Sample records for element functionally conserved

  1. Conservation and functional element discovery in 20 angiosperm plant genomes.


    Hupalo, Daniel; Kern, Andrew D


    Here, we describe the construction of a phylogenetically deep, whole-genome alignment of 20 flowering plants, along with an analysis of plant genome conservation. Each included angiosperm genome was aligned to a reference genome, Arabidopsis thaliana, using the LASTZ/MULTIZ paradigm and tools from the University of California-Santa Cruz Genome Browser source code. In addition to the multiple alignment, we created a local genome browser displaying multiple tracks of newly generated genome annotation, as well as annotation sourced from published data of other research groups. An investigation into A. thaliana gene features present in the aligned A. lyrata genome revealed better conservation of start codons, stop codons, and splice sites within our alignments (51% of features from A. thaliana conserved without interruption in A. lyrata) when compared with previous publicly available plant pairwise alignments (34% of features conserved). The detailed view of conservation across angiosperms revealed not only high coding-sequence conservation but also a large set of previously uncharacterized intergenic conservation. From this, we annotated the collection of conserved features, revealing dozens of putative noncoding RNAs, including some with recorded small RNA expression. Comparing conservation between kingdoms revealed a faster decay of vertebrate genome features when compared with angiosperm genomes. Finally, conserved sequences were searched for folding RNA features, including but not limited to noncoding RNA (ncRNA) genes. Among these, we highlight a double hairpin in the 5'-untranslated region (5'-UTR) of the PRIN2 gene and a putative ncRNA with homology targeting the LAF3 protein.

  2. Genetic evidence for conserved non-coding element function across species–the ears have it

    PubMed Central

    Turner, Eric E.; Cox, Timothy C.


    Comparison of genomic sequences from diverse vertebrate species has revealed numerous highly conserved regions that do not appear to encode proteins or functional RNAs. Often these “conserved non-coding elements,” or CNEs, can direct gene expression to specific tissues in transgenic models, demonstrating they have regulatory function. CNEs are frequently found near “developmental” genes, particularly transcription factors, implying that these elements have essential regulatory roles in development. However, actual examples demonstrating CNE regulatory functions across species have been few, and recent loss-of-function studies of several CNEs in mice have shown relatively minor effects. In this Perspectives article, we discuss new findings in “fancy” rats and Highland cattle demonstrating that function of a CNE near the Hmx1 gene is crucial for normal external ear development and when disrupted can mimic loss-of function Hmx1 coding mutations in mice and humans. These findings provide important support for conserved developmental roles of CNEs in divergent species, and reinforce the concept that CNEs should be examined systematically in the ongoing search for genetic causes of human developmental disorders in the era of genome-scale sequencing. PMID:24478720

  3. Functionally conserved cis-regulatory elements of COL18A1 identified through zebrafish transgenesis.


    Kague, Erika; Bessling, Seneca L; Lee, Josephine; Hu, Gui; Passos-Bueno, Maria Rita; Fisher, Shannon


    Type XVIII collagen is a component of basement membranes, and expressed prominently in the eye, blood vessels, liver, and the central nervous system. Homozygous mutations in COL18A1 lead to Knobloch Syndrome, characterized by ocular defects and occipital encephalocele. However, relatively little has been described on the role of type XVIII collagen in development, and nothing is known about the regulation of its tissue-specific expression pattern. We have used zebrafish transgenesis to identify and characterize cis-regulatory sequences controlling expression of the human gene. Candidate enhancers were selected from non-coding sequence associated with COL18A1 based on sequence conservation among mammals. Although these displayed no overt conservation with orthologous zebrafish sequences, four regions nonetheless acted as tissue-specific transcriptional enhancers in the zebrafish embryo, and together recapitulated the major aspects of col18a1 expression. Additional post-hoc computational analysis on positive enhancer sequences revealed alignments between mammalian and teleost sequences, which we hypothesize predict the corresponding zebrafish enhancers; for one of these, we demonstrate functional overlap with the orthologous human enhancer sequence. Our results provide important insight into the biological function and regulation of COL18A1, and point to additional sequences that may contribute to complex diseases involving COL18A1. More generally, we show that combining functional data with targeted analyses for phylogenetic conservation can reveal conserved cis-regulatory elements in the large number of cases where computational alignment alone falls short.

  4. Annotation of cis-regulatory elements by identification, subclassification, and functional assessment of multispecies conserved sequences

    PubMed Central

    Hughes, Jim R.; Cheng, Jan-Fang; Ventress, Nicki; Prabhakar, Shyam; Clark, Kevin; Anguita, Eduardo; De Gobbi, Marco; de Jong, Pieter; Rubin, Eddy; Higgs, Douglas R.


    An important step toward improving the annotation of the human genome is to identify cis-acting regulatory elements from primary DNA sequence. One approach is to compare sequences from multiple, divergent species. This approach distinguishes multispecies conserved sequences (MCS) in noncoding regions from more rapidly evolving neutral DNA. Here, we have analyzed a region of ≈238kb containing the human α globin cluster that was sequenced and/or annotated across the syntenic region in 22 species spanning 500 million years of evolution. Using a variety of bioinformatic approaches and correlating the results with many aspects of chromosome structure and function in this region, we were able to identify and evaluate the importance of 24 individual MCSs. This approach sensitively and accurately identified previously characterized regulatory elements but also discovered unidentified promoters, exons, splicing, and transcriptional regulatory elements. Together, these studies demonstrate an integrated approach by which to identify, subclassify, and predict the potential importance of MCSs. PMID:15998734

  5. A functionally conserved Polycomb response element from mouse HoxD complex responds to heterochromatin factors

    NASA Astrophysics Data System (ADS)

    Vasanthi, Dasari; Nagabhushan, A.; Matharu, Navneet Kaur; Mishra, Rakesh K.


    Anterior-posterior body axis in all bilaterians is determined by the Hox gene clusters that are activated in a spatio-temporal order. This expression pattern of Hox genes is established and maintained by regulatory mechanisms that involve higher order chromatin structure and Polycomb group (PcG) and trithorax group (trxG) proteins. We identified earlier a Polycomb response element (PRE) in the mouse HoxD complex that is functionally conserved in flies. We analyzed the molecular and genetic interactions of mouse PRE using Drosophila melanogaster and vertebrate cell culture as the model systems. We demonstrate that the repressive activity of this PRE depends on PcG/trxG genes as well as the heterochromatin components. Our findings indicate that a wide range of factors interact with the HoxD PRE that can contribute to establishing the expression pattern of homeotic genes in the complex early during development and maintain that pattern at subsequent stages.

  6. Conservation defines functional motifs in the squint/nodal-related 1 RNA dorsal localization element

    PubMed Central

    Gilligan, Patrick C.; Kumari, Pooja; Lim, Shimin; Cheong, Albert; Chang, Alex; Sampath, Karuna


    RNA localization is emerging as a general principle of sub-cellular protein localization and cellular organization. However, the sequence and structural requirements in many RNA localization elements remain poorly understood. Whereas transcription factor-binding sites in DNA can be recognized as short degenerate motifs, and consensus binding sites readily inferred, protein-binding sites in RNA often contain structural features, and can be difficult to infer. We previously showed that zebrafish squint/nodal-related 1 (sqt/ndr1) RNA localizes to the future dorsal side of the embryo. Interestingly, mammalian nodal RNA can also localize to dorsal when injected into zebrafish embryos, suggesting that the sequence motif(s) may be conserved, even though the fish and mammal UTRs cannot be aligned. To define potential sequence and structural features, we obtained ndr1 3′-UTR sequences from approximately 50 fishes that are closely, or distantly, related to zebrafish, for high-resolution phylogenetic footprinting. We identify conserved sequence and structural motifs within the zebrafish/carp family and catfish. We find that two novel motifs, a single-stranded AGCAC motif and a small stem-loop, are required for efficient sqt RNA localization. These findings show that comparative sequencing in the zebrafish/carp family is an efficient approach for identifying weak consensus binding sites for RNA regulatory proteins. PMID:21149265

  7. Conservation of Fold and Topology of Functional Elements in Thiamin Pyrophosphate Enzymes

    NASA Technical Reports Server (NTRS)

    Dominiak, P.; Ciszak, E. M.


    Thiamin pyrophosphate (TPP)-dependent enzymes are a highly divergent family of proteins binding both TPP and metal ions. They perform decarboxylation-hydroxyaldehydes. Prior -ketoacids and of a common - (O=)C-C(OH)- fragment of to knowledge of three-dimensional structures of these enzmes, the GDGY25-30NN sequence was used to identify these enzymes. Subsequently, a number of structural studies on those enzymes revealed multi-subunit organization and the features of the two duplicate cofactor binding sites. Analyzing the structures of 44 structurally known enzymes, we found that the common structure of these enzymes is reduced to 180-220 amino acid long fragments of two PP and two PYR domains that form the [PP:PYR]2 binding center of two cofactor molecules. The structures of PP and PYR are arranged in a similar fold-sheet with triplets of helices on both sides.Dconsisting of a six-stranded Residues surrounding the cofactors are not strictly conserved, but they provide the same interatomic contacts required for the catalytic functions that these enzymes perform while maintaining interactive structural integrity. These structural and functional amino acids are topological counterparts located in the same positions of the conserved fold of sets of PP and PYR domains. Additional parallels include short fragments of sequences that link these amino acids to the fold and function. This report on the structural commonalities amongst TPP dependent enzymes is thought to contribute new approaches to annotation that may assist in advancing the functional proteomics of TPP dependent enzymes, and trace their complexity within evolutionary context.

  8. Functional conservation of Pax6 regulatory elements in humans and mice demonstrated with a novel transgenic reporter mouse

    PubMed Central

    Tyas, David A; Simpson, T Ian; Carr, Catherine B; Kleinjan, Dirk A; van Heyningen, Veronica; Mason, John O; Price, David J


    Background The Pax6 transcription factor is expressed during development in the eyes and in specific CNS regions, where it is essential for normal cell proliferation and differentiation. Mice lacking one or both copies of the Pax6 gene model closely humans with loss-of-function mutations in the PAX6 locus. The sequence of the Pax6/PAX6 protein is identical in mice and humans and previous studies have shown structural conservation of the gene's regulatory regions. Results We generated a transgenic mouse expressing green fluorescent protein (GFP) and neomycin resistance under the control of the entire complement of human PAX6 regulatory elements using a modified yeast artificial chromosome (YAC). Expression of GFP was studied in embryos from 9.5 days on and was confined to cells known to express Pax6. GFP expression was sufficiently strong that expressing cells could be distinguished from non-expressing cells using flow cytometry. Conclusion This work demonstrates the functional conservation of the regulatory elements controlling Pax6/PAX6 expression in mice and humans. The transgene provides an excellent tool for studying the functions of different Pax6/PAX6 regulatory elements in controlling Pax6 expression in animals that are otherwise normal. It will allow the analysis and isolation of cells in which Pax6 is activated, irrespective of the status of the endogenous locus. PMID:16674807

  9. The Function of the Conserved Regulatory Element within the Second Intron of the Mammalian Csf1r Locus

    PubMed Central

    O’Neal, Julie; Sester, David P.; Tagoh, Hiromi; Ingram, Richard M.; Pridans, Clare; Bonifer, Constanze; Hume, David A.


    The gene encoding the receptor for macrophage colony-stimulating factor (CSF-1R) is expressed exclusively in cells of the myeloid lineages as well as trophoblasts. A conserved element in the second intron, Fms-Intronic Regulatory Element (FIRE), is essential for macrophage-specific transcription of the gene. However, the molecular details of how FIRE activity is regulated and how it impacts the Csf1r promoter have not been characterised. Here we show that agents that down-modulate Csf1r mRNA transcription regulated promoter activity altered the occupancy of key FIRE cis-acting elements including RUNX1, AP1, and Sp1 binding sites. We demonstrate that FIRE acts as an anti-sense promoter in macrophages and reversal of FIRE orientation within its native context greatly reduced enhancer activity in macrophages. Mutation of transcription initiation sites within FIRE also reduced transcription. These results demonstrate that FIRE is an orientation-specific transcribed enhancer element. PMID:23383005

  10. Profiling of conserved non-coding elements upstream of SHOX and functional characterisation of the SHOX cis-regulatory landscape

    PubMed Central

    Verdin, Hannah; Fernández-Miñán, Ana; Benito-Sanz, Sara; Janssens, Sandra; Callewaert, Bert; Waele, Kathleen De; Schepper, Jean De; François, Inge; Menten, Björn; Heath, Karen E.; Gómez-Skarmeta, José Luis; Baere, Elfride De


    Genetic defects such as copy number variations (CNVs) in non-coding regions containing conserved non-coding elements (CNEs) outside the transcription unit of their target gene, can underlie genetic disease. An example of this is the short stature homeobox (SHOX) gene, regulated by seven CNEs located downstream and upstream of SHOX, with proven enhancer capacity in chicken limbs. CNVs of the downstream CNEs have been reported in many idiopathic short stature (ISS) cases, however, only recently have a few CNVs of the upstream enhancers been identified. Here, we set out to provide insight into: (i) the cis-regulatory role of these upstream CNEs in human cells, (ii) the prevalence of upstream CNVs in ISS, and (iii) the chromatin architecture of the SHOX cis-regulatory landscape in chicken and human cells. Firstly, luciferase assays in human U2OS cells, and 4C-seq both in chicken limb buds and human U2OS cells, demonstrated cis-regulatory enhancer capacities of the upstream CNEs. Secondly, CNVs of these upstream CNEs were found in three of 501 ISS patients. Finally, our 4C-seq interaction map of the SHOX region reveals a cis-regulatory domain spanning more than 1 Mb and harbouring putative new cis-regulatory elements. PMID:26631348

  11. Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

    SciTech Connect

    Santini, Simona; Boore, Jeffrey L.; Meyer, Axel


    Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involved in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.

  12. Evolutionary conservation of regulatory elements in vertebrate Hox gene clusters.


    Santini, Simona; Boore, Jeffrey L; Meyer, Axel


    Comparisons of DNA sequences among evolutionarily distantly related genomes permit identification of conserved functional regions in noncoding DNA. Hox genes are highly conserved in vertebrates, occur in clusters, and are uninterrupted by other genes. We aligned (PipMaker) the nucleotide sequences of the HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human, and mouse, which are separated by approximately 500 million years of evolution. In support of our approach, several identified putative regulatory elements known to regulate the expression of Hox genes were recovered. The majority of the newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac database). The regulatory intergenic regions located between the genes that are expressed most anteriorly in the embryo are longer and apparently more evolutionarily conserved than those at the other end of Hox clusters. Different presumed regulatory sequences are retained in either the Aalpha or Abeta duplicated Hox clusters in the fish lineages. This suggests that the conserved elements are involved in different gene regulatory networks and supports the duplication-deletion-complementation model of functional divergence of duplicated genes.

  13. CEGA--a catalog of conserved elements from genomic alignments.


    Dousse, Aline; Junier, Thomas; Zdobnov, Evgeny M


    By identifying genomic sequence regions conserved among several species, comparative genomics offers opportunities to discover putatively functional elements without any prior knowledge of what these functions might be. Comparative analyses across mammals estimated 4-5% of the human genome to be functionally constrained, a much larger fraction than the 1-2% occupied by annotated protein-coding or RNA genes. Such functionally constrained yet unannotated regions have been referred to as conserved non-coding sequences (CNCs) or ultra-conserved elements (UCEs), which remain largely uncharacterized but probably form a highly heterogeneous group of elements including enhancers, promoters, motifs, and others. To facilitate the study of such CNCs/UCEs, we present our resource of Conserved Elements from Genomic Alignments (CEGA), accessible from Harnessing the power of multiple species comparisons to detect genomic elements under purifying selection, CEGA provides a comprehensive set of CNCs identified at different radiations along the vertebrate lineage. Evolutionary constraint is identified using threshold-free phylogenetic modeling of unbiased and sensitive global alignments of genomic synteny blocks identified using protein orthology. We identified CNCs independently for five vertebrate clades, each referring to a different last common ancestor and therefore to an overlapping but varying set of CNCs with 24 488 in vertebrates, 241 575 in amniotes, 709 743 in Eutheria, 642 701 in Boreoeutheria and 612 364 in Euarchontoglires, spanning from 6 Mbp in vertebrates to 119 Mbp in Euarchontoglires. The dynamic CEGA web interface displays alignments, genomic locations, as well as biologically relevant data to help prioritize and select CNCs of interest for further functional investigations.

  14. A characteristic space-time conservation element and solution element method for conservation laws

    NASA Astrophysics Data System (ADS)

    Shen, Hua; Wen, Chih-Yung; Zhang, De-Liang


    In this paper, an upwind space-time conservation element and solution element (CE/SE) method is developed to solve conservation laws. In the present method, the mesh quantity and spatial derivatives are the independent marching variables, which is consistent with the original CE/SE method proposed by Chang (1995) [5]. The staggered time marching strategy and the definition of conservation element (CE) also follow Chang's propositions. Nevertheless, the definition of solution element (SE) is modified from that of Chang. The numerical flux through the interface of two different conservation elements is not directly derived by a Taylor expansion in the reversed time direction as proposed by Chang, but determined by an upwind procedure. This modification does not change the local and global conservative features of the original method. Although, the time marching scheme of mesh variables is the same with the original method, the upwind fluxes are involved in the calculation of spatial derivatives, yielding a totally different approach from that of Chang's method. The upwind procedure breaks the space-time inversion invariance of the original scheme, so that the new scheme can be directly applied to capture discontinuities without spurious oscillations. In addition, the present method maintains low dissipation in a wide range of CFL number (from 10-6 to 1). Furthermore, we extend the upwind CE/SE method to solve the Euler equations by adopting three different approximate Riemann solvers including Harten, Lax and van Leer (HLL) Riemann solver, contact discontinuity restoring HLLC Riemann solver and mathematically rigorous Roe Riemann solver. Extensive numerical examples are carried out to demonstrate the robustness of the present method. The numerical results show that the new CE/SE solvers perform improved resolutions.

  15. Multigenome DNA sequence conservation identifies Hox cis-regulatory elements

    PubMed Central

    Kuntz, Steven G.; Schwarz, Erich M.; DeModena, John A.; De Buysscher, Tristan; Trout, Diane; Shizuya, Hiroaki; Sternberg, Paul W.; Wold, Barbara J.


    To learn how well ungapped sequence comparisons of multiple species can predict cis-regulatory elements in Caenorhabditis elegans, we made such predictions across the large, complex ceh-13/lin-39 locus and tested them transgenically. We also examined how prediction quality varied with different genomes and parameters in our comparisons. Specifically, we sequenced ∼0.5% of the C. brenneri and C. sp. 3 PS1010 genomes, and compared five Caenorhabditis genomes (C. elegans, C. briggsae, C. brenneri, C. remanei, and C. sp. 3 PS1010) to find regulatory elements in 22.8 kb of noncoding sequence from the ceh-13/lin-39 Hox subcluster. We developed the MUSSA program to find ungapped DNA sequences with N-way transitive conservation, applied it to the ceh-13/lin-39 locus, and transgenically assayed 21 regions with both high and low degrees of conservation. This identified 10 functional regulatory elements whose activities matched known ceh-13/lin-39 expression, with 100% specificity and a 77% recovery rate. One element was so well conserved that a similar mouse Hox cluster sequence recapitulated the native nematode expression pattern when tested in worms. Our findings suggest that ungapped sequence comparisons can predict regulatory elements genome-wide. PMID:18981268

  16. Implicit Space-Time Conservation Element and Solution Element Schemes

    NASA Technical Reports Server (NTRS)

    Chang, Sin-Chung; Himansu, Ananda; Wang, Xiao-Yen


    Artificial numerical dissipation is in important issue in large Reynolds number computations. In such computations, the artificial dissipation inherent in traditional numerical schemes can overwhelm the physical dissipation and yield inaccurate results on meshes of practical size. In the present work, the space-time conservation element and solution element method is used to construct new and accurate implicit numerical schemes such that artificial numerical dissipation will not overwhelm physical dissipation. Specifically, these schemes have the property that numerical dissipation vanishes when the physical viscosity goes to zero. These new schemes therefore accurately model the physical dissipation even when it is extremely small. The new schemes presented are two highly accurate implicit solvers for a convection-diffusion equation. The two schemes become identical in the pure convection case, and in the pure diffusion case. The implicit schemes are applicable over the whole Reynolds number range, from purely diffusive equations to convection-dominated equations with very small viscosity. The stability and consistency of the schemes are analysed, and some numerical results are presented. It is shown that, in the inviscid case, the new schemes become explicit and their amplification factors are identical to those of the Leapfrog scheme. On the other hand, in the pure diffusion case, their principal amplification factor becomes the amplification factor of the Crank-Nicolson scheme.

  17. A 3-dimensional mass conserving element for compressible flows

    NASA Technical Reports Server (NTRS)

    Fix, G.; Suri, M.


    A variety of finite element schemes has been used in the numerical approximation of compressible flows particularly in underwater acoustics. In many instances instabilities have been generated due to the lack of mass conservation. Two- and three-dimensional elements are developed which avoid these problems.

  18. New alloys to conserve critical elements

    NASA Technical Reports Server (NTRS)

    Stephens, J. R.


    Based on availability of domestic reserves, chromium is one of the most critical elements within the U.S. metal industry. New alloys having reduced chromium contents which offer potential as substitutes for higher chromium containing alloys currently in use are being investigated. This paper focuses primarily on modified Type 304 stainless steels having one-third less chromium, but maintaining comparable oxidation and corrosion properties to that of type 304 stainless steel, the largest single use of chromium. Substitutes for chromium in these modified Type 304 stainless steel alloys include silicon and aluminum plus molybdenum.

  19. BLSSpeller: exhaustive comparative discovery of conserved cis-regulatory elements

    PubMed Central

    De Witte, Dieter; Van de Velde, Jan; Decap, Dries; Van Bel, Michiel; Audenaert, Pieter; Demeester, Piet; Dhoedt, Bart; Vandepoele, Klaas; Fostier, Jan


    Motivation: The accurate discovery and annotation of regulatory elements remains a challenging problem. The growing number of sequenced genomes creates new opportunities for comparative approaches to motif discovery. Putative binding sites are then considered to be functional if they are conserved in orthologous promoter sequences of multiple related species. Existing methods for comparative motif discovery usually rely on pregenerated multiple sequence alignments, which are difficult to obtain for more diverged species such as plants. As a consequence, misaligned regulatory elements often remain undetected. Results: We present a novel algorithm that supports both alignment-free and alignment-based motif discovery in the promoter sequences of related species. Putative motifs are exhaustively enumerated as words over the IUPAC alphabet and screened for conservation using the branch length score. Additionally, a confidence score is established in a genome-wide fashion. In order to take advantage of a cloud computing infrastructure, the MapReduce programming model is adopted. The method is applied to four monocotyledon plant species and it is shown that high-scoring motifs are significantly enriched for open chromatin regions in Oryza sativa and for transcription factor binding sites inferred through protein-binding microarrays in O.sativa and Zea mays. Furthermore, the method is shown to recover experimentally profiled ga2ox1-like KN1 binding sites in Z.mays. Availability and implementation: BLSSpeller was written in Java. Source code and manual are available at Contact: or Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26254488

  20. A Summary of the Space-Time Conservation Element and Solution Element (CESE) Method

    NASA Technical Reports Server (NTRS)

    Wang, Xiao-Yen J.


    The space-time Conservation Element and Solution Element (CESE) method for solving conservation laws is examined for its development motivation and design requirements. The characteristics of the resulting scheme are discussed. The discretization of the Euler equations is presented to show readers how to construct a scheme based on the CESE method. The differences and similarities between the CESE method and other traditional methods are discussed. The strengths and weaknesses of the method are also addressed.

  1. The key elements of a comprehensive global mammal conservation strategy.


    Rondinini, Carlo; Rodrigues, Ana S L; Boitani, Luigi


    A global strategy is necessary to achieve the level of coordination, synergy and therefore optimization of resources to achieve the broad goal of conserving mammals worldwide. Key elements for the development of such a strategy include: an institutional subject that owns the strategy; broad conservation goals, quantitative targets derived from them and appropriate indicators; data on the distribution of species, their threats, the cost-effectiveness of conservation actions; and a set of methods for the identification of conservation priorities. Previous global mammal research investigated phylogeny, extinction risk, and the species and areas that should be regarded as global conservation priorities. This theme issue presents new key elements: an updated Red List Index, a new list of evolutionarily distinct and globally endangered species, new high-resolution mammal distribution models, a global connectivity analysis and scenarios of future mammal distribution based on climate and land-cover change. Area prioritization schemes account for mammalian phylogeny, governance and cost-benefit of measures to abate habitat loss. Three discussion papers lay the foundations for the development of a global unifying mammal conservation strategy, which should not be further deterred by the knowledge gaps still existing.

  2. Conserved Noncoding Elements in the Most Distant Genera of Cephalochordates: The Goldilocks Principle

    PubMed Central

    Yue, Jia-Xing; Kozmikova, Iryna; Ono, Hiroki; Nossa, Carlos W.; Kozmik, Zbynek; Putnam, Nicholas H.; Yu, Jr-Kai; Holland, Linda Z.


    Cephalochordates, the sister group of vertebrates + tunicates, are evolving particularly slowly. Therefore, genome comparisons between two congeners of Branchiostoma revealed so many conserved noncoding elements (CNEs), that it was not clear how many are functional regulatory elements. To more effectively identify CNEs with potential regulatory functions, we compared noncoding sequences of genomes of the most phylogenetically distant cephalochordate genera, Asymmetron and Branchiostoma, which diverged approximately 120–160 million years ago. We found 113,070 noncoding elements conserved between the two species, amounting to 3.3% of the genome. The genomic distribution, target gene ontology, and enriched motifs of these CNEs all suggest that many of them are probably cis-regulatory elements. More than 90% of previously verified amphioxus regulatory elements were re-captured in this study. A search of the cephalochordate CNEs around 50 developmental genes in several vertebrate genomes revealed eight CNEs conserved between cephalochordates and vertebrates, indicating sequence conservation over >500 million years of divergence. The function of five CNEs was tested in reporter assays in zebrafish, and one was also tested in amphioxus. All five CNEs proved to be tissue-specific enhancers. Taken together, these findings indicate that even though Branchiostoma and Asymmetron are distantly related, as they are evolving slowly, comparisons between them are likely optimal for identifying most of their tissue-specific cis-regulatory elements laying the foundation for functional characterizations and a better understanding of the evolution of developmental regulation in cephalochordates. PMID:27412606

  3. High-Resolution Genuinely Multidimensional Solution of Conservation Laws by the Space-Time Conservation Element and Solution Element Method

    NASA Technical Reports Server (NTRS)

    Himansu, Ananda; Chang, Sin-Chung; Yu, Sheng-Tao; Wang, Xiao-Yen; Loh, Ching-Yuen; Jorgenson, Philip C. E.


    In this overview paper, we review the basic principles of the method of space-time conservation element and solution element for solving the conservation laws in one and two spatial dimensions. The present method is developed on the basis of local and global flux conservation in a space-time domain, in which space and time are treated in a unified manner. In contrast to the modern upwind schemes, the approach here does not use the Riemann solver and the reconstruction procedure as the building blocks. The drawbacks of the upwind approach, such as the difficulty of rationally extending the 1D scalar approach to systems of equations and particularly to multiple dimensions is here contrasted with the uniformity and ease of generalization of the Conservation Element and Solution Element (CE/SE) 1D scalar schemes to systems of equations and to multiple spatial dimensions. The assured compatibility with the simplest type of unstructured meshes, and the uniquely simple nonreflecting boundary conditions of the present method are also discussed. The present approach has yielded high-resolution shocks, rarefaction waves, acoustic waves, vortices, ZND detonation waves, and shock/acoustic waves/vortices interactions. Moreover, since no directional splitting is employed, numerical resolution of two-dimensional calculations is comparable to that of the one-dimensional calculations. Some sample applications displaying the strengths and broad applicability of the CE/SE method are reviewed.

  4. Activation function 2 (AF-2) of retinoic acid receptor and 9-cis retinoic acid receptor: presence of a conserved autonomous constitutive activating domain and influence of the nature of the response element on AF-2 activity.

    PubMed Central

    Durand, B; Saunders, M; Gaudon, C; Roy, B; Losson, R; Chambon, P


    A motif essential for the transcriptional activation function 2 (AF-2) present in the E region of retinoic acid receptor (RAR) alpha and 9-cis retinoic acid receptor (RXR) alpha has been characterized as an amphipathic alpha-helix whose main features are conserved between transcriptionally active members of the nuclear receptor superfamily. This conserved motif, which can activate autonomously in the absence of ligand in animal and yeast cells, can be swapped between nuclear receptors without affecting the ligand dependency for activation of transcription, thus indicating that a ligand-dependent conformational change is necessary to reveal the AF-2 activation potential within the E region of the nuclear receptor. Interestingly, we show that the precise nature of the direct repeat response element to which RAR/RXR heterodimers are bound can affect the activity of the AF-2s of the heterodimeric partners, as well as the relative efficiency with which all-trans and 9-cis retinoic acids activate the RAR partner. Images PMID:7957103

  5. Deriving indicators for breast conserving surgery using finite element analysis.


    Thanoon, D; Garbey, M; Bass, B L


    Breast conserving therapy (BCT), comprising a complete surgical excision of the tumour (partial mastectomy) with post-operative radiotherapy to the remaining breast tissue, is feasible for most women undergoing treatment for breast cancer. The goal of BCT is to achieve local control of the cancer, as well as to preserve a breast that satisfies a woman's cosmetic concerns. Although most women undergo partial mastectomy with satisfactory cosmetic results, in many patients the remaining breast is left with major cosmetic defects including concave deformities, distortion of the nipple-areolar complex, asymmetry and changes in tissue density characterised by excessive density associated with parenchymal scarring, as well as breast pain. There are currently no tools, other than surgical experience and judgement, which can predict the impact of partial mastectomy on the contour, the deformity of the treated breast and the mechanical stress that it induces. In this study, we use a finite element model to execute virtual surgery and carry out a sensitivity analysis on the resection location, the resection size, the breast tissue mechanical property and the different post-surgery recovery stage. We output the result in two different built-in indicators labelled as the cosmetic and the functional indicators. This study used the breast model for three women with breast cancer who have been elected to undergo BCT and are being treated at the Methodist Hospital in Houston, TX. The goal of this study was to propose a first glimpse of the key parameter leading to satisfactory post-BCT cosmetic results.

  6. Conservation of intron and intein insertion sites: implications for life histories of parasitic genetic elements

    PubMed Central


    Background Inteins and introns are genetic elements that are removed from proteins and RNA after translation or transcription, respectively. Previous studies have suggested that these genetic elements are found in conserved parts of the host protein. To our knowledge this type of analysis has not been done for group II introns residing within a gene. Here we provide quantitative statistical support from an analyses of proteins that host inteins, group I introns, group II introns and spliceosomal introns across all three domains of life. Results To determine whether or not inteins, group I, group II, and spliceosomal introns are found preferentially in conserved regions of their respective host protein, conservation profiles were generated and intein and intron positions were mapped to the profiles. Fisher's combined probability test was used to determine the significance of the distribution of insertion sites across the conservation profile for each protein. For a subset of studied proteins, the conservation profile and insertion positions were mapped to protein structures to determine if the insertion sites correlate to regions of functional activity. All inteins and most group I introns were found to be preferentially located within conserved regions; in contrast, a bacterial intein-like protein, group II and spliceosomal introns did not show a preference for conserved sites. Conclusions These findings demonstrate that inteins and group I introns are found preferentially in conserved regions of their respective host proteins. Homing endonucleases are often located within inteins and group I introns and these may facilitate mobility to conserved regions. Insertion at these conserved positions decreases the chance of elimination, and slows deletion of the elements, since removal of the elements has to be precise as not to disrupt the function of the protein. Furthermore, functional constrains on the targeted site make it more difficult for hosts to evolve immunity

  7. HIV-1 conserved-element vaccines: relationship between sequence conservation and replicative capacity.


    Rolland, Morgane; Manocheewa, Siriphan; Swain, J Victor; Lanxon-Cookson, Erinn C; Kim, Moon; Westfall, Dylan H; Larsen, Brendan B; Gilbert, Peter B; Mullins, James I


    To overcome the problem of HIV-1 variability, candidate vaccine antigens have been designed to be composed of conserved elements of the HIV-1 proteome. Such candidate vaccines could be improved with a better understanding of both HIV-1 evolutionary constraints and the fitness cost of specific mutations. We evaluated the in vitro fitness cost of 23 mutations engineered in the HIV-1 subtype B Gag-p24 Center-of-Tree (COT) protein through fitness competition assays. While some mutations at conserved sites exacted a high fitness cost, as expected under the assumption that the most conserved residue confers the highest fitness, there was no overall strong relationship between sequence conservation and replicative capacity. By comparing sites that have evolved since the beginning of the epidemic to those that have remain unchanged, we found that sites that have evolved over time were more likely to correspond to HLA-associated sites and that their mutation had limited fitness costs. Our data showed no transcendent link between high conservation and high fitness cost, indicating that merely focusing on conserved segments of HIV-1 would not be sufficient for a successful vaccine strategy. Nonetheless, a subset of sites exacted a high fitness cost upon mutation--these sites have been under selective pressure to change since the beginning of the epidemic but have proved virtually nonmutable and could constitute preferred targets for vaccine design.

  8. A characteristic space-time conservation element and solution element method for conservation laws II. Multidimensional extension

    NASA Astrophysics Data System (ADS)

    Shen, Hua; Wen, Chih-Yung


    The characteristic space-time conservation element and solution element (CE/SE) schemes proposed by Shen et al. (2015) [15] are straightforward extended to multidimensional schemes on 2D rectangular meshes which strictly follow the space-time conservation law. The schemes for solving both scalar conservation laws and compressible Euler equations with shock waves are developed. They are accurate and robust with CFL widely ranging from 0 to nearly 1. In Euler solvers, the frequently-used Harten, Lax and van Leer (HLL) Riemann solver, contact discontinuity restoring HLLC Riemann solver and Roe Riemann solver are employed to calculate the upwind fluxes as examples. When standard grid-aligned Riemann solvers are employed, the carbuncle phenomena are significantly suppressed when comparing with conventional upwind schemes. If rotated Riemann solvers are employed, nearly carbuncle-free results are obtained. Several well understood numerical examples are carried out to demonstrate that the 2D characteristic CE/SE schemes can simultaneously capture shocks and details of complex flow structures very well.

  9. Structural Relationships between Highly Conserved Elements and Genes in Vertebrate Genomes

    PubMed Central

    Sun, Hong; Skogerbø, Geir; Wang, Zhen; Liu, Wei; Li, Yixue


    Large numbers of sequence elements have been identified to be highly conserved among vertebrate genomes. These highly conserved elements (HCEs) are often located in or around genes that are involved in transcription regulation and early development. They have been shown to be involved in cis-regulatory activities through both in vivo and additional computational studies. We have investigated the structural relationships between such elements and genes in six vertebrate genomes human, mouse, rat, chicken, zebrafish and tetraodon and detected several thousand cases of conserved HCE-gene associations, and also cases of HCEs with no common target genes. A few examples underscore the potential significance of our findings about several individual genes. We found that the conserved association between HCE/HCEs and gene/genes are not restricted to elements by their absolute distance on the genome. Notably, long-range associations were identified and the molecular functions of the associated genes do not show any particular overrepresentation of the functional categories previously reported. HCEs in close proximity are found to be linked with different set of gene/genes. The results reflect the highly complex correlation between HCEs and their putative target genes. PMID:19008958

  10. Parallel, adaptive finite element methods for conservation laws

    NASA Technical Reports Server (NTRS)

    Biswas, Rupak; Devine, Karen D.; Flaherty, Joseph E.


    We construct parallel finite element methods for the solution of hyperbolic conservation laws in one and two dimensions. Spatial discretization is performed by a discontinuous Galerkin finite element method using a basis of piecewise Legendre polynomials. Temporal discretization utilizes a Runge-Kutta method. Dissipative fluxes and projection limiting prevent oscillations near solution discontinuities. A posteriori estimates of spatial errors are obtained by a p-refinement technique using superconvergence at Radau points. The resulting method is of high order and may be parallelized efficiently on MIMD computers. We compare results using different limiting schemes and demonstrate parallel efficiency through computations on an NCUBE/2 hypercube. We also present results using adaptive h- and p-refinement to reduce the computational cost of the method.

  11. Model dielectric functions and conservation laws

    NASA Astrophysics Data System (ADS)

    Shirley, Eric L.


    There continues to be a need for calculating dielectric screening of charges in solids. Most work has been done in the random-phase approximation (RPA) with minor variations, which proves to be quite accurate for many applications. However, this is still a time-consuming and computationally intensive approach, and model dielectric functions can be valuable for this reason. This talk discusses several conservation laws related to dielectric screening and a model dielectric function that obeys such laws. Shortcomings of model functions that are difficult to overcome will be touched on, and a possible means of combining results from RPA and model calculations will be addressed.

  12. Evolution and Conservation of Plant NLR Functions

    PubMed Central

    Jacob, Florence; Vernaldi, Saskia; Maekawa, Takaki


    In plants and animals, nucleotide-binding domain and leucine-rich repeats (NLR)-containing proteins play pivotal roles in innate immunity. Despite their similar biological functions and protein architecture, comparative genome-wide analyses of NLRs and genes encoding NLR-like proteins suggest that plant and animal NLRs have independently arisen in evolution. Furthermore, the demonstration of interfamily transfer of plant NLR functions from their original species to phylogenetically distant species implies evolutionary conservation of the underlying immune principle across plant taxonomy. In this review we discuss plant NLR evolution and summarize recent insights into plant NLR-signaling mechanisms, which might constitute evolutionarily conserved NLR-mediated immune mechanisms. PMID:24093022

  13. Finite element solution for energy conservation using a highly stable explicit integration algorithm

    NASA Technical Reports Server (NTRS)

    Baker, A. J.; Manhardt, P. D.


    Theoretical derivation of a finite element solution algorithm for the transient energy conservation equation in multidimensional, stationary multi-media continua with irregular solution domain closure is considered. The complete finite element matrix forms for arbitrarily irregular discretizations are established, using natural coordinate function representations. The algorithm is embodied into a user-oriented computer program (COMOC) which obtains transient temperature distributions at the node points of the finite element discretization using a highly stable explicit integration procedure with automatic error control features. The finite element algorithm is shown to posses convergence with discretization for a transient sample problem. The condensed form for the specific heat element matrix is shown to be preferable to the consistent form. Computed results for diverse problems illustrate the versatility of COMOC, and easily prepared output subroutines are shown to allow quick engineering assessment of solution behavior.

  14. Comparison of ultra-conserved elements in drosophilids and vertebrates.


    Makunin, Igor V; Shloma, Viktor V; Stephen, Stuart J; Pheasant, Michael; Belyakin, Stepan N


    Metazoan genomes contain many ultra-conserved elements (UCEs), long sequences identical between distant species. In this study we identified UCEs in drosophilid and vertebrate species with a similar level of phylogenetic divergence measured at protein-coding regions, and demonstrated that both the length and number of UCEs are larger in vertebrates. The proportion of non-exonic UCEs declines in distant drosophilids whilst an opposite trend was observed in vertebrates. We generated a set of 2,126 Sophophora UCEs by merging elements identified in several drosophila species and compared these to the eutherian UCEs identified in placental mammals. In contrast to vertebrates, the Sophophora UCEs are depleted around transcription start sites. Analysis of 52,954 P-element, piggyBac and Minos insertions in the D. melanogaster genome revealed depletion of the P-element and piggyBac insertions in and around the Sophophora UCEs. We examined eleven fly strains with transposon insertions into the intergenic UCEs and identified associated phenotypes in five strains. Four insertions behave as recessive lethals, and in one case we observed a suppression of the marker gene within the transgene, presumably by silenced chromatin around the integration site. To confirm the lethality is caused by integration of transposons we performed a phenotype rescue experiment for two stocks and demonstrated that the excision of the transposons from the intergenic UCEs restores viability. Sequencing of DNA after the transposon excision in one fly strain with the restored viability revealed a 47 bp insertion at the original transposon integration site suggesting that the nature of the mutation is important for the appearance of the phenotype. Our results suggest that the UCEs in flies and vertebrates have both common and distinct features, and demonstrate that a significant proportion of intergenic drosophila UCEs are sensitive to disruption.

  15. 10 CFR Appendix D to Part 436 - Energy Program Conservation Elements

    Code of Federal Regulations, 2011 CFR


    ... 10 Energy 3 2011-01-01 2011-01-01 false Energy Program Conservation Elements D Appendix D to Part 436 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION FEDERAL ENERGY MANAGEMENT AND PLANNING PROGRAMS Pt. 436, App. D Appendix D to Part 436—Energy Program Conservation Elements (a) In all successful...

  16. 10 CFR Appendix D to Part 436 - Energy Program Conservation Elements

    Code of Federal Regulations, 2010 CFR


    ... 10 Energy 3 2010-01-01 2010-01-01 false Energy Program Conservation Elements D Appendix D to Part 436 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION FEDERAL ENERGY MANAGEMENT AND PLANNING PROGRAMS Pt. 436, App. D Appendix D to Part 436—Energy Program Conservation Elements (a) In all successful...

  17. 10 CFR Appendix D to Part 436 - Energy Program Conservation Elements

    Code of Federal Regulations, 2013 CFR


    ... 10 Energy 3 2013-01-01 2013-01-01 false Energy Program Conservation Elements D Appendix D to Part 436 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION FEDERAL ENERGY MANAGEMENT AND PLANNING PROGRAMS Pt. 436, App. D Appendix D to Part 436—Energy Program Conservation Elements (a) In all successful...

  18. 10 CFR Appendix D to Part 436 - Energy Program Conservation Elements

    Code of Federal Regulations, 2012 CFR


    ... 10 Energy 3 2012-01-01 2012-01-01 false Energy Program Conservation Elements D Appendix D to Part 436 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION FEDERAL ENERGY MANAGEMENT AND PLANNING PROGRAMS Pt. 436, App. D Appendix D to Part 436—Energy Program Conservation Elements (a) In all successful...

  19. 10 CFR Appendix D to Part 436 - Energy Program Conservation Elements

    Code of Federal Regulations, 2014 CFR


    ... 10 Energy 3 2014-01-01 2014-01-01 false Energy Program Conservation Elements D Appendix D to Part 436 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION FEDERAL ENERGY MANAGEMENT AND PLANNING PROGRAMS Pt. 436, App. D Appendix D to Part 436—Energy Program Conservation Elements (a) In all successful...

  20. Conserved Gating Elements in TRPC4 and TRPC5 Channels*

    PubMed Central

    Beck, Andreas; Speicher, Tilman; Stoerger, Christof; Sell, Thomas; Dettmer, Viviane; Jusoh, Siti A.; Abdulmughni, Ammar; Cavalié, Adolfo; Philipp, Stephan E.; Zhu, Michael X.; Helms, Volkhard; Wissenbach, Ulrich; Flockerzi, Veit


    TRPC4 and TRPC5 proteins share 65% amino acid sequence identity and form Ca2+-permeable nonselective cation channels. They are activated by stimulation of receptors coupled to the phosphoinositide signaling cascade. Replacing a conserved glycine residue within the cytosolic S4–S5 linker of both proteins by a serine residue forces the channels into an open conformation. Expression of the TRPC4G503S and TRPC5G504S mutants causes cell death, which could be prevented by buffering the Ca2+ of the culture medium. Current-voltage relationships of the TRPC4G503S and TRPC5G504S mutant ion channels resemble that of fully activated TRPC4 and TRPC5 wild-type channels, respectively. Modeling the structure of the transmembrane domains and the pore region (S4-S6) of TRPC4 predicts a conserved serine residue within the C-terminal sequence of the predicted S6 helix as a potential interaction site. Introduction of a second mutation (S623A) into TRPC4G503S suppressed the constitutive activation and partially rescued its function. These results indicate that the S4–S5 linker is a critical constituent of TRPC4/C5 channel gating and that disturbance of its sequence allows channel opening independent of any sensor domain. PMID:23677990

  1. The Conservation/Solution Element (STE) Method for Linear Potential Flow Problems

    NASA Technical Reports Server (NTRS)

    Adeyeye, John O.; Attia, Naguib F.; Jackson, Joy; Hunter, Timothy


    The potential equation is discretized on rectangular domains using the Conservation/Solution Element Method (STE) approach. Computational examples with a discussion of numerical experience gained are given.

  2. Kohlrausch regulating function and other conservation laws in electrophoresis.


    Hruska, Vlastimil; Gas, Bohuslav


    The Kohlrausch regulating function (KRF) is a conservation law (conservation function), which is held in electrophoresis and which enables calculation of the so-called adjusted concentrations of constituents. The KRF is not the only conservation function and, depending on the complexity of the electrophoretic system, other conservation laws may be obeyed having a broader range of applicability. The conservation laws are tightly related to system eigenmobilities and system zones (system peaks). In principle, no system eigenmobility is exactly zero, but in most practical cases at least one system's eigenmobility is close to zero. The existence of the close-to-zero eigenmobility inherently points to the existence of a conservation function and a system zone which is stationary. The stationary system zone is called injection zone, stagnant zone, water peak, or solvent dip. Electrophoretic (electromigration) systems can be divided into two types: (i) conservation systems, in which the absolute value of at least one system eigenmobility is close to zero and where at least one conservation law is obeyed and (ii) nonconservation systems, where no system eigenmobility is close to zero and no conservation law is obeyed. The paper reviews work dealing with conservation functions in electromigration, derives some "historical" conservation functions in a new way, derives several conservation functions for systems of multivalent electrolytes, and discusses electrophoretic systems that have nonconservation behavior. In some typical instances, the conservation functions are simulated by means of a dynamic simulation tool and depicted graphically.

  3. Highly Conserved Elements and Chromosome Structure Evolution in Mitochondrial Genomes in Ciliates

    PubMed Central

    Gershgorin, Roman A.; Gorbunov, Konstantin Yu.; Zverkov, Oleg A.; Rubanov, Lev I.; Seliverstov, Alexandr V.; Lyubetsky, Vassily A.


    Recent phylogenetic analyses are incorporating ultraconserved elements (UCEs) and highly conserved elements (HCEs). Models of evolution of the genome structure and HCEs initially faced considerable algorithmic challenges, which gave rise to (often unnatural) constraints on these models, even for conceptually simple tasks such as the calculation of distance between two structures or the identification of UCEs. In our recent works, these constraints have been addressed with fast and efficient solutions with no constraints on the underlying models. These approaches have led us to an unexpected result: for some organelles and taxa, the genome structure and HCE set, despite themselves containing relatively little information, still adequately resolve the evolution of species. We also used the HCE identification to search for promoters and regulatory elements that characterize the functional evolution of the genome. PMID:28264444

  4. A new numerical framework for solving conservation laws: The method of space-time conservation element and solution element

    NASA Technical Reports Server (NTRS)

    Chang, Sin-Chung; To, Wai-Ming


    A new numerical framework for solving conservation laws is being developed. It employs: (1) a nontraditional formulation of the conservation laws in which space and time are treated on the same footing, and (2) a nontraditional use of discrete variables such as numerical marching can be carried out by using a set of relations that represents both local and global flux conservation.

  5. Conserved Endonuclease Function of Hantavirus L Polymerase

    PubMed Central

    Rothenberger, Sylvia; Torriani, Giulia; Johansson, Maria U.; Kunz, Stefan; Engler, Olivier


    Hantaviruses are important emerging pathogens belonging to the Bunyaviridae family. Like other segmented negative strand RNA viruses, the RNA-dependent RNA polymerase (RdRp) also known as L protein of hantaviruses lacks an intrinsic “capping activity”. Hantaviruses therefore employ a “cap snatching” strategy acquiring short 5′ RNA sequences bearing 5′cap structures by endonucleolytic cleavage from host cell transcripts. The viral endonuclease activity implicated in cap snatching of hantaviruses has been mapped to the N-terminal domain of the L protein. Using a combination of molecular modeling and structure–function analysis we confirm and extend these findings providing evidence for high conservation of the L endonuclease between Old and New World hantaviruses. Recombinant hantavirus L endonuclease showed catalytic activity and a defined cation preference shared by other viral endonucleases. Based on the previously reported remarkably high activity of hantavirus L endonuclease, we established a cell-based assay for the hantavirus endonuclase function. The robustness of the assay and its high-throughput compatible format makes it suitable for small molecule drug screens to identify novel inhibitors of hantavirus endonuclease. Based on the high degree of similarity to RdRp endonucleases, some candidate inhibitors may be broadly active against hantaviruses and other emerging human pathogenic Bunyaviruses. PMID:27144576

  6. Space-Time Conservation Element and Solution Element Method Being Developed

    NASA Technical Reports Server (NTRS)

    Chang, Sin-Chung; Himansu, Ananda; Jorgenson, Philip C. E.; Loh, Ching-Yuen; Wang, Xiao-Yen; Yu, Sheng-Tao


    The engineering research and design requirements of today pose great computer-simulation challenges to engineers and scientists who are called on to analyze phenomena in continuum mechanics. The future will bring even more daunting challenges, when increasingly complex phenomena must be analyzed with increased accuracy. Traditionally used numerical simulation methods have evolved to their present state by repeated incremental extensions to broaden their scope. They are reaching the limits of their applicability and will need to be radically revised, at the very least, to meet future simulation challenges. At the NASA Lewis Research Center, researchers have been developing a new numerical framework for solving conservation laws in continuum mechanics, namely, the Space-Time Conservation Element and Solution Element Method, or the CE/SE method. This method has been built from fundamentals and is not a modification of any previously existing method. It has been designed with generality, simplicity, robustness, and accuracy as cornerstones. The CE/SE method has thus far been applied in the fields of computational fluid dynamics, computational aeroacoustics, and computational electromagnetics. Computer programs based on the CE/SE method have been developed for calculating flows in one, two, and three spatial dimensions. Results have been obtained for numerous problems and phenomena, including various shock-tube problems, ZND detonation waves, an implosion and explosion problem, shocks over a forward-facing step, a blast wave discharging from a nozzle, various acoustic waves, and shock/acoustic-wave interactions. The method can clearly resolve shock/acoustic-wave interactions, wherein the difference of the magnitude between the acoustic wave and shock could be up to six orders. In two-dimensional flows, the reflected shock is as crisp as the leading shock. CE/SE schemes are currently being used for advanced applications to jet and fan noise prediction and to chemically

  7. [Trace elements maintaining the vital functions].


    Arakawa, Yasuaki


    In a healthy condition, trace elements constituting the living body are regulated and maintained their balance of each other and their range of physiological optimum concentration in order to maintain the normal vital functions. When the optimum conditions of their balance and their homeostasis, however, are broken down by deficiency or excess of certain trace element, an excess accumulation or deficiency of specified element is induced and it follows that peculiar disease is caused according to function of each specified element. Generally, the disturbance of major elements such as O, C, H, N, Ca, P will induce a nutrition lesion and electrolytic abnormality, and the disturbance of 10 trace elements such as Fe, F, Si, Zn, Sr, Rb, Br, Pb, Mn, Cu being at ppm order and 14 ultra-trace elements such as Al, Cd, Sn, Ba, Hg, Se, I, Mo, Ni, B, Cr, As, Co, V being at ppb order will give rise to functional disorder of enzyme and physiological active substance in living body.

  8. Steady and Unsteady Nozzle Simulations Using the Conservation Element and Solution Element Method

    NASA Technical Reports Server (NTRS)

    Friedlander, David Joshua; Wang, Xiao-Yen J.


    This paper presents results from computational fluid dynamic (CFD) simulations of a three-stream plug nozzle. Time-accurate, Euler, quasi-1D and 2D-axisymmetric simulations were performed as part of an effort to provide a CFD-based approach to modeling nozzle dynamics. The CFD code used for the simulations is based on the space-time Conservation Element and Solution Element (CESE) method. Steady-state results were validated using the Wind-US code and a code utilizing the MacCormack method while the unsteady results were partially validated via an aeroacoustic benchmark problem. The CESE steady-state flow field solutions showed excellent agreement with solutions derived from the other methods and codes while preliminary unsteady results for the three-stream plug nozzle are also shown. Additionally, a study was performed to explore the sensitivity of gross thrust computations to the control surface definition. The results showed that most of the sensitivity while computing the gross thrust is attributed to the control surface stencil resolution and choice of stencil end points and not to the control surface definition itself.Finally, comparisons between the quasi-1D and 2D-axisymetric solutions were performed in order to gain insight on whether a quasi-1D solution can capture the steady and unsteady nozzle phenomena without the cost of a 2D-axisymmetric simulation. Initial results show that while the quasi-1D solutions are similar to the 2D-axisymmetric solutions, the inability of the quasi-1D simulations to predict two dimensional phenomena limits its accuracy.

  9. One-Step Direct Aeroacoustic Simulation Using Space-Time Conservation Element and Solution Element Method

    NASA Astrophysics Data System (ADS)

    Ho, C. Y.; Leung, R. C. K.; Zhou, K.; Lam, G. C. Y.; Jiang, Z.


    One-step direct aeroacoustic simulation (DAS) has received attention from aerospace and mechanical high-pressure fluid-moving system manufacturers for quite some time. They aim to simulate the unsteady flow and acoustic field in the duct simultaneously in order to investigate the aeroacoustic generation mechanisms. Because of the large length and energy scale disparities between the acoustic far field and the aerodynamic near field, highly accurate and high-resolution simulation scheme is required. This involves the use of high order compact finite difference and time advancement schemes in simulation. However, in this situation, large buffer zones are always needed to suppress the spurious numerical waves emanating from computational boundaries. This further increases the computational resources to yield accurate results. On the other hand, for such problem as supersonic jet noise, the numerical scheme should be able to resolve both strong shock waves and weak acoustic waves simultaneously. Usually numerical aeroa-coustic scheme that is good for low Mach number flow is not able to give satisfactory simulation results for shock wave. Therefore, the aeroacoustic research community has been looking for a more efficient one-step DAS scheme that has the comparable accuracy to the finite-difference approach with smaller buffer regions, yet is able to give accurate solutions from subsonic to supersonic flows. The conservation element and solution element (CE/SE) scheme is one of the possible schemes satisfying the above requirements. This paper aims to report the development of a CE/SE scheme for one-step DAS and illustrate its robustness and effectiveness with two selected benchmark problems.

  10. Recurrent modification of a conserved cis-regulatory element underlies fruit fly pigmentation diversity.


    Rogers, William A; Salomone, Joseph R; Tacy, David J; Camino, Eric M; Davis, Kristen A; Rebeiz, Mark; Williams, Thomas M


    The development of morphological traits occurs through the collective action of networks of genes connected at the level of gene expression. As any node in a network may be a target of evolutionary change, the recurrent targeting of the same node would indicate that the path of evolution is biased for the relevant trait and network. Although examples of parallel evolution have implicated recurrent modification of the same gene and cis-regulatory element (CRE), little is known about the mutational and molecular paths of parallel CRE evolution. In Drosophila melanogaster fruit flies, the Bric-à-brac (Bab) transcription factors control the development of a suite of sexually dimorphic traits on the posterior abdomen. Female-specific Bab expression is regulated by the dimorphic element, a CRE that possesses direct inputs from body plan (ABD-B) and sex-determination (DSX) transcription factors. Here, we find that the recurrent evolutionary modification of this CRE underlies both intraspecific and interspecific variation in female pigmentation in the melanogaster species group. By reconstructing the sequence and regulatory activity of the ancestral Drosophila melanogaster dimorphic element, we demonstrate that a handful of mutations were sufficient to create independent CRE alleles with differing activities. Moreover, intraspecific and interspecific dimorphic element evolution proceeded with little to no alterations to the known body plan and sex-determination regulatory linkages. Collectively, our findings represent an example where the paths of evolution appear biased to a specific CRE, and drastic changes in function were accompanied by deep conservation of key regulatory linkages.

  11. Spectral/HP Element Method With Hierarchical Reconstruction for Solving Hyperbolic Conservation Laws

    SciTech Connect

    Xu, Zhiliang; Lin, Guang


    Hierarchical reconstruction (HR) has been successfully applied to prevent oscillations in solutions computed by finite volume, discontinuous Galerkin, spectral volume schemes when solving hyperbolic conservation laws. In this paper, we demonstrate that HR can also be combined with spectral/hp element methods for solving hyperbolic conservation laws. We show that HR preserves the order of accuracy of spectral/hp element methods for smooth solutions and generate essentially non-oscillatory solution profiles for shock wave problems.

  12. New functionalities in abundant element oxides: ubiquitous element strategy.


    Hosono, Hideo; Hayashi, Katsuro; Kamiya, Toshio; Atou, Toshiyuki; Susaki, Tomofumi


    While most ceramics are composed of ubiquitous elements (the ten most abundant elements within the Earth's crust), many advanced materials are based on rare elements. A 'rare-element crisis' is approaching owing to the imbalance between the limited supply of rare elements and the increasing demand. Therefore, we propose a 'ubiquitous element strategy' for materials research, which aims to apply abundant elements in a variety of innovative applications. Creation of innovative oxide materials and devices based on conventional ceramics is one specific challenge. This review describes the concept of ubiquitous element strategy and gives some highlights of our recent research on the synthesis of electronic, thermionic and structural materials using ubiquitous elements.

  13. New alloys to conserve critical elements. [replacing chromium in steels

    NASA Technical Reports Server (NTRS)

    Stephens, J. R.


    Previous studies and surveys on availability of domestic reserves have shown that chromium is a most critical element within the U.S. metal industry. More precisely, the bulk of chromium is consumed in the production of stainless steels, specifically Type 304 stainless steel (304SS) which contains 18% Cr. The present paper deals with means of reducing chromium in commercial stainless steels by substituting more abundant or less expensive elements with the intent of maintaining the properties of 304SS. The discussion focuses on some of the oxidation and corrosion properties of new substitute stainless steels with only 12% Cr, which represents a potential saving of 33% of the chromium consumed in the production of 304SS. The alloying elements substituted for Cr in 304SS are selected according to their potential for protective oxide formation during high-temperature oxidation; these are Al, Si, Ti, Y, and misch metal which is 99.7% rare-earth metals containing 50 to 55% cerium. Other alloying elements to impart corrosion resistance are Mn, Mo, and V.

  14. Matrix elements from moments of correlation functions

    SciTech Connect

    Chang, Chia Cheng; Bouchard, Chris; Orginos, Konstantinos; Richards, David G.


    Momentum-space derivatives of matrix elements can be related to their coordinate-space moments through the Fourier transform. We derive these expressions as a function of momentum transfer Q2 for asymptotic in/out states consisting of a single hadron. We calculate corrections to the finite volume moments by studying the spatial dependence of the lattice correlation functions. This method permits the computation of not only the values of matrix elements at momenta accessible on the lattice, but also the momentum-space derivatives, providing {\\it a priori} information about the Q2 dependence of form factors. As a specific application we use the method, at a single lattice spacing and with unphysically heavy quarks, to directly obtain the slope of the isovector form factor at various Q2, whence the isovector charge radius. The method has potential application in the calculation of any hadronic matrix element with momentum transfer, including those relevant to hadronic weak decays.

  15. CisMols Analyzer: identification of compositionally similar cis-element clusters in ortholog conserved regions of coordinately expressed genes

    PubMed Central

    Jegga, Anil G.; Gupta, Ashima; Gowrisankar, Sivakumar; Deshmukh, Mrunal A.; Connolly, Steven; Finley, Kevin; Aronow, Bruce J.


    Combinatorial interactions of sequence-specific trans-acting factors with localized genomic cis-element clusters are the principal mechanism for regulating tissue-specific and developmental gene expression. With the emergence of expanding numbers of genome-wide expression analyses, the identification of the cis-elements responsible for specific patterns of transcriptional regulation represents a critical area of investigation. Computational methods for the identification of functional cis-regulatory modules are difficult to devise, principally because of the short length and degenerate nature of individual cis-element binding sites and the inherent complexity that is generated by combinatorial interactions within cis-clusters. Filtering candidate cis-element clusters based on phylogenetic conservation is helpful for an individual ortholog gene pair, but combining data from cis-conservation and coordinate expression across multiple genes is a more difficult problem. To approach this, we have extended an ortholog gene-pair database with additional analytical architecture to allow for the analysis and identification of maximal numbers of compositionally similar and phylogenetically conserved cis-regulatory element clusters from a list of user-selected genes. The system has been successfully tested with a series of functionally related and microarray profile-based co-expressed ortholog pairs of promoters and genes using known regulatory regions as training sets and co-expressed genes in the olfactory and immunohematologic systems as test sets. CisMols Analyzer is accessible via a Web interface at . PMID:15980500

  16. A conserved RNA structural element within the hepatitis B virus post-transcriptional regulatory element enhance nuclear export of intronless transcripts and repress the splicing mechanism.


    Visootsat, Akasit; Payungporn, Sunchai; T-Thienprasert, Nattanan P


    Hepatitis B virus (HBV) infection is a primary cause of hepatocellular carcinoma and liver cirrhosis worldwide. To develop novel antiviral drugs, a better understanding of HBV gene expression regulation is vital. One important aspect is to understand how HBV hijacks the cellular machinery to export unspliced RNA from the nucleus. The HBV post-transcriptional regulatory element (HBV PRE) has been proposed to be the HBV RNA nuclear export element. However, the function remains controversial, and the core element is unclear. This study, therefore, aimed to identify functional regulatory elements within the HBV PRE and investigate their functions. Using bioinformatics programs based on sequence conservation and conserved RNA secondary structures, three regulatory elements were predicted, namely PRE 1151-1410, PRE 1520-1620 and PRE 1650-1684. PRE 1151-1410 significantly increased intronless and unspliced luciferase activity in both HepG2 and COS-7 cells. Likewise, PRE 1151-1410 significantly elevated intronless and unspliced HBV surface transcripts in liver cancer cells. Moreover, motif analysis predicted that PRE 1151-1410 contains several regulatory motifs. This study reported the roles of PRE 1151-1410 in intronless transcript nuclear export and the splicing mechanism. Additionally, these results provide knowledge in the field of HBV RNA regulation. Moreover, PRE 1151-1410 may be used to enhance the expression of other mRNAs in intronless reporter plasmids.

  17. Defining functional DNA elements in the human genome.


    Kellis, Manolis; Wold, Barbara; Snyder, Michael P; Bernstein, Bradley E; Kundaje, Anshul; Marinov, Georgi K; Ward, Lucas D; Birney, Ewan; Crawford, Gregory E; Dekker, Job; Dunham, Ian; Elnitski, Laura L; Farnham, Peggy J; Feingold, Elise A; Gerstein, Mark; Giddings, Morgan C; Gilbert, David M; Gingeras, Thomas R; Green, Eric D; Guigo, Roderic; Hubbard, Tim; Kent, Jim; Lieb, Jason D; Myers, Richard M; Pazin, Michael J; Ren, Bing; Stamatoyannopoulos, John A; Weng, Zhiping; White, Kevin P; Hardison, Ross C


    With the completion of the human genome sequence, attention turned to identifying and annotating its functional DNA elements. As a complement to genetic and comparative genomics approaches, the Encyclopedia of DNA Elements Project was launched to contribute maps of RNA transcripts, transcriptional regulator binding sites, and chromatin states in many cell types. The resulting genome-wide data reveal sites of biochemical activity with high positional resolution and cell type specificity that facilitate studies of gene regulation and interpretation of noncoding variants associated with human disease. However, the biochemically active regions cover a much larger fraction of the genome than do evolutionarily conserved regions, raising the question of whether nonconserved but biochemically active regions are truly functional. Here, we review the strengths and limitations of biochemical, evolutionary, and genetic approaches for defining functional DNA segments, potential sources for the observed differences in estimated genomic coverage, and the biological implications of these discrepancies. We also analyze the relationship between signal intensity, genomic coverage, and evolutionary conservation. Our results reinforce the principle that each approach provides complementary information and that we need to use combinations of all three to elucidate genome function in human biology and disease.

  18. Defining functional DNA elements in the human genome

    PubMed Central

    Kellis, Manolis; Wold, Barbara; Snyder, Michael P.; Bernstein, Bradley E.; Kundaje, Anshul; Marinov, Georgi K.; Ward, Lucas D.; Birney, Ewan; Crawford, Gregory E.; Dekker, Job; Dunham, Ian; Elnitski, Laura L.; Farnham, Peggy J.; Feingold, Elise A.; Gerstein, Mark; Giddings, Morgan C.; Gilbert, David M.; Gingeras, Thomas R.; Green, Eric D.; Guigo, Roderic; Hubbard, Tim; Kent, Jim; Lieb, Jason D.; Myers, Richard M.; Pazin, Michael J.; Ren, Bing; Stamatoyannopoulos, John A.; Weng, Zhiping; White, Kevin P.; Hardison, Ross C.


    With the completion of the human genome sequence, attention turned to identifying and annotating its functional DNA elements. As a complement to genetic and comparative genomics approaches, the Encyclopedia of DNA Elements Project was launched to contribute maps of RNA transcripts, transcriptional regulator binding sites, and chromatin states in many cell types. The resulting genome-wide data reveal sites of biochemical activity with high positional resolution and cell type specificity that facilitate studies of gene regulation and interpretation of noncoding variants associated with human disease. However, the biochemically active regions cover a much larger fraction of the genome than do evolutionarily conserved regions, raising the question of whether nonconserved but biochemically active regions are truly functional. Here, we review the strengths and limitations of biochemical, evolutionary, and genetic approaches for defining functional DNA segments, potential sources for the observed differences in estimated genomic coverage, and the biological implications of these discrepancies. We also analyze the relationship between signal intensity, genomic coverage, and evolutionary conservation. Our results reinforce the principle that each approach provides complementary information and that we need to use combinations of all three to elucidate genome function in human biology and disease. PMID:24753594

  19. Conserved RNA cis-elements regulate alternative splicing of Lepidopteran doublesex.


    Wang, Xiu-Ye; Zheng, Zeng-Zhang; Song, Hong-Sheng; Xu, Yong-Zhen


    Doublesex (dsx) is a downstream key regulator in insect sex determination pathway. In Drosophila, alternative splicing of Dm-dsx gene is sex-specifically regulated by transformer (tra), in which the functional TRA promotes female-specific Dm-dsx. However, the sex determination pathway in Lepidoptera is not well understood; here we focused on alternative splicing of doublesex (dsx) in two agricultural pests, Asian corn borer (Ostrinia furnacalis) and cotton bollworm (Helicoverpa armigera), as well as the silkworm (Bombyx mori). More than a dozen new alternative splicing isoforms of dsx were found in the Lepidopteran females, which exist in all tested developmental stages and differentiated tissues. Alignment of mRNA and protein sequences of doublesex revealed high conservation of this gene in Lepidoptera. Strength analysis of splice sites revealed a weak 5' splice site at intron 3 in Lepidopteran dsx, which was experimentally confirmed. Furthermore, we identified highly conserved RNA sequences in the Lepidopteran dsx, including RNA elements I (14 nt), II (11 nt), III (26 nt), IV (17 nt), 3E-1 (8 nt) and 3E-2 (8 nt). The RNA elements III and IV were previously found in exon 4 of B. mori dsx and bound with Bm-PSI, which suppressed the inclusion of exons 3 & 4 into the male-specific Bm-dsx. Then we identified and analyzed the homologous genes of Bm-psi in the two Lepidopteran pests, which expressed at similar levels and exhibited a unique isoform in the males and females from each Lepidoptera. Importantly, mutagenesis of Bm-dsx mini-genes and their expression in BmN cell line demonstrated that three RNA elements are involved in the female-specific alternative splicing of Bm-dsx. Mutations in the RNA cis-elements 3E-1 and 3E-2 resulted in decreased inclusion of exon 3 into the female-specific dsx mRNA, suggesting that these two elements would be exonic splicing enhancers that facilitate the recognition of the weak 5' splice site at intron 3 of Lepidopteran dsx. We

  20. World-line Green functions with momentum and source conservations

    NASA Astrophysics Data System (ADS)

    Sato, Haru-Tada


    Based on the generating functional method with an external source function, a useful constraint on the source function is proposed for analyzing the one- and two-loop world-line Green functions. The constraint plays the same role as the momentum conservation law of a certain nontrivial form, and transforms ambiguous Green functions into the uniquely defined Green functions. We also argue reparametrizations of the Green functions defined on differently parameterized world-line diagrams.

  1. Maximum-principle-satisfying space-time conservation element and solution element scheme applied to compressible multifluids

    NASA Astrophysics Data System (ADS)

    Shen, Hua; Wen, Chih-Yung; Parsani, Matteo; Shu, Chi-Wang


    A maximum-principle-satisfying space-time conservation element and solution element (CE/SE) scheme is constructed to solve a reduced five-equation model coupled with the stiffened equation of state for compressible multifluids. We first derive a sufficient condition for CE/SE schemes to satisfy maximum-principle when solving a general conservation law. And then we introduce a slope limiter to ensure the sufficient condition which is applicative for both central and upwind CE/SE schemes. Finally, we implement the upwind maximum-principle-satisfying CE/SE scheme to solve the volume-fraction-based five-equation model for compressible multifluids. Several numerical examples are carried out to carefully examine the accuracy, efficiency, conservativeness and maximum-principle-satisfying property of the proposed approach.

  2. New functionalities in abundant element oxides: ubiquitous element strategy

    PubMed Central

    Hosono, Hideo; Hayashi, Katsuro; Kamiya, Toshio; Atou, Toshiyuki; Susaki, Tomofumi


    While most ceramics are composed of ubiquitous elements (the ten most abundant elements within the Earth's crust), many advanced materials are based on rare elements. A ‘rare-element crisis’ is approaching owing to the imbalance between the limited supply of rare elements and the increasing demand. Therefore, we propose a ‘ubiquitous element strategy’ for materials research, which aims to apply abundant elements in a variety of innovative applications. Creation of innovative oxide materials and devices based on conventional ceramics is one specific challenge. This review describes the concept of ubiquitous element strategy and gives some highlights of our recent research on the synthesis of electronic, thermionic and structural materials using ubiquitous elements. PMID:27877391

  3. Functionally conserved enhancers with divergent sequences in distant vertebrates


    Yang, Song; Oksenberg, Nir; Takayama, Sachiko; ...


    To examine the contributions of sequence and function conservation in the evolution of enhancers, we systematically identified enhancers whose sequences are not conserved among distant groups of vertebrate species, but have homologous function and are likely to be derived from a common ancestral sequence. In conclusion, our approach combined comparative genomics and epigenomics to identify potential enhancer sequences in the genomes of three groups of distantly related vertebrate species.

  4. Recurrent Modification of a Conserved Cis-Regulatory Element Underlies Fruit Fly Pigmentation Diversity

    PubMed Central

    Rogers, William A.; Salomone, Joseph R.; Tacy, David J.; Camino, Eric M.; Davis, Kristen A.; Rebeiz, Mark; Williams, Thomas M.


    The development of morphological traits occurs through the collective action of networks of genes connected at the level of gene expression. As any node in a network may be a target of evolutionary change, the recurrent targeting of the same node would indicate that the path of evolution is biased for the relevant trait and network. Although examples of parallel evolution have implicated recurrent modification of the same gene and cis-regulatory element (CRE), little is known about the mutational and molecular paths of parallel CRE evolution. In Drosophila melanogaster fruit flies, the Bric-à-brac (Bab) transcription factors control the development of a suite of sexually dimorphic traits on the posterior abdomen. Female-specific Bab expression is regulated by the dimorphic element, a CRE that possesses direct inputs from body plan (ABD-B) and sex-determination (DSX) transcription factors. Here, we find that the recurrent evolutionary modification of this CRE underlies both intraspecific and interspecific variation in female pigmentation in the melanogaster species group. By reconstructing the sequence and regulatory activity of the ancestral Drosophila melanogaster dimorphic element, we demonstrate that a handful of mutations were sufficient to create independent CRE alleles with differing activities. Moreover, intraspecific and interspecific dimorphic element evolution proceeded with little to no alterations to the known body plan and sex-determination regulatory linkages. Collectively, our findings represent an example where the paths of evolution appear biased to a specific CRE, and drastic changes in function were accompanied by deep conservation of key regulatory linkages. PMID:24009528

  5. A reporter assay in lamprey embryos reveals both functional conservation and elaboration of vertebrate enhancers.


    Parker, Hugo J; Sauka-Spengler, Tatjana; Bronner, Marianne; Elgar, Greg


    The sea lamprey is an important model organism for investigating the evolutionary origins of vertebrates. As more vertebrate genome sequences are obtained, evolutionary developmental biologists are becoming increasingly able to identify putative gene regulatory elements across the breadth of the vertebrate taxa. The identification of these regions makes it possible to address how changes at the genomic level have led to changes in developmental gene regulatory networks and ultimately to the evolution of morphological diversity. Comparative genomics approaches using sea lamprey have already predicted a number of such regulatory elements in the lamprey genome. Functional characterisation of these sequences and other similar elements requires efficient reporter assays in lamprey. In this report, we describe the development of a transient transgenesis method for lamprey embryos. Focusing on conserved non-coding elements (CNEs), we use this method to investigate their functional conservation across the vertebrate subphylum. We find instances of both functional conservation and lineage-specific functional evolution of CNEs across vertebrates, emphasising the utility of functionally testing homologous CNEs in their host species.

  6. Conserved Structural Elements in the V3 Crown of HIV-1 gp120

    SciTech Connect

    Jiang, X.; Burke, V; Totrov, M; Williams, C; Cardozo, T; Gorny, M; Zolla-Pazner, S; Kong, X


    Binding of the third variable region (V3) of the HIV-1 envelope glycoprotein gp120 to the cell-surface coreceptors CCR5 or CXCR4 during viral entry suggests that there are conserved structural elements in this sequence-variable region. These conserved elements could serve as epitopes to be targeted by a vaccine against HIV-1. Here we perform a systematic structural analysis of representative human anti-V3 monoclonal antibodies in complex with V3 peptides, revealing that the crown of V3 has four conserved structural elements: an arch, a band, a hydrophobic core and the peptide backbone. These are either unaffected by or are subject to minimal sequence variation. As these regions are targeted by cross-clade neutralizing human antibodies, they provide a blueprint for the design of vaccine immunogens that could elicit broadly cross-reactive protective antibodies.

  7. Energy conserving discontinuous Galerkin spectral element method for the Vlasov-Poisson system

    NASA Astrophysics Data System (ADS)

    Madaule, Éric; Restelli, Marco; Sonnendrücker, Eric


    We propose a new, energy conserving, spectral element, discontinuous Galerkin method for the approximation of the Vlasov-Poisson system in arbitrary dimension, using Cartesian grids. The method is derived from the one proposed in [4], with two modifications: energy conservation is obtained by a suitable projection operator acting on the solution of the Poisson problem, rather than by solving multiple Poisson problems, and all the integrals appearing in the finite element formulation are approximated with Gauss-Lobatto quadrature, thereby yielding a spectral element formulation. The resulting method has the following properties: exact energy conservation (up to errors introduced by the time discretization), stability (thanks to the use of upwind numerical fluxes), high order accuracy and high locality. For the time discretization, we consider both Runge-Kutta methods and exponential integrators, and show results for 1D and 2D cases (2D and 4D in phase space, respectively).

  8. Ancient vertebrate conserved noncoding elements have been evolving rapidly in teleost fishes.


    Lee, Alison P; Kerk, Sze Yen; Tan, Yue Ying; Brenner, Sydney; Venkatesh, Byrappa


    Vertebrate genomes contain thousands of conserved noncoding elements (CNEs) that often function as tissue-specific enhancers. In this study, we have identified CNEs in human, dog, chicken, Xenopus, and four teleost fishes (zebrafish, stickleback, medaka, and fugu) using elephant shark, a cartilaginous vertebrate, as the base genome and investigated the evolution of these ancient vertebrate CNEs (aCNEs) in bony vertebrate lineages. Our analysis shows that aCNEs have been evolving at different rates in different bony vertebrate lineages. Although 78-83% of CNEs have diverged beyond recognition ("lost") in different teleost fishes, only 24% and 40% have been lost in the chicken and mammalian lineages, respectively. Relative rate tests of substitution rates in CNEs revealed that the teleost fish CNEs have been evolving at a significantly higher rate than those in other bony vertebrates. In the ray-finned fish lineage, 68% of aCNEs were lost before the divergence of the four teleosts. This implicates the "fish-specific" whole-genome duplication in the accelerated evolution and the loss of a large number of both copies of duplicated CNEs in teleost fishes. The aCNEs are rich in tissue-specific enhancers and thus many of them are likely to be evolutionarily constrained cis-regulatory elements. The rapid evolution of aCNEs might have affected the expression patterns driven by them. Transgenic zebrafish assay of some human CNE enhancers that have been lost in teleosts has indicated instances of conservation or changes in trans-acting factors between mammals and fishes.

  9. A Mass Conservation Algorithm for Adaptive Unrefinement Meshes Used by Finite Element Methods

    DTIC Science & Technology


    dimensional mesh generation. In: Proc. 4th ACM-SIAM Symp. on Disc. Algorithms. (1993) 83–92 [9] Weatherill, N., Hassan, O., Marcum, D., Marchant, M.: Grid ...Conference on Computational Science, ICCS 2012 A Mass Conservation Algorithm For Adaptive Unrefinement Meshes Used By Finite Element Methods Hung V. Nguyen...velocity fields, and chemical distribution, as well as conserve mass, especially for water quality applications. Solution accuracy depends highly on mesh

  10. Application of the space-time conservation element and solution element method to shock-tube problem

    NASA Technical Reports Server (NTRS)

    Wang, Xiao-Yen; Chow, Chuen-Yen; Chang, Sin-Chung


    An Euler solver based on the method of space-time conservation element and solution element is in this paper to simulate shock-tube flows involving shock waves, contact discontinuities, expansion waves and their intersections. Seven test problems are considered to examine the capability of this method. The numerical results, when compared with exact solutions and/or numerical solutions by other methods, indicate that the present method can accurately resolve strong shock and contact discontinuities without using any ad hoc techniques which are used only at the neighborhood of a discontinuity.

  11. Local Function Conservation in Sequence and Structure Space

    PubMed Central

    Weinhold, Nils; Sander, Oliver; Domingues, Francisco S.; Lengauer, Thomas; Sommer, Ingolf


    We assess the variability of protein function in protein sequence and structure space. Various regions in this space exhibit considerable difference in the local conservation of molecular function. We analyze and capture local function conservation by means of logistic curves. Based on this analysis, we propose a method for predicting molecular function of a query protein with known structure but unknown function. The prediction method is rigorously assessed and compared with a previously published function predictor. Furthermore, we apply the method to 500 functionally unannotated PDB structures and discuss selected examples. The proposed approach provides a simple yet consistent statistical model for the complex relations between protein sequence, structure, and function. The GOdot method is available online ( PMID:18604264

  12. Local function conservation in sequence and structure space.


    Weinhold, Nils; Sander, Oliver; Domingues, Francisco S; Lengauer, Thomas; Sommer, Ingolf


    We assess the variability of protein function in protein sequence and structure space. Various regions in this space exhibit considerable difference in the local conservation of molecular function. We analyze and capture local function conservation by means of logistic curves. Based on this analysis, we propose a method for predicting molecular function of a query protein with known structure but unknown function. The prediction method is rigorously assessed and compared with a previously published function predictor. Furthermore, we apply the method to 500 functionally unannotated PDB structures and discuss selected examples. The proposed approach provides a simple yet consistent statistical model for the complex relations between protein sequence, structure, and function. The GOdot method is available online (

  13. Linking biodiversity to ecosystem function: Implications for conservation ecology

    USGS Publications Warehouse

    Schwartz, M.W.; Brigham, C.A.; Hoeksema, J.D.; Lyons, K.G.; Mills, M.H.; van Mantgem, P.


    We evaluate the empirical and theoretical support for the hypothesis that a large proportion of native species richness is required to maximize ecosystem stability and sustain function. This assessment is important for conservation strategies because sustenance of ecosystem functions has been used as an argument for the conservation of species. If ecosystem functions are sustained at relatively low species richness, then arguing for the conservation of ecosystem function, no matter how important in its own right, does not strongly argue for the conservation of species. Additionally, for this to be a strong conservation argument the link between species diversity and ecosystem functions of value to the human community must be clear. We review the empirical literature to quantify the support for two hypotheses: (1) species richness is positively correlated with ecosystem function, and (2) ecosystem functions do not saturate at low species richness relative to the observed or experimental diversity. Few empirical studies demonstrate improved function at high levels of species richness. Second, we analyze recent theoretical models in order to estimate the level of species richness required to maintain ecosystem function. Again we find that, within a single trophic level, most mathematical models predict saturation of ecosystem function at a low proportion of local species richness. We also analyze a theoretical model linking species number to ecosystem stability. This model predicts that species richness beyond the first few species does not typically increase ecosystem stability. One reason that high species richness may not contribute significantly to function or stability is that most communities are characterized by strong dominance such that a few species provide the vast majority of the community biomass. Rapid turnover of species may rescue the concept that diversity leads to maximum function and stability. The role of turnover in ecosystem function and

  14. Linking biodiversity to ecosystem function: implications for conservation ecology.


    Schwartz, M W; Brigham, C A; Hoeksema, J D; Lyons, K G; Mills, M H; van Mantgem, P J


    We evaluate the empirical and theoretical support for the hypothesis that a large proportion of native species richness is required to maximize ecosystem stability and sustain function. This assessment is important for conservation strategies because sustenance of ecosystem functions has been used as an argument for the conservation of species. If ecosystem functions are sustained at relatively low species richness, then arguing for the conservation of ecosystem function, no matter how important in its own right, does not strongly argue for the conservation of species. Additionally, for this to be a strong conservation argument the link between species diversity and ecosystem functions of value to the human community must be clear. We review the empirical literature to quantify the support for two hypotheses: (1) species richness is positively correlated with ecosystem function, and (2) ecosystem functions do not saturate at low species richness relative to the observed or experimental diversity. Few empirical studies demonstrate improved function at high levels of species richness. Second, we analyze recent theoretical models in order to estimate the level of species richness required to maintain ecosystem function. Again we find that, within a single trophic level, most mathematical models predict saturation of ecosystem function at a low proportion of local species richness. We also analyze a theoretical model linking species number to ecosystem stability. This model predicts that species richness beyond the first few species does not typically increase ecosystem stability. One reason that high species richness may not contribute significantly to function or stability is that most communities are characterized by strong dominance such that a few species provide the vast majority of the community biomass. Rapid turnover of species may rescue the concept that diversity leads to maximum function and stability. The role of turnover in ecosystem function and

  15. Fast and systematic genome-wide discovery of conserved regulatory elements using a non-alignment based approach

    PubMed Central

    Elemento, Olivier; Tavazoie, Saeed


    We describe a powerful new approach for discovering globally conserved regulatory elements between two genomes. The method is fast, simple and comprehensive, without requiring alignments. Its application to pairs of yeasts, worms, flies and mammals yields a large number of known and novel putative regulatory elements. Many of these are validated by independent biological observations, have spatial and/or orientation biases, are co-conserved with other elements and show surprising conservation across large phylogenetic distances. PMID:15693947

  16. Conservative site-specific and single-copy transgenesis in human LINE-1 elements

    PubMed Central

    Vijaya Chandra, Shree Harsha; Makhija, Harshyaa; Peter, Sabrina; Myint Wai, Cho Mar; Li, Jinming; Zhu, Jindong; Ren, Zhonglu; D'Alcontres, Martina Stagno; Siau, Jia Wei; Chee, Sharon; Ghadessy, Farid John; Dröge, Peter


    Genome engineering of human cells plays an important role in biotechnology and molecular medicine. In particular, insertions of functional multi-transgene cassettes into suitable endogenous sequences will lead to novel applications. Although several tools have been exploited in this context, safety issues such as cytotoxicity, insertional mutagenesis and off-target cleavage together with limitations in cargo size/expression often compromise utility. Phage λ integrase (Int) is a transgenesis tool that mediates conservative site-specific integration of 48 kb DNA into a safe harbor site of the bacterial genome. Here, we show that an Int variant precisely recombines large episomes into a sequence, termed attH4X, found in 1000 human Long INterspersed Elements-1 (LINE-1). We demonstrate single-copy transgenesis through attH4X-targeting in various cell lines including hESCs, with the flexibility of selecting clones according to transgene performance and downstream applications. This is exemplified with pluripotency reporter cassettes and constitutively expressed payloads that remain functional in LINE1-targeted hESCs and differentiated progenies. Furthermore, LINE-1 targeting does not induce DNA damage-response or chromosomal aberrations, and neither global nor localized endogenous gene expression is substantially affected. Hence, this simple transgene addition tool should become particularly useful for applications that require engineering of the human genome with multi-transgenes. PMID:26673710

  17. Conservative site-specific and single-copy transgenesis in human LINE-1 elements.


    Vijaya Chandra, Shree Harsha; Makhija, Harshyaa; Peter, Sabrina; Myint Wai, Cho Mar; Li, Jinming; Zhu, Jindong; Ren, Zhonglu; D'Alcontres, Martina Stagno; Siau, Jia Wei; Chee, Sharon; Ghadessy, Farid John; Dröge, Peter


    Genome engineering of human cells plays an important role in biotechnology and molecular medicine. In particular, insertions of functional multi-transgene cassettes into suitable endogenous sequences will lead to novel applications. Although several tools have been exploited in this context, safety issues such as cytotoxicity, insertional mutagenesis and off-target cleavage together with limitations in cargo size/expression often compromise utility. Phage λ integrase (Int) is a transgenesis tool that mediates conservative site-specific integration of 48 kb DNA into a safe harbor site of the bacterial genome. Here, we show that an Int variant precisely recombines large episomes into a sequence, term edattH4X, found in 1000 human Long INterspersed Elements-1 (LINE-1). We demonstrate single-copy transgenesis through attH4X-targeting in various cell lines including hESCs, with the flexibility of selecting clones according to transgene performance and downstream applications. This is exemplified with pluripotency reporter cassettes and constitutively expressed payloads that remain functional in LINE1-targeted hESCs and differentiated progenies. Furthermore, LINE-1 targeting does not induce DNA damage-response or chromosomal aberrations, and neither global nor localized endogenous gene expression is substantially affected. Hence, this simple transgene addition tool should become particularly useful for applications that require engineering of the human genome with multi-transgenes.

  18. Conservation of sequence and function in fertilization of the cortical granule serine protease in echinoderms.


    Oulhen, Nathalie; Xu, Dongdong; Wessel, Gary M


    Conservation of the cortical granule serine protease during fertilization in echinoderms was tested both functionally in sea stars, and computationally throughout the echinoderm phylum. We find that the inhibitor of serine protease (soybean trypsin inhibitor) effectively blocks proper transition of the sea star fertilization envelope into a protective sperm repellent, whereas inhibitors of the other main types of proteases had no effect. Scanning the transcriptomes of 15 different echinoderm ovaries revealed sequences of high conservation to the originally identified sea urchin cortical serine protease, CGSP1. These conserved sequences contained the catalytic triad necessary for enzymatic activity, and the tandemly repeated LDLr-like repeats. We conclude that the protease involved in the slow block to polyspermy is an essential and conserved element of fertilization in echinoderms, and may provide an important reagent for identification and testing of the cell surface proteins in eggs necessary for sperm binding.

  19. Conservation of sequence and function in fertilization of the cortical granule serine protease in echinoderms

    PubMed Central

    Oulhen, Nathalie; Xu, Dongdong; Wessel, Gary M.


    Conservation of the cortical granule serine protease during fertilization in echinoderms was tested both functionally in sea stars, and computationally throughout the echinoderm phylum. We find that the inhibitor of serine protease (soybean trypsin inhibitor) effectively blocks proper transition of the sea star fertilization envelope into a protective sperm repellent, whereas inhibitors of the other main types of proteases had no effect. Scanning the transcriptomes of 15 different echinoderm ovaries revealed sequences of high conservation to the originally identified sea urchin cortical serine protease, CGSP1. These conserved sequences contained the catalytic triad necessary for enzymatic activity, and the tandemly repeated LDLr-like repeats. We conclude that the protease involved in the slow block to polyspermy is an essential and conserved element of fertilization in echinoderms, and may provide an important reagent for identification and testing of the cell surface proteins in eggs necessary for sperm binding. PMID:24878526

  20. Structure of a Conserved Retroviral RNA Packaging Element by NMR Spectroscopy and Cryo-Electron Tomography

    PubMed Central

    Miyazaki, Yasuyuki; Irobalieva, Rossitza N.; Tolbert, Blanton; Smalls-Mantey, Adjoa; Iyalla, Kilali; Loeliger, Kelsey; D’Souza, Victoria; Khant, Htet; Schmid, Michael F.; Garcia, Eric; Telesnitsky, Alice; Chiu, Wah; Summers, Michael F.


    The 5′-untranslated regions (5′-UTRs) of all gammaretroviruses contain a conserved “double hairpin motif” (ΨCD) that is required for genome packaging. Both hairpins (SL-C and SL-D) contain GACG tetraloops that, in isolated RNAs, are capable of forming “kissing” interactions stabilized by two intermolecular G-C base pairs. We have determined the three-dimensional structure of the double hairpin from the Moloney Murine Leukemia Virus (MoMuLV) ([ΨCD]2, 132-nucleotides, 42.8 kDaltons) using a 2H-edited NMR spectroscopy-based approach. This approach enabled the detection of 1H-1H dipolar interactions that were not observed in previous studies of isolated SL-C and SL-D hairpin RNAs using traditional 1H-1H correlated and 1H-13C-edited NMR methods. The hairpins participate in intermolecular cross-kissing interactions (SL-C to SL-D’ and SLC’ to SL-D), and stack in an end-to-end manner (SL-C to SL-D and SL-C’ to SL-D’) that gives rise to an elongated overall shape (ca. 95 Å by 45 Å by 25 Å). The global structure was confirmed by cryo-electron tomography (cryo-ET), making [ΨCD]2 simultaneously the smallest RNA to be structurally characterized to date by cryo-ET and among the largest to be determined by NMR. Our findings suggest that, in addition to promoting dimerization, [ΨCD]2 functions as a scaffold that helps initiate virus assembly by exposing a cluster of conserved UCUG elements for binding to the cognate nucleocapsid domains of assembling viral Gag proteins. PMID:20933521

  1. DAX1 regulatory networks unveil conserved and potentially new functions.


    Martins, Rute S T; Power, Deborah M; Fuentes, Juan; Deloffre, Laurence A M; Canário, Adelino V M


    DAX1 is an orphan nuclear receptor with actions in mammalian sex determination, regulation of steroidogenesis, embryonic development and neural differentiation. Conserved patterns of DAX1 gene expression from mammals to fish have been taken to suggest conserved function. In the present study, the European sea bass, Dicentrarchus labrax, DAX1 promoter was isolated and its conserved features compared to other fish and mammalian DAX1 promoters in order to derive common regulators and functional gene networks. Fish and mammalian DAX1 promoters share common sets of transcription factor frameworks which were also present in the promoter region of another 127 genes. Pathway analysis clustered these into candidate gene networks associated with the fish and mammalian DAX1. The networks identified are concordant with described functions for DAX1 in embryogenesis, regulation of transcription, endocrine development and steroid production. Novel candidate gene network partners were also identified, which implicate DAX1 in ion homeostasis and transport, lipid transport and skeletal development. Experimental evidence is provided supporting roles for DAX1 in steroid signalling and osmoregulation in fish. These results highlight the usefulness of the in silico comparative approach to analyse gene regulation for hypothesis generation. Conserved promoter architecture can be used also to predict potentially new gene functions. The approach reported can be applied to genes from model and non-model species.

  2. Different Evolutionary Strategies To Conserve Chromatin Boundary Function in the Bithorax Complex

    PubMed Central

    Cleard, Fabienne; Wolle, Daniel; Taverner, Andrew M.; Aoki, Tsutomu; Deshpande, Girish; Andolfatto, Peter; Karch, Francois; Schedl, Paul


    Chromatin boundary elements subdivide chromosomes in multicellular organisms into physically independent domains. In addition to this architectural function, these elements also play a critical role in gene regulation. Here we investigated the evolution of a Drosophila Bithorax complex boundary element called Fab-7, which is required for the proper parasegment specific expression of the homeotic Abd-B gene. Using a “gene” replacement strategy, we show that Fab-7 boundaries from two closely related species, D. erecta and D. yakuba, and a more distant species, D. pseudoobscura, are able to substitute for the melanogaster boundary. Consistent with this functional conservation, the two known Fab-7 boundary factors, Elba and LBC, have recognition sequences in the boundaries from all species. However, the strategies used for maintaining binding and function in the face of sequence divergence is different. The first is conventional, and depends upon conservation of the 8 bp Elba recognition sequence. The second is unconventional, and takes advantage of the unusually large and flexible sequence recognition properties of the LBC boundary factor, and the deployment of multiple LBC recognition elements in each boundary. In the former case, binding is lost when the recognition sequence is altered. In the latter case, sequence divergence is accompanied by changes in the number, relative affinity, and location of the LBC recognition elements. PMID:28007886

  3. Combinatorial Gene Regulatory Functions Underlie Ultraconserved Elements in Drosophila.


    Warnefors, Maria; Hartmann, Britta; Thomsen, Stefan; Alonso, Claudio R


    Ultraconserved elements (UCEs) are discrete genomic elements conserved across large evolutionary distances. Although UCEs have been linked to multiple facets of mammalian gene regulation their extreme evolutionary conservation remains largely unexplained. Here, we apply a computational approach to investigate this question in Drosophila, exploring the molecular functions of more than 1,500 UCEs shared across the genomes of 12 Drosophila species. Our data indicate that Drosophila UCEs are hubs for gene regulatory functions and suggest that UCE sequence invariance originates from their combinatorial roles in gene control. We also note that the gene regulatory roles of intronic and intergenic UCEs (iUCEs) are distinct from those found in exonic UCEs (eUCEs). In iUCEs, transcription factor (TF) and epigenetic factor binding data strongly support iUCE roles in transcriptional and epigenetic regulation. In contrast, analyses of eUCEs indicate that they are two orders of magnitude more likely than the expected to simultaneously include protein-coding sequence, TF-binding sites, splice sites, and RNA editing sites but have reduced roles in transcriptional or epigenetic regulation. Furthermore, we use a Drosophila cell culture system and transgenic Drosophila embryos to validate the notion of UCE combinatorial regulatory roles using an eUCE within the Hox gene Ultrabithorax and show that its protein-coding region also contains alternative splicing regulatory information. Taken together our experiments indicate that UCEs emerge as a result of combinatorial gene regulatory roles and highlight common features in mammalian and insect UCEs implying that similar processes might underlie ultraconservation in diverse animal taxa.

  4. Combinatorial Gene Regulatory Functions Underlie Ultraconserved Elements in Drosophila

    PubMed Central

    Warnefors, Maria; Hartmann, Britta; Thomsen, Stefan; Alonso, Claudio R.


    Ultraconserved elements (UCEs) are discrete genomic elements conserved across large evolutionary distances. Although UCEs have been linked to multiple facets of mammalian gene regulation their extreme evolutionary conservation remains largely unexplained. Here, we apply a computational approach to investigate this question in Drosophila, exploring the molecular functions of more than 1,500 UCEs shared across the genomes of 12 Drosophila species. Our data indicate that Drosophila UCEs are hubs for gene regulatory functions and suggest that UCE sequence invariance originates from their combinatorial roles in gene control. We also note that the gene regulatory roles of intronic and intergenic UCEs (iUCEs) are distinct from those found in exonic UCEs (eUCEs). In iUCEs, transcription factor (TF) and epigenetic factor binding data strongly support iUCE roles in transcriptional and epigenetic regulation. In contrast, analyses of eUCEs indicate that they are two orders of magnitude more likely than the expected to simultaneously include protein-coding sequence, TF-binding sites, splice sites, and RNA editing sites but have reduced roles in transcriptional or epigenetic regulation. Furthermore, we use a Drosophila cell culture system and transgenic Drosophila embryos to validate the notion of UCE combinatorial regulatory roles using an eUCE within the Hox gene Ultrabithorax and show that its protein-coding region also contains alternative splicing regulatory information. Taken together our experiments indicate that UCEs emerge as a result of combinatorial gene regulatory roles and highlight common features in mammalian and insect UCEs implying that similar processes might underlie ultraconservation in diverse animal taxa. PMID:27247329

  5. Application of the Space-Time Conservation Element and Solution Element Method to One-Dimensional Advection-Diffusion Problems

    NASA Technical Reports Server (NTRS)

    Wang, Xiao-Yen; Chow, Chuen-Yen; Chang, Sin-Chung


    Test problems are used to examine the performance of several one-dimensional numerical schemes based on the space-time conservation and solution element (CE/SE) method. Investigated in this paper are the CE/SE schemes constructed previously for solving the linear unsteady advection-diffusion equation and the schemes derived here for solving the nonlinear viscous and inviscid Burgers equations. In comparison with the numerical solutions obtained using several traditional finite-difference schemes with similar accuracy, the CE/SE solutions display much lower numerical dissipation and dispersion errors.

  6. p53 genes function to restrain mobile elements

    PubMed Central

    Wylie, Annika; Jones, Amanda E.; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V.; Rakheja, Dinesh; Chen, Kenneth S.; Hammer, Robert E.; Comerford, Sarah A.; Amatruda, James F.; Abrams, John M.


    Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53− germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5′ sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility. PMID:26701264

  7. The Method of Space-time Conservation Element and Solution Element: Development of a New Implicit Solver

    NASA Technical Reports Server (NTRS)

    Chang, S. C.; Wang, X. Y.; Chow, C. Y.; Himansu, A.


    The method of space-time conservation element and solution element is a nontraditional numerical method designed from a physicist's perspective, i.e., its development is based more on physics than numerics. It uses only the simplest approximation techniques and yet is capable of generating nearly perfect solutions for a 2-D shock reflection problem used by Helen Yee and others. In addition to providing an overall view of the new method, we introduce a new concept in the design of implicit schemes, and use it to construct a highly accurate solver for a convection-diffusion equation. It is shown that, in the inviscid case, this new scheme becomes explicit and its amplification factors are identical to those of the Leapfrog scheme. On the other hand, in the pure diffusion case, its principal amplification factor becomes the amplification factor of the Crank-Nicolson scheme.

  8. A strongly conservative finite element method for the coupling of Stokes and Darcy flow

    NASA Astrophysics Data System (ADS)

    Kanschat, G.; Rivière, B.


    We consider a model of coupled free and porous media flow governed by Stokes and Darcy equations with the Beavers-Joseph-Saffman interface condition. This model is discretized using divergence-conforming finite elements for the velocities in the whole domain. Discontinuous Galerkin techniques and mixed methods are used in the Stokes and Darcy subdomains, respectively. This discretization is strongly conservative in Hdiv( Ω) and we show convergence. Numerical results validate our findings and indicate optimal convergence orders.

  9. Regulation of photoreceptor gene transcription via a highly conserved transcriptional regulatory element by vsx gene products

    PubMed Central

    Pan, Yi; Comiskey, Daniel F.; Kelly, Lisa E.; Chandler, Dawn S.


    Purpose The photoreceptor conserved element-1 (PCE-1) sequence is found in the transcriptional regulatory regions of many genes expressed in photoreceptors. The retinal homeobox (Rx or Rax) gene product functions by binding to PCE-1 sites. However, other transcriptional regulators have also been reported to bind to PCE-1. One of these, vsx2, is expressed in retinal progenitor and bipolar cells. The purpose of this study is to identify Xenopus laevis vsx gene products and characterize vsx gene product expression and function with respect to the PCE-1 site. Methods X. laevis vsx gene products were amplified with PCR. Expression patterns were determined with in situ hybridization using whole or sectioned X. laevis embryos and digoxigenin- or fluorescein-labeled antisense riboprobes. DNA binding characteristics of the vsx gene products were analyzed with electrophoretic mobility shift assays (EMSAs) using in vitro translated proteins and radiolabeled oligonucleotide probes. Gene transactivation assays were performed using luciferase-based reporters and in vitro transcribed effector gene products, injected into X. laevis embryos. Results We identified one vsx1 and two vsx2 gene products. The two vsx2 gene products are generated by alternate mRNA splicing. We verified that these gene products are expressed in the developing retina and that expression resolves into distinct cell types in the mature retina. Finally, we found that vsx gene products can bind the PCE-1 site in vitro and that the two vsx2 isoforms have different gene transactivation activities. Conclusions vsx gene products are expressed in the developing and mature neural retina. vsx gene products can bind the PCE-1 site in vitro and influence the expression of a rhodopsin promoter-luciferase reporter gene. The two isoforms of vsx have different gene transactivation activities in this reporter gene system. PMID:28003732

  10. A brief description of a new numerical framework for solving conservation laws: The method of space-time conservation element and solution element

    NASA Technical Reports Server (NTRS)

    Chang, Sin-Chung; To, Wai-Ming


    A new numerical method for solving conservation laws is being developed. It differs substantially from the well established methods, i.e., finite difference, finite volume, finite element, and spectral methods, in both concept and methodology. It is much simpler than a typical high resolution method. No flux limiter or any technique related to characteristics is involved. No artificial viscosity or smoothing is introduced, and no moving mesh is used. Yet this method is capable of generating highly accurate shock tube solutions. The slight numerical overshoot and/or oscillations generated can be removed if a simple averaging formula initially used is replaced by a weighted formula. This modification has little effect on other parts of the solution. Because of its simplicity, generalization of this new method for multi-dimensional problems is straightforward.

  11. Prediction of synergistic transcription factors by function conservation

    PubMed Central

    Hu, Zihua; Hu, Boyu; Collins, James F


    Background Previous methods employed for the identification of synergistic transcription factors (TFs) are based on either TF enrichment from co-regulated genes or phylogenetic footprinting. Despite the success of these methods, both have limitations. Results We propose a new strategy to identify synergistic TFs by function conservation. Rather than aligning the regulatory sequences from orthologous genes and then identifying conserved TF binding sites (TFBSs) in the alignment, we developed computational approaches to implement the novel strategy. These methods include combinatorial TFBS enrichment utilizing distance constraints followed by enrichment of overlapping orthologous genes from human and mouse, whose regulatory sequences contain the enriched TFBS combinations. Subsequently, integration of function conservation from both TFBS and overlapping orthologous genes was achieved by correlation analyses. These techniques have been used for genome-wide promoter analyses, which have led to the identification of 51 homotypic TF combinations; the validity of these approaches has been exemplified by both known TF-TF interactions and function coherence analyses. We further provide computational evidence that our novel methods were able to identify synergistic TFs to a much greater extent than phylogenetic footprinting. Conclusion Function conservation based on the concordance of combinatorial TFBS enrichment along with enrichment of overlapping orthologous genes has been proven to be a successful means for the identification of synergistic TFs. This approach avoids the limitations of phylogenetic footprinting as it does not depend upon sequence alignment. It utilizes existing gene annotation data, such as those available in GO, thus providing an alternative method for functional TF discovery and annotation. PMID:18053230

  12. A conserved 11 nucleotide sequence contains an essential promoter element of the maize mitochondrial atp1 gene.

    PubMed Central

    Rapp, W D; Stern, D B


    To determine the structure of a functional plant mitochondrial promoter, we have partially purified an RNA polymerase activity that correctly initiates transcription at the maize mitochondrial atp1 promoter in vitro. Using a series of 5' deletion constructs, we found that essential sequences are located within--19 nucleotides (nt) of the transcription initiation site. The region surrounding the initiation site includes conserved sequence motifs previously proposed to be maize mitochondrial promoter elements. Deletion of a conserved 11 nt sequence showed that it is critical for promoter function, but deletion or alteration of conserved upstream G(A/T)3-4 repeats had no effect. When the atp1 11 nt sequence was inserted into different plasmids lacking mitochondrial promoter activity, transcription was only observed for one of these constructs. We infer from these data that the functional promoter extends beyond this motif, most likely in the 5' direction. The maize mitochondrial cox3 and atp6 promoters also direct transcription initiation in this in vitro system, suggesting that it may be widely applicable for studies of mitochondrial transcription in this species. Images PMID:1372246

  13. Functional conservation of the sex-lethal sex determining promoter, Sxl-Pe, in Drosophila virilis.


    Jinks, Timothy Morgan; Calhoun, Gretchen; Schedl, Paul


    The primary sex determination signal in Drosophila melanogaster, the ratio of X chromosomes to autosomes, sets the activity state of the switch gene, Sex-lethal ( Sxl), by regulating the establishment promoter, m-Sxl-Pe. We have identified and characterized the establishment promoter, v-Sxl-Pe, of the distantly related species Drosophila virilis. Like melanogaster, the virilis Sxl-Pe is organized into four sub-domains: the Sxl-Pe mRNA leader and exon E1 of Sxl protein, the core promoter, the sex-specific element and the augmentation element. The core promoter and sex-specific element of v-Sxl-Pe show considerable sequence similarity to m-Sxl-Pe and contain target sites for components of the X/A signaling system. While the augmentation element of v-Sxl-Pe also has sequence motifs that could function as target sites for the X/A signaling system, it shows little similarity to the melanogaster augmentation element. Functional studies reveal that v-Sxl-Pe drives sex-specific expression in D. melanogaster embryos and that the activity of the virilis promoter is controlled by known components of the melanogaster X/A counting system. Although v-Sxl-Pe responds appropriately to the melanogaster sex determination signal, it is less active than Sxl-Pe from melanogaster. Unexpectedly, the reduced activity is due to differences in the activity of the conserved core promoter, while the non-conserved augmentation element functions effectively. These findings suggest that low-affinity target sites for the X/A counting system are critical for the functioning of Sxl-Pe.

  14. Functional and Structural Analysis of the Conserved EFhd2 Protein

    PubMed Central

    Acosta, Yancy Ferrer; Rodríguez Cruz, Eva N.; Vaquer, Ana del C.; Vega, Irving E.


    EFhd2 is a novel protein conserved from C. elegans to H. sapiens. This novel protein was originally identified in cells of the immune and central nervous systems. However, it is most abundant in the central nervous system, where it has been found associated with pathological forms of the microtubule-associated protein tau. The physiological or pathological roles of EFhd2 are poorly understood. In this study, a functional and structural analysis was carried to characterize the molecular requirements for EFhd2’s calcium binding activity. The results showed that mutations of a conserved aspartate on either EF-hand motif disrupted the calcium binding activity, indicating that these motifs work in pair as a functional calcium binding domain. Furthermore, characterization of an identified single-nucleotide polymorphisms (SNP) that introduced a missense mutation indicates the importance of a conserved phenylalanine on EFhd2 calcium binding activity. Structural analysis revealed that EFhd2 is predominantly composed of alpha helix and random coil structures and that this novel protein is thermostable. EFhd2’s thermo stability depends on its N-terminus. In the absence of the N-terminus, calcium binding restored EFhd2’s thermal stability. Overall, these studies contribute to our understanding on EFhd2 functional and structural properties, and introduce it into the family of canonical EF-hand domain containing proteins. PMID:22973849

  15. Functionally conserved effects of rapamycin exposure on zebrafish.


    Sucularli, Ceren; Shehwana, Huma; Kuscu, Cem; Dungul, Dilay Ciglidag; Ozdag, Hilal; Konu, Ozlen


    Mechanistic target of rapamycin (mTOR) is a conserved serine/threonine kinase important in cell proliferation, growth and protein translation. Rapamycin, a well‑known anti‑cancer agent and immunosuppressant drug, inhibits mTOR activity in different taxa including zebrafish. In the present study, the effect of rapamycin exposure on the transcriptome of a zebrafish fibroblast cell line, ZF4, was investigated. Microarray analysis demonstrated that rapamycin treatment modulated a large set of genes with varying functions including protein synthesis, assembly of mitochondrial and proteasomal machinery, cell cycle, metabolism and oxidative phosphorylation in ZF4 cells. A mild however, coordinated reduction in the expression of proteasomal and mitochondrial ribosomal subunits was detected, while the expression of numerous ribosomal subunits increased. Meta‑analysis of heterogeneous mouse rapamycin microarray datasets enabled the comparison of zebrafish and mouse pathways modulated by rapamycin, using Kyoto Encyclopedia of Genes and Genomes and Gene Ontology pathway analysis. The analyses demonstrated a high degree of functional conservation between zebrafish and mice in response to rapamycin. In addition, rapamycin treatment resulted in a marked dose‑dependent reduction in body size and pigmentation in zebrafish embryos. The present study is the first, to the best of our knowledge, to evaluate the conservation of rapamycin‑modulated functional pathways between zebrafish and mice, in addition to the dose‑dependent growth curves of zebrafish embryos upon rapamycin exposure.

  16. Functional Constraint Profiling of a Viral Protein Reveals Discordance of Evolutionary Conservation and Functionality

    PubMed Central

    Wu, Nicholas C.; Olson, C. Anders; Du, Yushen; Le, Shuai; Tran, Kevin; Remenyi, Roland; Gong, Danyang; Al-Mawsawi, Laith Q.; Qi, Hangfei; Wu, Ting-Ting; Sun, Ren


    Viruses often encode proteins with multiple functions due to their compact genomes. Existing approaches to identify functional residues largely rely on sequence conservation analysis. Inferring functional residues from sequence conservation can produce false positives, in which the conserved residues are functionally silent, or false negatives, where functional residues are not identified since they are species-specific and therefore non-conserved. Furthermore, the tedious process of constructing and analyzing individual mutations limits the number of residues that can be examined in a single study. Here, we developed a systematic approach to identify the functional residues of a viral protein by coupling experimental fitness profiling with protein stability prediction using the influenza virus polymerase PA subunit as the target protein. We identified a significant number of functional residues that were influenza type-specific and were evolutionarily non-conserved among different influenza types. Our results indicate that type-specific functional residues are prevalent and may not otherwise be identified by sequence conservation analysis alone. More importantly, this technique can be adapted to any viral (and potentially non-viral) protein where structural information is available. PMID:26132554

  17. Conserved thioredoxin fold is present in Pisum sativum L. sieve element occlusion-1 protein.


    Tuteja, Narendra; Umate, Pavan; Tuteja, Renu


    Homology-based three-dimensional model for Pisum sativum sieve element occlusion 1 (Ps.SEO1) (forisomes) protein was constructed. A stretch of amino acids (residues 320 to 456) which is well conserved in all known members of forisomes proteins was used to model the 3D structure of Ps.SEO1. The structural prediction was done using Protein Homology/analogY Recognition Engine (PHYRE) web server. Based on studies of local sequence alignment, the thioredoxin-fold containing protein [Structural Classification of Proteins (SCOP) code d1o73a_], a member of the glutathione peroxidase family was selected as a template for modeling the spatial structure of Ps.SEO1. Selection was based on comparison of primary sequence, higher match quality and alignment accuracy. Motif 1 (EVF) is conserved in Ps.SEO1, Vicia faba (Vf.For1) and Medicago truncatula (Mt.SEO3); motif 2 (KKED) is well conserved across all forisomes proteins and motif 3 (IGYIGNP) is conserved in Ps.SEO1 and Vf.For1.

  18. Cdc14: a highly conserved family of phosphatases with non-conserved functions?


    Mocciaro, Annamaria; Schiebel, Elmar


    CDC14 was originally identified by L. Hartwell in his famous screen for genes that regulate the budding yeast cell cycle. Subsequent work showed that Cdc14 belongs to a family of highly conserved dual-specificity phosphatases that are present in a wide range of organisms from yeast to human. Human CDC14B is even able to fulfill the essential functions of budding yeast Cdc14. In budding yeast, Cdc14 counteracts the activity of cyclin dependent kinase (Cdk1) at the end of mitosis and thus has important roles in the regulation of anaphase, mitotic exit and cytokinesis. On the basis of the functional conservation of other cell-cycle genes it seemed obvious to assume that Cdc14 phosphatases also have roles in late mitosis in mammalian cells and regulate similar targets to those found in yeast. However, analysis of the human Cdc14 proteins (CDC14A, CDC14B and CDC14C) by overexpression or by depletion using small interfering RNA (siRNA) has suggested functions that are quite different from those of ScCdc14. Recent studies in avian and human somatic cell lines in which the gene encoding either Cdc14A or Cdc14B had been deleted, have shown - surprisingly - that neither of the two phosphatases on its own is essential for viability, cell-cycle progression and checkpoint control. In this Commentary, we critically review the available data on the functions of yeast and vertebrate Cdc14 phosphatases, and discuss whether they indeed share common functions as generally assumed.

  19. A conservative multi-tracer transport scheme for spectral-element spherical grids

    NASA Astrophysics Data System (ADS)

    Erath, Christoph; Nair, Ramachandran D.


    Atmospheric models used for practical climate simulation must be capable handling the transport of hundreds of tracers. For computational efficiency conservative multi-tracer semi-Lagrangian type transport schemes are appropriate. Global models based on high-order Galerkin approach employ highly non-uniform spectral-element grids, and semi-Lagrangian transport is a challenge on those grids. A conservative semi-Lagrangian scheme (SPELT - SPectral-Element Lagrangian Transport) employing a multi-moment compact reconstruction procedure is developed for non-uniform quadrilateral grids. The scheme is based on a characteristic semi-Lagrangian method that avoids complex and expensive upstream area computations. The SPELT scheme has been implemented in the High-Order Method Modeling Environment (HOMME), which is based on a cubed-sphere grid with spectral-element spatial discretization. Additionally, we show the (strong) scalability and multi-tracer efficiency using several benchmark tests. The SPELT solution can be made monotonic (positivity preserving) by combining the flux-corrected transport algorithm, which is demonstrated on a uniform resolution grid. In particular, SPELT can be efficiently used for non-uniform grids and provides accurate and stable results for high-resolution meshes.

  20. Reprint of: A conservative multi-tracer transport scheme for spectral-element spherical grids

    NASA Astrophysics Data System (ADS)

    Erath, Christoph; Nair, Ramachandran D.


    Atmospheric models used for practical climate simulation must be capable handling the transport of hundreds of tracers. For computational efficiency conservative multi-tracer semi-Lagrangian type transport schemes are appropriate. Global models based on high-order Galerkin approach employ highly non-uniform spectral-element grids, and semi-Lagrangian transport is a challenge on those grids. A conservative semi-Lagrangian scheme (SPELT - SPectral-Element Lagrangian Transport) employing a multi-moment compact reconstruction procedure is developed for non-uniform quadrilateral grids. The scheme is based on a characteristic semi-Lagrangian method that avoids complex and expensive upstream area computations. The SPELT scheme has been implemented in the High-Order Method Modeling Environment (HOMME), which is based on a cubed-sphere grid with spectral-element spatial discretization. Additionally, we show the (strong) scalability and multi-tracer efficiency using several benchmark tests. The SPELT solution can be made monotonic (positivity preserving) by combining the flux-corrected transport algorithm, which is demonstrated on a uniform resolution grid. In particular, SPELT can be efficiently used for non-uniform grids and provides accurate and stable results for high-resolution meshes.

  1. Structural analysis of the regulatory elements of the type-II procollagen gene. Conservation of promoter and first intron sequences between human and mouse.

    PubMed Central

    Vikkula, M; Metsäranta, M; Syvänen, A C; Ala-Kokko, L; Vuorio, E; Peltonen, L


    Transcription of the type-II procollagen gene (COL2A1) is very specifically restricted to a limited number of tissues, particularly cartilages. In order to identify transcription-control motifs we have sequenced the promoter region and the first intron of the human and mouse COL2A1 genes. With the assumption that these motifs should be well conserved during evolution, we have searched for potential elements important for the tissue-specific transcription of the COL2A1 gene by aligning the two sequences with each other and with the available rat type-II procollagen sequence for the promoter. With this approach we could identify specific evolutionarily well-conserved motifs in the promoter area. On the other hand, several suggested regulatory elements in the promoter region did not show evolutionary conservation. In the middle of the first intron we found a cluster of well-conserved transcription-control elements and we conclude that these conserved motifs most probably possess a significant function in the control of the tissue-specific transcription of the COL2A1 gene. We also describe locations of additional, highly conserved nucleotide stretches, which are good candidate regions in the search for binding sites of yet-uncharacterized cartilage-specific transcription regulators of the COL2A1 gene. PMID:1637314

  2. Role of Conserved Non-Coding Regulatory Elements in LMW Glutenin Gene Expression

    PubMed Central

    Juhász, Angéla; Makai, Szabolcs; Sebestyén, Endre; Tamás, László; Balázs, Ervin


    Transcriptional regulation of LMW glutenin genes were investigated in-silico, using publicly available gene sequences and expression data. Genes were grouped into different LMW glutenin types and their promoter profiles were determined using cis-acting regulatory elements databases and published results. The various cis-acting elements belong to some conserved non-coding regulatory regions (CREs) and might act in two different ways. There are elements, such as GCN4 motifs found in the long endosperm box that could serve as key factors in tissue-specific expression. Some other elements, such as the AACA/TA motifs or the individual prolamin box variants, might modulate the level of expression. Based on the promoter sequences and expression characteristic LMW glutenin genes might be transcribed following two different mechanisms. Most of the s- and i-type genes show a continuously increasing expression pattern. The m-type genes, however, demonstrate normal distribution in their expression profiles. Differences observed in their expression could be related to the differences found in their promoter sequences. Polymorphisms in the number and combination of cis-acting elements in their promoter regions can be of crucial importance in the diverse levels of production of single LMW glutenin gene types. PMID:22242127

  3. Application of the Space-Time Conservation Element and Solution Element Method to One-Dimensional Convection-Diffusion Problems

    NASA Technical Reports Server (NTRS)

    Chang, Sin-Chung; Wang, Xiao-Yen; To, Wai-Ming


    In the space-time conservation element and solution element (CE/SE) method, the independent marching variables used comprise not only the mesh value of the physical dependent variables but also, in contrast to it typical numerical method, the Mesh values of the spatial derivatives of the physical variables The use of the extra marching variables results from the need to construct the two-level explicit and nondissipative schemes which are at the core of the CE/SE development. It also results from the need to minimize the stencil while maintaining accuracy. In this paper using the 1D(sub (alpha)-mu) scheme as an example, the effect of this added complication on consistency, accuracy and operation count is assessed. As part of this effort, an equivalent yet more efficient form of the alpha-mu scheme in which the independent marching variables are the local fluxes tied to each mesh point is introduced. Also, the intriguing relations that exist among the alpha-mu. Leapfrog, and DuFort-Frankel schemes are further explored. In addition, the redundance of the Leapfrog, DUFort-Frankel, and Lax scheme and the remedy for this redundance are discussed. This paper is concluded with the construction and evaluation of a CE/SE solver for the inviscid Burger equation.

  4. Applications of the Space-Time Conservation Element and Solution Element (CE/SE) Method to Computational Aeroacoustic Benchmark Problems

    NASA Technical Reports Server (NTRS)

    Wang, Xiao-Yen; Himansu, Ananda; Chang, Sin-Chung; Jorgenson, Philip C. E.


    The Internal Propagation problems, Fan Noise problem, and Turbomachinery Noise problems are solved using the space-time conservation element and solution element (CE/SE) method. The problems in internal propagation problems address the propagation of sound waves through a nozzle. Both the nonlinear and linear quasi 1D Euler equations are solved. Numerical solutions are presented and compared with the analytical solution. The fan noise problem concerns the effect of the sweep angle on the acoustic field generated by the interaction of a convected gust with a cascade of 3D flat plates. A parallel version of the 3D CE/SE Euler solver is developed and employed to obtain numerical solutions for a family of swept flat plates. Numerical solutions for sweep angles of 0, 5, 10, and 15 deg are presented. The turbomachinery problems describe the interaction of a 2D vortical gust with a cascade of flat-plate airfoils with/without a downstream moving grid. The 2D nonlinear Euler Equations are solved and the converged numerical solutions are presented and compared with the corresponding analytical solution. All the comparisons demonstrate that the CE/SE method is capable of solving aeroacoustic problems with/without shock waves in a simple and efficient manner. Furthermore, the simple non-reflecting boundary condition used in the CE/SE method which is not based on the characteristic theory works very well in 1D, 2D and 3D problems.

  5. Applications of the Method of Space-Time Conservation Element and the Solution Element to Unsteady Chemically Reactive Flows

    NASA Technical Reports Server (NTRS)

    Yu, Sheng-Tao


    This document reports the conclusion and findings of our research activities for this grant. The goal of the project is the development and application of the method of Space-Time Conservation Element and Solution Element, or the CE/SE method, to simulate chemically reacting flows. The product of this project will be a high-fidelity, time-accurate flow solver analyzing unsteady flow fields advanced propulsion concepts, including the low-emission turbojet engine combustion and flow fields of the Pulse Detonation Engines (PDE). Based on the documents and computer software of the CE/SE method that we have received from the CE/SE working group at NASA Lewis, we have focused our research effort on addressing outstanding technical issues related to the extension of the CE/SE method for unsteady, chemically reactive flows. In particular, we have made progresses in the following three aspects: (1) Derivation of the governing equations for reacting flows; (2) Numerical treatments of stiff source terms; and (3) Detailed simulations of ZND detonation waves.

  6. Evolutionary Conservation of Ceratitis capitata transformer Gene Function

    PubMed Central

    Pane, Attilio; De Simone, Annamaria; Saccone, Giuseppe; Polito, Catello


    Transformer functions as a binary switch gene in the sex determination and sexual differentiation of Drosophila melanogaster and Ceratitis capitata, two insect species that separated nearly 100 million years ago. The TRA protein is required for female differentiation of XX individuals, while XY individuals express smaller, presumably nonfunctional TRA peptides and consequently develop into adult males. In both species, tra confers female sexual identity through a well-conserved double-sex gene. However, unlike Drosophila tra, which is regulated by the upstream Sex-lethal gene, Ceratitis tra itself is likely to control a feedback loop that ensures the maintenance of the female sexual state. The putative CcTRA protein shares a very low degree of sequence identity with the TRA proteins from Drosophila species. However, in this study we show that a female-specific Ceratitis Cctra cDNA encoding the putative full-length CcTRA protein is able to support the female somatic and germline sexual differentiation of D. melanogaster XX; tra mutant adults. Although highly divergent, CcTRA can functionally substitute for DmTRA and induce the female-specific expression of both Dmdsx and Dmfru genes. These data demonstrate the unusual plasticity of the TRA protein that retains a conserved function despite the high evolutionary rate. We suggest that transformer plays an important role in providing a molecular basis for the variety of sex-determining systems seen among insects. PMID:15998727

  7. Inferring Functional Relationships from Conservation of Gene Order.


    Moreno-Hagelsieb, Gabriel


    Predicting functional associations using the Gene Neighbor Method depends on the simple idea that if genes are conserved next to each other in evolutionarily distant prokaryotes they might belong to a polycistronic transcription unit. The procedure presented in this chapter starts with the organization of the genes within genomes into pairs of adjacent genes. Then, the pairs of adjacent genes in a genome of interest are mapped to their corresponding orthologs in other, informative, genomes. The final step is to verify if the mapped orthologs are also pairs of adjacent genes in the informative genomes.

  8. Does the evolutionary conservation of microsatellite loci imply function?

    SciTech Connect

    Shriver, M.D.; Deka, R.; Ferrell, R.E.


    Microsatellites are highly polymorphic tandem arrays of short (1-6 bp) sequence motifs which have been found widely distributed in the genomes of all eukaryotes. We have analyzed allele frequency data on 16 microsatellite loci typed in the great apes (human, chimp, orangutan, and gorilla). The majority of these loci (13) were isolated from human genomic libraries; three were cloned from chimpanzee genomic DNA. Most of these loci are not only present in all apes species, but are polymorphic with comparable levels of heterozygosity and have alleles which overlap in size. The extent of divergence of allele frequencies among these four species were studies using the stepwise-weighted genetic distance (Dsw), which was previously shown to conform to linearity with evolutionary time since divergence for loci where mutations exist in a stepwise fashion. The phylogenetic tree of the great apes constructed from this distance matrix was consistent with the expected topology, with a high bootstrap confidence (82%) for the human/chimp clade. However, the allele frequency distributions of these species are 10 times more similar to each other than expected when they were calibrated with a conservative estimate of the time since separation of humans and the apes. These results are in agreement with sequence-based surveys of microsatellites which have demonstrated that they are highly (90%) conserved over short periods of evolutionary time (< 10 million years) and moderately (30%) conserved over long periods of evolutionary time (> 60-80 million years). This evolutionary conservation has prompted some authors to speculate that there are functional constraints on microsatellite loci. In contrast, the presence of directional bias of mutations with constraints and/or selection against aberrant sized alleles can explain these results.

  9. Regulation of the segmentation gene fushi tarazu has been functionally conserved in Drosophila.

    PubMed Central

    Maier, D; Preiss, A; Powell, J R


    An evolutionary approach was applied to identify elements involved in the regulation of the segmentation gene fushi tarazu (ftz) by comparing the Drosophila melanogaster ftz gene with its Drosophila hydei homologue. The overall organization of the ftz gene is very similar in both species. Surprisingly, ftz proved to be inverted in the ANT-C of D. hydei with respect to D. melanogaster. Strong homologies extend over the entire 6 kb of the ftz upstream region with the best match in the 'upstream element'. We identified several highly conserved boxes embedded in unrelated sequences that correspond extremely well to two germ layer specific enhancers in the upstream element. Transformation experiments revealed that D. hydei ftz gene products can restore D. melanogaster ftz function and, furthermore, that trans-acting factors from D. melanogaster recognize and control D. hydei ftz regulatory elements. These findings indicate a conservation of the entire regulatory network among segmentation genes for several millions of years during the evolution of Drosophila. Images Fig. 2. Fig. 6. PMID:2174353

  10. A locally conservative non-negative finite element formulation for anisotropic advective-diffusive-reactive systems

    NASA Astrophysics Data System (ADS)

    Mudunuru, M. K.; Shabouei, M.; Nakshatrala, K.


    Advection-diffusion-reaction (ADR) equations appear in various areas of life sciences, hydrogeological systems, and contaminant transport. Obtaining stable and accurate numerical solutions can be challenging as the underlying equations are coupled, nonlinear, and non-self-adjoint. Currently, there is neither a robust computational framework available nor a reliable commercial package known that can handle various complex situations. Herein, the objective of this poster presentation is to present a novel locally conservative non-negative finite element formulation that preserves the underlying physical and mathematical properties of a general linear transient anisotropic ADR equation. In continuous setting, governing equations for ADR systems possess various important properties. In general, all these properties are not inherited during finite difference, finite volume, and finite element discretizations. The objective of this poster presentation is two fold: First, we analyze whether the existing numerical formulations (such as SUPG and GLS) and commercial packages provide physically meaningful values for the concentration of the chemical species for various realistic benchmark problems. Furthermore, we also quantify the errors incurred in satisfying the local and global species balance for two popular chemical kinetics schemes: CDIMA (chlorine dioxide-iodine-malonic acid) and BZ (Belousov--Zhabotinsky). Based on these numerical simulations, we show that SUPG and GLS produce unphysical values for concentration of chemical species due to the violation of the non-negative constraint, contain spurious node-to-node oscillations, and have large errors in local and global species balance. Second, we proposed a novel finite element formulation to overcome the above difficulties. The proposed locally conservative non-negative computational framework based on low-order least-squares finite elements is able to preserve these underlying physical and mathematical properties

  11. Hedgehog signaling pathway function conserved in Tribolium segmentation

    PubMed Central

    Farzana, Laila


    In Drosophila, maintenance of parasegmental boundaries and formation of segmental grooves depend on interactions between segment polarity genes. Wingless and Engrailed appear to have similar roles in both short and long germ segmentation, but relatively little is known about the extent to which Hedgehog signaling is conserved. In a companion study to the Tribolium genome project, we analyzed the expression and function of hedgehog, smoothened, patched, and cubitus interruptus orthologs during segmentation in Tribolium. Their expression was largely conserved between Drosophila and Tribolium. Parental RNAi analysis of positive regulators of the pathway (Tc-hh, Tc-smo, or Tc-ci) resulted in small spherical cuticles with little or no evidence of segmental grooves. Segmental Engrailed expression in these embryos was initiated but not maintained. Wingless-independent Engrailed expression in the CNS was maintained and became highly compacted during germ band retraction, providing evidence that derivatives from every segment were present in these small spherical embryos. On the other hand, RNAi analysis of a negative regulator (Tc-ptc) resulted in embryos with ectopic segmental grooves visible during germband elongation but not discernible in the first instar larval cuticles. These transient grooves formed adjacent to Engrailed expressing cells that encircled wider than normal wg domains in the Tc-ptc RNAi embryos. These results suggest that the en–wg–hh gene circuit is functionally conserved in the maintenance of segmental boundaries during germ band retraction and groove formation in Tribolium and that the segment polarity genes form a robust genetic regulatory module in the segmentation of this short germ insect. PMID:18392879

  12. Human Intellectual Disability Genes Form Conserved Functional Modules in Drosophila

    PubMed Central

    Oortveld, Merel A. W.; Keerthikumar, Shivakumar; Oti, Martin; Nijhof, Bonnie; Fernandes, Ana Clara; Kochinke, Korinna; Castells-Nobau, Anna; van Engelen, Eva; Ellenkamp, Thijs; Eshuis, Lilian; Galy, Anne; van Bokhoven, Hans; Habermann, Bianca; Brunner, Han G.; Zweier, Christiane; Verstreken, Patrik; Huynen, Martijn A.; Schenck, Annette


    Intellectual Disability (ID) disorders, defined by an IQ below 70, are genetically and phenotypically highly heterogeneous. Identification of common molecular pathways underlying these disorders is crucial for understanding the molecular basis of cognition and for the development of therapeutic intervention strategies. To systematically establish their functional connectivity, we used transgenic RNAi to target 270 ID gene orthologs in the Drosophila eye. Assessment of neuronal function in behavioral and electrophysiological assays and multiparametric morphological analysis identified phenotypes associated with knockdown of 180 ID gene orthologs. Most of these genotype-phenotype associations were novel. For example, we uncovered 16 genes that are required for basal neurotransmission and have not previously been implicated in this process in any system or organism. ID gene orthologs with morphological eye phenotypes, in contrast to genes without phenotypes, are relatively highly expressed in the human nervous system and are enriched for neuronal functions, suggesting that eye phenotyping can distinguish different classes of ID genes. Indeed, grouping genes by Drosophila phenotype uncovered 26 connected functional modules. Novel links between ID genes successfully predicted that MYCN, PIGV and UPF3B regulate synapse development. Drosophila phenotype groups show, in addition to ID, significant phenotypic similarity also in humans, indicating that functional modules are conserved. The combined data indicate that ID disorders, despite their extreme genetic diversity, are caused by disruption of a limited number of highly connected functional modules. PMID:24204314

  13. Functional conservation of an ancestral Pellino protein in helminth species

    PubMed Central

    Cluxton, Christopher D.; Caffrey, Brian E.; Kinsella, Gemma K.; Moynagh, Paul N.; Fares, Mario A.; Fallon, Padraic G.


    The immune system of H. sapiens has innate signaling pathways that arose in ancestral species. This is exemplified by the discovery of the Toll-like receptor (TLR) pathway using free-living model organisms such as Drosophila melanogaster. The TLR pathway is ubiquitous and controls sensitivity to pathogen-associated molecular patterns (PAMPs) in eukaryotes. There is, however, a marked absence of this pathway from the plathyhelminthes, with the exception of the Pellino protein family, which is present in a number of species from this phylum. Helminth Pellino proteins are conserved having high similarity, both at the sequence and predicted structural protein level, with that of human Pellino proteins. Pellino from a model helminth, Schistosoma mansoni Pellino (SmPellino), was shown to bind and poly-ubiquitinate human IRAK-1, displaying E3 ligase activity consistent with its human counterparts. When transfected into human cells SmPellino is functional, interacting with signaling proteins and modulating mammalian signaling pathways. Strict conservation of a protein family in species lacking its niche signalling pathway is rare and provides a platform to examine the ancestral functions of Pellino proteins that may translate into novel mechanisms of immune regulation in humans. PMID:26120048

  14. Conservation patterns in different functional sequence categoriesof divergent Drosophila species

    SciTech Connect

    Papatsenko, Dmitri; Kislyuk, Andrey; Levine, Michael; Dubchak, Inna


    We have explored the distributions of fully conservedungapped blocks in genome-wide pairwise alignments of recently completedspecies of Drosophila: D.yakuba, D.ananassae, D.pseudoobscura, D.virilisand D.mojavensis. Based on these distributions we have found that nearlyevery functional sequence category possesses its own distinctiveconservation pattern, sometimes independent of the overall sequenceconservation level. In the coding and regulatory regions, the ungappedblocks were longer than in introns, UTRs and non-functional sequences. Atthe same time, the blocks in the coding regions carried 3N+2 signaturecharacteristic to synonymic substitutions in the 3rd codon positions.Larger block sizes in transcription regulatory regions can be explainedby the presence of conserved arrays of binding sites for transcriptionfactors. We also have shown that the longest ungapped blocks, or'ultraconserved' sequences, are associated with specific gene groups,including those encoding ion channels and components of the cytoskeleton.We discussed how restrained conservation patterns may help in mappingfunctional sequence categories and improving genomeannotation.

  15. Conservation of Planar Polarity Pathway Function Across the Animal Kingdom.


    Hale, Rosalind; Strutt, David


    Planar polarity is a well-studied phenomenon resulting in the directional coordination of cells in the plane of a tissue. In invertebrates and vertebrates, planar polarity is established and maintained by the largely independent core and Fat/Dachsous/Four-jointed (Ft-Ds-Fj) pathways. Loss of function of these pathways can result in a wide range of developmental or cellular defects, including failure of gastrulation and problems with placement and function of cilia. This review discusses the conservation of these pathways across the animal kingdom. The lack of vital core pathway components in basal metazoans suggests that the core planar polarity pathway evolved shortly after, but not necessarily alongside, the emergence of multicellularity.


    SciTech Connect



    Identifying functions for all gene products in all sequenced organisms is a central challenge of the post-genomic era. However, at least 30-50% of the proteins encoded by any given genome are of unknown function, or wrongly or vaguely annotated. Many of these 'unknown' proteins are common to prokaryotes and plants. We accordingly set out to predict and experimentally test the functions of such proteins. Our approach to functional prediction is integrative, coupling the extensive post-genomic resources available for plants with comparative genomics based on hundreds of microbial genomes, and functional genomic datasets from model microorganisms. The early phase is computer-assisted; later phases incorporate intellectual input from expert plant and microbial biochemists. The approach thus bridges the gap between automated homology-based annotations and the classical gene discovery efforts of experimentalists, and is much more powerful than purely computational approaches to identifying gene-function associations. Among Arabidopsis genes, we focused on those (2,325 in total) that (i) are unique or belong to families with no more than three members, (ii) are conserved between plants and prokaryotes, and (iii) have unknown or poorly known functions. Computer-assisted selection of promising targets for deeper analysis was based on homology .. independent characteristics associated in the SEED database with the prokaryotic members of each family, specifically gene clustering and phyletic spread, as well as availability of functional genomics data, and publications that could link candidate families to general metabolic areas, or to specific functions. In-depth comparative genomic analysis was then performed for about 500 top candidate families, which connected ~55 of them to general areas of metabolism and led to specific functional predictions for a subset of ~25 more. Twenty predicted functions were experimentally tested in at least one prokaryotic organism via reverse

  17. Conservation.

    ERIC Educational Resources Information Center

    National Audubon Society, New York, NY.

    This set of teaching aids consists of seven Audubon Nature Bulletins, providing the teacher and student with informational reading on various topics in conservation. The bulletins have these titles: Plants as Makers of Soil, Water Pollution Control, The Ground Water Table, Conservation--To Keep This Earth Habitable, Our Threatened Air Supply,…

  18. Elements and modulation of functional dynamics.


    Gibbs, Alan C


    The existing structure-function paradigm of drug discovery has been evolving toward the essential incorporation of dynamics data. This new functional dynamics paradigm emphasizes conformational entropy as a driving force of protein function and intermolecular recognition. Conformational dynamics (a proxy of conformational entropy) impacts the degree of protein (dis)order and the constitution of the conformational ensemble, the mechanisms of allostery and drug resistance, and the free energy of ligand binding. Specific protein and ligand conformations facilitate favorable, reciprocal interactions. The number of protein and ligand conformers that exhibit favorable binding interactions will vary from system to system. All binding scenarios can modulate protein dynamics by various levels of enthalpic and entropic contribution, with significant influence on the functional dynamics of the system. Analysis and consideration of resulting changes of activity, signaling, catalysis, and subsequent phenotypic outcome are powerful motivations in the drug design process.

  19. A mass, energy, enstrophy and vorticity conserving (MEEVC) mimetic spectral element discretization for the 2D incompressible Navier-Stokes equations

    NASA Astrophysics Data System (ADS)

    Palha, A.; Gerritsma, M.


    In this work we present a mimetic spectral element discretization for the 2D incompressible Navier-Stokes equations that in the limit of vanishing dissipation exactly preserves mass, kinetic energy, enstrophy and total vorticity on unstructured triangular grids. The essential ingredients to achieve this are: (i) a velocity-vorticity formulation in rotational form, (ii) a sequence of function spaces capable of exactly satisfying the divergence free nature of the velocity field, and (iii) a conserving time integrator. Proofs for the exact discrete conservation properties are presented together with numerical test cases on highly irregular triangular grids.

  20. 49 CFR 236.526 - Roadway element not functioning properly.

    Code of Federal Regulations, 2013 CFR


    ... Train Stop, Train Control and Cab Signal Systems Rules and Instructions; Roadway § 236.526 Roadway element not functioning properly. When a roadway element except track circuit of automatic train stop... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RULES, STANDARDS, AND INSTRUCTIONS GOVERNING THE...

  1. 49 CFR 236.526 - Roadway element not functioning properly.

    Code of Federal Regulations, 2010 CFR


    ... Train Stop, Train Control and Cab Signal Systems Rules and Instructions; Roadway § 236.526 Roadway element not functioning properly. When a roadway element except track circuit of automatic train stop... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RULES, STANDARDS, AND INSTRUCTIONS GOVERNING THE...

  2. 49 CFR 236.526 - Roadway element not functioning properly.

    Code of Federal Regulations, 2011 CFR


    ... Train Stop, Train Control and Cab Signal Systems Rules and Instructions; Roadway § 236.526 Roadway element not functioning properly. When a roadway element except track circuit of automatic train stop... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RULES, STANDARDS, AND INSTRUCTIONS GOVERNING THE...

  3. 49 CFR 236.526 - Roadway element not functioning properly.

    Code of Federal Regulations, 2012 CFR


    ... Train Stop, Train Control and Cab Signal Systems Rules and Instructions; Roadway § 236.526 Roadway element not functioning properly. When a roadway element except track circuit of automatic train stop... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RULES, STANDARDS, AND INSTRUCTIONS GOVERNING THE...

  4. 49 CFR 236.526 - Roadway element not functioning properly.

    Code of Federal Regulations, 2014 CFR


    ... Train Stop, Train Control and Cab Signal Systems Rules and Instructions; Roadway § 236.526 Roadway element not functioning properly. When a roadway element except track circuit of automatic train stop... ADMINISTRATION, DEPARTMENT OF TRANSPORTATION RULES, STANDARDS, AND INSTRUCTIONS GOVERNING THE...

  5. GPU accelerated Discrete Element Method (DEM) molecular dynamics for conservative, faceted particle simulations

    NASA Astrophysics Data System (ADS)

    Spellings, Matthew; Marson, Ryan L.; Anderson, Joshua A.; Glotzer, Sharon C.


    Faceted shapes, such as polyhedra, are commonly found in systems of nanoscale, colloidal, and granular particles. Many interesting physical phenomena, like crystal nucleation and growth, vacancy motion, and glassy dynamics are challenging to model in these systems because they require detailed dynamical information at the individual particle level. Within the granular materials community the Discrete Element Method has been used extensively to model systems of anisotropic particles under gravity, with friction. We provide an implementation of this method intended for simulation of hard, faceted nanoparticles, with a conservative Weeks-Chandler-Andersen (WCA) interparticle potential, coupled to a thermodynamic ensemble. This method is a natural extension of classical molecular dynamics and enables rigorous thermodynamic calculations for faceted particles.

  6. Functional conservation of atonal and Math1 in the CNS and PNS

    NASA Technical Reports Server (NTRS)

    Ben-Arie, N.; Hassan, B. A.; Bermingham, N. A.; Malicki, D. M.; Armstrong, D.; Matzuk, M.; Bellen, H. J.; Zoghbi, H. Y.


    To determine the extent to which atonal and its mouse homolog Math1 exhibit functional conservation, we inserted (beta)-galactosidase (lacZ) into the Math1 locus and analyzed its expression, evaluated consequences of loss of Math1 function, and expressed Math1 in atonal mutant flies. lacZ under the control of Math1 regulatory elements duplicated the previously known expression pattern of Math1 in the CNS (i.e., the neural tube, dorsal spinal cord, brainstem, and cerebellar external granule neurons) but also revealed new sites of expression: PNS mechanoreceptors (inner ear hair cells and Merkel cells) and articular chondrocytes. Expressing Math1 induced ectopic chordotonal organs (CHOs) in wild-type flies and partially rescued CHO loss in atonal mutant embryos. These data demonstrate that both the mouse and fly homologs encode lineage identity information and, more interestingly, that some of the cells dependent on this information serve similar mechanoreceptor functions.

  7. Investigating Evolutionary Conservation of Dendritic Cell Subset Identity and Functions

    PubMed Central

    Vu Manh, Thien-Phong; Bertho, Nicolas; Hosmalin, Anne; Schwartz-Cornil, Isabelle; Dalod, Marc


    Dendritic cells (DCs) were initially defined as mononuclear phagocytes with a dendritic morphology and an exquisite efficiency for naïve T-cell activation. DC encompass several subsets initially identified by their expression of specific cell surface molecules and later shown to excel in distinct functions and to develop under the instruction of different transcription factors or cytokines. Very few cell surface molecules are expressed in a specific manner on any immune cell type. Hence, to identify cell types, the sole use of a small number of cell surface markers in classical flow cytometry can be deceiving. Moreover, the markers currently used to define mononuclear phagocyte subsets vary depending on the tissue and animal species studied and even between laboratories. This has led to confusion in the definition of DC subset identity and in their attribution of specific functions. There is a strong need to identify a rigorous and consensus way to define mononuclear phagocyte subsets, with precise guidelines potentially applicable throughout tissues and species. We will discuss the advantages, drawbacks, and complementarities of different methodologies: cell surface phenotyping, ontogeny, functional characterization, and molecular profiling. We will advocate that gene expression profiling is a very rigorous, largely unbiased and accessible method to define the identity of mononuclear phagocyte subsets, which strengthens and refines surface phenotyping. It is uniquely powerful to yield new, experimentally testable, hypotheses on the ontogeny or functions of mononuclear phagocyte subsets, their molecular regulation, and their evolutionary conservation. We propose defining cell populations based on a combination of cell surface phenotyping, expression analysis of hallmark genes, and robust functional assays, in order to reach a consensus and integrate faster the huge but scattered knowledge accumulated by different laboratories on different cell types, organs, and

  8. Functional validation of a constitutive autonomous silencer element.


    Qi, Heyuan; Liu, Mingdong; Emery, David W; Stamatoyannopoulos, George


    Sequences of the genome that are capable of silencing gene expression are thought to play a key role in gene regulation. However, very few silencer elements capable of functioning in mammalian cells have been described, and only a fraction of these have been tested for the ability to function in an autonomous fashion. We report here the characterization and functional validation of a constitutive autonomous silencer element from the human genome called T39, and the comparison of T39 to three other putative silencer elements previously described by others. Functional analysis included one assay for enhancer-blocking insulator activity and two independent assays for silencer activity, all based on stable transfection and comparison to a neutral spacer control. In erythroid K562 cells, T39 exhibited potent silencer activity, the previously described element PRE2-S5 exhibited modest silencer activity, and the two other previously described elements exhibited no silencer activity. T39 was further found to be capable of silencing three disparate promoters, of silencing gene expression in three disparate cell lines, and of functioning as a single copy in a topology-independent manner. Of the four elements analyzed, only T39 exhibits a constitutive pattern of DNase hypersensitivity and binding by CTCF. In its native location the T39 element also exhibits a unique interaction profile with a subset of distal putative regulatory elements. Taken together, these studies validate T39 as a constitutive autonomous silencer, identify T39 as a defined control for future studies of other regulatory elements such as insulators, and provide a basic chromatin profile for one highly potent silencer element.

  9. Functional conservation of the Drosophila hybrid incompatibility gene Lhr

    PubMed Central


    Background Hybrid incompatibilities such as sterility and lethality are commonly modeled as being caused by interactions between two genes, each of which has diverged separately in one of the hybridizing lineages. The gene Lethal hybrid rescue (Lhr) encodes a rapidly evolving heterochromatin protein that causes lethality of hybrid males in crosses between Drosophila melanogaster females and D. simulans males. Previous genetic analyses showed that hybrid lethality is caused by D. simulans Lhr but not by D. melanogaster Lhr, confirming a critical prediction of asymmetry in the evolution of a hybrid incompatibility gene. Results Here we have examined the functional properties of Lhr orthologs from multiple Drosophila species, including interactions with other heterochromatin proteins, localization to heterochromatin, and ability to complement hybrid rescue in D. melanogaster/D. simulans hybrids. We find that these properties are conserved among most Lhr orthologs, including Lhr from D. melanogaster, D. simulans and the outgroup species D. yakuba. Conclusions We conclude that evolution of the hybrid lethality properties of Lhr between D. melanogaster and D. simulans did not involve extensive loss or gain of functions associated with protein interactions or localization to heterochromatin. PMID:21366928

  10. [Nutritional content, functional properties and conservation of edible flowers. Review].


    Lara-Cortés, Estrella; Osorio-Díaz, Perla; Jiménez-Aparicio, Antonio; Bautista-Bañios, Silvia


    The floriphagia that is the consumption of flowers as a food, is an old practice not widespread among consumers until some decades ago. Edible flowers contribute to increasing the appearance of food. They can provide biologically active substances including vitamin A, C, riboflavins, niacin, minerals such as calcium, phosphorous, iron and potassium that are eventually beneficial to consumers' health. This review includes some examples of edible flowers including roses, violets and nasturtium among others, uses and applications, sensorial characteristics and nutritional values that lead them to be considered as functional food: An important factor that affects the quality of edible flowers is the form in which they are preserved since it may affect their sensorial and nutritional characteristics. However, not all flowers can be eaten as food since there are some of them that can be toxic or even mortal. Finally, although the consumption of flowers is an ancient practice, there is little regulation in this regard. Of the review on edible flowers, it is concluded that there are still numerous aspects about them to evaluate such as nutritional and functional characteristics, conservation and regulation with the aim to extend its consumption.

  11. Use of a Drosophila Genome-Wide Conserved Sequence Database to Identify Functionally Related cis-Regulatory Enhancers

    PubMed Central

    Brody, Thomas; Yavatkar, Amarendra S; Kuzin, Alexander; Kundu, Mukta; Tyson, Leonard J; Ross, Jermaine; Lin, Tzu-Yang; Lee, Chi-Hon; Awasaki, Takeshi; Lee, Tzumin; Odenwald, Ward F


    Background: Phylogenetic footprinting has revealed that cis-regulatory enhancers consist of conserved DNA sequence clusters (CSCs). Currently, there is no systematic approach for enhancer discovery and analysis that takes full-advantage of the sequence information within enhancer CSCs. Results: We have generated a Drosophila genome-wide database of conserved DNA consisting of >100,000 CSCs derived from EvoPrints spanning over 90% of the genome. cis-Decoder database search and alignment algorithms enable the discovery of functionally related enhancers. The program first identifies conserved repeat elements within an input enhancer and then searches the database for CSCs that score highly against the input CSC. Scoring is based on shared repeats as well as uniquely shared matches, and includes measures of the balance of shared elements, a diagnostic that has proven to be useful in predicting cis-regulatory function. To demonstrate the utility of these tools, a temporally-restricted CNS neuroblast enhancer was used to identify other functionally related enhancers and analyze their structural organization. Conclusions: cis-Decoder reveals that co-regulating enhancers consist of combinations of overlapping shared sequence elements, providing insights into the mode of integration of multiple regulating transcription factors. The database and accompanying algorithms should prove useful in the discovery and analysis of enhancers involved in any developmental process. Developmental Dynamics 241:169–189, 2012. © 2011 Wiley Periodicals, Inc. Key findings A genome-wide catalog of Drosophila conserved DNA sequence clusters. cis-Decoder discovers functionally related enhancers. Functionally related enhancers share balanced sequence element copy numbers. Many enhancers function during multiple phases of development. PMID:22174086

  12. A triple helix within a pseudoknot is a conserved and essential element of telomerase RNA.


    Shefer, Kinneret; Brown, Yogev; Gorkovoy, Valentin; Nussbaum, Tamar; Ulyanov, Nikolai B; Tzfati, Yehuda


    Telomerase copies a short template within its integral telomerase RNA onto eukaryotic chromosome ends, compensating for incomplete replication and degradation. Telomerase action extends the proliferative potential of cells, and thus it is implicated in cancer and aging. Nontemplate regions of telomerase RNA are also crucial for telomerase function. However, they are highly divergent in sequence among species, and their roles are largely unclear. Using in silico three-dimensional modeling, constrained by mutational analysis, we propose a three-dimensional model for a pseudoknot in telomerase RNA of the budding yeast Kluyveromyces lactis. Interestingly, this structure includes a U-A.U major-groove triple helix. We confirmed the triple-helix formation in vitro using oligoribonucleotides and showed that it is essential for telomerase function in vivo. While triplex-disrupting mutations abolished telomerase function, triple compensatory mutations that formed pH-dependent G-C.C(+) triples restored the pseudoknot structure in a pH-dependent manner and partly restored telomerase function in vivo. In addition, we identified a novel type of triple helix that is formed by G-C.U triples, which also partly restored the pseudoknot structure and function. We propose that this unusual structure, so far found only in telomerase RNA, provides an essential and conserved telomerase-specific function.

  13. Class IIa Histone Deacetylases Are Conserved Regulators of Circadian Function*

    PubMed Central

    Fogg, Paul C. M.; O'Neill, John S.; Dobrzycki, Tomasz; Calvert, Shaun; Lord, Emma C.; McIntosh, Rebecca L. L.; Elliott, Christopher J. H.; Sweeney, Sean T.; Hastings, Michael H.; Chawla, Sangeeta


    Class IIa histone deacetylases (HDACs) regulate the activity of many transcription factors to influence liver gluconeogenesis and the development of specialized cells, including muscle, neurons, and lymphocytes. Here, we describe a conserved role for class IIa HDACs in sustaining robust circadian behavioral rhythms in Drosophila and cellular rhythms in mammalian cells. In mouse fibroblasts, overexpression of HDAC5 severely disrupts transcriptional rhythms of core clock genes. HDAC5 overexpression decreases BMAL1 acetylation on Lys-537 and pharmacological inhibition of class IIa HDACs increases BMAL1 acetylation. Furthermore, we observe cyclical nucleocytoplasmic shuttling of HDAC5 in mouse fibroblasts that is characteristically circadian. Mutation of the Drosophila homolog HDAC4 impairs locomotor activity rhythms of flies and decreases period mRNA levels. RNAi-mediated knockdown of HDAC4 in Drosophila clock cells also dampens circadian function. Given that the localization of class IIa HDACs is signal-regulated and influenced by Ca2+ and cAMP signals, our findings offer a mechanism by which extracellular stimuli that generate these signals can feed into the molecular clock machinery. PMID:25271152

  14. Evolutionary conservation of an atypical glucocorticoid-responsive element in the human tyrosine hydroxylase gene.


    Sheela Rani, C S; Soto-Pina, Alexandra; Iacovitti, Lorraine; Strong, Randy


    The human tyrosine hydroxylase (hTH) gene has a 42 bp evolutionarily conserved region designated (CR) II at -7.24 kb, which bears 93% homology to the region we earlier identified as containing the glucocorticoid response element, a 7 bp activator protein-1 (AP-1)-like motif in the rat TH gene. We cloned this hTH-CRII region upstream of minimal basal hTH promoter in luciferase (Luc) reporter vector, and tested glucocorticoid responsiveness in human cell lines. Dexamethasone (Dex) stimulated Luc activity of hTH-CRII in HeLa cells, while mifepristone, a glucocorticoid receptor (GR) antagonist, prevented Dex stimulation. Deletion of the 7 bp 5'-TGACTAA at -7243 bp completely abolished the Dex-stimulated Luc activity of hTH-CRII construct. The AP-1 agonist, tetradeconoyl-12,13-phorbol acetate (TPA), also stimulated hTH promoter activity, and Dex and TPA together further accentuated this response. Chromatin immunoprecipitation assays revealed the presence of both GR and AP-1 proteins, especially Jun family members, at this hTH promoter site. Dex did not stimulate hTH promoter activity in a catecholaminergic cell line, which had low endogenous GR levels, but did activate the response when GR was expressed exogenously. Thus, our studies have clearly identified a glucocorticoid-responsive element in a 7 bp AP-1-like motif in the promoter region at -7.24 kb of the human TH gene.

  15. SHOX gene and conserved noncoding element deletions/duplications in Colombian patients with idiopathic short stature

    PubMed Central

    Sandoval, Gloria Tatiana Vinasco; Jaimes, Giovanna Carola; Barrios, Mauricio Coll; Cespedes, Camila; Velasco, Harvy Mauricio


    SHOX gene mutations or haploinsufficiency cause a wide range of phenotypes such as Leri Weill dyschondrosteosis (LWD), Turner syndrome, and disproportionate short stature (DSS). However, this gene has also been found to be mutated in cases of idiopathic short stature (ISS) with a 3–15% frequency. In this study, the multiplex ligation-dependent probe amplification (MLPA) technique was employed to determine the frequency of SHOX gene mutations and their conserved noncoding elements (CNE) in Colombian patients with ISS. Patients were referred from different centers around the county. From a sample of 62 patients, 8.1% deletions and insertions in the intragenic regions and in the CNE were found. This result is similar to others published in other countries. Moreover, an isolated case of CNE 9 duplication and a new intron 6b deletion in another patient, associated with ISS, are described. This is one of the first studies of a Latin American population in which deletions/duplications of the SHOX gene and its CNE are examined in patients with ISS. PMID:24689071

  16. Algebraic evaluation of matrix elements in the Laguerre function basis

    NASA Astrophysics Data System (ADS)

    McCoy, A. E.; Caprio, M. A.


    The Laguerre functions constitute one of the fundamental basis sets for calculations in atomic and molecular electron-structure theory, with applications in hadronic and nuclear theory as well. While similar in form to the Coulomb bound-state eigenfunctions (from the Schrödinger eigenproblem) or the Coulomb-Sturmian functions (from a related Sturm-Liouville problem), the Laguerre functions, unlike these former functions, constitute a complete, discrete, orthonormal set for square-integrable functions in three dimensions. We construct the SU(1, 1) × SO(3) dynamical algebra for the Laguerre functions and apply the ideas of factorization (or supersymmetric quantum mechanics) to derive shift operators for these functions. We use the resulting algebraic framework to derive analytic expressions for matrix elements of several basic radial operators (involving powers of the radial coordinate and radial derivative) in the Laguerre function basis. We illustrate how matrix elements for more general spherical tensor operators in three dimensional space, such as the gradient, may then be constructed from these radial matrix elements.

  17. Telomerase RNA stem terminus element affects template boundary element function, telomere sequence, and shelterin binding.


    Webb, Christopher J; Zakian, Virginia A


    The stem terminus element (STE), which was discovered 13 y ago in human telomerase RNA, is required for telomerase activity, yet its mode of action is unknown. We report that the Schizosaccharomyces pombe telomerase RNA, TER1 (telomerase RNA 1), also contains a STE, which is essential for telomere maintenance. Cells expressing a partial loss-of-function TER1 STE allele maintained short stable telomeres by a recombination-independent mechanism. Remarkably, the mutant telomere sequence was different from that of wild-type cells. Generation of the altered sequence is explained by reverse transcription into the template boundary element, demonstrating that the STE helps maintain template boundary element function. The altered telomeres bound less Pot1 (protection of telomeres 1) and Taz1 (telomere-associated in Schizosaccharomyces pombe 1) in vivo. Thus, the S. pombe STE, although distant from the template, ensures proper telomere sequence, which in turn promotes proper assembly of the shelterin complex.

  18. FARME DB: a functional antibiotic resistance element database

    PubMed Central

    Wallace, James C.; Port, Jesse A.; Smith, Marissa N.; Faustman, Elaine M.


    Antibiotic resistance (AR) is a major global public health threat but few resources exist that catalog AR genes outside of a clinical context. Current AR sequence databases are assembled almost exclusively from genomic sequences derived from clinical bacterial isolates and thus do not include many microbial sequences derived from environmental samples that confer resistance in functional metagenomic studies. These environmental metagenomic sequences often show little or no similarity to AR sequences from clinical isolates using standard classification criteria. In addition, existing AR databases provide no information about flanking sequences containing regulatory or mobile genetic elements. To help address this issue, we created an annotated database of DNA and protein sequences derived exclusively from environmental metagenomic sequences showing AR in laboratory experiments. Our Functional Antibiotic Resistant Metagenomic Element (FARME) database is a compilation of publically available DNA sequences and predicted protein sequences conferring AR as well as regulatory elements, mobile genetic elements and predicted proteins flanking antibiotic resistant genes. FARME is the first database to focus on functional metagenomic AR gene elements and provides a resource to better understand AR in the 99% of bacteria which cannot be cultured and the relationship between environmental AR sequences and antibiotic resistant genes derived from cultured isolates. Database URL: PMID:28077567

  19. Functional Nanofibers and Colloidal Gels: Key Elements to Enhance Functionality

    NASA Astrophysics Data System (ADS)

    Vogel, Nancy Amanda

    Nanomaterials bridge the gap between bulk materials and molecular structures and are known for their unique material properties and highly functional nature which make them attractive for a variety of potential applications, from energy storage and pollution sensors to agricultural and biomedical products. These potential applications, coupled with advances in nanotechnology, have generated considerable interest in nanostructure research. The work presented in this dissertation focuses on two such nanostructures, electrospun nanofibers and nanodiamond particles, with an overarching goal of tailoring the material behavior for a desired outcome. Our first research theme focuses on realizing the full potential of chitosan electrospinning by understanding the mechanism that enables fiber formation through cyclodextrin complexation as a function of solution properties, solvent types, and cyclodextrin content. We demonstrate that cyclodextrin addition not only enables chitosan fiber formation, but also extends the composition and solvent window for nanofiber synthesis while introducing a variety of mat topologies, including three-dimensional, self-supporting mats. These fiber formation improvements cannot be fully explained by conventional electrospinning parameters, but instead seem to be related to the molecular interactions between chitosan and cyclodextrin. Our second research theme entails the modification of highly water soluble, poly(vinyl alcohol) (PVA) nanofibers dissolution properties via atomic layer deposition (ALD) post treatments. In this work, we demonstrate that applying different thicknesses of aluminum oxide nano-coatings can improve the stability of PVA nanofibers in high humidity conditions and significantly decrease the solubility of electrospun PVA mats in water, from seconds to multiple weeks. Controlling mat dissolution allows for the unique opportunity to modulate small molecule, such as drug, release from nanofibers without altering the core

  20. Conserved and Diverged Functions of the Calcineurin-Activated Prz1 Transcription Factor in Fission Yeast.


    Chatfield-Reed, Kate; Vachon, Lianne; Kwon, Eun-Joo Gina; Chua, Gordon


    Gene regulation in response to intracellular calcium is mediated by the calcineurin-activated transcription factor Prz1 in the fission yeast Schizosaccharomyces pombe Genome-wide studies of the Crz1 and CrzA fungal orthologs have uncovered numerous target genes involved in conserved and species-specific cellular processes. In contrast, very few target genes of Prz1 have been published. This article identifies an extensive list of genes using transcriptome and ChIP-chip analyses under inducing conditions of Prz1, including CaCl2 and tunicamycin treatment, as well as a ∆pmr1 genetic background. We identified 165 upregulated putative target genes of Prz1 in which the majority contained a calcium-dependent response element in their promoters, similar to that of the Saccharomyces cerevisiae ortholog Crz1 These genes were functionally enriched for Crz1-conserved processes such as cell-wall biosynthesis. Overexpression of prz1(+)increased resistance to the cell-wall degradation enzyme zymolyase, likely from upregulation of theO-mannosyltransferase encoding gene omh1(+) Loss of omh1(+)abrogates this phenotype. We uncovered a novel inhibitory role in flocculation for Prz1. Loss of prz1(+)resulted in constitutive flocculation and upregulation of genes encoding the flocculins Gsf2 and Pfl3, as well as the transcription factor Cbf12. The constitutive flocculation of the ∆prz1 strain was abrogated by the loss of gsf2(+) or cbf12(+) This study reveals that Prz1 functions as a positive and negative transcriptional regulator of genes involved in cell-wall biosynthesis and flocculation, respectively. Moreover, comparison of target genes between Crz1/CrzA and Prz1 indicate some conservation in DNA-binding specificity, but also substantial rewiring of the calcineurin-mediated transcriptional regulatory network.

  1. Conserved and Diverged Functions of the Calcineurin-Activated Prz1 Transcription Factor in Fission Yeast

    PubMed Central

    Chatfield-Reed, Kate; Vachon, Lianne; Kwon, Eun-Joo Gina; Chua, Gordon


    Gene regulation in response to intracellular calcium is mediated by the calcineurin-activated transcription factor Prz1 in the fission yeast Schizosaccharomyces pombe. Genome-wide studies of the Crz1 and CrzA fungal orthologs have uncovered numerous target genes involved in conserved and species-specific cellular processes. In contrast, very few target genes of Prz1 have been published. This article identifies an extensive list of genes using transcriptome and ChIP-chip analyses under inducing conditions of Prz1, including CaCl2 and tunicamycin treatment, as well as a ∆pmr1 genetic background. We identified 165 upregulated putative target genes of Prz1 in which the majority contained a calcium-dependent response element in their promoters, similar to that of the Saccharomyces cerevisiae ortholog Crz1. These genes were functionally enriched for Crz1-conserved processes such as cell-wall biosynthesis. Overexpression of prz1+ increased resistance to the cell-wall degradation enzyme zymolyase, likely from upregulation of the O-mannosyltransferase encoding gene omh1+. Loss of omh1+ abrogates this phenotype. We uncovered a novel inhibitory role in flocculation for Prz1. Loss of prz1+ resulted in constitutive flocculation and upregulation of genes encoding the flocculins Gsf2 and Pfl3, as well as the transcription factor Cbf12. The constitutive flocculation of the ∆prz1 strain was abrogated by the loss of gsf2+ or cbf12+. This study reveals that Prz1 functions as a positive and negative transcriptional regulator of genes involved in cell-wall biosynthesis and flocculation, respectively. Moreover, comparison of target genes between Crz1/CrzA and Prz1 indicate some conservation in DNA-binding specificity, but also substantial rewiring of the calcineurin-mediated transcriptional regulatory network. PMID:26896331

  2. Conserved Functional Motifs and Homology Modeling to Predict Hidden Moonlighting Functional Sites

    PubMed Central

    Wong, Aloysius; Gehring, Chris; Irving, Helen R.


    Moonlighting functional centers within proteins can provide them with hitherto unrecognized functions. Here, we review how hidden moonlighting functional centers, which we define as binding sites that have catalytic activity or regulate protein function in a novel manner, can be identified using targeted bioinformatic searches. Functional motifs used in such searches include amino acid residues that are conserved across species and many of which have been assigned functional roles based on experimental evidence. Molecules that were identified in this manner seeking cyclic mononucleotide cyclases in plants are used as examples. The strength of this computational approach is enhanced when good homology models can be developed to test the functionality of the predicted centers in silico, which, in turn, increases confidence in the ability of the identified candidates to perform the predicted functions. Computational characterization of moonlighting functional centers is not diagnostic for catalysis but serves as a rapid screening method, and highlights testable targets from a potentially large pool of candidates for subsequent in vitro and in vivo experiments required to confirm the functionality of the predicted moonlighting centers. PMID:26106597

  3. Element orbitals for Kohn-Sham density functional theory

    SciTech Connect

    Lin, Lin; Ying, Lexing


    We present a method to discretize the Kohn-Sham Hamiltonian matrix in the pseudopotential framework by a small set of basis functions automatically contracted from a uniform basis set such as planewaves. Each basis function is localized around an element, which is a small part of the global domain containing multiple atoms. We demonstrate that the resulting basis set achieves meV accuracy for 3D densely packed systems with a small number of basis functions per atom. The procedure is applicable to insulating and metallic systems.

  4. Analysis of evolutionary conservation patterns and their influence on identifying protein functional sites.


    Fang, Chun; Noguchi, Tamotsu; Yamana, Hayato


    Evolutionary conservation information included in position-specific scoring matrix (PSSM) has been widely adopted by sequence-based methods for identifying protein functional sites, because all functional sites, whether in ordered or disordered proteins, are found to be conserved at some extent. However, different functional sites have different conservation patterns, some of them are linear contextual, some of them are mingled with highly variable residues, and some others seem to be conserved independently. Every value in PSSMs is calculated independently of each other, without carrying the contextual information of residues in the sequence. Therefore, adopting the direct output of PSSM for prediction fails to consider the relationship between conservation patterns of residues and the distribution of conservation scores in PSSMs. In order to demonstrate the importance of combining PSSMs with the specific conservation patterns of functional sites for prediction, three different PSSM-based methods for identifying three kinds of functional sites have been analyzed. Results suggest that, different PSSM-based methods differ in their capability to identify different patterns of functional sites, and better combining PSSMs with the specific conservation patterns of residues would largely facilitate the prediction.

  5. Understanding the function of conserved variations in the catalytic loops of fungal glycoside hydrolase family 12.


    Damásio, André R L; Rubio, Marcelo V; Oliveira, Leandro C; Segato, Fernando; Dias, Bruno A; Citadini, Ana P; Paixão, Douglas A; Squina, Fabio M


    Enzymes that cleave the xyloglucan backbone at unbranched glucose residues have been identified in GH families 5, 7, 12, 16, 44, and 74. Fungi produce enzymes that populate 20 of 22 families that are considered critical for plant biomass deconstruction. We searched for GH12-encoding genes in 27 Eurotiomycetes genomes. After analyzing 50 GH12-related sequences, the conserved variations of the amino acid sequences were examined. Compared to the endoglucanases, the endo-xyloglucanase-associated YSG deletion at the negative subsites of the catalytic cleft with a SST insertion at the reducing end of the substrate-binding crevice is highly conserved. In addition, a highly conserved alanine residue was identified in all xyloglucan-specific enzymes, and this residue is substituted by arginine in more promiscuous glucanases. To understand the basis for the xyloglucan specificity displayed by certain GH12 enzymes, two fungal GH12 endoglucanases were chosen for mutagenesis and functional studies: an endo-xyloglucanase from Aspergillus clavatus (AclaXegA) and an endoglucanase from A. terreus (AtEglD). Comprehensive molecular docking studies and biochemical analyses were performed, revealing that mutations at the entrance of the catalytic cleft in AtEglD result in a wider binding cleft and the alteration of the substrate-cleavage pattern, implying that a trio of residues coordinates the interactions and binding to linear glycans. The loop insertion at the crevice-reducing end of AclaXegA is critical for catalytic efficiency to hydrolyze xyloglucan. The understanding of the structural elements governing endo-xyloglucanase activity on linear and branched glucans will facilitate future enzyme modifications with potential applications in industrial biotechnology.

  6. Evolution of the functionally conserved DCC gene in birds.


    Patthey, Cedric; Tong, Yong Guang; Tait, Christine Mary; Wilson, Sara Ivy


    Understanding the loss of conserved genes is critical for determining how phenotypic diversity is generated. Here we focus on the evolution of DCC, a gene that encodes a highly conserved neural guidance receptor. Disruption of DCC in animal models and humans results in major neurodevelopmental defects including commissural axon defects. Here we examine DCC evolution in birds, which is of particular interest as a major model system in neurodevelopmental research. We found the DCC containing locus was disrupted several times during evolution, resulting in both gene losses and faster evolution rate of salvaged genes. These data suggest that DCC had been lost independently twice during bird evolution, including in chicken and zebra finch, whereas it was preserved in many other closely related bird species, including ducks. Strikingly, we observed that commissural axon trajectory appeared similar regardless of whether DCC could be detected or not. We conclude that the DCC locus is susceptible to genomic instability leading to independent disruptions in different branches of birds and a significant influence on evolution rate. Overall, the phenomenon of loss or molecular evolution of a highly conserved gene without apparent phenotype change is of conceptual importance for understanding molecular evolution of key biological processes.

  7. Evolution of the functionally conserved DCC gene in birds

    PubMed Central

    Patthey, Cedric; Tong, Yong Guang; Tait, Christine Mary; Wilson, Sara Ivy


    Understanding the loss of conserved genes is critical for determining how phenotypic diversity is generated. Here we focus on the evolution of DCC, a gene that encodes a highly conserved neural guidance receptor. Disruption of DCC in animal models and humans results in major neurodevelopmental defects including commissural axon defects. Here we examine DCC evolution in birds, which is of particular interest as a major model system in neurodevelopmental research. We found the DCC containing locus was disrupted several times during evolution, resulting in both gene losses and faster evolution rate of salvaged genes. These data suggest that DCC had been lost independently twice during bird evolution, including in chicken and zebra finch, whereas it was preserved in many other closely related bird species, including ducks. Strikingly, we observed that commissural axon trajectory appeared similar regardless of whether DCC could be detected or not. We conclude that the DCC locus is susceptible to genomic instability leading to independent disruptions in different branches of birds and a significant influence on evolution rate. Overall, the phenomenon of loss or molecular evolution of a highly conserved gene without apparent phenotype change is of conceptual importance for understanding molecular evolution of key biological processes. PMID:28240293

  8. An unexpected, conserved element of the U3 snoRNA is required for Mpp10p association.

    PubMed Central

    Wormsley, S; Samarsky, D A; Fournier, M J; Baserga, S J


    The U3 small nucleolar ribonucleoprotein (snoRNP) is composed of a small nucleolar RNA (snoRNA) and at least 10 proteins. The U3 snoRNA base pairs with the pre-rRNA to carry out the A0, A1, and A2 processing reactions that lead to the release of the 18S rRNA from the nascent pre-rRNA transcript. The yeast U3 snoRNA can be divided into a short 5' domain (nt 1-39) and a larger 3' domain (73 to the 3' end) separated by a stretch of nucleotides called the hinge region (nt 40-72). The sequences required for pre-rRNA base pairing are found in the 5' domain and hinge region whereas the 3' domain is largely covered with proteins. Mpp10p, one of the protein components unique to the U3 snoRNP, plays a role in processing at the A1 and A2 sites. Because of its critical role in U3 snoRNP function, we determined which sequences in the U3 snoRNA are required for Mpp10p association. Unlike fibrillarin and all the previous U3 snoRNP components studied in this manner, sequences in the 3' domain are not sufficient for Mpp10p association. Instead, a conserved sequence element in the U3 snoRNA hinge region is required, placing Mpp10p near the 5' domain that carries out the pre-rRNA base-pairing interactions in the functional center of the U3 snoRNP. PMID:11421365

  9. Supplemental basis functions for the second transition row elements

    NASA Technical Reports Server (NTRS)

    Walch, S. P.; Nelin, C. J.; Bauschlicher, C. W., Jr.


    It is noted that for molecular calculations, the basis sets presented by Huzinaga (1977) need to be augmented by (1) 5p functions to describe the 5s - 5p near degeneracy; (2) a diffuse 4d function to provide for a balanced description of the 5s2 4dn, 5s1 4d(n+1), and 4d(n+2) states of the atom; and (3) a set of 4f functions to correlate the 4d functions. Here, the diffuse 4d function is similar in function to the diffuse 3d function for the first transition row elements recommended by Hay (1977). A table is included giving the optimized values for the diffuse 4d, the 5p, and 4f (STO exponent) functions. The diffuse 4d function and the 5p functions are optimized at the SCF level on the basis of the 5s1 4d(n+1) state (except for Pd, which is optimized for the 4d10 state) and the 5s1 5p1 4dn state, respectively. The table also gives the energies and the atomic symmetries for each of the SCF calculations.

  10. Sequence conservation in avian CR1: an interspersed repetitive DNA family evolving under functional constraints.

    PubMed Central

    Chen, Z Q; Ritzel, R G; Lin, C C; Hodgetts, R B


    CR1 is a short interspersed repetitive DNA element originally identified in the domestic chicken (Gallus gallus). However, unlike virtually all other such sequences described to date, CR1 is not confined to one or a few closely related species. It is probably a ubiquitous component of the avian genome, having been detected in representatives of nine orders encompassing a wide spectrum of the class Aves. This identification was made possible by using the polymerase chain reaction (PCR), which revealed interspecific similarities not detected by conventional Southern analysis. DNA sequence comparisons between a CR1 element isolated from a sarus crane (Grus antigone) and those isolated from an emu (Dromaius novaehollandiae) showed that two short highly conserved regions are present. These are included within two regions previously characterized in the CR1 units of domestic fowl. One of these behaves as a transcriptional silencer and the other is a binding site for a nuclear protein. Our observations suggest that CR1 has evolved under functional constraints and that interspersed repetitive sequences as a class may constitute a more significant component of the eukaryotic genome than is generally acknowledged. Images PMID:1829530

  11. High conservation of a 5' element required for RNA editing of a C target in chloroplast psbE transcripts.


    Hayes, Michael L; Hanson, Maureen R


    C-to-U editing modifies 30-40 distinct nucleotides within higher-plant chloroplast transcripts. Many C targets are located at the same position in homologous genes from different plants; these either could have emerged independently or could share a common origin. The 5' sequence GCCGUU, required for editing of C214 in tobacco psbE in vitro, is one of the few identified editing cis-elements. We investigated psbE sequences from many plant species to determine in what lineage(s) editing of psbE C214 emerged and whether the cis-element identified in tobacco is conserved in plants with a C214. The GCCGUU sequence is present at a high frequency in plants that carry a C214 in psbE. However, Sciadopitys verticillata (Pinophyta) edits C214 despite the presence of nucleotide differences compared to the conserved cis-element. The C214 site in psbE genes is represented in members of four branches of spermatophytes but not in gnetophytes, resulting in the parsimonious prediction that editing of psbE C214 was present in the ancestor of spermatophytes. Extracts from chloroplasts from a species that has a difference in the motif and lacks the C target are incapable of editing tobacco psbE C214 substrates, implying that the critical trans-acting protein factors were not retained without a C target. Because noncoding sequences are less constrained than coding regions, we analyzed sequences 5' to two C editing targets located within coding regions to search for possible editing-related conserved elements. Putative editing cis-elements were uncovered in the 5' UTRs near editing sites psbL C2 and ndhD C2.

  12. Conserving biodiversity and ecosystem function through limited development: an empirical evaluation.


    Milder, Jeffrey C; Lassoie, James P; Bedford, Barbara L


    Suburban, exurban, and rural development in the United States consumes nearly 1 million hectares of land per year and is a leading threat to biodiversity. In response to this threat, conservation development has been advanced as a way to combine land development and land conservation while providing functional protection for natural resources. Yet, although conservation development techniques have been in use for decades, there have been few critical evaluations of their conservation effectiveness. We addressed this deficiency by assessing the conservation outcomes of one type of conservation development project: conservation and limited development projects (CLDPs). Conducted by land trusts, landowners, and developers, CLDPs use revenue from limited development to finance the protection of land and natural resources. We compared a sample of 10 CLDPs from the eastern United States with their respective baseline scenarios (conventional development) and with a sample of conservation subdivisions--a different conservation development technique characterized by higher-density development. To measure conservation success, we created an evaluation method containing eight indicators that quantify project impacts to terrestrial and aquatic ecosystems at the site and in the surrounding landscape. The CLDPs protected and managed threatened natural resources including rare species and ecological communities. In terms of conservation benefits, the CLDPs significantly outperformed their respective baseline scenarios and the conservation subdivisions. These results imply that CLDPs can offer a low-impact alternative to conventional development and a low-cost method for protecting land when conventional conservation techniques are too expensive. In addition, our evaluation method demonstrates how planners and developers can incorporate appropriate ecological considerations when designing, reviewing, and evaluating conservation development projects.

  13. The Conserved Modular Elements of the Acyl Carrier Proteins of Lipid Synthesis Are Only Partially Interchangeable*

    PubMed Central

    Zhu, Lei; Cronan, John E.


    Prior work showed that expression of acyl carrier proteins (ACPs) of a diverse set of bacteria replaced the function of Escherichia coli ACP in lipid biosynthesis. However, the AcpAs of Lactococcus lactis and Enterococcus faecalis were inactive. Both failed to support growth of an E. coli acpP mutant strain. This defect seemed likely because of the helix II sequences of the two AcpAs, which differed markedly from those of the proteins that supported growth. To test this premise, chimeric ACPs were constructed in which L. lactis helix II replaced helix II of E. coli AcpP and vice versa. Expression of the AcpP protein L. lactis AcpA helix II allowed weak growth, whereas the L. lactis AcpA-derived protein that contained E. coli AcpP helix II failed to support growth of the E. coli mutant strain. Replacement of the L. lactis AcpA helix II residues in this protein showed that substitution of valine for the phenylalanine residue four residues downstream of the phosphopanthetheine-modified serine gave robust growth and allowed modification by the endogenous AcpS phosphopantetheinyl transferase (rather than the promiscuous Sfp transferase required to modify the L. lactis AcpA and the chimera of L. lactis AcpA helix II in AcpP). Further chimera constructs showed that the lack of function of the L. lactis AcpA-derived protein containing E. coli AcpP helix II was due to incompatibility of L. lactis AcpA helix I with the downstream elements of AcpP. Therefore, the origins of ACP incompatibility can reside in either helix I or in helix II. PMID:25861991

  14. The method of space-time and conservation element and solution element: A new approach for solving the Navier-Stokes and Euler equations

    NASA Technical Reports Server (NTRS)

    Chang, Sin-Chung


    A new numerical framework for solving conservation laws is being developed. This new framework differs substantially in both concept and methodology from the well-established methods, i.e., finite difference, finite volume, finite element, and spectral methods. It is conceptually simple and designed to overcome several key limitations of the above traditional methods. A two-level scheme for solving the convection-diffusion equation is constructed and used to illuminate the major differences between the present method and those previously mentioned. This explicit scheme, referred to as the a-mu scheme, has two independent marching variables.

  15. Combining Comparison Functions and Finite Element Approximations in CFD

    NASA Technical Reports Server (NTRS)

    Baumeister, Kenneth J.; Baumeister, Joseph F.


    In a variety of potential flow applications, the modal element method has been shown to significantly reduce the numerical grid, employ a more precise grid termination boundary condition, and give theoretical insight to the flow physics. The method employs eigenfunctions to replace the numerical grid over significant portions of the flow field. Generally, a numerical grid is employed around obstacles with complex geometry while eigenfunctions are applied to regions in the flow field where the boundary conditions can easily be satisfied. To handle a wider class of computational fluid dynamics (CFD) problems, the present paper extends the modal element to include function approximations which do not satisfy the governing differential equation. To accomplish this task, a double modal series approximation and weighted residual constraints are developed to force the comparison functions to satisfy the governing differential equation and to interface properly with the finite element solution. As an example, the method is applied to the problem of potential flow in a channel with two-dimensional cylindrical like obstacles. The calculated flow fields are in excellent agreement with exact analytical solutions.

  16. The Runt domain of AML1 (RUNX1) binds a sequence-conserved RNA motif that mimics a DNA element

    PubMed Central

    Fukunaga, Junichi; Nomura, Yusuke; Tanaka, Yoichiro; Amano, Ryo; Tanaka, Taku; Nakamura, Yoshikazu; Kawai, Gota; Sakamoto, Taiichi; Kozu, Tomoko


    AML1 (RUNX1) is a key transcription factor for hematopoiesis that binds to the Runt-binding double-stranded DNA element (RDE) of target genes through its N-terminal Runt domain. Aberrations in the AML1 gene are frequently found in human leukemia. To better understand AML1 and its potential utility for diagnosis and therapy, we obtained RNA aptamers that bind specifically to the AML1 Runt domain. Enzymatic probing and NMR analyses revealed that Apt1-S, which is a truncated variant of one of the aptamers, has a CACG tetraloop and two stem regions separated by an internal loop. All the isolated aptamers were found to contain the conserved sequence motif 5′-NNCCAC-3′ and 5′-GCGMGN′N′-3′ (M:A or C; N and N′ form Watson–Crick base pairs). The motif contains one AC mismatch and one base bulged out. Mutational analysis of Apt1-S showed that three guanines of the motif are important for Runt binding as are the three guanines of RDE, which are directly recognized by three arginine residues of the Runt domain. Mutational analyses of the Runt domain revealed that the amino acid residues used for Apt1-S binding were similar to those used for RDE binding. Furthermore, the aptamer competed with RDE for binding to the Runt domain in vitro. These results demonstrated that the Runt domain of the AML1 protein binds to the motif of the aptamer that mimics DNA. Our findings should provide new insights into RNA function and utility in both basic and applied sciences. PMID:23709277

  17. Sex Differences in the Association of Cerebral Hemispheric Specialization of Spatial Function with Conservation Task Performance.

    ERIC Educational Resources Information Center

    Affleck, Glenn; Joyce, Patricia


    The association of locus of cerebral hemispheric specialization of spatial function with identity and equivalence conservation judgments was tested in a group of four- to six-year-old right-handed children (N=31). (Author/MP)

  18. Conserved functions of the trigger loop and Gre factors in RNA cleavage by bacterial RNA polymerases.


    Miropolskaya, Nataliya; Esyunina, Daria; Kulbachinskiy, Andrey


    RNA cleavage by RNA polymerase (RNAP) is the central step in co-transcriptional RNA proofreading. Bacterial RNAPs were proposed to rely on the same mobile element of the active site, the trigger loop (TL), for both nucleotide addition and RNA cleavage. RNA cleavage can also be stimulated by universal Gre factors, which should replace the TL to get access to the RNAP active site. The contributions of the TL and Gre factors to RNA cleavage reportedly vary between RNAPs from different bacterial species and, probably, different types of transcription complexes. Here, by comparing RNAPs from Escherichia coli (Eco), Deinococcus radiodurans (Dra) and Thermus aquaticus (Taq) we show that the functions of the TL and Gre factors in RNA cleavage are conserved in various species, with important variations which may be related to extremophilic adaptation. Deletions of the TL strongly impair intrinsic RNA cleavage by all three RNAPs and eliminate the inter-species differences in the reaction rates. GreA factors activate RNA cleavage by wild-type RNAPs to similar levels. The rates of GreA-dependent cleavage are lower for ΔTL RNAP variants, suggesting that the TL contributes to the Gre function. Finally, neither the TL nor GreA can efficiently activate RNA cleavage in certain types of backtracked transcription complexes suggesting that these complexes adopt a catalytically inactive conformation probably important for transcription regulation.

  19. Conserved functions and extended Grad-Shafranov equation for low vorticity viscous plasmas with nonlinear flows

    SciTech Connect

    Martin, P.; Castro, E.; Haines, M.G.


    Tokamak equilibrium has been analyzed with the magnetohydrodynamics nonlinear momentum equation in the low vorticity case. A large simplification in the analysis is obtained in this case compared with previous general treatments for rotating plasmas in tokamaks. Now pressure is not conserved around magnetic surfaces, however, other generalized functions have been found, which are conserved on each magnetic surface. A generalized Grad-Shafranov-type equation has been also derived for this case. How to determine the gradient of these new conserved functions on each magnetic surface from their value at one point of the corresponding surface is also shown.

  20. Negative transcriptional regulatory element that functions in embryonal carcinoma cells.

    PubMed Central

    Ariizumi, K; Takahashi, H; Nakamura, M; Ariga, H


    We have cloned the polyomavirus mutant fPyF9, which persists in an episomal state in F9 embryonal carcinoma cells (K. Ariizumi and H. Ariga, Mol. Cell. Biol. 6:3920-3927, 1986). fPyF9 carries three copies of exogenous sequences, the prototype of which is a 21-base-pair repeat (box DNA), in the region of the enhancer B domain of wild-type polyomavirus DNA. The consensus sequence, GCATTCCATTGTT, is 13 base pairs long. The box DNA inserted into fPyF9 appeared to come from a cellular sequence and was present in many kinds of DNAs, including F9 chromosomal DNA. The biological function of box DNA was analyzed by chloramphenicol acetyltransferase expression assays, using chimeric plasmids containing box DNA conjugated with simian virus 40 promoter elements. The results showed that box DNA repressed the activities both of the simian virus 40 promoter and enhancer only in transfected undifferentiated F9 cells and not in differentiated LTK- cells. Box DNA functioned independently of orientation and position with respect to the promoter in an enhancerlike manner, although the effect of box DNA was opposite that of the enhancer. The XhoI linker insertion into the consensus sequences of box DNA abolished the repression activity, and the protein(s) recognizing the consensus sequences was identified only in F9 cells, not in L cells. These analyses suggest that box DNA may be a negative regulatory element that functions in undifferentiated cells. Images PMID:2550812

  1. A Space-Time Conservation Element and Solution Element Method for Solving the Two- and Three-Dimensional Unsteady Euler Equations Using Quadrilateral and Hexahedral Meshes

    NASA Technical Reports Server (NTRS)

    Zhang, Zeng-Chan; Yu, S. T. John; Chang, Sin-Chung; Jorgenson, Philip (Technical Monitor)


    In this paper, we report a version of the Space-Time Conservation Element and Solution Element (CE/SE) Method in which the 2D and 3D unsteady Euler equations are simulated using structured or unstructured quadrilateral and hexahedral meshes, respectively. In the present method, mesh values of flow variables and their spatial derivatives are treated as independent unknowns to be solved for. At each mesh point, the value of a flow variable is obtained by imposing a flux conservation condition. On the other hand, the spatial derivatives are evaluated using a finite-difference/weighted-average procedure. Note that the present extension retains many key advantages of the original CE/SE method which uses triangular and tetrahedral meshes, respectively, for its 2D and 3D applications. These advantages include efficient parallel computing ease of implementing non-reflecting boundary conditions, high-fidelity resolution of shocks and waves, and a genuinely multidimensional formulation without using a dimensional-splitting approach. In particular, because Riemann solvers, the cornerstones of the Godunov-type upwind schemes, are not needed to capture shocks, the computational logic of the present method is considerably simpler. To demonstrate the capability of the present method, numerical results are presented for several benchmark problems including oblique shock reflection, supersonic flow over a wedge, and a 3D detonation flow.

  2. Elements of a function analytic approach to probability.

    SciTech Connect

    Ghanem, Roger Georges; Red-Horse, John Robert


    We first provide a detailed motivation for using probability theory as a mathematical context in which to analyze engineering and scientific systems that possess uncertainties. We then present introductory notes on the function analytic approach to probabilistic analysis, emphasizing the connections to various classical deterministic mathematical analysis elements. Lastly, we describe how to use the approach as a means to augment deterministic analysis methods in a particular Hilbert space context, and thus enable a rigorous framework for commingling deterministic and probabilistic analysis tools in an application setting.

  3. Trace element geochemistry of soils and plants in Kenyan conservation areas and implications for wildlife nutrition.


    Maskall, J; Thornton, I


    Trace element concentrations in soils, plants and animals in National Parks and Wildlife Reserves in Kenya are assessed using geochemical mapping techniques. Soil trace element concentrations are shown to be related to soil parent material and possibly to pedological and hydrological factors. At Lake Nakuru National Park, plant trace element concentrations vary with plant species and the geochemical conditions that influence uptake are discussed. Impala at Lake Nakuru National Park and black rhino at Solio Wildlife Reserve are shown to have a lower blood copper status than animals from other areas. The trace element status of wildlife is assessed also with respect to critical concentrations used for domestic ruminants. It is suggested that at Lake Nakuru National Park, the low soil copper content and high molybdenum content of some plants contributes to the low copper status of impala and may also influence the nutrition of other species.

  4. Identity elements for the aminoacylation of metazoan mitochondrial tRNAArg have been widely conserved throughout evolution and ensure the fidelity of the AGR codon reassignment

    PubMed Central

    Igloi, Gabor L; Leisinger, Anne-Katrin


    Eumetazoan mitochondrial tRNAs possess structures (identity elements) that require the specific recognition by their cognate nuclear-encoded aminoacyl-tRNA synthetases. The AGA (arginine) codon of the standard genetic code has been reassigned to serine/glycine/termination in eumetazoan organelles and is translated in some organisms by a mitochondrially encoded tRNASerUCU. One mechanism to prevent mistranslation of the AGA codon as arginine would require a set of tRNA identity elements distinct from those possessed by the cytoplasmic tRNAArg in which the major identity elements permit the arginylation of all 5 encoded isoacceptors. We have performed comparative in vitro aminoacylation using an insect mitochondrial arginyl-tRNA synthetase and tRNAArgUCG structural variants. The established identity elements are sufficient to maintain the fidelity of tRNASerUCU reassignment. tRNAs having a UCU anticodon cannot be arginylated but can be converted to arginine acceptance by identity element transplantation. We have examined the evolutionary distribution and functionality of these tRNA elements within metazoan taxa. We conclude that the identity elements that have evolved for the recognition of mitochondrial tRNAArgUCG by the nuclear encoded mitochondrial arginyl-tRNA synthetases of eumetazoans have been extensively, but not universally conserved, throughout this clade. They ensure that the AGR codon reassignment in eumetazoan mitochondria is not compromised by misaminoacylation. In contrast, in other metazoans, such as Porifera, whose mitochondrial translation is dictated by the universal genetic code, recognition of the 2 encoded tRNAArgUCG/UCU isoacceptors is achieved through structural features that resemble those employed by the yeast cytoplasmic system. PMID:25603118

  5. Identity elements for the aminoacylation of metazoan mitochondrial tRNA(Arg) have been widely conserved throughout evolution and ensure the fidelity of the AGR codon reassignment.


    Igloi, Gabor L; Leisinger, Anne-Katrin


    Eumetazoan mitochondrial tRNAs possess structures (identity elements) that require the specific recognition by their cognate nuclear-encoded aminoacyl-tRNA synthetases. The AGA (arginine) codon of the standard genetic code has been reassigned to serine/glycine/termination in eumetazoan organelles and is translated in some organisms by a mitochondrially encoded tRNA(Ser)UCU. One mechanism to prevent mistranslation of the AGA codon as arginine would require a set of tRNA identity elements distinct from those possessed by the cytoplasmic tRNAArg in which the major identity elements permit the arginylation of all 5 encoded isoacceptors. We have performed comparative in vitro aminoacylation using an insect mitochondrial arginyl-tRNA synthetase and tRNAArgUCG structural variants. The established identity elements are sufficient to maintain the fidelity of tRNASerUCU reassignment. tRNAs having a UCU anticodon cannot be arginylated but can be converted to arginine acceptance by identity element transplantation. We have examined the evolutionary distribution and functionality of these tRNA elements within metazoan taxa. We conclude that the identity elements that have evolved for the recognition of mitochondrial tRNAArgUCG by the nuclear encoded mitochondrial arginyl-tRNA synthetases of eumetazoans have been extensively, but not universally conserved, throughout this clade. They ensure that the AGR codon reassignment in eumetazoan mitochondria is not compromised by misaminoacylation. In contrast, in other metazoans, such as Porifera, whose mitochondrial translation is dictated by the universal genetic code, recognition of the 2 encoded tRNAArgUCG/UCU isoacceptors is achieved through structural features that resemble those employed by the yeast cytoplasmic system.

  6. Does Sequence Conservation Provide Evidence for Biological Function?


    Omer, Seila; Harlow, Timothy J; Gogarten, Johann Peter


    Finding a signature of purifying selection in a gene is usually interpreted as evidence for the gene providing a function that is targeted by natural selection. This opinion offers a very different hypothesis: purifying selection may be due to removing harmful mutations from the population, that is, the gene and its encoded protein become harmful after a mutation occurred, possibly because the mutated protein interferes with the translation machinery, or because of toxicity of the misfolded protein. Finding a signature of purifying selection should not automatically be considered proof of the gene's selectable function.

  7. Functional studies on the ATM intronic splicing processing element.


    Lewandowska, Marzena A; Stuani, Cristiana; Parvizpur, Alireza; Baralle, Francisco E; Pagani, Franco


    In disease-associated genes, the understanding of the functional significance of deep intronic nucleotide variants may represent a difficult challenge. We have previously reported a new disease-causing mechanism that involves an intronic splicing processing element (ISPE) in ATM, composed of adjacent consensus 5' and 3' splice sites. A GTAA deletion within ISPE maintains potential adjacent splice sites, disrupts a non-canonical U1 snRNP interaction and activates an aberrant exon. In this paper, we demonstrate that binding of U1 snRNA through complementarity within a approximately 40 nt window downstream of the ISPE prevents aberrant splicing. By selective mutagenesis at the adjacent consensus ISPE splice sites, we show that this effect is not due to a resplicing process occurring at the ISPE. Functional comparison of the ATM mouse counterpart and evaluation of the pre-mRNA splicing intermediates derived from affected cell lines and hybrid minigene assays indicate that U1 snRNP binding at the ISPE interferes with the cryptic acceptor site. Activation of this site results in a stringent 5'-3' order of intron sequence removal around the cryptic exon. Artificial U1 snRNA loading by complementarity to heterologous exonic sequences represents a potential therapeutic method to prevent the usage of an aberrant CFTR cryptic exon. Our results suggest that ISPE-like intronic elements binding U1 snRNPs may regulate correct intron processing.

  8. Functional studies on the ATM intronic splicing processing element

    PubMed Central

    Lewandowska, Marzena A.; Stuani, Cristiana; Parvizpur, Alireza; Baralle, Francisco E.; Pagani, Franco


    In disease-associated genes, the understanding of the functional significance of deep intronic nucleotide variants may represent a difficult challenge. We have previously reported a new disease-causing mechanism that involves an intronic splicing processing element (ISPE) in ATM, composed of adjacent consensus 5′ and 3′ splice sites. A GTAA deletion within ISPE maintains potential adjacent splice sites, disrupts a non-canonical U1 snRNP interaction and activates an aberrant exon. In this paper, we demonstrate that binding of U1 snRNA through complementarity within a ∼40 nt window downstream of the ISPE prevents aberrant splicing. By selective mutagenesis at the adjacent consensus ISPE splice sites, we show that this effect is not due to a resplicing process occurring at the ISPE. Functional comparison of the ATM mouse counterpart and evaluation of the pre-mRNA splicing intermediates derived from affected cell lines and hybrid minigene assays indicate that U1 snRNP binding at the ISPE interferes with the cryptic acceptor site. Activation of this site results in a stringent 5′–3′ order of intron sequence removal around the cryptic exon. Artificial U1 snRNA loading by complementarity to heterologous exonic sequences represents a potential therapeutic method to prevent the usage of an aberrant CFTR cryptic exon. Our results suggest that ISPE-like intronic elements binding U1 snRNPs may regulate correct intron processing. PMID:16030351

  9. Enhancer turnover and conserved regulatory function in vertebrate evolution

    PubMed Central

    Domené, Sabina; Bumaschny, Viviana F.; de Souza, Flávio S. J.; Franchini, Lucía F.; Nasif, Sofía; Low, Malcolm J.; Rubinstein, Marcelo


    Mutations in regulatory regions including enhancers are an important source of variation and innovation during evolution. Enhancers can evolve by changes in the sequence, arrangement and repertoire of transcription factor binding sites, but whole enhancers can also be lost or gained in certain lineages in a process of turnover. The proopiomelanocortin gene (Pomc), which encodes a prohormone, is expressed in the pituitary and hypothalamus of all jawed vertebrates. We have previously described that hypothalamic Pomc expression in mammals is controlled by two enhancers—nPE1 and nPE2—that are derived from transposable elements and that presumably replaced the ancestral neuronal Pomc regulatory regions. Here, we show that nPE1 and nPE2, even though they are mammalian novelties with no homologous counterpart in other vertebrates, nevertheless can drive gene expression specifically to POMC neurons in the hypothalamus of larval and adult transgenic zebrafish. This indicates that when neuronal Pomc enhancers originated de novo during early mammalian evolution, the newly created cis- and trans-codes were similar to the ancestral ones. We also identify the neuronal regulatory region of zebrafish pomca and confirm that it is not homologous to the mammalian enhancers. Our work sheds light on the process of gene regulatory evolution by showing how a locus can undergo enhancer turnover and nevertheless maintain the ancestral transcriptional output. PMID:24218639

  10. Conservation of progesterone hormone function in invertebrate reproduction

    PubMed Central

    Stout, E. Paige; La Clair, James J.; Snell, Terry W.; Shearer, Tonya L.; Kubanek, Julia


    Steroids play fundamental roles regulating mammalian reproduction and development. Although sex steroids and their receptors are well characterized in vertebrates and several arthropod invertebrates, little is known about the hormones and receptors regulating reproduction in other invertebrate species. Evolutionary insights into ancient endocrine pathways can be gained by elucidating the hormones and receptors functioning in invertebrate reproduction. Using a combination of genomic analyses, receptor imaging, ligand identification, target elucidation, and exploration of function through receptor knockdown, we now show that comparable progesterone chemoreception exists in the invertebrate monogonont rotifer Brachionus manjavacas, suggesting an ancient origin of the signal transduction systems commonly associated with the development and integration of sexual behavior in mammals. PMID:20547846

  11. Conservation of floral homeotic gene function between Arabidopsis and antirrhinum.

    PubMed Central

    Irish, V F; Yamamoto, Y T


    Several homeotic genes controlling floral development have been isolated in both Antirrhinum and Arabidopsis. Based on the similarities in sequence and in the phenotypes elicited by mutations in some of these genes, it has been proposed that the regulatory hierarchy controlling floral development is comparable in these two species. We have performed a direct experimental test of this hypothesis by introducing a chimeric Antirrhinum Deficiens (DefA)/Arabidopsis APETALA3 (AP3) gene, under the control of the Arabidopsis AP3 promoter, into Arabidopsis. We demonstrated that this transgene is sufficient to partially complement severe mutations at the AP3 locus. In combination with a weak ap3 mutation, this transgene is capable of completely rescuing the mutant phenotype to a fully functional wild-type flower. These observations indicate that despite differences in DNA sequence and expression, DefA coding sequences can compensate for the loss of AP3 gene function. We discuss the implications of these results for the evolution of homeotic gene function in flowering plants. PMID:7580255

  12. Analysis of gene order conservation in eukaryotes identifies transcriptionally and functionally linked genes.


    Dávila López, Marcela; Martínez Guerra, Juan José; Samuelsson, Tore


    The order of genes in eukaryotes is not entirely random. Studies of gene order conservation are important to understand genome evolution and to reveal mechanisms why certain neighboring genes are more difficult to separate during evolution. Here, genome-wide gene order information was compiled for 64 species, representing a wide variety of eukaryotic phyla. This information is presented in a browser where gene order may be displayed and compared between species. Factors related to non-random gene order in eukaryotes were examined by considering pairs of neighboring genes. The evolutionary conservation of gene pairs was studied with respect to relative transcriptional direction, intergenic distance and functional relationship as inferred by gene ontology. The results show that among gene pairs that are conserved the divergently and co-directionally transcribed genes are much more common than those that are convergently transcribed. Furthermore, highly conserved pairs, in particular those of fungi, are characterized by a short intergenic distance. Finally, gene pairs of metazoa and fungi that are evolutionary conserved and that are divergently transcribed are much more likely to be related by function as compared to poorly conserved gene pairs. One example is the ribosomal protein gene pair L13/S16, which is unusual as it occurs both in fungi and alveolates. A specific functional relationship between these two proteins is also suggested by the fact that they are part of the same operon in both eubacteria and archaea. In conclusion, factors associated with non-random gene order in eukaryotes include relative gene orientation, intergenic distance and functional relationships. It seems likely that certain pairs of genes are conserved because the genes involved have a transcriptional and/or functional relationship. The results also indicate that studies of gene order conservation aid in identifying genes that are related in terms of transcriptional control.

  13. Analysis of Gene Order Conservation in Eukaryotes Identifies Transcriptionally and Functionally Linked Genes

    PubMed Central

    Dávila López, Marcela; Martínez Guerra, Juan José; Samuelsson, Tore


    The order of genes in eukaryotes is not entirely random. Studies of gene order conservation are important to understand genome evolution and to reveal mechanisms why certain neighboring genes are more difficult to separate during evolution. Here, genome-wide gene order information was compiled for 64 species, representing a wide variety of eukaryotic phyla. This information is presented in a browser where gene order may be displayed and compared between species. Factors related to non-random gene order in eukaryotes were examined by considering pairs of neighboring genes. The evolutionary conservation of gene pairs was studied with respect to relative transcriptional direction, intergenic distance and functional relationship as inferred by gene ontology. The results show that among gene pairs that are conserved the divergently and co-directionally transcribed genes are much more common than those that are convergently transcribed. Furthermore, highly conserved pairs, in particular those of fungi, are characterized by a short intergenic distance. Finally, gene pairs of metazoa and fungi that are evolutionary conserved and that are divergently transcribed are much more likely to be related by function as compared to poorly conserved gene pairs. One example is the ribosomal protein gene pair L13/S16, which is unusual as it occurs both in fungi and alveolates. A specific functional relationship between these two proteins is also suggested by the fact that they are part of the same operon in both eubacteria and archaea. In conclusion, factors associated with non-random gene order in eukaryotes include relative gene orientation, intergenic distance and functional relationships. It seems likely that certain pairs of genes are conserved because the genes involved have a transcriptional and/or functional relationship. The results also indicate that studies of gene order conservation aid in identifying genes that are related in terms of transcriptional control. PMID:20498846

  14. The conserved lymphokine element-0 in the IL5 promoter binds to a high mobility group-1 protein.


    Marrugo, J; Marsh, D G; Ghosh, B


    The conserved lymphokine elements-0 (CLE0) in the IL5 promoter is essential for the expression of IL-5. Here, we report the cloning and expression of a cDNA encoding a novel CLE0-binding protein, CLEBP-1 from a mouse Th2 clone, D10.G4.1. Interestingly, it was found that the CLEBP1 cDNA sequence was almost identical to the sequences of known high mobility group-1 (HMG1) cDNAs. When expressed as a recombinant fusion protein in Escherichia coli, CLEBP-1 was shown to bind to the IL5-CLE0 element in electrophoretic mobility-shift assays (EMSA) and southwestern blot analysis. The CLEBP-1 fusion protein cross-reacts with and-HMG-1/2 in Western blot analysis. It also binds to the CLE0 elements of IL4, GMCSF and GCSF genes. CLEBP-1 and closely related HMG-1 and HMG-2 proteins may play key roles in facilitating the expression of the lymphokine genes that contain CLE0 elements.

  15. Inhibition of exotoxin production by mobile genetic element SCCmec-encoded psm-mec RNA is conserved in staphylococcal species.


    Ikuo, Mariko; Nagano, Gentaro; Saito, Yuki; Mao, Han; Sekimizu, Kazuhisa; Kaito, Chikara


    Staphylococcal species acquire antibiotic resistance by incorporating the mobile-genetic element SCCmec. We previously found that SCCmec-encoded psm-mec RNA suppresses exotoxin production as a regulatory RNA, and the psm-mec translation product increases biofilm formation in Staphylococcus aureus. Here, we examined whether the regulatory role of psm-mec on host bacterial virulence properties is conserved among other staphylococcal species, S. epidermidis and S. haemolyticus, both of which are important causes of nosocomial infections. In S. epidermidis, introduction of psm-mec decreased the production of cytolytic toxins called phenol-soluble modulins (PSMs) and increased biofilm formation. Introduction of psm-mec with a stop-codon mutation that did not express PSM-mec protein but did express psm-mec RNA also decreased PSM production, but did not increase biofilm formation. Thus, the psm-mec RNA inhibits PSM production, whereas the PSM-mec protein increases biofilm formation in S. epidermidis. In S. haemolyticus, introduction of psm-mec decreased PSM production, but did not affect biofilm formation. The mutated psm-mec with a stop-codon also caused the same effect. Thus, the psm-mec RNA also inhibits PSM production in S. haemolyticus. These findings suggest that the inhibitory role of psm-mec RNA on exotoxin production is conserved among staphylococcal species, although the stimulating effect of the psm-mec gene on biofilm formation is not conserved.

  16. Multilevel Selection Theory and the Evolutionary Functions of Transposable Elements

    PubMed Central

    Brunet, Tyler D.P.; Doolittle, W. Ford


    One of several issues at play in the renewed debate over “junk DNA” is the organizational level at which genomic features might be seen as selected, and thus to exhibit function, as etiologically defined. The intuition frequently expressed by molecular geneticists that junk DNA is functional because it serves to “speed evolution” or as an “evolutionary repository” could be recast as a claim about selection between species (or clades) rather than within them, but this is not often done. Here, we review general arguments for the importance of selection at levels above that of organisms in evolution, and develop them further for a common genomic feature: the carriage of transposable elements (TEs). In many species, not least our own, TEs comprise a large fraction of all nuclear DNA, and whether they individually or collectively contribute to fitness—or are instead junk— is a subject of ongoing contestation. Even if TEs generally owe their origin to selfish selection at the lowest level (that of genomes), their prevalence in extant organisms and the prevalence of extant organisms bearing them must also respond to selection within species (on organismal fitness) and between species (on rates of speciation and extinction). At an even higher level, the persistence of clades may be affected (positively or negatively) by TE carriage. If indeed TEs speed evolution, it is at these higher levels of selection that such a function might best be attributed to them as a class. PMID:26253318

  17. Computation of Schenberg response function by using finite element modelling

    NASA Astrophysics Data System (ADS)

    Frajuca, C.; Bortoli, F. S.; Magalhaes, N. S.


    Schenberg is a detector of gravitational waves resonant mass type, with a central frequency of operation of 3200 Hz. Transducers located on the surface of the resonating sphere, according to a distribution half-dodecahedron, are used to monitor a strain amplitude. The development of mechanical impedance matchers that act by increasing the coupling of the transducers with the sphere is a major challenge because of the high frequency and small in size. The objective of this work is to study the Schenberg response function obtained by finite element modeling (FEM). Finnaly, the result is compared with the result of the simplified model for mass spring type system modeling verifying if that is suitable for the determination of sensitivity detector, as the conclusion the both modeling give the same results.

  18. Defining conservation priorities for freshwater fishes according to taxonomic, functional, and phylogenetic diversity

    USGS Publications Warehouse

    Strecker, Angela; Olden, Julian D.; Whittier, Joanna B.; Paukert, Craig P.


    To date, the predominant use of systematic conservation planning has been to evaluate and conserve areas of high terrestrial biodiversity. Although studies in freshwater ecosystems have received recent attention, research has rarely considered the potential trade-offs between protecting different dimensions of biodiversity and the ecological processes that maintain diversity. We provide the first systematic prioritization for freshwaters (focusing on the highly threatened and globally distinct fish fauna of the Lower Colorado River Basin, USA) simultaneously considering scenarios of: taxonomic, functional, and phylogenetic diversity; contemporary threats to biodiversity (including interactions with nonnative species); and future climate change and human population growth. There was 75% congruence between areas of highest conservation priority for different aspects of biodiversity, suggesting that conservation efforts can concurrently achieve strong complementarity among all types of diversity. However, sizable fractions of the landscape were incongruent across conservation priorities for different diversity scenarios, underscoring the importance of considering multiple dimensions of biodiversity and highlighting catchments that contribute disproportionately to taxonomic, functional, and phylogenetic diversity in the region. Regions of projected human population growth were not concordant with conservation priorities; however, higher human population abundance will likely have indirect effects on native biodiversity by increasing demand for water. This will come in direct conflict with projected reductions in precipitation and warmer temperatures, which have substantial overlap with regions of high contemporary diversity. Native and endemic fishes in arid ecosystems are critically endangered by both current and future threats, but our results highlight the use of systematic conservation planning for the optimal allocation of limited resources that incorporates

  19. Defining conservation priorities for freshwater fishes according to taxonomic, functional, and phylogenetic diversity

    USGS Publications Warehouse

    Strecker, A.L.; Olden, J.D.; Whittier, Joanna B.; Paukert, C.P.


    To date, the predominant use of systematic conservation planning has been to evaluate and conserve areas of high terrestrial biodiversity. Although studies in freshwater ecosystems have received recent attention, research has rarely considered the potential tradeoffs between protecting different dimensions of biodiversity and the ecological processes that maintain diversity. We provide the first systematic prioritization for freshwaters (focusing on the highly threatened and globally distinct fish fauna of the Lower Colorado River Basin, USA) simultaneously considering scenarios of: taxonomic, functional, and phylogenetic diversity;contemporary threats to biodiversity (including interactions with nonnative species);and future climate change and human population growth. There was 75% congruence between areas of highest conservation priority for different aspects of biodiversity, suggesting that conservation efforts can concurrently achieve strong complementarity among all types of diversity. However, sizable fractions of the landscape were incongruent across conservation priorities for different diversity scenarios, underscoring the importance of considering multiple dimensions of biodiversity and highlighting catchments that contribute disproportionately to taxonomic, functional, and phylogenetic diversity in the region. Regions of projected human population growth were not concordant with conservation priorities;however, higher human population abundance will likely have indirect effects on native biodiversity by increasing demand for water. This will come in direct conflict with projected reductions in precipitation and warmer temperatures, which have substantial overlap with regions of high contemporary diversity. Native and endemic fishes in arid ecosystems are critically endangered by both current and future threats, but our results highlight the use of systematic conservation planning for the optimal allocation of limited resources that incorporates multiple

  20. Detecting the limits of regulatory element conservation and divergence estimation using pairwise and multiple alignments

    PubMed Central

    Pollard, Daniel A; Moses, Alan M; Iyer, Venky N; Eisen, Michael B


    Background Molecular evolutionary studies of noncoding sequences rely on multiple alignments. Yet how multiple alignment accuracy varies across sequence types, tree topologies, divergences and tools, and further how this variation impacts specific inferences, remains unclear. Results Here we develop a molecular evolution simulation platform, CisEvolver, with models of background noncoding and transcription factor binding site evolution, and use simulated alignments to systematically examine multiple alignment accuracy and its impact on two key molecular evolutionary inferences: transcription factor binding site conservation and divergence estimation. We find that the accuracy of multiple alignments is determined almost exclusively by the pairwise divergence distance of the two most diverged species and that additional species have a negligible influence on alignment accuracy. Conserved transcription factor binding sites align better than surrounding noncoding DNA yet are often found to be misaligned at relatively short divergence distances, such that studies of binding site gain and loss could easily be confounded by alignment error. Divergence estimates from multiple alignments tend to be overestimated at short divergence distances but reach a tool specific divergence at which they cease to increase, leading to underestimation at long divergences. Our most striking finding was that overall alignment accuracy, binding site alignment accuracy and divergence estimation accuracy vary greatly across branches in a tree and are most accurate for terminal branches connecting sister taxa and least accurate for internal branches connecting sub-alignments. Conclusion Our results suggest that variation in alignment accuracy can lead to errors in molecular evolutionary inferences that could be construed as biological variation. These findings have implications for which species to choose for analyses, what kind of errors would be expected for a given set of species and how

  1. Functional analysis of eve stripe 2 enhancer evolution in Drosophila: rules governing conservation and change.


    Ludwig, M Z; Patel, N H; Kreitman, M


    Experimental investigations of eukaryotic enhancers suggest that multiple binding sites and trans-acting regulatory factors are often required for wild-type enhancer function. Genetic analysis of the stripe 2 enhancer of even-skipped (eve), an important developmental gene in Drosophila, provides support for this view. Given the importance of even-skipped expression in early Drosophila development, it might be predicted that many structural features of the stripe 2 enhancer will be evolutionarily conserved, including the DNA sequences of protein binding sites and the spacing between them. To test this hypothesis, we compared sequences of the stripe 2 enhancer between four species of Drosophila: D. melanogaster, D. yakuba, D. erecta and D. pseudoobscura. Our analysis revealed a large number of nucleotide substitutions in regulatory protein binding sites for bicoid, hunchback, Kruppel and giant, as well as a systematic change in the size of the enhancer. Some of the binding sites in D. melanogaster are either absent or modified in other species. One functionally important bicoid-binding site in D. melanogaster appears to be recently evolved. We, therefore, investigated possible functional consequences of sequence differences among these stripe 2 enhancers by P-element-mediated transformation. This analysis revealed that the eve stripe 2 enhancer from each of the four species drove reporter gene expression at the identical time and location in D. melanogaster embryos. Double staining of native eve protein and transgene mRNA in early embryos showed that the reporter gene mimicked native eve expression and, in every case, produced sharply defined stripes at the blastoderm stage that were coincident with eve stripe 2 protein. We argue that stripe 2 eve expression in Drosophila evolution can be viewed as being under constant stabilizing selection with respect to the location of the anterior and posterior borders of the stripe. We further hypothesize that the stripe 2

  2. Extracting electron transfer coupling elements from constrained density functional theory

    NASA Astrophysics Data System (ADS)

    Wu, Qin; Van Voorhis, Troy


    Constrained density functional theory (DFT) is a useful tool for studying electron transfer (ET) reactions. It can straightforwardly construct the charge-localized diabatic states and give a direct measure of the inner-sphere reorganization energy. In this work, a method is presented for calculating the electronic coupling matrix element (Hab) based on constrained DFT. This method completely avoids the use of ground-state DFT energies because they are known to irrationally predict fractional electron transfer in many cases. Instead it makes use of the constrained DFT energies and the Kohn-Sham wave functions for the diabatic states in a careful way. Test calculations on the Zn2+ and the benzene-Cl atom systems show that the new prescription yields reasonable agreement with the standard generalized Mulliken-Hush method. We then proceed to produce the diabatic and adiabatic potential energy curves along the reaction pathway for intervalence ET in the tetrathiafulvalene-diquinone (Q-TTF-Q) anion. While the unconstrained DFT curve has no reaction barrier and gives Hab≈17kcal /mol, which qualitatively disagrees with experimental results, the Hab calculated from constrained DFT is about 3kcal /mol and the generated ground state has a barrier height of 1.70kcal/mol, successfully predicting (Q-TTF-Q)- to be a class II mixed-valence compound.

  3. Numerical solution of transonic full stream function equations in conservation form

    NASA Technical Reports Server (NTRS)

    Hafez, M. M.


    The stream function equation in conservation form is solved iteratively based on the artificial compressibility method. The density is not a unique function of the mass flux. In order to avoid the ambiguity near the sonic line, the density is updated in terms of the velocity, which is obtained through a simple integration of a first order equation step by step in the flow field. Iteration algorithms and finite difference approximations are discussed and numerical results of both conservative and nonconservative calculations are presented.

  4. Conserved aspartic acid 233 and alanine 231 are not required for poliovirus polymerase function in replicons

    PubMed Central

    Freistadt, Marion S; Eberle, Karen E


    Nucleic acid polymerases have similar structures and motifs. The function of an aspartic acid (conserved in all classes of nucleic acid polymerases) in motif A remains poorly understood in RNA-dependent RNA polymerases. We mutated this residue to alanine in a poliovirus replicon. The resulting mutant could still replicate, although at a reduced level. In addition, mutation A231C (also in motif A) yielded high levels of replication. Taken together these results show that poliovirus polymerase conserved residues D233 and A231 are not essential to poliovirus replicon function. PMID:17352827

  5. An atlas of tissue-specific conserved coexpression for functional annotation and disease gene prediction.


    Piro, Rosario Michael; Ala, Ugo; Molineris, Ivan; Grassi, Elena; Bracco, Chiara; Perego, Gian Paolo; Provero, Paolo; Di Cunto, Ferdinando


    Gene coexpression relationships that are phylogenetically conserved between human and mouse have been shown to provide important clues about gene function that can be efficiently used to identify promising candidate genes for human hereditary disorders. In the past, such approaches have considered mostly generic gene expression profiles that cover multiple tissues and organs. The individual genes of multicellular organisms, however, can participate in different transcriptional programs, operating at scales as different as single-cell types, tissues, organs, body regions or the entire organism. Therefore, systematic analysis of tissue-specific coexpression could be, in principle, a very powerful strategy to dissect those functional relationships among genes that emerge only in particular tissues or organs. In this report, we show that, in fact, conserved coexpression as determined from tissue-specific and condition-specific data sets can predict many functional relationships that are not detected by analyzing heterogeneous microarray data sets. More importantly, we find that, when combined with disease networks, the simultaneous use of both generic (multi-tissue) and tissue-specific conserved coexpression allows a more efficient prediction of human disease genes than the use of generic conserved coexpression alone. Using this strategy, we were able to identify high-probability candidates for 238 orphan disease loci. We provide proof of concept that this combined use of generic and tissue-specific conserved coexpression can be very useful to prioritize the mutational candidates obtained from deep-sequencing projects, even in the case of genetic disorders as heterogeneous as XLMR.

  6. spalt is functionally conserved in Locusta and Drosophila to promote wing growth

    PubMed Central

    Wang, Dan; Li, Juanjuan; Liu, Suning; Zhou, Hang; Zhang, Long; Shi, Wangpeng; Shen, Jie


    Locusta has strong fly wings to ensure its long distance migration, but the molecular mechanism that regulates the Locusta wing development is poorly understood. To address the developmental mechanism of the Locusta flying wing, we cloned the Dpp target gene spalt (sal) and analyzed its function in wing growth in the Locusta. The Locusta wing size is apparently reduced with vein defects when sal is interfered by injection of dsRNA, indicating that sal is required for locust wing growth and vein formation. This function is conserved during the Drosophila wing development. To better understand sal’s function in wing growth, we then used Drosophila wing disc as a model for further study. We found that sal promotes cell proliferation in the whole wing disc via positive regulation of a microRNA bantam. Our results firstly unravel sal’s function in the Locusta wing growth and confirm a highly conserved function of sal in Locusta and Drosophila. PMID:28300136

  7. Conserved intergenic sequences revealed by CTAG-profiling in Salmonella: thermodynamic modeling for function prediction

    PubMed Central

    Tang, Le; Zhu, Songling; Mastriani, Emilio; Fang, Xin; Zhou, Yu-Jie; Li, Yong-Guo; Johnston, Randal N.; Guo, Zheng; Liu, Gui-Rong; Liu, Shu-Lin


    Highly conserved short sequences help identify functional genomic regions and facilitate genomic annotation. We used Salmonella as the model to search the genome for evolutionarily conserved regions and focused on the tetranucleotide sequence CTAG for its potentially important functions. In Salmonella, CTAG is highly conserved across the lineages and large numbers of CTAG-containing short sequences fall in intergenic regions, strongly indicating their biological importance. Computer modeling demonstrated stable stem-loop structures in some of the CTAG-containing intergenic regions, and substitution of a nucleotide of the CTAG sequence would radically rearrange the free energy and disrupt the structure. The postulated degeneration of CTAG takes distinct patterns among Salmonella lineages and provides novel information about genomic divergence and evolution of these bacterial pathogens. Comparison of the vertically and horizontally transmitted genomic segments showed different CTAG distribution landscapes, with the genome amelioration process to remove CTAG taking place inward from both terminals of the horizontally acquired segment. PMID:28262684

  8. Conserved intergenic sequences revealed by CTAG-profiling in Salmonella: thermodynamic modeling for function prediction

    NASA Astrophysics Data System (ADS)

    Tang, Le; Zhu, Songling; Mastriani, Emilio; Fang, Xin; Zhou, Yu-Jie; Li, Yong-Guo; Johnston, Randal N.; Guo, Zheng; Liu, Gui-Rong; Liu, Shu-Lin


    Highly conserved short sequences help identify functional genomic regions and facilitate genomic annotation. We used Salmonella as the model to search the genome for evolutionarily conserved regions and focused on the tetranucleotide sequence CTAG for its potentially important functions. In Salmonella, CTAG is highly conserved across the lineages and large numbers of CTAG-containing short sequences fall in intergenic regions, strongly indicating their biological importance. Computer modeling demonstrated stable stem-loop structures in some of the CTAG-containing intergenic regions, and substitution of a nucleotide of the CTAG sequence would radically rearrange the free energy and disrupt the structure. The postulated degeneration of CTAG takes distinct patterns among Salmonella lineages and provides novel information about genomic divergence and evolution of these bacterial pathogens. Comparison of the vertically and horizontally transmitted genomic segments showed different CTAG distribution landscapes, with the genome amelioration process to remove CTAG taking place inward from both terminals of the horizontally acquired segment.

  9. Conserved intergenic sequences revealed by CTAG-profiling in Salmonella: thermodynamic modeling for function prediction.


    Tang, Le; Zhu, Songling; Mastriani, Emilio; Fang, Xin; Zhou, Yu-Jie; Li, Yong-Guo; Johnston, Randal N; Guo, Zheng; Liu, Gui-Rong; Liu, Shu-Lin


    Highly conserved short sequences help identify functional genomic regions and facilitate genomic annotation. We used Salmonella as the model to search the genome for evolutionarily conserved regions and focused on the tetranucleotide sequence CTAG for its potentially important functions. In Salmonella, CTAG is highly conserved across the lineages and large numbers of CTAG-containing short sequences fall in intergenic regions, strongly indicating their biological importance. Computer modeling demonstrated stable stem-loop structures in some of the CTAG-containing intergenic regions, and substitution of a nucleotide of the CTAG sequence would radically rearrange the free energy and disrupt the structure. The postulated degeneration of CTAG takes distinct patterns among Salmonella lineages and provides novel information about genomic divergence and evolution of these bacterial pathogens. Comparison of the vertically and horizontally transmitted genomic segments showed different CTAG distribution landscapes, with the genome amelioration process to remove CTAG taking place inward from both terminals of the horizontally acquired segment.

  10. Conservation and rewiring of functional modules revealed by an epistasis map in fission yeast.


    Roguev, Assen; Bandyopadhyay, Sourav; Zofall, Martin; Zhang, Ke; Fischer, Tamas; Collins, Sean R; Qu, Hongjing; Shales, Michael; Park, Han-Oh; Hayles, Jacqueline; Hoe, Kwang-Lae; Kim, Dong-Uk; Ideker, Trey; Grewal, Shiv I; Weissman, Jonathan S; Krogan, Nevan J


    An epistasis map (E-MAP) was constructed in the fission yeast, Schizosaccharomyces pombe, by systematically measuring the phenotypes associated with pairs of mutations. This high-density, quantitative genetic interaction map focused on various aspects of chromosome function, including transcription regulation and DNA repair/replication. The E-MAP uncovered a previously unidentified component of the RNA interference (RNAi) machinery (rsh1) and linked the RNAi pathway to several other biological processes. Comparison of the S. pombe E-MAP to an analogous genetic map from the budding yeast revealed that, whereas negative interactions were conserved between genes involved in similar biological processes, positive interactions and overall genetic profiles between pairs of genes coding for physically associated proteins were even more conserved. Hence, conservation occurs at the level of the functional module (protein complex), but the genetic cross talk between modules can differ substantially.

  11. Detecting the limits of regulatory element conservation anddivergence estimation using pairwise and multiple alignments

    SciTech Connect

    Pollard, Daniel A.; Moses, Alan M.; Iyer, Venky N.; Eisen,Michael B.


    Background: Molecular evolutionary studies of noncodingsequences rely on multiple alignments. Yet how multiple alignmentaccuracy varies across sequence types, tree topologies, divergences andtools, and further how this variation impacts specific inferences,remains unclear. Results: Here we develop a molecular evolutionsimulation platform, CisEvolver, with models of background noncoding andtranscription factor binding site evolution, and use simulated alignmentsto systematically examine multiple alignment accuracy and its impact ontwo key molecular evolutionary inferences: transcription factor bindingsite conservation and divergence estimation. We find that the accuracy ofmultiple alignments is determined almost exclusively by the pairwisedivergence distance of the two most diverged species and that additionalspecies have a negligible influence on alignment accuracy. Conservedtranscription factor binding sites align better than surroundingnoncoding DNA yet are often found to be misaligned at relatively shortdivergence distances, such that studies of binding site gain and losscould easily be confounded by alignment error. Divergence estimates frommultiple alignments tend to be overestimated at short divergencedistances but reach a tool specific divergence at which they cease toincrease, leading to underestimation at long divergences. Our moststriking finding was that overall alignment accuracy, binding sitealignment accuracy and divergence estimation accuracy vary greatly acrossbranches in a tree and are most accurate for terminal branches connectingsister taxa and least accurate for internal branches connectingsub-alignments. Conclusions: Our results suggest that variation inalignment accuracy can lead to errors in molecular evolutionaryinferences that could be construed as biological variation. Thesefindings have implications for which species to choose for analyses, whatkind of errors would be expected for a given set of species and howmultiple alignment tools and

  12. Concentrations of Elements in Hellbender Blood and Fish Fillets from the Missouri Department of Conservation Monitoring Programs

    USGS Publications Warehouse

    May, Thomas W.; Walther, Mike J.; Brumbaugh, William G.


    This report presents the results of contaminant monitoring surveys conducted annually by the Missouri Department of Conservation to examine the levels of selected elemental contaminants in hellbender (Cryptobranchus alleganiensis) blood and fish. Catfish (Ictalurus furcatus, Ictalurus punctatus, Pylodictis olivaris), redhorse (Moxostoma anisorum, Moxostoma erythrurum), bass (Micropterus salmoides, Micropterus punctulatus, Micropterus Lacepede, Ambloplites rupestris), walleye (Sander vitreus), and sunfish (Lepomis megalotis) were collected from 17 sites as part of the Department's General Contaminant Monitoring Program. Bluegill (Lepomis macrochirus) and other sunfish (Lepomis megalotis, Lepomis cyanellus) were collected from 18 sites as part of the Department's Resource Assessment and Monitoring Program. Blood from hellbenders was collected from seven sites as part of the Department's Hellbender Monitoring Program.

  13. Sequence and domain conservation of the coelacanth Hsp40 and Hsp90 chaperones suggests conservation of function.


    Bishop, Özlem Tastan; Edkins, Adrienne Lesley; Blatch, Gregory Lloyd


    Molecular chaperones and their associated co-chaperones play an important role in preserving and regulating the active conformational state of cellular proteins. The chaperone complement of the Indonesian Coelacanth, Latimeria menadoensis, was elucidated using transcriptomic sequences. Heat shock protein 90 (Hsp90) and heat shock protein 40 (Hsp40) chaperones, and associated co-chaperones were focused on, and homologous human sequences were used to search the sequence databases. Coelacanth homologs of the cytosolic, mitochondrial and endoplasmic reticulum (ER) homologs of human Hsp90 were identified, as well as all of the major co-chaperones of the cytosolic isoform. Most of the human Hsp40s were found to have coelacanth homologs, and the data suggested that all of the chaperone machinery for protein folding at the ribosome, protein translocation to cellular compartments such as the ER and protein degradation were conserved. Some interesting similarities and differences were identified when interrogating human, mouse, and zebrafish homologs. For example, DnaJB13 is predicted to be a non-functional Hsp40 in humans, mouse, and zebrafish due to a corrupted histidine-proline-aspartic acid (HPD) motif, while the coelacanth homolog has an intact HPD. These and other comparisons enabled important functional and evolutionary questions to be posed for future experimental studies.

  14. LINE-1 retrotransposons: from 'parasite' sequences to functional elements.


    Paço, Ana; Adega, Filomena; Chaves, Raquel


    Long interspersed nuclear elements-1 (LINE-1) are the most abundant and active retrotransposons in the mammalian genomes. Traditionally, the occurrence of LINE-1 sequences in the genome of mammals has been explained by the selfish DNA hypothesis. Nevertheless, recently, it has also been argued that these sequences could play important roles in these genomes, as in the regulation of gene expression, genome modelling and X-chromosome inactivation. The non-random chromosomal distribution is a striking feature of these retroelements that somehow reflects its functionality. In the present study, we have isolated and analysed a fraction of the open reading frame 2 (ORF2) LINE-1 sequence from three rodent species, Cricetus cricetus, Peromyscus eremicus and Praomys tullbergi. Physical mapping of the isolated sequences revealed an interspersed longitudinal AT pattern of distribution along all the chromosomes of the complement in the three genomes. A detailed analysis shows that these sequences are preferentially located in the euchromatic regions, although some signals could be detected in the heterochromatin. In addition, a coincidence between the location of imprinted gene regions (as Xist and Tsix gene regions) and the LINE-1 retroelements was also observed. According to these results, we propose an involvement of LINE-1 sequences in different genomic events as gene imprinting, X-chromosome inactivation and evolution of repetitive sequences located at the heterochromatic regions (e.g. satellite DNA sequences) of the rodents' genomes analysed.

  15. The five elements process: designing optimal landscapes to meet bird conservation objectives

    USGS Publications Warehouse

    Will, T.C.; Ruth, J.M.; Rosenberg, K.V.; Krueper, D.; Hahn, D.; Fitzgerald, J.; Dettmers, R.; Beardmore, C.J.


    In February 2004 at Port Aransas, Texas, Partners in Flight (PIF) and representatives from the other NABCI bird initiative met to discuss the process of stepping down PIF continental population objectives (Rich et al. 2004) to regional and local scales. Participants also discussed rolling up local population estimates and targets to assess the feasibility of the landscape changes necessary to meet continental objectives. Since the process of stepping-down/rolling-up population objectives shifts focus from identifying priority species to formulating quantitative estimates of how much habitat was needed, where, and by when the Port Aransas group called the stepping-down/rolling-up process a??stepping forward.a?? Participants agreed that stepping forward objectives was the beginning of an inevitably iterative dialog necessary to evaluate the assumptions of PIF population estimates and objectives as well as the methods used to monitor local implementation. To facilitate the translation of continental population objectives into biologically sound, measurable regional and local population-based habitat targets the Port Aransas group recommended a process no commonly referred to as the Five Elements Processa?|

  16. Genetic and functional analysis of HIV-1 Rev Responsive Element (RRE) sequences from North-India

    PubMed Central


    HIV-1 Rev protein regulates the expression of HIV-1 transcripts by binding to a highly structured stem loop structure called the Rev Responsive Element (RRE) present in the genomic and partially spliced RNAs. Genetic variation in this structure is likely to affect binding of Rev protein and ultimately overall gene expression and replication. We characterized RRE sequences from 13 HIV-1 infected individuals from North India which also included two mother-child pairs following vertical transmission. We observed high degree of conservation of sequences, including the 9-nt (CACUAUGGG) long sequence in stem-loop B, required for efficient binding of Rev protein. All of our 13 RRE sequences possessed G to A (position 66) mutation located in the critical branched-stem-loop B which is not present in consensus C or B sequence. We derived a consensus RRE structure which showed interesting changes in the stem-loop structures including the stem-loop B. Mother-Child RRE sequences showed conservation of unique polymorphisms as well as some new mutations in child RRE sequences. Despite these changes, the ability to form multiple essential stem-loop structures required for Rev binding was conserved. RRE RNA derived from one of the samples, VT5, retained the ability to bind Rev protein under in vitro conditions although it showed alternate secondary structure. This is the first study from India describing the structural and possible functional implications due to very unique RRE sequence heterogeneity and its possible role in vertical transmission and gene expression. PMID:20682034

  17. Conserving the functional and phylogenetic trees of life of European tetrapods

    PubMed Central

    Thuiller, Wilfried; Maiorano, Luigi; Mazel, Florent; Guilhaumon, François; Ficetola, Gentile Francesco; Lavergne, Sébastien; Renaud, Julien; Roquet, Cristina; Mouillot, David


    Protected areas (PAs) are pivotal tools for biodiversity conservation on the Earth. Europe has had an extensive protection system since Natura 2000 areas were created in parallel with traditional parks and reserves. However, the extent to which this system covers not only taxonomic diversity but also other biodiversity facets, such as evolutionary history and functional diversity, has never been evaluated. Using high-resolution distribution data of all European tetrapods together with dated molecular phylogenies and detailed trait information, we first tested whether the existing European protection system effectively covers all species and in particular, those with the highest evolutionary or functional distinctiveness. We then tested the ability of PAs to protect the entire tetrapod phylogenetic and functional trees of life by mapping species' target achievements along the internal branches of these two trees. We found that the current system is adequately representative in terms of the evolutionary history of amphibians while it fails for the rest. However, the most functionally distinct species were better represented than they would be under random conservation efforts. These results imply better protection of the tetrapod functional tree of life, which could help to ensure long-term functioning of the ecosystem, potentially at the expense of conserving evolutionary history. PMID:25561666

  18. An arthropod cis-regulatory element functioning in sensory organ precursor development dates back to the Cambrian

    PubMed Central


    Background An increasing number of publications demonstrate conservation of function of cis-regulatory elements without sequence similarity. In invertebrates such functional conservation has only been shown for closely related species. Here we demonstrate the existence of an ancient arthropod regulatory element that functions during the selection of neural precursors. The activity of genes of the achaete-scute (ac-sc) family endows cells with neural potential. An essential, conserved characteristic of proneural genes is their ability to restrict their own activity to single or a small number of progenitor cells from their initially broad domains of expression. This is achieved through a process called lateral inhibition. A regulatory element, the sensory organ precursor enhancer (SOPE), is required for this process. First identified in Drosophila, the SOPE contains discrete binding sites for four regulatory factors. The SOPE of the Drosophila asense gene is situated in the 5' UTR. Results Through a manual comparison of consensus binding site sequences we have been able to identify a SOPE in UTR sequences of asense-like genes in species belonging to all four arthropod groups (Crustacea, Myriapoda, Chelicerata and Insecta). The SOPEs of the spider Cupiennius salei and the insect Tribolium castaneum are shown to be functional in transgenic Drosophila. This would place the origin of this regulatory sequence as far back as the last common ancestor of the Arthropoda, that is, in the Cambrian, 550 million years ago. Conclusions The SOPE is not detectable by inter-specific sequence comparison, raising the possibility that other ancient regulatory modules in invertebrates might have escaped detection. PMID:20868489

  19. New developments in the method of space-time conservation element and solution element: Applications to the Euler and Navier-Stokes equations

    NASA Technical Reports Server (NTRS)

    Chang, Sin-Chung


    A new numerical framework for solving conservation laws is being developed. This new approach differs substantially in both concept and methodology from the well-established methods--i.e., finite difference, finite volume, finite element, and spectral methods. It is conceptually simple and designed to avoid several key limitations to the above traditional methods. An explicit model scheme for solving a simple 1-D unsteady convection-diffusion equation is constructed and used to illuminate major differences between the current method and those mentioned above. Unexpectedly, its amplification factors for the pure convection and pure diffusion cases are identical to those of the Leapfrog and the DuFort-Frankel schemes, respectively. Also, this explicit scheme and its Navier-Stokes extension have the unusual property that their stabilities are limited only by the CFL condition. Moreover, despite the fact that it does not use any flux-limiter or slope-limiter, the Navier-Stokes solver is capable of generating highly accurate shock tube solutions with shock discontinuities being resolved within one mesh interval. An accurate Euler solver also is constructed through another extension. It has many unusual properties, e.g., numerical diffusion at all mesh points can be controlled by a set of local parameters.

  20. Melting temperature highlights functionally important RNA structure and sequence elements in yeast mRNA coding regions.


    Qi, Fei; Frishman, Dmitrij


    Secondary structure elements in the coding regions of mRNAs play an important role in gene expression and regulation, but distinguishing functional from non-functional structures remains challenging. Here we investigate the dependence of sequence-structure relationships in the coding regions on temperature based on the recent PARTE data by Wan et al. Our main finding is that the regions with high and low thermostability (high Tm and low Tm regions) are under evolutionary pressure to preserve RNA secondary structure and primary sequence, respectively. Sequences of low Tm regions display a higher degree of evolutionary conservation compared to high Tm regions. Low Tm regions are under strong synonymous constraint, while high Tm regions are not. These findings imply that high Tm regions contain thermo-stable functionally important RNA structures, which impose relaxed evolutionary constraint on sequence as long as the base-pairing patterns remain intact. By contrast, low thermostability regions contain single-stranded functionally important conserved RNA sequence elements accessible for binding by other molecules. We also find that theoretically predicted structures of paralogous mRNA pairs become more similar with growing temperature, while experimentally measured structures tend to diverge, which implies that the melting pathways of RNA structures cannot be fully captured by current computational approaches.

  1. Nicotinic receptors in non-human primates: analysis of genetic and functional conservation with humans

    PubMed Central

    Shorey-Kendrick, Lyndsey E.; Ford, Matthew M.; Allen, Daicia C.; Kuryatov, Alexander; Lindstrom, Jon; Wilhelm, Larry; Grant, Kathleen A.; Spindel, Eliot R.


    Nicotinic acetylcholine receptors (nAChRs) are highly conserved between humans and non-human primates. Conservation exists at the level of genomic structure, protein structure and epigenetics. Overall homology of nAChRs at the protein level is 98% in macaques versus 89% in mice, which is highly relevant for evaluating subtype-specific ligands that have different affinities in humans versus rodents. In addition to conservation at the protein level, there is high conservation of genomic structure in terms of intron and exon size and placement of CpG sites that play a key role in epigenetic regulation. Analysis of single nucleotide polymorphisms (SNPs) shows that while the majority of SNPs are not conserved between humans and macaques, some functional polymorphisms are. Most significantly, cynomolgus monkeys express a similar α5 nAChR Asp398Asn polymorphism to the human α5 Asp398Asn polymorphism that has been linked to greater nicotine addiction and smoking related disease. Monkeys can be trained to readily self-administer nicotine, and in an initial study we have demonstrated that cynomolgus monkeys bearing the α5 D398N polymorphism show a reduced behavioral sensitivity to oral nicotine and tend to consume it in a different pattern when compared to wild-type monkeys. Thus the combination of highly homologous nAChR, higher cortical functions and capacity for complex training makes non-human primates a unique model to study in vivo functions of nicotinic receptors. In particular, primate studies on nicotine addiction and evaluation of therapies to prevent or overcome nicotine addiction are likely to be highly predictive of treatment outcomes in humans. PMID:25661700

  2. Sorting out relationships among the grouse and ptarmigan using intron, mitochondrial, and ultra-conserved element sequences.


    Persons, Nicholas W; Hosner, Peter A; Meiklejohn, Kelly A; Braun, Edward L; Kimball, Rebecca T


    The Holarctic phasianid clade of the grouse and ptarmigan has received substantial attention in areas such as evolution of mating systems, display behavior, and population ecology related to their conservation and management as wild game species. There are multiple molecular phylogenetic studies that focus on grouse and ptarmigan. In spite of this, there is little consensus regarding historical relationships, particularly among genera, which has led to unstable and partial taxonomic revisions. We estimated the phylogeny of all currently recognized species using a combination of novel data from seven nuclear loci (largely intron sequences) and published data from one additional autosomal locus, two W-linked loci, and four mitochondrial regions. To explore relationships among genera and assess paraphyly of one genus more rigorously, we then added over 3000 ultra-conserved element (UCE) loci (over 1.7million bp) gathered using Illumina sequencing. The UCE topology agreed with that of the combined nuclear intron and previously published sequence data with 100% bootstrap support for all relationships. These data strongly support previous studies separating Bonasa from Tetrastes and Dendragapus from Falcipennis. However, the placement of Lagopus differed from previous studies, and we found no support for Falcipennis monophyly. Biogeographic analysis suggests that the ancestors of grouse and ptarmigan were distributed in the New World and subsequently underwent at least four dispersal events between the Old and New Worlds. Divergence time estimates from maternally-inherited and autosomal markers show stark differences across this clade, with divergence time estimates from maternally-inherited markers being nearly half that of the autosomal markers at some nodes, and nearly twice that at other nodes.

  3. A kinetic equation with kinetic entropy functions for scalar conservation laws

    NASA Technical Reports Server (NTRS)

    Perthame, Benoit; Tadmor, Eitan


    A nonlinear kinetic equation is constructed and proved to be well-adapted to describe general multidimensional scalar conservation laws. In particular, it is proved to be well-posed uniformly in epsilon - the microscopic scale. It is also shown that the proposed kinetic equation is equipped with a family of kinetic entropy functions - analogous to Boltzmann's microscopic H-function, such that they recover Krushkov-type entropy inequality on the macroscopic scale. Finally, it is proved by both - BV compactness arguments in the one-dimensional case, that the local density of kinetic particles admits a continuum limit, as it converges strongly with epsilon below 0 to the unique entropy solution of the corresponding conservation law.

  4. New Developments in the Method of Space-Time Conservation Element and Solution Element-Applications to Two-Dimensional Time-Marching Problems

    NASA Technical Reports Server (NTRS)

    Chang, Sin-Chung; Wang, Xiao-Yen; Chow, Chuen-Yen


    A new numerical discretization method for solving conservation laws is being developed. This new approach differs substantially in both concept and methodology from the well-established methods, i.e., finite difference, finite volume, finite element, and spectral methods. It is motivated by several important physical/numerical considerations and designed to avoid several key limitations of the above traditional methods. As a result of the above considerations, a set of key principles for the design of numerical schemes was put forth in a previous report. These principles were used to construct several numerical schemes that model a 1-D time-dependent convection-diffusion equation. These schemes were then extended to solve the time-dependent Euler and Navier-Stokes equations of a perfect gas. It was shown that the above schemes compared favorably with the traditional schemes in simplicity, generality, and accuracy. In this report, the 2-D versions of the above schemes, except the Navier-Stokes solver, are constructed using the same set of design principles. Their constructions are simplified greatly by the use of a nontraditional space-time mesh. Its use results in the simplest stencil possible, i.e., a tetrahedron in a 3-D space-time with a vertex at the upper time level and other three at the lower time level. Because of the similarity in their design, each of the present 2-D solvers virtually shares with its 1-D counterpart the same fundamental characteristics. Moreover, it is shown that the present Euler solver is capable of generating highly accurate solutions for a famous 2-D shock reflection problem. Specifically, both the incident and the reflected shocks can be resolved by a single data point without the presence of numerical oscillations near the discontinuity.

  5. Elongator function in tRNA wobble uridine modification is conserved between yeast and plants

    PubMed Central

    Mehlgarten, Constance; Jablonowski, Daniel; Wrackmeyer, Uta; Tschitschmann, Susan; Sondermann, David; Jäger, Gunilla; Gong, Zhizhong; Byström, Anders S; Schaffrath, Raffael; Breunig, Karin D


    Based on studies in yeast and mammalian cells the Elongator complex has been implicated in functions as diverse as histone acetylation, polarized protein trafficking and tRNA modification. Here we show that Arabidopsis mutants lacking the Elongator subunit AtELP3/ELO3 have a defect in tRNA wobble uridine modification. Moreover, we demonstrate that yeast elp3 and elp1 mutants expressing the respective Arabidopsis Elongator homologues AtELP3/ELO3 and AtELP1/ELO2 assemble integer Elongator complexes indicating a high degree of structural conservation. Surprisingly, in vivo complementation studies based on Elongator-dependent tRNA nonsense suppression and zymocin tRNase toxin assays indicated that while AtELP1 rescued defects of a yeast elp1 mutant, the most conserved Elongator gene AtELP3, failed to complement an elp3 mutant. This lack of complementation is due to incompatibility with yeast ELP1 as coexpression of both plant genes in an elp1 elp3 yeast mutant restored Elongator's tRNA modification function in vivo. Similarly, AtELP1, not ScELP1 also supported partial complementation by yeast–plant Elp3 hybrids suggesting that AtElp1 has less stringent sequence requirements for Elp3 than ScElp1. We conclude that yeast and plant Elongator share tRNA modification roles and propose that this function might be conserved in Elongator from all eukaryotic kingdoms of life. PMID:20398216

  6. Functional conservation of MIKC*-Type MADS box genes in Arabidopsis and rice pollen maturation.


    Liu, Yuan; Cui, Shaojie; Wu, Feng; Yan, Shuo; Lin, Xuelei; Du, Xiaoqiu; Chong, Kang; Schilling, Susanne; Theißen, Günter; Meng, Zheng


    There are two groups of MADS intervening keratin-like and C-terminal (MIKC)-type MADS box genes, MIKC(C) type and MIKC* type. In seed plants, the MIKC(C) type shows considerable diversity, but the MIKC* type has only two subgroups, P- and S-clade, which show conserved expression in the gametophyte. To examine the functional conservation of MIKC*-type genes, we characterized all three rice (Oryza sativa) MIKC*-type genes. All three genes are specifically expressed late in pollen development. The single knockdown or knockout lines, respectively, of the S-clade MADS62 and MADS63 did not show a mutant phenotype, but lines in which both S-clade genes were affected showed severe defects in pollen maturation and germination, as did knockdown lines of MADS68, the only P-clade gene in rice. The rice MIKC*-type proteins form strong heterodimeric complexes solely with partners from the other subclade; these complexes specifically bind to N10-type C-A-rich-G-boxes in vitro and regulate downstream gene expression by binding to N10-type promoter motifs. The rice MIKC* genes have a much lower degree of functional redundancy than the Arabidopsis thaliana MIKC* genes. Nevertheless, our data indicate that the function of heterodimeric MIKC*-type protein complexes in pollen development has been conserved since the divergence of monocots and eudicots, roughly 150 million years ago.

  7. Prioritizing conservation effort through the use of biological soil crusts as ecosystem function indicators in an arid region

    USGS Publications Warehouse

    Bowker, M.A.; Miller, M.E.; Belnap, J.; Sisk, T.D.; Johnson, N.C.


    Conservation prioritization usually focuses on conservation of rare species or biodiversity, rather than ecological processes. This is partially due to a lack of informative indicators of ecosystem function. Biological soil crusts (BSCs) trap and retain soil and water resources in arid ecosystems and function as major carbon and nitrogen fixers; thus, they may be informative indicators of ecosystem function. We created spatial models of multiple indicators of the diversity and function of BSCs (species richness, evenness, functional diversity, functional redundancy, number of rare species, number of habitat specialists, nitrogen and carbon fixation indices, soil stabilization, and surface roughening) for the 800,000-ha Grand Staircase-Escalante National Monument (Utah, U.S.A.). We then combined the indicators into a single BSC function map and a single BSC biodiversity map (2 alternative types of conservation value) with an unweighted averaging procedure and a weighted procedure derived from validations performance. We also modeled potential degradation with data from a rangeland assessment survey. To determine which areas on the landscape were the highest conservation priorities, we overlaid the function- and diversity-based conservation-value layers on the potential degradation layer. Different methods for ascribing conservation-value and conservation-priority layers all yielded strikingly similar results (r = 0.89-0.99), which suggests that in this case biodiversity and function can be conserved simultaneously. We believe BSCs can be used as indicators of ecosystem function in concert with other indicators (such as plant-community properties) and that such information can be used to prioritize conservation effort in drylands. ?? 2008 Society for Conservation Biology.

  8. Pi class glutathione S-transferase genes are regulated by Nrf 2 through an evolutionarily conserved regulatory element in zebrafish

    PubMed Central

    Suzuki, Takafumi; Takagi, Yaeko; Osanai, Hitoshi; Li, Li; Takeuchi, Miki; Katoh, Yasutake; Kobayashi, Makoto; Yamamoto, Masayuki


    Pi class GSTs (glutathione S-transferases) are a member of the vertebrate GST family of proteins that catalyse the conjugation of GSH to electrophilic compounds. The expression of Pi class GST genes can be induced by exposure to electrophiles. We demonstrated previously that the transcription factor Nrf 2 (NF-E2 p45-related factor 2) mediates this induction, not only in mammals, but also in fish. In the present study, we have isolated the genomic region of zebrafish containing the genes gstp1 and gstp2. The regulatory regions of zebrafish gstp1 and gstp2 have been examined by GFP (green fluorescent protein)-reporter gene analyses using microinjection into zebrafish embryos. Deletion and point-mutation analyses of the gstp1 promoter showed that an ARE (antioxidant-responsive element)-like sequence is located 50 bp upstream of the transcription initiation site which is essential for Nrf 2 transactivation. Using EMSA (electrophoretic mobility-shift assay) analysis we showed that zebrafish Nrf 2–MafK heterodimer specifically bound to this sequence. All the vertebrate Pi class GST genes harbour a similar ARE-like sequence in their promoter regions. We propose that this sequence is a conserved target site for Nrf 2 in the Pi class GST genes. PMID:15654768

  9. A fully-coupled flow-reactive-transport formulation based on element conservation, with application to CO2 storage simulations

    NASA Astrophysics Data System (ADS)

    Fan, Yaqing; Durlofsky, Louis J.; Tchelepi, Hamdi A.


    A numerical simulation framework for coupled multiphase flow, multicomponent transport and geochemical reactions in porous media is presented. The approach is an element-based formulation that combines the compositional modeling capabilities used in oil reservoir simulation with the treatment of chemical reactions used in groundwater modeling. The procedure employs a conservative finite-volume method with a fully-implicit treatment in time in order to preserve the nonlinear coupling of flow, transport, reactions, and mass transfer across phases. Phase behavior is described using cubic equations of state. In this framework, all the governing equations and associated constraints are cast in discrete residual form, such that any variable, or coefficient, can depend on any other variable in the problem. Prior to linearization, which is applied to construct the Jacobian matrix, no algebraic or analytic manipulation need be performed to reduce the nonlinear sets of equations and unknowns. Once the complete Jacobian matrix is assembled, a series of algebraic reductions (Schur complements), of the type used in compositional reservoir simulation, are performed to reduce the number of discrete equations that must be solved simultaneously. A GMRES solution strategy with CPR (Constrained Pressure Residual) preconditioning is applied to solve the reduced linear system. We demonstrate the formulation using two CO2 sequestration problems, one of which involves chemical reactions. The simulations demonstrate the efficiency and applicability of the overall procedure for modeling the long-term fate of sequestered CO2.

  10. Identifying Elements Critical for Functional and Sustainable Professional Learning Communities

    ERIC Educational Resources Information Center

    Richmond, Gail; Manokore, Viola


    In this paper, we examined data collected as part of a 5-year project designed to foster reform-based urban science teaching through teachers' communities of inquiry. Drawing upon a distributed leadership framework, we analyzed teacher "talk" during professional learning community (PLC) meetings. This analysis yielded five elements:…

  11. Conservation of CFTR codon frequency through primates suggests synonymous mutations could have a functional effect.


    Pizzo, Lucilla; Iriarte, Andrés; Alvarez-Valin, Fernando; Marín, Mónica


    Cystic fibrosis is an inherited chronic disease that affects the lungs and digestive system, with a prevalence of about 1:3000 people. Cystic fibrosis is caused by mutations in CFTR gene, which lead to a defective function of the chloride channel, the cystic fibrosis transmembrane conductance regulator (CFTR). Up-to-date, more than 1900 mutations have been reported in CFTR. However for an important proportion of them, their functional effects and the relation to disease are still not understood. Many of these mutations are silent (or synonymous), namely they do not alter the encoded amino acid. These synonymous mutations have been considered as neutral to protein function. However, more recent evidence in bacterial and human proteins has put this concept under revision. With the aim of understanding possible functional effects of synonymous mutations in CFTR, we analyzed human and primates CFTR codon usage and divergence patterns. We report the presence of regions enriched in rare and frequent codons. This spatial pattern of codon preferences is conserved in primates, but this cannot be explained by sequence conservation alone. In sum, the results presented herein suggest a functional implication of these regions of the gene that may be maintained by purifying selection acting to preserve a particular codon usage pattern along the sequence. Overall these results support the idea that several synonymous mutations in CFTR may have functional importance, and could be involved in the disease.

  12. Structure-function studies of nerve growth factor: functional importance of highly conserved amino acid residues.

    PubMed Central

    Ibáñez, C F; Hallböök, F; Ebendal, T; Persson, H


    Selected amino acid residues in chicken nerve growth factor (NGF) were replaced by site-directed mutagenesis. Mutated NGF sequences were transiently expressed in COS cells and the yield of NGF protein in conditioned medium was quantified by Western blotting. Binding of each mutant to NGF receptors on PC12 cells was evaluated in a competition assay. The biological activity was determined by measuring stimulation of neurite outgrowth from chick sympathetic ganglia. The residues homologous to the proposed receptor binding site of insulin (Ser18, Met19, Val21, Asp23) were substituted by Ala. Replacement of Ser18, Met19 and Asp23 did not affect NGF activity. Modification of Val21 notably reduced both receptor binding and biological activity, suggesting that this residue is important to retain a fully active NGF. The highly conserved Tyr51 and Arg99 were converted into Phe and Lys respectively, without changing the biological properties of the molecule. However, binding and biological activity were greatly impaired after the simultaneous replacement of both Arg99 and Arg102 by Gly. The three conserved Trp residues at positions 20, 75 and 98 were substituted by Phe. The Trp mutated proteins retained 15-60% of receptor binding and 40-80% of biological activity, indicating that the Trp residues are not essential for NGF activity. However, replacement of Trp20 significantly reduced the amount of NGF in the medium, suggesting that this residue may be important for protein stability. Images Fig. 4. PMID:2328722

  13. Cation-dependent folding of 3' cap-independent translation elements facilitates interaction of a 17-nucleotide conserved sequence with eIF4G.


    Kraft, Jelena J; Treder, Krzysztof; Peterson, Mariko S; Miller, W Allen


    The 3'-untranslated regions of many plant viral RNAs contain cap-independent translation elements (CITEs) that drive translation initiation at the 5'-end of the mRNA. The barley yellow dwarf virus-like CITE (BTE) stimulates translation by binding the eIF4G subunit of translation initiation factor eIF4F with high affinity. To understand this interaction, we characterized the dynamic structural properties of the BTE, mapped the eIF4G-binding sites on the BTE and identified a region of eIF4G that is crucial for BTE binding. BTE folding involves cooperative uptake of magnesium ions and is driven primarily by charge neutralization. Footprinting experiments revealed that functional eIF4G fragments protect the highly conserved stem-loop I and a downstream bulge. The BTE forms a functional structure in the absence of protein, and the loop that base pairs the 5'-untranslated region (5'-UTR) remains solvent-accessible at high eIF4G concentrations. The region in eIF4G between the eIF4E-binding site and the MIF4G region is required for BTE binding and translation. The data support the model in which the eIF4F complex binds directly to the BTE which base pairs simultaneously to the 5'-UTR, allowing eIF4F to recruit the 40S ribosomal subunit to the 5'-end.

  14. Correlation functions of main-chain polymer nematics constrained by tensorial and vectorial conservation laws.


    Svenšek, Daniel; Podgornik, Rudolf


    We present and analyze correlation functions of a main-chain polymer nematic in a continuum worm-like chain description for two types of constraints formalized by the tensorial and vectorial conservation laws, both originating in the microscopic chain integrity, i.e., the connectivity of the polymer chains. In particular, our aim is to identify the features of the correlation functions that are most susceptible to the differences between the two constraints. Besides the density and director autocorrelations in both the tensorial and vectorial cases, we calculate also the density-director correlation functions, the latter being a direct signature of the presence of a specific constraint. Its amplitude is connected to the strength of the constraint and is zero if none of the constraints are present, i.e., for a standard non-polymeric nematic. Generally, the correlation functions with the constraints differ substantially from the correlation functions in the non-polymeric case, if the constraints are strong which in practice requires long chains. Moreover, for the tensorial conservation law to be well distinguishable from the vectorial one, the chain persistence length should be much smaller than the total length of the chain, so that hairpins (chain backfolding) are numerous and the polar order is small.

  15. Structural and functional analysis of hypothetical and conserved proteins of Clostridium tetani.


    Enany, Shymaa


    The progress in biological technologies has led to rapid accumulation of microbial genomic sequences with a vast number of uncharacterized genes. Proteins encoded by these genes are usually uncharacterized, hypothetical, and/or conserved. In Clostridium tetani (C. tetani), these proteins constitute up to 50% of the expressed proteins. In this regard, understanding the functions and the structures of these proteins is crucially important, particularly in C. tetani, which is a medically important pathogen. Here, we used a variety of bioinformatics tools and databases to analyze 10 hypothetical and conserved proteins in C. tetani. We were able to provide a detailed overview of the functional contributions of some of these proteins in several cellular functions, including (1) evolving antibiotic resistance, (2) interaction with enzymes pathways, and (3) involvement in drug transportation. Among these candidates, we postulated the involvement of one of these hypothetical proteins in the pathogenic activity of tetanus. The structural and functional prediction of these proteins should serve in uncovering and better understanding the function of C. tetani cells to ultimately discover new possible drug targets.

  16. Functional Advantages of Conserved Intrinsic Disorder in RNA-Binding Proteins

    PubMed Central

    Varadi, Mihaly; Zsolyomi, Fruzsina; Guharoy, Mainak; Tompa, Peter


    Proteins form large macromolecular assemblies with RNA that govern essential molecular processes. RNA-binding proteins have often been associated with conformational flexibility, yet the extent and functional implications of their intrinsic disorder have never been fully assessed. Here, through large-scale analysis of comprehensive protein sequence and structure datasets we demonstrate the prevalence of intrinsic structural disorder in RNA-binding proteins and domains. We addressed their functionality through a quantitative description of the evolutionary conservation of disordered segments involved in binding, and investigated the structural implications of flexibility in terms of conformational stability and interface formation. We conclude that the functional role of intrinsically disordered protein segments in RNA-binding is two-fold: first, these regions establish extended, conserved electrostatic interfaces with RNAs via induced fit. Second, conformational flexibility enables them to target different RNA partners, providing multi-functionality, while also ensuring specificity. These findings emphasize the functional importance of intrinsically disordered regions in RNA-binding proteins. PMID:26439842

  17. Metabolic network structure and function in bacteria goes beyond conserved enzyme components

    PubMed Central

    Bazurto, Jannell V.; Downs, Diana M.


    For decades, experimental work has laid the foundation for our understanding of the linear and branched pathways that are integrated to form the metabolic networks on which life is built. Genetic and biochemical approaches applied in model organisms generate empirical data that correlate genes, gene products and their biological activities. In the post-genomic era, these results have served as the basis for the genome annotation that is routinely used to infer the metabolic capabilities of an organism and mathematically model the presumed metabolic network structure. At large, genome annotation and metabolic network reconstructions have demystified genomic content of non-culturable microorganisms and allowed researchers to explore the breadth of metabolisms in silico. Mis-annotation aside, it is unclear whether in silico reconstructions of metabolic structure from component parts accurately captures the higher levels of network organization and flux distribution. For this approach to provide accurate predictions, one must assume that the conservation of metabolic components leads to conservation of metabolic network architecture and function. This assumption has not been rigorously tested. Here we describe the implications of a recent study (MBio 5;7(1): e01840-15), which demonstrated that conservation of metabolic components was not sufficient to predict network structure and function. PMID:28357363

  18. Neotropical coastal lagoons: an appraisal of their biodiversity, functioning, threats and conservation management.


    Esteves, F A; Caliman, A; Santangelo, J M; Guariento, R D; Farjalla, V F; Bozelli, R L


    Neotropical coastal lagoons (NCL) are human-dominated ecosystems. Their distribution along densely populated coastal areas of developing countries makes these systems among the most threatened in the world. Here, we summarize some aspects of the causes and consequences of NCL biodiversity, their functioning, their importance to the surrounding populations, their fragility, and their responses to local and global anthropogenic impacts and the challenges that Neotropical countries face in conserving these systems. Although still scarce and geographically concentrated, a growing body of studies has shown that NCLs are physiographically diversified systems, which harbor a considerable and particular proportion of the Neotropical inland aquatic biodiversity. Despite the fact that coastal lagoons are ecotones that are intricately connected to surrounding environments, they develop mechanisms for structural and functional regulation, which confer to these systems higher productivity and carrying capacities than surrounding ecosystems. Such traits attract residential developments and subsidize local traditional populations with important economic and aesthetic ecosystem revenues such as fisheries and scenic beauty. However, the disorganized human occupation around NCLs are causing profound impacts such as eutrophication, salinization, exotic species introduction, as well as other effects, which are ultimately imposing major habitat degradations and biodiversity extirpations in NCLs. We argue that interdisciplinary conservation strategies, which integrate scientific expertise, government officials, private companies and the general public, are the most likely to overcome the geographic and economic obstacles to NCL conservation.

  19. Nmf9 Encodes a Highly Conserved Protein Important to Neurological Function in Mice and Flies

    PubMed Central

    Zhang, Shuxiao; Ross, Kevin D.; Seidner, Glen A.; Gorman, Michael R.; Poon, Tiffany H.; Wang, Xiaobo; Keithley, Elizabeth M.; Lee, Patricia N.; Martindale, Mark Q.; Joiner, William J.; Hamilton, Bruce A.


    Many protein-coding genes identified by genome sequencing remain without functional annotation or biological context. Here we define a novel protein-coding gene, Nmf9, based on a forward genetic screen for neurological function. ENU-induced and genome-edited null mutations in mice produce deficits in vestibular function, fear learning and circadian behavior, which correlated with Nmf9 expression in inner ear, amygdala, and suprachiasmatic nuclei. Homologous genes from unicellular organisms and invertebrate animals predict interactions with small GTPases, but the corresponding domains are absent in mammalian Nmf9. Intriguingly, homozygotes for null mutations in the Drosophila homolog, CG45058, show profound locomotor defects and premature death, while heterozygotes show striking effects on sleep and activity phenotypes. These results link a novel gene orthology group to discrete neurological functions, and show conserved requirement across wide phylogenetic distance and domain level structural changes. PMID:26131556

  20. Natural Selection and Functional Potentials of Human Noncoding Elements Revealed by Analysis of Next Generation Sequencing Data.


    Jha, Pankaj; Lu, Dongsheng; Xu, Shuhua


    Noncoding DNA sequences (NCS) have attracted much attention recently due to their functional potentials. Here we attempted to reveal the functional roles of noncoding sequences from the point of view of natural selection that typically indicates the functional potentials of certain genomic elements. We analyzed nearly 37 million single nucleotide polymorphisms (SNPs) of Phase I data of the 1000 Genomes Project. We estimated a series of key parameters of population genetics and molecular evolution to characterize sequence variations of the noncoding genome within and between populations, and identified the natural selection footprints in NCS in worldwide human populations. Our results showed that purifying selection is prevalent and there is substantial constraint of variations in NCS, while positive selectionis more likely to be specific to some particular genomic regions and regional populations. Intriguingly, we observed larger fraction of non-conserved NCS variants with lower derived allele frequency in the genome, indicating possible functional gain of non-conserved NCS. Notably, NCS elements are enriched for potentially functional markers such as eQTLs, TF motif, and DNase I footprints in the genome. More interestingly, some NCS variants associated with diseases such as Alzheimer's disease, Type 1 diabetes, and immune-related bowel disorder (IBD) showed signatures of positive selection, although the majority of NCS variants, reported as risk alleles by genome-wide association studies, showed signatures of negative selection. Our analyses provided compelling evidence of natural selection forces on noncoding sequences in the human genome and advanced our understanding of their functional potentials that play important roles in disease etiology and human evolution.

  1. SARM: a novel Toll-like receptor adaptor, is functionally conserved from arthropod to human.


    Belinda, Loh Wei-Ching; Wei, Wang Xiao; Hanh, Bui Thi Hong; Lei, Luan Xiao; Bow, Ho; Ling, Ding Jeak


    Sterile-alpha and Armadillo motif containing protein (SARM) was recently identified as the fifth member of the Toll-like receptor (TLR) adaptor family. Whilst the Caenorhabditis elegans SARM homologue, TIR-1, is crucial for efficient immune responses against bacterial infections, human SARM was demonstrated to function as a specific inhibitor of TRIF-dependent TLR signaling. The opposing role of SARM in C. elegans and human is intriguing, prompting us to seek clarification on the enigmatic function of SARM in an ancient species which relies solely on innate immunity for survival. Here, we report the discovery of a primitive but functional SARM (CrSARM) in the immune defense of a "living fossil", the horseshoe crab, Carcinoscorpius rotundicauda. CrSARM shares numerous signature motifs and displays significant homology with vertebrate and invertebrate SARM homologues. CrSARM downregulates TRIF-dependent TLR signaling suggesting the conservation of SARM function from horseshoe crab to human. During infection by Pseudomonas aeruginosa, CrSARM is rapidly upregulated within 3h and strongly repressed at 6h, coinciding with the timing of bacterial clearance, thus demonstrating its dynamic role in innate immunity. Furthermore, yeast-two-hybrid screening revealed several potential interaction partners of CrSARM implying the role of SARM in downregulating TLR signaling events. Altogether, our study shows that, although C. elegans SARM upregulates immune signaling, its disparate role as a suppressor of TLR signaling, specifically via TRIF and not MyD88, is well-conserved from horseshoe crab to human.

  2. Computational analysis of conserved coil functional residues in the mitochondrial genomic sequences of dermatophytes

    PubMed Central

    Gupta, Bulbul; Kaur, Jaspreet


    Dermatophyte is a group of closely related fungi that have the capacity to invade keratinized tissue of humans and other animals. The infection known as dermatophytosis, caused by members of the genera Microsporum, Trichophyton, and Epidermophyton includes infection to the groin (tinea cruris), beard (tinea barbae), scalp (tinea capitis), feet (tinea pedis), glabrous skin (tinea corporis), nail (tinea unguium), and hand (tinea manuum). The identification of evolutionary relationship between these three genera of dermatophyte is epidemiologically important to understand their pathogenicity. Mitochondrial DNA evolves more rapidly than a nuclear DNA due to higher rate of mutation but is very less affected by genetic recombination, making it an important tool for phylogenetic studies. Thus, here we present a novel scheme to identify the conserved coil functional residues of Trichophyton rubrum, Trichophyton mentagrophytes, Epidermophyton floccosum and Microsporum canis. Protein coding sequences of the mitochondrial genome were aligned for their similar sequences and homology modelling was performed for structure and pocket identification. The results obtained from comparative analysis of the protein sequences revealed the presence of functionally active sites in all the species of the genera Trichophyton and Microsporum. However in Epidermophyton floccosum it was observed in three protein sequences of the five studied. The absence of these conserved coil functional residues in E. floccusum may be correlated with lesser infectivity of this organism. The functional residues identified in the present study could be responsible for the disease and thus can act as putative target sites for drug designing. PMID:28149055

  3. Meikin is a conserved regulator of meiosis-I-specific kinetochore function.


    Kim, Jihye; Ishiguro, Kei-ichiro; Nambu, Aya; Akiyoshi, Bungo; Yokobayashi, Shihori; Kagami, Ayano; Ishiguro, Tadashi; Pendas, Alberto M; Takeda, Naoki; Sakakibara, Yogo; Kitajima, Tomoya S; Tanno, Yuji; Sakuno, Takeshi; Watanabe, Yoshinori


    The kinetochore is the crucial apparatus regulating chromosome segregation in mitosis and meiosis. Particularly in meiosis I, unlike in mitosis, sister kinetochores are captured by microtubules emanating from the same spindle pole (mono-orientation) and centromeric cohesion mediated by cohesin is protected in the following anaphase. Although meiotic kinetochore factors have been identified only in budding and fission yeasts, these molecules and their functions are thought to have diverged earlier. Therefore, a conserved mechanism for meiotic kinetochore regulation remains elusive. Here we have identified in mouse a meiosis-specific kinetochore factor that we termed MEIKIN, which functions in meiosis I but not in meiosis II or mitosis. MEIKIN plays a crucial role in both mono-orientation and centromeric cohesion protection, partly by stabilizing the localization of the cohesin protector shugoshin. These functions are mediated mainly by the activity of Polo-like kinase PLK1, which is enriched to kinetochores in a MEIKIN-dependent manner. Our integrative analysis indicates that the long-awaited key regulator of meiotic kinetochore function is Meikin, which is conserved from yeasts to humans.

  4. Control of plant stem cell function by conserved interacting transcriptional regulators

    PubMed Central

    Zhou, Yun; Liu, Xing; Engstrom, Eric M.; Nimchuk, Zachary L.; Pruneda-Paz, Jose L.; Tarr, Paul T.; Yan, An; Kay, Steve A.; Meyerowitz, Elliot M.


    SUMMARY Plant stem cells in the shoot apical meristem (SAM) and root apical meristem (RAM) provide for postembryonic development of above-ground tissues and roots, respectively, while secondary vascular stem cells sustain vascular development1–4. WUSCHEL (WUS), a homeodomain transcription factor expressed in the rib meristem of the SAM, is a key regulatory factor controlling stem cell populations in the Arabidopsis SAM5–6 and is thought to establish the shoot stem cell niche via a feedback circuit with the CLAVATA3 (CLV3) peptide signaling pathway7. WUSCHEL-RELATED HOMEOBOX5 (WOX5), specifically expressed in root quiescent center (QC), defines QC identity and functions interchangeably with WUS in control of shoot and root stem cell niches8. WOX4, expressed in Arabidopsis procambial cells, defines the vascular stem cell niche9–11. WUS/WOX family proteins are evolutionarily and functionally conserved throughout the plant kingdom12 and emerge as key actors in the specification and maintenance of stem cells within all meristems13. However, the nature of the genetic regime in stem cell niches that centers on WOX gene function has been elusive, and molecular links underlying conserved WUS/WOX function in stem cell niches remain unknown. Here we demonstrate that the Arabidopsis HAIRY MERISTEM (HAM)family transcription regulators act as conserved interacting co-factors with WUS/WOX proteins. HAM and WUS share common targets in vivo and their physical interaction is important in driving downstream transcriptional programs and in promoting shoot stem cell proliferation. Differences in the overlapping expression patterns of WOX and HAM family members underlie the formation of diverse stem cell niche locations, and the HAM family is essential for all of these stem cell niches. These findings establish a new framework for the control of stem cell production during plant development. PMID:25363783

  5. Modern money theory and ecological tax reform: A functional finance approach to energy conservation

    NASA Astrophysics Data System (ADS)

    McConnell, Scott L. B.

    This dissertation contributes to heterodox economics by developing a theoretical and policy-relevant link that will promote the conservation of energy while driving the value of the domestic currency. The analysis relies upon the theoretical foundation of modern money theory and functional finance, which states that "taxes-drive-money" where the value of a sovereign nation's currency is imputed through the acceptance by the sovereign nation of the currency in payment of taxation. This theoretical perspective lends itself to various public policy prescriptions, such as government employment policies or the employer of last resort (ELR), which has been discussed at length elsewhere (Wray 1998; Tcherneva 2007, Forstater 2003). This research contributes to this overall program by arguing that the basis for taxation under modern money theory allows public policy makers various alternatives regarding the make-up of the tax system in place. In particular, following functional finance, taxes do not have the sole purpose of paying for government spending, but rather drive the value of the currency and may be designed to perform other functions as well, such as penalizing socially undesirable behavior. The focus in this dissertation is on the amelioration of pollution and increasing energy conservation. The research question for this dissertation is this: what federally implemented tax would best serve the multiple criteria of 1) driving the value of the currency, 2) promoting energy conservation and 3) ameliorating income and wealth disparities inherent in a monetary production economy? This dissertation provides a suggestion for such a tax that would be part of a much larger overall policy program based upon the tenets of modern money theory and functional finance. Additionally, this research seeks to provide an important theoretical contribution to the emerging Post Keynesian and ecological economics dialog.

  6. Molecular genetic aetiology of general cognitive function is enriched in evolutionarily conserved regions

    PubMed Central

    Hill, W D; Davies, G; Harris, S E; Hagenaars, S P; Davies, Gail; Deary, Ian J; Debette, Stephanie; Verbaas, Carla I; Bressler, Jan; Schuur, Maaike; Smith, Albert V; Bis, Joshua C; Bennett, David A; Ikram, M Arfan; Launer, Lenore J; Fitzpatrick, Annette L; Seshadri, Sudha; van Duijn, Cornelia M; Mosley Jr, Thomas H; Liewald, D C; Penke, L; Gale, C R; Deary, I J


    Differences in general cognitive function have been shown to be partly heritable and to show genetic correlations with several psychiatric and physical disease states. However, to date, few single-nucleotide polymorphisms (SNPs) have demonstrated genome-wide significance, hampering efforts aimed at determining which genetic variants are most important for cognitive function and which regions drive the genetic associations between cognitive function and disease states. Here, we combine multiple large genome-wide association study (GWAS) data sets, from the CHARGE cognitive consortium (n=53 949) and UK Biobank (n=36 035), to partition the genome into 52 functional annotations and an additional 10 annotations describing tissue-specific histone marks. Using stratified linkage disequilibrium score regression we show that, in two measures of cognitive function, SNPs associated with cognitive function cluster in regions of the genome that are under evolutionary negative selective pressure. These conserved regions contained ~2.6% of the SNPs from each GWAS but accounted for ~40% of the SNP-based heritability. The results suggest that the search for causal variants associated with cognitive function, and those variants that exert a pleiotropic effect between cognitive function and health, will be facilitated by examining these enriched regions. PMID:27959336

  7. Cognitive-graphic method for constructing of hierarchical forms of basic functions of biquadratic finite element

    NASA Astrophysics Data System (ADS)

    Astionenko, I. O.; Litvinenko, O. I.; Osipova, N. V.; Tuluchenko, G. Ya.; Khomchenko, A. N.


    Recently the interpolation bases of the hierarchical type have been used for the problem solving of the approximation of multiple arguments functions (such as in the finite-element method). In this work the cognitive graphical method of constructing of the hierarchical form bases on the serendipity finite elements is suggested, which allowed to get the alternative bases on a biquadratic finite element from the serendipity family without internal knots' inclusion. The cognitive-graphic method allowed to improve the known interpolation procedure of Taylor and to get the modified elements with irregular arrangement of knots. The proposed procedures are universal and are spread in the area of finite-elements.

  8. Mammalian non-CG methylations are conserved and cell-type specific and may have been involved in the evolution of transposon elements.


    Guo, Weilong; Zhang, Michael Q; Wu, Hong


    Although non-CG methylations are abundant in several mammalian cell types, their biological significance is sparsely characterized. We gathered 51 human and mouse DNA methylomes from brain neurons, embryonic stem cells and induced pluripotent stem cells, primordial germ cells and oocytes. We utilized an unbiased sub-motif prediction method and reported CW as the representative non-CG methylation context, which is distinct from CC methylation in terms of sequence context and genomic distribution. A two-dimensional comparison of non-CG methylations across cell types and species was performed. Unambiguous studies of sequence preferences and genomic region enrichment showed that CW methylation is cell-type specific and is also conserved between humans and mice. In brain neurons, it was found that active long interspersed nuclear element-1 (LINE-1) lacked CW methylations but not CG methylations. Coincidentally, both human Alu and mouse B1 elements preferred high CW methylations at specific loci during their respective evolutionary development. Last, the strand-specific distributions of CW methylations in introns and long interspersed nuclear elements are also cell-type specific and conserved. In summary, our results illustrate that CW methylations are highly conserved among species, are dynamically regulated in each cell type, and are potentially involved in the evolution of transposon elements.

  9. Mammalian non-CG methylations are conserved and cell-type specific and may have been involved in the evolution of transposon elements

    PubMed Central

    Guo, Weilong; Zhang, Michael Q.; Wu, Hong


    Although non-CG methylations are abundant in several mammalian cell types, their biological significance is sparsely characterized. We gathered 51 human and mouse DNA methylomes from brain neurons, embryonic stem cells and induced pluripotent stem cells, primordial germ cells and oocytes. We utilized an unbiased sub-motif prediction method and reported CW as the representative non-CG methylation context, which is distinct from CC methylation in terms of sequence context and genomic distribution. A two-dimensional comparison of non-CG methylations across cell types and species was performed. Unambiguous studies of sequence preferences and genomic region enrichment showed that CW methylation is cell-type specific and is also conserved between humans and mice. In brain neurons, it was found that active long interspersed nuclear element-1 (LINE-1) lacked CW methylations but not CG methylations. Coincidentally, both human Alu and mouse B1 elements preferred high CW methylations at specific loci during their respective evolutionary development. Last, the strand-specific distributions of CW methylations in introns and long interspersed nuclear elements are also cell-type specific and conserved. In summary, our results illustrate that CW methylations are highly conserved among species, are dynamically regulated in each cell type, and are potentially involved in the evolution of transposon elements. PMID:27573482

  10. Conserved Gene Regulatory Function of the Carboxy-Terminal Domain of Dictyostelid C-Module-Binding Factor

    PubMed Central

    Schmith, Anika; Groth, Marco; Ratka, Josephine; Gatz, Sara; Spaller, Thomas; Siol, Oliver; Glöckner, Gernot


    C-module-binding factor A (CbfA) is a jumonji-type transcription regulator that is important for maintaining the expression and mobility of the retrotransposable element TRE5-A in the social amoeba Dictyostelium discoideum. CbfA-deficient cells have lost TRE5-A retrotransposition, are impaired in the ability to feed on bacteria, and do not enter multicellular development because of a block in cell aggregation. In this study, we performed Illumina RNA-seq of growing CbfA mutant cells to obtain a list of CbfA-regulated genes. We demonstrate that the carboxy-terminal domain of CbfA alone is sufficient to mediate most CbfA-dependent gene expression. The carboxy-terminal domain of CbfA from the distantly related social amoeba Polysphondylium pallidum restored the expression of CbfA-dependent genes in the D. discoideum CbfA mutant, indicating a deep conservation in the gene regulatory function of this domain in the dictyostelid clade. The CbfA-like protein CbfB displays ∼25% sequence identity with CbfA in the amino-terminal region, which contains a JmjC domain and two zinc finger regions and is thought to mediate chromatin-remodeling activity. In contrast to CbfA proteins, where the carboxy-terminal domains are strictly conserved in all dictyostelids, CbfB proteins have completely unrelated carboxy-terminal domains. Outside the dictyostelid clade, CbfA-like proteins with the CbfA-archetypical JmjC/zinc finger arrangement and individual carboxy-terminal domains are prominent in filamentous fungi but are not found in yeasts, plants, and metazoans. Our data suggest that two functional regions of the CbfA-like proteins evolved at different rates to allow the occurrence of species-specific adaptation processes during genome evolution. PMID:23355006

  11. Test functions for three-dimensional control-volume mixed finite-element methods on irregular grids

    USGS Publications Warehouse

    Naff, R.L.; Russell, T.F.; Wilson, J.D.; ,; ,; ,; ,; ,


    Numerical methods based on unstructured grids, with irregular cells, usually require discrete shape functions to approximate the distribution of quantities across cells. For control-volume mixed finite-element methods, vector shape functions are used to approximate the distribution of velocities across cells and vector test functions are used to minimize the error associated with the numerical approximation scheme. For a logically cubic mesh, the lowest-order shape functions are chosen in a natural way to conserve intercell fluxes that vary linearly in logical space. Vector test functions, while somewhat restricted by the mapping into the logical reference cube, admit a wider class of possibilities. Ideally, an error minimization procedure to select the test function from an acceptable class of candidates would be the best procedure. Lacking such a procedure, we first investigate the effect of possible test functions on the pressure distribution over the control volume; specifically, we look for test functions that allow for the elimination of intermediate pressures on cell faces. From these results, we select three forms for the test function for use in a control-volume mixed method code and subject them to an error analysis for different forms of grid irregularity; errors are reported in terms of the discrete L2 norm of the velocity error. Of these three forms, one appears to produce optimal results for most forms of grid irregularity.

  12. The evolutionarily dynamic IFN-inducible GTPase proteins play conserved immune functions in vertebrates and cephalochordates.


    Li, Guang; Zhang, Juyong; Sun, Yi; Wang, Hua; Wang, Yiquan


    Interferon (IFN)-inducible GTPases currently include four families of proteins: myxovirus resistant proteins (Mxs), guanylate-binding proteins (GBPs), immunity-related GTPase proteins (IRGs), and very large inducible GTPase proteins (VLIGs). They are all under conserved regulation by IFNs in humans and mice and play a critical role in preventing microbial infections. However, differences between vertebrates are poorly characterized, and their evolutionary origins have not been studied in detail. In this study, we performed comparative genomic analysis of the four families in 18 representative animals that yielded several unexpected results. Firstly, we found that Mx, GBP, and IRG protein families arose before the divergence of chordate subphyla, but VLIG emerged solely in vertebrates. Secondly, IRG, GBP, and VLIG families have experienced a high rate of gene gain and loss during the evolution, with the GBP family being lost entirely in two pufferfish and VLIG family lost in primates and carnivores. Thirdly, the regulation of these genes by IFNs is highly conserved throughout vertebrates although the VLIG protein sequences in fish have lost the first 870 amino acid residues. Finally, amphioxus IFN-inducible GTPase genes are all highly expressed in immune-related organs such as gill, liver, and intestine and are upregulated after challenge with PolyI:C and pathogens, although no IFNs or their receptors were detected in the current amphioxus genome database. These results suggest that IFN-inducible GTPase genes play conserved immune functions both in vertebrates and in cephalochordates.

  13. Structural and functional conservation of fungal MatA and human SRY sex-determining proteins.


    Czaja, Wioletta; Miller, Karen Y; Skinner, Michael K; Miller, Bruce L


    Sex determination in animals and fungi is regulated by specific sex-determining genes. The Aspergillus nidulans mating type gene matA and the human SRY (Sex-Determining Region Y) encode proteins containing a single HMG (high-mobility group) domain. Analysis of the amino-acid sequence of MatA and SRY transcription factors revealed significant structural similarity. The human SRY protein is able to functionally replace MatA and drives the sexual cycle in the fungus A. nidulans. Functional studies indicate that SRY drives early fruiting body development, and hybrid MatA protein carrying the SRY HMG box is fully capable of driving both early and late stages of sexual development, including gametogenesis. Our data suggest that SRY and MatA are both structurally and functionally related and conserved in regulating sexual processes. The fundamental mechanisms driving evolution of the genetic pathways underlying sex determination, sex chromosomes and sexual reproduction in eukaryotes appear similar.

  14. Transactivation domains are not functionally conserved between vertebrate and invertebrate serum response factors.


    Avila, Sonia; Casero, Marie-Carmen; Fernandez-Cantón, Rocío; Sastre, Leandro


    The transcription factor serum response factor (SRF) regulates expression of growth factor-dependent genes and muscle-specific genes in vertebrates. Homologous factors regulate differentiation of some ectodermic tissues in invertebrates. To explore the molecular basis of these different physiological functions, the functionality of human, Drosophila melanogaster and Artemia franciscana SRFs in mammalian cells has been compared in this article. D. melanogaster and, to a lesser extend, A. franciscana SRF co-expression represses the activity of strong SRF-dependent promoters, such as those of the mouse c-fos and A. franciscana actin 403 genes. Domain-exchange experiments showed that these results can be explained by the absence of a transactivation domain, functional in mammalian cells, in D. melanogaster and A. franciscana SRFs. Both invertebrate SRFs can dimerize with endogenous mouse SRF through the conserved DNA-binding and dimerization domain. Co-expression of human and A. franciscana SRFs activate expression of weaker SRF-dependent promoters, such as those of the human cardiac alpha-actin gene or an A. franciscana actin 403 promoter where the SRF-binding site has been mutated. Mapping of A. franciscana SRF domains involved in transcriptional activation has shown that the conserved DNA-binding and dimerization domain is neccessary, but not sufficient, for promoter activation in mammalian cells.

  15. Widespread Presence of Human BOULE Homologs among Animals and Conservation of Their Ancient Reproductive Function

    PubMed Central

    Naeem, Villian; Chen, Yanmei; Lee, Terrance; Angeloni, Nicholas; Wang, Yin; Xu, Eugene Yujun


    Sex-specific traits that lead to the production of dimorphic gametes, sperm in males and eggs in females, are fundamental for sexual reproduction and accordingly widespread among animals. Yet the sex-biased genes that underlie these sex-specific traits are under strong selective pressure, and as a result of adaptive evolution they often become divergent. Indeed out of hundreds of male or female fertility genes identified in diverse organisms, only a very small number of them are implicated specifically in reproduction in more than one lineage. Few genes have exhibited a sex-biased, reproductive-specific requirement beyond a given phylum, raising the question of whether any sex-specific gametogenesis factors could be conserved and whether gametogenesis might have evolved multiple times. Here we describe a metazoan origin of a conserved human reproductive protein, BOULE, and its prevalence from primitive basal metazoans to chordates. We found that BOULE homologs are present in the genomes of representative species of each of the major lineages of metazoans and exhibit reproductive-specific expression in all species examined, with a preponderance of male-biased expression. Examination of Boule evolution within insect and mammalian lineages revealed little evidence for accelerated evolution, unlike most reproductive genes. Instead, purifying selection was the major force behind Boule evolution. Furthermore, loss of function of mammalian Boule resulted in male-specific infertility and a global arrest of sperm development remarkably similar to the phenotype in an insect boule mutation. This work demonstrates the conservation of a reproductive protein throughout eumetazoa, its predominant testis-biased expression in diverse bilaterian species, and conservation of a male gametogenic requirement in mice. This shows an ancient gametogenesis requirement for Boule among Bilateria and supports a model of a common origin of spermatogenesis. PMID:20657660

  16. Extreme evolutionary conservation of functionally important regions in H1N1 influenza proteome.


    Warren, Samantha; Wan, Xiu-Feng; Conant, Gavin; Korkin, Dmitry


    The H1N1 subtype of influenza A virus has caused two of the four documented pandemics and is responsible for seasonal epidemic outbreaks, presenting a continuous threat to public health. Co-circulating antigenically divergent influenza strains significantly complicates vaccine development and use. Here, by combining evolutionary, structural, functional, and population information about the H1N1 proteome, we seek to answer two questions: (1) do residues on the protein surfaces evolve faster than the protein core residues consistently across all proteins that constitute the influenza proteome? and (2) in spite of the rapid evolution of surface residues in influenza proteins, are there any protein regions on the protein surface that do not evolve? To answer these questions, we first built phylogenetically-aware models of the patterns of surface and interior substitutions. Employing these models, we found a single coherent pattern of faster evolution on the protein surfaces that characterizes all influenza proteins. The pattern is consistent with the events of inter-species reassortment, the worldwide introduction of the flu vaccine in the early 80's, as well as the differences caused by the geographic origins of the virus. Next, we developed an automated computational pipeline to comprehensively detect regions of the protein surface residues that were 100% conserved over multiple years and in multiple host species. We identified conserved regions on the surface of 10 influenza proteins spread across all avian, swine, and human strains; with the exception of a small group of isolated strains that affected the conservation of three proteins. Surprisingly, these regions were also unaffected by genetic variation in the pandemic 2009 H1N1 viral population data obtained from deep sequencing experiments. Finally, the conserved regions were intrinsically related to the intra-viral macromolecular interaction interfaces. Our study may provide further insights towards the

  17. Annotation of Protein Domains Reveals Remarkable Conservation in the Functional Make up of Proteomes Across Superkingdoms.


    Nasir, Arshan; Naeem, Aisha; Khan, Muhammad Jawad; Nicora, Horacio D Lopez; Caetano-Anollés, Gustavo


    The functional repertoire of a cell is largely embodied in its proteome, the collection of proteins encoded in the genome of an organism. The molecular functions of proteins are the direct consequence of their structure and structure can be inferred from sequence using hidden Markov models of structural recognition. Here we analyze the functional annotation of protein domain structures in almost a thousand sequenced genomes, exploring the functional and structural diversity of proteomes. We find there is a remarkable conservation in the distribution of domains with respect to the molecular functions they perform in the three superkingdoms of life. In general, most of the protein repertoire is spent in functions related to metabolic processes but there are significant differences in the usage of domains for regulatory and extra-cellular processes both within and between superkingdoms. Our results support the hypotheses that the proteomes of superkingdom Eukarya evolved via genome expansion mechanisms that were directed towards innovating new domain architectures for regulatory and extra/intracellular process functions needed for example to maintain the integrity of multicellular structure or to interact with environmental biotic and abiotic factors (e.g., cell signaling and adhesion, immune responses, and toxin production). Proteomes of microbial superkingdoms Archaea and Bacteria retained fewer numbers of domains and maintained simple and smaller protein repertoires. Viruses appear to play an important role in the evolution of superkingdoms. We finally identify few genomic outliers that deviate significantly from the conserved functional design. These include Nanoarchaeum equitans, proteobacterial symbionts of insects with extremely reduced genomes, Tenericutes and Guillardia theta. These organisms spend most of their domains on information functions, including translation and transcription, rather than on metabolism and harbor a domain repertoire characteristic of

  18. Annotation of Protein Domains Reveals Remarkable Conservation in the Functional Make up of Proteomes Across Superkingdoms

    PubMed Central

    Nasir, Arshan; Naeem, Aisha; Khan, Muhammad Jawad; Lopez-Nicora, Horacio D.; Caetano-Anollés, Gustavo


    The functional repertoire of a cell is largely embodied in its proteome, the collection of proteins encoded in the genome of an organism. The molecular functions of proteins are the direct consequence of their structure and structure can be inferred from sequence using hidden Markov models of structural recognition. Here we analyze the functional annotation of protein domain structures in almost a thousand sequenced genomes, exploring the functional and structural diversity of proteomes. We find there is a remarkable conservation in the distribution of domains with respect to the molecular functions they perform in the three superkingdoms of life. In general, most of the protein repertoire is spent in functions related to metabolic processes but there are significant differences in the usage of domains for regulatory and extra-cellular processes both within and between superkingdoms. Our results support the hypotheses that the proteomes of superkingdom Eukarya evolved via genome expansion mechanisms that were directed towards innovating new domain architectures for regulatory and extra/intracellular process functions needed for example to maintain the integrity of multicellular structure or to interact with environmental biotic and abiotic factors (e.g., cell signaling and adhesion, immune responses, and toxin production). Proteomes of microbial superkingdoms Archaea and Bacteria retained fewer numbers of domains and maintained simple and smaller protein repertoires. Viruses appear to play an important role in the evolution of superkingdoms. We finally identify few genomic outliers that deviate significantly from the conserved functional design. These include Nanoarchaeum equitans, proteobacterial symbionts of insects with extremely reduced genomes, Tenericutes and Guillardia theta. These organisms spend most of their domains on information functions, including translation and transcription, rather than on metabolism and harbor a domain repertoire characteristic of

  19. Yeast gain-of-function mutations reveal structure–function relationships conserved among different subfamilies of transient receptor potential channels

    PubMed Central

    Su, Zhenwei; Zhou, Xinliang; Haynes, W. John; Loukin, Stephen H.; Anishkin, Andriy; Saimi, Yoshiro; Kung, Ching


    Transient receptor potential (TRP) channels found in animals, protists, and fungi are primary chemo-, thermo-, or mechanosensors. Current research emphasizes the characteristics of individual channels in each animal TRP subfamily but not the mechanisms common across subfamilies. A forward genetic screen of the TrpY1, the yeast TRP channel, recovered gain-of-function (GOF) mutations with phenotype in vivo and in vitro. Single-channel patch-clamp analyses of these GOF-mutant channels show prominent aberrations in open probability and channel kinetics. These mutations revealed functionally important aromatic amino acid residues in four locations: at the intracellular end of the fifth transmembrane helix (TM5), at both ends of TM6, and at the immediate extension of TM6. These aromatics have counterparts in most TRP subfamilies. The one in TM5 (F380L) aligns precisely with an exceptional Drosophila mutant allele (F550I) that causes constitutive activity in the canonical TRP channel, resulting in rapid and severe retinal degeneration beyond mere loss of phototaxis. Thus, this phenylalanine maintains the balance of various functional states (conformations) of a channel for insect phototransduction as well as one for fungal mechanotransduction. This residue is among a small cluster of phenylalanines found in all known subfamilies of TRP channels. This unique case illustrates that GOF mutations can reveal structure–function principles that can be generalized across different TRP subfamilies. It appears that the conserved aromatics in the four locations have conserved functions in most TRP channels. The possible mechanistic roles of these aromatics and the further use of yeast genetics to dissect TRP channels are discussed. PMID:18042709

  20. Functional architecture and evolution of transcriptional elements that drive gene coexpression.


    Brown, Christopher D; Johnson, David S; Sidow, Arend


    Transcriptional coexpression of interacting gene products is required for complex molecular processes; however, the function and evolution of cis-regulatory elements that orchestrate coexpression remain largely unexplored. We mutagenized 19 regulatory elements that drive coexpression of Ciona muscle genes and obtained quantitative estimates of the cis-regulatory activity of the 77 motifs that comprise these elements. We found that individual motif activity ranges broadly within and among elements, and among different instantiations of the same motif type. The activity of orthologous motifs is strongly constrained, although motif arrangement, type, and activity vary greatly among the elements of different co-regulated genes. Thus, the syntactical rules governing this regulatory function are flexible but become highly constrained evolutionarily once they are established in a particular element.

  1. [Analysis of trace elements in limestone for archeological functions

    SciTech Connect

    Blanc, A.; Holmes, L.; Harbottle, G.


    Numerous quarries in the Lutetian limestone formations of the Paris Basin provided stone for the building and the decoration of monuments from antiquity to the present. To determine the origin of stone used for masonry and sculptures in these monuments, a team of geologists and archaeologists has investigated 300 quarries and collected 2,300 samples. Petrographic and paleontologic examination of thin sections allows geologists to distinguish Lutetian limestones from Jurassic and Cretaceous limestones. Geologists also seek to formulate hypotheses regarding the origin of Lutetian limestones used for building and sculpture in the Paris region. In the search for the sources of building and sculptural stone, the analytical methods of geologists are limited because often several quarries produce the same lithofacies. A new tool is now available, however, to attack questions of provenance raised by art historians. Because limestones from different sources have distinctive patterns of trace-element concentrations, compositional analysis by neutron activation allows one to compare building or sculptural stone from one monument with stone from quarries or other monuments. This analytical method subjects a powdered limestone sample to standard neutron activation analysis procedures at Brookhaven National Laboratory. With the help of computer programs, the compositional fingerprints of Lutetian limestones can be determined and stored in a database. The limestone database contains data for approximately 2,100 samples from monuments, sculptures and quarries. It is particularly rich in samples from the Paris Basin.

  2. The importance of incorporating functional habitats into conservation planning for highly mobile species in dynamic systems.


    Webb, Matthew H; Terauds, Aleks; Tulloch, Ayesha; Bell, Phil; Stojanovic, Dejan; Heinsohn, Robert


    The distribution of mobile species in dynamic systems can vary greatly over time and space. Estimating their population size and geographic range can be problematic, with serious implications for conservation assessments. Scarce data on mobile species and the resources they need can also limit the type of analytical approaches available to derive such estimates. Here we quantify dynamic change in availability and use of key ecological resources required for breeding (i.e. food and nesting sites) for a critically endangered nomadic habitat specialist, the swift parrot (Lathamus discolor). We compare estimates of occupied habitat (km(2) ) derived from dynamic presence-background data climatic models to those derived from dynamic occupancy models that include a direct measure of food availability. We also compare estimates that incorporate fine resolution information on key ecological resources (i.e functional habitats) into distribution maps with more common approaches that typically focus on broader climatic suitability. For all models, both the extent and spatial location of occupied areas varied dramatically over the study period. The occupancy models produced significantly smaller (up to an order of magnitude) and more spatially discrete estimates of occupied habitat than climate-based models. Estimates accounting for the area of functional habitats were also significantly smaller than estimates based only on occupied habitat. Importantly, an increase (or decrease) in one functional habitat did not necessarily correspond to changes in the other, with consequences for overall habitat functionality. We argue that these patterns are typical for mobile resource specialists, but currently go unnoticed due to limited data on (1) species' presence/absence and (2) availability of key resources. Understanding changes in the relative availability of functional habitats is crucial to informing conservation planning and accurately assessing extinction risk for mobile

  3. Extensions of PDZ domains as important structural and functional elements.


    Wang, Conan K; Pan, Lifeng; Chen, Jia; Zhang, Mingjie


    'Divide and conquer' has been the guiding strategy for the study of protein structure and function. Proteins are divided into domains with each domain having a canonical structural definition depending on its type. In this review, we push forward with the interesting observation that many domains have regions outside of their canonical definition that affect their structure and function; we call these regions 'extensions'. We focus on the highly abundant PDZ (PSD-95, DLG1 and ZO-1) domain. Using bioinformatics, we find that many PDZ domains have potential extensions and we developed an openly-accessible website to display our results ( ). We propose, using well-studied PDZ domains as illustrative examples, that the roles of PDZ extensions can be classified into at least four categories: 1) protein dynamics-based modulation of target binding affinity, 2) provision of binding sites for macro-molecular assembly, 3) structural integration of multi-domain modules, and 4) expansion of the target ligand-binding pocket. Our review highlights the potential structural and functional importance of domain extensions, highlighting the significance of looking beyond the canonical boundaries of protein domains in general.

  4. Functional conservation of nucleosome formation selectively biases presumably neutral molecular variation in yeast genomes.


    Babbitt, Gregory A; Cotter, C R


    One prominent pattern of mutational frequency, long appreciated in comparative genomics, is the bias of purine/pyrimidine conserving substitutions (transitions) over purine/pyrimidine altering substitutions (transversions). Traditionally, this transitional bias has been thought to be driven by the underlying rates of DNA mutation and/or repair. However, recent sequencing studies of mutation accumulation lines in model organisms demonstrate that substitutions generally do not accumulate at rates that would indicate a transitional bias. These observations have called into question a very basic assumption of molecular evolution; that naturally occurring patterns of molecular variation in noncoding regions accurately reflect the underlying processes of randomly accumulating neutral mutation in nuclear genomes. Here, in Saccharomyces yeasts, we report a very strong inverse association (r = -0.951, P < 0.004) between the genome-wide frequency of substitutions and their average energetic effect on nucleosome formation, as predicted by a structurally based energy model of DNA deformation around the nucleosome core. We find that transitions occurring at sites positioned nearest the nucleosome surface, which are believed to function most importantly in nucleosome formation, alter the deformation energy of DNA to the nucleosome core by only a fraction of the energy changes typical of most transversions. When we examined the same substitutions set against random background sequences as well as an existing study reporting substitutions arising in mutation accumulation lines of Saccharomyces cerevisiae, we failed to find a similar relationship. These results support the idea that natural selection acting to functionally conserve chromatin organization may contribute significantly to genome-wide transitional bias, even in noncoding regions. Because nucleosome core structure is highly conserved across eukaryotes, our observations may also help to further explain locally elevated

  5. Comparative proteomics reveals a significant bias toward alternative protein isoforms with conserved structure and function.


    Ezkurdia, Iakes; del Pozo, Angela; Frankish, Adam; Rodriguez, Jose Manuel; Harrow, Jennifer; Ashman, Keith; Valencia, Alfonso; Tress, Michael L


    Advances in high-throughput mass spectrometry are making proteomics an increasingly important tool in genome annotation projects. Peptides detected in mass spectrometry experiments can be used to validate gene models and verify the translation of putative coding sequences (CDSs). Here, we have identified peptides that cover 35% of the genes annotated by the GENCODE consortium for the human genome as part of a comprehensive analysis of experimental spectra from two large publicly available mass spectrometry databases. We detected the translation to protein of "novel" and "putative" protein-coding transcripts as well as transcripts annotated as pseudogenes and nonsense-mediated decay targets. We provide a detailed overview of the population of alternatively spliced protein isoforms that are detectable by peptide identification methods. We found that 150 genes expressed multiple alternative protein isoforms. This constitutes the largest set of reliably confirmed alternatively spliced proteins yet discovered. Three groups of genes were highly overrepresented. We detected alternative isoforms for 10 of the 25 possible heterogeneous nuclear ribonucleoproteins, proteins with a key role in the splicing process. Alternative isoforms generated from interchangeable homologous exons and from short indels were also significantly enriched, both in human experiments and in parallel analyses of mouse and Drosophila proteomics experiments. Our results show that a surprisingly high proportion (almost 25%) of the detected alternative isoforms are only subtly different from their constitutive counterparts. Many of the alternative splicing events that give rise to these alternative isoforms are conserved in mouse. It was striking that very few of these conserved splicing events broke Pfam functional domains or would damage globular protein structures. This evidence of a strong bias toward subtle differences in CDS and likely conserved cellular function and structure is remarkable and

  6. New functional families (FunFams) in CATH to improve the mapping of conserved functional sites to 3D structures.


    Sillitoe, Ian; Cuff, Alison L; Dessailly, Benoit H; Dawson, Natalie L; Furnham, Nicholas; Lee, David; Lees, Jonathan G; Lewis, Tony E; Studer, Romain A; Rentzsch, Robert; Yeats, Corin; Thornton, Janet M; Orengo, Christine A


    CATH version 3.5 (Class, Architecture, Topology, Homology, available at contains 173 536 domains, 2626 homologous superfamilies and 1313 fold groups. When focusing on structural genomics (SG) structures, we observe that the number of new folds for CATH v3.5 is slightly less than for previous releases, and this observation suggests that we may now know the majority of folds that are easily accessible to structure determination. We have improved the accuracy of our functional family (FunFams) sub-classification method and the CATH sequence domain search facility has been extended to provide FunFam annotations for each domain. The CATH website has been redesigned. We have improved the display of functional data and of conserved sequence features associated with FunFams within each CATH superfamily.

  7. Vestigial and scalloped in the ladybird beetle: a conserved function in wing development and a novel function in pupal ecdysis.


    Ohde, T; Masumoto, M; Morita-Miwa, M; Matsuura, H; Yoshioka, H; Yaginuma, T; Niimi, T


    In Drosophila melanogaster, Vestigial (Vg) and Scalloped (Sd) form a transcription factor complex and play a crucial role in wing development. To extend our knowledge of insect wing formation, we isolated vg and sd homologues from two ladybird beetle species, Henosepilachna vigintioctopunctata and Harmonia axyridis. Although the ladybird beetle vg homologues had only low homology with D. melanogaster vg, ectopic expression of H. vigintioctopunctata vg induced wing-like tissues in antennae and legs of D. melanogaster. Subsequent larval RNA interference (RNAi) analysis in H. vigintioctopunctata demonstrated conserved functions of vg and sd in wing development, and an unexpected novel function of sd in pupal ecdysis. Furthermore, our results can be applied to the production of a flightless ladybird beetle for biological control purposes using larval RNAi.

  8. Rare earth elements (REEs) in the tropical South Atlantic and quantitative deconvolution of their non-conservative behavior

    NASA Astrophysics Data System (ADS)

    Zheng, Xin-Yuan; Plancherel, Yves; Saito, Mak A.; Scott, Peter M.; Henderson, Gideon M.


    This study presents new concentration measurements of dissolved rare earth elements (dREEs) along a full-depth east-west section across the tropical South Atlantic (∼12°S), and uses these data to investigate the oceanic cycling of the REEs. Enrichment of dREEs, associated with the redox cycling of Fe-Mn oxides, is observed in the oxygen minimum zone (OMZ) off the African shelf. For deeper-waters, a multi-parameter mixing model was developed to deconvolve the relative importance of physical transport (i.e., water mass mixing) from biogeochemical controls on the dREE distribution in the deep Atlantic. This approach enables chemical processes involved in REE cycling, not apparent from the measurements alone, to be distinguished and quantified. Results show that the measured dREE concentrations below ∼1000 m are dominantly controlled (>75%) by preformed REE concentrations resulting from water mass mixing. This result indicates that the linear correlation between dREEs and dissolved Si observed in Atlantic deep waters results from the dominantly conservative behavior of these tracers, rather than from similar chemical processes influencing both dREEs and Si. Minor addition of dREEs (∼10% of dNd and ∼5% of dYb) is observed in the deep (>∼4000 m) Brazil Basin, resulting from either remineralization of particles in-situ or along the flow path. Greater addition of dREEs (up to 25% for dNd and 20% for dYb) is found at ∼1500 m and below ∼4000 m in the Angola Basin near the African continental margin. Cerium anomalies suggest that different sources are responsible for these dREE addition plumes. The 1500 m excess is most likely attributed to dREE release from Fe oxides, whereas the 4000 m excess may be due to remineralization of calcite. Higher particulate fluxes and a more sluggish ocean circulation in the Angola Basin may explain why the dREE excesses in this basin are significantly higher than that observed in the Brazil Basin. Hydrothermal venting over the

  9. Microbial response to simulated global change is phylogenetically conserved and linked with functional potential.


    Amend, Anthony S; Martiny, Adam C; Allison, Steven D; Berlemont, Renaud; Goulden, Michael L; Lu, Ying; Treseder, Kathleen K; Weihe, Claudia; Martiny, Jennifer B H


    The high diversity of microbial communities hampers predictions about their responses to global change. Here we investigate the potential for using a phylogenetic, trait-based framework to capture the response of bacteria and fungi to global change manipulations. Replicated grassland plots were subjected to 3+ years of drought and nitrogen fertilization. The responses of leaf litter bacteria and fungi to these simulated changes were significantly phylogenetically conserved. Proportional changes in abundance were highly correlated among related organisms, such that relatives with approximately 5% ribosomal DNA genetic distance showed similar responses to the treatments. A microbe's change in relative abundance was significantly correlated between the treatments, suggesting a compromise between numerical abundance in undisturbed environments and resistance to change in general, independent of disturbance type. Lineages in which at least 90% of the microbes shared the same response were circumscribed at a modest phylogenetic depth (τD 0.014-0.021), but significantly larger than randomized simulations predict. In several clades, phylogenetic depth of trait consensus was higher. Fungal response to drought was more conserved than was response to nitrogen fertilization, whereas bacteria responded equally to both treatments. Finally, we show that a bacterium's response to the manipulations is correlated with its potential functional traits (measured here as the number of glycoside hydrolase genes encoding the capacity to degrade different types of carbohydrates). Together, these results suggest that a phylogenetic, trait-based framework may be useful for predicting shifts in microbial composition and functioning in the face of global change.

  10. Boltzmann-conserving classical dynamics in quantum time-correlation functions: “Matsubara dynamics”

    SciTech Connect

    Hele, Timothy J. H.; Willatt, Michael J.; Muolo, Andrea; Althorpe, Stuart C.


    We show that a single change in the derivation of the linearized semiclassical-initial value representation (LSC-IVR or “classical Wigner approximation”) results in a classical dynamics which conserves the quantum Boltzmann distribution. We rederive the (standard) LSC-IVR approach by writing the (exact) quantum time-correlation function in terms of the normal modes of a free ring-polymer (i.e., a discrete imaginary-time Feynman path), taking the limit that the number of polymer beads N → ∞, such that the lowest normal-mode frequencies take their “Matsubara” values. The change we propose is to truncate the quantum Liouvillian, not explicitly in powers of ħ{sup 2} at ħ{sup 0} (which gives back the standard LSC-IVR approximation), but in the normal-mode derivatives corresponding to the lowest Matsubara frequencies. The resulting “Matsubara” dynamics is inherently classical (since all terms O(ħ{sup 2}) disappear from the Matsubara Liouvillian in the limit N → ∞) and conserves the quantum Boltzmann distribution because the Matsubara Hamiltonian is symmetric with respect to imaginary-time translation. Numerical tests show that the Matsubara approximation to the quantum time-correlation function converges with respect to the number of modes and gives better agreement than LSC-IVR with the exact quantum result. Matsubara dynamics is too computationally expensive to be applied to complex systems, but its further approximation may lead to practical methods.

  11. Functional Outcome of Conservatively Treated Bilateral Neck of Femur Fracture in an Elderly: A Case Report

    PubMed Central


    Bilateral Neck of Femur (NOF) fractures is relatively rare. Surgery, either osteosynthesis or hemireplacement arthroplasty, is the mainstay of treatment. Significant complications are known to occur in such cases. In this case report, we present the functional outcome of a conservatively treated bilateral NOF fracture at one year, in a 93-year-old man. Our patient, a 93-year-old gentleman, sustained right side NOF fracture in May 2014 and left side NOF fracture in May 2015, both after trivial fall. He did not give consent for surgery considering high operative risk. Now, at one year follow-up he has no true or apparent limb length discrepancy. He is ambulant with walker, self reliant for toilet care and other personal needs. Harris hip score is 75.80 and 69.65 after 1 year from right and left NOF fracture respectively. In view of high mortality after surgery for NOF fracture in high risk patients or unavailability of resources, conservative treatment for bilateral NOF fracture can achieve satisfactory functional outcome in selected patients. PMID:28208960

  12. Functional conservation and diversification of the soybean maturity gene E1 and its homologs in legumes

    PubMed Central

    Zhang, Xingzheng; Zhai, Hong; Wang, Yaying; Tian, Xiaojie; Zhang, Yupeng; Wu, Hongyan; Lü, Shixiang; Yang, Guang; Li, Yuqiu; Wang, Lu; Hu, Bo; Bu, Qingyun; Xia, Zhengjun


    Gene regulatory networks involved in flowering time and photoperiodic responses in legumes remain unknown. Although the major maturity gene E1 has been successfully deciphered in soybean, knowledge on the functional conservation of this gene is limited to a certain extent to E1 homologs in legumes. The ectopic expression of Phvul.009G204600 (PvE1L), an E1 homolog from common bean, delayed the onset of flowering in soybean. By contrast, the ectopic expression of Medtr2g058520 (MtE1L) from Medicago truncatula did not affect the flowering of soybean. Characterization of the late-flowering mte1l mutant indicated that MtE1L promoted flowering in Medicago truncatula. Moreover, all transgenic E1, PvE1L and MtE1L soybean lines exhibited phenotypic changes in terms of plant height. Transgenic E1 or PvE1L plants were taller than the wild-type, whereas transgenic MtE1L plants produced dwarf phenotype with few nodes and short internode. Thus, functional conservation and diversification of E1 family genes from legumes in the regulation of flowering and plant growth may be associated with lineage specification and genomic duplication. PMID:27405888

  13. Post-transcriptional regulation of cytokine genes in fish: A role for conserved AU-rich elements located in the 3'-untranslated region of their mRNAs.


    Roca, Francisco J; Cayuela, María L; Secombes, Chris J; Meseguer, José; Mulero, Victoriano


    The overproduction of cytokines, such us interleukin-1beta (IL-1beta) and tumor necrosis factor alpha (TNFalpha), contributes to the pathological complications observed in many inflammatory diseases caused by bacterial endotoxins. The synthesis of these cytokines is tightly regulated at both transcriptional and post-transcriptional levels. Post-transcriptional regulation of gene expression depends on specific cis-acting sequences and trans-acting factors. Thus, the presence of adenylate- and uridylate-rich (AU-rich) elements (AREs) has been described in the 3'-untranslated regions (UTRs) of many unstable mammalian mRNAs. Although, it represents the most widespread, phylogenetically conserved and efficient determinant of mRNA stability among those so far characterized in mammalian cells, no studies are available on the functional relevance of this sequence in non-mammalian vertebrates. In this contribution, we study the enzymatic activity of various luciferase reporter constructs, containing or lacking the 3'UTR of IL-1beta and TNFalpha from different fish species, and report the finding that bony fish AREs are able to decrease luciferase activity but are less potent than their mammalian counterparts. Surprisingly, the 3'UTR of the IL-1beta from the cartilaginous fish small spotted catshark had the greatest ability to decrease luciferase activity. Lastly, the functional significance of the above was confirmed by measuring the half-life of IL-1beta and TNFalpha mRNAs in gilthead seabream leukocytes by blocking transcription with actinomycin D. Both cytokine mRNAs were unstable with an estimated half-life of about 45 min in control and activated cells.

  14. Evolutionarily conserved odorant receptor function questions ecological context of octenol role in mosquitoes

    PubMed Central

    Dekel, Amir; Pitts, Ronald J.; Yakir, Esther; Bohbot, Jonathan D.


    Olfaction is a key insect adaptation to a wide range of habitats. In the last thirty years, the detection of octenol by blood-feeding insects has been primarily understood in the context of animal host-seeking. The recent discovery of a conserved octenol receptor gene in the strictly nectar-feeding elephant mosquito Toxorhynchites amboinensis (TaOr8) suggests a different biological role. Here, we show that TaOR8 is a functional ortholog of its counterparts in blood-feeding mosquitoes displaying selectivity towards the (R)-enantiomer of octenol and susceptibility to the insect repellent DEET. These findings suggest that while the function of OR8 has been maintained throughout mosquito evolution, the context in which this receptor is operating has diverged in blood and nectar-feeding mosquitoes. PMID:27849027

  15. Functional conservation between mammalian MGRN1 and plant LOG2 ubiquitin ligases.


    Guerra, Damian D; Pratelli, Réjane; Kraft, Edward; Callis, Judy; Pilot, Guillaume


    Plant LOSS OF GDU 2 (LOG2) and Mammalian Mahogunin Ring Finger 1 (MGRN1) proteins are RING-type E3 ligases sharing similarity N-terminal to the RING domain. Deletion of this region disrupts the interaction of LOG2 with the plant membrane protein GLUTAMINE DUMPER1 (GDU1). Phylogenetic analysis identified two clades of LOG2/MGRN1-like proteins in vertebrates and plants. The ability of MGRN1 to functionally replace LOG2 was tested. MGRN1 ubiquitylates GDU1 in vitro and can partially substitute for LOG2 in the plant, partially restoring amino acid resistance to a GDU1-myc over-expression, log2-2 background. Altogether, these results suggest a conserved function for the N-terminal domain in evolution.

  16. EAG2 potassium channel with evolutionarily conserved function as a brain tumor target

    PubMed Central

    Huang, Xi; He, Ye; Dubuc, Adrian M.; Hashizume, Rintaro; Zhang, Wei; Reimand, Jüri; Yang, Huanghe; Wang, Tongfei A.; Stehbens, Samantha J.; Younger, Susan; Barshow, Suzanne; Zhu, Sijun; Cooper, Michael K.; Peacock, John; Ramaswamy, Vijay; Garzia, Livia; Wu, Xiaochong; Remke, Marc; Forester, Craig M.; Kim, Charles C.; Weiss, William A.; James, C. David; Shuman, Marc A.; Bader, Gary D.; Mueller, Sabine; Taylor, Michael D.; Jan, Yuh Nung; Jan, Lily Yeh


    Over 20% of the drugs for treating human diseases target ion channels, however, no cancer drug approved by the U.S. Food and Drug Administration (FDA) is intended to target an ion channel. Here, we demonstrate the evolutionarily conserved function of EAG2 potassium channel in promoting brain tumor growth and metastasis, delineate downstream pathways and uncover a mechanism for different potassium channels to functionally corporate and regulate mitotic cell volume and tumor progression. We show that EAG2 potassium channel is enriched at the trailing edge of migrating MB cells to regulate local cell volume dynamics, thereby facilitating cell motility. We identify the FDA-approved antipsychotic drug thioridazine as an EAG2 channel blocker that reduces xenografted MB growth and metastasis, and present a case report of repurposing thioridazine for treating a human patient. Our findings thus illustrate the potential of targeting ion channels in cancer treatment. PMID:26258683

  17. Characterization of "cis"-regulatory elements ("c"RE) associated with mammary gland function

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The Bos taurus genome assembly has propelled dairy science into a new era; still, most of the information encoded in the genome has not yet been decoded. The human Encyclopedia of DNA Elements (ENCODE) project has spearheaded the identification and annotation of functional genomic elements in the hu...

  18. Calculation of Moment Matrix Elements for Bilinear Quadrilaterals and Higher-Order Basis Functions

    DTIC Science & Technology



  19. Assessing functional annotation transfers with inter-species conserved coexpression: application to Plasmodium falciparum

    PubMed Central


    Background Plasmodium falciparum is the main causative agent of malaria. Of the 5 484 predicted genes of P. falciparum, about 57% do not have sufficient sequence similarity to characterized genes in other species to warrant functional assignments. Non-homology methods are thus needed to obtain functional clues for these uncharacterized genes. Gene expression data have been widely used in the recent years to help functional annotation in an intra-species way via the so-called Guilt By Association (GBA) principle. Results We propose a new method that uses gene expression data to assess inter-species annotation transfers. Our approach starts from a set of likely orthologs between a reference species (here S. cerevisiae and D. melanogaster) and a query species (P. falciparum). It aims at identifying clusters of coexpressed genes in the query species whose coexpression has been conserved in the reference species. These conserved clusters of coexpressed genes are then used to assess annotation transfers between genes with low sequence similarity, enabling reliable transfers of annotations from the reference to the query species. The approach was used with transcriptomic data sets of P. falciparum, S. cerevisiae and D. melanogaster, and enabled us to propose with high confidence new/refined annotations for several dozens hypothetical/putative P. falciparum genes. Notably, we revised the annotation of genes involved in ribosomal proteins and ribosome biogenesis and assembly, thus highlighting several potential drug targets. Conclusions Our approach uses both sequence similarity and gene expression data to help inter-species gene annotation transfers. Experiments show that this strategy improves the accuracy achieved when using solely sequence similarity and outperforms the accuracy of the GBA approach. In addition, our experiments with P. falciparum show that it can infer a function for numerous hypothetical genes. PMID:20078859

  20. The CRC orthologue from Pisum sativum shows conserved functions in carpel morphogenesis and vascular development

    PubMed Central

    Fourquin, Chloé; Primo, Amparo; Martínez-Fernández, Irene; Huet-Trujillo, Estefanía; Ferrándiz, Cristina


    Background and Aims CRABS CLAW (CRC) is a member of the YABBY family of transcription factors involved in carpel morphogenesis, floral determinacy and nectary specification in arabidopsis. CRC orthologues have been functionally characterized across angiosperms, revealing additional roles in leaf vascular development and carpel identity specification in Poaceae. These studies support an ancestral role of CRC orthologues in carpel development, while roles in vascular development and nectary specification appear to be derived. This study aimed to expand research on CRC functional conservation to the legume family in order to better understand the evolutionary history of CRC orthologues in angiosperms. Methods CRC orthologues from Pisum sativum and Medicago truncatula were identified. RNA in situ hybridization experiments determined the corresponding expression patterns throughout flower development. The phenotypic effects of reduced CRC activity were investigated in P. sativum using virus-induced gene silencing. Key Results CRC orthologues from P. sativum and M. truncatula showed similar expression patterns, mainly restricted to carpels and nectaries. However, these expression patterns differed from those of other core eudicots, most importantly in a lack of abaxial expression in the carpel and in atypical expression associated with the medial vein of the ovary. CRC downregulation in pea caused defects in carpel fusion and style/stigma development, both typically associated with CRC function in eudicots, but also affected vascular development in the carpel. Conclusions The data support the conserved roles of CRC orthologues in carpel fusion, style/stigma development and nectary development. In addition, an intriguing new aspect of CRC function in legumes was the unexpected role in vascular development, which could be shared by other species from widely diverged clades within the angiosperms, suggesting that this role could be ancestral rather than derived, as so far

  1. Surveying DNA Elements within Functional Genes of Heterocyst-Forming Cyanobacteria.


    Hilton, Jason A; Meeks, John C; Zehr, Jonathan P


    Some cyanobacteria are capable of differentiating a variety of cell types in response to environmental factors. For instance, in low nitrogen conditions, some cyanobacteria form heterocysts, which are specialized for N2 fixation. Many heterocyst-forming cyanobacteria have DNA elements interrupting key N2 fixation genes, elements that are excised during heterocyst differentiation. While the mechanism for the excision of the element has been well-studied, many questions remain regarding the introduction of the elements into the cyanobacterial lineage and whether they have been retained ever since or have been lost and reintroduced. To examine the evolutionary relationships and possible function of DNA sequences that interrupt genes of heterocyst-forming cyanobacteria, we identified and compared 101 interruption element sequences within genes from 38 heterocyst-forming cyanobacterial genomes. The interruption element lengths ranged from about 1 kb (the minimum able to encode the recombinase responsible for element excision), up to nearly 1 Mb. The recombinase gene sequences served as genetic markers that were common across the interruption elements and were used to track element evolution. Elements were found that interrupted 22 different orthologs, only five of which had been previously observed to be interrupted by an element. Most of the newly identified interrupted orthologs encode proteins that have been shown to have heterocyst-specific activity. However, the presence of interruption elements within genes with no known role in N2 fixation, as well as in three non-heterocyst-forming cyanobacteria, indicates that the processes that trigger the excision of elements may not be limited to heterocyst development or that the elements move randomly within genomes. This comprehensive analysis provides the framework to study the history and behavior of these unique sequences, and offers new insight regarding the frequency and persistence of interruption elements in

  2. Surveying DNA Elements within Functional Genes of Heterocyst-Forming Cyanobacteria

    PubMed Central

    Hilton, Jason A.; Meeks, John C.; Zehr, Jonathan P.


    Some cyanobacteria are capable of differentiating a variety of cell types in response to environmental factors. For instance, in low nitrogen conditions, some cyanobacteria form heterocysts, which are specialized for N2 fixation. Many heterocyst-forming cyanobacteria have DNA elements interrupting key N2 fixation genes, elements that are excised during heterocyst differentiation. While the mechanism for the excision of the element has been well-studied, many questions remain regarding the introduction of the elements into the cyanobacterial lineage and whether they have been retained ever since or have been lost and reintroduced. To examine the evolutionary relationships and possible function of DNA sequences that interrupt genes of heterocyst-forming cyanobacteria, we identified and compared 101 interruption element sequences within genes from 38 heterocyst-forming cyanobacterial genomes. The interruption element lengths ranged from about 1 kb (the minimum able to encode the recombinase responsible for element excision), up to nearly 1 Mb. The recombinase gene sequences served as genetic markers that were common across the interruption elements and were used to track element evolution. Elements were found that interrupted 22 different orthologs, only five of which had been previously observed to be interrupted by an element. Most of the newly identified interrupted orthologs encode proteins that have been shown to have heterocyst-specific activity. However, the presence of interruption elements within genes with no known role in N2 fixation, as well as in three non-heterocyst-forming cyanobacteria, indicates that the processes that trigger the excision of elements may not be limited to heterocyst development or that the elements move randomly within genomes. This comprehensive analysis provides the framework to study the history and behavior of these unique sequences, and offers new insight regarding the frequency and persistence of interruption elements in

  3. Genome-Wide Gene Expression Profiling Reveals Conserved and Novel Molecular Functions of the Stigma in Rice1[W

    PubMed Central

    Li, Meina; Xu, Wenying; Yang, Wenqiang; Kong, Zhaosheng; Xue, Yongbiao


    In angiosperms, the stigma provides initial nutrients and guidance cues for pollen grain germination and tube growth. However, little is known about the genes that regulate these processes in rice (Oryza sativa). Here, we generate rice stigma-specific or -preferential gene expression profiles through comparing genome-wide expression patterns of hand-dissected, unpollinated stigma at anthesis with seven tissues, including seedling shoot, seedling root, mature anther, ovary at anthesis, seeds 5 d after pollination, 10-d-old embryo, 10-d-old endosperm, and suspension-cultured cells by using both 57 K Affymetrix rice whole-genome array and 10 K rice cDNA microarray. A high reproducibility of the microarray results was detected between the two different technology platforms. In total, we identified 548 genes to be expressed specifically or predominantly in the stigma papillar cells of rice. Real-time quantitative reverse transcription-polymerase chain reaction analysis of 34 selected genes all confirmed their stigma-specific expression. The expression of five selected genes was further validated by RNA in situ hybridization. Gene Ontology analysis shows that several auxin-signaling components, transcription, and stress-related genes are significantly overrepresented in the rice stigma gene set. Interestingly, most of them also share several cis-regulatory elements with known stress-responsive genes, supporting the notion of an overlap of genetic programs regulating pollination and stress/defense responses. We also found that genes involved in cell wall metabolism and cellular communication appear to be conserved in the stigma between rice and Arabidopsis (Arabidopsis thaliana). Our results indicate that the stigmas appear to have conserved and novel molecular functions between rice and Arabidopsis. PMID:17556504

  4. Zebrafish mesonephric renin cells are functionally conserved and comprise two distinct morphological populations.


    Rider, Sebastien A; Christian, Helen C; Mullins, Linda J; Howarth, Amelia R; MacRae, Calum A; Mullins, John J


    Zebrafish provide an excellent model in which to assess the role of the renin-angiotensin system in renal development, injury, and repair. In contrast to mammals, zebrafish kidney organogenesis terminates with the mesonephros. Despite this, the basic functional structure of the nephron is conserved across vertebrates. The relevance of teleosts for studies relating to the regulation of the renin-angiotensin system was established by assessing the phenotype and functional regulation of renin-expressing cells in zebrafish. Transgenic fluorescent reporters for renin (ren), smooth muscle actin (acta2), and platelet-derived growth factor receptor-beta (pdgfrb) were studied to determine the phenotype and secretory ultrastructure of perivascular renin-expressing cells. Whole kidney ren transcription responded to altered salinity, pharmacological renin-angiotensin system inhibition, and renal injury. Mesonephric ren-expressing cells occupied niches at the preglomerular arteries and afferent arterioles, forming intermittent epithelioid-like multicellular clusters exhibiting a granular secretory ultrastructure. In contrast, renin cells of the efferent arterioles were thin bodied and lacked secretory granules. Renin cells expressed the perivascular cell markers acta2 and pdgfrb Transcriptional responses of ren to physiological challenge support the presence of a functional renin-angiotensin system and are consistent with the production of active renin. The reparative capability of the zebrafish kidney was harnessed to demonstrate that ren transcription is a marker for renal injury and repair. Our studies demonstrate substantive conservation of renin regulation across vertebrates, and ultrastructural studies of renin cells reveal at least two distinct morphologies of mesonephric perivascular ren-expressing cells.

  5. Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants

    PubMed Central

    Zeng, Changying; Wang, Wenquan; Zheng, Yun; Chen, Xin; Bo, Weiping; Song, Shun; Zhang, Weixiong; Peng, Ming


    MicroRNAs (miRNAs) are ∼21 nt non-coding RNAs which regulate post-transcriptional gene expression. miRNAs are key regulators of nearly all essential biological processes. Aiming at understanding miRNA’s functions in Euphorbiaceae, a large flowering plant family, we performed a genome-scale systematic study of miRNAs in Euphorbiaceae, by combining computational prediction and experimental analysis to overcome the difficulty of lack of genomes for most Euphorbiaceous species. Specifically, we predicted 85 conserved miRNAs in 23 families in the Castor bean (Ricinus communis), and experimentally verified and characterized 58 (68.2%) of the 85 miRNAs in at least one of four Euphorbiaceous species, the Castor bean, the Cassava (Manihot esculenta), the Rubber tree (Hevea brasiliensis) and the Jatropha (Jatropha curcas) during normal seedling development. To elucidate their function in stress response, we verified and profiled 48 (56.5%) of the 85 miRNAs under cold and drought stresses as well as during the processes of stress recovery. The results revealed some species- and condition-specific miRNA expression patterns. Finally, we predicted 258 miRNA:target partners, and identified the cleavage sites of six out of ten miRNA targets by a modified 5′ RACE. This study produced the first collection of miRNAs and their targets in Euphorbiaceae. Our results revealed wide conservation of many miRNAs and diverse functions in Euphorbiaceous plants during seedling growth and in response to abiotic stresses. PMID:19942686

  6. A Conserved Streptococcal Membrane Protein, LsrS, Exhibits a Receptor-Like Function for Lantibiotics

    PubMed Central

    Biswas, Saswati


    Streptococcus mutans strain GS-5 produces a two-peptide lantibiotic, Smb, which displays inhibitory activity against a broad spectrum of bacteria, including other streptococci. For inhibition, lantibiotics must recognize specific receptor molecules present on the sensitive bacterial cells. However, so far no such receptor proteins have been identified for any lantibiotics. In this study, using a powerful transposon mutagenesis approach, we have identified in Streptococcus pyogenes a gene that exhibits a receptor-like function for Smb. The protein encoded by that gene, which we named LsrS, is a membrane protein belonging to the CAAX protease family. We also found that nisin, a monopeptide lantibiotic, requires LsrS for its optimum inhibitory activity. However, we found that LsrS is not required for inhibition by haloduracin and galolacticin, both of which are two-peptide lantibiotics closely related to Smb. LsrS appears to be a well-conserved protein that is present in many streptococci, including S. mutans. Inactivation of SMU.662, an LsrS homolog, in S. mutans strains UA159 and V403 rendered the cells refractory to Smb-mediated killing. Furthermore, overexpression of LsrS in S. mutans created cells more susceptible to Smb. Although LsrS and its homolog contain the CAAX protease domain, we demonstrate that inactivation of the putative active sites on the LsrS protein has no effect on its receptor-like function. This is the first report describing a highly conserved membrane protein that displays a receptor-like function for lantibiotics. PMID:24509319

  7. The contrasting properties of conservation and correlated phylogeny in protein functional residue prediction

    PubMed Central

    Manning, Jonathan R; Jefferson, Emily R; Barton, Geoffrey J


    Background Amino acids responsible for structure, core function or specificity may be inferred from multiple protein sequence alignments where a limited set of residue types are tolerated. The rise in available protein sequences continues to increase the power of techniques based on this principle. Results A new algorithm, SMERFS, for predicting protein functional sites from multiple sequences alignments was compared to 14 conservation measures and to the MINER algorithm. Validation was performed on an automatically generated dataset of 1457 families derived from the protein interactions database SNAPPI-DB, and a smaller manually curated set of 148 families. The best performing measure overall was Williamson property entropy, with ROC0.1 scores of 0.0087 and 0.0114 for domain and small molecule contact prediction, respectively. The Lancet method performed worse than random on protein-protein interaction site prediction (ROC0.1 score of 0.0008). The SMERFS algorithm gave similar accuracy to the phylogenetic tree-based MINER algorithm but was superior to Williamson in prediction of non-catalytic transient complex interfaces. SMERFS predicts sites that are significantly more solvent accessible compared to Williamson. Conclusion Williamson property entropy is the the best performing of 14 conservation measures examined. The difference in performance of SMERFS relative to Williamson in manually defined complexes was dependent on complex type. The best choice of analysis method is therefore dependent on the system of interest. Additional computation employed by Miner in calculation of phylogenetic trees did not produce improved results over SMERFS. SMERFS performance was improved by use of windows over alignment columns, illustrating the necessity of considering the local environment of positions when assessing their functional significance. PMID:18221517

  8. Functional interaction of hybrid response elements with wild-type and mutant steroid hormone receptors.

    PubMed Central

    Truss, M; Chalepakis, G; Slater, E P; Mader, S; Beato, M


    Steroid hormone receptors can be divided into two subfamilies according to the structure of their DNA binding domains and the nucleotide sequences which they recognize. The glucocorticoid receptor and the progesterone receptor (PR) recognize an imperfect palindrome (glucocorticoid responsive element/progesterone responsive element [GRE/PRE]) with the conserved half-sequence TGTYCY, whereas the estrogen receptor (ER) recognizes a palindrome (estrogen responsive element) with the half-sequence TGACC. A series of symmetric and asymmetric variants of these hormone responsive elements (HREs) have been tested for receptor binding and for the ability to mediate induction in vivo. High-resolution analysis demonstrates that the overall number and distribution of contacts with the N-7 position of guanines and with the phosphate backbone of various HREs are quite similar for PR and ER. However, PR and glucocorticoid receptor, but not ER, are able to contact the 5'-methyl group of thymines found in position 3 of HREs, as shown by potassium permanganate interference. The ER mutant HE84, which contains a single amino acid exchange, Glu-203 to Gly, in the knuckle of ER, creates a promiscuous ER that is able to bind to GRE/PREs by contacting this thymine. Elements with the sequence GGTCAcagTGTYCT that represent hybrids between an estrogen response element and a GRE/PRE respond to estrogens, glucocorticoids, and progestins in vivo and bind all three wild-type receptors in vitro. These hybrid HREs could serve to confer promiscuous gene regulation. Images PMID:2038329

  9. Identification of functional glucocorticoid response elements in the mouse FoxO1 promoter.


    Qin, Weiping; Pan, Jiangping; Qin, Yiwen; Lee, David N; Bauman, William A; Cardozo, Christopher


    Glucocorticoids stimulate muscle atrophy through a cascade of signals that includes activation of FoxO transcription factors which then upregulate multiple genes to promote degradation of myofibrillar and other muscle proteins and inhibit protein synthesis. Our previous finding that glucocorticoids upregulate mRNA levels for FoxO1 in skeletal muscle led us to hypothesize that the FoxO1 gene contains one or more glucocorticoid response elements (GREs). Here we show that upregulation of FoxO1 expression by glucocorticoids requires the glucocorticoid receptor (GR) and binding of hormones to it. In cultured C2C12 myoblasts dexamethasone did not alter FoxO1 mRNA stability. Computational analysis predicted that the proximal promoter of the FoxO1 gene contained a cluster of eight GRE half sites and one highly conserved near-consensus SRE; the cluster is found between -800 and -2000bp upstream of the first codon of the FoxO1 gene. A reporter gene constructed using the first 2kb of the FoxO1 promoter was stimulated by dexamethasone. Removal of a 5' domain containing half of the GREs reduced reporter gene activity and removal of all GREs in this region ablated activation by dexamethasone. Restriction fragments of the cluster of 8 upstream GREs bound recombinant GR in gel shift assays. Collectively, the data demonstrate that the proximal promoter of the FoxO1 gene contains multiple functional GREs, indicating that upregulation of FoxO1 expression by glucocorticoids through GREs represents an additional mechanism by which the GR drives glucocorticoid-mediated muscle atrophy. These findings are also relevant to other physiological roles of FoxO1 such as regulation of hepatic metabolism.

  10. Functional studies of the Ciona intestinalis myogenic regulatory factor reveal conserved features of chordate myogenesis.


    Izzi, Stephanie A; Colantuono, Bonnie J; Sullivan, Kelly; Khare, Parul; Meedel, Thomas H


    Ci-MRF is the sole myogenic regulatory factor (MRF) of the ascidian Ciona intestinalis, an invertebrate chordate. In order to investigate its properties we developed a simple in vivo assay based on misexpressing Ci-MRF in the notochord of Ciona embryos. We used this assay to examine the roles of three structural motifs that are conserved among MRFs: an alanine-threonine (Ala-Thr) dipeptide of the basic domain that is known in vertebrates as the myogenic code, a cysteine/histidine-rich (C/H) domain found just N-terminal to the basic domain, and a carboxy-terminal amphipathic α-helix referred to as Helix III. We show that the Ala-Thr dipeptide is necessary for normal Ci-MRF function, and that while eliminating the C/H domain or Helix III individually has no demonstrable effect on Ci-MRF, simultaneous loss of both motifs significantly reduces its activity. Our studies also indicate that direct interaction between CiMRF and an essential E-box of Ciona Troponin I is required for the expression of this muscle-specific gene and that multiple classes of MRF-regulated genes exist in Ciona. These findings are consistent with substantial conservation of MRF-directed myogenesis in chordates and demonstrate for the first time that the Ala/Thr dipeptide of the basic domain of an invertebrate MRF behaves as a myogenic code.

  11. The essential function of Rrs1 in ribosome biogenesis is conserved in budding and fission yeasts.


    Wan, Kun; Kawara, Haruka; Yamamoto, Tomoyuki; Kume, Kazunori; Yabuki, Yukari; Goshima, Tetsuya; Kitamura, Kenji; Ueno, Masaru; Kanai, Muneyoshi; Hirata, Dai; Funato, Kouichi; Mizuta, Keiko


    The Rrs1 protein plays an essential role in the biogenesis of 60S ribosomal subunits in budding yeast (Saccharomyces cerevisiae). Here, we examined whether the fission yeast (Schizosaccharomyces pombe) homologue of Rrs1 also plays a role in ribosome biogenesis. To this end, we constructed two temperature-sensitive fission yeast strains, rrs1-D14/22G and rrs1-L51P, which had amino acid substitutions corresponding to those of the previously characterized budding yeast rrs1-84 (D22/30G) and rrs1-124 (L61P) strains, respectively. The fission yeast mutants exhibited severe defects in growth and 60S ribosomal subunit biogenesis at high temperatures. In addition, expression of the Rrs1 protein of fission yeast suppressed the growth defects of the budding yeast rrs1 mutants at high temperatures. Yeast two-hybrid analyses revealed that the interactions of Rrs1 with the Rfp2 and Ebp2 proteins were conserved in budding and fission yeasts. These results suggest that the essential function of Rrs1 in ribosome biogenesis may be conserved in budding and fission yeasts.

  12. Tailless patterning functions are conserved in the honeybee even in the absence of Torso signaling.


    Wilson, Megan J; Dearden, Peter K


    In Drosophila, the maternal Torso terminal signaling pathway activates expression of the gene tailless (tll), which is required for the patterning of anterior and posterior termini. We cloned the honeybee orthologue of tll (Am-tll) and found that embryonic expression of Am-tll resembles that of Drosophila, with expression in triangular anterior dorsal-lateral domains and a posterior cap. Functional studies revealed that Am-tll has an essential role in patterning the posterior terminal segments and the brain, similar to the activity of tll in other insects. As the honeybee genome lacks many of the components of the Torso pathway required for terminal patterning, we investigated the regulation of honeybee tailless (Am-tll). Am-tll is expressed maternally and, in the honeybee ovary, Am-tll mRNA becomes localized to the dorsal side of the oocyte, a process requiring the actin cytoskeleton. This RNA becomes redistributed in early embryos to a posterior domain. We also show that the activation of the anterior domain of Am-tll is dependent on honeybee orthodenticle-1. Together these findings indicate major differences in post-transcriptional regulation of tailless in the honeybee compared to other insects but that this regulation leads to a conserved expression pattern. These results provide an example of an early event in development evolving and yet still producing a conserved output for the rest of development to build upon.

  13. Functional conservation between members of an ancient duplicated transcription factor family, LSF/Grainyhead.


    Venkatesan, Kavitha; McManus, Heather R; Mello, Craig C; Smith, Temple F; Hansen, Ulla


    The LSF/Grainyhead transcription factor family is involved in many important biological processes, including cell cycle, cell growth and development. In order to investigate the evolutionary conservation of these biological roles, we have characterized two new family members in Caenorhabditis elegans and Xenopus laevis. The C.elegans member, Ce-GRH-1, groups with the Grainyhead subfamily, while the X.laevis member, Xl-LSF, groups with the LSF subfamily. Ce-GRH-1 binds DNA in a sequence-specific manner identical to that of Drosophila melanogaster Grainyhead. In addition, Ce-GRH-1 binds to sequences upstream of the C.elegans gene encoding aromatic L-amino-acid decarboxylase and genes involved in post-embryonic development, mab-5 and dbl-1. All three C.elegans genes are homologs of D.melanogaster Grainyhead-regulated genes. RNA-mediated interference of Ce-grh-1 results in embryonic lethality in worms, accompanied by soft, defective cuticles. These phenotypes are strikingly similar to those observed previously in D.melanogaster grainyhead mutants, suggesting conservation of the developmental role of these family members over the course of evolution. Our phylogenetic analysis of the expanded LSF/GRH family (including other previously unrecognized proteins/ESTs) suggests that the structural and functional dichotomy of this family dates back more than 700 million years, i.e. to the time when the first multicellular organisms are thought to have arisen.

  14. A Conserved Function of C. elegans CASY-1 Calsyntenin in Associative Learning

    PubMed Central

    Hoerndli, Frédéric J.; Walser, Michael; Fröhli Hoier, Erika; de Quervain, Dominique; Papassotiropoulos, Andreas; Hajnal, Alex


    Background Whole-genome association studies in humans have enabled the unbiased discovery of new genes associated with human memory performance. However, such studies do not allow for a functional or causal testing of newly identified candidate genes. Since polymorphisms in Calsyntenin 2 (CLSTN2) showed a significant association with episodic memory performance in humans, we tested the C. elegans CLSTN2 ortholog CASY-1 for possible functions in the associative behavior of C. elegans. Methodology/Principal Findings Using three different associative learning paradigms and functional rescue experiments, we show that CASY-1 plays an important role during associative learning in C. elegans. Furthermore, neuronal expression of human CLSTN2 in C. elegans rescues the learning defects of casy-1 mutants. Finally, genetic interaction studies and neuron-specific expression experiments suggest that CASY-1 may regulate AMPA-like GLR-1 glutamate receptor signaling. Conclusion/Significance Our experiments demonstrate a remarkable conservation of the molecular function of Calsyntenins between nematodes and humans and point at a role of C. elegans casy-1 in regulating a glutamate receptor signaling pathway. PMID:19287492

  15. An improved method for extracting matrix elements from lattice three-point functions

    SciTech Connect

    C. Aubin, K. Orginos


    The extraction of matrix elements from baryon three-point functions is complicated by the fact that the signal-to-noise drops rapidly as a function of time. Using a previously discussed method to improve the signal-to-noise for lattice two-point functions, we use this technique to do so for lattice three-point functions, using electromagnetic form factors for the nucleon and Delta as an example.

  16. Dissecting functions of the conserved oligomeric Golgi tethering complex using a cell-free assay.


    Cottam, Nathanael P; Wilson, Katherine M; Ng, Bobby G; Körner, Christian; Freeze, Hudson H; Ungar, Daniel


    Vesicle transport sorts proteins between compartments and is thereby responsible for generating the non-uniform protein distribution along the eukaryotic secretory and endocytic pathways. The mechanistic details of specific vesicle targeting are not yet well characterized at the molecular level. We have developed a cell-free assay that reconstitutes vesicle targeting utilizing the recycling of resident enzymes within the Golgi apparatus. The assay has physiological properties, and could be used to show that the two lobes of the conserved oligomeric Golgi tethering complex play antagonistic roles in trans-Golgi vesicle targeting. Moreover, we can show that the assay is sensitive to several different congenital defects that disrupt Golgi function and therefore cause glycosylation disorders. Consequently, this assay will allow mechanistic insight into the targeting step of vesicle transport at the Golgi, and could also be useful for characterizing some novel cases of congenital glycosylation disorders.

  17. Functional conservation of the human EXT1 tumor suppressor gene and its Drosophila homolog tout velu.


    Dasgupta, Ujjaini; Dixit, Bharat L; Rusch, Melissa; Selleck, Scott; The, Inge


    Heparan sulfate proteoglycans play a vital role in signaling of various growth factors in both Drosophila and vertebrates. In Drosophila, mutations in the tout velu (ttv) gene, a homolog of the mammalian EXT1 tumor suppressor gene, leads to abrogation of glycosaminoglycan (GAG) biosynthesis. This impairs distribution and signaling activities of various morphogens such as Hedgehog (Hh), Wingless (Wg), and Decapentaplegic (Dpp). Mutations in members of the exostosin (EXT) gene family lead to hereditary multiple exostosis in humans leading to bone outgrowths and tumors. In this study, we provide genetic and biochemical evidence that the human EXT1 (hEXT1) gene is conserved through species and can functionally complement the ttv mutation in Drosophila. The hEXT1 gene was able to rescue a ttv null mutant to adulthood and restore GAG biosynthesis.

  18. Structure, evolutionary conservation, and functions of angiotensin- and endothelin-converting enzymes.


    Macours, Nathalie; Poels, Jeroen; Hens, Korneel; Francis, Carmen; Huybrechts, Roger


    Angiotensin-converting enzyme, a member of the M2 metalloprotease family, and endothelin-converting enzyme, a member of the M13 family, are key components in the regulation of blood pressure and electrolyte balance in mammals. From this point of view, they serve as important drug targets. Recently, the involvement of these enzymes in the development of Alzheimer's disease was discovered. The existence of homologs of these enzymes in invertebrates indicates that these enzyme systems are highly conserved during evolution. Most invertebrates lack a closed circulatory system, which excludes the need for blood pressure regulators. Therefore, these organisms represent excellent targets for gaining new insights and revealing additional physiological roles of these important enzymes. This chapter reviews the structural and functional aspects of ACE and ECE and will particularly focus on these enzyme homologues in invertebrates.

  19. PCNA-binding proteins in the archaea: novel functionality beyond the conserved core.


    MacNeill, Stuart A


    Sliding clamps play an essential role in coordinating protein activity in DNA metabolism in all three domains of life. In eukaryotes and archaea, the sliding clamp is PCNA (proliferating cell nuclear antigen). Across the diversity of the archaea PCNA interacts with a highly conserved set of proteins with key roles in DNA replication and repair, including DNA polymerases B and D, replication factor C, the Fen1 nuclease and RNAseH2, but this core set of factors is likely to represent a fraction of the PCNA interactome only. Here, I review three recently characterised non-core archaeal PCNA-binding proteins NusS, NreA/NreB and TIP, highlighting what is known of their interactions with PCNA and their functions in vivo and in vitro. Gaining a detailed understanding of the non-core PCNA interactome will provide significant insights into key aspects of chromosome biology in divergent archaeal lineages.

  20. Structural and Functional Analyses of a Conserved Hydrophobic Pocket of Flavivirus Methyltransferase*

    PubMed Central

    Dong, Hongping; Liu, Lihui; Zou, Gang; Zhao, Yiwei; Li, Zhong; Lim, Siew Pheng; Shi, Pei-Yong; Li, Hongmin


    The flavivirus methyltransferase (MTase) sequentially methylates the N7 and 2′-O positions of the viral RNA cap (GpppA-RNA → m7GpppA-RNA → m7GpppAm-RNA), using S-adenosyl-l-methionine (AdoMet) as a methyl donor. We report here that sinefungin (SIN), an AdoMet analog, inhibits several flaviviruses through suppression of viral MTase. The crystal structure of West Nile virus MTase in complex with SIN inhibitor at 2.0-Å resolution revealed a flavivirus-conserved hydrophobic pocket located next to the AdoMet-binding site. The pocket is functionally critical in the viral replication and cap methylations. In addition, the N7 methylation efficiency was found to correlate with the viral replication ability. Thus, SIN analogs with modifications that interact with the hydrophobic pocket are potential specific inhibitors of flavivirus MTase. PMID:20685660

  1. Functional conservation of cold shock domains in bacteria and higher plants.


    Nakaminami, Kentaro; Karlson, Dale T; Imai, Ryozo


    In Escherichia coli, a family of cold shock proteins (CSPs) function as transcription antiterminators or translational enhancers at low temperature by destabilizing RNA secondary structure. A wheat nucleic acid-binding protein (WCSP1) was found to contain a cold shock domain (CSD) bearing high similarity to E. coli cold shock proteins. In the present study, a series of mutations were introduced into WCSP1, and its functionality was investigated by using in vivo and in vitro assays in the context of functional conservation with E. coli CSPs. Constitutive expression of WT WCSP1 in an E. coli cspA, cspB, cspE, cspG quadruple deletion mutant complemented its cold-sensitive phenotype, suggesting that WCSP1 shares a function with E. coli CSPs for cold adaptation. In addition, transcription antitermination activity was demonstrated for WCSP1 by using an E. coli strain that has a hairpin loop upstream of a chloramphenicol resistance gene. In vitro dsDNA melting assays clearly demonstrated that WCSP1 melts dsDNA, an activity that was positively correlated to the ability to bind ssDNA. When mutations were introduced at critical residues within the consensus RNA binding motifs (RNP1 and RNP2) of WCSP1, it failed to melt dsDNA. Studies with WCSP1-GFP fusion proteins documented patterns that are consistent with ER and nuclear localization. In vivo and in vitro functional analyses, coupled with subcellular localization data, suggest that WCSP1 may function as a RNA chaperone to destabilize secondary structure and is involved in the regulation of translation under low temperature.

  2. An actin cytoskeleton with evolutionarily conserved functions in the absence of canonical actin-binding proteins

    PubMed Central

    Paredez, Alexander R.; Assaf, Zoe June; Sept, David; Timofejeva, Ljudmilla; Dawson, Scott C.; Wang, Chung-Ju Rachel; Cande, W. Z.


    Giardia intestinalis, a human intestinal parasite and member of what is perhaps the earliest-diverging eukaryotic lineage, contains the most divergent eukaryotic actin identified to date and is the first eukaryote known to lack all canonical actin-binding proteins (ABPs). We sought to investigate the properties and functions of the actin cytoskeleton in Giardia to determine whether Giardia actin (giActin) has reduced or conserved roles in core cellular processes. In vitro polymerization of giActin produced filaments, indicating that this divergent actin is a true filament-forming actin. We generated an anti-giActin antibody to localize giActin throughout the cell cycle. GiActin localized to the cortex, nuclei, internal axonemes, and formed C-shaped filaments along the anterior of the cell and a flagella-bundling helix. These structures were regulated with the cell cycle and in encysting cells giActin was recruited to the Golgi-like cyst wall processing vesicles. Knockdown of giActin demonstrated that giActin functions in cell morphogenesis, membrane trafficking, and cytokinesis. Additionally, Giardia contains a single G protein, giRac, which affects the Giardia actin cytoskeleton independently of known target ABPs. These results imply that there exist ancestral and perhaps conserved roles for actin in core cellular processes that are independent of canonical ABPs. Of medical significance, the divergent giActin cytoskeleton is essential and commonly used actin-disrupting drugs do not depolymerize giActin structures. Therefore, the giActin cytoskeleton is a promising drug target for treating giardiasis, as we predict drugs that interfere with the Giardia actin cytoskeleton will not affect the mammalian host. PMID:21444821

  3. An actin cytoskeleton with evolutionarily conserved functions in the absence of canonical actin-binding proteins.


    Paredez, Alexander R; Assaf, Zoe June; Sept, David; Timofejeva, Ljudmilla; Dawson, Scott C; Wang, Chung-Ju Rachel; Cande, W Z


    Giardia intestinalis, a human intestinal parasite and member of what is perhaps the earliest-diverging eukaryotic lineage, contains the most divergent eukaryotic actin identified to date and is the first eukaryote known to lack all canonical actin-binding proteins (ABPs). We sought to investigate the properties and functions of the actin cytoskeleton in Giardia to determine whether Giardia actin (giActin) has reduced or conserved roles in core cellular processes. In vitro polymerization of giActin produced filaments, indicating that this divergent actin is a true filament-forming actin. We generated an anti-giActin antibody to localize giActin throughout the cell cycle. GiActin localized to the cortex, nuclei, internal axonemes, and formed C-shaped filaments along the anterior of the cell and a flagella-bundling helix. These structures were regulated with the cell cycle and in encysting cells giActin was recruited to the Golgi-like cyst wall processing vesicles. Knockdown of giActin demonstrated that giActin functions in cell morphogenesis, membrane trafficking, and cytokinesis. Additionally, Giardia contains a single G protein, giRac, which affects the Giardia actin cytoskeleton independently of known target ABPs. These results imply that there exist ancestral and perhaps conserved roles for actin in core cellular processes that are independent of canonical ABPs. Of medical significance, the divergent giActin cytoskeleton is essential and commonly used actin-disrupting drugs do not depolymerize giActin structures. Therefore, the giActin cytoskeleton is a promising drug target for treating giardiasis, as we predict drugs that interfere with the Giardia actin cytoskeleton will not affect the mammalian host.

  4. Microbial response to simulated global change is phylogenetically conserved and linked with functional potential

    PubMed Central

    Amend, Anthony S; Martiny, Adam C; Allison, Steven D; Berlemont, Renaud; Goulden, Michael L; Lu, Ying; Treseder, Kathleen K; Weihe, Claudia; Martiny, Jennifer B H


    The high diversity of microbial communities hampers predictions about their responses to global change. Here we investigate the potential for using a phylogenetic, trait-based framework to capture the response of bacteria and fungi to global change manipulations. Replicated grassland plots were subjected to 3+ years of drought and nitrogen fertilization. The responses of leaf litter bacteria and fungi to these simulated changes were significantly phylogenetically conserved. Proportional changes in abundance were highly correlated among related organisms, such that relatives with approximately 5% ribosomal DNA genetic distance showed similar responses to the treatments. A microbe's change in relative abundance was significantly correlated between the treatments, suggesting a compromise between numerical abundance in undisturbed environments and resistance to change in general, independent of disturbance type. Lineages in which at least 90% of the microbes shared the same response were circumscribed at a modest phylogenetic depth (τD 0.014–0.021), but significantly larger than randomized simulations predict. In several clades, phylogenetic depth of trait consensus was higher. Fungal response to drought was more conserved than was response to nitrogen fertilization, whereas bacteria responded equally to both treatments. Finally, we show that a bacterium's response to the manipulations is correlated with its potential functional traits (measured here as the number of glycoside hydrolase genes encoding the capacity to degrade different types of carbohydrates). Together, these results suggest that a phylogenetic, trait-based framework may be useful for predicting shifts in microbial composition and functioning in the face of global change. PMID:26046258

  5. Using Caenorhabditis elegans to Uncover Conserved Functions of Omega-3 and Omega-6 Fatty Acids

    PubMed Central

    Watts, Jennifer L.


    The nematode Caenorhabditis elegans is a powerful model organism to study functions of polyunsaturated fatty acids. The ability to alter fatty acid composition with genetic manipulation and dietary supplementation permits the dissection of the roles of omega-3 and omega-6 fatty acids in many biological process including reproduction, aging and neurobiology. Studies in C. elegans to date have mostly identified overlapping functions of 20-carbon omega-6 and omega-3 fatty acids in reproduction and in neurons, however, specific roles for either omega-3 or omega-6 fatty acids are beginning to emerge. Recent findings with importance to human health include the identification of a conserved Cox-independent prostaglandin synthesis pathway, critical functions for cytochrome P450 derivatives of polyunsaturated fatty acids, the requirements for omega-6 and omega-3 fatty acids in sensory neurons, and the importance of fatty acid desaturation for long lifespan. Furthermore, the ability of C. elegans to interconvert omega-6 to omega-3 fatty acids using the FAT-1 omega-3 desaturase has been exploited in mammalian studies and biotechnology approaches to generate mammals capable of exogenous generation of omega-3 fatty acids. PMID:26848697

  6. Using Caenorhabditis elegans to Uncover Conserved Functions of Omega-3 and Omega-6 Fatty Acids.


    Watts, Jennifer L


    The nematode Caenorhabditis elegans is a powerful model organism to study functions of polyunsaturated fatty acids. The ability to alter fatty acid composition with genetic manipulation and dietary supplementation permits the dissection of the roles of omega-3 and omega-6 fatty acids in many biological process including reproduction, aging and neurobiology. Studies in C. elegans to date have mostly identified overlapping functions of 20-carbon omega-6 and omega-3 fatty acids in reproduction and in neurons, however, specific roles for either omega-3 or omega-6 fatty acids are beginning to emerge. Recent findings with importance to human health include the identification of a conserved Cox-independent prostaglandin synthesis pathway, critical functions for cytochrome P450 derivatives of polyunsaturated fatty acids, the requirements for omega-6 and omega-3 fatty acids in sensory neurons, and the importance of fatty acid desaturation for long lifespan. Furthermore, the ability of C. elegans to interconvert omega-6 to omega-3 fatty acids using the FAT-1 omega-3 desaturase has been exploited in mammalian studies and biotechnology approaches to generate mammals capable of exogenous generation of omega-3 fatty acids.

  7. Calcineurin potentiates activation of the granulocyte-macrophage colony-stimulating factor gene in T cells: involvement of the conserved lymphokine element 0.

    PubMed Central

    Tsuboi, A; Masuda, E S; Naito, Y; Tokumitsu, H; Arai, K; Arai, N


    Granulocyte-macrophage colony-stimulating factor (GM-CSF) and interleukin-2 (IL-2) are produced by stimulation with phorbol-12-myristate acetate (PMA) and calcium ionophore (A23187) in human T cell leukemia Jurkat cells. The expression of GM-CSF and IL-2 is inhibited by immunosuppressive drugs such as cyclosporin A (CsA) and FK506. Earlier studies on the IL-2 gene expression showed that overexpression of calcineurin (CN), a Ca2+/calmodulin-dependent protein phosphatase, can stimulate transcription from the IL-2 promoter through the NF-AT-binding site. In this study, we obtained evidence that transfection of the cDNAs for CN A (catalytic) and CN B (regulatory) subunits also augments transcription from the GM-CSF promoter and recovers the transcription inhibited by CsA. The constitutively active type of the CN A subunit, which lacks the auto-inhibitory and calmodulin-binding domains, acts in synergy with PMA to activate transcription from the GM-CSF promoter. We also found that the active CN partially replaces calcium ionophore in synergy with PMA to induce expression of endogenous GM-CSF and IL-2. By multimerizing the regulatory elements of the GM-CSF promoter, we found that one of the target sites for the CN action is the conserved lymphokine element 0 (CLE0), located at positions between -54 and -40. Mobility shift assays showed that the CLE0 sequence has an AP1-binding site and is associated with an NF-AT-like factor, termed NF-CLE0 gamma. NF-CLE0 gamma binding is induced by PMA/A23187 and is inhibited by treatment with CsA. These results suggest that CN is involved in the coordinated induction of the GM-CSF and IL-2 genes and that the CLE0 sequence of the GM-CSF gene is a functional analogue of the NF-AT-binding site in the IL-2 promoter, which mediates signals downstream of T cell activation. Images PMID:8186461

  8. Mutagenesis of conserved amino acids of Helicobacter pylori fur reveals residues important for function.


    Carpenter, Beth M; Gancz, Hanan; Benoit, Stéphane L; Evans, Sarah; Olsen, Cara H; Michel, Sarah L J; Maier, Robert J; Merrell, D Scott


    The ferric uptake regulator (Fur) of the medically important pathogen Helicobacter pylori is unique in that it has been shown to function as a repressor both in the presence of an Fe2+ cofactor and in its apo (non-Fe2+-bound) form. However, virtually nothing is known concerning the amino acid residues that are important for Fur functioning. Therefore, mutations in six conserved amino acid residues of H. pylori Fur were constructed and analyzed for their impact on both iron-bound and apo repression. In addition, accumulation of the mutant proteins, protein secondary structure, DNA binding ability, iron binding capacity, and the ability to form higher-order structures were also examined for each mutant protein. While none of the mutated residues completely abrogated the function of Fur, we were able to identify residues that were critical for both iron-bound and apo-Fur repression. One mutation, V64A, did not alter regulation of any target genes. However, each of the five remaining mutations showed an effect on either iron-bound or apo regulation. Of these, H96A, E110A, and E117A mutations altered iron-bound Fur regulation and were all shown to influence iron binding to different extents. Additionally, the H96A mutation was shown to alter Fur oligomerization, and the E110A mutation was shown to impact oligomerization and DNA binding. Conversely, the H134A mutant exhibited changes in apo-Fur regulation that were the result of alterations in DNA binding. Although the E90A mutant exhibited alterations in apo-Fur regulation, this mutation did not affect any of the assessed protein functions. This study is the first for H. pylori to analyze the roles of specific amino acid residues of Fur in function and continues to highlight the complexity of Fur regulation in this organism.

  9. The conserved SKN-1/Nrf2 stress response pathway regulates synaptic function in Caenorhabditis elegans.


    Staab, Trisha A; Griffen, Trevor C; Corcoran, Connor; Evgrafov, Oleg; Knowles, James A; Sieburth, Derek


    The Nrf family of transcription factors plays a critical role in mediating adaptive responses to cellular stress and defends against neurodegeneration, aging, and cancer. Here, we report a novel role for the Caenorhabditis elegans Nrf homolog SKN-1 in regulating synaptic transmission at neuromuscular junctions (NMJs). Activation of SKN-1, either by acute pharmacological treatment with the mitochondrial toxin sodium arsenite or by mutations that cause constitutive SKN-1 activation, results in defects in neuromuscular function. Additionally, elimination of the conserved WD40 repeat protein WDR-23, a principal negative regulator of SKN-1, results in impaired locomotion and synaptic vesicle and neuropeptide release from cholinergic motor axons. Mutations that abolish skn-1 activity restore normal neuromuscular function to wdr-23 mutants and animals treated with toxin. We show that negative regulation of SKN-1 by WDR-23 in the intestine, but not at neuromuscular junctions, is necessary and sufficient for proper neuromuscular function. WDR-23 isoforms differentially localize to the outer membranes of mitochondria and to nuclei, and the effects of WDR-23 on neuromuscular function are dependent on its interaction with cullin E3 ubiquitin ligase. Finally, whole-transcriptome RNA sequencing of wdr-23 mutants reveals an increase in the expression of known SKN-1/Nrf2-regulated stress-response genes, as well as neurotransmission genes not previously implicated in SKN-1/Nrf2 responses. Together, our results indicate that SKN-1/Nrf2 activation may be a mechanism through which cellular stress, detected in one tissue, affects cellular function of a distal tissue through endocrine signaling. These results provide insight into how SKN-1/Nrf2 might protect the nervous system from damage in response to oxidative stress.

  10. Gamma-ray Emission from the Surface of Martian Satellites as a Function of Elemental Composition

    NASA Astrophysics Data System (ADS)

    Yoshida, Kouhei; Naito, Masayuki; Hasebe, Nobuyuki; Kusano, Hiroki; Nagaoka, Hiroshi; Ishii, Junya; Aoki, Daisuke

    Mars has two satellites, Phobos and Deimos. The Martian satellites have never been explored from the aspect of elemental composition. Their origins are still mysterious. Gamma-ray spectroscopy from the orbit of spacecraft is a powerful method to investigate elemental distribution and abundance of planets with no or thin atmosphere. In this work, gamma-ray emission from the Martian satellites was calculated as a function of elemental composition. Both chondritic and Martian compositions, which represent captured origin and giant impact origin, respectively, were assumed as elemental composition of Martian satellites. The gamma-ray fluxes induced by galactic cosmic rays at their surface were calculated for both of them. It was found that the elemental compositions of Martian satellites are clearly distinguished between chondritic or Martian by the gamma-ray emission rate ratios of Si/Fe and Ca/Fe and enable us to give strong constraint to the idea for the origin of the Martian satellites.

  11. Evaporation Loss of Light Elements as a Function of Cooling Rate: Logarithmic Law

    NASA Technical Reports Server (NTRS)

    Xiong, Yong-Liang; Hewins, Roger H.


    Knowledge about the evaporation loss of light elements is important to our understanding of chondrule formation processes. The evaporative loss of light elements (such as B and Li) as a function of cooling rate is of special interest because recent investigations of the distribution of Li, Be and B in meteoritic chondrules have revealed that Li varies by 25 times, and B and Be varies by about 10 times. Therefore, if we can extrapolate and interpolate with confidence the evaporation loss of B and Li (and other light elements such as K, Na) at a wide range of cooling rates of interest based upon limited experimental data, we would be able to assess the full range of scenarios relating to chondrule formation processes. Here, we propose that evaporation loss of light elements as a function of cooling rate should obey the logarithmic law.

  12. Concentration of elements in whole-body fish, fish fillets, fish muscle plugs, and fish eggs from the 2008 Missouri Department of Conservation General Contaminant Monitoring Program

    USGS Publications Warehouse

    May, Thomas W.; Walther, Michael J.; Brumbaugh, William G.; McKee, Michael J.


    This report presents the results of a contaminant monitoring survey conducted annually by the Missouri Department of Conservation to examine the levels of selected elemental contaminants in whole-body fish, fish fillets, fish muscle plugs, and fish eggs. Whole-body, fillet, or egg samples of catfish (Ictalurus punctatus, Ictalurus furcatus, Pylodictis olivaris), largemouth bass (Micropterus salmoides), walleye (Sander vitreus), crappie (Pomoxis annularis, Pomoxis nigromaculatus), shovelnose sturgeon (Scaphirhynchus platorynchus), northern hog sucker (Hypentelium nigricans), and Missouri saddled darter (Etheostoma tetrazonum) were collected from 23 sites as part of the Missouri Department of Conservation's Fish Contaminant Monitoring Program. Fish dorsal muscle plugs also were collected from walleye (Sander vitreus) at one of the sites.

  13. Distribution, structure and function of Nordic eelgrass (Zostera marina) ecosystems: implications for coastal management and conservation

    PubMed Central

    Boström, Christoffer; Baden, Susanne; Bockelmann, Anna-Christina; Dromph, Karsten; Fredriksen, Stein; Gustafsson, Camilla; Krause-Jensen, Dorte; Möller, Tiia; Nielsen, Søren Laurentius; Olesen, Birgit; Olsen, Jeanine; Pihl, Leif; Rinde, Eli


    This paper focuses on the marine foundation eelgrass species, Zostera marina, along a gradient from the northern Baltic Sea to the north-east Atlantic. This vast region supports a minimum of 1480 km2 eelgrass (maximum >2100 km2), which corresponds to more than four times the previously quantified area of eelgrass in Western Europe.Eelgrass meadows in the low salinity Baltic Sea support the highest diversity (4–6 spp.) of angiosperms overall, but eelgrass productivity is low (<2 g dw m-2 d-1) and meadows are isolated and genetically impoverished. Higher salinity areas support monospecific meadows, with higher productivity (3–10 g dw m-2 d-1) and greater genetic connectivity. The salinity gradient further imposes functional differences in biodiversity and food webs, in particular a decline in number, but increase in biomass of mesograzers in the Baltic.Significant declines in eelgrass depth limits and areal cover are documented, particularly in regions experiencing high human pressure. The failure of eelgrass to re-establish itself in affected areas, despite nutrient reductions and improved water quality, signals complex recovery trajectories and calls for much greater conservation effort to protect existing meadows.The knowledge base for Nordic eelgrass meadows is broad and sufficient to establish monitoring objectives across nine national borders. Nevertheless, ensuring awareness of their vulnerability remains challenging. Given the areal extent of Nordic eelgrass systems and the ecosystem services they provide, it is crucial to further develop incentives for protecting them. © 2014 The Authors. Aquatic Conservation: Marine and Freshwater Ecosystems published by John Wiley & Sons, Ltd. PMID:26167100

  14. Distribution, structure and function of Nordic eelgrass (Zostera marina) ecosystems: implications for coastal management and conservation.


    Boström, Christoffer; Baden, Susanne; Bockelmann, Anna-Christina; Dromph, Karsten; Fredriksen, Stein; Gustafsson, Camilla; Krause-Jensen, Dorte; Möller, Tiia; Nielsen, Søren Laurentius; Olesen, Birgit; Olsen, Jeanine; Pihl, Leif; Rinde, Eli


    This paper focuses on the marine foundation eelgrass species, Zostera marina, along a gradient from the northern Baltic Sea to the north-east Atlantic. This vast region supports a minimum of 1480 km(2) eelgrass (maximum >2100 km(2)), which corresponds to more than four times the previously quantified area of eelgrass in Western Europe.Eelgrass meadows in the low salinity Baltic Sea support the highest diversity (4-6 spp.) of angiosperms overall, but eelgrass productivity is low (<2 g dw m(-2) d(-1)) and meadows are isolated and genetically impoverished. Higher salinity areas support monospecific meadows, with higher productivity (3-10 g dw m(-2) d(-1)) and greater genetic connectivity. The salinity gradient further imposes functional differences in biodiversity and food webs, in particular a decline in number, but increase in biomass of mesograzers in the Baltic.Significant declines in eelgrass depth limits and areal cover are documented, particularly in regions experiencing high human pressure. The failure of eelgrass to re-establish itself in affected areas, despite nutrient reductions and improved water quality, signals complex recovery trajectories and calls for much greater conservation effort to protect existing meadows.The knowledge base for Nordic eelgrass meadows is broad and sufficient to establish monitoring objectives across nine national borders. Nevertheless, ensuring awareness of their vulnerability remains challenging. Given the areal extent of Nordic eelgrass systems and the ecosystem services they provide, it is crucial to further develop incentives for protecting them. © 2014 The Authors. Aquatic Conservation: Marine and Freshwater Ecosystems published by John Wiley & Sons, Ltd.

  15. A Functionally Conserved Gene Regulatory Network Module Governing Olfactory Neuron Diversity

    PubMed Central

    Okuwa, Sumie; Maciejewski, Abigail; Brandt, Alicia T.; Reinhold, Dominik; Jones, Corbin D.; Volkan, Pelin Cayirlioglu


    Sensory neuron diversity is required for organisms to decipher complex environmental cues. In Drosophila, the olfactory environment is detected by 50 different olfactory receptor neuron (ORN) classes that are clustered in combinations within distinct sensilla subtypes. Each sensilla subtype houses stereotypically clustered 1–4 ORN identities that arise through asymmetric divisions from a single multipotent sensory organ precursor (SOP). How each class of SOPs acquires a unique differentiation potential that accounts for ORN diversity is unknown. Previously, we reported a critical component of SOP diversification program, Rotund (Rn), increases ORN diversity by generating novel developmental trajectories from existing precursors within each independent sensilla type lineages. Here, we show that Rn, along with BarH1/H2 (Bar), Bric-à-brac (Bab), Apterous (Ap) and Dachshund (Dac), constitutes a transcription factor (TF) network that patterns the developing olfactory tissue. This network was previously shown to pattern the segmentation of the leg, which suggests that this network is functionally conserved. In antennal imaginal discs, precursors with diverse ORN differentiation potentials are selected from concentric rings defined by unique combinations of these TFs along the proximodistal axis of the developing antennal disc. The combinatorial code that demarcates each precursor field is set up by cross-regulatory interactions among different factors within the network. Modifications of this network lead to predictable changes in the diversity of sensilla subtypes and ORN pools. In light of our data, we propose a molecular map that defines each unique SOP fate. Our results highlight the importance of the early prepatterning gene regulatory network as a modulator of SOP and terminally differentiated ORN diversity. Finally, our model illustrates how conserved developmental strategies are used to generate neuronal diversity. PMID:26765103

  16. [Conservative surgery for supraglottic carcinoma. Surgical technique. Oncologic and functional results].


    Vega, S F; Scola, B; Vega, M F; Martinez, T; Scola, E


    We present the results of a retrospective study of 817 patients treated with conservative surgery for carcinomas of the supraglottic larynx at ENT department of the Gregorio Maranón Hospital between 1962-1993. The disease was staged using the criteria set forth in 1988 by the AJCC, and 36,2% were stages III and IV. From the 817 patients treated with conservative surgery 230 were extended supraglottic laryngectomies. Our theoretic treatment protocol is presented. The 5 years actuarial uncorrected survival rate related to stage was 83,9%, 83,2%, 78,5% and 55,3% for stages I, II, III and IV respectively. Local-regional failure occurred in 32,9% patients overall, and the most common site for local-regional failure was the cervical nodes. The 5 years local control rate related to stage was 86,97%, 89,1%, 82,15% and 66,55% for stages I, II, III and IV respectively. In extended supraglottic laryngectomies the 5 years uncorrected survival rate was 62,6% in supraglottic laryngectomies (SL) extended to the base of the tongue, 62,5% in SL extended to the hypopharynx, 72,5% in SL extended to the arythenoyd and 79,4% in SL extended to the vocal chord. The 5 years local control rate was 87% in SL extended to the base of the tongue, 85,7% in SL extended to the hypopharynx, 97% in SL extended to the arythenoid and 90,8% in SL extended to the vocal chord. Functional results have been evaluated according to a three grade scale. Good and fair results were 97.6% for swallowing, 90% for respiration and 95.8% for the quality of voice.

  17. A Functionally Conserved Gene Regulatory Network Module Governing Olfactory Neuron Diversity.


    Li, Qingyun; Barish, Scott; Okuwa, Sumie; Maciejewski, Abigail; Brandt, Alicia T; Reinhold, Dominik; Jones, Corbin D; Volkan, Pelin Cayirlioglu


    Sensory neuron diversity is required for organisms to decipher complex environmental cues. In Drosophila, the olfactory environment is detected by 50 different olfactory receptor neuron (ORN) classes that are clustered in combinations within distinct sensilla subtypes. Each sensilla subtype houses stereotypically clustered 1-4 ORN identities that arise through asymmetric divisions from a single multipotent sensory organ precursor (SOP). How each class of SOPs acquires a unique differentiation potential that accounts for ORN diversity is unknown. Previously, we reported a critical component of SOP diversification program, Rotund (Rn), increases ORN diversity by generating novel developmental trajectories from existing precursors within each independent sensilla type lineages. Here, we show that Rn, along with BarH1/H2 (Bar), Bric-à-brac (Bab), Apterous (Ap) and Dachshund (Dac), constitutes a transcription factor (TF) network that patterns the developing olfactory tissue. This network was previously shown to pattern the segmentation of the leg, which suggests that this network is functionally conserved. In antennal imaginal discs, precursors with diverse ORN differentiation potentials are selected from concentric rings defined by unique combinations of these TFs along the proximodistal axis of the developing antennal disc. The combinatorial code that demarcates each precursor field is set up by cross-regulatory interactions among different factors within the network. Modifications of this network lead to predictable changes in the diversity of sensilla subtypes and ORN pools. In light of our data, we propose a molecular map that defines each unique SOP fate. Our results highlight the importance of the early prepatterning gene regulatory network as a modulator of SOP and terminally differentiated ORN diversity. Finally, our model illustrates how conserved developmental strategies are used to generate neuronal diversity.

  18. Functional redundancy of octamer elements in the mouse mammary tumor virus promoter.

    PubMed Central

    Huang, M; Lee, J W; Peterson, D O


    The promoter of mouse mammary tumor virus contains three overlapping sequence elements related to the octamer consensus (ATGCAAAT) that are largely contained within two 10 bp direct repeats (CTTATGTAAA) separated by a 2 bp spacer between 60 and 39 relative to the start of transcription. Gel electrophoresis mobility shift competition assays demonstrate that the most distal of these octamer-related elements is recognized by a protein that also binds to the most proximal element, while the central octamer-related element is not efficiently recognized. Transient transfection assays with altered promoters reveal that the portion of the 10 bp repeat that is not related to the octamer consensus appears not to be important for transcription. The distal and proximal octamer-related elements are, at least to some extent, functionally redundant. Complete deletion of one element has little or no effect on promoter activity so long as certain spacing constraints among remaining promoter elements are maintained. Systematic variation of such spacing reveals a cyclic effect on promoter activity corresponding to the periodicity of Bform DNA, suggesting functional interactions between proteins bound to adjacent sites. Images PMID:8255781

  19. Evolutionarily conserved and nonconserved cellular localizations and functions of human SIRT proteins.


    Michishita, Eriko; Park, Jean Y; Burneskis, Jenna M; Barrett, J Carl; Horikawa, Izumi


    Sir2 is a NAD+-dependent protein deacetylase that extends lifespan in yeast and worms. This study examines seven human proteins homologous to Sir2 (SIRT1 through SIRT7) for cellular localization, expression profiles, protein deacetylation activity, and effects on human cell lifespan. We found that: 1) three nuclear SIRT proteins (SIRT1, SIRT6, and SIRT7) show different subnuclear localizations: SIRT6 and SIRT7 are associated with heterochromatic regions and nucleoli, respectively, where yeast Sir2 functions; 2) SIRT3, SIRT4, and SIRT5 are localized in mitochondria, an organelle that links aging and energy metabolism; 3) cellular p53 is a major in vivo substrate of SIRT1 deacetylase, but not the other six SIRT proteins; 4) SIRT1, but not the other two nuclear SIRT proteins, shows an in vitro deacetylase activity on histone H4 and p53 peptides; and 5) overexpression of any one of the seven SIRT proteins does not extend cellular replicative lifespan in normal human fibroblasts or prostate epithelial cells. This study supports the notion that multiple human SIRT proteins have evolutionarily conserved and nonconserved functions at different cellular locations and reveals that the lifespan of normal human cells, in contrast to that of lower eukaryotes, cannot be manipulated by increased expression of a single SIRT protein.

  20. Conserved function of core clock proteins in the gymnosperm Norway spruce (Picea abies L. Karst).


    Karlgren, Anna; Gyllenstrand, Niclas; Källman, Thomas; Lagercrantz, Ulf


    From studies of the circadian clock in the plant model species Arabidopsis (Arabidopsis thaliana), a number of important properties and components have emerged. These include the genes CIRCADIAN CLOCK ASSOCIATED 1 (CCA1), GIGANTEA (GI), ZEITLUPE (ZTL) and TIMING OF CAB EXPRESSION 1 (TOC1 also known as PSEUDO-RESPONSE REGULATOR 1 (PRR1)) that via gene expression feedback loops participate in the circadian clock. Here, we present results from ectopic expression of four Norway spruce (Picea abies) putative homologs (PaCCA1, PaGI, PaZTL and PaPRR1) in Arabidopsis, their flowering time, circadian period length, red light response phenotypes and their effect on endogenous clock genes were assessed. For PaCCA1-ox and PaZTL-ox the results were consistent with Arabidopsis lines overexpressing the corresponding Arabidopsis genes. For PaGI consistent results were obtained when expressed in the gi2 mutant, while PaGI and PaPRR1 expressed in wild type did not display the expected phenotypes. These results suggest that protein function of PaCCA1, PaGI and PaZTL are at least partly conserved compared to Arabidopsis homologs, however further studies are needed to reveal the protein function of PaPRR1. Our data suggest that components of the three-loop network typical of the circadian clock in angiosperms were present before the split of gymnosperms and angiosperms.

  1. Redox proteins in mammalian cell death: an evolutionarily conserved function in mitochondria and prokaryotes.


    Punj, Vasu; Chakrabarty, A M


    Mammalian cell mitochondria are believed to have prokaryotic ancestry. Mitochondria are not only the powerhouse of energy generation within the eukaryotic cell but they also play a major role in inducing apoptotic cell death through release of redox proteins such as cytochrome c and the apoptosis-inducing factor (AIF), a flavoprotein with NADH oxidase activity. Recent evidence indicates that some present day prokaryotes release redox proteins that induce apoptosis in mammalian cells through stabilization of the tumour suppressor protein p53. p53 interacts with mitochondria either directly or through activation of the genes for pro-apoptotic proteins such as Bax or NOXA or genes that encode redox enzymes responsible for the production of reactive oxygen species (ROS). The analogy between the ancient ancestors of present day bacteria, the mitochondria, and the present day bacteria with regard to their ability to release redox proteins for triggering mammalian cell death is an interesting example of functional conservation during the hundreds of millions of years of evolution. It is possible that the ancestors of the present day prokaryotes released redox proteins to kill the ancestors of the eukaryotes. During evolution of the mitochondria from prokaryotes as obligate endosymbionts, the mitochondria maintained the same functions to programme their own host cell death.

  2. The evolutionarily conserved RNA binding protein SMOOTH is essential for maintaining normal muscle function.


    Draper, Isabelle; Tabaka, Meg E; Jackson, F Rob; Salomon, Robert N; Kopin, Alan S


    The Drosophila smooth gene encodes an RNA binding protein that has been well conserved through evolution. To investigate the pleiotropic functions mediated by the smooth gene, we have selected and characterized two sm mutants, which are viable as adults yet display robust phenotypes (including a significant decrease in lifespan). Utilizing these mutants, we have made the novel observation that disruption of the smooth/CG9218 locus leads to age-dependent muscle degeneration, and motor dysfunction. Histological characterization of adult sm mutants revealed marked abnormalities in the major thoracic tubular muscle: the tergal depressor of the trochanter (TDT). Corresponding defects include extensive loss/disruption of striations and nuclei. These pathological changes are recapitulated in flies that express a smooth RNA interference construct (sm RNAi) in the mesoderm. In contrast, targeting sm RNAi constructs to motor neurons does not alter muscle morphology. In addition to examining the TDT phenotype, we explored whether other muscular abnormalities were evident. Utilizing physiological assays developed in the laboratory, we have found that the thoracic muscle defect is preceded by dysmotility of the gastrointestinal tract. SMOOTH thus joins a growing list of hnRNPs that have previously been linked to muscle physiology/pathophysiology. Our findings in Drosophila set the stage for investigating the role of the corresponding mammalian homolog, hnRNP L, in muscle function.

  3. Phylogenetic conservation of the regulatory and functional properties of the Vav oncoprotein family

    SciTech Connect

    Couceiro, Jose R.; Martin-Bermudo, Maria D.; Bustelo, Xose R. . E-mail:


    Vav proteins are phosphorylation-dependent GDP/GTP exchange factors for Rho/Rac GTPases. Despite intense characterization of mammalian Vav proteins both biochemically and genetically, there is little information regarding the conservation of their biological properties in lower organisms. To approach this issue, we have performed a characterization of the regulatory, catalytic, and functional properties of the single Vav family member of Drosophila melanogaster. These analyses have shown that the intramolecular mechanisms controlling the enzyme activity of mammalian Vav proteins are already present in Drosophila, suggesting that such properties have been set up before the divergence between protostomes and deuterostomes during evolution. We also show that Drosophila and mammalian Vav proteins have similar catalytic specificities. As a consequence, Drosophila Vav can trigger oncogenic transformation, morphological change, and enhanced cell motility in mammalian cells. Gain-of-function studies using transgenic flies support the implication of this protein in cytoskeletal-dependent processes such as embryonic dorsal closure, myoblast fusion, tracheal development, and the migration/guidance of different cell types. These results highlight the important roles of Vav proteins in the signal transduction pathways regulating cytoskeletal dynamics. Moreover, they indicate that the foundations for the regulatory and enzymatic activities of this protein family have been set up very early during evolution.

  4. Structural genomics of highly conserved microbial genes of unknown function in search of new antibacterial targets.


    Abergel, Chantal; Coutard, Bruno; Byrne, Deborah; Chenivesse, Sabine; Claude, Jean-Baptiste; Deregnaucourt, Céline; Fricaux, Thierry; Gianesini-Boutreux, Celine; Jeudy, Sandra; Lebrun, Régine; Maza, Caroline; Notredame, Cédric; Poirot, Olivier; Suhre, Karsten; Varagnol, Majorie; Claverie, Jean-Michel


    With more than 100 antibacterial drugs at our disposal in the 1980's, the problem of bacterial infection was considered solved. Today, however, most hospital infections are insensitive to several classes of antibacterial drugs, and deadly strains of Staphylococcus aureus resistant to vancomycin--the last resort antibiotic--have recently begin to appear. Other life-threatening microbes, such as Enterococcus faecalis and Mycobacterium tuberculosis are already able to resist every available antibiotic. There is thus an urgent, and continuous need for new, preferably large-spectrum, antibacterial molecules, ideally targeting new biochemical pathways. Here we report on the progress of our structural genomics program aiming at the discovery of new antibacterial gene targets among evolutionary conserved genes of uncharacterized function. A series of bioinformatic and comparative genomics analyses were used to identify a set of 221 candidate genes common to Gram-positive and Gram-negative bacteria. These genes were split between two laboratories. They are now submitted to a systematic 3-D structure determination protocol including cloning, protein expression and purification, crystallization, X-ray diffraction, structure interpretation, and function prediction. We describe here our strategies for the 111 genes processed in our laboratory. Bioinformatics is used at most stages of the production process and out of 111 genes processed--and 17 months into the project--108 have been successfully cloned, 103 have exhibited detectable expression, 84 have led to the production of soluble protein, 46 have been purified, 12 have led to usable crystals, and 7 structures have been determined.

  5. Structural but not functional conservation of an immune molecule: a tachylectin-like gene in Hydractinia.


    Mali, Brahim; Soza-Ried, Jorge; Frohme, Marcus; Frank, Uri


    Tachylectin-related proteins are a recently characterized group of pattern recognition molecules, functioning in the innate immunity of various animals, from the ancient sponges to vertebrates. Tachylectins are characterized by six internal tandem repeats forming beta-propeller domains. We have identified and characterized a tachylectin-related gene in the colonial marine hydroid, Hydractinia echinata. The predicted gene product, termed CTRN, contained an N-terminal signal peptide and had a well-conserved tachylectin-like structure. RT-PCR analyses revealed only post-metamorphic expression while no mRNA was detected during embryonic development or in planula larvae. Exposure of colonies to LPS under conditions known to activate an immune response in Hydractinia did not result in upregulation of the gene. In situ hybridization analysis of metamorphosed animals detected CTRN transcripts only in a small subpopulation of neurons and their precursor cells, localized in a ring-like structure around the mouth of polyps. The same ring-like structure of CTRN expressing neurons was also observed in young polyp buds, predicting the position of the future mouth. This type of expression pattern can hardly be attributed to an immune-relevant gene. Thus, despite high structural similarity to tachylectins, this cnidarian member of this group seems to be an exception to all other tachylectins identified so far as it seems to have no function in cnidarian innate immunity.

  6. N-dimensional switch function for energy conservation in multiprocess reaction dynamics.


    Mogo, César; Brandão, João


    The MReaDy program was designed for studying Multiprocess Reactive Dynamic systems, that is, complex chemical systems involving different and concurrent reactions. It builds a global potential energy surface integrating a variety of potential energy surfaces, each one of them representing an elementary reaction expected to play a role in the chemical process. For each elementary reaction, energy continuity problems may happen in the transition between potential energy surfaces due to differences in the functional form for each of the fragments, especially if built by different authors. A N-dimensional switch function is introduced in MReaDy in order to overcome such a problem. As an example, results of a collision trajectory calculation for H2  + OH → H3 O are presented, showing smooth transition in the potential energy, leading to conservation in the total energy. Calculations for a hydrogen combustion system from 1000 K up to 4000 K shows a variation of 0.012% when compared to the total energy of the system. © 2016 Wiley Periodicals, Inc.

  7. Identification of functional elements and regulatory circuits by Drosophila modENCODE.


    Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L; Landolin, Jane M; Bristow, Christopher A; Ma, Lijia; Lin, Michael F; Washietl, Stefan; Arshinoff, Bradley I; Ay, Ferhat; Meyer, Patrick E; Robine, Nicolas; Washington, Nicole L; Di Stefano, Luisa; Berezikov, Eugene; Brown, Christopher D; Candeias, Rogerio; Carlson, Joseph W; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y; Will, Sebastian; Alekseyenko, Artyom A; Artieri, Carlo; Booth, Benjamin W; Brooks, Angela N; Dai, Qi; Davis, Carrie A; Duff, Michael O; Feng, Xin; Gorchakov, Andrey A; Gu, Tingting; Henikoff, Jorja G; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K; Riddle, Nicole C; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E; Schwartz, Yuri B; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E; Brent, Michael R; Cherbas, Lucy; Elgin, Sarah C R; Gingeras, Thomas R; Grossman, Robert; Hoskins, Roger A; Kaufman, Thomas C; Kent, William; Kuroda, Mitzi I; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J; Celniker, Susan E; Henikoff, Steven; Karpen, Gary H; Lai, Eric C; MacAlpine, David M; Stein, Lincoln D; White, Kevin P; Kellis, Manolis


    To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation.

  8. 3D Functional Elements Deep Inside Silicon with Nonlinear Laser Lithography

    NASA Astrophysics Data System (ADS)

    Tokel, Onur; Turnali, Ahmet; Ergecen, Emre; Pavlov, Ihor; Ilday, Fatih Omer

    Functional optical and electrical elements fabricated on silicon (Si) constitute fundamental building blocks of electronics and Si-photonics. However, since the highly successful established lithography are geared towards surface processing, elements embedded inside Si simply do not exist. Here, we present a novel direct-laser writing method for positioning buried functional elements inside Si wafers. This new phenomenon is distinct from previous work, in that the surface of Si is not modified. By exploiting nonlinear interactions of a focused laser, permanent refractive index changes are induced inside Si. The imprinted index contrast is then used to demonstrate a plethora of functional elements and capabilities embedded inside Si. In particular, we demonstrate the first functional optical element inside Si, the first information-storage capability inside Si, creation of high-resolution subsurface holograms, buried multilevel structures, and complex 3D architectures in Si, none of which is currently possible with other methods. This new approach complements available techniques by taking advantage of the real estate under Si, and therefore can pave the way for creating entirely new multilevel devices through electronic-photonic integration.

  9. The Space-Time Conservation Element and Solution Element Method: A New High-Resolution and Genuinely Multidimensional Paradigm for Solving Conservation Laws. 1; The Two Dimensional Time Marching Schemes

    NASA Technical Reports Server (NTRS)

    Chang, Sin-Chung; Wang, Xiao-Yen; Chow, Chuen-Yen


    A new high resolution and genuinely multidimensional numerical method for solving conservation laws is being, developed. It was designed to avoid the limitations of the traditional methods. and was built from round zero with extensive physics considerations. Nevertheless, its foundation is mathmatically simple enough that one can build from it a coherent, robust. efficient and accurate numerical framework. Two basic beliefs that set the new method apart from the established methods are at the core of its development. The first belief is that, in order to capture physics more efficiently and realistically, the modeling, focus should be placed on the original integral form of the physical conservation laws, rather than the differential form. The latter form follows from the integral form under the additional assumption that the physical solution is smooth, an assumption that is difficult to realize numerically in a region of rapid chance. such as a boundary layer or a shock. The second belief is that, with proper modeling of the integral and differential forms themselves, the resulting, numerical solution should automatically be consistent with the properties derived front the integral and differential forms, e.g., the jump conditions across a shock and the properties of characteristics. Therefore a much simpler and more robust method can be developed by not using the above derived properties explicitly.

  10. Structural features of the murine dihydrofolate reductase transcription termination region: identification of a conserved DNA sequence element.

    PubMed Central

    Frayne, E G; Kellems, R E


    Structural features of the transcription termination region for the mouse dihydrofolate reductase gene have been determined and compared with those of several other known termination regions for protein coding genes. A common feature identified among these termination regions was the presence of a 20 bp consensus DNA sequence element (ATCAGAATATAGGAAAGTAGCAAT). The results imply that the 20 bp consensus DNA sequence element is important for signaling RNA polymerase II transcription termination at least in the several vertebrate species investigated. Furthermore, the results suggest that for the dhfr gene and possibly for other genes in mice as well, the potential termination consensus sequence can exist as part of a long interspersed repetitive DNA element. Images PMID:3714472

  11. Functional Conservation and Divergence of daf-22 Paralogs in Pristionchus pacificus Dauer Development.


    Markov, Gabriel V; Meyer, Jan M; Panda, Oishika; Artyukhin, Alexander B; Claaßen, Marc; Witte, Hanh; Schroeder, Frank C; Sommer, Ralf J


    Small-molecule signaling in nematode dauer formation has emerged as a major model to study chemical communication in development and evolution. Developmental arrest as nonfeeding and stress-resistant dauer larvae represents the major survival and dispersal strategy. Detailed studies in Caenorhabditis elegans and Pristionchus pacificus revealed that small-molecule communication changes rapidly in evolution resulting in extreme structural diversity of small-molecule compounds. In C. elegans, a blend of ascarosides constitutes the dauer pheromone, whereas the P. pacificus dauer pheromone includes additional paratosides and integrates building blocks from diverse primary metabolic pathways. Despite this complexity of small-molecule structures and functions, little is known about the biosynthesis of small molecules in nematodes outside C. elegans Here, we show that the genes encoding enzymes of the peroxisomal β-oxidation pathway involved in small-molecule biosynthesis evolve rapidly, including gene duplications and domain switching. The thiolase daf-22, the most downstream factor in C. elegans peroxisomal β-oxidation, has duplicated in P. pacificus, resulting in Ppa-daf-22.1, which still contains the sterol-carrier-protein (SCP) domain that was lost in C. elegans daf-22, and Ppa-daf-22.2. Using the CRISPR/Cas9 system, we induced mutations in both P. pacificus daf-22 genes and identified an unexpected complexity of functional conservation and divergence. Under well-fed conditions, ascaroside biosynthesis proceeds exclusively via Ppa-daf-22.1 In contrast, starvation conditions induce Ppa-daf-22.2 activity, resulting in the production of a specific subset of ascarosides. Gene expression studies indicate a reciprocal up-regulation of both Ppa-daf-22 genes, which is, however, independent of starvation. Thus, our study reveals an unexpected functional complexity of dauer development and evolution.

  12. Functional conservation of PISTILLATA activity in a pea homolog lacking the PI motif.


    Berbel, Ana; Navarro, Cristina; Ferrándiz, Cristina; Cañas, Luis Antonio; Beltrán, José-Pío; Madueño, Francisco


    Current understanding of floral development is mainly based on what we know from Arabidopsis (Arabidopsis thaliana) and Antirrhinum majus. However, we can learn more by comparing developmental mechanisms that may explain morphological differences between species. A good example comes from the analysis of genes controlling flower development in pea (Pisum sativum), a plant with more complex leaves and inflorescences than Arabidopsis and Antirrhinum, and a different floral ontogeny. The analysis of UNIFOLIATA (UNI) and STAMINA PISTILLOIDA (STP), the pea orthologs of LEAFY and UNUSUAL FLORAL ORGANS, has revealed a common link in the regulation of flower and leaf development not apparent in Arabidopsis. While the Arabidopsis genes mainly behave as key regulators of flower development, where they control the expression of B-function genes, UNI and STP also contribute to the development of the pea compound leaf. Here, we describe the characterization of P. sativum PISTILLATA (PsPI), a pea MADS-box gene homologous to B-function genes like PI and GLOBOSA (GLO), from Arabidopsis and Antirrhinum, respectively. PsPI encodes for an atypical PI-type polypeptide that lacks the highly conserved C-terminal PI motif. Nevertheless, constitutive expression of PsPI in tobacco (Nicotiana tabacum) and Arabidopsis shows that it can specifically replace the function of PI, being able to complement the strong pi-1 mutant. Accordingly, PsPI expression in pea flowers, which is dependent on STP, is identical to PI and GLO. Interestingly, PsPI is also transiently expressed in young leaves, suggesting a role of PsPI in pea leaf development, a possibility that fits with the established role of UNI and STP in the control of this process.

  13. Non-Periodic Finite-Element Formulation of Orbital-Free Density Functional Theory

    SciTech Connect

    Gavini, V; Knap, J; Bhattacharya, K; Ortiz, M


    We propose an approach to perform orbital-free density functional theory calculations in a non-periodic setting using the finite-element method. We consider this a step towards constructing a seamless multi-scale approach for studying defects like vacancies, dislocations and cracks that require quantum mechanical resolution at the core and are sensitive to long range continuum stresses. In this paper, we describe a local real space variational formulation for orbital-free density functional theory, including the electrostatic terms and prove existence results. We prove the convergence of the finite-element approximation including numerical quadratures for our variational formulation. Finally, we demonstrate our method using examples.

  14. Higher-order adaptive finite-element methods for Kohn–Sham density functional theory

    SciTech Connect

    Motamarri, P.; Nowak, M.R.; Leiter, K.; Knap, J.; Gavini, V.


    We present an efficient computational approach to perform real-space electronic structure calculations using an adaptive higher-order finite-element discretization of Kohn–Sham density-functional theory (DFT). To this end, we develop an a priori mesh-adaption technique to construct a close to optimal finite-element discretization of the problem. We further propose an efficient solution strategy for solving the discrete eigenvalue problem by using spectral finite-elements in conjunction with Gauss–Lobatto quadrature, and a Chebyshev acceleration technique for computing the occupied eigenspace. The proposed approach has been observed to provide a staggering 100–200-fold computational advantage over the solution of a generalized eigenvalue problem. Using the proposed solution procedure, we investigate the computational efficiency afforded by higher-order finite-element discretizations of the Kohn–Sham DFT problem. Our studies suggest that staggering computational savings—of the order of 1000-fold—relative to linear finite-elements can be realized, for both all-electron and local pseudopotential calculations, by using higher-order finite-element discretizations. On all the benchmark systems studied, we observe diminishing returns in computational savings beyond the sixth-order for accuracies commensurate with chemical accuracy, suggesting that the hexic spectral-element may be an optimal choice for the finite-element discretization of the Kohn–Sham DFT problem. A comparative study of the computational efficiency of the proposed higher-order finite-element discretizations suggests that the performance of finite-element basis is competing with the plane-wave discretization for non-periodic local pseudopotential calculations, and compares to the Gaussian basis for all-electron calculations to within an order of magnitude. Further, we demonstrate the capability of the proposed approach to compute the electronic structure of a metallic system containing 1688

  15. Higher-order adaptive finite-element methods for Kohn-Sham density functional theory

    NASA Astrophysics Data System (ADS)

    Motamarri, P.; Nowak, M. R.; Leiter, K.; Knap, J.; Gavini, V.


    We present an efficient computational approach to perform real-space electronic structure calculations using an adaptive higher-order finite-element discretization of Kohn-Sham density-functional theory (DFT). To this end, we develop an a priori mesh-adaption technique to construct a close to optimal finite-element discretization of the problem. We further propose an efficient solution strategy for solving the discrete eigenvalue problem by using spectral finite-elements in conjunction with Gauss-Lobatto quadrature, and a Chebyshev acceleration technique for computing the occupied eigenspace. The proposed approach has been observed to provide a staggering 100-200-fold computational advantage over the solution of a generalized eigenvalue problem. Using the proposed solution procedure, we investigate the computational efficiency afforded by higher-order finite-element discretizations of the Kohn-Sham DFT problem. Our studies suggest that staggering computational savings-of the order of 1000-fold-relative to linear finite-elements can be realized, for both all-electron and local pseudopotential calculations, by using higher-order finite-element discretizations. On all the benchmark systems studied, we observe diminishing returns in computational savings beyond the sixth-order for accuracies commensurate with chemical accuracy, suggesting that the hexic spectral-element may be an optimal choice for the finite-element discretization of the Kohn-Sham DFT problem. A comparative study of the computational efficiency of the proposed higher-order finite-element discretizations suggests that the performance of finite-element basis is competing with the plane-wave discretization for non-periodic local pseudopotential calculations, and compares to the Gaussian basis for all-electron calculations to within an order of magnitude. Further, we demonstrate the capability of the proposed approach to compute the electronic structure of a metallic system containing 1688 atoms using

  16. Identifying Cytochrome P450 Functional Networks and Their Allosteric Regulatory Elements

    DTIC Science & Technology


    Adx is a small iron - sulfur protein that transfers electrons from NADPH to terminal CYP as part of the overall metabolic processing of substrates. We...needed to create a systematic approach that allows us to identify putative allosteric sites. Here, we present combined co-evolutionary analysis and...isoform. The cysteine residue, which connects to iron , is conserved among the isoforms, implying that the catalytic function is co- evolved and similar for

  17. The method of space-time conservation element and solution element-applications to one-dimensional and two-dimensional time-marching flow problems

    NASA Technical Reports Server (NTRS)

    Chang, Sin-Chung; Wang, Xiao-Yen; Chow, Chuen-Yen


    A nontraditional numerical method for solving conservation laws is being developed. The new method is designed from a physicist's perspective, i.e., its development is based more on physics than numerics. Even though it uses only the simplest approximation techniques, a 2D time-marching Euler solver developed recently using the new method is capable of generating nearly perfect solutions for a 2D shock reflection problem used by Helen Yee and others. Moreover, a recent application of this solver to computational aeroacoustics (CAA) problems reveals that: (1) accuracy of its results is comparable to that of a 6th order compact difference scheme even though nominally the current solver is only of 2nd-order accuracy; (2) generally, the non-reflecting boundary condition can be implemented in a simple way without involving characteristic variables; and (3) most importantly, the current solver is capable of handling both continuous and discontinuous flows very well and thus provides a unique numerical tool for solving those flow problems where the interactions between sound waves and shocks are important, such as the noise field around a supersonic over- or under-expansion jet.

  18. Structural Conservation and Functional Diversity of the Poxvirus Immune Evasion (PIE) Domain Superfamily.


    Nelson, Christopher A; Epperson, Megan L; Singh, Sukrit; Elliott, Jabari I; Fremont, Daved H


    Poxviruses encode a broad array of proteins that serve to undermine host immune defenses. Structural analysis of four of these seemingly unrelated proteins revealed the recurrent use of a conserved beta-sandwich fold that has not been observed in any eukaryotic or prokaryotic protein. Herein we propose to call this unique structural scaffolding the PIE (Poxvirus Immune Evasion) domain. PIE domain containing proteins are abundant in chordopoxvirinae, with our analysis identifying 20 likely PIE subfamilies among 33 representative genomes spanning 7 genera. For example, cowpox strain Brighton Red appears to encode 10 different PIEs: vCCI, A41, C8, M2, T4 (CPVX203), and the SECRET proteins CrmB, CrmD, SCP-1, SCP-2, and SCP-3. Characterized PIE proteins all appear to be nonessential for virus replication, and all contain signal peptides for targeting to the secretory pathway. The PIE subfamilies differ primarily in the number, size, and location of structural embellishments to the beta-sandwich core that confer unique functional specificities. Reported ligands include chemokines, GM-CSF, IL-2, MHC class I, and glycosaminoglycans. We expect that the list of ligands and receptors engaged by the PIE domain will grow as we come to better understand how this versatile structural architecture can be tailored to manipulate host responses to infection.

  19. Structural Conservation and Functional Diversity of the Poxvirus Immune Evasion (PIE) Domain Superfamily

    PubMed Central

    Nelson, Christopher A.; Epperson, Megan L.; Singh, Sukrit; Elliott, Jabari I.; Fremont, Daved H.


    Poxviruses encode a broad array of proteins that serve to undermine host immune defenses. Structural analysis of four of these seemingly unrelated proteins revealed the recurrent use of a conserved beta-sandwich fold that has not been observed in any eukaryotic or prokaryotic protein. Herein we propose to call this unique structural scaffolding the PIE (Poxvirus Immune Evasion) domain. PIE domain containing proteins are abundant in chordopoxvirinae, with our analysis identifying 20 likely PIE subfamilies among 33 representative genomes spanning 7 genera. For example, cowpox strain Brighton Red appears to encode 10 different PIEs: vCCI, A41, C8, M2, T4 (CPVX203), and the SECRET proteins CrmB, CrmD, SCP-1, SCP-2, and SCP-3. Characterized PIE proteins all appear to be nonessential for virus replication, and all contain signal peptides for targeting to the secretory pathway. The PIE subfamilies differ primarily in the number, size, and location of structural embellishments to the beta-sandwich core that confer unique functional specificities. Reported ligands include chemokines, GM-CSF, IL-2, MHC class I, and glycosaminoglycans. We expect that the list of ligands and receptors engaged by the PIE domain will grow as we come to better understand how this versatile structural architecture can be tailored to manipulate host responses to infection. PMID:26343707

  20. Pan-cancer transcriptome analysis reveals long noncoding RNAs with conserved function

    PubMed Central

    Cabanski, Christopher R; White, Nicole M; Dang, Ha X; Silva-Fisher, Jessica M; Rauck, Corinne E; Cicka, Danielle; Maher, Christopher A


    A growing number of gene-centric studies have highlighted the emerging significance of lncRNAs in cancer. However, these studies primarily focus on a single cancer type. Therefore, we conducted a pan-cancer analysis of lncRNAs comparing tumor and matched normal expression levels using RNA-Seq data from ∼ 3,000 patients in 8 solid tumor types. While the majority of differentially expressed lncRNAs display tissue-specific expression we discovered 229 lncRNAs with outlier or differential expression across multiple cancers, which we refer to as 'onco-lncRNAs'. Due to their consistent altered expression, we hypothesize that these onco-lncRNAs may have conserved oncogenic and tumor suppressive functions across cancers. To address this, we associated the onco-lncRNAs in biological processes based on their co-expressed protein coding genes. To validate our predictions, we experimentally confirmed cell growth dependence of 2 novel oncogenic lncRNAs, onco-lncRNA-3 and onco-lncRNA-12, and a previously identified lncRNA CCAT1. Overall, we discovered lncRNAs that may have broad oncogenic and tumor suppressor roles that could significantly advance our understanding of cancer lncRNA biology. PMID:25864709

  1. Identification of Cis-regulatory elements in the mouse Pax9/Nkx2-9 genomic region: implication for evolutionary conserved synteny.

    PubMed Central

    Santagati, Fabio; Abe, Kuniya; Schmidt, Volker; Schmitt-John, Thomas; Suzuki, Misao; Yamamura, Ken-Ichi; Imai, Kenji


    We previously reported close physical linkage between Pax9 and Nkx2-9 in the human, mouse, and pufferfish (Fugu rubripes) genomes. In this study, we analyzed cis-regulatory elements of the two genes by comparative sequencing in the three species and by transgenesis in the mouse. We identified two regions including conserved noncoding sequences that possessed specific enhancer activities for expression of Pax9 in the medial nasal process and of Nkx2-9 in the ventral neural tube. Remarkably, the latter contained the consensus Gli-binding motif. Interestingly, the identified Pax9 cis-regulatory sequences were located in an intron of the neighboring gene Slc25a21. Close examination of an extended genomic interval around Pax9 revealed the presence of strong synteny conservation in the human, mouse, and Fugu genomes. We propose such an intersecting organization of cis-regulatory sequences in multigenic regions as a possible mechanism that maintains evolutionary conserved synteny. PMID:14504231

  2. Structural and functional studies of conserved nucleotide-binding protein LptB in lipopolysaccharide transport

    SciTech Connect

    Wang, Zhongshan; Xiang, Quanju; Zhu, Xiaofeng; Dong, Haohao; He, Chuan; Wang, Haiyan; Zhang, Yizheng; Wang, Wenjian; Dong, Changjiang


    Highlights: • Determination of the structure of the wild-type LptB in complex with ATP and Mg{sup 2+}. • Demonstrated that ATP binding residues are essential for LptB’s ATPase activity and LPS transport. • Dimerization is required for the LptB’s function and LPS transport. • Revealed relationship between activity of the LptB and the vitality of E. coli cells. - Abstract: Lipopolysaccharide (LPS) is the main component of the outer membrane of Gram-negative bacteria, which plays an essential role in protecting the bacteria from harsh conditions and antibiotics. LPS molecules are transported from the inner membrane to the outer membrane by seven LPS transport proteins. LptB is vital in hydrolyzing ATP to provide energy for LPS transport, however this mechanism is not very clear. Here we report wild-type LptB crystal structure in complex with ATP and Mg{sup 2+}, which reveals that its structure is conserved with other nucleotide-binding proteins (NBD). Structural, functional and electron microscopic studies demonstrated that the ATP binding residues, including K42 and T43, are crucial for LptB’s ATPase activity, LPS transport and the vitality of Escherichia coli cells with the exceptions of H195A and Q85A; the H195A mutation does not lower its ATPase activity but impairs LPS transport, and Q85A does not alter ATPase activity but causes cell death. Our data also suggest that two protomers of LptB have to work together for ATP hydrolysis and LPS transport. These results have significant impacts in understanding the LPS transport mechanism and developing new antibiotics.

  3. Functional conservation of coenzyme Q biosynthetic genes among yeasts, plants, and humans.


    Hayashi, Kazuhiro; Ogiyama, Yuki; Yokomi, Kazumasa; Nakagawa, Tsuyoshi; Kaino, Tomohiro; Kawamukai, Makoto


    Coenzyme Q (CoQ) is an essential factor for aerobic growth and oxidative phosphorylation in the electron transport system. The biosynthetic pathway for CoQ has been proposed mainly from biochemical and genetic analyses of Escherichia coli and Saccharomyces cerevisiae; however, the biosynthetic pathway in higher eukaryotes has been explored in only a limited number of studies. We previously reported the roles of several genes involved in CoQ synthesis in the fission yeast Schizosaccharomyces pombe. Here, we expand these findings by identifying ten genes (dps1, dlp1, ppt1, and coq3-9) that are required for CoQ synthesis. CoQ10-deficient S. pombe coq deletion strains were generated and characterized. All mutant fission yeast strains were sensitive to oxidative stress, produced a large amount of sulfide, required an antioxidant to grow on minimal medium, and did not survive at the stationary phase. To compare the biosynthetic pathway of CoQ in fission yeast with that in higher eukaryotes, the ability of CoQ biosynthetic genes from humans and plants (Arabidopsis thaliana) to functionally complement the S. pombe coq deletion strains was determined. With the exception of COQ9, expression of all other human and plant COQ genes recovered CoQ10 production by the fission yeast coq deletion strains, although the addition of a mitochondrial targeting sequence was required for human COQ3 and COQ7, as well as A. thaliana COQ6. In summary, this study describes the functional conservation of CoQ biosynthetic genes between yeasts, humans, and plants.

  4. Origin recognition specificity in pT181 plasmids is determined by a functionally asymmetric palindromic DNA element.

    PubMed Central

    Wang, P Z; Projan, S J; Henriquez, V; Novick, R P


    The leading strand replication origin of pT181 plasmids consists of two adjacent inverted repeat elements (IR-II and IR-III), which are involved in origin recognition by the initiator (Rep) protein. The conserved core element, IR-II, which contains the initiation nick site, is induced by Rep to form a cruciform structure, probably the primary substrate for the initiation of rolling circle replication. The divergent repeat, IR-III, constitutes the determinant of origin recognition specificity. We show here that the distal arm of IR-III is not required for sequence-specific recognition, whereas the proximal arm and central region are required. Since the initiator is dimeric, we presume that it binds symmetrically to IR-III. A unique type of DNA-protein interaction is proposed, in which the lack of sequence requirement for the distal arm is a consequence of binding to the adjacent IR-II, which thereby polarizes the stringency of binding to the two arms of IR-III. In addition, genetic evidence indicates that both the spacing and the phasing of IR-II to IR-III are crucial for function and that the central segment of IR-III may serve to position the two flanking half-sites for optimal interaction of Rep with IR-III. Images PMID:8428593

  5. Ground-state properties of third-row elements with nonlocal density functionals

    SciTech Connect

    Bagno, P.; Jepsen, O.; Gunnarsson, O.


    The cohesive energy, the lattice parameter, and the bulk modulus of third-row elements are calculated using the Langreth-Mehl-Hu (LMH), the Perdew-Wang (PW), and the gradient expansion functionals. The PW functional is found to give somewhat better results than the LMH functional and both are found to typically remove half the errors in the local-spin-density (LSD) approximation, while the gradient expansion gives worse results than the local-density approximation. For Fe both the LMH and PW functionals correctly predict a ferromagnetic bcc ground state, while the LSD approximation and the gradient expansion predict a nonmagnetic fcc ground state.

  6. Band-limited Green's Functions for Quantitative Evaluation of Acoustic Emission Using the Finite Element Method

    NASA Technical Reports Server (NTRS)

    Leser, William P.; Yuan, Fuh-Gwo; Leser, William P.


    A method of numerically estimating dynamic Green's functions using the finite element method is proposed. These Green's functions are accurate in a limited frequency range dependent on the mesh size used to generate them. This range can often match or exceed the frequency sensitivity of the traditional acoustic emission sensors. An algorithm is also developed to characterize an acoustic emission source by obtaining information about its strength and temporal dependence. This information can then be used to reproduce the source in a finite element model for further analysis. Numerical examples are presented that demonstrate the ability of the band-limited Green's functions approach to determine the moment tensor coefficients of several reference signals to within seven percent, as well as accurately reproduce the source-time function.

  7. Dissecting the gene network of dietary restriction to identify evolutionarily conserved pathways and new functional genes.


    Wuttke, Daniel; Connor, Richard; Vora, Chintan; Craig, Thomas; Li, Yang; Wood, Shona; Vasieva, Olga; Shmookler Reis, Robert; Tang, Fusheng; de Magalhães, João Pedro


    Dietary restriction (DR), limiting nutrient intake from diet without causing malnutrition, delays the aging process and extends lifespan in multiple organisms. The conserved life-extending effect of DR suggests the involvement of fundamental mechanisms, although these remain a subject of debate. To help decipher the life-extending mechanisms of DR, we first compiled a list of genes that if genetically altered disrupt or prevent the life-extending effects of DR. We called these DR-essential genes and identified more than 100 in model organisms such as yeast, worms, flies, and mice. In order for other researchers to benefit from this first curated list of genes essential for DR, we established an online database called GenDR ( To dissect the interactions of DR-essential genes and discover the underlying lifespan-extending mechanisms, we then used a variety of network and systems biology approaches to analyze the gene network of DR. We show that DR-essential genes are more conserved at the molecular level and have more molecular interactions than expected by chance. Furthermore, we employed a guilt-by-association method to predict novel DR-essential genes. In budding yeast, we predicted nine genes related to vacuolar functions; we show experimentally that mutations deleting eight of those genes prevent the life-extending effects of DR. Three of these mutants (OPT2, FRE6, and RCR2) had extended lifespan under ad libitum, indicating that the lack of further longevity under DR is not caused by a general compromise of fitness. These results demonstrate how network analyses of DR using GenDR can be used to make phenotypically relevant predictions. Moreover, gene-regulatory circuits reveal that the DR-induced transcriptional signature in yeast involves nutrient-sensing, stress responses and meiotic transcription factors. Finally, comparing the influence of gene expression changes during DR on the interactomes of multiple organisms led

  8. A conserved structural motif reveals the essential transcriptional repression function of Spen proteins and their role in developmental signaling.


    Ariyoshi, Mariko; Schwabe, John W R


    Spen proteins regulate the expression of key transcriptional effectors in diverse signaling pathways. They are large proteins characterized by N-terminal RNA-binding motifs and a highly conserved C-terminal SPOC domain. The specific biological role of the SPOC domain (Spen paralog and ortholog C-terminal domain), and hence, the common function of Spen proteins, has been unclear to date. The Spen protein, SHARP (SMRT/HDAC1-associated repressor protein), was identified as a component of transcriptional repression complexes in both nuclear receptor and Notch/RBP-Jkappa signaling pathways. We have determined the 1.8 A crystal structure of the SPOC domain from SHARP. This structure shows that essentially all of the conserved surface residues map to a positively charged patch. Structure-based mutational analysis indicates that this conserved region is responsible for the interaction between SHARP and the universal transcriptional corepressor SMRT/NCoR (silencing mediator for retinoid and thyroid receptors/nuclear receptor corepressor. We demonstrate that this interaction involves a highly conserved acidic motif at the C terminus of SMRT/NCoR. These findings suggest that the conserved function of the SPOC domain is to mediate interaction with SMRT/NCoR corepressors, and that Spen proteins play an essential role in the repression complex.

  9. Mapping overlapping functional elements embedded within the protein-coding regions of RNA viruses

    PubMed Central

    Firth, Andrew E.


    Identification of the full complement of genes and other functional elements in any virus is crucial to fully understand its molecular biology and guide the development of effective control strategies. RNA viruses have compact multifunctional genomes that frequently contain overlapping genes and non-coding functional elements embedded within protein-coding sequences. Overlapping features often escape detection because it can be difficult to disentangle the multiple roles of the constituent nucleotides via mutational analyses, while high-throughput experimental techniques are often unable to distinguish functional elements from incidental features. However, RNA viruses evolve very rapidly so that, even within a single species, substitutions rapidly accumulate at neutral or near-neutral sites providing great potential for comparative genomics to distinguish the signature of purifying selection. Computationally identified features can then be efficiently targeted for experimental analysis. Here we analyze alignments of protein-coding virus sequences to identify regions where there is a statistically significant reduction in the degree of variability at synonymous sites, a characteristic signature of overlapping functional elements. Having previously tested this technique by experimental verification of discoveries in selected viruses, we now analyze sequence alignments for ∼700 RNA virus species to identify hundreds of such regions, many of which have not been previously described. PMID:25326325


    EPA Science Inventory

    The effect of varying physical and chemical properties of activated carbons on adsorption of elemental mercury [Hg(0)] was studied by treating two activated carbons to modify their surface functional groups and pore structures. Heat treatment (1200 K) in nitrogen (N2), air oxidat...

  11. Method for studying the phase function in tunable diffraction optical elements

    SciTech Connect

    Paranin, V D; Tukmakov, K N


    A method for studying the phase function in tunable diffraction optical elements is proposed, based on measurement of the transmission of interelectrode gaps. The mathematical description of the method, which is approved experimentally, is developed. The instrumental error effects are analysed. (laser applications and other topics in quantum electronics)

  12. A functional analysis of the P-element gene-transfer vector in insects

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A P-element mobility excision assay was used to determine if non-drosophilid insects could support P gene vector function. Present studies included the testing of Muscids, Sphaerocerids, and Phorids, none of which were able to support P mobility. A new excision indicator plasmid was developed allowi...

  13. Flow path functioning identified from fundamental dynamics in sub-hourly, non-conservative stream chemistry

    NASA Astrophysics Data System (ADS)

    Chappell, N. A.; Jones, T.


    Within upland streams, concentration & load of many solutes (e.g. H+, DOC) varies very rapidly through storm periods. The shape & features of concentration or load chemographs are an expression of the fundamental dynamics in hydrologic & biogeochemical delivery mechanisms integrated at basin scales. If storm-period chemographs are grossly under-sampled so that time-series does not represent the true chemograph shape, then numerical descriptors of this shape or of the dynamic relationship between controlling variables (e.g. rainfall) & the chemograph will be distorted from true values (Littlewood 1992 IH Rpt 117; Littlewood & Croke 2013 Hydrol Res). Distortions of these dynamic response characteristics or DRCs (model parameters) can then lead to misinterpretation of hydrologic & biogeochemical processes via errors in relative contributions of identified flow paths, rates of propagation along these paths etc. A transfer function (TF) approach can be used to illustrate minimum sampling intensities needed to avoid these errors. Given 15-min observations, CAPTAIN-RIV identification routines for continuous-time TFs give Time Constants (TCs) of only 2 hrs for fast components of responses of rainfall to H+ load in Llyn Brianne streams (Chappell et al 2013 BHS). Given that Time Series Analysis dictates a sampling intensity five times finer than the TC, sampling at 24 min intervals or shorter was needed & achieved in this example. Considerable work is now focused on modeling of chemically-conservative river constituents (namely chloride & water isotopes) to help determine differences in residence times, storage & other DRCs of rainfall-streamflow & associated solute paths (Hrachowitz et al 2013 Hydrol Earth Syst Sci). Comparatively little modeling has focused on high frequency (i.e. sub-hourly), non-conservative river solutes (e.g. H+, DOC). Modeling of these basin-integrated variables should be considered complementary to that for conservative solutes, given: (1) their

  14. Conservation of position and sequence of a novel, widely expressed gene containing the major human {alpha}-globin regulatory element

    SciTech Connect

    Vyas, P.; Vickers, M.A.; Picketts, D.J.; Higgs, D.R.


    We have determined the cDNA and genomic structure of a gene (-14 gene) that lies adjacent to the human {alpha}-globin cluster. Although it is expressed in a wide range of cell lines and tissues, a previously described erythroid-specific regulatory element that controls expression of the {alpha}-globin genes lies within intron 5 of this gene. Analysis of the -14 gene promoter shows that it is GC rich and associated with a constitutively expressed DNase 1 hypersensitive site; unlike the {alpha}-globin promoter, it does not contain a TATA or CCAAT box. These and other differences in promoter structure may explain why the erythroid regulatory element interacts specifically with the {alpha}-globin promoters and not the -14 gene promoter, which lies between the {alpha} promoters and their regulatory element. Interspecies comparisons demonstrate that the sequence and location of the -14 gene adjacent to the a cluster have been maintained since the bird/mammal divergence, 270 million years ago. 38 refs., 6 figs.

  15. Rounding up active cis-elements in the triple C corral: combining conservation, cleavage and conformation capture for the analysis of regulatory gene domains.


    McBride, David J; Kleinjan, Dirk A


    Identification and functional analysis of potential cis-regulatory elements is a laborious process that often depends on removing putative elements from their natural context to study their activity. While such methods provide valuable information about the isolated element, they disregard the potential role of an element's interaction(s) with other regulatory sequences and the three-dimensional structure of an active gene locus. Here, two novel methods are discussed--chromosome conformation capture (3C) and RNA-TRAP--that can be used to detect interactions between distal regulatory sites and which thus indicate the chromosomal conformation that is adopted by a gene locus in various states of transcriptional activity. Combined with comparative genomics and traditional DNase I hypersensitive site mapping, these methods form a powerful approach for the study of the mechanisms of long-range transcriptional regulation.

  16. Global functions in global-local finite-element analysis of localized stresses in prismatic structures

    NASA Technical Reports Server (NTRS)

    Dong, Stanley B.


    An important consideration in the global local finite-element method (GLFEM) is the availability of global functions for the given problem. The role and mathematical requirements of these global functions in a GLFEM analysis of localized stress states in prismatic structures are discussed. A method is described for determining these global functions. Underlying this method are theorems due to Toupin and Knowles on strain energy decay rates, which are related to a quantitative expression of Saint-Venant's principle. It is mentioned that a mathematically complete set of global functions can be generated, so that any arbitrary interface condition between the finite element and global subregions can be represented. Convergence to the true behavior can be achieved with increasing global functions and finite-element degrees of freedom. Specific attention is devoted to mathematically two-dimensional and three-dimensional prismatic structures. Comments are offered on the GLFEM analysis of NASA flat panel with a discontinuous stiffener. Methods for determining global functions for other effects are also indicated, such as steady-state dynamics and bodies under initial stress.

  17. Numerical advection by conservation of second-order moments. [for trace element spatial distribution and chemical interaction in atmosphere

    NASA Technical Reports Server (NTRS)

    Prather, M. J.


    A new, accurate, and nondiffusive method for three-dimensional advection of trace species is presented. The method preserves tracer structures by conserving the second-order moments of the spatial distribution of tracer during advection. Upstream transport and second-order tracer distribution are described, and the moments of the tracer distribution about the center of a grid box are formally defined and related to the polynomial distribution. Formulas are presented which describe how the moments of a grid box are decomposed into a unique set of moments centered about each subbox and how they are reassembled into new grid boxes. A one-dimensional example if tracer transport is given, and limits necessary to maintain positive tracer concentrations are derived. The accuracy and stability of this method are analytically examined, and numerical experiments testing the effective resolution are presented. The method is compared with other methods for numerical advection of tracers.

  18. Conserved tertiary couplings stabilize elements in the PDZ fold, leading to characteristic patterns of domain conformational flexibility.


    Ho, Bosco K; Agard, David A


    Single-domain allostery has been postulated to occur through intramolecular pathways of signaling within a protein structure. We had previously investigated these pathways by introducing a local thermal perturbation and analyzed the anisotropic propagation of structural changes throughout the protein. Here, we develop an improved approach, the Rotamerically Induced Perturbation (RIP), that identifies strong couplings between residues by analyzing the pathways of heat-flow resulting from thermal excitation of rotameric rotations at individual residues. To explore the nature of these couplings, we calculate the complete coupling maps of 5 different PDZ domains. Although the PDZ domain is a well conserved structural fold that serves as a scaffold in many protein-protein complexes, different PDZ domains display unique patterns of conformational flexibility in response to ligand binding: some show a significant shift in a set of alpha-helices, while others do not. Analysis of the coupling maps suggests a simple relationship between the computed couplings and observed conformational flexibility. In domains where the alpha-helices are rigid, we find couplings of the alpha-helices to the body of the protein, whereas in domains having ligand-responsive alpha-helices, no couplings are found. This leads to a model where the alpha-helices are intrinsically dynamic but can be damped if sidechains interact at key tertiary contacts. These tertiary contacts correlate to high covariation contacts as identified by the statistical coupling analysis method. As these dynamic modules are exploited by various allosteric mechanisms, these tertiary contacts have been conserved by evolution.

  19. Elemental carbon exposure and lung function in school children from Mexico City.


    Barraza-Villarreal, A; Escamilla-Nuñez, M C; Hernández-Cadena, L; Texcalac-Sangrador, J L; Sienra-Monge, J J; Del Río-Navarro, B E; Cortez-Lugo, M; Sly, P D; Romieu, I


    Though exposure to air pollution has a detrimental effect on respiratory health, few studies have examined the association between elemental carbon exposure and lung function among schoolchildren. The aim of the present study was to present the association between short-term elemental carbon exposure and lung function in schoolchildren from Mexico City. 55 asthmatic and 40 non-asthmatic children were followed for an average of 22 weeks. A spirometry test was performed every 15 days during follow-up. Portable air samplers collected particulate matter onto Teflon filters. Gravimetric analysis was conducted and elemental carbon was quantified using transmission densitometry. The association between the main variables was analysed using linear mixed effects models. The mean ± sd of elemental carbon light absorption was 92.7 ± 54.7 Mm(-1). An increase of one interquartile range in the 24-h average of elemental carbon (100.93 Mm(-1)) was associated with a significant negative impact on forced expiratory volume in 1 s (FEV(1)) (-62.0 (95% CI -123.3- -1.2) mL) and forced expiratory flow at 25-75% of forced vital capacity (FVC) (FEF(25-75%)) (-111 (95% CI -228.3- -4.1) mL) among asthmatic children, equal to 3.3% and 5.5%, respectively; and on FEV(1) (-95.0 (95% CI -182.3- -8.5) mL) and FVC (-105.0 (95% CI -197.0- -13.7) mL) among non-asthmatic children. Exposure to elemental carbon resulted in an important negative effect on lung function in atopic schoolchildren, regardless of asthma status.

  20. The conserved carboxyl domain of MorC, an inner membrane protein of Aggregatibacter actinomycetemcomitans, is essential for membrane function.


    Smith, K P; Voogt, R D; Ruiz, T; Mintz, K P


    Morphogenesis protein C (MorC) of Aggregatibacter actinomycetemcomitans is important for maintaining the membrane morphology and integrity of the cell envelope of this oral pathogen. The MorC sequence and operon organization were found to be conserved in Gammaproteobacteria, based on a bioinformatic analysis of 435 sequences from representative organisms. Functional conservation of MorC was investigated using an A. actinomycetemcomitans morC mutant as a model system to express MorC homologs from four phylogenetically diverse representatives of the Gammaproteobacteria: Haemophilus influenzae, Escherichia coli, Pseudomonas aeruginosa, and Moraxella catarrhalis. The A. actinomycetemcomitans strains expressing the homologous proteins were assessed for sensitivity to bile salts, leukotoxin secretion, autoaggregation and membrane morphology. MorC from the most closely related organism (H. influenzae) was functionally identical to MorC from A. actinomycetemcomitans. However, the genes from more distantly related organisms restored some but not all A. actinomycetemcomitans mutant phenotypes. In addition, deletion mutagenesis indicated that the most conserved portion of the protein, the C-terminus DUF490 domain, was necessary to maintain the integrity of the membrane. Deletion of the last 10 amino acids of this domain of the A. actinomycetemcomitans MorC protein was sufficient to disrupt membrane stability and leukotoxin secretion. The data suggest that the MorC sequence is functionally conserved across Gammaproteobacteria and the C-terminus of the protein is essential for maintaining membrane physiology.

  1. Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles.


    Wang, Jianbin; Czech, Benjamin; Crunk, Amanda; Wallace, Adam; Mitreva, Makedonka; Hannon, Gregory J; Davis, Richard E


    Eukaryotic cells express several classes of small RNAs that regulate gene expression and ensure genome maintenance. Endogenous siRNAs (endo-siRNAs) and Piwi-interacting RNAs (piRNAs) mainly control gene and transposon expression in the germline, while microRNAs (miRNAs) generally function in post-transcriptional gene silencing in both somatic and germline cells. To provide an evolutionary and developmental perspective on small RNA pathways in nematodes, we identified and characterized known and novel small RNA classes through gametogenesis and embryo development in the parasitic nematode Ascaris suum and compared them with known small RNAs of Caenorhabditis elegans. piRNAs, Piwi-clade Argonautes, and other proteins associated with the piRNA pathway have been lost in Ascaris. miRNAs are synthesized immediately after fertilization in utero, before pronuclear fusion, and before the first cleavage of the zygote. This is the earliest expression of small RNAs ever described at a developmental stage long thought to be transcriptionally quiescent. A comparison of the two classes of Ascaris endo-siRNAs, 22G-RNAs and 26G-RNAs, to those in C. elegans, suggests great diversification and plasticity in the use of small RNA pathways during spermatogenesis in different nematodes. Our data reveal conserved characteristics of nematode small RNAs as well as features unique to Ascaris that illustrate significant flexibility in the use of small RNAs pathways, some of which are likely an adaptation to Ascaris' life cycle and parasitism. The transcriptome assembly has been submitted to NCBI Transcriptome Shotgun Assembly Sequence Database( under accession numbers JI163767–JI182837 and JI210738–JI257410.

  2. Semiclassical matrix elements for a chaotic propagator in the scar function basis

    NASA Astrophysics Data System (ADS)

    Rivas, Alejandro M. F.


    A semiclassical approximation for the matrix elements of a quantum chaotic propagator in the scar function basis has been derived. The obtained expression is solely expressed in terms of canonical invariant objects. For our purpose, we have used the recently developed, semiclassical matrix elements of the propagator in coherent states, together with the linearization of the flux in the neighborhood of a classically unstable periodic orbit of chaotic two-dimensional systems. The expression derived here is successfully verified to be exact for a (linear) cat map, after the theory is adapted to a discrete phase space appropriate to a quantized torus.

  3. Demonstration of the functional role of conserved Glu-Arg residues in the Staphylococcus aureus ferrichrome transporter.


    Vinés, Enrique D; Speziali, Craig D; Heinrichs, David E


    The features that govern the interaction of ligand binding proteins with membrane permeases of cognate ABC transporters are largely unknown. Using sequence alignments and structural modeling based on the structure of the Escherichia coli BtuCD vitamin B12 transporter, we identified six conserved basic residues in the permease, comprised of FhuB and FhuG proteins, in the ferrichrome transporter of Staphylococcus aureus. Using alanine-scanning mutagenesis we demonstrate that two of these residues, FhuB Arg-71 and FhuG Arg-61, play a more dominant role in transporter function than FhuB Arg-74 and Arg-311, and FhuG Arg-64 and Lys-306. Moreover, we show that at positions 71 and 61 in FhuB and FhuG, respectively, arginine cannot be substituted for lysine without loss of transporter function. Previously, our laboratory demonstrated the importance of conserved acidic residues in the ferrichrome binding protein, FhuD2. Taken together, these results support the hypothesis that Glu-Arg salt bridges are critical for the interaction of the ligand binding protein with the transmembrane domains FhuB and FhuG. This hypothesis was further studied by "charge swapping" experiments whereby we constructed a S. aureus strain expressing FhuD2 with conserved residues Glu-97 and Glu-231 replaced by Arg and FhuB and FhuG with conserved basic residues Arg-71 and Arg-61, respectively, replaced by Glu. A strain containing this combination of substitutions restored partial function to the ferrichrome transporter. The results provide a direct demonstration of the functional importance of conserved basic residues on the extracellular surface of the ferrichrome permease in the Gram-positive bacterium S. aureus.

  4. A Fortran program to calculate the matrix elements of the Coulomb interaction involving hydrogenic wave functions

    NASA Astrophysics Data System (ADS)

    Sarkadi, L.


    The program MTRXCOUL [1] calculates the matrix elements of the Coulomb interaction between a charged particle and an atomic electron, ∫ψf∗ (r) | R - r | - 1ψi(r) d r. Bound-free transitions are considered, and non-relativistic hydrogenic wave functions are used. In this revised version a bug discovered in the F3Y CPC Program Library (PL) subprogram [2] is fixed. Furthermore, the COULCC CPC PL subprogram [3] applied for the calculations of the radial wave functions of the free states and the Bessel functions is replaced by the CPC PL subprogram DCOUL [4].

  5. Evolutionarily conserved sequences on human chromosome 21

    SciTech Connect

    Frazer, Kelly A.; Sheehan, John B.; Stokowski, Renee P.; Chen, Xiyin; Hosseini, Roya; Cheng, Jan-Fang; Fodor, Stephen P.A.; Cox, David R.; Patil, Nila


    Comparison of human sequences with the DNA of other mammals is an excellent means of identifying functional elements in the human genome. Here we describe the utility of high-density oligonucleotide arrays as a rapid approach for comparing human sequences with the DNA of multiple species whose sequences are not presently available. High-density arrays representing approximately 22.5 Mb of nonrepetitive human chromosome 21 sequence were synthesized and then hybridized with mouse and dog DNA to identify sequences conserved between humans and mice (human-mouse elements) and between humans and dogs (human-dog elements). Our data show that sequence comparison of multiple species provides a powerful empiric method for identifying actively conserved elements in the human genome. A large fraction of these evolutionarily conserved elements are present in regions on chromosome 21 that do not encode known genes.

  6. Conservation success as a function of good alignment of social and ecological structures and processes.


    Bodin, Orjan; Crona, Beatrice; Thyresson, Matilda; Golz, Anna-Lea; Tengö, Maria


    How to create and adjust governing institutions so that they align (fit) with complex ecosystem processes and structures across scales is an issue of increasing concern in conservation. It is argued that lack of such social-ecological fit makes governance and conservation difficult, yet progress in explicitly defining and rigorously testing what constitutes a good fit has been limited. We used a novel modeling approach and data from case studies of fishery and forest conservation to empirically test presumed relationships between conservation outcomes and certain patterns of alignment of social-ecological interdependences. Our approach made it possible to analyze conservation outcome on a systems level while also providing information on how individual actors are positioned in the complex web of social-ecological interdependencies. We found that when actors who shared resources were also socially linked, conservation at the level of the whole social-ecological system was positively affected. When the scales at which individual actors used resources and the scale at which ecological resources were interconnected to other ecological resources were aligned through tightened feedback loops, conservation outcome was better than when they were not aligned. The analysis of individual actors' positions in the web of social-ecological interdependencies was helpful in understanding why a system has a certain level of social-ecological fit. Results of analysis of positions showed that different actors contributed in very different ways to achieve a certain fit and revealed some underlying difference between the actors, for example in terms of actors' varying rights to access and use different ecological resources.

  7. Structural and functional conservation of key domains in InsP[subscript 3] and ryanodine receptors

    SciTech Connect

    Seo, Min-Duk; Velamakanni, Saroj; Ishiyama, Noboru; Stathopulos, Peter B.; Rossi, Ana M.; Khan, Samir A.; Dale, Philippa; Li, Congmin; Ames, James B.; Ikura, Mitsuhiko; Taylor, Colin W.


    Inositol-1,4,5-trisphosphate receptors (InsP{sub 3}Rs) and ryanodine receptors (RyRs) are tetrameric intracellular Ca{sup 2+} channels. In each of these receptor families, the pore, which is formed by carboxy-terminal transmembrane domains, is regulated by signals that are detected by large cytosolic structures. InsP{sub 3}R gating is initiated by InsP{sub 3} binding to the InsP{sub 3}-binding core (IBC, residues 224-604 of InsP{sub 3}R1) and it requires the suppressor domain (SD, residues 1-223 of InsP{sub 3}R1). Here we present structures of the amino-terminal region (NT, residues 1-604) of rat InsP{sub 3}R1 with (3.6 {angstrom}) and without (3.0 {angstrom}) InsP{sub 3} bound. The arrangement of the three NT domains, SD, IBC-{beta} and IBC-{alpha}, identifies two discrete interfaces ({alpha} and {beta}) between the IBC and SD. Similar interfaces occur between equivalent domains (A, B and C) in RyR1 (ref. 9). The orientations of the three domains when docked into a tetrameric structure of InsP{sub 3}R and of the ABC domains docked into RyR are remarkably similar. The importance of the {alpha}-interface for activation of InsP{sub 3}R and RyR is confirmed by mutagenesis and, for RyR, by disease-causing mutations. Binding of InsP{sub 3} causes partial closure of the clam-like IBC, disrupting the {beta}-interface and pulling the SD towards the IBC. This reorients an exposed SD loop ('hotspot' (HS) loop) that is essential for InsP{sub 3}R activation. The loop is conserved in RyR and includes mutations that are associated with malignant hyperthermia and central core disease. The HS loop interacts with an adjacent NT, suggesting that activation re-arranges inter-subunit interactions. The A domain of RyR functionally replaced the SD in full-length InsP{sub 3}R, and an InsP{sub 3}R in which its C-terminal transmembrane region was replaced by that from RyR1 was gated by InsP{sub 3} and blocked by ryanodine. Activation mechanisms are conserved between InsP{sub 3}R and Ry

  8. Multiple DNA sequence elements are necessary for the function of an immunoglobulin heavy chain promoter.

    PubMed Central

    Eaton, S; Calame, K


    Sequences required for the function of the mouse V1 immunoglobulin heavy chain variable-region (VH) promoter were identified by transient transfection of the normal and mutated promoters into plasmacytoma cells. Our results identify four regions required for normal promoter function: (i) the octamer ATGCAAAT, previously identified by others; (ii) a heptamer, CTAATGA; (iii) a pyrimidine-rich region; and (iv) a region between positions -125 and -251 relative to the transcription start site. Sequence analysis of 19 mouse and human VH 5' flanking regions shows that the heptamer and pyrimidine stretch are strongly conserved. We have also demonstrated that the octamer functions in an orientation independent manner in the VH promoter. Images PMID:3118372

  9. pTC Plasmids from Sulfolobus Species in the Geothermal Area of Tengchong, China: Genomic Conservation and Naturally-Occurring Variations as a Result of Transposition by Mobile Genetic Elements

    PubMed Central

    Xiang, Xiaoyu; Huang, Xiaoxing; Wang, Haina; Huang, Li


    Plasmids occur frequently in Archaea. A novel plasmid (denoted pTC1) containing typical conjugation functions has been isolated from Sulfolobus tengchongensis RT8-4, a strain obtained from a hot spring in Tengchong, China, and characterized. The plasmid is a circular double-stranded DNA molecule of 20,417 bp. Among a total of 26 predicted pTC1 ORFs, 23 have homologues in other known Sulfolobus conjugative plasmids (CPs). pTC1 resembles other Sulfolobus CPs in genome architecture, and is most highly conserved in the genomic region encoding conjugation functions. However, attempts to demonstrate experimentally the capacity of the plasmid for conjugational transfer were unsuccessful. A survey revealed that pTC1 and its closely related plasmid variants were widespread in the geothermal area of Tengchong. Variations of the plasmids at the target sites for transposition by an insertion sequence (IS) and a miniature inverted-repeat transposable element (MITE) were readily detected. The IS was efficiently inserted into the pTC1 genome, and the inserted sequence was inactivated and degraded more frequently in an imprecise manner than in a precise manner. These results suggest that the host organism has evolved a strategy to maintain a balance between the insertion and elimination of mobile genetic elements to permit genomic plasticity while inhibiting their fast spreading. PMID:25686154

  10. Archaeal Haloarcula californiae Icosahedral Virus 1 Highlights Conserved Elements in Icosahedral Membrane-Containing DNA Viruses from Extreme Environments

    PubMed Central

    Demina, Tatiana A.; Pietilä, Maija K.; Svirskaitė, Julija; Ravantti, Janne J.; Atanasova, Nina S.; Bamford, Dennis H.


    ABSTRACT Despite their high genomic diversity, all known viruses are structurally constrained to a limited number of virion morphotypes. One morphotype of viruses infecting bacteria, archaea, and eukaryotes is the tailless icosahedral morphotype with an internal membrane. Although it is considered an abundant morphotype in extreme environments, only seven such archaeal viruses are known. Here, we introduce Haloarcula californiae icosahedral virus 1 (HCIV-1), a halophilic euryarchaeal virus originating from salt crystals. HCIV-1 also retains its infectivity under low-salinity conditions, showing that it is able to adapt to environmental changes. The release of progeny virions resulting from cell lysis was evidenced by reduced cellular oxygen consumption, leakage of intracellular ATP, and binding of an indicator ion to ruptured cell membranes. The virion contains at least 12 different protein species, lipids selectively acquired from the host cell membrane, and a 31,314-bp-long linear double-stranded DNA (dsDNA). The overall genome organization and sequence show high similarity to the genomes of archaeal viruses in the Sphaerolipoviridae family. Phylogenetic analysis based on the major conserved components needed for virion assembly—the major capsid proteins and the packaging ATPase—placed HCIV-1 along with the alphasphaerolipoviruses in a distinct, well-supported clade. On the basis of its virion morphology and sequence similarities, most notably, those of its core virion components, we propose that HCIV-1 is a member of the PRD1-adenovirus structure-based lineage together with other sphaerolipoviruses. This addition to the lineage reinforces the notion of the ancient evolutionary links observed between the viruses and further highlights the limits of the choices found in nature for formation of a virion. PMID:27435460

  11. Concentrations of elements in fish fillets, fish muscle plugs, and crayfish from the 2007 Missouri Department of Conservation General Contaminant Monitoring Program

    USGS Publications Warehouse

    May, Thomas W.; Walther, Michael J.; Brumbaugh, William G.; McKee, Michael J.


    This report presents the results of a contaminant monitoring survey conducted annually by the Missouri Department of Conservation to examine the levels of selected elemental contaminants in fish fillets, fish muscle plugs, and crayfish. Fillets of channel catfish (Ictalurus punctatus), bass (Micropterus salmoides, Micropterus dolomieu, Morone chrysops), walleye (Sander vitreus), common carp (Cyprinus carpio), lake sturgeon (Acipenser fulvescens), northern hog sucker (Hypentelium nigricans), and rainbow trout (Oncorhynchus mykiss) were collected from 21 sites as part of the Department's Fish Contaminant Monitoring Program. Long-pincered crayfish (Orconectes longidigitus) were collected from one site to assess trophic transfer of metals to fish. Fish muscle plugs were collected from smallmouth bass (Micropterus dolomieu) at two different locations from one site.

  12. Investigating the functionality of an OCT4-short response element in human induced pluripotent stem cells

    PubMed Central

    Vega-Crespo, Agustin; Truong, Brian; Hermann, Kip J; Awe, Jason P; Chang, Katherine M; Lee, Patrick C; Schoenberg, Benjamen E; Wu, Lily; Byrne, James A; Lipshutz, Gerald S


    Pluripotent stem cells offer great therapeutic promise for personalized treatment platforms for numerous injuries, disorders, and diseases. Octamer-binding transcription factor 4 (OCT4) is a key regulatory gene maintaining pluripotency and self-renewal of mammalian cells. With site-specific integration for gene correction in cellular therapeutics, use of the OCT4 promoter may have advantages when expressing a suicide gene if pluripotency remains. However, the human OCT4 promoter region is 4 kb in size, limiting the capacity of therapeutic genes and other regulatory components for viral vectors, and decreasing the efficiency of homologous recombination. The purpose of this investigation was to characterize the functionality of a novel 967bp OCT4-short response element during pluripotency and to examine the OCT4 titer-dependent response during differentiation to human derivatives not expressing OCT4. Our findings demonstrate that the OCT4-short response element is active in pluripotency and this activity is in high correlation with transgene expression in vitro, and the OCT4-short response element is inactivated when pluripotent cells differentiate. These studies demonstrate that this shortened OCT4 regulatory element is functional and may be useful as part of an optimized safety component in a site-specific gene transferring system that could be used as an efficient and clinically applicable safety platform for gene transfer in cellular therapeutics. PMID:27500178

  13. Diffraction efficiency and aberrations of diffractive elements obtained from orthogonal expansion of the point spread function

    NASA Astrophysics Data System (ADS)

    Schwiegerling, Jim


    The Point Spread Function (PSF) indirectly encodes the wavefront aberrations of an optical system and therefore is a metric of the system performance. Analysis of the PSF properties is useful in the case of diffractive optics where the wavefront emerging from the exit pupil is not necessarily continuous and consequently not well represented by traditional wavefront error descriptors such as Zernike polynomials. The discontinuities in the wavefront from diffractive optics occur in cases where step heights in the element are not multiples of the illumination wavelength. Examples include binary or N-step structures, multifocal elements where two or more foci are intentionally created or cases where other wavelengths besides the design wavelength are used. Here, a technique for expanding the electric field amplitude of the PSF into a series of orthogonal functions is explored. The expansion coefficients provide insight into the diffraction efficiency and aberration content of diffractive optical elements. Furthermore, this technique is more broadly applicable to elements with a finite number of diffractive zones, as well as decentered patterns.

  14. A Conserved Domain in Type III Secretion Links the Cytoplasmic Domain of InvA to Elements of the Basal Body

    SciTech Connect

    Lilic, M.; Quezada, C; Stebbins, C


    Protein type III secretion systems (T3SSs) are organic nanosyringes that achieve an energy-dependent translocation of bacterial proteins through the two membranes of Gram-negative organisms. Examples include the pathogenic systems of animals, plants and symbiotic bacteria that inject factors into eukaryotic cells, and the flagellar export system that secretes flagellin. T3SSs possess a core of several membrane-associated proteins that are conserved across all known bacterial species that use this system. The Salmonella protein InvA is one of the most highly conserved proteins of this core of critical T3SS components. The crystal structure of a C-terminal domain of InvA reveals an unexpected homology to domains that have been repeatedly found as building blocks of other elements of the T3SS apparatus. This suggests the surprising hypothesis that evolution has produced a significant component of the apparatus structure through a series of gene-duplication and gene-rearrangement events.

  15. A conserved domain in type III secretion links the cytoplasmic domain of InvA to elements of the basal body

    SciTech Connect

    Lilic, Mirjana; Quezada, Cindy M.; Stebbins, C. Erec


    The cytoplasmic domain of Salmonella InvA shares homology to a recurring scaffold in the membrane-spanning components of the type II and type III secretion systems. Protein type III secretion systems (T3SSs) are organic nanosyringes that achieve an energy-dependent translocation of bacterial proteins through the two membranes of Gram-negative organisms. Examples include the pathogenic systems of animals, plants and symbiotic bacteria that inject factors into eukaryotic cells, and the flagellar export system that secretes flagellin. T3SSs possess a core of several membrane-associated proteins that are conserved across all known bacterial species that use this system. The Salmonella protein InvA is one of the most highly conserved proteins of this core of critical T3SS components. The crystal structure of a C-terminal domain of InvA reveals an unexpected homology to domains that have been repeatedly found as building blocks of other elements of the T3SS apparatus. This suggests the surprising hypothesis that evolution has produced a significant component of the apparatus structure through a series of gene-duplication and gene-rearrangement events.

  16. Regulatory elements required for development of caenorhabditis elegans hermaphrodites are conserved in the tra-2 homologue of C. remanei, a male/female sister species.

    PubMed Central

    Haag, E S; Kimble, J


    The Caenorhabditis elegans hermaphrodite is essentially a female that produces sperm. In C. elegans, tra-2 promotes female fates and must be repressed to achieve hermaphrodite spermatogenesis. In an effort to learn how mating systems evolve, we have cloned tra-2 from C. remanei, the closest gonochoristic relative of C. elegans. We found its structure to be similar to that of Ce-tra-2 but its sequence to be divergent. RNA interference demonstrates that Cr-tra-2 promotes female fates. Two sites of tra-2 regulation are required for the onset of hermaphrodite spermatogenesis in C. elegans. One, the MX region of TRA-2, is as well conserved in C. remanei as it is in C. briggsae (another male/hermaphrodite species), suggesting that this control is not unique to hermaphrodites. Another, the DRE/TGE element of the tra-2 3' UTR, was not detected by sequence analysis. However, gel-shift assays demonstrate that a factor in C. remanei can bind specifically to the Cr-tra-2 3' UTR, suggesting that this translational control is also conserved. We propose that both controls are general and do not constitute a novel "switch" that enables sexual mosaicism in hermaphrodites. However, subtle quantitative or qualitative differences in their employment may underlie differences in mating system seen in Caenorhabditis. PMID:10790387

  17. High-resolution interrogation of functional elements in the noncoding genome

    PubMed Central

    Sanjana, Neville E.; Wright, Jason; Zheng, Kaijie; Shalem, Ophir; Fontanillas, Pierre; Joung, Julia; Cheng, Christine; Regev, Aviv; Zhang, Feng


    The noncoding genome affects gene regulation and disease, yet we lack tools for rapid identification and manipulation of noncoding elements. We develop a CRISPR screen employing ~18,000 sgRNAs targeting >700 kb surrounding the genes NF1, NF2, and CUL3, which are involved in BRAF inhibitor resistance in melanoma. We find that noncoding locations that modulate drug resistance also harbor predictive hallmarks of noncoding function. With a subset of regions at the CUL3 locus, we demonstrate that engineered mutations alter transcription factor occupancy and long-range and local epigenetic environments, implicating these sites in gene regulation and chemotherapeutic resistance. Though our expansion of the potential of pooled CRISPR screens we provide tools for genomic discovery and for elucidating biologically relevant mechanisms of gene regulation. Pooled CRISPR mutagenesis identifies functional elements in the noncoding genome. PMID:27708104

  18. Calculation of the matrix elements of the Coulomb interaction involving relativistic hydrogenic wave functions

    NASA Astrophysics Data System (ADS)

    Sarkadi, L.


    The program MTRDCOUL [1] calculates the matrix elements of the Coulomb interaction between a charged particle and an atomic electron, ∫ ψf∗ (r) ∣ R - r∣-1ψi(r) d r. Bound-free transitions are considered, and relativistic hydrogenic wave functions are used. In this revised version a bug discovered in the F3Y CPC Program Library subprogram [2] is fixed.

  19. Post mortem function of AtMC9 in xylem vessel elements.


    Bollhöner, Benjamin; Zhang, Bo; Stael, Simon; Denancé, Nicolas; Overmyer, Kirk; Goffner, Deborah; Van Breusegem, Frank; Tuominen, Hannele


    Cell death of xylem elements is manifested by rupture of the tonoplast and subsequent autolysis of the cellular contents. Metacaspases have been implicated in various forms of plant cell death but regulation and execution of xylem cell death by metacaspases remains unknown. Analysis of the type II metacaspase gene family in Arabidopsis thaliana supported the function of METACASPASE 9 (AtMC9) in xylem cell death. Progression of xylem cell death was analysed in protoxylem vessel elements of 3-d-old atmc9 mutant roots using reporter gene analysis and electron microscopy. Protoxylem cell death was normally initiated in atmc9 mutant lines, but detailed electron microscopic analyses revealed a role for AtMC9 in clearance of the cell contents post mortem, that is after tonoplast rupture. Subcellular localization of fluorescent AtMC9 reporter fusions supported a post mortem role for AtMC9. Further, probe-based activity profiling suggested a function of AtMC9 on activities of papain-like cysteine proteases. Our data demonstrate that the function of AtMC9 in xylem cell death is to degrade vessel cell contents after vacuolar rupture. We further provide evidence on a proteolytic cascade in post mortem autolysis of xylem vessel elements and suggest that AtMC9 is part of this cascade.

  20. The role of reserves and anthropogenic elements for functional connectivity and resilience of ephemeral habitats

    USGS Publications Warehouse

    Uden, Daniel R.; Hellman, Michelle L.; Angeler, David G.; Allen, Craig R.


    Ecological reserves provide important wildlife habitat in many landscapes, and the functional connectivity of reserves and other suitable habitat patches is crucial for the persistence and resilience of spatially structured populations. To maintain or increase connectivity at spatial scales larger than individual patches, conservation actions may focus on creating and maintaining reserves and/or influencing management on non-reserves. Using a graph-theoretic approach, we assessed the functional connectivity and spatial distribution of wetlands in the Rainwater Basin of Nebraska, USA, an intensively cultivated agricultural matrix, at four assumed, but ecologically realistic, anuran dispersal distances. We compared connectivity in the current landscape to the historical landscape and putative future landscapes, and evaluated the importance of individual and aggregated reserve and non-reserve wetlands for maintaining connectivity. Connectivity was greatest in the historical landscape, where wetlands were also the most densely distributed. The construction of irrigation reuse pits for water storage has maintained connectivity in the current landscape by replacing destroyed wetlands, but these pits likely provide suboptimal habitat. Also, because there are fewer total wetlands (i.e., wetlands and irrigation reuse pits) in the current landscape than the historical landscape, and because the distribution of current wetlands is less clustered than that of historical wetlands, larger and longer dispersing, sometimes nonnative species may be favored over smaller, shorter dispersing species of conservation concern. Because of their relatively low number, wetland reserves do not affect connectivity as greatly as non-reserve wetlands or irrigation reuse pits; however, they likely provide the highest quality anuran habitat. To improve future levels of resilience in this wetland habitat network, management could focus on continuing to improve the conservation status of non

  1. The value of countryside elements in the conservation of a threatened arboreal marsupial Petaurus norfolcensis in agricultural landscapes of south-eastern Australia--the disproportional value of scattered trees.


    Crane, Mason J; Lindenmayer, David B; Cunningham, Ross B


    Human activities, particularly agriculture, have transformed much of the world's terrestrial environment. Within these anthropogenic landscapes, a variety of relictual and semi-natural habitats exist, which we term countryside elements. The habitat value of countryside elements (hereafter termed 'elements') is increasingly recognised. We quantify the relative value of four kinds of such 'elements' (linear roadside remnants, native vegetation patches, scattered trees and tree plantings) used by a threatened Australian arboreal marsupial, the squirrel glider (Petaurus norfolcensis). We examined relationships between home range size and the availability of each 'element' and whether the usage was relative to predicted levels of use. The use of 'elements' by gliders was largely explained by their availability, but there was a preference for native vegetation patches and scattered trees. We found home range size was significantly smaller with increasing area of scattered trees and a contrasting effect with increasing area of linear roadside remnants or native vegetation patches. Our work showed that each 'element' was used and as such had a role in the conservation of the squirrel glider, but their relative value varied. We illustrate the need to assess the conservation value of countryside elements so they can be incorporated into the holistic management of agricultural landscapes. This work demonstrates the disproportional value of scattered trees, underscoring the need to specifically incorporate and/or enhance the protection and recruitment of scattered trees in biodiversity conservation policy and management.

  2. Transposable element fragments in protein-coding regions and their contributions to human functional proteins.


    Wu, Ming; Li, Li; Sun, Zhirong


    Transposable elements (TEs) and their contributions to protein-coding regions are of particular interest. Here we searched for TE fragments in Homo sapiens at both the transcript and protein levels. We found evidence in support of TE exonization and its association with alternative splicing. Despite recent findings that long evolutionary times are required to incorporate TE into proteins, we found many functional proteins with translated TE cassettes derived from young TEs. Analyses of two Bcl-family proteins and Alu-encoded segments suggest the coding and functional potential of TE sequences.

  3. A Global Interpolation Function (GIF) boundary element code for viscous flows

    NASA Technical Reports Server (NTRS)

    Reddy, D. R.; Lafe, O.; Cheng, A. H-D.


    Using global interpolation functions (GIF's), boundary element solutions are obtained for two- and three-dimensional viscous flows. The solution is obtained in the form of a boundary integral plus a series of global basis functions. The unknown coefficients of the GIF's are determined to ensure the satisfaction of the governing equations at selected collocation points. The values of the coefficients involved in the boundary integral equations are determined by enforcing the boundary conditions. Both primitive variable and vorticity-velocity formulations are examined.

  4. Impact of conservation land management practices on soil microbial function in an agricultural watershed

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The USDA Conservation Reserve Program (CRP) involves removing agricultural land from production and replanting with native vegetation for the purpose of reducing agriculture’s impact on the environment. In 2002, part of the Beasley Lake watershed in the Mississippi Delta was enrolled in CRP. In ad...

  5. Functional and Phylogenetic Analyses of a Conserved Regulatory Program in the Phloem of Minor Veins1[w

    PubMed Central

    Ayre, Brian G.; Blair, Jaime E.; Turgeon, Robert


    The minor-vein phloem of mature leaves is developmentally and physiologically distinct from the phloem in the rest of the vascular system. Phloem loading of transport sugars occurs in the minor veins, and consistent with this, galactinol synthase is expressed in the minor veins of melon (Cucumis melo) as part of the symplastic-loading mechanism that operates in this species. A galactinol synthase promoter from melon drives gene expression in the minor-vein companion cells of both transgenic tobacco (Nicotiana tabacum) and Arabidopsis. Neither of these plants use galactinol in the phloem-loading process, implying that the promoter responds to a minor-vein-specific regulatory cascade that is highly conserved across a broad range of eudicotyledons. Detailed analysis of this promoter by truncation and mutagenesis identified three closely coupled sequences that unambiguously modulate tissue specificity. These sequences cooperate in a combinatorial fashion: two promote expression throughout the vascular system of the plant, whereas the third functions to repress expression in the larger bundles. In a complementary approach, phylogenetic footprinting was used to obtain single-nucleotide resolution of conserved sites in orthologous promoters from diverse members of the Cucurbitaceae. This comparative analysis confirmed the importance of the closely coupled sites but also revealed other highly conserved sequences that may modulate promoter strength or contribute to expression patterns outside of the phloem. The conservation of this regulatory design among species that phloem load by different mechanisms supports a model for organismal development in which tissues and cell types are controlled by relatively ancient and conserved paradigms but expression of genes influencing final form and function are relatively plastic. PMID:14526110

  6. Large-scale All-electron Density Functional Theory Calculations using Enriched Finite Element Method

    NASA Astrophysics Data System (ADS)

    Kanungo, Bikash; Gavini, Vikram

    We present a computationally efficient method to perform large-scale all-electron density functional theory calculations by enriching the Lagrange polynomial basis in classical finite element (FE) discretization with atom-centered numerical basis functions, which are obtained from the solutions of the Kohn-Sham (KS) problem for single atoms. We term these atom-centered numerical basis functions as enrichment functions. The integrals involved in the construction of the discrete KS Hamiltonian and overlap matrix are computed using an adaptive quadrature grid based on gradients in the enrichment functions. Further, we propose an efficient scheme to invert the overlap matrix by exploiting its LDL factorization and employing spectral finite elements along with Gauss-Lobatto quadrature rules. Finally, we use a Chebyshev polynomial based acceleration technique to compute the occupied eigenspace in each self-consistent iteration. We demonstrate the accuracy, efficiency and scalability of the proposed method on various metallic and insulating benchmark systems, with systems ranging in the order of 10,000 electrons. We observe a 50-100 fold reduction in the overall computational time when compared to classical FE calculations while being commensurate with the desired chemical accuracy. We acknowledge the support of NSF (Grant No. 1053145) and ARO (Grant No. W911NF-15-1-0158) in conducting this work.

  7. Coevolution Pattern and Functional Conservation or Divergence of miR167s and their targets across Diverse Plant Species

    PubMed Central

    Barik, Suvakanta; Kumar, Ashutosh; Sarkar Das, Shabari; Yadav, Sandeep; Gautam, Vibhav; Singh, Archita; Singh, Sharmila; Sarkar, Ananda K.


    microRNAs (miRNAs), a class of endogenously produced small non-coding RNAs of 20–21 nt length, processed from precursor miRNAs, regulate many developmental processes by negatively regulating the target genes in both animals and plants. The coevolutionary pattern of a miRNA family and their targets underscores its functional conservation or diversification. The miR167 regulates various aspects of plant development in Arabidopsis by targeting ARF6 and ARF8. The evolutionary conservation or divergence of miR167s and their target genes are poorly understood till now. Here we show the evolutionary relationship among 153 MIR167 genes obtained from 33 diverse plant species. We found that out of the 153 of miR167 sequences retrieved from the “miRBase”, 27 have been annotated to be processed from the 3′ end, and have diverged distinctively from the other miR167s produced from 5′ end. Our analysis reveals that gma-miR167h/i and mdm-miR167a are processed from 3′ end and have evolved separately, diverged most resulting in novel targets other than their known ones, and thus led to functional diversification, especially in apple and soybean. We also show that mostly conserved miR167 sequences and their target AUXIN RESPONSE FACTORS (ARFs) have gone through parallel evolution leading to functional diversification among diverse plant species. PMID:26459056

  8. Coevolution Pattern and Functional Conservation or Divergence of miR167s and their targets across Diverse Plant Species.


    Barik, Suvakanta; Kumar, Ashutosh; Sarkar Das, Shabari; Yadav, Sandeep; Gautam, Vibhav; Singh, Archita; Singh, Sharmila; Sarkar, Ananda K


    microRNAs (miRNAs), a class of endogenously produced small non-coding RNAs of 20-21 nt length, processed from precursor miRNAs, regulate many developmental processes by negatively regulating the target genes in both animals and plants. The coevolutionary pattern of a miRNA family and their targets underscores its functional conservation or diversification. The miR167 regulates various aspects of plant development in Arabidopsis by targeting ARF6 and ARF8. The evolutionary conservation or divergence of miR167s and their target genes are poorly understood till now. Here we show the evolutionary relationship among 153 MIR167 genes obtained from 33 diverse plant species. We found that out of the 153 of miR167 sequences retrieved from the "miRBase", 27 have been annotated to be processed from the 3' end, and have diverged distinctively from the other miR167s produced from 5' end. Our analysis reveals that gma-miR167h/i and mdm-miR167a are processed from 3' end and have evolved separately, diverged most resulting in novel targets other than their known ones, and thus led to functional diversification, especially in apple and soybean. We also show that mostly conserved miR167 sequences and their target AUXIN RESPONSE FACTORS (ARFs) have gone through parallel evolution leading to functional diversification among diverse plant species.

  9. Essential elements for translation: the germline factor Vasa functions broadly in somatic cells

    PubMed Central

    Yajima, Mamiko; Wessel, Gary M.


    ABSTRACT Vasa is a conserved RNA-helicase found in the germ lines of all metazoans tested. Whereas Vasa presence is often indicated as a metric for germline determination in animals, it is also expressed in stem cells of diverse origin. Recent research suggests, however, that Vasa has a much broader function, including a significant role in cell cycle regulation. Results herein indicate that Vasa is utilized widely, and often induced transiently, during development in diverse somatic cells and adult precursor tissues. We identified that Vasa in the sea urchin is essential for: (1) general mRNA translation during embryogenesis, (2) developmental re-programming upon manipulations to the embryo and (3) larval wound healing. We also learned that Vasa interacted with mRNAs in the perinuclear area and at the spindle in an Importin-dependent manner during cell cycle progression. These results suggest that, when present, Vasa functions are essential to contributing to developmental regulation. PMID:25977366

  10. Essential elements for translation: the germline factor Vasa functions broadly in somatic cells.


    Yajima, Mamiko; Wessel, Gary M


    Vasa is a conserved RNA-helicase found in the germ lines of all metazoans tested. Whereas Vasa presence is often indicated as a metric for germline determination in animals, it is also expressed in stem cells of diverse origin. Recent research suggests, however, that Vasa has a much broader function, including a significant role in cell cycle regulation. Results herein indicate that Vasa is utilized widely, and often induced transiently, during development in diverse somatic cells and adult precursor tissues. We identified that Vasa in the sea urchin is essential for: (1) general mRNA translation during embryogenesis, (2) developmental re-programming upon manipulations to the embryo and (3) larval wound healing. We also learned that Vasa interacted with mRNAs in the perinuclear area and at the spindle in an Importin-dependent manner during cell cycle progression. These results suggest that, when present, Vasa functions are essential to contributing to developmental regulation.

  11. Invertrons, a class of structurally and functionally related genetic elements that includes linear DNA plasmids, transposable elements, and genomes of adeno-type viruses.

    PubMed Central

    Sakaguchi, K


    Invertrons are genetic elements composed of DNA with inverted terminal repeats at both ends, covalently bonded to terminal proteins involved in the initiation of DNA replication at both their 5' termini when they exist in the cytoplasm of their host in free form. They function as viruses, linear DNA plasmids, transposable elements, and sometimes combinations of two of these properties. They differ from retroviruses and related retro-type transposons which have direct repeats on both their genomic ends and exploit RNA intermediates for replication of their DNA. A model for replication and integration of invertrons is presented, as well as a model for transposition of transposable elements. PMID:2157134

  12. Differential nuclease sensitivity profiling of chromatin reveals biochemical footprints coupled to gene expression and functional DNA elements in maize.


    Vera, Daniel L; Madzima, Thelma F; Labonne, Jonathan D; Alam, Mohammad P; Hoffman, Gregg G; Girimurugan, S B; Zhang, Jinfeng; McGinnis, Karen M; Dennis, Jonathan H; Bass, Hank W


    The eukaryotic genome is organized into nucleosomes, the fundamental units of chromatin. The positions of nucleosomes on DNA regulate protein-DNA interactions and in turn influence DNA-templated events. Despite the increasing number of genome-wide maps of nucleosome position, how global changes in gene expression relate to changes in nucleosome position is poorly understood. We show that in nucleosome occupancy mapping experiments in maize (Zea mays), particular genomic regions are highly susceptible to variation introduced by differences in the extent to which chromatin is digested with micrococcal nuclease (MNase). We exploited this digestion-linked variation to identify protein footprints that are hypersensitive to MNase digestion, an approach we term differential nuclease sensitivity profiling (DNS-chip). Hypersensitive footprints were enriched at the 5' and 3' ends of genes, associated with gene expression levels, and significantly overlapped with conserved noncoding sequences and the binding sites of the transcription factor KNOTTED1. We also found that the tissue-specific regulation of gene expression was linked to tissue-specific hypersensitive footprints. These results reveal biochemical features of nucleosome organization that correlate with gene expression levels and colocalize with functional DNA elements. This approach to chromatin profiling should be broadly applicable to other species and should shed light on the relationships among chromatin organization, protein-DNA interactions, and genome regulation.

  13. A generalized finite element method with global-local enrichment functions for confined plasticity problems

    NASA Astrophysics Data System (ADS)

    Kim, D.-J.; Duarte, C. A.; Proenca, S. P.


    The main feature of partition of unity methods such as the generalized or extended finite element method is their ability of utilizing a priori knowledge about the solution of a problem in the form of enrichment functions. However, analytical derivation of enrichment functions with good approximation properties is mostly limited to two-dimensional linear problems. This paper presents a procedure to numerically generate proper enrichment functions for three-dimensional problems with confined plasticity where plastic evolution is gradual. This procedure involves the solution of boundary value problems around local regions exhibiting nonlinear behavior and the enrichment of the global solution space with the local solutions through the partition of unity method framework. This approach can produce accurate nonlinear solutions with a reduced computational cost compared to standard finite element methods since computationally intensive nonlinear iterations can be performed on coarse global meshes after the creation of enrichment functions properly describing localized nonlinear behavior. Several three-dimensional nonlinear problems based on the rate-independent J 2 plasticity theory with isotropic hardening are solved using the proposed procedure to demonstrate its robustness, accuracy and computational efficiency.

  14. [Functioning of the anaesthetic conserving device: aspects to consider for use in inhalational sedation].


    Meiser, A; Bellgardt, M; Vogelsang, H; Sirtl, C; Weber, T


    The new anaesthetic conserving device (ACD) allows the use of isoflurane and sevoflurane without classical anaesthesia workstations. Volatile anaesthetic exhaled by the patient is absorbed by a reflector and released to the patient during the next inspiration. Liquid anaesthetic is delivered via a syringe pump. Currently the use of the ACD is spreading among European intensive care units (ICU). This article focuses on the functioning of the device and on particularities which are important to consider. The ACD constantly reflects 90% of the exhaled anaesthetic back to the patient, but if one exhaled breath contains more than 10 ml of anaesthetic vapour (e.g. >1 vol% in 1,000 ml), the capacity of the reflector will be exceeded and relatively more anaesthetic will be lost to the patient. This spill over decreases efficiency but it also contributes to safety as very high concentrations are averted. Compared to classical anaesthesia systems the ACD used in conjunction with ICU ventilators offers advantages in the ICU setting: investment costs are low, carbon dioxide absorbent is not needed, breathing comfort is higher, anaesthetic consumption is low (equal to an anaesthesia circuit with a fresh gas flow of approximately 1 l/min) and anaesthetic concentrations can be controlled very quickly (increased by small boluses and decreased by removal of the ACD). On the other hand, case costs are higher (single patient use) and a dead space of 100 ml is added. There are pitfalls: by a process called auto-pumping, expansion of bubbles inside the syringe may lead to uncontrolled anaesthetic delivery. Auto-pumping is provoked by high positioning of the syringe pump, heat and prior cooling of the liquid anaesthetic. Inherent to the device is an early inspiratory concentration peak and an end-inspiratory dip which may mislead commonly used gas monitors. Workplace concentrations can be minimized by proper handling, a sufficient turnover of room air is important and gas from the

  15. Tracing the origin of functional and conserved domains in the human proteome: implications for protein evolution at the modular level

    PubMed Central

    Pal, Lipika R; Guda, Chittibabu


    Background The functional repertoire of the human proteome is an incremental collection of functions accomplished by protein domains evolved along the Homo sapiens lineage. Therefore, knowledge on the origin of these functionalities provides a better understanding of the domain and protein evolution in human. The lack of proper comprehension about such origin has impelled us to study the evolutionary origin of human proteome in a unique way as detailed in this study. Results This study reports a unique approach for understanding the evolution of human proteome by tracing the origin of its constituting domains hierarchically, along the Homo sapiens lineage. The uniqueness of this method lies in subtractive searching of functional and conserved domains in the human proteome resulting in higher efficiency of detecting their origins. From these analyses the nature of protein evolution and trends in domain evolution can be observed in the context of the entire human proteome data. The method adopted here also helps delineate the degree of divergence of functional families occurred during the course of evolution. Conclusion This approach to trace the evolutionary origin of functional domains in the human proteome facilitates better understanding of their functional versatility as well as provides insights into the functionality of hypothetical proteins present in the human proteome. This work elucidates the origin of functional and conserved domains in human proteins, their distribution along the Homo sapiens lineage, occurrence frequency of different domain combinations and proteome-wide patterns of their distribution, providing insights into the evolutionary solution to the increased complexity of the human proteome. PMID:17090320

  16. The gp63 Gene Cluster Is Highly Polymorphic in Natural Leishmania (Viannia) braziliensis Populations, but Functional Sites Are Conserved

    PubMed Central

    Medina, Lilian S.; Souza, Bruno Araújo; Queiroz, Adriano; Guimarães, Luiz Henrique; Lima Machado, Paulo Roberto; M Carvalho, Edgar; Wilson, Mary Edythe; Schriefer, Albert


    GP63 or leishmanolysin is the major surface protease of Leishmania spp. involved in parasite virulence and host cell interaction. As such, GP63 is a potential target of eventual vaccines against these protozoa. In the current study we evaluate the polymorphism of gp63 in Leishmania (Viannia) braziliensis isolated from two sets of American tegumentary leishmaniasis (ATL) cases from Corte de Pedra, Brazil, including 35 cases diagnosed between 1994 and 2001 and 6 cases diagnosed between 2008 and 2011. Parasites were obtained from lesions by needle aspiration and cultivation. Genomic DNA was extracted, and 405 bp fragments, including sequences encoding the putative macrophage interacting sites, were amplified from gp63 genes of all isolates. DNA amplicons were cloned into plasmid vectors and ten clones per L. (V.) braziliensis isolate were sequenced. Alignment of cloned sequences showed extensive polymorphism among gp63 genes within, and between parasite isolates. Overall, 45 different polymorphic alleles were detected in all samples, which could be segregated into two clusters. Cluster one included 25, and cluster two included 20 such genotypes. The predicted peptides showed overall conservation below 50%. In marked contrast, the conservation at segments with putative functional domains approached 90% (Fisher’s exact test p<0.0001). These findings show that gp63 is very polymorphic even among parasites from a same endemic focus, but the functional domains interacting with the mammalian host environment are conserved. PMID:27648939

  17. Stress Responses of Small Heat Shock Protein Genes in Lepidoptera Point to Limited Conservation of Function across Phylogeny

    PubMed Central

    Zhang, Bo; Zheng, Jincheng; Peng, Yu; Liu, Xiaoxia; Hoffmann, Ary A.; Ma, Chun-Sen


    The small heat shock protein (sHsp) family is thought to play an important role in protein refolding and signal transduction, and thereby protect organisms from stress. However little is known about sHsp function and conservation across phylogenies. In the current study, we provide a comprehensive assessment of small Hsp genes and their stress responses in the oriental fruit moth (OFM), Grapholita molesta. Fourteen small heat shock proteins of OFM clustered with related Hsps in other Lepidoptera despite a high level of variability among them, and in contrast to the highly conserved Hsp11.1. The only known lepidopteran sHsp ortholog (Hsp21.3) was consistently unaffected under thermal stress in Lepidoptera where it has been characterized. However the phylogenetic position of the sHsps within the Lepidoptera was not associated with conservation of induction patterns under thermal extremes or diapause. These findings suggest that the sHsps have evolved rapidly to develop new functions within the Lepidoptera. PMID:26196395

  18. Analysis of Fibroblast growth factor 15 cis-elements reveals two conserved enhancers which are closely related to cardiac outflow tract development.


    Saitsu, Hirotomo; Shiota, Kohei; Ishibashi, Makoto


    Fibroblast growth factor 15 (Fgf15) is expressed in the developing mouse central nervous system and pharyngeal arches. Fgf15 mutant mice showed defects of the cardiac outflow tract probably because of aberrant behavior of the cardiac neural crest cells. In this study, we examined cis-elements of the Fgf15 gene by transient transgenic analysis using lacZ as a reporter. We identified two enhancers: one directed lacZ expression in the hindbrain/spinal cord and the other in the posterior midbrain (pmb), rhombomere1 (r1) and pharyngeal epithelia. Interestingly, human genomic regions which are highly homologous to these two mouse enhancers showed almost the same enhancer activities as those of mice in transgenic mouse embryos, indicating that the two enhancers are conserved between humans and mice. We also showed that the mouse and human pmb/r1 enhancer can regulate lacZ expression in chick embryos in almost the same way as in mouse embryos. We found that the lacZ expression domain with this enhancer was expanded by ectopic Fgf8b expression, suggesting that this enhancer is regulated by Fgf8 signaling. Moreover, over-expression of Fgf15 resulted in up-regulation of Fgf8 expression in the isthmus/r1. These findings suggest that a reciprocal positive regulation exists between Fgf15 and Fgf8 in the isthmus/r1. Together with cardiac outflow tract defects in Fgf15 mutants, the conservation of enhancers in the hindbrain/spinal cord and pharyngeal epithelia suggests that human FGF19 (ortholog of Fgf15) is involved in early development and the distribution of cardiac neural crest cells and is one of the candidate genes for congenital heart defects.

  19. Identification of functional elements and regulatory circuits by Drosophila modENCODE

    SciTech Connect

    Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V.; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L.; Landolin, Jane M.; Bristow, Christopher A.; Ma, Lijia; Lin, Michael F.; Washietl, Stefan; Arshinoff, Bradley I.; Ay, Ferhat; Meyer, Patrick E.; Robine, Nicolas; Washington, Nicole L.; Stefano, Luisa Di; Berezikov, Eugene; Brown, Christopher D.; Candeias, Rogerio; Carlson, Joseph W.; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y.; Will, Sebastian; Alekseyenko, Artyom A.; Artieri, Carlo; Booth, Benjamin W.; Brooks, Angela N.; Dai, Qi; Davis, Carrie A.; Duff, Michael O.; Feng, Xin; Gorchakov, Andrey A.; Gu, Tingting; Henikoff, Jorja G.; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K.; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K.; Riddle, Nicole C.; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E.; Schwartz, Yuri B.; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H.; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E.; Brent, Michael R.; Cherbas, Lucy; Elgin, Sarah C. R.; Gingeras, Thomas R.; Grossman, Robert; Hoskins, Roger A.; Kaufman, Thomas C.; Kent, William; Kuroda, Mitzi I.; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W.; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R.; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J.; Celniker, Susan E.; Henikoff, Steven; Karpen, Gary H.; Lai, Eric C.; MacAlpine, David M.; Stein, Lincoln D.; White, Kevin P.; Kellis, Manolis


    To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation. Several years after the complete genetic sequencing of many species, it is still unclear how to translate genomic information into a functional map of cellular and developmental programs. The Encyclopedia of DNA Elements (ENCODE) (1) and model organism ENCODE (modENCODE) (2) projects use diverse genomic assays to comprehensively annotate the Homo sapiens (human), Drosophila melanogaster (fruit fly), and Caenorhabditis elegans (worm) genomes, through systematic generation and computational integration of functional genomic data sets. Previous genomic studies in flies have made seminal contributions to our understanding of basic biological mechanisms and genome functions, facilitated by genetic, experimental, computational, and manual annotation of the euchromatic and heterochromatic genome (3), small genome size, short life cycle, and a deep knowledge of development, gene function, and chromosome biology. The functions

  20. Functional Conservation of the Glide/Gcm Regulatory Network Controlling Glia, Hemocyte, and Tendon Cell Differentiation in Drosophila.


    Cattenoz, Pierre B; Popkova, Anna; Southall, Tony D; Aiello, Giuseppe; Brand, Andrea H; Giangrande, Angela


    High-throughput screens allow us to understand how transcription factors trigger developmental processes, including cell specification. A major challenge is identification of their binding sites because feedback loops and homeostatic interactions may mask the direct impact of those factors in transcriptome analyses. Moreover, this approach dissects the downstream signaling cascades and facilitates identification of conserved transcriptional programs. Here we show the results and the validation of a DNA adenine methyltransferase identification (DamID) genome-wide screen that identifies the direct targets of Glide/Gcm, a potent transcription factor that controls glia, hemocyte, and tendon cell differentiation in Drosophila. The screen identifies many genes that had not been previously associated with Glide/Gcm and highlights three major signaling pathways interacting with Glide/Gcm: Notch, Hedgehog, and JAK/STAT, which all involve feedback loops. Furthermore, the screen identifies effector molecules that are necessary for cell-cell interactions during late developmental processes and/or in ontogeny. Typically, immunoglobulin (Ig) domain-containing proteins control cell adhesion and axonal navigation. This shows that early and transiently expressed fate determinants not only control other transcription factors that, in turn, implement a specific developmental program but also directly affect late developmental events and cell function. Finally, while the mammalian genome contains two orthologous Gcm genes, their function has been demonstrated in vertebrate-specific tissues, placenta, and parathyroid glands, begging questions on the evolutionary conservation of the Gcm cascade in higher organisms. Here we provide the first evidence for the conservation of Gcm direct targets in humans. In sum, this work uncovers novel aspects of cell specification and sets the basis for further understanding of the role of conserved Gcm gene regulatory cascades.

  1. The expression pattern of genes involved in early neurogenesis suggests distinct and conserved functions in the diplopod Glomeris marginata.


    Pioro, Hilary L; Stollewerk, Angelika


    We have shown recently that the expression and function of proneural genes is conserved in chelicerates and myriapods, although groups of neural precursors are specified in the ventral neuroectoderm of these arthropod groups, rather than single cells as in insects and crustaceans. We present additional evidence that the pattern of neurogenesis seen in chelicerates and in previously analyzed myriapod species is representative of both arthropod groups, by analysing the formation of neural precursors in the diplopod Archispirostreptus sp. This raises the question as to what extent the genetic network has been modified to result in different modes of neurogenesis in the arthropod group. To find out which components of the neural genetic network might account for the different mode of neural precursor formation in chelicerates and myriapods, we identified genes in the diplopod Glomeris marginata that are known to be involved in early neurogenesis in Drosophila and studied their expression pattern. In Drosophila, early neurogenesis is controlled by proneural genes that encode HLH transcription factors. These genes belong to two major subfamilies, the achaete-scute group and the atonal group. Different proneural proteins activate both a common neural programme and distinct neuronal subtype-specific target genes. We show that the expression pattern of homologs of the Drosophila proneural genes daughterless, atonal, and Sox B1 are partially conserved in Glomeris mariginata. While the expression of the pan-neural gene snail is conserved in the ventral neuroectoderm of G. marginata, we found an additional expression domain in the ventral midline. We conclude that, although the components of the genetic network involved in specification of neural precursors seem to be conserved in chelicerates, myriapods, and Drosophila, the function of some of the genes might have changed during evolution.

  2. Functional Conservation of the Glide/Gcm Regulatory Network Controlling Glia, Hemocyte, and Tendon Cell Differentiation in Drosophila

    PubMed Central

    Cattenoz, Pierre B.; Popkova, Anna; Southall, Tony D.; Aiello, Giuseppe; Brand, Andrea H.; Giangrande, Angela


    High-throughput screens allow us to understand how transcription factors trigger developmental processes, including cell specification. A major challenge is identification of their binding sites because feedback loops and homeostatic interactions may mask the direct impact of those factors in transcriptome analyses. Moreover, this approach dissects the downstream signaling cascades and facilitates identification of conserved transcriptional programs. Here we show the results and the validation of a DNA adenine methyltransferase identification (DamID) genome-wide screen that identifies the direct targets of Glide/Gcm, a potent transcription factor that controls glia, hemocyte, and tendon cell differentiation in Drosophila. The screen identifies many genes that had not been previously associated with Glide/Gcm and highlights three major signaling pathways interacting with Glide/Gcm: Notch, Hedgehog, and JAK/STAT, which all involve feedback loops. Furthermore, the screen identifies effector molecules that are necessary for cell-cell interactions during late developmental processes and/or in ontogeny. Typically, immunoglobulin (Ig) domain–containing proteins control cell adhesion and axonal navigation. This shows that early and transiently expressed fate determinants not only control other transcription factors that, in turn, implement a specific developmental program but also directly affect late developmental events and cell function. Finally, while the mammalian genome contains two orthologous Gcm genes, their function has been demonstrated in vertebrate-specific tissues, placenta, and parathyroid glands, begging questions on the evolutionary conservation of the Gcm cascade in higher organisms. Here we provide the first evidence for the conservation of Gcm direct targets in humans. In sum, this work uncovers novel aspects of cell specification and sets the basis for further understanding of the role of conserved Gcm gene regulatory cascades. PMID:26567182

  3. The PRE and PQ box are functionally distinct yeast pheromone response elements.

    PubMed Central

    Sengupta, P; Cochran, B H


    Saccharomyces cerevisiae mating pheromones function by binding to cell surface receptors and activating signal transduction processes which regulate gene expression. In this report, we have analyzed the minimum sequence requirements for conferring both a and alpha mating pheromone inducibilities onto a heterologous promoter. Here we show that the repetitive pheromone response element (PRE) which binds to STE12 protein is sufficient to confer pheromone responsiveness only when present in multiple copies. Moreover, by itself, it is preferentially responsive to alpha factor in a cells. In contrast, a single copy of the PQ box of the STE3 upstream activation sequence (UAS) is sufficient to confer a-factor responsiveness in alpha cells. The PQ box binds both MCM1 and MAT alpha 1 in a cooperative manner, and neither the P nor Q site alone is sufficient to confer a-factor responsiveness. In a cells, however, even multiple copies of the PQ box fail to confer alpha-factor responsiveness. Therefore, the PRE and the PQ box are functionally distinct pheromone-responsive elements with opposite cell type specificities. Moreover, these results indicate that the MCM1 protein functions in a signal transduction pathway in a manner analogous to that of its mammalian homolog, the serum response factor, which regulates the expression of the c-fos proto-oncogene in mammals. PMID:2247085

  4. CLHM-1 is a Functionally Conserved and Conditionally Toxic Ca2+-Permeable Ion Channel in Caenorhabditis elegans

    PubMed Central

    Tanis, Jessica E.; Ma, Zhongming; Krajacic, Predrag; He, Liping; Foskett, J. Kevin


    Disruption of neuronal Ca2+ homeostasis contributes to neurodegenerative diseases through mechanisms that are not fully understood. A polymorphism in CALHM1, a recently described ion channel that regulates intracellular Ca2+ levels, is a possible risk factor for late-onset Alzheimer's disease. Since there are six potentially redundant CALHM family members in humans, the physiological and pathophysiological consequences of CALHM1 function in vivo remain unclear. The nematode Caenorhabditis elegans expresses a single CALHM1 homolog, CLHM-1. Here we find that CLHM-1 is expressed at the plasma membrane of sensory neurons and muscles. Like human CALHM1, C. elegans CLHM-1 is a Ca2+-permeable ion channel regulated by voltage and extracellular Ca2+. Loss of clhm-1 in the body-wall muscles disrupts locomotory kinematics and biomechanics, demonstrating that CLHM-1 has a physiologically significant role in vivo. The motility defects observed in clhm-1 mutant animals can be rescued by muscle-specific expression of either C. elegans CLHM-1 or human CALHM1, suggesting that the function of these proteins is conserved in vivo. Overexpression of either C. elegans CLHM-1 or human CALHM1 in neurons is toxic, causing degeneration through a necrotic-like mechanism that is partially Ca2+ dependent. Our data show that CLHM-1 is a functionally conserved ion channel that plays an important but potentially toxic role in excitable cell function. PMID:23884934

  5. Association of tissue lineage and gene expression: conservatively and differentially expressed genes define common and special functions of tissues

    PubMed Central


    Background Embryogenesis is the process by which the embryo is formed, develops, and establishes developmental hierarchies of tissues. The recent advance in microarray technology made it possible to investigate the tissue specific patterns of gene expression and their relationship with tissue lineages. This study is focused on how tissue specific functions, tissue lineage, and cell differentiation are correlated, which is essential to understand embryonic development and organism complexity. Results We performed individual gene and gene set based analysis on multiple tissue expression data, in association with the classic topology of mammalian fate maps of embryogenesis. For each sub-group of tissues on the fate map, conservatively, differentially and correlatively expressed genes or gene sets were identified. Tissue distance was found to correlate with gene expression divergence. Tissues of the ectoderm or mesoderm origins from the same segments on the fate map shared more similar expression pattern than those from different origins. Conservatively expressed genes or gene sets define common functions in a tissue group and are related to tissue specific diseases, which is supported by results from Gene Ontology and KEGG pathway analysis. Gene expression divergence is larger in certain human tissues than in the mouse homologous tissues. Conclusion The results from tissue lineage and gene expression analysis indicate that common function features of neighbor tissue groups were defined by the conservatively expressed genes and were related to tissue specific diseases, and differentially expressed genes contribute to the functional divergence of tissues. The difference of gene expression divergence in human and mouse homologous tissues reflected the organism complexity, i.e. distinct neural development levels and different body sizes. PMID:21172044

  6. Trends in element incorporation in hyaline and porcelaneous foraminifera as a function of pCO2

    NASA Astrophysics Data System (ADS)

    van Dijk, Inge; de Nooijer, Lennart J.; Reichart, Gert-Jan


    In this study we analyzed the impact of seawater carbonate chemistry on the incorporation of elements in both hyaline and porcelaneous larger benthic foraminifera. We observed a higher incorporation of Zn and Ba when pCO2 increases from 350 to 1200 ppm. Modeling the activity of free ions as a function of pCO2 shows that speciation of some elements (like Zn and Ba) is mainly influenced by the formation of carbonate complexes in seawater. Hence, differences in foraminiferal uptake of these might be related primarily by the speciation of these elements in seawater. We investigated differences in trends in element incorporation between hyaline (perforate) and porcelaneous (imperforate) foraminifera in order to unravel processes involved in element uptake and subsequent foraminiferal calcification. In hyaline foraminifera we observed a correlation of element incorporation of different elements between species, reflected by a general higher incorporation of elements in species with higher Mg content. Between porcelaneous species, inter-element differences are much smaller. Besides these contrasting trends in element incorporation, however, similar trends are observed in element incorporation as a function of seawater carbonate chemistry in both hyaline and porcelaneous species. This suggests similar mechanisms responsible for the transportation of ions to the site of calcification for these groups of foraminifera, although the contribution of these processes might differ across species.

  7. Conservation and Covariance in Small Bacterial Phosphoglycosyltransferases Identify the Functional Catalytic Core.


    Lukose, Vinita; Luo, Lingqi; Kozakov, Dima; Vajda, Sandor; Allen, Karen N; Imperiali, Barbara


    Phosphoglycosyltransferases (PGTs) catalyze the transfer of a C1'-phosphosugar from a soluble sugar nucleotide diphosphate to a polyprenol phosphate. These enzymes act at the membrane interface, forming the first membrane-associated intermediates in the biosynthesis of cell-surface glycans and glycoconjugates, including glycoproteins, glycolipids, and the peptidoglycan in bacteria. PGTs vary greatly in both their membrane topologies and their substrate preferences. PGTs, such as MraY and WecA, are polytopic, while other families of uniquely prokaryotic enzymes have only a single predicted transmembrane helix. PglC, a PGT involved in the biosynthesis of N-linked glycoproteins in the enteropathogen Campylobacter jejuni, is representative of one of the structurally most simple members of the diverse family of small bacterial PGT enzymes. Herein, we apply bioinformatics and covariance-weighted distance constraints in geometry- and homology-based model building, together with mutational analysis, to investigate monotopic PGTs. The pool of 15000 sequences that are analyzed include the PglC-like enzymes, as well as sequences from two other related PGTs that contain a "PglC-like" domain embedded in their larger structures (namely, the bifunctional PglB family, typified by PglB from Neisseria gonorrheae, and WbaP-like enzymes, typified by WbaP from Salmonella enterica). Including these two subfamilies of PGTs in the analysis highlights key residues conserved across all three families of small bacterial PGTs. Mutagenesis analysis of these conserved residues provides further information about the essentiality of many of these residues in catalysis. Construction of a structural model of the cytosolic globular domain utilizing three-dimensional distance constraints, provided by conservation covariance analysis, provides additional insight into the catalytic core of these families of small bacterial PGT enzymes.

  8. Regulation of DNA replication at the end of the mitochondrial D-loop involves the helicase TWINKLE and a conserved sequence element

    PubMed Central

    Jemt, Elisabeth; Persson, Örjan; Shi, Yonghong; Mehmedovic, Majda; Uhler, Jay P.; Dávila López, Marcela; Freyer, Christoph; Gustafsson, Claes M.; Samuelsson, Tore; Falkenberg, Maria


    The majority of mitochondrial DNA replication events are terminated prematurely. The nascent DNA remains stably associated with the template, forming a triple-stranded displacement loop (D-loop) structure. However, the function of the D-loop region of the mitochondrial genome remains poorly understood. Using a comparative genomics approach we here identify two closely related 15 nt sequence motifs of the D-loop, strongly conserved among vertebrates. One motif is at the D-loop 5′-end and is part of the conserved sequence block 1 (CSB1). The other motif, here denoted coreTAS, is at the D-loop 3′-end. Both these sequences may prevent transcription across the D-loop region, since light and heavy strand transcription is terminated at CSB1 and coreTAS, respectively. Interestingly, the replication of the nascent D-loop strand, occurring in a direction opposite to that of heavy strand transcription, is also terminated at coreTAS, suggesting that coreTAS is involved in termination of both transcription and replication. Finally, we demonstrate that the loading of the helicase TWINKLE at coreTAS is reversible, implying that this site is a crucial component of a switch between D-loop formation and full-length mitochondrial DNA replication. PMID:26253742

  9. Role of structural and functional elements of mouse methionine-S-sulfoxide reductase in its subcellular distribution.


    Kim, Hwa-Young; Gladyshev, Vadim N


    Oxidized forms of methionine residues in proteins can be repaired by methionine-S-sulfoxide reductase (MsrA) and methionine-R-sulfoxide reductase (MsrB). In mammals, three MsrBs are present, which are targeted to various subcellular compartments. In contrast, only a single mammalian MsrA gene is known whose products have been detected in both cytosol and mitochondria. Factors that determine the location of the protein in these compartments are not known. Here, we found that MsrA was present in cytosol, nucleus, and mitochondria in mouse cells and tissues and that the major enzyme forms detected in various compartments were generated from a single-translation product rather than by alternative translation initiation. Both cytosolic and mitochondrial forms were processed with respect to the N-terminal signal peptide, and the distribution of the protein occurred post-translationally. Deletion of amino acids 69-108, 69-83, 84-108, or 217-233, which contained elements important for MsrA structure and function, led to exclusive mitochondrial location of MsrA, whereas a region that affected substrate binding but was not part of the overall fold had no influence on the subcellular distribution. The data suggested that proper structure-function organization of MsrA played a role in subcellular distribution of this protein in mouse cells. These findings were recapitulated by expressing various forms of mouse MsrA in Saccharomyces cerevisiae, suggesting conservation of the mechanisms responsible for distribution of the mammalian enzyme among different cellular compartments.

  10. Trace element seasonality in marine macroalgae of different functional-form groups.


    Malea, Paraskevi; Chatziapostolou, Anastasia; Kevrekidis, Theodoros


    Novel information on the seasonality of element accumulation in seaweeds is provided. Seasonal patterns of As, Ba, Cd, Co, Cr, Cu, Mn, Mo, Ni, Pb, Se, Sr, U, V and Zn concentrations in macroalgae belonging to different functional-form groups (Ulva intestinalis, Ulva rigida, Codium fragile, Gracilaria gracilis) from the Thessaloniki Gulf, Aegean Sea were determined and compared. Uni- and multivariate data analyses were applied. Element concentrations generally decreased during spring and/or summer, probably due to the growth effect, but a reverse trend, particularly in Ulva species, was also observed. Most elements (Cd, Co, Cr, Cu, Mo, Ni, Pb, Sr) in Ulva species displayed a comparatively low monthly variability, indicating that the extent of seasonal variation is closely related to thallus morphology and growth strategy. In particular, these data suggest that Cd, Co, Cr, Cu, Mo, Ni, Pb and Sr contents in fast-growing, sheet-like macroalgae are less influenced by the season, compared to their contents in coarsely-branched and thick-leathery macroalgae; therefore, sheet-like macroalgae may be more appropriate to be used in biomonitoring of coastal waters. The data presented could be utilized in the development of biomonitoring programmes for the protection of coastal environments.

  11. The structure and function of the rous sarcoma virus RNA stability element.


    Withers, Johanna B; Beemon, Karen L


    For simple retroviruses, such as the Rous sarcoma virus (RSV), post-transcriptional control elements regulate viral RNA splicing, export, stability, and packaging into virions. These RNA sequences interact with cellular host proteins to regulate and facilitate productive viral infections. One such element, known as the RSV stability element (RSE), is required for maintaining stability of the full-length unspliced RNA. This viral RNA serves as the mRNA for the Gag and Pol proteins and also as the genome packaged in progeny virions. When the RSE is deleted from the viral RNA, the unspliced RNA becomes unstable and is degraded in a Upf1-dependent manner. Current evidence suggests that the RSE inhibits recognition of the viral gag termination codon by the nonsense-mediated mRNA decay (NMD) pathway. We believe that the RSE acts as an insulator to NMD, thereby preventing at least one of the required functional steps that target an mRNA for degradation. Here, we discuss the history of the RSE and the current model of how the RSE is interacting with cellular NMD factors.

  12. Superheavy Element Chemistry by Relativistic Density Functional Theory Electronic Structure Modeling

    NASA Astrophysics Data System (ADS)

    Zaitsevskii, A. V.; Polyaev, A. V.; Demidov, Yu. A.; Mosyagin, N. S.; Lomachuk, Yu. V.; Titov, A. V.


    Two-component density functional theory in its non-collinear formulation combined with the accurate relativistic electronic structure model defined by shape-consistent small-core pseudopotentials (PP/RDFT) provides a robust basis of efficient computational schemes for predicting energetic and structural properties of complex polyatomic systems including superheavy elements (SHEs). Because of the exceptional role of thermochromatography in the experiments on the "chemical" identification of SHEs with atomic numbers Z ≥ 112, we focus on the description of the adsorption of single SHE atoms on the surfaces of solids through cluster modeling of adsorption complexes. In some cases our results differ significantly from those of previous theoretical studies. The results of systematic comparative studies on chemical bonding in simple molecules of binary compounds of SHEs and their nearest homologs with most common light elements, obtained at the PP/RDFT level and visualized through the "chemical graphs", provide the understanding of the general chemistry of SHEs which at present cannot be derived from the experimental data. These results are used to discuss the main trends in changing chemical properties of the elements in the given group of the periodic table and demonstrate the specificity of SHEs.

  13. Enrichment of Conserved Synaptic Activity-Responsive Element in Neuronal Genes Predicts a Coordinated Response of MEF2, CREB and SRF

    PubMed Central

    Rodríguez-Tornos, Fernanda M.; San Aniceto, Iñigo; Cubelos, Beatriz; Nieto, Marta


    A unique synaptic activity-responsive element (SARE) sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity. We hypothesize that this sequence is a broad mechanism that regulates gene expression in response to synaptic activation and during plasticity; and that analysis of SARE-containing genes could identify molecular mechanisms involved in brain disorders. To search for conserved SARE sequences in the mammalian genome, we used the SynoR in silico tool, and found the SARE cluster predominantly in the regulatory regions of genes expressed specifically in the nervous system; most were related to neural development and homeostatic maintenance. Two of these SARE sequences were tested in luciferase assays and proved to promote transcription in response to neuronal activation. Supporting the predictive capacity of our candidate list, up-regulation of several SARE containing genes in response to neuronal activity was validated using external data and also experimentally using primary cortical neurons and quantitative real time RT-PCR. The list of SARE-containing genes includes several linked to mental retardation and cognitive disorders, and is significantly enriched in genes that encode mRNA targeted by FMRP (fragile X mental retardation protein). Our study thus supports the idea that SARE sequences are relevant transcriptional regulatory elements that participate in plasticity. In addition, it offers a comprehensive view of how activity-responsive transcription factors coordinate their actions and increase the selectivity of their targets. Our data suggest that analysis of SARE-containing genes will reveal yet-undescribed pathways of synaptic plasticity and additional candidate genes disrupted in mental disease. PMID:23382855

  14. Positive and negative functional interactions between promoter elements from different classes of RNA polymerase III-transcribed genes.

    PubMed Central

    Parry, H D; Mattaj, I W


    Consensus tRNA gene promoter elements, A and B boxes, were introduced into the coding sequence of a Xenopus U6 gene. Combinations in which A and B boxes were coupled to wild-type or mutant U6 promoters were made. In this way information about both the functions of individual promoter elements and functional relationships between different classes of RNA polymerase III promoter element were obtained. Mutants in which the U6 PSE was non-functional were rescued by the presence of a B box, indicating a degree of functional relationship between these two elements. Moreover, the B box acted to increase the transcriptional activity and competitive strength of the wild-type U6 promoter. In contrast, no evidence was obtained to suggest that a tRNA A box can interact productively with U6 promoter elements in the absence of a B box. Data obtained suggest that the U6 PSE functions as an 'adaptor', being necessary to enable the basal U6 promoter to respond to upstream enhancement. Certain combinations of U6 and tRNA promoter elements are shown to be mutually antagonistic by a mechanism which is likely to involve blockage of transcription initiation. In summary, the U6 and tRNA promoters are shown to consist of functionally related, but distinct, promoter elements whose interactions shed new light on their normal roles in transcription. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. Fig. 8. PMID:2323333

  15. Functional Role of Histidine in the Conserved His-x-Asp Motif in the Catalytic Core of Protein Kinases.


    Zhang, Lun; Wang, Jian-Chuan; Hou, Li; Cao, Peng-Rong; Wu, Li; Zhang, Qian-Sen; Yang, Huai-Yu; Zang, Yi; Ding, Jian-Ping; Li, Jia


    The His-x-Asp (HxD) motif is one of the most conserved structural components of the catalytic core of protein kinases; however, the functional role of the conserved histidine is unclear. Here we report that replacement of the HxD-histidine with Arginine or Phenylalanine in Aurora A abolishes both the catalytic activity and auto-phosphorylation, whereas the Histidine-to-tyrosine impairs the catalytic activity without affecting its auto-phosphorylation. Comparisons of the crystal structures of wild-type (WT) and mutant Aurora A demonstrate that the impairment of the kinase activity is accounted for by (1) disruption of the regulatory spine in the His-to-Arg mutant, and (2) change in the geometry of backbones of the Asp-Phe-Gly (DFG) motif and the DFG-1 residue in the His-to-Tyr mutant. In addition, bioinformatics analyses show that the HxD-histidine is a mutational hotspot in tumor tissues. Moreover, the H174R mutation of the HxD-histidine, in the tumor suppressor LKB1 abrogates the inhibition of anchorage-independent growth of A549 cells by WT LKB1. Based on these data, we propose that the HxD-histidine is involved in a conserved inflexible organization of the catalytic core that is required for the kinase activity. Mutation of the HxD-histidine may also be involved in the pathogenesis of some diseases including cancer.

  16. A density-functional-theory-based finite element model to study the mechanical properties of zigzag phosphorene nanotubes

    NASA Astrophysics Data System (ADS)

    Ansari, R.; Shahnazari, A.; Rouhi, S.


    In this paper, the density functional theory calculations are used to obtain the elastic properties of zigzag phosphorene nanotubes. Besides, based on the similarity between phosphorene nanotubes and a space-frame structure, a three-dimensional finite element model is proposed in which the atomic bonds are simulated by beam elements. The results of density functional theory are employed to compute the properties of the beam elements. Finally, using the proposed finite element model, the elastic modulus of the zigzag phosphorene nanotubes is computed. It is shown that phosphorene nanotubes with larger radii have larger Young's modulus. Comparing the results of finite element model with those of density functional theory, it is concluded that the proposed model can predict the elastic modulus of phosphorene nanotubes with a good accuracy.

  17. Functional elements of the steroid hormone-responsive promoter of mouse mammary tumor virus.

    PubMed Central

    Toohey, M G; Lee, J W; Huang, M; Peterson, D O


    Transcription from the promoter of mouse mammary tumor virus is subject to induction by several classes of steroid hormones as well as to repression by a negative regulatory element present in the long terminal repeats of proviral DNA. In order to characterize the functional elements of the promoter that in some way must respond to these regulatory signals, a number of promoter mutations were constructed, including a set of linker-scanning mutations across the entire promoter region. Analysis of these mutated promoters with a transient-transfection assay defined at least three mutation-sensitive promoter elements that are required for both basal and hormone-induced transcription. One mutation-sensitive region contains a TATA element located at approximately position -30 with respect to the start of transcription. A second mutation-sensitive region contains two 10-base-pair direct repeats located between positions -60 and -38, within which are embedded three copies of octamer-related sequences; complete disruption of this region of the promoter leads to a more severe decrease in transcription than do any of the linker-scanning mutations, suggesting that the repeated sequences may be at least partially functionally redundant. Gel electrophoresis mobility shift assays were used to demonstrate specific binding of a nuclear protein to this region of the promoter. A third mutation-sensitive region contains a binding site for nuclear factor 1 (NF-1) located between positions -77 and -63. Site-directed mutations in the NF-1-binding site which increase the apparent affinity of NF-1 for the promoter in vitro do not decrease the hormone dependence of transcription, suggesting that transcriptional activation mediated by steroid hormone-receptor complexes cannot be explained by facilitation or stabilization of the interaction of promoter sequences with NF-1 and consistent with the idea that binding of NF-1 is not rate determining in transcription from the mouse mammary tumor

  18. Concentrations of elements in fish fillets, fish muscle plugs, and crayfish from the 2011 Missouri Department of Conservation general contaminant monitoring program

    USGS Publications Warehouse

    May, Thomas W.; Walther, Michael J.; Brumbaugh, William G.; McKee, Michael J.


    This report presents the results of a contaminant monitoring survey conducted annually by the Missouri Department of Conservation to examine the levels of selected elemental contaminants in fish fillets, fish muscle plugs, and crayfish. Fillet samples of yellow bullhead (Ameiurus natalis), golden redhorse (Moxostoma erythrurum), longear sunfish (Lepomis megalotis), and channel catfish (Ictalurus punctatus) were collected from six sites as part of the Missouri Department of Conservation’s Fish Contaminant Monitoring Program. Fish dorsal muscle plugs were collected from largemouth bass (Micropterus salmoides) at eight of the sites, and crayfish from two sites. Following preparation and analysis of the samples, highlights of the data were as follows: cadmium and lead residues were most elevated in crayfish tissue samples from the Big River at Cherokee Landing, with 1 to 8 micrograms per gram dry weight and 22 to 45 micrograms per gram dry weight, respectively. Some dorsal muscle plugs from largemouth bass collected from Clearwater Lake, Lake St. Louis, Noblett Lake, Hazel Creek Lake, and Harrison County Lake contained mercury residues (1.7 to 4.7 micrograms per gram dry weight) that exceeded the U.S. Environmental Protection Agency Water Quality Criterion of 1.5 micrograms per gram dry weight of fish tissue (equivalent to 0.30 micrograms per gram wet weight).

  19. The Chinese hamster Alu-equivalent sequence: a conserved highly repetitious, interspersed deoxyribonucleic acid sequence in mammals has a structure suggestive of a transposable element.

    PubMed Central

    Haynes, S R; Toomey, T P; Leinwand, L; Jelinek, W R


    A consensus sequence has been determined for a major interspersed deoxyribonucleic acid repeat in the genome of Chinese hamster ovary cells (CHO cells). This sequence is extensively homologous to (i) the human Alu sequence (P. L. Deininger et al., J. Mol. Biol., in press), (ii) the mouse B1 interspersed repetitious sequence (Krayev et al., Nucleic Acids Res. 8:1201-1215, 1980) (iii) an interspersed repetitious sequence from African green monkey deoxyribonucleic acid (Dhruva et al., Proc. Natl. Acad. Sci. U.S.A. 77:4514-4518, 1980) and (iv) the CHO and mouse 4.5S ribonucleic acid (this report; F. Harada and N. Kato, Nucleic Acids Res. 8:1273-1285, 1980). Because the CHO consensus sequence shows significant homology to the human Alu sequence it is termed the CHO Alu-equivalent sequence. A conserved structure surrounding CHO Alu-equivalent family members can be recognized. It is similar to that surrounding the human Alu and the mouse B1 sequences, and is represented as follows: direct repeat-CHO-Alu-A-rich sequence-direct repeat. A composite interspersed repetitious sequence has been identified. Its structure is represented as follows: direct repeat-residue 47 to 107 of CHO-Alu-non-Alu repetitious sequence-A-rich sequence-direct repeat. Because the Alu flanking sequences resemble those that flank known transposable elements, we think it likely that the Alu sequence dispersed throughout the mammalian genome by transposition. Images PMID:9279371

  20. The functions of the multiproduct and rapidly evolving dec-1 eggshell gene are conserved between evolutionarily distant species of Drosophila.

    PubMed Central

    Badciong, J C; Otto, J M; Waring, G L


    The Drosophila dec-1 gene encodes multiple proteins that are required for female fertility and proper eggshell morphogenesis. Genetic and immunolocalization data suggest that the different DEC-1 proteins are functionally distinct. To identify regions within the proteins with potential biological significance, we cloned and sequenced the D. yakuba and D. virilis dec-1 homologs. Interspecies comparisons of the predicted translation products revealed rapidly evolving sequences punctuated by blocks of conserved amino acids. Despite extensive amino acid variability, the proteins produced by the different dec-1 homologs were functionally interchangeable. The introduction of transgenes containing either the D. yakuba or the D. virilis dec-1 open reading frames into a D. melanogaster DEC-1 protein null mutant was sufficient to restore female fertility and wild-type eggshell morphology. Normal expression and extracellular processing of the DEC-1 proteins was correlated with the phenotypic rescue. The nature of the conserved features highlighted by the evolutionary comparison and the molecular resemblance of some of these features to those found in other extracellular proteins suggests functional correlates for some of the multiple DEC-1 derivatives. PMID:11729155

  1. Adsorption enhancement of elemental mercury onto sulphur-functionalized silica gel adsorbents.


    Johari, Khairiraihanna; Saman, Norasikin; Mat, Hanapi


    In this study, elemental mercury (EM) adsorbents were synthesized using tetraethyl orthosilicate (TEOS) and 3-mercaptopropyl trimethoxysilane as silica precursors. The synthesized silica gel (SG)-TEOS was further functionalized through impregnation with elemental sulphur and carbon disulphide (CS2). The SG adsorbents were then characterized by using scanning electron microscope, Fourier transform infra-red spectrophotometer, nitrogen adsorption/desorption, and energy-dispersive X-ray diffractometer. The EM adsorption of the SG adsorbents was determined using fabricated fixed-bed adsorber. The EM adsorption results showed that the sulphur-functionalized SG adsorbents had a greater Hgo breakthrough adsorption capacity, confirming that the presence of sulphur in silica matrices can improve Hgo adsorption performance due to their high affinity towards mercury. The highest Hgo adsorption capacity was observed for SG-TEOS(CS2) (82.62 microg/g), which was approximately 2.9 times higher than SG-TEOS (28.47 microg/g). The rate of Hgo adsorption was observed higher for sulphur-impregnated adsorbents, and decreased with the increase in the bed temperatures.

  2. Functional Characterization of Glycoprotein H Chimeras Composed of Conserved Domains of the Pseudorabies Virus and Herpes Simplex Virus 1 Homologs

    PubMed Central

    Böhm, Sebastian W.; Backovic, Marija; Klupp, Barbara G.; Rey, Felix A.; Fuchs, Walter


    ABSTRACT Membrane fusion is indispensable for entry of enveloped viruses into host cells. The conserved core fusion machinery of the Herpesviridae consists of glycoprotein B (gB) and the gH/gL complex. Recently, crystal structures of gH/gL of herpes simplex virus 2 (HSV-2) and Epstein-Barr virus and of a core fragment of pseudorabies virus (PrV) gH identified four structurally conserved gH domains. To investigate functional conservation, chimeric genes encoding combinations of individual domains of PrV and herpes simplex virus 1 (HSV-1) gH were expressed in rabbit kidney cells, and their processing and transport to the cell surface, as well as activity in fusion assays including gB, gD, and gL of PrV or HSV-1, were analyzed. Chimeric gH containing domain I of HSV-1 and domains II to IV of PrV exhibited limited fusion activity in the presence of PrV gB and gD and HSV-1 gL, but not of PrV gL. More strikingly, chimeric gH consisting of PrV domains I to III and HSV-1 domain IV exhibited considerable fusion activity together with PrV gB, gD, and gL. Replacing PrV gB with the HSV-1 protein significantly enhanced this activity. A cell line stably expressing this chimeric gH supported replication of gH-deleted PrV. Our results confirm the specificity of domain I for gL binding, demonstrate functional conservation of domain IV in two alphaherpesviruses from different genera, and indicate species-specific interactions of this domain with gB. They also suggest that gH domains II and III might form a structural and functional unit which does not tolerate major substitutions. IMPORTANCE Envelope glycoprotein H (gH) is essential for herpesvirus-induced membrane fusion, which is required for host cell entry and viral spread. Although gH is structurally conserved within the Herpesviridae, its precise role and its interactions with other components of the viral fusion machinery are not fully understood. Chimeric proteins containing domains of gH proteins from different

  3. Conserved and novel functions of programmed cellular senescence during vertebrate development

    PubMed Central

    Davaapil, Hongorzul; Brockes, Jeremy P.


    Cellular senescence, a form of stable cell cycle arrest that is traditionally associated with tumour suppression, has been recently found to occur during mammalian development. Here, we show that cell senescence is an intrinsic part of the developmental programme in amphibians. Programmed senescence occurs in specific structures during defined time windows during amphibian development. It contributes to the physiological degeneration of the amphibian pronephros and to the development of the cement gland and oral cavity. In both contexts, senescence depends on TGFβ but is independent of ERK/MAPK activation. Furthermore, elimination of senescent cells through temporary TGFβ inhibition leads to developmental defects. Our findings uncover conserved and new roles of senescence in vertebrate organogenesis and support the view that cellular senescence may have arisen in evolution as a developmental mechanism. PMID:27888193

  4. Structural levansucrase gene (lsdA) constitutes a functional locus conserved in the species Gluconacetobacter diazotrophicus.


    Hernández, L; Sotolongo, M; Rosabal, Y; Menéndez, C; Ramírez, R; Caballero-Mellado, J; Arrieta, J


    Levansucrase (EC was identified as a constitutive exoenzyme in 14 Gluconacetobacter diazotrophicus strains recovered from different host plants in diverse geographical regions. The enzyme, consisting of a single 60-kDa polypeptide, hydrolysed sucrose to synthesise oligofructans and levan. Sugar-cane-associated strains of the most abundant genotype (electrophoretic type 1) showed maximal values of levansucrase production. These values were three-fold higher than those of the isolates recovered from coffee plants. Restriction fragment length polymorphism analysis revealed a high degree of conservation of the levansucrase locus (IsdA) among the 14 strains under study, which represented 11 different G. diazotrophicus genotypes. Targeted disruption of the lsdA gene in four representative strains abolished their ability to grow on sucrose, indicating that the endophytic species G. diazotrophicus utilises plant sucrose via levansucrase.

  5. The RNA Transport Element of the Murine musD Retrotransposon Requires Long-range Intramolecular Interactions for Function*

    PubMed Central

    Legiewicz, Michal; Zolotukhin, Andrei S.; Pilkington, Guy R.; Purzycka, Katarzyna J.; Mitchell, Michelle; Uranishi, Hiroaki; Bear, Jenifer; Pavlakis, George N.; Le Grice, Stuart F. J.; Felber, Barbara K.


    Retrovirus replication requires specialized transport mechanisms to export genomic mRNA from the nucleus to the cytoplasm of the infected cell. This regulation is mediated by a combination of viral and/or cellular factors that interact with cis-acting RNA export elements linking the viral RNA to the cellular CRM1 or NXF1 nuclear export pathways. Endogenous type D murine LTR retrotransposons (musD) were reported to contain an RNA export element located upstream of the 3′-LTR. Although functionally equivalent, the musD export element, termed the musD transport element, is distinct from the other retroviral RNA export elements, such as the constitutive transport element of simian/Mason-Pfizer monkey retroviruses and the RNA transport element found in rodent intracisternal A-particle LTR retrotransposons. We demonstrate here that the minimal RNA transport element (musD transport element) of musD comprises multiple secondary structure elements that presumably serve as recognition signals for the cellular export machinery. We identified two classes of tertiary interactions, namely kissing loops and a pseudoknot. This work constitutes the first example of an RNA transport element requiring such structural motifs to mediate nuclear export. PMID:20978285

  6. Functional magnetic resonance imaging study of Piaget's conservation-of-number task in preschool and school-age children: a neo-Piagetian approach.


    Houdé, Olivier; Pineau, Arlette; Leroux, Gaëlle; Poirel, Nicolas; Perchey, Guy; Lanoë, Céline; Lubin, Amélie; Turbelin, Marie-Renée; Rossi, Sandrine; Simon, Grégory; Delcroix, Nicolas; Lamberton, Franck; Vigneau, Mathieu; Wisniewski, Gabriel; Vicet, Jean-René; Mazoyer, Bernard


    Jean Piaget's theory is a central reference point in the study of logico-mathematical development in children. One of the most famous Piagetian tasks is number conservation. Failures and successes in this task reveal two fundamental stages in children's thinking and judgment, shifting at approximately 7 years of age from visuospatial intuition to number conservation. In the current study, preschool children (nonconservers, 5-6 years of age) and school-age children (conservers, 9-10 years of age) were presented with Piaget's conservation-of-number task and monitored by functional magnetic resonance imaging (fMRI). The cognitive change allowing children to access conservation was shown to be related to the neural contribution of a bilateral parietofrontal network involved in numerical and executive functions. These fMRI results highlight how the behavioral and cognitive stages Piaget formulated during the 20th century manifest in the brain with age.

  7. Conserved and variant molecular and functional features of multiple egg yolk precursor proteins (vitellogenins) in white perch (Morone americana) and other teleosts.


    Reading, Benjamin J; Hiramatsu, Naoshi; Sawaguchi, Sayumi; Matsubara, Takahiro; Hara, Akihiko; Lively, Mark O; Sullivan, Craig V


    Three complete cDNAs encoding different forms of vitellogenin (Vtg) were isolated from a white perch (Morone americana) liver cDNA library and characterized with respect to immunobiochemical and functional features of the three Vtgs and their product yolk proteins (YPs) in this species and in the congeneric striped bass (Morone saxatilis). The two longest cDNAs encoded Vtgs with a complete suite of yolk protein domains that, based on comparisons with vtg sequences from other species, were categorized as VtgAa and VtgAb using the current nomenclature for multiple teleost Vtgs. The shorter cDNA encoded a Vtg that lacked a phosvitin domain, had a shortened C-terminus, and was categorized as VtgC. Mapping of peptide sequences from the purified Vtgs and their derived YPs to Vtg sequences deduced from the cDNAs definitively identified the white perch VtgAa, VtgAb, and VtgC proteins. Detailed comparisons of the primary structures of each Vtg with partial or complete sequences of Morone yolk proteins or of Vtgs from other fishes revealed conserved and variant structural elements of teleost Vtgs with functional significance, including, as examples, signal peptide cleavage sites, dimerization sites, cathepsin D protease recognition sites, and receptor-binding domains. These comparisons also yielded an interim revision of the classification scheme for multiple teleost Vtgs.

  8. Green element simulations of multiaquifer flows with a time-dependent Green's function

    NASA Astrophysics Data System (ADS)

    Taigbenu, Akpofure E.


    A new formulation of the Green element method (GEM), based on the transient Green's function of the diffusion differential operator, is herein used to solve the problem of transient flow in multiply layered aquifers that are separated by aquitards (leaky strata) which provide hydraulic interactions between them. By adopting the commonly used hydraulic flow approximation, flow in the aquifers is considered to take place in two lateral dimensions and in one vertical direction in the aquitards. As with an earlier GE multiaquifer model, the current model solves the one-dimensional flow in the aquitards by the formulation of [Appl. Math. Model. 22 (1998) 687] but uses the transient Green's function of the diffusion operator to solve the two-dimensional aquifer flow instead of the logarithmic Green's function formulation of [Water Resour. Res. 36 (2000) 3631]. In essence, the current formulation uses the same form of Green's functions for both flows in the aquifers and aquitards. While this can be viewed as an advantage of the current formulation over the previous one, the former presents other computational challenges and intricacies that are discussed in this paper. Applying the current formulation, and incorporating a Picard-type iterative algorithm, solutions are provided for regional flows in heterogeneous multiaquifer systems of arbitrary geometries that are subjected to point and distributed recharge of arbitrary strengths.

  9. 3D finite element model of the chinchilla ear for characterizing middle ear functions.


    Wang, Xuelin; Gan, Rong Z


    Chinchilla is a commonly used animal model for research of sound transmission through the ear. Experimental measurements of the middle ear transfer function in chinchillas have shown that the middle ear cavity greatly affects the tympanic membrane (TM) and stapes footplate (FP) displacements. However, there is no finite element (FE) model of the chinchilla ear available in the literature to characterize the middle ear functions with the anatomical features of the chinchilla ear. This paper reports a recently completed 3D FE model of the chinchilla ear based on X-ray micro-computed tomography images of a chinchilla bulla. The model consisted of the ear canal, TM, middle ear ossicles and suspensory ligaments, and the middle ear cavity. Two boundary conditions of the middle ear cavity wall were simulated in the model as the rigid structure and the partially flexible surface, and the acoustic-mechanical coupled analysis was conducted with these two conditions to characterize the middle ear function. The model results were compared with experimental measurements reported in the literature including the TM and FP displacements and the middle ear input admittance in chinchilla ear. An application of this model was presented to identify the acoustic role of the middle ear septa-a unique feature of chinchilla middle ear cavity. This study provides the first 3D FE model of the chinchilla ear for characterizing the middle ear functions through the acoustic-mechanical coupled FE analysis.

  10. Adaptive Finite Element Method for Solving the Exact Kohn-Sham Equation of Density Functional Theory

    SciTech Connect

    Bylaska, Eric J.; Holst, Michael; Weare, John H.


    Results of the application of an adaptive finite element (FE) based solution using the FETK library of M. Holst to Density Functional Theory (DFT) approximation to the electronic structure of atoms and molecules are reported. The severe problem associated with the rapid variation of the electronic wave functions in the near singular regions of the atomic centers is treated by implementing completely unstructured simplex meshes that resolve these features around atomic nuclei. This concentrates the computational work in the regions in which the shortest length scales are necessary and provides for low resolution in regions for which there is no electron density. The accuracy of the solutions significantly improved when adaptive mesh refinement was applied, and it was found that the essential difficulties of the Kohn-Sham eigenvalues equation were the result of the singular behavior of the atomic potentials. Even though the matrix representations of the discrete Hamiltonian operator in the adaptive finite element basis are always sparse with a linear complexity in the number of discretization points, the overall memory and computational requirements for the solver implemented were found to be quite high. The number of mesh vertices per atom as a function of the atomic number Z and the required accuracy e (in atomic units) was esitmated to be v (e;Z) = 122:37 * Z2:2346 /1:1173 , and the number of floating point operations per minimization step for a system of NA atoms was found to be 0(N3A*v(e,Z0) (e.g. Z=26, e=0.0015 au, and NA=100, the memory requirement and computational cost would be ~0.2 terabytes and ~25 petaflops). It was found that the high cost of the method could be reduced somewhat by using a geometric based refinement strategy to fix the error near the singularities.

  11. The catalytic domain CysPc of the DEK1 calpain is functionally conserved in land plants.


    Liang, Zhe; Demko, Viktor; Wilson, Robert C; Johnson, Kenneth A; Ahmad, Rafi; Perroud, Pierre-François; Quatrano, Ralph; Zhao, Sen; Shalchian-Tabrizi, Kamran; Otegui, Marisa S; Olsen, Odd-Arne; Johansen, Wenche


    DEK1, the single calpain of land plants, is a member of the ancient membrane bound TML-CysPc-C2L calpain family that dates back 1.5 billion years. Here we show that the CysPc-C2L domains of land plant calpains form a separate sub-clade in the DEK1 clade of the phylogenetic tree of plants. The charophycean alga Mesostigma viride DEK1-like gene is clearly divergent from those in land plants, suggesting that a major evolutionary shift in DEK1 occurred during the transition to land plants. Based on genetic complementation of the Arabidopsis thaliana dek1-3 mutant using CysPc-C2L domains of various origins, we show that these two domains have been functionally conserved within land plants for at least 450 million years. This conclusion is based on the observation that the CysPc-C2L domains of DEK1 from the moss Physcomitrella patens complements the A. thaliana dek1-3 mutant phenotype. In contrast, neither the CysPc-C2L domains from M. viride nor chimeric animal-plant calpains complement this mutant. Co-evolution analysis identified differences in the interactions between the CysPc-C2L residues of DEK1 and classical calpains, supporting the view that the two enzymes are regulated by fundamentally different mechanisms. Using the A. thaliana dek1-3 complementation assay, we show that four conserved amino acid residues of two Ca²⁺-binding sites in the CysPc domain of classical calpains are conserved in land plants and functionally essential in A. thaliana DEK1.

  12. Comparative genomics and experimental promoter analysis reveal functional liver-specific elements in mammalian hepatic lipase genes

    PubMed Central

    van Deursen, Diederik; Botma, Gert-Jan; Jansen, Hans; Verhoeven, Adrie JM


    Background Mammalian hepatic lipase (HL) genes are transcribed almost exclusively in hepatocytes. The basis for this liver-restricted expression is not completely understood. We hypothesized that the responsible cis-acting elements are conserved among mammalian HL genes. To identify these elements, we made a genomic comparison of 30 kb of 5'-flanking region of the rat, mouse, rhesus monkey, and human HL genes. The in silico data were verified by promoter-reporter assays in transfected hepatoma HepG2 and non-hepatoma HeLa cells using serial 5'-deletions of the rat HL (-2287/+9) and human HL (-685/+13) promoter region. Results Highly conserved elements were present at the proximal promoter region, and at 14 and 22 kb upstream of the transcriptional start site. Both of these upstream elements increased transcriptional activity of the human HL (-685/+13) promoter region 2–3 fold. Within the proximal HL promoter region, conserved clusters of transcription factor binding sites (TFBS) were identified at -240/-200 (module A), -80/-40 (module B), and -25/+5 (module C) by the rVista software. In HepG2 cells, modules B and C, but not module A, were important for basal transcription. Module B contains putative binding sites for hepatocyte nuclear factors HNF1α. In the presence of module B, transcription from the minimal HL promoter was increased 1.5–2 fold in HepG2 cells, but inhibited 2–4 fold in HeLa cells. Conclusion Our data demonstrate that searching for conserved non-coding sequences by comparative genomics is a valuable tool in identifying candidate enhancer elements. With this approach, we found two putative enhancer elements in the far upstream region of the HL gene. In addition, we obtained evidence that the -80/-40 region of the HL gene is responsible for enhanced HL promoter activity in hepatoma cells, and for silencing HL promoter activity in non-liver cells. PMID:17428321

  13. Functional Annotation of Conserved Hypothetical Proteins from Haemophilus influenzae Rd KW20

    PubMed Central

    Shahbaaz, Mohd; Md. ImtaiyazHassan; Ahmad, Faizan


    Haemophilus influenzae is a Gram negative bacterium that belongs to the family Pasteurellaceae, causes bacteremia, pneumonia and acute bacterial meningitis in infants. The emergence of multi-drug resistance H. influenzae strain in clinical isolates demands the development of better/new drugs against this pathogen. Our study combines a number of bioinformatics tools for function predictions of previously not assigned proteins in the genome of H. influenzae. This genome was extensively analyzed and found 1,657 functional proteins in which function of 429 proteins are unknown, termed as hypothetical proteins (HPs). Amino acid sequences of all 429 HPs were extensively annotated and we successfully assigned the function to 296 HPs with high confidence. We also characterized the function of 124 HPs precisely, but with less confidence. We believed that sequence of a protein can be used as a framework to explain known functional properties. Here we have combined the latest versions of protein family databases, protein motifs, intrinsic features from the amino acid sequence, pathway and genome context methods to assign a precise function to hypothetical proteins for which no experimental information is available. We found these HPs belong to various classes of proteins such as enzymes, transporters, carriers, receptors, signal transducers, binding proteins, virulence and other proteins. The outcome of this work will be helpful for a better understanding of the mechanism of pathogenesis and in finding novel therapeutic targets for H. influenzae. PMID:24391926

  14. A novel fragile X syndrome mutation reveals a conserved role for the carboxy-terminus in FMRP localization and function.


    Okray, Zeynep; de Esch, Celine E F; Van Esch, Hilde; Devriendt, Koen; Claeys, Annelies; Yan, Jiekun; Verbeeck, Jelle; Froyen, Guy; Willemsen, Rob; de Vrij, Femke M S; Hassan, Bassem A


    Loss of function of the FMR1 gene leads to fragile X syndrome (FXS), the most common form of intellectual disability. The loss of FMR1 function is usually caused by epigenetic silencing of the FMR1 promoter leading to expansion and subsequent methylation of a CGG repeat in the 5' untranslated region. Very few coding sequence variations have been experimentally characterized and shown to be causal to the disease. Here, we describe a novel FMR1 mutation and reveal an unexpected nuclear export function for the C-terminus of FMRP. We screened a cohort of patients with typical FXS symptoms who tested negative for CGG repeat expansion in the FMR1 locus. In one patient, we identified a guanine insertion in FMR1 exon 15. This mutation alters the open reading frame creating a short novel C-terminal sequence, followed by a stop codon. We find that this novel peptide encodes a functional nuclear localization signal (NLS) targeting the patient FMRP to the nucleolus in human cells. We also reveal an evolutionarily conserved nuclear export function associated with the endogenous C-terminus of FMRP. In vivo analyses in Drosophila demonstrate that a patient-mimetic mutation alters the localization and function of Dfmrp in neurons, leading to neomorphic neuronal phenotypes.

  15. Identification of critical amino acid residues and functional conservation of the Neurospora crassa and Rattus norvegicus orthologues of neuronal calcium sensor-1.


    Gohain, Dibakar; Deka, Rekha; Tamuli, Ranjan


    Neuronal calcium sensor-1 (NCS-1) is a member of neuronal calcium sensor family of proteins consisting of an amino terminal myristoylation domain and four conserved calcium (Ca(2+)) binding EF-hand domains. We performed site-directed mutational analysis of three key amino acid residues that are glycine in the conserved site for the N-terminal myristoylation, a conserved glutamic acid residue responsible for Ca(2+) binding in the third EF-hand (EF3), and an unusual non-conserved amino acid arginine at position 175 in the Neurospora crassa NCS-1. The N. crassa strains possessing the ncs-1 mutant allele of these three amino acid residues showed impairment in functions ranging from growth, Ca(2+) stress tolerance, and ultraviolet survival. In addition, heterologous expression of the NCS-1 from Rattus norvegicus in N. crassa confirmed its interspecies functional conservation. Moreover, functions of glutamic acid at position 120, the first Ca(2+) binding residue among all the EF-hands of the R. norvegicus NCS-1 was found conserved. Thus, we identified three critical amino acid residues of N. crassa NCS-1, and demonstrated its functional conservation across species using the orthologue from R. norvegicus.

  16. Structural and Functional Characterizations of SsgB, a Conserved Activator of Developmental Cell Division in Morphologically Complex Actinomycetes*

    PubMed Central

    Xu, Qingping; Traag, Bjørn A.; Willemse, Joost; McMullan, Daniel; Miller, Mitchell D.; Elsliger, Marc-André; Abdubek, Polat; Astakhova, Tamara; Axelrod, Herbert L.; Bakolitsa, Constantina; Carlton, Dennis; Chen, Connie; Chiu, Hsiu-Ju; Chruszcz, Maksymilian; Clayton, Thomas; Das, Debanu; Deller, Marc C.; Duan, Lian; Ellrott, Kyle; Ernst, Dustin; Farr, Carol L.; Feuerhelm, Julie; Grant, Joanna C.; Grzechnik, Anna; Grzechnik, Slawomir K.; Han, Gye Won; Jaroszewski, Lukasz; Jin, Kevin K.; Klock, Heath E.; Knuth, Mark W.; Kozbial, Piotr; Krishna, S. Sri; Kumar, Abhinav; Marciano, David; Minor, Wladek; Mommaas, A. Mieke; Morse, Andrew T.; Nigoghossian, Edward; Nopakun, Amanda; Okach, Linda; Oommachen, Silvya; Paulsen, Jessica; Puckett, Christina; Reyes, Ron; Rife, Christopher L.; Sefcovic, Natasha; Tien, Henry J.; Trame, Christine B.; van den Bedem, Henry; Wang, Shuren; Weekes, Dana; Hodgson, Keith O.; Wooley, John; Deacon, Ashley M.; Godzik, Adam; Lesley, Scott A.; Wilson, Ian A.; van Wezel, Gilles P.


    SsgA-like proteins (SALPs) are a family of homologous cell division-related proteins that occur exclusively in morphologically complex actinomycetes. We show that SsgB, a subfamily of SALPs, is the archetypal SALP that is functionally conserved in all sporulating actinomycetes. Sporulation-specific cell division of Streptomyces coelicolor ssgB mutants is restored by introduction of distant ssgB orthologues from other actinomycetes. Interestingly, the number of septa (and spores) of the complemented null mutants is dictated by the specific ssgB orthologue that is expressed. The crystal structure of the SsgB from Thermobifida fusca was determined at 2.6 Å resolution and represents the first structure for this family. The structure revealed similarities to a class of eukaryotic “whirly” single-stranded DNA/RNA-binding proteins. However, the electro-negative surface of the SALPs suggests that neither SsgB nor any of the other SALPs are likely to interact with nucleotide substrates. Instead, we show that a conserved hydrophobic surface is likely to be important for SALP function and suggest that proteins are the likely binding partners. PMID:19567872

  17. Structural and Functional Characterizations of SsgB, a Conserved Activator of Developmental Cell Division in Morphologically Complex Actinomycetes

    SciTech Connect

    Xu, Qingping; Traag, Bjørn A.; Willemse, Joost; McMullan, Daniel; Miller, Mitchell D.; Elsliger, Marc-André; Abdubek, Polat; Astakhova, Tamara; Axelrod, Herbert L.; Bakolitsa, Constantina; Carlton, Dennis; Chen, Connie; Chiu, Hsiu-Ju; Chruszcz, Maksymilian; Clayton, Thomas; Das, Debanu; Deller, Marc C.; Duan, Lian; Ellrott, Kyle; Ernst, Dustin; Farr, Carol L.; Feuerhelm, Julie; Grant, Joanna C.; Grzechnik, Anna; Grzechnik, Slawomir K.; Han, Gye Won; Jaroszewski, Lukasz; Jin, Kevin K.; Klock, Heath E.; Knuth, Mark W.; Kozbial, Piotr; Krishna, S. Sri; Kumar, Abhinav; Marciano, David; Minor, Wladek; Mommaas, A. Mieke; Morse, Andrew T.; Nigoghossian, Edward; Nopakun, Amanda; Okach, Linda; Oommachen, Silvya; Paulsen, Jessica; Puckett, Christina; Reyes, Ron; Rife, Christopher L.; Sefcovic, Natasha; Tien, Henry J.; Trame, Christine B.; van den Bedem, Henry; Wang, Shuren; Weekes, Dana; Hodgson, Keith O.; Wooley, John; Deacon, Ashley M.; Godzik, Adam; Lesley, Scott A.; Wilson, Ian A.; van Wezel, Gilles P.


    SsgA-like proteins (SALPs) are a family of homologous cell division-related proteins that occur exclusively in morphologically complex actinomycetes. We show that SsgB, a subfamily of SALPs, is the archetypal SALP that is functionally conserved in all sporulating actinomycetes. Sporulation-specific cell division of Streptomyces coelicolor ssgB mutants is restored by introduction of distant ssgB orthologues from other actinomycetes. Interestingly, the number of septa (and spores) of the complemented null mutants is dictated by the specific ssgB orthologue that is expressed. The crystal structure of the SsgB from Thermobifida fusca was determined at 2.6 {angstrom} resolution and represents the first structure for this family. The structure revealed similarities to a class of eukaryotic 'whirly' single-stranded DNA/RNA-binding proteins. However, the electro-negative surface of the SALPs suggests that neither SsgB nor any of the other SALPs are likely to interact with nucleotide substrates. Instead, we show that a conserved hydrophobic surface is likely to be important for SALP function and suggest that proteins are the likely binding partners.

  18. Conservation of core complex subunits shaped the structure and function of photosystem I in the secondary endosymbiont alga Nannochloropsis gaditana.


    Alboresi, Alessandro; Le Quiniou, Clotilde; Yadav, Sathish K N; Scholz, Martin; Meneghesso, Andrea; Gerotto, Caterina; Simionato, Diana; Hippler, Michael; Boekema, Egbert J; Croce, Roberta; Morosinotto, Tomas


    Photosystem I (PSI) is a pigment protein complex catalyzing the light-driven electron transport from plastocyanin to ferredoxin in oxygenic photosynthetic organisms. Several PSI subunits are highly conserved in cyanobacteria, algae and plants, whereas others are distributed differentially in the various organisms. Here we characterized the structural and functional properties of PSI purified from the heterokont alga Nannochloropsis gaditana, showing that it is organized as a supercomplex including a core complex and an outer antenna, as in plants and other eukaryotic algae. Differently from all known organisms, the N. gaditana PSI supercomplex contains five peripheral antenna proteins, identified by proteome analysis as type-R light-harvesting complexes (LHCr4-8). Two antenna subunits are bound in a conserved position, as in PSI in plants, whereas three additional antennae are associated with the core on the other side. This peculiar antenna association correlates with the presence of PsaF/J and the absence of PsaH, G and K in the N. gaditana genome and proteome. Excitation energy transfer in the supercomplex is highly efficient, leading to a very high trapping efficiency as observed in all other PSI eukaryotes, showing that although the supramolecular organization of PSI changed during evolution, fundamental functional properties such as trapping efficiency were maintained.

  19. Functional role of inorganic trace elements in angiogenesis--Part I: N, Fe, Se, P, Au, and Ca.


    Saghiri, Mohammad Ali; Asatourian, Armen; Orangi, Jafar; Sorenson, Christine M; Sheibani, Nader


    Many inorganic elements are recognized as being essential for the growth of all living organisms. Transfer of nutrients and waste material from cells and tissues in the biological systems are accomplished through a functional vasculature network. Maintenance of the vascular system is vital to the wellbeing of organisms, and its alterations contribute to pathogenesis of many diseases. This article is the first part of a review on the functional role of inorganic elements including nitrogen, iron, selenium, phosphorus, gold, and calcium in angiogenesis. The methods of exposure, structure, mechanisms, and potential activity of these elements are briefly summarized. An electronic search was performed on the role of these elements in angiogenesis from January 2005 to April 2014. The recent aspects of the relationship between different elements and their role in angiogenesis, and production of pro- and anti-angiogenic factors were assessed. Several studies emphasized the role of these elements on the different phases of angiogenesis process in vivo. These elements can either enhance or inhibit angiogenesis events. Nitrogen in combination with bisphosphonates has antiangiogenic effects, while nitric oxide promotes the production of angiogenic growth factors. Iron deficiency can stimulate angiogenesis, but its excess suppresses angiogenesis events. Gold nanoparticles and selenium agents have therapeutic effects due to their anti-angiogenic characteristics, while phosphorus and calcium ions are regarded as pro-angiogenic elements. Understanding how these elements impact angiogenesis may provide new strategies for treatment of many diseases with neovascular component.

  20. Esthetic and functional recovery of extensively decayed posterior teeth through conservative treatment.


    Barroso, Sheila Daiane; Jales, Talita Santos; Corrêa-Faria, Patrícia; de Alcântara, Carlos Eduardo Pinto; Botelho, Adriana Maria; Tavano, Karine Taís Aguiar


    The case exemplifies the combination of two important principles in dentistry: 1) the maintenance of pulp vitality by the partial excavation of the contaminated dentin followed by the application of a biomaterial; and 2) esthetic and functional recovery based on biological restoration. Tooth vitality was confirmed two months after pulp treatment and restoration was accomplished with a fragment of a tooth extracted from another individual. This method is easy to perform and offers esthetic, functional, emotional and social benefits to the patient.

  1. Conserved functional antagonism of CELF and MBNL proteins controls stem cell-specific alternative splicing in planarians.


    Solana, Jordi; Irimia, Manuel; Ayoub, Salah; Orejuela, Marta Rodriguez; Zywitza, Vera; Jens, Marvin; Tapial, Javier; Ray, Debashish; Morris, Quaid; Hughes, Timothy R; Blencowe, Benjamin J; Rajewsky, Nikolaus


    In contrast to transcriptional regulation, the function of alternative splicing (AS) in stem cells is poorly understood. In mammals, MBNL proteins negatively regulate an exon program specific of embryonic stem cells; however, little is known about the in vivo significance of this regulation. We studied AS in a powerful in vivo model for stem cell biology, the planarian Schmidtea mediterranea. We discover a conserved AS program comprising hundreds of alternative exons, microexons and introns that is differentially regulated in planarian stem cells, and comprehensively identify its regulators. We show that functional antagonism between CELF and MBNL factors directly controls stem cell-specific AS in planarians, placing the origin of this regulatory mechanism at the base of Bilaterians. Knockdown of CELF or MBNL factors lead to abnormal regenerative capacities by affecting self-renewal and differentiation sets of genes, respectively. These results highlight the importance of AS interactions in stem cell regulation across metazoans.

  2. On purpose in science, conservation and government. The functional integrity of the earth is at issue not biodiversity.


    Woodwell, George M


    of the integrity of function of landscapes (and waterbodies). Emphasis falls on forests in the normally naturally forested parts of the earth because forests are so large in area globally and have such a large influence on virtually every aspect of environment. Functional integrity requires structural integrity over 85% or more of the naturally forested zone in most areas. It also requires objective measurement and definition by the scientific community. Suddenly, conservation has become, not the preservation of biodiversity, honorable as that may be, but the preservation of the functional integrity of the human environment. That purpose is the central purpose that we assign to the governments that we establish in democracies to define and defend the public interest. It is past time for the scientific and conservation communities to recognize the urgency of this transition, join in defining competent new objectives for conservation, and to convey to the public the urgency of the need for governmental responsibility in protecting the public interest in a habitable biosphere.

  3. Brightness of Solar Magnetic Elements As a Function of Magnetic Flux at High Spatial Resolution

    NASA Astrophysics Data System (ADS)

    Kahil, F.; Riethmüller, T. L.; Solanki, S. K.


    We investigate the relationship between the photospheric magnetic field of small-scale magnetic elements in the quiet-Sun (QS) at disk center and the brightness at 214, 300, 313, 388, 397, and 525.02 nm. To this end, we analyzed spectropolarimetric and imaging time series acquired simultaneously by the Imaging Magnetograph eXperiment magnetograph and the SuFI filter imager on board the balloon-borne observatory {{S}}{{UNRISE}} during its first science flight in 2009, with high spatial and temporal resolution. We find a clear dependence of the contrast in the near ultraviolet and the visible on the line-of-sight component of the magnetic field, B LOS, which is best described by a logarithmic model. This function effectively represents the relationship between the Ca ii H-line emission and B LOS and works better than the power-law fit adopted by previous studies. This, along with the high contrast reached at these wavelengths, will help with determining the contribution of small-scale elements in the QS to the irradiance changes for wavelengths below 388 nm. At all wavelengths, including the continuum at 525.40 nm, the intensity contrast does not decrease with increasing B LOS. This result also strongly supports the fact that {{S}}{{UNRISE}} has resolved small strong magnetic field elements in the internetwork, resulting in constant contrasts for large magnetic fields in our continuum contrast at 525.40 nm versus the B LOS scatterplot, unlike the turnover obtained in previous observational studies. This turnover is due to the intermixing of the bright magnetic features with the dark intergranular lanes surrounding them.

  4. Classification and Functional Analyses of Putative Conserved Proteins from Chlamydophila pneumoniae CWL029.


    Khan, Shama; Shahbaaz, Mohd; Bisetty, Krishna; Ahmad, Faizan; Hassan, Md Imtaiyaz


    Chlamydophila pneumoniae, a Gram-negative bacterium belongs to the family Chlamydiaceae, is known to cause community-acquired pneumonia and bronchitis. There is a need for genomic analyses of C. pneumoniae as its chronic infections result in reactive airway disease, lung cancer and asthma. Recent advancement in the sequencing techniques led to the generation of large genomic data. In order to utilize these data, sequence-based function predictions were used for annotating the uncharacterized genes. The genome of C. pneumoniae encodes 1052 proteins, which include a group of 366 functionally uncharacterized proteins, known as "hypothetical proteins" (HPs). Functions of these HPs were predicted by utilizing an integrated approach that combines varieties of bioinformatics tools. The functions of 142 proteins were successfully predicted and categorized into different classes of enzymes, transport proteins, binding proteins and virulence factors. Among these functionally annotated HPs, we were able to identify 12 virulent HPs. Furthermore, the HP with the highest virulence score was subjected to molecular dynamics (MD) simulations to better understand their dynamical behavior in explicit water conditions. These analyses could be utilized for an in-depth understanding of virulence mechanism. The functional knowledge of these proteins could be useful in drug design and discovery process of infections caused by C. pneumoniae.

  5. Conservation of spatial memory function in the pallial forebrain of reptiles and ray-finned fishes.


    Rodríguez, Fernando; López, J Carlos; Vargas, J Pedro; Gómez, Yolanda; Broglio, Cristina; Salas, Cosme


    The hippocampus of mammals and birds is critical for spatial memory. Neuroanatomical evidence indicates that the medial cortex (MC) of reptiles and the lateral pallium (LP) of ray-finned fishes could be homologous to the hippocampus of mammals and birds. In this work, we studied the effects of lesions to the MC of turtles and to the LP of goldfish in spatial memory. Lesioned animals were trained in place, and cue maze tasks and crucial probe and transfer tests were performed. In experiment 1, MC-lesioned turtles in the place task failed to locate the goal during trials in which new start positions were used, whereas sham animals navigated directly to the goal independently of start location. In contrast, no deficit was observed in cue learning. In experiment 2, LP lesion produced a dramatic impairment in goldfish trained in the place task, whereas medial and dorsal pallium lesions did not decrease accuracy. In addition, none of these pallial lesions produced deficits in cue learning. These results indicate that lesions to the MC of turtles and to the LP of goldfish, like hippocampal lesions in mammals and birds, selectively impair map-like memory representations of the environmental space. Thus, the forebrain structures of reptiles and teleost fish neuroanatomically equivalent to the mammalian and avian hippocampus also share a central role in spatial cognition. Present results suggest that the presence of a hippocampus-dependent spatial memory system is a primitive feature of the vertebrate forebrain that has been conserved through evolution.

  6. Conservation and diversity of Foxp2 expression in muroid rodents: functional implications.


    Campbell, Polly; Reep, Roger L; Stoll, Margaret L; Ophir, Alexander G; Phelps, Steven M


    FOXP2, the first gene causally linked to a human language disorder, is implicated in song acquisition, production, and perception in oscine songbirds, the evolution of speech and language in hominids, and the evolution of echolocation in bats. Despite the evident relevance of Foxp2 to vertebrate acoustic communication, a comprehensive description of neural expression patterns is currently lacking in mammals. Here we use immunocytochemistry to systematically describe the neural distribution of Foxp2 protein in four species of muroid rodents: Scotinomys teguina and S. xerampelinus ("singing mice"), the deer mouse, Peromyscus maniculatus, and the lab mouse, Mus musculus. While expression patterns were generally highly conserved across brain regions, we identified subtle but consistent interspecific differences in Foxp2 distribution, most notably in the medial amygdala and nucleus accumbens, and in layer V cortex throughout the brain. Throughout the brain, Foxp2 was highly enriched in areas involved in modulation of fine motor output (striatum, mesolimbic dopamine circuit, olivocerebellar system) and in multimodal sensory processing and sensorimotor integration (thalamus, cortex). We propose a generalized model for Foxp2-modulated pathways in the adult brain including, but not limited to, fine motor production and auditory perception.

  7. Role of Conserved Proline Residues in Human Apolipoprotein A-IV Structure and Function*

    PubMed Central

    Deng, Xiaodi; Walker, Ryan G.; Morris, Jamie; Davidson, W. Sean; Thompson, Thomas B.


    Apolipoprotein (apo)A-IV is a lipid emulsifying protein linked to a range of protective roles in obesity, diabetes, and cardiovascular disease. It exists in several states in plasma including lipid-bound in HDL and chylomicrons and as monomeric and dimeric lipid-free/poor forms. Our recent x-ray crystal structure of the central domain of apoA-IV shows that it adopts an elongated helical structure that dimerizes via two long reciprocating helices. A striking feature is the alignment of conserved proline residues across the dimer interface. We speculated that this plays important roles in the structure of the lipid-free protein and its ability to bind lipid. Here we show that the systematic conversion of these prolines to alanine increased the thermodynamic stability of apoA-IV and its propensity to oligomerize. Despite the structural stabilization, we noted an increase in the ability to bind and reorganize lipids and to promote cholesterol efflux from cells. The novel properties of these mutants allowed us to isolate the first trimeric form of an exchangeable apolipoprotein and characterize it by small-angle x-ray scattering and chemical cross-linking. The results suggest that the reciprocating helix interaction is a common feature of all apoA-IV oligomers. We propose a model of how self-association of apoA-IV can result in spherical lipoprotein particles, a model that may have broader applications to other exchangeable apolipoprotein family members. PMID:25733664

  8. Effect of duct obstruction on structure, elemental composition, and function of rat submandibular glands

    SciTech Connect

    Sagstroem, S.S.; Sagulin, G.B.; Roomans, G.M. )


    Obstruction of salivary glands occurs in association with a number of pathological conditions. It has been suggested that the major changes found in the salivary glands of patients with cystic fibrosis are due to obstruction of the excretory duct by viscous mucus. In the present study, the effect of excretory duct obstruction on structure, elemental composition and function of rat submandibular gland was investigated. Obstruction was effected by infusion of a fast-hardening protein emulsion in the main excretory duct. After 1 week, and more pronounced after 2 weeks of obstruction the number of granular duct cells had decreased in the obstructed gland. X-ray microanalysis showed an increase in Mg, Ca and K, and a decrease in Na levels in the acinar cells, compared to normal glands. The contralateral glands apparently underwent compensatory hypertrophy and showed a similar pattern of changes in elemental composition. The composition of pilocarpine-induced submandibular saliva was neither in the obstructed nor in the contralateral gland significantly different from that in control glands. However, the flow rate was somewhat lower. Hence, increase in cellular Ca levels in submandibular gland acinar cells in cystic fibrosis could be secondary to duct obstruction, but the present study does not support the hypothesis that duct obstruction would result in changes in the composition of saliva.

  9. FARE-CAFE: a database of functional and regulatory elements of cancer-associated fusion events.


    Korla, Praveen Kumar; Cheng, Jack; Huang, Chien-Hung; Tsai, Jeffrey J P; Liu, Yu-Hsuan; Kurubanjerdjit, Nilubon; Hsieh, Wen-Tsong; Chen, Huey-Yi; Ng, Ka-Lok


    Chromosomal translocation (CT) is of enormous clinical interest because this disorder is associated with various major solid tumors and leukemia. A tumor-specific fusion gene event may occur when a translocation joins two separate genes. Currently, various CT databases provide information about fusion genes and their genomic elements. However, no database of the roles of fusion genes, in terms of essential functional and regulatory elements in oncogenesis, is available. FARE-CAFE is a unique combination of CTs, fusion proteins, protein domains, domain-domain interactions, protein-protein interactions, transcription factors and microRNAs, with subsequent experimental information, which cannot be found in any other CT database. Genomic DNA information including, for example, manually collected exact locations of the first and second break points, sequences and karyotypes of fusion genes are included. FARE-CAFE will substantially facilitate the cancer biologist's mission of elucidating the pathogenesis of various types of cancer. This database will ultimately help to develop 'novel' therapeutic approaches. Database URL:

  10. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.


    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E


    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency.

  11. Architectural and Functional Diversity of Polycomb Group Response Elements in Drosophila

    PubMed Central

    Brown, J. Lesley; Kassis, Judith A.


    Polycomb group response elements (PREs) play an essential role in gene regulation by the Polycomb group (PcG) repressor proteins in Drosophila. PREs are required for the recruitment and maintenance of repression by the PcG proteins. PREs are made up of binding sites for multiple DNA-binding proteins, but it is still unclear what combination(s) of binding sites is required for PRE activity. Here we compare the binding sites and activities of two closely linked yet separable PREs of the Drosophila engrailed (en) gene, PRE1 and PRE2. Both PRE1 and PRE2 contain binding sites for multiple PRE–DNA-binding proteins, but the number, arrangement, and spacing of the sites differs between the two PREs. These differences have functional consequences. Both PRE1 and PRE2 mediate pairing-sensitive silencing of mini-white, a functional assay for PcG repression; however, PRE1 requires two binding sites for Pleiohomeotic (Pho), whereas PRE2 requires only one Pho-binding site for this activity. Furthermore, for full pairing-sensitive silencing activity, PRE1 requires an AT-rich region not found in PRE2. These two PREs behave differently in a PRE embryonic and larval reporter construct inserted at an identical location in the genome. Our data illustrate the diversity of architecture and function of PREs. PMID:23934890

  12. Functional conservation and coherence of HIV-1 subtype A Vpu alleles

    PubMed Central

    Romani, Bizhan; Kavyanifard, Amirarsalan; Allahbakhshi, Elham


    Functional studies of HIV-1 proteins are normally conducted using lab adapted strains of HIV-1. The extent of those functions in clinical strains is sometimes unknown. In this study, we amplified and sequenced HIV-1 Vpu from 10 Iranian patients infected with HIV-1. Phylogenetic analysis indicated that the Vpu alleles were closely related to the CRF35_AD from Iran and subtype A Vpu. We addressed some of the well-established functions of the HIV-1 Vpu, as well as some of its recently reported functions. Ability of the clinical strains of subtype A Vpu alleles for downregulation of CD4 was similar to that of the lab adapted NL4.3 Vpu. Majority of the subtype A Vpu alleles performed stronger than NL4.3 Vpu for downregulation of SNAT1. The Vpu alleles differentially induced downregulation of HLA-C, ranging from no effect to 88% downregulation of surface HLA-C. Downregulation of tetherin and enhancement of virus release was similar for the subtype A Vpu alleles and NL4.3. Subtype A Vpu alleles were more potent when compared with NL4.3 for inhibition of NF-κB activation. Our study shows that subtype A Vpu alleles exert the classical functions of HIV-1 Vpu. PMID:28317943

  13. Functional conservation and coherence of HIV-1 subtype A Vpu alleles.


    Romani, Bizhan; Kavyanifard, Amirarsalan; Allahbakhshi, Elham


    Functional studies of HIV-1 proteins are normally conducted using lab adapted strains of HIV-1. The extent of those functions in clinical strains is sometimes unknown. In this study, we amplified and sequenced HIV-1 Vpu from 10 Iranian patients infected with HIV-1. Phylogenetic analysis indicated that the Vpu alleles were closely related to the CRF35_AD from Iran and subtype A Vpu. We addressed some of the well-established functions of the HIV-1 Vpu, as well as some of its recently reported functions. Ability of the clinical strains of subtype A Vpu alleles for downregulation of CD4 was similar to that of the lab adapted NL4.3 Vpu. Majority of the subtype A Vpu alleles performed stronger than NL4.3 Vpu for downregulation of SNAT1. The Vpu alleles differentially induced downregulation of HLA-C, ranging from no effect to 88% downregulation of surface HLA-C. Downregulation of tetherin and enhancement of virus release was similar for the subtype A Vpu alleles and NL4.3. Subtype A Vpu alleles were more potent when compared with NL4.3 for inhibition of NF-κB activation. Our study shows that subtype A Vpu alleles exert the classical functions of HIV-1 Vpu.

  14. Marine reserves lag behind wilderness in the conservation of key functional roles

    PubMed Central

    D'agata, Stéphanie; Mouillot, David; Wantiez, Laurent; Friedlander, Alan M.; Kulbicki, Michel; Vigliola, Laurent


    Although marine reserves represent one of the most effective management responses to human impacts, their capacity to sustain the same diversity of species, functional roles and biomass of reef fishes as wilderness areas remains questionable, in particular in regions with deep and long-lasting human footprints. Here we show that fish functional diversity and biomass of top predators are significantly higher on coral reefs located at more than 20 h travel time from the main market compared with even the oldest (38 years old), largest (17,500 ha) and most restrictive (no entry) marine reserve in New Caledonia (South-Western Pacific). We further demonstrate that wilderness areas support unique ecological values with no equivalency as one gets closer to humans, even in large and well-managed marine reserves. Wilderness areas may therefore serve as benchmarks for management effectiveness and act as the last refuges for the most vulnerable functional roles. PMID:27354026

  15. Marine reserves lag behind wilderness in the conservation of key functional roles.


    D'agata, Stéphanie; Mouillot, David; Wantiez, Laurent; Friedlander, Alan M; Kulbicki, Michel; Vigliola, Laurent


    Although marine reserves represent one of the most effective management responses to human impacts, their capacity to sustain the same diversity of species, functional roles and biomass of reef fishes as wilderness areas remains questionable, in particular in regions with deep and long-lasting human footprints. Here we show that fish functional diversity and biomass of top predators are significantly higher on coral reefs located at more than 20 h travel time from the main market compared with even the oldest (38 years old), largest (17,500 ha) and most restrictive (no entry) marine reserve in New Caledonia (South-Western Pacific). We further demonstrate that wilderness areas support unique ecological values with no equivalency as one gets closer to humans, even in large and well-managed marine reserves. Wilderness areas may therefore serve as benchmarks for management effectiveness and act as the last refuges for the most vulnerable functional roles.

  16. Family matters: structural and functional conservation of centromere-associated proteins from yeast to humans.


    Westermann, Stefan; Schleiffer, Alexander


    Kinetochores form the fundamental link between chromosomal domains termed centromeres and spindle microtubules in all eukaryotes. This connection, provided by a large, multiprotein complex, is essential for precise chromosome segregation and thus ensures genetic stability. Here, we review recent insights into the composition and function of centromeric chromatin. Multiple approaches have converged to identify centromere-associated proteins from yeast to humans. Among them are newly characterized histone-fold family members that operate at the DNA-kinetochore interface and provide critical connections between chromosomes and microtubules. Together, these findings contribute to a unified view of how centromeric chromatin functions as a regulated scaffold for kinetochore assembly.

  17. Morgan’s Legacy: Fruit Flies and the Functional Annotation of Conserved Genes

    PubMed Central

    Bellen, Hugo J.; Yamamoto, Shinya


    In 1915, “The Mechanism of Mendelian Heredity” was published by four prominent Drosophila geneticists. They discovered that genes form linkage groups on chromosomes inherited in a Mendelian fashion and laid the genetic foundation that promoted Drosophila as a model organism. Flies continue to offer great opportunities, including studies in the field of functional genomics. PMID:26406362

  18. Local responses to participatory conservation in Annapurna conservation area, Nepal.


    Khadka, Damodar; Nepal, Sanjay K


    Biodiversity conservation has undergone a profound change in philosophy, policies and management approaches over the last forty years. The traditional top-down approach to nature protection has been widely criticized for failing to include critical social elements in management practices, and is being gradually replaced by a slew of participatory strategies under the rubric of bottom-up conservation. The new approach recognizes local communities as key partners in wildlife management and seeks their participation in social development and biodiversity conservation. However, every social context is different in its structure and functions, and in the way social groups respond to calls for participation. In order to gain a better understanding of the approach and the barriers encountered in its implementation, a questionnaire survey of 188 households was employed in the communities of the Upper Mustang extension of Annapurna Conservation Area (ACA) in Nepal. The study provides a comparative analysis of community participation and its barriers between Non-Tourist (NT) and Tourist (TV) villages. The results revealed important differences between the two groups in terms of their participation in community programs, barriers to participation, and perception of benefits from participation. Owing to their distinct spatial, demographic and attitudinal differences, the two village groups have their own sets of needs, values and motivation factors which cannot be generalized and treated as such. The research clearly identifies the need for the conservation agency to be creative in devising strategies and initiatives appropriate to specific social groups so as to optimize their input in participatory conservation.

  19. A bioinformatic survey of distribution, conservation, and probable functions of LuxR solo regulators in bacteria.


    Subramoni, Sujatha; Florez Salcedo, Diana Vanessa; Suarez-Moreno, Zulma R


    LuxR solo transcriptional regulators contain both an autoinducer binding domain (ABD; N-terminal) and a DNA binding Helix-Turn-Helix domain (HTH; C-terminal), but are not associated with a cognate N-acyl homoserine lactone (AHL) synthase coding gene in the same genome. Although a few LuxR solos have been characterized, their distributions as well as their role in bacterial signal perception and other processes are poorly understood. In this study we have carried out a systematic survey of distribution of all ABD containing LuxR transcriptional regulators (QS domain LuxRs) available in the InterPro database (IPR005143), and identified those lacking a cognate AHL synthase. These LuxR solos were then analyzed regarding their taxonomical distribution, predicted functions of neighboring genes and the presence of complete AHL-QS systems in the genomes that carry them. Our analyses reveal the presence of one or multiple predicted LuxR solos in many proteobacterial genomes carrying QS domain LuxRs, some of them harboring genes for one or more AHL-QS circuits. The presence of LuxR solos in bacteria occupying diverse environments suggests potential ecological functions for these proteins beyond AHL and interkingdom signaling. Based on gene context and the conservation levels of invariant amino acids of ABD, we have classified LuxR solos into functionally meaningful groups or putative orthologs. Surprisingly, putative LuxR solos were also found in a few non-proteobacterial genomes which are not known to carry AHL-QS systems. Multiple predicted LuxR solos in the same genome appeared to have different levels of conservation of invariant amino acid residues of ABD questioning their binding to AHLs. In summary, this study provides a detailed overview of distribution of LuxR solos and their probable roles in bacteria with genome sequence information.

  20. A bioinformatic survey of distribution, conservation, and probable functions of LuxR solo regulators in bacteria

    PubMed Central

    Subramoni, Sujatha; Florez Salcedo, Diana Vanessa; Suarez-Moreno, Zulma R.


    LuxR solo transcriptional regulators contain both an autoinducer binding domain (ABD; N-terminal) and a DNA binding Helix-Turn-Helix domain (HTH; C-terminal), but are not associated with a cognate N-acyl homoserine lactone (AHL) synthase coding gene in the same genome. Although a few LuxR solos have been characterized, their distributions as well as their role in bacterial signal perception and other processes are poorly understood. In this study we have carried out a systematic survey of distribution of all ABD containing LuxR transcriptional regulators (QS domain LuxRs) available in the InterPro database (IPR005143), and identified those lacking a cognate AHL synthase. These LuxR solos were then analyzed regarding their taxonomical distribution, predicted functions of neighboring genes and the presence of complete AHL-QS systems in the genomes that carry them. Our analyses reveal the presence of one or multiple predicted LuxR solos in many proteobacterial genomes carrying QS domain LuxRs, some of them harboring genes for one or more AHL-QS circuits. The presence of LuxR solos in bacteria occupying diverse environments suggests potential ecological functions for these proteins beyond AHL and interkingdom signaling. Based on gene context and the conservation levels of invariant amino acids of ABD, we have classified LuxR solos into functionally meaningful groups or putative orthologs. Surprisingly, putative LuxR solos were also found in a few non-proteobacterial genomes which are not known to carry AHL-QS systems. Multiple predicted LuxR solos in the same genome appeared to have different levels of conservation of invariant amino acid residues of ABD questioning their binding to AHLs. In summary, this study provides a detailed overview of distribution of LuxR solos and their probable roles in bacteria with genome sequence information. PMID:25759807

  1. 8.2% of the Human genome is constrained: variation in rates of turnover across functional element classes in the human lineage.


    Rands, Chris M; Meader, Stephen; Ponting, Chris P; Lunter, Gerton


    Ten years on from the finishing of the human reference genome sequence, it remains unclear what fraction of the human genome confers function, where this sequence resides, and how much is shared with other mammalian species. When addressing these questions, functional sequence has often been equated with pan-mammalian conserved sequence. However, functional elements that are short-lived, including those contributing to species-specific biology, will not leave a footprint of long-lasting negative selection. Here, we address these issues by identifying and characterising sequence that has been constrained with respect to insertions and deletions for pairs of eutherian genomes over a range of divergences. Within noncoding sequence, we find increasing amounts of mutually constrained sequence as species pairs become more closely related, indicating that noncoding constrained sequence turns over rapidly. We estimate that half of present-day noncoding constrained sequence has been gained or lost in approximately the last 130 million years (half-life in units of divergence time, d1/2 = 0.25-0.31). While enriched with ENCODE biochemical annotations, much of the short-lived constrained sequences we identify are not detected by models optimized for wider pan-mammalian conservation. Constrained DNase 1 hypersensitivity sites, promoters and untranslated regions have been more evolutionarily stable than long noncoding RNA loci which have turned over especially rapidly. By contrast, protein coding sequence has been highly stable, with an estimated half-life of over a billion years (d1/2 = 2.1-5.0). From extrapolations we estimate that 8.2% (7.1-9.2%) of the human genome is presently subject to negative selection and thus is likely to be functional, while only 2.2% has maintained constraint in both human and mouse since these species diverged. These results reveal that the evolutionary history of the human genome has been highly dynamic, particularly for its noncoding yet

  2. Rules to limp by: joint compensation conserves limb function after peripheral nerve injury.


    Bauman, Jay M; Chang, Young-Hui


    Locomotion persists across all manner of internal and external perturbations. The objective of this study was to identify locomotor compensation strategies in rodent models of peripheral nerve injury. We found that hip-to-toe limb length and limb angle was preferentially preserved over individual joint angles after permanent denervation of rat ankle extensor muscles. These findings promote further enquiry into the significance of limb-level function for neuromechanical control of legged locomotion.

  3. Functional conservation and diversification of APETALA1/FRUITFULL genes in Brachypodium distachyon.


    Li, Qi; Wang, Ye; Wang, Fuxiang; Guo, Yuyu; Duan, Xueqing; Sun, Jinhao; An, Hailong


    The duplicated grass APETALA1/FRUITFULL (AP1/FUL) genes have distinct but overlapping patterns of expression, suggesting their discrete roles in transition to flowering, specification of spikelet meristem identity and specification of floral organ identity. In this study, we analyzed the expression patterns and functions of four AP1/FUL paralogs (BdVRN1, BdFUL2, BdFUL3 and BdFUL4) in Brachypodium distachyon, a model plant for the temperate cereals and related grasses. Among the four genes tested, only BdVRN1 could remember the prolonged cold treatment. The recently duplicated BdVRN1 and BdFUL2 genes were expressed in a highly consistent manner and ectopic expressions of them caused similar phenotypes such as extremely early flowering and severe morphological alterations of floral organs, indicating their redundant roles in floral transition, inflorescence development and floral organ identity. In comparison, ectopic expressions of BdFUL3 and BdFUL4 only caused a moderate early flowering phenotype, suggesting their divergent function. In yeast two-hybrid assay, both BdVRN1 and BdFUL2 physically interact with SEP proteins but only BdFUL2 is able to form a homodimer. BdVRN1 also interacts weakly with BdFUL2. Our results indicate that, since the separation of AP1/FUL genes in grasses, the process of sub- or neo-functionalization has occurred and paralogs function redundantly and/or separately in flowering competence and inflorescence development.

  4. Structure and Function of the SWIRM Domain, a Conserved Protein Module Found in Chromatin Regulatory Complexes

    SciTech Connect

    Da,G.; Lenkart, J.; Zhao, K.; Shiekhattar, R.; Cairns, B.; Marmorstein, R.


    The SWIRM domain is a module found in the Swi3 and Rsc8 subunits of SWI/SNF-family chromatin remodeling complexes, and the Ada2 and BHC110/LSD1 subunits of chromatin modification complexes. Here we report the high-resolution crystal structure of the SWIRM domain from Swi3 and characterize the in vitro and in vivo function of the SWIRM domains from Saccharomyces cerevisiae Swi3 and Rsc8. The Swi3 SWIRM forms a four-helix bundle containing a pseudo 2-fold axis and a helix-turn-helix motif commonly found in DNA-binding proteins. We show that the Swi3 SWIRM binds free DNA and mononucleosomes with high and comparable affinity and that a subset of Swi3 substitution mutants that display growth defects in vivo also show impaired DNA-binding activity in vitro, consistent with a nucleosome targeting function of this domain. Genetic and biochemical studies also reveal that the Rsc8 and Swi3 SWIRM domains are essential for the proper assembly and in vivo functions of their respective complexes. Together, these studies identify the SWIRM domain as an essential multifunctional module for the regulation of gene expression.

  5. Structure and function of the SWIRM domain, a conserved protein module found in chromatin regulatory complexes.


    Da, Guoping; Lenkart, Jeffrey; Zhao, Kehao; Shiekhattar, Ramin; Cairns, Bradley R; Marmorstein, Ronen


    The SWIRM domain is a module found in the Swi3 and Rsc8 subunits of SWI/SNF-family chromatin remodeling complexes, and the Ada2 and BHC110/LSD1 subunits of chromatin modification complexes. Here we report the high-resolution crystal structure of the SWIRM domain from Swi3 and characterize the in vitro and in vivo function of the SWIRM domains from Saccharomyces cerevisiae Swi3 and Rsc8. The Swi3 SWIRM forms a four-helix bundle containing a pseudo 2-fold axis and a helix-turn-helix motif commonly found in DNA-binding proteins. We show that the Swi3 SWIRM binds free DNA and mononucleosomes with high and comparable affinity and that a subset of Swi3 substitution mutants that display growth defects in vivo also show impaired DNA-binding activity in vitro, consistent with a nucleosome targeting function of this domain. Genetic and biochemical studies also reveal that the Rsc8 and Swi3 SWIRM domains are essential for the proper assembly and in vivo functions of their respective complexes. Together, these studies identify the SWIRM domain as an essential multifunctional module for the regulation of gene expression.

  6. Evolutionarily Conserved Dual Lysine Motif Determines the Non-Chaperone Function of Secreted Hsp90alpha in Tumor Progression

    PubMed Central

    Sahu, Divya; Hou, Yingping; Tsen, Fred; Tong, Chang; O’Brien, Kathryn; Situ, Alan J.; Schmidt, Thomas; Chen, Mei; Ying, Qilong; Ulmer, Tobias S.; Woodley, David T.; Li, Wei


    Both intracellular and extracellular heat shock protein-90 (Hsp90) family proteins (α and β) have been shown to support tumor progression. The tumor-promoting activity of the intracellular Hsp90 proteins is attributed to their N-terminal ATPase-driven chaperone function. What determines the extracellular function of secreted Hsp90 was unclear. Here we show that knocking out Hsp90α nullifies tumor cell abilities to migrate, invade and metastasize without affecting cell survival and growth. Knocking out Hsp90β leads to cell death. Extracellular supplementation with recombinant Hsp90α, but not Hsp90β, protein recovers the tumorigenicity of Hsp90α-knockout cells. Sequential mutagenesis identifies two evolutionarily conserved lysine residues, lys-270 and lys-277, in Hsp90α subfamily that determine the extracellular Hsp90α function. Hsp90β subfamily lacks the dual lysine motif and does not show the same extracellular function. Substitutions of gly-262 and thr-269 in Hsp90β with lysines convert Hsp90β to act as Hsp90α outside the cells. Monoclonal antibody, 1G6-D7, against the dual lysine region of secreted Hsp90α blocks de novo tumor formation and significantly inhibits expansion of already formed tumors. This study suggests an alternative therapeutic approach to selectively target the extracellular Hsp90α to the conventional approach targeting the ATPase of intracellular Hsp90α and Hsp90β in cancer. PMID:27721406

  7. Thymidine kinases share a conserved function for nucleotide salvage and play an essential role in Arabidopsis thaliana growth and development.


    Xu, Jing; Zhang, Lin; Yang, Dong-Lei; Li, Qun; He, Zuhua


    Thymidine kinases (TKs) are important components in the nucleotide salvage pathway. However, knowledge about plant TKs is quite limited. In this study, the molecular function of TKs in Arabidopsis thaliana was investigated. Two TKs were identified and named AtTK1 and AtTK2. Expression of both genes was ubiquitous, but AtTK1 was strongly expressed in high-proliferation tissues. AtTK1 was localized to the cytosol, whereas AtTK2 was localized to the mitochondria. Mutant analysis indicated that the two genes function coordinately to sustain normal plant development. Enzymatic assays showed that the two TK proteins shared similar catalytic specificity for pyrimidine nucleosides. They were able to complement an Escherichia coli strain lacking TK activity. 5'-Fluorodeoxyuridine (FdU) resistance and 5-ethynyl 2'-deoxyuridine (EdU) incorporation assays confirmed their activity in vivo. Furthermore, the tk mutant phenotype could be alleviated by nucleotide feeding, establishing that the biosynthesis of pyrimidine nucleotides was disrupted by the TK deficiency. Finally, both human and rice (Oryza sativa) TKs were able to rescue the tk mutants, demonstrating the functional conservation of TKs across organisms. Taken together, our findings clarify the specialized function of two TKs in A. thaliana and establish that the salvage pathway mediated by the kinases is essential for plant growth and development.

  8. Conservation: Toward firmer ground

    NASA Technical Reports Server (NTRS)


    The following aspects of energy conservation were reviewed in order to place the problems in proper perspective: history and goals, conservation accounting-criteria, and a method to overcome obstacles. The effect of changing prices and available supplies of energy sources and their causes on consumption levels during the last few decades were described. Some examples of attainable conservation goals were listed and justified. A number of specific criteria applicable to conservation accounting were given. Finally, a discussion was presented to relate together the following aspects of energy conservation: widespread impact, involvement of government, industry, politics, moral and ethical aspects, urgency and time element.

  9. Design of new generation femoral prostheses using functionally graded materials: a finite element analysis.


    Oshkour, A A; Abu Osman, N A; Yau, Y H; Tarlochan, F; Abas, W A B Wan


    This study aimed to develop a three-dimensional finite element model of a functionally graded femoral prosthesis. The model consisted of a femoral prosthesis created from functionally graded materials (FGMs), cement, and femur. The hip prosthesis was composed of FGMs made of titanium alloy, chrome-cobalt, and hydroxyapatite at volume fraction gradient exponents of 0, 1, and 5, respectively. The stress was measured on the femoral prosthesis, cement, and femur. Stress on the neck of the femoral prosthesis was not sensitive to the properties of the constituent material. However, stress on the stem and cement decreased proportionally as the volume fraction gradient exponent of the FGM increased. Meanwhile, stress became uniform on the cement mantle layer. In addition, stress on the femur in the proximal part increased and a high surface area of the femoral part was involved in absorbing the stress. As such, the stress-shielding area decreased. The results obtained in this study are significant in the design and longevity of new prosthetic devices because FGMs offer the potential to achieve stress distribution that more closely resembles that of the natural bone in the femur.

  10. Conserved form and function of the germinal epithelium through 500 million years of vertebrate evolution.


    Grier, Harry J; Uribe, Mari Carmen; Lo Nostro, Fabiana L; Mims, Steven D; Parenti, Lynne R


    The germinal epithelium, i.e., the site of germ cell production in males and females, has maintained a constant form and function throughout 500 million years of vertebrate evolution. The distinguishing characteristic of germinal epithelia among all vertebrates, males, and females, is the presence of germ cells among somatic epithelial cells. The somatic epithelial cells, Sertoli cells in males or follicle (granulosa) cells in females, encompass and isolate germ cells. Morphology of all vertebrate germinal epithelia conforms to the standard definition of an epithelium: epithelial cells are interconnected, border a body surface or lumen, are avascular and are supported by a basement membrane. Variation in morphology of gonads, which develop from the germinal epithelium, is correlated with the evolution of reproductive modes. In hagfishes, lampreys, and elasmobranchs, the germinal epithelia of males produce spermatocysts. A major rearrangement of testis morphology diagnoses osteichthyans: the spermatocysts are arranged in tubules or lobules. In protogynous (female to male) sex reversal in teleost fishes, female germinal epithelial cells (prefollicle cells) and oogonia transform into the first male somatic cells (Sertoli cells) and spermatogonia in the developing testis lobules. This common origin of cell types from the germinal epithelium in fishes with protogynous sex reversal supports the homology of Sertoli cells and follicle cells. Spermatogenesis in amphibians develops within spermatocysts in testis lobules. In amniotes vertebrates, the testis is composed of seminiferous tubules wherein spermatogenesis occurs radially. Emerging research indicates that some mammals do not have lifetime determinate fecundity. The fact emerged that germinal epithelia occur in the gonads of all vertebrates examined herein of both sexes and has the same form and function across all vertebrate taxa. Continued study of the form and function of the germinal epithelium in vertebrates

  11. A static analysis of three-dimensional functionally graded beams through hierarchical one-dimensional finite elements

    SciTech Connect

    Giunta, G.; Belouettar, S.


    In this paper, the static response of three-dimensional beams made of functionally graded materials is investigated through a family of hierarchical one-dimensional finite elements. A wide variety of elements is proposed differing by the kinematic formulation and the number of nodes per elements along the beam axis. Elements’ stiffness matrix and load vector are derived in a unified nuclear form that does not depend upon the a priori expansion order over the cross-section nor the finite element approximation along the beam axis. Results are validated towards three-dimensional finite element models as well as equivalent Navier-type analytical solutions. The numerical investigations show that accurate and efficient solutions (when compared with full three-dimensional FEM solutions) can be obtained by the proposed family of hierarchical one-dimensional elements’ family.

  12. Conserved regulatory mechanism controls the development of cells with rooting functions in land plants

    PubMed Central

    Tam, Thomas Ho Yuen; Catarino, Bruno; Dolan, Liam


    Land plants develop filamentous cells—root hairs, rhizoids, and caulonemata—at the interface with the soil. Members of the group XI basic helix–loop–helix (bHLH) transcription factors encoded by LOTUS JAPONICUS ROOTHAIRLESS1-LIKE (LRL) genes positively regulate the development of root hairs in the angiosperms Lotus japonicus, Arabidopsis thaliana, and rice (Oryza sativa). Here we show that auxin promotes rhizoid and caulonema development by positively regulating the expression of PpLRL1 and PpLRL2, the two LRL genes in the Physcomitrella patens genome. Although the group VIII bHLH proteins, AtROOT HAIR DEFECTIVE6 and AtROOT HAIR DEFECTIVE SIX-LIKE1, promote root-hair development by positively regulating the expression of AtLRL3 in A. thaliana, LRL genes promote rhizoid development independently of PpROOT HAIR DEFECTIVE SIX-LIKE1 and PpROOT HAIR DEFECITVE SIX-LIKE2 (PpRSL1 and PpRSL2) gene function in P. patens. Together, these data demonstrate that both LRL and RSL genes are components of an ancient auxin-regulated gene network that controls the development of tip-growing cells with rooting functions among most extant land plants. Although this network has diverged in the moss and the angiosperm lineages, our data demonstrate that the core network acted in the last common ancestor of the mosses and angiosperms that existed sometime before 420 million years ago. PMID:26150509

  13. In vivo "photofootprint" changes at sequences between the yeast GAL1 upstream activating sequence and "TATA" element require activated GAL4 protein but not a functional TATA element.

    PubMed Central

    Selleck, S B; Majors, J


    Transcription of the yeast GAL1 and GAL10 genes is induced by growth on galactose. Using the technique of photofootprinting in vivo, we previously documented equivalent transcription-dependent footprints within the putative "TATA" elements of both genes. To explore the functional significance of these observations, we created a 3-base-pair substitution mutation within the GAL1 promoter TATA element, which disrupted the ATATAA consensus sequence but left intact the photomodification targets. The mutation reduced galactose-induced RNA levels by a factor of 100. The mutant promoter no longer displayed the characteristic TATA sequence footprint, supporting the hypothesis that transcription activation involves the binding of a TATA box factor. We also observed a collection of transcription-correlated alterations in the modification pattern at sites between the UASG and the GAL1 TATA element, within sequences that are not required for inducible transcription. These patterns, characteristic of the induced wild-type GAL1 gene, were still galactose inducible with the TATA mutant GAl1 promoter, despite the low level of transcription from this promoter. We conclude that the GAL4-dependent protein/DNA structure responsible for the altered pattern within nonessential sequences is therefore not strictly coupled to an active TATA element or to high levels of expression. Nonetheless, the patterns probably reflect a stable protein-dependent structure that accompanies assembly of the transcription initiation complex. Images PMID:3041409

  14. Spt-Ada-Gcn5-Acetyltransferase (SAGA) Complex in Plants: Genome Wide Identification, Evolutionary Conservation and Functional Determination.


    Srivastava, Rakesh; Rai, Krishan Mohan; Pandey, Bindu; Singh, Sudhir P; Sawant, Samir V


    The recruitment of RNA polymerase II on a promoter is assisted by the assembly of basal transcriptional machinery in eukaryotes. The Spt-Ada-Gcn5-Acetyltransferase (SAGA) complex plays an important role in transcription regulation in eukaryotes. However, even in the advent of genome sequencing of various plants, SAGA complex has been poorly defined for their components and roles in plant development and physiological functions. Computational analysis of Arabidopsis thaliana and Oryza sativa genomes for SAGA complex resulted in the identification of 17 to 18 potential candidates for SAGA subunits. We have further classified the SAGA complex based on the conserved domains. Phylogenetic analysis revealed that the SAGA complex proteins are evolutionary conserved between plants, yeast and mammals. Functional annotation showed that they participate not only in chromatin remodeling and gene regulation, but also in different biological processes, which could be indirect and possibly mediated via the regulation of gene expression. The in silico expression analysis of the SAGA components in Arabidopsis and O. sativa clearly indicates that its components have a distinct expression profile at different developmental stages. The co-expression analysis of the SAGA components suggests that many of these subunits co-express at different developmental stages, during hormonal interaction and in response to stress conditions. Quantitative real-time PCR analysis of SAGA component genes further confirmed their expression in different plant tissues and stresses. The expression of representative salt, heat and light inducible