point mutations at the same loci. One non-Ty insertion similar in size to Ty, however, did not show this bias. Mitotic conversion events deleting insertions were more frequently associated with crossing over than those deleting point mutations. In meiosis, conversion events duplicating the element were more common than those that deleted the element for one of the loci (HIS4) examined. PMID:2547693

  8. Identifier (ID) elements are not preferentially located to brain-specific genes: high ID element representation in other tissue-specific- and housekeeping genes of the rat.

    PubMed

    Goldman, Andrés; Capoano, Carlos A; González-López, Evangelina; Geisinger, Adriana

    2014-01-01

    BC1 is a short non-coding RNA from rodents, which is transcribed by RNA pol III. Its RNA is highly abundant in the brain, where it exerts a post-transcriptional regulatory role in dendrites. Upon transcription, retroposition and insertion, BC1 gives rise to a subclass of short interspersed repetitive sequences (SINEs) named identifier (ID) elements. IDs can become integrated inside non-coding regions of RNA pol II transcription units, and - although challenged by a couple of reports - their preferential location to brain-specific genes has been long proposed. Furthermore, an additional, cis-regulatory role in the control of brain-specific pol II-directed transcripts has been suggested for these sequences. In this work we used Northern blot and in silico analyses to examine IDs' location among pol II transcription units in different tissues, and in housekeeping genes. ID sequences appeared distributed in a similar fashion within tissue-specific hnRNA populations of the brain, testis and liver, and within housekeeping primary transcripts as well. Moreover, when the lengths of the unprocessed transcripts were considered, ID representation was higher in housekeeping ones. On the other hand, ID elements appeared similarly distributed among the different gene regions, with the obvious exclusion of those sequences where strict constraints for proper gene expression exist. Altogether, the widespread distribution of ID elements in all the analyzed genes - including housekeeping - and in all gene regions, suggests a random location, raising questions about the specific cis-regulatory role of those sequences.

  9. Zebrafish U6 small nuclear RNA gene promoters contain a SPH element in an unusual location.

    PubMed

    Halbig, Kari M; Lekven, Arne C; Kunkel, Gary R

    2008-09-15

    Promoters for vertebrate small nuclear RNA (snRNA) genes contain a relatively simple array of transcriptional control elements, divided into proximal and distal regions. Most of these genes are transcribed by RNA polymerase II (e.g., U1, U2), whereas the U6 gene is transcribed by RNA polymerase III. Previously identified vertebrate U6 snRNA gene promoters consist of a proximal sequence element (PSE) and TATA element in the proximal region, plus a distal region with octamer (OCT) and SphI postoctamer homology (SPH) elements. We have found that zebrafish U6 snRNA promoters contain the SPH element in a novel proximal position immediately upstream of the TATA element. The zebrafish SPH element is recognized by SPH-binding factor/selenocysteine tRNA gene transcription activating factor/zinc finger protein 143 (SBF/Staf/ZNF143) in vitro. Furthermore, a zebrafish U6 promoter with a defective SPH element is inefficiently transcribed when injected into embryos.

  10. A functional gene array for detection of bacterial virulence elements

    SciTech Connect

    Jaing, C

    2007-11-01

    We report our development of the first of a series of microarrays designed to detect pathogens with known mechanisms of virulence and antibiotic resistance. By targeting virulence gene families as well as genes unique to specific biothreat agents, these arrays will provide important data about the pathogenic potential and drug resistance profiles of unknown organisms in environmental samples. To validate our approach, we developed a first generation array targeting genes from Escherichia coli strains K12 and CFT073, Enterococcus faecalis and Staphylococcus aureus. We determined optimal probe design parameters for microorganism detection and discrimination, measured the required target concentration, and assessed tolerance for mismatches between probe and target sequences. Mismatch tolerance is a priority for this application, due to DNA sequence variability among members of gene families. Arrays were created using the NimbleGen Maskless Array Synthesizer at Lawrence Livermore National Laboratory. Purified genomic DNA from combinations of one or more of the four target organisms, pure cultures of four related organisms, and environmental aerosol samples with spiked-in genomic DNA were hybridized to the arrays. Based on the success of this prototype, we plan to design further arrays in this series, with the goal of detecting all known virulence and antibiotic resistance gene families in a greatly expanded set of organisms.

  11. Satellite DNA-like elements associated with genes within euchromatin of the beetle Tribolium castaneum.

    PubMed

    Brajković, Josip; Feliciello, Isidoro; Bruvo-Mađarić, Branka; Ugarković, Durđica

    2012-08-01

    In the red flour beetle Tribolium castaneum the major TCAST satellite DNA accounts for 35% of the genome and encompasses the pericentromeric regions of all chromosomes. Because of the presence of transcriptional regulatory elements and transcriptional activity in these sequences, TCAST satellite DNAs also have been proposed to be modulators of gene expression within euchromatin. Here, we analyze the distribution of TCAST homologous repeats in T. castaneum euchromatin and study their association with genes as well as their potential gene regulatory role. We identified 68 arrays composed of TCAST-like elements distributed on all chromosomes. Based on sequence characteristics the arrays were composed of two types of TCAST-like elements. The first type consists of TCAST satellite-like elements in the form of partial monomers or tandemly arranged monomers, up to tetramers, whereas the second type consists of TCAST-like elements embedded with a complex unit that resembles a DNA transposon. TCAST-like elements were also found in the 5' untranslated region (UTR) of the CR1-3_TCa retrotransposon, and therefore retrotransposition may have contributed to their dispersion throughout the genome. No significant difference in the homogenization of dispersed TCAST-like elements was found either at the level of local arrays or chromosomes nor among different chromosomes. Of 68 TCAST-like elements, 29 were located within introns, with the remaining elements flanked by genes within a 262 to 404,270 nt range. TCAST-like elements are statistically overrepresented near genes with immunoglobulin-like domains attesting to their nonrandom distribution and a possible gene regulatory role. PMID:22908042

  12. Satellite DNA-Like Elements Associated With Genes Within Euchromatin of the Beetle Tribolium castaneum

    PubMed Central

    Brajković, Josip; Feliciello, Isidoro; Bruvo-Mađarić, Branka; Ugarković, Đurđica

    2012-01-01

    In the red flour beetle Tribolium castaneum the major TCAST satellite DNA accounts for 35% of the genome and encompasses the pericentromeric regions of all chromosomes. Because of the presence of transcriptional regulatory elements and transcriptional activity in these sequences, TCAST satellite DNAs also have been proposed to be modulators of gene expression within euchromatin. Here, we analyze the distribution of TCAST homologous repeats in T. castaneum euchromatin and study their association with genes as well as their potential gene regulatory role. We identified 68 arrays composed of TCAST-like elements distributed on all chromosomes. Based on sequence characteristics the arrays were composed of two types of TCAST-like elements. The first type consists of TCAST satellite-like elements in the form of partial monomers or tandemly arranged monomers, up to tetramers, whereas the second type consists of TCAST-like elements embedded with a complex unit that resembles a DNA transposon. TCAST-like elements were also found in the 5′ untranslated region (UTR) of the CR1-3_TCa retrotransposon, and therefore retrotransposition may have contributed to their dispersion throughout the genome. No significant difference in the homogenization of dispersed TCAST-like elements was found either at the level of local arrays or chromosomes nor among different chromosomes. Of 68 TCAST-like elements, 29 were located within introns, with the remaining elements flanked by genes within a 262 to 404,270 nt range. TCAST-like elements are statistically overrepresented near genes with immunoglobulin-like domains attesting to their nonrandom distribution and a possible gene regulatory role. PMID:22908042

  13. Periodic, Quasi-periodic and Chaotic Dynamics in Simple Gene Elements with Time Delays

    NASA Astrophysics Data System (ADS)

    Suzuki, Yoko; Lu, Mingyang; Ben-Jacob, Eshel; Onuchic, José N.

    2016-02-01

    Regulatory gene circuit motifs play crucial roles in performing and maintaining vital cellular functions. Frequently, theoretical studies of gene circuits focus on steady-state behaviors and do not include time delays. In this study, the inclusion of time delays is shown to entirely change the time-dependent dynamics for even the simplest possible circuits with one and two gene elements with self and cross regulations. These elements can give rise to rich behaviors including periodic, quasi-periodic, weak chaotic, strong chaotic and intermittent dynamics. We introduce a special power-spectrum-based method to characterize and discriminate these dynamical modes quantitatively. Our simulation results suggest that, while a single negative feedback loop of either one- or two-gene element can only have periodic dynamics, the elements with two positive/negative feedback loops are the minimalist elements to have chaotic dynamics. These elements typically have one negative feedback loop that generates oscillations, and another unit that allows frequent switches among multiple steady states or between oscillatory and non-oscillatory dynamics. Possible dynamical features of several simple one- and two-gene elements are presented in details. Discussion is presented for possible roles of the chaotic behavior in the robustness of cellular functions and diseases, for example, in the context of cancer.

  14. Periodic, Quasi-periodic and Chaotic Dynamics in Simple Gene Elements with Time Delays

    PubMed Central

    Suzuki, Yoko; Lu, Mingyang; Ben-Jacob, Eshel; Onuchic, José N.

    2016-01-01

    Regulatory gene circuit motifs play crucial roles in performing and maintaining vital cellular functions. Frequently, theoretical studies of gene circuits focus on steady-state behaviors and do not include time delays. In this study, the inclusion of time delays is shown to entirely change the time-dependent dynamics for even the simplest possible circuits with one and two gene elements with self and cross regulations. These elements can give rise to rich behaviors including periodic, quasi-periodic, weak chaotic, strong chaotic and intermittent dynamics. We introduce a special power-spectrum-based method to characterize and discriminate these dynamical modes quantitatively. Our simulation results suggest that, while a single negative feedback loop of either one- or two-gene element can only have periodic dynamics, the elements with two positive/negative feedback loops are the minimalist elements to have chaotic dynamics. These elements typically have one negative feedback loop that generates oscillations, and another unit that allows frequent switches among multiple steady states or between oscillatory and non-oscillatory dynamics. Possible dynamical features of several simple one- and two-gene elements are presented in details. Discussion is presented for possible roles of the chaotic behavior in the robustness of cellular functions and diseases, for example, in the context of cancer. PMID:26876008

  15. Periodic, Quasi-periodic and Chaotic Dynamics in Simple Gene Elements with Time Delays.

    PubMed

    Suzuki, Yoko; Lu, Mingyang; Ben-Jacob, Eshel; Onuchic, José N

    2016-02-15

    Regulatory gene circuit motifs play crucial roles in performing and maintaining vital cellular functions. Frequently, theoretical studies of gene circuits focus on steady-state behaviors and do not include time delays. In this study, the inclusion of time delays is shown to entirely change the time-dependent dynamics for even the simplest possible circuits with one and two gene elements with self and cross regulations. These elements can give rise to rich behaviors including periodic, quasi-periodic, weak chaotic, strong chaotic and intermittent dynamics. We introduce a special power-spectrum-based method to characterize and discriminate these dynamical modes quantitatively. Our simulation results suggest that, while a single negative feedback loop of either one- or two-gene element can only have periodic dynamics, the elements with two positive/negative feedback loops are the minimalist elements to have chaotic dynamics. These elements typically have one negative feedback loop that generates oscillations, and another unit that allows frequent switches among multiple steady states or between oscillatory and non-oscillatory dynamics. Possible dynamical features of several simple one- and two-gene elements are presented in details. Discussion is presented for possible roles of the chaotic behavior in the robustness of cellular functions and diseases, for example, in the context of cancer.

  16. Identification of genetic elements associated with EPSPS gene amplification

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Weed populations can have high genetic plasticity and rapid responses to environmental selection pressures. For example, 100-fold amplification of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene evolved to confer resistance to glyphosate, the world's most important herbicide, in the wee...

  17. Role of Conserved Non-Coding Regulatory Elements in LMW Glutenin Gene Expression

    PubMed Central

    Juhász, Angéla; Makai, Szabolcs; Sebestyén, Endre; Tamás, László; Balázs, Ervin

    2011-01-01

    Transcriptional regulation of LMW glutenin genes were investigated in-silico, using publicly available gene sequences and expression data. Genes were grouped into different LMW glutenin types and their promoter profiles were determined using cis-acting regulatory elements databases and published results. The various cis-acting elements belong to some conserved non-coding regulatory regions (CREs) and might act in two different ways. There are elements, such as GCN4 motifs found in the long endosperm box that could serve as key factors in tissue-specific expression. Some other elements, such as the AACA/TA motifs or the individual prolamin box variants, might modulate the level of expression. Based on the promoter sequences and expression characteristic LMW glutenin genes might be transcribed following two different mechanisms. Most of the s- and i-type genes show a continuously increasing expression pattern. The m-type genes, however, demonstrate normal distribution in their expression profiles. Differences observed in their expression could be related to the differences found in their promoter sequences. Polymorphisms in the number and combination of cis-acting elements in their promoter regions can be of crucial importance in the diverse levels of production of single LMW glutenin gene types. PMID:22242127

  18. The organization structure and regulatory elements of Chlamydomonas histone genes reveal features linking plant and animal genes.

    PubMed

    Fabry, S; Müller, K; Lindauer, A; Park, P B; Cornelius, T; Schmitt, R

    1995-09-01

    The genome of the green alga Chlamydomonas reinhardtii contains approximately 15 gene clusters of the nucleosomal (or core) histone H2A, H2B, H3 and H4 genes and at least one histone H1 gene. Seven non-allelic histone gene loci were isolated from a genomic library, physically mapped, and the nucleotide sequences of three isotypes of each core histone gene species and one linked H1 gene determined. The core histone genes are organized in clusters of H2A-H2B and H3-H4 pairs, in which each gene pair shows outwardly divergent transcription from a short (< 300 bp) intercistronic region. These intercistronic regions contain typically conserved promoter elements, namely a TATA-box and the three motifs TGGCCAG-G(G/C)-CGAG, CGTTGACC and CGGTTG. Different from the genes of higher plants, but like those of animals and the related alga Volvox, the 3' untranslated regions contain no poly A signal, but a palindromic sequence (3' palindrome) essential for mRNA processing is present. One single H1 gene was found in close linkage to a H2A-H2B pair. The H1 upstream region contains the octameric promoter element GGTTGACC (also found upstream of the core histone genes) and two specific sequence motifs that are shared only with the Volvox H1 promoters. This suggests differential transcription of the H1 and the core histone genes. The H1 gene is interrupted by two introns. Unlike Volvox H3 genes, the three sequenced H3 isoforms are intron-free. Primer-directed PCR of genomic DNA demonstrated, however, that at least 8 of the about 15 H3 genes do contain one intron at a conserved position. In synchronized C. reinhardtii cells, H4 mRNA levels (representative of all core histone mRNAs) peak during cell division, suggesting strict replication-dependent gene control. The derived peptide sequences place C. reinhardtii core histones closer to plants than to animals, except that the H2A histones are more animal-like. The peptide sequence of histone H1 is closely related to the V. carteri VH1-II

  19. The organization structure and regulatory elements of Chlamydomonas histone genes reveal features linking plant and animal genes.

    PubMed

    Fabry, S; Müller, K; Lindauer, A; Park, P B; Cornelius, T; Schmitt, R

    1995-09-01

    The genome of the green alga Chlamydomonas reinhardtii contains approximately 15 gene clusters of the nucleosomal (or core) histone H2A, H2B, H3 and H4 genes and at least one histone H1 gene. Seven non-allelic histone gene loci were isolated from a genomic library, physically mapped, and the nucleotide sequences of three isotypes of each core histone gene species and one linked H1 gene determined. The core histone genes are organized in clusters of H2A-H2B and H3-H4 pairs, in which each gene pair shows outwardly divergent transcription from a short (< 300 bp) intercistronic region. These intercistronic regions contain typically conserved promoter elements, namely a TATA-box and the three motifs TGGCCAG-G(G/C)-CGAG, CGTTGACC and CGGTTG. Different from the genes of higher plants, but like those of animals and the related alga Volvox, the 3' untranslated regions contain no poly A signal, but a palindromic sequence (3' palindrome) essential for mRNA processing is present. One single H1 gene was found in close linkage to a H2A-H2B pair. The H1 upstream region contains the octameric promoter element GGTTGACC (also found upstream of the core histone genes) and two specific sequence motifs that are shared only with the Volvox H1 promoters. This suggests differential transcription of the H1 and the core histone genes. The H1 gene is interrupted by two introns. Unlike Volvox H3 genes, the three sequenced H3 isoforms are intron-free. Primer-directed PCR of genomic DNA demonstrated, however, that at least 8 of the about 15 H3 genes do contain one intron at a conserved position. In synchronized C. reinhardtii cells, H4 mRNA levels (representative of all core histone mRNAs) peak during cell division, suggesting strict replication-dependent gene control. The derived peptide sequences place C. reinhardtii core histones closer to plants than to animals, except that the H2A histones are more animal-like. The peptide sequence of histone H1 is closely related to the V. carteri VH1-II

  20. The Berkeley Drosophila Genome Project gene disruption project: Single P-element insertions mutating 25% of vital Drosophila genes.

    PubMed Central

    Spradling, A C; Stern, D; Beaton, A; Rhem, E J; Laverty, T; Mozden, N; Misra, S; Rubin, G M

    1999-01-01

    A fundamental goal of genetics and functional genomics is to identify and mutate every gene in model organisms such as Drosophila melanogaster. The Berkeley Drosophila Genome Project (BDGP) gene disruption project generates single P-element insertion strains that each mutate unique genomic open reading frames. Such strains strongly facilitate further genetic and molecular studies of the disrupted loci, but it has remained unclear if P elements can be used to mutate all Drosophila genes. We now report that the primary collection has grown to contain 1045 strains that disrupt more than 25% of the estimated 3600 Drosophila genes that are essential for adult viability. Of these P insertions, 67% have been verified by genetic tests to cause the associated recessive mutant phenotypes, and the validity of most of the remaining lines is predicted on statistical grounds. Sequences flanking >920 insertions have been determined to exactly position them in the genome and to identify 376 potentially affected transcripts from collections of EST sequences. Strains in the BDGP collection are available from the Bloomington Stock Center and have already assisted the research community in characterizing >250 Drosophila genes. The likely identity of 131 additional genes in the collection is reported here. Our results show that Drosophila genes have a wide range of sensitivity to inactivation by P elements, and provide a rationale for greatly expanding the BDGP primary collection based entirely on insertion site sequencing. We predict that this approach can bring >85% of all Drosophila open reading frames under experimental control. PMID:10471706

  1. Regulatory elements responsible for inducible expression of the granulocyte colony-stimulating factor gene in macrophages.

    PubMed Central

    Nishizawa, M; Nagata, S

    1990-01-01

    Granulocyte colony-stimulating factor (G-CSF) plays an essential role in granulopoiesis during bacterial infection. Macrophages produce G-CSF in response to bacterial endotoxins such as lipopolysaccharide (LPS). To elucidate the mechanism of the induction of G-CSF gene in macrophages or macrophage-monocytes, we have examined regulatory cis elements in the promoter of mouse G-CSF gene. Analyses of linker-scanning and internal deletion mutants of the G-CSF promoter by the chloramphenicol acetyltransferase assay have indicated that at least three regulatory elements are indispensable for the LPS-induced expression of the G-CSF gene in macrophages. When one of the three elements was reiterated and placed upstream of the TATA box of the G-CSF promoter, it mediated inducibility as a tissue-specific and orientation-independent enhancer. Although this element contains a conserved NF-kappa B-like binding site, the gel retardation assay and DNA footprint analysis with nuclear extracts from macrophage cell lines demonstrated that nuclear proteins bind to the DNA sequence downstream of the NF-kappa B-like element, but not to the conserved element itself. The DNA sequence of the binding site was found to have some similarities to the LPS-responsive element which was recently identified in the promoter of the mouse class II major histocompatibility gene. Images PMID:1691438

  2. Gene disruptions using P transposable elements: An integral component of the Drosophila genome project

    SciTech Connect

    Spradling, A.C.; Stern, D.M.; Kiss, I.

    1995-11-21

    Biologists require genetic as well as molecular tools to decipher genomic information and ultimately to understand gene function. The Berkeley Drosophila Genome Project is addressing these needs with a massive gene disruption project that uses individual, genetically engineered P transposable elements to target open reading frames throughout the Drosophila genome DNA flanking the insertions is sequenced thereby placing and extensive series of genetic markers on the physical genomic map and associating insertions with specific open reading frames and genes. Insertions from the collection now lie within or near most Drosophila genes, greatly reducing the time required to identify new mutations and analyze gene functions. Information revealed from these studies about P element site specificity is being used to target the remaining open reading frames. 38 refs., 5 figs., 1 tab.

  3. The structure of the human peripherin gene (PRPH) and identification of potential regulatory elements

    SciTech Connect

    Foley, J.; Ley, C.A.; Parysek, L.M.

    1994-07-15

    The authors determined the complete nucleotide sequence of the coding region of the human peripherin gene (PRPH), as well as 742 bp 5{prime} to the cap site and 584 bp 3{prime} to the stop codon, and compared its structure and sequence to the rat and mouse genes. The overall structure of 9 exons separated by 8 introns is conserved among these three mammalian species. The nucleotide sequences of the human peripherin gene exons were 90% identical to the rat gene sequences, and the predicted human peripherin protein differed from rat peripherin at only 18 of 475 amino acid residues. Comparison of the 5{prime} flanking regions of the human peripherin gene and rodent genes revealed extensive areas of high homology. Additional conserved segments were found in introns 1 and 2. Within the 5{prime} region, potential regulatory sequences, including a nerve growth factor negative regulatory element, a Hox protein binding site, and a heat shock element, were identified in all peripherin genes. The positional conservation of each element suggests that they may be important in the tissue-specific, developmental-specific, and injury-specific expression of the peripherin gene. 24 refs., 2 figs., 1 tab.

  4. Integrating Epigenomic Elements and GWASs Identifies BDNF Gene Affecting Bone Mineral Density and Osteoporotic Fracture Risk.

    PubMed

    Guo, Yan; Dong, Shan-Shan; Chen, Xiao-Feng; Jing, Ying-Aisha; Yang, Man; Yan, Han; Shen, Hui; Chen, Xiang-Ding; Tan, Li-Jun; Tian, Qing; Deng, Hong-Wen; Yang, Tie-Lin

    2016-01-01

    To identify susceptibility genes for osteoporosis, we conducted an integrative analysis that combined epigenomic elements and previous genome-wide association studies (GWASs) data, followed by validation at population and functional levels, which could identify common regulatory elements and predict new susceptibility genes that are biologically meaningful to osteoporosis. By this approach, we found a set of distinct epigenomic elements significantly enriched or depleted in the promoters of osteoporosis-associated genes, including 4 transcription factor binding sites, 27 histone marks, and 21 chromatin states segmentation types. Using these epigenomic marks, we performed reverse prediction analysis to prioritize the discovery of new candidate genes. Functional enrichment analysis of all the prioritized genes revealed several key osteoporosis related pathways, including Wnt signaling. Genes with high priority were further subjected to validation using available GWASs datasets. Three genes were significantly associated with spine bone mineral density, including BDNF, PDE4D, and SATB2, which all closely related to bone metabolism. The most significant gene BDNF was also associated with osteoporotic fractures. RNA interference revealed that BDNF knockdown can suppress osteoblast differentiation. Our results demonstrated that epigenomic data could be used to indicate common epigenomic marks to discover additional loci with biological functions for osteoporosis. PMID:27465306

  5. Integrating Epigenomic Elements and GWASs Identifies BDNF Gene Affecting Bone Mineral Density and Osteoporotic Fracture Risk

    PubMed Central

    Guo, Yan; Dong, Shan-Shan; Chen, Xiao-Feng; Jing, Ying-Aisha; Yang, Man; Yan, Han; Shen, Hui; Chen, Xiang-Ding; Tan, Li-Jun; Tian, Qing; Deng, Hong-Wen; Yang, Tie-Lin

    2016-01-01

    To identify susceptibility genes for osteoporosis, we conducted an integrative analysis that combined epigenomic elements and previous genome-wide association studies (GWASs) data, followed by validation at population and functional levels, which could identify common regulatory elements and predict new susceptibility genes that are biologically meaningful to osteoporosis. By this approach, we found a set of distinct epigenomic elements significantly enriched or depleted in the promoters of osteoporosis-associated genes, including 4 transcription factor binding sites, 27 histone marks, and 21 chromatin states segmentation types. Using these epigenomic marks, we performed reverse prediction analysis to prioritize the discovery of new candidate genes. Functional enrichment analysis of all the prioritized genes revealed several key osteoporosis related pathways, including Wnt signaling. Genes with high priority were further subjected to validation using available GWASs datasets. Three genes were significantly associated with spine bone mineral density, including BDNF, PDE4D, and SATB2, which all closely related to bone metabolism. The most significant gene BDNF was also associated with osteoporotic fractures. RNA interference revealed that BDNF knockdown can suppress osteoblast differentiation. Our results demonstrated that epigenomic data could be used to indicate common epigenomic marks to discover additional loci with biological functions for osteoporosis. PMID:27465306

  6. Multiple silencer elements are involved in regulating the chicken vimentin gene.

    PubMed Central

    Garzon, R J; Zehner, Z E

    1994-01-01

    Vimentin, a member of the intermediate filament protein family, exhibits tissue- as well as development-specific expression. Transcription factors that are involved in expression of the chicken vimentin gene have been described and include a cis-acting silencer element (SE3) that is involved in the down-regulation of this gene (F. X. Farrell, C. M. Sax, and Z. E. Zehner, Mol. Cell. Biol. 10:2349-2358, 1990). In this study, we report the identification of two additional silencer elements (SE1 and SE2). We show by transfection analysis that all three silencer elements are functionally active and that optimal silencing occurs when multiple (at least two) silencer elements are present. In addition, the previously identified SE3 can be divided into three subregions, each of which is moderately active alone. By gel mobility shift assays, all three silencer elements plus SE3 subregions bind a protein which by Southwestern (DNA-protein) blot analysis is identical in molecular mass (approximately 95 kDa). DNase I footprinting experiments indicate that this protein binds to purine-rich sites. Therefore, multiple elements appear to be involved in the negative regulation of the chicken vimentin gene, which may be important in the regulation of other genes as well. Images PMID:8289833

  7. Coding sequences of functioning human genes derived entirely from mobile element sequences.

    PubMed

    Britten, Roy J

    2004-11-30

    Among all of the many examples of mobile elements or "parasitic sequences" that affect the function of the human genome, this paper describes several examples of functioning genes whose sequences have been almost completely derived from mobile elements. There are many examples where the synthetic coding sequences of observed mRNA sequences are made up of mobile element sequences, to an extent of 80% or more of the length of the coding sequences. In the examples described here, the genes have named functions, and some of these functions have been studied. It appears that each of the functioning genes was originally formed from mobile elements and that in some process of molecular evolution a coding sequence was derived that could be translated into a protein that is of some importance to human biology. In one case (AD7C), the coding sequence is 99% made up of a cluster of Alu sequences. In another example, the gene BNIP3 coding sequence is 97% made up of sequences from an apparent human endogenous retrovirus. The Syncytin gene coding sequence appears to be made from an endogenous retrovirus envelope gene. PMID:15546984

  8. Gene conversion as a secondary mechanism of short interspersed element (SINE) evolution

    SciTech Connect

    Kass, D.H.; Batzer, M.A.; Deininger, P.L. |

    1995-01-01

    The Alu repetitive family of short interspersed elements (SINEs) in primates can be subdivided into distinct subfamilies by specific diagnostic nucleotide changes. The older subfamilies are generally very abundant, while the younger subfamilies have fewer copies. Some of the youngest Alu elements are absent in the orthologous loci of nonhuman primates, indicative of recent retroposition events, the primary mode of SINE evolutions. PCR analysis of one young Alu subfamily (Sb2) member found in the low-density lipoprotein receptor gene apparently revealed the presence of this element in the green monkey, orangutan, gorilla, and chimpanzee genomes, as well as the human genome. However, sequence analysis of these genomes revealed a highly mutated, older, primate-specific Alu element was present at this position in the nonhuman primates. Comparison of the flanking DNA sequences upstream of this Alu insertion corresponded to evolution expected for standard primate phylogeny, but comparison of the Alu repeat sequences revealed that the human element departed from this phylogeny. The change in the human sequence apparently occurred by a gene conversion event only within the Alu element itself, converting it from one of the oldest to one of the youngest Alu subfamilies. Although gene conversions of Alu elements are clearly very rare, this finding shows that such events can occur and contribute to specific cases of SINE subfamily evolution.

  9. Promoter elements determining weak expression of the GAL4 regulatory gene of Saccharomyces cerevisiae.

    PubMed Central

    Griggs, D W; Johnston, M

    1993-01-01

    The GAL4 gene of Saccharomyces cerevisiae (encoding the activator of transcription of the GAL genes) is poorly expressed and is repressed during growth on glucose. To determine the basis for its weak expression and to identify DNA sequences recognized by proteins that activate transcription of a gene that itself encodes an activator of transcription, we have analyzed GAL4 promoter structure. We show that the GAL4 promoter is about 90-fold weaker than the strong GAL1 promoter and at least 7-fold weaker than the feeble URA3 promoter and that this low level of GAL4 expression is primarily due to a weak promoter. By deletion mapping, the GAL4 promoter can be divided into three functional regions. Two of these regions contain positive elements; a distal region termed the UASGAL4 (upstream activation sequence) contains redundant elements that increase promoter function, and a central region termed the UESGAL4 (upstream essential sequence) is essential for even basal levels of GAL4 expression. The third element, an upstream repression sequence, mediates glucose repression of GAL4 expression and is located between the UES and the transcriptional start site. The UASGAL4 is unusual because it is not interchangable with UAS elements in other yeast promoters; it does not function as a UAS element when inserted in a CYC1 promoter, and a normally strong UAS functions poorly in place of UASGAL4 in the GAL4 promoter. Similarly, the UES element of GAL4 does not function as a TATA element in a test promoter, and consensus TATA elements do not function in place of UES elements in the GAL4 promoter. These results suggest that GAL4 contains a weak TATA-less promoter and that the proteins regulating expression of this regulatory gene may be novel and context specific. PMID:8393142

  10. Identification of a cyclic-AMP-responsive element within the rat somatostatin gene.

    PubMed Central

    Montminy, M R; Sevarino, K A; Wagner, J A; Mandel, G; Goodman, R H

    1986-01-01

    We have examined the regulation of somatostatin gene expression by cAMP in PC12 rat pheochromocytoma cells transfected with the rat somatostatin gene. Forskolin at 10 microM caused a 4-fold increase in somatostatin mRNA levels within 4 hr of treatment in stably transfected cells. Chimeric genes containing the somatostatin gene promoter fused to the bacterial reporter gene encoding chloramphenicol acetyltransferase were also induced by cAMP in PC12 cells. To delineate the sequences required for response to cAMP, we constructed a series of promoter deletion mutants. Our studies defined a region between 60 and 29 base pairs upstream from the transcriptional initiation site that conferred cAMP responsiveness when placed adjacent to the simian virus 40 promoter. Within the cAMP-responsive element of the somatostatin gene, we observed an 8-base palindrome, 5'-TGACGTCA-3', which is highly conserved in many other genes whose expression is regulated by cAMP. cAMP responsiveness was greatly reduced when the somatostatin fusion genes were transfected into the mutant PC12 line A126-1B2, which is deficient in cAMP-dependent protein kinase 2. Our studies indicate that transcriptional regulation of the somatostatin gene by cAMP requires protein kinase 2 activity and may depend upon a highly conserved promoter element. Images PMID:2875459

  11. Amplification of Distant Estrogen Response Elements Deregulates Target Genes Associated with Tamoxifen Resistance in Breast Cancer

    PubMed Central

    Hsu, Pei-Yin; Hsu, Hang-Kai; Lan, Xun; Juan, Liran; Yan, Pearlly S.; Labanowska, Jadwiga; Heerema, Nyla; Hsiao, Tzu-Hung; Chiu, Yu-Chiao; Chen, Yidong; Liu, Yunlong; Li, Lang; Li, Rong; Thompson, Ian M.; Nephew, Kenneth P.; Sharp, Zelton D.; Kirma, Nameer B.; Jin, Victor X.; Huang, Tim H.-M.

    2013-01-01

    SUMMARY A causal role of gene amplification in tumorigenesis is well-known, while amplification of DNA regulatory elements as an oncogenic driver remains unclear. In this study, we integrated next-generation sequencing approaches to map distant estrogen response elements (DEREs) that remotely control transcription of target genes through chromatin proximity. Two densely mapped DERE regions located on chromosomes 17q23 and 20q13 were frequently amplified in ERα-positive luminal breast cancer. These aberrantly amplified DEREs deregulated target gene expression potentially linked to cancer development and tamoxifen resistance. Progressive accumulation of DERE copies was observed in normal breast progenitor cells chronically exposed to estrogenic chemicals. These findings may extend to other DNA regulatory elements, the amplification of which can profoundly alter target transcriptome during tumorigenesis. PMID:23948299

  12. Identification of cis-elements conferring high levels of gene expression in non-green plastids.

    PubMed

    Zhang, Jiang; Ruf, Stephanie; Hasse, Claudia; Childs, Liam; Scharff, Lars B; Bock, Ralph

    2012-10-01

    Although our knowledge about the mechanisms of gene expression in chloroplasts has increased substantially over the past decades, next to nothing is known about the signals and factors that govern expression of the plastid genome in non-green tissues. Here we report the development of a quantitative method suitable for determining the activity of cis-acting elements for gene expression in non-green plastids. The in vivo assay is based on stable transformation of the plastid genome and the discovery that root length upon seedling growth in the presence of the plastid translational inhibitor kanamycin is directly proportional to the expression strength of the resistance gene nptII in transgenic tobacco plastids. By testing various combinations of promoters and translation initiation signals, we have used this experimental system to identify cis-elements that are highly active in non-green plastids. Surprisingly, heterologous expression elements from maize plastids were significantly more efficient in conferring high expression levels in root plastids than homologous expression elements from tobacco. Our work has established a quantitative method for characterization of gene expression in non-green plastid types, and has led to identification of cis-elements for efficient plastid transgene expression in non-green tissues, which are valuable tools for future transplastomic studies in basic and applied research.

  13. Repressive BMP2 gene regulatory elements near the BMP2 promoter

    SciTech Connect

    Jiang, Shan; Chandler, Ronald L.; Fritz, David T.; Mortlock, Douglas P.; Rogers, Melissa B.

    2010-02-05

    The level of bone morphogenetic protein 2 (BMP2) profoundly influences essential cell behaviors such as proliferation, differentiation, apoptosis, and migration. The spatial and temporal pattern of BMP2 synthesis, particular in diverse embryonic cells, is highly varied and dynamic. We have identified GC-rich sequences within the BMP2 promoter region that strongly repress gene expression. These elements block the activity of a highly conserved, osteoblast enhancer in response to FGF2 treatment. Both positive and negative gene regulatory elements control BMP2 synthesis. Detecting and mapping the repressive motifs is essential because they impede the identification of developmentally regulated enhancers necessary for normal BMP2 patterns and concentration.

  14. Transposable Elements Contribute to Activation of Maize Genes in Response to Abiotic Stress

    PubMed Central

    Makarevitch, Irina; Waters, Amanda J.; West, Patrick T.; Stitzer, Michelle; Hirsch, Candice N.; Ross-Ibarra, Jeffrey; Springer, Nathan M.

    2015-01-01

    Transposable elements (TEs) account for a large portion of the genome in many eukaryotic species. Despite their reputation as “junk” DNA or genomic parasites deleterious for the host, TEs have complex interactions with host genes and the potential to contribute to regulatory variation in gene expression. It has been hypothesized that TEs and genes they insert near may be transcriptionally activated in response to stress conditions. The maize genome, with many different types of TEs interspersed with genes, provides an ideal system to study the genome-wide influence of TEs on gene regulation. To analyze the magnitude of the TE effect on gene expression response to environmental changes, we profiled gene and TE transcript levels in maize seedlings exposed to a number of abiotic stresses. Many genes exhibit up- or down-regulation in response to these stress conditions. The analysis of TE families inserted within upstream regions of up-regulated genes revealed that between four and nine different TE families are associated with up-regulated gene expression in each of these stress conditions, affecting up to 20% of the genes up-regulated in response to abiotic stress, and as many as 33% of genes that are only expressed in response to stress. Expression of many of these same TE families also responds to the same stress conditions. The analysis of the stress-induced transcripts and proximity of the transposon to the gene suggests that these TEs may provide local enhancer activities that stimulate stress-responsive gene expression. Our data on allelic variation for insertions of several of these TEs show strong correlation between the presence of TE insertions and stress-responsive up-regulation of gene expression. Our findings suggest that TEs provide an important source of allelic regulatory variation in gene response to abiotic stress in maize. PMID:25569788

  15. Transposable elements: an abundant and natural source of regulatory sequences for host genes.

    PubMed

    Rebollo, Rita; Romanish, Mark T; Mager, Dixie L

    2012-01-01

    The fact that transposable elements (TEs) can influence host gene expression was first recognized more than 50 years ago. However, since that time, TEs have been widely regarded as harmful genetic parasites-selfish elements that are rarely co-opted by the genome to serve a beneficial role. Here, we survey recent findings that relate to TE impact on host genes and remind the reader that TEs, in contrast to other noncoding parts of the genome, are uniquely suited to gene regulatory functions. We review recent studies that demonstrate the role of TEs in establishing and rewiring gene regulatory networks and discuss the overall ubiquity of exaptation. We suggest that although individuals within a population can be harmed by the deleterious effects of new TE insertions, the presence of TE sequences in a genome is of overall benefit to the population. PMID:22905872

  16. A characterization of the elements comprising the promoter of the mouse ribosomal protein gene RPS16.

    PubMed

    Hariharan, N; Perry, R P

    1989-07-11

    The elements comprising the mouse rpS16 promoter were characterized by transfection experiments with mutant genes in which various portions of the 5' flanking region and exon I were removed or substituted with extraneous DNA sequence. These experiments were carried out with otherwise intact rpS16 genes transfected into monkey kidney (COS) cells and also with chimeric rpS16-CAT gene constructs transfected into mouse plasmacytoma cells and COS cells. The locations of the functionally important elements were generally correlated with the locations of binding sites for specific nuclear factors, which were identified by gel-mobility shift analyses and methylation interference footprints. The most upstream element, which is located approximately 165 bp from the cap site, binds the Sp1 transcription factor and augments the promoter activity by 2 to 2.5-fold. In addition, there is a complex bipartite element in the -83 to -59 region, an element in the -37 to -12 region and an element in the +9 to +29 region of exon I, all of which are essential for rpS16 expression. The rpS16 promoter has a general architecture that resembles other mouse rp promoters; however, it also possesses some distinctive characteristics. PMID:2762128

  17. Rearrangement of Upstream Regulatory Elements Leads to Ectopic Expression of the Drosophila Mulleri Adh-2 Gene

    PubMed Central

    Falb, D.; Fischer, J.; Maniatis, T.

    1992-01-01

    The Adh-2 gene of Drosophila mulleri is expressed in the larval fat body and the adult fat body and hindgut, and a 1500-bp element located 2-3 kb upstream of the Adh-2 promoter is necessary for maximal levels of transcription. Previous work demonstrated that deletion of sequences between this upstream element and the Adh-2 promoter results in Adh-2 gene expression in a novel larval tissue, the middle midgut. In this study we show that the upstream element possesses all of the characteristics of a transcriptional enhancer: its activity is independent of orientation, it acts on a heterologous promoter, and it functions at various positions both 5' and 3' to the Adh-2 gene. Full enhancer function can be localized to a 750-bp element, although other regions possess some redundant activity. The ectopic expression pattern is dependent on the proximity of at least two sequence elements. Thus, tissue-specific transcription can involve complex proximity-dependent interactions among combinations of regulatory elements. PMID:1459428

  18. The uteroglobin gene region: hormonal regulation, repetitive elements and complete nucleotide sequence of the gene.

    PubMed Central

    Suske, G; Wenz, M; Cato, A C; Beato, M

    1983-01-01

    Differential uteroglobin induction represents an appropriate model for the molecular analysis of the mechanism by which steroid hormones control gene expression in mammals. We have analyzed the structure and hormonal regulation of a 35 Kb region of genomic DNA in which the uteroglobin gene is located. The complete sequence of 3,700 nucleotides including the uteroglobin gene and its flanking regions has been determined, and the limits of the gene established by S1 nuclease mapping. Several regions containing repeated sequences were mapped by blot hybridization, one of which is located within the large intron in the uteroglobin gene. Analysis of the RNAs extracted from endometrium, lung and liver, after treatment with estrogen and/or progesterone shows that within the 35 Kb region, the uteroglobin gene is the only DNA segment whose transcription into stable RNA is induced by progesterone. Images PMID:6304644

  19. Comparative genome sequencing of drosophila pseudoobscura: Chromosomal, gene and cis-element evolution

    SciTech Connect

    Richards, Stephen; Liu, Yue; Bettencourt, Brian R.; Hradecky, Pavel; Letovsky, Stan; Nielsen, Rasmus; Thornton, Kevin; Todd, Melissa J.; Chen, Rui; Meisel, Richard P.; Couronne, Olivier; Hua, Sujun; Smith, Mark A.; Bussemaker, Harmen J.; van Batenburg, Marinus F.; Howells, Sally L.; Scherer, Steven E.; Sodergren, Erica; Matthews, Beverly B.; Crosby, Madeline A.; Schroeder, Andrew J.; Ortiz-Barrientos, Daniel; Rives, Catherine M.; Metzker, Michael L.; Muzny, Donna M.; Scott, Graham; Steffen, David; Wheeler, David A.; Worley, Kim C.; Havlak, Paul; Durbin, K. James; Egan, Amy; Gill, Rachel; Hume, Jennifer; Morgan, Margaret B.; Miner, George; Hamilton, Cerissa; Huang, Yanmei; Waldron, Lenee; Verduzco, Daniel; Blankenburg, Kerstin P.; Dubchak, Inna; Noor, Mohamed A.F.; Anderson, Wyatt; White, Kevin P.; Clark, Andrew G.; Schaeffer, Stephen W.; Gelbart, William; Weinstock, George M.; Gibbs, Richard A.

    2004-04-01

    The genome sequence of a second fruit fly, D. pseudoobscura, presents an opportunity for comparative analysis of a primary model organism D. melanogaster. The vast majority of Drosophila genes have remained on the same arm, but within each arm gene order has been extensively reshuffled leading to the identification of approximately 1300 syntenic blocks. A repetitive sequence is found in the D. pseudoobscura genome at many junctions between adjacent syntenic blocks. Analysis of this novel repetitive element family suggests that recombination between offset elements may have given rise to many paracentric inversions, thereby contributing to the shuffling of gene order in the D. pseudoobscura lineage. Based on sequence similarity and synteny, 10,516 putative orthologs have been identified as a core gene set conserved over 35 My since divergence. Genes expressed in the testes had higher amino acid sequence divergence than the genome wide average consistent with the rapid evolution of sex-specific proteins. Cis-regulatory sequences are more conserved than control sequences between the species but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible. Overall, a picture of repeat mediated chromosomal rearrangement, and high co-adaptation of both male genes and cis-regulatory sequences emerges as important themes of genome divergence between these species of Drosophila.

  20. Comparative genome sequencing of Drosophila pseudoobscura: Chromosomal, gene, and cis-element evolution

    PubMed Central

    Richards, Stephen; Liu, Yue; Bettencourt, Brian R.; Hradecky, Pavel; Letovsky, Stan; Nielsen, Rasmus; Thornton, Kevin; Hubisz, Melissa J.; Chen, Rui; Meisel, Richard P.; Couronne, Olivier; Hua, Sujun; Smith, Mark A.; Zhang, Peili; Liu, Jing; Bussemaker, Harmen J.; van Batenburg, Marinus F.; Howells, Sally L.; Scherer, Steven E.; Sodergren, Erica; Matthews, Beverly B.; Crosby, Madeline A.; Schroeder, Andrew J.; Ortiz-Barrientos, Daniel; Rives, Catharine M.; Metzker, Michael L.; Muzny, Donna M.; Scott, Graham; Steffen, David; Wheeler, David A.; Worley, Kim C.; Havlak, Paul; Durbin, K. James; Egan, Amy; Gill, Rachel; Hume, Jennifer; Morgan, Margaret B.; Miner, George; Hamilton, Cerissa; Huang, Yanmei; Waldron, Lenée; Verduzco, Daniel; Clerc-Blankenburg, Kerstin P.; Dubchak, Inna; Noor, Mohamed A.F.; Anderson, Wyatt; White, Kevin P.; Clark, Andrew G.; Schaeffer, Stephen W.; Gelbart, William; Weinstock, George M.; Gibbs, Richard A.

    2005-01-01

    We have sequenced the genome of a second Drosophila species, Drosophila pseudoobscura, and compared this to the genome sequence of Drosophila melanogaster, a primary model organism. Throughout evolution the vast majority of Drosophila genes have remained on the same chromosome arm, but within each arm gene order has been extensively reshuffled, leading to a minimum of 921 syntenic blocks shared between the species. A repetitive sequence is found in the D. pseudoobscura genome at many junctions between adjacent syntenic blocks. Analysis of this novel repetitive element family suggests that recombination between offset elements may have given rise to many paracentric inversions, thereby contributing to the shuffling of gene order in the D. pseudoobscura lineage. Based on sequence similarity and synteny, 10,516 putative orthologs have been identified as a core gene set conserved over 25–55 million years (Myr) since the pseudoobscura/melanogaster divergence. Genes expressed in the testes had higher amino acid sequence divergence than the genome-wide average, consistent with the rapid evolution of sex-specific proteins. Cis-regulatory sequences are more conserved than random and nearby sequences between the species—but the difference is slight, suggesting that the evolution of cis-regulatory elements is flexible. Overall, a pattern of repeat-mediated chromosomal rearrangement, and high coadaptation of both male genes and cis-regulatory sequences emerges as important themes of genome divergence between these species of Drosophila. PMID:15632085

  1. Scavenger receptor A gene regulatory elements target gene expression to macrophages and to foam cells of atherosclerotic lesions.

    PubMed Central

    Horvai, A; Palinski, W; Wu, H; Moulton, K S; Kalla, K; Glass, C K

    1995-01-01

    Transcription of the macrophage scavenger receptor A gene is markedly upregulated during monocyte to macrophage differentiation. In these studies, we demonstrate that 291 bp of the proximal scavenger receptor promoter, in concert with a 400-bp upstream enhancer element, is sufficient to direct macrophage-specific expression of a human growth hormone reporter in transgenic mice. These regulatory elements, which contain binding sites for PU.1, AP-1, and cooperating ets-domain transcription factors, are also sufficient to mediate regulation of transgene expression during the in vitro differentiation of bone marrow progenitor cells in response to macrophage colony-stimulating factor. Mutation of the PU.1 binding site within the scavenger receptor promoter severely impairs transgene expression, consistent with a crucial role of PU.1 in regulating the expression of the scavenger receptor gene. The ability of the scavenger receptor promoter and enhancer to target gene expression to macrophages in vivo, including foam cells of atherosclerotic lesions, suggests that these regulatory elements will be of general utility in the study of macrophage differentiation and function by permitting specific modifications of macrophage gene expression. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:7777517

  2. A functional analysis of the P-element gene-transfer vector in insects

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A P-element mobility excision assay was used to determine if non-drosophilid insects could support P gene vector function. Present studies included the testing of Muscids, Sphaerocerids, and Phorids, none of which were able to support P mobility. A new excision indicator plasmid was developed allowi...

  3. VIP gene transcription is regulated by far upstream enhancer and repressor elements.

    PubMed

    Liu, D; Krajniak, K; Chun, D; Sena, M; Casillas, R; Lelièvre, V; Nguyen, T; Bravo, D; Colburn, S; Waschek, J A

    2001-06-01

    SK-N-SH human neuroblastoma subclones differ widely in basal and second messenger induction of the gene encoding the neuropeptide vasoactive intestinal peptide (VIP). These differences were recapitulated by a chimeric gene which consisted of 5.2 kb of the human VIP gene 5' flanking sequence fused to a reporter. Subsequent gene deletion experiments revealed several regulatory regions on the gene, including a 645-bp sequence located approximately 4.0 upstream from the transcription start site. Here we examined this upstream region in detail. Inhibitory sequences were found to be present on each end of the 645-bp fragment. When removed, basal transcription increased more than 50-fold. Subsequent deletion/mutation analysis showed that the 213-bp fragment contained at least two enhancer elements. One of these was localized to an AT-rich 42-bp sequence shown by others to bind Oct proteins in neuroblastoma cells, while the other corresponded to a composite AP-1/ets element. In addition to these enhancers, a 28-bp sequence on the 213-bp fragment with no apparent homology to known silencers inhibited transcription. The studies provide molecular details of a complex regulatory region on the VIP gene that is likely to be used to finely tune the level of gene transcription in vivo.

  4. Analysis of functional elements in the human Egr-1 gene promoter.

    PubMed

    Aicher, W K; Sakamoto, K M; Hack, A; Eibel, H

    1999-01-01

    The early growth response (Egr)-1 gene encoding a zinc-finger transcription factor is transiently induced in many different cell types upon various differentiation signals. However, in synovial fibroblasts of rheumatoid arthritis patients, Egr-1 is constitutively expressed at high levels, and several genes with Egr-1 binding sites in their promoter regions have been associated with disease progression of RA. We analyzed the control of Egr-1 transcription by characterizing those regulatory elements in the Egr-1 promoter that induce Egr-1 expression in fibroblasts. Using reporter gene assays and deletion mutants of the Egr-1 promoter we could demonstrate that Egr-1 transcription is mainly activated by a single serum response element, whereas other transcription factor binding sites, including binding sites for AP-1 or Egr-1, were found to play a minor role. Furthermore, we identified a novel regulatory element in the human Egr-1 promoter similar to a NF kappa-B binding site. Deletion of this element enhanced Egr-1 promoter activity in 3T3 but not in L929 fibroblasts. Stimulation by phorbolester induced only transient Egr-1 expression in 3T3 fibroblasts but a extended expression of Egr-1 in L929 cells. These data suggest that in fibroblasts the most proximal serum response element in the Egr-1 promoter represents the major activation site, whereas binding of the NFkB-like factor may serve as negative regulatory signal for Egr-1 transcription in fibroblasts.

  5. Functional characterization of transcriptional regulatory elements in the upstream region of the yeast GLK1 gene.

    PubMed Central

    Herrero, P; Flores, L; de la Cera, T; Moreno, F

    1999-01-01

    The glucokinase gene GLK1 of the yeast Saccharomyces cerevisiae is transcriptionally regulated in response to the carbon source of the growth medium. Northern-blot analysis shows that the GLK1 gene is expressed at a basal level in the presence of glucose, de-repressed more than 6-fold under conditions of sugar limitation and more than 25-fold under conditions of ethanol induction. lacZ fusions of the GLK1 gene promoter were constructed and a deletion analysis was performed in order to identify the cis-acting regulatory elements of the promoter that controls GLK1 gene expression. First, the expression seemed to be mediated mainly by one GCR1 and three stress-responsive element (STRE) activating elements. Secondly, an ethanol repression autoregulation (ERA)/twelve-fold TA repeat (TAB) repressor element was identified within the promoter region of the GLK1 gene. A specific and differential protein binding to the STRE was observed with extracts from de-repressed and repressed cells. No differential binding to the GCR1 or ERA/TAB elements was observed with extracts from de-repressed and repressed cells, but, in both cases, the binding was competed for by an excess of the unlabelled GLK1(GCR1) and GLK1(ERA) sequence. The transcription factors Msn2 and Msn4, which bind to the GLK1 upstream region through the STRE, contribute to inductive activation. The transcription factor Gcr1, which binds through the GCR1 element, contributes to constitutive activation. In order to achieve the severe glucose repression of GLK1, constitutive repressor factors acting through the ERA/TAB element must counteract constitutive activation generated by Gcr1 binding to the GCR1 element. Full expression of the GLK1 gene is produced by inductive activation of three STRE when Msn2 and Msn4 proteins are translocated to the nucleus by covalent modification. The combinatorial effect of the entire region leads to the regulated transcription of GLK1, i.e., silent in media with glucose and other

  6. A negative element involved in Kaposi's sarcoma-associated herpesvirus-encoded ORF11 gene expression

    SciTech Connect

    Chen, Lei

    2009-01-01

    The ORF11 of the Kaposi's sarcoma-associated herpesvirus (KSHV) is a lytic viral gene with delayed-early expression kinetics. How the ORF11 gene expression is regulated in the KSHV lytic cascade is largely unknown. Here we report that the deletion of the KSHV viral IL-6 gene from the viral genome leads to deregulated ORF11 gene expression. The KSHV-encoded viral IL-6 protein was found not to be essentially involved in the regulation of ORF11, suggesting a potential transcriptional cis-regulation. A negative element was identified downstream of the ORF11 gene, which suppresses the ORF11 basal promoter activity in a position-independent manner.

  7. Identification and characterization of a cis-regulatory element for zygotic gene expression in Chlamydomonas reinhardtii

    DOE PAGES

    Hamaji, Takashi; Lopez, David; Pellegrini, Matteo; Umen, James

    2016-03-26

    Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C. reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient tomore » confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. Furthermore, we predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes.« less

  8. Identification and Characterization of a cis-Regulatory Element for Zygotic Gene Expression in Chlamydomonas reinhardtii

    PubMed Central

    Hamaji, Takashi; Lopez, David; Pellegrini, Matteo; Umen, James

    2016-01-01

    Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C. reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient to confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. We predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes. PMID:27172209

  9. Identification and Characterization of a cis-Regulatory Element for Zygotic Gene Expression in Chlamydomonas reinhardtii.

    PubMed

    Hamaji, Takashi; Lopez, David; Pellegrini, Matteo; Umen, James

    2016-01-01

    Upon fertilization Chlamydomonas reinhardtii zygotes undergo a program of differentiation into a diploid zygospore that is accompanied by transcription of hundreds of zygote-specific genes. We identified a distinct sequence motif we term a zygotic response element (ZYRE) that is highly enriched in promoter regions of C reinhardtii early zygotic genes. A luciferase reporter assay was used to show that native ZYRE motifs within the promoter of zygotic gene ZYS3 or intron of zygotic gene DMT4 are necessary for zygotic induction. A synthetic luciferase reporter with a minimal promoter was used to show that ZYRE motifs introduced upstream are sufficient to confer zygotic upregulation, and that ZYRE-controlled zygotic transcription is dependent on the homeodomain transcription factor GSP1. We predict that ZYRE motifs will correspond to binding sites for the homeodomain proteins GSP1-GSM1 that heterodimerize and activate zygotic gene expression in early zygotes. PMID:27172209

  10. Transfer of antibiotic-resistance genes via phage-related mobile elements.

    PubMed

    Brown-Jaque, Maryury; Calero-Cáceres, William; Muniesa, Maite

    2015-05-01

    Antibiotic resistance is a major concern for society because it threatens the effective prevention of infectious diseases. While some bacterial strains display intrinsic resistance, others achieve antibiotic resistance by mutation, by the recombination of foreign DNA into the chromosome or by horizontal gene acquisition. In many cases, these three mechanisms operate together. Several mobile genetic elements (MGEs) have been reported to mobilize different types of resistance genes and despite sharing common features, they are often considered and studied separately. Bacteriophages and phage-related particles have recently been highlighted as MGEs that transfer antibiotic resistance. This review focuses on phages, phage-related elements and on composite MGEs (phages-MGEs) involved in antibiotic resistance mobility. We review common features of these elements, rather than differences, and provide a broad overview of the antibiotic resistance transfer mechanisms observed in nature, which is a necessary first step to controlling them.

  11. Chromatin boundary elements organize genomic architecture and developmental gene regulation in Drosophila Hox clusters.

    PubMed

    Ma, Zhibo; Li, Mo; Roy, Sharmila; Liu, Kevin J; Romine, Matthew L; Lane, Derrick C; Patel, Sapna K; Cai, Haini N

    2016-08-26

    The three-dimensional (3D) organization of the eukaryotic genome is critical for its proper function. Evidence suggests that extensive chromatin loops form the building blocks of the genomic architecture, separating genes and gene clusters into distinct functional domains. These loops are anchored in part by a special type of DNA elements called chromatin boundary elements (CBEs). CBEs were originally found to insulate neighboring genes by blocking influences of transcriptional enhancers or the spread of silent chromatin. However, recent results show that chromatin loops can also play a positive role in gene regulation by looping out intervening DNA and "delivering" remote enhancers to gene promoters. In addition, studies from human and model organisms indicate that the configuration of chromatin loops, many of which are tethered by CBEs, is dynamically regulated during cell differentiation. In particular, a recent work by Li et al has shown that the SF1 boundary, located in the Drosophila Hox cluster, regulates local genes by tethering different subsets of chromatin loops: One subset enclose a neighboring gene ftz, limiting its access by the surrounding Scr enhancers and restrict the spread of repressive histones during early embryogenesis; and the other loops subdivide the Scr regulatory region into independent domains of enhancer accessibility. The enhancer-blocking activity of these CBE elements varies greatly in strength and tissue distribution. Further, tandem pairing of SF1 and SF2 facilitate the bypass of distal enhancers in transgenic flies, providing a mechanism for endogenous enhancers to circumvent genomic interruptions resulting from chromosomal rearrangement. This study demonstrates how a network of chromatin boundaries, centrally organized by SF1, can remodel the 3D genome to facilitate gene regulation during development. PMID:27621770

  12. Chromatin boundary elements organize genomic architecture and developmental gene regulation in Drosophila Hox clusters

    PubMed Central

    Ma, Zhibo; Li, Mo; Roy, Sharmila; Liu, Kevin J; Romine, Matthew L; Lane, Derrick C; Patel, Sapna K; Cai, Haini N

    2016-01-01

    The three-dimensional (3D) organization of the eukaryotic genome is critical for its proper function. Evidence suggests that extensive chromatin loops form the building blocks of the genomic architecture, separating genes and gene clusters into distinct functional domains. These loops are anchored in part by a special type of DNA elements called chromatin boundary elements (CBEs). CBEs were originally found to insulate neighboring genes by blocking influences of transcriptional enhancers or the spread of silent chromatin. However, recent results show that chromatin loops can also play a positive role in gene regulation by looping out intervening DNA and “delivering” remote enhancers to gene promoters. In addition, studies from human and model organisms indicate that the configuration of chromatin loops, many of which are tethered by CBEs, is dynamically regulated during cell differentiation. In particular, a recent work by Li et al has shown that the SF1 boundary, located in the Drosophila Hox cluster, regulates local genes by tethering different subsets of chromatin loops: One subset enclose a neighboring gene ftz, limiting its access by the surrounding Scr enhancers and restrict the spread of repressive histones during early embryogenesis; and the other loops subdivide the Scr regulatory region into independent domains of enhancer accessibility. The enhancer-blocking activity of these CBE elements varies greatly in strength and tissue distribution. Further, tandem pairing of SF1 and SF2 facilitate the bypass of distal enhancers in transgenic flies, providing a mechanism for endogenous enhancers to circumvent genomic interruptions resulting from chromosomal rearrangement. This study demonstrates how a network of chromatin boundaries, centrally organized by SF1, can remodel the 3D genome to facilitate gene regulation during development.

  13. Chromatin boundary elements organize genomic architecture and developmental gene regulation in Drosophila Hox clusters

    PubMed Central

    Ma, Zhibo; Li, Mo; Roy, Sharmila; Liu, Kevin J; Romine, Matthew L; Lane, Derrick C; Patel, Sapna K; Cai, Haini N

    2016-01-01

    The three-dimensional (3D) organization of the eukaryotic genome is critical for its proper function. Evidence suggests that extensive chromatin loops form the building blocks of the genomic architecture, separating genes and gene clusters into distinct functional domains. These loops are anchored in part by a special type of DNA elements called chromatin boundary elements (CBEs). CBEs were originally found to insulate neighboring genes by blocking influences of transcriptional enhancers or the spread of silent chromatin. However, recent results show that chromatin loops can also play a positive role in gene regulation by looping out intervening DNA and “delivering” remote enhancers to gene promoters. In addition, studies from human and model organisms indicate that the configuration of chromatin loops, many of which are tethered by CBEs, is dynamically regulated during cell differentiation. In particular, a recent work by Li et al has shown that the SF1 boundary, located in the Drosophila Hox cluster, regulates local genes by tethering different subsets of chromatin loops: One subset enclose a neighboring gene ftz, limiting its access by the surrounding Scr enhancers and restrict the spread of repressive histones during early embryogenesis; and the other loops subdivide the Scr regulatory region into independent domains of enhancer accessibility. The enhancer-blocking activity of these CBE elements varies greatly in strength and tissue distribution. Further, tandem pairing of SF1 and SF2 facilitate the bypass of distal enhancers in transgenic flies, providing a mechanism for endogenous enhancers to circumvent genomic interruptions resulting from chromosomal rearrangement. This study demonstrates how a network of chromatin boundaries, centrally organized by SF1, can remodel the 3D genome to facilitate gene regulation during development. PMID:27621770

  14. Two distinct promoter elements in the human rRNA gene identified by linker scanning mutagenesis.

    PubMed Central

    Haltiner, M M; Smale, S T; Tjian, R

    1986-01-01

    A cell-free RNA polymerase I transcription system was used to evaluate the transcription efficiency of 21 linker scanning mutations that span the human rRNA gene promoter. Our analysis revealed the presence of two major control elements, designated the core and upstream elements, that affect the level of transcription initiation. The core element extends from -45 to +18 relative to the RNA start site, and transcription is severely affected (up to 100-fold) by linker scanning mutations in this region. Linker scanning and deletion mutations in the upstream element, located between nucleotides -156 and -107, cause a three- to fivefold reduction in transcription. Under certain reaction conditions, such as the presence of a high ratio of protein to template or supplementation of the reaction with partially purified protein fractions, sequences upstream of the core element can have an even greater effect (20- to 50-fold) on RNA polymerase I transcription. Primer extension analysis showed that RNA synthesized from all of these mutant templates is initiated at the correct in vivo start site. To examine the functional relationship between the core and the upstream region, mutant promoters were constructed that alter the orientation, distance, or multiplicity of these control elements relative to each other. The upstream control element appears to function in only one orientation, and its position relative to the core is constrained within a fairly narrow region. Moreover, multiple core elements in close proximity to each other have an inhibitory effect on transcription. Images PMID:3785147

  15. Regulatory elements required for the activation and repression of the protocadherin-alpha gene cluster.

    PubMed

    Kehayova, Polina; Monahan, Kevin; Chen, Weisheng; Maniatis, Tom

    2011-10-11

    The mouse protocadherin (Pcdh) -α, -β, and -γ gene clusters encode more than 50 protein isoforms, the combinatorial expression of which generates vast single-cell diversity in the brain. At present, the mechanisms by which this diversity is expressed are not understood. Here we show that two transcriptional enhancer elements, HS5-1 and HS7, play a critical role in Pcdhα gene expression in mice. We show that the HS5-1 element functions as an enhancer in neurons and a silencer in nonneuronal cells. The enhancer activity correlates with the binding of zinc finger DNA binding protein CTCF to the target promoters, and the silencer activity requires the binding of the REST/NRSF repressor complex in nonneuronal cells. Thus, the HS5-1 element functions as a neuron-specific enhancer and nonneuronal cell repressor. In contrast, the HS7 element functions as a Pcdhα cluster-wide transcription enhancer element. These studies reveal a complex organization of regulatory elements required for generating single cell Pcdh diversity. PMID:21949399

  16. Functional redundancy of promoter elements ensures efficient transcription of the human 7SK gene in vivo.

    PubMed

    Boyd, D C; Turner, P C; Watkins, N J; Gerster, T; Murphy, S

    1995-11-10

    Deletion and mutation studies of the human 7SK gene transfected into HeLa cells have identified three functional regions of the promoter corresponding to the TATA box at -25, the proximal sequence element (PSE) between -49 and -65 and the distal sequence element (DSE) between -243 and -210. These elements show sequence homology to equivalent regions in other snRNA genes and are functionally analogous. Unlike the DSEs of many snRNA genes however, the 7SK DSE does not contain a consensus binding site for the transcription factor Oct-1 but rather, contains two non-consensus Oct-1 binding sites that can function independently of one another to enhance transcription. Unusually, the 7SK PSE can retain function even after extensive mutation and removal of the conserved TGACC of the PSE has little effect in the context of the whole promoter. However, the same mutation abolishes transcription in the absence of the DSE suggesting that protein/protein interactions between DSE and PSE binding factors can compensate for a mutant PSE. Mutation of the 7SK TATA box allows snRNA type transcription by RNA polymerase II to occur and this is enhanced by the DSE, indicating that both the DSE and the PSE can also function with pol II. In addition, mutation of the TATA box does not abolish pol III dependent transcription, suggesting that other sequence elements may also play a role in the determination of polymerase specificity. Although the human 7SK gene is transcribed efficiently in Xenopus oocytes, analysis of the 7SK wild-type gene and mutants in Xenopus oocytes gives significantly different results from the analysis in HeLa cells indicating that the recognition of functional elements is not the same in the two systems.

  17. Identification of peroxisome-proliferator responsive element in the mouse HSL gene

    SciTech Connect

    Yajima, Hiroaki . E-mail: hyajima@kirin.co.jp; Kobayashi, Yumie; Kanaya, Tomoka; Horino, Yoko

    2007-01-12

    Hormone-sensitive lipase (HSL) catalyzes the rate-limiting step of lipolysis in adipose tissue. Several studies suggest that protein phosphorylation regulates the HSL enzymatic activity. On the other hand, the precise mechanism of the transcriptional regulation of the HSL gene remains to be elucidated. Here, we identified a functional peroxisome-proliferator responsive element (PPRE) in the mouse HSL promoter by reporter assay in CV-1 cells using serial deletion and point mutants of the 5'-flanking region. Chromatin immunoprecipitation (ChIP) analysis revealed that both peroxisome-proliferator activated receptor (PPAR{gamma}) and retinoid X receptor (RXR{alpha}) interacted with the region. Binding of the PPAR{gamma}/RXR{alpha} heterodimer to the PPRE sequence was also confirmed by electrophoretic mobility shift assay. These results indicate that the HSL gene is transcriptionally regulated by PPAR{gamma}/RXR{alpha} heterodimer, and suggest that a cis-acting element regulates the HSL gene expression.

  18. Identification of peroxisome-proliferator responsive element in the mouse HSL gene.

    PubMed

    Yajima, Hiroaki; Kobayashi, Yumie; Kanaya, Tomoka; Horino, Yoko

    2007-01-12

    Hormone-sensitive lipase (HSL) catalyzes the rate-limiting step of lipolysis in adipose tissue. Several studies suggest that protein phosphorylation regulates the HSL enzymatic activity. On the other hand, the precise mechanism of the transcriptional regulation of the HSL gene remains to be elucidated. Here, we identified a functional peroxisome-proliferator responsive element (PPRE) in the mouse HSL promoter by reporter assay in CV-1 cells using serial deletion and point mutants of the 5'-flanking region. Chromatin immunoprecipitation (ChIP) analysis revealed that both peroxisome-proliferator activated receptor (PPARgamma) and retinoid X receptor (RXRalpha) interacted with the region. Binding of the PPARgamma/RXRalpha heterodimer to the PPRE sequence was also confirmed by electrophoretic mobility shift assay. These results indicate that the HSL gene is transcriptionally regulated by PPARgamma/RXRalpha heterodimer, and suggest that a cis-acting element regulates the HSL gene expression.

  19. DNA elements regulating alpha1-tubulin gene induction during regeneration of eukaryotic flagella.

    PubMed

    Periz, G; Keller, L R

    1997-07-01

    Eukaryotic flagella are complex organelles composed of more than 200 polypeptides. Little is known about the regulatory mechanisms governing synthesis of the flagellar protein subunits and their assembly into this complex organelle. The unicellular green alga Chlamydomonas reinhardtii is the premier experimental model system for studying such cellular processes. When acid shocked, C. reinhardtii excises its flagella, rapidly and coordinately activates transcription of a set of flagellar genes, and ultimately regenerates a new flagellar pair. To define functionally the regulatory sequences that govern induction of the set of genes after acid shock, we analyzed the alpha1-tubulin gene promoter. To simplify transcriptional analysis in vivo, we inserted the selectable marker gene ARG7 on the same plasmid with a tagged alpha1-tubulin gene and stably introduced it into C. reinhardtii cells. By deletion of various sequences, two promoter regions (-176 to -122 and -85 to -16) were identified as important for induction of the tagged alpha1-tubulin gene. Deleting the region between -176 and -122 from the transcription start site resulted in an induction level which was only 45 to 70% of that of the resident gene. Deleting the region upstream of -56 resulted in a complete loss of inducibility without affecting basal expression. The alpha1-tubulin promoter region from -85 to -16 conferred partial acid shock inducibility to an arylsulfatase (ARS) reporter gene. These results show that induction of the alpha1-tubulin gene after acid shock is a complex response that requires diverse sequence elements.

  20. DNA elements regulating alpha1-tubulin gene induction during regeneration of eukaryotic flagella.

    PubMed Central

    Periz, G; Keller, L R

    1997-01-01

    Eukaryotic flagella are complex organelles composed of more than 200 polypeptides. Little is known about the regulatory mechanisms governing synthesis of the flagellar protein subunits and their assembly into this complex organelle. The unicellular green alga Chlamydomonas reinhardtii is the premier experimental model system for studying such cellular processes. When acid shocked, C. reinhardtii excises its flagella, rapidly and coordinately activates transcription of a set of flagellar genes, and ultimately regenerates a new flagellar pair. To define functionally the regulatory sequences that govern induction of the set of genes after acid shock, we analyzed the alpha1-tubulin gene promoter. To simplify transcriptional analysis in vivo, we inserted the selectable marker gene ARG7 on the same plasmid with a tagged alpha1-tubulin gene and stably introduced it into C. reinhardtii cells. By deletion of various sequences, two promoter regions (-176 to -122 and -85 to -16) were identified as important for induction of the tagged alpha1-tubulin gene. Deleting the region between -176 and -122 from the transcription start site resulted in an induction level which was only 45 to 70% of that of the resident gene. Deleting the region upstream of -56 resulted in a complete loss of inducibility without affecting basal expression. The alpha1-tubulin promoter region from -85 to -16 conferred partial acid shock inducibility to an arylsulfatase (ARS) reporter gene. These results show that induction of the alpha1-tubulin gene after acid shock is a complex response that requires diverse sequence elements. PMID:9199320

  1. Report of a chimeric origin of transposable elements in a bovine-coding gene.

    PubMed

    Almeida, L M; Amaral, M E J; Silva, I T; Silva, W A; Riggs, P K; Carareto, C M

    2008-02-01

    Despite the wide distribution of transposable elements (TEs) in mammalian genomes, part of their evolutionary significance remains to be discovered. Today there is a substantial amount of evidence showing that TEs are involved in the generation of new exons in different species. In the present study, we searched 22,805 genes and reported the occurrence of TE-cassettes in coding sequences of 542 cow genes using the RepeatMasker program. Despite the significant number (542) of genes with TE insertions in exons only 14 (2.6%) of them were translated into protein, which we characterized as chimeric genes. From these chimeric genes, only the FAST kinase domains 3 (FASTKD3) gene, present on chromosome BTA 20, is a functional gene and showed evidence of the exaptation event. The genome sequence analysis showed that the last exon coding sequence of bovine FASTKD3 is approximately 85% similar to the ART2A retrotransposon sequence. In addition, comparison among FASTKD3 proteins shows that the last exon is very divergent from those of Homo sapiens, Pan troglodytes and Canis familiares. We suggest that the gene structure of bovine FASTKD3 gene could have originated by several ectopic recombinations between TE copies. Additionally, the absence of TE sequences in all other species analyzed suggests that the TE insertion is clade-specific, mainly in the ruminant lineage.

  2. A VNTR element associated with steroid sulfatase gene deletions stimulates recombination in cultured cells

    SciTech Connect

    Gong, Y.; Li, X.M.; Shapiro, L.J.

    1994-09-01

    Steroid sulfatase deficiency is a common genetic disorder, with a prevalence of approximately one in every 3500 males world wide. About 90% of these patients have complete gene deletions, which appear to result from recombination between members of a low-copy repeat family (CRI-232 is the prototype) that flank the gene. RU1 and RU2 are two VNTR elements found within each of these family members. RU1 consists of 30 bp repeating units and its length shows minimal variation among individuals. The RU2 element consists of repeating sequences which are highly asymmetric, with about 90% purines and no C`s on one strand, and range from 0.6 kb to over 23 kb among different individuals. We conducted a study to determine if the RU1 or RU2 elements can promote recombination in an in vivo test system. We inserted these elements adjacent to the neo gene in each of two pSV2neo derivatives, one of which has a deletion in the 5{prime} portion of the neo gene and the other having a deletion in the 3{prime} portion. These plasmids were combined and used to transfect EJ cells. Survival of cells in G418 indicates restoration of a functional neo gene by recombination between two deletion constructs. Thus counting G418 resistant colonies gives a quantitative measure of the enhancement of recombination by the inserted VNTR elements. The results showed no effect on recombination by the inserted RU1 element (compared to the insertion of a nonspecific sequence), while the RU2 element stimulated recombination by 3.5-fold (P<0.01). A separate set of constructs placed RU1 or RU2 within the intron of an exon trapping vector. Following tranfection of cells, recombination events were monitored by a PCR assay that detected the approximation of primer binding sites (as a result of recombination). These studies showed that, as in the first set of experiments, the highly variable RU2 element is capable of stimulating somatic recombination in mammalian cells.

  3. Transcription of the interleukin 4 gene is regulated by multiple promoter elements

    PubMed Central

    1993-01-01

    Activation of T helper cell 1 (Th1) and Th2 results in transcription of the interleukin 2 (IL-2) and IL-4 cytokine genes, respectively. Whereas many of the regulatory elements and factors responsible for IL-2 transcription in T cells are well defined, little is known about parallel mechanisms that drive transcription of the IL-4 gene. Here we have analyzed the murine IL-4 promoter, both in vivo and in a Th2 clone. 3 kb of IL-4 upstream sequence is shown to be sufficient to achieve tissue-specific and inducible expression of a thymidine kinase reporter gene in vivo in a manner that mirrors the expression of endogenous IL-4. Tissue-specific and inducible expression is also demonstrated in a Th2 clone, but not in a B cell line. Deletional and mutational analysis of the IL-4 promoter demonstrated that sequences from -100 to -28 were necessary for a transcriptional response to Concanavalin A or anti-CD3 monoclonal antibody. An overlapping, yet smaller region, spanning the sequences from -60 to -28 bp was shown to be required for the response to ionomycin. Mutation of an 8-bp region from -43 to -35 of the IL-4 promoter completely abrogated IL-4 gene transcription in response to all stimuli tested. In addition, our results show that the effects of the immunosuppressive agent Cyclosporin A map to the same DNA sequences as the positive control elements. These results identify DNA sequences that are functionally important for the control of IL-4 gene transcription both in vivo and in vitro. Although these sequences are highly conserved in the human and murine IL-4 genes, they are largely not present in the IL-2 enhancer complex. Thus, cytokine-specific cis-acting elements may be one mechanism by which these two cytokine genes are differentially regulated. PMID:8496684

  4. Genome-wide discovery of cis-elements in promoter sequences using gene expression.

    PubMed

    Troukhan, Maxim; Tatarinova, Tatiana; Bouck, John; Flavell, Richard B; Alexandrov, Nickolai N

    2009-04-01

    The availability of complete or nearly complete genome sequences, a large number of 5' expressed sequence tags, and significant public expression data allow for a more accurate identification of cis-elements regulating gene expression. We have implemented a global approach that takes advantage of available expression data, genomic sequences, and transcript information to predict cis-elements associated with specific expression patterns. The key components of our approach are: (1) precise identification of transcription start sites, (2) specific locations of cis-elements relative to the transcription start site, and (3) assessment of statistical significance for all sequence motifs. By applying our method to promoters of Arabidopsis thaliana and Mus musculus, we have identified motifs that affect gene expression under specific environmental conditions or in certain tissues. We also found that the presence of the TATA box is associated with increased variability of gene expression. Strong correlation between our results and experimentally determined motifs shows that the method is capable of predicting new functionally important cis-elements in promoter sequences. PMID:19231992

  5. Transposable elements: insertion pattern and impact on gene expression evolution in hominids.

    PubMed

    Warnefors, Maria; Pereira, Vini; Eyre-Walker, Adam

    2010-08-01

    Transposable elements (TEs) can affect the regulation of nearby genes through several mechanisms. Here, we examine to what extent recent TE insertions have contributed to the evolution of gene expression in hominids. We compare expression levels of human and chimpanzee orthologs and detect a weak increase in expression divergence (ED) for genes with species-specific TE insertions compared with unaffected genes. However, we show that genes with TE insertions predating the human-chimpanzee split also exhibit a similar increase in ED and therefore conclude that the increase is not due to the transcriptional influence of the TEs. These results are further confirmed by lineage-specific analysis of ED, using rhesus macaque as an outgroup: Human-chimpanzee ortholog pairs, where one ortholog has suffered TE insertion but not the other, do not show increased ED along the lineage where the insertion occurred, relative to the other lineage. We also show that genes with recent TE insertions tend to produce more alternative transcripts but find no evidence that the TEs themselves promote transcript diversity. Finally, we observe that TEs are enriched upstream relative to downstream of genes and show that this is due to insertional bias, rather than selection, because this bias is only observed in genes expressed in the germ line. This provides an alternative neutral explanation for the accumulation of TEs in upstream sequences.

  6. Evidence of extensive non-allelic gene conversion among LTR elements in the human genome

    PubMed Central

    Trombetta, Beniamino; Fantini, Gloria; D’Atanasio, Eugenia; Sellitto, Daniele; Cruciani, Fulvio

    2016-01-01

    Long Terminal Repeats (LTRs) are nearly identical DNA sequences found at either end of Human Endogenous Retroviruses (HERVs). The high sequence similarity that exists among different LTRs suggests they could be substrate of ectopic gene conversion events. To understand the extent to which gene conversion occurs and to gain new insights into the evolutionary history of these elements in humans, we performed an intra-species phylogenetic study of 52 LTRs on different unrelated Y chromosomes. From this analysis, we obtained direct evidence that demonstrates the occurrence of ectopic gene conversion in several LTRs, with donor sequences located on both sex chromosomes and autosomes. We also found that some of these elements are characterized by an extremely high density of polymorphisms, showing one of the highest nucleotide diversities in the human genome, as well as a complex patchwork of sequences derived from different LTRs. Finally, we highlighted the limits of current short-read NGS studies in the analysis of genetic diversity of the LTRs in the human genome. In conclusion, our comparative re-sequencing analysis revealed that ectopic gene conversion is a common event in the evolution of LTR elements, suggesting complex genetic links among LTRs from different chromosomes. PMID:27346230

  7. A fish-specific transposable element shapes the repertoire of p53 target genes in zebrafish.

    PubMed

    Micale, Lucia; Loviglio, Maria Nicla; Manzoni, Marta; Fusco, Carmela; Augello, Bartolomeo; Migliavacca, Eugenia; Cotugno, Grazia; Monti, Eugenio; Borsani, Giuseppe; Reymond, Alexandre; Merla, Giuseppe

    2012-01-01

    Transposable elements, as major components of most eukaryotic organisms' genomes, define their structural organization and plasticity. They supply host genomes with functional elements, for example, binding sites of the pleiotropic master transcription factor p53 were identified in LINE1, Alu and LTR repeats in the human genome. Similarly, in this report we reveal the role of zebrafish (Danio rerio) EnSpmN6_DR non-autonomous DNA transposon in shaping the repertoire of the p53 target genes. The multiple copies of EnSpmN6_DR and their embedded p53 responsive elements drive in several instances p53-dependent transcriptional modulation of the adjacent gene, whose human orthologs were frequently previously annotated as p53 targets. These transposons define predominantly a set of target genes whose human orthologs contribute to neuronal morphogenesis, axonogenesis, synaptic transmission and the regulation of programmed cell death. Consistent with these biological functions the orthologs of the EnSpmN6_DR-colonized loci are enriched for genes expressed in the amygdala, the hippocampus and the brain cortex. Our data pinpoint a remarkable example of convergent evolution: the exaptation of lineage-specific transposons to shape p53-regulated neuronal morphogenesis-related pathways in both a hominid and a teleost fish. PMID:23118857

  8. Evidence of extensive non-allelic gene conversion among LTR elements in the human genome.

    PubMed

    Trombetta, Beniamino; Fantini, Gloria; D'Atanasio, Eugenia; Sellitto, Daniele; Cruciani, Fulvio

    2016-01-01

    Long Terminal Repeats (LTRs) are nearly identical DNA sequences found at either end of Human Endogenous Retroviruses (HERVs). The high sequence similarity that exists among different LTRs suggests they could be substrate of ectopic gene conversion events. To understand the extent to which gene conversion occurs and to gain new insights into the evolutionary history of these elements in humans, we performed an intra-species phylogenetic study of 52 LTRs on different unrelated Y chromosomes. From this analysis, we obtained direct evidence that demonstrates the occurrence of ectopic gene conversion in several LTRs, with donor sequences located on both sex chromosomes and autosomes. We also found that some of these elements are characterized by an extremely high density of polymorphisms, showing one of the highest nucleotide diversities in the human genome, as well as a complex patchwork of sequences derived from different LTRs. Finally, we highlighted the limits of current short-read NGS studies in the analysis of genetic diversity of the LTRs in the human genome. In conclusion, our comparative re-sequencing analysis revealed that ectopic gene conversion is a common event in the evolution of LTR elements, suggesting complex genetic links among LTRs from different chromosomes. PMID:27346230

  9. Evidence of extensive non-allelic gene conversion among LTR elements in the human genome.

    PubMed

    Trombetta, Beniamino; Fantini, Gloria; D'Atanasio, Eugenia; Sellitto, Daniele; Cruciani, Fulvio

    2016-01-01

    Long Terminal Repeats (LTRs) are nearly identical DNA sequences found at either end of Human Endogenous Retroviruses (HERVs). The high sequence similarity that exists among different LTRs suggests they could be substrate of ectopic gene conversion events. To understand the extent to which gene conversion occurs and to gain new insights into the evolutionary history of these elements in humans, we performed an intra-species phylogenetic study of 52 LTRs on different unrelated Y chromosomes. From this analysis, we obtained direct evidence that demonstrates the occurrence of ectopic gene conversion in several LTRs, with donor sequences located on both sex chromosomes and autosomes. We also found that some of these elements are characterized by an extremely high density of polymorphisms, showing one of the highest nucleotide diversities in the human genome, as well as a complex patchwork of sequences derived from different LTRs. Finally, we highlighted the limits of current short-read NGS studies in the analysis of genetic diversity of the LTRs in the human genome. In conclusion, our comparative re-sequencing analysis revealed that ectopic gene conversion is a common event in the evolution of LTR elements, suggesting complex genetic links among LTRs from different chromosomes.

  10. Regulation of caulimovirus gene expression and the involvement of cis-acting elements on both viral transcripts.

    PubMed

    Scholthof, H B; Wu, F C; Gowda, S; Shepherd, R J

    1992-09-01

    In a further analysis of gene regulation of figwort mosaic virus (FMV), a caulimovirus, we studied transient gene expression with modified viral genomes in Nicotiana edwardsonii cell suspension protoplasts. The results demonstrated that the presence of the promoter for the full-length RNA interferes with expression from the separate downstream promoter for gene VI. In addition, expression of gene VI was inhibited by cis-acting sequences within gene VI itself. Both inhibitory effects could be partially relieved by coelectroporation with a plasmid that produces gene VI protein, demonstrating that expression of gene VI is transactivated by its own product. Subsequent expression studies with partially redundant FMV plasmids containing a reporter gene in frame with gene IV showed that efficient transactivation of CAT expression relies on a cis-acting element inside the downstream gene VI. Insertions of a transcriptional terminator upstream of the cis-acting element for premature termination of transcription showed that the cis-acting region is not a DNA element but is active only as a feature of the RNA transcript. We conclude that the cis-acting element, together with the transacting gene VI product, enhances expression of all major genes, including gene VI, from the polycistronic mRNA and the separate mRNA for gene VI.

  11. Short interspersed DNA elements and miRNAs: a novel hidden gene regulation layer in zebrafish?

    PubMed

    Scarpato, Margherita; Angelini, Claudia; Cocca, Ennio; Pallotta, Maria M; Morescalchi, Maria A; Capriglione, Teresa

    2015-09-01

    In this study, we investigated by in silico analysis the possible correlation between microRNAs (miRNAs) and Anamnia V-SINEs (a superfamily of short interspersed nuclear elements), which belong to those retroposon families that have been preserved in vertebrate genomes for millions of years and are actively transcribed because they are embedded in the 3' untranslated region (UTR) of several genes. We report the results of the analysis of the genomic distribution of these mobile elements in zebrafish (Danio rerio) and discuss their involvement in generating miRNA gene loci. The computational study showed that the genes predicted to bear V-SINEs can be targeted by miRNAs with a very high hybridization E-value. Gene ontology analysis indicates that these genes are mainly involved in metabolic, membrane, and cytoplasmic signaling pathways. Nearly all the miRNAs that were predicted to target the V-SINEs of these genes, i.e., miR-338, miR-9, miR-181, miR-724, miR-735, and miR-204, have been validated in similar regulatory roles in mammals. The large number of genes bearing a V-SINE involved in metabolic and cellular processes suggests that V-SINEs may play a role in modulating cell responses to different stimuli and in preserving the metabolic balance during cell proliferation and differentiation. Although they need experimental validation, these preliminary results suggest that in the genome of D. rerio, as in other TE families in vertebrates, the preservation of V-SINE retroposons may also have been favored by their putative role in gene network modulation. PMID:26363800

  12. cis-acting regulatory elements within gag genes of avian retroviruses.

    PubMed Central

    Arrigo, S; Yun, M; Beemon, K

    1987-01-01

    A cis-acting enhancer element has been detected within the gag gene of several avian retroviruses, including Rous sarcoma virus, Fujinami sarcoma virus, and the endogenous Rous-associated virus-0. A consensus enhancer core sequence, GTGGTTTG, is present in all of these viral genomes, approximately 900 bases downstream from the site of initiation of transcription. When an internal fragment derived from the gag gene of any of these viruses (spanning nucleotides 533 to approximately 1149) was inserted into a plasmid containing the chloramphenicol acetyltransferase (cat) gene under control of the simian virus 40 promoter, 9- or 21-fold enhancement of CAT expression was observed after transfection into mouse L cells and chicken embryo fibroblasts, respectively. This enhancement was not dependent on the position of insertion of the gag fragment into the plasmid. However, there was a strong dependence on orientation, with higher levels of CAT expression in constructs in which the 5' end of the gag fragment was nearest to the promoter, suggesting a possible negative regulatory element at the 3' end of this fragment. Deletion of the 3' end of the insert resulted in a gag fragment, containing nucleotides 533 to 1017, which enhanced expression equally in either orientation. When the gag fragment was inserted into a plasmid containing the cat gene under the control of an intact Rous sarcoma virus long terminal repeat, it induced a two- to threefold increase in CAT activity and CAT mRNA levels. Translation of the gag fragment did not appear to be necessary for the observed enhancement, since two insertional mutations resulting in frameshifts in the gag insert did not affect CAT expression. However, deletion of a 330-base internal fragment from the gag insert restored a basal level of CAT activity. These results suggest that retroviruses have regulatory elements within their genes distinct from those in the long terminal repeats that flank the genes. Images PMID:3031470

  13. Metagenomic Profiling of Antibiotic Resistance Genes and Mobile Genetic Elements in a Tannery Wastewater Treatment Plant

    PubMed Central

    Wang, Zhu; Zhang, Xu-Xiang; Huang, Kailong; Miao, Yu; Shi, Peng; Liu, Bo; Long, Chao; Li, Aimin

    2013-01-01

    Antibiotics are often used to prevent sickness and improve production in animal agriculture, and the residues in animal bodies may enter tannery wastewater during leather production. This study aimed to use Illumina high-throughput sequencing to investigate the occurrence, diversity and abundance of antibiotic resistance genes (ARGs) and mobile genetic elements (MGEs) in aerobic and anaerobic sludge of a full-scale tannery wastewater treatment plant (WWTP). Metagenomic analysis showed that Proteobacteria, Firmicutes, Bacteroidetes and Actinobacteria dominated in the WWTP, but the relative abundance of archaea in anaerobic sludge was higher than in aerobic sludge. Sequencing reads from aerobic and anaerobic sludge revealed differences in the abundance of functional genes between both microbial communities. Genes coding for antibiotic resistance were identified in both communities. BLAST analysis against Antibiotic Resistance Genes Database (ARDB) further revealed that aerobic and anaerobic sludge contained various ARGs with high abundance, among which sulfonamide resistance gene sul1 had the highest abundance, occupying over 20% of the total ARGs reads. Tetracycline resistance genes (tet) were highly rich in the anaerobic sludge, among which tet33 had the highest abundance, but was absent in aerobic sludge. Over 70 types of insertion sequences were detected in each sludge sample, and class 1 integrase genes were prevalent in the WWTP. The results highlighted prevalence of ARGs and MGEs in tannery WWTPs, which may deserve more public health concerns. PMID:24098424

  14. Genome Organization and Gene Expression Shape the Transposable Element Distribution in the Drosophila melanogaster Euchromatin

    PubMed Central

    Fontanillas, Pierre; Hartl, Daniel L; Reuter, Max

    2007-01-01

    The distribution of transposable elements (TEs) in a genome reflects a balance between insertion rate and selection against new insertions. Understanding the distribution of TEs therefore provides insights into the forces shaping the organization of genomes. Past research has shown that TEs tend to accumulate in genomic regions with low gene density and low recombination rate. However, little is known about the factors modulating insertion rates across the genome and their evolutionary significance. One candidate factor is gene expression, which has been suggested to increase local insertion rate by rendering DNA more accessible. We test this hypothesis by comparing the TE density around germline- and soma-expressed genes in the euchromatin of Drosophila melanogaster. Because only insertions that occur in the germline are transmitted to the next generation, we predicted a higher density of TEs around germline-expressed genes than soma-expressed genes. We show that the rate of TE insertions is greater near germline- than soma-expressed genes. However, this effect is partly offset by stronger selection for genome compactness (against excess noncoding DNA) on germline-expressed genes. We also demonstrate that the local genome organization in clusters of coexpressed genes plays a fundamental role in the genomic distribution of TEs. Our analysis shows that—in addition to recombination rate—the distribution of TEs is shaped by the interaction of gene expression and genome organization. The important role of selection for compactness sheds a new light on the role of TEs in genome evolution. Instead of making genomes grow passively, TEs are controlled by the forces shaping genome compactness, most likely linked to the efficiency of gene expression or its complexity and possibly their interaction with mechanisms of TE silencing. PMID:18081425

  15. Conjugative transposons: an unusual and diverse set of integrated gene transfer elements.

    PubMed Central

    Salyers, A A; Shoemaker, N B; Stevens, A M; Li, L Y

    1995-01-01

    Conjugative transposons are integrated DNA elements that excise themselves to form a covalently closed circular intermediate. This circular intermediate can either reintegrate in the same cell (intracellular transposition) or transfer by conjugation to a recipient and integrate into the recipient's genome (intercellular transposition). Conjugative transposons were first found in gram-positive cocci but are now known to be present in a variety of gram-positive and gram-negative bacteria also. Conjugative transposons have a surprisingly broad host range, and they probably contribute as much as plasmids to the spread of antibiotic resistance genes in some genera of disease-causing bacteria. Resistance genes need not be carried on the conjugative transposon to be transferred. Many conjugative transposons can mobilize coresident plasmids, and the Bacteroides conjugative transposons can even excise and mobilize unlinked integrated elements. The Bacteroides conjugative transposons are also unusual in that their transfer activities are regulated by tetracycline via a complex regulatory network. PMID:8531886

  16. Characterisation of a DNA sequence element that directs Dictyostelium stalk cell-specific gene expression.

    PubMed

    Ceccarelli, A; Zhukovskaya, N; Kawata, T; Bozzaro, S; Williams, J

    2000-12-01

    The ecmB gene of Dictyostelium is expressed at culmination both in the prestalk cells that enter the stalk tube and in ancillary stalk cell structures such as the basal disc. Stalk tube-specific expression is regulated by sequence elements within the cap-site proximal part of the promoter, the stalk tube (ST) promoter region. Dd-STATa, a member of the STAT transcription factor family, binds to elements present in the ST promoter-region and represses transcription prior to entry into the stalk tube. We have characterised an activatory DNA sequence element, that lies distal to the repressor elements and that is both necessary and sufficient for expression within the stalk tube. We have mapped this activator to a 28 nucleotide region (the 28-mer) within which we have identified a GA-containing sequence element that is required for efficient gene transcription. The Dd-STATa protein binds to the 28-mer in an in vitro binding assay, and binding is dependent upon the GA-containing sequence. However, the ecmB gene is expressed in a Dd-STATa null mutant, therefore Dd-STATa cannot be responsible for activating the 28-mer in vivo. Instead, we identified a distinct 28-mer binding activity in nuclear extracts from the Dd-STATa null mutant, the activity of this GA binding activity being largely masked in wild type extracts by the high affinity binding of the Dd-STATa protein. We suggest, that in addition to the long range repression exerted by binding to the two known repressor sites, Dd-STATa inhibits transcription by direct competition with this putative activator for binding to the GA sequence.

  17. Cytogenetic mapping of the Muller F element genes in Drosophila willistoni group.

    PubMed

    Pita, Sebastián; Panzera, Yanina; Lúcia da Silva Valente, Vera; de Melo, Zilpa das Graças Silva; Garcia, Carolina; Garcia, Ana Cristina Lauer; Montes, Martín Alejandro; Rohde, Claudia

    2014-10-01

    Comparative genomics in Drosophila began in 1940, when Muller stated that the ancestral haploid karyotype of this genus is constituted by five acrocentric chromosomes and one dot chromosome, named A to F elements. In some species of the willistoni group such as Drosophila willistoni and D. insularis, the F element, instead of a dot chromosome, has been incorporated into the E element, forming chromosome III (E + F fusion). The aim of this study was to investigate the scope of the E + F fusion in the willistoni group, evaluating six other species. Fluorescent in situ hybridization was used to locate two genes of the F element previously studied-cubitus interruptus (ci) and eyeless (ey)-in species of the willistoni and bocainensis subgroups. Moreover, polytene chromosome photomaps corresponding to the F element (basal portion of chromosome III) were constructed for each species studied. In D. willistoni, D. paulistorum and D. equinoxialis, the ci gene was located in subSectction 78B and the ey gene in 78C. In D. tropicalis, ci was located in subSection 76B and ey in 76C. In species of the bocainensis subgroup, ci and ey were localized, respectively, at subsections 76B and 76C in D. nebulosa and D. capricorni, and 76A and 76C in D. fumipennis. Despite the differences in the subsection numbers, all species showed the same position for ci and ey. The results confirm the synteny of E + F fusion in willistoni and bocainensis subgroups, and allow estimating the occurrence of this event at 15 Mya, at least.

  18. Activation of enhancer elements by the homeobox gene Cdx2 is cell line specific.

    PubMed Central

    Taylor, J K; Levy, T; Suh, E R; Traber, P G

    1997-01-01

    Cdx2 is a caudal-related homeodomain transcription factor that is expressed in complex patterns during mouse development and at high levels in the intestinal epithelium of adult mice. Cdx2 activates transcription of intestinal gene promoters containing specific binding sites. Moreover, Cdx2 has been shown to induce intestinal differentiation in cell lines. In this study, we show that Cdx2 is able to bind to two well defined enhancer elements in the HoxC8 gene. We then demonstrate that Cdx2 is able to activate transcription of heterologous promoters when its DNA binding element is placed in an enhancer context. Furthermore, the ability to activate enhancer elements is cell-line dependent. When the Cdx2 activation domain was linked to the Gal4 DNA binding domain, the chimeric protein was able to activate Gal4 enhancer constructs in an intestinal cell line, but was unable to activate transcription in NIH3T3 cells. These data suggest that there are cell-specific factors that allow the Cdx2 activation domain to function in the activation of enhancer elements. We hypothesize that either a co-activator protein or differential phosphorylation of the activation domain may be the mechanism for intestinal cell line-specific function of Cdx2 and possibly in other tissues in early development. PMID:9171078

  19. Apo CIII gene transcription is regulated by a cytokine inducible NF-kappa B element.

    PubMed Central

    Gruber, P J; Torres-Rosado, A; Wolak, M L; Leff, T

    1994-01-01

    Overproduction of Apo CIII causes elevated plasma triglyceride levels in transgenic animals and is associated with hypertriglyceridemia in humans. The regulation of apo CIII production is likely to play an important role in controlling plasma triglyceride levels. As an initial step in determining the role of transcriptional regulation in the production of apo CIII and in triglyceride metabolism, we have begun to characterize the activity of specific transcriptional regulatory elements in the CIII promoter. In the current study, we have identified and characterized an NF-kappa B regulatory element located 150 nucleotides upstream from the transcriptional start site of the apo CIII gene. Purified NF-kappa B, as well as an NF-kappa B protein in HepG2 cell nuclear extracts, bound specifically to this sequence element. The hepatic protein was induced by phorbol ester (PMA), and reacted with antibodies to the p50 and p65 subunits of NF-kappa B. The NF-kappa B element conferred PMA and IL1-beta inducible transcriptional activity to a heterologous promoter/reporter construct when transfected into HepG2 cells. Analysis of the full length CIII promoter demonstrated that the inducible activity of the NF-kappa B element was suppressed by sequences in the apo CIII enhancer element located approximately 500 nucleotides upstream of the NF-kappa B binding site. A deletion removing the enhancer restored the PMA inducible activity of the NF-kappa B binding site. These results indicate that apo CIII gene expression is regulated by NF-kappa B, and suggest that apo CIII production may be modulated by cellular signals, like inflammatory cytokines, that activate NF-kB. Images PMID:8036173

  20. Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing.

    SciTech Connect

    Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D.

    2003-06-01

    OAK-B135 In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3 kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally important for activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection, but also highlight that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites.

  1. A novel regulatory element between the human FGA and FGG genes.

    PubMed

    Fish, Richard J; Neerman-Arbez, Marguerite

    2012-09-01

    High circulating fibrinogen levels correlate with cardiovascular disease (CVD) risk. Fibrinogen levels vary between people and also change in response to physiological and environmental stimuli. A modest proportion of the variation in fibrinogen levels can be explained by genotype, inferring that variation in genomic sequences that regulate the fibrinogen genes ( FGA , FGB and FGG ) may affect hepatic fibrinogen production and perhaps CVD risk. We previously identified a conserved liver enhancer in the fibrinogen gene cluster (CNC12), between FGB and FGA . Genome-wide Chromatin immunoprecipitation-sequencing (ChIP-seq) demonstrated that transcription factors which bind fibrinogen gene promoters also interact with CNC12, as well as two potential fibrinogen enhancers (PFE), between FGA and FGG . Here we show that one of the PFE sequences has potent hepatocyte enhancer activity. Using a luciferase reporter gene system, we found that PFE2 enhances minimal promoter- and FGA promoter-driven gene expression in hepatoma cells, regardless of its orientation with respect to the promoters. A region within PFE2 bears a short series of conserved nucleotides which maintain enhancer activity without flanking sequence. We also demonstrate that PFE2 is a liver enhancer in vivo, driving enhanced green fluorescent protein expression in transgenic zebrafish larval livers. Our study shows that combining public domain ChIP-seq data with in vitro and in vivo functional tests can identify novel fibrinogen gene cluster regulatory sequences. Variation in such elements could affect fibrinogen production and influence CVD risk.

  2. Mobile inverted-repeat elements of the Tourist family are associated with the genes of many cereal grasses.

    PubMed Central

    Bureau, T E; Wessler, S R

    1994-01-01

    Tourist was originally described as a 128-bp insertion mutation in the maize wx-B2 allele. Subsequent analysis revealed that Tourist elements are in the introns or flanking sequences of 11 maize genes and a single barley gene. In this study we report that Tourist elements are frequently associated with the wild-type genes of two other grasses, rice and sorghum. Six of 35 rice and 5 of 8 sorghum complete gene sequences reported to date contain Tourist elements. Furthermore, 11 additional maize genes have been found to contain Tourist elements, bringing the current total of elements associated with maize genes to 23. Sequence comparison of Tourist elements has led to the identification of four subfamilies, designated A-D. Evidence is presented for the recent mobility of elements in three of these subfamilies and in three of the four grass species. These data suggest that Tourist elements are highly repetitive in the genomes of some and perhaps all members of the grasses. Images PMID:8108422

  3. Mobile inverted-repeat elements of the Tourist family are associated with the genes of many cereal grasses.

    PubMed

    Bureau, T E; Wessler, S R

    1994-02-15

    Tourist was originally described as a 128-bp insertion mutation in the maize wx-B2 allele. Subsequent analysis revealed that Tourist elements are in the introns or flanking sequences of 11 maize genes and a single barley gene. In this study we report that Tourist elements are frequently associated with the wild-type genes of two other grasses, rice and sorghum. Six of 35 rice and 5 of 8 sorghum complete gene sequences reported to date contain Tourist elements. Furthermore, 11 additional maize genes have been found to contain Tourist elements, bringing the current total of elements associated with maize genes to 23. Sequence comparison of Tourist elements has led to the identification of four subfamilies, designated A-D. Evidence is presented for the recent mobility of elements in three of these subfamilies and in three of the four grass species. These data suggest that Tourist elements are highly repetitive in the genomes of some and perhaps all members of the grasses.

  4. Parkinson-associated risk variant in enhancer element produces subtle effect on target gene expression

    PubMed Central

    Soldner, Frank; Stelzer, Yonatan; Shivalila, Chikdu S.; Abraham, Brian J.; Latourelle, Jeanne C.; Barrasa, M. Inmaculada; Goldmann, Johanna; Myers, Richard H.; Young, Richard A.; Jaenisch, Rudolf

    2016-01-01

    Genome-wide association studies (GWAS) have identified numerous genetic variants associated with complex diseases but mechanistic insights are impeded by the lack of understanding of how specific risk variants functionally contribute to the underlying pathogenesis1. It has been proposed that cis-acting effects of non-coding risk variants on gene expression are a major factor for phenotypic variation of complex traits and disease susceptibility. Recent genome-scale chromatin mapping studies have highlighted the enrichment of GWAS variants in regulatory DNA elements of disease-relevant cell types2–6. Furthermore, single nucleotide polymorphism (SNP)-specific changes in transcription factor (TF) binding are correlated with heritable alterations in chromatin state and considered a major mediator of sequence-dependent regulation of gene expression7–10. Here we describe a novel strategy to functionally dissect the cis-acting effect of genetic risk variants in regulatory elements on gene expression by combining genome-wide epigenetic information with clustered regularly-interspaced short palindromic repeats (CRISPR)/Cas9 genome editing in human pluripotent stem cells (hPSCs). By generating a genetically precisely controlled experimental system we identify a common Parkinson’s disease (PD)-associated risk variant in a non-coding distal enhancer element that regulates the expression of alpha-synuclein (SNCA), a key gene implicated in the pathogenesis of PD. Our data suggest that the transcriptional deregulation of SNCA is associated with sequence-dependent binding of the brain-specific TFs EMX2 and NKX6-1. This work establishes an experimental paradigm to functionally connect genetic variation with disease relevant phenotypes. PMID:27096366

  5. Identification of novel Drosophila meiotic genes recovered in a P-element screen.

    PubMed Central

    Sekelsky, J J; McKim, K S; Messina, L; French, R L; Hurley, W D; Arbel, T; Chin, G M; Deneen, B; Force, S J; Hari, K L; Jang, J K; Laurençon, A C; Madden, L D; Matthies, H J; Milliken, D B; Page, S L; Ring, A D; Wayson, S M; Zimmerman, C C; Hawley, R S

    1999-01-01

    The segregation of homologous chromosomes from one another is the essence of meiosis. In many organisms, accurate segregation is ensured by the formation of chiasmata resulting from crossing over. Drosophila melanogaster females use this type of recombination-based system, but they also have mechanisms for segregating achiasmate chromosomes with high fidelity. We describe a P-element mutagenesis and screen in a sensitized genetic background to detect mutations that impair meiotic chromosome pairing, recombination, or segregation. Our screen identified two new recombination-deficient mutations: mei-P22, which fully eliminates meiotic recombination, and mei-P26, which decreases meiotic exchange by 70% in a polar fashion. We also recovered an unusual allele of the ncd gene, whose wild-type product is required for proper structure and function of the meiotic spindle. However, the screen yielded primarily mutants specifically defective in the segregation of achiasmate chromosomes. Although most of these are alleles of previously undescribed genes, five were in the known genes alphaTubulin67C, CycE, push, and Trl. The five mutations in known genes produce novel phenotypes for those genes. PMID:10353897

  6. A major thyroid hormone response element in the third intron of the rat growth hormone gene.

    PubMed Central

    Sap, J; de Magistris, L; Stunnenberg, H; Vennström, B

    1990-01-01

    The rat growth hormone (RGH) gene constitutes a well-documented model system for the direct regulation of transcription by thyroid hormones. In order to analyse its interaction with sequences in the RGH gene, we have overproduced the thyroid hormone receptor-alpha (c-erbA) protein using a vaccinia virus expression system. The expressed protein bound T3 and DNA-cellulose with expected affinities, and the major binding site for the receptor protein was found to be located in the third intron of the RGH gene. This site displayed significantly higher affinity for the receptor protein than a previously described thyroid hormone response element (TRE) in the promoter of this gene, and also conferred stronger hormone responsiveness in vivo to a heterologous promoter. The data suggest that this novel TRE plays a major role in the regulation of rat growth hormone gene expression by thyroid hormones. Images Fig. 1. Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. Fig. 8. PMID:2155782

  7. Codon usage biases of transposable elements and host nuclear genes in Arabidopsis thaliana and Oryza sativa.

    PubMed

    Jia, Jia; Xue, Qingzhong

    2009-12-01

    Transposable elements (TEs) are mobile genetic entities ubiquitously distributed in nearly all genomes. High frequency of codons ending in A/T in TEs has been previously observed in some species. In this study, the biases in nucleotide composition and codon usage of TE transposases and host nuclear genes were investigated in the AT-rich genome of Arabidopsis thaliana and the GC-rich genome of Oryza sativa. Codons ending in A/T are more frequently used by TEs compared with their host nuclear genes. A remarkable positive correlation between highly expressed nuclear genes and C/G-ending codons were detected in O. sativa (r=0.944 and 0.839, respectively, P<0.0001) but not in A. thaliana, indicating a close association between the GC content and gene expression level in monocot species. In both species, TE codon usage biases are similar to that of weakly expressed genes. The expression and activity of TEs may be strictly controlled in plant genomes. Mutation bias and selection pressure have simultaneously acted on the TE evolution in A. thaliana and O. sativa. The consistently observed biases of nucleotide composition and codon usage of TEs may also provide a useful clue to accurately detect TE sequences in different species. PMID:20172490

  8. Codon usage biases of transposable elements and host nuclear genes in Arabidopsis thaliana and Oryza sativa.

    PubMed

    Jia, Jia; Xue, Qingzhong

    2009-12-01

    Transposable elements (TEs) are mobile genetic entities ubiquitously distributed in nearly all genomes. High frequency of codons ending in A/T in TEs has been previously observed in some species. In this study, the biases in nucleotide composition and codon usage of TE transposases and host nuclear genes were investigated in the AT-rich genome of Arabidopsis thaliana and the GC-rich genome of Oryza sativa. Codons ending in A/T are more frequently used by TEs compared with their host nuclear genes. A remarkable positive correlation between highly expressed nuclear genes and C/G-ending codons were detected in O. sativa (r=0.944 and 0.839, respectively, P<0.0001) but not in A. thaliana, indicating a close association between the GC content and gene expression level in monocot species. In both species, TE codon usage biases are similar to that of weakly expressed genes. The expression and activity of TEs may be strictly controlled in plant genomes. Mutation bias and selection pressure have simultaneously acted on the TE evolution in A. thaliana and O. sativa. The consistently observed biases of nucleotide composition and codon usage of TEs may also provide a useful clue to accurately detect TE sequences in different species.

  9. Viral expression cassette elements to enhance transgene target specificity and expression in gene therapy.

    PubMed

    Powell, Sara Kathleen; Rivera-Soto, Ricardo; Gray, Steven James

    2015-01-01

    Over the last five years, the number of clinical trials involving AAV (adeno-associated virus) and lentiviral vectors continue to increase by about 150 trials each year. For continued success, AAV and lentiviral expression cassettes need to be designed to meet each disease's specific needs. This review discusses how viral vector expression cassettes can be engineered with elements to enhance target specificity and increase transgene expression. The key differences relating to target specificity between ubiquitous and tissue-specific promoters are discussed, as well as how endogenous miRNAs and their target sequences have been used to restrict transgene expression. Specifically, relevant studies indicating how cis-acting elements such as introns, WPRE, polyadenylation signals, and the CMV enhancer are highlighted to show their utility for enhancing transgene expression in gene therapy applications. All discussion bears in mind that expression cassettes have space constraints. In conclusion, this review can serve as a menu of vector genome design elements and their cost in terms of space to thoughtfully engineer viral vectors for gene therapy. PMID:25636961

  10. Viral Expression Cassette Elements to Enhance Transgene Target Specificity and Expression in Gene Therapy

    PubMed Central

    Powell, Sara Kathleen; Rivera-Soto, Ricardo; Gray, Steven James

    2015-01-01

    Over the last five years, the number of clinical trials involving AAV (adeno-associated virus) and lentiviral vectors continue to increase by about 150 trials each year. For continued success, AAV and lentiviral expression cassettes need to be designed to meet each disease's specific needs. This review discusses how viral vector expression cassettes can be engineered with elements to enhance target specificity and increase transgene expression. The key differences relating to target specificity between ubiquitous and tissue-specific promoters are discussed, as well as how endogenous miRNAs and their target sequences have been used to restrict transgene expression. Specifically, relevant studies indicating how cis-acting elements such as introns, WPRE, polyadenylation signals, and the CMV enhancer are highlighted to show their utility for enhancing transgene expression in gene therapy applications. All discussion bears in mind that expression cassettes have space constraints. In conclusion, this review can serve as a menu of vector genome design elements and their cost in terms of space to thoughtfully engineer viral vectors for gene therapy. PMID:25636961

  11. Gene expression analysis of metallothionein and mineral elements uptake in tomato (Solanum lycopersicum) exposed to cadmium.

    PubMed

    Kısa, Dursun; Öztürk, Lokman; Tekin, Şaban

    2016-09-01

    Heavy metals such as Cd are considered to be the most important pollutants in soil contamination. Cd is a non-essential element adversely affecting plant growth and development, and it has caused some physiological and molecular changes. Metallothioneins (MTs) are low molecular weight, cysteine-rich, and metal binding proteins. In this study, we aimed to evaluate the MT gene expression levels and minerals uptake in the tissues of Solanum lycopersicum exposed to Cd. The transcriptional expression of the MT genes was determined by real-time quantitative PCR. The MT genes were regulated by the Cd and the mineral elements uptake changed tissue type and applied doses. The MT1 and MT2 transcript levels increased in the roots, the leaves and the fruits of the tomato. The MT3 and MT4 transcript pattern changed according to the tissue types. The Cd treatment on the growth medium increased the Mg, Ca, and Fe content in both the leaves and fruits of the tomato. However, the Cd affected the mineral levels in the roots depending on the mineral types and doses. Also, the Cd content increased in the roots, the leaves, and the fruits of the tomato, respectively. The results presented in this study show that Cd has synergistic and/or antagonistic effects on minerals depending on the tissue types. These results indicate that the MT1 and MT2 expression pattern increased together with the Mg, Ca, and Fe content in both the leaves and the fruits of the tomato. PMID:27363704

  12. Mineralocorticoid receptor interaction with SP1 generates a new response element for pathophysiologically relevant gene expression

    PubMed Central

    Meinel, Sandra; Ruhs, Stefanie; Schumann, Katja; Strätz, Nicole; Trenkmann, Kay; Schreier, Barbara; Grosse, Ivo; Keilwagen, Jens; Gekle, Michael; Grossmann, Claudia

    2013-01-01

    The mineralocorticoid receptor (MR) is a ligand-induced transcription factor belonging to the steroid receptor family and involved in water-electrolyte homeostasis, blood pressure regulation, inflammation and fibrosis in the renocardiovascular system. The MR shares a common hormone-response-element with the glucocorticoid receptor but nevertheless elicits MR-specific effects including enhanced epidermal growth factor receptor (EGFR) expression via unknown mechanisms. The EGFR is a receptor tyrosine kinase that leads to activation of MAP kinases, but that can also function as a signal transducer for other signaling pathways. In the present study, we mechanistically investigate the interaction between a newly discovered MR- but not glucocorticoid receptor- responsive-element (=MRE1) of the EGFR promoter, specificity protein 1 (SP1) and MR to gain general insights into MR-specificity. Biological relevance of the interaction for EGFR expression and consequently for different signaling pathways in general is demonstrated in human, rat and murine vascular smooth muscle cells and cells of EGFR knockout mice. A genome-wide promoter search for identical binding regions followed by quantitative PCR validation suggests that the identified MR-SP1–MRE1 interaction might be applicable to other genes. Overall, a novel principle of MR-specific gene expression is explored that applies to the pathophysiologically relevant expression of the EGFR and potentially also to other genes. PMID:23821666

  13. Sex Steroids Regulate Expression of Genes Containing Long Interspersed Elements-1s in Breast Cancer Cells.

    PubMed

    Chaiwongwatanakul, Saichon; Yanatatsaneejit, Pattamawadee; Tongsima, Sissades; Mutirangura, Apiwat; Boonyaratanakornkit, Viroj

    2016-01-01

    Long interspersed elements-1s (LINE-1s) are dispersed all over the human genome. There is evidence that hypomethylation of LINE-1s and levels of sex steroids regulate gene expression leading to cancer development. Here, we compared mRNA levels of genes containing an intragenic LINE-1 in breast cancer cells treated with various sex steroids from Gene Expression Omnibus (GEO), with the gene expression database using chi-square analysis (http://www.ncbi.nlm.nih.gov/geo). We evaluated whether sex steroids influence expression of genes containing an intragenic LINE-1. Three sex steroids at various concentrations, 1 and 10 nM estradiol (E2), 10 nM progesterone (PG) and 10 nM androgen (AN), were assessed. In breast cancer cells treated with 1 or 10 nM E2, a significant percentage of genes containing an intragenic LINE-1 were down-regulated. A highly significant percentage of E2-regulated genes containing an intragenic LINE-1 was down-regulated in cells treated with 1 nM E2 for 3 hours (<3.70E-25; OR=1.91; 95% CI=2.16-1.69). Similarly, high percentages of PG or AN- regulated genes containing an intragenic LINE-1 were also down-regulated in cells treated with 10 nM PG or 10 nM AN for 16 hr (p=9.53E-06; OR=1.65; 95% CI=2.06-1.32 and p=3.81E-14; OR=2.01; 95% CI=2.42-1.67). Interestingly, a significant percentage of AN-regulated genes containing an intragenic LINE-1 was up-regulated in cells treated with 10 nM AN for 16 hr (p=4.03E-02; OR=1.40; 95% CI=1.95-1.01). These findings suggest that intragenic LINE-1s may play roles in sex steroid mediated gene expression in breast cancer cells, which could have significant implications for the development and progression of sex steroid-dependent cancers. PMID:27644652

  14. Differential interactions of promoter elements in stress responses of the Arabidopsis Adh gene.

    PubMed Central

    Dolferus, R; Jacobs, M; Peacock, W J; Dennis, E S

    1994-01-01

    The Adh (alcohol dehydrogenase, EC 1.1.1.1.) gene from Arabidopsis thaliana (L.) Heynh. can be induced by dehydration and cold, as well as by hypoxia. A 1-kb promoter fragment (CADH: -964 to +53) is sufficient to confer the stress induction and tissue-specific developmental expression characteristics of the Adh gene to a beta-glucuronidase reporter gene. Deletion mapping of the 5' end and site-specific mutagenesis identified four regions of the promoter essential for expression under the three stress conditions. Some sequence elements are important for response to all three stress treatments, whereas others are stress specific. The most critical region essential for expression of the Arabidopsis Adh promoter under all three environmental stresses (region IV: -172 to -141) contains sequences homologous to the GT motif (-160 to -152) and the GC motif (-147 to -144) of the maize Adh1 anaerobic responsive element. Region III (-235 to -172) contains two regions shown by R.J. Ferl and B.H. Laughner ([1989] Plant Mol Biol 12: 357-366) to bind regulatory proteins; mutation of the G-box-1 region (5'-CCACGTGG-3', -216 to -209) does not affect expression under uninduced or hypoxic conditions, but significantly reduces induction by cold stress and, to a lesser extent, by dehydration stress. Mutation of the other G-box-like sequence (G-box-2: 5'-CCAAGTGG-3', -193 to -182) does not change hypoxic response and affects cold and dehydration stress only slightly. G-box-2 mutations also promote high levels of expression under uninduced conditions. Deletion of region I (-964 to -510) results in increased expression under uninduced and all stress conditions, suggesting that this region contains a repressor binding site. Region II (-510 to -384) contains a positive regulatory element and is necessary for high expression levels under all treatments. PMID:7972489

  15. Ancora: a web resource for exploring highly conserved noncoding elements and their association with developmental regulatory genes

    PubMed Central

    Engström, Pär G; Fredman, David; Lenhard, Boris

    2008-01-01

    Metazoan genomes contain arrays of highly conserved noncoding elements (HCNEs) that span developmental regulatory genes and define regulatory domains. We describe Ancora , a web resource that provides data and tools for exploring genomic organization of HCNEs for multiple genomes. Ancora includes a genome browser that shows HCNE locations and features novel HCNE density plots as a powerful tool to discover developmental regulatory genes and distinguish their regulatory elements and domains. PMID:18279518

  16. Functional conservation of cis-regulatory elements of heat-shock genes over long evolutionary distances.

    PubMed

    He, Zhengying; Eichel, Kelsie; Ruvinsky, Ilya

    2011-01-01

    Transcriptional control of gene regulation is an intricate process that requires precise orchestration of a number of molecular components. Studying its evolution can serve as a useful model for understanding how complex molecular machines evolve. One way to investigate evolution of transcriptional regulation is to test the functions of cis-elements from one species in a distant relative. Previous results suggested that few, if any, tissue-specific promoters from Drosophila are faithfully expressed in C. elegans. Here we show that, in contrast, promoters of fly and human heat-shock genes are upregulated in C. elegans upon exposure to heat. Inducibility under conditions of heat shock may represent a relatively simple "on-off" response, whereas complex expression patterns require integration of multiple signals. Our results suggest that simpler aspects of regulatory logic may be retained over longer periods of evolutionary time, while more complex ones may be diverging more rapidly.

  17. Regulation of Dlx3 gene expression in visceral arches by evolutionarily conserved enhancer elements

    SciTech Connect

    Kenta Sumiyama; Frank H. Ruddle

    2003-04-01

    The mammalian Distal-less (Dlx) clusters (Dlx1-2, Dlx5-6, and Dlx3-7) have a nested expression pattern in developing visceral (branchial) arches. Genetic regulatory mechanisms controlling Dlx spatial expression within the visceral arches have not yet been defined. Here we show that an enhancer in the Dlx3-7 cluster can regulate the visceral arch specific expression pattern of the Dlx3 gene. We have used a 79-kb transgene construct containing the entire Dlx3-7 bigene cluster with a LacZ reporter inserted in frame in the first exon of the Dlx3 gene. Visceral arch expression is absent when a 4-kb element located within the Dlx3-7 intergenic region is deleted. A 245-bp element (I37-2) whose DNA sequence is highly conserved between human and mouse located within the 4kb-deleted region can drive visceral arch expression when fused to a hsp68-lacZ reporter transgene construct. Reporter expression is detected in 9.5 and 10.5 days postcoitum transgenic embryos in a manner consistent with the endogenous Dlx3 expression pattern in the mesenchyme of the first and second visceral arches. Thus the I37-2 element is both necessary and sufficient for Dlx3 expression. The I37-2 element contains several putative binding sites for several transcription factors including Dlx and other homeodomain proteins within the evolutionarily conserved region. Significantly, the I37-2 element shows a sequence-match including a Dlx binding site to a cis-element in the Dlx5-6 intermediate region designated mI56i [Zerucha, T., Stuhmer, T., Hatch, G., Park, B. K., Long, Q., Yu, G., Gambarotta, A., Schultz, J. R., Rubenstein, J. L. & Ekker, M. (2000) J. Neurosci. 20, 709-721], despite distant phylogenetic relationship between these clusters. Our results provide evidence for a concerted role for DLX auto- and cross-regulation in the establishment of a nested expression pattern for Dlx3-7 and Dlx5-6 clusters within the visceral arches.

  18. Ribosomal RNA genes of Trypanosoma brucei. Cloning of a rRNA gene containing a mobile element.

    PubMed Central

    Hasan, G; Turner, M J; Cordingley, J S

    1982-01-01

    An ordered restriction map of the ribosomal RNA genes of Trypanosoma brucei brucei is presented. Bgl II fragments of T.b.brucei genomic DNA were cloned into pAT 153, and the clones containing rDNA identified. Restriction maps were established and the sense strands identified. One clone was shown by heteroduplex mapping to contain a 1.1 kb inserted sequence which was demonstrated to be widely distributed throughout the genomes of members of the subgenus Trypanozoon. However, in two other subgenera of Trypanosoma, Nannomonas and Schizotrypanum, the sequence is far less abundant. Analysis of the genomic DNA from two serodemes of T.b.brucei showed that the sequence was present in the rRNA of only one of them, implying that the sequence is a mobile element and that its appearance in rDNA is a comparitively recent occurrence. Images PMID:6294613

  19. Paucity of chimeric gene-transposable element transcripts in the Drosophila melanogaster genome

    PubMed Central

    Lipatov, Mikhail; Lenkov, Kapa; Petrov, Dmitri A; Bergman, Casey M

    2005-01-01

    Background Recent analysis of the human and mouse genomes has shown that a substantial proportion of protein coding genes and cis-regulatory elements contain transposable element (TE) sequences, implicating TE domestication as a mechanism for the origin of genetic novelty. To understand the general role of TE domestication in eukaryotic genome evolution, it is important to assess the acquisition of functional TE sequences by host genomes in a variety of different species, and to understand in greater depth the population dynamics of these mutational events. Results Using an in silico screen for host genes that contain TE sequences, we identified a set of 63 mature "chimeric" transcripts supported by expressed sequence tag (EST) evidence in the Drosophila melanogaster genome. We found a paucity of chimeric TEs relative to expectations derived from non-chimeric TEs, indicating that the majority (~80%) of TEs that generate chimeric transcripts are deleterious and are not observed in the genome sequence. Using a pooled-PCR strategy to assay the presence of gene-TE chimeras in wild strains, we found that over half of the observed chimeric TE insertions are restricted to the sequenced strain, and ~15% are found at high frequencies in North American D. melanogaster populations. Estimated population frequencies of chimeric TEs did not differ significantly from non-chimeric TEs, suggesting that the distribution of fitness effects for the observed subset of chimeric TEs is indistinguishable from the general set of TEs in the genome sequence. Conclusion In contrast to mammalian genomes, we found that fewer than 1% of Drosophila genes produce mRNAs that include bona fide TE sequences. This observation can be explained by the results of our population genomic analysis, which indicates that most potential chimeric TEs in D. melanogaster are deleterious but that a small proportion may contribute to the evolution of novel gene sequences such as nested or intercalated gene

  20. The RY/Sph element mediates transcriptional repression of maturation genes from late maturation to early seedling growth.

    PubMed

    Guerriero, Gea; Martin, Nathalie; Golovko, Anna; Sundström, Jens F; Rask, Lars; Ezcurra, Ines

    2009-11-01

    In orthodox seeds, the transcriptional activator ABI3 regulates two major stages in embryo maturation: a mid-maturation (MAT) stage leading to accumulation of storage compounds, and a late maturation (LEA) stage leading to quiescence and desiccation tolerance. Our aim was to elucidate mechanisms for transcriptional shutdown of MAT genes during late maturation, to better understand phase transition between MAT and LEA stages. Using transgenic and transient approaches in Nicotiana, we examined activities of two ABI3-dependent reporter genes driven by multimeric RY and abscisic acid response elements (ABREs) from a Brassica napus napin gene, termed RY and ABRE, where the RY reporter requires ABI3 DNA binding. Expression of RY peaks during mid-maturation and drops during late maturation, mimicking the MAT gene program, and in Arabidopsis thaliana RY elements are over-represented in MAT, but not in LEA, genes. The ABI3 transactivation of RY is inhibited by staurosporine, by a PP2C phosphatase, and by a repressor of maturation genes, VAL1/HSI2. The RY element mediates repression of MAT genes, and we propose that transcriptional shutdown of the MAT program during late maturation involves inhibition of ABI3 DNA binding by dephosphorylation. Later, during seedling growth, VAL1/HSI2 family repressors silence MAT genes by binding RY elements.

  1. Multiple single-stranded cis elements are associated with activated chromatin of the human c-myc gene in vivo.

    PubMed Central

    Michelotti, G A; Michelotti, E F; Pullner, A; Duncan, R C; Eick, D; Levens, D

    1996-01-01

    Transcription activation and repression of eukaryotic genes are associated with conformational and topological changes of the DNA and chromatin, altering the spectrum of proteins associated with an active gene. Segments of the human c-myc gene possessing non-B structure in vivo located with enzymatic and chemical probes. Sites hypertensive to cleavage with single-strand-specific S1 nuclease or the single-strand-selective agent potassium permanganate included the major promoters P1 and P2 as well as the far upstream sequence element (FUSE) and CT elements, which bind, respectively, the single-strand-specific factors FUSE-binding protein and heterogeneous nuclear ribonucleoprotein K in vitro. Active and inactive c-myc genes yielded different patterns of S1 nuclease and permanganate sensitivity, indicating alternative chromatin configurations of active and silent genes. The melting of specific cis elements of active c-myc genes in vivo suggested that transcriptionally associated torsional strain might assist strand separation and facilitate factor binding. Therefore, the interaction of FUSE-binding protein and heterogeneous nuclear ribonucleoprotein K with supercoiled DNA was studied. Remarkably, both proteins recognize their respective elements torsionally strained but not as liner duplexes. Single-strand- or supercoil-dependent gene regulatory proteins may directly link alterations in DNA conformation and topology with changes in gene expression. PMID:8649373

  2. An ant colony optimization based algorithm for identifying gene regulatory elements.

    PubMed

    Liu, Wei; Chen, Hanwu; Chen, Ling

    2013-08-01

    It is one of the most important tasks in bioinformatics to identify the regulatory elements in gene sequences. Most of the existing algorithms for identifying regulatory elements are inclined to converge into a local optimum, and have high time complexity. Ant Colony Optimization (ACO) is a meta-heuristic method based on swarm intelligence and is derived from a model inspired by the collective foraging behavior of real ants. Taking advantage of the ACO in traits such as self-organization and robustness, this paper designs and implements an ACO based algorithm named ACRI (ant-colony-regulatory-identification) for identifying all possible binding sites of transcription factor from the upstream of co-expressed genes. To accelerate the ants' searching process, a strategy of local optimization is presented to adjust the ants' start positions on the searched sequences. By exploiting the powerful optimization ability of ACO, the algorithm ACRI can not only improve precision of the results, but also achieve a very high speed. Experimental results on real world datasets show that ACRI can outperform other traditional algorithms in the respects of speed and quality of solutions. PMID:23746735

  3. Identification and Analysis of Regulatory Elements in Porcine Bone Morphogenetic Protein 15 Gene Promoter.

    PubMed

    Wan, Qianhui; Wang, Yaxian; Wang, Huayan

    2015-10-27

    Bone morphogenetic protein 15 (BMP15) is secreted by the mammalian oocytes and is indispensable for ovarian follicular development, ovulation, and fertility. To determine the regulation mechanism of BMP15 gene, the regulatory sequence of porcine BMP15 was investigated in this study. The cloned BMP15 promoter retains the cell-type specificity, and is activated in cells derived from ovarian tissue. The luciferase assays in combination with a series of deletion of BMP15 promoter sequence show that the -427 to -376 bp region of BMP15 promoter is the primary regulatory element, in which there are a number of transcription factor binding sites, including LIM homeobox 8 (LHX8), newborn ovary homeobox gene (NOBOX), and paired-like homeodomain transcription factor 1 (PITX1). Determination of tissue-specific expression reveals that LHX8, but not PITX1 and NOBOX, is exclusively expressed in pig ovary tissue and is translocated into the cell nuclei. Overexpression of LHX8 in Chinese hamster ovary (CHO) cells could significantly promote BMP15 promoter activation. This study confirms a key regulatory element that is located in the proximal region of BMP15 promoter and is regulated by the LHX8 factor.

  4. Identification and Analysis of Regulatory Elements in Porcine Bone Morphogenetic Protein 15 Gene Promoter

    PubMed Central

    Wan, Qianhui; Wang, Yaxian; Wang, Huayan

    2015-01-01

    Bone morphogenetic protein 15 (BMP15) is secreted by the mammalian oocytes and is indispensable for ovarian follicular development, ovulation, and fertility. To determine the regulation mechanism of BMP15 gene, the regulatory sequence of porcine BMP15 was investigated in this study. The cloned BMP15 promoter retains the cell-type specificity, and is activated in cells derived from ovarian tissue. The luciferase assays in combination with a series of deletion of BMP15 promoter sequence show that the −427 to −376 bp region of BMP15 promoter is the primary regulatory element, in which there are a number of transcription factor binding sites, including LIM homeobox 8 (LHX8), newborn ovary homeobox gene (NOBOX), and paired-like homeodomain transcription factor 1 (PITX1). Determination of tissue-specific expression reveals that LHX8, but not PITX1 and NOBOX, is exclusively expressed in pig ovary tissue and is translocated into the cell nuclei. Overexpression of LHX8 in Chinese hamster ovary (CHO) cells could significantly promote BMP15 promoter activation. This study confirms a key regulatory element that is located in the proximal region of BMP15 promoter and is regulated by the LHX8 factor. PMID:26516845

  5. Pack-Mutator-like transposable elements (Pack-MULEs) induce directional modification of genes through biased insertion and DNA acquisition.

    PubMed

    Jiang, Ning; Ferguson, Ann A; Slotkin, R Keith; Lisch, Damon

    2011-01-25

    In monocots, many genes demonstrate a significant negative GC gradient, meaning that the GC content declines along the orientation of transcription. Such a gradient is not observed in the genes of the dicot plant Arabidopsis. In addition, a lack of homology is often observed when comparing the 5' end of the coding region of orthologous genes in rice and Arabidopsis. The reasons for these differences have been enigmatic. The presence of GC-rich sequences at the 5' end of genes may influence the conformation of chromatin, the expression level of genes, as well as the recombination rate. Here we show that Pack-Mutator-like transposable elements (Pack-MULEs) that carry gene fragments specifically acquire GC-rich fragments and preferentially insert into the 5' end of genes. The resulting Pack-MULEs form independent, GC-rich transcripts with a negative GC gradient. Alternatively, the Pack-MULEs evolve into additional exons at the 5' end of existing genes, thus altering the GC content in those regions. We demonstrate that Pack-MULEs modify the 5' end of genes and are at least partially responsible for the negative GC gradient of genes in grasses. Such a unique and global impact on gene composition and gene structure has not been observed for any other transposable elements.

  6. Characterization of transcriptional activation and inserted-into-gene preference of various transposable elements in the Brassica species.

    PubMed

    Gao, Caihua; Xiao, Meili; Jiang, Lingyan; Li, Jiana; Yin, Jiaming; Ren, Xiaodong; Qian, Wei; Oscar, Ortegón; Fu, Donghui; Tang, Zhanglin

    2012-07-01

    Transposable elements (TEs) have attracted increasing attention because of their tremendous contributions to genome reorganization and gene variation through dramatic proliferation and excision via transposition. However, less known are the transcriptional activation of various TEs and the characteristics of TE insertion into genomes at the genome-wide level. In the present study, we focused on TE genes for transposition and gene disruption by insertion of TEs in expression sequences of Brassica, to investigate the transcriptional activation of TEs, the biased insertion of TEs into genes, and their salient characteristics. Long terminal repeat (LTR-retrotransposon) accounted for the majority of these active TE genes (70.8%), suggesting that transposition activation varied with TE type. 6.1% genes were interrupted by LTR-retrotransposons, which indicated their preference for insertion into genes. TEs were preferentially inserted into cellular component-specific genes acted as "binding" elements and involved in metabolic processes. TEs have a biased insertion into some host genes that were involved with important molecular functions and TE genes exhibited spatiotemporal expression. These results suggested that various types of transposons differentially contributed to gene variation and affected gene function.

  7. Activating the expression of bacterial cryptic genes by rpoB mutations in RNA polymerase or by rare earth elements.

    PubMed

    Ochi, Kozo; Tanaka, Yukinori; Tojo, Shigeo

    2014-02-01

    Since bacteria were found to contain genes encoding enzymes that synthesize a plethora of potential secondary metabolites, interest has grown in the activation of these cryptic pathways. Homologous and heterologous expression of these cryptic secondary metabolite-biosynthetic genes, often "silent" under ordinary laboratory fermentation conditions, may lead to the discovery of novel secondary metabolites. We review current progress on this topic, describing concepts for activating silent genes. We especially focus on genetic manipulation of transcription and translation, as well as the utilization of rare earth elements as a novel method to activate the silent genes. The possible roles of silent genes in bacterial physiology are also discussed. PMID:24127067

  8. DEG 10, an update of the database of essential genes that includes both protein-coding genes and noncoding genomic elements.

    PubMed

    Luo, Hao; Lin, Yan; Gao, Feng; Zhang, Chun-Ting; Zhang, Ren

    2014-01-01

    The combination of high-density transposon-mediated mutagenesis and high-throughput sequencing has led to significant advancements in research on essential genes, resulting in a dramatic increase in the number of identified prokaryotic essential genes under diverse conditions and a revised essential-gene concept that includes all essential genomic elements, rather than focusing on protein-coding genes only. DEG 10, a new release of the Database of Essential Genes (available at http://www.essentialgene.org), has been developed to accommodate these quantitative and qualitative advancements. In addition to increasing the number of bacterial and archaeal essential genes determined by genome-wide gene essentiality screens, DEG 10 also harbors essential noncoding RNAs, promoters, regulatory sequences and replication origins. These essential genomic elements are determined not only in vitro, but also in vivo, under diverse conditions including those for survival, pathogenesis and antibiotic resistance. We have developed customizable BLAST tools that allow users to perform species- and experiment-specific BLAST searches for a single gene, a list of genes, annotated or unannotated genomes. Therefore, DEG 10 includes essential genomic elements under different conditions in three domains of life, with customizable BLAST tools.

  9. Resistance Genes and Genetic Elements Associated with Antibiotic Resistance in Clinical and Commensal Isolates of Streptococcus salivarius.

    PubMed

    Chaffanel, Fanny; Charron-Bourgoin, Florence; Libante, Virginie; Leblond-Bourget, Nathalie; Payot, Sophie

    2015-06-15

    The diversity of clinical (n = 92) and oral and digestive commensal (n = 120) isolates of Streptococcus salivarius was analyzed by multilocus sequence typing (MLST). No clustering of clinical or commensal strains can be observed in the phylogenetic tree. Selected strains (92 clinical and 46 commensal strains) were then examined for their susceptibilities to tetracyclines, macrolides, lincosamides, aminoglycosides, and phenicol antibiotics. The presence of resistance genes tet(M), tet(O), erm(A), erm(B), mef(A/E), and catQ and associated genetic elements was investigated by PCR, as was the genetic linkage of resistance genes. High rates of erythromycin and tetracycline resistance were observed among the strains. Clinical strains displayed either the erm(B) (macrolide-lincosamide-streptogramin B [MLSB] phenotype) or mef(A/E) (M phenotype) resistance determinant, whereas almost all the commensal strains harbored the mef(A/E) resistance gene, carried by a macrolide efflux genetic assembly (MEGA) element. A genetic linkage between a macrolide resistance gene and genes of Tn916 was detected in 23 clinical strains and 5 commensal strains, with a predominance of Tn3872 elements (n = 13), followed by Tn6002 (n = 11) and Tn2009 (n = 4) elements. Four strains harboring a mef(A/E) gene were also resistant to chloramphenicol and carried a catQ gene. Sequencing of the genome of one of these strains revealed that these genes colocalized on an IQ-like element, as already described for other viridans group streptococci. ICESt3-related elements were also detected in half of the isolates. This work highlights the potential role of S. salivarius in the spread of antibiotic resistance genes both in the oral sphere and in the gut. PMID:25862227

  10. Resistance Genes and Genetic Elements Associated with Antibiotic Resistance in Clinical and Commensal Isolates of Streptococcus salivarius.

    PubMed

    Chaffanel, Fanny; Charron-Bourgoin, Florence; Libante, Virginie; Leblond-Bourget, Nathalie; Payot, Sophie

    2015-06-15

    The diversity of clinical (n = 92) and oral and digestive commensal (n = 120) isolates of Streptococcus salivarius was analyzed by multilocus sequence typing (MLST). No clustering of clinical or commensal strains can be observed in the phylogenetic tree. Selected strains (92 clinical and 46 commensal strains) were then examined for their susceptibilities to tetracyclines, macrolides, lincosamides, aminoglycosides, and phenicol antibiotics. The presence of resistance genes tet(M), tet(O), erm(A), erm(B), mef(A/E), and catQ and associated genetic elements was investigated by PCR, as was the genetic linkage of resistance genes. High rates of erythromycin and tetracycline resistance were observed among the strains. Clinical strains displayed either the erm(B) (macrolide-lincosamide-streptogramin B [MLSB] phenotype) or mef(A/E) (M phenotype) resistance determinant, whereas almost all the commensal strains harbored the mef(A/E) resistance gene, carried by a macrolide efflux genetic assembly (MEGA) element. A genetic linkage between a macrolide resistance gene and genes of Tn916 was detected in 23 clinical strains and 5 commensal strains, with a predominance of Tn3872 elements (n = 13), followed by Tn6002 (n = 11) and Tn2009 (n = 4) elements. Four strains harboring a mef(A/E) gene were also resistant to chloramphenicol and carried a catQ gene. Sequencing of the genome of one of these strains revealed that these genes colocalized on an IQ-like element, as already described for other viridans group streptococci. ICESt3-related elements were also detected in half of the isolates. This work highlights the potential role of S. salivarius in the spread of antibiotic resistance genes both in the oral sphere and in the gut.

  11. Resistance Genes and Genetic Elements Associated with Antibiotic Resistance in Clinical and Commensal Isolates of Streptococcus salivarius

    PubMed Central

    Chaffanel, Fanny; Charron-Bourgoin, Florence; Libante, Virginie; Leblond-Bourget, Nathalie

    2015-01-01

    The diversity of clinical (n = 92) and oral and digestive commensal (n = 120) isolates of Streptococcus salivarius was analyzed by multilocus sequence typing (MLST). No clustering of clinical or commensal strains can be observed in the phylogenetic tree. Selected strains (92 clinical and 46 commensal strains) were then examined for their susceptibilities to tetracyclines, macrolides, lincosamides, aminoglycosides, and phenicol antibiotics. The presence of resistance genes tet(M), tet(O), erm(A), erm(B), mef(A/E), and catQ and associated genetic elements was investigated by PCR, as was the genetic linkage of resistance genes. High rates of erythromycin and tetracycline resistance were observed among the strains. Clinical strains displayed either the erm(B) (macrolide-lincosamide-streptogramin B [MLSB] phenotype) or mef(A/E) (M phenotype) resistance determinant, whereas almost all the commensal strains harbored the mef(A/E) resistance gene, carried by a macrolide efflux genetic assembly (MEGA) element. A genetic linkage between a macrolide resistance gene and genes of Tn916 was detected in 23 clinical strains and 5 commensal strains, with a predominance of Tn3872 elements (n = 13), followed by Tn6002 (n = 11) and Tn2009 (n = 4) elements. Four strains harboring a mef(A/E) gene were also resistant to chloramphenicol and carried a catQ gene. Sequencing of the genome of one of these strains revealed that these genes colocalized on an IQ-like element, as already described for other viridans group streptococci. ICESt3-related elements were also detected in half of the isolates. This work highlights the potential role of S. salivarius in the spread of antibiotic resistance genes both in the oral sphere and in the gut. PMID:25862227

  12. Sterol regulatory element-binding proteins are transcriptional regulators of the thyroglobulin gene in thyroid cells.

    PubMed

    Wen, Gaiping; Eder, Klaus; Ringseis, Robert

    2016-08-01

    The genes encoding sodium/iodide symporter (NIS) and thyroid peroxidase (TPO), both of which are essential for thyroid hormone (TH) synthesis, were shown to be regulated by sterol regulatory element-binding proteins (SREBP)-1c and -2. In the present study we tested the hypothesis that transcription of a further gene essential for TH synthesis, the thyroglobulin (TG) gene, is under the control of SREBP. To test this hypothesis, we studied the influence of inhibition of SREBP maturation and SREBP knockdown on TG expression in FRTL-5 thyrocytes and explored transcriptional regulation of the TG promoter by reporter gene experiments in FRTL-5 and HepG2 cells, gel shift assays and chromatin immunoprecipitation. Inhibition of SREBP maturation by 25-hydroxycholesterol and siRNA-mediated knockdown of either SREBP-1c or SREBP-2 decreased mRNA and protein levels of TG in FRTL-5 thyrocytes. Reporter gene assays with wild-type and mutated TG promoter reporter truncation constructs revealed that the rat TG promoter is transcriptionally activated by nSREBP-1c and nSREBP-2. DNA-binding assays and chromatin immunoprecipitation assays showed that both nSREBP-1c and nSREBP-2 bind to a SREBP binding motif with characteristics of an E-box SRE at position -63 in the rat TG promoter. In connection with recent findings that NIS and TPO are regulated by SREBP in thyrocytes the present findings support the view that SREBP are regulators of essential steps of TH synthesis in the thyroid gland such as iodide uptake, iodide oxidation and iodination of tyrosyl residues of TG. This moreover suggests that SREBP may be molecular targets for pharmacological modulation of TH synthesis. PMID:27321819

  13. Autotetraploid rice methylome analysis reveals methylation variation of transposable elements and their effects on gene expression

    PubMed Central

    Zhang, Jie; Liu, Yuan; Xia, En-Hua; Yao, Qiu-Yang; Liu, Xiang-Dong; Gao, Li-Zhi

    2015-01-01

    Polyploidy, or whole-genome duplication (WGD), serves as a key innovation in plant evolution and is an important genomic feature for all eukaryotes. Neopolyploids have to overcome difficulties in meiosis, genomic alterations, changes of gene expression, and epigenomic reorganization. However, the underlying mechanisms for these processes are poorly understood. One of the most interesting aspects is that genome doubling events increase the dosage of all genes. Unlike allopolyploids entangled by both hybridization and polyploidization, autopolyploids, especially artificial lines, in relatively uniform genetic background offer a model system to understand mechanisms of genome-dosage effects. To investigate DNA methylation effects in response to WGD rather than hybridization, we produced autotetraploid rice with its diploid donor, Oryza sativa ssp. indica cv. Aijiaonante, both of which were independently self-pollinated over 48 generations, and generated and compared their comprehensive transcriptomes, base pair-resolution methylomes, and siRNAomes. DNA methylation variation of transposable elements (TEs) was observed as widespread in autotetraploid rice, in which hypermethylation of class II DNA transposons was predominantly noted in CHG and CHH contexts. This was accompanied by changes of 24-nt siRNA abundance, indicating the role of the RNA-directed DNA methylation pathway. Our results showed that the increased methylation state of class II TEs may suppress the expression of neighboring genes in autotetraploid rice that has obtained double alleles, leading to no significant differences in transcriptome alterations for most genes from its diploid donor. Collectively, our findings suggest that chromosome doubling induces methylation variation in TEs that affect gene expression and may become a “genome shock” response factor to help neoautopolyploids adapt to genome-dosage effects. PMID:26621743

  14. Evolutionary conservation of an atypical glucocorticoid-responsive element in the human tyrosine hydroxylase gene.

    PubMed

    Sheela Rani, C S; Soto-Pina, Alexandra; Iacovitti, Lorraine; Strong, Randy

    2013-07-01

    The human tyrosine hydroxylase (hTH) gene has a 42 bp evolutionarily conserved region designated (CR) II at -7.24 kb, which bears 93% homology to the region we earlier identified as containing the glucocorticoid response element, a 7 bp activator protein-1 (AP-1)-like motif in the rat TH gene. We cloned this hTH-CRII region upstream of minimal basal hTH promoter in luciferase (Luc) reporter vector, and tested glucocorticoid responsiveness in human cell lines. Dexamethasone (Dex) stimulated Luc activity of hTH-CRII in HeLa cells, while mifepristone, a glucocorticoid receptor (GR) antagonist, prevented Dex stimulation. Deletion of the 7 bp 5'-TGACTAA at -7243 bp completely abolished the Dex-stimulated Luc activity of hTH-CRII construct. The AP-1 agonist, tetradeconoyl-12,13-phorbol acetate (TPA), also stimulated hTH promoter activity, and Dex and TPA together further accentuated this response. Chromatin immunoprecipitation assays revealed the presence of both GR and AP-1 proteins, especially Jun family members, at this hTH promoter site. Dex did not stimulate hTH promoter activity in a catecholaminergic cell line, which had low endogenous GR levels, but did activate the response when GR was expressed exogenously. Thus, our studies have clearly identified a glucocorticoid-responsive element in a 7 bp AP-1-like motif in the promoter region at -7.24 kb of the human TH gene.

  15. Effects of Transposable Elements on the Expression of the Forked Gene of Drosophila Melanogaster

    PubMed Central

    Hoover, K. K.; Chien, A. J.; Corces, V. G.

    1993-01-01

    The products of the forked gene are involved in the formation and/or maintenance of a temporary fibrillar structure within the developing bristle rudiment of Drosophila melanogaster. Mutations in the forked locus alter this structure and result in aberrant development of macrochaetae, microchaetae and trichomes. The locus has been characterized at the molecular level by walking, mutant characterization and transcript analysis. Expression of the six forked transcripts is temporally restricted to midlate pupal development. At this time, RNAs of 6.4, 5.6, 5.4, 2.5, 1.9 and 1.1 kilobases (kb) are detected by Northern analysis. The coding region of these RNAs has been found to be within a 21-kb stretch of genomic DNA. The amino terminus of the proteins encoded by the 5.4- and 5.6-kb forked transcripts contain tandem copies of ankyrin-like repeats that may play an important role in the function of forked-encoded products. The profile of forked RNA expression is altered in seven spontaneous mutations characterized during this study. Three forked mutations induced by the insertion of the gypsy retrotransposon contain a copy of this element inserted into an intron of the gene. In these mutants, the 5.6-, 5.4- and 2.5-kb forked mRNAs are truncated via recognition of the polyadenylation site in the 5' long terminal repeat of the gypsy retrotransposon. These results help explain the role of the forked gene in fly development and further our understanding of the role of transposable elements in mutagenesis. PMID:8244011

  16. Identification of cis-acting regulatory elements in the promoter region of the rat brain creatine kinase gene.

    PubMed Central

    Hobson, G M; Molloy, G R; Benfield, P A

    1990-01-01

    The functional organization of the rat brain creatine kinase (ckb) promoter was analyzed by deletion, linker scanning, and substitution mutagenesis. Mutations were introduced into the ckb promoter of hybrid ckb/neo (neomycin resistance gene) genes, and the mutant genes were expressed transiently in HeLa cells. Expression was assayed by primer extension analysis of neo RNA, which allowed the transcription start sites and the amount of transcription to be determined. Transfections and primer extension reactions were internally controlled by simultaneous analysis of transcription from the adenovirus VA gene located on the same plasmid as the hybrid ckb/neo gene. We demonstrate that 195 bp of the ckb promoter is sufficient for efficient in vivo expression in HeLa cells. A nonconsensus TTAA element at -28 bp appears to provide the TATA box function for the ckb promoter in vivo. Two CCAAT elements, one at -84 bp and the other at -54 bp, and a TATAAA TA element (a consensus TATA box sequence) at -66 bp are required for efficient transcription from the TTAA element. In addition, we present evidence that the consensus beta-globin TATA box responds to the TATAAATA element in the same way as the ckb nonconsensus TTAA element. Images PMID:2247071

  17. In vivo expression of MHC class I genes depends on the presence of a downstream barrier element.

    PubMed

    Cohen, Helit; Parekh, Palak; Sercan, Zeynep; Kotekar, Aparna; Weissman, Jocelyn D; Singer, Dinah S

    2009-08-26

    Regulation of MHC class I gene expression is critical to achieve proper immune surveillance. In this work, we identify elements downstream of the MHC class I promoter that are necessary for appropriate in vivo regulation: a novel barrier element that protects the MHC class I gene from silencing and elements within the first two introns that contribute to tissue specific transcription. The barrier element is located in intergenic sequences 3' to the polyA addition site. It is necessary for stable expression in vivo, but has no effect in transient transfection assays. Accordingly, in both transgenic mice and stably transfected cell lines, truncation of the barrier resulted in transcriptional gene silencing, increased nucleosomal density and decreased histone H3K9/K14 acetylation and H3K4 di-methylation across the gene. Significantly, distinct sequences within the barrier element govern anti-silencing and chromatin modifications. Thus, this novel barrier element functions to maintain transcriptionally permissive chromatin organization and prevent transcriptional silencing of the MHC class I gene, ensuring it is poised to respond to immune signaling.

  18. Trans-silencing by P elements inserted in subtelomeric heterochromatin involves the Drosophila Polycomb group gene, Enhancer of zeste.

    PubMed Central

    Roche, S E; Rio, D C

    1998-01-01

    Drosophila P-element transposition is regulated by a maternally inherited state known as P cytotype. An important aspect of P cytotype is transcriptional repression of the P-element promoter. P cytotype can also repress non-P-element promoters within P-element ends, suggesting that P cytotype repression might involve chromatin-based transcriptional silencing. To learn more about the role of chromatin in P cytotype repression, we have been studying the P strain Lk-P(1A). This strain contains two full-length P elements inserted in the heterochromatic telomere-associated sequences (TAS elements) at cytological location 1A. Mutations in the Polycomb group gene (Pc-G gene), Enhancer of zeste (E(z)), whose protein product binds at 1A, resulted in a loss of Lk-P(1A) cytotype control. E(z) mutations also affected the trans-silencing of heterologous promoters between P-element termini by P-element transgenes inserted in the TAS repeats. These data suggest that pairing interactions between P elements, resulting in exchange of chromatin structures, may be a mechanism for controlling the expression and activity of P elements. PMID:9691041

  19. VIP1 response elements mediate mitogen-activated protein kinase 3-induced stress gene expression.

    PubMed

    Pitzschke, Andrea; Djamei, Armin; Teige, Markus; Hirt, Heribert

    2009-10-27

    The plant pathogen Agrobacterium tumefaciens transforms plant cells by delivering its T-DNA into the plant cell nucleus where it integrates into the plant genome and causes tumor formation. A key role of VirE2-interacting protein 1 (VIP1) in the nuclear import of T-DNA during Agrobacterium-mediated plant transformation has been unravelled and VIP1 was shown to undergo nuclear localization upon phosphorylation by the mitogen-activated protein kinase MPK3. Here, we provide evidence that VIP1 encodes a functional bZIP transcription factor that stimulates stress-dependent gene expression by binding to VIP1 response elements (VREs), a DNA hexamer motif. VREs are overrepresented in promoters responding to activation of the MPK3 pathway such as Trxh8 and MYB44. Accordingly, plants overexpressing VIP1 accumulate high levels of Trxh8 and MYB44 transcripts, whereas stress-induced expression of these genes is impaired in mpk3 mutants. Trxh8 and MYB44 promoters are activated by VIP1 in a VRE-dependent manner. VIP1 strongly enhances expression from a synthetic promoter harboring multiple VRE copies and directly interacts with VREs in vitro and in vivo. Chromatin immunoprecipitation assays of the MYB44 promoter confirm that VIP1 binding to VREs is enhanced under conditions of MPK3 pathway stimulation. These results provide molecular insight into the cellular mechanism of target gene regulation by the MPK3 pathway. PMID:19820165

  20. Role of Estrogen Response Element in the Human Prolactin Gene: Transcriptional Response and Timing

    PubMed Central

    McNamara, Anne V.; Adamson, Antony D.; Dunham, Lee S. S.; Semprini, Sabrina; Spiller, David G.; McNeilly, Alan S.; Mullins, John J.

    2016-01-01

    The use of bacterial artificial chromosome (BAC) reporter constructs in molecular physiology enables the inclusion of large sections of flanking DNA, likely to contain regulatory elements and enhancers regions that contribute to the transcriptional output of a gene. Using BAC recombineering, we have manipulated a 160-kb human prolactin luciferase (hPRL-Luc) BAC construct and mutated the previously defined proximal estrogen response element (ERE) located −1189 bp relative to the transcription start site, to assess its involvement in the estrogen responsiveness of the entire hPRL locus. We found that GH3 cell lines stably expressing Luc under control of the ERE-mutated hPRL promoter (ERE-Mut) displayed a dramatically reduced transcriptional response to 17β-estradiol (E2) treatment compared with cells expressing Luc from the wild-type (WT) ERE hPRL-Luc promoter (ERE-WT). The −1189 ERE controls not only the response to E2 treatment but also the acute transcriptional response to TNFα, which was abolished in ERE-Mut cells. ERE-WT cells displayed a biphasic transcriptional response after TNFα treatment, the acute phase of which was blocked after treatment with the estrogen receptor antagonist 4-hydroxy-tamoxifen. Unexpectedly, we show the oscillatory characteristics of hPRL promoter activity in individual living cells were unaffected by disruption of this crucial response element, real-time bioluminescence imaging showed that transcription cycles were maintained, with similar cycle lengths, in ERE-WT and ERE-Mut cells. These data suggest the −1189 ERE is the dominant response element involved in the hPRL transcriptional response to both E2 and TNFα and, crucially, that cycles of hPRL promoter activity are independent of estrogen receptor binding. PMID:26691151

  1. Identification and characterization of novel Salmonella mobile elements involved in the dissemination of genes linked to virulence and transmission.

    PubMed

    Moreno Switt, Andrea I; den Bakker, Henk C; Cummings, Craig A; Rodriguez-Rivera, Lorraine D; Govoni, Gregory; Raneiri, Matthew L; Degoricija, Lovorka; Brown, Stephanie; Hoelzer, Karin; Peters, Joseph E; Bolchacova, Elena; Furtado, Manohar R; Wiedmann, Martin

    2012-01-01

    The genetic diversity represented by >2,500 different Salmonella serovars provides a yet largely uncharacterized reservoir of mobile elements that can contribute to the frequent emergence of new pathogenic strains of this important zoonotic pathogen. Currently, our understanding of Salmonella mobile elements is skewed by the fact that most studies have focused on highly virulent or common serovars. To gain a more global picture of mobile elements in Salmonella, we used prediction algorithms to screen for mobile elements in 16 sequenced Salmonella genomes representing serovars for which no prior genome scale mobile element data were available. From these results, selected mobile elements underwent further analyses in the form of validation studies, comparative analyses, and PCR-based population screens. Through this analysis we identified a novel plasmid that has two cointegrated replicons (IncI1-IncFIB); this plasmid type was found in four genomes representing different Salmonella serovars and contained a virulence gene array that had not been previously identified. A Salmonella Montevideo isolate contained an IncHI and an IncN2 plasmid, which both encoded antimicrobial resistance genes. We also identified two novel genomic islands (SGI2 and SGI3), and 42 prophages with mosaic architecture, seven of them harboring known virulence genes. Finally, we identified a novel integrative conjugative element (ICE) encoding a type IVb pilus operon in three non-typhoidal Salmonella serovars. Our analyses not only identified a considerable number of mobile elements that have not been previously reported in Salmonella, but also found evidence that these elements facilitate transfer of genes that were previously thought to be limited in their distribution among Salmonella serovars. The abundance of mobile elements encoding pathogenic properties may facilitate the emergence of strains with novel combinations of pathogenic traits.

  2. A new family of retroviral long terminal repeat elements in the human genome identified by their homologies to an element 5{prime} to the spider monkey haptoglobin gene

    SciTech Connect

    Erickson, L.M.; Maeda, N.

    1995-06-10

    A new family of retroviral long terminal repeats that we name Spm-LTR has been identified as a result of DNA sequence comparisons between the entire Gen-Bank databank and an element, SPHP, located 5{prime} to the haptoglobin gene of spider monkeys. The 18 human Spm-LTR sequences so identified fall into three subtypes. There is no sequence similarity between Spm-LTR elements and any endogenous retroviral LTR sequences previously reported except for general features that define LTRs. However, a previously described repeated sequence (MER-4) forms a portion of the Spm-LTR sequence. 13 refs., 1 fig., 1 tab.

  3. Dual regulatory effects of non-coding GC-rich elements on the expression of virulence genes in malaria parasites.

    PubMed

    Wei, Guiying; Zhao, Yuemeng; Zhang, Qingfeng; Pan, Weiqing

    2015-12-01

    As the primary virulence factor of falciparum malaria, var genes harboring mutually exclusive expression pattern lead to antigenic variation and immune evasion of this pathogen in human host. Although various mechanisms contribute to silence of var genes, little is known of transcriptional activation pathways of a single var gene and maintenance of its active state with other silent var loci. Here, we report a monoallelic expression pattern of the non-coding GC-elements flanking chromosomal internal var genes, and transcript from the active one was required for activation of the var gene in the same array. Meanwhile, GFP reporter assays revealed a repressive effect on the adjacent gene induced by DNA motifs of the insulator-like GC-element, which was linked to heterochromatin subnuclear localization. Taken together, these data for the first time provide experimental evidence of the dual cis- and trans-acting regulatory functions of the GC-elements in both silence and activation of var genes, which would advance our understanding of the complex regulatory network of the virulence gene family in P. falciparum.

  4. The Arabidopsis thaliana MHX gene includes an intronic element that boosts translation when localized in a 5' UTR intron.

    PubMed

    Akua, Tsofit; Shaul, Orit

    2013-11-01

    The mechanisms that underlie the ability of some introns to increase gene expression, a phenomenon called intron-mediated enhancement (IME), are not fully understood. It is also not known why introns localized in the 5'-untranslated region (5' UTR) are considerably longer than downstream eukaryotic introns. It was hypothesized that this extra length results from the presence of some functional intronic elements. However, deletion analyses studies carried out thus far were unable to identify specific intronic regions necessary for IME. Using deletion analysis and a gain-of-function approach, an internal element that considerably increases translational efficiency, without affecting splicing, was identified in the 5' UTR intron of the Arabidopsis thaliana MHX gene. Moreover, the ability of this element to enhance translation was diminished by a minor downstream shift in the position of introns containing it from the 5' UTR into the coding sequence. These data suggest that some of the extra length of 5' UTR introns results from the presence of elements that enhance translation, and, moreover, from the ability of 5' UTR introns to provide preferable platforms for such elements over downstream introns. The impact of the identified intronic element on translational efficiency was augmented upon removal of neighbouring intronic elements. Interference between different intronic elements had not been reported thus far. This interference may support the bioinformatics-based idea that some of the extra sequence of 5' UTR introns is also necessary for separating different functional intronic elements.

  5. Redundant cis-acting elements control expression of the Drosophila affinidisjuncta Adh gene in the larval fat body.

    PubMed Central

    McKenzie, R W; Hu, J; Brennan, M D

    1994-01-01

    The alcohol dehydrogenase (Adh) gene in the Hawaiian species of fruit fly, Drosophila affinidisjuncta, like the Adh genes from all Drosophila species analyzed, is expressed at high levels in the larval fat body via a larval-specific promoter. To identify the cis-acting elements involved in this highly conserved aspect of Adh gene expression, deleted D. affinidisjuncta genes were introduced into D. melanogaster by somatic transformation. Unlike previously described methods, this transformation system allows analysis of Adh gene expression specifically in the larval fat body. The arrangement of sequences influencing expression of the proximal promoter of this gene in the larval fat body differs markedly from that described for the Adh gene from the distant relative, D. melanogaster. Multiple redundant elements dispersed 5' and 3' to the gene, only some of which map to regions carrying evolutionarily conserved sequences, affect expression in the fat body. D. affinidisjuncta employs a novel mode of Adh gene regulation in which the proximal promoter is influenced by sequences having roles in expression of the distal promoter. This gene is also unique in that far upstream sequences can compensate for loss of sequences within 200 bp of the proximal RNA start site. Furthermore, expression is influenced in an unusual, context-dependent manner by a naturally-occurring 3' duplication of the proximal promoter--a feature found only in Hawaiian species. Images PMID:8165141

  6. Somatic variegation and germinal mutability reflect the position of transposable element dissociation within the maize R gene

    SciTech Connect

    Alleman, M.; Kermicle, J.L. )

    1993-09-01

    The R gene regulates the timing and tissue-specificity of anthocyanin deposition during maize development. The Ac/Ds system of transposable elements was used to induce insertional mutants of the R-sc:124 allele during two cycles of mutagenesis. Of 43 unstable, spotted-aleurone mutants generated, 42 contain inserts of the Ds6 transposable element differing only in the position and orientation of the element. The remaining mutant, r-sc;ml, contained an insert of a Ds element of the approximate size of the Ds1 transposable element. The patterns of somatic variegation of these mutants, resulting from excision of Ds, define a spectrum of phenotypes ranging from sparse to dense variegation. The sparsely variegated mutants produce many germinal revertants and few stable null derivatives. Molecular analysis shows that the sparsely variegated alleles are caused by Ds6 insertions in protein coding regions of R-sc:124 whereas the densely variegated mutants result from insertions in introns or in flanking regions of the gene. The excision rate of Ds6 from R, estimated as the proportion of R genomic DNA restriction fragments lacking the element, was uniform regardless of position, orientation or whether the element was inserted in R-sc:124 or another R allele. The excision rate was greater, however, for the mutable alleles involving the Ds element from r-sc:m1. These data indicate that, although the excision rates are uniform for a given Ds element, the somatic and germinal mutability patterns of alleles associated with that element vary widely and depend primarily on the position of the transposable element within coding or noncoding regions of the gene.

  7. Histone H3 K27 acetylation marks a potent enhancer element on the adipogenic master regulator gene Pparg2

    PubMed Central

    Ramlee, Muhammad Khairul; Zhang, Qiongyi; Idris, Muhammad; Peng, Xu; Sim, Choon Kiat; Han, Weiping; Xu, Feng

    2014-01-01

    PPARγ2 is expressed almost exclusively in adipose tissue and plays a central role in adipogenesis. Despite intensive studies over the last 2 decades, the mechanism regulating the expression of the Pparg2 gene, especially the role of cis-regulatory elements, is still not completely understood. Here, we report a comprehensive investigation of the enhancer elements within the murine Pparg2 gene. Utilizing the combined techniques of sequence conservation analysis and chromatin marker examination, we identified a potent enhancer element that augmented the expression of a reporter gene under the control of the Pparg2 promoter by 20-fold. This enhancer element was first identified as highly conserved non-coding sequence 10 (CNS10) and was later shown to be enriched with the enhancer marker H3 K27 acetylation. Further studies identified a binding site for p300 as the essential enhancer element in CNS10. Moreover, p300 physically binds to CNS10 and is required for the enhancer activity of CNS10. The depletion of p300 by siRNA resulted in significantly impaired activation of Pparg2 at the early stages of 3T3-L1 adipogenesis. In summary, our study identified a novel enhancer element on the murine Pparg2 gene and suggested a novel mechanism for the regulation of Pparg2 expression by p300 in 3T3-L1 adipogenesis. PMID:25485585

  8. The CHR promoter element controls cell cycle-dependent gene transcription and binds the DREAM and MMB complexes

    PubMed Central

    Müller, Gerd A.; Quaas, Marianne; Schümann, Michael; Krause, Eberhard; Padi, Megha; Fischer, Martin; Litovchick, Larisa; DeCaprio, James A.; Engeland, Kurt

    2012-01-01

    Cell cycle-dependent gene expression is often controlled on the transcriptional level. Genes like cyclin B, CDC2 and CDC25C are regulated by cell cycle-dependent element (CDE) and cell cycle genes homology region (CHR) promoter elements mainly through repression in G0/G1. It had been suggested that E2F4 binding to CDE sites is central to transcriptional regulation. However, some promoters are only controlled by a CHR. We identify the DREAM complex binding to the CHR of mouse and human cyclin B2 promoters in G0. Association of DREAM and cell cycle-dependent regulation is abrogated when the CHR is mutated. Although E2f4 is part of the complex, a CDE is not essential but can enhance binding of DREAM. We show that the CHR element is not only necessary for repression of gene transcription in G0/G1, but also for activation in S, G2 and M phases. In proliferating cells, the B-myb-containing MMB complex binds the CHR of both promoters independently of the CDE. Bioinformatic analyses identify many genes which contain conserved CHR elements in promoters binding the DREAM complex. With Ube2c as an example from that screen, we show that inverse CHR sites are functional promoter elements that can bind DREAM and MMB. Our findings indicate that the CHR is central to DREAM/MMB-dependent transcriptional control during the cell cycle. PMID:22064854

  9. Widespread contribution of transposable elements to the innovation of gene regulatory networks.

    PubMed

    Sundaram, Vasavi; Cheng, Yong; Ma, Zhihai; Li, Daofeng; Xing, Xiaoyun; Edge, Peter; Snyder, Michael P; Wang, Ting

    2014-12-01

    Transposable elements (TEs) have been shown to contain functional binding sites for certain transcription factors (TFs). However, the extent to which TEs contribute to the evolution of TF binding sites is not well known. We comprehensively mapped binding sites for 26 pairs of orthologous TFs in two pairs of human and mouse cell lines (representing two cell lineages), along with epigenomic profiles, including DNA methylation and six histone modifications. Overall, we found that 20% of binding sites were embedded within TEs. This number varied across different TFs, ranging from 2% to 40%. We further identified 710 TF-TE relationships in which genomic copies of a TE subfamily contributed a significant number of binding peaks for a TF, and we found that LTR elements dominated these relationships in human. Importantly, TE-derived binding peaks were strongly associated with open and active chromatin signatures, including reduced DNA methylation and increased enhancer-associated histone marks. On average, 66% of TE-derived binding events were cell type-specific with a cell type-specific epigenetic landscape. Most of the binding sites contributed by TEs were species-specific, but we also identified binding sites conserved between human and mouse, the functional relevance of which was supported by a signature of purifying selection on DNA sequences of these TEs. Interestingly, several TFs had significantly expanded binding site landscapes only in one species, which were linked to species-specific gene functions, suggesting that TEs are an important driving force for regulatory innovation. Taken together, our data suggest that TEs have significantly and continuously shaped gene regulatory networks during mammalian evolution.

  10. Effects of ionizing radiation on expression of genes encoding cytoskeletal elements: Kinetics and dose effects

    SciTech Connect

    Woloschak, G.E.; Shearin-Jones, P.; Chang-Liu, C.M. )

    1990-01-01

    We examined the modulation in expression of genes encoding three cytoskeletal elements (beta-actin, gamma-actin, and alpha-tubulin) in Syrian hamster embryo (SHE) cells following exposure to ionizing radiations. Early-passage SHE cells were irradiated in plateau phase with various low doses (12-200 cGy) of neutrons, gamma-rays, or x-rays. RNA samples were prepared from cells at different times postexposure and were analyzed for levels of specific transcripts by northern blots. The results revealed that alpha-tubulin was induced by both high-linear energy of transfer (LET) (neutrons) and low-LET (gamma-rays and x-rays) radiations with similar kinetics. The peak in alpha-tubulin mRNA accumulation occurred between 1 and 3 h postexposure; for gamma-actin mRNA, accumulation was similarly induced. For both gamma-actin and alpha-tubulin, the higher the dose during the first hour postexposure (up to 200 cGy gamma-rays), the greater the level of mRNA induction. In contrast, mRNA specific for beta-actin showed decreased accumulation during the first hour following radiation exposure, and remained low up to 3 h postexposure. These results document the differential modulation of genes specific for cytoskeletal elements following radiation exposure. In addition, they demonstrate a decrease in the ratio of beta-actin:gamma-actin mRNA within the first 3 h following gamma-ray exposure. These changes in mRNA accumulation are similar to those reported in some transformed cell lines and in cells treated with tumor promoters, which suggests a role for changes in actin- and tubulin-mRNA expression in radiation-mediated transformation.

  11. Widespread contribution of transposable elements to the innovation of gene regulatory networks

    PubMed Central

    Sundaram, Vasavi; Cheng, Yong; Ma, Zhihai; Li, Daofeng; Xing, Xiaoyun; Edge, Peter

    2014-01-01

    Transposable elements (TEs) have been shown to contain functional binding sites for certain transcription factors (TFs). However, the extent to which TEs contribute to the evolution of TF binding sites is not well known. We comprehensively mapped binding sites for 26 pairs of orthologous TFs in two pairs of human and mouse cell lines (representing two cell lineages), along with epigenomic profiles, including DNA methylation and six histone modifications. Overall, we found that 20% of binding sites were embedded within TEs. This number varied across different TFs, ranging from 2% to 40%. We further identified 710 TF–TE relationships in which genomic copies of a TE subfamily contributed a significant number of binding peaks for a TF, and we found that LTR elements dominated these relationships in human. Importantly, TE-derived binding peaks were strongly associated with open and active chromatin signatures, including reduced DNA methylation and increased enhancer-associated histone marks. On average, 66% of TE-derived binding events were cell type-specific with a cell type-specific epigenetic landscape. Most of the binding sites contributed by TEs were species-specific, but we also identified binding sites conserved between human and mouse, the functional relevance of which was supported by a signature of purifying selection on DNA sequences of these TEs. Interestingly, several TFs had significantly expanded binding site landscapes only in one species, which were linked to species-specific gene functions, suggesting that TEs are an important driving force for regulatory innovation. Taken together, our data suggest that TEs have significantly and continuously shaped gene regulatory networks during mammalian evolution. PMID:25319995

  12. DNase I hypersensitivity sites and nuclear protein binding on the fatty acid synthase gene: identification of an element with properties similar to known glucose-responsive elements.

    PubMed Central

    Foufelle, F; Lepetit, N; Bosc, D; Delzenne, N; Morin, J; Raymondjean, M; Ferré, P

    1995-01-01

    We have shown previously that fatty acid synthase (FAS) gene expression is positively regulated by glucose in rat adipose tissue and liver. In the present study, we have identified in the first intron of the gene a sequence closely related to known glucose-responsive elements such as in the L-pyruvate kinase and S14 genes, including a putative upstream stimulatory factor/major late transcription factor (USF/MLTF) binding site (E-box) (+ 292 nt to + 297 nt). Location of this sequence corresponds to a site of hypersensitivity to DNase I which is present in the liver but not in the spleen. Moreover, using this information from a preliminary report of the present work, others have shown that a + 283 nt to + 303 nt sequence of the FAS gene can confer glucose responsiveness to a heterologous promoter. The protein binding to this region has been investigated in vitro by a combination of DNase I footprinting and gel-retardation experiments with synthetic oligonucleotides and known nuclear proteins. DNase I footprinting experiments using a + 161 nt to + 405 nt fragment of the FAS gene demonstrate that a region from + 290 nt to + 316 nt is protected by nuclear extracts from liver and spleen. This region binds two ubiquitous nuclear factors, USF/MLTF and the CAAT-binding transcription factor/nuclear factor 1 (CTF/NF1). Binding of these factors is similar in nuclear extracts from liver which does or does not express the FAS gene as observed for glucose-responsive elements in the L-pyruvate kinase and S14 genes. This suggests a posttranslational modification of a factor of the complex after glucose stimulation. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 PMID:7772036

  13. DNase I hypersensitivity sites and nuclear protein binding on the fatty acid synthase gene: identification of an element with properties similar to known glucose-responsive elements.

    PubMed

    Foufelle, F; Lepetit, N; Bosc, D; Delzenne, N; Morin, J; Raymondjean, M; Ferré, P

    1995-06-01

    We have shown previously that fatty acid synthase (FAS) gene expression is positively regulated by glucose in rat adipose tissue and liver. In the present study, we have identified in the first intron of the gene a sequence closely related to known glucose-responsive elements such as in the L-pyruvate kinase and S14 genes, including a putative upstream stimulatory factor/major late transcription factor (USF/MLTF) binding site (E-box) (+ 292 nt to + 297 nt). Location of this sequence corresponds to a site of hypersensitivity to DNase I which is present in the liver but not in the spleen. Moreover, using this information from a preliminary report of the present work, others have shown that a + 283 nt to + 303 nt sequence of the FAS gene can confer glucose responsiveness to a heterologous promoter. The protein binding to this region has been investigated in vitro by a combination of DNase I footprinting and gel-retardation experiments with synthetic oligonucleotides and known nuclear proteins. DNase I footprinting experiments using a + 161 nt to + 405 nt fragment of the FAS gene demonstrate that a region from + 290 nt to + 316 nt is protected by nuclear extracts from liver and spleen. This region binds two ubiquitous nuclear factors, USF/MLTF and the CAAT-binding transcription factor/nuclear factor 1 (CTF/NF1). Binding of these factors is similar in nuclear extracts from liver which does or does not express the FAS gene as observed for glucose-responsive elements in the L-pyruvate kinase and S14 genes. This suggests a posttranslational modification of a factor of the complex after glucose stimulation.

  14. Plasmid metagenome reveals high levels of antibiotic resistance genes and mobile genetic elements in activated sludge.

    PubMed

    Zhang, Tong; Zhang, Xu-Xiang; Ye, Lin

    2011-01-01

    The overuse or misuse of antibiotics has accelerated antibiotic resistance, creating a major challenge for the public health in the world. Sewage treatment plants (STPs) are considered as important reservoirs for antibiotic resistance genes (ARGs) and activated sludge characterized with high microbial density and diversity facilitates ARG horizontal gene transfer (HGT) via mobile genetic elements (MGEs). However, little is known regarding the pool of ARGs and MGEs in sludge microbiome. In this study, the transposon aided capture (TRACA) system was employed to isolate novel plasmids from activated sludge of one STP in Hong Kong, China. We also used Illumina Hiseq 2000 high-throughput sequencing and metagenomics analysis to investigate the plasmid metagenome. Two novel plasmids were acquired from the sludge microbiome by using TRACA system and one novel plasmid was identified through metagenomics analysis. Our results revealed high levels of various ARGs as well as MGEs for HGT, including integrons, transposons and plasmids. The application of the TRACA system to isolate novel plasmids from the environmental metagenome, coupled with subsequent high-throughput sequencing and metagenomic analysis, highlighted the prevalence of ARGs and MGEs in microbial community of STPs.

  15. Phylogenetic and Genomic Analyses Resolve the Origin of Important Plant Genes Derived from Transposable Elements

    PubMed Central

    Joly-Lopez, Zoé; Hoen, Douglas R.; Blanchette, Mathieu; Bureau, Thomas E.

    2016-01-01

    Once perceived as merely selfish, transposable elements (TEs) are now recognized as potent agents of adaptation. One way TEs contribute to evolution is through TE exaptation, a process whereby TEs, which persist by replicating in the genome, transform into novel host genes, which persist by conferring phenotypic benefits. Known exapted TEs (ETEs) contribute diverse and vital functions, and may facilitate punctuated equilibrium, yet little is known about this process. To better understand TE exaptation, we designed an approach to resolve the phylogenetic context and timing of exaptation events and subsequent patterns of ETE diversification. Starting with known ETEs, we search in diverse genomes for basal ETEs and closely related TEs, carefully curate the numerous candidate sequences, and infer detailed phylogenies. To distinguish TEs from ETEs, we also weigh several key genomic characteristics including repetitiveness, terminal repeats, pseudogenic features, and conserved domains. Applying this approach to the well-characterized plant ETEs MUG and FHY3, we show that each group is paraphyletic and we argue that this pattern demonstrates that each originated in not one but multiple exaptation events. These exaptations and subsequent ETE diversification occurred throughout angiosperm evolution including the crown group expansion, the angiosperm radiation, and the primitive evolution of angiosperms. In addition, we detect evidence of several putative novel ETE families. Our findings support the hypothesis that TE exaptation generates novel genes more frequently than is currently thought, often coinciding with key periods of evolution. PMID:27189548

  16. Cis elements and trans-acting factors affecting regulation of a nonphotosynthetic light-regulated gene for chloroplast glutamine synthetase.

    PubMed Central

    Tjaden, G; Edwards, J W; Coruzzi, G M

    1995-01-01

    The glutamine synthetase (GS) gene family in pea (Pisum sativum) consists of four nuclear genes encoding distinct isoenzymes. Molecular studies have show that the GS2 gene encoding chloroplast-localized GS is expected in specific cell types and is regulated by diverse factors such as light and photorespiration. Here, we present the nucleotide sequence of the pea GS2 gene promoter. To identify the elements involved in regulation of GS2 expression, GS2 promoter-deletion analyses were performed using GS2-GUS fusions in tobacco (Nicotiana tabacum). This analysis revealed that the GS2 transit peptide is not required for mesophyll cell-specific expression of beta-glucuronidase (GUS). GUS activity was induced 2- to 4-fold in light-grown versus etiolated T1 seedlings. However, high levels of GUS activity were observed in etiolated seedlings. This observation demonstrated that regulation of expression of GS2, a nonphotosynthetic light-regulated gene, involves additional factors. A 323-bp GS2 promoter sequence is sufficient to confer light regulation to the GUS reporter gene in leaves of mature transgenic tobacco. Light-regulated expression of this pea gene promoter is observed in both tobacco and Arabidopsis, suggesting that the regulatory elements are conserved. Gel-shift analysis detected DNA-protein complexes formed with potential transcription elements within this short, light-responsive GS2 promoter fragment. PMID:7630938

  17. Regulatory elements necessary for termination of transcription within the immunoglobulin heavy chain gene locus

    SciTech Connect

    Moore, B.B.

    1992-01-01

    Previous experimentation demonstrated that regulation of the IgM only phenotype in both pre-B and immature B cells was primarily at the transcriptional level. Expression of IgD mRNA involves transcription of the entire 29 kilobase rearranged [mu]-[delta] locus. Mature B cells transcribe the [beta] exons at approximately half the level that they transcribe the [delta] gene. Early B cells however, transcribe the [mu] gene with approximately 90% more efficiency than they do the [delta] gene. Specifically, early B cells show a transcription termination event occurring within a 1 kilobase region of the [mu]-[delta] intron. This dissertation analyzes the sequence elements necessary to encode the transcription termination event within the [mu]-[delta] intron. This work shows that the termination motif consists of specific sequences within the [mu]m poly(A) site as well as a region of the [mu]-[delta] intron contained within a 1200 base pair fragment. The 1200 base pair fragment extends from the Pst I site within the intron and ends just prior to the C[delta]1 exon. This fragment contains a 162 base pair unique sequence inverted repeat (USIR). Furthermore, the [mu]m site is specifically required because the [mu]s site was unable to substitute, despite extensive usage. In addition, the USIR-containing intron functions in an orientation-dependent manner. Analysis of this termination motif in a variety of lymphoid and non-lymphoid cells suggests that this motif is an intrinsic polymerase II termination motif. This implies that transcription termination in early B cells is by a default model and that active regulation of this motif involves an anti-termination event in mature B cells.

  18. Prevalence of mobile genetic elements and transposase genes in Vibrio alginolyticus from the southern coastal region of China and their role in horizontal gene transfer.

    PubMed

    Luo, Peng; Jiang, Haiying; Wang, Yanhong; Su, Ting; Hu, Chaoqun; Ren, Chunhua; Jiang, Xiao

    2012-12-01

    Vibrio alginolyticus has high genetic diversity, but little is known about the means by which it has been acquired. In this study, the distributions of mobile genetic elements (MGEs), including integrating conjugative elements (ICEs), superintegron-like cassettes (SICs), insertion sequences (ISs), and two types of transposase genes (valT1 and valT2), in 192 strains of V. alginolyticus were investigated. ICE, SIC, and IS elements, valT1, and valT2 were detected in 8.9%, 13.0%, 4.7%, 9.4%, and 2.6% of the strains, respectively. Blast searches and phylogenetic analysis of the acquired sequences of the ICE, SIC, IS elements and transposase genes showed that the corresponding homologues were bacterial and derived from extensive sources. The high prevalences of these MGEs in V. alginolyticus implied the extensive and frequent exchange of genes with environmental bacteria and that these elements strongly contribute to the genetic and phenotypic diversity of the bacterium. To our knowledge, this is the first report of V. alginolyticus harboring ICE and SIC elements.

  19. Long-range regulation by shared retinoic acid response elements modulates dynamic expression of posterior Hoxb genes in CNS development.

    PubMed

    Ahn, Youngwook; Mullan, Hillary E; Krumlauf, Robb

    2014-04-01

    Retinoic acid (RA) signaling plays an important role in determining the anterior boundary of Hox gene expression in the neural tube during embryogenesis. In particular, RA signaling is implicated in a rostral expansion of the neural expression domain of 5׳ Hoxb genes (Hoxb9-Hoxb5) in mice. However, underlying mechanisms for this gene regulation have remained elusive due to the lack of RA responsive element (RARE) in the 5׳ half of the HoxB cluster. To identify cis-regulatory elements required for the rostral expansion, we developed a recombineering technology to serially label multiple genes with different reporters in a single bacterial artificial chromosome (BAC) vector containing the mouse HoxB cluster. This allowed us to simultaneously monitor the expression of multiple genes. In contrast to plasmid-based reporters, transgenic BAC reporters faithfully recapitulated endogenous gene expression patterns of the Hoxb genes including the rostral expansion. Combined inactivation of two RAREs, DE-RARE and ENE-RARE, in the BAC completely abolished the rostral expansion of the 5׳ Hoxb genes. Knock-out of endogenous DE-RARE lead to significantly reduced expression of multiple Hoxb genes and attenuated Hox gene response to exogenous RA treatment in utero. Regulatory potential of DE-RARE was further demonstrated by its ability to anteriorize 5׳ Hoxa gene expression in the neural tube when inserted into a HoxA BAC reporter. Our data demonstrate that multiple RAREs cooperate to remotely regulate 5׳ Hoxb genes during CNS development, providing a new insight into the mechanisms for gene regulation within the Hox clusters.

  20. Enhancer activity of light-responsive regulatory elements in the untranslated leader regions of cyanobacterial psbA genes.

    PubMed Central

    Li, R; Golden, S S

    1993-01-01

    Three psbA genes encoding the D1 protein of the photosystem II reaction center are differentially expressed under different light intensities in the cyanobacterium Synechococcus sp. strain PCC 7942. Two of the three psbA genes, psbAII and psbAIII, are induced rapidly when light intensity is increased from 125 x 10(-6) mol.m-2.s-1 to 750 x 10(-6) mol.m-2.s-1. A recombinational cloning vector that carries a transcriptional lacZ reporter gene was used to characterize the controlling elements responsible for light induction. At least three distinct cis elements are present in the regulatory regions of pbsAII and psbAIII: basal promoters, comparable to Escherichia coli sigma 70 promoters in position and sequence, confer constitutive expression of the genes under both low and high light intensities; negative elements upstream of the promoters down-regulate the expression of the corresponding gene; and sequences downstream of the promoters that correspond to the untranslated leader regions of the mRNAs (+1 to +41 in psbAII and +1 to +39 in psbAIII) are responsible for increased expression under high light. When these light-responsive elements were combined with an E. coli promoter (conII) in different positions and orientations, the expression of the lacZ gene was induced 4- to 11-fold. The induction of gene expression under high light by these enhancers was position independent but orientation dependent. When the elements were combined with the conII promoter in the correct orientation, they also conferred a small but reproducible level of light-responsive expression on this E. coli promoter. Images Fig. 1 Fig. 3 Fig. 4 PMID:8265608

  1. Glucocorticoid activation of chromogranin A gene expression. Identification and characterization of a novel glucocorticoid response element.

    PubMed Central

    Rozansky, D J; Wu, H; Tang, K; Parmer, R J; O'Connor, D T

    1994-01-01

    Glucocorticoids regulate catecholamine biosynthesis and storage at several sites. Chromogranin A, an abundant protein complexed with catecholamines in secretory vesicles of chromaffin cells and sympathetic axons, is also augmented by glucocorticoids. This study reports isolation of the rat chromogranin A promoter to elucidate transcriptional regulation of chromogranin A biosynthesis by glucocorticoids in neuroendocrine cells. Endogenous chromogranin A gene expression was activated up to 3.5-fold in chromaffin cells by glucocorticoid, in time-dependent fashion. Inhibition of new protein synthesis by cycloheximide did not alter the rise in chromogranin A mRNA, suggesting that glucocorticoids directly activate the chromogranin A promoter; nuclear runoff assays confirmed a 3.3-fold increased rate of initiation of new chromogranin A transcripts after glucocorticoid. Transfected rat chromogranin A promoter/luciferase reporter constructs were activated 2.6-3.1-fold by glucocorticoid, and selective agonist/antagonist studies determined that dexamethasone effects were mediated by glucocorticoid receptors. Both rat and mouse chromogranin A promoter/luciferase reporter constructs were activated by glucocorticoid. A series of promoter deletions narrowed the region of glucocorticoid action to a 93-bp section of the promoter, from position -526 to -619 bp upstream of the cap site. A 15-bp sequence ([-583 bp] 5'-ACATGAGTGTGTCCT-3' [-597 bp]) within this region showed partial homology to a glucocorticoid response element (GRE; half-site in italics) consensus sequence, and several lines of experimental evidence confirmed its function as a GRE: (a) site-directed mutation of this GRE prevented glucocorticoid activation of a chromogranin A promoter/reporter; (b) transfer of this GRE to a heterologous (thymidine kinase) promoter/reporter conferred activation by glucocorticoid, in copy number-dependent and orientation-independent fashion; and (c) electrophoretic gel mobility shifts

  2. Epstein-Barr virus transcription factor Zta acts through distal regulatory elements to directly control cellular gene expression.

    PubMed

    Ramasubramanyan, Sharada; Osborn, Kay; Al-Mohammad, Rajaei; Naranjo Perez-Fernandez, Ijiel B; Zuo, Jianmin; Balan, Nicolae; Godfrey, Anja; Patel, Harshil; Peters, Gordon; Rowe, Martin; Jenner, Richard G; Sinclair, Alison J

    2015-04-20

    Lytic replication of the human gamma herpes virus Epstein-Barr virus (EBV) is an essential prerequisite for the spread of the virus. Differential regulation of a limited number of cellular genes has been reported in B-cells during the viral lytic replication cycle. We asked whether a viral bZIP transcription factor, Zta (BZLF1, ZEBRA, EB1), drives some of these changes. Using genome-wide chromatin immunoprecipitation coupled to next-generation DNA sequencing (ChIP-seq) we established a map of Zta interactions across the human genome. Using sensitive transcriptome analyses we identified 2263 cellular genes whose expression is significantly changed during the EBV lytic replication cycle. Zta binds 278 of the regulated genes and the distribution of binding sites shows that Zta binds mostly to sites that are distal to transcription start sites. This differs from the prevailing view that Zta activates viral genes by binding exclusively at promoter elements. We show that a synthetic Zta binding element confers Zta regulation at a distance and that distal Zta binding sites from cellular genes can confer Zta-mediated regulation on a heterologous promoter. This leads us to propose that Zta directly reprograms the expression of cellular genes through distal elements. PMID:25779048

  3. Epstein–Barr virus transcription factor Zta acts through distal regulatory elements to directly control cellular gene expression

    PubMed Central

    Ramasubramanyan, Sharada; Osborn, Kay; Al-Mohammad, Rajaei; Naranjo Perez-Fernandez, Ijiel B.; Zuo, Jianmin; Balan, Nicolae; Godfrey, Anja; Patel, Harshil; Peters, Gordon; Rowe, Martin; Jenner, Richard G.; Sinclair, Alison J.

    2015-01-01

    Lytic replication of the human gamma herpes virus Epstein-Barr virus (EBV) is an essential prerequisite for the spread of the virus. Differential regulation of a limited number of cellular genes has been reported in B-cells during the viral lytic replication cycle. We asked whether a viral bZIP transcription factor, Zta (BZLF1, ZEBRA, EB1), drives some of these changes. Using genome-wide chromatin immunoprecipitation coupled to next-generation DNA sequencing (ChIP-seq) we established a map of Zta interactions across the human genome. Using sensitive transcriptome analyses we identified 2263 cellular genes whose expression is significantly changed during the EBV lytic replication cycle. Zta binds 278 of the regulated genes and the distribution of binding sites shows that Zta binds mostly to sites that are distal to transcription start sites. This differs from the prevailing view that Zta activates viral genes by binding exclusively at promoter elements. We show that a synthetic Zta binding element confers Zta regulation at a distance and that distal Zta binding sites from cellular genes can confer Zta-mediated regulation on a heterologous promoter. This leads us to propose that Zta directly reprograms the expression of cellular genes through distal elements. PMID:25779048

  4. The use of a non-LTR element to date the formation of the Sdic gene cluster.

    PubMed

    Ponce, Rita

    2007-11-01

    Transposable elements comprise a considerable part of eukaryotic genomes, and there is increasing evidence for their role in the evolution of genomes. The number of active transposable elements present in the host genome at any given time is probably small relative to the number of elements that no longer transpose. The elements that have lost the ability to transpose tend to evolve neutrally. For example, non-LTR retrotransposons often become 5' truncated due to their own transposition mechanism and hence lose their ability to transpose. The resulting transposons can be characterized as "dead-on-arrival" (DOA) elements. Because they are abundant and ubiquitous, and evolve neutrally in the location where they were inserted, these DOA non-LTR elements make a useful tool to date molecular events. There are four copies of a "dead-on-arrival" RT1C element on the recently formed Sdic gene cluster of Drosophila melanogaster, that are not present in the equivalent region of the other species of the melanogaster subgroup. The life history of the RT1C elements in the genome of D. melanogaster was used to determine the insertion chronology of the elements in the cluster and to date the duplication events that originated this cluster.

  5. Definition of regulatory sequence elements in the promoter region and the first intron of the myotonic dystrophy protein kinase gene.

    PubMed

    Storbeck, C J; Sabourin, L A; Waring, J D; Korneluk, R G

    1998-04-10

    Myotonic dystrophy is the most common inherited adult neuromuscular disorder with a global frequency of 1/8000. The genetic defect is an expanding CTG trinucleotide repeat in the 3'-untranslated region of the myotonic dystrophy protein kinase gene. We present the in vitro characterization of cis regulatory elements controlling transcription of the myotonic dystrophy protein kinase gene in myoblasts and fibroblasts. The region 5' to the initiating ATG contains no consensus TATA or CCAAT box. We have mapped two transcriptional start sites by primer extension. Deletion constructs from this region fused to the bacterial chloramphenicol acetyltransferase reporter gene revealed only subtle muscle specific cis elements. The strongest promoter activity mapped to a 189-base pair fragment. This sequence contains a conserved GC box to which the transcription factor Sp1 binds. Reporter gene constructs containing a 2-kilobase pair first intron fragment of the myotonic dystrophy protein kinase gene enhances reporter activity up to 6-fold in the human rhabdomyosarcoma myoblast cell line TE32 but not in NIH 3T3 fibroblasts. Co-transfection of a MyoD expression vector with reporter constructs containing the first intron into 10 T1/2 fibroblasts resulted in a 10-20-fold enhancement of expression. Deletion analysis of four E-box elements within the first intron reveal that these elements contribute to enhancer activity similarly in TE32 myoblasts and 10 T1/2 fibroblasts. These data suggest that E-boxes within the myotonic dystrophy protein kinase first intron mediate interactions with upstream promoter elements to up-regulate transcription of this gene in myoblasts.

  6. Gene invasion in distant eukaryotic lineages: discovery of mutually exclusive genetic elements reveals marine biodiversity.

    PubMed

    Monier, Adam; Sudek, Sebastian; Fast, Naomi M; Worden, Alexandra Z

    2013-09-01

    Inteins are rare, translated genetic parasites mainly found in bacteria and archaea, while spliceosomal introns are distinctly eukaryotic features abundant in most nuclear genomes. Using targeted metagenomics, we discovered an intein in an Atlantic population of the photosynthetic eukaryote, Bathycoccus, harbored by the essential spliceosomal protein PRP8 (processing factor 8 protein). Although previously thought exclusive to fungi, we also identified PRP8 inteins in parasitic (Capsaspora) and predatory (Salpingoeca) protists. Most new PRP8 inteins were at novel insertion sites that, surprisingly, were not in the most conserved regions of the gene. Evolutionarily, Dikarya fungal inteins at PRP8 insertion site a appeared more related to the Bathycoccus intein at a unique insertion site, than to other fungal and opisthokont inteins. Strikingly, independent analyses of Pacific and Atlantic samples revealed an intron at the same codon as the Bathycoccus PRP8 intein. The two elements are mutually exclusive and neither was found in cultured Bathycoccus or other picoprasinophyte genomes. Thus, wild Bathycoccus contain one of few non-fungal eukaryotic inteins known and a rare polymorphic intron. Our data indicate at least two Bathycoccus ecotypes exist, associated respectively with oceanic or mesotrophic environments. We hypothesize that intein propagation is facilitated by marine viruses; and, while intron gain is still poorly understood, presence of a spliceosomal intron where a locus lacks an intein raises the possibility of new, intein-primed mechanisms for intron gain. The discovery of nucleus-encoded inteins and associated sequence polymorphisms in uncultivated marine eukaryotes highlights their diversity and reveals potential sexual boundaries between populations indistinguishable by common marker genes.

  7. Importance of Mobile Genetic Elements and Conjugal Gene Transfer for Subsurface Microbial Community Adaptation to Biotransformation of Metals

    SciTech Connect

    Sorensen, Soren J.

    2005-06-01

    The overall goal of this project is to investigate the effect of mobile genetic elements and conjugal gene transfer on subsurface microbial community adaptation to mercury and chromium stress and biotransformation. Our studies focus on the interaction between the fate of these metals in the subsurface and the microbial community structure and activity.

  8. Transformation mapping of the regulatory elements of the ecdysone-inducible P1 gene of Drosophila melanogaster

    SciTech Connect

    Maschat, F.; Dubertret, M.L.; Lepesant, J.A. )

    1991-05-01

    The transcription of the P1 gene is induced by 20-hydroxyecdysone in fat bodies of third-instar larvae. Germ line transformation showed that sequences between {minus}138 to +276 contain elements required for a qualitatively correct developmental and hormonal regulation of P1 transcription. Sequences from {minus}138 to {minus}68 are essential for this expression.

  9. Binding of TFIIIC to SINE Elements Controls the Relocation of Activity-Dependent Neuronal Genes to Transcription Factories

    PubMed Central

    Crepaldi, Luca; Policarpi, Cristina; Coatti, Alessandro; Sherlock, William T.; Jongbloets, Bart C.; Down, Thomas A.; Riccio, Antonella

    2013-01-01

    In neurons, the timely and accurate expression of genes in response to synaptic activity relies on the interplay between epigenetic modifications of histones, recruitment of regulatory proteins to chromatin and changes to nuclear structure. To identify genes and regulatory elements responsive to synaptic activation in vivo, we performed a genome-wide ChIPseq analysis of acetylated histone H3 using somatosensory cortex of mice exposed to novel enriched environmental (NEE) conditions. We discovered that Short Interspersed Elements (SINEs) located distal to promoters of activity-dependent genes became acetylated following exposure to NEE and were bound by the general transcription factor TFIIIC. Importantly, under depolarizing conditions, inducible genes relocated to transcription factories (TFs), and this event was controlled by TFIIIC. Silencing of the TFIIIC subunit Gtf3c5 in non-stimulated neurons induced uncontrolled relocation to TFs and transcription of activity-dependent genes. Remarkably, in cortical neurons, silencing of Gtf3c5 mimicked the effects of chronic depolarization, inducing a dramatic increase of both dendritic length and branching. These findings reveal a novel and essential regulatory function of both SINEs and TFIIIC in mediating gene relocation and transcription. They also suggest that TFIIIC may regulate the rearrangement of nuclear architecture, allowing the coordinated expression of activity-dependent neuronal genes. PMID:23966877

  10. Comparative genomics reveals a functional thyroid-specific element in the far upstream region of the PAX8 gene

    PubMed Central

    2010-01-01

    Background The molecular mechanisms leading to a fully differentiated thyrocite are still object of intense study even if it is well known that thyroglobulin, thyroperoxidase, NIS and TSHr are the marker genes of thyroid differentiation. It is also well known that Pax8, TTF-1, Foxe1 and Hhex are the thyroid-enriched transcription factors responsible for the expression of the above genes, thus are responsible for the differentiated thyroid phenotype. In particular, the role of Pax8 in the fully developed thyroid gland was studied in depth and it was established that it plays a key role in thyroid development and differentiation. However, to date the bases for the thyroid-enriched expression of this transcription factor have not been unraveled yet. Here, we report the identification and characterization of a functional thyroid-specific enhancer element located far upstream of the Pax8 gene. Results We hypothesized that regulatory cis-acting elements are conserved among mammalian genes. Comparison of a genomic region extending for about 100 kb at the 5'-flanking region of the mouse and human Pax8 gene revealed several conserved regions that were tested for enhancer activity in thyroid and non-thyroid cells. Using this approach we identified one putative thyroid-specific regulatory element located 84.6 kb upstream of the Pax8 transcription start site. The in silico data were verified by promoter-reporter assays in thyroid and non-thyroid cells. Interestingly, the identified far upstream element manifested a very high transcriptional activity in the thyroid cell line PC Cl3, but showed no activity in HeLa cells. In addition, the data here reported indicate that the thyroid-enriched transcription factor TTF-1 is able to bind in vitro and in vivo the Pax8 far upstream element, and is capable to activate transcription from it. Conclusions Results of this study reveal the presence of a thyroid-specific regulatory element in the 5' upstream region of the Pax8 gene. The

  11. Uptake and effect of rare earth elements on gene expression in Methylosinus trichosporium OB3b.

    PubMed

    Gu, Wenyu; Farhan Ul Haque, Muhammad; DiSpirito, Alan A; Semrau, Jeremy D

    2016-07-01

    It is well known that Methylosinus trichosporium OB3b has two forms of methane monooxygenase (MMO) responsible for the initial conversion of methane to methanol, a cytoplasmic (soluble) methane monooxygenase and a membrane-associated (particulate) methane monooxygenase, and that copper strongly regulates expression of these alternative forms of MMO. More recently, it has been discovered that M. trichosporium OB3b has multiple types of the methanol dehydrogenase (MeDH), i.e. the Mxa-type MeDH (Mxa-MeDH) and Xox-type MeDH (Xox-MeDH), and the expression of these two forms is regulated by the availability of the rare earth element (REE), cerium. Here, we extend these studies and show that lanthanum, praseodymium, neodymium and samarium also regulate expression of alternative forms of MeDH. The effect of these REEs on MeDH expression, however, was only observed in the absence of copper. Further, a mutant of M. trichosporium OB3b, where the Mxa-MeDH was knocked out, was able to grow in the presence of lanthanum, praseodymium and neodymium, but was not able to grow in the presence of samarium. Collectively, these data suggest that multiple levels of gene regulation by metals exist in M. trichosporium OB3b, but that copper overrides the effect of other metals by an as yet unknown mechanism. PMID:27190151

  12. Uptake and effect of rare earth elements on gene expression in Methylosinus trichosporium OB3b.

    PubMed

    Gu, Wenyu; Farhan Ul Haque, Muhammad; DiSpirito, Alan A; Semrau, Jeremy D

    2016-07-01

    It is well known that Methylosinus trichosporium OB3b has two forms of methane monooxygenase (MMO) responsible for the initial conversion of methane to methanol, a cytoplasmic (soluble) methane monooxygenase and a membrane-associated (particulate) methane monooxygenase, and that copper strongly regulates expression of these alternative forms of MMO. More recently, it has been discovered that M. trichosporium OB3b has multiple types of the methanol dehydrogenase (MeDH), i.e. the Mxa-type MeDH (Mxa-MeDH) and Xox-type MeDH (Xox-MeDH), and the expression of these two forms is regulated by the availability of the rare earth element (REE), cerium. Here, we extend these studies and show that lanthanum, praseodymium, neodymium and samarium also regulate expression of alternative forms of MeDH. The effect of these REEs on MeDH expression, however, was only observed in the absence of copper. Further, a mutant of M. trichosporium OB3b, where the Mxa-MeDH was knocked out, was able to grow in the presence of lanthanum, praseodymium and neodymium, but was not able to grow in the presence of samarium. Collectively, these data suggest that multiple levels of gene regulation by metals exist in M. trichosporium OB3b, but that copper overrides the effect of other metals by an as yet unknown mechanism.

  13. Transcription of gypsy elements in a Y-chromosome male fertility gene of Drosophila hydei

    SciTech Connect

    Hochstenbach, R.; Harhangi, H.; Hennig, W.

    1996-02-01

    We have found that defective gypsy retrotransposons are a major constituent of the lampbrush loop pair Nooses in the short arm of Y chromosome of Drosophila hydei. The loop pair is formed by male fertility gene Q during the primary spermatocyte stage of spermatogenesis, each loop being a single transcription unit with an estimated length of 260 kb. Using fluorescent in situ hybridization, we show that throughout the loop transcripts gypsy elements are interspersed with blocks of a tandemly repetitive Y-specific DNA sequence, ayl. Nooses transcripts containing both sequence types show a wide size range on Northern blots, do not migrate to the cytoplasm, and are degraded just before the first meiotic division. Only one strand of ayl and only the coding strand of gypsy can be detected in the loop transcripts. However, as cloned genomic DNA fragments also display opposite orientations of ayl and gypsy, such DNA sections cannot be part of the Nooses. Hence, they are most likely derived from the flanking heterochromatin. The direction of transcription of ayl and gypsy thus appears to be of a functional significance. 76 refs., 5 figs.

  14. The human involucrin gene is transcriptionally repressed through a tissue-specific silencer element recognized by Oct-2.

    PubMed

    Azuara-Liceaga, Elisa; Sandoval, Marisol; Corona, Matilde; Gariglio, Patricio; López-Bayghen, Esther

    2004-05-28

    Involucrin is an important marker of epithelial differentiation which expression is upregulated just after basal cells are pushed into the suprabasal layer in stratified epithelia. Several transcription factors and regulatory elements had been described as responsible for turning on the gene. However, it is evident that in basal cell layer, additional mechanisms are involved in keeping the gene silent before the differentiation process starts. In this work, we located a potential transcriptional silencer in a 52bp sequence whose integrity is necessary for silencing the proximal enhancer promoter element (PEP) in multiplying keratinocytes. Octamer-binding sites were noticed in this fragment and the specific binding of Oct-2 transcription factor was detected. Oct-2 appears to be implicated in an epithelial-specific repression activity recorded only in keratinocytes and C33-A cell line. Overexpression of Oct-2 repressed the involucrin promoter activity in epithelial cells and in the presence of the silencer element.

  15. P-Element Insertion Alleles of Essential Genes on the Third Chromosome of Drosophila Melanogaster: Mutations Affecting Embryonic Pns Development

    PubMed Central

    Salzberg, A.; Prokopenko, S. N.; He, Y.; Tsai, P.; Pal, M.; Maroy, P.; Glover, D. M.; Deak, P.; Bellen, H. J.

    1997-01-01

    To identify novel genes and to isolate tagged mutations in known genes that are required for the development of the peripheral nervous system (PNS), we have screened a novel collection of 2460 strains carrying lethal or semilethal P-element insertions on the third chromosome. Monoclonal antibody 22C10 was used as a marker to visualize the embryonic PNS. We identified 109 mutant strains that exhibited reproducible phenotypes in the PNS. Cytological and genetic analyses of these strains indicated that 87 mutations affect previously identified genes: tramtrack (n = 18 alleles), string (n = 15), cyclin A (n = 13), single-minded (n = 13), Delta (n = 9), neuralized (n = 4), pointed (n = 4), extra macrochaetae (n = 4), prospero (n = 3), tartan (n = 2), and pebble (n = 2). In addition, 13 mutations affect genes that we identified recently in a chemical mutagenesis screen designed to isolate similar mutants: hearty (n = 3), dorsotonals (n = 2), pavarotti (n = 2), sanpodo (n = 2), dalmatian (n = 1), missensed (n = 1), senseless (n = 1), and sticky ch1 (n = 1). The remaining nine mutations define seven novel complementation groups. The data presented here demonstrate that this collection of P elements will be useful for the identification and cloning of novel genes on the third chromosome, since >70% of mutations identified in the screen are caused by the insertion of a P element. A comparison between this screen and a chemical mutagenesis screen undertaken earlier highlights the complementarity of the two types of genetic screens. PMID:9409832

  16. Identification and mapping of expressed genes, simple sequence repeats and transposable elements in centromeric regions of rice chromosomes.

    PubMed

    Mizuno, Hiroshi; Ito, Kazue; Wu, Jianzhong; Tanaka, Tsuyoshi; Kanamori, Hiroyuki; Katayose, Yuichi; Sasaki, Takuji; Matsumoto, Takashi

    2006-12-31

    The genomic sequences derived from rice centromeric regions were analyzed to facilitate the comprehensive understanding of the rice genome. A rice centromere-specific satellite sequence, RCS2/TrsD/CentO, was used to screen P1-derived artificial chromosome (PAC) and bacterial artificial chromosome (BAC) genomic libraries derived from Oryza sativa L. ssp. japonica cultivar Nipponbare. Physical maps of the centromeric regions were constructed by DNA fingerprinting methods and the aligned clones were analyzed by end sequencing. BLAST analysis revealed the composition of genes, centromeric satellites and other repetitive elements, such as RIRE7/CRR, RIRE8, Squiq, Anaconda, CACTA and miniature inverted-repeat transposable elements. Fiber-fluorescent in situ hybridization analysis also indicated the presence of distinct clusters of RCS2/TrsD/CentO satellite interspersed with other elements, instead of a long homogeneous region. Several expressed genes, sequences representative of ancestral organellar insertions, relatively long simple sequence repeats (SSRs), and sequences corresponding to 5S and 45S ribosomal RNA genes were also identified. Thirty-one gene sequences showed high-similarity to rice full-length cDNA sequences that had not been matched to the published rice genome sequence in silico. These results suggest the presence of expressed genes within and around the clusters of RCS2/TrsD/CentO satellites in unsequenced centromeric regions of the rice chromosomes.

  17. Identification of a peroxisome proliferator responsive element (PPRE)-like cis-element in mouse plasminogen activator inhibitor-1 gene promoter

    SciTech Connect

    Chen Jiegen; Li Xi; Huang Haiyan; Liu Honglei; Liu Deguo; Song Tanjing; Ma Chungu; Ma Duan; Song Houyan; Tang Qiqun . E-mail: qqtang@shmu.edu.cn

    2006-09-01

    PAI-1 is expressed and secreted by adipose tissue which may mediate the pathogenesis of obesity-associated cardiovascular complications. Evidence is presented in this report that PAI-1 is not expressed by preadipocyte, but significantly induced during 3T3-L1 adipocyte differentiation and the PAI-1 expression correlates with the induction of peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}). A peroxisome proliferator responsive element (PPRE)-like cis-element (-206TCCCCCATGCCCT-194) is identified in the mouse PAI-1 gene promoter by electrophoretic mobility shift assay (EMSA) combined with transient transfection experiments; the PPRE-like cis-element forms a specific DNA-protein complex only with adipocyte nuclear extracts, not with preadipocyte nuclear extracts; the DNA-protein complex can be totally competed away by non-labeled consensus PPRE, and can be supershifted with PPAR{gamma} antibody. Mutation of this PPRE-like cis-element can abolish the transactivation of mouse PAI-1 promoter mediated by PPAR{gamma}. Specific PPAR{gamma} ligand Pioglitazone can significantly induce the PAI-1 expression, and stimulate the secretion of PAI-1 into medium.

  18. Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter

    SciTech Connect

    Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi

    2011-07-01

    Highlights: {yields} The sequences of -604 to -84 bp of the pUPII promoter contained the region of a putative negative cis-regulatory element. {yields} The core promoter was located in the 5F-1. {yields} Transcription factor HNF4 can directly bind in the pUPII core promoter region, which plays a critical role in controlling promoter activity. {yields} These features of the pUPII promoter are fundamental to development of a target-specific vector. -- Abstract: Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

  19. Combining Hi-C data with phylogenetic correlation to predict the target genes of distal regulatory elements in human genome.

    PubMed

    Lu, Yulan; Zhou, Yuanpeng; Tian, Weidong

    2013-12-01

    Defining the target genes of distal regulatory elements (DREs), such as enhancer, repressors and insulators, is a challenging task. The recently developed Hi-C technology is designed to capture chromosome conformation structure by high-throughput sequencing, and can be potentially used to determine the target genes of DREs. However, Hi-C data are noisy, making it difficult to directly use Hi-C data to identify DRE-target gene relationships. In this study, we show that DREs-gene pairs that are confirmed by Hi-C data are strongly phylogenetic correlated, and have thus developed a method that combines Hi-C read counts with phylogenetic correlation to predict long-range DRE-target gene relationships. Analysis of predicted DRE-target gene pairs shows that genes regulated by large number of DREs tend to have essential functions, and genes regulated by the same DREs tend to be functionally related and co-expressed. In addition, we show with a couple of examples that the predicted target genes of DREs can help explain the causal roles of disease-associated single-nucleotide polymorphisms located in the DREs. As such, these predictions will be of importance not only for our understanding of the function of DREs but also for elucidating the causal roles of disease-associated noncoding single-nucleotide polymorphisms.

  20. Multiple elements within the 5' distal enhancer of the mouse heme oxygenase-1 gene mediate induction by heavy metals.

    PubMed

    Alam, J

    1994-10-01

    A 268-base pair 5' distal fragment, SX2, which mediates basal level and inducer-dependent activation of the mouse heme oxygenase-1 gene, contains two activator protein-1 (AP-1) binding sites (Alam, J., and Zhining, D. (1992) J. Biol. Chem. 267, 21894-21900). Mutation of both AP-1 binding elements diminishes (by 50-70%), but does not abolish, the enhancer activity of SX2 in transient expression assays, suggesting that other sequences contribute to enhancer function. Directly upstream of the AP-1 binding sites are two copies of a sequence motif, TGAGGAAAT, which resemble elements found in cellular and viral genes that are known to interact with the CCAAT/enhancer-binding protein (C/EBP) family of transcription factors. These SX2 sequences bind specifically to liver-enriched, heat-stable nuclear proteins and confer C/EBP alpha-dependent transactivation of the heterologous chloramphenicol acetyltransferase (CAT) gene. Site-directed mutagenesis of these 9-base pair elements abolishes protein binding and transactivation, establishing these sequences as functional C/EBP binding sites. Stably transfected SX2/CAT fusion genes are induced between 37- and 44-fold in mouse hepatoma, Hepa, cells and between 52- and 111-fold in mouse fibroblast L929 cells in response to CdCl2 treatment. Subfragments of SX2 lacking the AP-1 binding elements do not mediate cadmium-dependent activation of the CAT gene, whereas subfragments containing the AP-1 binding elements, but lacking the C/EBP binding sites, exhibit only partial transcriptional activity. Site-directed mutagenesis of one or more of the C/EBP and AP-1 binding sites indicates that each of these elements is required for optimal activity of the SX2 enhancer fragment. The AP-1 binding elements, however, appear to be more important for induction as constructs containing multiple copies of either of the AP-1 binding elements, but not the C/EBP binding sequences, are readily activated by CdCl2. Treatment of Hepa cells with cadmium or

  1. SIRT1 gene expression upon genotoxic damage is regulated by APE1 through nCaRE-promoter elements

    PubMed Central

    Antoniali, Giulia; Lirussi, Lisa; D'Ambrosio, Chiara; Dal Piaz, Fabrizio; Vascotto, Carlo; Casarano, Elena; Marasco, Daniela; Scaloni, Andrea; Fogolari, Federico; Tell, Gianluca

    2014-01-01

    Apurinic/apyrimidinic endonuclease 1 (APE1) is a multifunctional protein contributing to genome stability via repair of DNA lesions via the base excision repair pathway. It also plays a role in gene expression regulation and RNA metabolism. Another, poorly characterized function is its ability to bind to negative calcium responsive elements (nCaRE) of some gene promoters. The presence of many functional nCaRE sequences regulating gene transcription can be envisioned, given their conservation within ALU repeats. To look for functional nCaRE sequences within the human genome, we performed bioinformatic analyses and identified 57 genes potentially regulated by APE1. We focused on sirtuin-1 (SIRT1) deacetylase due to its involvement in cell stress, including senescence, apoptosis, and tumorigenesis, and its role in the deacetylation of APE1 after genotoxic stress. The human SIRT1 promoter presents two nCaRE elements stably bound by APE1 through its N-terminus. We demonstrate that APE1 is part of a multiprotein complex including hOGG1, Ku70, and RNA Pol II, which is recruited on SIRT1 promoter to regulate SIRT1 gene functions during early response to oxidative stress. These findings provide new insights into the role of nCaRE sequences in the transcriptional regulation of mammalian genes. PMID:24356447

  2. Aquaculture changes the profile of antibiotic resistance and mobile genetic element associated genes in Baltic Sea sediments.

    PubMed

    Muziasari, Windi I; Pärnänen, Katariina; Johnson, Timothy A; Lyra, Christina; Karkman, Antti; Stedtfeld, Robert D; Tamminen, Manu; Tiedje, James M; Virta, Marko

    2016-04-01

    Antibiotics are commonly used in aquaculture and they can change the environmental resistome by increasing antibiotic resistance genes (ARGs). Sediment samples were collected from two fish farms located in the Northern Baltic Sea, Finland, and from a site outside the farms (control). The sediment resistome was assessed by using a highly parallel qPCR array containing 295 primer sets to detect ARGs, mobile genetic elements and the 16S rRNA gene. The fish farm resistomes were enriched in transposon and integron associated genes and in ARGs encoding resistance to antibiotics which had been used to treat fish at the farms. Aminoglycoside resistance genes were also enriched in the farm sediments despite the farms not having used aminoglycosides. In contrast, the total relative abundance values of ARGs were higher in the control sediment resistome and they were mainly genes encoding efflux pumps followed by beta-lactam resistance genes, which are found intrinsically in many bacteria. This suggests that there is a natural Baltic sediment resistome. The resistome associated with fish farms can be from native ARGs enriched by antibiotic use at the farms and/or from ARGs and mobile elements that have been introduced by fish farming.

  3. Interaction of the CCAAT displacement protein with shared regulatory elements required for transcription of paired histone genes.

    PubMed Central

    el-Hodiri, H M; Perry, M

    1995-01-01

    The H2A and H2B genes of the Xenopus xlh3 histone gene cluster are transcribed in opposite directions from initiation points located approximately 235 bp apart. The close proximity of these genes to one another suggests that their expression may be controlled by either a single bidirectional promoter or by separate promoters. Our analysis of the transcription of histone gene pairs containing deletions and site-specific mutations of intergenic DNA revealed that both promoters are distinct but that they overlap physically and share multiple regulatory elements, providing a possible basis for the coordinate regulation of their in vivo activities. Using the intergenic DNA fragment as a probe and extracts from mammalian and amphibian cells, we observed the formation of a specific complex containing the CCAAT displacement protein (CDP). The formation of the CDP-containing complex was not strictly dependent on any single element in the intergenic region but instead required the presence of at least two of the three CCAAT motifs. Interestingly, similar CDP-containing complexes were formed on the promoters from the three other histone genes. The binding of CDP to histone gene promoters may contribute to the coordination of their activities during the cell cycle and early development. PMID:7791766

  4. Aquaculture changes the profile of antibiotic resistance and mobile genetic element associated genes in Baltic Sea sediments.

    PubMed

    Muziasari, Windi I; Pärnänen, Katariina; Johnson, Timothy A; Lyra, Christina; Karkman, Antti; Stedtfeld, Robert D; Tamminen, Manu; Tiedje, James M; Virta, Marko

    2016-04-01

    Antibiotics are commonly used in aquaculture and they can change the environmental resistome by increasing antibiotic resistance genes (ARGs). Sediment samples were collected from two fish farms located in the Northern Baltic Sea, Finland, and from a site outside the farms (control). The sediment resistome was assessed by using a highly parallel qPCR array containing 295 primer sets to detect ARGs, mobile genetic elements and the 16S rRNA gene. The fish farm resistomes were enriched in transposon and integron associated genes and in ARGs encoding resistance to antibiotics which had been used to treat fish at the farms. Aminoglycoside resistance genes were also enriched in the farm sediments despite the farms not having used aminoglycosides. In contrast, the total relative abundance values of ARGs were higher in the control sediment resistome and they were mainly genes encoding efflux pumps followed by beta-lactam resistance genes, which are found intrinsically in many bacteria. This suggests that there is a natural Baltic sediment resistome. The resistome associated with fish farms can be from native ARGs enriched by antibiotic use at the farms and/or from ARGs and mobile elements that have been introduced by fish farming. PMID:26976842

  5. Transcriptional regulation of PRPF31 gene expression by MSR1 repeat elements causes incomplete penetrance in retinitis pigmentosa

    PubMed Central

    Rose, Anna M.; Shah, Amna Z.; Venturini, Giulia; Krishna, Abhay; Chakravarti, Aravinda; Rivolta, Carlo; Bhattacharya, Shomi S.

    2016-01-01

    PRPF31-associated retinitis pigmentosa presents a fascinating enigma: some mutation carriers are blind, while others are asymptomatic. We identify the major molecular cause of this incomplete penetrance through three cardinal features: (1) there is population variation in the number (3 or 4) of a minisatellite repeat element (MSR1) adjacent to the PRPF31 core promoter; (2) in vitro, 3-copies of the MSR1 element can repress gene transcription by 50 to 115-fold; (3) the higher-expressing 4-copy allele is not observed among symptomatic PRPF31 mutation carriers and correlates with the rate of asymptomatic carriers in different populations. Thus, a linked transcriptional modifier decreases PRPF31 gene expression that leads to haploinsufficiency. This result, taken with other identified risk alleles, allows precise genetic counseling for the first time. We also demonstrate that across the human genome, the presence of MSR1 repeats in the promoters or first introns of genes is associated with greater population variability in gene expression indicating that copy number variation of MSR1s is a generic controller of gene expression and promises to provide new insights into our understanding of gene expression regulation. PMID:26781568

  6. Lead Exposure during Early Human Development and DNA Methylation of Imprinted Gene Regulatory Elements in Adulthood

    PubMed Central

    Li, Yue; Xie, Changchun; Murphy, Susan K.; Skaar, David; Nye, Monica; Vidal, Adriana C.; Cecil, Kim M.; Dietrich, Kim N.; Puga, Alvaro; Jirtle, Randy L.; Hoyo, Cathrine

    2015-01-01

    30 to 78 months. Conclusions: Our findings provide evidence that early childhood lead exposure results in sex-dependent and gene-specific DNA methylation differences in the DMRs of PEG3, IGF2/H19, and PLAGL1/HYMAI in adulthood. Citation: Li Y, Xie C, Murphy SK, Skaar D, Nye M, Vidal AC, Cecil KM, Dietrich KN, Puga A, Jirtle RL, Hoyo C. 2016. Lead exposure during early human development and DNA methylation of imprinted gene regulatory elements in adulthood. Environ Health Perspect 124:666–673; http://dx.doi.org/10.1289/ehp.1408577 PMID:26115033

  7. Modular changes of cis-regulatory elements from two functional Pit1 genes in the duplicated genome of Cyprinus carpio.

    PubMed

    Kausel, G; Salazar, M; Castro, L; Vera, T; Romero, A; Muller, M; Figueroa, J

    2006-10-15

    The pituitary-specific transcription factor Pit1 is involved in its own regulation and in a network of transcriptional regulation of hypothalamo-hypophyseal factors including prolactin (PRL) and growth hormone (GH). In the ectotherm teleost Cyprinus carpio, Pit1 plays an important role in regulation of the adaptive response to seasonal environmental changes. Two Pit1 genes exist in carp, a tetraploid vertebrate and transcripts of both genes were detected by RT-PCR analysis. Powerful comparative analyses of the 5'-flanking regions revealed copy specific changes comprising modular functional units in the naturally evolved promoters. These include the precise replacement of four nucleotides around the transcription start site embedded in completely conserved regions extending upstream of the TATA-box, an additional transcription factor binding site in the 5'-UTR of gene-I and, instead, duplication of a 9 bp element in gene-II. Binding of nuclear factors was assessed by electro mobility shift assays using extracts from rat pituitary cells and carp pituitary. Binding was confirmed at one conserved Pit1, one conserved CREB and one consensus MTF1. Interestingly, two functional Pit1 sites and one putative MTF1 binding site are unique to the Pit1 gene-I. In situ hybridization experiments revealed that the expression of gene-I in winter carp was significantly stronger than that of gene-II. Our data suggest that the specific control elements identified in the proximal regulatory region are physiologically relevant for the function of the duplicated Pit1 genes in carp and highlight modular changes in the architecture of two Pit1 genes that evolved for at least 12 MYA in the same organism.

  8. Abscisic acid-induced gene expression in the liverwort Marchantia polymorpha is mediated by evolutionarily conserved promoter elements.

    PubMed

    Ghosh, Totan K; Kaneko, Midori; Akter, Khaleda; Murai, Shuhei; Komatsu, Kenji; Ishizaki, Kimitsune; Yamato, Katsuyuki T; Kohchi, Takayuki; Takezawa, Daisuke

    2016-04-01

    Abscisic acid (ABA) is a phytohormone widely distributed among members of the land plant lineage (Embryophyta), regulating dormancy, stomata closure and tolerance to environmental stresses. In angiosperms (Magnoliophyta), ABA-induced gene expression is mediated by promoter elements such as the G-box-like ACGT-core motifs recognized by bZIP transcription factors. In contrast, the mode of regulation by ABA of gene expression in liverworts (Marchantiophyta), representing one of the earliest diverging land plant groups, has not been elucidated. In this study, we used promoters of the liverwort Marchantia polymorpha dehydrin and the wheat Em genes fused to the β-glucuronidase (GUS) reporter gene to investigate ABA-induced gene expression in liverworts. Transient assays of cultured cells of Marchantia indicated that ACGT-core motifs proximal to the transcription initiation site play a role in the ABA-induced gene expression. The RY sequence recognized by B3 transcriptional regulators was also shown to be responsible for the ABA-induced gene expression. In transgenic Marchantia plants, ABA treatment elicited an increase in GUS expression in young gemmalings, which was abolished by simultaneous disruption of the ACGT-core and RY elements. ABA-induced GUS expression was less obvious in mature thalli than in young gemmalings, associated with reductions in sensitivity to exogenous ABA during gametophyte growth. In contrast, lunularic acid, which had been suggested to function as an ABA-like substance, had no effect on GUS expression. The results demonstrate the presence of ABA-specific response mechanisms mediated by conserved cis-regulatory elements in liverworts, implying that the mechanisms had been acquired in the common ancestors of embryophytes. PMID:26456006

  9. The muscle creatine kinase gene is regulated by multiple upstream elements, including a muscle-specific enhancer

    SciTech Connect

    Jaynes, J.B.; Johnson, J.E.; Buskin, J.N.; Gartside, C.L.; Hauschka, S.D.

    1988-01-01

    Muscle creatine kinase (MCK) is induced to high levels during skeletal muscle differentiation. The authors examined the upstream regulatory elements of the mouse MCK gene which specify its activation during myogenesis in culture. Fusion genes containing up to 3,300 nucleotides (nt) of MCK 5' flanking DNA in various positions and orientations relative to the bacterial chloramphenicol acetyltransferase (CAT) structural gene were transfected into cultured cells. Transient expression of CAT was compared between proliferating and differentiated MM14 mouse myoblasts and with nonmyogenic mouse L cells. The major effector of high-level expression was found to have the properties of a transcriptional enhancer. This element, located between 1,050 and 1,256 nt upstream of the transcription start site, was also found to have a major influence on the tissue and differentiation specificity of MCK expression; it activated either the MCK promoter or heterologous promoters only in differentiated muscle cells. Comparisons of viral and cellular enhancer sequences with the MCK enhancer revealed some similarities to essential regions of the simian virus 40 enhancer as well as to a region of the immunoglobulin heavy-chain enhancer, which has been implicated in tissue-specific protein binding. Even in the absence of the enhancer, low-level expression from a 776-nt MCK promoter retained differentiation specificity. In addition to positive regulatory elements, our data provide some evidence for negative regulatory elements with activity in myoblasts. These may contribute to the cell type and differentiation specificity of MCK expression.

  10. TARGeT: a web-based pipeline for retrieving and characterizing gene and transposable element families from genomic sequences.

    PubMed

    Han, Yujun; Burnette, James M; Wessler, Susan R

    2009-06-01

    Gene families compose a large proportion of eukaryotic genomes. The rapidly expanding genomic sequence database provides a good opportunity to study gene family evolution and function. However, most gene family identification programs are restricted to searching protein databases where data are often lagging behind the genomic sequence data. Here, we report a user-friendly web-based pipeline, named TARGeT (Tree Analysis of Related Genes and Transposons), which uses either a DNA or amino acid 'seed' query to: (i) automatically identify and retrieve gene family homologs from a genomic database, (ii) characterize gene structure and (iii) perform phylogenetic analysis. Due to its high speed, TARGeT is also able to characterize very large gene families, including transposable elements (TEs). We evaluated TARGeT using well-annotated datasets, including the ascorbate peroxidase gene family of rice, maize and sorghum and several TE families in rice. In all cases, TARGeT rapidly recapitulated the known homologs and predicted new ones. We also demonstrated that TARGeT outperforms similar pipelines and has functionality that is not offered elsewhere.

  11. Cytotype regulation by telomeric P elements in Drosophila melanogaster: evidence for involvement of an RNA interference gene.

    PubMed

    Simmons, Michael J; Ryzek, Don-Felix; Lamour, Cecile; Goodman, Joseph W; Kummer, Nicole E; Merriman, Peter J

    2007-08-01

    P elements inserted at the left telomere of the X chromosome evoke the P cytotype, a maternally inherited condition that regulates the P-element family in the Drosophila germline. This regulation is completely disrupted in stocks heterozygous for mutations in aubergine, a gene whose protein product is involved in RNA interference. However, cytotype is not disrupted in stocks heterozygous for mutations in two other RNAi genes, piwi and homeless (spindle-E), or in a stock heterozygous for a mutation in the chromatin protein gene Enhancer of zeste. aubergine mutations exert their effects in the female germline, where the P cytotype is normally established and through which it is maintained. These effects are transmitted maternally to offspring of both sexes independently of the mutations themselves. Lines derived from mutant aubergine stocks reestablish the P cytotype quickly, unlike lines derived from stocks heterozygous for a mutation in Suppressor of variegation 205, the gene that encodes the telomere-capping protein HP1. Cytotype regulation by telomeric P elements may be tied to a system that uses RNAi to regulate the activities of telomeric retrotransposons in Drosophila. PMID:17603126

  12. CACTA-superfamily transposable element is inserted in MYB transcription factor gene of soybean line producing variegated seeds.

    PubMed

    Yan, Fan; Di, Shaokang; Takahashi, Ryoji

    2015-08-01

    The R gene of soybean, presumably encoding a MYB transcription factor, controls seed coat color. The gene consists of multiple alleles, R (black), r-m (black spots and (or) concentric streaks on brown seed), and r (brown seed). This study was conducted to determine the structure of the MYB transcription factor gene in a near-isogenic line (NIL) having r-m allele. PCR amplification of a fragment of the candidate gene Glyma.09G235100 generated a fragment of about 1 kb in the soybean cultivar Clark, whereas a fragment of about 14 kb in addition to fragments of 1 and 1.4 kb were produced in L72-2040, a Clark 63 NIL with the r-m allele. Clark 63 is a NIL of Clark with the rxp and Rps1 alleles. A DNA fragment of 13 060 bp was inserted in the intron of Glyma.09G235100 in L72-2040. The fragment had the CACTA motif at both ends, imperfect terminal inverted repeats (TIR), inverse repetition of short sequence motifs close to the 5' and 3' ends, and a duplication of three nucleotides at the site of integration, indicating that it belongs to a CACTA-superfamily transposable element. We designated the element as Tgm11. Overall nucleotide sequence, motifs of TIR, and subterminal repeats were similar to those of Tgm1 and Tgs1, suggesting that these elements comprise a family.

  13. Regulatory elements involved in constitutive and phorbol ester-inducible expression of the plasminogen activator inhibitor type 2 gene promoter.

    PubMed Central

    Cousin, E; Medcalf, R L; Bergonzelli, G E; Kruithof, E K

    1991-01-01

    Gene transcription rates and mRNA levels of plasminogen activator inhibitor type 2 (PAI-2) are markedly induced by the tumor promoting agent phorbol 12-myristate 13-acetate (PMA) in human HT1080 fibrosarcoma cells. To identify promoter elements required for basal-, and phorbol ester-inducible expression, deletion mutants of the PAI-1 promoter fused to the chloramphenicol acetyl transferase (CAT) reporter gene, were transiently expressed in HT1080 cells. Constitutive CAT activity was expressed from constructs containing more than 215 bp of promoter sequence, whereas deletion to position -91 bp abolished CAT gene expression. Treatment of transfected cells with PMA resulted in a three- to ten-fold increase in CAT expression from all constructs except from the construct shortened to position -91. DNAse1 protection analysis of the promoter region between -215 and the transcription initiation site revealed numerous protected regions, including two AP1-like binding sites (AP1a and AP1b) and one CRE-like element. Site-directed mutagenesis of the AP1a site or of the CRE-like site resulted in the loss of basal CAT activity and abolished the PMA effect, whereas mutagenesis of AP1b only partially inhibited basal and PMA-mediated expression. Our results suggest that the PAI-2 promoter contains at least two elements required for basal gene transcription and PMA-mediated induction. Images PMID:1650454

  14. Elements of lentiviral vector design toward gene therapy for treating mucopolysaccharidosis I.

    PubMed

    Ou, Li; Przybilla, Michael J; Koniar, Brenda L; Whitley, Chester B

    2016-09-01

    Mucopolysaccharidosis type I (MPS I) is a lysosomal disease caused by α-l-iduronidase (IDUA) deficiency and accumulation of glycosaminoglycans (GAG). Lentiviral vector encoding correct IDUA cDNA could be used for treating MPS I. To optimize the lentiviral vector design, 9 constructs were designed by combinations of various promoters, enhancers, and codon optimization. After in vitro transfection into 293FT cells, 5 constructs achieved the highest IDUA activities (5613 to 7358 nmol/h/mg protein). These 5 candidate vectors were then tested by injection (1 × 10(7) TU/g) into neonatal MPS I mice. After 30 days, one vector, CCEoIDW, achieved the highest IDUA levels: 2.6% of wildtype levels in the brain, 9.9% in the heart, 200% in the liver and 257% in the spleen. CCEoIDW achieved the most significant GAG reduction: down 49% in the brain, 98% in the heart, 100% in the liver and 95% in the spleen. Further, CCEoIDW had the lowest transgene frequency, especially in the gonads (0.03 ± 0.01 copies/100 cells), reducing the risk of insertional mutagenesis and germ-line transmission. Therefore, CCEoIDW is selected as the optimal lentiviral vector for treating MPS I disease and will be applied in large animal preclinical studies. Further, taken both in vitro and in vivo comparisons together, codon optimization, use of EF-1α promoter and woodchuck hepatitis virus posttranscriptional response element (WPRE) could enhance transgene expression. These results provided a better understanding of factors contributing efficient transgene expression in lentiviral gene therapies. PMID:27556013

  15. Transposable elements are enriched within or in close proximity to xenobiotic-metabolizing cytochrome P450 genes

    PubMed Central

    Chen, Song; Li, Xianchun

    2007-01-01

    Background Transposons, i.e. transposable elements (TEs), are the major internal spontaneous mutation agents for the variability of eukaryotic genomes. To address the general issue of whether transposons mediate genomic changes in environment-adaptation genes, we scanned two alleles per each of the six xenobiotic-metabolizing Helicoverpa zea cytochrome P450 loci, including CYP6B8, CYP6B27, CYP321A1, CYP321A2, CYP9A12v3 and CYP9A14, for the presence of transposon insertions by genome walking and sequence analysis. We also scanned thirteen Drosophila melanogaster P450s genes for TE insertions by in silico mapping and literature search. Results Twelve novel transposons, including LINEs (long interspersed nuclear elements), SINEs (short interspersed nuclear elements), MITEs (miniature inverted-repeat transposable elements), one full-length transib-like transposon, and one full-length Tcl-like DNA transpson, are identified from the alleles of the six H. zea P450 genes. The twelve transposons are inserted into the 5'flanking region, 3'flanking region, exon, or intron of the six environment-adaptation P450 genes. In D. melanogaster, seven out of the eight Drosophila P450s (CYP4E2, CYP6A2, CYP6A8, CYP6A9, CYP6G1, CYP6W1, CYP12A4, CYP12D1) implicated in insecticide resistance are associated with a variety of transposons. By contrast, all the five Drosophila P450s (CYP302A1, CYP306A1, CYP307A1, CYP314A1 and CYP315A1) involved in ecdysone biosynthesis and developmental regulation are free of TE insertions. Conclusion These results indicate that TEs are selectively retained within or in close proximity to xenobiotic-metabolizing P450 genes. PMID:17381843

  16. Characterization of five subgroups of the sieve element occlusion gene family in Glycine max reveals genes encoding non-forisome P-proteins, forisomes and forisome tails.

    PubMed

    Zielonka, Sascia; Ernst, Antonia M; Hawat, Susan; Twyman, Richard M; Prüfer, Dirk; Noll, Gundula A

    2014-09-01

    P-proteins are structural phloem proteins discussed to be involved in the rapid sealing of injured sieve elements. P-proteins are found in all dicotyledonous and some monocotyledonous plants, but additional crystalloid P-proteins, known as forisomes, have evolved solely in the Fabaceae. Both types are encoded by members of the sieve element occlusion (SEO) gene family, which comprises seven phylogenetic subgroups. The Fabaceae-specific subgroup 1 contains genes encoding forisome subunits in e.g. Medicago truncatula, Vicia faba, Dipteryx panamensis and Canavalia gladiata whereas basal subgroup 5 encodes P-proteins in Nicotiana tabacum (tobacco) and Arabidopsis thaliana. The function of remaining subgroups is still unknown. We chose Glycine max (soybean) as a model to investigate SEO proteins representing different subgroups in one species. We isolated native P-proteins to determine the SEO protein composition and analyzed the expression pattern, localization and structure of the G. max SEO proteins representing five of the subgroups. We found that subgroup 1 GmSEO genes encode forisome subunits, a member of subgroup 5 encodes a non-forisome P-protein and subgroup 2 GmSEO genes encode the components of forisome tails, which are present in a restricted selection of Fabaceaen species. We therefore present the first molecular characterization of a Fabaceae non-forisome P-protein and the first evidence that forisome tails are encoded by a phylogenetically-distinct branch of the SEO gene family.

  17. Direct regulation of knot gene expression by Ultrabithorax and the evolution of cis-regulatory elements in Drosophila.

    PubMed

    Hersh, Bradley M; Carroll, Sean B

    2005-04-01

    The regulation of development by Hox proteins is important in the evolution of animal morphology, but how the regulatory sequences of Hox-regulated target genes function and evolve is unclear. To understand the regulatory organization and evolution of a Hox target gene, we have identified a wing-specific cis-regulatory element controlling the knot gene, which is expressed in the developing Drosophila wing but not the haltere. This regulatory element contains a single binding site that is crucial for activation by the transcription factor Cubitus interruptus (Ci), and a cluster of binding sites for repression by the Hox protein Ultrabithorax (UBX). The negative and positive control regions are physically separable, demonstrating that UBX does not repress by competing for occupancy of Ci-binding sites. Although knot expression is conserved among Drosophila species, this cluster of UBX binding sites is not. We isolated the knot wing cis-regulatory element from D. pseudoobscura, which contains a cluster of UBX-binding sites that is not homologous to the functionally defined D. melanogaster cluster. It is, however, homologous to a second D. melanogaster region containing a cluster of UBX sites that can also function as a repressor element. Thus, the knot regulatory region in D. melanogaster has two apparently functionally redundant blocks of sequences for repression by UBX, both of which are widely separated from activator sequences. This redundancy suggests that the complete evolutionary unit of regulatory control is larger than the minimal experimentally defined control element. The span of regulatory sequences upon which selection acts may, in general, be more expansive and less modular than functional studies of these elements have previously indicated.

  18. Characterization of new bacterial catabolic genes and mobile genetic elements by high throughput genetic screening of a soil metagenomic library.

    PubMed

    Jacquiod, Samuel; Demanèche, Sandrine; Franqueville, Laure; Ausec, Luka; Xu, Zhuofei; Delmont, Tom O; Dunon, Vincent; Cagnon, Christine; Mandic-Mulec, Ines; Vogel, Timothy M; Simonet, Pascal

    2014-11-20

    A mix of oligonucleotide probes was used to hybridize soil metagenomic DNA from a fosmid clone library spotted on high density membranes. The pooled radio-labeled probes were designed to target genes encoding glycoside hydrolases GH18, dehalogenases, bacterial laccases and mobile genetic elements (integrases from integrons and insertion sequences). Positive hybridizing spots were affiliated to the corresponding clones in the library and the metagenomic inserts were sequenced. After assembly and annotation, new coding DNA sequences related to genes of interest were identified with low protein similarity against the closest hits in databases. This work highlights the sensitivity of DNA/DNA hybridization techniques as an effective and complementary way to recover novel genes from large metagenomic clone libraries. This study also supports that some of the identified catabolic genes might be associated with horizontal transfer events.

  19. A novel target-specific gene delivery system combining baculovirus and sequence-specific long interspersed nuclear elements.

    PubMed

    Kawashima, Tomoko; Osanai, Mizuko; Futahashi, Ryo; Kojima, Tetsuya; Fujiwara, Haruhiko

    2007-07-01

    Transposable elements are valuable for somatic and germ-line transformation. However, long interspersed nuclear elements (LINEs) have not been used because of poor information on the transposition mechanism. We have developed a novel gene delivery system combining baculovirus AcNPV and two silkworm LINEs, SART1 and R1, which integrate into specific sequences of telomeric repeats and 28S ribosomal DNA, respectively. When two LINEs containing the enhanced green fluorescent protein gene recombined into AcNPV were infected into fifth instar larvae of the silkworm, we observed target-specific retrotransposition of LINEs at 72h post-infection, using polymerase chain reaction amplification and sequencing. Telomere- and 28S rDNA-specific transposition occurred in all nine tissues tested, including the ovary and testis. This is the first demonstration of site-specific gene delivery in living larvae. Insertion efficiencies were dependent on the virus titer for injection and the host strains of Bombyx mori. Using this system, we successfully detected the intergeneration transmission of retrotransposed sequences. In addition, AcNPV-mediated SART1 also transposed into telomere of another lepidopteran, Orgyia recens, suggesting that this system is useful for a wide variety of AcNPV-infectious insects. Site-specific gene delivery by virus-mediated LINE will be a potential gene therapy tool to avoid harmful unexpected insertions.

  20. Expressed Repeat Elements Improve RT-qPCR Normalization across a Wide Range of Zebrafish Gene Expression Studies

    PubMed Central

    Vanhauwaert, Suzanne; Van Peer, Gert; Rihani, Ali; Janssens, Els; Rondou, Pieter; Lefever, Steve; De Paepe, Anne; Coucke, Paul J.; Speleman, Frank; Vandesompele, Jo; Willaert, Andy

    2014-01-01

    The selection and validation of stably expressed reference genes is a critical issue for proper RT-qPCR data normalization. In zebrafish expression studies, many commonly used reference genes are not generally applicable given their variability in expression levels under a variety of experimental conditions. Inappropriate use of these reference genes may lead to false interpretation of expression data and unreliable conclusions. In this study, we evaluated a novel normalization method in zebrafish using expressed repetitive elements (ERE) as reference targets, instead of specific protein coding mRNA targets. We assessed and compared the expression stability of a number of EREs to that of commonly used zebrafish reference genes in a diverse set of experimental conditions including a developmental time series, a set of different organs from adult fish and different treatments of zebrafish embryos including morpholino injections and administration of chemicals. Using geNorm and rank aggregation analysis we demonstrated that EREs have a higher overall expression stability compared to the commonly used reference genes. Moreover, we propose a limited set of ERE reference targets (hatn10, dna15ta1 and loopern4), that show stable expression throughout the wide range of experiments in this study, as strong candidates for inclusion as reference targets for qPCR normalization in future zebrafish expression studies. Our applied strategy to find and evaluate candidate expressed repeat elements for RT-qPCR data normalization has high potential to be used also for other species. PMID:25310091

  1. Analysis of the chromatin domain organisation around the plastocyanin gene reveals an MAR-specific sequence element in Arabidopsis thaliana.

    PubMed

    van Drunen, C M; Oosterling, R W; Keultjes, G M; Weisbeek, P J; van Driel, R; Smeekens, S C

    1997-10-01

    The Arabidopsis thaliana genome is currently being sequenced, eventually leading towards the unravelling of all potential genes. We wanted to gain more insight into the way this genome might be organized at the ultrastructural level. To this extent we identified matrix attachment regions demarking potential chromatin domains, in a 16 kb region around the plastocyanin gene. The region was cloned and sequenced revealing six genes in addition to the plastocyanin gene. Using an heterologous in vitro nuclear matrix binding assay, to search for evolutionary conserved matrix attachment regions (MARs), we identified three such MARs. These three MARs divide the region into two small chromatin domains of 5 kb, each containing two genes. Comparison of the sequence of the three MARs revealed a degenerated 21 bp sequence that is shared between these MARs and that is not found elsewhere in the region. A similar sequence element is also present in four other MARs of Arabidopsis.Therefore, this sequence may constitute a landmark for the position of MARs in the genome of this plant. In a genomic sequence database of Arabidopsis the 21 bp element is found approximately once every 10 kb. The compactness of the Arabidopsis genome could account for the high incidence of MARs and MRSs we observed.

  2. Lactogenic hormonal induction of long distance interactions between beta-casein gene regulatory elements

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lactogenic hormone regulation of beta-casein gene expression in mammary epithelial cells provides, an excellent model in which to study the mechanisms by which steroid and peptide hormone signaling control gene expression. Prolactin- and glucocorticoid-mediated induction of beta-casein gene express...

  3. Regulatory elements in the first intron contribute to transcriptional regulation of the beta 3 tubulin gene by 20-hydroxyecdysone in Drosophila Kc cells.

    PubMed Central

    Bruhat, A; Tourmente, S; Chapel, S; Sobrier, M L; Couderc, J L; Dastugue, B

    1990-01-01

    We have studied the transcriptional regulation of the beta 3 tubulin gene by the steroid hormone 20-hydroxyecdysone (20-OH-E) in Drosophila Kc cells. A series of hybrid genes with varying tubulin gene lengths driving the bacterial chloramphenicol acetyl transferase (CAT) gene were constructed. The promoter activity was assayed after transient expression in Kc cells, in the presence or absence of 20-OH-E. We find that 0.91Kb upstream from the transcription start site contain one or several hormone independent positive cis-acting elements, responsible for the constitutive expression of the beta 3 tubulin gene. In the large (4.5 Kb) first intron of this gene, we identified additional hormone dependent negative and positive regulatory elements, which can act in both directions and in a position-independence manner. Then, the negative intron element(s), which repress the transcription in the absence of 20-OH-E has characteristics of silencer. Images PMID:2349088

  4. An active hAT transposable element causing bud mutation of carnation by insertion into the flavonoid 3'-hydroxylase gene.

    PubMed

    Momose, Masaki; Nakayama, Masayoshi; Itoh, Yoshio; Umemoto, Naoyuki; Toguri, Toshihiro; Ozeki, Yoshihiro

    2013-04-01

    The molecular mechanisms underlying spontaneous bud mutations, which provide an important breeding tool in carnation, are poorly understood. Here we describe a new active hAT type transposable element, designated Tdic101, the movement of which caused a bud mutation in carnation that led to a change of flower color from purple to deep pink. The color change was attributed to Tdic101 insertion into the second intron of F3'H, the gene for flavonoid 3'-hydroxylase responsible for purple pigment production. Regions on the deep pink flowers of the mutant can revert to purple, a visible phenotype of, as we show, excision of the transposable element. Sequence analysis revealed that Tdic101 has the characteristics of an autonomous element encoding a transposase. A related, but non-autonomous element dTdic102 was found to move in the genome of the bud mutant as well. Its mobilization might be the result of transposase activities provided by other elements such as Tdic101. In carnation, therefore, the movement of transposable elements plays an important role in the emergence of a bud mutation.

  5. Molecular dissection of cis-acting regulatory elements from 5'-proximal regions of a vaccinia virus late gene cluster.

    PubMed

    Miner, J N; Weinrich, S L; Hruby, D E

    1988-01-01

    Promoter elements responsible for directing the transcription of six tightly clustered vaccinia virus (VV) late genes (open reading frames [ORFs] D11, D12, D13, A1, A2, and A3) from the HindIII D/A region of the viral genome were identified within the upstream sequences proximal to each individual locus. These regions were identified as promoters by excising them from the VV genome, abutting them to the bacterial chloramphenicol acetyl transferase gene, and demonstrating their ability to drive expression of the reporter gene in transient-expression assays in an orientation-specific manner. To delineate the 5' boundary of the upstream elements, two of the VV late gene (A1 and D13) promoter: CAT constructs were subjected to deletion mutagenesis procedures. A series of 5' deletions of the ORF A1 promoter from -114 to -24 showed no reduction in promoter activity, whereas additional deletion of the sequences from -24 to +2 resulted in the complete loss of activity. Deletion of the ORF A1 fragment from -114 to -104 resulted in a 24% increase in activity, suggesting the presence of a negative regulatory region. In marked contrast to previous 5' deletion analyses which have identified VV late promoters as 20- to 30-base-pair cap-proximal sequences, 5' deletions to define the upstream boundary of the ORF D13 promoter identified two positive regulatory regions, the first between -235 and -170 and the second between -123 and -106. Background levels of chloramphenicol acetyltransferase expression were obtained with deletions past -88. Significantly, this places the ORF D13 regulatory regions within the upstream coding sequences of the ORF A1. A high-stringency computer search for homologies between VV late promoters that have been thus far characterized was carried out. Several potential consensus sequences were found just upstream from RNA start sites of temporally related promoter elements. Three major conclusions are drawn from these experiments. (i) The presence of

  6. Horizontal Gene Acquisitions, Mobile Element Proliferation, and Genome Decay in the Host-Restricted Plant Pathogen Erwinia Tracheiphila.

    PubMed

    Shapiro, Lori R; Scully, Erin D; Straub, Timothy J; Park, Jihye; Stephenson, Andrew G; Beattie, Gwyn A; Gleason, Mark L; Kolter, Roberto; Coelho, Miguel C; De Moraes, Consuelo M; Mescher, Mark C; Zhaxybayeva, Olga

    2016-03-01

    Modern industrial agriculture depends on high-density cultivation of genetically similar crop plants, creating favorable conditions for the emergence of novel pathogens with increased fitness in managed compared with ecologically intact settings. Here, we present the genome sequence of six strains of the cucurbit bacterial wilt pathogen Erwinia tracheiphila (Enterobacteriaceae) isolated from infected squash plants in New York, Pennsylvania, Kentucky, and Michigan. These genomes exhibit a high proportion of recent horizontal gene acquisitions, invasion and remarkable amplification of mobile genetic elements, and pseudogenization of approximately 20% of the coding sequences. These genome attributes indicate that E. tracheiphila recently emerged as a host-restricted pathogen. Furthermore, chromosomal rearrangements associated with phage and transposable element proliferation contribute to substantial differences in gene content and genetic architecture between the six E. tracheiphila strains and other Erwinia species. Together, these data lead us to hypothesize that E. tracheiphila has undergone recent evolution through both genome decay (pseudogenization) and genome expansion (horizontal gene transfer and mobile element amplification). Despite evidence of dramatic genomic changes, the six strains are genetically monomorphic, suggesting a recent population bottleneck and emergence into E. tracheiphila's current ecological niche. PMID:26992913

  7. Horizontal Gene Acquisitions, Mobile Element Proliferation, and Genome Decay in the Host-Restricted Plant Pathogen Erwinia Tracheiphila

    PubMed Central

    Shapiro, Lori R.; Scully, Erin D.; Straub, Timothy J.; Park, Jihye; Stephenson, Andrew G.; Beattie, Gwyn A.; Gleason, Mark L.; Kolter, Roberto; Coelho, Miguel C.; De Moraes, Consuelo M.; Mescher, Mark C.; Zhaxybayeva, Olga

    2016-01-01

    Modern industrial agriculture depends on high-density cultivation of genetically similar crop plants, creating favorable conditions for the emergence of novel pathogens with increased fitness in managed compared with ecologically intact settings. Here, we present the genome sequence of six strains of the cucurbit bacterial wilt pathogen Erwinia tracheiphila (Enterobacteriaceae) isolated from infected squash plants in New York, Pennsylvania, Kentucky, and Michigan. These genomes exhibit a high proportion of recent horizontal gene acquisitions, invasion and remarkable amplification of mobile genetic elements, and pseudogenization of approximately 20% of the coding sequences. These genome attributes indicate that E. tracheiphila recently emerged as a host-restricted pathogen. Furthermore, chromosomal rearrangements associated with phage and transposable element proliferation contribute to substantial differences in gene content and genetic architecture between the six E. tracheiphila strains and other Erwinia species. Together, these data lead us to hypothesize that E. tracheiphila has undergone recent evolution through both genome decay (pseudogenization) and genome expansion (horizontal gene transfer and mobile element amplification). Despite evidence of dramatic genomic changes, the six strains are genetically monomorphic, suggesting a recent population bottleneck and emergence into E. tracheiphila’s current ecological niche. PMID:26992913

  8. Identification of cis-acting elements as DNase I hypersensitive sites in lysozyme gene chromatin.

    PubMed

    Sippel, A E; Saueressig, H; Huber, M C; Hoefer, H C; Stief, A; Borgmeyer, U; Bonifer, C

    1996-01-01

    DNase I hypersensitive sites in chromatin of eukaryotic cells mark the positions of multifactorial cis-acting elements. Mapping DH sites by indirect end labeling is a convenient procedure used for identifying regulatory elements within extensive regions of chromatin and for gaining information about their functional specificity as well as their fine structure.

  9. Identification of cis-acting elements as DNase I hypersensitive sites in lysozyme gene chromatin.

    PubMed

    Sippel, A E; Saueressig, H; Huber, M C; Hoefer, H C; Stief, A; Borgmeyer, U; Bonifer, C

    1996-01-01

    DNase I hypersensitive sites in chromatin of eukaryotic cells mark the positions of multifactorial cis-acting elements. Mapping DH sites by indirect end labeling is a convenient procedure used for identifying regulatory elements within extensive regions of chromatin and for gaining information about their functional specificity as well as their fine structure. PMID:8902808

  10. A negatively acting DNA sequence element mediates phytochrome-directed repression of phyA gene transcription.

    PubMed Central

    Bruce, W B; Deng, X W; Quail, P H

    1991-01-01

    Phytochrome represses transcription of its own phyA genes within 5 min of light-triggered conversion to its active Pfr form. We have utilized microprojectile mediated gene transfer into etiolated rice seedlings to delineate sequence elements in the oat phyA3 promoter responsible for this regulation. Linker-scan mutagenesis of this promoter has identified two positive elements which together are necessary for maximal transcription in the absence of Pfr. These elements are designated PE1, centered at position -357 bp, and PE3, centered at position -96 bp. Sequence mutagenesis immediately downstream of PE3 results in maximal transcription in the presence of high Pfr levels, indicating that Pfr represses phyA3 transcription through a negatively acting sequence element. This element, designated RE1, with the sequence CATGGGCGCGG, encompasses a motif that is highly conserved in all monocot phyA promoters thus far characterized. DNase I protection analysis indicates that oat nuclear extracts contain multiple factors that bind to an array of sequence motifs, including PE1 and part of PE3, within 400 bp upstream of the oat phyA3 transcription start site. This DNA-binding pattern is not altered by Pfr. Weak binding to part of the RE1 motif is evident but also with no difference between high and low Pfr levels. We conclude that the signal transduction chain that mediates Pfr-directed repression of phyA3 transcription terminates with a negatively acting transcription factor that binds to the sequence element RE1. Images PMID:1915276

  11. Gene Network Rewiring to Study Melanoma Stage Progression and Elements Essential for Driving Melanoma

    PubMed Central

    Kaushik, Abhinav; Bhatia, Yashuma; Ali, Shakir; Gupta, Dinesh

    2015-01-01

    Metastatic melanoma patients have a poor prognosis, mainly attributable to the underlying heterogeneity in melanoma driver genes and altered gene expression profiles. These characteristics of melanoma also make the development of drugs and identification of novel drug targets for metastatic melanoma a daunting task. Systems biology offers an alternative approach to re-explore the genes or gene sets that display dysregulated behaviour without being differentially expressed. In this study, we have performed systems biology studies to enhance our knowledge about the conserved property of disease genes or gene sets among mutually exclusive datasets representing melanoma progression. We meta-analysed 642 microarray samples to generate melanoma reconstructed networks representing four different stages of melanoma progression to extract genes with altered molecular circuitry wiring as compared to a normal cellular state. Intriguingly, a majority of the melanoma network-rewired genes are not differentially expressed and the disease genes involved in melanoma progression consistently modulate its activity by rewiring network connections. We found that the shortlisted disease genes in the study show strong and abnormal network connectivity, which enhances with the disease progression. Moreover, the deviated network properties of the disease gene sets allow ranking/prioritization of different enriched, dysregulated and conserved pathway terms in metastatic melanoma, in agreement with previous findings. Our analysis also reveals presence of distinct network hubs in different stages of metastasizing tumor for the same set of pathways in the statistically conserved gene sets. The study results are also presented as a freely available database at http://bioinfo.icgeb.res.in/m3db/. The web-based database resource consists of results from the analysis presented here, integrated with cytoscape web and user-friendly tools for visualization, retrieval and further analysis. PMID

  12. Specialized chromatin structure domain boundary elements flanking a Drosophila heat shock gene locus are under torsional strain in vivo.

    PubMed

    Jupe, E R; Sinden, R R; Cartwright, I L

    1995-02-28

    An in vivo assay employing psoralen cross-linking was used to investigate the presence of unrestrained supercoiling in DNA sequences located in nontranscribed regions flanking the 3' ends of the pair of divergent heat shock protein 70 (hsp70) genes at locus 87A7 of Drosophila. Two of the regions examined contain sequences comprising the previously defined specialized chromatin structure elements (scs and scs'). Both of these putative chromosomal domain boundaries exhibited very similar levels of unrestrained negative supercoiling that remained high regardless of the transcriptional status of the hsp70 genes. The steric accessibility of the scs region before heat shock was 3-fold higher than either flanking region (consistent with its previously documented DNase I hypersensitivity); this increased an additional 2-fold following hsp70 gene activation without a concomitant rise in the accessibility of flanking regions. Most notably, a sequence which lies outside the presumed 87A7 domain, as defined by the centromere-proximal scs element, exhibited no detectable torsional tension regardless of gene activity in the domain. A sequence located just inside the scs region displayed a low level of tension that was also essentially unaffected by transcription, consistent with data obtained previously for a similarly situated fragment at the centromere-distal scs' location. The existence of a highly localized region of supercoiling within the scs and scs' sequences might be related to their activity in vivo as insulators of chromosomal position effects in Drosophila. PMID:7873544

  13. Transposable element dynamics and PIWI regulation impacts lncRNA and gene expression diversity in Drosophila ovarian cell cultures

    PubMed Central

    Sytnikova, Yuliya A.; Rahman, Reazur; Chirn, Gung-wei; Clark, Josef P.

    2014-01-01

    Piwi proteins and Piwi-interacting RNAs (piRNAs) repress transposable elements (TEs) from mobilizing in gonadal cells. To determine the spectrum of piRNA-regulated targets that may extend beyond TEs, we conducted a genome-wide survey for transcripts associated with PIWI and for transcripts affected by PIWI knockdown in Drosophila ovarian somatic sheet (OSS) cells, a follicle cell line expressing the Piwi pathway. Despite the immense sequence diversity among OSS cell piRNAs, our analysis indicates that TE transcripts are the major transcripts associated with and directly regulated by PIWI. However, several coding genes were indirectly regulated by PIWI via an adjacent de novo TE insertion that generated a nascent TE transcript. Interestingly, we noticed that PIWI-regulated genes in OSS cells greatly differed from genes affected in a related follicle cell culture, ovarian somatic cells (OSCs). Therefore, we characterized the distinct genomic TE insertions across four OSS and OSC lines and discovered dynamic TE landscapes in gonadal cultures that were defined by a subset of active TEs. Particular de novo TEs appeared to stimulate the expression of novel candidate long noncoding RNAs (lncRNAs) in a cell lineage-specific manner, and some of these TE-associated lncRNAs were associated with PIWI and overlapped PIWI-regulated genes. Our analyses of OSCs and OSS cells demonstrate that despite having a Piwi pathway to suppress endogenous mobile elements, gonadal cell TE landscapes can still dramatically change and create transcriptome diversity. PMID:25267525

  14. Germline cell death is inhibited by P-element insertions disrupting the dcp-1/pita nested gene pair in Drosophila.

    PubMed

    Laundrie, Bonni; Peterson, Jeanne S; Baum, Jason S; Chang, Jeffrey C; Fileppo, Dana; Thompson, Sharona R; McCall, Kimberly

    2003-12-01

    Germline cell death in Drosophila oogenesis is controlled by distinct signals. The death of nurse cells in late oogenesis is developmentally regulated, whereas the death of egg chambers during mid-oogenesis is induced by environmental stress or developmental abnormalities. P-element insertions in the caspase gene dcp-1 disrupt both dcp-1 and the outlying gene, pita, leading to lethality and defective nurse cell death in late oogenesis. By isolating single mutations in the two genes, we have found that the loss of both genes contributes to this ovary phenotype. Mutants of pita, which encodes a C2H2 zinc-finger protein, are homozygous lethal and show dumpless egg chambers and premature nurse cell death in germline clones. Early nurse cell death is not observed in the dcp-1/pita double mutants, suggesting that dcp-1+ activity is required for the mid-oogenesis cell death seen in pita mutants. dcp-1 mutants are viable and nurse cell death in late oogenesis occurs normally. However, starvation-induced germline cell death during mid-oogenesis is blocked, leading to a reduction and inappropriate nuclear localization of the active caspase Drice. These findings suggest that the combinatorial loss of pita and dcp-1 leads to the increased survival of abnormal egg chambers in mutants bearing the P-element alleles and that dcp-1 is essential for cell death during mid-oogenesis.

  15. Transposable element dynamics and PIWI regulation impacts lncRNA and gene expression diversity in Drosophila ovarian cell cultures.

    PubMed

    Sytnikova, Yuliya A; Rahman, Reazur; Chirn, Gung-Wei; Clark, Josef P; Lau, Nelson C

    2014-12-01

    Piwi proteins and Piwi-interacting RNAs (piRNAs) repress transposable elements (TEs) from mobilizing in gonadal cells. To determine the spectrum of piRNA-regulated targets that may extend beyond TEs, we conducted a genome-wide survey for transcripts associated with PIWI and for transcripts affected by PIWI knockdown in Drosophila ovarian somatic sheet (OSS) cells, a follicle cell line expressing the Piwi pathway. Despite the immense sequence diversity among OSS cell piRNAs, our analysis indicates that TE transcripts are the major transcripts associated with and directly regulated by PIWI. However, several coding genes were indirectly regulated by PIWI via an adjacent de novo TE insertion that generated a nascent TE transcript. Interestingly, we noticed that PIWI-regulated genes in OSS cells greatly differed from genes affected in a related follicle cell culture, ovarian somatic cells (OSCs). Therefore, we characterized the distinct genomic TE insertions across four OSS and OSC lines and discovered dynamic TE landscapes in gonadal cultures that were defined by a subset of active TEs. Particular de novo TEs appeared to stimulate the expression of novel candidate long noncoding RNAs (lncRNAs) in a cell lineage-specific manner, and some of these TE-associated lncRNAs were associated with PIWI and overlapped PIWI-regulated genes. Our analyses of OSCs and OSS cells demonstrate that despite having a Piwi pathway to suppress endogenous mobile elements, gonadal cell TE landscapes can still dramatically change and create transcriptome diversity.

  16. Nontoxic Strains of Cyanobacteria Are the Result of Major Gene Deletion Events Induced by a Transposable Element

    PubMed Central

    Christiansen, Guntram; Molitor, Carole; Philmus, Benjamin

    2008-01-01

    Blooms that are formed by cyanobacteria consist of toxic and nontoxic strains. The mechanisms that result in the occurrence of nontoxic strains are enigmatic. All the nontoxic strains of the filamentous cyanobacterium Planktothrix that were isolated from 9 European countries were found to have lost 90% of a large microcystin synthetase (mcy) gene cluster that encoded the synthesis of the toxic peptide microcystin (MC). Those strains still contain the flanking regions of the mcy gene cluster along with remnants of the transposable elements that are found in between. The majority of the strains still contain a gene coding for a distinct thioesterase type II (mcyT), which is putatively involved in MC synthesis. The insertional inactivation of mcyT in an MC-producing strain resulted in the reduction of MC synthesis by 94 ± 2% (1 standard deviation). Nontoxic strains that occur in shallow lakes throughout Europe form a monophyletic lineage. A second lineage consists of strains that contain the mcy gene cluster but differ in their photosynthetic pigment composition, which is due to the occurrence of strains that contain phycocyanin or large amounts of phycoerythrin in addition to phycocyanin. Strains containing phycoerythrin typically occur in deep-stratified lakes. The rare occurrence of gene cluster deletion, paired with the evolutionary diversification of the lineages of strains that lost or still contain the mcy gene cluster, needs to be invoked in order to explain the absence or dominance of toxic cyanobacteria in various habitats. PMID:18502770

  17. A novel tumor necrosis factor-responsive transcription factor which recognizes a regulatory element in hemopoietic growth factor genes

    SciTech Connect

    Shannon, M.F.; Pell, L.M.; Kuczek, E.S.; Occhiodoro, F.S.; Dunn, S.M.; Vadas, M.A. ); Lenardo, M.J. )

    1990-06-01

    A conserved DNA sequence element, termed cytokine 1 (CK-1), is found in the promoter regions of many hemopoietic growth factor (HGF) genes. Mutational analyses and modification interference experiments show that this sequence specifically binds a nuclear transcription factor, NF-GMa, which is a protein with a molecular mass of 43 kilodaltons. It interacts with different affinities with the CK-1-like sequence from a number of HGF genes, including granulocyte macrophage colony-stimulating factor (GM-CSF), granulocyte (G)-CSF, interleukin 3 (IL-3), and IL-5. The authors show that the level of NF-GMa binding is induced in embryonic fibroblasts by tumor necrosis factor {alpha} (TNF-{alpha}) treatment and that the CK-1 sequence from the G-CSF gene is a TNF-{alpha}-responsive enhancer in these cells.

  18. R1 and R2 retrotransposable elements of Drosophila evolve at rates similar to those of nuclear genes.

    PubMed

    Eickbush, D G; Lathe, W C; Francino, M P; Eickbush, T H

    1995-02-01

    The non-long-terminal repeat retrotransposable elements, R1 and R2, insert at unique locations in the 28S ribosomal RNA genes of insects. Based on the nucleotide sequences of these elements in the eight members of the melanogaster species subgroup of the genus Drosophila, they have been maintained by vertical germline transmission for the 17-20 million year history of this subgroup. The stable inheritance of R1 and R2 within these species has enabled a determination of their nucleotide substitution rates. The sequence of the R1 and R2 elements from D. ambigua, a member of the obscura species group, has also been determined to enable an extrapolation of this rate over an estimated 45-60 million years. The mean rate of substitutions at synonymous sites (Ks) was 6.6 and 9.6 times the rate at replacement sites (Ka) in the R1 and R2 elements, respectively. Both elements appear to have been under selective pressure to maintain their open reading frames and thus their ability to retrotranspose for most of their evolution in these lineages. Using the rate of change at synonymous sites (Ks) as the best indicator of the nucleotide substitution rate, the mean Ks values for R1 and R2 were 2.3 and 2.2 times that of the alcohol dehydrogenase (Adh) genes. However, this faster rate is a result of the lower codon usage bias of R1 and R2 compared with that of Adh. When the Ks rates of R1 and R2 were compared with that of a larger number of nuclear genes available from at least two of the nine species under investigation, R1 and R2 were found to evolve in most lineages at rates similar to that of nuclear genes with low codon bias. The ability of R1 and R2 to maintain their presence in this species subgroup by retrotransposition while exhibiting rates of nucleotide evolution similar to nuclear genes suggests these transposition events are rare or not as error prone as that of retroviruses.

  19. Tc, an unusual promoter element required for constitutive transcription of the yeast HIS3 gene.

    PubMed Central

    Mahadevan, S; Struhl, K

    1990-01-01

    Tc is the proximal promoter element required for constitutive his3 transcription that occurs in the absence of the canonical TATA element (TR) and is initiated from the +1 site. The TC element, unlike TR, does not respond to transcriptional stimulation by the GCN4 or GAL4 activator protein. Analysis of deletion, substitution, and point mutations indicates that Tc mapped between nucleotides -54 and -83 and is a sequence-dependent element because it could not be functionally replaced by other DNA sequences. However, in contrast to the behavior of typical promoter elements, it was surprisingly difficult to eliminate Tc function by base pair substitutions. Of 15 derivatives averaging four substitutions in the Tc region and representing 40% of all possible single changes, only 1 inactivated the Tc element. Moreover, the phenotypes of mutant and hybrid elements indicated that inactivation of Tc required multiple changes. The spacing between Tc and the initiation region could be varied over a 30-base-pair range without significantly affecting the level of transcription from the +1 site. From these results, we consider it possible that Tc may not interact with TFIID or some other typical sequence-specific transcription factor, but instead might influence transcription, either directly or indirectly, by its DNA structure. Images PMID:2201891

  20. Identification and characterization of regulatory elements in the promoter of ACVR1, the gene mutated in Fibrodysplasia Ossificans Progressiva

    PubMed Central

    2013-01-01

    Background The ACVR1 gene encodes a type I receptor for bone morphogenetic proteins (BMPs). Mutations in the ACVR1 gene are associated with Fibrodysplasia Ossificans Progressiva (FOP), a rare and extremely disabling disorder characterized by congenital malformation of the great toes and progressive heterotopic endochondral ossification in muscles and other non-skeletal tissues. Several aspects of FOP pathophysiology are still poorly understood, including mechanisms regulating ACVR1 expression. This work aimed to identify regulatory elements that control ACVR1 gene transcription. Methods and results We first characterized the structure and composition of human ACVR1 gene transcripts by identifying the transcription start site, and then characterized a 2.9 kb upstream region. This region showed strong activating activity when tested by reporter gene assays in transfected cells. We identified specific elements within the 2.9 kb region that are important for transcription factor binding using deletion constructs, co-transfection experiments with plasmids expressing selected transcription factors, site-directed mutagenesis of consensus binding-site sequences, and by protein/DNA binding assays. We also characterized a GC-rich minimal promoter region containing binding sites for the Sp1 transcription factor. Conclusions Our results showed that several transcription factors such as Egr-1, Egr-2, ZBTB7A/LRF, and Hey1, regulate the ACVR1 promoter by binding to the -762/-308 region, which is essential to confer maximal transcriptional activity. The Sp1 transcription factor acts at the most proximal promoter segment upstream of the transcription start site. We observed significant differences in different cell types suggesting tissue specificity of transcriptional regulation. These findings provide novel insights into the molecular mechanisms that regulate expression of the ACVR1 gene and that could be targets of new strategies for future therapeutic treatments. PMID:24047559

  1. Antagonistic Gene Activities Determine the Formation of Pattern Elements along the Mediolateral Axis of the Arabidopsis Fruit

    PubMed Central

    González-Reig, Santiago; Ripoll, Juan José; Vera, Antonio; Yanofsky, Martin F.; Martínez-Laborda, Antonio

    2012-01-01

    The Arabidopsis fruit mainly consists of a mature ovary that shows three well defined territories that are pattern elements along the mediolateral axis: the replum, located at the medial plane of the flower, and the valve and the valve margin, both of lateral nature. JAG/FIL activity, which includes the combined functions of JAGGED (JAG), FILAMENTOUS FLOWER (FIL), and YABBY3 (YAB3), contributes to the formation of the two lateral pattern elements, whereas the cooperating genes BREVIPEDICELLUS (BP) and REPLUMLESS (RPL) promote replum development. A recent model to explain pattern formation along the mediolateral axis hypothesizes that JAG/FIL activity and BP/RPL function as antagonistic lateral and medial factors, respectively, which tend to repress each other. In this work, we demonstrate the existence of mutual exclusion mechanisms between both kinds of factors, and how this determines the formation and size of the three territories. Medial factors autonomously constrain lateral factors so that they only express outside the replum, and lateral factors negatively regulate the medially expressed BP gene in a non-autonomous fashion to ensure correct replum development. We also have found that ASYMMETRIC LEAVES1 (AS1), previously shown to repress BP both in leaves and ovaries, collaborates with JAG/FIL activity, preventing its repression by BP and showing synergistic interactions with JAG/FIL activity genes. Therefore AS gene function (the function of the interacting genes AS1 and AS2) has been incorporated in the model as a new lateral factor. Our model of antagonistic factors provides explanation for mutant fruit phenotypes in Arabidopsis and also may help to understand natural variation of fruit shape in Brassicaceae and other species, since subtle changes in gene expression may cause conspicuous changes in the size of the different tissue types. PMID:23133401

  2. Gene promoter of apoptosis inhibitory protein IAP2: identification of enhancer elements and activation by severe hypoxia.

    PubMed Central

    Dong, Zheng; Nishiyama, Junichiro; Yi, Xiaolan; Venkatachalam, Manjeri A; Denton, Michael; Gu, Sumin; Li, Senlin; Qiang, Mei

    2002-01-01

    Inhibitors of apoptosis (IAPs) antagonize cell death and regulate the cell cycle. One mechanism controlling IAP expression is translation initiation through the internal ribosome entry sites. Alternatively, IAP expression can be regulated at the transcription level. We showed recently the activation of IAP2 transcription by severe hypoxia. To pursue this regulation, we have cloned the full-length cDNA of rat IAP2, and have isolated and analysed the promoter regions of this gene. The cDNA encodes a protein of 589 amino acids, exhibiting structural features of IAP. In rat tissues, a major IAP2 transcript of approximately 3.5 kb was detected. We subsequently isolated 3.3 kb of the proximal 5'-flanking regions of this gene, which showed significant promoter activity. Of interest, 5' sequential deletion of the promoter sequence identified an enhancer of approximately 200 bp. Deletion of cAMP-response-element-binding protein (CREB) sites in the enhancer sequence diminished its activity. Finally, the IAP2 gene promoter was activated significantly by severe hypoxia and not by CoCl(2) or desferrioxamine, pharmacological inducers of hypoxia-inducible factor-1. In conclusion, in this study we have cloned the full-length cDNA of rat IAP2, and for the first time we have isolated and analysed promoter sequences of this gene, leading to the identification of enhancer elements. Moreover, we have demonstrated activation of the gene promoter by severe hypoxia, a condition shown to induce IAP2. These findings provide a basis for further investigation of gene regulation of IAP2, a protein with multiple functions. PMID:12023884

  3. Demystifying the secret mission of enhancers: linking distal regulatory elements to target genes

    PubMed Central

    Yao, Lijing; Berman, Benjamin P.; Farnham, Peggy J.

    2015-01-01

    Abstract Enhancers are short regulatory sequences bound by sequence-specific transcription factors and play a major role in the spatiotemporal specificity of gene expression patterns in development and disease. While it is now possible to identify enhancer regions genomewide in both cultured cells and primary tissues using epigenomic approaches, it has been more challenging to develop methods to understand the function of individual enhancers because enhancers are located far from the gene(s) that they regulate. However, it is essential to identify target genes of enhancers not only so that we can understand the role of enhancers in disease but also because this information will assist in the development of future therapeutic options. After reviewing models of enhancer function, we discuss recent methods for identifying target genes of enhancers. First, we describe chromatin structure-based approaches for directly mapping interactions between enhancers and promoters. Second, we describe the use of correlation-based approaches to link enhancer state with the activity of nearby promoters and/or gene expression. Third, we describe how to test the function of specific enhancers experimentally by perturbing enhancer–target relationships using high-throughput reporter assays and genome editing. Finally, we conclude by discussing as yet unanswered questions concerning how enhancers function, how target genes can be identified, and how to distinguish direct from indirect changes in gene expression mediated by individual enhancers. PMID:26446758

  4. Isolation of Sparus auratus prolactin gene and activity of the cis-acting regulatory elements.

    PubMed

    Astola, Antonio; Ortiz, Manuela; Calduch-Giner, Josep A; Pérez-Sánchez, Jaume; Valdivia, Manuel M

    2003-10-15

    A sea bream prolactin (sbPRL) gene was isolated using a prolactin cDNA fragment, generated by PCR as a probe. The gene analyzed comprises 3.5 kb of DNA containing five exons as described previously for other fish PRL genes. Analysis of 1.0 kb of the proximal promoter sequence reveals a consensus TATAA box, up to seven (A/T)3NCAT consensus motifs for binding of the pituitary-specific factor Pit-1 and putative CREB and GATA binding sites. CHO culture cells co-transfected with a sbPRL promoter sequence and a sea bream Pit-1 cDNA expression plasmid showed expression of a linked luciferase reporter gene. Transient expression experiments with 5'-delection mutants reveals at least three regulatory regions on the sbPRL gene, two with a stimulatory effect on transcription and one with apparent inhibitory effect. From a comparative point of view, this study of PRL gene in Sparus auratus, correlates well with those previously published on tilapia and rainbow trout. The molecular data reported will be useful for comparative analysis of gene regulation in the GH/PRL gene family in teleosts.

  5. Demystifying the secret mission of enhancers: linking distal regulatory elements to target genes.

    PubMed

    Yao, Lijing; Berman, Benjamin P; Farnham, Peggy J

    2015-01-01

    Enhancers are short regulatory sequences bound by sequence-specific transcription factors and play a major role in the spatiotemporal specificity of gene expression patterns in development and disease. While it is now possible to identify enhancer regions genomewide in both cultured cells and primary tissues using epigenomic approaches, it has been more challenging to develop methods to understand the function of individual enhancers because enhancers are located far from the gene(s) that they regulate. However, it is essential to identify target genes of enhancers not only so that we can understand the role of enhancers in disease but also because this information will assist in the development of future therapeutic options. After reviewing models of enhancer function, we discuss recent methods for identifying target genes of enhancers. First, we describe chromatin structure-based approaches for directly mapping interactions between enhancers and promoters. Second, we describe the use of correlation-based approaches to link enhancer state with the activity of nearby promoters and/or gene expression. Third, we describe how to test the function of specific enhancers experimentally by perturbing enhancer-target relationships using high-throughput reporter assays and genome editing. Finally, we conclude by discussing as yet unanswered questions concerning how enhancers function, how target genes can be identified, and how to distinguish direct from indirect changes in gene expression mediated by individual enhancers. PMID:26446758

  6. Strong inhibition of fimbrial 3 subunit gene transcription by a novel downstream repressive element in Bordetella pertussis.

    PubMed

    Chen, Qing; Boulanger, Alice; Hinton, Deborah M; Stibitz, Scott

    2014-08-01

    The Bvg-regulated promoters for the fimbrial subunit genes fim2 and fim3 of Bordetella pertussis behave differently from each other both in vivo and in vitro. In vivo Pfim2 is significantly stronger than Pfim3 , even though predictions based on the DNA sequences of BvgA-binding motifs and core promoter elements would indicate the opposite. In vitro Pfim3 demonstrated robust BvgA∼P-dependent transcriptional activation, while none was seen with Pfim2 . This apparent contradiction was investigated further. By swapping sequence elements we created a number of hybrid promoters and assayed their strength in vivo. We found that, while Pfim3 promoter elements upstream of the +1 transcriptional start site do indeed direct Bvg-activated transcription more efficiently than those of Pfim2 , the overall promoter strength of Pfim3  in vivo is reduced due to sequences downstream of +1 that inhibit transcription more than 250-fold. This element, the DRE (downstream repressive element), was mapped to the 15 bp immediately downstream of the Pfim3 +1. Placing the DRE in different promoter contexts indicated that its activity was not specific to fim promoters, or even to Bvg-regulated promoters. However it does appear to be specific to Bordetella species in that it did not function in Escherichia coli.

  7. Strong inhibition of fimbrial 3 subunit gene transcription by a novel downstream repressive element in Bordetella pertussis

    PubMed Central

    Chen, Qing; Boulanger, Alice; Hinton, Deborah M.; Stibitz, Scott

    2015-01-01

    The Bvg-regulated promoters for the fimbrial subunit genes fim2 and fim3 of B. pertussis behave differently from each other both in vivo and in vitro. In vivo Pfim2 is significantly stronger than Pfim3, even though predictions based on the DNA sequences of BvgA binding motifs and core promoter elements would indicate the opposite. In vitro Pfim3 demonstrated robust BvgA~P-dependent transcriptional activation, while none was seen with Pfim2. This apparent contradiction was investigated further. By swapping sequence elements we created a number of hybrid promoters and assayed their strength in vivo. We found that, while Pfim3 promoter elements upstream of the +1 transcriptional start site do indeed direct Bvg-activated transcription more efficiently than those of Pfim2, the overall promoter strength of Pfim3 in vivo is reduced due to sequences downstream of +1 that inhibit transcription more than 250-fold. This element, the DRE (downstream repressive element), was mapped to the 15 bp immediately downstream of the Pfim3 +1. Placing the DRE in different promoter contexts indicated that its activity was not specific to fim promoters, or even to Bvg-regulated promoters. However it does appear to be specific to Bordetella species in that it did not function in E. coli. PMID:24963821

  8. Identification of a cis-regulatory element by transient analysis of co-ordinately regulated genes

    PubMed Central

    Dare, Andrew P; Schaffer, Robert J; Lin-Wang, Kui; Allan, Andrew C; Hellens, Roger P

    2008-01-01

    Background Transcription factors (TFs) co-ordinately regulate target genes that are dispersed throughout the genome. This co-ordinate regulation is achieved, in part, through the interaction of transcription factors with conserved cis-regulatory motifs that are in close proximity to the target genes. While much is known about the families of transcription factors that regulate gene expression in plants, there are few well characterised cis-regulatory motifs. In Arabidopsis, over-expression of the MYB transcription factor PAP1 (PRODUCTION OF ANTHOCYANIN PIGMENT 1) leads to transgenic plants with elevated anthocyanin levels due to the co-ordinated up-regulation of genes in the anthocyanin biosynthetic pathway. In addition to the anthocyanin biosynthetic genes, there are a number of un-associated genes that also change in expression level. This may be a direct or indirect consequence of the over-expression of PAP1. Results Oligo array analysis of PAP1 over-expression Arabidopsis plants identified genes co-ordinately up-regulated in response to the elevated expression of this transcription factor. Transient assays on the promoter regions of 33 of these up-regulated genes identified eight promoter fragments that were transactivated by PAP1. Bioinformatic analysis on these promoters revealed a common cis-regulatory motif that we showed is required for PAP1 dependent transactivation. Conclusion Co-ordinated gene regulation by individual transcription factors is a complex collection of both direct and indirect effects. Transient transactivation assays provide a rapid method to identify direct target genes from indirect target genes. Bioinformatic analysis of the promoters of these direct target genes is able to locate motifs that are common to this sub-set of promoters, which is impossible to identify with the larger set of direct and indirect target genes. While this type of analysis does not prove a direct interaction between protein and DNA, it does provide a tool to

  9. [Engineering and screening of artificial riboswitch as a novel gene control element].

    PubMed

    Yang, Huiyong; Diao, Yong; Lin, Junsheng; Xu, Rui'an

    2012-02-01

    Various artificial riboswitches have been constructed by utilization of designed aptamers or by modification of natural riboswitch systems, because they can regulate gene expression in a highly efficient, precise and fast way, and promise to supply simple cis-acting, modular, and non-immunogenic system for use in future gene therapy applications. In this review, we present an overview of currently available technologies to design and select engineered riboswitches, and discuss some possible technologies that would allow them highly responsive to non-natural ligands, and dynamic control of gene expression in mammalian cells. Though how to bring custom-designed riboswitches as a novel and versatile tool box to gene control system is still a great challenge, the combination of structure-activity relationship information, computer based molecular design, in vitro selection, and high-through screening will serve as powerful tools for further development of riboswitch based gene regulatory systems. PMID:22667116

  10. Regulatory elements in the 5'region of 16SrRNA gene of Bacillus sp. strain SJ­101

    PubMed Central

    Singh, Braj R; Al-Khedhairy, Abdulaziz A; Alarifi, Saud A; Musarrat, Javed

    2009-01-01

    Advancement in bioinformatics with the development of computational tools has enabled the in­silico prediction and identification of transcription regulatory factors and other genetic elements with great ease. In this study, computational analysis of sequence homology of 546 bp 5’ region of 16SrRNA gene of Bacillus sp. strain SJ­101 resulted in identification of promoter­like sequences within the rrn gene. Using BPROM tool, the regulatory motifs like -35 and -10 boxes were mapped at 392 and 411 positions, respectively. Furthermore, the cis-acting elements as the binding sites for transcription factors (TF) cpxR and argR were identified at positions 413 and 416 at the upstream of an open reading frame (ORF). The probable functions of the putative TFs were predicted through the Uni­Prot/Swiss­Prot protein database. Search for the Shine­Dalgarno sequence (SD) found the presence of highly conserved SD sequence (AATACC), and a short 42 bp coding sequence/ORF bounded with characteristic transcription start site (AAC) and a stop codon (TGA) at positions 426 and 465 downstream to the promoter elements. A 13 amino acid long translation product of a short ORF has exhibited 100% homology with protein sequences of Bacillus spp., while showing some degree of polymorphism with other reference strains. The comparative homology of the small protein exhibited maximum similarity with Prolyl­4 hydroxylase of Chlamydomonas reinhardtii with 4.11 ZSCORE. The highly conserved regulatory elements and the putative ORF predicted within the 16SrRNA gene may help understand the role of relatively unexplored short ORFs within rrn operon, and their functional products in genetic regulatory mechanisms in eubacteria. PMID:19759811

  11. Parental Allele-Specific Chromatin Configuration in a Boundary–Imprinting-Control Element Upstream of the Mouse H19 Gene

    PubMed Central

    Khosla, Sanjeev; Aitchison, Alan; Gregory, Richard; Allen, Nicholas D.; Feil, Robert

    1999-01-01

    The mouse H19 gene is expressed from the maternal chromosome exclusively. A 2-kb region at 2 to 4 kb upstream of H19 is paternally methylated throughout development, and these sequences are necessary for the imprinted expression of both H19 and the 5′-neighboring Igf2 gene. In particular, on the maternal chromosome this element appears to insulate the Igf2 gene from enhancers located downstream of H19. We analyzed the chromatin organization of this element by assaying its sensitivity to nucleases in nuclei. Six DNase I hypersensitive sites (HS sites) were detected on the unmethylated maternal chromosome exclusively, the two most prominent of which mapped 2.25 and 2.75 kb 5′ to the H19 transcription initiation site. Five of the maternal HS sites were present in expressing and nonexpressing tissues and in embryonic stem (ES) cells. They seem, therefore, to reflect the maternal origin of the chromosome rather than the expression of H19. A sixth maternal HS site, at 3.45 kb upstream of H19, was detected in ES cells only. The nucleosomal organization of this element was analyzed in tissues and ES cells by micrococcal nuclease digestion. Specifically on the maternal chromosome, an unusual and strong banding pattern was obtained, suggestive of a nonnucleosomal organization. From our studies, it appears that the unusual chromatin organization with the presence of HS sites (maternal chromosome) and DNA methylation (paternal chromosome) in this element are mutually exclusive and reflect alternate epigenetic states. In addition, our data suggest that nonhistone proteins are associated with the maternal chromosome and that these might be involved in its boundary function. PMID:10082521

  12. Multiple Promoter Elements Contribute to Activity of the Follicle-Stimulating Hormone Receptor (FSHR) Gene in Testicular Sertoli Cells

    PubMed Central

    Heckert, Leslie L.; Daggett, Melissa A. F.; Chen, Jiangkai

    2006-01-01

    The FSH receptor (FSHR) is expressed only in granulosa cells of the ovary and Sertoli cells of the testis. This highly specific pattern of gene expression asserts that transcriptional events unique to these two cell types are responsible for activation of the FSHR gene. We have characterized the promoter elements required for activity of the rat FSHR gene in a Sertoli cell line MSC-1, primary cultures of rat Sertoli cells, and two non-Sertoli cell lines. Transient transfection analysis of deletion and block replacement mutants identified several elements, both 5′ and 3′ to the transcriptional start sites, that are essential for full promoter activity in Sertoli cells. These studies confirmed the use of an important E box element (CACGTG), which had the single greatest impact on promoter function. Bases within the core CACGTG of the E box, as well as flanking sequences, were shown to be essential for its function. Electrophoretic mobility shift assays identified both upstream stimulatory factor 1 (USF1) and USF2 as primary components of the complexes binding the E box. Sequence requirements for USF binding in vitro modestly diverged from the sequence requirements for in vivo function of the element. Comparison of the E box binding proteins in different cell types revealed that similar proteins bind the E box in Sertoli and non-Sertoli cell lines. Extracts from primary cultures of rat and mouse Sertoli cells have a second E box-binding complex that cross-reacts with USF antibodies that is not present in the cell lines. PMID:9773974

  13. Linking polymorphic p53 response elements with gene expression in airway epithelial cells of smokers and cancer risk.

    PubMed

    Wang, Xuting; Pittman, Gary S; Bandele, Omari J; Bischof, Jason J; Liu, Gang; Brothers, John F; Spira, Avrum; Bell, Douglas A

    2014-12-01

    Chronic cigarette smoking exposes airway epithelial cells to thousands of carcinogens, oxidants and DNA-damaging agents, creating a field of molecular injury in the airway and altering gene expression. Studies of cytologically normal bronchial epithelial cells from smokers have identified transcription-based biomarkers that may prove useful in early diagnosis of lung cancer, including a number of p53-regulated genes. The ability of p53 to regulate transcription is critical for tumor suppression, and this suggests that single-nucleotide polymorphisms (SNPs) in functional p53 binding sites (p53 response elements, or p53REs) that affect gene expression could influence susceptibility to cancer. To connect p53RE SNP genotype with gene expression and cancer risk, we identified a set of 204 SNPs in putative p53REs, and performed cis expression quantitative trait loci (eQTL) analysis, assessing associations between SNP genotypes and mRNA levels of adjacent genes in bronchial epithelial cells obtained from 44 cigarette smokers. To further test and validate these genotype-expression associations, we searched published eQTL studies from independent populations and determined that 53% (39/74) of the bronchial epithelial eQTLs were observed in at least one of other studies. SNPs in p53REs were also evaluated for effects on p53-DNA binding using a quantitative in vitro protein-DNA binding assay. Last, based on linkage disequilibrium, we found 6 p53RE SNPs associated with gene expression were identified as cancer risk SNPs by either genome-wide association studies or candidate gene studies. We provide an approach for identifying and evaluating potentially functional SNPs that may modulate the airway gene expression response to smoking and may influence susceptibility to cancers.

  14. Bacteriophages of Staphylococcus aureus efficiently package various bacterial genes and mobile genetic elements including SCCmec with different frequencies.

    PubMed

    Mašlaňová, Ivana; Doškař, Jiří; Varga, Marian; Kuntová, Lucie; Mužík, Jan; Malúšková, Denisa; Růžičková, Vladislava; Pantůček, Roman

    2013-02-01

    Staphylococcus aureus is a serious human and veterinary pathogen in which new strains with increasing virulence and antimicrobial resistance occur due to acquiring new genes by horizontal transfer. It is generally accepted that temperate bacteriophages play a major role in gene transfer. In this study, we proved the presence of various bacterial genes of the S. aureus COL strain directly within the phage particles via qPCR and quantified their packaging frequency. Non-parametric statistical analysis showed that transducing bacteriophages φ11, φ80 and φ80α of serogroup B, in contrast to serogroup A bacteriophage φ81, efficiently package selected chromosomal genes localized in 4 various loci of the chromosome and 8 genes carried on variable elements, such as staphylococcal cassette chromosome SCCmec, staphylococcal pathogenicity island SaPI1, genomic islands vSaα and vSaβ, and plasmids with various frequency. Bacterial gene copy number per ng of DNA isolated from phage particles ranged between 1.05 × 10(2) for the tetK plasmid gene and 3.86 × 10(5) for the SaPI1 integrase gene. The new and crucial finding that serogroup B bacteriophages can package concurrently ccrA1 (1.16 × 10(4)) and mecA (1.26 × 10(4)) located at SCCmec type I into their capsids indicates that generalized transduction plays an important role in the evolution and emergence of new methicillin-resistant clones.

  15. Chicken beta B1-crystallin gene expression: presence of conserved functional polyomavirus enhancer-like and octamer binding-like promoter elements found in non-lens genes.

    PubMed Central

    Roth, H J; Das, G C; Piatigorsky, J

    1991-01-01

    Expression of the chicken beta B1-crystallin gene was examined. Northern (RNA) blot and primer extension analyses showed that while abundant in the lens, the beta B1 mRNA is absent from the liver, brain, heart, skeletal muscle, and fibroblasts of the chicken embryo, suggesting lens specificity. Promoter fragments ranging from 434 to 126 bp of 5'-flanking sequence (plus 30 bp of exon 1) of the beta B1 gene fused to the bacterial chloramphenicol acetyltransferase gene functioned much more efficiently in transfected embryonic chicken lens epithelial cells than in transfected primary muscle fibroblasts or HeLa cells. Transient expression of recombinant plasmids in cultured lens cells, DNase I footprinting, in vitro transcription in a HeLa cell extract, and gel mobility shift assays were used to identify putative functional promoter elements of the beta B1-crystallin gene. Sequence analysis revealed a number of potential regulatory elements between positions -126 and -53 of the beta B1 promoter, including two Sp1 sites, two octamer binding sequence-like sites (OL-1 and OL-2), and two polyomavirus enhancer-like sites (PL-1 and PL-2). Deletion and site-specific mutation experiments established the functional importance of PL-1 (-116 to -102), PL-2 (-90 to -76), and OL-2 (-75 to -68). DNase I footprinting using a lens or a HeLa cell nuclear extract and gel mobility shifts using a lens nuclear extract indicated the presence of putative lens transcription factors binding to these DNA sequences. Competition experiments provided evidence that PL-1 and PL-2 recognize the same or very similar factors, while OL-2 recognizes a different factor. Our data suggest that the same or closely related transcription factors found in many tissues are used for expression of the chicken beta B1-crystallin gene in the lens. Images PMID:1996106

  16. T cell receptor gene usage in the response to lambda repressor cI protein. An apparent bias in the usage of a V alpha gene element

    PubMed Central

    1988-01-01

    The T cell response to the lambda repressor cI protein is directed to the same region of the protein (residues 12-26) in both BALB/c and A/J mice. A panel of T cell hybridomas specific for P12-26 in the context of either I-Ek or I-Ad have been isolated To further understand the molecular interaction between the TCR and the Ia-P12-26 complex, the primary structures of the TCR of five T cell hybridomas have been determined. Southern and Northern analyses indicate that two members of the V alpha 3 gene family are used by 13 out of 14 I-Ek-restricted T cells. Four different V beta genes are used by these T cell hybridomas, while the majority (8 out of 13) express V beta 1 in combination with the J beta 2.1 element. No clear correlation can be seen in this system between gene usage and MHC restriction. In addition, the fine specificity of I-Ek-restricted T cells to a single amino acid substitution [Phe22/His22]P12-26 is not attributed to the usage of particular V alpha and V beta elements. The V alpha 3 family gene is also used by a few I-Ad-restricted T cells. Interestingly, these I-Ad T cells share a reactivity pattern more similar to that of I-Ek- restricted T cells than other I-Ad-restricted T cells. The nonrandom selection V alpha 3 is also demonstrated by the fact that V alpha 3 is used by P12-26-specific, but not by cytochrome c- or staphylococcal nucleus-specific, I-Ek-restricted T cells. This suggests that although antigen specificity may not be accounted for by either chain of the TCR, the members of V alpha 3 genes may be selected by the antigen (P12- 26). PMID:2971753

  17. PreCisIon: PREdiction of CIS-regulatory elements improved by gene's positION.

    PubMed

    Elati, Mohamed; Nicolle, Rémy; Junier, Ivan; Fernández, David; Fekih, Rim; Font, Julio; Képès, François

    2013-02-01

    Conventional approaches to predict transcriptional regulatory interactions usually rely on the definition of a shared motif sequence on the target genes of a transcription factor (TF). These efforts have been frustrated by the limited availability and accuracy of TF binding site motifs, usually represented as position-specific scoring matrices, which may match large numbers of sites and produce an unreliable list of target genes. To improve the prediction of binding sites, we propose to additionally use the unrelated knowledge of the genome layout. Indeed, it has been shown that co-regulated genes tend to be either neighbors or periodically spaced along the whole chromosome. This study demonstrates that respective gene positioning carries significant information. This novel type of information is combined with traditional sequence information by a machine learning algorithm called PreCisIon. To optimize this combination, PreCisIon builds a strong gene target classifier by adaptively combining weak classifiers based on either local binding sequence or global gene position. This strategy generically paves the way to the optimized incorporation of any future advances in gene target prediction based on local sequence, genome layout or on novel criteria. With the current state of the art, PreCisIon consistently improves methods based on sequence information only. This is shown by implementing a cross-validation analysis of the 20 major TFs from two phylogenetically remote model organisms. For Bacillus subtilis and Escherichia coli, respectively, PreCisIon achieves on average an area under the receiver operating characteristic curve of 70 and 60%, a sensitivity of 80 and 70% and a specificity of 60 and 56%. The newly predicted gene targets are demonstrated to be functionally consistent with previously known targets, as assessed by analysis of Gene Ontology enrichment or of the relevant literature and databases.

  18. A gene expression map of the larval Xenopus laevis head reveals developmental changes underlying the evolution of new skeletal elements.

    PubMed

    Square, Tyler; Jandzik, David; Cattell, Maria; Coe, Alex; Doherty, Jacob; Medeiros, Daniel Meulemans

    2015-01-15

    The morphology of the vertebrate head skeleton is highly plastic, with the number, size, shape, and position of its components varying dramatically between groups. While this evolutionary flexibility has been key to vertebrate success, its developmental and genetic bases are poorly understood. The larval head skeleton of the frog Xenopus laevis possesses a unique combination of ancestral tetrapod features and anuran-specific novelties. We built a detailed gene expression map of the head mesenchyme in X. laevis during early larval development, focusing on transcription factor families with known functions in vertebrate head skeleton development. This map was then compared to homologous gene expression in zebrafish, mouse, and shark embryos to identify conserved and evolutionarily flexible aspects of vertebrate head skeleton development. While we observed broad conservation of gene expression between X. laevis and other gnathostomes, we also identified several divergent features that correlate to lineage-specific novelties. We noted a conspicuous change in dlx1/2 and emx2 expression in the second pharyngeal arch, presaging the differentiation of the reduced dorsal hyoid arch skeletal element typical of modern anamniote tetrapods. In the first pharyngeal arch we observed a shift in the expression of the joint inhibitor barx1, and new expression of the joint marker gdf5, shortly before skeletal differentiation. This suggests that the anuran-specific infrarostral cartilage evolved by partitioning of Meckel's cartilage with a new paired joint. Taken together, these comparisons support a model in which early patterning mechanisms divide the vertebrate head mesenchyme into a highly conserved set of skeletal precursor populations. While subtle changes in this early patterning system can affect skeletal element size, they do not appear to underlie the evolution of new joints or cartilages. In contrast, later expression of the genes that regulate skeletal element

  19. An adaptive transposable element insertion in the regulatory region of the EO gene in the domesticated silkworm, Bombyx mori.

    PubMed

    Sun, Wei; Shen, Yi-Hong; Han, Min-Jin; Cao, Yun-Feng; Zhang, Ze

    2014-12-01

    Although there are many studies to show a key role of transposable elements (TEs) in adaptive evolution of higher organisms, little is known about the molecular mechanisms. In this study, we found that a partial TE (Taguchi) inserted in the cis-regulatory region of the silkworm ecdysone oxidase (EO) gene, which encodes a crucial enzyme to reduce the titer of molting hormone (20-hydroxyecdysone, 20E). The TE insertion occurred during domestication of silkworm and the frequency of the TE insertion in the domesticated silkworm (Bombyx mori) is high, 54.24%. The linkage disequilibrium in the TE inserted strains of the domesticated silkworm was elevated. Molecular population genetics analyses suggest that this TE insertion is adaptive for the domesticated silkworm. Luminescent reporter assay shows that the TE inserted in the cis-regulatory region of the EO gene functions as a 20E-induced enhancer of the gene expression. Further, phenotypic bioassay indicates that the silkworm with the TE insertion exhibited more stable developmental phenotype than the silkworm without the TE insertion when suffering from food shortage. Thus, the inserted TE in the cis-regulatory region of the EO gene increased developmental uniformity of silkworm individuals through regulating 20E metabolism, partially explaining transformation of a domestication developmental trait in the domesticated silkworm. Our results emphasize the exceptional role of gene expression regulation in developmental transition of domesticated animals.

  20. Pi class glutathione S-transferase genes are regulated by Nrf 2 through an evolutionarily conserved regulatory element in zebrafish

    PubMed Central

    Suzuki, Takafumi; Takagi, Yaeko; Osanai, Hitoshi; Li, Li; Takeuchi, Miki; Katoh, Yasutake; Kobayashi, Makoto; Yamamoto, Masayuki

    2005-01-01

    Pi class GSTs (glutathione S-transferases) are a member of the vertebrate GST family of proteins that catalyse the conjugation of GSH to electrophilic compounds. The expression of Pi class GST genes can be induced by exposure to electrophiles. We demonstrated previously that the transcription factor Nrf 2 (NF-E2 p45-related factor 2) mediates this induction, not only in mammals, but also in fish. In the present study, we have isolated the genomic region of zebrafish containing the genes gstp1 and gstp2. The regulatory regions of zebrafish gstp1 and gstp2 have been examined by GFP (green fluorescent protein)-reporter gene analyses using microinjection into zebrafish embryos. Deletion and point-mutation analyses of the gstp1 promoter showed that an ARE (antioxidant-responsive element)-like sequence is located 50 bp upstream of the transcription initiation site which is essential for Nrf 2 transactivation. Using EMSA (electrophoretic mobility-shift assay) analysis we showed that zebrafish Nrf 2–MafK heterodimer specifically bound to this sequence. All the vertebrate Pi class GST genes harbour a similar ARE-like sequence in their promoter regions. We propose that this sequence is a conserved target site for Nrf 2 in the Pi class GST genes. PMID:15654768

  1. The upstream muscle-specific enhancer of the rat muscle creatine kinase gene is composed of multiple elements.

    PubMed Central

    Horlick, R A; Benfield, P A

    1989-01-01

    A series of constructs that links the rat muscle creatine kinase promoter to the bacterial chloramphenicol acetyltransferase gene was generated. These constructs were introduced into differentiating mouse C2C12 myogenic cells to localize sequences that are important for up-regulation of the creatine kinase gene during myogenic differentiation. A muscle-specific enhancer element responsible for induction of chloramphenicol acetyltransferase expression during myogenesis was localized to a 159-base-pair region from 1,031 to 1,190 base pairs upstream of the transcription start site. Analysis of transient expression experiments using promoters mutated by deletion indicated the presence of multiple functional domains within this muscle-specific regulatory element. A DNA fragment spanning this region was used in DNase I protection experiments. Nuclear extracts derived from C2 myotubes protected three regions (designated E1, E2, and E3) on this fragment from digestion, which indicated there may be three or more trans-acting factors that interact with the creatine kinase muscle enhancer. Gel retardation assays revealed that factors able to bind specifically to E1, E2, and E3 are present in a wide variety of tissues and cell types. Transient expression assays demonstrated that elements in regions E1 and E3, but not necessarily E2, are required for full enhancer activity. Images PMID:2761536

  2. Androgen regulation of the TMPRSS2 gene and the effect of a SNP in an androgen response element.

    PubMed

    Clinckemalie, Liesbeth; Spans, Lien; Dubois, Vanessa; Laurent, Michaël; Helsen, Christine; Joniau, Steven; Claessens, Frank

    2013-12-01

    More than 50% of prostate cancers have undergone a genomic reorganization that juxtaposes the androgen-regulated promoter of TMPRSS2 and the protein coding parts of several ETS oncogenes. These gene fusions lead to prostate-specific and androgen-induced ETS expression and are associated with aggressive lesions, poor prognosis, and early-onset prostate cancer. In this study, we showed that an enhancer at 13 kb upstream of the TMPRSS2 transcription start site is crucial for the androgen regulation of the TMPRSS2 gene when tested in bacterial artificial chromosomal vectors. Within this enhancer, we identified the exact androgen receptor binding sequence. This newly identified androgen response element is situated next to two binding sites for the pioneer factor GATA2, which were identified by DNase I footprinting. Both the androgen response element and the GATA-2 binding sites are involved in the enhancer activity. Importantly, a single nucleotide polymorphism (rs8134378) within this androgen response element reduces binding and transactivation by the androgen receptor. The presence of this SNP might have implications on the expression and/or formation levels of TMPRSS2 fusions, because both have been shown to be influenced by androgens.

  3. RNA aptamers as genetic control devices: the potential of riboswitches as synthetic elements for regulating gene expression.

    PubMed

    Berens, Christian; Groher, Florian; Suess, Beatrix

    2015-02-01

    RNA utilizes many different mechanisms to control gene expression. Among the regulatory elements that respond to external stimuli, riboswitches are a prominent and elegant example. They consist solely of RNA and couple binding of a small molecule ligand to the so-called "aptamer domain" with a conformational change in the downstream "expression platform" which then determines system output. The modular organization of riboswitches and the relative ease with which ligand-binding RNA aptamers can be selected in vitro against almost any molecule have led to the rapid and widespread adoption of engineered riboswitches as artificial genetic control devices in biotechnology and synthetic biology over the past decade. This review highlights proof-of-principle applications to demonstrate the versatility and robustness of engineered riboswitches in regulating gene expression in pro- and eukaryotes. It then focuses on strategies and parameters to identify aptamers that can be integrated into synthetic riboswitches that are functional in vivo, before finishing with a reflection on how to improve the regulatory properties of engineered riboswitches, so that we can not only further expand riboswitch applicability, but also finally fully exploit their potential as control elements in regulating gene expression. PMID:25676052

  4. Epigenetic conservation at gene regulatory elements revealed by non-methylated DNA profiling in seven vertebrates.

    PubMed

    Long, Hannah K; Sims, David; Heger, Andreas; Blackledge, Neil P; Kutter, Claudia; Wright, Megan L; Grützner, Frank; Odom, Duncan T; Patient, Roger; Ponting, Chris P; Klose, Robert J

    2013-01-01

    Two-thirds of gene promoters in mammals are associated with regions of non-methylated DNA, called CpG islands (CGIs), which counteract the repressive effects of DNA methylation on chromatin. In cold-blooded vertebrates, computational CGI predictions often reside away from gene promoters, suggesting a major divergence in gene promoter architecture across vertebrates. By experimentally identifying non-methylated DNA in the genomes of seven diverse vertebrates, we instead reveal that non-methylated islands (NMIs) of DNA are a central feature of vertebrate gene promoters. Furthermore, NMIs are present at orthologous genes across vast evolutionary distances, revealing a surprising level of conservation in this epigenetic feature. By profiling NMIs in different tissues and developmental stages we uncover a unifying set of features that are central to the function of NMIs in vertebrates. Together these findings demonstrate an ancient logic for NMI usage at gene promoters and reveal an unprecedented level of epigenetic conservation across vertebrate evolution. DOI:http://dx.doi.org/10.7554/eLife.00348.001. PMID:23467541

  5. Multitasking of the piRNA Silencing Machinery: Targeting Transposable Elements and Foreign Genes in the Bdelloid Rotifer Adineta vaga.

    PubMed

    Rodriguez, Fernando; Arkhipova, Irina R

    2016-05-01

    RNA-mediated silencing processes play a key role in silencing of transposable elements, especially in the germ line, where piwi-interacting RNAs (piRNAs) are responsible for suppressing transposon mobility and maintaining genome integrity. We previously reported that the genome of Adineta vaga, the first sequenced representative of the phylum Rotifera (class Bdelloidea), is characterized by massive levels of horizontal gene transfer, by unusually low transposon content, and by highly diversified RNA-mediated silencing machinery. Here, we investigate genome-wide distribution of pi-like small RNAs, which in A. vaga are 25-31 nucleotides in length and have a strong 5'-uridine bias, while lacking ping-pong amplification signatures. In agreement with expectations, 71% of mapped reads corresponded to annotated transposons, with 93% of these reads being in the antisense orientation. Unexpectedly, a significant fraction of piRNAs originate from predicted coding regions corresponding to genes of putatively foreign origin. The distribution of piRNAs across foreign genes is not biased toward 3'-UTRs, instead resembling transposons in uniform distribution pattern throughout the gene body, and in predominantly antisense orientation. We also find that genes with small RNA coverage, including a number of genes of metazoan origin, are characterized by higher occurrence of telomeric repeats in the surrounding genomic regions, and by higher density of transposons in the vicinity, which have the potential to promote antisense transcription. Our findings highlight the complex interplay between RNA-based silencing processes and acquisition of genes at the genome periphery, which can result either in their loss or eventual domestication and integration into the host genome.

  6. Multitasking of the piRNA Silencing Machinery: Targeting Transposable Elements and Foreign Genes in the Bdelloid Rotifer Adineta vaga.

    PubMed

    Rodriguez, Fernando; Arkhipova, Irina R

    2016-05-01

    RNA-mediated silencing processes play a key role in silencing of transposable elements, especially in the germ line, where piwi-interacting RNAs (piRNAs) are responsible for suppressing transposon mobility and maintaining genome integrity. We previously reported that the genome of Adineta vaga, the first sequenced representative of the phylum Rotifera (class Bdelloidea), is characterized by massive levels of horizontal gene transfer, by unusually low transposon content, and by highly diversified RNA-mediated silencing machinery. Here, we investigate genome-wide distribution of pi-like small RNAs, which in A. vaga are 25-31 nucleotides in length and have a strong 5'-uridine bias, while lacking ping-pong amplification signatures. In agreement with expectations, 71% of mapped reads corresponded to annotated transposons, with 93% of these reads being in the antisense orientation. Unexpectedly, a significant fraction of piRNAs originate from predicted coding regions corresponding to genes of putatively foreign origin. The distribution of piRNAs across foreign genes is not biased toward 3'-UTRs, instead resembling transposons in uniform distribution pattern throughout the gene body, and in predominantly antisense orientation. We also find that genes with small RNA coverage, including a number of genes of metazoan origin, are characterized by higher occurrence of telomeric repeats in the surrounding genomic regions, and by higher density of transposons in the vicinity, which have the potential to promote antisense transcription. Our findings highlight the complex interplay between RNA-based silencing processes and acquisition of genes at the genome periphery, which can result either in their loss or eventual domestication and integration into the host genome. PMID:27017627

  7. Multiple transcribed elements control expression of the Escherichia coli btuB gene.

    PubMed Central

    Franklund, C V; Kadner, R J

    1997-01-01

    Repression by vitamin B12 of the cobalamin transport protein BtuB in the outer membrane of Escherichia coli operates at both the transcriptional and translational levels and is controlled by transcribed sequences within the leader and proximal portion of the btuB coding sequence. The effects of deletions from either end of this region on repression and expression were determined with lac fusions. An element at the 5' end of the transcript and the putative attenuator within the coding sequence were required for transcriptional repression. The presence of either element caused a marked reduction in btuB-lacZ expression which was reversed by the presence of a conserved sequence element in the leader, suggesting the importance of long-range interactions in the btuB leader for expression and regulation. PMID:9190822

  8. Characterization of oocyte-expressed GDF9 gene in buffalo and mapping of its TSS and putative regulatory elements.

    PubMed

    Roy, B; Rajput, S; Raghav, S; Kumar, P; Verma, A; Jain, A; Jain, T; Singh, D; De, S; Goswami, S L; Datta, T K

    2013-05-01

    Summary In spite of emerging evidence about the vital role of GDF9 in determination of oocyte competence, there is insufficient information about its regulation of oocyte-specific expression, particularly in livestock animals. Because of the distinct prominence of buffalo as a dairy animal, the present study was undertaken to isolate and characterize GDF9 cDNA using orthologous primers based on the bovine GDF9 sequence. GDF9 transcripts were found to be expressed in oocytes irrespective of their follicular origin, and shared a single transcription start site (TSS) at -57 base pairs (bp) upstream of ATG. Assignment of the TSS is consistent with the presence of a TATA element at -23 of the TSS mapped in this study. Localization of a buffalo-specific minimal promoter within 320 bp upstream of ATG was consolidated by identification of an E-box element at -113bp. Presence of putative transcription factor binding sites and other cis regulatory elements were analyzed at ~5 kb upstream of TSS. Various germ cell-specific cis-acting regulatory elements (BNCF, BRNF, NR2F, SORY, Foxh1, OCT1, LHXF etc.) have been identified in the 5' flanking region of the buffalo GDF9 gene, including NOBOX DNA binding elements and consensuses E-boxes (CANNTG). Presence of two conserved E-boxes found on buffalo sequence at -520 and -718 positions deserves attention in view of its sequence deviation from other species. Two NOBOX binding elements (NBE) were detected at the -3471 and -203 positions. The fall of the NBE within the putative minimal promoter territory of buffalo GDF9 and its unique non-core binding sequence could have a possible role in the control of the core promoter activity.

  9. Efficient inversions and duplications of mammalian regulatory DNA elements and gene clusters by CRISPR/Cas9

    PubMed Central

    Li, Jinhuan; Shou, Jia; Guo, Ya; Tang, Yuanxiao; Wu, Yonghu; Jia, Zhilian; Zhai, Yanan; Chen, Zhifeng; Xu, Quan; Wu, Qiang

    2015-01-01

    The human genome contains millions of DNA regulatory elements and a large number of gene clusters, most of which have not been tested experimentally. The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated nuclease 9 (Cas9) programed with a synthetic single-guide RNA (sgRNA) emerges as a method for genome editing in virtually any organisms. Here we report that targeted DNA fragment inversions and duplications could easily be achieved in human and mouse genomes by CRISPR with two sgRNAs. Specifically, we found that, in cultured human cells and mice, efficient precise inversions of DNA fragments ranging in size from a few tens of bp to hundreds of kb could be generated. In addition, DNA fragment duplications and deletions could also be generated by CRISPR through trans-allelic recombination between the Cas9-induced double-strand breaks (DSBs) on two homologous chromosomes (chromatids). Moreover, junctions of combinatorial inversions and duplications of the protocadherin (Pcdh) gene clusters induced by Cas9 with four sgRNAs could be detected. In mice, we obtained founders with alleles of precise inversions, duplications, and deletions of DNA fragments of variable sizes by CRISPR. Interestingly, we found that very efficient inversions were mediated by microhomology-mediated end joining (MMEJ) through short inverted repeats. We showed for the first time that DNA fragment inversions could be transmitted through germlines in mice. Finally, we applied this CRISPR method to a regulatory element of the Pcdhα cluster and found a new role in the regulation of members of the Pcdhγ cluster. This simple and efficient method should be useful in manipulating mammalian genomes to study millions of regulatory DNA elements as well as vast numbers of gene clusters. PMID:25757625

  10. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  11. A Novel Peroxisome Proliferator Response Element Modulates Hepatic Low Density Lipoprotein Receptor Gene Transcription in Response to PPARδ Activation

    PubMed Central

    Shende, Vikram R.; Singh, Amar Bahadur; Liu, Jingwen

    2016-01-01

    The hepatic expression of LDLR gene is regulated primarily at the transcriptional level by a sterol-regulatory element (SRE) in its proximal promoter region which is the site of action of SRE-binding protein 2 (SREBP2). However whether additional cis-regulatory elements contribute to LDLR transcription has not been fully explored. We investigated the function of a putative PPAR-response element (PPRE) sequence motif located at −768 to −752 bases upstream of the transcription start site of human LDLR gene in response to PPARδ activation. Promoter luciferase reporter analyses showed that treating HepG2 cells with PPARδ agonist L165041 markedly increased the activity of a full-length LDLR promoter construct (pLDLR-1192) without any effects on the shorter promoter reporter pLDLR-234 that contains only the core regulatory elements SRE-1 and SP1 sites. Importantly, mutation of the PPRE sequence greatly attenuated the induction of the full-length LDLR promoter activity by L165041 without affecting rosuvastatin mediated transactivation. Electrophoretic mobility shift and chromatin immunoprecipitation assays further confirmed the binding of PPARδ to the LDLR-PPRE site. Treating HepG2 cells with L165041 elevated the mRNA and protein expressions of LDLR without affecting the LDLR mRNA decay rate. The induction of LDLR expression by PPARδ agonist was further observed in liver tissue of mice and hamsters treated with L165041. Altogether, our studies identify a novel PPRE-mediated regulatory mechanism for LDLR transcription and suggest that combined treatment of statin with PPARδ agonists may have advantageous effects on LDLR expression. PMID:26443862

  12. Thyroid hormone-regulated gene expression in juvenile mouse liver: identification of thyroid response elements using microarray profiling and in silico analyses

    PubMed Central

    2011-01-01

    Background Disruption of thyroid hormone signalling can alter growth, development and energy metabolism. Thyroid hormones exert their effects through interactions with thyroid receptors that directly bind thyroid response elements and can alter transcriptional activity of target genes. The effects of short-term thyroid hormone perturbation on hepatic mRNA transcription in juvenile mice were evaluated, with the goal of identifying genes containing active thyroid response elements. Thyroid hormone disruption was induced from postnatal day 12 to 15 by adding goitrogens to dams' drinking water (hypothyroid). A subgroup of thyroid hormone-disrupted pups received intraperitoneal injections of replacement thyroid hormones four hours prior to sacrifice (replacement). An additional group received only thyroid hormones four hours prior to sacrifice (hyperthyroid). Hepatic mRNA was extracted and hybridized to Agilent mouse microarrays. Results Transcriptional profiling enabled the identification of 28 genes that appeared to be under direct thyroid hormone-regulation. The regulatory regions of the genome adjacent to these genes were examined for half-site sequences that resemble known thyroid response elements. A bioinformatics search identified 33 thyroid response elements in the promoter regions of 13 different genes thought to be directly regulated by thyroid hormones. Thyroid response elements found in the promoter regions of Tor1a, 2310003H01Rik, Hect3d and Slc25a45 were further validated by confirming that the thyroid receptor is associated with these sequences in vivo and that it can bind directly to these sequences in vitro. Three different arrangements of thyroid response elements were identified. Some of these thyroid response elements were located far up-stream (> 7 kb) of the transcription start site of the regulated gene. Conclusions Transcriptional profiling of thyroid hormone disrupted animals coupled with a novel bioinformatics search revealed new thyroid

  13. Nonsense mutation-associated Becker muscular dystrophy: interplay between exon definition and splicing regulatory elements within the DMD gene

    PubMed Central

    Flanigan, Kevin M.; Dunn, Diane M.; von Niederhausern, Andrew; Soltanzadeh, Payam; Howard, Michael T.; Sampson, Jacinda B.; Swoboda, Kathryn J.; Bromberg, Mark B.; Mendell, Jerry R.; Taylor, Laura; Anderson, Christine B.; Pestronk, Alan; Florence, Julaine; Connolly, Anne M.; Mathews, Katherine D.; Wong, Brenda; Finkel, Richard S.; Bonnemann, Carsten G.; Day, John W.; McDonald, Craig; Weiss, Robert B.

    2013-01-01

    Nonsense mutations are usually predicted to function as null alleles due to premature termination of protein translation. However, nonsense mutations in the DMD gene, encoding the dystrophin protein, have been associated with both the severe Duchenne Muscular Dystrophy (DMD) and milder Becker Muscular Dystrophy (BMD) phenotypes. In a large survey, we identified 243 unique nonsense mutations in the DMD gene, and for 210 of these we could establish definitive phenotypes. We analyzed the reading frame predicted by exons flanking those in which nonsense mutations were found, and present evidence that nonsense mutations resulting in BMD likely do so by inducing exon skipping, confirming that exonic point mutations affecting exon definition have played a significant role in determining phenotype. We present a new model based on the combination of exon definition and intronic splicing regulatory elements for the selective association of BMD nonsense mutations with a subset of DMD exons prone to mutation-induced exon skipping. PMID:21972111

  14. Fins into limbs: Autopod acquisition and anterior elements reduction by modifying gene networks involving 5'Hox, Gli3, and Shh.

    PubMed

    Tanaka, Mikiko

    2016-05-01

    Two major morphological changes occurred during the fin-to-limb transition: the appearance of the autopod, and the reduction of anterior skeletal elements. In the past decades, numerous approaches to the study of genetic developmental systems involved in patterning of fins/limbs among different taxa have provided clues to better understand the mechanism of the fin-to-limb transition. In this article, I discuss recent progress toward elucidating the evolutionary origin of the autopod and the mechanism through which the multiple-basal bones of ancestral fins were reduced into a single bone (humerus/femur). A particular focus of this article is the patterning mechanism of the tetrapod limb and chondrichthyan fin controlled by gene networks involving the 5'Hox genes, Gli3 and Shh. These recent data provide possible scenarios that could have led to the transformation of fins into limbs. PMID:26992366

  15. Nonsense mutation-associated Becker muscular dystrophy: interplay between exon definition and splicing regulatory elements within the DMD gene.

    PubMed

    Flanigan, Kevin M; Dunn, Diane M; von Niederhausern, Andrew; Soltanzadeh, Payam; Howard, Michael T; Sampson, Jacinda B; Swoboda, Kathryn J; Bromberg, Mark B; Mendell, Jerry R; Taylor, Laura E; Anderson, Christine B; Pestronk, Alan; Florence, Julaine M; Connolly, Anne M; Mathews, Katherine D; Wong, Brenda; Finkel, Richard S; Bonnemann, Carsten G; Day, John W; McDonald, Craig; Weiss, Robert B

    2011-03-01

    Nonsense mutations are usually predicted to function as null alleles due to premature termination of protein translation. However, nonsense mutations in the DMD gene, encoding the dystrophin protein, have been associated with both the severe Duchenne Muscular Dystrophy (DMD) and milder Becker Muscular Dystrophy (BMD) phenotypes. In a large survey, we identified 243 unique nonsense mutations in the DMD gene, and for 210 of these we could establish definitive phenotypes. We analyzed the reading frame predicted by exons flanking those in which nonsense mutations were found, and present evidence that nonsense mutations resulting in BMD likely do so by inducing exon skipping, confirming that exonic point mutations affecting exon definition have played a significant role in determining phenotype. We present a new model based on the combination of exon definition and intronic splicing regulatory elements for the selective association of BMD nonsense mutations with a subset of DMD exons prone to mutation-induced exon skipping.

  16. Multiple Herbicide Resistance in Lolium multiflorum and Identification of Conserved Regulatory Elements of Herbicide Resistance Genes.

    PubMed

    Mahmood, Khalid; Mathiassen, Solvejg K; Kristensen, Michael; Kudsk, Per

    2016-01-01

    Herbicide resistance is a ubiquitous challenge to herbicide sustainability and a looming threat to control weeds in crops. Recently four genes were found constituently over-expressed in herbicide resistant individuals of Lolium rigidum, a close relative of Lolium multiflorum. These include two cytochrome P450s, one nitronate monooxygenase and one glycosyl-transferase. Higher expressions of these four herbicide metabolism related (HMR) genes were also observed after herbicides exposure in the gene expression databases, indicating them as reliable markers. In order to get an overview of herbicidal resistance status of L. multiflorum L, 19 field populations were collected. Among these populations, four populations were found to be resistant to acetolactate synthase (ALS) inhibitors while three exhibited resistance to acetyl-CoA carboxylase (ACCase) inhibitors in our initial screening and dose response study. The genotyping showed the presence of mutations Trp-574-Leu and Ile-2041-Asn in ALS and ACCase, respectively, and qPCR experiments revealed the enhanced expression of HMR genes in individuals of certain resistant populations. Moreover, co-expression networks and promoter analyses of HMR genes in O. sativa and A. thaliana resulted in the identification of a cis-regulatory motif and zinc finger transcription factors. The identified transcription factors were highly expressed similar to HMR genes in response to xenobiotics whereas the identified motif is known to play a vital role in coping with environmental stresses and maintaining genome stability. Overall, our findings provide an important step forward toward a better understanding of metabolism-based herbicide resistance that can be utilized to devise novel strategies of weed management. PMID:27547209

  17. Multiple Herbicide Resistance in Lolium multiflorum and Identification of Conserved Regulatory Elements of Herbicide Resistance Genes

    PubMed Central

    Mahmood, Khalid; Mathiassen, Solvejg K.; Kristensen, Michael; Kudsk, Per

    2016-01-01

    Herbicide resistance is a ubiquitous challenge to herbicide sustainability and a looming threat to control weeds in crops. Recently four genes were found constituently over-expressed in herbicide resistant individuals of Lolium rigidum, a close relative of Lolium multiflorum. These include two cytochrome P450s, one nitronate monooxygenase and one glycosyl-transferase. Higher expressions of these four herbicide metabolism related (HMR) genes were also observed after herbicides exposure in the gene expression databases, indicating them as reliable markers. In order to get an overview of herbicidal resistance status of L. multiflorum L, 19 field populations were collected. Among these populations, four populations were found to be resistant to acetolactate synthase (ALS) inhibitors while three exhibited resistance to acetyl-CoA carboxylase (ACCase) inhibitors in our initial screening and dose response study. The genotyping showed the presence of mutations Trp-574-Leu and Ile-2041-Asn in ALS and ACCase, respectively, and qPCR experiments revealed the enhanced expression of HMR genes in individuals of certain resistant populations. Moreover, co-expression networks and promoter analyses of HMR genes in O. sativa and A. thaliana resulted in the identification of a cis-regulatory motif and zinc finger transcription factors. The identified transcription factors were highly expressed similar to HMR genes in response to xenobiotics whereas the identified motif is known to play a vital role in coping with environmental stresses and maintaining genome stability. Overall, our findings provide an important step forward toward a better understanding of metabolism-based herbicide resistance that can be utilized to devise novel strategies of weed management. PMID:27547209

  18. Retinoic acid response element in the human alcohol dehydrogenase gene ADH3: implications for regulation of retinoic acid synthesis.

    PubMed Central

    Duester, G; Shean, M L; McBride, M S; Stewart, M J

    1991-01-01

    Retinoic acid regulation of one member of the human class I alcohol dehydrogenase (ADH) gene family was demonstrated, suggesting that the retinol dehydrogenase function of ADH may play a regulatory role in the biosynthetic pathway for retinoic acid. Promoter activity of human ADH3, but not ADH1 or ADH2, was shown to be activated by retinoic acid in transient transfection assays of Hep3B human hepatoma cells. Deletion mapping experiments identified a region in the ADH3 promoter located between -328 and -272 bp which confers retinoic acid activation. This region was also demonstrated to confer retinoic acid responsiveness on the ADH1 and ADH2 genes in heterologous promoter fusions. Within a 34-bp stretch, the ADH3 retinoic acid response element (RARE) contains two TGACC motifs and one TGAAC motif, both of which exist in RAREs controlling other genes. A block mutation of the TGACC sequence located at -289 to -285 bp eliminated the retinoic acid response. As assayed by gel shift DNA binding studies, the RARE region (-328 to -272 bp) of ADH3 bound the human retinoic acid receptor beta (RAR beta) and was competed for by DNA containing a RARE present in the gene encoding RAR beta. Since ADH catalyzes the conversion of retinol to retinal, which can be further converted to retinoic acid by aldehyde dehydrogenase, these results suggest that retinoic acid activation of ADH3 constitutes a positive feedback loop regulating retinoic acid synthesis. Images PMID:1996113

  19. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

    PubMed

    Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm

    2015-05-01

    Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle. PMID:25973601

  20. Induction of electrophile-responsive element (EpRE)-mediated gene expression by tomato extracts in vitro.

    PubMed

    Gijsbers, Linda; van Eekelen, Henriëtte D L M; Nguyen, Thuy H; de Haan, Laura H J; van der Burg, Bart; Aarts, Jac M M J G; Rietjens, Ivonne M C M; Bovy, Arnaud G

    2012-12-01

    The market for food products with additional health benefits is increasing rapidly and tools for identification of bio-functional characteristics of food items are essential. To facilitate the detection of beneficial effects of tomato on gene expression, methods to prepare tomato extracts suitable to test in the EpRE LUX assay and other cell-based reporter gene assays for health-related bioactivity mechanisms, were developed. An isoprenoid-containing chloroform extract of tomato fruit and most individual isoprenoids did not induce electrophile-responsive element (EpRE)-mediated gene expression. A semi-polar extract of tomato fruits, enzymatically hydrolysed to remove the glycosyl residues from the phenolic ingredients was able to induce EpRE-mediated luciferase expression at both mRNA and protein level, which might be partly due to the presence of quercetin, kaempferol, naringenin and naringenin chalcone. It was concluded that induction of EpRE-regulated genes, such as detoxifying phase II and antioxidant enzymes, may contribute to the beneficial health effects of tomato.

  1. Increasing prevalence of ciprofloxacin-resistant food-borne Salmonella strains harboring multiple PMQR elements but not target gene mutations

    PubMed Central

    Lin, Dachuan; Chen, Kaichao; Wai-Chi Chan, Edward; Chen, Sheng

    2015-01-01

    Fluoroquinolone resistance in Salmonella has become increasingly prevalent in recent years. To probe the molecular basis of this phenomenon, the genetic and phenotypic features of fluoroquinolone resistant Salmonella strains isolated from food samples were characterized. Among the 82 Salmonella strains tested, resistance rate of the three front line antibiotics of ceftriaxone, ciprofloxacin and azithromycin was 10%, 39% and 25% respectively, which is significantly higher than that reported in other countries. Ciprofloxacin resistant strains typically exhibited cross-resistance to multiple antibiotics including ceftriaxone, primarily due to the presence of multiple PMQR genes and the blaCTX-M-65, blaCTX-M-55 blaCMY-2 and blaCMY-72 elements. The prevalence rate of the oqxAB and aac(6’)-Ib-cr genes were 91% and 75% respectively, followed by qnrS (66%), qnrB (16%) and qnrD (3%). The most common PMQR combination observable was aac(6’)-Ib-cr-oqxAB-qnrS2, which accounted for 50% of the ciprofloxacin resistant strains. Interestingly, such isolates contained either no target mutations or only a single gyrA mutation. Conjugation and hybridization experiments suggested that most PMQR genes were located either in the chromosome or a non-transferrable plasmid. To summarize, findings in this work suggested that PMQRs greatly facilitate development of fluoroquinolone resistance in Salmonella by abolishing the requirement of target gene mutations. PMID:26435519

  2. Identification of a novel cyclosporin-sensitive element in the human tumor necrosis factor alpha gene promoter

    PubMed Central

    1993-01-01

    Tumor necrosis factor alpha (TNF-alpha), a cytokine with pleiotropic biological effects, is produced by a variety of cell types in response to induction by diverse stimuli. In this paper, TNF-alpha mRNA is shown to be highly induced in a murine T cell clone by stimulation with T cell receptor (TCR) ligands or by calcium ionophores alone. Induction is rapid, does not require de novo protein synthesis, and is completely blocked by the immunosuppressant cyclosporin A (CsA). We have identified a human TNF-alpha promoter element, kappa 3, which plays a key role in the calcium-mediated inducibility and CsA sensitivity of the gene. In electrophoretic mobility shift assays, an oligonucleotide containing kappa 3 forms two DNA protein complexes with proteins that are present in extracts from unstimulated T cells. These complexes appear in nuclear extracts only after T cell stimulation. Induction of the inducible nuclear complexes is rapid, independent of protein synthesis, and blocked by CsA, and thus, exactly parallels the induction of TNF-alpha mRNA by TCR ligands or by calcium ionophore. Our studies indicate that the kappa 3 binding factor resembles the preexisting component of nuclear factor of activated T cells. Thus, the TNF-alpha gene is an immediate early gene in activated T cells and provides a new model system in which to study CsA-sensitive gene induction in activated T cells. PMID:8376940

  3. Creation of cis-regulatory elements during sea urchin evolution by co-option and optimization of a repetitive sequence adjacent to the spec2a gene.

    PubMed

    Dayal, Sandeep; Kiyama, Takae; Villinski, Jeffrey T; Zhang, Ning; Liang, Shuguang; Klein, William H

    2004-09-15

    The creation, preservation, and degeneration of cis-regulatory elements controlling developmental gene expression are fundamental genome-level evolutionary processes about which little is known. Here, we identify critical differences in cis-regulatory elements controlling the expression of the sea urchin aboral ectoderm-specific spec genes. We found multiple copies of a repetitive sequence element termed RSR in genomes of species within the Strongylocentrotidae family, but RSRs were not detected in genomes of species outside Strongylocentrotidae. spec genes in Strongylocentrotus purpuratus are invariably associated with RSRs, and the spec2a RSR functioned as a transcriptional enhancer and displayed greater activity than did spec1 or spec2c RSRs. Single-base pair differences at two cis-regulatory elements within the spec2a RSR increased the binding affinities of four transcription factors, SpCCAAT-binding factor at one element and SpOtx, SpGoosecoid, and SpGATA-E at another. The cis-regulatory elements to which these four factors bound were recent evolutionary acquisitions that acted to either activate or repress transcription, depending on the cell type. These elements were found in the spec2a RSR ortholog in Strongylocentrotus pallidus but not in RSR orthologs of Strongylocentrotus droebachiensis or Hemicentrotus pulcherrimus. Our results indicated that a dynamic pattern of cis-regulatory element evolution exists for spec genes despite their conserved aboral ectoderm expression.

  4. An AP-2 element acts synergistically with the cyclic AMP- and Phorbol ester-inducible enhancer of the human proenkephalin gene

    SciTech Connect

    Hyman, S.E.; Comb, M.; Pearlberg, J.; Goodman, H.M.

    1989-01-01

    An enhancer with two DNA elements, one containing the sequence CGTCA, is required for cyclic AMP-and phorbol ester-inducible transcription of the human proenkephalin gene. The authors report that an AP-2 element located adjacent to the enhancer acts synergistically with it to confer maximal response to cyclic AMP and phorbol esters.

  5. A recent evolutionary change affects a regulatory element in the human FOXP2 gene.

    PubMed

    Maricic, Tomislav; Günther, Viola; Georgiev, Oleg; Gehre, Sabine; Curlin, Marija; Schreiweis, Christiane; Naumann, Ronald; Burbano, Hernán A; Meyer, Matthias; Lalueza-Fox, Carles; de la Rasilla, Marco; Rosas, Antonio; Gajovic, Srecko; Kelso, Janet; Enard, Wolfgang; Schaffner, Walter; Pääbo, Svante

    2013-04-01

    The FOXP2 gene is required for normal development of speech and language. By isolating and sequencing FOXP2 genomic DNA fragments from a 49,000-year-old Iberian Neandertal and 50 present-day humans, we have identified substitutions in the gene shared by all or nearly all present-day humans but absent or polymorphic in Neandertals. One such substitution is localized in intron 8 and affects a binding site for the transcription factor POU3F2, which is highly conserved among vertebrates. We find that the derived allele of this site is less efficient than the ancestral allele in activating transcription from a reporter construct. The derived allele also binds less POU3F2 dimers than POU3F2 monomers compared with the ancestral allele. Because the substitution in the POU3F2 binding site is likely to alter the regulation of FOXP2 expression, and because it is localized in a region of the gene associated with a previously described signal of positive selection, it is a plausible candidate for having caused a recent selective sweep in the FOXP2 gene.

  6. Statins Increase Plasminogen Activator Inhibitor Type 1 Gene Transcription through a Pregnane X Receptor Regulated Element

    PubMed Central

    Stanley, Frederick M.; Linder, Kathryn M.; Cardozo, Timothy J.

    2015-01-01

    Plasminogen activator inhibitor type 1 (PAI-1) is a multifunctional protein that has important roles in inflammation and wound healing. Its aberrant regulation may contribute to many disease processes such as heart disease. The PAI-1 promoter is responsive to multiple inputs including cytokines, growth factors, steroids and oxidative stress. The statin drugs, atorvastatin, mevastatin and rosuvastatin, increased basal and stimulated expression of the PAI-1 promoter 3-fold. A statin-responsive, nuclear hormone response element was previously identified in the PAI-1 promoter, but it was incompletely characterized. We characterized this direct repeat (DR) of AGGTCA with a 3-nucleotide spacer at -269/-255 using deletion and directed mutagenesis. Deletion or mutation of this element increased basal transcription from the promoter suggesting that it repressed PAI-1 transcription in the unliganded state. The half-site spacing and the ligand specificity suggested that this might be a pregnane X receptor (PXR) responsive element. Computational molecular docking showed that atorvastatin, mevastatin and rosuvastatin were structurally compatible with the PXR ligand-binding pocket in its agonist conformation. Experiments with Gal4 DNA binding domain fusion proteins showed that Gal4-PXR was activated by statins while other DR + 3 binding nuclear receptor fusions were not. Overexpression of PXR further enhanced PAI-1 transcription in response to statins. Finally, ChIP experiments using Halo-tagged PXR and RXR demonstrated that both components of the PXR-RXR heterodimer bound to this region of the PAI-1 promoter. PMID:26379245

  7. Characterization of the antioxidant responsive element (ARE): A xenobiotic responsive element controlling expression of the rat glutathione S-transferase Ya subunit gene by phenolic antioxidants

    SciTech Connect

    Rushmore, T.H.; Pickett, C.B. )

    1991-03-11

    The antioxidant responsive element (ARE) is responsible for part of the basal level expression of the Ya subunit gene and for the induction by phenolic antioxidants and metabolites of planar aromatic hydrocarbons (PAH), such as {beta}-naphthoflavone ({beta}-NF). As an initial step in the characterization of the mechanism(s) by which phenolic antioxidants and metabolites of PAH activate transcription via the ARE, the authors prepared 5{prime} and 3{prime}-deletions and point mutants of the 41 bp ARE, transfected them into HepG2 cells and monitored the basal and {beta}-NF inducible activities. Deletion analysis permitted separation of the basal and {beta}-NF inducible components of the ARE. The minimum sequence required for {beta}-NF inducible expression was PuGTGACAAAGCAPu, nucleotides {minus}697 to {minus}687. Point mutations at nucleotides {minus}696, {minus}695, {minus}694, {minus}693, {minus}689 or {minus}688 abolished the {beta}-NF inducible expression. Mutations at the other positions had little or no effect on {beta}-NF inducible expression. Gel shift assays suggest that at least 2 proteins bind to regions within the ARE shown to be important for basal and {beta}-NF inducible expression.

  8. Characterization of the cheetah serum amyloid A1 gene: critical role and functional polymorphism of a cis-acting element.

    PubMed

    Zhang, Beiru; Une, Yumi; Ge, Fengxia; Fu, Xiaoying; Qian, Jinze; Zhang, Pengyao; Sawashita, Jinko; Higuchi, Keiichi; Mori, Masayuki

    2008-01-01

    Amyloid A (AA) amyloidosis is one of the principal causes of morbidity and mortality in captive cheetahs (Acinonyx jubatus), which are in danger of extinction. For practical conservation of this species, therefore, it is critical to elucidate the etiology of AA amyloidosis, especially to understand the mechanisms of transcriptional regulation of serum amyloid A (SAA), a precursor protein of the AA protein. In this study, the structure and nucleotide sequence of the cheetah SAA1 gene including the 5'-flanking promoter/enhancer region was determined. Putative nuclear factor kappa-B (NF-kappaB) and CCAAT/enhancer binding protein beta (C/EBPbeta) cis-acting elements, which play key roles in SAA1 transcriptional induction in response to inflammation, were identified in the 5'-flanking region of the cheetah SAA1 gene. Fortuitously, a single nucleotide polymorphism was identified in the captive cheetah cohort in the putative NF-kappaB cis-acting element and had a remarkable effect on SAA1 transcriptional induction. These results provide a foundation not only for clarifying the etiology of AA amyloidosis in the cheetah but also for contriving a strategy for conservation of this species.

  9. Double hairpin elements and tandem repeats in the non-coding region of Adenoides eludens chloroplast gene minicircles.

    PubMed

    Nelson, Martha J; Green, Beverley R

    2005-09-26

    Dinoflagellate plastid genomes are unique in having a reduced number of genes, most of which are found on unigenic minicircles of 2-3 kb. Although the dinoflagellate Adenoides eludens has larger minicircles of about 5 kb, they still carry only one gene. In addition, digenic circles of about 10 kb were detected and mapped by PCR. The non-coding regions of both unigenic and digenic circles share a number of common features including a pair of conserved cores in opposite orientation, four large families of tandem repeats and a number of double hairpin elements (DHEs). They most closely resemble the non-coding regions of the Symbiodinium psbA minicircles, but are much longer, less conserved and have an even greater variety of DHEs and tandem repeats. The presence of so many recombinogenic elements suggests models for the origin of minicircles from a multigenic ancestral chloroplast genome, and raises the possibility of recombination-directed replication rather than defined replication origins in the minicircles.

  10. Light regulation of plant gene expression by an upstream enhancer-like element.

    PubMed

    Timko, M P; Kausch, A P; Castresana, C; Fassler, J; Herrera-Estrella, L; Van den Broeck, G; Van Montagu, M; Schell, J; Cashmore, A R

    Light regulates many varied physiological and developmental phenomena during plant growth and differentiation, including the formation of a photosynthetically competent chloroplast from a proplastid. The expression of ribulose 1,5-bisphosphate carboxylase small subunit (rbcS) genes is regulated by light in a development- and tissue-specific manner2,3. In some plant species, phytochrome has been demonstrated to mediate this response, and photoregulation of rbcS expression occurs at least in part at the level of transcription. We have shown previously that a 5'-noncoding fragment (4-973 base pairs (bp) upstream of the messenger RNA cap site) of the pea rbcS ss3.6 gene contains all of the nucleotide sequence information necessary to direct the photoregulated expression of a bacterial chloramphenicol acetyltransferase (cat) gene in tobacco. Consistent with these findings, Morelli et al.11 have shown by deletion analysis of a second rbcS gene promoter, that the sequences required for photoregulated expression of rbcS E9 reside within the 5'-noncoding region. They identified an upstream region of approximately 700 bp needed for maximum transcription but not light-dark regulation, and a region from -35 to -2 bp which included the TATA box and contained the necessary information for light responsiveness. We now demonstrate that regulatory sequences 5' distal to the rbcS ss3.6 TATA box and transcriptional start site not only contain the information necessary for maximum expression, but also confer photoregulation. These upstream regulatory sequences function independently of orientation when fused to their homologous promoter or a heterologous promoter.

  11. [Analysis of conserved flanking elements associated with antibiotic resistance genes dissemination].

    PubMed

    Liu, Jian; Mao, Da-Qing; Ren, Jun; Luo, Yi; Cao, Wen-Qing

    2012-01-01

    The overuse of antibiotics in medicine, animal husbandry, and aquiculture industry increases the emergence of antibiotic resistant bacteria and antibiotic resistance genes (ARGs), and also, accelerates the dissemination of ARGs within environmental bacteria. In this study, the total DNA was directly extracted from environmental samples, and the upstream and downstream of antibiotic resistance genes were directly amplified by thermal asymmetric interlaced PCR (Tail-PCR) technique. By optimizing the Tail-PCR program, the multiple flanking sequences of tetW, including 6 upstream sequences and 9 downstream sequences, were simultaneously acquired. Through the bioinformatics analysis, the upstream of tetW presented a perfect inverted repeat (IR), a known tetW regulator peptide, and an insertional sequence (IS), whereas the downstream of tetW presented a most conservative fragment and a common open reading frame (ORF) coding methyltransferase. This study not only revealed several conserved flanking tetW gene modules, but also supplied a highly-efficient and convenient methodology for the research of tetW's dissemination within bacteria, i. e., several flanking sequences could be concisely obtained from one sample by using Tail-PCR program.

  12. Engineering ligand-responsive gene-control elements: lessons learned from natural riboswitches.

    PubMed

    Link, K H; Breaker, R R

    2009-10-01

    In the last two decades, remarkable advances have been made in the development of technologies used to engineer new aptamers and ribozymes. This has encouraged interest among researchers who seek to create new types of gene-control systems that can be made to respond specifically to small-molecule signals. Validation of the fact that RNA molecules can exhibit the characteristics needed to serve as precision genetic switches has come from the discovery of numerous classes of natural ligand-sensing RNAs called riboswitches. Although a great deal of progress has been made toward engineering useful designer riboswitches, considerable advances are needed before the performance characteristics of these RNAs match those of protein systems that have been co-opted to regulate gene expression. In this review, we will evaluate the potential for engineered RNAs to regulate gene expression and lay out possible paths to designer riboswitches based on currently available technologies. Furthermore, we will discuss some technical advances that would empower RNA engineers who seek to make routine the production of designer riboswitches that can function in eukaryotes. PMID:19587710

  13. Pilot sequencing of onion genomic DNA reveals fragments of transposable elements, low gene densities, and significant gene enrichment after methyl filtration.

    PubMed

    Jakse, Jernej; Meyer, Jenelle D F; Suzuki, Go; McCallum, John; Cheung, Foo; Town, Christopher D; Havey, Michael J

    2008-10-01

    Sequencing of the onion (Allium cepa) genome is challenging because it has one of the largest nuclear genomes among cultivated plants. We undertook pilot sequencing of onion genomic DNA to estimate gene densities and investigate the nature and distribution of repetitive DNAs. Complete sequences from two onion BACs were AT rich (64.8%) and revealed long tracts of degenerated retroviral elements and transposons, similar to other larger plant genomes. Random BACs were end sequenced and only 3 of 460 ends showed significant (e < -25) non-organellar hits to the protein databases. The BAC-end sequences were AT rich (63.4%), similar to the completely sequenced BACs. A total of 499,997 bp of onion genomic DNA yielded an estimated mean density of one gene per 168 kb, among the lowest reported to date. Methyl filtration was highly effective relative to random shotgun reads in reducing frequencies of anonymous sequences from 82 to 55% and increasing non-organellar protein hits from 4 to 42%. Our results revealed no evidence for gene-dense regions and indicated that sequencing of methyl-filtered genomic fragments should be an efficient approach to reveal genic sequences in the onion genome.

  14. Characterization of a gene encoding a DNA binding protein with specificity for a light-responsive element.

    PubMed Central

    Gilmartin, P M; Memelink, J; Hiratsuka, K; Kay, S A; Chua, N H

    1992-01-01

    The sequence element of box II (GTGTGGTTAATATG) is a regulatory component of a light-responsive element present within the upstream region of pea rbcS-3A. The nuclear protein GT-1 was defined previously as a DNA binding activity that interacts with box II. Here, we describe the isolation and characterization of cDNA sequences that encode a DNA binding protein with specificity for this element. The recombinant protein, tobacco GT-1a, shows similar sequence requirements for DNA binding to nuclear GT-1, as assayed by its ability to interact with previously defined 2-bp scanning mutations of box II, and is shown to be immunologically related to nuclear GT-1. The predicted structure of the 43-kD protein derived from the cDNA sequence suggests the presence of a novel helix-helix-turn-helix (HHTH) motif. Comparison between the predicted protein sequence encoded by the tobacco GT-1a cDNA and that of another GT binding protein, rice GT-2, reveals strong amino acid conservation over the HHTH region; this motif appears to be involved in the interaction between the recombinant protein and box II. Genomic DNA gel blot analysis indicated the presence of a small gene family of related sequences within the tobacco nuclear genome. RNA gel blot analysis of tobacco mRNA using the isolated cDNA as a probe showed that transcripts are present in several tissues, including both light-grown and dark-adapted leaves. PMID:1392598

  15. Identification of positive and negative regulatory elements governing cell-type-specific expression of the neural cell adhesion molecule gene.

    PubMed Central

    Hirsch, M R; Gaugler, L; Deagostini-Bazin, H; Bally-Cuif, L; Goridis, C

    1990-01-01

    The neural cell adhesion molecule (NCAM) is one of the most prevalent cell adhesion molecules in vertebrates. Its expression is subject to complex cell-type- and developmental-stage-dependent regulation. To study this regulation at the level of transcription, we analyzed the promoter region of the mouse NCAM gene. The NCAM promoter did not contain a typical TATA box. Transcription started at several sites that were used indiscriminately by different cell types, implying that the different NCAM isoforms are expressed from a single promoter. Sequences responsible for both promotion and inhibition of transcription resided within 840 base pairs upstream of the main transcriptional start site. The sequence from positions -645 to -37 relative to the translation initiation site directed high levels of expression in NCAM-expressing N2A cells. The same fragment was six times less active but still significantly active in L cells, but this activity was repressed by inclusion of an additional upstream segment. We mapped eight domains of interactions with nuclear proteins within the 840-base-pair region. The segment with maximum promoter activity contained two adjacent footprints, the occupation of which appeared to be mutually exclusive. One of them corresponded to an Sp1-factor-binding consensus site, the other one bound a factor with nuclear factor I activity. The single protected domain in the fragment harboring a repressor activity consisted of a GGA repeat resembling negative regulatory elements in other promoters. Three adjacent binding sites occupied an A + T-rich segment and contained ATTA motifs also found in the recognition elements of homeodomain proteins. These results show that negative and positive elements interact to regulate the tissue-specific patterns of expression of the NCAM gene and indicate that a factor related to nuclear factor I is involved in its transcriptional control. Images PMID:2325642

  16. Highly variable individual donor cell fates characterize robust horizontal gene transfer of an integrative and conjugative element

    PubMed Central

    Delavat, François; Mitri, Sara; Pelet, Serge; van der Meer, Jan Roelof

    2016-01-01

    Horizontal gene transfer is an important evolutionary mechanism for bacterial adaptation. However, given the typical low transfer frequencies in a bacterial population, little is known about the fate and interplay of donor cells and the mobilized DNA during transfer. Here we study transfer of an integrative and conjugative element (ICE) among individual live bacterial cells. ICEs are widely distributed mobile DNA elements that are different than plasmids because they reside silent in the host chromosome and are maintained through vertical descent. Occasionally, ICEs become active, excise, and transmit their DNA to a new recipient, where it is reintegrated. We develop a fluorescent tool to differentiate excision, transfer, and reintegration of a model ICE named ICEclc (for carrying the clc genes for chlorocatechol metabolism) among single Pseudomonas cells by using time-lapse microscopy. We find that ICEclc activation is initiated in stationary phase cells, but excision and transfer predominantly occur only when such cells have been presented with new nutrients. Donors with activated ICE develop a number of different states, characterized by reduced cell division rates or growth arrest, persistence, or lysis, concomitant with ICE excision, and likely, ICE loss or replication. The donor cell state transitions can be described by using a stochastic model, which predicts that ICE fitness is optimal at low initiation rates in stationary phase. Despite highly variable donor cell fates, ICE transfer is remarkably robust overall, with 75% success after excision. Our results help to better understand ICE behavior and shed a new light on bacterial cellular differentiation during horizontal gene transfer. PMID:27247406

  17. Highly variable individual donor cell fates characterize robust horizontal gene transfer of an integrative and conjugative element.

    PubMed

    Delavat, François; Mitri, Sara; Pelet, Serge; van der Meer, Jan Roelof

    2016-06-14

    Horizontal gene transfer is an important evolutionary mechanism for bacterial adaptation. However, given the typical low transfer frequencies in a bacterial population, little is known about the fate and interplay of donor cells and the mobilized DNA during transfer. Here we study transfer of an integrative and conjugative element (ICE) among individual live bacterial cells. ICEs are widely distributed mobile DNA elements that are different than plasmids because they reside silent in the host chromosome and are maintained through vertical descent. Occasionally, ICEs become active, excise, and transmit their DNA to a new recipient, where it is reintegrated. We develop a fluorescent tool to differentiate excision, transfer, and reintegration of a model ICE named ICEclc (for carrying the clc genes for chlorocatechol metabolism) among single Pseudomonas cells by using time-lapse microscopy. We find that ICEclc activation is initiated in stationary phase cells, but excision and transfer predominantly occur only when such cells have been presented with new nutrients. Donors with activated ICE develop a number of different states, characterized by reduced cell division rates or growth arrest, persistence, or lysis, concomitant with ICE excision, and likely, ICE loss or replication. The donor cell state transitions can be described by using a stochastic model, which predicts that ICE fitness is optimal at low initiation rates in stationary phase. Despite highly variable donor cell fates, ICE transfer is remarkably robust overall, with 75% success after excision. Our results help to better understand ICE behavior and shed a new light on bacterial cellular differentiation during horizontal gene transfer. PMID:27247406

  18. Analysis of the role of 5' and 3' flanking sequence elements upon in vivo expression of the plant tRNATrp genes.

    PubMed Central

    Ulmasov, B; Folk, W

    1995-01-01

    We have isolated the majority (seven) of the tRNA(Trp) genes of Arabidopsis and have studied the 5' and 3' flanking sequence requirements for their efficient expression in vivo by using an assay requiring translational suppression of the luciferase reporter gene. The expressed tRNA(Trp) genes contain no highly conserved 5' flanking sequences; however, these sequences are distinctly AT rich, contain several possible TATA elements, and are bound in vitro by recombinant plant TATA binding protein. Replacement of the natural 5' flanking sequences with three different sequences lacking TATA elements reduced expression in vivo up to 10-fold; the same effect was observed when the TATA elements of the natural 5' sequences were inactivated by point mutations. Introduction of a single TATA element from the adenovirus major late promoter into an artificial 5' flanking region of the tRNA(Trp) gene enhanced expression in vivo when the TATA element was placed at position -32 relative to the first nucleotide of the mature tRNA sequence, but not when it was placed at position -24. Primer extension analyses of in vitro transcripts revealed that the position of the TATA element helps dictate the start site of transcription. Efficient expression of the tRNA genes in vivo also required 3' flanking sequences capable of terminating transcription. PMID:7580260

  19. Validation of an interferon stimulatory response element reporter gene assay for quantifying type I interferons.

    PubMed

    McCoski, S R; Xie, M; Hall, E B; Mercadante, P M; Spencer, T E; Lonergan, P; Ealy, A D

    2014-04-01

    The goal of this work was to develop a virus-free, cell-based interferon (IFN) bioassay and determine the utility of this assay on biological samples that contained IFN-τ, the trophoblast-secreted maternal recognition of pregnancy factor in ruminants. Madin-Darby bovine kidney cells were transduced with lentiviral particles that contained a firefly luciferase reporter construct driven by an IFN stimulatory response element (ISRE). Stably transduced cells were selected with the use of puromycin resistance. A linear, dose-responsive response was detected with human IFN-α and ovine IFN-τ. Interferon activity was detected in conditioned media from bovine trophoblast cells and uterine flushes collected from sheep and cattle. Activity also was detected in media collected after individual or small group culture of in vitro-produced bovine blastocysts at day 8 to 10 after fertilization. In summary, this IFN stimulatory response element-reporter assay may be used as an alternative to virus-dependent, cytopathic assays. It contains a similar sensitivity to IFNs and can be completed in a shorter time than cytopathic assays and does not require heightened biosafety conditions after cell transduction.

  20. Eukaryotic gene invasion by a bacterial mobile insertion sequence element IS2 during cloning into a plasmid vector.

    PubMed

    Senejani, Alireza G; Sweasy, Joann B

    2010-01-01

    Escherichia coli (E. coli) are commonly used as hosts for DNA cloning and sequencing. Upon transformation of E. coli with recombined vector carrying a gene of interest, the bacteria multiply the gene of interest while maintaining the integrity of its content. During the subcloning of a mouse genomic fragment into a plasmid vector, we noticed that the size of the insert increased significantly upon replication in E. coli. The sequence of the insert was determined and found to contain a novel DNA sequence within the mouse genomic insert. A BLAST search of GenBank revealed the novel sequence to be that of the Insertion Sequence 2 (IS2) element from E. coli that was likely inserted during replication in that organism. Importantly, a detailed search of GenBank shows that the IS2 is present within many eukaryotic nucleotide sequences, and in many cases, has been annotated as being part of the protein. The results of this study suggest that one must perform additional careful analysis of the sequence results using BLAST comparisons, and further verification of gene annotation before submission into the GenBank. PMID:20678256

  1. Lactogenic hormonal induction of long distance interactions between beta-casein gene regulatory elements.

    PubMed

    Kabotyanski, Elena B; Rijnkels, Monique; Freeman-Zadrowski, Courtneay; Buser, Adam C; Edwards, Dean P; Rosen, Jeffrey M

    2009-08-21

    Lactogenic hormone regulation of beta-casein gene expression in mammary epithelial cells provides an excellent model in which to study the mechanisms by which steroid and peptide hormone signaling control gene expression. Prolactin- and glucocorticoid-mediated induction of beta-casein gene expression involves two principal regulatory regions, a proximal promoter and a distal enhancer located in the mouse approximately -6 kb upstream of the transcription start site. Using a chromosome conformation capture assay and quantitative real time PCR, we demonstrate that a chromatin loop is created in conjunction with the recruitment of specific transcription factors and p300 in HC11 mammary epithelial cells. Stimulation with both prolactin and hydrocortisone is required for the induction of these long range interactions between the promoter and enhancer, and no DNA looping was observed in nontreated cells or cells treated with each of the hormones separately. The lactogenic hormone-induced interaction between the proximal promoter and distal enhancer was confirmed in hormone-treated primary three-dimensional mammary acini cultures. In addition, the developmental regulation of DNA looping between the beta-casein regulatory regions was observed in lactating but not in virgin mouse mammary glands. Furthermore, beta-casein mRNA induction and long range interactions between these regulatory regions were inhibited in a progestin-dependent manner following stimulation with prolactin and hydrocortisone in HC11 cells expressing human PR-B. Collectively, these data suggest that the communication between these regulatory regions with intervening DNA looping is a crucial step required to both create and maintain active chromatin domains and regulate transcription.

  2. Targeted Deletion of the Antisilencer/Enhancer (ASE) Element from Intron 1 of the Myelin Proteolipid Protein Gene (Plp1) in Mouse Reveals that the Element Is Dispensable for Plp1 Expression in Brain during Development and Remyelination

    PubMed Central

    Pereira, Glauber B.; Meng, Fanxue; Kockara, Neriman T.; Yang, Baoli; Wight, Patricia A.

    2012-01-01

    Myelin proteolipid protein gene (Plp1) expression is temporally regulated in brain, which peaks during the active myelination period of CNS development. Previous studies with Plp1-lacZ transgenic mice demonstrated that (mouse) Plp1 intron 1 DNA is required for high levels of expression in oligodendrocytes. Deletion-transfection analysis revealed the intron contains a single positive regulatory element operative in the N20.1 oligodendroglial cell line, which was named ASE (antisilencer/enhancer) based on its functional properties in these cells. To investigate the role of the ASE in vivo, the element was deleted from the native gene in mouse using a Cre/lox strategy. While removal of the ASE from Plp1-lacZ constructs profoundly decreased expression in transfected oligodendroglial cell lines (N20.1 and Oli-neu), the element was dispensable to achieve normal levels of Plp1 gene expression in mouse during development (except perhaps at postnatal day 15) and throughout the remyelination period following cuprizone-induced (acute) demyelination. Thus, it is possible that the ASE is nonfunctional in vivo, or that loss of the ASE from the native gene in mouse can be compensated for by the presence of other regulatory elements within the Plp1 gene. PMID:23157328

  3. A gene-type-specific enhancer regulates the carbamyl phosphate synthetase I promoter by cooperating with the proximal GAG activating element.

    PubMed Central

    Goping, I S; Lamontagne, S; Shore, G C; Nguyen, M

    1995-01-01

    The rat carbamyl phosphate synthetase I gene is expressed in two cell types: hepatocytes and epithelial cells of the intestinal mucosa. The proximal promoter contains a single activating element, GAG, two repressor elements (sites I and III) and an anti-repressor element (site II). Although these elements together exhibit the potential for complex regulation, they are unable to confer tissue-specific promoter activity. Here we have identified a cell-type-specific enhancer that lies 10 kilobases upstream of the promoter. Unexpectedly, the enhancer also functioned in a gene-type-specific manner. The enhancer stimulated promoter activity exclusively through the proximal GAG element. Abrogation of GAG, either directly by mutation of GAG or indirectly by sites I and III repressors, abolished enhancer activation. Conversely, activation of the heterologous thymidine kinase promoter by the enhancer required the introduction of GAG. The requirement for GAG, therefore, functions to constrain the enhancer to a specific target promoter. PMID:7784176

  4. Genome-wide identification of regulatory elements and reconstruction of gene regulatory networks of the green alga Chlamydomonas reinhardtii under carbon deprivation.

    PubMed

    Winck, Flavia Vischi; Vischi Winck, Flavia; Arvidsson, Samuel; Riaño-Pachón, Diego Mauricio; Hempel, Sabrina; Koseska, Aneta; Nikoloski, Zoran; Urbina Gomez, David Alejandro; Rupprecht, Jens; Mueller-Roeber, Bernd

    2013-01-01

    The unicellular green alga Chlamydomonas reinhardtii is a long-established model organism for studies on photosynthesis and carbon metabolism-related physiology. Under conditions of air-level carbon dioxide concentration [CO2], a carbon concentrating mechanism (CCM) is induced to facilitate cellular carbon uptake. CCM increases the availability of carbon dioxide at the site of cellular carbon fixation. To improve our understanding of the transcriptional control of the CCM, we employed FAIRE-seq (formaldehyde-assisted Isolation of Regulatory Elements, followed by deep sequencing) to determine nucleosome-depleted chromatin regions of algal cells subjected to carbon deprivation. Our FAIRE data recapitulated the positions of known regulatory elements in the promoter of the periplasmic carbonic anhydrase (Cah1) gene, which is upregulated during CCM induction, and revealed new candidate regulatory elements at a genome-wide scale. In addition, time series expression patterns of 130 transcription factor (TF) and transcription regulator (TR) genes were obtained for cells cultured under photoautotrophic condition and subjected to a shift from high to low [CO2]. Groups of co-expressed genes were identified and a putative directed gene-regulatory network underlying the CCM was reconstructed from the gene expression data using the recently developed IOTA (inner composition alignment) method. Among the candidate regulatory genes, two members of the MYB-related TF family, Lcr1 (Low-CO 2 response regulator 1) and Lcr2 (Low-CO2 response regulator 2), may play an important role in down-regulating the expression of a particular set of TF and TR genes in response to low [CO2]. The results obtained provide new insights into the transcriptional control of the CCM and revealed more than 60 new candidate regulatory genes. Deep sequencing of nucleosome-depleted genomic regions indicated the presence of new, previously unknown regulatory elements in the C. reinhardtii genome. Our work can

  5. Corepressor for element-1-silencing transcription factor preferentially mediates gene networks underlying neural stem cell fate decisions.

    PubMed

    Abrajano, Joseph J; Qureshi, Irfan A; Gokhan, Solen; Molero, Aldrin E; Zheng, Deyou; Bergman, Aviv; Mehler, Mark F

    2010-09-21

    The repressor element-1 (RE1) silencing transcription factor/neuron-restrictive silencer factor (REST/NRSF) silences neuronal genes in neural stem cells (NSCs) and nonneuronal cells through its role as a dynamic modular platform for recruitment of transcriptional and epigenetic regulatory cofactors to RE1-containing promoters. In embryonic stem cells, the REST regulatory network is highly integrated with the transcriptional circuitry governing self-renewal and pluripotency, although its exact functional role is unclear. The C-terminal cofactor for REST, CoREST, also acts as a modular scaffold, but its cell type-specific roles have not been elucidated. We used chromatin immunoprecipitation-on-chip to examine CoREST and REST binding sites in NSCs and their proximate progenitor species. In NSCs, we identified a larger number of CoREST (1,820) compared with REST (322) target genes. The majority of these CoREST targets do not contain known RE1 motifs. Notably, these CoREST target genes do play important roles in pluripotency networks, in modulating NSC identity and fate decisions and in epigenetic processes previously associated with both REST and CoREST. Moreover, we found that NSC-mediated developmental transitions were associated primarily with liberation of CoREST from promoters with transcriptional repression favored in less lineage-restricted radial glia and transcriptional activation favored in more lineage-restricted neuronal-oligodendrocyte precursors. Clonal NSC REST and CoREST gene manipulation paradigms further revealed that CoREST has largely independent and previously uncharacterized roles in promoting NSC multilineage potential and modulating early neural fate decisions. PMID:20823235

  6. The Evolutionary Dynamics of Ribosomal Genes, Histone H3, and Transposable Rex Elements in the Genome of Atlantic Snappers.

    PubMed

    Costa, Gideão Wagner Werneck Félix da; Cioffi, Marcelo de Bello; Bertollo, Luiz Antonio Carlos; Molina, Wagner Franco

    2016-03-01

    Lutjanidae is a family of primarily marine and carnivorous fishes distributed in the Atlantic, Indian, and Pacific oceans, with enormous economic and ecological importance. In order to better clarify the conservative chromosomal evolution of Lutjanidae, we analyzed the evolutionary dynamics of 5 repetitive DNA classes in 5 Lutjanus and in 1 Ocyurus species from the Western Atlantic. The ribosomal 18S sites were generally located in a single chromosome pair, except for L. jocu and L. alexandrei where they are found in 2 pairs. In turn, the 5S rDNA sites are unique, terminal and nonsyntenic with the 18S rDNA sites. In 3 species analyzed, H3 hisDNA genes were found in 1 chromosomal pair. However, while L. jocu presented 2 H3 sites, O. chrysurus showed a noteworthy dispersion of this gene in almost all chromosomes of the karyotype. Retrotransposons Rex1 and Rex3 do not exhibit any association with the explosive distribution of H3 sequences in O. chrysurus. The low compartmentalization of Rex elements, in addition to the general nondynamic distribution of ribosomal and H3 genes, corroborate the karyotype conservatism in Lutjanidae species, also at the microstructural level. However, some "disturbing evolutionary waves" can break down this conservative scenario, as evidenced by the massive random dispersion of H3 hisDNA in the genome of O. chrysurus. The implication of the genomic expansion of H3 histone genes and their functionality remain unknown, although suggesting that they have higher evolutionary dynamics than previously thought. PMID:26792596

  7. Conserved promoter elements in the CYP6B gene family suggest common ancestry for cytochrome P450 monooxygenases mediating furanocoumarin detoxification.

    PubMed

    Hung, C F; Holzmacher, R; Connolly, E; Berenbaum, M R; Schuler, M A

    1996-10-29

    Despite the fact that Papilio glaucus and Papilio polyxenes share no single hostplant species, both species feed to varying extents on hostplants that contain furanocoumarins. P. glaucus contains two nearly identical genes, CYP6B4v2 and CYP6B5v1, and P. polyxenes contains two related genes, CYP6B1v3 and CYP6B3v2. Except for CYP6B3v2, the substrate specificity of which has not yet been defined, each of the encoded cytochrome P450 monooxygenases (P450s) metabolizes an array of linear furanocoumarins. All four genes are transcriptionally induced in larvae by exposure to the furanocoumarin xanthotoxin; several are also induced by other furanocoumarins. Comparisons of the organizational structures of these genes indicate that all have the same intron/exon arrangement. Sequences in the promoter regions of the P. glaucus CYP6B4v2/CYP6B5v1 genes and the P. polyxenes CYP6B3v2 gene are similar but not identical to the -146 to -97 region of CYP6B1v3 gene, which contains a xanthotoxin-responsive element (XRE-xan) important for basal and xanthotoxin-inducible transcription of CYP6B1v3. Complements of the xenobiotic-responsive element (XRE-AhR) in the dioxin-inducible human and rat CYP1A1 genes also exist in all four promoters, suggesting that these genes may be regulated by dioxin. Antioxidant-responsive elements (AREs) in mouse and rat glutathione S-transferase genes and the Barbie box element (Bar) in the bacterial CYP102 gene exist in the CYP6B1v3, CYP6B4v2, and CYP6B5v1 promoters. Similarities in the protein sequences, intron positions, and xanthotoxin- and xenobiotic-responsive promoter elements indicate that these insect CYP6B genes are derived from a common ancestral gene. Evolutionary comparisons between these P450 genes are the first available for a group of insect genes transcriptionally regulated by hostplant allelochemicals and provide insights into the process by which insects evolve specialized feeding habits.

  8. The Tc1/mariner transposable element family shapes genetic variation and gene expression in the protist Trichomonas vaginalis

    PubMed Central

    2014-01-01

    Background Trichomonas vaginalis is the most prevalent non-viral sexually transmitted parasite. Although the protist is presumed to reproduce asexually, 60% of its haploid genome contains transposable elements (TEs), known contributors to genome variability. The availability of a draft genome sequence and our collection of >200 global isolates of T. vaginalis facilitate the study and analysis of TE population dynamics and their contribution to genomic variability in this protist. Results We present here a pilot study of a subset of class II Tc1/mariner TEs that belong to the T. vaginalis Tvmar1 family. We report the genetic structure of 19 Tvmar1 loci, their ability to encode a full-length transposase protein, and their insertion frequencies in 94 global isolates from seven regions of the world. While most of the Tvmar1 elements studied exhibited low insertion frequencies, two of the 19 loci (locus 1 and locus 9) show high insertion frequencies of 1.00 and 0.96, respectively. The genetic structuring of the global populations identified by principal component analysis (PCA) of the Tvmar1 loci is in general agreement with published data based on genotyping, showing that Tvmar1 polymorphisms are a robust indicator of T. vaginalis genetic history. Analysis of expression of 22 genes flanking 13 Tvmar1 loci indicated significantly altered expression of six of the genes next to five Tvmar1 insertions, suggesting that the insertions have functional implications for T. vaginalis gene expression. Conclusions Our study is the first in T. vaginalis to describe Tvmar1 population dynamics and its contribution to genetic variability of the parasite. We show that a majority of our studied Tvmar1 insertion loci exist at very low frequencies in the global population, and insertions are variable between geographical isolates. In addition, we observe that low frequency insertion is related to reduced or abolished expression of flanking genes. While low insertion frequencies might be

  9. Evolutionary origin of Rosaceae-specific active non-autonomous hAT elements and their contribution to gene regulation and genomic structural variation.

    PubMed

    Wang, Lu; Peng, Qian; Zhao, Jianbo; Ren, Fei; Zhou, Hui; Wang, Wei; Liao, Liao; Owiti, Albert; Jiang, Quan; Han, Yuepeng

    2016-05-01

    Transposable elements account for approximately 30 % of the Prunus genome; however, their evolutionary origin and functionality remain largely unclear. In this study, we identified a hAT transposon family, termed Moshan, in Prunus. The Moshan elements consist of three types, aMoshan, tMoshan, and mMoshan. The aMoshan and tMoshan types contain intact or truncated transposase genes, respectively, while the mMoshan type is miniature inverted-repeat transposable element (MITE). The Moshan transposons are unique to Rosaceae, and the copy numbers of different Moshan types are significantly correlated. Sequence homology analysis reveals that the mMoshan MITEs are direct deletion derivatives of the tMoshan progenitors, and one kind of mMoshan containing a MuDR-derived fragment were amplified predominately in the peach genome. The mMoshan sequences contain cis-regulatory elements that can enhance gene expression up to 100-fold. The mMoshan MITEs can serve as potential sources of micro and long noncoding RNAs. Whole-genome re-sequencing analysis indicates that mMoshan elements are highly active, and an insertion into S-haplotype-specific F-box gene was reported to cause the breakdown of self-incompatibility in sour cherry. Taken together, all these results suggest that the mMoshan elements play important roles in regulating gene expression and driving genomic structural variation in Prunus.

  10. Dosage Compensation of X-Linked Muller Element F Genes but Not X-Linked Transgenes in the Australian Sheep Blowfly

    PubMed Central

    Linger, Rebecca J.; Belikoff, Esther J.; Scott, Maxwell J.

    2015-01-01

    In most animals that have X and Y sex chromosomes, chromosome-wide mechanisms are used to balance X-linked gene expression in males and females. In the fly Drosophila melanogaster, the dosage compensation mechanism also generally extends to X-linked transgenes. Over 70 transgenic lines of the Australian sheep blowfly Lucilia cuprina have been made as part of an effort to develop male-only strains for a genetic control program of this major pest of sheep. All lines carry a constitutively expressed fluorescent protein marker gene. In all 12 X-linked lines, female larvae show brighter fluorescence than male larvae, suggesting the marker gene is not dosage compensated. This has been confirmed by quantitative RT-PCR for selected lines. To determine if endogenous X-linked genes are dosage compensated, we isolated 8 genes that are orthologs of genes that are on the fourth chromosome in D. melanogaster. Recent evidence suggests that the D. melanogaster fourth chromosome, or Muller element F, is the ancestral X chromosome in Diptera that has reverted to an autosome in Drosophila species. We show by quantitative PCR of male and female DNA that 6 of the 8 linkage group F genes reside on the X chromosome in L. cuprina. The other two Muller element F genes were found to be autosomal in L. cuprina, whereas two Muller element B genes were found on the same region of the X chromosome as the L. cuprina orthologs of the D. melanogaster Ephrin and gawky genes. We find that the L. cuprina X chromosome genes are equally expressed in males and females (i.e., fully dosage compensated). Thus, unlike in Drosophila, it appears that the Lucilia dosage compensation system is specific for genes endogenous to the X chromosome and cannot be co-opted by recently arrived transgenes. PMID:26506426

  11. Dosage Compensation of X-Linked Muller Element F Genes but Not X-Linked Transgenes in the Australian Sheep Blowfly.

    PubMed

    Linger, Rebecca J; Belikoff, Esther J; Scott, Maxwell J

    2015-01-01

    In most animals that have X and Y sex chromosomes, chromosome-wide mechanisms are used to balance X-linked gene expression in males and females. In the fly Drosophila melanogaster, the dosage compensation mechanism also generally extends to X-linked transgenes. Over 70 transgenic lines of the Australian sheep blowfly Lucilia cuprina have been made as part of an effort to develop male-only strains for a genetic control program of this major pest of sheep. All lines carry a constitutively expressed fluorescent protein marker gene. In all 12 X-linked lines, female larvae show brighter fluorescence than male larvae, suggesting the marker gene is not dosage compensated. This has been confirmed by quantitative RT-PCR for selected lines. To determine if endogenous X-linked genes are dosage compensated, we isolated 8 genes that are orthologs of genes that are on the fourth chromosome in D. melanogaster. Recent evidence suggests that the D. melanogaster fourth chromosome, or Muller element F, is the ancestral X chromosome in Diptera that has reverted to an autosome in Drosophila species. We show by quantitative PCR of male and female DNA that 6 of the 8 linkage group F genes reside on the X chromosome in L. cuprina. The other two Muller element F genes were found to be autosomal in L. cuprina, whereas two Muller element B genes were found on the same region of the X chromosome as the L. cuprina orthologs of the D. melanogaster Ephrin and gawky genes. We find that the L. cuprina X chromosome genes are equally expressed in males and females (i.e., fully dosage compensated). Thus, unlike in Drosophila, it appears that the Lucilia dosage compensation system is specific for genes endogenous to the X chromosome and cannot be co-opted by recently arrived transgenes. PMID:26506426

  12. Transposable element insertion location bias and the dynamics of gene drive in mosquito populations.

    PubMed

    Rasgon, J L; Gould, F

    2005-10-01

    Some vector-borne disease control strategies using transgenic mosquitoes require transgene spread to high frequency in populations. Transposable elements (TEs) are DNA sequences that replicate and transpose within the genomes of other organisms and may therefore be represented in the next generation in higher frequencies than predicted by Mendelian segregation. This over-representation has allowed some TEs to spread through natural populations. Transgenes incorporated within a TE sequence are expected to be driven into populations as long as there is a positive balance between fitness costs and over-representation. Models have been used to examine parameters that affect this balance but did not take into account biased insertion of TEs to linked sites in the genome. A simulation model was created to examine the impact of insertion bias on TE spread in mosquito populations. TEs that induce no fitness costs are predicted to increase in frequency over a wide range of parameter values but spread is slower for lower levels of transposition and non-local movement. If TEs are costly, high proportions of local movement can slow or halt spread. To function as a robust transgene drive mechanism a TE should replicate and transpose > 10%/insert/generation, induce < 1% fitness cost/insert, and move preferentially to unlinked sites in the genome.

  13. The aryl hydrocarbon receptor regulates an essential transcriptional element in the immunoglobulin heavy chain gene.

    PubMed

    Wourms, Michael J; Sulentic, Courtney E W

    2015-05-01

    Ig heavy chain (Igh) transcription involves several regulatory elements including the 3'Igh regulatory region (3'IghRR). 3'IghRR activity is modulated by several transcription factors, including NF-κB and AP-1 and potentially the aryl hydrocarbon receptor (AhR). The prototypical AhR ligand 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) inhibits antibody secretion and 3'IghRR activity. However, the exact mechanism is unknown and TCDD can modulate NF-κB and AP-1 in an AhR-independent manner. To determine if the AhR is a significant regulator of the 3'IghRR, we utilized a mouse B-cell line that stably expresses a 3'IghRR-regulated transgene and either an AhR antagonist or shRNA targeting the AhR. Disruption of the AhR pathway reversed TCDD-induced suppression of the 3'IghRR-regulated transgene and of endogenous Ig demonstrating a biologically significant effect of the AhR on 3'IghRR activation. Altered human 3'IGHRR activity by AhR ligands, which include dietary, environmental, and pharmaceutical chemicals, may have significant implications to human diseases previously associated with the 3'IGHRR.

  14. Mechanism Profiling of Hepatotoxicity Caused by Oxidative Stress Using Antioxidant Response Element Reporter Gene Assay Models and Big Data

    PubMed Central

    Kim, Marlene Thai; Huang, Ruili; Sedykh, Alexander; Wang, Wenyi; Xia, Menghang; Zhu, Hao

    2015-01-01

    Background: Hepatotoxicity accounts for a substantial number of drugs being withdrawn from the market. Using traditional animal models to detect hepatotoxicity is expensive and time-consuming. Alternative in vitro methods, in particular cell-based high-throughput screening (HTS) studies, have provided the research community with a large amount of data from toxicity assays. Among the various assays used to screen potential toxicants is the antioxidant response element beta lactamase reporter gene assay (ARE-bla), which identifies chemicals that have the potential to induce oxidative stress and was used to test > 10,000 compounds from the Tox21 program. Objective: The ARE-bla computational model and HTS data from a big data source (PubChem) were used to profile environmental and pharmaceutical compounds with hepatotoxicity data. Methods: Quantitative structure–activity relationship (QSAR) models were developed based on ARE-bla data. The models predicted the potential oxidative stress response for known liver toxicants when no ARE-bla data were available. Liver toxicants were used as probe compounds to search PubChem Bioassay and generate a response profile, which contained thousands of bioassays (> 10 million data points). By ranking the in vitro–in vivo correlations (IVIVCs), the most relevant bioassay(s) related to hepatotoxicity were identified. Results: The liver toxicants profile contained the ARE-bla and relevant PubChem assays. Potential toxicophores for well-known toxicants were created by identifying chemical features that existed only in compounds with high IVIVCs. Conclusion: Profiling chemical IVIVCs created an opportunity to fully explore the source-to-outcome continuum of modern experimental toxicology using cheminformatics approaches and big data sources. Citation: Kim MT, Huang R, Sedykh A, Wang W, Xia M, Zhu H. 2016. Mechanism profiling of hepatotoxicity caused by oxidative stress using antioxidant response element reporter gene assay models and

  15. CRISPR-Cas9 Genome Editing of a Single Regulatory Element Nearly Abolishes Target Gene Expression in Mice

    PubMed Central

    Han, Yu; Slivano, Orazio J.; Christie, Christine K.; Cheng, Albert W.; Miano, Joseph M.

    2014-01-01

    Objective To ascertain the importance of a single regulatory element in the control of Cnn1 expression using CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9) genome editing. Approach and Results The CRISPR/Cas9 system was used to produce 3/18 founder mice carrying point mutations in an intronic CArG box of the smooth muscle cell (SMC)-restricted Cnn1 gene. Each founder was bred for germ line transmission of the mutant CArG box and littermate interbreeding to generate homozygous mutant (Cnn1ΔCArG/ΔCArG) mice. Quantitative RT-PCR, Western blotting, and confocal immunofluorescence microscopy showed dramatic reductions in Cnn1 mRNA and CNN1 protein expression in Cnn1ΔCArG/ΔCArG mice with no change in other SMC-restricted genes and little evidence of off-target edits elsewhere in the genome. In vivo chromatin immunoprecipitation assay revealed a sharp decrease in binding of SRF to the mutant CArG box. Loss of CNN1 expression was coincident with an increase in Ki-67 positive cells in the normal vessel wall. Conclusion CRISPR/Cas9 genome editing of a single CArG box nearly abolishes Cnn1 expression in vivo and evokes increases in SMC DNA synthesis. This facile genome editing system paves the way for a new generation of studies designed to test the importance of individual regulatory elements in living animals, including regulatory variants in conserved sequence blocks linked to human disease. PMID:25538209

  16. A novel regulatory element (E77) isolated from CHO‐K1 genomic DNA enhances stable gene expression in Chinese hamster ovary cells

    PubMed Central

    Kang, Shin‐Young; Kim, Yeon‐Gu; Kang, Seunghee; Lee, Hong Weon

    2016-01-01

    Abstract Vectors flanked by regulatory DNA elements have been used to generate stable cell lines with high productivity and transgene stability; however, regulatory elements in Chinese hamster ovary (CHO) cells, which are the most widely used mammalian cells in biopharmaceutical production, are still poorly understood. We isolated a novel gene regulatory element from CHO‐K1 cells, designated E77, which was found to enhance the stable expression of a transgene. A genomic library was constructed by combining CHO‐K1 genomic DNA fragments with a CMV promoter‐driven GFP expression vector, and the E77 element was isolated by screening. The incorporation of the E77 regulatory element resulted in the generation of an increased number of clones with high expression, thereby enhancing the expression level of the transgene in the stable transfectant cell pool. Interestingly, the E77 element was found to consist of two distinct fragments derived from different locations in the CHO genome shotgun sequence. High and stable transgene expression was obtained in transfected CHO cells by combining these fragments. Additionally, the function of E77 was found to be dependent on its site of insertion and specific orientation in the vector construct. Our findings demonstrate that stable gene expression mediated by the CMV promoter in CHO cells may be improved by the isolated novel gene regulatory element E77 identified in the present study. PMID:26762773

  17. The role of vaccinia termination factor and cis-acting elements in vaccinia virus early gene transcription termination.

    PubMed

    Tate, Jessica; Gollnick, Paul

    2015-11-01

    Vaccinia virus early gene transcription termination requires the virion form of the viral RNA polymerase (vRNAP), Nucleoside Triphosphate Phosphohydrolase I (NPHI), ATP, the vaccinia termination factor (VTF), and a U5NU termination signal in the nascent transcript. VTF, also the viral mRNA capping enzyme, binds U5NU, and NPHI hydrolyzes ATP to release the transcript. NPHI can release transcripts independent of VTF and U5NU if vRNAP is not actively elongating. However, VTF and U5NU are required for transcript release from an elongating vRNAP, suggesting that the function of VTF and U5NU may be to stall the polymerase. Here we demonstrate that VTF inhibits transcription elongation by enhancing vRNAP pausing. Hence VTF provides the connection between the termination signal in the RNA transcript and viral RNA polymerase to initiate transcription termination. We also provide evidence that a second cis-acting element downstream of U5NU influences the location and efficiency of early gene transcription termination.

  18. Inducer effect on the complex formation between rat liver nuclear proteins and cytochrome P450 2B gene regulatory elements.

    PubMed

    Duzhak, T G; Schwartz, E I; Gulyaeva, L F; Lyakhovich, V V

    2002-09-01

    DNA gel retardation assay has been applied to the investigation of complexes between rat liver nuclear proteins and Barbie box positive regulatory element of cytochrome P450 2B (CYP2B) genes. The intensities of B1 and B2 bands detected in the absence of an inducer increased after 30 min protein incubation with phenobarbital (PB) or triphenyldioxane (TPD), but not with 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene (TCPOPOB). In addition, a new complex (B3 band) was for the first time detected under induction by PB, TPD, and TCPOPOB. Increase in the incubation time up to 2 h facilitated the formation of other new complexes (B4 and B5 bands), which were detected only in the presence of TPD. The use of [3H]TPD in hybridization experiments revealed that this inducer, capable of binding to Barbie box DNA, is also present in B4 and B5 complexes. It is probable that the investigated compounds activate the same proteins at the initial induction steps, which correlates with the formation of B1, B2, and B3 complexes. The further induction step might be inducer-specific, as indicated by the formation of B4 and B5 complexes in the presence of TPD only. Thus, the present data suggest the possibility of specific gene activation signaling pathways that are dependent on a particular inducer. PMID:12387719

  19. Identification of a cis-acting element in nitrogen fixation genes recognized by CnfR in the nonheterocystous nitrogen-fixing cyanobacterium Leptolyngbya boryana.

    PubMed

    Tsujimoto, Ryoma; Kamiya, Narumi; Fujita, Yuichi

    2016-08-01

    The filamentous cyanobacterium Leptolyngbya boryana has the ability to fix nitrogen without any heterocysts under microoxic conditions. Previously, we identified the cnfR gene for a master transcriptional activator for nitrogen fixation (nif) genes in a 50-kb gene cluster containing nif and nif-related genes in L. boryana. We showed that CnfR activates the transcription of nif genes in response to low oxygen conditions, which allows the oxygen-vulnerable enzyme nitrogenase to function. However, the regulatory mechanism that underlies regulation by CnfR remains unknown. In this study, we identified a conserved cis-acting element that is recognized by CnfR. We established a reporter system in the non-diazotrophic cyanobacterium Synechocystis sp. PCC 6803 using luciferase genes (luxAB). Reporter analysis was performed with a series of truncated and modified upstream regulatory regions of nifB and nifP. The cis-element can be divided into nine motifs I-IX, and it is located 76 bp upstream of the transcriptional start sites of nifB and nifP. Six motifs of them are essential for transcriptional activation by CnfR. This cis-acting element is conserved in the upstream regions of nif genes in all diazotrophic cyanobacteria, including Anabaena and Cyanothece, thereby suggesting that the transcriptional regulation by CnfR is widespread in nitrogen-fixing cyanobacteria.

  20. Conserved regulatory elements of the promoter sequence of the gene rpoH of enteric bacteria

    PubMed Central

    Ramírez-Santos, Jesús; Collado-Vides, Julio; García-Varela, Martin; Gómez-Eichelmann, M. Carmen

    2001-01-01

    The rpoH regulatory region of different members of the enteric bacteria family was sequenced or downloaded from GenBank and compared. In addition, the transcriptional start sites of rpoH of Yersinia frederiksenii and Proteus mirabilis, two distant members of this family, were determined. Sequences similar to the σ70 promoters P1, P4 and P5, to the σE promoter P3 and to boxes DnaA1, DnaA2, cAMP receptor protein (CRP) boxes CRP1, CRP2 and box CytR present in Escherichia coli K12, were identified in sequences of closely related bacteria such as: E.coli, Shigella flexneri, Salmonella enterica serovar Typhimurium, Citrobacter freundii, Enterobacter cloacae and Klebsiella pneumoniae. In more distant bacteria, Y.frederiksenii and P.mirabilis, the rpoH regulatory region has a distal P1-like σ70 promoter and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. Sequences similar to the regulatory boxes were not identified in these bacteria. This study suggests that the general pattern of transcription of the rpoH gene in enteric bacteria includes a distal σ70 promoter, >200 nt upstream of the initiation codon, and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. A second proximal σ70 promoter under catabolite-regulation is probably present only in bacteria closely related to E.coli. PMID:11139607

  1. Transformation of Mucor circinelloides with autoreplicative vectors containing homologous and heterologous ARS elements and the dominant Cbx(r) carboxine-resistance gene.

    PubMed

    Ortiz-Alvarado, R; Gonzalez-Hernandez, G A; Torres-Guzman, J C; Gutierrez-Corona, J F

    2006-03-01

    Mucor circinelloides transformants prototrophic to leucine and resistant to carboxine (Leu(+) Cbx(r)) have been obtained by treatment of protoplasts with plasmid constructs containing homologous leuA gene and adjacent autonomously replicating sequences (ARS) element combined with the Cbx(r)(carboxine-resistance) gene of Ustilago maydis and ARS sequences from this basidiomycete (plasmid pGG37) or from the 2 mu plasmid of Saccharomyces cerevisiae (plasmid pGG43). The presence in the same plasmid molecule of the M. circinelloides leuA gene and adjacent ARS element together with heterologous ARS elements produced an increase in the transformation frequency of about 65-120%. The presence of autoreplicating plasmid molecules in the transformants was demonstrated by mitotic stability experiments, by Southern analysis, and by the rescue of plasmids from transformed bacterial cells.

  2. Androgen response element of the glycine N-methyltransferase gene is located in the coding region of its first exon.

    PubMed

    Lee, Cheng-Ming; Yen, Chia-Hung; Tzeng, Tsai-Yu; Huang, Yu-Zen; Chou, Kuan-Hsien; Chang, Tai-Jay; Arthur Chen, Yi-Ming

    2013-01-01

    Androgen plays an important role in the pathogenesis of PCa (prostate cancer). Previously, we identified GNMT (glycine N-methyltransferase) as a tumour susceptibility gene and characterized its promoter region. Besides, its enzymatic product-sarcosine has been recognized as a marker for prognosis of PCa. The goals of this study were to determine whether GNMT is regulated by androgen and to map its AREs (androgen response elements). Real-time PCR analyses showed that R1881, a synthetic AR (androgen receptor) agonist induced GNMT expression in AR-positive LNCaP cells, but not in AR-negative DU145 cells. In silico prediction showed that there are four putative AREs in GNMT-ARE1, ARE2 and ARE3 are located in the intron 1 and ARE4 is in the intron 2. Consensus ARE motif deduced from published AREs was used to identify the fifth ARE-ARE5 in the coding region of exon 1. Luciferase reporter assay found that only ARE5 mediated the transcriptional activation of R1881. ARE3 overlaps with a YY1 [Yin and Yang 1 (motif (CaCCATGTT, +1118/+1126)] that was further confirmed by antibody supershift and ChIP (chromatin immunoprecipitation) assays. EMSA (electrophoretic mobility shift assay) and ChIP assay confirmed that AR interacts with ARE5 in vitro and in vivo. In summary, GNMT is an AR-targeted gene with its functional ARE located at +19/+33 of the first exon. These results are valuable for the study of the influence of androgen on the gene expression of GNMT especially in the pathogenesis of cancer. PMID:23883094

  3. Reverted glutathione S-transferase-like genes that influence flower color intensity of carnation (Dianthus caryophyllus L.) originated from excision of a transposable element.

    PubMed

    Momose, Masaki; Itoh, Yoshio; Umemoto, Naoyuki; Nakayama, Masayoshi; Ozeki, Yoshihiro

    2013-12-01

    A glutathione S-transferase-like gene, DcGSTF2, is responsible for carnation (Dianthus caryophyllus L.) flower color intensity. Two defective genes, DcGSTF2mu with a nonsense mutation and DcGSTF2-dTac1 containing a transposable element dTac1, have been characterized in detail in this report. dTac1 is an active element that produces reverted functional genes by excision of the element. A pale-pink cultivar 'Daisy' carries both defective genes, whereas a spontaneous deep-colored mutant 'Daisy-VPR' lost the element from DcGSTF2-dTac1. This finding confirmed that dTac1 is active and that the resulting reverted gene, DcGSTF2rev1, missing the element is responsible for this color change. Crosses between the pale-colored cultivar '06-LA' and a deep-colored cultivar 'Spectrum' produced segregating progeny. Only the deep-colored progeny had DcGSTF2rev2 derived from the 'Spectrum' parent, whereas progeny with pale-colored flowers had defective forms from both parents, DcGSTF2mu and DcGSTF2-dTac1. Thus, DcGSTF2rev2 had functional activity and likely originated from excision of dTac1 since there was a footprint sequence at the vacated site of the dTac1 insertion. Characterizing the DcGSTF2 genes in several cultivars revealed that the two functional genes, DcGSTF2rev1 and DcGSTF2rev2, have been used for some time in carnation breeding with the latter in use for more than half a century.

  4. Cell-specific transcription of the peripherin gene in neuronal cell lines involves a cis-acting element surrounding the TATA box.

    PubMed Central

    Desmarais, D; Filion, M; Lapointe, L; Royal, A

    1992-01-01

    Peripherin is a neurone-specific intermediate filament protein expressed mostly in the peripheral nervous system. To localize sequences that are important for the regulation of peripherin gene transcription, we have functionally dissected its promoter. Transfection into different cell lines and deletion mapping of peripherin-lacZ hybrid constructs indicated that the first 98 bp preceding the transcription start site of the gene were sufficient to confer cell-type specific expression. DNase I footprinting experiments revealed three protected sequences in this region, that were named PER1, PER2 and PER3. The PER2 and PER3 elements, localized between -98 to -46, interact with proteins that seem widely distributed. Deletion of these elements severely decreased the level of reporter gene activity. The PER1 element, which overlaps the TATA box, interacts with a DNA-binding protein prevailing in peripherin expressing cell lines. However, the core promoter, which contains the PER1 element, was inefficient in driving gene expression. Experiments designed to test the contribution of each element showed that PER2 and PER3 were important in determining the level of expression, while PER1 was important for cell-type specificity. In fact the polyoma virus enhancer linked to the peripherin gene core promoter was found to limit reporter gene activity to peripherin expressing cell lines. Together, these experiments indicate that co-operative interactions between different regions of the promoter are necessary for efficient and cell-type specific transcription of the peripherin gene in a subset of neuronal cells. Images PMID:1639068

  5. A carbon source-responsive promoter element necessary for activation of the isocitrate lyase gene ICL1 is common to genes of the gluconeogenic pathway in the yeast Saccharomyces cerevisiae.

    PubMed Central

    Schöler, A; Schüller, H J

    1994-01-01

    The expression of yeast genes encoding gluconeogenic enzymes depends strictly on the carbon source available in the growth medium. We have characterized the control region of the isocitrate lyase gene ICL1, which is derepressed more than 200-fold after transfer of cells from fermentative to nonfermentative growth conditions. Deletion analysis of the ICL1 promoter led to the identification of an upstream activating sequence element, UASICL1 (5' CATTCATCCG 3'), necessary and sufficient for conferring carbon source-dependent regulation on a heterologous reporter gene. Similar sequence motifs were also found in the upstream regions of coregulated genes involved in gluconeogenesis. This carbon source-responsive element (CSRE) interacts with a protein factor, designated Ang1 (activator of nonfermentative growth), detectable only in extracts derived from derepressed cells. Gene activation mediated by the CSRE requires the positively acting derepression genes CAT1 (= SNF1 and CCR1) and CAT3 (= SNF4). In the respective mutants, Ang1-CSRE interaction was no longer observed under repressing or derepressing conditions. Since binding of Ang1 factor to the CSRE could be competed for by an upstream sequence derived from the fructose-1,6-bisphosphatase gene FBP1, we propose that the CSRE functions as a UAS element common to genes of the gluconeogenic pathway. Images PMID:8196607

  6. NAC transcription factor genes: genome-wide identification, phylogenetic, motif and cis-regulatory element analysis in pigeonpea (Cajanus cajan (L.) Millsp.).

    PubMed

    Satheesh, Viswanathan; Jagannadham, P Tej Kumar; Chidambaranathan, Parameswaran; Jain, P K; Srinivasan, R

    2014-12-01

    The NAC (NAM, ATAF and CUC) proteins are plant-specific transcription factors implicated in development and stress responses. In the present study 88 pigeonpea NAC genes were identified from the recently published draft genome of pigeonpea by using homology based and de novo prediction programmes. These sequences were further subjected to phylogenetic, motif and promoter analyses. In motif analysis, highly conserved motifs were identified in the NAC domain and also in the C-terminal region of the NAC proteins. A phylogenetic reconstruction using pigeonpea, Arabidopsis and soybean NAC genes revealed 33 putative stress-responsive pigeonpea NAC genes. Several stress-responsive cis-elements were identified through in silico analysis of the promoters of these putative stress-responsive genes. This analysis is the first report of NAC gene family in pigeonpea and will be useful for the identification and selection of candidate genes associated with stress tolerance. PMID:25108674

  7. Maize Adh-1 promoter sequences control anaerobic regulation: addition of upstream promoter elements from constitutive genes is necessary for expression in tobacco

    PubMed Central

    Ellis, J.G.; Llewellyn, D.J.; Dennis, E.S.; Peacock, W.J.

    1987-01-01

    The promoter region of a maize alcohol dehydrogenase gene (Adh-1) was linked to a reporter gene encoding chloramphenicol acetyl transferase (CAT) and transformed stably into tobacco cells using T-DNA vectors. No CAT enzyme activity could be detected in transgenic tobacco plants unless upstream promoter elements from the octopine synthase gene or the cauliflower mosaic virus 35S promoter were supplied in addition to the maize promoter region. CAT enzyme activity and transcription of the chimaeric gene were then readily detected after anaerobic induction. The first 247 bp upstream of the translation initiation codon of the maize Adh-1 gene were sufficient to impose anaerobic regulation on the hybrid gene and S1 nuclease mapping confirmed mRNA initiation is from the normal maize Adh-1 transcription start point. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Fig. 5.Fig. 6. PMID:15981329

  8. The distal elements, OCT and SPH, stimulate the formation of preinitiation complexes on a human U6 snRNA gene promoter in vitro.

    PubMed

    Kunkel, G R; Hixson, J D

    1998-03-15

    The distal control region of a human U6 small nuclear RNA (snRNA) gene promoter contains two separable elements, octamer (OCT) and SPH, found in many vertebrate snRNA genes. Complete distal regions generally account for a 4- to 100-fold stimulation of snRNA gene promoters. We examined the mechanism of transcriptional stimulation by each element when linked to the proximal U6 promoter. Multimers of either OCT or SPH did not increase transcriptional levels above that with a single copy, either in transfected human cells or after in vitro transcription in a HeLa S100 extract. The orientation of a single SPH element differentially stimulated transcription in transfected cells, whereas the orientation of an octamer element was not important. Using Sarkosyl to limit transcription to a single-round, we concluded that promoters containing either OCT or SPH elements supported an increased number of preinitiation complexes in vitro. Furthermore, the rate of formation of U6 promoter preinitiation complexes resistant to low (0.015%) concentrations of Sarkosyl was accelerated on templates containing either OCT or SPH. However, neither element had a significant effect on the number of rounds of reinitiation in the S100 extract.

  9. A universal algorithm for genome-wide in silicio identification of biologically significant gene promoter putative cis-regulatory-elements; identification of new elements for reactive oxygen species and sucrose signaling in Arabidopsis.

    PubMed

    Geisler, Matt; Kleczkowski, Leszek A; Karpinski, Stanislaw

    2006-02-01

    Short motifs of many cis-regulatory elements (CREs) can be found in the promoters of most Arabidopsis genes, and this raises the question of how their presence can confer specific regulation. We developed a universal algorithm to test the biological significance of CREs by first identifying every Arabidopsis gene with a CRE and then statistically correlating the presence or absence of the element with the gene expression profile on multiple DNA microarrays. This algorithm was successfully verified for previously characterized abscisic acid, ethylene, sucrose and drought responsive CREs in Arabidopsis, showing that the presence of these elements indeed correlates with treatment-specific gene induction. Later, we used standard motif sampling methods to identify 128 putative motifs induced by excess light, reactive oxygen species and sucrose. Our algorithm was able to filter 20 out of 128 novel CREs which significantly correlated with gene induction by either heat, reactive oxygen species and/or sucrose. The position, orientation and sequence specificity of CREs was tested in silicio by analyzing the expression of genes with naturally occurring sequence variations. In three novel CREs the forward orientation correlated with sucrose induction and the reverse orientation with sucrose suppression. The functionality of the predicted novel CREs was experimentally confirmed using Arabidopsis cell-suspension cultures transformed with short promoter fragments or artificial promoters fused with the GUS reporter gene. Our genome-wide analysis opens up new possibilities for in silicio verification of the biological significance of newly discovered CREs, and allows for subsequent selection of such CREs for experimental studies.

  10. Analysis of sh-m6233, a mutation induced by the transposable element Ds in the sucrose synthase gene of Zea mays.

    PubMed

    Weck, E; Courage, U; Döring, H P; Fedoroff, N; Starlinger, P

    1984-08-01

    The unstable allele sh-m6233 caused by insertion of the transposable element Ds into the sucrose synthase gene of maize, was cloned. The mutation is caused by the insertion of an 4 kb DNA segment, consisting of two identical Ds elements of 2000 bp length, of which one is inserted into the center of the other in inverted orientation. This structure is, at the level of restriction mapping and partial DNA sequencing, identical to the double Ds element found in a larger insert in the mutant allele sh-m5933. 8 bp of host DNA are duplicated upon insertion. In a revertant, a 6-bp duplication is retained. PMID:16453542

  11. Thyroid hormones directly activate the expression of the human and mouse uncoupling protein-3 genes through a thyroid response element in the proximal promoter region

    PubMed Central

    2004-01-01

    The transcription of the human UCP3 (uncoupling protein-3) gene in skeletal muscle is tightly regulated by metabolic signals related to fatty acid availability. However, changes in thyroid status also modulate UCP3 gene expression, albeit by unknown mechanisms. We created transgenic mice bearing the entire human UCP3 gene to investigate the effect of thyroid hormones on human UCP3 gene expression. Treatment of human UCP3 transgenic mice with thyroid hormones induced the expression of the human gene in skeletal muscle. In addition, transient transfection experiments demonstrate that thyroid hormones activate the transcription of the human UCP3 gene promoter when MyoD and the TR (thyroid hormone receptor) were co-transfected. The action of thyroid hormones on UCP3 gene transcription is mediated by the binding of the TR to a proximal region in the UCP3 gene promoter that contains a direct repeat structure. An intact DNA sequence of this site is required for thyroid hormone responsiveness and TR binding. Chromatin immunoprecipitation assays revealed that the TR binds this element in vivo. The murine Ucp3 gene promoter was also dependent on MyoD and responsive to thyroid hormone in transient transfection assays. However, it was much less sensitive to thyroid hormone than the human UCP3 promoter. In summary, UCP3 gene transcription is activated by thyroid hormone treatment in vivo, and this activation is mediated by a TRE (thyroid hormone response element) in the proximal promoter region. Such regulation suggests a link between UCP3 gene expression and the effects of thyroid hormone on mitochondrial function in skeletal muscle. PMID:15496137

  12. Development of crop-specific transposable element (SINE) markers for studying gene flow from oilseed rape to wild radish.

    PubMed

    Prieto, J L; Pouilly, N; Jenczewski, E; Deragon, J M; Chèvre, A M

    2005-08-01

    The screening of wild populations for evidence of gene flow from a crop to a wild related species requires the unambiguous detection of crop genes within the genome of the wild species, taking into account the intraspecific variability of each species. If the crop and wild relatives share a common ancestor, as is the case for the Brassica crops and their wild relatives (subtribe Brassiceae), the species-specific markers needed to make this unambiguous detection are difficult to identify. In the model oilseed rape (Brassica napus, AACC, 2n = 38)-wild radish (Raphanus raphanistrum, RrRr, 2n = 18) system, we utilized the presence or absence of a short-interspersed element (SINE) at a given locus to develop oilseed rape-specific markers, as SINE insertions are irreversible. By means of sequence-specific amplified polymorphism (SINE-SSAP) reactions, we identified and cloned 67 bands specific to the oilseed rape genome and absent from that of wild radish. Forty-seven PCR-specific markers were developed from three combinations of primers anchored either in (1) the 5'- and 3'-genomic sequences flanking the SINE, (2) the 5'-flanking and SINE internal sequences or (3) the SINE internal and flanking 3'-sequences. Seventeen markers were monomorphic whatever the oilseed rape varieties tested, whereas 30 revealed polymorphism and behaved either as dominant (17) or co-dominant (13) markers. Polymorphic markers were mapped on 19 genomic regions assigned to ten linkage groups. The markers developed will be efficient tools to trace the occurrence and frequency of introgressions of oilseed rape genomic region within wild radish populations. PMID:15942756

  13. Hypoosmotic expression of Dunaliella bardawil ζ-carotene desaturase is attributed to a hypoosmolarity-responsive element different from other key carotenogenic genes.

    PubMed

    Lao, Yong-Min; Xiao, Lan; Luo, Li-Xin; Jiang, Jian-Guo

    2014-05-01

    Some key carotenogenic genes (crts) in Dunaliella bardawil are regulated in response to salt stress partly due to salt-inducible cis-acting elements in their promoters. Thus, we isolated and compared the ζ-carotene desaturase (Dbzds) promoter with other crts promoters including phytoene synthase (Dbpsy), phytoene desaturase (Dbpds), and lycopene β-cyclase1 (DblycB1) to identify salt-inducible element(s) in the Dbzds promoter. In silico analysis of the Dbzds promoter found several potential cis-acting elements, such as abscisic acid response element-like sequence, myelocytomatosis oncogene1 recognition motif, AGC box, anaerobic motif2, and activation sequence factor1 binding site. Remarkably, instead of salt-inducible elements, we found a unique regulatory sequence architecture in the Dbzds promoter: a hypoosmolarity-responsive element (HRE) candidate followed by a potential hypoosmolarity-inducible factor GBF5 binding site. Deletion experiments demonstrated that only HRE, but not the GBF5 binding site, is responsible for hypoosmotic expression of the fusion of Zeocin resistance gene (ble) to the enhanced green fluorescent protein (egfp) chimeric gene under salt stress. Dbzds transcripts were in accordance with those of ble-egfp driven by the wild-type Dbzds promoter. Consequently, Dbzds is hypoosmotically regulated by its promoter, and HRE is responsible for this hypoosmotic response. Finally, the hypoosmolarity mechanism of Dbzds was studied by comparing transcript profiles and regulatory elements of Dbzds with those of Dbpsy, Dbpds, DblycB1, and DblycB2, revealing that different induction characteristics of crts may correlate with regulatory sequence architecture. PMID:24632600

  14. Hypoosmotic Expression of Dunaliella bardawil ζ-Carotene Desaturase Is Attributed to a Hypoosmolarity-Responsive Element Different from Other Key Carotenogenic Genes1[C][W

    PubMed Central

    Lao, Yong-Min; Xiao, Lan; Luo, Li-Xin; Jiang, Jian-Guo

    2014-01-01

    Some key carotenogenic genes (crts) in Dunaliella bardawil are regulated in response to salt stress partly due to salt-inducible cis-acting elements in their promoters. Thus, we isolated and compared the ζ-carotene desaturase (Dbzds) promoter with other crts promoters including phytoene synthase (Dbpsy), phytoene desaturase (Dbpds), and lycopene β-cyclase1 (DblycB1) to identify salt-inducible element(s) in the Dbzds promoter. In silico analysis of the Dbzds promoter found several potential cis-acting elements, such as abscisic acid response element-like sequence, myelocytomatosis oncogene1 recognition motif, AGC box, anaerobic motif2, and activation sequence factor1 binding site. Remarkably, instead of salt-inducible elements, we found a unique regulatory sequence architecture in the Dbzds promoter: a hypoosmolarity-responsive element (HRE) candidate followed by a potential hypoosmolarity-inducible factor GBF5 binding site. Deletion experiments demonstrated that only HRE, but not the GBF5 binding site, is responsible for hypoosmotic expression of the fusion of Zeocin resistance gene (ble) to the enhanced green fluorescent protein (egfp) chimeric gene under salt stress. Dbzds transcripts were in accordance with those of ble-egfp driven by the wild-type Dbzds promoter. Consequently, Dbzds is hypoosmotically regulated by its promoter, and HRE is responsible for this hypoosmotic response. Finally, the hypoosmolarity mechanism of Dbzds was studied by comparing transcript profiles and regulatory elements of Dbzds with those of Dbpsy, Dbpds, DblycB1, and DblycB2, revealing that different induction characteristics of crts may correlate with regulatory sequence architecture. PMID:24632600

  15. Transcriptional regulation of the human acid alpha-glucosidase gene. Identification of a repressor element and its transcription factors Hes-1 and YY1.

    PubMed

    Yan, B; Heus, J; Lu, N; Nichols, R C; Raben, N; Plotz, P H

    2001-01-19

    Acid alpha-glucosidase, the product of a housekeeping gene, is a lysosomal enzyme that degrades glycogen. A deficiency of this enzyme is responsible for a recessively inherited myopathy and cardiomyopathy, glycogenesis type II. We have previously demonstrated that the human acid alpha-glucosidase gene expression is regulated by a silencer within intron 1, which is located in the 5'-untranslated region. In this study, we have used deletion analysis, electrophoretic mobility shift assay, and footprint analysis to further localize the silencer to a 25-base pair element. The repressive effect on the TK promoter was about 50% in both orientations in expression plasmid, and two transcriptional factors were identified with antibodies binding specifically to the element. Mutagenesis and functional analyses of the element demonstrated that the mammalian homologue 1 of Drosophila hairy and Enhancer of split (Hes-1) binding to an E box (CACGCG) and global transcription factor-YY1 binding to its core site function as a transcriptional repressor. Furthermore, the overexpression of Hes-1 significantly enhanced the repressive effect of the silencer element. The data should be helpful in understanding the expression and regulation of the human acid alpha-glucosidase gene as well as other lysosomal enzyme genes.

  16. Molecular cloning and characterization of interferon alpha/beta response element binding factors of the murine (2'-5')oligoadenylate synthetase ME-12 gene.

    PubMed Central

    Yan, C; Tamm, I

    1991-01-01

    Seven clones encoding interferon response element binding factors have been isolated from a mouse fibroblast lambda gt11 cDNA library by using a 32P end-labeled tandem trimer of the mouse (2'-5')oligoadenylate synthetase gene interferon response element as a probe. Clone 16 shares strong similarity (95%) at both DNA and amino acid level with YB-1, a human major histocompatibility complex class II Y-box DNA-binding protein, and with dbpB, a human epidermal growth factor receptor gene enhancer region binding protein. The product of the gene represented by clone 16 may represent a factor that regulates multiple genes by binding to a variety of 5' regulatory elements. Clone 25 is a 2407-base-pair-long cDNA and contains a putative 311-amino acid open reading frame corresponding to an estimated mass of 35.5 kDa. This putative protein, designated as interferon response element binding factor 1 (IREBF-1), contains an acidic domain, three heptad repeat leucine arrays, and a region that shares similarity with the yeast transcriptional factor GAL4 DNA-binding domain. Furthermore, the C terminus of IREBF-1 shows an unusual amphipathic property: within a 79-amino acid range, one side of the alpha-helical region contains a preponderance of hydrophobic amino acids and the other side contains hydrophilic amino acids. This type of structure provides a strong hydrophobic force for protein-protein interaction. Images PMID:1986360

  17. Differential control by IHF and cAMP of two oppositely oriented genes, hpt and gcd, in Escherichia coli: significance of their partially overlapping regulatory elements.

    PubMed

    Izu, H; Ito, S; Elias, M D; Yamada, M

    2002-01-01

    The hpt gene, which encodes hypoxanthine phosphoribosyltransferase, is located next to, but transcribed in the opposite direction to, the gcd gene, which codes for a membrane-bound glucose dehydrogenase, at 3.1 min on the Escherichia coli genome. In their promoter-operator region, putative regulatory elements for integration host factor (IHF) and for the complex comprising 3', 5'-cyclic AMP (cAMP) and its receptor protein (CRP) are present, and they overlap the promoters for hpt and gcd, respectively. The involvement of IHF and cAMP-CRP, as well as the corresponding putative cis-acting elements, in the expression of the two genes was investigated by using lacZ operon fusions. In an adenylate cyclase-deficient strain, addition of cAMP increased the expression of hpt and reduced the expression of gcd. In agreement with this observation, the introduction of mutations into the putative binding element for the cAMP-CRP complex enhanced the expression of gcd. In contrast, mutations introduced into the putative IHF-binding elements increased the level of hpt expression. Similar results were obtained with IHF-defective strains. Thus, the expression of the two genes is regulated in a mutually exclusive manner. Additional experiments with mutations at the -10 sequence of the gcd promoter suggest that the binding of RNA polymerase to the hpt promoter interferes with the interaction of RNA polymerase with the gcd promoter, and vice versa.

  18. Neisserial Correia repeat-enclosed elements do not influence the transcription of pil genes in Neisseria gonorrhoeae and Neisseria meningitidis.

    PubMed

    Lin, Ya-Hsun; Ryan, Catherine S; Davies, John K

    2011-10-01

    Two human-specific neisserial pathogens, Neisseria gonorrhoeae and Neisseria meningitidis, require the expression of type IV pili (tfp) for initial attachment to the host during infection. However, the mechanisms controlling the assembly and functionality of tfp are poorly understood. It is known that the gonococcal pilE gene, encoding the major subunit, is positively regulated by IHF, a multifunctional DNA binding protein. A neisserial specific repetitive DNA sequence, termed the Correia repeat-enclosed element (CREE) is situated upstream of three pil loci: pilHIJKX (pilH-X), pilGD, and pilF. CREEs have been shown to contain strong promoters, and some CREE variants contain a functional IHF binding site. CREEs might therefore be involved in the regulation of tfp biogenesis in pathogenic Neisseria. Site-directed and deletion mutagenesis on promoter::cat reporter constructs demonstrated that transcription of pilH-X and pilGD is from a σ(70) promoter and is independent of the CREE. The insertion of a CREE in the pilF promoter region in N. meningitidis generated a functional σ(70) promoter. However, there is also a functional promoter at this position in N. gonorrhoeae, where there is no CREE. These results suggest CREE insertion in these three pil loci does not influence transcription and that IHF does not coordinately regulate tfp biogenesis.

  19. Functional dissection of an enhancer-like element located within the second intron of the human U2AF1L4 gene.

    PubMed

    Didych, D A; Smirnov, N A; Kotova, E S; Akopov, S B; Nikolaev, L G; Sverdlov, E D

    2011-08-01

    A detailed functional and evolutionary analysis of an enhancer element of the human genome (enhancer 12) located in the second intron of the U2AF1L4 gene, which we identified earlier, is presented. Overlapping fragments of the studied genome region were analyzed for enhancer activity, and the site responsible for the activity of this element was identified using transient transfections of HeLa cells. Comparison of the enhancer 12 sequence with orthologous sequences from seven primate species revealed the existence of evolutionarily conserved sequences within this element. One of the identified conservative regions is likely responsible for the enhancer activity and is able to specifically interact in vitro with proteins of HeLa cell nuclear extract. The ability of orthologous primate sequences to compete with enhancer 12 for binding with HeLa cell nuclear extract proteins and to enhance the activity of the reporter gene in transient transfection of HeLa cells is demonstrated. PMID:22022969

  20. Structural analysis of the regulatory elements of the type-II procollagen gene. Conservation of promoter and first intron sequences between human and mouse.

    PubMed Central

    Vikkula, M; Metsäranta, M; Syvänen, A C; Ala-Kokko, L; Vuorio, E; Peltonen, L

    1992-01-01

    Transcription of the type-II procollagen gene (COL2A1) is very specifically restricted to a limited number of tissues, particularly cartilages. In order to identify transcription-control motifs we have sequenced the promoter region and the first intron of the human and mouse COL2A1 genes. With the assumption that these motifs should be well conserved during evolution, we have searched for potential elements important for the tissue-specific transcription of the COL2A1 gene by aligning the two sequences with each other and with the available rat type-II procollagen sequence for the promoter. With this approach we could identify specific evolutionarily well-conserved motifs in the promoter area. On the other hand, several suggested regulatory elements in the promoter region did not show evolutionary conservation. In the middle of the first intron we found a cluster of well-conserved transcription-control elements and we conclude that these conserved motifs most probably possess a significant function in the control of the tissue-specific transcription of the COL2A1 gene. We also describe locations of additional, highly conserved nucleotide stretches, which are good candidate regions in the search for binding sites of yet-uncharacterized cartilage-specific transcription regulators of the COL2A1 gene. PMID:1637314

  1. Transcriptional regulation of genes encoding the selenium-free [NiFe]-hydrogenases in the archaeon Methanococcus voltae involves positive and negative control elements.

    PubMed Central

    Noll, I; Müller, S; Klein, A

    1999-01-01

    Methanococcus voltae harbors genetic information for two pairs of homologous [NiFe]-hydrogenases. Two of the enzymes contain selenocysteine, while the other two gene groups encode apparent isoenzymes that carry cysteinyl residues in the homologous positions. The genes coding for the selenium-free enzymes, frc and vhc, are expressed only under selenium limitation. They are transcribed out of a common intergenic region. A series of deletions made in the intergenic region localized a common negative regulatory element for the vhc and frc promoters as well as two activator elements that are specific for each of the two transcription units. Repeated sequences, partially overlapping the frc promoter, were also detected. Mutations in these repeated heptanucleotide sequences led to a weak induction of a reporter gene under the control of the frc promoters in the presence of selenium. This result suggests that the heptamer repeats contribute to the negative regulation of the frc transcription unit. PMID:10430564

  2. Studying Genes

    MedlinePlus

    ... Area What are genes? Genes are sections of DNA that contain instructions for making the molecules—many ... material in an organism. This includes genes and DNA elements that control the activity of genes. Does ...

  3. Specificity of a retinoic acid response element in the phosphoenolpyruvate carboxykinase gene promoter: consequences of both retinoic acid and thyroid hormone receptor binding.

    PubMed Central

    Lucas, P C; Forman, B M; Samuels, H H; Granner, D K

    1991-01-01

    The ability of a retinoic acid (RA) response element (RARE) in the phosphoenolpyruvate carboxykinase (PEPCK) gene promoter to mediate effects of either RA or thyroid hormone (T3) on gene expression was studied. Fusion gene constructs consisting of PEPCK promoter sequences ligated to the chloramphenicol acetyltransferase (CAT) reporter gene were used for this analysis. While T3 induced CAT expression to a small degree (about twofold) when such constructs were transiently transfected into H4IIE rat hepatoma cells, along with an expression vector encoding the alpha subtype of the T3 receptor (TR), this effect was mediated by promoter sequences distinct from the PEPCK RARE. Although TRs were capable of binding the PEPCK RARE in the form of putative monomers, dimers, and heterodimers with RA receptors (RARs), this element failed to mediate any positive effect of T3 on gene expression. In contrast, the PEPCK RARE mediated six- to eightfold induction of CAT expression by RA. When TRs were coexpressed along with RARs in transfected H4IIE cells, this RA induction was substantially blunted in a T3-independent manner. This inhibitory effect may be due to the binding of nonfunctional TRs or TR-RAR heterodimers to the PEPCK RARE. A model is proposed to explain the previously observed in vivo effects of T3 on PEPCK gene expression. Images PMID:1656224

  4. Cis and trans-acting elements involved in the activation of Arabidopsis thaliana A1 gene encoding the translation elongation factor EF-1 alpha.

    PubMed Central

    Curie, C; Liboz, T; Bardet, C; Gander, E; Médale, C; Axelos, M; Lescure, B

    1991-01-01

    In A. thaliana the translation elongation factor EF-1 alpha is encoded by a small multigenic family of four members (A1-A4). The A1 gene promoter has been dissected and examined in a transient expression system using the GUS reporter gene. Deletion analysis has shown that several elements are involved in the activation process. One cis-acting domain, the TEF 1 box, has been accurately mapped 100 bp upstream of the transcription initiation site. This domain is the target for trans-acting factors identified in nuclear extracts prepared from A. thaliana. Homologies are found between the TEF 1 box and sequences present at the same location within the A2, A3 and A4 promoters. This observation, together with those obtained from gel retardation assays performed using DNA fragments from the A4 promoter, suggest that the activation process mediated by the TEF 1 element is conserved among the A. thaliana EF-1 alpha genes. Analysis of nearly full length cDNA clones has shown that in addition to a single intron located within the coding region, the A1 gene contains a second intron located within the 5' non coding region. Such an intron is also present within the A2, A3 and A4 genes. This 5' intervening sequence appears to be essential to obtain a maximum GUS activity driven by the A1 gene promoter. Images PMID:1840652

  5. The variances of Sp1 and NF-κB elements correlate with the greater capacity of Chinese HIV-1 B′-LTR for driving gene expression

    PubMed Central

    Qu, Di; Li, Chuan; Sang, Feng; Li, Qiang; Jiang, Zhi-Qiang; Xu, Li-Ran; Guo, Hui-Jun; Zhang, Chiyu; Wang, Jian-Hua

    2016-01-01

    The 5′ end of HIV-1 long terminal repeat (LTR) serves as a promoter that plays an essential role in driving viral gene transcription. Manipulation of HIV-1 LTR provides a potential therapeutic strategy for suppressing viral gene expression or excising integrated provirus. Subtype-specific genetic diversity in the LTR region has been observed. The minor variance of LTR, particularly in the transcription factor binding sites, can have a profound impact on its activity. However, the LTR profiles from major endemic Chinese subtypes are not well characterized. Here, by characterizing the sequences and functions of LTRs from endemic Chinese HIV-1 subtypes, we showed that nucleotide variances of Sp1 core promoter and NF-κB element are associated with varied LTR capacity for driving viral gene transcription. The greater responsiveness of Chinese HIV-1 B′-LTR for driving viral gene transcription upon stimulation is associated with an increased level of viral reactivation. Moreover, we demonstrated that the introduction of CRISPR/dead Cas9 targeting Sp1 or NF-κB element suppressed viral gene expression. Taken together, our study characterized LTRs from endemic HIV-1 subtypes in China and suggests a potential target for the suppression of viral gene expression and a novel strategy that facilitates the accomplishment of a functional cure. PMID:27698388

  6. Enrichment of Conserved Synaptic Activity-Responsive Element in Neuronal Genes Predicts a Coordinated Response of MEF2, CREB and SRF

    PubMed Central

    Rodríguez-Tornos, Fernanda M.; San Aniceto, Iñigo; Cubelos, Beatriz; Nieto, Marta

    2013-01-01

    A unique synaptic activity-responsive element (SARE) sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity. We hypothesize that this sequence is a broad mechanism that regulates gene expression in response to synaptic activation and during plasticity; and that analysis of SARE-containing genes could identify molecular mechanisms involved in brain disorders. To search for conserved SARE sequences in the mammalian genome, we used the SynoR in silico tool, and found the SARE cluster predominantly in the regulatory regions of genes expressed specifically in the nervous system; most were related to neural development and homeostatic maintenance. Two of these SARE sequences were tested in luciferase assays and proved to promote transcription in response to neuronal activation. Supporting the predictive capacity of our candidate list, up-regulation of several SARE containing genes in response to neuronal activity was validated using external data and also experimentally using primary cortical neurons and quantitative real time RT-PCR. The list of SARE-containing genes includes several linked to mental retardation and cognitive disorders, and is significantly enriched in genes that encode mRNA targeted by FMRP (fragile X mental retardation protein). Our study thus supports the idea that SARE sequences are relevant transcriptional regulatory elements that participate in plasticity. In addition, it offers a comprehensive view of how activity-responsive transcription factors coordinate their actions and increase the selectivity of their targets. Our data suggest that analysis of SARE-containing genes will reveal yet-undescribed pathways of synaptic plasticity and additional candidate genes disrupted in mental disease. PMID:23382855

  7. Characterization of the cis elements in the proximal promoter regions of the anthocyanin pathway genes reveals a common regulatory logic that governs pathway regulation

    PubMed Central

    Zhu, Zhixin; Wang, Hailong; Wang, Yiting; Guan, Shan; Wang, Fang; Tang, Jingyu; Zhang, Ruijuan; Xie, Lulu; Lu, Yingqing

    2015-01-01

    Cellular activities such as compound synthesis often require the transcriptional activation of an entire pathway; however, the molecular mechanisms underlying pathway activation have rarely been explained. Here, the cis regulatory architecture of the anthocyanin pathway genes targeted by the transcription factor (TF) complex including MYB, bHLH, and WDR was systematically analysed in one species and the findings extended to others. In Ipomoea purpurea, the IpMYB1-IpbHLH2-IpWDR1 (IpMBW) complex was found to be orthologous to the PAP1-GL3-TTG1 (AtPGT) complex of Arabidopsis thaliana, and interacted with a 7-bp MYB-recognizing element (MRE) and a 6-bp bHLH-recognizing element (BRE) at the proximal promoter region of the pathway genes. There was little transcription of the gene in the absence of the MRE or BRE. The cis elements identified experimentally converged on two syntaxes, ANCNNCC for MREs and CACN(A/C/T)(G/T) for BREs, and our bioinformatic analysis showed that these were present within anthocyanin gene promoters in at least 35 species, including both gymnosperms and angiosperms. For the anthocyanin pathway, IpMBW and AtPGT recognized the interspecific promoters of both early and later genes. In A. thaliana, the seed-specific TF complex (TT2, TT8, and TTG1) may regulate all the anthocyanin pathway genes, in addition to the proanthocyanidin-specific BAN. When multiple TF complexes in the anthocyanin pathway were compared, the cis architecture played a role larger than the TF complex in determining the variation in promoter activity. Collectively, a cis logic common to the pathway gene promoters was found, and this logic is essential for the trans factors to regulate the pathway. PMID:25911741

  8. Cis-acting elements essential for light regulation of the nuclear gene encoding the A subunit of chloroplast glyceraldehyde 3-phosphate dehydrogenase in Arabidopsis thaliana.

    PubMed Central

    Park, S C; Kwon, H B; Shih, M C

    1996-01-01

    We report the characterization of cis-acting elements involved in light regulation of the nuclear gene (GapA) that encodes the A subunit of glyceraldehyde 3-phosphate dehydrogenase in Arabidopsis thaliana. Our previous deletion analyses indicate that the -277 to -195 upstream region of GapA is essential for light induction of the beta-glucuronidase reporter gene in transgenic tobacco (Nicotiana tabacum) plants. This region contains three direct repeats with the consensus sequence 5'-CAAATGAA(A/G)A-3' (Gap boxes). Our results show that 2-bp substitutions of the last four nucleotides (AA or GA) of the Gap boxes by CC abolish light induction of the beta-glucuronidase reporter gene in vivo and affect binding of the Gap box binding factor in vitro. We have also identified an additional cis-acting element, AE (Activation Element) box, that is involved in regulation of GapA. A combination of a Gap box trimer and an AE box dimer can confer light responsiveness of the cauliflower mosaic virus 35S promoter containing the -92 to +6 upstream sequence, whereas oligomers of Gap boxes or AE boxes alone cannot confer light responsiveness on the same promoter. These results suggest that Gap boxes and AE boxes function together as the light-responsive element of GapA. PMID:8972600

  9. The STAT3 HIES mutation is a gain-of-function mutation that activates genes via AGG-element carrying promoters

    PubMed Central

    Xu, Li; Ji, Jin-Jun; Le, Wangping; Xu, Yan S.; Dou, Dandan; Pan, Jieli; Jiao, Yifeng; Zhong, Tianfei; Wu, Dehong; Wang, Yumei; Wen, Chengping; Xie, Guan-Qun; Yao, Feng; Zhao, Heng; Fan, Yong-Sheng; Chin, Y. Eugene

    2015-01-01

    Cytokine or growth factor activated STAT3 undergoes multiple post-translational modifications, dimerization and translocation into nuclei, where it binds to serum-inducible element (SIE, ‘TTC(N3)GAA’)-bearing promoters to activate transcription. The STAT3 DNA binding domain (DBD, 320–494) mutation in hyper immunoglobulin E syndrome (HIES), called the HIES mutation (R382Q, R382W or V463Δ), which elevates IgE synthesis, inhibits SIE binding activity and sensitizes genes such as TNF-α for expression. However, the mechanism by which the HIES mutation sensitizes STAT3 in gene induction remains elusive. Here, we report that STAT3 binds directly to the AGG-element with the consensus sequence ‘AGG(N3)AGG’. Surprisingly, the helical N-terminal region (1–355), rather than the canonical STAT3 DBD, is responsible for AGG-element binding. The HIES mutation markedly enhances STAT3 AGG-element binding and AGG-promoter activation activity. Thus, STAT3 is a dual specificity transcription factor that promotes gene expression not only via SIE- but also AGG-promoter activity. PMID:26384563

  10. Cooperativity between the J and S elements of class II major histocompatibility complex genes as enhancers in normal and class II- negative patient and mutant B cell lines

    PubMed Central

    1995-01-01

    The class II major histocompatibility complex genes all contain in their proximal promoters three cis-elements called S, X, and Y that are conserved in both sequence and position, and a fourth element, J, conserved in sequence but not in position. J, X, and Y and, to some extent, S, have been shown to be functionally important in regulation of expression of these genes. In the present study, a protein factor that binds cooperatively to the S plus J elements of the promoter of the class II major histocompatibility complex gene DPA has been detected. Moreover, functional cooperativity between S and J in activation of the enhancerless -40 interferon-beta (-40 IFN-beta) promoter has been demonstrated. Finally, the latter assay appears to subdivide complementation group A of class II negative human B cell lines that includes both mutants generated in vitro and cells from patients with the bare lymphocyte syndrome (type II). In three of these cell lines, the enhancerless -40 IFN-beta promoter containing the S plus J elements was functionally active, while in the others it was inactive. PMID:7790817

  11. Shotgun metagenomics reveals a wide array of antibiotic resistance genes and mobile elements in a polluted lake in India

    PubMed Central

    Bengtsson-Palme, Johan; Boulund, Fredrik; Fick, Jerker; Kristiansson, Erik; Larsson, D. G. Joakim

    2014-01-01

    There is increasing evidence for an environmental origin of many antibiotic resistance genes. Consequently, it is important to identify environments of particular risk for selecting and maintaining such resistance factors. In this study, we described the diversity of antibiotic resistance genes in an Indian lake subjected to industrial pollution with fluoroquinolone antibiotics. We also assessed the genetic context of the identified resistance genes, to try to predict their genetic transferability. The lake harbored a wide range of resistance genes (81 identified gene types) against essentially every major class of antibiotics, as well as genes responsible for mobilization of genetic material. Resistance genes were estimated to be 7000 times more abundant than in a Swedish lake included for comparison, where only eight resistance genes were found. The sul2 and qnrD genes were the most common resistance genes in the Indian lake. Twenty-six known and 21 putative novel plasmids were recovered in the Indian lake metagenome, which, together with the genes found, indicate a large potential for horizontal gene transfer through conjugation. Interestingly, the microbial community of the lake still included a wide range of taxa, suggesting that, across most phyla, bacteria has adapted relatively well to this highly polluted environment. Based on the wide range and high abundance of known resistance factors we have detected, it is plausible that yet unrecognized resistance genes are also present in the lake. Thus, we conclude that environments polluted with waste from antibiotic manufacturing could be important reservoirs for mobile antibiotic resistance genes. PMID:25520706

  12. Gain of a New Exon by a Lineage-Specific Alu Element-Integration Event in the BCS1L Gene during Primate Evolution

    PubMed Central

    Park, Sang-Je; Kim, Young-Hyun; Lee, Sang-Rae; Choe, Se-Hee; Kim, Myung-Jin; Kim, Sun-Uk; Kim, Ji-Su; Sim, Bo-Woong; Song, Bong-Seok; Jeong, Kang-Jin; Jin, Yeung-Bae; Lee, Youngjeon; Park, Young-Ho; Park, Young Il; Huh, Jae-Won; Chang, Kyu-Tae

    2015-01-01

    BCS1L gene encodes mitochondrial protein and is a member of conserved AAA protein family. This gene is involved in the incorporation of Rieske FeS and Qcr10p into complex III of respiratory chain. In our previous study, AluYRa2-derived alternative transcript in rhesus monkey genome was identified. However, this transcript has not been reported in human genome. In present study, we conducted evolutionary analysis of AluYRa2-exonized transcript with various primate genomic DNAs and cDNAs from humans, rhesus monkeys, and crab-eating monkeys. Remarkably, our results show that AluYRa2 element has only been integrated into genomes of Macaca species. This Macaca lineage-specific integration of AluYRa2 element led to exonization event in the first intron region of BCS1L gene by producing a conserved 3′ splice site. Intriguingly, in rhesus and crab-eating monkeys, more diverse transcript variants by alternative splicing (AS) events, including exon skipping and different 5′ splice sites from humans, were identified. Alignment of amino acid sequences revealed that AluYRa2-exonized transcript has short N-terminal peptides. Therefore, AS events play a major role in the generation of various transcripts and proteins during primate evolution. In particular, lineage-specific integration of Alu elements and species-specific Alu-derived exonization events could be important sources of gene diversification in primates. PMID:26537194

  13. Functional analysis of peroxisome-proliferator-responsive element motifs in genes of fatty acid-binding proteins

    PubMed Central

    2004-01-01

    Retinoic acids and long-chain fatty acids are lipophilic agonists of nuclear receptors such as RXRs (retinoic X receptors) and PPARs (peroxisome-proliferator-activated receptors) respectively. These agonists are also ligands of intracellular lipid-binding proteins, which include FABPs (fatty acid-binding proteins). We reported previously that L (liver-type)-FABP targets fatty acids to the nucleus of hepatocytes and affects PPARα activation, which binds together with an RXR subtype to a PPRE (peroxisome-proliferator-responsive element). In the present study, we first determined the optimal combination of murine PPAR/RXR subtypes for binding to known murine FABP-PPREs and to those found by computer search and then tested their in vitro functionality. We show that all PPARs bind to L-FABP-PPRE, PPARα, PPARγ1 and PPARγ2 to A (adipocyte-type)-FABP-PPRE. All PPAR/RXR heterodimers transactivate L-FABP-PPRE, best are combinations of PPARα with RXRα or RXRγ. In contrast, PPARα heterodimers do not transactivate A-FABP-PPRE, best combinations are of PPARγ1 with RXRα and RXRγ, and of PPARγ2 with all RXR subtypes. We found that the predicted E (epidermal-type)- and H (heart-type)-FABP-PPREs are not activated by any PPAR/RXR combination without or with the PPAR pan-agonist bezafibrate. In the same way, C2C12 myoblasts transfected with promoter fragments of E-FABP and H-FABP genes containing putative PPREs are also not activated through stimulation of PPARs with bezafibrate applied to the cells. These results demonstrate that only PPREs of L- and A-FABP promoters are functional, and that binding of PPAR/RXR heterodimers to a PPRE in vitro does not necessarily predict transactivation. PMID:15130092

  14. Cloning and characterization of the dehydration-responsive element-binding protein 2A gene in Eruca vesicaria subsp sativa.

    PubMed

    Huang, B L; Zhang, X K; Li, Y Y; Li, D Y; Ma, M Y; Cai, D T; Wu, W H; Huang, B Q

    2016-01-01

    Eruca vesicaria subsp sativa is one of the most tolerant Cruciferae species to drought, and dehydration-responsive element-binding protein 2A (DREB2A) is involved in responses to salinity, heat, and particularly drought. In this study, a gene encoding EvDREB2A was cloned and characterized in E. vesicaria subsp sativa. The full-length EvDREB2A cDNA sequence contained a 388-bp 5'-untranslated region (UTR), a 348-bp 3'-UTR, and a 1002-bp open reading frame that encoded 334 amino acid residues. The theoretical isoelectric point of the EvDREB2A protein was 4.80 and the molecular weight was 37.64 kDa. The genomic sequence of EvDREB2A contained no introns. Analysis using SMART indicated that EvDREB2A contains a conserved AP2 domain, similar to other plant DREBs. Phylogenetic analysis revealed that EvDREB2A and DREB2As from Brassica rapa, Eutrema salsugineum, Arabidopsis thaliana, Arabidopsis lyrata, and Arachis hypogaea formed a small subgroup, which clustered with DREB2Bs from A. lyrata, A. thaliana, Camelina sativa, and B. rapa to form a larger subgroup. EvDREB2A is most closely related to B. rapa DREB2A, followed by DREB2As from E. salsugineum, A. thaliana, A. hypogaea, and A. lyrata. A quantitative real-time polymerase chain reaction indicated that EvDREB2A expression was highest in the leaves, followed by the roots and hypocotyls, and was lowest in the flower buds. EvDREB2A could be used to improve drought tolerance in crops.

  15. Intrauterine growth restriction perturbs nucleosome depletion at a growth hormone-responsive element in the mouse IGF-1 gene.

    PubMed

    McKnight, Robert A; Yost, Christian C; Yu, Xing; Wiedmeier, Julia E; Callaway, Christopher W; Brown, Ashley S; Lane, Robert H; Fung, Camille M

    2015-12-01

    Intrauterine growth restriction (IUGR) is a common human pregnancy complication. IUGR offspring carry significant postnatal risk for early-onset metabolic syndrome, which is associated with persistent reduction in IGF-1 protein expression. We have previously shown that preadolescent IUGR male mice have decreased hepatic IGF-1 mRNA and circulating IGF-1 protein at postnatal day 21, the age when growth hormone (GH) normally upregulates hepatic IGF-1 expression. Here we studied nucleosome occupancy and CpG methylation at a putative growth hormone-responsive element in intron 2 (in2GHRE) of the hepatic IGF-1 gene in normal, sham-operated, and IUGR mice. Nucleosome occupancy and CpG methylation were determined in embryonic stem cells (ESCs) and in liver at postnatal days 14, 21, and 42. For CpG methylation, additional time points out to 2 yr were analyzed. We confirmed the putative mouse in2GHRE was GH-responsive, and in normal mice, a single nucleosome was displaced from the hepatic in2GHRE by postnatal day 21, which exposed two STAT5b DNA binding sites. Nucleosome displacement correlated with developmentally programmed CpG demethylation. Finally, IUGR significantly altered the nucleosome-depleted region (NDR) at the in2GHRE of IGF-1 on postnatal day 21, with either complete absence of the NDR or with a shifted NDR exposing only one of two STAT5b DNA binding sites. An NDR shift was also seen in offspring of sham-operated mothers. We conclude that prenatal insult such as IUGR or anesthesia/surgery could perturb the proper formation of a well-positioned NDR at the mouse hepatic IGF-1 in2GHRE necessary for transitioning to an open chromatin state.

  16. Transcription of the Drosophila melanogaster 5S RNA gene requires an upstream promoter and four intragenic sequence elements

    SciTech Connect

    Sharp, S.J.; Garcia, A.D.

    1988-03-01

    Linker-scanning (LS) mutations were constructed spanning the length of the Drosophila melanogaster 5S RNA gene. In vitro transcription analysis of the LS 5S DNAs revealed five transcription control regions. One control region essential for the transcription initiation was identified in the 5'-flanking sequence. The major sequence determinants of this upstream promoter region were located between coordinates -39 and -26 (-30 region), but important sequences extended to the transcription start site at position 1. Since mutations in the upstream promoter did not alter the ability of 5S DNA to sequester transcription factors into a stable transcription complex, it appears that this control region involved the interaction of RNA polymerase III. Active 5S DNA transcription additionally required the four intragenic control regions (ICRs) located between coordinates 3 and 18 (ICR I), 37 and 44 (ICR II), 48 and 61 (ICR III), and 78 and 98 (ICR IV). LS mutations in each ICR decreased the ability of 5S DNA to sequester transcription factors. ICR III, ICR IV, and the spacer sequence between were similar in sequence and position to the determinant elements of the multipartite ICR of Xenopus 5S DNA. The importance of ICR III and ICR IV in transcription initiation and in sequestering transcription factors suggests the presence of an activity in D. melanogaster similar to transcription factor TFIIIA of Xenopus laevis and HeLa cells. Transcription initiation of Drosophila 5S DNA was not eliminated by LS mutations in the spacer region even though these mutations reduced the ability of the TFIIIA-like activity to bind.

  17. Intrauterine growth restriction perturbs nucleosome depletion at a growth hormone-responsive element in the mouse IGF-1 gene.

    PubMed

    McKnight, Robert A; Yost, Christian C; Yu, Xing; Wiedmeier, Julia E; Callaway, Christopher W; Brown, Ashley S; Lane, Robert H; Fung, Camille M

    2015-12-01

    Intrauterine growth restriction (IUGR) is a common human pregnancy complication. IUGR offspring carry significant postnatal risk for early-onset metabolic syndrome, which is associated with persistent reduction in IGF-1 protein expression. We have previously shown that preadolescent IUGR male mice have decreased hepatic IGF-1 mRNA and circulating IGF-1 protein at postnatal day 21, the age when growth hormone (GH) normally upregulates hepatic IGF-1 expression. Here we studied nucleosome occupancy and CpG methylation at a putative growth hormone-responsive element in intron 2 (in2GHRE) of the hepatic IGF-1 gene in normal, sham-operated, and IUGR mice. Nucleosome occupancy and CpG methylation were determined in embryonic stem cells (ESCs) and in liver at postnatal days 14, 21, and 42. For CpG methylation, additional time points out to 2 yr were analyzed. We confirmed the putative mouse in2GHRE was GH-responsive, and in normal mice, a single nucleosome was displaced from the hepatic in2GHRE by postnatal day 21, which exposed two STAT5b DNA binding sites. Nucleosome displacement correlated with developmentally programmed CpG demethylation. Finally, IUGR significantly altered the nucleosome-depleted region (NDR) at the in2GHRE of IGF-1 on postnatal day 21, with either complete absence of the NDR or with a shifted NDR exposing only one of two STAT5b DNA binding sites. An NDR shift was also seen in offspring of sham-operated mothers. We conclude that prenatal insult such as IUGR or anesthesia/surgery could perturb the proper formation of a well-positioned NDR at the mouse hepatic IGF-1 in2GHRE necessary for transitioning to an open chromatin state. PMID:26487705

  18. Cloning and characterization of the dehydration-responsive element-binding protein 2A gene in Eruca vesicaria subsp sativa.

    PubMed

    Huang, B L; Zhang, X K; Li, Y Y; Li, D Y; Ma, M Y; Cai, D T; Wu, W H; Huang, B Q

    2016-01-01

    Eruca vesicaria subsp sativa is one of the most tolerant Cruciferae species to drought, and dehydration-responsive element-binding protein 2A (DREB2A) is involved in responses to salinity, heat, and particularly drought. In this study, a gene encoding EvDREB2A was cloned and characterized in E. vesicaria subsp sativa. The full-length EvDREB2A cDNA sequence contained a 388-bp 5'-untranslated region (UTR), a 348-bp 3'-UTR, and a 1002-bp open reading frame that encoded 334 amino acid residues. The theoretical isoelectric point of the EvDREB2A protein was 4.80 and the molecular weight was 37.64 kDa. The genomic sequence of EvDREB2A contained no introns. Analysis using SMART indicated that EvDREB2A contains a conserved AP2 domain, similar to other plant DREBs. Phylogenetic analysis revealed that EvDREB2A and DREB2As from Brassica rapa, Eutrema salsugineum, Arabidopsis thaliana, Arabidopsis lyrata, and Arachis hypogaea formed a small subgroup, which clustered with DREB2Bs from A. lyrata, A. thaliana, Camelina sativa, and B. rapa to form a larger subgroup. EvDREB2A is most closely related to B. rapa DREB2A, followed by DREB2As from E. salsugineum, A. thaliana, A. hypogaea, and A. lyrata. A quantitative real-time polymerase chain reaction indicated that EvDREB2A expression was highest in the leaves, followed by the roots and hypocotyls, and was lowest in the flower buds. EvDREB2A could be used to improve drought tolerance in crops. PMID:27525923

  19. Identification and characterization of cis-acting elements conferring insulin responsiveness on hamster cholesterol 7alpha-hydroxylase gene promoter.

    PubMed Central

    De Fabiani, E; Crestani, M; Marrapodi, M; Pinelli, A; Golfieri, V; Galli, G

    2000-01-01

    Bile acid biosynthesis occurs primarily through a pathway initiated by the 7alpha-hydroxylation of cholesterol, catalysed by cholesterol 7alpha-hydroxylase (encoded by CYP7A1). Insulin down-regulates CYP7A1 transcription. The aim of our study was to characterize the sequences of hamster CYP7A1 promoter, mediating the response to insulin. We therefore performed transient transfection assays with CYP7A1 promoter/luciferase chimaeras mutated at putative response elements and studied protein-DNA interactions by means of gel electrophoresis mobility-shift assay. Here we show that two sequences confer insulin responsiveness on hamster CYP7A1 promoter: a canonical insulin response sequence TGTTTTG overlapping a binding site for hepatocyte nuclear factor 3 (HNF-3) (at nt -235 to -224) and a binding site for HNF-4 at nt -203 to -191. In particular we show that the hamster CYP7A1 insulin response sequence is part of a complex unit involved in specific interactions with multiple transcription factors such as members of the HNF-3 family; this region does not bind very strongly to HNF-3 and as a consequence partly contributes to the transactivation of the gene. Another sequence located at nt -138 to -128 binds to HNF-3 and is involved in the tissue-specific regulation of hamster CYP7A1. The sequence at nt -203 to -191 is not only essential for insulin effect but also has a major role in the liver-specific expression of CYP7A1; it is the target of HNF-4. Therefore the binding sites for liver-enriched factors, present in the hamster CYP7A1 proximal promoter in close vicinity and conserved between species, constitute a regulatory unit important for basal hepatic expression and tissue restriction of the action of hormones such as insulin. PMID:10727413

  20. Missense and silent tau gene mutations cause frontotemporal dementia with parkinsonism-chromosome 17 type, by affecting multiple alternative RNA splicing regulatory elements.

    PubMed

    D'Souza, I; Poorkaj, P; Hong, M; Nochlin, D; Lee, V M; Bird, T D; Schellenberg, G D

    1999-05-11

    Frontotemporal dementia with parkinsonism, chromosome 17 type (FTDP-17) is caused by mutations in the tau gene, and the signature lesions of FTDP-17 are filamentous tau inclusions. Tau mutations may be pathogenic either by altering protein function or gene regulation. Here we show that missense, silent, and intronic tau mutations can increase or decrease splicing of tau exon 10 (E10) by acting on 3 different cis-acting regulatory elements. These elements include an exon splicing enhancer that can either be strengthened (mutation N279(K)) or destroyed (mutation Delta280(K)), resulting in either constitutive E10 inclusion or the exclusion of E10 from tau transcripts. E10 contains a second regulatory element that is an exon splicing silencer, the function of which is abolished by a silent FTDP-17 mutation (L284(L)), resulting in excess E10 inclusion. A third element inhibiting E10 splicing is contained in the intronic sequences directly flanking the 5' splice site of E10 and intronic FTDP-17 mutations in this element enhance E10 inclusion. Thus, tau mutations cause FTDP-17 by multiple pathological mechanisms, which may explain the phenotypic heterogeneity observed in FTDP-17, as exemplified by an unusual family described here with tau pathology as well as amyloid and neuritic plaques.

  1. Ty1 Integrase Interacts with RNA Polymerase III-specific Subcomplexes to Promote Insertion of Ty1 Elements Upstream of Polymerase (Pol) III-transcribed Genes.

    PubMed

    Cheung, Stephanie; Ma, Lina; Chan, Patrick H W; Hu, Hui-Lan; Mayor, Thibault; Chen, Hung-Ta; Measday, Vivien

    2016-03-18

    Retrotransposons are eukaryotic mobile genetic elements that transpose by reverse transcription of an RNA intermediate and are derived from retroviruses. The Ty1 retrotransposon of Saccharomyces cerevisiae belongs to the Ty1/Copia superfamily, which is present in every eukaryotic genome. Insertion of Ty1 elements into the S. cerevisiae genome, which occurs upstream of genes transcribed by RNA Pol III, requires the Ty1 element-encoded integrase (IN) protein. Here, we report that Ty1-IN interacts in vivo and in vitro with RNA Pol III-specific subunits to mediate insertion of Ty1 elements upstream of Pol III-transcribed genes. Purification of Ty1-IN from yeast cells followed by mass spectrometry (MS) analysis identified an enrichment of peptides corresponding to the Rpc82/34/31 and Rpc53/37 Pol III-specific subcomplexes. GFP-Trap purification of multiple GFP-tagged RNA Pol III subunits from yeast extracts revealed that the majority of Pol III subunits co-purify with Ty1-IN but not two other complexes required for Pol III transcription, transcription initiation factors (TF) IIIB and IIIC. In vitro binding studies with bacterially purified RNA Pol III proteins demonstrate that Rpc31, Rpc34, and Rpc53 interact directly with Ty1-IN. Deletion of the N-terminal 280 amino acids of Rpc53 abrogates insertion of Ty1 elements upstream of the hot spot SUF16 tRNA locus and abolishes the interaction of Ty1-IN with Rpc37. The Rpc53/37 complex therefore has an important role in targeting Ty1-IN to insert Ty1 elements upstream of Pol III-transcribed genes. PMID:26797132

  2. Lithium induces gene expression through lymphoid enhancer-binding factor/T-cell factor responsive element in rat PC12 cells.

    PubMed

    Bettini, Ezio; Magnani, Enrico; Terstappen, Georg C

    2002-01-01

    Lithium inhibits glycogen synthase kinase-3 (GSK-3), which leads to an increase of cytoplasmic beta-catenin levels. In some cell types, but not in others, activated beta-catenin interacts with members of the lymphoid enhancer-binding factor (LEF)/T-cell factor (TCF) family of transcription factors and induces gene expression. Lithium effect on LEF/TCF-mediated gene expression has never been evaluated in cells with a neuronal phenotype. We have constructed a LEF/TCF-dependent luciferase reporter gene to investigate lithium effects on transcription in PC12 cells. In transiently transfected PC12 cells, lithium induced a time-dependent increase in LEF/TCF-mediated luciferase activity. These results are consistent with the known inhibitory effects of lithium on GSK-3 and represent the first demonstration that a LEF/TCF responsive element also mediates lithium-induced gene expression in PC12 cells.

  3. Drosophila TDP-43 RNA-Binding Protein Facilitates Association of Sister Chromatid Cohesion Proteins with Genes, Enhancers and Polycomb Response Elements

    PubMed Central

    Misulovin, Ziva; Gause, Maria; Rickels, Ryan A; Shilatifard, Ali

    2016-01-01

    The cohesin protein complex mediates sister chromatid cohesion and participates in transcriptional control of genes that regulate growth and development. Substantial reduction of cohesin activity alters transcription of many genes without disrupting chromosome segregation. Drosophila Nipped-B protein loads cohesin onto chromosomes, and together Nipped-B and cohesin occupy essentially all active transcriptional enhancers and a large fraction of active genes. It is unknown why some active genes bind high levels of cohesin and some do not. Here we show that the TBPH and Lark RNA-binding proteins influence association of Nipped-B and cohesin with genes and gene regulatory sequences. In vitro, TBPH and Lark proteins specifically bind RNAs produced by genes occupied by Nipped-B and cohesin. By genomic chromatin immunoprecipitation these RNA-binding proteins also bind to chromosomes at cohesin-binding genes, enhancers, and Polycomb response elements (PREs). RNAi depletion reveals that TBPH facilitates association of Nipped-B and cohesin with genes and regulatory sequences. Lark reduces binding of Nipped-B and cohesin at many promoters and aids their association with several large enhancers. Conversely, Nipped-B facilitates TBPH and Lark association with genes and regulatory sequences, and interacts with TBPH and Lark in affinity chromatography and immunoprecipitation experiments. Blocking transcription does not ablate binding of Nipped-B and the RNA-binding proteins to chromosomes, indicating transcription is not required to maintain binding once established. These findings demonstrate that RNA-binding proteins help govern association of sister chromatid cohesion proteins with genes and enhancers. PMID:27662615

  4. SP1-binding elements, within the common metaxin-thrombospondin 3 intergenic region, participate in the regulation of the metaxin gene.

    PubMed Central

    Collins, M; Bornstein, P

    1996-01-01

    Metaxin (Mtx) is an essential nuclear gene which is expressed ubiquitously in mice and encodes a mitochondrial protein. The gene is located upstream and is transcribed divergently from the thrombospondin 3 (Thbs3) gene; 1352 nucleotides separate the putative translation start sites. Although the Mtx and Thbs3 genes share a common intergenic region, transient transfection experiments in rat chondro-sarcoma cells and in NIH-3T3 fibroblasts demonstrated that the elements required for expression of the Mtx gene are situated within a short proximal promoter and have no major effect on the transcription of Thbs3. The metaxin --377 bp promoter contains four clustered GC boxes between nucleotides --146 and --58 and an inverted GT box between nucleotides --152 and --161, but does not contain TATA or CCAAT boxes. Like many genes regulated by a TATA-less promoter, the transcription start site of metaxin is heterogeneous. The major start site is only 13 bp upstream from the putative translation start site. Electrophoretic mobility shift, competition and supershift assays showed that the ubiquitous transcription factor, Sp1, and, to a lesser extent, the Sp1-related protein, Sp3, bind to four of these Sp1-binding motifs. Co-transfection of metaxin promoter-luciferase constructs and an Sp1 expression vector into Schneider Drosophila cells, which do not synthesize Sp1, demonstrated that the metaxin gene is activated by Sp1. Deletion of the four upstream Sp1-binding elements, on the other hand, demonstrated that these motifs are superfluous in context of the larger Mtx promoter. Thus, despite the potential for common regulatory mechanisms, the available evidence indicates that the Mtx minimal promoter does not significantly affect Thbs3 gene expression. PMID:8871542

  5. GmDREB2A;2, a canonical DEHYDRATION-RESPONSIVE ELEMENT-BINDING PROTEIN2-type transcription factor in soybean, is posttranslationally regulated and mediates dehydration-responsive element-dependent gene expression.

    PubMed

    Mizoi, Junya; Ohori, Teppei; Moriwaki, Takashi; Kidokoro, Satoshi; Todaka, Daisuke; Maruyama, Kyonoshin; Kusakabe, Kazuya; Osakabe, Yuriko; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2013-01-01

    Soybean (Glycine max) is an important crop around the world. Abiotic stress conditions, such as drought and heat, adversely affect its survival, growth, and production. The DEHYDRATION-RESPONSIVE ELEMENT-BINDING PROTEIN2 (DREB2) group includes transcription factors that contribute to drought and heat stress tolerance by activating transcription through the cis-element dehydration-responsive element (DRE) in response to these stress stimuli. Two modes of regulation, transcriptional and posttranslational, are important for the activation of gene expression by DREB2A in Arabidopsis (Arabidopsis thaliana). However, the regulatory system of DREB2 in soybean is not clear. We identified a new soybean DREB2 gene, GmDREB2A;2, that was highly induced not only by dehydration and heat but also by low temperature. GmDREB2A;2 exhibited a high transactivation activity via DRE and has a serine/threonine-rich region, which corresponds to a negative regulatory domain of DREB2A that is involved in its posttranslational regulation, including destabilization. Despite the partial similarity between these sequences, the activity and stability of the GmDREB2A;2 protein were enhanced by removal of the serine/threonine-rich region in both Arabidopsis and soybean protoplasts, suggestive of a conserved regulatory mechanism that involves the recognition of serine/threonine-rich sequences with a specific pattern. The heterologous expression of GmDREB2A;2 in Arabidopsis induced DRE-regulated stress-inducible genes and improved stress tolerance. However, there were variations in the growth phenotypes of the transgenic Arabidopsis, the induced genes, and their induction ratios between GmDREB2A;2 and DREB2A. Therefore, the basic function and regulatory machinery of DREB2 have been maintained between Arabidopsis and soybean, although differentiation has also occurred.

  6. Molecular structure of the chicken vitamin D-induced calbindin-D28K gene reveals eleven exons, six Ca2+-binding domains, and numerous promoter regulatory elements.

    PubMed

    Minghetti, P P; Cancela, L; Fujisawa, Y; Theofan, G; Norman, A W

    1988-04-01

    The seco-steroid hormone 1,25-dihydroxyvitamin D3 is known to induce the expression of a calcium binding protein termed calbindin-D28K in a variety of target tissues. In order to comprehend the mechanism of induction we have cloned and sequenced the chicken calbindin-D28K gene. The gene spans some 18.5 kilobases (kb) of chromosomal DNA from the putative Cap site to the polyadenylation site of the 2.8 kb mRNA. It is split into 11 coding exons by 10 intervening sequences. The promoter region of this gene is markedly G + C-rich (60-80%) extending from -225 to +400. Within this region we find 70 CpG dinucleotides, four G-C boxes, and numerous known promoter regulatory signals. These putative regulatory signals include a TATA box (ATAAATA) at -30 and a CAT box (CCAAT) at -326. Ten additional variant CAT boxes are found in the upstream promoter region (-218 to -770) of this gene. Furthermore we have identified a glucocorticoid-like responsive element at -410 (TCTACACACTGTTCC) and this element overlaps a metal responsive element (TGCACTC) and a variant CAT box (CCAAAT) and juxtaposes an enhancer-like core element (AAATGGT) on its 3'-side. In addition, the calbindin-D28K promoter is composed of a variety of simple repeated sequences, some of which are components of putative regulatory signals. All splice junctions were found to conform to the GT-AG rule. A consensus sequence of the 5'-splice junction reads AG/GTAAG-TTATA. A consensus sequence of the 3'-splice site consists of two elements: a pyrimidine track (mainly T) followed by ACAG/G-T. A two-dimensional model of calbindin-D28K was constructed which projects the existence of 6 alpha-helix-loop-alpha-helix regions characteristic of calcium binding domains. The 3'-end of the gene consists of a single large (2039 base pair) uninterrupted exon, an organizational feature common to other members of the calcium binding protein gene family which include calmodulin, parvalbumin, Spec I, myosin light chains, etc. Another feature

  7. RNA-seq-Based Gene Annotation and Comparative Genomics of Four Fungal Grass Pathogens in the Genus Zymoseptoria Identify Novel Orphan Genes and Species-Specific Invasions of Transposable Elements.

    PubMed

    Grandaubert, Jonathan; Bhattacharyya, Amitava; Stukenbrock, Eva H

    2015-04-27

    The fungal pathogen Zymoseptoria tritici (synonym Mycosphaerella graminicola) is a prominent pathogen of wheat. The reference genome of the isolate IPO323 is one of the best-assembled eukaryotic genomes and encodes more than 10,000 predicted genes. However, a large proportion of the previously annotated gene models are incomplete, with either no start or no stop codons. The availability of RNA-seq data allows better predictions of gene structure. We here used two different RNA-seq datasets, de novo transcriptome assemblies, homology-based comparisons, and trained ab initio gene callers to generate a new gene annotation of Z. tritici IPO323. The annotation pipeline was also applied to re-sequenced genomes of three closely related species of Z. tritici: Z. pseudotritici, Z. ardabiliae, and Z. brevis. Comparative analyses of the predicted gene models using the four Zymoseptoria species revealed sets of species-specific orphan genes enriched with putative pathogenicity-related genes encoding small secreted proteins that may play essential roles in virulence and host specificity. De novo repeat identification allowed us to show that few families of transposable elements are shared between Zymoseptoria species while we observe many species-specific invasions and expansions. The annotation data presented here provide a high-quality resource for future studies of Z. tritici and its sister species and provide detailed insight into gene and genome evolution of fungal plant pathogens.

  8. Overlapping protein-binding sites within a negative regulatory element modulate the brain-preferential expression of the human HPRT gene

    SciTech Connect

    Rincon-Limas, D.E.; Amaya-Manzanares, E.; Nino-Rosales, M.L.

    1994-09-01

    The hypoxanthine phosphoribosyltransferase (HPRT) gene, whose deficiency in humans causes the Lesch-Nyhan syndrome, is constitutively expressed at low levels in all tissues but at higher levels in the brain, the significance and mechanism of which is unknown. Towards dissecting this molecular mechanism, we have previously identified a 182 bp element (hHPRT-NE) within the 5{prime}-flanking region of the human HPRT gene which is involved not only in conferring neuronal specificity but also in repressing gene expression in non-neuronal tissues. Here we report that this element interacts with different nuclear proteins, some of which are present specifically in neuronal cells (complex I) and others of which are present in cells showing constitutive expression of the gene (complex II). In addition, we found that complex I factors are expressed in human NT2/D1 cells following induction of neuronal differentiation by retinoic acid. This finding correlates with an increase of HPRT gene transcription following neuronal differentiation, as demonstrated by RT-PCR and RNAase protection assays. We also mapped the binding sites for both complexes to a 60 bp region which, when tested by transient transfections in cultured fibroblasts, functioned as a repressor element. Methylation interference footprinting revealed a minimal unique DNA motif as the binding site for nuclear proteins from both neuronal and non-neuronal sources. Moreover, UV-crosslinking experiments showed that both complexes are formed by the association of several distinct proteins. Strikingly, site-directed mutagenesis of the footprinted region indicated that different nucleotides are essential for the association of these two complexes. These data suggest that differential formation of DNA-protein complexes at this regulatory domain could be a major determinant in the brain-preferential expression of the human HPRT gene.

  9. S2F, a leaf-specific trans-acting factor, binds to a novel cis-acting element and differentially activates the RPL21 gene.

    PubMed Central

    Lagrange, T; Gauvin, S; Yeo, H J; Mache, R

    1997-01-01

    Tissue-specific factors control the differential expression of nuclear genes encoding plastid proteins. To identify some of these factors, the light-independent spinach RPL21 gene encoding the plastid ribosomal protein L21 was chosen as a model. The RPL21 promoter organization was defined by transient and stable transfections of RPL21 promoter deletion mutants fused to a reporter gene. The following results were obtained. (1) We identified a strong core promoter, spanning the transcription start site region, sufficient to drive high levels of gene expression. (2) We identified two non-overlapping positive and negative domains, located upstream from the core promoter region, that modulate core promoter activity independently of light. (3) We found that the positive domain contains a new cis-acting element, the S2 site, related to but different from the light-responsive GT-1 binding site. We show that the S2 site binds a leaf-specific nuclear factor (named S2F). The S2 site is conserved in the promoter region of many nuclear genes encoding plastid proteins. Experiments with transgenic tobacco plants confirmed that the S2 site is critical for positive domain activity in leaf tissues. The S2 site is thus identified as a new tissue-specific, light-independent regulatory element. PMID:9286115

  10. Antisense targeting of 3' end elements involved in DUX4 mRNA processing is an efficient therapeutic strategy for facioscapulohumeral dystrophy: a new gene-silencing approach.

    PubMed

    Marsollier, Anne-Charlotte; Ciszewski, Lukasz; Mariot, Virginie; Popplewell, Linda; Voit, Thomas; Dickson, George; Dumonceaux, Julie

    2016-04-15

    Defects in mRNA 3'end formation have been described to alter transcription termination, transport of the mRNA from the nucleus to the cytoplasm, stability of the mRNA and translation efficiency. Therefore, inhibition of polyadenylation may lead to gene silencing. Here, we choose facioscapulohumeral dystrophy (FSHD) as a model to determine whether or not targeting key 3' end elements involved in mRNA processing using antisense oligonucleotide drugs can be used as a strategy for gene silencing within a potentially therapeutic context. FSHD is a gain-of-function disease characterized by the aberrant expression of the Double homeobox 4 (DUX4) transcription factor leading to altered pathogenic deregulation of multiple genes in muscles. Here, we demonstrate that targeting either the mRNA polyadenylation signal and/or cleavage site is an efficient strategy to down-regulate DUX4 expression and to decrease the abnormally high-pathological expression of genes downstream of DUX4. We conclude that targeting key functional 3' end elements involved in pre-mRNA to mRNA maturation with antisense drugs can lead to efficient gene silencing and is thus a potentially effective therapeutic strategy for at least FSHD. Moreover, polyadenylation is a crucial step in the maturation of almost all eukaryotic mRNAs, and thus all mRNAs are virtually eligible for this antisense-mediated knockdown strategy. PMID:26787513

  11. [Preparation and primary genetic analysis of Drosophila melanogaster transformants line w'lz(b)/XXywf, containing mini-white genes, integrated in the genome during P-element-dependent transformation].

    PubMed

    Prokhorova, A V; Voloshina, M A; Shostak, N G; Barskiĭ, V E; Golubovskiĭ, M D

    1994-07-01

    Transformation of Drosophila melanogaster using P-element-based vectors yielded 129 sublines, which carried mini-white gene copies in the different genome regions. Dependence of mini-white gene expression on the location, gene dosage, and sex of the transformed individuals was analyzed. The mutation lzb was shown to suppress mini-white gene expression, the degree of suppression depending on the location and dosage of the mini-white gene. PMID:7958802

  12. Excision of transposable elements from the chalcone isomerase and dihydroflavonol 4-reductase genes may contribute to the variegation of the yellow-flowered carnation (Dianthus caryophyllus).

    PubMed

    Itoh, Yoshio; Higeta, Daisuke; Suzuki, Akane; Yoshida, Hiroyuki; Ozeki, Yoshihiro

    2002-05-01

    In the "Rhapsody" cultivar of the carnation, which bears white flowers variegated with red flecks and sectors, a transposable element, dTdic1, belonging to the Ac/Ds superfamily, was found within the dihydroflavonol 4-reductase (DFR) gene. The red flecks and sectors of "Rhapsody" may be attributable to a reversion to DFR activity after the excision of dTdic1. The yellow color of the carnation petals is attributed to the synthesis and accumulation of chalcone 2'-glucoside. In several of the carnation cultivars that bear yellow flowers variegated with white flecks and sectors, both the chalcone isomerase (CHI) and DFR genes are disrupted by dTdic1.

  13. Eradication of Myc-overexpressing small cell lung cancer cells transfected with herpes simplex virus thymidine kinase gene containing Myc-Max response elements.

    PubMed

    Kumagai, T; Tanio, Y; Osaki, T; Hosoe, S; Tachibana, I; Ueno, K; Kijima, T; Horai, T; Kishimoto, T

    1996-01-15

    Herpes simplex virus thymidine kinase (HSV-TK) gene was ligated with four repeats of the Myc-Max response elements (a core nucleotide sequence CACGTG), and its utility for gene therapy was examined by the treatment of either c-, L- or N-myc-overexpressing the small cell lung cancer (SCLC) cell line with ganciclovir (GCV). The chloramphenicol acetyltransferase assay demonstrated that the overexpression of any myc genes activated transcription from the CAT gene depending on the Myc-Max binding sites. The transduction of the HSV-TK gene ligated with the CACGTG core rendered all three SCLC lines to be more sensitive to GCV than parental ones in vitro. In addition, the growth of c- or L-myc-overexpressing SCLC cells containing the hybrid HSV-TK gene were significantly suppressed by GCV in vivo. When parental SCLC cells were mixed with HSV-TK-expressing tumor cells at a ratio of 1:3, GCV treatment inhibited tumor growth by 90% compared with parental cells only, indicating the existence of the "bystander effect." These data suggest that the CACGTG-driven HSV-TK gene may be useful for the treatment of SCLC overexpressing any type of myc family oncogenes.

  14. Short interspersed nuclear elements (SINEs) are abundant in Solanaceae and have a family-specific impact on gene structure and genome organization.

    PubMed

    Seibt, Kathrin M; Wenke, Torsten; Muders, Katja; Truberg, Bernd; Schmidt, Thomas

    2016-05-01

    Short interspersed nuclear elements (SINEs) are highly abundant non-autonomous retrotransposons that are widespread in plants. They are short in size, non-coding, show high sequence diversity, and are therefore mostly not or not correctly annotated in plant genome sequences. Hence, comparative studies on genomic SINE populations are rare. To explore the structural organization and impact of SINEs, we comparatively investigated the genome sequences of the Solanaceae species potato (Solanum tuberosum), tomato (Solanum lycopersicum), wild tomato (Solanum pennellii), and two pepper cultivars (Capsicum annuum). Based on 8.5 Gbp sequence data, we annotated 82 983 SINE copies belonging to 10 families and subfamilies on a base pair level. Solanaceae SINEs are dispersed over all chromosomes with enrichments in distal regions. Depending on the genome assemblies and gene predictions, 30% of all SINE copies are associated with genes, particularly frequent in introns and untranslated regions (UTRs). The close association with genes is family specific. More than 10% of all genes annotated in the Solanaceae species investigated contain at least one SINE insertion, and we found genes harbouring up to 16 SINE copies. We demonstrate the involvement of SINEs in gene and genome evolution including the donation of splice sites, start and stop codons and exons to genes, enlargement of introns and UTRs, generation of tandem-like duplications and transduction of adjacent sequence regions.

  15. Human Papillomavirus E6 Knockdown Restores Adenovirus Mediated-estrogen Response Element Linked p53 Gene Transfer in HeLa Cells.

    PubMed

    Kajitani, Koji; Honda, Ken-Ichi; Terada, Hiroyuki; Yasui, Tomoyo; Sumi, Toshiyuki; Koyama, Masayasu; Ishiko, Osamu

    2015-01-01

    The p53 gene is inactivated by the human papillomavirus (HPV) E6 protein in the majority of cervical cancers. Treatment of HeLa S3 cells with siRNA for HPV E6 permitted adenovirus-mediated transduction of a p53 gene linked to an upstream estrogen response element (ERE). Our previous study in non-siRNA treated HHUA cells, which are derived from an endometrial cancer and express estrogen receptor β, showed enhancing effects of an upstream ERE on adenovirus-mediated p53 gene transduction. In HeLa S3 cells treated with siRNA for HPV E6, adenovirus-mediated transduction was enhanced by an upstream ERE linked to a p53 gene carrying a proline variant at codon 72, but not for a p53 gene with arginine variant at codon 72. Expression levels of p53 mRNA and Coxsackie/adenovirus receptor (CAR) mRNA after adenovirus-mediated transfer of an ERE-linked p53 gene (proline variant at codon 72) were higher compared with those after non-ERE-linked p53 gene transfer in siRNA-treated HeLa S3 cells. Western blot analysis showed lower β-tubulin levels and comparatively higher p53/β-tubulin or CAR /β-tubulin ratios in siRNA-treated HeLa S3 cells after adenovirus-mediated ERE-linked p53 gene (proline variant at codon 72) transfer compared with those in non-siRNA-treated cells. Apoptosis, as measured by annexin V binding, was higher after adenovirus-mediated ERE-linked p53 gene (proline variant at codon 72) transfer compared with that after non-ERE-linked p53 gene transfer in siRNA-treated cells.

  16. Confined housing system increased abdominal and subcutaneous fat deposition and gene expressions of carbohydrate response element-binding protein and sterol regulatory element-binding protein 1 in chicken.

    PubMed

    Li, Q; Zhao, X L; Gilbert, E R; Liu, Y P; Wang, Y; Qiu, M H; Zhu, Q

    2015-01-01

    Free-range production system is increasingly being used in poultry breeding and feed production in many countries. The objective of the current experiment was to evaluate the effects of different raising systems on fat-related traits and mRNA levels of liver lipogenesis genes in Erlang Mountainous chicken. Each of 10 birds (91 day old) from caged, indoor-floor housed, and free-range housing systems was slaughtered, and fat-related traits, live body weight (BW), subcutaneous fat thickness (SFT), abdominal fat weight (AFW), abdominal fat percentage (AFP), and intramuscular fat content were determined. The mRNA levels of liver X receptor α, carbohydrate response element-binding protein (ChREBP), sterol regulatory element-binding protein-1 (SREBP1), and fatty acid synthase were detected. The caged chicken exhibited significantly higher BW, SFT, and AFW than those of free-ranged chicken (P < 0.05). All the 4 genes had a similar expression pattern, and they showed the highest level in caged chicken, while the lowest level was found in free-ranged chicken. Association analysis indicated that there were significant (P < 0.05) or highly significant (P < 0.01) positive correlations between the mRNA levels of ChREBP, SREBP1, and fat traits of SFT, AFW, and AFP. Thus, we deduced that increased fat deposition in caged chicken was probably induced by increased gene expression of ChREBP and SREBP1 in the liver. PMID:25730060

  17. Confined housing system increased abdominal and subcutaneous fat deposition and gene expressions of carbohydrate response element-binding protein and sterol regulatory element-binding protein 1 in chicken.

    PubMed

    Li, Q; Zhao, X L; Gilbert, E R; Liu, Y P; Wang, Y; Qiu, M H; Zhu, Q

    2015-02-06

    Free-range production system is increasingly being used in poultry breeding and feed production in many countries. The objective of the current experiment was to evaluate the effects of different raising systems on fat-related traits and mRNA levels of liver lipogenesis genes in Erlang Mountainous chicken. Each of 10 birds (91 day old) from caged, indoor-floor housed, and free-range housing systems was slaughtered, and fat-related traits, live body weight (BW), subcutaneous fat thickness (SFT), abdominal fat weight (AFW), abdominal fat percentage (AFP), and intramuscular fat content were determined. The mRNA levels of liver X receptor α, carbohydrate response element-binding protein (ChREBP), sterol regulatory element-binding protein-1 (SREBP1), and fatty acid synthase were detected. The caged chicken exhibited significantly higher BW, SFT, and AFW than those of free-ranged chicken (P < 0.05). All the 4 genes had a similar expression pattern, and they showed the highest level in caged chicken, while the lowest level was found in free-ranged chicken. Association analysis indicated that there were significant (P < 0.05) or highly significant (P < 0.01) positive correlations between the mRNA levels of ChREBP, SREBP1, and fat traits of SFT, AFW, and AFP. Thus, we deduced that increased fat deposition in caged chicken was probably induced by increased gene expression of ChREBP and SREBP1 in the liver.

  18. Goblet-cell-specific transcription of mouse intestinal trefoil factor gene results from collaboration of complex series of positive and negative regulatory elements.

    PubMed Central

    Itoh, H; Inoue, N; Podolsky, D K

    1999-01-01

    Intestinal trefoil factor (ITF) is expressed selectively in intestinal goblet cells. Previous studies of the rat ITF gene identified one cis-regulatory element, designated the goblet-cell-response element (GCRE), present in the proximal region of the promoter. To identify additional cis-regulatory elements responsible for goblet-cell-specific expression, a DNA fragment containing 6353 bp of the 5'-flanking region of the mouse ITF gene was cloned and its promoter activity was examined extensively. In human and murine intestinal-derived cell lines (LS174T and CMT-93), the luciferase activities of a 6.3-kb construct were 5- and 2-fold greater than the smaller 1.8-kb construct, respectively. In contrast, the activity in non-intestinal cell lines (HepG2 and HeLa) was 2-4-fold lower than the smaller construct. In the region downstream from the 1.8-kb position, strong luciferase activities in LS174T and HepG2 cells were observed using a 201-bp construct. Interestingly, increased activity was almost completely suppressed in cells transfected with a 391-bp construct. Detailed analyses of this region revealed the existence of a 11-bp positive regulatory element (-181 to -170; ACCTCTTCCTG) and a 9-bp negative regulatory element (-208 to -200; ATTGACAGA) in addition to the GCRE. All three elements were well conserved among human, rat and mouse ITF gene promoters. In addition, a mutant 1.8-kb construct in which the negative regulatory region was deleted yielded the same approximate luciferase activity as a 6.3-kb construct, suggesting binding of a goblet-cell-specific silencer inhibitor (SI) between -6.3 and -1.8 kb. The SI present in goblet cells may block the silencers' binding to the pre-initiation complex and allow increased transcriptional activity driven by specific and non-specific enhancers. High-level expression of the mouse ITF gene specifically in intestinal goblet cells may be achieved through the combined effects of these regulatory elements. PMID:10393106

  19. A Phox2- and Hand2-dependent Hand1 cis-regulatory element reveals a unique gene dosage requirement for Hand2 during sympathetic neurogenesis.

    PubMed

    Vincentz, Joshua W; VanDusen, Nathan J; Fleming, Andrew B; Rubart, Michael; Firulli, Beth A; Howard, Marthe J; Firulli, Anthony B

    2012-02-01

    Neural crest cell specification and differentiation to a sympathetic neuronal fate serves as an important model for neurogenesis and depends upon the function of both bHLH transcription factors, notably Hand2, and homeodomain transcription factors, including Phox2b. Here, we define a 1007 bp cis-regulatory element 5' of the Hand1 gene sufficient to drive reporter expression within the sympathetic chain of transgenic mice. Comparative genomic analyses uncovered evolutionarily conserved consensus-binding sites within this element, which chromatin immunoprecipitation and electrophoretic mobility shift assays confirm are bound by Hand2 and Phox2b. Mutational analyses revealed that the conserved Phox2 and E-box binding sites are necessary for proper cis-regulatory element activity, and expression analyses on both Hand2 conditionally null and hypomorphic backgrounds demonstrate that Hand2 is required for reporter activation in a gene dosage-dependent manner. We demonstrate that Hand2 and Hand1 differentially bind the E-boxes in this cis-regulatory element, establishing molecular differences between these two factors. Finally, we demonstrate that Hand1 is dispensable for normal tyrosine hydroxylase (TH) and dopamine β-hydroxylase (DBH) expression in sympathetic neurons, even when Hand2 gene dosage is concurrently reduced by half. Together, these data define a tissue-specific Hand1 cis-regulatory element controlled by two factors essential for the development of the sympathetic nervous system and provide in vivo regulatory evidence to support previous findings that Hand2, rather than Hand1, is predominantly responsible for regulating TH, DBH, and Hand1 expression in developing sympathetic neurons.

  20. Nerve growth factor-induced derepression of peripherin gene expression is associated with alterations in proteins binding to a negative regulatory element.

    PubMed Central

    Thompson, M A; Lee, E; Lawe, D; Gizang-Ginsberg, E; Ziff, E B

    1992-01-01

    The peripherin gene, which encodes a neuronal-specific intermediate filament protein, is transcriptionally induced with a late time course when nerve growth factor (NGF) stimulates PC12 cells to differentiate into neurons. We have studied its transcriptional regulation in order to better understand the neuronal-specific end steps of the signal transduction pathway of NGF. By 5' deletion mapping of the peripherin promoter, we have localized two positive regulatory elements necessary for full induction by NGF: a distal positive element and a proximal constitutive element within 111 bp of the transcriptional start site. In addition, there is a negative regulatory element (NRE; -179 to -111), the deletion of which results in elevated basal expression of the gene. Methylation interference footprinting of the NRE defined a unique sequence, GGCAGGGCGCC, as the binding site for proteins present in nuclear extracts from both undifferentiated and differentiated PC12 cells. However, DNA mobility shift assays using an oligonucleotide probe containing the footprinted sequence demonstrate a prominent retarded complex in extracts from undifferentiated PC12 cells which migrates with slower mobility than do the complexes produced by using differentiated PC12 cell extract. Transfection experiments using peripherin-chloramphenicol acetyltransferase constructs in which the footprinted sequence has been mutated confirm that the NRE has a functional, though not exclusive, role in repressing peripherin expression in undifferentiated and nonneuronal cells. We propose a two-step model of activation of peripherin by NGF in which dissociation of a repressor from the protein complex at the NRE, coupled with a positive signal from the distal positive element, results in depression of the gene. Images PMID:1588954

  1. Activation of proglucagon gene transcription through a novel promoter element by the caudal-related homeodomain protein cdx-2/3.

    PubMed Central

    Jin, T; Drucker, D J

    1996-01-01

    The proglucagon gene is expressed in a highly restricted tissue-specific manner in the A cells of the pancreatic islet and the L cells of the small and large intestines. The results of previous experiments indicate that cell-specific expression of the proglucagon gene is mediated by proteins that interact with the proximal G1 promoter element. We show here that the G1 element contains several AT-rich subdomains that bind proteins present in islet and enteroendocrine cell extracts. Electrophoretic mobility shift assay experiments using specific antisera identified the homeobox protein cdx-2/3 (which designates the same homeobox protein called cdx-2 for mice and cdx-3 for hamsters) as a major component of the G1-Gc2 complex in islet and intestinal cells. Mutations of the Gc element that decreased cdx-2/3 binding also resulted in decreased proglucagon promoter activity in islet and intestinal cell lines. The finding that cdx-2/3 mediates activation of the proglucagon promoter in both islet and enteroendocrine cells is consistent with the common endodermal lineage of these tissues and provides new insight into the coordinate regulation of genes expressed in both pancreatic and intestinal endocrine cell types. PMID:8524295

  2. A role for selective androgen response elements in the development of the epididymis and the androgen control of the 5α reductase II gene.

    PubMed

    Kerkhofs, Stefanie; Dubois, Vanessa; De Gendt, Karel; Helsen, Christine; Clinckemalie, Liesbeth; Spans, Lien; Schuit, Frans; Boonen, Steven; Vanderschueren, Dirk; Saunders, Philippa T K; Verhoeven, Guido; Claessens, Frank

    2012-10-01

    The androgen receptor (AR) recognizes two types of DNA elements that are dimers of 5'-AGAACA-3'-like hexamers, either organized as inverted or direct repeats. We developed a mouse model [(specificity affecting AR knock-in (SPARKI)] in which the AR DNA-binding domain was mutated such that it lost binding to direct repeats but not to inverted elements. The impaired fertility of the male SPARKI mice correlates with the reduced motility of the spermatozoa, a characteristic that is developed during transit through the epididymis. Comparative transcriptome analyses revealed that the expression of 39 genes is changed in SPARKI epididymis. Remarkably, the expression of the steroid 5α-reductase type II (Srd5α2) gene, which metabolizes testosterone into the more potent dihydrotestosterone, is reduced 4-fold in SPARKI vs. wild type. The comparison of the SPARKI phenotype with that of Srd5α2-knockout mice shows, however, that the reduced Srd5α2 expression cannot explain all defects of the SPARKI epididymis. Moreover, we describe three new selective androgen response elements (AREs), which control the androgen responsiveness of the Srd5α2 gene. We conclude that the SPARKI model can be considered a knockout model for AR functioning via selective AREs and that this has a dramatic effect on sperm maturation in the epididymis.

  3. Identification of CROWN ROOTLESS1-regulated genes in rice reveals specific and conserved elements of postembryonic root formation.

    PubMed

    Coudert, Yoan; Le, Van Anh Thi; Adam, Hélène; Bès, Martine; Vignols, Florence; Jouannic, Stefan; Guiderdoni, Emmanuel; Gantet, Pascal

    2015-04-01

    In monocotyledons, the root system is mostly composed of postembryonic shoot-borne roots called crown roots. In rice (Oryza sativa), auxin promotes crown root initiation via the LOB-domain transcription factor (LBD) transcription factor CROWN ROOTLESS1 (CRL1); however, the gene regulatory network downstream of CRL1 remains largely unknown. We tested CRL1 transcriptional activity in yeast and in planta, identified CRL1-regulated genes using an inducible gene expression system and a transcriptome analysis, and used in situ hybridization to demonstrate coexpression of a sample of CRL1-regulated genes with CRL1 in crown root primordia. We show that CRL1 positively regulates 277 genes, including key genes involved in meristem patterning (such as QUIESCENT-CENTER SPECIFIC HOMEOBOX; QHB), cell proliferation and hormone homeostasis. Many genes are homologous to Arabidopsis genes involved in lateral root formation, but about a quarter are rice-specific. Our study reveals that several genes acting downstream of LBD transcription factors controlling postembryonic root formation are conserved between monocots and dicots. It also provides evidence that specific genes are involved in the formation of shoot-derived roots in rice.

  4. An environmental analysis of genes associated with schizophrenia: hypoxia and vascular factors as interacting elements in the neurodevelopmental model.

    PubMed

    Schmidt-Kastner, R; van Os, J; Esquivel, G; Steinbusch, H W M; Rutten, B P F

    2012-12-01

    Investigating and understanding gene-environment interaction (G × E) in a neurodevelopmentally and biologically plausible manner is a major challenge for schizophrenia research. Hypoxia during neurodevelopment is one of several environmental factors related to the risk of schizophrenia, and links between schizophrenia candidate genes and hypoxia regulation or vascular expression have been proposed. Given the availability of a wealth of complex genetic information on schizophrenia in the literature without knowledge on the connections to environmental factors, we now systematically collected genes from candidate studies (using SzGene), genome-wide association studies (GWAS) and copy number variation (CNV) analyses, and then applied four criteria to test for a (theoretical) link to ischemia-hypoxia and/or vascular factors. In all, 55% of the schizophrenia candidate genes (n=42 genes) met the criteria for a link to ischemia-hypoxia and/or vascular factors. Genes associated with schizophrenia showed a significant, threefold enrichment among genes that were derived from microarray studies of the ischemia-hypoxia response (IHR) in the brain. Thus, the finding of a considerable match between genes associated with the risk of schizophrenia and IHR and/or vascular factors is reproducible. An additional survey of genes identified by GWAS and CNV analyses suggested novel genes that match the criteria. Findings for interactions between specific variants of genes proposed to be IHR and/or vascular factors with obstetric complications in patients with schizophrenia have been reported in the literature. Therefore, the extended gene set defined here may form a reasonable and evidence-based starting point for hypothesis-based testing of G × E interactions in clinical genetic and translational neuroscience studies.

  5. The first intron of the 4F2 heavy-chain gene contains a transcriptional enhancer element that binds multiple nuclear proteins

    SciTech Connect

    Karpinski, B.A.; Yang, L.H.; Cacheris, P.; Morle, G.D.; Leiden, J.M.

    1989-06-01

    The authors utilized the human 4F2 heavy-chain (4F2HC) gene as a model system to study the regulation of inducible gene expression during normal human T-cell activation. Previous studies have demonstrated that 4F2HC gene expression is induced during normal T-cell activation and that the activity of the gene is regulated, at least in part, by the interaction of a constitutively active 5'-flanking housekeeping promoter and a phorbol ester-responsive transcriptional attenuator element located in the exon 1-intron 1 region of the gene. They now report that 4F2HC intron 1 contains a transcriptional enhancer element which is active on a number of heterologous promoters in a variety of murine and human cells. This enhancer element has been mapped to a 187-base-pair RsaI-AluI fragment from 4F2HC intron 1. DNase I footprinting and gel mobility shift analyses demonstrated that this fragment contains two nuclear protein-binding sites (NF-4FA and NF-4FB) which flank a consensus binding site for the inducible AP-1 transcription factor. Deletion analysis showed that the NF-4FA, NF-4FB, and AP-1 sequences are each necessary for full enhancer activity. Murine 4F2HC intron 1 displayed enhancer activity similar to that of its human counterpart. Comparison of the sequences of human and murine 4F2HC intron 1s demonstrated that the NF-4FA, NF-4FB, and AP-1 sequence motifs have been highly conserved during mammalian evolution.

  6. Genomic organization of the Neurospora crassa gsn gene: possible involvement of the STRE and HSE elements in the modulation of transcription during heat shock.

    PubMed

    Freitas, F Zanolli; Bertolini, M C

    2004-12-01

    Glycogen synthase, an enzyme involved in glycogen biosynthesis, is regulated by phosphorylation and by the allosteric ligand glucose-6-phosphate (G6P). In addition, enzyme levels can be regulated by changes in gene expression. We recently cloned a cDNA for glycogen synthase ( gsn) from Neurospora crassa, and showed that gsn transcription decreased when cells were exposed to heat shock (shifted from 30 degrees C to 45 degrees C). In order to understand the mechanisms that control gsn expression, we isolated the gene, including its 5' and 3' flanking regions, from the genome of N. crassa. An ORF of approximately 2.4 kb was identified, which is interrupted by four small introns (II-V). Intron I (482 bp) is located in the 5'UTR region. Three putative Transcription Initiation Sites (TISs) were mapped, one of which lies downstream of a canonical TATA-box sequence (5'-TGTATAAA-3'). Analysis of the 5'-flanking region revealed the presence of putative transcription factor-binding sites, including Heat Shock Elements (HSEs) and STress Responsive Elements (STREs). The possible involvement of these motifs in the negative regulation of gsn transcription was investigated using Electrophoretic Mobility Shift Assays (EMSA) with nuclear extracts of N. crassa mycelium obtained before and after heat shock, and DNA fragments encompassing HSE and STRE elements from the 5'-flanking region. While elements within the promoter region are involved in transcription under heat shock, elements in the 5'UTR intron may participate in transcription during vegetative growth. The results thus suggest that N. crassa possesses trans -acting elements that interact with the 5'-flanking region to regulate gsn transcription during heat shock and vegetative growth.

  7. Characterization of 5' end of human thromboxane receptor gene. Organizational analysis and mapping of protein kinase C--responsive elements regulating expression in platelets.

    PubMed

    D'Angelo, D D; Davis, M G; Houser, W A; Eubank, J J; Ritchie, M E; Dorn, G W

    1995-09-01

    Platelet thromboxane receptors are acutely and reversibly upregulated after acute myocardial infarction. To determine if platelet thromboxane receptors are under transcriptional control, we isolated and characterized human genomic DNA clones containing the 5' flanking region of the thromboxane receptor gene. The exon-intron structure of the 5' portion of the thromboxane receptor gene was determined initially by comparing the nucleotide sequence of the 5' flanking genomic clone with that of a novel human uterine thromboxane receptor cDNA that extended the mRNA 141 bp further upstream than the previously identified human placental cDNA. A major transcription initiation site was located in three human tissues approximately 560 bp upstream from the translation initiation codon and 380 bp upstream from any previously identified transcription initiation site. The thromboxane receptor gene has neither a TATA nor a CAAT consensus site. Promoter function of the 5' flanking region of the thromboxane receptor gene was evaluated by transfection of thromboxane receptor gene promoter/chloramphenicol acetyltransferase (CAT) chimera plasmids into platelet-like K562 cells. Thromboxane receptor promoter activity, as assessed by CAT expression, was relatively weak but was significantly enhanced by phorbol ester treatment. Functional analysis of 5' deletion constructs in transfected K562 cells and gel mobility shift localized the major phorbol ester-responsive motifs in the thromboxane receptor gene promoter to a cluster of activator protein-2 (AP-2) binding consensus sites located approximately 1.8 kb 5' from the transcription initiation site. These studies are the first to determine the structure and organization of the 5' end of the thromboxane receptor gene and demonstrate that thromboxane receptor gene expression can be regulated by activation of protein kinase C via induction of an AP-2-like nuclear factor binding to upstream promoter elements. These findings strongly suggest

  8. Gap junctional communication modulates gene transcription by altering the recruitment of Sp1 and Sp3 to connexin-response elements in osteoblast promoters

    NASA Technical Reports Server (NTRS)

    Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto

    2003-01-01

    Loss-of-function mutations of gap junction proteins, connexins, represent a mechanism of disease in a variety of tissues. We have shown that recessive (gene deletion) or dominant (connexin45 overexpression) disruption of connexin43 function results in osteoblast dysfunction and abnormal expression of osteoblast genes, including down-regulation of osteocalcin transcription. To elucidate the molecular mechanisms of gap junction-sensitive transcriptional regulation, we systematically analyzed the rat osteocalcin promoter for sensitivity to gap junctional intercellular communication. We identified an Sp1/Sp3 containing complex that assembles on a minimal element in the -70 to -57 region of the osteocalcin promoter in a gap junction-dependent manner. This CT-rich connexin-response element is necessary and sufficient to confer gap junction sensitivity to the osteocalcin proximal promoter. Repression of osteocalcin transcription occurs as a result of displacement of the stimulatory Sp1 by the inhibitory Sp3 on the promoter when gap junctional communication is perturbed. Modulation of Sp1/Sp3 recruitment also occurs on the collagen Ialpha1 promoter and translates into gap junction-sensitive transcriptional control of collagen Ialpha1 gene expression. Thus, regulation of Sp1/Sp3 recruitment to the promoter may represent a potential general mechanism for transcriptional control of target genes by signals passing through gap junctions.

  9. MyoD Is a Novel Activator of Porcine FIT1 Gene by Interacting with the Canonical E-Box Element during Myogenesis.

    PubMed

    Yan, Chi; Xia, Xiaoliang; He, Junxian; Ren, Zhuqing; Xu, Dequan; Xiong, Yuanzhu; Zuo, Bo

    2015-01-01

    Fat-induced transcript 1 (FIT1/FITM1) gene is a member of the conserved gene family important for triglyceride-rich lipid droplet accumulation. FIT1 gene displays a similar muscle-specific expression across pigs, mice, and humans. Thus pigs can act as a useful model of many human diseases resulting from misexpression of FIT1 gene. Triglyceride content in skeletal muscle plays a key role in pork meat quality and flavors. An insertion/deletion mutation in porcine FIT1 coding region shows a high correlation with a series of fat traits. To gain better knowledge of the potential role of FIT1 gene in human diseases and the correlations with pork meat quality, our attention is given to the region upstream of the porcine FIT1 coding sequence. We cloned ~1 kb of the 5'-flanking region of porcine FIT1 gene to define the role of this sequence in modulating the myogenic expression. A canonical E-box element that activated porcine FIT1 promoter activity during myogenesis was identified. Further analysis demonstrated that promoter activity was induced by overexpression of MyoD1, which bound to this canonical E-box during C2C12 differentiation. This is the first evidence that FIT1 as the direct novel target of MyoD is involved in muscle development.

  10. MyoD Is a Novel Activator of Porcine FIT1 Gene by Interacting with the Canonical E-Box Element during Myogenesis

    PubMed Central

    Yan, Chi; Xia, Xiaoliang; He, Junxian; Ren, Zhuqing; Xu, Dequan; Xiong, Yuanzhu; Zuo, Bo

    2015-01-01

    Fat-induced transcript 1 (FIT1/FITM1) gene is a member of the conserved gene family important for triglyceride-rich lipid droplet accumulation. FIT1 gene displays a similar muscle-specific expression across pigs, mice, and humans. Thus pigs can act as a useful model of many human diseases resulting from misexpression of FIT1 gene. Triglyceride content in skeletal muscle plays a key role in pork meat quality and flavors. An insertion/deletion mutation in porcine FIT1 coding region shows a high correlation with a series of fat traits. To gain better knowledge of the potential role of FIT1 gene in human diseases and the correlations with pork meat quality, our attention is given to the region upstream of the porcine FIT1 coding sequence. We cloned ~1 kb of the 5′-flanking region of porcine FIT1 gene to define the role of this sequence in modulating the myogenic expression. A canonical E-box element that activated porcine FIT1 promoter activity during myogenesis was identified. Further analysis demonstrated that promoter activity was induced by overexpression of MyoD1, which bound to this canonical E-box during C2C12 differentiation. This is the first evidence that FIT1 as the direct novel target of MyoD is involved in muscle development. PMID:26492245

  11. Selective repression of gene expression in neuropathic pain by the neuron-restrictive silencing factor/repressor element-1 silencing transcription (NRSF/REST).

    PubMed

    Willis, Dianna E; Wang, Meng; Brown, Elizabeth; Fones, Lilah; Cave, John W

    2016-06-20

    Neuropathic pain often develops following nerve injury as a result of maladaptive changes that occur in the injured nerve and along the nociceptive pathways of the peripheral and central nervous systems. Multiple cellular and molecular mechanisms likely account for these changes; however, the exact nature of these mechanisms remain largely unknown. A growing number of studies suggest that alteration in gene expression is an important step in the progression from acute to chronic pain states and epigenetic regulation has been proposed to drive this change in gene expression. In this review, we discuss recent evidence that the DNA-binding protein neuron-restrictive silencing factor/repressor element-1 silencing transcription factor (NRSF/REST) is an important component in the development and maintenance of neuropathic pain through its role as a transcriptional regulator for a select subset of genes that it normally represses during development. PMID:26679228

  12. Increased Variation in Adh Enzyme Activity in Drosophila Mutation-Accumulation Experiment Is Not Due to Transposable Elements at the Adh Structural Gene

    PubMed Central

    Aquadro, C. F.; Tachida, H.; Langley, C. H.; Harada, K.; Mukai, T.

    1990-01-01

    We present here a molecular analysis of the region surrounding the structural gene encoding alcohol dehydrogenase (Adh) in 47 lines of Drosophila melanogaster that have each accumulated mutations for 300 generations. While these lines show a significant increase in variation of alcohol dehydrogenase enzyme activity compared to control lines, we found no restriction map variation in a 13-kb region including the complete Adh structural gene and roughly 5 kb of both 5' and 3' sequences. Thus, the rapid accumulation of ADH activity variation after 28,200 allele generations does not appear to have been due to the mobilization of transposable elements into or out of the Adh structural gene region. PMID:1963870

  13. Caffeic acid phenethyl ester stimulates human antioxidant response element-mediated expression of the NAD(P)H:quinone oxidoreductase (NQO1) gene.

    PubMed

    Jaiswal, A K; Venugopal, R; Mucha, J; Carothers, A M; Grunberger, D

    1997-02-01

    Caffeic acid phenethyl ester (CAPE) is a phenolic antioxidant derived from the propolis of honeybee hives. CAPE was shown to inhibit the formation of intracellular hydrogen peroxide and oxidized bases in DNA of 12-O-tetradecanoylphorbol-13-acetate (TPA)-treated HeLa cells and was also found to induce a redox change that correlated with differential growth effects in transformed cells but not the nontumorigenic parental ones. Mediated via the electrophile or human antioxidant response element (hARE), induction of the expression of NAD(P)H quinone oxidoreductase (NQO1) and glutathione S-transferase Ya subunit genes by certain phenolic antioxidants has been correlated with the chemopreventive properties of these agents. Here, we determined by Northern analysis that CAPE treatment of hepatoma cells stimulates NQO1 gene expression in cultured human hepatoma cells (HepG2), and we characterized the effects of CAPE treatment on the expression of a reporter gene either containing or lacking the hARE or carrying a mutant version of this element in rodent hepatoma (Hepa-1) transfectants. A dose-dependent transactivation of human hARE-mediated chloramphenicol acetyltransferase (cat) gene expression was observed upon treatments of the Hepa-1 transfectants with TPA, a known inducer, as well as with CAPE. The combined treatments resulted in an apparent additive stimulation of the reporter expression. To learn whether this activation of cat gene expression was effected by protein kinase C in CAPE-treated cells, a comparison was made of cat gene activity after addition of calphostin, a protein kinase C inhibitor. Calphostin reduced the cat gene induction by TPA but not by CAPE, suggesting that stimulation of gene expression in this system by these agents proceeds via distinct mechanisms. Band-shift experiments to examine binding of transactivator proteins from nuclear extracts of treated and untreated cells to a hARE DNA probe showed that TPA exposure increased the binding level

  14. Expression of the human granulocyte-macrophage colony stimulating factor (hGM-CSF) gene under control of the 5'-regulatory sequence of the goat alpha-S1-casein gene with and without a MAR element in transgenic mice.

    PubMed

    Burkov, I A; Serova, I A; Battulin, N R; Smirnov, A V; Babkin, I V; Andreeva, L E; Dvoryanchikov, G A; Serov, O L

    2013-10-01

    Expression of the human granulocyte-macrophage colony-stimulating factor (hGM-CSF) gene under the control of the 5'-regulatory sequence of the goat alpha-S1-casein gene with and without a matrix attachment region (MAR) element from the Drosophila histone 1 gene was studied in four and eight transgenic mouse lines, respectively. Of the four transgenic lines carrying the transgene without MAR, three had correct tissues-specific expression of the hGM-CSF gene in the mammary gland only and no signs of cell mosaicism. The concentration of hGM-CSF in the milk of transgenic females varied from 1.9 to 14 μg/ml. One line presented hGM-CSF in the blood serum, indicating ectopic expression. The values of secretion of hGM-CSF in milk of 6 transgenic lines carrying the transgene with MAR varied from 0.05 to 0.7 μg/ml, and two of these did not express hGM-CSF. Three of the four examined animals from lines of this group showed ectopic expression of the hGM-CSF gene, as determined by RT-PCR and immunofluorescence analyses, as well as the presence of hGM-CSF in the blood serum. Mosaic expression of the hGM-CSF gene in mammary epithelial cells was specific to all examined transgenic mice carrying the transgene with MAR but was never observed in the transgenic mice without MAR. The mosaic expression was not dependent on transgene copy number. Thus, the expected "protective or enhancer effect" from the MAR element on the hGM-CSF gene expression was not observed.

  15. RT-qPCR gene expression analysis in zebrafish: Preanalytical precautions and use of expressed repetitive elements for normalization.

    PubMed

    Vanhauwaert, S; Lefever, S; Coucke, P; Speleman, F; De Paepe, A; Vandesompele, J; Willaert, A

    2016-01-01

    Gene expression analysis is increasingly important in many fields of biological research. Understanding patterns of expressed genes is assumed to provide insight into complex regulatory networks and can lead to the identification of genes relevant to specific biological processes, including disease. Among different techniques, reverse transcription quantitative polymerase chain reaction (RT-qPCR) is currently regarded as the gold standard for targeted quantification of RNA gene expression, especially because of its high sensitivity, specificity, accuracy, and precision, and also because of its practical simplicity and processing speed. However, different critical factors can influence the outcome of RT-qPCR studies, including isolation of RNA, reverse transcription to cDNA, and data analysis. These factors need to be addressed in order to obtain biologically meaningful results. In this chapter, we describe how RT-qPCR can be used in a reliable way to successfully study differential gene expression in zebrafish. Hereby, we especially focus on how expressed repetitive elements can be employed as reference targets in zebrafish RT-qPCR studies and how they can further improve the quality of the data. PMID:27443934

  16. LPS injection reprograms the expression and the 3' UTR of a CAP gene by alternative polyadenylation and the formation of a GAIT element in Ciona intestinalis.

    PubMed

    Vizzini, Aiti; Bonura, Angela; Longo, Valeria; Sanfratello, Maria Antonietta; Parrinello, Daniela; Cammarata, Matteo; Colombo, Paolo

    2016-09-01

    The diversification of cellular functions is one of the major characteristics of multicellular organisms which allow cells to modulate their gene expression, leading to the formation of transcripts and proteins with different functions and concentrations in response to different stimuli. CAP genes represent a widespread family of proteins belonging to the cysteine-rich secretory protein, antigen 5 and pathogenesis-related 1 superfamily which, it has been proposed, play key roles in the infection process and the modulation of immune responses in host animals. The ascidian Ciona intestinalis represents a group of proto-chordates with an exclusively innate immune system that has been widely studied in the field of comparative and developmental immunology. Using this biological system, we describe the identification of a novel APA mechanism by which an intronic polyadenylation signal is activated by LPS injection, leading to the formation of a shorter CAP mRNA capable of expressing the first CAP exon plus 19 amino acid residues whose sequence is contained within the first intron of the annotated gene. Furthermore, such an APA event causes the expression of a translational controlling cis-acting GAIT element which is not present in the previously isolated CAP isoform and identified in the 3'-UTR of other immune-related genes, suggesting an intriguing scenario in which both transcriptional and post-transcriptional control mechanisms are involved in the activation of the CAP gene during inflammatory response in C. intestinalis. PMID:27514009

  17. Characterization of various promoter regions of the human DNA helicase-encoding genes and identification of duplicated ets (GGAA) motifs as an essential transcription regulatory element.

    PubMed

    Uchiumi, Fumiaki; Watanabe, Takeshi; Tanuma, Sei-ichi

    2010-05-15

    DNA helicases are important in the regulation of DNA transaction and thereby various cellular functions. In this study, we developed a cost-effective multiple DNA transfection assay with DEAE-dextran reagent and analyzed the promoter activities of the human DNA helicases. The 5'-flanking regions of the human DNA helicase-encoding genes were isolated and subcloned into luciferase (Luc) expression plasmids. They were coated onto 96-well plate and used for co-transfection with a renilla-Luc expression vector into various cells, and dual-Luc assays were performed. The profiles of promoter activities were dependent on cell lines used. Among these human DNA helicase genes, XPB, RecQL5, and RTEL promoters were activated during TPA-induced HL-60 cell differentiation. Interestingly, duplicated ets (GGAA) elements are commonly located around the transcription start sites of these genes. The duplicated GGAA motifs are also found in the promoters of DNA replication/repair synthesis factor genes including PARG, ATR, TERC, and Rb1. Mutation analyses suggested that the duplicated GGAA-motifs are necessary for the basal promoter activity in various cells and some of them positively respond to TPA in HL-60 cells. TPA-induced response of 44-bp in the RTEL promoter was attenuated by co-transfection of the PU.1 expression vector. These findings suggest that the duplicated ets motifs regulate DNA-repair associated gene expressions during macrophage-like differentiation of HL-60 cells.

  18. Analysis of Five Gene Sets in Chimpanzees Suggests Decoupling between the Action of Selection on Protein-Coding and on Noncoding Elements

    PubMed Central

    Santpere, Gabriel; Carnero-Montoro, Elena; Petit, Natalia; Serra, François; Hvilsom, Christina; Rambla, Jordi; Heredia-Genestar, Jose Maria; Halligan, Daniel L.; Dopazo, Hernan; Navarro, Arcadi; Bosch, Elena

    2015-01-01

    We set out to investigate potential differences and similarities between the selective forces acting upon the coding and noncoding regions of five different sets of genes defined according to functional and evolutionary criteria: 1) two reference gene sets presenting accelerated and slow rates of protein evolution (the Complement and Actin pathways); 2) a set of genes with evidence of accelerated evolution in at least one of their introns; and 3) two gene sets related to neurological function (Parkinson’s and Alzheimer’s diseases). To that effect, we combine human–chimpanzee divergence patterns with polymorphism data obtained from target resequencing 20 central chimpanzees, our closest relatives with largest long-term effective population size. By using the distribution of fitness effect-alpha extension of the McDonald–Kreitman test, we reproduce inferences of rates of evolution previously based only on divergence data on both coding and intronic sequences and also obtain inferences for other classes of genomic elements (untranslated regions, promoters, and conserved noncoding sequences). Our results suggest that 1) the distribution of fitness effect-alpha method successfully helps distinguishing different scenarios of accelerated divergence (adaptation or relaxed selective constraints) and 2) the adaptive history of coding and noncoding sequences within the gene sets analyzed is decoupled. PMID:25977458

  19. Analysis of Five Gene Sets in Chimpanzees Suggests Decoupling between the Action of Selection on Protein-Coding and on Noncoding Elements.

    PubMed

    Santpere, Gabriel; Carnero-Montoro, Elena; Petit, Natalia; Serra, François; Hvilsom, Christina; Rambla, Jordi; Heredia-Genestar, Jose Maria; Halligan, Daniel L; Dopazo, Hernan; Navarro, Arcadi; Bosch, Elena

    2015-05-14

    We set out to investigate potential differences and similarities between the selective forces acting upon the coding and noncoding regions of five different sets of genes defined according to functional and evolutionary criteria: 1) two reference gene sets presenting accelerated and slow rates of protein evolution (the Complement and Actin pathways); 2) a set of genes with evidence of accelerated evolution in at least one of their introns; and 3) two gene sets related to neurological function (Parkinson's and Alzheimer's diseases). To that effect, we combine human-chimpanzee divergence patterns with polymorphism data obtained from target resequencing 20 central chimpanzees, our closest relatives with largest long-term effective population size. By using the distribution of fitness effect-alpha extension of the McDonald-Kreitman test, we reproduce inferences of rates of evolution previously based only on divergence data on both coding and intronic sequences and also obtain inferences for other classes of genomic elements (untranslated regions, promoters, and conserved noncoding sequences). Our results suggest that 1) the distribution of fitness effect-alpha method successfully helps distinguishing different scenarios of accelerated divergence (adaptation or relaxed selective constraints) and 2) the adaptive history of coding and noncoding sequences within the gene sets analyzed is decoupled.

  20. LPS injection reprograms the expression and the 3' UTR of a CAP gene by alternative polyadenylation and the formation of a GAIT element in Ciona intestinalis.

    PubMed

    Vizzini, Aiti; Bonura, Angela; Longo, Valeria; Sanfratello, Maria Antonietta; Parrinello, Daniela; Cammarata, Matteo; Colombo, Paolo

    2016-09-01

    The diversification of cellular functions is one of the major characteristics of multicellular organisms which allow cells to modulate their gene expression, leading to the formation of transcripts and proteins with different functions and concentrations in response to different stimuli. CAP genes represent a widespread family of proteins belonging to the cysteine-rich secretory protein, antigen 5 and pathogenesis-related 1 superfamily which, it has been proposed, play key roles in the infection process and the modulation of immune responses in host animals. The ascidian Ciona intestinalis represents a group of proto-chordates with an exclusively innate immune system that has been widely studied in the field of comparative and developmental immunology. Using this biological system, we describe the identification of a novel APA mechanism by which an intronic polyadenylation signal is activated by LPS injection, leading to the formation of a shorter CAP mRNA capable of expressing the first CAP exon plus 19 amino acid residues whose sequence is contained within the first intron of the annotated gene. Furthermore, such an APA event causes the expression of a translational controlling cis-acting GAIT element which is not present in the previously isolated CAP isoform and identified in the 3'-UTR of other immune-related genes, suggesting an intriguing scenario in which both transcriptional and post-transcriptional control mechanisms are involved in the activation of the CAP gene during inflammatory response in C. intestinalis.

  1. Reciprocal Loss of CArG-Boxes and Auxin Response Elements Drives Expression Divergence of MPF2-Like MADS-Box Genes Controlling Calyx Inflation

    PubMed Central

    Khan, Muhammad Ramzan; Hu, Jinyong; Ali, Ghulam Muhammad

    2012-01-01

    Expression divergence is thought to be a hallmark of functional diversification between homologs post duplication. Modification in regulatory elements has been invoked to explain expression divergence after duplication for several MADS-box genes, however, verification of reciprocal loss of cis-regulatory elements is lacking in plants. Here, we report that the evolution of MPF2-like genes has entailed degenerative mutations in a core promoter CArG-box and an auxin response factor (ARF) binding element in the large 1st intron in the coding region. Previously, MPF2-like genes were duplicated into MPF2-like-A and -B through genome duplication in Withania and Tubocapsicum (Withaninae). The calyx of Withania grows exorbitantly after pollination unlike Tubocapsicum, where it degenerates. Besides inflated calyx syndrome formation, MPF2-like transcription factors are implicated in functions both during the vegetative and reproductive development as well as in phase transition. MPF2-like-A of Withania (WSA206) is strongly expressed in sepals, while MPF2-like-B (WSB206) is not. Interestingly, their combined expression patterns seem to replicate the pattern of their closely related hypothetical progenitors from Vassobia and Physalis. Using phylogenetic shadowing, site-directed mutagenesis and motif swapping, we could show that the loss of a conserved CArG-box in MPF2-like-B of Withania is responsible for impeding its expression in sepals. Conversely, loss of an ARE in MPF2-like-A relaxed the constraint on expression in sepals. Thus, the ARE is an active suppressor of MPF2-like gene expression in sepals, which in contrast is activated via the CArG-box. The observed expression divergence in MPF2-like genes due to reciprocal loss of cis-regulatory elements has added to genetic and phenotypic variations in the Withaninae and enhanced the potential of natural selection for the adaptive evolution of ICS. Moreover, these results provide insight into the interplay of floral

  2. Disruption of the Abdominal-B Promoter Tethering Element Results in a Loss of Long-Range Enhancer-Directed Hox Gene Expression in Drosophila

    PubMed Central

    Ho, Margaret C. W.; Schiller, Benjamin J.; Akbari, Omar S.; Bae, Esther; Drewell, Robert A.

    2011-01-01

    There are many examples within gene complexes of transcriptional enhancers interacting with only a subset of target promoters. A number of molecular mechanisms including promoter competition, insulators and chromatin looping are thought to play a role in regulating these interactions. At the Drosophila bithorax complex (BX-C), the IAB5 enhancer specifically drives gene expression only from the Abdominal-B (Abd-B) promoter, even though the enhancer and promoter are 55 kb apart and are separated by at least three insulators. In previous studies, we discovered that a 255 bp cis-regulatory module, the promoter tethering element (PTE), located 5′ of the Abd-B transcriptional start site is able to tether IAB5 to the Abd-B promoter in transgenic embryo assays. In this study we examine the functional role of the PTE at the endogenous BX-C using transposon-mediated mutagenesis. Disruption of the PTE by P element insertion results in a loss of enhancer-directed Abd-B expression during embryonic development and a homeotic transformation of abdominal segments. A partial deletion of the PTE and neighboring upstream genomic sequences by imprecise excision of the P element also results in a similar loss of Abd-B expression in embryos. These results demonstrate that the PTE is an essential component of the regulatory network at the BX-C and is required in vivo to mediate specific long-range enhancer-promoter interactions. PMID:21283702

  3. Identification of an initiator-like element essential for the expression of the tissue inhibitor of metalloproteinases-4 (Timp-4) gene.

    PubMed Central

    Young, David A; Phillips, Blaine W; Lundy, Caroline; Nuttall, Robert K; Hogan, Aileen; Schultz, Gilbert A; Leco, Kevin J; Clark, Ian M; Edwards, Dylan R

    2002-01-01

    We have used real-time quantitative reverse transcriptase PCR (TaqMan) to quantify the expression of the four tissue inhibitor of metalloproteinases (Timp) genes in mouse tissues during development and in the adult. Among the four Timp genes, Timp-4 shows the most restricted pattern of expression, with highest RNA levels in brain, heart and testes. These data indicate that in the brain, Timp-4 transcripts are temporally regulated during development, becoming more abundant than those of the other Timps after birth. Cloning of the Timp-4 gene confirmed a five-exon organization resembling that of Timp-2 and Timp-3, and like all Timps, Timp-4 is located within an intron of a synapsin gene. Ribonuclease protection analysis and 5'-rapid amplification of cDNA ends PCR identified multiple transcription starts for Timp-4 from brain and heart mRNA. The promoter region of Timp-4 was functional in transient transfection analysis in mouse C3H10T1/2 fibroblasts, where it directed basal expression that was non-inducible by serum. The TATA-less promoter contains consensus motifs for Sp1 and an inverted CCAAT box upstream of an initiator-like element that is in close proximity to a transcription start site. Mutation of the CCAAT box caused a 2-fold increase in reporter expression. More significantly, mutation of the Sp1 motif or initiator-like element almost completely abolished reporter expression. This first functional characterization of the Timp-4 promoter shows it to be distinct from other members of the Timp family and provides insights into potential mechanisms controlling the tight spatio-temporal expression pattern of the gene. PMID:11988080

  4. Widespread disruption of repressor element-1 silencing transcription factor/neuron-restrictive silencer factor occupancy at its target genes in Huntington's disease.

    PubMed

    Zuccato, Chiara; Belyaev, Nikolai; Conforti, Paola; Ooi, Lezanne; Tartari, Marzia; Papadimou, Evangelia; MacDonald, Marcy; Fossale, Elisa; Zeitlin, Scott; Buckley, Noel; Cattaneo, Elena

    2007-06-27

    Huntingtin is a protein that is mutated in Huntington's disease (HD), a dominant inherited neurodegenerative disorder. We previously proposed that, in addition to the gained toxic activity of the mutant protein, selective molecular dysfunctions in HD may represent the consequences of the loss of wild-type protein activity. We first reported that wild-type huntingtin positively affects the transcription of the brain-derived neurotrophic factor (BDNF) gene, a cortically derived survival factor for the striatal neurons that are mainly affected in the disease. Mutation in huntingtin decreases BDNF gene transcription. One mechanism involves the activation of repressor element 1/neuron-restrictive silencer element (RE1/NRSE) located within the BDNF promoter. We now show that increased binding of the RE1 silencing transcription factor/neuron-restrictive silencer factor (REST/NRSF) repressor occurs at multiple genomic RE1/NRSE loci in HD cells, in animal models, and in postmortem brains, resulting in a decrease of RE1/NRSE-mediated gene transcription. The same molecular phenotype is produced in cells and brain tissue depleted of endogenous huntingtin, thereby directly validating the loss-of-function hypothesis of HD. Through a ChIP (chromatin immunoprecipitation)-on-chip approach, we examined occupancy of multiple REST/NRSF target genes in the postmortem HD brain, providing the first example of the application of this technology to neurodegenerative diseases. Finally, we show that attenuation of REST/NRSF binding restores BDNF levels, suggesting that relief of REST/NRSF mediated repression can restore aberrant neuronal gene transcription in HD. PMID:17596446

  5. First identification of Tn916-like element in industrial strains of Lactobacillus vini that spread the tet-M resistance gene.

    PubMed

    Mendonça, Allyson Andrade; de Lucena, Brigida Thais Luckwu; de Morais, Márcia Maria Camargo; de Morais, Marcos Antonio

    2016-02-01

    The open process used to ferment sugar cane juice or molasses to produce ethanol fuel is prone to contamination by bacterial cells of different species, in particular Lactobacilli. The situation can be exacerbated by the emergence of resistant cells to industrial antibiotics that are normally used to combat this contamination. In this work, two Lactobacillus vini isolates from ethanol distilleries were identified and found to be resistant to doxycycline, a tetracycline derivative, although sensitive to other antibiotics tested. The identification of these isolates was confirmed by sequencing the pheS gene and their clonal origin was shown by PCR-fingerprinting analysis. Moreover, the isolates were shown to carry the transposable element Tn916 that harboured the tet-M gene. Furthermore, conjugation experiments showed that both isolates were capable of transferring this element, and as a result, the tet-M gene, to Enterococcus faecalis reference strain. Finally, the identification of tetracycline resistance in the same distilleries in other Lactobacilli, suggested that inter-species transfer of antibiotic resistance may be occurring in the industrial environment, and thus impairing the efficiency of the antibiotic treatment and causing serious health concerns. PMID:26722009

  6. A reporter promoter assay confirmed the role of a distal promoter NOBOX binding element in enhancing expression of GDF9 gene in buffalo oocytes.

    PubMed

    Roy, Bhaskar; Rajput, Sandeep; Raghav, Sarvesh; Kumar, Parveen; Verma, Arpana; Kumar, Sandeep; De, Sachinandan; Goswami, Surender Lal; Datta, Tirtha Kumar

    2012-11-01

    Growth differentiation factor 9 is primarily expressed in oocytes and plays a vital role in oocyte cumulus crosstalk. Earlier studies with buffalo oocytes revealed differential expression of this gene under different media stimulation conditions which, in turn, are correlated with the blastocyst yield. In this study, different germ cell specific cis elements including a NOBOX binding elements (NBE) and several E-boxes were identified at the 5' upstream region of buffalo GDF9 gene and their potential role in GDF9 expression was investigated. Transfecting oocytes with GDF9 promoter deletion constructs harbouring the NBE reporter gene revealed a 33% increase in GFP as well as the luciferase signal signifying its role in stimulating the minimal promoter activity of GDF9 in buffalo oocytes. Site directed mutation of core binding nucleotides at NBE at 1.8 kb upstream to TSS further confirmed its role for enhancing the basal transcriptional activity of GDF9 promoter in buffalo oocytes. Current work will provide important leads for understanding the role of GDF9 in oocytes competence and designing a more physiological IVF protocol in case of buffalo.

  7. The Ewing sarcoma protein (EWS) binds directly to the proximal elements of the macrophage-specific promoter of the CSF-1 receptor (csf1r) gene.

    PubMed

    Hume, David A; Sasmono, Tedjo; Himes, S Roy; Sharma, Sudarshana M; Bronisz, Agnieszka; Constantin, Myrna; Ostrowski, Michael C; Ross, Ian L

    2008-05-15

    Many macrophage-specific promoters lack classical transcriptional start site elements such as TATA boxes and Sp1 sites. One example is the CSF-1 receptor (CSF-1R, CD115, c-fms), which is used as a model of the transcriptional regulation of macrophage genes. To understand the molecular basis of start site recognition in this gene, we identified cellular proteins binding specifically to the transcriptional start site (TSS) region. The mouse and human csf1r TSS were identified using cap analysis gene expression (CAGE) data. Conserved elements flanking the TSS cluster were analyzed using EMSAs to identify discrete DNA-binding factors in primary bone marrow macrophages as candidate transcriptional regulators. Two complexes were identified that bind in a highly sequence-specific manner to the mouse and human TSS proximal region and also to high-affinity sites recognized by myeloid zinc finger protein 1 (Mzf1). The murine proteins were purified by DNA affinity isolation from the RAW264.7 macrophage cell line and identified by mass spectrometry as EWS and FUS/TLS, closely related DNA and RNA-binding proteins. Chromatin immunoprecipitation experiments in bone marrow macrophages confirmed that EWS, but not FUS/TLS, was present in vivo on the CSF-1R proximal promoter in unstimulated primary macrophages. Transfection assays suggest that EWS does not act as a conventional transcriptional activator or repressor. We hypothesize that EWS contributes to start site recognition in TATA-less mammalian promoters.

  8. P elements inserted in the vicinity of or within the Drosophila snRNP SmD3 gene nested in the first intron of the Ornithine Decarboxylase Antizyme gene affect only the expression of SmD3.

    PubMed Central

    Schenkel, Heide; Hanke, Susanne; De Lorenzo, Cécilia; Schmitt, Rolf; Mechler, Bernard M

    2002-01-01

    The Drosophila gene for snRNP SmD3 (SmD3) is contained in reverse orientation within the first intron of the Ornithine Decarboxylase Antizyme (AZ) gene. Previous studies show that two closely linked P elements cause the gutfeeling phenotype characterized by embryonic lethality and aberrant neuronal and muscle cell differentiation. However, the exact nature of the gene(s) affected in the gutfeeling phenotype remained unknown. This study shows that a series of P inserts located within the 5'-untranslated region (5'-UTR) of SmD3 or its promoter affects only the expression of SmD3. Our analysis reveals that the gutfeeling phenotype associated with P elements inserted in the 5'-UTR of SmD3 results from amorphic or strongly hypomorphic mutations. In contrast, P inserts in the SmD3 promoter region reduce the expression of SmD3 without abolishing it and produce larval lethality with overgrown imaginal discs, brain hemispheres, and hematopoietic organs. The lethality of these mutations could be rescued by an SmD3+ transgene. Finally, inactivation of AZ was obtained by complementing with SmD3+ the deficiency Df(2R)guf(lex47) that uncovers both SmD3 and AZ. Interestingly, AZ inactivation causes a new phenotype characterized by late larval lethality and atrophy of the brain, imaginal discs, hematopoietic organs, and salivary glands. PMID:12072471

  9. Miniature Inverted–Repeat Transposable Elements (MITEs) Have Been Accumulated through Amplification Bursts and Play Important Roles in Gene Expression and Species Diversity in Oryza sativa

    PubMed Central

    Lu, Chen; Chen, Jiongjiong; Zhang, Yu; Hu, Qun; Su, Wenqing; Kuang, Hanhui

    2012-01-01

    Miniature inverted–repeat transposable elements (MITEs) are predicted to play important roles on genome evolution. We developed a BLASTN-based approach for de novo identification of MITEs and systematically analyzed MITEs in rice genome. The genome of rice cultivar Nipponbare (Oryza sativa ssp. japonica) harbors 178,533 MITE-related sequences classified into 338 families. Pairwise nucleotide diversity and phylogenetic tree analysis indicated that individual MITE families were resulted from one or multiple rounds of amplification bursts. The timing of amplification burst varied considerably between different MITE families or subfamilies. MITEs are associated with 23,623 (58.2%) genes in rice genome. At least 7,887 MITEs are transcribed and more than 3,463 were transcribed with rice genes. The MITE sequences transcribed with rice coding genes form 1,130 pairs of potential natural sense/antisense transcripts. MITEs generate 23.5% (183,837 of 781,885) of all small RNAs identified from rice. Some MITE families generated small RNAs mainly from the terminals, while other families generated small RNAs predominantly from the central region. More than half (51.8%) of the MITE-derived small RNAs were generated exclusively by MITEs located away from genes. Genome-wide analysis showed that genes associated with MITEs have significantly lower expression than genes away from MITEs. Approximately 14.8% of loci with full-length MITEs have presence/absence polymorphism between rice cultivars 93-11 (O. sativa ssp. indica) and Nipponbare. Considering that different sets of genes may be regulated by MITE-derived small RNAs in different genotypes, MITEs provide considerable diversity for O. sativa. PMID:22096216

  10. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    PubMed Central

    2012-01-01

    Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement) or, less commonly, linked to 35 S rDNA units (L-type). The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6) but not all species. Two species contained major L-type and minor S-type units (termed Ls-type). The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’) is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs. PMID:22716941

  11. Carbon allocation and element composition in four Chlamydomonas mutants defective in genes related to the CO2 concentrating mechanism.

    PubMed

    Memmola, Francesco; Mukherjee, Bratati; Moroney, James V; Giordano, Mario

    2014-09-01

    Four mutants of Chlamydomonas reinhardtii with defects in different components of the CO2 concentrating mechanism (CCM) or in Rubisco activase were grown autotrophically at high pCO2 and then transferred to low pCO2, in order to study the role of different components of the CCM on carbon allocation and elemental composition. To study carbon allocation, we measured the relative size of the main organic pools by Fourier Transform Infrared spectroscopy. Total reflection X-ray fluorescence was used to analyze the elemental composition of algal cells. Our data show that although the organic pools increased their size at high CO2 in all strains, their stoichiometry was highly homeostatic, i.e., the ratios between carbohydrates and proteins, lipid and proteins, and carbohydrates and lipids, did not change significantly. The only exception was the wild-type 137c, in which proteins decreased relative to carbohydrates and lipids, when the cells were transferred to low CO2. It is noticeable that the two wild types used in this study responded differently to the transition from high to low CO2. Malfunctions of the CCM influenced the concentration of several elements, somewhat altering cell elemental stoichiometry: especially the C/P and N/P ratios changed appreciably in almost all strains as a function of the growth CO2 concentration, except in 137c and the Rubisco activase mutant rca1. In strain cia3, defective in the lumenal carbonic anhydrase (CA), the cell quotas of P, S, Ca, Mn, Fe, and Zn were about 5-fold higher at low CO2 than at high CO2. A Principle Components Analysis showed that, mostly because of its elemental composition, cia3 behaved in a substantially different way from all other strains, at low CO2. The lumenal CA thus plays a crucial role, not only for the correct functioning of the CCM, but also for element utilization. Not surprisingly, growth at high CO2 attenuated differences among strains.

  12. Cluster of genes that encode positive and negative elements influencing filament length in a heterocyst-forming cyanobacterium.

    PubMed

    Merino-Puerto, Victoria; Herrero, Antonia; Flores, Enrique

    2013-09-01

    The filamentous, heterocyst-forming cyanobacteria perform oxygenic photosynthesis in vegetative cells and nitrogen fixation in heterocysts, and their filaments can be hundreds of cells long. In the model heterocyst-forming cyanobacterium Anabaena sp. strain PCC 7120, the genes in the fraC-fraD-fraE operon are required for filament integrity mainly under conditions of nitrogen deprivation. The fraC operon transcript partially overlaps gene all2395, which lies in the opposite DNA strand and ends 1 bp beyond fraE. Gene all2395 produces transcripts of 1.35 kb (major transcript) and 2.2 kb (minor transcript) that overlap fraE and whose expression is dependent on the N-control transcription factor NtcA. Insertion of a gene cassette containing transcriptional terminators between fraE and all2395 prevented production of the antisense RNAs and resulted in an increased length of the cyanobacterial filaments. Deletion of all2395 resulted in a larger increase of filament length and in impaired growth, mainly under N2-fixing conditions and specifically on solid medium. We denote all2395 the fraF gene, which encodes a protein restricting filament length. A FraF-green fluorescent protein (GFP) fusion protein accumulated significantly in heterocysts. Similar to some heterocyst differentiation-related proteins such as HglK, HetL, and PatL, FraF is a pentapeptide repeat protein. We conclude that the fraC-fraD-fraE←fraF gene cluster (where the arrow indicates a change in orientation), in which cis antisense RNAs are produced, regulates morphology by encoding proteins that influence positively (FraC, FraD, FraE) or negatively (FraF) the length of the filament mainly under conditions of nitrogen deprivation. This gene cluster is often conserved in heterocyst-forming cyanobacteria. PMID:23813733

  13. Cluster of Genes That Encode Positive and Negative Elements Influencing Filament Length in a Heterocyst-Forming Cyanobacterium

    PubMed Central

    Merino-Puerto, Victoria; Herrero, Antonia

    2013-01-01

    The filamentous, heterocyst-forming cyanobacteria perform oxygenic photosynthesis in vegetative cells and nitrogen fixation in heterocysts, and their filaments can be hundreds of cells long. In the model heterocyst-forming cyanobacterium Anabaena sp. strain PCC 7120, the genes in the fraC-fraD-fraE operon are required for filament integrity mainly under conditions of nitrogen deprivation. The fraC operon transcript partially overlaps gene all2395, which lies in the opposite DNA strand and ends 1 bp beyond fraE. Gene all2395 produces transcripts of 1.35 kb (major transcript) and 2.2 kb (minor transcript) that overlap fraE and whose expression is dependent on the N-control transcription factor NtcA. Insertion of a gene cassette containing transcriptional terminators between fraE and all2395 prevented production of the antisense RNAs and resulted in an increased length of the cyanobacterial filaments. Deletion of all2395 resulted in a larger increase of filament length and in impaired growth, mainly under N2-fixing conditions and specifically on solid medium. We denote all2395 the fraF gene, which encodes a protein restricting filament length. A FraF-green fluorescent protein (GFP) fusion protein accumulated significantly in heterocysts. Similar to some heterocyst differentiation-related proteins such as HglK, HetL, and PatL, FraF is a pentapeptide repeat protein. We conclude that the fraC-fraD-fraE←fraF gene cluster (where the arrow indicates a change in orientation), in which cis antisense RNAs are produced, regulates morphology by encoding proteins that influence positively (FraC, FraD, FraE) or negatively (FraF) the length of the filament mainly under conditions of nitrogen deprivation. This gene cluster is often conserved in heterocyst-forming cyanobacteria. PMID:23813733

  14. Nuclear proteins TREF1 and TREF2 bind to the transcriptional control element of the transferrin receptor gene and appear to be associated as a heterodimer.

    PubMed Central

    Roberts, M R; Miskimins, W K; Ruddle, F H

    1989-01-01

    Two novel proteins that bind specifically to the transferrin receptor (TR) promoter, have been isolated from HeLa cell nuclear extract using a combination of ion exchange and oligonucleotide-affinity chromatography. TREF1 and TREF2, which have apparent molecular weights of 82 and 62 kDa, respectively, appear to be associated as a heterocomplex (TREF), and both proteins are able to contact target DNA directly. TREF interacts specifically with a region of the TR promoter which contains the TR transcriptional control element. This region is similar in sequence to the cAMP-responsive and phorbol ester-responsive elements found in several viral and cellular genes. Binding of TREF to the TR promoter results in modification of DNA topology over multiple helical turns, including a sequence revealed by a helical periodicity map as having an unusual structure. Images PMID:2519614

  15. [Molecular evolution of mobile elements of the gypsy group: a homolog of the gag gene in Drosophila].

    PubMed

    Nefedova, L N; Kim, A I

    2009-01-01

    Retrotransposons of the gypsy group of Drosophila melanogaster that are structurally similar to retroviruses of vertebrates occupy an important place among retroelements of eukaryotes. The infectious abilities of some retrotransposons of this group (gypsy, ZAM, and Idefix) have been demonstrated experimentally, and therefore they are true retroviruses. It is supposed that retrotransposons can evolve acquiring new components, the sources of which remain to be elucidated. In this work, the CG4680 gene (Gag related protein, Grp) homologous to gag of retrotransposons of the gypsy group has been identified in the genome of D. melanogaster and characterized. The Grp gene product has a highly conserved structure in different species of the Drosophilidae family and is under of stabilizing selection, which suggests its important genomic function in Drosophila. In view of the earlier data, it can be concluded that homologous genes of all components of gypsy retrotransposons are present in the Drosophila genome. These genes can be both precursors and products of domestication of retrovirus genes.

  16. Genome Wide Analysis Reveals Zic3 Interaction with Distal Regulatory Elements of Stage Specific Developmental Genes in Zebrafish

    PubMed Central

    Kumar, Vibhor; Srinivasan, Kandhadayar G.; Orlov, Yuriy; Ravishankar, Ashwini; Prabhakar, Shyam; Stanton, Lawrence W.; Korzh, Vladimir; Mathavan, Sinnakaruppan

    2013-01-01

    Zic3 regulates early embryonic patterning in vertebrates. Loss of Zic3 function is known to disrupt gastrulation, left-right patterning, and neurogenesis. However, molecular events downstream of this transcription factor are poorly characterized. Here we use the zebrafish as a model to study the developmental role of Zic3 in vivo, by applying a combination of two powerful genomics approaches – ChIP-seq and microarray. Besides confirming direct regulation of previously implicated Zic3 targets of the Nodal and canonical Wnt pathways, analysis of gastrula stage embryos uncovered a number of novel candidate target genes, among which were members of the non-canonical Wnt pathway and the neural pre-pattern genes. A similar analysis in zic3-expressing cells obtained by FACS at segmentation stage revealed a dramatic shift in Zic3 binding site locations and identified an entirely distinct set of target genes associated with later developmental functions such as neural development. We demonstrate cis-regulation of several of these target genes by Zic3 using in vivo enhancer assay. Analysis of Zic3 binding sites revealed a distribution biased towards distal intergenic regions, indicative of a long distance regulatory mechanism; some of these binding sites are highly conserved during evolution and act as functional enhancers. This demonstrated that Zic3 regulation of developmental genes is achieved predominantly through long distance regulatory mechanism and revealed that developmental transitions could be accompanied by dramatic changes in regulatory landscape. PMID:24204288

  17. Suppression of the Barley uroporphyrinogen III synthase Gene by a Ds Activation Tagging Element Generates Developmental Photosensitivity[W

    PubMed Central

    Ayliffe, Michael A.; Agostino, Anthony; Clarke, Bryan C.; Furbank, Robert; von Caemmerer, Susanne; Pryor, Anthony J.

    2009-01-01

    Chlorophyll production involves the synthesis of photoreactive intermediates that, when in excess, are toxic due to the production of reactive oxygen species (ROS). A novel, activation-tagged barley (Hordeum vulgare) mutant is described that results from antisense suppression of a uroporphyrinogen III synthase (Uros) gene, the product of which catalyzes the sixth step in the synthesis of chlorophyll and heme. In homozygous mutant plants, uroporphyrin(ogen) I accumulates by spontaneous cyclization of hydroxyl methylbilane, the substrate of Uros. Accumulation of this tetrapyrrole intermediate results in photosensitive cell death due to the production of ROS. The efficiency of Uros gene suppression is developmentally regulated, being most effective in mature seedling leaves compared with newly emergent leaves. Reduced transcript accumulation of a number of nuclear-encoded photosynthesis genes occurs in the mutant, even under 3% light conditions, consistent with a retrograde plastid-nuclear signaling mechanism arising from Uros gene suppression. A similar set of nuclear genes was repressed in wild-type barley following treatment with a singlet oxygen-generating herbicide, but not by a superoxide generating herbicide, suggesting that the retrograde signaling apparent in the mutant is specific to singlet oxygen. PMID:19336693

  18. Expression of the human Hand1 gene in trophoblastic cells is transcriptionally regulated by activating and repressing specificity protein (Sp)-elements.

    PubMed

    Vasicek, Richard; Meinhardt, Gudrun; Haidweger, Eva; Rotheneder, Hans; Husslein, Peter; Knöfler, Martin

    2003-01-01

    The tissue-specific basic helix-loop-helix protein Hand1 is essential for the formation of trophoblast giant cells of the murine placenta. In humans, Hand1 is detectable in trophoblastic tumour cells suggesting an equivalent role in trophoblast differentiation. To understand its mode of expression we have cloned and characterized the human Hand1 gene promoter. Primer extension analyses suggest that transcription initiates 19 nucleotides downstream of the TATA element of the proximal 5' flanking region. Expression of luciferase reporter constructs harboring deletions of the 9.5 kb Hand1 5' flanking sequence defines a promoter region within 274 bp upstream of the transcriptional start site. Compared to a reporter bearing only the TATA box, the proximal promoter activates transcription up to 30-fold. However, transcriptional activity of the region was observed in both Hand1-expressing and non-expressing cell lines. Sequencing, DNAseI footprint analyses and electrophoretic mobility shift assays reveal the presence of four GC-rich sequences, which show different affinities to the endogenous specificity proteins (Sp), and a CCAAT box. In vitro, the Sp-elements mainly interact with Sp1 and Sp3 while the CCAAT element is recognized by the alpha CAAT binding factor protein. Mutant luciferase reporters bearing single active or inactive recognition sites demonstrate that two of the four Sp-binding sites (I and IV) contribute little to the overall transcription rate. The two other Sp-cognate sequences, II and III, downregulate and activate reporter expression 2.3- and 2.6-fold, respectively. Co-transfections of Sp1/Sp3 expression vectors and mutated reporter constructs in Sp-deficient SL2 cells indicate that the Sp-binding site II and III indeed function as repressing and activating enhancer sequences. In summary, the data suggest that constitutive expression of the Hand1 gene in cultured cells is regulated by a complex interplay of Sp-proteins interacting with activator and

  19. Identification of a lactose-responsive element upstream of the promoter of Bacillus megaterium beta-galactosidase-encoding gene mbgA.

    PubMed

    Li, Jen-Ming; Chiou, Chih-Yung; Lee, Tian-Ren; Chen, Yuan-Shou; Shaw, Gwo-Chyuan

    2005-07-01

    The Bacillus megaterium mbgA gene encodes a lactose-hydrolyzing beta-galactosidase. An AraC/XylS-type activator BgaR can activate mbgA transcription in response to lactose. In this report, we show by various deletion analyses and point mutagenesis analyses that an inverted repeat centered at position -60.5 relative to the mbgA transcriptional initiation site is the cis-acting element responsible for lactose induction of mbgA expression. PMID:15971092

  20. Pilot Sequencing of Onion Genomic DNA Reveals Fragments of Transposable Elements, Low Gene Densities, and Significant Gene Enrichment After Methyl Filtration

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Onion (Allium cepa) is a diploid (2n=2x=16) monocot with one of the largest nuclear genomes among cultivated plants, over 6 and 16 times that of maize and rice, respectively. In this study, we sequenced onion BACs to estimate gene densities and investigate the nature and distribution of repetitive ...

  1. A downstream regulatory element located within the coding sequence mediates autoregulated expression of the yeast fatty acid synthase gene FAS2 by the FAS1 gene product.

    PubMed

    Wenz, P; Schwank, S; Hoja, U; Schüller, H J

    2001-11-15

    The fatty acid synthase genes FAS1 and FAS2 of the yeast Saccharomyces cerevisiae are transcriptionally co-regulated by general transcription factors (such as Reb1, Rap1 and Abf1) and by the phospholipid-specific heterodimeric activator Ino2/Ino4, acting via their corresponding upstream binding sites. Here we provide evidence for a positive autoregulatory influence of FAS1 on FAS2 expression. Even with a constant FAS2 copy number, a 10-fold increase of FAS2 transcript amount was observed in the presence of FAS1 in multi-copy, compared to a fas1 null mutant. Surprisingly, the first 66 nt of the FAS2 coding region turned out as necessary and sufficient for FAS1-dependent gene expression. FAS2-lacZ fusion constructs deleted for this region showed high reporter gene expression even in the absence of FAS1, arguing for a negatively-acting downstream repression site (DRS) responsible for FAS1-dependent expression of FAS2. Our data suggest that the FAS1 gene product, in addition to its catalytic function, is also required for the coordinate biosynthetic control of the yeast FAS complex. An excess of uncomplexed Fas1 may be responsible for the deactivation of an FAS2-specific repressor, acting via the DRS. PMID:11713312

  2. Role of the cgtA gene function in DNA replication of extrachromosomal elements in Escherichia coli.

    PubMed

    Ulanowska, Katarzyna; Sikora, Aleksandra; Wegrzyn, Grzegorz; Czyz, Agata

    2003-07-01

    The cgtA gene codes for a common GTP-binding protein whose homologues were found in all prokaryotic and eukaryotic organisms investigated so far. Although cgtA is an essential gene in most bacterial species, its precise functions in the regulation of cellular processes are largely unknown. In Escherichia coli, dysfunction or overexpression of the cgtA gene causes problems in various chromosomal functions, like synchronization of DNA replication initiation and partitioning of daughter chromosomes after a replication round. It is not know how the cgtA gene product regulates these processes. Here we investigated effects of cgtA dysfunction on replication of plasmid and phage replicons. We found that replication of some plasmids (e.g., ColE1-like) is not affected in the cgtA mutant. On the other hand, dysfunction of the cgtA gene caused a strong inhibition of lambda plasmid DNA replication. Bacteriophage lambda development was severely impaired in the cgtA mutant. Replication of other plasmid replicons (derivatives of F, R1, R6K, and RK2) was influenced by the cgtA mutation moderately. It seems that DNA synthesis per se is not affected by CgtA, and that this protein might control replication initiation indirectly, by regulation of function(s) or production of one or more replication factors. In fact, we found that level of the host-encoded replication protein DnaA is significantly decreased in the cgtA mutant. This indicates that CgtA is involved in the regulation of dnaA gene expression.

  3. Further studies on the GS element. A novel mycobacterial insertion sequence (IS1612), inserted into an acetylase gene (mpa) in Mycobacterium avium subsp. silvaticum but not in Mycobacterium avium subsp. paratuberculosis.

    PubMed

    Bull, T J; Sheridan, J M; Martin, H; Sumar, N; Tizard, M; Hermon-Taylor, J

    2000-12-20

    We have recently described the GS element, found in Mycobacterium avium subsp. paratuberculosis (MAP), Mycobacterium avium subsp. silvaticum (MAS) and some isolates of Mycobacterium avium subsp. avium serotype 2 (MAAs2), which contains a set of genes of low GC% content, putatively associated with the biosynthesis, modification and transference of fucose to cell wall glycopeptidolipids. Here we describe a further gene of low GC% content (mpa), within the GS element in MAP. mpa is a putative acetyltransferase with homology to genes directly responsible for host specificity and virulence in Salmonella typhimurium and Shigella flexneri. Unlike other GS genes, strong homologues of mpa have not been found in related species, including Mycobacterium tuberculosis (MTB). In MAP, mpa encodes an ORF of 445aa, however, in MAS and MAAs2 mpa contains a single inserted copy of a novel insertion sequence. This element (IS1612) has two sets of inverted repeats at each terminus and encodes two ORFs with good homologies to transposase and helper proteins of IS21 (E. coli) and IS1415 (R. erythropolis). Sequence comparisons between mpa in MAP and MAS indicate the target site for IS1612 is duplicated on insertion to give a direct repeat at each end of the element. Immediately, downstream of the mpa gene in both MAP and MAS are a group of three genes with good homology to the daunorubicin resistance cluster. This cluster has a high GC% content which suggests a 'border' for the GS element. A short motif present at the beginning of this cluster matches with an inverted repeat of this motif at the beginning of the first gene in the GS element. This encapsulates the whole of this group of low GC% genes in MAP and further suggests its cassette-like nature. Homologues of the GS element in MTB show a marked similarity of organisation, suggesting a parallel role for these genes in both pathogens.

  4. Relative Strengths of Promoters Provided by Common Mobile Genetic Elements Associated with Resistance Gene Expression in Gram-Negative Bacteria.

    PubMed

    Kamruzzaman, Muhammad; Patterson, Jason D; Shoma, Shereen; Ginn, Andrew N; Partridge, Sally R; Iredell, Jonathan R

    2015-08-01

    Comparison of green fluorescent protein expression from outward-facing promoters (POUT) of ISAba1, ISEcp1, and ISAba125 revealed approximate equivalence in strength, intermediate between PCS (strong) and PCWTGN-10 (weak) class 1 integron promoter variants, >30-fold stronger than POUT of ISCR1, and >5 times stronger than Ptac. Consistent with its usual role, PCWTGN-10 produces more mRNA from a "downstream" gfp gene transcriptionally linked to a "usual" PCWTGN-10-associated gene cassette than does POUT of ISAba1. PMID:26055385

  5. Evaluation of IRX Genes and Conserved Noncoding Elements in a Region on 5p13.3 Linked to Families with Familial Idiopathic Scoliosis and Kyphosis

    PubMed Central

    Justice, Cristina M.; Bishop, Kevin; Carrington, Blake; Mullikin, Jim C.; Swindle, Kandice; Marosy, Beth; Sood, Raman; Miller, Nancy H.; Wilson, Alexander F.

    2016-01-01

    Because of genetic heterogeneity present in idiopathic scoliosis, we previously defined clinical subsets (a priori) from a sample of families with idiopathic scoliosis to find genes involved with spinal curvature. Previous genome-wide linkage analysis of seven families with at least two individuals with kyphoscoliosis found linkage (P-value = 0.002) in a 3.5-Mb region on 5p13.3 containing only three known genes, IRX1, IRX2, and IRX4. In this study, the exons of IRX1, IRX2, and IRX4, the conserved noncoding elements in the region, and the exons of a nonprotein coding RNA, LOC285577, were sequenced. No functional sequence variants were identified. An intrafamilial test of association found several associated noncoding single nucleotide variants. The strongest association was with rs12517904 (P = 0.00004), located 6.5 kb downstream from IRX1. In one family, the genotypes of nine variants differed from the reference allele in all individuals with kyphoscoliosis, and two of three individuals with scoliosis, but did not differ from the reference allele in all other genotyped individuals. One of these variants, rs117273909, was located in a conserved noncoding region that functions as an enhancer in mice. To test whether the variant allele at rs117273909 had an effect on enhancer activity, zebrafish transgenesis was performed with overlapping fragments of 198 and 687 bp containing either the wild type or the variant allele. Our data suggests that this region acts as a regulatory element; however, its size and target gene(s) need to be identified to determine its role in idiopathic scoliosis. PMID:27172222

  6. Characterization of a Disease-associated Mutation Affecting a Putative Splicing Regulatory Element in Intron 6b of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Gene*

    PubMed Central

    Faà, Valeria; Incani, Federica; Meloni, Alessandra; Corda, Denise; Masala, Maddalena; Baffico, A. Maria; Seia, Manuela; Cao, Antonio; Rosatelli, M. Cristina

    2009-01-01

    Cystic fibrosis (CF) is a common recessive disorder caused by >1600 mutations in the CF transmembrane conductance regulator (CFTR) gene. About 13% of CFTR mutations are classified as “splicing mutations,” but for almost 40% of these, their role in affecting the pre-mRNA splicing of the gene is not yet defined. In this work, we describe a new splicing mutation detected in three unrelated Italian CF patients. By DNA analyses and mRNA studies, we identified the c.1002–1110_1113delTAAG mutation localized in intron 6b of the CFTR gene. At the mRNA level, this mutation creates an aberrant inclusion of a sequence of 101 nucleotides between exons 6b and 7. This sequence corresponds to a portion of intron 6b and resembles a cryptic exon because it is characterized by an upstream ag and a downstream gt sequence, which are most probably recognized as 5′- and 3′-splice sites by the spliceosome. Through functional analysis of this splicing defect, we show that this mutation abolishes the interaction of the splicing regulatory protein heterogeneous nuclear ribonucleoprotein A2/B1 with an intronic splicing regulatory element and creates a new recognition motif for the SRp75 splicing factor, causing activation of the cryptic exon. Our results show that the c.1002–1110_1113delTAAG mutation creates a new intronic splicing regulatory element in intron 6b of the CFTR gene exclusively recognized by SRp75. PMID:19759008

  7. Carbohydrate-Responsive Element-Binding Protein (ChREBP) Is a Negative Regulator of ARNT/HIF-1β Gene Expression in Pancreatic Islet β-Cells

    PubMed Central

    Noordeen, Nafeesa A.; Khera, Tarnjit K.; Sun, Gao; Longbottom, E. Rebecca; Pullen, Timothy J.; da Silva Xavier, Gabriela; Rutter, Guy A.; Leclerc, Isabelle

    2010-01-01

    OBJECTIVE Carbohydrate-responsive element-binding protein (ChREBP) is a transcription factor that has been shown to regulate carbohydrate metabolism in the liver and pancreatic β-cells in response to elevated glucose concentrations. Because few genes have been identified so far as bona fide ChREBP-target genes, we have performed a genome-wide analysis of the ChREBP transcriptome in pancreatic β-cells. RESEARCH DESIGN AND METHODS Chromatin immunoprecipitation and high-density oligonucleotide tiling arrays (ChIP-chip; Agilent Technologies) using MIN6 pancreatic β-cell extracts were performed together with transcriptional and other analysis using standard techniques. RESULTS One of the genes identified by ChIP-chip and linked to glucose sensing and insulin secretion was aryl hydrocarbon receptor nuclear translocator (ARNT)/hypoxia-inducible factor-1β (HIF-1β), a transcription factor implicated in altered gene expression and pancreatic-islet dysfunction in type 2 diabetes. We first confirmed that elevated glucose concentrations decreased ARNT/HIF-1β levels in INS-1 (832/13) cells and primary mouse islets. Demonstrating a role for ChREBP in ARNT gene regulation, ChREBP silencing increased ARNT mRNA levels in INS-1 (832/13) cells, and ChREBP overexpression decreased ARNT mRNA in INS-1 (832/13) cells and primary mouse islets. We demonstrated that ChREBP and Max-like protein X (MLX) bind on the ARNT/HIF-1β promoter on the proximal region that also confers the negative glucose responsiveness. CONCLUSIONS These results demonstrate that ChREBP acts as a novel repressor of the ARNT/HIF-1β gene and might contribute to β-cell dysfunction induced by glucotoxicity. PMID:19833882

  8. DNA methylation is a determinative element of photosynthesis gene expression in amyloplasts from liquid-cultured cells of sycamore (Acer pseudoplatanus L.).

    PubMed

    Ngernprasirtsiri, J; Kobayashi, H; Akazawa, T

    1990-10-01

    Transcriptional regulation has been shown to operate as a selective control mechanism of expression of photosynthetic genes in the nonphotosynthetic plastids, amyloplasts, of a white-wild cell line of sycamore (Acer pseudoplatanus L.). To elaborate the mechanisms governing the transcriptional regulation at the molecular level, we have examined the template activity of the amyloplast DNA compared to the chloroplast DNA by using the in vitro run-off transcription assay system with extracts of the two plastid types. The results of these assays clearly indicate that most of the amyloplast DNA regions do not serve as a template for the in vitro transcription regardless of the plastid extracts; this is in contrast to the chloroplast DNA which serves as an active template. It is highly likely that the template activity of amyloplast DNA per se is the modulating element of transcriptional regulation. Parallel experiments determining the DNA base content by HPLC analysis have shown that a variety of methylated bases, especially 5-methylcytosine, are localized in the DNA regions containing suppressed genes of the amyloplast genome. In sharp contrast, methylated bases were undetectable in the expressed gene regions of amyloplast and whole chloroplast genomes. The overall findings strongly support the notion that DNA methylation is involved in the selective suppression of photosynthetic genes in the nonphotosynthetic plastids of cultured sycamore cells.

  9. Isolation of pig mitochondrial 3-hydroxy-3-methylglutaryl-CoA synthase gene promoter: characterization of a peroxisome proliferator-responsive element.

    PubMed Central

    Ortiz, J A; Mallolas, J; Nicot, C; Bofarull, J; Rodríguez, J C; Hegardt, F G; Haro, D; Marrero, P F

    1999-01-01

    Low expression of the mitochondrial 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) synthase gene during development correlates with an unusually low hepatic ketogenic capacity and lack of hyperketonaemia in piglets. Here we report the isolation and characterization of the 5' end of the pig mitochondrial HMG-CoA synthase gene. The 581 bp region proximal to the transcription start site permits transcription of a reporter gene, confirming the function of the promoter. The pig mitochondrial HMG-CoA synthase promoter is trans-activated by the peroxisomal proliferator-activated receptor (PPAR), and a functional response element for PPAR (PPRE) has been localized in the promoter region. Pig PPRE is constituted by an imperfect direct repeat (DR-1) and a downstream sequence, both of which are needed to confer PPAR-sensitivity to a thymidine kinase promoter and to form complexes with PPAR.retinoid X receptor heterodimers. A role of PPAR trans-activation in starvation-associated induction of gene expression is suggested. PMID:9882632

  10. Closing the gaps on human chromosome 19 revealed genes with a high density of repetitive tandemly arrayed elements.

    SciTech Connect

    Leem, Sun-Hee; Kouprina, Natalay; Grimwood, Jane; Kim, Jung-Hyun; Mullokandov, Michael; Yoon, Young-Ho; Chae, Ji-Youn; Morgan, Jenna; Lucas, Susan; Richardson, Paul; Detter, Chris; Glavina, Tijana; Rubin, Eddy; Barrett, J. Carl; Larionov, Vladimir

    2003-09-01

    The reported human genome sequence includes about 400 gaps of unknown sequence that were not found in the bacterial artificial chromosome (BAC) and cosmid libraries used for sequencing of the genome. These missing sequences correspond to {approx} 1 percent of euchromatic regions of the human genome. Gap filling is a laborious process because it relies on analysis of random clones of numerous genomic BAC or cosmid libraries. In this work we demonstrate that closing the gaps can be accelerated by a selective recombinational capture of missing chromosomal segments in yeast. The use of both methodologies allowed us to close the four remaining gaps on the human chromosome 19. Analysis of the gap sequences revealed that they contain several abnormalities that could result in instability of the sequences in microbe hosts, including large blocks of micro- and minisatellites and a high density of Alu repeats. Sequencing of the gap regions, in both BAC and YAC forms, allowed us to generate a complete sequence of four genes, including the neuronal cell signaling gene SCK1/SLI. The SCK1/SLI gene contains a record number of minisatellites, most of which are polymorphic and transmitted through meiosis following a Mendelian inheritance. In conclusion, the use of the alternative recombinational cloning system in yeast may greatly accelerate work on closing the remaining gaps in the human genome (as well as in other complex genomes) to achieve the goal of annotation of all human genes.

  11. Regulatory elements and structural features of Beta vulgaris polygalacturonase-inhibiting protein gene for fungal and pest control

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polygalacturonase-inhibiting proteins (PGIPs) are involved in plant defense. PGIPs are cell wall leucine-rich repeat (LRR) proteins that are known to inhibit pathogen and pest polygalacturonases (PGs) during the infection process. Several sugar beet (Beta vulgaris L.) PGIP genes (BvPGIP) were clon...

  12. The Arabidopsis floral homeotic gene PISTILLATA is regulated by discrete cis-elements responsive to induction and maintenance signals.

    PubMed

    Honma, T; Goto, K

    2000-05-01

    PISTILLATA is a B-class floral organ identity gene required for the normal development of petals and stamens in Arabidopsis. PISTILLATA expression is induced in the stage 3 flowers (early expression) and is maintained until anthesis (late expression). To explore in more detail the developmentally regulated gene expression of PISTILLATA, we have analyzed the PISTILLATA promoter using uidA (beta)-glucuronidase gene) fusion constructs (PI::GUS) in transgenic Arabidopsis. Promoter deletion analyses suggest that early PISTILLATA expression is mediated by the distal region and that late expression is mediated by the proximal region. Based on the PI::GUS expression patterns in the loss- and gain-of-function alleles of meristem or organ identity genes, we have shown that LEAFY and UNUSUAL FLORAL ORGANS induce PISTILLATA expression in a flower-independent manner via a distal promoter, and that PISTILLATA and APETALA3 maintain PISTILLATA expression (autoregulation) in the later stages of flower development via a proximal promoter. In addition, we have demonstrated that de novo protein synthesis is required for the PISTILLATA autoregulatory circuit. PMID:10769227

  13. Transcriptome Analysis of an Insecticide Resistant Housefly Strain: Insights about SNPs and Regulatory Elements in Cytochrome P450 Genes

    PubMed Central

    Asp, Torben; Kristensen, Michael

    2016-01-01

    Background Insecticide resistance in the housefly, Musca domestica, has been investigated for more than 60 years. It will enter a new era after the recent publication of the housefly genome and the development of multiple next generation sequencing technologies. The genetic background of the xenobiotic response can now be investigated in greater detail. Here, we investigate the 454-pyrosequencing transcriptome of the spinosad-resistant 791spin strain in relation to the housefly genome with focus on P450 genes. Results The de novo assembly of clean reads gave 35,834 contigs consisting of 21,780 sequences of the spinosad resistant strain. The 3,648 sequences were annotated with an enzyme code EC number and were mapped to 124 KEGG pathways with metabolic processes as most highly represented pathway. One hundred and twenty contigs were annotated as P450s covering 44 different P450 genes of housefly. Eight differentially expressed P450s genes were identified and investigated for SNPs, CpG islands and common regulatory motifs in promoter and coding regions. Functional annotation clustering of metabolic related genes and motif analysis of P450s revealed their association with epigenetic, transcription and gene expression related functions. The sequence variation analysis resulted in 12 SNPs and eight of them found in cyp6d1. There is variation in location, size and frequency of CpG islands and specific motifs were also identified in these P450s. Moreover, identified motifs were associated to GO terms and transcription factors using bioinformatic tools. Conclusion Transcriptome data of a spinosad resistant strain provide together with genome data fundamental support for future research to understand evolution of resistance in houseflies. Here, we report for the first time the SNPs, CpG islands and common regulatory motifs in differentially expressed P450s. Taken together our findings will serve as a stepping stone to advance understanding of the mechanism and role of P450s

  14. Evidence that Altered Cis Element Spacing Affects PpsR Mediated Redox Control of Photosynthesis Gene Expression in Rubrivivax gelatinosus.

    PubMed

    Shimizu, Takayuki; Cheng, Zhuo; Matsuura, Katsumi; Masuda, Shinji; Bauer, Carl E

    2015-01-01

    PpsR is a major regulator of photosynthesis gene expression among all characterized purple photosynthetic bacteria. This transcription regulator has been extensively characterized in Rhodobacter (Rba.) capsulatus and Rba. sphaeroides which are members of the α-proteobacteria lineage. In this study, we have investigated the biochemical properties and mutational effects of a ppsR deletion strain in the β-proteobacterium Rubrivivax (Rvi.) gelatinosus in order to reveal phylogenetically conserved mechanisms and species-specific characteristics. A deletion of the ppsR gene resulted in de-repression of photosystem synthesis showing that PpsR functions as a repressor of photosynthesis genes in this species. We also constructed a Rvi. gelatinosus PpsR mutant in which a conserved cysteine at position 436 was changed to an alanine to examine whether or not this residue is important for sensing redox, as reported in Rhodobacter species. Surprisingly, the Cys436 Ala mutant retained the ability to repress photosynthesis gene expression under aerobic conditions, suggesting that PpsR from Rvi. gelatinosus has different redox-responding characteristics. Furthermore, biochemical analyses demonstrated that Rvi. gelatinosus PpsR only shows redox-dependent binding to promoters with 9-bp spacing, but not 8-bp spacing, between two PpsR-recognition sequences. These results indicate that redox-dependent binding of PpsR requires appropriate cis configuration of PpsR target sequences in Rvi. gelatinosus. These results also indicate that PpsR homologs from different species regulate photosynthesis genes with altered biochemical properties.

  15. Structure, inheritance, and transcriptional effects of Pce1, an insertional element within Phanerochaete chrysosporium lignin peroxidase gene lipI

    SciTech Connect

    Gaskell, J.; Wymelenberg, A.V.; Cullen, D. |

    1995-08-01

    A 1747-bp insertion within a lignin peroxidase allele of Phanerochaete chrysosporium BKM-F-1767 is described. Pce1, the element, lies immediately adjacent to the fourth intron of lipI2. Southern blots reveal the presence of Pce1-homologous sequences in other P. chrysosporium strains. Transposon-like features include inverted terminal repeats and a dinucleotide (TA) target duplication. Atypical of transposons, Pce1 is present at very low copy numbers (one to five copies), and conserved transposase motifs are lacking. The mutation transcriptionally inactivates lipI2 and is inherited in a 1:1 Mendelian fashion among haploid progeny. Thus, Pce1 is a transposon-like element that may play a significant role in generating ligninolytic variation in certain P. chrysosporium strains. 39 refs., 7 figs.

  16. The Role of Crowding Forces in Juxtaposing β-Globin Gene Domain Remote Regulatory Elements in Mouse Erythroid Cells.

    PubMed

    Golov, Arkadiy K; Gavrilov, Alexey A; Razin, Sergey V

    2015-01-01

    The extremely high concentration of macromolecules in a eukaryotic cell nucleus indicates that the nucleoplasm is a crowded macromolecular solution in which large objects tend to gather together due to crowding forces. It has been shown experimentally that crowding forces support the integrity of various nuclear compartments. However, little is known about their role in control of chromatin dynamics in vivo. Here, we experimentally addressed the possible role of crowding forces in spatial organization of the eukaryotic genome. Using the mouse β-globin domain as a model, we demonstrated that spatial juxtaposition of the remote regulatory elements of this domain in globin-expressing cells may be lost and restored by manipulation of the level of macromolecular crowding. In addition to proving the role of crowding forces in shaping interphase chromatin, our results suggest that the folding of the chromatin fiber is a major determinant in juxtaposing remote genomic elements. PMID:26436546

  17. Proximal promoter elements of the human zeta-globin gene confer embryonic-specific expression on a linked reporter gene in transgenic mice.

    PubMed

    Pondel, M D; Sharpe, J A; Clark, S; Pearson, L; Wood, W G; Proudfoot, N J

    1996-11-01

    We have investigated the transcriptional regulation of the human embryonic zeta-globin gene promoter. First, we examined the effect that deletion of sequences 5' to zeta-globin's CCAAT box have on zeta-promoter activity in erythroid cell lines. Deletions of sequences between -116 and -556 (cap = 0) had little effect while further deletion to -84 reduced zeta-promoter activity by only 2-3-fold in both transiently and stably transfected erythroid cells. Constructs containing 67, 84 and 556 bp of zeta-globin 5' flanking region linked to a beta-galactosidase reporter gene (lacZ) and hypersensitive site -40 (HS-40) of the human alpha-globin gene cluster were then employed for the generation of transgenic mice. LacZ expression from all constructs, including a 67 bp zeta-globin promoter, was erythroid-specific and most active between 8.5 and 10.5 days post-fertilisation. By 16.5 days gestation, lacZ expression dropped 40-100-fold. These results suggest that embryonic-specific activation of the human zeta-globin promoter is conferred by a 67 bp zeta-promoter fragment containing only a CCAAT and TATA box. PMID:8932366

  18. Human antioxidant-response-element-mediated regulation of type 1 NAD(P)H:quinone oxidoreductase gene expression. Effect of sulfhydryl modifying agents.

    PubMed

    Li, Y; Jaiswal, A K

    1994-11-15

    Human antioxidant-response element (hARE) containing two copies of the AP1/AP1-like elements arranged as inverse repeat is known to mediate basal and beta-naphthoflavone-induced transcription of the type 1 NAD(P)H:quinone oxidoreductase (NQO1) gene. Band-shift assays revealed that beta-naphthoflavone increased binding of nuclear proteins at the hARE. Super shift assays identified Jun-D and c-Fos proteins in the band-shift complexes observed with control and beta-naphthoflavone-treated Hepa-1 nuclear extracts. Hepa-1 cells stably transformed with hARE-tk-chloramphenicol acetyl transferase (CAT) recombinant plasmid were used to demonstrate that, in addition to beta-naphthoflavone, a variety of antioxidants, tumor promoters and hydrogen peroxide (H2O2) also increased expression of hARE-mediated CAT gene. beta-naphthoflavone induction of the CAT gene expression in Hepa-1 cells was found insensitive to inhibitors of protein kinase C and tyrosine kinases. However, binding of regulatory proteins at the hARE and the CAT gene expression in Hepa-1 cells were increased by dithiothreitol, 2-mercaptoethanol and diamide. Treatment of the Hepa-1 cells with N-ethylmaleimide reduced binding of proteins at the hARE and interfered with expression and beta-naphthoflavone induction of the CAT gene. These results suggested a role of sulfhydryl modification of hARE binding (Jun and Fos) proteins which mediate basal and induced expression of the NQO1 gene. We also report that in-vitro-translated products of the proto-oncogenes, Jun and Fos, bind to the hARE in band-shift assays. The incubation of Jun and Fos proteins with small amounts of nuclear extract from dimethylsulfoxide-treated (control) or beta-naphthoflavone treated Hepa-1 cells prior to band-shift assays increased the binding of Jun and Fos proteins to the hARE. Interestingly, the increase in binding of Jun and Fos proteins to the hARE was more prominent with beta-naphthoflavone-treated nuclear extract as compared to the control

  19. A Xenopus laevis gene encoding EF-1 alpha S, the somatic form of elongation factor 1 alpha: sequence, structure, and identification of regulatory elements required for embryonic transcription.

    PubMed

    Johnson, A D; Krieg, P A

    1995-01-01

    Transcription of the Xenopus laevis EF-1 alpha S gene commences at the mid-blastula stage of embryonic development and then continues constitutively in all somatic tissues. The EF-1 alpha S promoter is extremely active in the early Xenopus embryo where EF-1 alpha S transcripts account for as much as 40% of all new polyadenylated transcripts. We have isolated the Xenopus EF-1 alpha S gene and used microinjection techniques to identify promoter elements responsible for embryonic transcription. These in vivo expression studies have identified an enhancer fragment, located approximately 4.4 kb upstream of the transcription start site, that is required for maximum expression from the EF-1 alpha S promoter. The enhancer fragment contains both an octamer and a G/C box sequence, but mutation studies indicate that the octamer plays no significant role in regulation of EF-1 alpha S expression in the embryo. The presence of a G/C element in the enhancer and of multiple G/C boxes in the proximal promoter region suggests that the G/C box binding protein, Sp1, plays a major role in the developmental regulation of EF-1 alpha S promoter activity. PMID:8565334

  20. Metallic trace element body burdens and gene expression analysis of biomarker candidates in Eisenia fetida, using an "exposure/depuration" experimental scheme with field soils.

    PubMed

    Bernard, Fabien; Brulle, Franck; Douay, Francis; Lemière, Sébastien; Demuynck, Sylvain; Vandenbulcke, Franck

    2010-07-01

    Smelting plant activities lead to the accumulation of Metal Trace Elements (MTEs) in soils. The presence of high concentrations of MTEs can generate an environmental stress likely to affect macroinvertebrates living in close soil contact such as the Annelida Oligochaeta. Eisenia fetida, an ecotoxicologically important test species, was successively exposed to two field soils: (1) a highly contaminated agricultural topsoil collected near the former smelter Metaleurop Nord (Noyelles-Godault, France) which contaminated surrounding soils by its atmospheric emissions [exposure phase], and then (2) a slightly contaminated topsoil from an urban garden located in the conurbation of Lille (Wambrechies) [depuration phase]. Two analyses were performed during each phase. Firstly, the gene expression levels of four biomarker candidates identified in previous studies were analyzed in E. fetida coelomocytes. These candidates are Cd-metallothionein, phytochelatin synthase, coactosin-like protein and lysenin. Secondly, the body burdens of the following elements Cd, Pb, Zn, Cu, Fe, Ca, and P were measured. Moreover, both analyses were also performed in Lumbricus rubellus, an Annelid species collected from the two tested soil-originating sites. Analysis of gene expression and MTE body burdens in both species are discussed to: (1) evaluate expression biomarkers; (2) gain insight the detoxification processes and the long-term response to a metallic stress and (3) compare the responses observed in a test species (E. fetida) with the responses of a field species (L. rubellus).

  1. Identification and characterization of a functional retinoic acid/thyroid hormone-response element upstream of the human insulin gene enhancer.

    PubMed Central

    Clark, A R; Wilson, M E; London, N J; James, R F; Docherty, K

    1995-01-01

    A deletion analysis of the human insulin gene extending to 2 kb upstream of the transcription start site provided evidence of regulatory sequences located upstream of the insulin-linked polymorphic region (ILPR). Within this ILPR-distal region is a sequence (Ink, for insulin kilobase upstream) which contains three potential nuclear hormone-receptor half-sites, closely matching the consensus sequence AGGTCA. These sequences are arranged as a palindromic element with zero spacing over-lapping a direct repeat with 2 bp spacing. The Ink sequence was used in electrophoretic mobility-shift assays within nuclear extracts from COS-7 cells overexpressing the vitamin D, thyroid hormone or retinoic acid receptors, or from an insulin-expressing hamster cell line, HIT-T15. These studies suggest that the insulin-expressing cell line contains thyroid hormone and retinoic acid receptors at least, and that these receptors are able to recognize the Ink sequence. Three copies of the Ink sequence were placed upstream of the thymidine kinase promoter and firefly luciferase reporter gene. In COS-7 cells expressing the appropriate nuclear hormone receptor, this construct was responsive to both thyroid hormone (18-fold) and all-trans-retinoic acid (31-fold). In HIT-T15 cells the same construct responded to all-trans-retinoic acid, but not to thyroid hormone. Within the context of a 2 kb insulin gene fragment, the Ink sequence was shown to be activated by retinoic acid and by the retinoic acid receptor, but acted as a negative element in the presence of both retinoic acid and the retinoic acid receptor. Mutagenesis studies demonstrated that the palindromic sequence was important for the retinoic acid response, and for binding of complexes containing retinoic acid receptor. In human islets of Langerhans, retinoic acid was shown to stimulate insulin mRNA levels. These results demonstrate that a functional nuclear hormone-receptor-response element is located upstream of the human ILPR. As

  2. A feedback control element near the transcription start site of the maize Shrunken gene determines promoter activity.

    PubMed Central

    Maas, C; Schaal, S; Werr, W

    1990-01-01

    The transcriptional activity of the Shrunken (Sh) promoter of Zea mays was monitored in transient expression assays using the neomycin phosphotransferase (NPT) II gene as a reporter in maize suspension protoplasts. Shortly after transfection, expression of this chimeric NPTII gene was negatively affected by high extracellular sucrose concentrations in the protoplast cultivation medium. However, 3-5 days after transfection an up to 405-fold increase in NPTII activity was observed. This could be blocked by dichlorobenzonitril (DCB) an inhibitor of cellulose biosynthesis. In the analysis of promoter deletions 20 bp upstream of the Sh transcription start site were sufficient to reproduce the expression profile and the activity of the full promoter. Surprisingly this start sequence does not include the natural TATA-box. Images Fig.1 Fig.2 Fig.3 Fig.4 PMID:2145150

  3. The TTSMI database: a catalog of triplex target DNA sites associated with genes and regulatory elements in the human genome

    PubMed Central

    Jenjaroenpun, Piroon; Chew, Chee Siang; Yong, Tai Pang; Choowongkomon, Kiattawee; Thammasorn, Wimada; Kuznetsov, Vladimir A.

    2015-01-01

    A triplex target DNA site (TTS), a stretch of DNA that is composed of polypurines, is able to form a triple-helix (triplex) structure with triplex-forming oligonucleotides (TFOs) and is able to influence the site-specific modulation of gene expression and/or the modification of genomic DNA. The co-localization of a genomic TTS with gene regulatory signals and functional genome structures suggests that TFOs could potentially be exploited in antigene strategies for the therapy of cancers and other genetic diseases. Here, we present the TTS Mapping and Integration (TTSMI; http://ttsmi.bii.a-star.edu.sg) database, which provides a catalog of unique TTS locations in the human genome and tools for analyzing the co-localization of TTSs with genomic regulatory sequences and signals that were identified using next-generation sequencing techniques and/or predicted by computational models. TTSMI was designed as a user-friendly tool that facilitates (i) fast searching/filtering of TTSs using several search terms and criteria associated with sequence stability and specificity, (ii) interactive filtering of TTSs that co-localize with gene regulatory signals and non-B DNA structures, (iii) exploration of dynamic combinations of the biological signals of specific TTSs and (iv) visualization of a TTS simultaneously with diverse annotation tracks via the UCSC genome browser. PMID:25324314

  4. The TTSMI database: a catalog of triplex target DNA sites associated with genes and regulatory elements in the human genome.

    PubMed

    Jenjaroenpun, Piroon; Chew, Chee Siang; Yong, Tai Pang; Choowongkomon, Kiattawee; Thammasorn, Wimada; Kuznetsov, Vladimir A

    2015-01-01

    A triplex target DNA site (TTS), a stretch of DNA that is composed of polypurines, is able to form a triple-helix (triplex) structure with triplex-forming oligonucleotides (TFOs) and is able to influence the site-specific modulation of gene expression and/or the modification of genomic DNA. The co-localization of a genomic TTS with gene regulatory signals and functional genome structures suggests that TFOs could potentially be exploited in antigene strategies for the therapy of cancers and other genetic diseases. Here, we present the TTS Mapping and Integration (TTSMI; http://ttsmi.bii.a-star.edu.sg) database, which provides a catalog of unique TTS locations in the human genome and tools for analyzing the co-localization of TTSs with genomic regulatory sequences and signals that were identified using next-generation sequencing techniques and/or predicted by computational models. TTSMI was designed as a user-friendly tool that facilitates (i) fast searching/filtering of TTSs using several search terms and criteria associated with sequence stability and specificity, (ii) interactive filtering of TTSs that co-localize with gene regulatory signals and non-B DNA structures, (iii) exploration of dynamic combinations of the biological signals of specific TTSs and (iv) visualization of a TTS simultaneously with diverse annotation tracks via the UCSC genome browser.

  5. Regulation of gene expression in the protozoan parasite Entamoeba invadens: identification of core promoter elements and promoters with stage-specific expression patterns.

    PubMed

    Manna, Dipak; Ehrenkaufer, Gretchen M; Singh, Upinder

    2014-10-01

    Developmental switching between life-cycle stages is a common feature among many pathogenic organisms. Entamoeba histolytica is an important human pathogen and is a leading parasitic cause of death globally. During its life cycle, Entamoeba converts between cysts (essential for disease transmission) and trophozoites (responsible for tissue invasion). Despite being central to its biology, the triggers that are involved in the developmental pathways of this parasite are not well understood. In order to define the transcriptional network associated with stage conversion we used Entamoeba invadens which serves as a model system for Entamoeba developmental biology, and performed RNA sequencing at different developmental time points. In this study RNA-Seq data was utilised to define basal transcriptional control elements as well as to identify promoters which regulate stage-specific gene expression patterns. We discovered that the 5' and 3' untranslated regions of E. invadens genes are short, a median of 20 nucleotides (nt) and 26 nt respectively. Bioinformatics analysis of DNA sequences proximate to the start and stop codons identified two conserved motifs: (i) E. invadens Core Promoter Motif - GAAC-Like (EiCPM-GL) (GAACTACAAA), and (ii) E. invadens 3'-U-Rich Motif (Ei3'-URM) (TTTGTT) in the 5' and 3' flanking regions, respectively. Electrophoretic mobility shift assays demonstrated that both motifs specifically bind nuclear protein(s) from E. invadens trophozoites. Additionally, we identified select genes with stage-specific expression patterns and analysed the ability of each gene promoter to drive a luciferase reporter gene during the developmental cycle. This approach confirmed three trophozoite-specific, four encystation-specific and two excystation-specific promoters. This work lays the framework for use of stage-specific promoters to express proteins of interest in a particular life-cycle stage, adding to the molecular toolbox for genetic manipulation of E

  6. Hypoxia-Response Element (HRE)–Directed Transcriptional Regulation of the Rat Lysyl Oxidase Gene in Response to Cobalt and Cadmium

    PubMed Central

    Li, Wande

    2013-01-01

    Lysyl oxidase (LO) catalyzes crosslink of collagen, elastin, and histone H1, stabilizing the extracellular matrix and cell nucleus. This enzyme displays dual functions for tumorigenesis, i.e., as a tumor suppressor inactivating the ras oncogene and as a tumor promoter enhancing malignant cell metastasis. To elucidate LO transcriptional regulation, we have cloned the 804 base pair region upstream of the translation start site (ATG) of the rat LO gene with the maximal promoter activity. Computer analysis indicated that at least four hypoxia-response element (HRE) consensuses (5′-ACGTG-3′) exist in the cloned LO promoter. Treatment of rat lung fibroblasts (RFL6) with CoCl2 (Co, 10–100 μM), a chemical hypoxia reagent, enhanced LO mRNA expression and promoter activities. Overexpression of LO was associated with upregulation of hypoxia-inducible factor (HIF)-1α at mRNA levels in cobalt (Co)–treated cells. Thus, LO is a hypoxia-responsive gene. Dominant negative-HIF-1α inhibited LO promoter activities stimulated by Co. Electrophoretic mobility shift, oligonucleotide competition, and in vitro translated HIF-1α binding assays indicated that only one HRE mapped at −387/−383 relative to ATG was functionally active among four consensuses. Site-directed mutation of this HRE significantly diminished the Co-induced and LO promoter-directed expression of the reporter gene. Cadmium (Cd), an inducer of reactive oxygen species, inhibited HIF-1α mRNA expression and HIF-1α binding to the LO gene in Co-treated cells as revealed by RT-PCR and ChIP assays, respectively. Thus, modulation of the HRE activity by Co and Cd plays a critical role in LO gene transactivation. PMID:23161664

  7. csrT Represents a New Class of csrA-Like Regulatory Genes Associated with Integrative Conjugative Elements of Legionella pneumophila

    PubMed Central

    Abbott, Zachary D.; Flynn, Kaitlin J.; Byrne, Brenda G.; Mukherjee, Sampriti; Kearns, Daniel B.

    2015-01-01

    ABSTRACT Bacterial evolution is accelerated by mobile genetic elements. To spread horizontally and to benefit the recipient bacteria, genes encoded on these elements must be properly regulated. Among the legionellae are multiple integrative conjugative elements (ICEs) that each encode a paralog of the broadly conserved regulator csrA. Using bioinformatic analyses, we deduced that specific csrA paralogs are coinherited with particular lineages of the type IV secretion system that mediates horizontal spread of its ICE, suggesting a conserved regulatory interaction. As a first step to investigate the contribution of csrA regulators to this class of mobile genetic elements, we analyzed here the activity of the csrA paralog encoded on Legionella pneumophila ICE-βox. Deletion of this gene, which we name csrT, had no observed effect under laboratory conditions. However, ectopic expression of csrT abrogated the protection to hydrogen peroxide and macrophage degradation that ICE-βox confers to L. pneumophila. When ectopically expressed, csrT also repressed L. pneumophila flagellin production and motility, a function similar to the core genome's canonical csrA. Moreover, csrT restored the repression of motility to csrA mutants of Bacillus subtilis, a finding consistent with the predicted function of CsrT as an mRNA binding protein. Since all known ICEs of legionellae encode coinherited csrA-type IV secretion system pairs, we postulate that CsrA superfamily proteins regulate ICE activity to increase their horizontal spread, thereby expanding L. pneumophila versatility. IMPORTANCE ICEs are mobile DNA elements whose type IV secretion machineries mediate spread among bacterial populations. All surveyed ICEs within the Legionella genus also carry paralogs of the essential life cycle regulator csrA. It is striking that the csrA loci could be classified into distinct families based on either their sequence or the subtype of the adjacent type IV secretion system locus. To

  8. High-level expression of a sweet potato sporamin gene promoter: beta-glucuronidase (GUS) fusion gene in the stems of transgenic tobacco plants is conferred by multiple cell type-specific regulatory elements.

    PubMed

    Ohta, S; Hattori, T; Morikami, A; Nakamura, K

    1991-03-01

    Genes coding for sporamin, the most abundant protein of the tuberous root of the sweet potato, are expressed at a high levels in the stems of plantlets cultured axenically on sucrose-containing medium. Their expression is also induced in leaf-petiole explants by high concentrations of sucrose. A fusion gene comprising of the 1 kb 5' upstream region of the gSPO-A1 gene coding for the A-type sporamin and the coding sequence of bacterial beta-glucuronidase (GUS) was introduced into the tobacco genome by Agrobacterium-mediated transformation. Transgenic tobacco plants cultured axenically on sucrose-containing medium expressed GUS activity predominantly in their stems. Histochemical examination of GUS activity using a chromogenic substrate showed a distinct spatial pattern of GUS staining in the stem. Strong GUS activity was detected in the internal phloem of the vascular system and at the node, especially at the base of the axillary bud. Relatively weaker GUS activity was also detected in pith parenchyma. A 5' deletion of the promoter to nucleotide -305, relative to the transcription start site, did not alter significantly the level of GUS activity or the spatial pattern of GUS staining in the stem. However, further deletions to -237 and -192 resulted in a decrease in the level of GUS activity in the stem that occurred simultaneously with the loss of GUS staining in both the internal phloem and at the base of the axillary bud. However, plants with these deletion constructs still exhibited the predominant expression pattern of GUS activity in the stem and GUS staining in the pith parenchyma cells. Deletion to -94 completely abolished the expression of GUS activity. These results indicate that a sequence between -305 and -237 contains a cis-regulatory element(s) that is required for expression of the GUS reporter gene in both the internal phloem and at the base of the axillary bud, while a sequence between -192 and -94 contains a cis-acting element(s) that is required

  9. Blue eye color in humans may be caused by a perfectly associated founder mutation in a regulatory element located within the HERC2 gene inhibiting OCA2 expression.

    PubMed

    Eiberg, Hans; Troelsen, Jesper; Nielsen, Mette; Mikkelsen, Annemette; Mengel-From, Jonas; Kjaer, Klaus W; Hansen, Lars

    2008-03-01

    The human eye color is a quantitative trait displaying multifactorial inheritance. Several studies have shown that the OCA2 locus is the major contributor to the human eye color variation. By linkage analysis of a large Danish family, we finemapped the blue eye color locus to a 166 Kbp region within the HERC2 gene. By association analyses, we identified two SNPs within this region that were perfectly associated with the blue and brown eye colors: rs12913832 and rs1129038. Of these, rs12913832 is located 21.152 bp upstream from the OCA2 promoter in a highly conserved sequence in intron 86 of HERC2. The brown eye color allele of rs12913832 is highly conserved throughout a number of species. As shown by a Luciferase assays in cell cultures, the element significantly reduces the activity of the OCA2 promoter and electrophoretic mobility shift assays demonstrate that the two alleles bind different subsets of nuclear extracts. One single haplotype, represented by six polymorphic SNPs covering half of the 3' end of the HERC2 gene, was found in 155 blue-eyed individuals from Denmark, and in 5 and 2 blue-eyed individuals from Turkey and Jordan, respectively. Hence, our data suggest a common founder mutation in an OCA2 inhibiting regulatory element as the cause of blue eye color in humans. In addition, an LOD score of Z = 4.21 between hair color and D14S72 was obtained in the large family, indicating that RABGGTA is a candidate gene for hair color.

  10. Cell type-specific gene expression in the neuroendocrine system. A neuroendocrine-specific regulatory element in the promoter of chromogranin A, a ubiquitous secretory granule core protein.

    PubMed Central

    Wu, H; Rozansky, D J; Webster, N J; O'Connor, D T

    1994-01-01

    The acidic secretory protein chromogranin A universally occurs in amine and peptide hormone and neurotransmitter storage granules throughout the neuroendocrine system. What factors govern the activity of the chromogranin A gene, to yield such a widespread yet neuroendocrine-selective pattern of expression? To address this question, we isolated the mouse chromogranin A gene promoter. The promoter conferred cell type-specific expression in several neuroendocrine cell types (adrenal medullary chromaffin cells, anterior pituitary corticotropes, and anterior pituitary somatolactotropes) but not in control (fibroblast or kidney) cells. In neuroendocrine cells, analysis of promoter deletions established both positive and negative transcriptional regulatory domains. A distal positive domain (-4.8/-2.2 kbp) was discovered, as well as negative (-258/-181 bp) and positive (-147/-61 bp) domains in the proximate promoter. The proximate promoter contained a minimal neuroendocrine-specific element between -77 and -61 bp. Sequence alignment of the mouse promoter with corresponding regions in rat and bovine clones indicated that the mouse sequence shares over 85% homology with rat and 52% with bovine promoters. DNaseI footprinting and electrophoretic gel mobility shift assays demonstrated the presence of nuclear factors in neuroendocrine cells that recognized the proximate promoter. We conclude that the chromogranin A promoter contains both positive and negative domains governing its cell type-specific pattern of transcription, and that a small proximate region of the promoter, containing novel as well as previously described elements, interacts specifically with neuroendocrine nuclear proteins, and is thereby sufficient to ensure widespread neuroendocrine expression of the gene. Images PMID:8040254

  11. Identification of an oxygen-responsive element in the 5'-flanking sequence of the rat cytosolic phosphoenolpyruvate carboxykinase-1 gene, modulating its glucagon-dependent activation.

    PubMed Central

    Bratke, J; Kietzmann, T; Jungermann, K

    1999-01-01

    The glucagon-stimulated transcription of the cytosolic phosphoenolpyruvate carboxykinase-1 (PCK1) gene is mediated by cAMP and positively modulated by oxygen in primary hepatocytes. Rat hepatocytes were transfected with constructs containing the first 2500, 493 or 281 bp of the PCK1 5'-flanking region in front of the chloramphenicol acetyltransferase (CAT) reporter gene. With all three constructs glucagon induced CAT activity with decreasing efficiency maximally under arterial pO2 and to about 65% under venous pO2. Rat hepatocytes were then transfected with constructs containing the first 493 bp of the PCK1 5'-flanking region in front of the luciferase (LUC) reporter gene, which were block-mutated at the CRE1 (cAMP-response element-1; -93/-86), putative CRE2 (-146/-139), promoter element (P) 1 (-118/-104), P2 (-193/-181) or P4 (-291/-273) sites. Glucagon induced LUC activity strongly when the P1 and P2 sites were mutated and weakly when the P4 site was mutated; induction of the P1, P2 and P4 mutants was positively modulated by the pO2. Glucagon also induced LUC activity strongly when the putative CRE2 site was altered; however, induction of the CRE2 mutant was not modulated by the pO2. Glucagon did not induce LUC activity when the CRE1 site was modified. These experiments suggested that the CRE1 but not the putative CRE2 was an essential site necessary for the cAMP-mediated PCK1 gene activation by glucagon and that the putative CRE2 site was involved in the oxygen-dependent modulation of PCK1 gene activation. To confirm these conclusions rat hepatocytes were transfected with simian virus 40 (SV40)-promoter-driven LUC-gene constructs containing three CRE1 sequences (-95/-84), three CRE2 sequences (-148/-137) or three CRE1 sequences plus two CRE2 sequences of the PCK1 gene in front of the SV40 promoter. Glucagon induced LUC activity markedly when the CRE1, but not when the CRE2, sites were in front of the SV40-LUC gene; however, induction of the (CRE1)3SV40-LUC

  12. Regulation of sterol regulatory-element binding protein 1 gene expression in liver: role of insulin and protein kinase B/cAkt.

    PubMed Central

    Fleischmann, M; Iynedjian, P B

    2000-01-01

    Insulin stimulates the transcription of the sterol regulatory- element binding protein (SREBP) 1/ADD1 gene in liver. Hepatocytes in primary culture were used to delineate the insulin signalling pathway for induction of SREBP1 gene expression. The inhibitors of phosphoinositide 3-kinase (PI 3-kinase), wortmannin and LY 294002, abolished the insulin-dependent increase in SREBP1 mRNA, whereas the inhibitor of the mitogen- activated protein kinase cascade, PD 98059, was without effect. To investigate the role of protein kinase B (PKB)/cAkt downstream of PI 3-kinase, hepatocytes were transduced with an adenovirus encoding a PKB--oestrogen receptor fusion protein. The PKB activity of this recombinant protein was rapidly activated in hepatocytes challenged with 4-hydroxytamoxifen (OHT), as was endogenous PKB in hepatocytes challenged with insulin. The addition of OHT to transduced hepatocytes resulted in accumulation of SREBP1 mRNA, with a time-course and magnitude similar to the effect of insulin in non-transduced cells. The level of SREBP1 mRNA was not increased by OHT in hepatocytes expressing a mutant form of the recombinant protein whose PKB activity was not activated by OHT. Thus acute activation of PKB is sufficient to induce SREBP1 mRNA accumulation in primary hepatocytes, and might be the major signalling event by which insulin induces SREBP1 gene expression in the liver. PMID:10861205

  13. Melanoma loss-of-function mutants in Xiphophorus caused by Xmrk-oncogene deletion and gene disruption by a transposable element.

    PubMed Central

    Schartl, M; Hornung, U; Gutbrod, H; Volff, J N; Wittbrodt, J

    1999-01-01

    The overexpression of the Xmrk oncogene (ONC-Xmrk) in pigment cells of certain Xiphophorus hybrids has been found to be the primary change that results in the formation of malignant melanoma. Spontaneous mutant stocks have been isolated that have lost the ability to induce tumor formation when crossed with Xiphophorus helleri. Two of these loss-of-function mutants were analyzed for genetic defects in ONC-Xmrk's. In the lof-1 mutant a novel transposable element, TX-1, has jumped into ONC-Xmrk, leading to a disruption of the gene and a truncated protein product lacking the carboxyterminal domain of the receptor tyrosine kinase. TX-1 is obviously an active LTR-containing retrotransposon in Xiphophorus that was not found in other fish species outside the family Poeciliidae. Surprisingly, it does not encode any protein, suggesting the existence of a helper function for this retroelement. In the lof-2 mutant the entire ONC-Xmrk gene was found to be deleted. These data show that ONC-Xmrk is indeed the tumor-inducing gene of Xiphophorus and thus the critical constituent of the tumor (Tu) locus. PMID:10545466

  14. The ribosomal protein L34 gene from the mosquito, Aedes albopictus: exon-intron organization, copy number, and potential regulatory elements.

    PubMed

    Niu, L L; Fallon, A M

    1999-12-01

    We describe the structural analysis of genomic DNA encoding ribosomal protein (rp) L34 from the mosquito, Aedes albopictus. Comparison of genomic DNA sequences encompassing approximately 8 kb with the rpL34 cDNA sequence showed that the gene contains three exons and two introns, encoding a primary transcript with a deduced size of 6196 nucleotides from the transcription start site to the polyadenylation site. Exon 1, which is not translated, measures only 45 bp, and is separated from Exon 2 by a 359 bp intron. Exon 2 measures 78 bp, and contains the AUG translation initiation codon 14 nucleotides downstream of its 5'-end. Downstream of Exon 2 is a 5270 bp intron, followed by the remainder of the coding sequence in Exon 3, which measures 444 bp including the polyadenylation signal. We used a novel PCR-based procedure to obtain 1.7 kb of DNA upstream of the rpL34 gene. Like the previously described Ae. albopictus rpL8 gene and various mammalian rp genes, the DNA immediately upstream of the rpL34 gene lacks the TATA box, and the rpL34 transcription initiation site is embedded in a characteristic polypyrimidine tract. The 5'-flanking DNA contained a number of cis-acting elements that potentially interact with transcription factors characterized by basic domains, zinc-coordinating DNA binding domains, helix-turn-helix motifs, and beta scaffold factors with minor groove contacts. Particularly striking was the conservation of an AP-4 binding site within 100 nucleotides upstream of the transcription initiation site in both Aal-rpL34 and Aal-rpL8 genes. Comparison of Southern hybridization signals using probes from the 5' and 3'-ends of the 5.3 kb second intron and the cDNA suggested that the Ae. albopictus rpL34 gene most likely occurs as a single expressed copy per haploid genome with restriction enzyme polymorphisms in the upstream flanking DNA and the likely presence of one or more pseudogenes. PMID:10612044

  15. The imprinted SNRPN gene is associated with a polycistronic mRNA and an imprinting control element

    SciTech Connect

    Saitoh, S.; Nicholls, R.D.; Seip, J.

    1994-09-01

    The small nuclear ribonucleoprotein-associated protein SmN (SNRPN) gene is located in the Prader-Willi syndrome (PWS) critical region in chromosome 15q11-q13. We have previously shown that it is functionally imprinted in humans, being only expressed from the paternal allele and differentially methylated on parental alleles. Therefore, SNRPN may have a role in PWS, although genetic studies suggest that at least two genes may be necessary for the classical PWS phenotype. We have characterized the SNRPN genomic structure, and shown that it comprises ten exons. Surprisingly, we identified an open reading frame (ORF) in the first three exons, 190-bp 5{prime} to the SmN ORF. Notably, the majority of base substitutions bewteen human and rodents in the upstream ORF occurred in the wobble position of codons, suggesting selection for a protein coding function. This ORF, which we name SNURF (SNRPN upstream reading frame) encodes a putative polypeptide of 71 amino acids. By analogy to prokaryotic operons that encode proteins with related functions, it is possible that SNURF may have a role in pre-mRNA splicing.

  16. Regulation of the tryptophan biosynthetic genes in Bacillus halodurans: common elements but different strategies than those used by Bacillus subtilis.

    PubMed

    Szigeti, Reka; Milescu, Mirela; Gollnick, Paul

    2004-02-01

    In Bacillus subtilis, an RNA binding protein called TRAP regulates both transcription and translation of the tryptophan biosynthetic genes. Bacillus halodurans is an alkaliphilic Bacillus species that grows at high pHs. Previous studies of this bacterium have focused on mechanisms of adaptation for growth in alkaline environments. We have characterized the regulation of the tryptophan biosynthetic genes in B. halodurans and compared it to that in B. subtilis. B. halodurans encodes a TRAP protein with 71% sequence identity to the B. subtilis protein. Expression of anthranilate synthetase, the first enzyme in the pathway to tryptophan, is regulated significantly less in B. halodurans than in B. subtilis. Examination of the control of the B. halodurans trpEDCFBA operon both in vivo and in vitro shows that only transcription is regulated, whereas in B. subtilis both transcription of the operon and translation of trpE are controlled. The attenuation mechanism that controls transcription in B. halodurans is similar to that in B. subtilis, but there are some differences in the predicted RNA secondary structures in the B. halodurans trp leader region, including the presence of a potential anti-antiterminator structure. Translation of trpG, which is within the folate operon in both bacilli, is regulated similarly in the two species. PMID:14729709

  17. Select Prenatal Environmental Exposures and Subsequent Alterations of Gene-Specific and Repetitive Element DNA Methylation in Fetal Tissues.

    PubMed

    Green, Benjamin B; Marsit, Carmen J

    2015-06-01

    Strong evidence implicates maternal environmental exposures in contributing to adverse outcomes during pregnancy and later in life through the developmental origins of health and disease hypothesis. Recent research suggests these effects are mediated through the improper regulation of DNA methylation in offspring tissues, specifically placental tissue, which plays a critical role in fetal development. This article reviews the relevant literature relating DNA methylation in multiple tissues at or near delivery to several prenatal environmental toxicants and stressors, including cigarette smoke, endocrine disruptors, heavy metals, as well as maternal diet. These human studies expand upon previously reported outcomes in animal model interventions and include effects on both imprinted and non-imprinted genes. We have also noted some of the strengths and limitations in the approaches used, and consider the appropriate interpretation of these findings in terms of their effect size and their relationship to differential gene expression and potential health outcomes. The studies suggest an important role of DNA methylation in mediating the effects of the intrauterine environment on children's health and a need for additional research to better clarify the role of this epigenetic mechanism as well as others. PMID:26231362

  18. Select Prenatal Environmental Exposures and Subsequent Alterations of Gene-Specific and Repetitive Element DNA Methylation in Fetal Tissues

    PubMed Central

    Green, Benjamin B.; Marsit, Carmen J.

    2015-01-01

    Strong evidence implicates maternal environmental exposures in contributing to adverse outcomes during pregnancy and later in life through the developmental origins of health and disease hypothesis. Recent research suggests these effects are mediated through the improper regulation of DNA methylation in offspring tissues, specifically placental tissue, which plays a critical role in fetal development. This article reviews the relevant literature relating DNA methylation in multiple tissues at or near delivery to several prenatal environmental toxicants and stressors, including cigarette smoke, endocrine disruptors, heavy metals, as well as maternal diet. These human studies expand upon previously reported outcomes in animal model interventions and include effects on both imprinted and non-imprinted genes. We have also noted some of the strengths and limitations in the approaches used, and consider the appropriate interpretation of these findings in terms of their effect size and their relationship to differential gene expression and potential health outcomes. The studies suggest an important role of DNA methylation in mediating the effects of the intrauterine environment on children’s health and a need for additional research to better clarify the role of this epigenetic mechanism as well as others. PMID:26231362

  19. Presenilins regulate neurotrypsin gene expression and neurotrypsin-dependent agrin cleavage via cyclic AMP response element-binding protein (CREB) modulation.

    PubMed

    Almenar-Queralt, Angels; Kim, Sonia N; Benner, Christopher; Herrera, Cheryl M; Kang, David E; Garcia-Bassets, Ivan; Goldstein, Lawrence S B

    2013-12-01

    Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment.

  20. The housekeeping gene (GA3PDH) and the long interspersed nuclear element (LINE) in the blood and organs of rats treated with cocaine.

    PubMed

    Voskresenskiy, Anatoliy M; Sun, Lena S

    2008-08-01

    Housekeeping genes are necessary for maintenance of the vital activity of the cells of any phylum of organisms. Transposons or mobile genetic elements are eurysynusic in nature. Thus, the role of these and other genes in the pathogenesis of many diseases and of drug addiction in particular is being investigated. The goal of the work is to determine the influence of cocaine on the activity of GA3PDH and on a representative of the LINE family (L1Rn) in plasma, and in a pellet of blood cells, and in the organs of rats. Gene expression was evaluated by RT-PCR. The GA3PDH (452-bp fragment) was predictably found in plasma, in a pellet of blood cells, and in organs. Its quantity in plasma was greater in the experimental groups