Antegrade jj stenting after percutaneous renal procedures: The 'pull and push' technique.

PubMed

Ratkal, Jaideep M; Sharma, Elias

2015-06-01

A JJ stent is inserted antegradely after percutaneous renal procedures like percutaneous nephrolithotomy (PCNL) for renal calculus disease, and for endopyelotomy for pelvi-ureteric junction obstruction. We describe a technique for antegrade stent insertion after PCNL.

RNA connectivity requirements between conserved elements in the core of the yeast telomerase RNP

PubMed Central

Mefford, Melissa A; Rafiq, Qundeel; Zappulla, David C

2013-01-01

Telomerase is a specialized chromosome end-replicating enzyme required for genome duplication in many eukaryotes. An RNA and reverse transcriptase protein subunit comprise its enzymatic core. Telomerase is evolving rapidly, particularly its RNA component. Nevertheless, nearly all telomerase RNAs, including those of H. sapiens and S. cerevisiae, share four conserved structural elements: a core-enclosing helix (CEH), template-boundary element, template, and pseudoknot, in this order along the RNA. It is not clear how these elements coordinate telomerase activity. We find that although rearranging the order of the four conserved elements in the yeast telomerase RNA subunit, TLC1, disrupts activity, the RNA ends can be moved between the template and pseudoknot in vitro and in vivo. However, the ends disrupt activity when inserted between the other structured elements, defining an Area of Required Connectivity (ARC). Within the ARC, we find that only the junction nucleotides between the pseudoknot and CEH are essential. Integrating all of our findings provides a basic map of functional connections in the core of the yeast telomerase RNP and a framework to understand conserved element coordination in telomerase mechanism. PMID:24129512

CRISPR-based screening of genomic island excision events in bacteria.

PubMed

Selle, Kurt; Klaenhammer, Todd R; Barrangou, Rodolphe

2015-06-30

Genomic analysis of Streptococcus thermophilus revealed that mobile genetic elements (MGEs) likely contributed to gene acquisition and loss during evolutionary adaptation to milk. Clustered regularly interspaced short palindromic repeats-CRISPR-associated genes (CRISPR-Cas), the adaptive immune system in bacteria, limits genetic diversity by targeting MGEs including bacteriophages, transposons, and plasmids. CRISPR-Cas systems are widespread in streptococci, suggesting that the interplay between CRISPR-Cas systems and MGEs is one of the driving forces governing genome homeostasis in this genus. To investigate the genetic outcomes resulting from CRISPR-Cas targeting of integrated MGEs, in silico prediction revealed four genomic islands without essential genes in lengths from 8 to 102 kbp, totaling 7% of the genome. In this study, the endogenous CRISPR3 type II system was programmed to target the four islands independently through plasmid-based expression of engineered CRISPR arrays. Targeting lacZ within the largest 102-kbp genomic island was lethal to wild-type cells and resulted in a reduction of up to 2.5-log in the surviving population. Genotyping of Lac(-) survivors revealed variable deletion events between the flanking insertion-sequence elements, all resulting in elimination of the Lac-encoding island. Chimeric insertion sequence footprints were observed at the deletion junctions after targeting all of the four genomic islands, suggesting a common mechanism of deletion via recombination between flanking insertion sequences. These results established that self-targeting CRISPR-Cas systems may direct significant evolution of bacterial genomes on a population level, influencing genome homeostasis and remodeling.

Antegrade jj stenting after percutaneous renal procedures: The ‘pull and push’ technique

PubMed Central

Ratkal, Jaideep M.; Sharma, Elias

2014-01-01

A JJ stent is inserted antegradely after percutaneous renal procedures like percutaneous nephrolithotomy (PCNL) for renal calculus disease, and for endopyelotomy for pelvi-ureteric junction obstruction. We describe a technique for antegrade stent insertion after PCNL. PMID:26413327

Identifying structural variation in haploid microbial genomes from short-read resequencing data using breseq.

PubMed

Barrick, Jeffrey E; Colburn, Geoffrey; Deatherage, Daniel E; Traverse, Charles C; Strand, Matthew D; Borges, Jordan J; Knoester, David B; Reba, Aaron; Meyer, Austin G

2014-11-29

Mutations that alter chromosomal structure play critical roles in evolution and disease, including in the origin of new lifestyles and pathogenic traits in microbes. Large-scale rearrangements in genomes are often mediated by recombination events involving new or existing copies of mobile genetic elements, recently duplicated genes, or other repetitive sequences. Most current software programs for predicting structural variation from short-read DNA resequencing data are intended primarily for use on human genomes. They typically disregard information in reads mapping to repeat sequences, and significant post-processing and manual examination of their output is often required to rule out false-positive predictions and precisely describe mutational events. We have implemented an algorithm for identifying structural variation from DNA resequencing data as part of the breseq computational pipeline for predicting mutations in haploid microbial genomes. Our method evaluates the support for new sequence junctions present in a clonal sample from split-read alignments to a reference genome, including matches to repeat sequences. Then, it uses a statistical model of read coverage evenness to accept or reject these predictions. Finally, breseq combines predictions of new junctions and deleted chromosomal regions to output biologically relevant descriptions of mutations and their effects on genes. We demonstrate the performance of breseq on simulated Escherichia coli genomes with deletions generating unique breakpoint sequences, new insertions of mobile genetic elements, and deletions mediated by mobile elements. Then, we reanalyze data from an E. coli K-12 mutation accumulation evolution experiment in which structural variation was not previously identified. Transposon insertions and large-scale chromosomal changes detected by breseq account for ~25% of spontaneous mutations in this strain. In all cases, we find that breseq is able to reliably predict structural variation with modest read-depth coverage of the reference genome (>40-fold). Using breseq to predict structural variation should be useful for studies of microbial epidemiology, experimental evolution, synthetic biology, and genetics when a reference genome for a closely related strain is available. In these cases, breseq can discover mutations that may be responsible for important or unintended changes in genomes that might otherwise go undetected.

Endogenous avian leukosis viral loci in the Red Jungle Fowl genome assembly.

PubMed

Benkel, Bernhard; Rutherford, Katherine

2014-12-01

The current build (galGal4) of the genome of the ancestor of the modern chicken, the Red Jungle Fowl, contains a single endogenous avian leukosis viral element (ALVE) on chromosome 1 (designated RSV-LTR; family ERVK). The assembly shows the ALVE provirus juxtaposed with a member of a second family of avian endogenous retroviruses (designated GGERV20; family ERVL); however, the status of the 3' end of the ALVE element as well as its flanking region remain unclear due to a gap in the reference genome sequence. In this study, we filled the gap in the assembly using a combination of long-range PCR (LR-PCR) and a short contig present in the unassembled portion of the reference genome database. Our results demonstrate that the ALVE element (ALVE-JFevB) is inserted into the putative envelope region of a GGERV20 element, roughly 1 kbp from its 3' end, and that ALVE-JFevB is complete, and depending on its expression status, potentially capable of directing the production of virus. Moreover, the unassembled portion of the genome database contains junction fragments for a second, previously characterized endogenous proviral element, ALVE-6. ©2014 Poultry Science Association Inc.

Whole genome sequencing of cytogenetically balanced chromosome translocations identifies potentially pathological gene disruptions and highlights the importance of microhomology in the mechanism of formation

PubMed Central

Gustavsson, Peter; Förster, Alisa; Hofmeister, Wolfgang; Wincent, Josephine; Zachariadis, Vasilios; Anderlid, Britt-Marie; Nordgren, Ann; Mäkitie, Outi; Wirta, Valtteri; Käller, Max; Vezzi, Francesco; Lupski, James R; Nordenskjöld, Magnus; Lundberg, Elisabeth Syk; Carvalho, Claudia M. B.; Lindstrand, Anna

2016-01-01

Most balanced translocations are thought to result mechanistically from non-homologous endjoining (NHEJ) or, in rare cases of recurrent events, by nonallelic homologous recombination (NAHR). Here, we use low coverage mate pair whole genome sequencing to fine map rearrangement breakpoint junctions in both phenotypically normal and affected translocation carriers. In total, 46 junctions from 22 carriers of balanced translocations were characterized. Genes were disrupted in 48% of the breakpoints; recessive genes in four normal carriers and known dominant intellectual disability genes in three affected carriers. Finally, seven candidate disease genes were disrupted in five carriers with neurocognitive disabilities (SVOPL, SUSD1, TOX, NCALD, SLC4A10) and one XX-male carrier with Tourette syndrome (LYPD6, GPC5). Breakpoint junction analyses revealed microhomology and small templated insertions in a substantive fraction of the analyzed translocations (17.4%; n=4); an observation that was substantiated by reanalysis of 37 previously published translocation junctions. Microhomology associated with templated-insertions is a characteristic seen in the breakpoint junctions of rearrangements mediated by the error prone replication-based repair mechanisms (RBMs). Our data implicate that a mechanism involving template switching might contribute to the formation of at least 15% of the interchromosomal translocation events. PMID:27862604

Translocation and gross deletion breakpoints in human inherited disease and cancer II: Potential involvement of repetitive sequence elements in secondary structure formation between DNA ends.

PubMed

Chuzhanova, Nadia; Abeysinghe, Shaun S; Krawczak, Michael; Cooper, David N

2003-09-01

Translocations and gross deletions are responsible for a significant proportion of both cancer and inherited disease. Although such gene rearrangements are nonuniformly distributed in the human genome, the underlying mutational mechanisms remain unclear. We have studied the potential involvement of various types of repetitive sequence elements in the formation of secondary structure intermediates between the single-stranded DNA ends that recombine during rearrangements. Complexity analysis was used to assess the potential of these ends to form secondary structures, the maximum decrease in complexity consequent to a gross rearrangement being used as an indicator of the type of repeat and the specific DNA ends involved. A total of 175 pairs of deletion/translocation breakpoint junction sequences available from the Gross Rearrangement Breakpoint Database [GRaBD; www.uwcm.ac.uk/uwcm/mg/grabd/grabd.html] were analyzed. Potential secondary structure was noted between the 5' flanking sequence of the first breakpoint and the 3' flanking sequence of the second breakpoint in 49% of rearrangements and between the 5' flanking sequence of the second breakpoint and the 3' flanking sequence of the first breakpoint in 36% of rearrangements. Inverted repeats, inversions of inverted repeats, and symmetric elements were found in association with gross rearrangements at approximately the same frequency. However, inverted repeats and inversions of inverted repeats accounted for the vast majority (83%) of deletions plus small insertions, symmetric elements for one-half of all antigen receptor-mediated translocations, while direct repeats appear only to be involved in mediating simple deletions. These findings extend our understanding of illegitimate recombination by highlighting the importance of secondary structure formation between single-stranded DNA ends at breakpoint junctions. Copyright 2003 Wiley-Liss, Inc.

Antenna feed system for receiving circular polarization and transmitting linear polarization

NASA Technical Reports Server (NTRS)

Seidel, B. L.; Bathker, D. A. (Inventor)

1979-01-01

An invention is described which provides for receiving a circularly polarized signal from an antenna feed connected to orthogonally spaced antenna elements. It also provides for transmitting a linearly polarized signal through the same feed without switches, and without suffering a 3 dB polarization mismatch loss, using an arrangement of hybrid junctions. The arrangement is comprised of two dividing hybrid junctions, each connected to a different pair of antenna elements and a summing hybrid junction. In one version, a receiver is connected to the summing hybrid junction directly. A diplexer is used to connect a transmitter to only one pair of antenna elements. In another version, designated left and right circularly polarized (LCP and RCP) transmitters are connected to the summing hybrid junction by separate diplexers, and separate LCP and RCP sensitive receivers are connected to the diplexers in order to transmit linearly polarized signals using all four antenna elements while receiving circularly polarized signals as before. An orthomode junction and horn antenna may replace the two dividing hybrid junctions and antenna feed.

Global-Local Finite Element Analysis of Bonded Single-Lap Joints

NASA Technical Reports Server (NTRS)

Kilic, Bahattin; Madenci, Erdogan; Ambur, Damodar R.

2004-01-01

Adhesively bonded lap joints involve dissimilar material junctions and sharp changes in geometry, possibly leading to premature failure. Although the finite element method is well suited to model the bonded lap joints, traditional finite elements are incapable of correctly resolving the stress state at junctions of dissimilar materials because of the unbounded nature of the stresses. In order to facilitate the use of bonded lap joints in future structures, this study presents a finite element technique utilizing a global (special) element coupled with traditional elements. The global element includes the singular behavior at the junction of dissimilar materials with or without traction-free surfaces.

Effects of oxygen-inserted layers on diffusion of boron, phosphorus, and arsenic in silicon for ultra-shallow junction formation

NASA Astrophysics Data System (ADS)

Zhang, X.; Connelly, D.; Takeuchi, H.; Hytha, M.; Mears, R. J.; Rubin, L. M.; Liu, T.-J. K.

2018-03-01

The effects of oxygen-inserted (OI) layers on the diffusion of boron (B), phosphorus (P), and arsenic (As) in silicon (Si) are investigated, for ultra-shallow junction formation by high-dose ion implantation followed by rapid thermal annealing. The projected range (Rp) of the implanted dopants is shallower than the depth of the OI layers. Secondary ion mass spectrometry is used to compare the dopant profiles in silicon samples that have OI layers against the dopant profiles in control samples that do not have OI layers. Diffusion is found to be substantially retarded by the OI layers for B and P, and less for As, providing shallower junction depth. The experimental results suggest that the OI layers serve to block the diffusion of Si self-interstitials and thereby effectively reduce interstitial-aided diffusion beyond the depth of the OI layers. The OI layers also help to retain more dopants within the Si, which technology computer-aided design simulations indicate to be beneficial for achieving shallower junctions with lower sheet resistance to enable further miniaturization of planar metal-oxide-semiconductor field-effect transistors for improved integrated-circuit performance and cost per function.

Chemical sensor

NASA Technical Reports Server (NTRS)

Rauh, R. David (Inventor)

1990-01-01

A sensor for detecting a chemical substance includes an insertion element having a structure which enables insertion of the chemical substance with a resulting change in the bulk electrical characteristics of the insertion element under conditions sufficient to permit effective insertion; the change in the bulk electrical characteristics of the insertion element is detected as an indication of the presence of the chemical substance.

Spin injection into silicon in three-terminal vertical and four-terminal lateral devices with Fe/Mg/MgO/Si tunnel junctions having an ultrathin Mg insertion layer

NASA Astrophysics Data System (ADS)

Sato, Shoichi; Nakane, Ryosho; Hada, Takato; Tanaka, Masaaki

2017-12-01

We demonstrate that the spin injection/extraction efficiency is enhanced by an ultrathin Mg insertion layer (⩽2 nm) in Fe /Mg /MgO /n+-Si tunnel junctions. In diode-type vertical three-terminal devices fabricated on a Si substrate, we observe the narrower three-terminal Hanle (N-3TH) signals indicating true spin injection into Si and estimate the spin polarization in Si to be 16% when the thickness of the Mg insertion layer is 1 nm, whereas no N-3TH signal is observed without the Mg insertion. This means that the spin injection/extraction efficiency is enhanced by suppressing the formation of a magnetically dead layer at the Fe/MgO interface. We also observe clear spin transport signals, such as nonlocal Hanle signals and spin-valve signals, in a lateral four-terminal device with the same Fe /Mg /MgO /n+-Si tunnel junctions fabricated on a Si-on-insulator substrate. It is found that both the intensity and linewidth of the spin signals are affected by the geometrical effects (device geometry and size). We have derived analytical functions taking into account the device structures, including channel thickness and electrode size, and estimated important parameters: spin lifetime and spin polarization. Our analytical functions explain the experimental results very well. Our study shows the importance of suppressing a magnetically dead layer and provides a unified understanding of spin injection/detection signals in different device geometries.

The Impact of Preoperative α-Adrenergic Antagonists on Ureteral Access Sheath Insertion Force and the Upper Limit of Force Required to Avoid Ureteral Mucosal Injury: A Randomized Controlled Study.

PubMed

Koo, Kyo Chul; Yoon, Jun-Ho; Park, No-Cheol; Lee, Hye Sun; Ahn, Hyun Kyu; Lee, Kwang Suk; Kim, Do Kyung; Cho, Kang Su; Chung, Byung Ha; Hong, Chang Hee

2018-06-01

Excessive bulking force during primary access of the ureteral access sheath may induce ureteral injury. We investigated the efficacy of preoperative α-blockade to reduce ureteral access sheath insertion force and determine the upper limit required to avoid ureteral injury. In this randomized controlled trial 135 patients from a single institution who had ureteropelvic junction or renal pelvis stones and were scheduled to undergo retrograde intrarenal surgery were prospectively enrolled from December 2015 to January 2017. Of the patients 41 and 42 were randomly assigned to the control and experimental groups, respectively. The experimental group received α-blockade preoperatively. The 21 patients who were pre-stented were assessed separately. We developed a homemade device to measure maximal ureteral access sheath insertion force. Our ureteral access sheath insertion force measurement device showed excellent reproducibility. Higher insertion velocity resulted in greater maximal sheath insertion force. Maximal insertion force in the α-blockade group was significantly lower than in the control group at the ureterovesical junction (p = 0.008) and the proximal ureter (p = 0.036). Maximal insertion force in the α-blockade group was comparable to that in pre-stented patients. Female patients and patients 70 years old or older showed a lower maximal ureteral access sheath insertion force than their counterparts. The rate of grade 2 or greater ureteral injury was lower in the α-blockade group than in controls (p = 0.038). No injury occurred in any case in which ureteral access sheath insertion force did not exceed 600 G. Preoperative α-blockade and slow sheath placement may reduce maximal ureteral access sheath insertion force. If the force exceeds 600 G, a smaller diameter sheath may be an alternative. Alternatively the procedure can be terminated and followed later by pre-stented retrograde intrarenal surgery. Copyright © 2018 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Effects of Single P-Element Insertions on Bristle Number and Viability in Drosophila Melanogaster

PubMed Central

Lyman, R. F.; Lawrence, F.; Nuzhdin, S. V.; Mackay, TFC.

1996-01-01

Single P-element mutagenesis was used to construct 1094 lines with P[lArB] inserts on all three major chromosomes in an isogenic background previously free of P elements. The effects of insertions on bristle number and on viability were assessed by comparison to 392 control lines. The variance and effects of P-element inserts on bristle number and viability were larger than those inferred from spontaneous mutations. The distributions of effects on bristle number were symmetrical and highly leptokurtic, such that a few inserts with large effects caused most of the increase in variance. The distribution of effects on viability were negatively skewed and platykurtic. On average, the effects of P-element insertions on bristle number were partly recessive and on viability were completely recessive. P-element inserts with large effects on bristle number tended to have reduced viability, but the correlation between the absolute value of the effects on bristle number and on viability was not strong. Fifty P-element inserts tagging quantitative trait loci (QTLs) with large effects on bristle number were mapped cytogenetically. Two P-element-induced scabrous alleles and five extramacrochaetae alleles were generated. Single P-element mutagenesis is a powerful method for identifying QTLs at the level of genetic locus. PMID:8722781

Effects of single P-element insertions on bristle number and viability in Drosophila melanogaster.

PubMed

Lyman, R F; Lawrence, F; Nuzhdin, S V; Mackay, T F

1996-05-01

Single P-element mutagenesis was used to construct 1094 lines with P[lArB] inserts on all three major chromosomes in an isogenic background previously free of P elements. The effects of insertions on bristle number and on viability were assessed by comparison to 392 control lines. The variance and effects of P-element inserts on bristle number and viability were larger than those inferred from spontaneous mutations. The distributions of effects on bristle number were symmetrical and highly leptokurtic, such that a few inserts with large effects caused most of the increase in variance. The distribution of effects on viability were negatively skewed and platykurtic. On average, the effects of P-element insertions on bristle number were partly recessive and on viability were completely recessive. P-element inserts with large effects on bristle number tended to have reduced viability, but the correlation between the absolute value of the effects on bristle number and on viability was not strong. Fifty P-element inserts tagging quantitative trait loci (QTLs) with large effects on bristle number were mapped cytogenetically. Two P-element-induced scabrous alleles and five extramacrochaetae alleles were generated. Single P-element mutagenesis is a powerful method for identifying QTLs at the level of genetic locus.

Generation of West Nile virus infectious clones containing amino acid insertions between capsid and capsid anchor.

PubMed

Vandergaast, Rianna; Hoover, Lisa I; Zheng, Kang; Fredericksen, Brenda L

2014-04-09

West Nile virus (WNV) is a positive-sense RNA arbovirus responsible for recent outbreaks of severe neurological disease within the US and Europe. Large-scale analyses of antiviral compounds that inhibit virus replication have been limited due to the lack of an adequate WN reporter virus. Previous attempts to insert a reporter into the 3' untranslated region of WNV generated unstable viruses, suggesting that this region does not accommodate additional nucleotides. Here, we engineered two WNV infectious clones containing insertions at the Capsid (C)/Capsid Anchor (CA) junction of the viral polyprotein. Recombinant viruses containing a TAT(1-67) or Gaussia Luciferase (GLuc) gene at this location were successfully recovered. However, rapid loss of most, if not all, of the reporter sequence occurred for both viruses, indicating that the reporter viruses were not stable. While the GLuc viruses predominantly reverted back to wild-type WNV length, the TAT viruses retained up to 75 additional nucleotides of the reporter sequence. These additional nucleotides were stable over at least five passages and did not significantly alter WNV fitness. Thus, the C/CA junction of WNV can tolerate additional nucleotides, though insertions are subject to certain constraints.

Generation of West Nile Virus Infectious Clones Containing Amino Acid Insertions Between Capsid and Capsid Anchor

PubMed Central

Vandergaast, Rianna; Hoover, Lisa I.; Zheng, Kang; Fredericksen, Brenda L.

2014-01-01

West Nile virus (WNV) is a positive-sense RNA arbovirus responsible for recent outbreaks of severe neurological disease within the US and Europe. Large-scale analyses of antiviral compounds that inhibit virus replication have been limited due to the lack of an adequate WN reporter virus. Previous attempts to insert a reporter into the 3’ untranslated region of WNV generated unstable viruses, suggesting that this region does not accommodate additional nucleotides. Here, we engineered two WNV infectious clones containing insertions at the Capsid (C)/Capsid Anchor (CA) junction of the viral polyprotein. Recombinant viruses containing a TAT(1-67) or Gaussia Luciferase (GLuc) gene at this location were successfully recovered. However, rapid loss of most, if not all, of the reporter sequence occurred for both viruses, indicating that the reporter viruses were not stable. While the GLuc viruses predominantly reverted back to wild-type WNV length, the TAT viruses retained up to 75 additional nucleotides of the reporter sequence. These additional nucleotides were stable over at least five passages and did not significantly alter WNV fitness. Thus, the C/CA junction of WNV can tolerate additional nucleotides, though insertions are subject to certain constraints. PMID:24721788

Full-length and defective enterovirus G genomes with distinct torovirus protease insertions are highly prevalent on a Chinese pig farm.

PubMed

Wang, Yan; Zhang, Wen; Liu, Zhijian; Fu, Xingli; Yuan, Jiaqi; Zhao, Jieji; Lin, Yuan; Shen, Quan; Wang, Xiaochun; Deng, Xutao; Delwart, Eric; Shan, Tongling; Yang, Shixing

2018-05-21

Recombination occurs frequently between enteroviruses (EVs) which are classified within the same species of the Picornaviridae family. Here, using viral metagenomics, the genomes of two recombinant EV-Gs (strains EVG 01/NC_CHI/2014 and EVG 02/NC_CHI/2014) found in the feces of pigs from a swine farm in China are described. The two strains are characterized by distinct insertion of a papain-like protease gene from toroviruses classified within the Coronaviridae family. According to recent reports the site of the torovirus protease insertion was located at the 2C/3A junction region in EVG 02/NC_CHI/2014. For the other variant EVG 01/NC_CHI/2014, the inserted protease sequence replaced the entire viral capsid protein region up to the VP1/2A junction. These two EV-G strains were highly prevalent in the same pig farm with all animals shedding the full-length genome (EVG 02/NC_CHI/2014) while 65% also shed the capsid deletion mutant (EVG 01/NC_CHI/2014). A helper-defective virus relationship between the two co-circulating EV-G recombinants is hypothesized.

Thermo-electric modular structure and method of making same

DOEpatents

Freedman, N.S.; Horsting, C.W.; Lawrence, W.F.; Carrona, J.J.

1974-01-29

A method is presented for making a thermoelectric module wtth the aid of an insulating wafer having opposite metallized surfaces, a pair of similar equalizing sheets of metal, a hot-junction strap of metal, a thermoelectric element having hot- and cold-junction surfaces, and a radiator sheet of metal. The method comprises the following steps: brazing said equalizer sheets to said opposite metallized surfaces, respectively, of said insulating wafer with pure copper in a non-oxidizing ambient; brazing one surface of said hot-junction strap to one of the surfaces of said equalizing sheet with a nickel-gold alloy in a non- oxidizing ambient; and diffusion bonding said hot-junction surface of said thermoelectric element to the other surface of said hot-junction strap and said radiator sheet to said cold-junction surface of said thermoelectric element, said diffusion bonding being carried out in a non-oxidizing ambient, under compressive loading, at a temperature of about 550 deg C., and for about one-half hour. (Official Gazette)

Endoscopic Removal of a Nitinol Mesh Stent from the Ureteropelvic Junction after 15 Years

PubMed Central

Smrkolj, Tomaž; Šalinović, Domagoj

2015-01-01

We report a rare case of a patient with a large stone encrusted on a nitinol mesh stent in the ureteropelvic junction. The stent was inserted in the year 2000 after failure of two pyeloplasty procedures performed due to symptomatic ureteropelvic junction stenosis. By combining minimally invasive urinary stone therapies—extracorporeal shock wave lithotripsy, semirigid ureterorenoscopy with laser lithotripsy, and percutaneous nephrolithotomy—it was possible to completely remove the encrusted stone and nitinol mesh stent that was implanted for 15 years, rendering the patient symptom and obstruction free. PMID:26697258

Effects of P Element Insertions on Quantitative Traits in Drosophila Melanogaster

PubMed Central

Mackay, TFC.; Lyman, R. F.; Jackson, M. S.

1992-01-01

P element mutagenesis was used to construct 94 third chromosome lines of Drosophila melanogaster which contained on average 3.1 stable P element inserts, in an inbred host strain background previously free of P elements. The homozygous and heterozygous effects of the inserts on viability and abdominal and sternopleural bristle number were ascertained by comparing the chromosome lines with inserts to insert-free control lines of the inbred host strain. P elements reduced average homozygous viability by 12.2% per insert and average heterozygous viability by 5.5% per insert, and induced recessive lethal mutations at a rate of 3.8% per insert. Mutational variation for the bristle traits averaged over both sexes was 0.03V(e) per homozygous P insert and 0.003V(e) per heterozygous P insert, where V(e) is the environmental variance. Mutational variation was greater for the sexes considered separately because inserts had large pleiotropic effects on sex dimorphism of bristle characters. The distributions of homozygous effects of inserts on the bristle traits were asymmetrical, with the largest effects in the direction of reducing bristle number; and highly leptokurtic, with most of the increase in variance contributed by a few lines with large effects. The inserts had partially recessive effects on the bristle traits. Insert lines with extreme bristle effects had on average greatly reduced viability. PMID:1311697

Rapid synthesis of acetylcholine receptors at neuromuscular junctions.

PubMed

Ramsay, D A; Drachman, D B; Pestronk, A

1988-10-11

The rate of acetylcholine receptor (AChR) degradation in mature, innervated mammalian neuromuscular junctions has recently been shown to be biphasic; up to 20% are rapidly turned over (RTOs; half life less than 1 day) whereas the remainder are lost more slowly ('stable' AChRs; half life 10-12 days). In order to maintain normal junctional receptor density, synthesis and insertion of AChRs should presumably be sufficiently rapid to replace both the RTOs and the stable receptors. We have tested this prediction by blocking pre-existing AChRs in the mouse sternomastoid muscle with alpha-bungarotoxin (alpha-BuTx), and monitoring the subsequent appearance of 'new' junctional AChRs at intervals of 3 h to 20 days by labeling them with 125I-alpha-BuTx. The results show that new receptors were initially inserted rapidly (16% at 24 h and 28% at 48 h). The rate of increase of 'new' 125I-alpha-BuTx binding sites gradually slowed down during the remainder of the time period studied. Control observations excluded possible artifacts of the experimental procedure including incomplete blockade of AChRs, dissociation of toxin-receptor complexes, or experimentally induced alteration of receptor synthesis. The present demonstration of rapid synthesis and incorporation of AChRs at innervated neuromuscular junctions provides support for the concept of a subpopulation of rapidly turned over AChRs. The RTOs may serve as precursors for the larger population of stable receptors and have an important role in the metabolism of the neuromuscular synapse.

Design and Photovoltaic Properties of Graphene/Silicon Solar Cell

NASA Astrophysics Data System (ADS)

Xu, Dikai; Yu, Xuegong; Yang, Lifei; Yang, Deren

2018-04-01

Graphene/silicon (Gr/Si) Schottky junction solar cells have attracted widespread attention for the fabrication of high-efficiency and low-cost solar cells. However, their performance is still limited by the working principles of Schottky junctions. Modulating the working mechanism of the solar cells into a quasi p-n junction has advantages, including higher open-circuit voltage (V OC) and less carrier recombination. In this study, Gr/Si quasi p-n junction solar cells were formed by inserting a tunneling Al2O3 interlayer in-between graphene and silicon, which led to obtain the PCE up to 8.48% without antireflection or chemical doping techniques. Our findings could pave a new way for the development of Gr/Si solar cells.

Role of interface layers on Tunneling Magnetoresistance

NASA Astrophysics Data System (ADS)

Yang, See-Hun; Samant, Mahesh; Parkin, Stuart S. P.

2002-03-01

Thin non-magnetic metallic layers inserted at the interface between tunneling barriers and the ferromagnetic electrodes in magnetic tunnel junctions quenches the magnetoresistance (TMR) exhibited by some structures[1]. Studies have been carried out on exchange biased magnetic tunnel junction structures in which one of the ferromagnetic electrodes is pinned by coupling to IrMn or PtMn antiferromagnetic layers. For metallic aluminum interface layers thicknesses of just a few angstrom completely suppress the TMR although this characteristic thickness depends on the roughness of the tunneling barrier. A variety of structures will be discussed in which a number of interface layers have been introduced. In particular results for insertion of Cu, Ru and Cr layers on either side of the tunnel barrier will be presented. A number of techniques including XANES, XMCD and high resolution cross-section transmission electron microscopy have been used to study the structure and morphology of the interface layers and to correlate the structure of these layers with the magneto-transport properties of the tunneling junctions. [1] S.S.P. Parkin, US patent 5,764,567 issued by the United States Patent and Trademark Office, June 9, 1998.

Gap junctional communication modulates gene transcription by altering the recruitment of Sp1 and Sp3 to connexin-response elements in osteoblast promoters

NASA Technical Reports Server (NTRS)

Stains, Joseph P.; Lecanda, Fernando; Screen, Joanne; Towler, Dwight A.; Civitelli, Roberto

2003-01-01

Loss-of-function mutations of gap junction proteins, connexins, represent a mechanism of disease in a variety of tissues. We have shown that recessive (gene deletion) or dominant (connexin45 overexpression) disruption of connexin43 function results in osteoblast dysfunction and abnormal expression of osteoblast genes, including down-regulation of osteocalcin transcription. To elucidate the molecular mechanisms of gap junction-sensitive transcriptional regulation, we systematically analyzed the rat osteocalcin promoter for sensitivity to gap junctional intercellular communication. We identified an Sp1/Sp3 containing complex that assembles on a minimal element in the -70 to -57 region of the osteocalcin promoter in a gap junction-dependent manner. This CT-rich connexin-response element is necessary and sufficient to confer gap junction sensitivity to the osteocalcin proximal promoter. Repression of osteocalcin transcription occurs as a result of displacement of the stimulatory Sp1 by the inhibitory Sp3 on the promoter when gap junctional communication is perturbed. Modulation of Sp1/Sp3 recruitment also occurs on the collagen Ialpha1 promoter and translates into gap junction-sensitive transcriptional control of collagen Ialpha1 gene expression. Thus, regulation of Sp1/Sp3 recruitment to the promoter may represent a potential general mechanism for transcriptional control of target genes by signals passing through gap junctions.

Adaptive properties of human cementum and cementum dentin junction with age

PubMed Central

Jang, Andrew T.; Lin, Jeremy D.; Choi, Ryan M.; Choi, Erin M.; Seto, Melanie L.; Ryder, Mark I.; Gansky, Stuart A.; Curtis, Donald A.; Ho, Sunita P.

2014-01-01

Objectives The objective of this study was to evaluate age related changes age related changes in physical (structure/mechanical properties) and chemical (elemental/inorganic mineral content) properties of cementum layers interfacing dentin. Methods Human mandibular molars (N=43) were collected and sorted by age (younger = 19–39, middle = 40–60, older = 61–81 years). The structures of primary and secondary cementum (PC, SC) types were evaluated using light and atomic force microscopy (AFM) techniques. Chemical composition of cementum layers were characterized through gravimetric analysis by estimating ash weight and concentrations of Ca, Mn, and Zn trace elements in the analytes through inductively coupled plasma mass spectroscopy. The hardness of PC and SC was determined using microindentation and site-specific reduced elastic modulus properties were determined using nanoindentation techniques. Results PC contained fibrous, 1–3 µm wide hygroscopic radial PDL-inserts. SC illustrated PC-like structure adjacent to a multilayered architecture composing of regions that contained mineral dominant lamellae. The width of cementum dentin junction (CDJ) decreased as measured from cementum enamel junction (CEJ) to the tooth apex (49–21µm), and significantly decreased with age (44–23µm; p<0.05). The inorganic ratio defined as the ratio of post-burn to pre-burn increased with age within primary cementum (PC) and secondary cementum (SC). Cementum showed an increase in hardness with age (PC (0.40–0.46GPa), SC (0.37–0.43GPa)), while dentin showed a decreasing trend (coronal dentin (0.70–0.72GPa); apical dentin (0.63 – 0.73 GPa)). Significance The observed physicochemical changes are indicative of an increased mineralization of cementum and CDJ over time. Changes in tissue properties of the teeth can alter overall tooth biomechanics, and in turn the entire bone-tooth complex including the periodontal ligament. This study provides baseline information about the changes in physicochemical properties of cementum with age, which can be identified as adaptive in nature. PMID:25133753

Enhanced Data Authentication System v. 2.0

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thomas, Maikael A.; Tolsch, Brandon Jeffrey; Schwartz, Steven Robert

EDAS is a system, comprised on hardware and software, that plugs in to an existing data stream, and branches all data for transmission to a secondary observer computer. The EDAS Junction box, which inserts into the data stream, has Java software that forms these data into packets, digitally signs, encrypts, and sends these packets to a safeguards inspector computer. Further, there is a second Java program running on the secondary observer computer that receives data from the EDAS Junction Box to decrypt, authenticate, and store incoming packets. Also, there is a stand-alone Java program that is used to configure themore » EDAS Junction Box.« less

Characterization of Genomic Deletion Efficiency Mediated by Clustered Regularly Interspaced Palindromic Repeats (CRISPR)/Cas9 Nuclease System in Mammalian Cells*♦

PubMed Central

Canver, Matthew C.; Bauer, Daniel E.; Dass, Abhishek; Yien, Yvette Y.; Chung, Jacky; Masuda, Takeshi; Maeda, Takahiro; Paw, Barry H.; Orkin, Stuart H.

2014-01-01

The clustered regularly interspaced palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 nuclease system has provided a powerful tool for genome engineering. Double strand breaks may trigger nonhomologous end joining repair, leading to frameshift mutations, or homology-directed repair using an extrachromosomal template. Alternatively, genomic deletions may be produced by a pair of double strand breaks. The efficiency of CRISPR/Cas9-mediated genomic deletions has not been systematically explored. Here, we present a methodology for the production of deletions in mammalian cells, ranging from 1.3 kb to greater than 1 Mb. We observed a high frequency of intended genomic deletions. Nondeleted alleles are nonetheless often edited with inversions or small insertion/deletions produced at CRISPR recognition sites. Deleted alleles also typically include small insertion/deletions at predicted deletion junctions. We retrieved cells with biallelic deletion at a frequency exceeding that of probabilistic expectation. We demonstrate an inverse relationship between deletion frequency and deletion size. This work suggests that CRISPR/Cas9 is a robust system to produce a spectrum of genomic deletions to allow investigation of genes and genetic elements. PMID:24907273

Resonant optical device with a microheater

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lentine, Anthony L.; DeRose, Christopher

2017-04-04

A resonant photonic device is provided. The device comprises an optical waveguiding element, such as an optical resonator, that includes a diode junction region, two signal terminals configured to apply a bias voltage across the junction region, and a heater laterally separated from the optical waveguiding element. A semiconductor electrical barrier element is juxtaposed to the heater. A metallic strip is electrically and thermally connected at one end to a signal terminal of the optical waveguiding element and thermally connected at another end to the barrier element.

Effects of Spaceflight on the Attachment of Muscle to the Tibia, Fibula and Calcaneus

NASA Technical Reports Server (NTRS)

Johnson, R. B.; Tsao, A. K.; St.John, K. R.; Betcher, R. A.; Tucci, M. A.; Parsell, D. E.; Dai, X.; Zardiackas, L. D.; Benghuzzi, H. A.

1999-01-01

Microgravity significantly reduces transmission of ground-reaction forces to bones, promoting atrophy. There is little information available concerning the effects of microgravity on bones at sites where anti-gravity muscles are attached (tendon-bone junctions). This study evaluates the effects of microgravity on the origin and insertion sites of anti-gravity muscles on the rat tibia, fibula and calcaneus. Changes in the strength of those tendon-bone junctions could predispose the animal to injury following spaceflight.

Biased insert for installing data transmission components in downhole drilling pipe

DOEpatents

Hall, David R [Provo, UT; Briscoe, Michael A [Lehi, UT; Garner, Kory K [Payson, UT; Wilde, Tyson J [Spanish Fork, UT

2007-04-10

An apparatus for installing data transmission hardware in downhole tools includes an insert insertable into the box end or pin end of drill tool, such as a section of drill pipe. The insert typically includes a mount portion and a slide portion. A data transmission element is mounted in the slide portion of the insert. A biasing element is installed between the mount portion and the slide portion and is configured to create a bias between the slide portion and the mount portion. This biasing element is configured to compensate for varying tolerances encountered in different types of downhole tools. In selected embodiments, the biasing element is an elastomeric material, a spring, compressed gas, or a combination thereof.

Traumatic Tear of the Latissimus Dorsi Myotendinous Junction

PubMed Central

Friedman, Michael V.; Stensby, J. Derek; Hillen, Travis J.; Demertzis, Jennifer L.; Keener, Jay D.

2015-01-01

A case of a latissimus dorsi myotendinous junction strain in an avid CrossFit athlete is presented. The patient developed acute onset right axillary burning and swelling and subsequent palpable pop with weakness while performing a “muscle up.” Magnetic resonance imaging examination demonstrated a high-grade tear of the right latissimus dorsi myotendinous junction approximately 9 cm proximal to its intact humeral insertion. There were no other injuries to the adjacent shoulder girdle structures. Isolated strain of the latissimus dorsi myotendinous junction is a very rare injury with a scarcity of information available regarding its imaging appearance and preferred treatment. This patient was treated conservatively and was able to resume active CrossFit training within 3 months. At 6 months postinjury, he had only a mild residual functional deficit compared with his preinjury level. PMID:26502450

SETA Support for the DARPA Microelectronics Technology Insertion Program of the Microelectronics Technology Office

DTIC Science & Technology

1992-08-17

Conclusions. Key personnel planned and administered the 193-nm lithography SBIR workshop on May 7, 1992 as well as planned the GaAs Insertion...converters can use Josephson junctions (JJ) to improve performance. Superconductive quantum interference devices (SQUIDs), such as JJs, are used to form...forward control of a lithography stepper. Mark Conner at Booz-Allen has copies of the charts. You should take a few minutes to review them. I asked Costos

Experimental single-strain mobilomics reveals events that shape pathogen emergence

DOE PAGES

Schoeniger, Joseph S.; Hudson, Corey M.; Bent, Zachary W.; ...

2016-07-04

Virulence and resistance genes carried on mobile DNAs such as genomic islands (GIs) and plasmids promote bacterial pathogen emergence. An early step in the mobilization of GIs is their excision, which produces both a circular form of the GI and a deletion site in the chromosome; circular forms have also been described for some bacterial insertion sequences (ISs). We demonstrate that the recombinant sequence produced at the junction of such circles, and their corresponding deletion sites, can be detected sensitively in high throughput sequencing data, using new computational methods that enable empirical discovery of new mobile DNAs. Applied to themore » rich mobilome of a single strain (Kpn2146) of the emerging multidrug-resistant pathogen Klebsiella pneumoniae, our approach detected circular junctions for six GIs and seven IS types (several of the latter not previously known to circularize). Our methods further revealed differential biology of multiple mobile DNAs, imprecision of integrases and transposases, and differential activity among identical IS copies for IS26, ISKpn18 and ISKpn21. Exonuclease was used to enrich for circular dsDNA molecules, and internal calibration with the native Kpn2146 plasmids showed that not all molecules bearing GI and IS circular junctions were circular dsDNAs. Transposition events were also detected, revealing replicon preference (ISKpn18 preferring a conjugative IncA/C2 plasmid), local action (IS26), regional preferences, selection (against capsule synthesis), and left-right IS end swapping. Efficient discovery and global characterization of numerous mobile elements per experiment will allow detailed accounting of bacterial evolution, explaining the new gene combinations that arise in emerging pathogens.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schoeniger, Joseph S.; Hudson, Corey M.; Bent, Zachary W.

Virulence and resistance genes carried on mobile DNAs such as genomic islands (GIs) and plasmids promote bacterial pathogen emergence. An early step in the mobilization of GIs is their excision, which produces both a circular form of the GI and a deletion site in the chromosome; circular forms have also been described for some bacterial insertion sequences (ISs). We demonstrate that the recombinant sequence produced at the junction of such circles, and their corresponding deletion sites, can be detected sensitively in high throughput sequencing data, using new computational methods that enable empirical discovery of new mobile DNAs. Applied to themore » rich mobilome of a single strain (Kpn2146) of the emerging multidrug-resistant pathogen Klebsiella pneumoniae, our approach detected circular junctions for six GIs and seven IS types (several of the latter not previously known to circularize). Our methods further revealed differential biology of multiple mobile DNAs, imprecision of integrases and transposases, and differential activity among identical IS copies for IS26, ISKpn18 and ISKpn21. Exonuclease was used to enrich for circular dsDNA molecules, and internal calibration with the native Kpn2146 plasmids showed that not all molecules bearing GI and IS circular junctions were circular dsDNAs. Transposition events were also detected, revealing replicon preference (ISKpn18 preferring a conjugative IncA/C2 plasmid), local action (IS26), regional preferences, selection (against capsule synthesis), and left-right IS end swapping. Efficient discovery and global characterization of numerous mobile elements per experiment will allow detailed accounting of bacterial evolution, explaining the new gene combinations that arise in emerging pathogens.« less

CSReport: A New Computational Tool Designed for Automatic Analysis of Class Switch Recombination Junctions Sequenced by High-Throughput Sequencing.

PubMed

Boyer, François; Boutouil, Hend; Dalloul, Iman; Dalloul, Zeinab; Cook-Moreau, Jeanne; Aldigier, Jean-Claude; Carrion, Claire; Herve, Bastien; Scaon, Erwan; Cogné, Michel; Péron, Sophie

2017-05-15

B cells ensure humoral immune responses due to the production of Ag-specific memory B cells and Ab-secreting plasma cells. In secondary lymphoid organs, Ag-driven B cell activation induces terminal maturation and Ig isotype class switch (class switch recombination [CSR]). CSR creates a virtually unique IgH locus in every B cell clone by intrachromosomal recombination between two switch (S) regions upstream of each C region gene. Amount and structural features of CSR junctions reveal valuable information about the CSR mechanism, and analysis of CSR junctions is useful in basic and clinical research studies of B cell functions. To provide an automated tool able to analyze large data sets of CSR junction sequences produced by high-throughput sequencing (HTS), we designed CSReport, a software program dedicated to support analysis of CSR recombination junctions sequenced with a HTS-based protocol (Ion Torrent technology). CSReport was assessed using simulated data sets of CSR junctions and then used for analysis of Sμ-Sα and Sμ-Sγ1 junctions from CH12F3 cells and primary murine B cells, respectively. CSReport identifies junction segment breakpoints on reference sequences and junction structure (blunt-ended junctions or junctions with insertions or microhomology). Besides the ability to analyze unprecedentedly large libraries of junction sequences, CSReport will provide a unified framework for CSR junction studies. Our results show that CSReport is an accurate tool for analysis of sequences from our HTS-based protocol for CSR junctions, thereby facilitating and accelerating their study. Copyright © 2017 by The American Association of Immunologists, Inc.

Effectiveness of the levonorgestrel-releasing intrauterine system in the treatment of adenomyosis diagnosed and monitored by magnetic resonance imaging.

PubMed

Bragheto, Aristides M; Caserta, Nelson; Bahamondes, Luis; Petta, Carlos A

2007-09-01

This study was conducted to evaluate the effect of the levonorgestrel-releasing intrauterine system (LNG-IUS) on adenomyotic lesions diagnosed and monitored by magnetic resonance imaging (MRI). LNG-IUS was inserted during menstrual bleeding in 29 women, 24 to 46 years of age, with MRI-diagnosed adenomyosis associated with menorrhagia and dysmenorrhea. Clinical evaluations were carried out at baseline and at 3 and 6 months postinsertion. MRI was performed at baseline and at 6 months postinsertion and was used to calculate junctional zone thickness (in mm), to define the junctional zone borders, to identify the presence of high-signal foci on T(2)-weighted images and to calculate uterine volume (in mL). A significant reduction of 24.2% in junctional zone thickness was observed (p<.0001); however, no significant decrease in uterine volume was observed (142.6 mL vs. 136.4 mL; p=.2077) between baseline and the 6-month evaluation. A significant decrease in pain score was observed at 3 and 6 months after insertion (p<.0001); however, six women continued to report pain scores >3 at 6 months of observation. At 3 months of use, the most common bleeding pattern was spotting, and at 6 months of observation, oligomenorrhea was the most common pattern observed, although spotting was present in one third of the women. The insertion of an LNG-IUS led to a reduction in pain and abnormal bleeding associated with adenomyosis. MRI was useful for monitoring response of adenomyotic lesions to the LNG-IUS.

Controlled carrier screening in p-n NiO/GaN piezoelectric generators by an Al2O3 insertion layer

NASA Astrophysics Data System (ADS)

Johar, Muhammad Ali; Jeong, Dae Kyung; Afifi Hassan, Mostafa; Kang, Jin-Ho; Ha, Jun-Seok; Key Lee, June; Ryu, Sang-Wan

2017-12-01

The performance of a piezoelectric generator (PG) depends significantly on the internal screening process inside the device. As piezoelectric charges appear on both ends of the piezoelectric crystal, internal screening starts to decrease the piezoelectric bias. Therefore, the piezoelectric energy generated by external stress is not fully utilized by external circuit, which is the most challenging aspect of high-efficiency PGs. In this work, the internal screening effect of a NiO/GaN p-n PG was analyzed and controlled with an Al2O3 insertion layer. Internal screening in the p-n diode PG was categorized into free-carrier screening in neutral regions and junction screening due to charge drift across the junction. It was observed that junction screening could be significantly suppressed by inserting an Al2O3 layer and that effect was dominant in a leaky diode PG. With this implementation, the piezoelectric bias of the NiO/GaN PG was improved by a factor of ~100 for high-leakage diodes and a factor of ~1.6 for low-leakage diodes. Consequently, NiO/Al2O3/GaN PGs under a stress of 5 MPa provided a piezoelectric bias of 12.1 V and a current density of 2.25 µA cm-2. The incorporation of a highly resistive Al2O3 layer between p-NiO and n-GaN layers in NiO/GaN heterojunctions provides an efficient means of improving the piezoelectric performance by controlling the internal screening of the piezoelectric field.

Design and development of ultra-wideband 3 dB hybrid coupler for Ion cyclotron resonance frequency heating in tokamak.

PubMed

Yadav, Rana Pratap; Kumar, Sunil; Kulkarni, S V

2014-04-01

Design and development of a high power ultra-wideband, 3 dB tandem hybrid coupler is presented and its application in ICRF heating of the tokamak is discussed. In order to achieve the desired frequency band of 38-112 MHz and 200 kW power handling capability, the 3 dB hybrid coupler is developed using two 3-element 8.34 ± 0.2 dB coupled lines sections in tandem. In multi-element coupled lines, junctions are employed for the joining of coupled elements that produce the undesirable reactance called junction discontinuity effect. The effect becomes prominent in the high power multi-element coupled lines for high frequency (HF) and very high frequency(VHF) applications because of larger structural dimensions. Junction discontinuity effect significantly deteriorates coupling and output performance from the theoretical predictions. For the analysis of junction discontinuity effect and its compensation, a theoretical approach has been developed and generalized for n-element coupled lines section. The theory has been applied in the development of the 3 dB hybrid coupler. The fabricated hybrid coupler has been experimentally characterized using vector network analyzer and obtained results are found in good agreement with developed theory.

Transoesophageal echocardiographic evaluation of central venous catheter positioning using Peres' formula or a radiological landmark-based approach: a prospective randomized single-centre study.

PubMed

Ahn, J H; Kim, I S; Yang, J H; Lee, I G; Seo, D H; Kim, S P

2017-02-01

The lower superior vena cava (SVC), near its junction with the right atrium (RA), is considered the ideal location for the central venous catheter tip to ensure proper function and prevent injuries. We determined catheter insertion depth with a new formula using the sternoclavicular joint and the carina as radiological landmarks, with a 1.5 cm safety margin. The accuracy of tip positioning with the radiological landmark-based technique (R) and Peres' formula (P) was compared using transoesophageal echocardiography. Real-time ultrasound-guided central venous catheter insertion was done through the right internal jugular or subclavian vein. Patients were randomly assigned to either the P group (n=93) or the R group (n=95). Optimal catheter tip position was considered to be within 2 cm above and 1 cm below the RA-SVC junction. Catheter tip position, abutment, angle to the vascular wall, and flow stream were evaluated on a bicaval view. The distance from the skin insertion point to the RA-SVC junction and determined depth of catheter insertion were more strongly correlated in the R group [17.4 (1.2) and 16.7 (1.5) cm; r=0.821, P<0.001] than in the P group [17.3 (1.2) and 16.4 (1.1) cm; r=0.517, P<0.001], with z=3.96 (P<0.001). More tips were correctly positioned in the R group than in the P group (74 vs 93%, P=0.001). Abutment, tip angle to the lateral wall >40°, and disrupted flow stream were comparable. Catheter tip position was more accurate with a radiological landmark-based technique than with Peres' formula. Clinical Trial Registry of Korea: https://cris.nih.go.kr/cris/index.jsp KCT0001937. © The Author 2017. Published by Oxford University Press on behalf of the British Journal of Anaesthesia. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Net Fluorescein Flux Across Corneal Endothelium Strongly Suggests Fluid Transport is due to Electro-osmosis.

PubMed

Sanchez, J M; Cacace, V; Kusnier, C F; Nelson, R; Rubashkin, A A; Iserovich, P; Fischbarg, J

2016-08-01

We have presented prior evidence suggesting that fluid transport results from electro-osmosis at the intercellular junctions of the corneal endothelium. Such phenomenon ought to drag other extracellular solutes. We have investigated this using fluorescein-Na2 as an extracellular marker. We measured unidirectional fluxes across layers of cultured human corneal endothelial (HCE) cells. SV-40-transformed HCE layers were grown to confluence on permeable membrane inserts. The medium was DMEM with high glucose and no phenol red. Fluorescein-labeled medium was placed either on the basolateral or the apical side of the inserts; the other side carried unlabeled medium. The inserts were held in a CO2 incubator for 1 h (at 37 °C), after which the entire volume of the unlabeled side was collected. After that, label was placed on the opposite side, and the corresponding paired sample was collected after another hour. Fluorescein counts were determined with a (Photon Technology) DeltaScan fluorometer (excitation 380 nm; emission 550 nm; 2 nm bwth). Samples were read for 60 s. The cells utilized are known to transport fluid from the basolateral to the apical side, just as they do in vivo in several species. We used 4 inserts for influx and efflux (total: 20 1-h periods). We found a net flux of fluorescein from the basolateral to the apical side. The flux ratio was 1.104 ± 0.056. That difference was statistically significant (p = 0.00006, t test, paired samples). The endothelium has a definite restriction at the junctions. Hence, an asymmetry in unidirectional fluxes cannot arise from osmosis, and can only point instead to paracellular solvent drag. We suggest, once more, that such drag is due to electro-osmotic coupling at the paracellular junctions.

Response to crizotinib in a non-small-cell lung cancer patient harboring an EML4-ALK fusion with an atypical LTBP1 insertion.

PubMed

Aguado, Cristina; Gil, Maria-de-Los-Llanos; Yeste, Zaira; Giménez-Capitán, Ana; Teixidó, Cristina; Karachaliou, Niki; Viteri, Santiago; Rosell, Rafael; Molina-Vila, Miguel A

2018-01-01

Fusion of the anaplastic lymphoma receptor tyrosine kinase gene ( ALK ) with the echinoderm microtubule-associated protein 4 gene ( EML4 ) is the second most common actionable alteration in non-small-cell lung cancer, with a frequency of 5%. Here, we present a case of an EML4-ALK-positive patient with an atypical in-frame insertion from the LTBP1 gene in the canonical junction of variant 1 . The patient was a 39-year-old never-smoker female diagnosed with Stage IV lung adenocarcinoma. A core biopsy was negative for EGFR and KRAS mutations but positive for ALK immunohistochemistry and fluorescence in situ hybridization. When submitted to nCounter, the sample showed a 3'/5' imbalance indicative of an ALK rearrangement, but failed to give a positive signal for any of the variants tested. Finally, a band with a molecular weight higher than expected appeared after reverse transcriptase-polymerase chain reaction analysis. When Sanger sequencing was performed, the band revealed an atypical EML4-ALK fusion gene with an in-frame 129 bp insertion. A 115 bp segment of the insertion corresponded to an intronic region of LTBP1 , a gene located in the short arm of chromosome 2, between ALK and EML4 . The patient received crizotinib and showed a good therapeutic response that is still ongoing after 12 months. Our result suggests that short in-frame insertions of other genes in the EML4-ALK junction do not affect the sensitivity of the EML4-ALK fusion protein to crizotinib.

Linear response formulism of a carbon nano-onion stringed to gold electrodes

NASA Astrophysics Data System (ADS)

Kaur, Milanpreet; Sawhney, Ravinder Singh; Engles, Derick

2017-04-01

Density functional theory is used to investigate the electronic state of a carbon nano-onion conglobated by endohedral-ing the highly curved C20 fullerene within its parent fullerene C60. The Non-Equilibrium Green's Function is later employed to examine the quantum transport when the carbon nano-onion, C20@C60 is stringed to the pair of gold electrodes of (001) plane. The computed results are evaluated and compared with C20 and C60 junctions. The calculated electronic parameters of these molecular junctions are utilized to extrapolate their two electrical parameters: current and conductance. The carbon nano-onion junction assembled from the C20 and C60 molecules displays the combined effect of their molecular junctions when organized separately. Also, the insertion of C20 molecule in the hollow cavity of C60 fullerene leads to the enhancement of its current and conductance in carbon nano-onion junction formed, when compared to the one constructed otherwise.

Spin-transfer torque in spin filter tunnel junctions

NASA Astrophysics Data System (ADS)

Ortiz Pauyac, Christian; Kalitsov, Alan; Manchon, Aurelien; Chshiev, Mairbek

2014-12-01

Spin-transfer torque in a class of magnetic tunnel junctions with noncollinear magnetizations, referred to as spin filter tunnel junctions, is studied within the tight-binding model using the nonequilibrium Green's function technique within Keldysh formalism. These junctions consist of one ferromagnet (FM) adjacent to a magnetic insulator (MI) or two FM separated by a MI. We find that the presence of the magnetic insulator dramatically enhances the magnitude of the spin-torque components compared to conventional magnetic tunnel junctions. The fieldlike torque is driven by the spin-dependent reflection at the MI/FM interface, which results in a small reduction of its amplitude when an insulating spacer (S) is inserted to decouple MI and FM layers. Meanwhile, the dampinglike torque is dominated by the tunneling electrons that experience the lowest barrier height. We propose a device of the form FM/(S)/MI/(S)/FM that takes advantage of these characteristics and allows for tuning the spin-torque magnitudes over a wide range just by rotation of the magnetization of the insulating layer.

Spin transport and spin accumulation signals in Si studied in tunnel junctions with a Fe/Mg ferromagnetic multilayer and an amorphous SiOxNy tunnel barrier

NASA Astrophysics Data System (ADS)

Nakane, Ryosho; Hada, Takato; Sato, Shoichi; Tanaka, Masaaki

2018-04-01

We studied the spin accumulation signals in phosphorus-doped n+-Si (8 × 1019 cm-3) by measuring the spin transport in three-terminal vertical devices with Fe(3 nm)/Mg(0 and 1 nm)/SiOxNy(1 nm)/n+-Si(001) tunnel junctions, where the amorphous SiOxNy layer was formed by oxnitridation of the Si substrate with radio frequency plasma. Obvious spin accumulation signals were observed at 4-300 K in the spin extraction geometry when the thickness of the Mg insertion layer was 1 nm. We found that by inserting a thin (1 nm) Mg layer, intermixing of Fe and SiOxNy is suppressed, leading to the appearance of the spin accumulation signals, and this result is consistent with the dead layer model recently proposed by our group [S. Sato et al., Appl. Phys. Lett. 107, 032407 (2015)]. We obtained relatively high spin polarization (PS) of electrons tunneling through the junction and long spin lifetime (τS): PS = 16% and τS = 5.6 ns at 4 K and PS = 7.5% and τS = 2.7 ns at 300 K. Tunnel junctions with an amorphous SiOxNy tunnel barrier are very promising for Si-based spintronic devices, since they can be formed by the method compatible with the silicon complementary metal-oxide-semiconductor technology.

Traumatic Tear of the Latissimus Dorsi Myotendinous Junction: Case Report of a CrossFit-Related Injury.

PubMed

Friedman, Michael V; Stensby, J Derek; Hillen, Travis J; Demertzis, Jennifer L; Keener, Jay D

2015-01-01

A case of a latissimus dorsi myotendinous junction strain in an avid CrossFit athlete is presented. The patient developed acute onset right axillary burning and swelling and subsequent palpable pop with weakness while performing a "muscle up." Magnetic resonance imaging examination demonstrated a high-grade tear of the right latissimus dorsi myotendinous junction approximately 9 cm proximal to its intact humeral insertion. There were no other injuries to the adjacent shoulder girdle structures. Isolated strain of the latissimus dorsi myotendinous junction is a very rare injury with a scarcity of information available regarding its imaging appearance and preferred treatment. This patient was treated conservatively and was able to resume active CrossFit training within 3 months. At 6 months postinjury, he had only a mild residual functional deficit compared with his preinjury level. © 2015 The Author(s).

The Transposable Element Mariner Mediates Germline Transformation in Drosophila Melanogaster

PubMed Central

Lidholm, D. A.; Lohe, A. R.; Hartl, D. L.

1993-01-01

A vector for germline transformation in Drosophila melanogaster was constructed using the transposable element mariner. The vector, denoted pMlwB, contains a mariner element disrupted by an insertion containing the wild-type white gene from D. melanogaster, the β-galactosidase gene from Escherichia coli and sequences that enable plasmid replication and selection in E. coli. The white gene is controlled by the promoter of the D. melanogaster gene for heat-shock protein 70, and the β-galactosidase gene is flanked upstream by the promoter of the transposable element P as well as that of mariner. The MlwB element was introduced into the germline of D. melanogaster by co-injection into embryos with an active mariner element, Mos1, which codes for a functional transposase and serves as a helper. Two independent germline insertions were isolated and characterized. The results show that the MlwB element inserted into the genome in a mariner-dependent manner with the termini of the inverted repeats inserted at a TA dinucleotide. Both insertions exhibit an unexpected degree of germline and somatic stability, even in the presence of an active mariner element in the genetic background. These results demonstrate that the mariner transposable element, which is small (1286 bp) and relatively homogeneous in size among different copies, is nevertheless capable of promoting the insertion of the large (13.2 kb) MlwB element. Because of the widespread phylogenetic distribution of mariner among insects, these results suggest that mariner might provide a wide hostrange transformation vector for insects. PMID:8394264

Charge splitters and charge transport junctions based on guanine quadruplexes

NASA Astrophysics Data System (ADS)

Sha, Ruojie; Xiang, Limin; Liu, Chaoren; Balaeff, Alexander; Zhang, Yuqi; Zhang, Peng; Li, Yueqi; Beratan, David N.; Tao, Nongjian; Seeman, Nadrian C.

2018-04-01

Self-assembling circuit elements, such as current splitters or combiners at the molecular scale, require the design of building blocks with three or more terminals. A promising material for such building blocks is DNA, wherein multiple strands can self-assemble into multi-ended junctions, and nucleobase stacks can transport charge over long distances. However, nucleobase stacking is often disrupted at junction points, hindering electric charge transport between the two terminals of the junction. Here, we show that a guanine-quadruplex (G4) motif can be used as a connector element for a multi-ended DNA junction. By attaching specific terminal groups to the motif, we demonstrate that charges can enter the structure from one terminal at one end of a three-way G4 motif, and can exit from one of two terminals at the other end with minimal carrier transport attenuation. Moreover, we study four-way G4 junction structures by performing theoretical calculations to assist in the design and optimization of these connectors.

Polarization-induced Zener tunnel diodes in GaN/InGaN/GaN heterojunctions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yan, Xiaodong; Li, Wenjun; Islam, S. M.

By the insertion of thin In{sub x}Ga{sub 1−x}N layers into Nitrogen-polar GaN p-n junctions, polarization-induced Zener tunnel junctions are studied. The reverse-bias interband Zener tunneling current is found to be weakly temperature dependent, as opposed to the strongly temperature-dependent forward bias current. This indicates tunneling as the primary reverse-bias current transport mechanism. The Indium composition in the InGaN layer is systematically varied to demonstrate the increase in the interband tunneling current. Comparing the experimentally measured tunneling currents to a model helps identify the specific challenges in potentially taking such junctions towards nitride-based polarization-induced tunneling field-effect transistors.

Method of modifying a volume mesh using sheet insertion

DOEpatents

Borden, Michael J [Albuquerque, NM; Shepherd, Jason F [Albuquerque, NM

2006-08-29

A method and machine-readable medium provide a technique to modify a hexahedral finite element volume mesh using dual generation and sheet insertion. After generating a dual of a volume stack (mesh), a predetermined algorithm may be followed to modify (refine) the volume mesh of hexahedral elements. The predetermined algorithm may include the steps of locating a sheet of hexahedral mesh elements, determining a plurality of hexahedral elements within the sheet to refine, shrinking the plurality of elements, and inserting a new sheet of hexahedral elements adjacently to modify the volume mesh. Additionally, another predetermined algorithm using mesh cutting may be followed to modify a volume mesh.

Characterization of genomic deletion efficiency mediated by clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 nuclease system in mammalian cells.

PubMed

Canver, Matthew C; Bauer, Daniel E; Dass, Abhishek; Yien, Yvette Y; Chung, Jacky; Masuda, Takeshi; Maeda, Takahiro; Paw, Barry H; Orkin, Stuart H

2014-08-01

The clustered regularly interspaced short [corrected] palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 nuclease system has provided a powerful tool for genome engineering. Double strand breaks may trigger nonhomologous end joining repair, leading to frameshift mutations, or homology-directed repair using an extrachromosomal template. Alternatively, genomic deletions may be produced by a pair of double strand breaks. The efficiency of CRISPR/Cas9-mediated genomic deletions has not been systematically explored. Here, we present a methodology for the production of deletions in mammalian cells, ranging from 1.3 kb to greater than 1 Mb. We observed a high frequency of intended genomic deletions. Nondeleted alleles are nonetheless often edited with inversions or small insertion/deletions produced at CRISPR recognition sites. Deleted alleles also typically include small insertion/deletions at predicted deletion junctions. We retrieved cells with biallelic deletion at a frequency exceeding that of probabilistic expectation. We demonstrate an inverse relationship between deletion frequency and deletion size. This work suggests that CRISPR/Cas9 is a robust system to produce a spectrum of genomic deletions to allow investigation of genes and genetic elements. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

PubMed

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

[Mechanism of the dentino-enamel junction on the resist-crack propagation of human teeth by the finite element method].

PubMed

Jingjing, Zheng; Tiezhou, Hou; Hong, Tao; Xueyan, Guo; Cui, Wu

2014-10-01

This study aims to identify the crack tip stress intensity factor of the propagation process, crack propagation path, and the changes in the shape of the crack tip by the finite element method. The finite element model of dentino-enamel junction was established with ANSYS software, and the length of the initial crack in the single edge was set to 0.1 mm. The lower end of the sample was fixed. The tensile load of 1 MPa with frequency of 5 Hz was applied to the upper end. The stress intensity factor, deflection angle, and changes in the shape of the crack tip in the crack propagation were calculated by ANSYS. The stress intensity factor suddenly and continuously decreased in dentino-enamel junction as the crack extended. A large skewed angle appeared, and the stress on crack tip was reduced. The dentino-enamel junction on human teeth may resist crack propagation through stress reduction.

The insertional history of an active family of L1 retrotransposons in humans.

PubMed

Boissinot, Stéphane; Entezam, Ali; Young, Lynn; Munson, Peter J; Furano, Anthony V

2004-07-01

As humans contain a currently active L1 (LINE-1) non-LTR retrotransposon family (Ta-1), the human genome database likely provides only a partial picture of Ta-1-generated diversity. We used a non-biased method to clone Ta-1 retrotransposon-containing loci from representatives of four ethnic populations. We obtained 277 distinct Ta-1 loci and identified an additional 67 loci in the human genome database. This collection represents approximately 90% of the Ta-1 population in the individuals examined and is thus more representative of the insertional history of Ta-1 than the human genome database, which lacked approximately 40% of our cloned Ta-1 elements. As both polymorphic and fixed Ta-1 elements are as abundant in the GC-poor genomic regions as in ancestral L1 elements, the enrichment of L1 elements in GC-poor areas is likely due to insertional bias rather than selection. Although the chromosomal distribution of Ta-1 inserts is generally a function of chromosomal length and gene density, chromosome 4 significantly deviates from this pattern and has been much more hospitable to Ta-1 insertions than any other chromosome. Also, the intra-chromosomal distribution of Ta-1 elements is not uniform. Ta-1 elements tend to cluster, and the maximal gaps between Ta-1 inserts are larger than would be expected from a model of uniform random insertion. Copyright 2004 Cold Spring Harbor Laboratory Press ISSN

Avian Paramyxovirus Type-3 as a Vaccine Vector: Identification of a Genome Location for High Level Expression of a Foreign Gene

PubMed Central

Yoshida, Asuka; Samal, Siba K.

2017-01-01

Avian paramyxovirus serotype 3 (APMV-3) causes infection in a wide variety of avian species, but it does not cause apparent diseases in chickens. On the contrary, APMV-1, also known as Newcastle disease virus (NDV), can cause severe disease in chickens. Currently, natural low virulence strains of NDV are used as live-attenuated vaccines throughout the world. NDV is also being evaluated as a vaccine vector against poultry pathogens. However, due to routine vaccination programs, chickens often possess pre-existing antibodies against NDV, which may cause the chickens to be less sensitive to recombinant NDV vaccines expressing antigens of other avian pathogens. Therefore, it may be possible for an APMV-3 vector vaccine to circumvent this issue. In this study, we determined the optimal insertion site in the genome of APMV-3 for high level expression of a foreign gene. We generated recombinant APMV-3 viruses expressing the green fluorescent protein (GFP) by inserting the GFP gene at five different intergenic regions in the genome. The levels of GFP transcription and translation were evaluated. Interestingly, the levels of GFP transcription and translation did not follow the 3′-to-5′ attenuation mechanism of non-segmented, negative-sense RNA viruses. The insertion of GFP gene into the P-M gene junction resulted in higher level of expression of GFP than when the gene was inserted into the upstream N-P gene junction. Unlike NDV, insertion of GFP did not attenuate the growth efficiency of AMPV-3. Thus, APMV-3 could be a more useful vaccine vector for avian pathogens than NDV. PMID:28473820

Avian Paramyxovirus Type-3 as a Vaccine Vector: Identification of a Genome Location for High Level Expression of a Foreign Gene.

PubMed

Yoshida, Asuka; Samal, Siba K

2017-01-01

Avian paramyxovirus serotype 3 (APMV-3) causes infection in a wide variety of avian species, but it does not cause apparent diseases in chickens. On the contrary, APMV-1, also known as Newcastle disease virus (NDV), can cause severe disease in chickens. Currently, natural low virulence strains of NDV are used as live-attenuated vaccines throughout the world. NDV is also being evaluated as a vaccine vector against poultry pathogens. However, due to routine vaccination programs, chickens often possess pre-existing antibodies against NDV, which may cause the chickens to be less sensitive to recombinant NDV vaccines expressing antigens of other avian pathogens. Therefore, it may be possible for an APMV-3 vector vaccine to circumvent this issue. In this study, we determined the optimal insertion site in the genome of APMV-3 for high level expression of a foreign gene. We generated recombinant APMV-3 viruses expressing the green fluorescent protein (GFP) by inserting the GFP gene at five different intergenic regions in the genome. The levels of GFP transcription and translation were evaluated. Interestingly, the levels of GFP transcription and translation did not follow the 3'-to-5' attenuation mechanism of non-segmented, negative-sense RNA viruses. The insertion of GFP gene into the P-M gene junction resulted in higher level of expression of GFP than when the gene was inserted into the upstream N-P gene junction. Unlike NDV, insertion of GFP did not attenuate the growth efficiency of AMPV-3. Thus, APMV-3 could be a more useful vaccine vector for avian pathogens than NDV.

Templated sequence insertion polymorphisms in the human genome

NASA Astrophysics Data System (ADS)

Onozawa, Masahiro; Aplan, Peter

2016-11-01

Templated Sequence Insertion Polymorphism (TSIP) is a recently described form of polymorphism recognized in the human genome, in which a sequence that is templated from a distant genomic region is inserted into the genome, seemingly at random. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; Class 1 TSIPs show features of insertions that are mediated via the LINE-1 ORF2 protein, including 1) target-site duplication (TSD), 2) polyadenylation 10-30 nucleotides downstream of a “cryptic” polyadenylation signal, and 3) preference for insertion at a 5’-TTTT/A-3’ sequence. In contrast, class 2 TSIPs show features consistent with repair of a DNA double-strand break via insertion of a DNA “patch” that is derived from a distant genomic region. Survey of a large number of normal human volunteers demonstrates that most individuals have 25-30 TSIPs, and that these TSIPs track with specific geographic regions. Similar to other forms of human polymorphism, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases.

QuickMap: a public tool for large-scale gene therapy vector insertion site mapping and analysis.

PubMed

Appelt, J-U; Giordano, F A; Ecker, M; Roeder, I; Grund, N; Hotz-Wagenblatt, A; Opelz, G; Zeller, W J; Allgayer, H; Fruehauf, S; Laufs, S

2009-07-01

Several events of insertional mutagenesis in pre-clinical and clinical gene therapy studies have created intense interest in assessing the genomic insertion profiles of gene therapy vectors. For the construction of such profiles, vector-flanking sequences detected by inverse PCR, linear amplification-mediated-PCR or ligation-mediated-PCR need to be mapped to the host cell's genome and compared to a reference set. Although remarkable progress has been achieved in mapping gene therapy vector insertion sites, public reference sets are lacking, as are the possibilities to quickly detect non-random patterns in experimental data. We developed a tool termed QuickMap, which uniformly maps and analyzes human and murine vector-flanking sequences within seconds (available at www.gtsg.org). Besides information about hits in chromosomes and fragile sites, QuickMap automatically determines insertion frequencies in +/- 250 kb adjacency to genes, cancer genes, pseudogenes, transcription factor and (post-transcriptional) miRNA binding sites, CpG islands and repetitive elements (short interspersed nuclear elements (SINE), long interspersed nuclear elements (LINE), Type II elements and LTR elements). Additionally, all experimental frequencies are compared with the data obtained from a reference set, containing 1 000 000 random integrations ('random set'). Thus, for the first time a tool allowing high-throughput profiling of gene therapy vector insertion sites is available. It provides a basis for large-scale insertion site analyses, which is now urgently needed to discover novel gene therapy vectors with 'safe' insertion profiles.

Towards molecular electronics with large-area molecular junctions.

PubMed

Akkerman, Hylke B; Blom, Paul W M; de Leeuw, Dago M; de Boer, Bert

2006-05-04

Electronic transport through single molecules has been studied extensively by academic and industrial research groups. Discrete tunnel junctions, or molecular diodes, have been reported using scanning probes, break junctions, metallic crossbars and nanopores. For technological applications, molecular tunnel junctions must be reliable, stable and reproducible. The conductance per molecule, however, typically varies by many orders of magnitude. Self-assembled monolayers (SAMs) may offer a promising route to the fabrication of reliable devices, and charge transport through SAMs of alkanethiols within nanopores is well understood, with non-resonant tunnelling dominating the transport mechanism. Unfortunately, electrical shorts in SAMs are often formed upon vapour deposition of the top electrode, which limits the diameter of the nanopore diodes to about 45 nm. Here we demonstrate a method to manufacture molecular junctions with diameters up to 100 microm with high yields (> 95 per cent). The junctions show excellent stability and reproducibility, and the conductance per unit area is similar to that obtained for benchmark nanopore diodes. Our technique involves processing the molecular junctions in the holes of a lithographically patterned photoresist, and then inserting a conducting polymer interlayer between the SAM and the metal top electrode. This simple approach is potentially low-cost and could pave the way for practical molecular electronics.

Retroviral DNA Integration Directed by HIV Integration Protein in Vitro

NASA Astrophysics Data System (ADS)

Bushman, Frederic D.; Fujiwara, Tamio; Craigie, Robert

1990-09-01

Efficient retroviral growth requires integration of a DNA copy of the viral RNA genome into a chromosome of the host. As a first step in analyzing the mechanism of integration of human immunodeficiency virus (HIV) DNA, a cell-free system was established that models the integration reaction. The in vitro system depends on the HIV integration (IN) protein, which was partially purified from insect cells engineered to express IN protein in large quantities. Integration was detected in a biological assay that scores the insertion of a linear DNA containing HIV terminal sequences into a λ DNA target. Some integration products generated in this assay contained five-base pair duplications of the target DNA at the recombination junctions, a characteristic of HIV integration in vivo; the remaining products contained aberrant junctional sequences that may have been produced in a variation of the normal reaction. These results indicate that HIV IN protein is the only viral protein required to insert model HIV DNA sequences into a target DNA in vitro.

Orangutan Alu quiescence reveals possible source element: support for ancient backseat drivers

PubMed Central

2012-01-01

Background Sequence analysis of the orangutan genome revealed that recent proliferative activity of Alu elements has been uncharacteristically quiescent in the Pongo (orangutan) lineage, compared with all previously studied primate genomes. With relatively few young polymorphic insertions, the genomic landscape of the orangutan seemed like the ideal place to search for a driver, or source element, of Alu retrotransposition. Results Here we report the identification of a nearly pristine insertion possessing all the known putative hallmarks of a retrotranspositionally competent Alu element. It is located in an intronic sequence of the DGKB gene on chromosome 7 and is highly conserved in Hominidae (the great apes), but absent from Hylobatidae (gibbon and siamang). We provide evidence for the evolution of a lineage-specific subfamily of this shared Alu insertion in orangutans and possibly the lineage leading to humans. In the orangutan genome, this insertion contains three orangutan-specific diagnostic mutations which are characteristic of the youngest polymorphic Alu subfamily, AluYe5b5_Pongo. In the Homininae lineage (human, chimpanzee and gorilla), this insertion has acquired three different mutations which are also found in a single human-specific Alu insertion. Conclusions This seemingly stealth-like amplification, ongoing at a very low rate over millions of years of evolution, suggests that this shared insertion may represent an ancient backseat driver of Alu element expansion. PMID:22541534

Orangutan Alu quiescence reveals possible source element: support for ancient backseat drivers.

PubMed

Walker, Jerilyn A; Konkel, Miriam K; Ullmer, Brygg; Monceaux, Christopher P; Ryder, Oliver A; Hubley, Robert; Smit, Arian Fa; Batzer, Mark A

2012-04-30

Sequence analysis of the orangutan genome revealed that recent proliferative activity of Alu elements has been uncharacteristically quiescent in the Pongo (orangutan) lineage, compared with all previously studied primate genomes. With relatively few young polymorphic insertions, the genomic landscape of the orangutan seemed like the ideal place to search for a driver, or source element, of Alu retrotransposition. Here we report the identification of a nearly pristine insertion possessing all the known putative hallmarks of a retrotranspositionally competent Alu element. It is located in an intronic sequence of the DGKB gene on chromosome 7 and is highly conserved in Hominidae (the great apes), but absent from Hylobatidae (gibbon and siamang). We provide evidence for the evolution of a lineage-specific subfamily of this shared Alu insertion in orangutans and possibly the lineage leading to humans. In the orangutan genome, this insertion contains three orangutan-specific diagnostic mutations which are characteristic of the youngest polymorphic Alu subfamily, AluYe5b5_Pongo. In the Homininae lineage (human, chimpanzee and gorilla), this insertion has acquired three different mutations which are also found in a single human-specific Alu insertion. This seemingly stealth-like amplification, ongoing at a very low rate over millions of years of evolution, suggests that this shared insertion may represent an ancient backseat driver of Alu element expansion.

Natural mutagenesis of human genomes by endogenous retrotransposons.

PubMed

Iskow, Rebecca C; McCabe, Michael T; Mills, Ryan E; Torene, Spencer; Pittard, W Stephen; Neuwald, Andrew F; Van Meir, Erwin G; Vertino, Paula M; Devine, Scott E

2010-06-25

Two abundant classes of mobile elements, namely Alu and L1 elements, continue to generate new retrotransposon insertions in human genomes. Estimates suggest that these elements have generated millions of new germline insertions in individual human genomes worldwide. Unfortunately, current technologies are not capable of detecting most of these young insertions, and the true extent of germline mutagenesis by endogenous human retrotransposons has been difficult to examine. Here, we describe technologies for detecting these young retrotransposon insertions and demonstrate that such insertions indeed are abundant in human populations. We also found that new somatic L1 insertions occur at high frequencies in human lung cancer genomes. Genome-wide analysis suggests that altered DNA methylation may be responsible for the high levels of L1 mobilization observed in these tumors. Our data indicate that transposon-mediated mutagenesis is extensive in human genomes and is likely to have a major impact on human biology and diseases.

Annular dilatation and loss of sino-tubular junction in aneurysmatic aorta: implications on leaflet quality at the time of surgery. A finite element study†

PubMed Central

Weltert, Luca; de Tullio, Marco D.; Afferrante, Luciano; Salica, Andrea; Scaffa, Raffaele; Maselli, Daniele; Verzicco, Roberto; De Paulis, Ruggero

2013-01-01

OBJECTIVES In the belief that stress is the main determinant of leaflet quality deterioration, we sought to evaluate the effect of annular and/or sino-tubular junction dilatation on leaflet stress. A finite element computer-assisted stress analysis was used to model four different anatomic conditions and analyse the consequent stress pattern on the aortic valve. METHODS Theoretical models of four aortic root configurations (normal, with dilated annulus, with loss of sino-tubular junction and with both dilatation simultaneously) were created with computer-aided design technique. The pattern of stress and strain was then analysed by means of finite elements analysis, when a uniform pressure of 100 mmHg was applied to the model. Analysis produced von Mises charts (colour-coded, computational, three-dimensional stress-pattern graphics) and bidimensional plots of compared stress on arc-linear line, which allowed direct comparison of stress in the four different conditions. RESULTS Stresses both on the free margin and on the ‘belly’ of the leaflet rose from 0.28 MPa (normal conditions) to 0.32 MPa (+14%) in case of isolated dilatation of the sino-tubular junction, while increased to 0.42 MPa (+67%) in case of isolated annular dilatation, with no substantial difference whether sino-tubular junction dilatation was present or not. CONCLUSIONS Annular dilatation is the key element determining an increased stress on aortic leaflets independently from an associated sino-tubular junction dilatation. The presence of annular dilatation associated with root aneurysm greatly decreases the chance of performing a valve sparing procedure without the need for additional manoeuvres on leaflet tissue. This information may lead to a refinement in the optimal surgical strategy. PMID:23536020

Experimental single-strain mobilomics reveals events that shape pathogen emergence.

PubMed

Schoeniger, Joseph S; Hudson, Corey M; Bent, Zachary W; Sinha, Anupama; Williams, Kelly P

2016-08-19

Virulence genes on mobile DNAs such as genomic islands (GIs) and plasmids promote bacterial pathogen emergence. Excision is an early step in GI mobilization, producing a circular GI and a deletion site in the chromosome; circular forms are also known for some bacterial insertion sequences (ISs). The recombinant sequence at the junctions of such circles and deletions can be detected sensitively in high-throughput sequencing data, using new computational methods that enable empirical discovery of mobile DNAs. For the rich mobilome of a hospital Klebsiella pneumoniae strain, circularization junctions (CJs) were detected for six GIs and seven IS types. Our methods revealed differential biology of multiple mobile DNAs, imprecision of integrases and transposases, and differential activity among identical IS copies for IS26, ISKpn18 and ISKpn21 Using the resistance of circular dsDNA molecules to exonuclease, internally calibrated with the native plasmids, showed that not all molecules bearing GI CJs were circular. Transpositions were also detected, revealing replicon preference (ISKpn18 prefers a conjugative IncA/C2 plasmid), local action (IS26), regional preferences, selection (against capsule synthesis) and IS polarity inversion. Efficient discovery and global characterization of numerous mobile elements per experiment improves accounting for the new gene combinations that arise in emerging pathogens. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Numerical Computation of Electric Field and Potential Along Silicone Rubber Insulators Under Contaminated and Dry Band Conditions

NASA Astrophysics Data System (ADS)

Arshad; Nekahi, A.; McMeekin, S. G.; Farzaneh, M.

2016-09-01

Electrical field distribution along the insulator surface is considered one of the important parameters for the performance evaluation of outdoor insulators. In this paper numerical simulations were carried out to investigate the electric field and potential distribution along silicone rubber insulators under various polluted and dry band conditions. Simulations were performed using commercially available simulation package Comsol Multiphysics based on the finite element method. Various pollution severity levels were simulated by changing the conductivity of pollution layer. Dry bands of 2 cm width were inserted at the high voltage end, ground end, middle part, shed, sheath, and at the junction of shed and sheath to investigate the effect of dry band location and width on electric field and potential distribution. Partial pollution conditions were simulated by applying pollution layer on the top and bottom surface respectively. It was observed from the simulation results that electric field intensity was higher at the metal electrode ends and at the junction of dry bands. Simulation results showed that potential distribution is nonlinear in the case of clean and partially polluted insulator and linear for uniform pollution layer. Dry band formation effect both potential and electric field distribution. Power dissipated along the insulator surface and the resultant heat generation was also studied. The results of this study could be useful in the selection of polymeric insulators for contaminated environments.

Many P-Element Insertions Affect Wing Shape in Drosophila melanogaster

PubMed Central

Weber, Kenneth; Johnson, Nancy; Champlin, David; Patty, April

2005-01-01

A screen of random, autosomal, homozygous-viable P-element insertions in D. melanogaster found small effects on wing shape in 11 of 50 lines. The effects were due to single insertions and remained stable and significant for over 5 years, in repeated, high-resolution measurements. All 11 insertions were within or near protein-coding transcription units, none of which were previously known to affect wing shape. Many sites in the genome can affect wing shape. PMID:15545659

Many P-element insertions affect wing shape in Drosophila melanogaster.

PubMed

Weber, Kenneth; Johnson, Nancy; Champlin, David; Patty, April

2005-03-01

A screen of random, autosomal, homozygous-viable P-element insertions in D. melanogaster found small effects on wing shape in 11 of 50 lines. The effects were due to single insertions and remained stable and significant for over 5 years, in repeated, high-resolution measurements. All 11 insertions were within or near protein-coding transcription units, none of which were previously known to affect wing shape. Many sites in the genome can affect wing shape.

P-Element Insertion Alleles of Essential Genes on the Third Chromosome of Drosophila Melanogaster: Correlation of Physical and Cytogenetic Maps in Chromosomal Region 86e-87f

PubMed Central

Deak, P.; Omar, M. M.; Saunders, RDC.; Pal, M.; Komonyi, O.; Szidonya, J.; Maroy, P.; Zhang, Y.; Ashburner, M.; Benos, P.; Savakis, C.; Siden-Kiamos, I.; Louis, C.; Bolshakov, V. N.; Kafatos, F. C.; Madueno, E.; Modolell, J.; Glover, D. M.

1997-01-01

We have established a collection of 2460 lethal or semi-lethal mutant lines using a procedure thought to insert single P elements into vital genes on the third chromosome of Drosophila melanogaster. More than 1200 randomly selected lines were examined by in situ hybridization and 90% found to contain single insertions at sites that mark 89% of all lettered subdivisions of the Bridges' map. A set of chromosomal deficiencies that collectively uncover ~25% of the euchromatin of chromosome 3 reveal lethal mutations in 468 lines corresponding to 145 complementation groups. We undertook a detailed analysis of the cytogenetic interval 86E-87F and identified 87 P-element-induced mutations falling into 38 complementation groups, 16 of which correspond to previously known genes. Twenty-one of these 38 complementation groups have at least one allele that has a P-element insertion at a position consistent with the cytogenetics of the locus. We have rescued P elements and flanking chromosomal sequences from the 86E-87F region in 35 lines with either lethal or genetically silent P insertions, and used these as probes to identify cosmids and P1 clones from the Drosophila genome projects. This has tied together the physical and genetic maps and has linked 44 previously identified cosmid contigs into seven ``supercontigs'' that span the interval. STS data for sequences flanking one side of the P-element insertions in 49 lines has identified insertions in the αγ element at 87C, two known transposable elements, and the open reading frames of seven putative single copy genes. These correspond to five known genes in this interval, and two genes identified by the homology of their predicted products to known proteins from other organisms. PMID:9409831

Strong Fermi-Level Pinning at Metal/n-Si(001) Interface Ensured by Forming an Intact Schottky Contact with a Graphene Insertion Layer.

PubMed

Yoon, Hoon Hahn; Jung, Sungchul; Choi, Gahyun; Kim, Junhyung; Jeon, Youngeun; Kim, Yong Soo; Jeong, Hu Young; Kim, Kwanpyo; Kwon, Soon-Yong; Park, Kibog

2017-01-11

We report the systematic experimental studies demonstrating that a graphene layer inserted at metal/n-Si(001) interface is efficient to explore interface Fermi-level pinning effect. It is confirmed that an inserted graphene layer prevents atomic interdiffusion to form an atomically abrupt Schottky contact. The Schottky barriers of metal/graphene/n-Si(001) junctions show a very weak dependence on metal work-function, implying that the metal Fermi-level is almost completely pinned at charge neutrality level close to the valence band edge of Si. The atomically impermeable and electronically transparent properties of graphene can be used generally to form an intact Schottky contact for all semiconductors.

Enhanced production of recombinant proteins with Corynebacterium glutamicum by deletion of insertion sequences (IS elements).

PubMed

Choi, Jae Woong; Yim, Sung Sun; Kim, Min Jeong; Jeong, Ki Jun

2015-12-29

In most bacteria, various jumping genetic elements including insertion sequences elements (IS elements) cause a variety of genetic rearrangements resulting in harmful effects such as genome and recombinant plasmid instability. The genetic stability of a plasmid in a host is critical for high-level production of recombinant proteins, and in this regard, the development of an IS element-free strain could be a useful strategy for the enhanced production of recombinant proteins. Corynebacterium glutamicum, which is a workhorse in the industrial-scale production of various biomolecules including recombinant proteins, also has several IS elements, and it is necessary to identify the critical IS elements and to develop IS element deleted strain. From the cultivation of C. glutamicum harboring a plasmid for green fluorescent protein (GFP) gene expression, non-fluorescent clones were isolated by FACS (fluorescent activated cell sorting). All the isolated clones had insertions of IS elements in the GFP coding region, and two major IS elements (ISCg1 and ISCg2 families) were identified. By co-cultivating cells harboring either the isolated IS element-inserted plasmid or intact plasmid, it was clearly confirmed that cells harboring the IS element-inserted plasmids became dominant during the cultivation due to their growth advantage over cells containing intact plasmids, which can cause a significant reduction in recombinant protein production during cultivation. To minimize the harmful effects of IS elements on the expression of heterologous genes in C. glutamicum, two IS element free C. glutamicum strains were developed in which each major IS element was deleted, and enhanced productivity in the engineered C. glutamicum strain was successfully demonstrated with three models: GFP, poly(3-hydroxybutyrate) [P(3HB)] and γ-aminobutyrate (GABA). Our findings clearly indicate that the hopping of IS elements could be detrimental to the production of recombinant proteins in C. glutamicum, emphasizing the importance of developing IS element free host strains.

A 547 GHz SIS Receiver Employing a Submicron Nb Junction with an Integrated Matching Circuit

NASA Technical Reports Server (NTRS)

Febvre, P.; McGrath, W.; Leduc, H.; Batelaan, P.; Frerking, M.; Hernichel, J.; Bumble, B.

1993-01-01

The most sensitive heterodyne receivers used for millimeter wave and submillimeter wave radioastronomy employ superconductor-insulator-superconductor (SIS) tunnel junctions as the nonlinear mixing element.

Recombinations in Staphylococcal Cassette Chromosome mec Elements Compromise the Molecular Detection of Methicillin Resistance in Staphylococcus aureus

PubMed Central

Hill-Cawthorne, Grant A.; Hudson, Lyndsey O.; El Ghany, Moataz Fouad Abd; Piepenburg, Olaf; Nair, Mridul; Dodgson, Andrew; Forrest, Matthew S.

2014-01-01

Clinical laboratories are increasingly using molecular tests for methicillin-resistant Staphylococcus aureus (MRSA) screening. However, primers have to be targeted to a variable chromosomal region, the staphylococcal cassette chromosome mec (SCCmec). We initially screened 726 MRSA isolates from a single UK hospital trust by recombinase polymerase amplification (RPA), a novel, isothermal alternative to PCR. Undetected isolates were further characterised using multilocus sequence, spa typing and whole genome sequencing. 96% of our tested phenotypically MRSA isolates contained one of the six orfX-SCCmec junctions our RPA test and commercially available molecular tests target. However 30 isolates could not be detected. Sequencing of 24 of these isolates demonstrated recombinations within the SCCmec element with novel insertions that interfered with the RPA, preventing identification as MRSA. This result suggests that clinical laboratories cannot rely solely upon molecular assays to reliably detect all methicillin-resistance. The presence of significant recombinations in the SCCmec element, where the majority of assays target their primers, suggests that there will continue to be isolates that escape identification. We caution that dependence on amplification-based molecular assays will continue to result in failure to diagnose a small proportion (∼4%) of MRSA isolates, unless the true level of SCCmec natural diversity is determined by whole genome sequencing of a large collection of MRSA isolates. PMID:24972080

An SRY mutation causing human sex reversal resolves a general mechanism of structure-specific DNA recognition: application to the four-way DNA junction.

PubMed

Peters, R; King, C Y; Ukiyama, E; Falsafi, S; Donahoe, P K; Weiss, M A

1995-04-11

SRY, a genetic "master switch" for male development in mammals, exhibits two biochemical activities: sequence-specific recognition of duplex DNA and sequence-independent binding to the sharp angles of four-way DNA junctions. Here, we distinguish between these activities by analysis of a mutant SRY associated with human sex reversal (46, XY female with pure gonadal dysgenesis). The substitution (168T in human SRY) alters a nonpolar side chain in the minor-groove DNA recognition alpha-helix of the HMG box [Haqq, C.M., King, C.-Y., Ukiyama, E., Haqq, T.N., Falsalfi, S., Donahoe, P.K., & Weiss, M.A. (1994) Science 266, 1494-1500]. The native (but not mutant) side chain inserts between specific base pairs in duplex DNA, interrupting base stacking at a site of induced DNA bending. Isotope-aided 1H-NMR spectroscopy demonstrates that analogous side-chain insertion occurs on binding of SRY to a four-way junction, establishing a shared mechanism of sequence- and structure-specific DNA binding. Although the mutant DNA-binding domain exhibits > 50-fold reduction in sequence-specific DNA recognition, near wild-type affinity for four-way junctions is retained. Our results (i) identify a shared SRY-DNA contact at a site of either induced or intrinsic DNA bending, (ii) demonstrate that this contact is not required to bind an intrinsically bent DNA target, and (iii) rationalize patterns of sequence conservation or diversity among HMG boxes. Clinical association of the I68T mutation with human sex reversal supports the hypothesis that specific DNA recognition by SRY is required for male sex determination.

Conformational trapping of mismatch recognition complex MSH2/MSH3 on repair-resistant DNA loops.

PubMed

Lang, Walter H; Coats, Julie E; Majka, Jerzy; Hura, Greg L; Lin, Yuyen; Rasnik, Ivan; McMurray, Cynthia T

2011-10-18

Insertion and deletion of small heteroduplex loops are common mutations in DNA, but why some loops are prone to mutation and others are efficiently repaired is unknown. Here we report that the mismatch recognition complex, MSH2/MSH3, discriminates between a repair-competent and a repair-resistant loop by sensing the conformational dynamics of their junctions. MSH2/MSH3 binds, bends, and dissociates from repair-competent loops to signal downstream repair. Repair-resistant Cytosine-Adenine-Guanine (CAG) loops adopt a unique DNA junction that traps nucleotide-bound MSH2/MSH3, and inhibits its dissociation from the DNA. We envision that junction dynamics is an active participant and a conformational regulator of repair signaling, and governs whether a loop is removed by MSH2/MSH3 or escapes to become a precursor for mutation.

Tnt1 Retrotransposon Mutagenesis: A Tool for Soybean Functional Genomics1[W][OA

PubMed Central

Cui, Yaya; Barampuram, Shyam; Stacey, Minviluz G.; Hancock, C. Nathan; Findley, Seth; Mathieu, Melanie; Zhang, Zhanyuan; Parrott, Wayne A.; Stacey, Gary

2013-01-01

Insertional mutagenesis is a powerful tool for determining gene function in both model and crop plant species. Tnt1, the transposable element of tobacco (Nicotiana tabacum) cell type 1, is a retrotransposon that replicates via an RNA copy that is reverse transcribed and integrated elsewhere in the plant genome. Based on studies in a variety of plants, Tnt1 appears to be inactive in normal plant tissue but can be reactivated by tissue culture. Our goal was to evaluate the utility of the Tnt1 retrotransposon as a mutagenesis strategy in soybean (Glycine max). Experiments showed that the Tnt1 element was stably transformed into soybean plants by Agrobacterium tumefaciens-mediated transformation. Twenty-seven independent transgenic lines carrying Tnt1 insertions were generated. Southern-blot analysis revealed that the copy number of transposed Tnt1 elements ranged from four to 19 insertions, with an average of approximately eight copies per line. These insertions showed Mendelian segregation and did not transpose under normal growth conditions. Analysis of 99 Tnt1 flanking sequences revealed insertions into 62 (62%) annotated genes, indicating that the element preferentially inserts into protein-coding regions. Tnt1 insertions were found in all 20 soybean chromosomes, indicating that Tnt1 transposed throughout the soybean genome. Furthermore, fluorescence in situ hybridization experiments validated that Tnt1 inserted into multiple chromosomes. Passage of transgenic lines through two different tissue culture treatments resulted in Tnt1 transposition, significantly increasing the number of insertions per line. Thus, our data demonstrate the Tnt1 retrotransposon to be a powerful system that can be used for effective large-scale insertional mutagenesis in soybean. PMID:23124322

High Performance Amplifier Element Realization via MoS2/GaTe Heterostructures.

PubMed

Yan, Xiao; Zhang, David Wei; Liu, Chunsen; Bao, Wenzhong; Wang, Shuiyuan; Ding, Shijin; Zheng, Gengfeng; Zhou, Peng

2018-04-01

2D layered materials (2DLMs), together with their heterostructures, have been attracting tremendous research interest in recent years because of their unique physical and electrical properties. A variety of circuit elements have been made using mechanically exfoliated 2DLMs recently, including hard drives, detectors, sensors, and complementary metal oxide semiconductor field-effect transistors. However, 2DLM-based amplifier circuit elements are rarely studied. Here, the integration of 2DLMs with 3D bulk materials to fabricate vertical junction transistors with current amplification based on a MoS 2 /GaTe heterostructure is reported. Vertical junction transistors exhibit the typical current amplification characteristics of conventional bulk bipolar junction transistors while having good current transmission coefficients (α ∼ 0.95) and current gain coefficient (β ∼ 7) at room temperature. The devices provide new attractive prospects in the investigation of 2DLM-based integrated circuits based on amplifier circuits.

Thermocouple, multiple junction reference oven

NASA Technical Reports Server (NTRS)

Leblanc, L. P. (Inventor)

1981-01-01

An improved oven for maintaining the junctions of a plurality of reference thermocouples at a common and constant temperature is described. The oven is characterized by a cylindrical body defining a heat sink with axially extended-cylindrical cavity a singularized heating element which comprises a unitary cylindrical heating element consisting of a resistance heating coil wound about the surface of metallic spool with an axial bore defined and seated in the cavity. Other features of the oven include an annular array of radially extended bores defined in the cylindrical body and a plurality of reference thermocouple junctions seated in the bores in uniformly spaced relation with the heating element, and a temperature sensing device seated in the axial bore for detecting temperature changes as they occur in the spool and circuit to apply a voltage across the coil in response to detected drops in temperatures of the spool.

High Performance Amplifier Element Realization via MoS2/GaTe Heterostructures

PubMed Central

Yan, Xiao; Zhang, David Wei; Liu, Chunsen; Bao, Wenzhong; Wang, Shuiyuan; Ding, Shijin; Zheng, Gengfeng

2018-01-01

Abstract 2D layered materials (2DLMs), together with their heterostructures, have been attracting tremendous research interest in recent years because of their unique physical and electrical properties. A variety of circuit elements have been made using mechanically exfoliated 2DLMs recently, including hard drives, detectors, sensors, and complementary metal oxide semiconductor field‐effect transistors. However, 2DLM‐based amplifier circuit elements are rarely studied. Here, the integration of 2DLMs with 3D bulk materials to fabricate vertical junction transistors with current amplification based on a MoS2/GaTe heterostructure is reported. Vertical junction transistors exhibit the typical current amplification characteristics of conventional bulk bipolar junction transistors while having good current transmission coefficients (α ∼ 0.95) and current gain coefficient (β ∼ 7) at room temperature. The devices provide new attractive prospects in the investigation of 2DLM‐based integrated circuits based on amplifier circuits. PMID:29721428

Posterior medial meniscus root ligament lesions: MRI classification and associated findings.

PubMed

Choi, Ja-Young; Chang, Eric Y; Cunha, Guilherme M; Tafur, Monica; Statum, Sheronda; Chung, Christine B

2014-12-01

The purposes of this study were to determine the prevalence of altered MRI appearances of "posterior medial meniscus root ligament (PMMRL)" lesions, introduce a classification of lesion types, and report associated findings. We retrospectively reviewed 419 knee MRI studies to identify the presence of PMMRL lesions. Classification was established on the basis of lesions encountered. The medial compartment was assessed for medial meniscal tears in the meniscus proper, medial meniscal extrusion, insertional PMMRL osseous changes, regional synovitis, osteoarthritis, insufficiency fracture, and cruciate ligament abnormality. PMMRL abnormalities occurred in 28.6% (120/419) of the studies: degeneration, 14.3% (60/419) and tear, 14.3% (60/419). Our classification system included degeneration and tearing. Tearing was categorized as partial or complete with delineation of the point of failure as entheseal, midsubstance, or junction to meniscus. Of all tears, 93.3% (56/60) occurred at the meniscal junction. Univariate analysis revealed significant differences between the knees with and without PMMRL lesions in age, medial meniscal tear, medial meniscal extrusion, insertional PMMRL osseous change, regional synovitis, osteoarthritis, insufficiency fracture (p=0.017), and cruciate ligament degeneration (p<0.001). PMMRL lesions are commonly detected in symptomatic patients. We have introduced an MRI classification system. PMMRL lesions are significantly associated with age, medial meniscal tears, medial meniscal extrusion, insertional PMMRL osseous change, regional synovitis, osteoarthritis, insufficiency fracture, and cruciate ligament degeneration.

LCR-initiated rearrangements at the IDS locus, completed with Alu-mediated recombination or non-homologous end joining.

PubMed

Oshima, Junko; Lee, Jennifer A; Breman, Amy M; Fernandes, Priscilla H; Babovic-Vuksanovic, Dusica; Ward, Patricia A; Wolfe, Lynne A; Eng, Christine M; Del Gaudio, Daniela

2011-07-01

Mucopolysaccharidosis type II (MPS II) is caused by mutations in the IDS gene, which encodes the lysosomal enzyme iduronate-2-sulfatase. In ∼20% of MPS II patients the disorder is caused by gross IDS structural rearrangements. We identified two male cases harboring complex rearrangements involving the IDS gene and the nearby pseudogene, IDSP1, which has been annotated as a low-copy repeat (LCR). In both cases the rearrangement included a partial deletion of IDS and an inverted insertion of the neighboring region. In silico analyses revealed the presence of repetitive elements as well as LCRs at the junctions of rearrangements. Our models illustrate two alternative consequences of rearrangements initiated by non-allelic homologous recombination of LCRs: resolution by a second recombination event (that is, Alu-mediated recombination), or resolution by non-homologous end joining repair. These complex rearrangements have the potential to be recurrent and may be present among those MSP II cases with previously uncharacterized aberrations involving IDS.

Nanotube junctions

DOEpatents

Crespi, Vincent Henry; Cohen, Marvin Lou; Louie, Steven Gwon; Zettl, Alexander Karlwalte

2004-12-28

The present invention comprises a new nanoscale metal-semiconductor, semiconductor-semiconductor, or metal-metal junction, designed by introducing topological or chemical defects in the atomic structure of the nanotube. Nanotubes comprising adjacent sections having differing electrical properties are described. These nanotubes can be constructed from combinations of carbon, boron, nitrogen and other elements. The nanotube can be designed having different indices on either side of a junction point in a continuous tube so that the electrical properties on either side of the junction vary in a useful fashion. For example, the inventive nanotube may be electrically conducting on one side of a junction and semiconducting on the other side. An example of a semiconductor-metal junction is a Schottky barrier. Alternatively, the nanotube may exhibit different semiconductor properties on either side of the junction. Nanotubes containing heterojunctions, Schottky barriers, and metal-metal junctions are useful for microcircuitry.

Nanotube junctions

DOEpatents

Crespi, Vincent Henry; Cohen, Marvin Lou; Louie, Steven Gwon Sheng; Zettl, Alexander Karlwalter

2003-01-01

The present invention comprises a new nanoscale metal-semiconductor, semiconductor-semiconductor, or metal-metal junction, designed by introducing topological or chemical defects in the atomic structure of the nanotube. Nanotubes comprising adjacent sections having differing electrical properties are described. These nanotubes can be constructed from combinations of carbon, boron, nitrogen and other elements. The nanotube can be designed having different indices on either side of a junction point in a continuous tube so that the electrical properties on either side of the junction vary in a useful fashion. For example, the inventive nanotube may be electrically conducting on one side of a junction and semiconducting on the other side. An example of a semiconductor-metal junction is a Schottky barrier. Alternatively, the nanotube may exhibit different semiconductor properties on either side of the junction. Nanotubes containing heterojunctions, Schottky barriers, and metal-metal junctions are useful for microcircuitry.

Dependency of tunneling magneto-resistance on Fe insertion-layer thickness in Co{sub 2}Fe{sub 6}B{sub 2}/MgO-based magnetic tunneling junctions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chae, Kyo-Suk; Samsung Electronics Co., Ltd., San #16 Banwol-dong, Hwasung-City, Gyeonggi-Do 445-701; Park, Jea-Gun, E-mail: parkjgL@hanyang.ac.kr

For Co{sub 2}Fe{sub 6}B{sub 2}/MgO-based perpendicular magnetic tunneling junctions spin valves with [Co/Pd]{sub n}-synthetic-antiferromagnetic (SyAF) layers, the tunneling-magneto-resistance (TMR) ratio strongly depends on the nanoscale Fe insertion-layer thickness (t{sub Fe}) between the Co{sub 2}Fe{sub 6}B{sub 2} pinned layer and MgO tunneling barrier. The TMR ratio rapidly increased as t{sub Fe} increased up to 0.4 nm by improving the crystalline linearity of a MgO tunneling barrier and by suppressing the diffusion of Pd atoms from a [Co/Pd]{sub n}-SyAF. However, it abruptly decreased by further increasing t{sub Fe} in transferring interfacial-perpendicular magnetic anisotropy into the IMA characteristic of the Co{sub 2}Fe{sub 6}B{sub 2}more » pinned layer. Thus, the TMR ratio peaked at t{sub Fe} = 0.4 nm: i.e., 120% at 29 Ωμm{sup 2}.« less

Intein-modified enzymes, their production and industrial applications

DOEpatents

Apgar, James; Lessard, Philip; Raab, Michael R.; Shen, Binzhang; Lazar, Gabor; de la Vega, Humberto

2016-10-11

A method of predicting an intein insertion site in a protein that will lead to a switching phenotype is provided. The method includes identifying a plurality of C/T/S sites within the protein; selecting from the plurality of C/T/S/ sites those that are ranked 0.75 or higher by a support vector machine, within ten angstroms of the active site of the protein, and at or near a loop-.beta.-sheet junction or a loop-.alpha.-helix junction. A method of controlling protein activity and hosts including proteins with controlled activity are also provided. Also, intein modified proteins and plants containing intein modified proteins are provided.

Compositions and methods for the expression of selenoproteins in eukaryotic cells

DOEpatents

Gladyshev, Vadim [Lincoln, NE; Novoselov, Sergey [Puschino, RU

2012-09-25

Recombinant nucleic acid constructs for the efficient expression of eukaryotic selenoproteins and related methods for production of recombinant selenoproteins are provided. The nucleic acid constructs comprise novel selenocysteine insertion sequence (SECIS) elements. Certain novel SECIS elements of the invention contain non-canonical quartet sequences. Other novel SECIS elements provided by the invention are chimeric SECIS elements comprising a canonical SECIS element that contains a non-canonical quartet sequence and chimeric SECIS elements comprising a non-canonical SECIS element that contains a canonical quartet sequence. The novel SECIS elements of the invention facilitate the insertion of selenocysteine residues into recombinant polypeptides.

Quantitative analysis of bristle number in Drosophila mutants identifies genes involved in neural development

NASA Technical Reports Server (NTRS)

Norga, Koenraad K.; Gurganus, Marjorie C.; Dilda, Christy L.; Yamamoto, Akihiko; Lyman, Richard F.; Patel, Prajal H.; Rubin, Gerald M.; Hoskins, Roger A.; Mackay, Trudy F.; Bellen, Hugo J.

2003-01-01

BACKGROUND: The identification of the function of all genes that contribute to specific biological processes and complex traits is one of the major challenges in the postgenomic era. One approach is to employ forward genetic screens in genetically tractable model organisms. In Drosophila melanogaster, P element-mediated insertional mutagenesis is a versatile tool for the dissection of molecular pathways, and there is an ongoing effort to tag every gene with a P element insertion. However, the vast majority of P element insertion lines are viable and fertile as homozygotes and do not exhibit obvious phenotypic defects, perhaps because of the tendency for P elements to insert 5' of transcription units. Quantitative genetic analysis of subtle effects of P element mutations that have been induced in an isogenic background may be a highly efficient method for functional genome annotation. RESULTS: Here, we have tested the efficacy of this strategy by assessing the extent to which screening for quantitative effects of P elements on sensory bristle number can identify genes affecting neural development. We find that such quantitative screens uncover an unusually large number of genes that are known to function in neural development, as well as genes with yet uncharacterized effects on neural development, and novel loci. CONCLUSIONS: Our findings establish the use of quantitative trait analysis for functional genome annotation through forward genetics. Similar analyses of quantitative effects of P element insertions will facilitate our understanding of the genes affecting many other complex traits in Drosophila.

Preparation of high temperature gas-cooled reactor fuel element

DOEpatents

Bradley, Ronnie A.; Sease, John D.

1976-01-01

This invention relates to a method for the preparation of high temperature gas-cooled reactor (HTGR) fuel elements wherein uncarbonized fuel rods are inserted in appropriate channels of an HTGR fuel element block and the entire block is inserted in an autoclave for in situ carbonization under high pressure. The method is particularly applicable to remote handling techniques.

Efficient transposition of the Tnt1 tobacco retrotransposon in the model legume Medicago truncatula.

PubMed

d'Erfurth, Isabelle; Cosson, Viviane; Eschstruth, Alexis; Lucas, Helene; Kondorosi, Adam; Ratet, P

2003-04-01

The tobacco element, Tnt1, is one of the few active retrotransposons in plants. Its transposition is activated during protoplast culture in tobacco and tissue culture in the heterologous host Arabidopsis thaliana. Here, we report its transposition in the R108 line of Medicago truncatula during the early steps of the in vitro transformation-regeneration process. Two hundred and twenty-five primary transformants containing Tnt1 were obtained. Among them, 11.2% contained only transposed copies of the element, indicating that Tnt1 transposed very early and efficiently during the in vitro transformation process, possibly even before the T-DNA integration. The average number of insertions per transgenic line was estimated to be about 15. These insertions were stable in the progeny and could be separated by segregation. Inspection of the sequences flanking the insertion sites revealed that Tnt1 had no insertion site specificity and often inserted in genes (one out of three insertions). Thus, our work demonstrates the functioning of an efficient transposable element in leguminous plants. These results indicate that Tnt1 can be used as a powerful tool for insertion mutagenesis in M. truncatula.

First principles calculation for Gilbert damping constants in ferromagnetic/non-magnetic junctions

NASA Astrophysics Data System (ADS)

Hiramatsu, R.; Miura, D.; Sakuma, A.

2018-05-01

We evaluated an intrinsic α in ferromagnetic (FM)/non-magnetic (NM) junctions from first principles (FM = Co, Fe, and Ni and NM = Cu, Pd, and Pt) to investigate the effects of the inserted NM layer. α is calculated by liner muffin-tin orbital methods based on the torque-correlation model. We confirmed that Gilbert damping is enhanced and saturated as NM thickness increases, and that the enhancement is greater in NM materials having a stronger spin-orbital interaction. By contrast, the calculated FM thickness dependences of α show that Gilbert damping tends to decrease and be saturated as the FM thickness increases. Under the torque-correlation model, the dependences of α on FM and NM thickness can be explained by considering the electronic structure of the total system, including junction interfaces, which exhibit similar behaviors derived by spin pumping theory.

Myofibroblasts Electrotonically Coupled to Cardiomyocytes Alter Conduction: Insights at the Cellular Level from a Detailed In silico Tissue Structure Model

PubMed Central

Jousset, Florian; Maguy, Ange; Rohr, Stephan; Kucera, Jan P.

2016-01-01

Fibrotic myocardial remodeling is typically accompanied by the appearance of myofibroblasts (MFBs). In vitro, MFBs were shown to slow conduction and precipitate ectopic activity following gap junctional coupling to cardiomyocytes (CMCs). To gain further mechanistic insights into this arrhythmogenic MFB-CMC crosstalk, we performed numerical simulations in cell-based high-resolution two-dimensional tissue models that replicated experimental conditions. Cell dimensions were determined using confocal microscopy of single and co-cultured neonatal rat ventricular CMCs and MFBs. Conduction was investigated as a function of MFB density in three distinct cellular tissue architectures: CMC strands with endogenous MFBs, CMC strands with coating MFBs of two different sizes, and CMC strands with MFB inserts. Simulations were performed to identify individual contributions of heterocellular gap junctional coupling and of the specific electrical phenotype of MFBs. With increasing MFB density, both endogenous and coating MFBs slowed conduction. At MFB densities of 5–30%, conduction slowing was most pronounced in strands with endogenous MFBs due to the MFB-dependent increase in axial resistance. At MFB densities >40%, very slow conduction and spontaneous activity was primarily due to MFB-induced CMC depolarization. Coating MFBs caused non-uniformities of resting membrane potential, which were more prominent with large than with small MFBs. In simulations of MFB inserts connecting two CMC strands, conduction delays increased with increasing insert lengths and block appeared for inserts >1.2 mm. Thus, electrophysiological properties of engineered CMC-MFB co-cultures depend on MFB density, MFB size and their specific positioning in respect to CMCs. These factors may influence conduction characteristics in the heterocellular myocardium. PMID:27833567

Structure and transcriptional impact of divergent repetitive elements inserted within Phanerochaete chrysosporium strain RP-78 genes

Treesearch

Luis F. Larrondo; Paulo Canessa; Rafael Vicuna; Philip Stewart; Amber Vanden Wymelenberg; Dan Cullen

2007-01-01

We describe the structure, organization, and transcriptional impact of repetitive elements within the lignin-degrading basidiomycete, Phanerochaete chrysosporium. Searches of the P. chrysosporium genome revealed five copies of pce1, a 1,750-nt non-autonomous, class II element. Alleles encoding a putative glucosyltransferase and a cytochrome P450 harbor pce insertions...

Varactor with integrated micro-discharge source

DOE Office of Scientific and Technical Information (OSTI.GOV)

Elizondo-Decanini, Juan M.; Manginell, Ronald P.; Moorman, Matthew W.

2016-10-18

An apparatus that includes a varactor element and an integrated micro-discharge source is disclosed herein. In a general embodiment, the apparatus includes at least one np junction and at least one voltage source that is configured to apply voltage across the np junction. The apparatus further includes an aperture that extends through the np junction. When the voltage is applied across the np junction, gas in the aperture is ionized, forming a plasma, in turn causing a micro-discharge (of light, charge particles, and space charge) to occur. The light (charge particles, and space charge) impinges upon the surface of themore » np junction exposed in the aperture, thereby altering capacitance of the np junction. When used within an oscillator circuit, the effect of the plasma on the np-junction extends the capacitance changes of the np-junction and extends the oscillator frequency range in ways not possible by a conventional voltage controlled oscillator (VCO).« less

K-Band Latching Switches

NASA Technical Reports Server (NTRS)

Piotrowski, W. S.; Raue, J. E.

1984-01-01

Design, development, and tests are described for two single-pole-double-throw latching waveguide ferrite switches: a K-band switch in WR-42 waveguide and a Ka-band switch in WR-28 waveguide. Both switches have structurally simple junctions, mechanically interlocked without the use of bonding materials; they are impervious to the effects of thermal, shock, and vibration stresses. Ferrite material for the Ka-band switch with a proper combination of magnetic and dielectric properties was available and resulted in excellent low loss, wideband performance. The high power handling requirement of the K-band switch limited the choice of ferrite to nickel-zinc compositions with adequate magnetic properties, but with too low relative dielectric constant. The relative dielectric constant determines the junction dimensions for given frequency responses. In this case the too low value unavoidably leads to a larger than optimum junction volume, increasing the insertion loss and restricting the operating bandwidth. Efforts to overcome the materials-related difficulties through the design of a composite junction with increased effective dielectric properties efforts to modify the relative dielectric constant of nickel-zinc ferrite are examined.

Insertion and deletion polymorphisms of the ancient AluS family in the human genome.

PubMed

Kryatova, Maria S; Steranka, Jared P; Burns, Kathleen H; Payer, Lindsay M

2017-01-01

Polymorphic Alu elements account for 17% of structural variants in the human genome. The majority of these belong to the youngest AluY subfamilies, and most structural variant discovery efforts have focused on identifying Alu polymorphisms from these currently retrotranspositionally active subfamilies. In this report we analyze polymorphisms from the evolutionarily older AluS subfamily, whose peak activity was tens of millions of years ago. We annotate the AluS polymorphisms, assess their likely mechanism of origin, and evaluate their contribution to structural variation in the human genome. Of 52 previously reported polymorphic AluS elements ascertained for this study, 48 were confirmed to belong to the AluS subfamily using high stringency subfamily classification criteria. Of these, the majority (77%, 37/48) appear to be deletion polymorphisms. Two polymorphic AluS elements (4%) have features of non-classical Alu insertions and one polymorphic AluS element (2%) likely inserted by a mechanism involving internal priming. Seven AluS polymorphisms (15%) appear to have arisen by the classical target-primed reverse transcription (TPRT) retrotransposition mechanism. These seven TPRT products are 3' intact with 3' poly-A tails, and are flanked by target site duplications; L1 ORF2p endonuclease cleavage sites were also observed, providing additional evidence that these are L1 ORF2p endonuclease-mediated TPRT insertions. Further sequence analysis showed strong conservation of both the RNA polymerase III promoter and SRP9/14 binding sites, important for mediating transcription and interaction with retrotransposition machinery, respectively. This conservation of functional features implies that some of these are fairly recent insertions since they have not diverged significantly from their respective retrotranspositionally competent source elements. Of the polymorphic AluS elements evaluated in this report, 15% (7/48) have features consistent with TPRT-mediated insertion, thus suggesting that some AluS elements have been more active recently than previously thought, or that fixation of AluS insertion alleles remains incomplete. These data expand the potential significance of polymorphic AluS elements in contributing to structural variation in the human genome. Future discovery efforts focusing on polymorphic AluS elements are likely to identify more such polymorphisms, and approaches tailored to identify deletion alleles may be warranted.

The Nucleotide Excision Repair Pathway Limits L1 Retrotransposition

PubMed Central

Servant, Geraldine; Streva, Vincent A.; Derbes, Rebecca S.; Wijetunge, Madushani I.; Neeland, Marc; White, Travis B.; Belancio, Victoria P.; Roy-Engel, Astrid M.; Deininger, Prescott L.

2017-01-01

Long interspersed elements 1 (L1) are active mobile elements that constitute almost 17% of the human genome. They amplify through a “copy-and-paste” mechanism termed retrotransposition, and de novo insertions related to these elements have been reported to cause 0.2% of genetic diseases. Our previous data demonstrated that the endonuclease complex ERCC1-XPF, which cleaves a 3′ DNA flap structure, limits L1 retrotransposition. Although the ERCC1-XPF endonuclease participates in several different DNA repair pathways, such as single-strand annealing, or in telomere maintenance, its recruitment to DNA lesions is best characterized in the nucleotide excision repair (NER) pathway. To determine if the NER pathway prevents the insertion of retroelements in the genome, we monitored the retrotransposition efficiencies of engineered L1 elements in NER-deficient cells and in their complemented versions. Core proteins of the NER pathway, XPD and XPA, and the lesion binding protein, XPC, are involved in limiting L1 retrotransposition. In addition, sequence analysis of recovered de novo L1 inserts and their genomic locations in NER-deficient cells demonstrated the presence of abnormally large duplications at the site of insertion, suggesting that NER proteins may also play a role in the normal L1 insertion process. Here, we propose new functions for the NER pathway in the maintenance of genome integrity: limitation of insertional mutations caused by retrotransposons and the prevention of potentially mutagenic large genomic duplications at the site of retrotransposon insertion events. PMID:28049704

Diagnostic use of computational retrotransposon detection: Successful definition of pathogenetic mechanism in a ciliopathy phenotype.

PubMed

Takenouchi, Toshiki; Kuchikata, Tomu; Yoshihashi, Hiroshi; Fujiwara, Mineko; Uehara, Tomoko; Miyama, Sahoko; Yamada, Shiro; Kosaki, Kenjiro

2017-05-01

Among more than 5,000 human monogenic disorders with known causative genes, transposable element insertion of a Long Interspersed Nuclear Element 1 (LINE1, L1) is known as the mechanistic basis in only 13 genetic conditions. Meckel-Gruber syndrome is a rare ciliopathy characterized by occipital encephalocele and cystic kidney disease. Here, we document a boy with occipital encephalocele, post-axial polydactyly, and multicystic renal disease. A medical exome analysis detected a heterozygous frameshift mutation, c.4582_4583delCG p.(Arg1528Serfs*17) in CC2D2A in the maternally derived allele. The further use of a dedicated bioinformatics algorithm for detecting retrotransposon insertions led to the detection of an L1 insertion affecting exon 7 in the paternally derived allele. The complete sequencing and sequence homology analysis of the inserted L1 element showed that the L1 element was classified as L1HS (L1 human specific) and that the element had intact open reading frames in the two L1-encoded proteins. This observation ranks Meckel-Gruber syndrome as only the 14th disorder to be caused by an L1 insertion among more than 5,000 known human genetic disorders. Although a transposable element detection algorithm is not included in the current best-practice next-generation sequencing analysis, the present observation illustrates the utility of such an algorithm, which would require modest computational time and resources. Whether the seemingly infrequent recognition of L1 insertion in the pathogenesis of human genetic diseases might simply reflect a lack of appropriate detection methods remains to be seen. © 2017 Wiley Periodicals, Inc.

Gene structure of CYP3A4, an adult-specific form of cytochrome P450 in human livers, and its transcriptional control.

PubMed

Hashimoto, H; Toide, K; Kitamura, R; Fujita, M; Tagawa, S; Itoh, S; Kamataki, T

1993-12-01

CYP3 A4 is the adult-specific form of cytochrome P450 in human livers [Komori, M., Nishio, K., Kitada, M., Shiramatsu, K., Muroya, K., Soma, M., Nagashima, K. & Kamataki, T. (1990) Biochemistry 29, 4430-4433]. The sequences of three genomic clones for CYP3A4 were analyzed for all exons, exon-intron junctions and the 5'-flanking region from the major transcription site to nucleotide position -1105, and compared with those of the CYP3A7 gene, a fetal-specific form of cytochrome P450 in humans. The results showed that the identity of 5'-flanking sequences between CYP3A4 and CYP3A7 genes was 91%, and that each 5'-flanking region had characteristic sequences termed as NFSE (P450NF-specific element) and HFLaSE (P450HFLa specific element), respectively. A basic transcription element (BTE) also lay in the 5'-flanking region of the CYP3A4 gene as seen in many CYP genes [Yanagida, A., Sogawa, K., Yasumoto, K. & Fujii-Kuriyama, Y. (1990) Mol. Cell. Biol. 10, 1470-1475]. The BTE binding factor (BTEB) was present in both adult and fetal human livers. To examine the transcriptional activity of the CYP3A4 gene, DNA fragments in the 5'-flanking region of the gene were inserted in front of the simian virus 40 promoter and the chloramphenicol acetyltransferase structural gene, and the constructs were transfected in HepG2 cells. The analysis of the chloramphenicol acetyltransferase activity indicated that (a) specific element(s) which could bind with a factor(s) in livers was present in the 5'-flanking region of the CYP3A4 gene to show the transcriptional activity.

Ty1-copia elements reveal diverse insertion sites linked to polymorphisms among flax (Linum usitatissimum L.) accessions.

PubMed

Galindo-González, Leonardo; Mhiri, Corinne; Grandbastien, Marie-Angèle; Deyholos, Michael K

2016-12-07

Initial characterization of the flax genome showed that Ty1-copia retrotransposons are abundant, with several members being recently inserted, and in close association with genes. Recent insertions indicate a potential for ongoing transpositional activity that can create genomic diversity among accessions, cultivars or varieties. The polymorphisms generated constitute a good source of molecular markers that may be associated with phenotype if the insertions alter gene activity. Flax, where accessions are bred mainly for seed nutritional properties or for fibers, constitutes a good model for studying the relationship of transpositional activity with diversification and breeding. In this study, we estimated copy number and used a type of transposon display known as Sequence-Specific Amplification Polymorphisms (SSAPs), to characterize six families of Ty1-copia elements across 14 flax accessions. Polymorphic insertion sites were sequenced to find insertions that could potentially alter gene expression, and a preliminary test was performed with selected genes bearing transposable element (TE) insertions. Quantification of six families of Ty1-copia elements indicated different abundances among TE families and between flax accessions, which suggested diverse transpositional histories. SSAPs showed a high level of polymorphism in most of the evaluated retrotransposon families, with a trend towards higher levels of polymorphism in low-copy number families. Ty1-copia insertion polymorphisms among cultivars allowed a general distinction between oil and fiber types, and between spring and winter types, demonstrating their utility in diversity studies. Characterization of polymorphic insertions revealed an overwhelming association with genes, with insertions disrupting exons, introns or within 1 kb of coding regions. A preliminary test on the potential transcriptional disruption by TEs of four selected genes evaluated in three different tissues, showed one case of significant impact of the insertion on gene expression. We demonstrated that specific Ty1-copia families have been active since breeding commenced in flax. The retrotransposon-derived polymorphism can be used to separate flax types, and the close association of many insertions with genes defines a good source of potential mutations that could be associated with phenotypic changes, resulting in diversification processes.

Rotifer rDNA-specific R9 retrotransposable elements generate an exceptionally long target site duplication upon insertion.

PubMed

Gladyshev, Eugene A; Arkhipova, Irina R

2009-12-15

Ribosomal DNA genes in many eukaryotes contain insertions of non-LTR retrotransposable elements belonging to the R2 clade. These elements persist in the host genomes by inserting site-specifically into multicopy target sites, thereby avoiding random disruption of single-copy host genes. Here we describe R9 retrotransposons from the R2 clade in the 28S RNA genes of bdelloid rotifers, small freshwater invertebrate animals best known for their long-term asexuality and for their ability to survive repeated cycles of desiccation and rehydration. While the structural organization of R9 elements is highly similar to that of other members of the R2 clade, they are characterized by two distinct features: site-specific insertion into a previously unreported target sequence within the 28S gene, and an unusually long target site duplication of 126 bp. We discuss the implications of these findings in the context of bdelloid genome organization and the mechanisms of target-primed reverse transcription.

The Plasmodium selenoproteome

PubMed Central

Lobanov, Alexey V.; Delgado, Cesar; Rahlfs, Stefan; Novoselov, Sergey V.; Kryukov, Gregory V.; Gromer, Stephan; Hatfield, Dolph L.; Becker, Katja; Gladyshev, Vadim N.

2006-01-01

The use of selenocysteine (Sec) as the 21st amino acid in the genetic code has been described in all three major domains of life. However, within eukaryotes, selenoproteins are only known in animals and algae. In this study, we characterized selenoproteomes and Sec insertion systems in protozoan Apicomplexa parasites. We found that among these organisms, Plasmodium and Toxoplasma utilized Sec, whereas Cryptosporidium did not. However, Plasmodium had no homologs of known selenoproteins. By searching computationally for evolutionarily conserved selenocysteine insertion sequence (SECIS) elements, which are RNA structures involved in Sec insertion, we identified four unique Plasmodium falciparum selenoprotein genes. These selenoproteins were incorrectly annotated in PlasmoDB, were conserved in other Plasmodia and had no detectable homologs in other species. We provide evidence that two Plasmodium SECIS elements supported Sec insertion into parasite and endogenous selenoproteins when they were expressed in mammalian cells, demonstrating that the Plasmodium SECIS elements are functional and indicating conservation of Sec insertion between Apicomplexa and animals. Dependence of the plasmodial parasites on selenium suggests possible strategies for antimalarial drug development. PMID:16428245

SV40 host-substituted variants: a new look at the monkey DNA inserts and recombinant junctions.

PubMed

Singer, Maxine; Winocour, Ernest

2011-04-10

The available monkey genomic data banks were examined in order to determine the chromosomal locations of the host DNA inserts in 8 host-substituted SV40 variant DNAs. Five of the 8 variants contained more than one linked monkey DNA insert per tandem repeat unit and in all cases but one, the 19 monkey DNA inserts in the 8 variants mapped to different locations in the monkey genome. The 50 parental DNAs (32 monkey and 18 SV40 DNA segments) which spanned the crossover and flanking regions that participated in monkey/monkey and monkey/SV40 recombinations were characterized by substantial levels of microhomology of up to 8 nucleotides in length; the parental DNAs also exhibited direct and inverted repeats at or adjacent to the crossover sequences. We discuss how the host-substituted SV40 variants arose and the nature of the recombination mechanisms involved. Copyright © 2011 Elsevier Inc. All rights reserved.

S Elements: A Family of Tc1-like Transposons in the Genome of Drosophila Melanogaster

PubMed Central

Merriman, P. J.; Grimes, C. D.; Ambroziak, J.; Hackett, D. A.; Skinner, P.; Simmons, M. J.

1995-01-01

The S elements form a diverse family of long-inverted-repeat transposons within the genome of Drosophila melanogaster. These elements vary in size and sequence, the longest consisting of 1736 bp with 234-bp inverted terminal repeats. The longest open reading frame in an intact S element could encode a 345-amino acid polypeptide. This polypeptide is homologous to the transposases of the mariner-Tc1 superfamily of transposable elements. S elements are ubiquitous in D. melanogaster populations and also appear to be present in the genomes of two sibling species; however, they seem to be absent from 17 other Drosophila species that were examined. Within D. melanogaster strains, there are, on average, 37.4 cytologically detectable S elements per diploid genome. These elements are scattered throughout the chromosomes, but several sites in both the euchromatin and β heterochromatin are consistently occupied. The discovery of an S-element-insertion mutation and a reversion of this mutation indicates that S elements are at least occasionally mobile in the D. melanogaster genome. These elements seem to insert at an AT dinucleotide within a short palindrome and apparently duplicate that dinucleotide upon insertion. PMID:8601484

Illegitimate V(D)J recombination-mediated deletions in Notch1 and Bcl11b are not sufficient for extensive clonal expansion and show minimal age or sex bias in frequency or junctional processing

PubMed Central

Champagne, Devin P.; Shockett, Penny E.

2014-01-01

Illegitimate V(D)J recombination at oncogenes and tumor suppressor genes is implicated in formation of several T cell malignancies. Notch1 and Bcl11b, genes involved in developing T cell specification, selection, proliferation, and survival, were previously shown to contain hotspots for deletional illegitimate V(D)J recombination associated with radiation-induced thymic lymphoma. Interestingly, these deletions were also observed in wild-type animals. In this study, we conducted frequency, clonality, and junctional processing analyses of Notch1 and Bcl11b deletions during mouse development and compared results to published analyses of authentic V(D)J rearrangements at the T cell receptor beta (TCRβ) locus and illegitimate V(D)J deletions observed at the human, nonimmune HPRT1 locus not involved in T cell malignancies. We detect deletions in Notch1 and Bcl11b in thymic and splenic T cell populations, consistent with cells bearing deletions in the circulating lymphocyte pool. Deletions in thymus can occur in utero, increase in frequency between fetal and postnatal stages, are detected at all ages examined between fetal and 7 months, exhibit only limited clonality (contrasting with previous results in radiation-sensitive mouse strains), and consistent with previous reports are more frequent in Bcl11b, partially explained by relatively high Recombination Signal Information Content (RIC) scores. Deletion junctions in Bcl11b exhibit greater germline nucleotide loss, while in Notch1 palindromic (P) nucleotides are more abundant, although average P nucleotide length is similar for both genes and consistent with results at the TCRβ locus. Non-templated (N) nucleotide insertions appear to increase between fetal and postnatal stages for Notch1, consistent with normal terminal deoxynucleotidyl transferase (TdT) activity; however, neonatal Bcl11b junctions contain elevated levels of N insertions. Finally, contrasting with results at the HPRT1 locus, we find no obvious age or gender bias in junctional processing, and inverted repeats at recessed coding ends (Pr nucleotides) correspond mostly to single-base additions consistent with normal TdT activity. PMID:24530429

Effects of a Transposable Element Insertion on Alcohol Dehydrogenase Expression in Drosophila Melanogaster

PubMed Central

Dunn, R. C.; Laurie, C. C.

1995-01-01

Variation in the DNA sequence and level of alcohol dehydrogenase (Adh) gene expression in Drosophila melanogaster have been studied to determine what types of DNA polymorphisms contribute to phenotypic variation in natural populations. The Adh gene, like many others, shows a high level of variability in both DNA sequence and quantitative level of expression. A number of transposable element insertions occur in the Adh region and one of these, a copia insertion in the 5' flanking region, is associated with unusually low Adh expression. To determine whether this insertion (called RI42) causes the low expression level, the insertion was excised from the cloned RI42 Adh gene and the effect was assessed by P-element transformation. Removal of this insertion causes a threefold increase in the level of ADH, clearly showing that it contributes to the naturally occurring variation in expression at this locus. Removal of all but one LTR also causes a threefold increase, indicating that the mechanism is not a simple sequence disruption. Furthermore, this copia insertion, which is located between the two Adh promoters and their upstream enhancer sequences, has differential effects on the levels of proximal and distal transcripts. Finally, a test for the possible modifying effects of two suppressor loci, su(w(a)) and su(f), on this insertional mutation was negative, in contrast to a previous report in the literature. PMID:7498745

A Predictive Model of Intein Insertion Site for Use in the Engineering of Molecular Switches

PubMed Central

Apgar, James; Ross, Mary; Zuo, Xiao; Dohle, Sarah; Sturtevant, Derek; Shen, Binzhang; de la Vega, Humberto; Lessard, Philip; Lazar, Gabor; Raab, R. Michael

2012-01-01

Inteins are intervening protein domains with self-splicing ability that can be used as molecular switches to control activity of their host protein. Successfully engineering an intein into a host protein requires identifying an insertion site that permits intein insertion and splicing while allowing for proper folding of the mature protein post-splicing. By analyzing sequence and structure based properties of native intein insertion sites we have identified four features that showed significant correlation with the location of the intein insertion sites, and therefore may be useful in predicting insertion sites in other proteins that provide native-like intein function. Three of these properties, the distance to the active site and dimer interface site, the SVM score of the splice site cassette, and the sequence conservation of the site showed statistically significant correlation and strong predictive power, with area under the curve (AUC) values of 0.79, 0.76, and 0.73 respectively, while the distance to secondary structure/loop junction showed significance but with less predictive power (AUC of 0.54). In a case study of 20 insertion sites in the XynB xylanase, two features of native insertion sites showed correlation with the splice sites and demonstrated predictive value in selecting non-native splice sites. Structural modeling of intein insertions at two sites highlighted the role that the insertion site location could play on the ability of the intein to modulate activity of the host protein. These findings can be used to enrich the selection of insertion sites capable of supporting intein splicing and hosting an intein switch. PMID:22649521

Controllable 0–π Josephson junctions containing a ferromagnetic spin valve

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gingrich, E. C.; Niedzielski, Bethany M.; Glick, Joseph A.

Superconductivity and ferromagnetism are antagonistic forms of order, and rarely coexist. Many interesting new phenomena occur, however, in hybrid superconducting/ferromagnetic systems. For example, a Josephson junction containing a ferromagnetic material can exhibit an intrinsic phase shift of π in its ground state for certain thicknesses of the material. Such ‘π-junctions’ were first realized experimentally in 2001, and have been proposed as circuit elements for both high-speed classical superconducting computing and for quantum computing. Here we demonstrate experimentally that the phase state of a Josephson junction containing two ferromagnetic layers can be toggled between 0 and pi by changing the relativemore » orientation of the two magnetizations. These controllable 0–π junctions have immediate applications in cryogenic memory, where they serve as a necessary component to an ultralow power superconducting computer. Such a fully superconducting computer is estimated to be orders of magnitude more energy-efficient than current semiconductor-based supercomputers. Here, phase-controllable junctions also open up new possibilities for superconducting circuit elements such as superconducting ‘programmable logic’, where they could function in superconducting analogues to field-programmable gate arrays.« less

Controllable 0–π Josephson junctions containing a ferromagnetic spin valve

DOE PAGES

Gingrich, E. C.; Niedzielski, Bethany M.; Glick, Joseph A.; ...

2016-03-14

Superconductivity and ferromagnetism are antagonistic forms of order, and rarely coexist. Many interesting new phenomena occur, however, in hybrid superconducting/ferromagnetic systems. For example, a Josephson junction containing a ferromagnetic material can exhibit an intrinsic phase shift of π in its ground state for certain thicknesses of the material. Such ‘π-junctions’ were first realized experimentally in 2001, and have been proposed as circuit elements for both high-speed classical superconducting computing and for quantum computing. Here we demonstrate experimentally that the phase state of a Josephson junction containing two ferromagnetic layers can be toggled between 0 and pi by changing the relativemore » orientation of the two magnetizations. These controllable 0–π junctions have immediate applications in cryogenic memory, where they serve as a necessary component to an ultralow power superconducting computer. Such a fully superconducting computer is estimated to be orders of magnitude more energy-efficient than current semiconductor-based supercomputers. Here, phase-controllable junctions also open up new possibilities for superconducting circuit elements such as superconducting ‘programmable logic’, where they could function in superconducting analogues to field-programmable gate arrays.« less

TEs or not TEs? That is the evolutionary question.

PubMed

Vaknin, Keren; Goren, Amir; Ast, Gil

2009-10-23

Transposable elements (TEs) have contributed a wide range of functional sequences to their host genomes. A recent paper in BMC Molecular Biology discusses the creation of new transcripts by transposable element insertion upstream of retrocopies and the involvement of such insertions in tissue-specific post-transcriptional regulation.

Advance of Mechanically Controllable Break Junction for Molecular Electronics.

PubMed

Wang, Lu; Wang, Ling; Zhang, Lei; Xiang, Dong

2017-06-01

Molecular electronics stands for the ultimate size of functional elements, keeping up with an unstoppable trend over the past few decades. As a vital component of molecular electronics, single molecular junctions have attracted significant attention from research groups all over the world. Due to its pronounced superiority, the mechanically controllable break junctions (MCBJ) technique has been widely applied to characterize the dynamic performance of single molecular junctions. This review presents a system analysis for single-molecule junctions and offers an overview of four test-beds for single-molecule junctions, thus offering more insight into the mechanisms of electron transport. We mainly focus on the development of state-of-the-art mechanically controlled break junctions. The three-terminal gated MCBJ approaches are introduced to manipulate the electron transport of molecules, and MCBJs are combined with characterization techniques. Additionally, applications of MCBJs and remarkable properties of single molecules are addressed. Finally, the challenges and perspective for the mechanically controllable break junctions technique are provided.

Compact Magic-T using microstrip-slotline transitions

NASA Technical Reports Server (NTRS)

U-Yen, Kongpop (Inventor); Wollack, Edward J. (Inventor); Doiron, Terence (Inventor); Moseley, Samuel H. (Inventor)

2010-01-01

The design of a compact low-loss Magic-T is described. The planar Magic-T incorporates a compact microstrip-slotline tee junction and small microstrip-slotline transition area to reduce slotline radiation. The Magic-T produces broadband in-phase and out-of-phase power combiner/divider responses, has low in-band insertion loss, and small in-band phase and amplitude imbalance.

76 FR 78631 - Questar Pipeline Company; Notice of Intent To Prepare an Environmental Assessment for the...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-12-19

... are currently exposed, which would be removed. Questar would also construct a pig launcher/receiver \\1\\ facility at its new Mainline 103/68 junction. \\1\\ A pipeline ``pig'' is a device used to clean or inspect the pipeline. A pig launcher/receiver is an aboveground facility where pigs are inserted or retrieved...

Landscape of Insertion Polymorphisms in the Human Genome

PubMed Central

Onozawa, Masahiro; Goldberg, Liat; Aplan, Peter D.

2015-01-01

Nucleotide substitutions, small (<50 bp) insertions or deletions (indels), and large (>50 bp) deletions are well-known causes of genetic variation within the human genome. We recently reported a previously unrecognized form of polymorphic insertions, termed templated sequence insertion polymorphism (TSIP), in which the inserted sequence was templated from a distant genomic region, and was inserted in the genome through reverse transcription of an RNA intermediate. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; class 1 TSIPs show target site duplication, polyadenylation, and preference for insertion at a 5′-TTTT/A-3′ sequence, suggesting a LINE-1 based insertion mechanism, whereas class 2 TSIPs show features consistent with repair of a DNA double strand break by nonhomologous end joining. To gain a more complete picture of TSIPs throughout the human population, we evaluated whole-genome sequence from 52 individuals, and identified 171 TSIPs. Most individuals had 25–30 TSIPs, and common (present in >20% of individuals) TSIPs were found in individuals throughout the world, whereas rare TSIPs tended to cluster in specific geographic regions. The number of rare TSIPs was greater than the number of common TSIPs, suggesting that TSIP generation is an ongoing process. Intriguingly, mitochondrial sequences were a frequent template for class 2 insertions, used more commonly than any nuclear chromosome. Similar to single nucleotide polymorphisms and indels, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases, and can be useful in tracking historical migration of populations. PMID:25745018

Mobile element biology – new possibilities with high-throughput sequencing

PubMed Central

Xing, Jinchuan; Witherspoon, David J.; Jorde, Lynn B.

2014-01-01

Mobile elements compose more than half of the human genome, but until recently their large-scale detection was time-consuming and challenging. With the development of new high-throughput sequencing technologies, the complete spectrum of mobile element variation in humans can now be identified and analyzed. Thousands of new mobile element insertions have been discovered, yielding new insights into mobile element biology, evolution, and genomic variation. We review several high-throughput methods, with an emphasis on techniques that specifically target mobile element insertions in humans, and we highlight recent applications of these methods in evolutionary studies and in the analysis of somatic alterations in human cancers. PMID:23312846

Josephson junction as the receiving and measuring element in panoramic receiver: frequencymeter in terahertz band

NASA Astrophysics Data System (ADS)

Denisov, Alexander; Gudkov, Alexander; Qiu, Jing Hui

2014-10-01

Josephson junction (JJ) can be used as the criterion in single-block super wide band frequency-meter and as the sensitive element in the super wide band panoramic receiver. There presented the theoretical and experimental investigations and described the innovation decision about to combine both devices in one new microwave device. JJ in this case works in self-pump mode regime. New device can be especially convenient for the experimental purposes with new generation structures when radiated power is small and frequency are unknown correctly.

Functional impact of the human mobilome.

PubMed

Babatz, Timothy D; Burns, Kathleen H

2013-06-01

The human genome is replete with interspersed repetitive sequences derived from the propagation of mobile DNA elements. Three families of human retrotransposons remain active today: LINE1, Alu, and SVA elements. Since 1988, de novo insertions at previously recognized disease loci have been shown to generate highly penetrant alleles in Mendelian disorders. Only recently has the extent of germline-transmitted retrotransposon insertion polymorphism (RIP) in human populations been fully realized. Also exciting are recent studies of somatic retrotransposition in human tissues and reports of tumor-specific insertions, suggesting roles in tissue heterogeneity and tumorigenesis. Here we discuss mobile elements in human disease with an emphasis on exciting developments from the last several years. Copyright © 2013 Elsevier Ltd. All rights reserved.

Activity of genes with functions in human Williams-Beuren Syndrome are impacted by mobile element insertions in the gray wolf genome.

PubMed

vonHoldt, Bridgett M; Ji, Sarah S; Aardema, Matthew L; Stahler, Daniel; Udell, Monique A R; Sinsheimer, Janet S

2018-06-01

In canines, transposon dynamics have been associated with a hyper-social behavioral syndrome, although the functional mechanism has yet to be described. We investigate the epigenetic and transcriptional consequences of these behavior-associated mobile element insertions in dogs and Yellowstone wolves. We posit that the transposons themselves may not be the causative feature; rather, their transcriptional regulation may exert the functional impact. We survey four outlier transposons associated with hyper-sociability, with the expectation that they are targeted for epigenetic silencing. We predict hyper-methylation of mobile element insertions (MEIs), suggestive that the epigenetic silencing of and not the MEIs themselves may be driving dysregulation of nearby genes. We found that transposon-derived sequences are significantly hyper-methylated, regardless of their copy number or species. Further, we have assessed transcriptome sequence data and found evidence that mobile element insertions impact the expression levels of six genes (WBSCR17, LIMK1, GTF2I, WBSCR27, BAZ1B, and BCL7B), all of which have known roles in human Williams-Beuren syndrome due to changes in copy number, typically hemizygosity. Although further evidence is needed, our results suggest that a few insertions alter local expression at multiple genes, likely through a cis-regulatory mechanism that excludes proximal methylation.

The site-specific ribosomal DNA insertion element R1Bm belongs to a class of non-long-terminal-repeat retrotransposons.

PubMed Central

Xiong, Y; Eickbush, T H

1988-01-01

Two types of insertion elements, R1 and R2 (previously called type I and type II), are known to interrupt the 28S ribosomal genes of several insect species. In the silkmoth, Bombyx mori, each element occupies approximately 10% of the estimated 240 ribosomal DNA units, while at most only a few copies are located outside the ribosomal DNA units. We present here the complete nucleotide sequence of an R1 insertion from B. mori (R1Bm). This 5.1-kilobase element contains two overlapping open reading frames (ORFs) which together occupy 88% of its length. ORF1 is 461 amino acids in length and exhibits characteristics of retroviral gag genes. ORF2 is 1,051 amino acids in length and contains homology to reverse transcriptase-like enzymes. The analysis of 3' and 5' ends of independent isolates from the ribosomal locus supports the suggestion that R1 is still functioning as a transposable element. The precise location of the element within the genome implies that its transposition must occur with remarkable insertion sequence specificity. Comparison of the deduced amino acid sequences from six retrotransposons, R1 and R2 of B. mori, I factor and F element of Drosophila melanogaster, L1 of Mus domesticus, and Ingi of Trypanosoma brucei, reveals a relatively high level of sequence homology in the reverse transcriptase region. Like R1, these elements lack long terminal repeats. We have therefore named this class of related elements the non-long-terminal-repeat (non-LTR) retrotransposons. Images PMID:2447482

Placing three-dimensional isoparametric elements into NASTRAN. [alterations in matrix assembly to simplify generation of higher order elements

NASA Technical Reports Server (NTRS)

Newman, M. B.; Filstrup, A. W.

1973-01-01

Linear (8 node), parabolic (20 node), cubic (32 node) and mixed (some edges linear, some parabolic and some cubic) have been inserted into NASTRAN, level 15.1. First the dummy element feature was used to check out the stiffness matrix generation routines for the linear element in NASTRAN. Then, the necessary modules of NASTRAN were modified to include the new family of elements. The matrix assembly was changed so that the stiffness matrix of each isoparametric element is only generated once as the time to generate these higher order elements tends to be much longer than the other elements in NASTRAN. This paper presents some of the experiences and difficulties of inserting a new element or family of elements into NASTRAN.

Identification of Genomic Insertion and Flanking Sequence of G2-EPSPS and GAT Transgenes in Soybean Using Whole Genome Sequencing Method.

PubMed

Guo, Bingfu; Guo, Yong; Hong, Huilong; Qiu, Li-Juan

2016-01-01

Molecular characterization of sequence flanking exogenous fragment insertion is essential for safety assessment and labeling of genetically modified organism (GMO). In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS) method. More than 22.4 Gb sequence data (∼21 × coverage) for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundaries of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of genomic insertion sites of G2-EPSPS and GAT transgenes will facilitate the utilization of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS was a cost-effective and rapid method for identifying sites of T-DNA insertions and flanking sequences in soybean.

Method for producing a thin sample band in a microchannel device

DOEpatents

Griffiths, Stewart K [Livermore, CA; Nilson, Robert H [Cardiff, CA

2004-08-03

The present invention improves the performance of microchannel systems for chemical and biological synthesis and analysis by providing a method and apparatus for producing a thin band of a species sample. Thin sample bands improve the resolution of microchannel separation processes, as well as many other processes requiring precise control of sample size and volume. The new method comprises a series of steps in which a species sample is manipulated by controlled transport through a junction formed at the intersection of four or more channels. A sample is first inserted into the end of one of these channels in the vicinity of the junction. Next, this sample is thinned by transport across the junction one or more times. During these thinning steps, flow enters the junction through one of the channels and exists through those remaining, providing a divergent flow field that progressively stretches and thins the band with each traverse of the junction. The thickness of the resulting sample band may be smaller than the channel width. Moreover, the thickness of the band may be varied and controlled by altering the method alone, without modification to the channel or junction geometries. The invention is applicable to both electroosmotic and electrophoretic transport, to combined electrokinetic transport, and to some special cases in which bulk fluid transport is driven by pressure gradients. It is further applicable to channels that are open, filled with a gel or filled with a porous or granular material.

Apparatus for producing a thin sample band in a microchannel system

DOEpatents

Griffiths, Stewart K [Livermore, CA; Nilson, Robert H [Cardiff, CA

2008-05-13

The present invention improves the performance of microchannel systems for chemical and biological synthesis and analysis by providing a method and apparatus for producing a thin band of a species sample. Thin sample bands improve the resolution of microchannel separation processes, as well as many other processes requiring precise control of sample size and volume. The new method comprises a series of steps in which a species sample is manipulated by controlled transport through a junction formed at the intersection of four or more channels. A sample is first inserted into the end of one of these channels in the vicinity of the junction. Next, this sample is thinned by transport across the junction one or more times. During these thinning steps, flow enters the junction through one of the channels and exists through those remaining, providing a divergent flow field that progressively stretches and thins the band with each traverse of the junction. The thickness of the resulting sample band may be smaller than the channel width. Moreover, the thickness of the band may be varied and controlled by altering the method alone, without modification to the channel or junction geometries. The invention is applicable to both electroosmotic and electrophoretic transport, to combined electrokinetic transport, and to some special cases in which bulk fluid transport is driven by pressure gradients. It is further applicable to channels that are open, filled with a gel or filled with a porous or granular material.

The Tgm9-induced indexed insertional mutant collection to conduct community-based reverse genetics studies in soybean

USDA-ARS?s Scientific Manuscript database

Until now, functional analyses of soybean genes have been very arduous because of the lack of a rapid transformation procedure. Recently identified the active endogenous type II transposable element, Tgm9, excises from insertion sites and restores wild-type phenotypes. Thus, this element provides a ...

“Agrolistic” transformation of plant cells: Integration of T-strands generated in planta

PubMed Central

Hansen, Geneviève; Chilton, Mary-Dell

1996-01-01

We describe a novel plant transformation technique, termed “agrolistic,” that combines the advantages of the Agrobacterium transformation system with the high efficiency of biolistic DNA delivery. Agrolistic transformation allows integration of the gene of interest without undesired vector sequence. The virulence genes virD1 and virD2 from Agrobacterium tumefaciens that are required in bacteria for excision of T-strands from the tumor-inducing plasmid were placed under the control of the CaMV35S promoter and codelivered with a target plasmid containing border sequences flanking the gene of interest. Transient expression assays in tobacco and in maize cells indicated that vir gene products caused strand-specific nicking in planta at the right border sequence, similar to VirD1/VirD2-catalyzed T-strand excision observed in Agrobacterium. Agrolistically transformed tobacco calli were obtained after codelivery of virD1 and virD2 genes together with a selectable marker flanked by border sequences. Some inserts exhibited right junctions with plant DNA that corresponded precisely to the sequence expected for T-DNA (portion of the tumor-inducing plasmid that is transferred to plant cells) insertion events. We designate these as “agrolistic” inserts, as distinguished from “biolistic” inserts. Both types of inserts were found in some transformed lines. The frequency of agrolistic inserts was 20% that of biolistic inserts. PMID:8962167

[Construction of a general AAV vector regulated by minimal and artificial hypoxic-responsive element].

PubMed

Nie, Xiao-wei; Sun, Li-jun; Hao, Yue-wen; Yang, Guang-xiao; Wang, Quan-ying

2011-03-01

To synthesize the minimal and artificial HRE, and to insert it into the anterior extremity of CMV promoter of a AAV plasmid, and then to construct the AAV regulated by hypoxic-responsive element which was introduced into 293 cell by method of Ca3(PO4)2 using three plasmids. Thus obtaining the adenoassociated virus vector regulated by hypoxic-responsive element was possibly used for gene therapy in ischemia angiocardiopathy and cerebrovascular disease. Artificially synthesize the 36 bp nucleotide sequences of four connection in series HIF-binding sites A/GCGTG(4×HBS)and a 35 bp nucleotide sequences spacing inserted into anterior extremity of CMV promoter TATA Box, then amplified by PCR. The cDNA fragment was confirmed to be right by DNA sequencing. Molecular biology routine method was used to construct a AAV vector regulated by minimal hypoxic-responsive element after the normal CMV promoter in AAV vector was replaced by the CMV promoter included minimal hypoxic-responsive element. Then, NT4-6His-PR39 fusogenic peptide was inserted into MCS of the plasmid, the recombinant AAV vector was obtained by three plasmid co-transfection in 293 cells, in which we can also investigate the expression of 6×His using immunochemistry in hypoxia environment. Artificial HRE was inserted into anterior extremity of CMV promoter and there was a correct spacing between the HRE and the TATA-box. The DNA sequencing and restriction enzyme digestion results indicated that the AAV regulated by hypoxic-responsive element was successfully constructed. Compared to the control group, the expressions of 6×His was significantly increased in the experimental groups in hypoxia environment, which confirmed that the AAV effectually regulated by the minimal HRE was inserted into anterior extremity of CMV promoter. The HRE is inserted into anterior extremity of CMV promoter to lack incision enzyme recognition site by PCR. And eukaryotic expression vector regulated by hypoxic-responsive is constructed. The AAV effectually regulated by the minimal HRE inserted into anterior extremity of CMV promoter. The vector is successfully constructed and it has important theoretical and practical value in the synteresis and therapy of ischemia angiocardiopathy and cerebrovascular disease.

In and out of the rRNA genes: characterization of Pokey elements in the sequenced Daphnia genome

PubMed Central

2013-01-01

Background Only a few transposable elements are known to exhibit site-specific insertion patterns, including the well-studied R-element retrotransposons that insert into specific sites within the multigene rDNA. The only known rDNA-specific DNA transposon, Pokey (superfamily: piggyBac) is found in the freshwater microcrustacean, Daphnia pulex. Here, we present a genome-wide analysis of Pokey based on the recently completed whole genome sequencing project for D. pulex. Results Phylogenetic analysis of Pokey elements recovered from the genome sequence revealed the presence of four lineages corresponding to two divergent autonomous families and two related lineages of non-autonomous miniature inverted repeat transposable elements (MITEs). The MITEs are also found at the same 28S rRNA gene insertion site as the Pokey elements, and appear to have arisen as deletion derivatives of autonomous elements. Several copies of the full-length Pokey elements may be capable of producing an active transposase. Surprisingly, both families of Pokey possess a series of 200 bp repeats upstream of the transposase that is derived from the rDNA intergenic spacer (IGS). The IGS sequences within the Pokey elements appear to be evolving in concert with the rDNA units. Finally, analysis of the insertion sites of Pokey elements outside of rDNA showed a target preference for sites similar to the specific sequence that is targeted within rDNA. Conclusions Based on the target site preference of Pokey elements and the concerted evolution of a segment of the element with the rDNA unit, we propose an evolutionary path by which the ancestors of Pokey elements have invaded the rDNA niche. We discuss how specificity for the rDNA unit may have evolved and how this specificity has played a role in the long-term survival of these elements in the subgenus Daphnia. PMID:24059783

Enhanced photovoltaic performances of graphene/Si solar cells by insertion of a MoS₂ thin film.

PubMed

Tsuboi, Yuka; Wang, Feijiu; Kozawa, Daichi; Funahashi, Kazuma; Mouri, Shinichiro; Miyauchi, Yuhei; Takenobu, Taishi; Matsuda, Kazunari

2015-09-14

Transition-metal dichalcogenides exhibit great potential as active materials in optoelectronic devices because of their characteristic band structure. Here, we demonstrated that the photovoltaic performances of graphene/Si Schottky junction solar cells were significantly improved by inserting a chemical vapor deposition (CVD)-grown, large MoS2 thin-film layer. This layer functions as an effective electron-blocking/hole-transporting layer. We also demonstrated that the photovoltaic properties are enhanced with the increasing number of graphene layers and the decreasing thickness of the MoS2 layer. A high photovoltaic conversion efficiency of 11.1% was achieved with the optimized trilayer-graphene/MoS2/n-Si solar cell.

Total internal reflection optical switch using the reverse breakdown of a pn junction in silicon.

PubMed

Kim, Jong-Hun; Park, Hyo-Hoon

2015-11-01

We demonstrate a new type of silicon total-internal-reflection optical switch with a simple pn junction functioning both as a reflector and a heater. The reflector is placed between asymmetrically y-branched multimode waveguides with an inclination angle corresponding to half of the branch angle. When the reflector is at rest, incident light is reflected in accordance to the refractive index difference due to the plasma dispersion effect of the pre-doped carriers. Switching to the transmission state is attained under a reverse breakdown of the pn junction by the thermo-optic effect which smears the refractive index difference. From this switching scheme, we confirmed the switching operation with a shallow total-internal-reflection region of 1 μm width. At a 6° branch angle, an extinction ratio of 12 dB and an insertion loss of -4.2  dB are achieved along with a thermal heating power of 151.5 mW.

Investigation of fluid-structure interaction with various types of junction coupling

NASA Astrophysics Data System (ADS)

Ahmadi, A.; Keramat, A.

2010-10-01

In this study of water hammer with fluid-structure interaction (FSI) the main aim was the investigation of junction coupling effects. Junction coupling effects were studied in various types of discrete points, such as pumps, valves and branches. The emphasis was placed on an unrestrained pump and branch in the system, and the associated relations were derived for modelling them. Proposed relations were considered as boundary conditions for the numerical modelling which was implemented using the finite element method for the structural equations and the method of characteristics for the hydraulic equations. The results can be used by engineers in finding where junction coupling is significant.

Vector for IS element entrapment and functional characterization based on turning on expression of distal promoterless genes.

PubMed

Szeverényi, I; Hodel, A; Arber, W; Olasz, F

1996-09-26

We constructed and characterized a novel trap vector for rapid isolation of insertion sequences. The strategy used for the isolation of IS elements is based on the ability of many IS elements to turn on the expression of otherwise silent genes distal to some sites of insertion. The simple transposition of an IS element can sometimes cause the constitutive expression of promoterless antibiotic resistance genes resulting in selectable phenotypes. The trap vector pAW1326 is based on a pBR322 replicon, it carries ampicillin and streptomycin resistance genes, and also silenced genes that confer chloramphenicol and kanamycin resistance once activated. The trap vector pAW1326 proved to be efficient and 85 percent of all isolated mutations were insertions. The majority of IS elements resident in the studied Escherichia coli strains tested became trapped, namely IS2, IS3, IS5, IS150, IS186 and Tn1000. We also encountered an insertion sequence, called IS10L/R-2, which is a hybrid of the two IS variants IS10L and IS10R. IS10L/R-2 is absent from most E. coli strains, but it is detectable in some strains such as JM109 which had been submitted to Tn10 mutagenesis. The distribution of the insertion sequences within the trap region was not random. Rather, the integration of chromosomal mobile genetic elements into the offered target sequence occurred in element-specific clusters. This is explained both by the target specificity and by the specific requirements for the activation of gene transcription by the DNA rearrangement. The employed trap vector pAW1326 proved to be useful for the isolation of mobile genetic elements, for a demonstration of their transposition activity as well as for the further characterization of some of the functional parameters of transposition.

Performance tradeoff between lateral and interdigitated doping patterns for high speed carrier-depletion based silicon modulators.

PubMed

Yu, Hui; Pantouvaki, Marianna; Van Campenhout, Joris; Korn, Dietmar; Komorowska, Katarzyna; Dumon, Pieter; Li, Yanlu; Verheyen, Peter; Absil, Philippe; Alloatti, Luca; Hillerkuss, David; Leuthold, Juerg; Baets, Roel; Bogaerts, Wim

2012-06-04

Carrier-depletion based silicon modulators with lateral and interdigitated PN junctions are compared systematically on the same fabrication platform. The interdigitated diode is shown to outperform the lateral diode in achieving a low VπLπ of 0.62 V∙cm with comparable propagation loss at the expense of a higher depletion capacitance. The low VπLπ of the interdigitated PN junction is employed to demonstrate 10 Gbit/s modulation with 7.5 dB extinction ration from a 500 µm long device whose static insertion loss is 2.8 dB. In addition, up to 40 Gbit/s modulation is demonstrated for a 3 mm long device comprising a lateral diode and a co-designed traveling wave electrode.

SINE Retrotransposition: Evaluation of Alu Activity and Recovery of De Novo Inserts.

PubMed

Ade, Catherine; Roy-Engel, Astrid M

2016-01-01

Mobile element activity is of great interest due to its impact on genomes. However, the types of mobile elements that inhabit any given genome are remarkably varied. Among the different varieties of mobile elements, the Short Interspersed Elements (SINEs) populate many genomes, including many mammalian species. Although SINEs are parasites of Long Interspersed Elements (LINEs), SINEs have been highly successful in both the primate and rodent genomes. When comparing copy numbers in mammals, SINEs have been vastly more successful than other nonautonomous elements, such as the retropseudogenes and SVA. Interestingly, in the human genome the copy number of Alu (a primate SINE) outnumbers LINE-1 (L1) copies 2 to 1. Estimates suggest that the retrotransposition rate for Alu is tenfold higher than LINE-1 with about 1 insert in every twenty births. Furthermore, Alu-induced mutagenesis is responsible for the majority of the documented instances of human retroelement insertion-induced disease. However, little is known on what contributes to these observed differences between SINEs and LINEs. The development of an assay to monitor SINE retrotransposition in culture has become an important tool for the elucidation of some of these differences. In this chapter, we present details of the SINE retrotransposition assay and the recovery of de novo inserts. We also focus on the nuances that are unique to the SINE assay.

``Dressing'' lines and vertices in calculations of matrix elements with the coupled-cluster method and determination of Cs atomic properties

NASA Astrophysics Data System (ADS)

Derevianko, Andrei; Porsev, Sergey G.

2005-03-01

We consider evaluation of matrix elements with the coupled-cluster method. Such calculations formally involve infinite number of terms and we devise a method of partial summation (dressing) of the resulting series. Our formalism is built upon an expansion of the product C†C of cluster amplitudes C into a sum of n -body insertions. We consider two types of insertions: particle (hole) line insertion and two-particle (two-hole) random-phase-approximation-like insertion. We demonstrate how to “dress” these insertions and formulate iterative equations. We illustrate the dressing equations in the case when the cluster operator is truncated at single and double excitations. Using univalent systems as an example, we upgrade coupled-cluster diagrams for matrix elements with the dressed insertions and highlight a relation to pertinent fourth-order diagrams. We illustrate our formalism with relativistic calculations of the hyperfine constant A(6s) and the 6s1/2-6p1/2 electric-dipole transition amplitude for the Cs atom. Finally, we augment the truncated coupled-cluster calculations with otherwise omitted fourth order diagrams. The resulting analysis for Cs is complete through the fourth order of many-body perturbation theory and reveals an important role of triple and disconnected quadruple excitations.

Method Producing an SNS Superconducting Junction with Weak Link Barrier

NASA Technical Reports Server (NTRS)

Hunt, Brian D. (Inventor)

1999-01-01

A method of producing a high temperature superconductor Josephson element and an improved SNS weak link barrier element is provided. A YBaCuO superconducting electrode film is deposited on a substrate at a temperature of approximately 800 C. A weak link barrier layer of a nonsuperconducting film of N-YBaCuO is deposited over the electrode at a temperature range of 520 C. to 540 C. at a lower deposition rate. Subsequently a superconducting counter-electrode film layer of YBaCuO is deposited over the weak link barrier layer at approximately 800 C. The weak link barrier layer has a thickness of approximately 50 A and the SNS element can be constructed to provide an edge geometry junction.

The Application of Ultrasonic Inspection to Crimped Electrical Connections

NASA Technical Reports Server (NTRS)

Cramer, K. Elliott; Perey, Daniel F.; Yost, William T.

2010-01-01

The development of a new ultrasonic measurement technique to quantitatively assess wire crimp terminations is discussed. The development of a prototype instrument, based on a modified, commercially available, crimp tool, is demonstrated for applying this technique when wire crimps are installed. The crimp tool has three separate crimping locations that accommodate the three different ferrule diameters. The crimp tool in this study is capable of crimping wire diameters ranging from 12 to 26 American Wire Gauge (AWG). A transducer design is presented that allows for interrogation of each of the three crimp locations on the crimp tool without reconfiguring the device. An analysis methodology, based on transmitted ultrasonic energy and timing of the first received pulse is shown to correlate to both crimp location in the tool and the AWG of the crimp/ferrule combination. The detectability of a number of the crimp failure pathologies, such as missing strands, partially inserted wires and incomplete crimp compression, is discussed. A wave propagation model, solved by finite element analysis, describes the compressional ultrasonic wave propagation through the junction during the crimping process.

E-cadherin junction formation involves an active kinetic nucleation process

PubMed Central

Biswas, Kabir H.; Hartman, Kevin L.; Yu, Cheng-han; Harrison, Oliver J.; Song, Hang; Smith, Adam W.; Huang, William Y. C.; Lin, Wan-Chen; Guo, Zhenhuan; Padmanabhan, Anup; Troyanovsky, Sergey M.; Dustin, Michael L.; Shapiro, Lawrence; Honig, Barry; Zaidel-Bar, Ronen; Groves, Jay T.

2015-01-01

Epithelial (E)-cadherin-mediated cell−cell junctions play important roles in the development and maintenance of tissue structure in multicellular organisms. E-cadherin adhesion is thus a key element of the cellular microenvironment that provides both mechanical and biochemical signaling inputs. Here, we report in vitro reconstitution of junction-like structures between native E-cadherin in living cells and the extracellular domain of E-cadherin (E-cad-ECD) in a supported membrane. Junction formation in this hybrid live cell-supported membrane configuration requires both active processes within the living cell and a supported membrane with low E-cad-ECD mobility. The hybrid junctions recruit α-catenin and exhibit remodeled cortical actin. Observations suggest that the initial stages of junction formation in this hybrid system depend on the trans but not the cis interactions between E-cadherin molecules, and proceed via a nucleation process in which protrusion and retraction of filopodia play a key role. PMID:26290581

E-cadherin junction formation involves an active kinetic nucleation process

DOE PAGES

Biswas, Kabir H.; Hartman, Kevin L.; Yu, Cheng -han; ...

2015-08-19

Epithelial (E)-cadherin-mediated cell–cell junctions play important roles in the development and maintenance of tissue structure in multicellular organisms. E-cadherin adhesion is thus a key element of the cellular microenvironment that provides both mechanical and biochemical signaling inputs. Here, we report in vitro reconstitution of junction-like structures between native E-cadherin in living cells and the extracellular domain of E-cadherin in a supported membrane. Junction formation in this hybrid live cell-supported membrane configuration requires both active processes within the living cell and a supported membrane with low E-cad-ECD mobility. The hybrid junctions recruit α-catenin and exhibit remodeled cortical actin. Observations suggest thatmore » the initial stages of junction formation in this hybrid system depend on the trans but not the cis interactions between E-cadherin molecules, and proceed via a nucleation process in which protrusion and retraction of filopodia play a key role.« less

E-cadherin junction formation involves an active kinetic nucleation process

DOE Office of Scientific and Technical Information (OSTI.GOV)

Biswas, Kabir H.; Hartman, Kevin L.; Yu, Cheng -han

Epithelial (E)-cadherin-mediated cell–cell junctions play important roles in the development and maintenance of tissue structure in multicellular organisms. E-cadherin adhesion is thus a key element of the cellular microenvironment that provides both mechanical and biochemical signaling inputs. Here, we report in vitro reconstitution of junction-like structures between native E-cadherin in living cells and the extracellular domain of E-cadherin in a supported membrane. Junction formation in this hybrid live cell-supported membrane configuration requires both active processes within the living cell and a supported membrane with low E-cad-ECD mobility. The hybrid junctions recruit α-catenin and exhibit remodeled cortical actin. Observations suggest thatmore » the initial stages of junction formation in this hybrid system depend on the trans but not the cis interactions between E-cadherin molecules, and proceed via a nucleation process in which protrusion and retraction of filopodia play a key role.« less

77 FR 12278 - Questar Pipeline Company; Notice of Availability of the Environmental Assessment for the Proposed...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-02-29

... Mainline 103; and Construct a pig launcher/receiver \\1\\ at the new Mainline 103/68 junction. \\1\\ A pipeline ``pig'' is a device used to clean or inspect the pipeline. A pig launcher/receiver is an aboveground facility where pigs are inserted or retrieved from the pipeline. The FERC staff mailed copies of the EA to...

Insertion sequences enrichment in extreme Red sea brine pool vent.

PubMed

Elbehery, Ali H A; Aziz, Ramy K; Siam, Rania

2017-03-01

Mobile genetic elements are major agents of genome diversification and evolution. Limited studies addressed their characteristics, including abundance, and role in extreme habitats. One of the rare natural habitats exposed to multiple-extreme conditions, including high temperature, salinity and concentration of heavy metals, are the Red Sea brine pools. We assessed the abundance and distribution of different mobile genetic elements in four Red Sea brine pools including the world's largest known multiple-extreme deep-sea environment, the Red Sea Atlantis II Deep. We report a gradient in the abundance of mobile genetic elements, dramatically increasing in the harshest environment of the pool. Additionally, we identified a strong association between the abundance of insertion sequences and extreme conditions, being highest in the harshest and deepest layer of the Red Sea Atlantis II Deep. Our comparative analyses of mobile genetic elements in secluded, extreme and relatively non-extreme environments, suggest that insertion sequences predominantly contribute to polyextremophiles genome plasticity.

Rapid discrimination of sequences flanking and within T-DNA insertions in the Arabidopsis genome.

PubMed

Ponce, M R; Quesada, V; Micol, J L

1998-05-01

An improvement to previous methods for recovering Arabidopsis thaliana genomic DNA flanking T-DNA insertions is presented that allows for the avoidance of some of the cloning difficulties caused by the concatameric nature of T-DNA inserts. The principle of the procedure is to categorize by size restriction fragments of mutant DNA, produced in separate digestions with NdeI and Bst1107I. Given that the sites for these two enzymes are contiguous within the pGV3850:1003 T-DNA construct, the restriction fragments obtained fall into two categories: those showing identical size in both digestions, which correspond to sequences internal to T-DNA concatamers; and those of different sizes, that contain the junctions between plant DNA and the T-DNA insert. Such a criterion makes it possible to easily distinguish the digestion products corresponding to internal T-DNA parts, which do not deserve further attention, and those which presumably include a segment of the locus of interest. Discrimination between restriction fragments of genomic mutant DNA can be made on rescued plasmids, inverse PCR amplification products or bands in a genomic blot.

Modified band alignment effect in ZnO/Cu2O heterojunction solar cells via Cs2O buffer insertion

NASA Astrophysics Data System (ADS)

Eom, Kiryung; Lee, Dongyoon; Kim, Seunghwan; Seo, Hyungtak

2018-02-01

The effects of a complex buffer layer of cesium oxide (Cs2O) on the photocurrent response in oxide heterojunction solar cells (HSCs) were investigated. A p-n junction oxide HSC was fabricated using p-type copper (I) oxide (Cu2O) and n-type zinc oxide (ZnO); the buffer layer was inserted between the Cu2O and fluorine-doped tin oxide (FTO). Ultraviolet-visible (UV-vis) and x-ray and ultraviolet photoelectron spectroscopy analyses were performed to characterize the electronic band structures of cells, both with and without this buffer layer. In conjunction with the measured band electronic structures, the significantly improved visible-range photocurrent spectra of the buffer-inserted HSC were analyzed in-depth. As a result, the 1 sun power conversion efficiency was increased by about three times by the insertion of buffer layer. The physicochemical origin of the photocurrent enhancement was mainly ascribed to the increased photocarrier density in the buffer layer and modified valence band offset to promote the effective hole transfer at the interface to FTO on the band-alignment model.

SECIS elements in the coding regions of selenoprotein transcripts are functional in higher eukaryotes

PubMed Central

Mix, Heiko; Lobanov, Alexey V.; Gladyshev, Vadim N.

2007-01-01

Expression of selenocysteine (Sec)-containing proteins requires the presence of a cis-acting mRNA structure, called selenocysteine insertion sequence (SECIS) element. In bacteria, this structure is located in the coding region immediately downstream of the Sec-encoding UGA codon, whereas in eukaryotes a completely different SECIS element has evolved in the 3′-untranslated region. Here, we report that SECIS elements in the coding regions of selenoprotein mRNAs support Sec insertion in higher eukaryotes. Comprehensive computational analysis of all available viral genomes revealed a SECIS element within the ORF of a naturally occurring selenoprotein homolog of glutathione peroxidase 4 in fowlpox virus. The fowlpox SECIS element supported Sec insertion when expressed in mammalian cells as part of the coding region of viral or mammalian selenoproteins. In addition, readthrough at UGA was observed when the viral SECIS element was located upstream of the Sec codon. We also demonstrate successful de novo design of a functional SECIS element in the coding region of a mammalian selenoprotein. Our data provide evidence that the location of the SECIS element in the untranslated region is not a functional necessity but rather is an evolutionary adaptation to enable a more efficient synthesis of selenoproteins. PMID:17169995

Tendon healing in a bone tunnel. Part II: Histologic analysis after biodegradable interference fit fixation in a model of anterior cruciate ligament reconstruction in sheep.

PubMed

Weiler, Andreas; Hoffmann, Reinhard F G; Bail, Hermann J; Rehm, Oliver; Südkamp, Norbert P

2002-02-01

Tendon-to-bone healing of soft-tissue grafts has been described to progress by the development of a fibrous interzone that undergoes a maturation process leading to the development of an indirect type of ligament insertion. Previous studies used extra-articular models or fixation far away from the joint line; thus, no data are available investigating tendon-to-bone healing of a soft-tissue graft fixed anatomically. Therefore, we studied the tendon-to-bone healing of the anatomic soft-tissue graft interference fit fixation in a model of anterior cruciate ligament (ACL) reconstruction in sheep. Animal study. Thirty-five mature sheep underwent ACL reconstruction with an autologous Achilles tendon split graft. Grafts were directly fixed with biodegradable poly-(D,L-lactide) interference screws. Animals were euthanized after 6, 9, 12, 24, and 52 weeks and histologic evaluations were performed. Undecalcified specimens were evaluated under normal and polarized light. Additionally, animals received a polychrome sequential labeling (tetracycline, xylenol orange, and calcein green) to determine bone growth per time under fluorescent light. Intratunnel histologic findings at 6 weeks showed a tendon-bone junction with only a partial fibrous interzone between the graft tissue and the surrounding bone. A mature intratunnel tendon-bone junction with a zone of fibrocartilage was found at 9 to 12 weeks. At the tunnel entrance site a wide regular ligamentous insertion site was seen in all specimens after 24 weeks. This insertion showed regular patterns such as the direct type of insertion of a normal ligament with a dense basophilic transition zone consisting of mineralized cartilage. A fibrous interzone between the graft tissue and the bone tunnel was only partially developed, which is in contrast to all previous studies in which nonanatomic fixation was used. Thus, it is reasonable to assume that the tendon-to-bone healing in the present study may progress partially by direct-contact healing without the development of a fibrous interzone. To our knowledge, this is the first report describing the development of a direct type of ligament insertion after ACL replacement with a soft-tissue graft. This is in contrast to previous studies reporting the development of an indirect type of insertion when using nonanatomic fixation far away from the joint line. Thus, histologic data strongly indicate that anatomic interference fit fixation is beneficial for tendon-to-bone incorporation by leading to the development of a direct type of ligament insertion.

New high-efficiency silicon solar cells

NASA Technical Reports Server (NTRS)

Daud, T.; Crotty, G. T.

1985-01-01

A design for silicon solar cells was investigated as an approach to increasing the cell open-circuit voltage and efficiency for flat-plate terrestrial photovoltaic applications. This deviates from past designs, where either the entire front surface of the cell is covered by a planar junction or the surface is textured before junction formation, which results in an even greater (up to 70%) junction area. The heavily doped front region and the junction space charge region are potential areas of high recombination for generated and injected minority carriers. The design presented reduces junction area by spreading equidiameter dot junctions across the surface of the cell, spaced about a diffusion length or less from each other. Various dot diameters and spacings allowed variations in total junction area. A simplified analysis was done to obtain a first-order design optimization. Efficiencies of up to 19% can be obtained. Cell fabrication involved extra masking steps for selective junction diffusion, and made surface passivation a key element in obtaining good collection. It also involved photolithography, with line widths down to microns. A method is demonstrated for achieving potentially high open-circuit voltages and solar-cell efficiencies.

The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure.

PubMed

Valle-García, David; Griffiths, Lyra M; Dyer, Michael A; Bernstein, Emily; Recillas-Targa, Félix

2014-01-01

The SWI/SNF-like chromatin-remodeling protein ATRX has emerged as a key factor in the regulation of α-globin gene expression, incorporation of histone variants into the chromatin template and, more recently, as a frequently mutated gene across a wide spectrum of cancers. Therefore, the availability of a functional ATRX cDNA for expression studies is a valuable tool for the scientific community. We have identified two independent transposon insertions of a bacterial IS10 element into exon 8 of ATRX isoform 2 coding sequence in two different plasmids derived from a single source. We demonstrate that these insertion events are common and there is an insertion hotspot within the ATRX cDNA. Such IS10 insertions produce a truncated form of ATRX, which significantly compromises its nuclear localization. In turn, we describe ways to prevent IS10 insertion during propagation and cloning of ATRX-containing vectors, including optimal growth conditions, bacterial strains, and suggested sequencing strategies. Finally, we have generated an insertion-free plasmid that is available to the community for expression studies of ATRX.

A major insertion accounts for a significant proportion of mutations underlying human lipoprotein lipase deficiency

DOE Office of Scientific and Technical Information (OSTI.GOV)

Langlois, S.; Kastelein, J.J.; Hayden, M.R.

1989-02-01

Lipoprotein lipase is an important enzyme involved in triacylglycerol metabolism. Primary LPL deficiency is a genetic disorder that is usually manifested by a severe elevation in triacylglycerol levels. The authors have used a recently isolated LPL cDNA clone to study 15 probands from 11 families with this inherited disorder. Surprisingly, 7 of the probands from 4 families, of different ancestries, had a similar insertion in their LPL gene. In contrast to other human genetic disorders, where insertions are rare causes of mutation, this insertion accounts for a significant proportion of the alleles causing LPL deficiency. Detailed restriction mapping of themore » insertion revealed that it was unlikely to be a duplication of neighboring DNA and that it was not similar to the consensus sequence of human L1 repetitive elements. This suggests that there must be other mechanisms of insertional mutagenesis in human genetic disease besides transposition of mobile L1 repetitive elements.« less

Insertion of an SVA element, a nonautonomous retrotransposon, in PMS2 intron 7 as a novel cause of Lynch syndrome.

PubMed

van der Klift, Heleen M; Tops, Carli M; Hes, Frederik J; Devilee, Peter; Wijnen, Juul T

2012-07-01

Heterozygous germline mutations in the mismatch repair gene PMS2 predispose carriers for Lynch syndrome, an autosomal dominant predisposition to cancer. Here, we present a LINE-1-mediated retrotranspositional insertion in PMS2 as a novel mutation type for Lynch syndrome. This insertion, detected with Southern blot analysis in the genomic DNA of the patient, is characterized as a 2.2 kb long 5' truncated SVA_F element. The insertion is not detectable by current diagnostic testing limited to MLPA and direct Sanger sequencing on genomic DNA. The molecular nature of this insertion could only be resolved in RNA from cultured lymphocytes in which nonsense-mediated RNA decay was inhibited. Our report illustrates the technical problems encountered in the detection of this mutation type. Especially large heterozygous insertions will remain unnoticed because of preferential amplification of the smaller wild-type allele in genomic DNA, and are probably underreported in the mutation spectra of autosomal dominant disorders. © 2012 Wiley Periodicals, Inc.

The Genome Sequence of Avibacterium paragallinarum Strain CL Has a Large Repertoire of Insertion Sequence Elements.

PubMed

Horta-Valerdi, Guillermo; Sanchez-Alonso, Maria Patricia; Perez-Marquez, Victor M; Negrete-Abascal, Erasmo; Vaca-Pacheco, Sergio; Hernandez-Gonzalez, Ismael; Gomez-Lunar, Zulema; Olmedo-Álvarez, Gabriela; Vázquez-Cruz, Candelario

2017-04-13

The draft genome sequence of Avibacterium paragallinarum strain CL serovar C is reported here. The genome comprises 154 contigs corresponding to 2.4 Mb with 41% G+C content and many insertion sequence (IS) elements, a characteristic not previously reported in A. paragallinarum . Copyright © 2017 Horta-Valerdi et al.

Transposon Insertion Finder (TIF): a novel program for detection of de novo transpositions of transposable elements.

PubMed

Nakagome, Mariko; Solovieva, Elena; Takahashi, Akira; Yasue, Hiroshi; Hirochika, Hirohiko; Miyao, Akio

2014-03-14

Transposition event detection of transposable element (TE) in the genome using short reads from the next-generation sequence (NGS) was difficult, because the nucleotide sequence of TE itself is repetitive, making it difficult to identify locations of its insertions by alignment programs for NGS. We have developed a program with a new algorithm to detect the transpositions from NGS data. In the process of tool development, we used next-generation sequence (NGS) data of derivative lines (ttm2 and ttm5) of japonica rice cv. Nipponbare, regenerated through cell culture. The new program, called a transposon insertion finder (TIF), was applied to detect the de novo transpositions of Tos17 in the regenerated lines. TIF searched 300 million reads of a line within 20 min, identifying 4 and 12 de novo transposition in ttm2 and ttm5 lines, respectively. All of the transpositions were confirmed by PCR/electrophoresis and sequencing. Using the program, we also detected new transposon insertions of P-element from NGS data of Drosophila melanogaster. TIF operates to find the transposition of any elements provided that target site duplications (TSDs) are generated by their transpositions.

Dynamic analysis of a needle insertion for soft materials: Arbitrary Lagrangian-Eulerian-based three-dimensional finite element analysis.

PubMed

Yamaguchi, Satoshi; Tsutsui, Kihei; Satake, Koji; Morikawa, Shigehiro; Shirai, Yoshiaki; Tanaka, Hiromi T

2014-10-01

Our goal was to develop a three-dimensional finite element model that enables dynamic analysis of needle insertion for soft materials. To demonstrate large deformation and fracture, we used the arbitrary Lagrangian-Eulerian (ALE) method for fluid analysis. We performed ALE-based finite element analysis for 3% agar gel and three types of copper needle with bevel tips. To evaluate simulation results, we compared the needle deflection and insertion force with corresponding experimental results acquired with a uniaxial manipulator. We studied the shear stress distribution of agar gel on various time scales. For 30°, 45°, and 60°, differences in deflections of each needle between both sets of results were 2.424, 2.981, and 3.737mm, respectively. For the insertion force, there was no significant difference for mismatching area error (p<0.05) between simulation and experimental results. Our results have the potential to be a stepping stone to develop pre-operative surgical planning to estimate an optimal needle insertion path for MR image-guided microwave coagulation therapy and for analyzing large deformation and fracture in biological tissues. Copyright © 2014 Elsevier Ltd. All rights reserved.

Successful Gene Tagging in Lettuce Using the Tnt1 Retrotransposon from Tobacco

PubMed Central

Mazier, Marianne; Botton, Emmanuel; Flamain, Fabrice; Bouchet, Jean-Paul; Courtial, Béatrice; Chupeau, Marie-Christine; Chupeau, Yves; Maisonneuve, Brigitte; Lucas, Hélène

2007-01-01

The tobacco (Nicotiana tabacum) element Tnt1 is one of the few identified active retrotransposons in plants. These elements possess unique properties that make them ideal genetic tools for gene tagging. Here, we demonstrate the feasibility of gene tagging using the retrotransposon Tnt1 in lettuce (Lactuca sativa), which is the largest genome tested for retrotransposon mutagenesis so far. Of 10 different transgenic bushes carrying a complete Tnt1 containing T-DNA, eight contained multiple transposed copies of Tnt1. The number of transposed copies of the element per plant was particularly high, the smallest number being 28. Tnt1 transposition in lettuce can be induced by a very simple in vitro culture protocol. Tnt1 insertions were stable in the progeny of the primary transformants and could be segregated genetically. Characterization of the sequences flanking some insertion sites revealed that Tnt1 often inserted into genes. The progeny of some primary transformants showed phenotypic alterations due to recessive mutations. One of these mutations was due to Tnt1 insertion in the gibberellin 3β-hydroxylase gene. Taken together, these results indicate that Tnt1 is a powerful tool for insertion mutagenesis especially in plants with a large genome. PMID:17351058

Demonstration of the Potential of Magnetic Tunnel Junctions for a Universal RAM Technology

NASA Astrophysics Data System (ADS)

Gallagher, William J.

2000-03-01

Over the past four years, tunnel junctions with magnetic electrodes have emerged as promising devices for future magnetoresistive sensing and for information storage. This talk will review advances in these devices, focusing particularly on the use of magnetic tunnel junctions for magnetic random access memory (MRAM). Exchange-biased versions of magnetic tunnel junctions (MTJs) in particular will be shown to have useful properties for forming magnetic memory storage elements in a novel cross-point architecture. Exchange-biased MTJ elements have been made with areas as small as 0.1 square microns and have shown magnetoresistance values exceeding 40 The potential of exchange-biased MTJs for MRAM has been most seriously explored in a demonstration experiment involving the integration of 0.25 micron CMOS technology with a special magnetic tunnel junction "back end." The magnetic back end is based upon multi-layer magnetic tunnel junction growth technology which was developed using research-scale equipment and one-inch size substrates. For the demonstration, the CMOS wafers processed through two metal layers were cut into one-inch squares for depositions of bottom-pinned exchange-biased magnetic tunnel junctions. The samples were then processed through four additional lithographic levels to complete the circuits. The demonstration focused attention on a number of processing and device issues that were addressed successfully enough that key performance aspects of MTJ MRAM were demonstrated in 1 K bit arrays, including reads and writes in less than 10 ns and nonvolatility. While other key issues remain to be addressed, these results suggest that MTJ MRAM might simultaneously provide much of the functionality now provided separately by SRAM, DRAM, and NVRAM.

Regulation of gap junction channels and hemichannels by phosphorylation and redox changes: a revision.

PubMed

Pogoda, Kristin; Kameritsch, Petra; Retamal, Mauricio A; Vega, José L

2016-05-24

Post-translational modifications of connexins play an important role in the regulation of gap junction and hemichannel permeability. The prerequisite for the formation of functional gap junction channels is the assembly of connexin proteins into hemichannels and their insertion into the membrane. Hemichannels can affect cellular processes by enabling the passage of signaling molecules between the intracellular and extracellular space. For the intercellular communication hemichannels from one cell have to dock to its counterparts on the opposing membrane of an adjacent cell to allow the transmission of signals via gap junctions from one cell to the other. The controlled opening of hemichannels and gating properties of complete gap junctions can be regulated via post-translational modifications of connexins. Not only channel gating, but also connexin trafficking and assembly into hemichannels can be affected by post-translational changes. Recent investigations have shown that connexins can be modified by phosphorylation/dephosphorylation, redox-related changes including effects of nitric oxide (NO), hydrogen sulfide (H2S) or carbon monoxide (CO), acetylation, methylation or ubiquitination. Most of the connexin isoforms are known to be phosphorylated, e.g. Cx43, one of the most studied connexin at all, has 21 reported phosphorylation sites. In this review, we provide an overview about the current knowledge and relevant research of responsible kinases, connexin phosphorylation sites and reported effects on gap junction and hemichannel regulation. Regarding the effects of oxidants we discuss the role of NO in different cell types and tissues and recent studies about modifications of connexins by CO and H2S.

Electronic transport across a junction between armchair graphene nanotube and zigzag nanoribbon. Transmission in an armchair nanotube without a zigzag half-line of dimers

NASA Astrophysics Data System (ADS)

Sharma, Basant Lal

2018-05-01

Based on the well known nearest-neighbor tight-binding approximation for graphene, an exact expression for the electronic conductance across a zigzag nanoribbon/armchair nanotube junction is presented for non-interacting electrons. The junction results from the removal of a half-row of zigzag dimers in armchair nanotube, or equivalently by partial rolling of zigzag nanoribbon and insertion of a half-row of zigzag dimers in between. From the former point of view, a discrete form of Dirichlet condition is imposed on a zigzag half-line of dimers assuming the vanishing of wave function outside the physical structure. A closed form expression is provided for the reflection and transmission moduli for the outgoing wave modes for each given electronic wave mode incident from either side of the junction. It is demonstrated that such a contact junction between the nanotube and nanoribbon exhibits negligible backscattering, and the transmission has been found to be nearly ballistic. In contrast to the previously reported studies for partially unzipped carbon nanotubes (CNTs), using the same tight binding model, it is found that due to the "defect" there is certain amount of mixing between the electronic wave modes with even and odd reflection symmetries. But the junction remains a perfect valley filter for CNTs at certain energy ranges. Applications aside from the electronic case, include wave propagation in quasi-one-dimensional honeycomb structures of graphene-like constitution. The paper includes several numerical calculations, analytical derivations, and graphical results, which complement the provision of succinct closed form expressions.

Where tendons and ligaments meet bone: attachment sites (‘entheses’) in relation to exercise and/or mechanical load

PubMed Central

Benjamin, M; Toumi, H; Ralphs, J R; Bydder, G; Best, T M; Milz, S

2006-01-01

Entheses (insertion sites, osteotendinous junctions, osteoligamentous junctions) are sites of stress concentration at the region where tendons and ligaments attach to bone. Consequently, they are commonly subject to overuse injuries (enthesopathies) that are well documented in a number of sports. In this review, we focus on the structure–function correlations of entheses on both the hard and the soft tissue sides of the junction. Particular attention is paid to mechanical factors that influence form and function and thus to exploring the relationship between entheses and exercise. The molecular parameters indicative of adaptation to mechanical stress are evaluated, and the basis on which entheses are classified is explained. The application of the ‘enthesis organ’ concept (a collection of tissues adjacent to the enthesis itself, which jointly serve the common function of stress dissipation) to understanding enthesopathies is considered and novel roles of adipose tissue at entheses are reviewed. A distinction is made between different locations of fat at entheses, and possible functions include space-filling and proprioception. The basic anchorage role of entheses is considered in detail and comparisons are explored between entheses and other biological ‘anchorage’ sites. The ability of entheses for self-repair is emphasized and a range of enthesopathies common in sport are reviewed (e.g. tennis elbow, golfer's elbow, jumper's knee, plantar fasciitis and Achilles insertional tendinopathies). Attention is drawn to the degenerative, rather than inflammatory, nature of most enthesopathies in sport. The biomechanical factors contributing to the development of enthesopathies are reviewed and the importance of considering the muscle–tendon–bone unit as a whole is recognized. Bony spur formation is assessed in relation to other changes at entheses which parallel those in osteoarthritic synovial joints. PMID:16637873

Microwave integrated circuit for Josephson voltage standards

NASA Technical Reports Server (NTRS)

Holdeman, L. B.; Toots, J.; Chang, C. C. (Inventor)

1980-01-01

A microwave integrated circuit comprised of one or more Josephson junctions and short sections of microstrip or stripline transmission line is fabricated from thin layers of superconducting metal on a dielectric substrate. The short sections of transmission are combined to form the elements of the circuit and particularly, two microwave resonators. The Josephson junctions are located between the resonators and the impedance of the Josephson junctions forms part of the circuitry that couples the two resonators. The microwave integrated circuit has an application in Josephson voltage standards. In this application, the device is asymmetrically driven at a selected frequency (approximately equal to the resonance frequency of the resonators), and a d.c. bias is applied to the junction. By observing the current voltage characteristic of the junction, a precise voltage, proportional to the frequency of the microwave drive signal, is obtained.

Development of Balanced SIS Mixers for ALMA Band-10

NASA Astrophysics Data System (ADS)

Shitov, Sergey V.; Koryukin, Oleg V.; Uzawa, Yoshinory; Noguchi, Takashi; Uvarov, Andrey V.; Cohn, Ilya A.

2006-05-01

A few concepts of a wide-band balanced SIS mixer employing submicron-sized SIS junctions are under development for 787-950 GHz frequency range. A quasioptical DSB balanced mixer with integrated cross-slot antenna is considered as the less laborious and cheaper option. The silicon lens-antenna beam efficiency is expected above 80 % across the whole band with first-order sidelobe below -16 dB. To use the conservative horn antenna solution, a single chamber waveguide DSB balanced mixer is developed. Two equal probe-type SIS chips are inserted into a full-height waveguide through its opposite broad walls; these two mixers are driven by the signal waveguide in series. The LO current is transferred to the mixers in parallel via a capacitive probe inserted through the narrow wall of the signal waveguide from the neighboring LO waveguide. The HFSS model demonstrated the LO power coupling efficiency above -3 dB, almost perfect signal transfer and the LO cross talk below -30 dB that take into account misalignment (misbalance) of the chips. It is demonstrated numerically using Tucker's 3-port model that unequal pump of junctions of a twin-SIS mixer can lead, in spite of the perfect signal coupling, to degradation of the gain performance up to -3 dB, especially at the top of the ALMA Band-10.

Obstructive hydrocephalus secondary to odontoid pannus: case report and review of literature.

PubMed

Soon, Wai Cheong; Thanabalasundaram, Gopiga; Thant, Kyaw Zayar; Ogbonnaya, Ebere Sunny; Harrisson, Stuart Edward

2018-04-01

Odontoid pannus or periodontoid pseudotumour is associated with a variety of rheumatological conditions. We report a case of an 80-year old man who presented with acute hydrocephalus following an emergency operation to amputate his infected left big toe. Imaging revealed a large tissue mass causing severe compression at the cervico-medullary junction and obstruction of CSF flow. The acute hydrocephalus was presumed to be related to neck manoeuvring during general anaesthesia. Following an initial emergency CSF diversion through external ventricular drainage catheter insertion, the patient subsequently underwent ventriculo-peritoneal insertion and posterior spinal decompression and fixation. To our knowledge, there have been no reported cases of tophaceous gout of the odontoid pannus causing acute hydrocephalus.

Enhancing electron transport in molecular wires by insertion of a ferrocene center.

PubMed

Sun, Yan-Yan; Peng, Zheng-Lian; Hou, Rong; Liang, Jing-Hong; Zheng, Ju-Fang; Zhou, Xiao-Yi; Zhou, Xiao-Shun; Jin, Shan; Niu, Zhen-Jiang; Mao, Bing-Wei

2014-02-14

We have determined the conductance of alkane-linked ferrocene molecules with carboxylic acid anchoring groups using the STM break junction technique, and three sets of conductance values were found, i.e. high conductance (HC), medium conductance (MC) and low conductance (LC) values. The enhancing effect of the incorporated ferrocene on the electron transport in saturated alkane molecular wires is demonstrated by the increased conductance of the ferrocene molecules, attributed to the reduction of the tunneling barrier and the HOMO-LUMO gap induced by the insertion of ferrocene. Furthermore, the electron-withdrawing carbonyl group on the unconjugated backbone has little or no influence on single-molecule conductance. The current work provides a feasible approach for the design of high-performance molecular wires.

Retrotransposons of the Tnt1B family are mobile in Nicotiana plumbaginifolia and can induce alternative splicing of the host gene upon insertion.

PubMed

Leprinc, A S; Grandbastien, M A; Christian, M

2001-11-01

Active retrotransposons have been identified in Nicotiana plumbaginifolia by their ability to disrupt the nitrate reductase gene in chlorate-resistant mutants selected from protoplast-derived cultures. In mutants E23 and F97, two independent insertions of Tnp2, a new retrotransposon closely related to the tobacco Tnt1 elements, were detected in the nitrate reductase gene. These two Tnp2 elements are members of the Tnt1B subfamily which shows that Tnt1B elements can be active and mutagenic in the N. plumbaginifolia genome. Furthermore, these results suggest that Tnt1B is the most active family of Tntl elements in N. plumbaginifolia, whereas in tobacco only members of the Tnt1A subfamily were found inserted in the nitrate reductase gene. The transcriptional regulations of Tnp2 and Tnt1A elements are most probably different due to non-conserved U3 regions. Our results thus support the hypothesis that different Nicotiana species contain different active Tntl subfamilies and that only one active Tntl subfamily might be maintained in each of these species. The Tnp2 insertion found in the F97 mutant was found to be spliced out of the nitrate reductase mRNA by activation of cryptic donor and acceptor sites in the nitrate reductase and the Tnp2 sequences respectively.

Glucocorticoids induce transactivation of tight junction genes occludin and claudin-5 in retinal endothelial cells via a novel cis-element.

PubMed

Felinski, Edward A; Cox, Amy E; Phillips, Brett E; Antonetti, David A

2008-06-01

Tight junctions between vascular endothelial cells help to create the blood-brain and blood-retinal barriers. Breakdown of the retinal tight junction complex is problematic in several disease states including diabetic retinopathy. Glucocorticoids can restore and/or preserve the endothelial barrier to paracellular permeability, although the mechanism remains unclear. We show that glucocorticoid treatment of primary retinal endothelial cells increases content of the tight junction proteins occludin and claudin-5, co-incident with an increase in barrier properties of endothelial monolayers. The glucocorticoid receptor antagonist RU486 reverses both the glucocorticoid-stimulated increase in occludin content and the increase in barrier properties. Transcriptional activity from the human occludin and claudin-5 promoters increases in retinal endothelial cells upon glucocorticoid treatment, and is dependent on the glucocorticoid receptor (GR) as demonstrated by siRNA. Deletion analysis of the occludin promoter reveals a 205bp sequence responsible for the glucocorticoid response. However, this region does not possess a canonical glucocorticoid response element and does not bind to the GR in a chromatin immunoprecipitation (ChIP) assay. Mutational analysis of this region revealed a novel 40bp occludin enhancer element (OEE), containing two highly conserved regions of 10 and 13 base pairs, that is both necessary and sufficient for glucocorticoid-induced gene expression in retinal endothelial cells. These data suggest a novel mechanism for glucocorticoid induction of vascular endothelial barrier properties through increased occludin and claudin-5 gene expression.

GLUCOCORTICOIDS INDUCE TRANSACTIVATION OF TIGHT JUNCTION GENES OCCLUDIN AND CLAUDIN-5 IN RETINAL ENDOTHELIAL CELLS VIA A NOVEL CIS-ELEMENT

PubMed Central

Felinski, Edward A.; Cox, Amy E.; Phillips, Brett E.; Antonetti, David A.

2008-01-01

Tight junctions between vascular endothelial cells help to create the blood-brain and blood-retinal barriers. Breakdown of the retinal tight junction complex is problematic in several disease states including diabetic retinopathy. Glucocorticoids can restore and/or preserve the endothelial barrier to paracellular permeability, although the mechanism remains unclear. We show that glucocorticoid treatment of primary retinal endothelial cells increases content of the tight junction proteins occludin and claudin-5, co-incident with an increase in barrier properties of endothelial monolayers. The glucocorticoid receptor antagonist RU486 reverses both the glucocorticoid-stimulated increase in occludin content and the increase in barrier properties. Transcriptional activity from the human occludin and claudin-5 promoters increases in retinal endothelial cells upon glucocorticoid treatment, and is dependent on the glucocorticoid receptor (GR) as demonstrated by siRNA. Deletion analysis of the occludin promoter reveals a 205 bp sequence responsible for the glucocorticoid response. However, this region does not posses a canonical glucocorticoid response element and does not bind to the GR in a chromatin immunoprecipitation (ChIP) assay. Mutational analysis of this region revealed a novel 40 bp occludin enhancer element (OEE), containing two highly-conserved regions of 10 and 13 base pairs, that is both necessary and sufficient for glucocorticoid-induced gene expression in retinal endothelial cells. These data suggest a novel mechanism for glucocorticoid induction of vascular endothelial barrier properties through increased occludin and claudin-5 gene expression. PMID:18501346

Complete genome analysis of three Acinetobacter baumannii clinical isolates in China for insight into the diversification of drug resistance elements.

PubMed

Zhu, Lingxiang; Yan, Zhongqiang; Zhang, Zhaojun; Zhou, Qiming; Zhou, Jinchun; Wakeland, Edward K; Fang, Xiangdong; Xuan, Zhenyu; Shen, Dingxia; Li, Quan-Zhen

2013-01-01

The emergence and rapid spreading of multidrug-resistant Acinetobacter baumannii strains has become a major health threat worldwide. To better understand the genetic recombination related with the acquisition of drug-resistant elements during bacterial infection, we performed complete genome analysis on three newly isolated multidrug-resistant A. baumannii strains from Beijing using next-generation sequencing technology. Whole genome comparison revealed that all 3 strains share some common drug resistant elements including carbapenem-resistant bla OXA-23 and tetracycline (tet) resistance islands, but the genome structures are diversified among strains. Various genomic islands intersperse on the genome with transposons and insertions, reflecting the recombination flexibility during the acquisition of the resistant elements. The blood-isolated BJAB07104 and ascites-isolated BJAB0868 exhibit high similarity on their genome structure with most of the global clone II strains, suggesting these two strains belong to the dominant outbreak strains prevalent worldwide. A large resistance island (RI) of about 121-kb, carrying a cluster of resistance-related genes, was inserted into the ATPase gene on BJAB07104 and BJAB0868 genomes. A 78-kb insertion element carrying tra-locus and bla OXA-23 island, can be either inserted into one of the tniB gene in the 121-kb RI on the chromosome, or transformed to conjugative plasmid in the two BJAB strains. The third strains of this study, BJAB0715, which was isolated from spinal fluid, exhibit much more divergence compared with above two strains. It harbors multiple drug-resistance elements including a truncated AbaR-22-like RI on its genome. One of the unique features of this strain is that it carries both bla OXA-23 and bla OXA-58 genes on its genome. Besides, an Acinetobacter lwoffii adeABC efflux element was found inserted into the ATPase position in BJAB0715. Our comparative analysis on currently completed Acinetobacter baumannii genomes revealed extensive and dynamic genome organizations, which may facilitate the bacteria to acquire drug-resistance elements into their genomes.

Hissar-Alai and the Pamirs: Junction and Position in the System of Mobile Belts of Central Asia

NASA Astrophysics Data System (ADS)

Leonov, M. G.; Rybin, A. K.; Batalev, V. Yu.; Matyukov, V. E.; Shchelochkov, G. G.

2018-01-01

The position of the Pamirs and the Hissar-Alai mountainous system in the structure of Central Asia and features of their junction are considered. It is shown that their outer contours and tectonic infrastructure are significantly distinct in the planar pattern: latitudinally linear and arched for the Hissar-Alai and the Pamirs, respectively. These structures logically match those of the Central Asian and Alpine-Himalayan belts, respectively. The Pamir orogen is a relatively autonomous structural element of the crust, which is located discordantly relative to the country lithospheric blocks. Most of the Pamirs (at least, the Northern and Central) probably form a giant allochthon on the ancient basement of the Tarim and Afghan-Tajik blocks. The junction zone of these two "hard" crustal segments is reflected in the transverse Transpamir threshold, which is expressed in the relief, deep structure, and seismicity. The specific geological structure of the junction zone of the Pamirs and Hissar-Alai (systems of the Tarim, Alai, and Afghan-Tajik troughs) is shown. It suggested that this zone is a damper, which significantly neutralizes the dynamic influence of the Pamir and the southernmost elements of the Pamir-Punjab syntax on Hissar-Alai structures.

Incomplete Lineage Sorting and Hybridization Statistics for Large-Scale Retroposon Insertion Data

PubMed Central

Kuritzin, Andrej; Kischka, Tabea

2016-01-01

Ancient retroposon insertions can be used as virtually homoplasy-free markers to reconstruct the phylogenetic history of species. Inherited, orthologous insertions in related species offer reliable signals of a common origin of the given species. One prerequisite for such a phylogenetically informative insertion is that the inserted element was fixed in the ancestral population before speciation; if not, polymorphically inserted elements may lead to random distributions of presence/absence states during speciation and possibly to apparently conflicting reconstructions of their ancestry. Fortunately, such misleading fixed cases are relatively rare but nevertheless, need to be considered. Here, we present novel, comprehensive statistical models applicable for (1) analyzing any pattern of rare genomic changes, (2) testing and differentiating conflicting phylogenetic reconstructions based on rare genomic changes caused by incomplete lineage sorting or/and ancestral hybridization, and (3) differentiating between search strategies involving genome information from one or several lineages. When the new statistics are applied, in non-conflicting cases a minimum of three elements present in both of two species and absent in a third group are considered significant support (p<0.05) for the branching of the third from the other two, if all three of the given species are screened equally for genome or experimental data. Five elements are necessary for significant support (p<0.05) if a diagnostic locus derived from only one of three species is screened, and no conflicting markers are detected. Most potentially conflicting patterns can be evaluated for their significance and ancestral hybridization can be distinguished from incomplete lineage sorting by considering symmetric or asymmetric distribution of rare genomic changes among possible tree configurations. Additionally, we provide an R-application to make the new KKSC insertion significance test available for the scientific community at http://retrogenomics.uni-muenster.de:3838/KKSC_significance_test/. PMID:26967525

Proteomic analysis of laser capture microscopy purified myotendinous junction regions from muscle sections

PubMed Central

2014-01-01

The myotendinous junction is a specialized structure of the muscle fibre enriched in mechanosensing complexes, including costameric proteins and core elements of the z-disc. Here, laser capture microdissection was applied to purify membrane regions from the myotendinous junctions of mouse skeletal muscles, which were then processed for proteomic analysis. Sarcolemma sections from the longitudinal axis of the muscle fibre were used as control for the specificity of the junctional preparation. Gene ontology term analysis of the combined lists indicated a statistically significant enrichment in membrane-associated proteins. The myotendinous junction preparation contained previously uncharacterized proteins, a number of z-disc costameric ligands (e.g., actinins, capZ, αB cristallin, filamin C, cypher, calsarcin, desmin, FHL1, telethonin, nebulin, titin and an enigma-like protein) and other proposed players of sarcomeric stretch sensing and signalling, such as myotilin and the three myomesin homologs. A subset were confirmed by immunofluorescence analysis as enriched at the myotendinous junction, suggesting that laser capture microdissection from muscle sections is a valid approach to identify novel myotendinous junction players potentially involved in mechanotransduction pathways. PMID:25071420

Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach.

PubMed

Frimodt-Møller, Jakob; Charbon, Godefroid; Krogfelt, Karen A; Løbner-Olesen, Anders

2017-09-11

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In bacteria, the impact of the genetic context on the function of a genetic element can be difficult to assess. Several mechanisms, including topological effects, transcriptional interference from neighboring genes, and/or replication-associated gene dosage, may affect the function of a given genetic element. Here, we describe a method that permits the random integration of a DNA element into the chromosome of Escherichia coli and select the most favorable locations using a simple growth competition experiment. The method takes advantage of a well-described transposon-based system of random insertion, coupled with a selection of the fittest clone(s) by growth advantage, a procedure that is easily adjustable to experimental needs. The nature of the fittest clone(s) can be determined by whole-genome sequencing on a complex multi-clonal population or by easy gene walking for the rapid identification of selected clones. Here, the non-coding DNA region DARS2, which controls the initiation of chromosome replication in E. coli, was used as an example. The function of DARS2 is known to be affected by replication-associated gene dosage; the closer DARS2 gets to the origin of DNA replication, the more active it becomes. DARS2 was randomly inserted into the chromosome of a DARS2-deleted strain. The resultant clones containing individual insertions were pooled and competed against one another for hundreds of generations. Finally, the fittest clones were characterized and found to contain DARS2 inserted in close proximity to the original DARS2 location.

Comparison of Ultra-Conserved Elements in Drosophilids and Vertebrates

PubMed Central

Makunin, Igor V.; Shloma, Viktor V.; Stephen, Stuart J.; Pheasant, Michael; Belyakin, Stepan N.

2013-01-01

Metazoan genomes contain many ultra-conserved elements (UCEs), long sequences identical between distant species. In this study we identified UCEs in drosophilid and vertebrate species with a similar level of phylogenetic divergence measured at protein-coding regions, and demonstrated that both the length and number of UCEs are larger in vertebrates. The proportion of non-exonic UCEs declines in distant drosophilids whilst an opposite trend was observed in vertebrates. We generated a set of 2,126 Sophophora UCEs by merging elements identified in several drosophila species and compared these to the eutherian UCEs identified in placental mammals. In contrast to vertebrates, the Sophophora UCEs are depleted around transcription start sites. Analysis of 52,954 P-element, piggyBac and Minos insertions in the D. melanogaster genome revealed depletion of the P-element and piggyBac insertions in and around the Sophophora UCEs. We examined eleven fly strains with transposon insertions into the intergenic UCEs and identified associated phenotypes in five strains. Four insertions behave as recessive lethals, and in one case we observed a suppression of the marker gene within the transgene, presumably by silenced chromatin around the integration site. To confirm the lethality is caused by integration of transposons we performed a phenotype rescue experiment for two stocks and demonstrated that the excision of the transposons from the intergenic UCEs restores viability. Sequencing of DNA after the transposon excision in one fly strain with the restored viability revealed a 47 bp insertion at the original transposon integration site suggesting that the nature of the mutation is important for the appearance of the phenotype. Our results suggest that the UCEs in flies and vertebrates have both common and distinct features, and demonstrate that a significant proportion of intergenic drosophila UCEs are sensitive to disruption. PMID:24349264

Diversity and structure of PIF/Harbinger-like elements in the genome of Medicago truncatula

PubMed Central

Grzebelus, Dariusz; Lasota, Slawomir; Gambin, Tomasz; Kucherov, Gregory; Gambin, Anna

2007-01-01

Background Transposable elements constitute a significant fraction of plant genomes. The PIF/Harbinger superfamily includes DNA transposons (class II elements) carrying terminal inverted repeats and producing a 3 bp target site duplication upon insertion. The presence of an ORF coding for the DDE/DDD transposase, required for transposition, is characteristic for the autonomous PIF/Harbinger-like elements. Based on the above features, PIF/Harbinger-like elements were identified in several plant genomes and divided into several evolutionary lineages. Availability of a significant portion of Medicago truncatula genomic sequence allowed for mining PIF/Harbinger-like elements, starting from a single previously described element MtMaster. Results Twenty two putative autonomous, i.e. carrying an ORF coding for TPase and complete terminal inverted repeats, and 67 non-autonomous PIF/Harbinger-like elements were found in the genome of M. truncatula. They were divided into five families, MtPH-A5, MtPH-A6, MtPH-D,MtPH-E, and MtPH-M, corresponding to three previously identified and two new lineages. The largest families, MtPH-A6 and MtPH-M were further divided into four and three subfamilies, respectively. Non-autonomous elements were usually direct deletion derivatives of the putative autonomous element, however other types of rearrangements, including inversions and nested insertions were also observed. An interesting structural characteristic – the presence of 60 bp tandem repeats – was observed in a group of elements of subfamily MtPH-A6-4. Some families could be related to miniature inverted repeat elements (MITEs). The presence of empty loci (RESites), paralogous to those flanking the identified transposable elements, both autonomous and non-autonomous, as well as the presence of transposon insertion related size polymorphisms, confirmed that some of the mined elements were capable for transposition. Conclusion The population of PIF/Harbinger-like elements in the genome of M. truncatula is diverse. A detailed intra-family comparison of the elements' structure proved that they proliferated in the genome generally following the model of abortive gap repair. However, the presence of tandem repeats facilitated more pronounced rearrangements of the element internal regions. The insertion polymorphism of the MtPH elements and related MITE families in different populations of M. truncatula, if further confirmed experimentally, could be used as a source of molecular markers complementary to other marker systems. PMID:17996080

AlInAsSb for GaSb-based multi-junction solar cells

NASA Astrophysics Data System (ADS)

Tournet, J.; Rouillard, Y.; Tournié, E.

2018-02-01

Bandgap engineering, by means of alloying or inserting nanostructures, is the bedrock of high efficiency photovoltaics. III-V quaternary alloys in particular enable bandgap tailoring of a multi-junction subcell while conserving a single lattice parameter. Among the possible candidates, AlInAsSb could in theory reach the widest range of bandgap energies while being lattice-matched to InP or GaSb. Although these material systems are still emerging photovoltaic segments, they do offer advantages for multi-junction design. GaSbbased structures in particular can make use of highly efficient GaSb/InAs tunnel junctions to connect the subcells. There has been only little information concerning GaSb-lattice matched AlInAsSb in the literature. The alloy's miscibility gap can be circumvented by the use of non-equilibrium techniques. Nevertheless, appropriate growth conditions remain to be found in order to produce a stable alloy. Furthermore, the abnormally low bandgap energies reported for the material need to be confirmed and interpreted with a multi-junction perspective. In this work, we propose a tandem structure made of an AlInAsSb top cell and a GaSb bottom cell. An epitaxy study of the AlInAsSb alloy lattice-matched to GaSb was first performed. The subcells were then grown and processed. The GaSb subcell yielded an efficiency of 5.9% under 1 sun and the tandem cell is under optimization. Preliminary results are presented in this document.

Effect of graphene tunnel barrier on Schottky barrier height of Heusler alloy Co2MnSi/graphene/n-Ge junction

NASA Astrophysics Data System (ADS)

Gui-fang, Li; Jing, Hu; Hui, Lv; Zhijun, Cui; Xiaowei, Hou; Shibin, Liu; Yongqian, Du

2016-02-01

We demonstrate that the insertion of a graphene tunnel barrier between Heusler alloy Co2MnSi and the germanium (Ge) channel modulates the Schottky barrier height and the resistance-area product of the spin diode. We confirm that the Fermi level is depinned and a reduction in the electron Schottky barrier height (SBH) occurs following the insertion of the graphene layer between Co2MnSi and Ge. The electron SBH is modulated in the 0.34 eV-0.61 eV range. Furthermore, the transport mechanism changes from rectifying to symmetric tunneling following the insertion. This behavior provides a pathway for highly efficient spin injection from a Heusler alloy into a Ge channel with high electron and hole mobility. Project supported by the National Natural Science Foundation of China (Grant No. 61504107) and the Fundamental Research Funds for the Central Universities, China (Grant Nos. 3102014JCQ01059 and 3102015ZY043).

D{sub H} element reading frame selection is influenced by an Ig heavy chain transgene, but not by bcl-2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tarlinton, D.; Strasser, A.; McLean, M.

1995-04-01

Mouse B cell precursors containing Ig D{sub H}J{sub H} junctions in one particular reading frame are selectively lost during B cell development. In this register, arbitrarily referred to as reading frame 2, D{sub H}J{sub H} junctions give rise to an open reading frame starting upstream of the D{sub H} element and including the D{sub H}J{sub H}-peptide fused to the constant region of IgM. Expression of this protein, called D{mu}, has been strongly implicated in the loss of B cell precursors containing reading frame 2 D{sub H}J{sub H} junctions. In an attempt to elucidate the means of D{mu} counterselection, we havemore » examined the reading frame distribution of D{sub H}J{sub H} junctions in peripheral B cells from mice transgenic for either the human bcl-2 oncogene or for a functionally rearranged Ig {mu} heavy chain. In bcl-2 transgenic mice, reading frame 2 accounted for < 5% of the D{sub H}J{sub H} junctions in peripheral B cells, a value not significantly different from controls. Reading frames 1 and 3 were equally represented among the remaining junctions. By contrast, the reading frame distribution of endogenous D{sub H}J{sub H} junctions in splenic B cells from Ig {mu} heavy chain transgenic mice showed no evidence of bias against D{mu} encoding D{sub H}J{sub H} junctions. Reading frames 2 and 3 accounted for 27% and 30% of the sequenced D{sub H}J{sub H} junctions, respectively, and the remaining 43% were reading frame 1. Thus although the presence of BCL-2 cannot prevent the selective loss of reading frame 2 D{sub H}J{sub H} B cells, a functional {mu} heavy chain can. These results suggest that D{mu}-expressing B cell precursors may be selectively lost because of the premature and inappropriate cessation of heavy chain gene rearrangement rather than because of the induction of an apoptotic process which can be blocked by BCL-2. 42 refs., 4 figs., 4 tabs.« less

Tuning Carrier Tunneling in van der Waals Heterostructures for Ultrahigh Detectivity.

PubMed

Vu, Quoc An; Lee, Jin Hee; Nguyen, Van Luan; Shin, Yong Seon; Lim, Seong Chu; Lee, Kiyoung; Heo, Jinseong; Park, Seongjun; Kim, Kunnyun; Lee, Young Hee; Yu, Woo Jong

2017-01-11

Semiconducting transition metal dichalcogenides (TMDs) are promising materials for photodetection over a wide range of visible wavelengths. Photodetection is generally realized via a phototransistor, photoconductor, p-n junction photovoltaic device, and thermoelectric device. The photodetectivity, which is a primary parameter in photodetector design, is often limited by either low photoresponsivity or a high dark current in TMDs materials. Here, we demonstrated a highly sensitive photodetector with a MoS 2 /h-BN/graphene heterostructure, by inserting a h-BN insulating layer between graphene electrode and MoS 2 photoabsorber, the dark-carriers were highly suppressed by the large electron barrier (2.7 eV) at the graphene/h-BN junction while the photocarriers were effectively tunneled through small hole barrier (1.2 eV) at the MoS 2 /h-BN junction. With both high photocurrent/dark current ratio (>10 5 ) and high photoresponsivity (180 AW -1 ), ultrahigh photodetectivity of 2.6 × 10 13 Jones was obtained at 7 nm thick h-BN, about 100-1000 times higher than that of previously reported MoS 2 -based devices.

The interface modification for GNWs/Si Schottky junction with PEI/PEIE interlayers

NASA Astrophysics Data System (ADS)

Zhou, Quan; Liu, Xiangzhi; Luo, Wei; Shen, Jun; Wang, Yuefeng; Wei, Dapeng

2018-03-01

Polyethylenimine ethoxylated (PEIE) and polyethyl-enimine (PEI), the two kinds of interface buffer layer, are widely used in the organic light-emitting diodes and solar cells for band alignment adjustment. In this report, we carefully studied the influence of the inserting organic layer on the graphene nanowalls(GNWS)/Si junction quality and the photoresponse of the Schottky devices. We found that thinner layers of PEI could decrease the dark current and improve the photo-to-dark ratio to 105 for n-Si devices. The s-kink effect and degradation of open circuit voltage could be observed for thicker thickness and excessive doping. Relatively, PEIE with stable thin layer not only improve the rectifying characteristics of p-Si devices but also the incident photon conversion efficiency. The maximus IPCE could reach 44% and be adjusted to zero by the reverse bias. The tunneling inhibition for electrons can be alleviated by increasing the barrier height. Our results provide an attractive method to improve the efficiency of pristine GNWs/Si junction with interface doping and passivation.

K-band high power latching switch. [communication satellite system

NASA Technical Reports Server (NTRS)

Mlinar, M. J.; Piotrowski, W. S.; Raue, J. E.

1980-01-01

A 19 GHz waveguide latching switch with a bandwidth of 1400 MHz and an exceptionally low insertion loss of 0.25 dB was demonstrated. The RF and driver ferrites are separate structures and can be optimized individually. This analysis for each structure is separately detailed. Basically, the RF section features a dual turnstile junction. The circulator consists of a dielectric tube which contains two ferrite rods, and a dielectric spacer separating the ferrite parts along the center of symmetry of the waveguide to form two turnstiles. This subassembly is indexed and locked in the center of symmetry of a uniform junction of three waveguides by the metallic transformers installed in the top and bottom walls of the housing. The switching junction and its actuating circuitry met all RF performance objectives and all shock and vibration requirements with no physical damage or performance degradation. It exceeds thermal requirements by operating over a 100 C temperature range (-44 C to +56 C) and has a high power handling capability allowing up to 100 W of CW input power.

Muscular force transmission: a unified, dual or multiple system? A review and some explorative experimental results.

PubMed

Huijing, P

1999-10-01

Structures contributing to force transmission in muscle are reviewed combining some historical and relatively recently published experimental data. Also, effects of aponeurotomy and tenotomy are reviewed shortly as well as some new experimental results regarding these interventions that reinforce the concept of myofascial force transmission. The review is also illustrated by some new images of single muscle fibres from Xenopus Laevis indicative of such transmission and some data about locations of insertion of human gluteus maximus muscle. From this review and the new material, emerges a line of thought indicating that mechanical connections between muscle fibres and intramuscular connective tissue play an important role in force transmission. New experimental observations are presented for non-spanning muscle (i.c., rat biceps femoris muscle), regarding the great variety of types of intramuscular connections that exist i n addition to myo-tendinous junctions at the perimuscular ends of muscle fibres. Such connections are classified as (1) tapered end connections, (2) Myo-myonal junctions, (3) myo-epimysial junctions and (3) Myo-endomysial junctions. This line of thought is followed up by consideration of a possible role of connections of intra- and extramuscular connective tissue in force transmission out of the muscle. Experimental results of an explorative nature, regarding the interactions of extensor digitorum longus (EDL), tibialis anterior (TA) and hallucis longus (HAL) muscles within a relatively intact dorsal flexor compartment of the rat hind leg, indicate that: (1) length force properties of EDL are influenced by TA activity in a length dependent fashion. Depending on TA length, force exerted by EDL, kept at constant origin insertion distance, is variable and the effect is influenced by EDL length itself as well; (2) Force is transmitted from muscle to extramuscular connective tissue and vice versa. As a consequence force exerted at proximal and distal tendons of a muscle are not always equal. The difference being transmitted by extramuscular connective tissue and may appear at the tendons of other muscles or may be transmitted via connective tissue directly to bone. It is concluded that the system of force transmission from skeletal muscle should be considered as a multiple system.

Side-wall spacer passivated sub-μm Josephson junction fabrication process

NASA Astrophysics Data System (ADS)

Grönberg, Leif; Kiviranta, Mikko; Vesterinen, Visa; Lehtinen, Janne; Simbierowicz, Slawomir; Luomahaara, Juho; Prunnila, Mika; Hassel, Juha

2017-12-01

We present a structure and a fabrication method for superconducting tunnel junctions down to the dimensions of 200 nm using i-line UV lithography. The key element is a sidewall-passivating spacer structure (SWAPS) which is shaped for smooth crossline contacting and low parasitic capacitance. The SWAPS structure enables formation of junctions with dimensions at or below the lithography-limited linewidth. An additional benefit is avoiding the excessive use of amorphous dielectric materials which is favorable in sub-Kelvin microwave applications often plagued by nonlinear and lossy dielectrics. We apply the structure to niobium trilayer junctions, and provide characterization results yielding evidence on wafer-scale scalability, and critical current density tuning in the range of 0.1-3.0 kA cm-2. We discuss the applicability of the junction process in the context of different applications, such as SQUID magnetometers and Josephson parametric amplifiers.

n-B-pi-p Superlattice Infrared Detector

NASA Technical Reports Server (NTRS)

Ting, David Z.; Bandara, Sumith V.; Hill, Cory J.; Gunapala, Sarath D.

2011-01-01

A specially designed barrier (B) is inserted at the n-pi junction [where most GR (generation-recombination) processes take place] in the standard n-pi-p structure to substantially reduce generation-recombination dark currents. The resulting n-Bpi- p structure also has reduced tunneling dark currents, thereby solving some of the limitations to which current type II strained layer superlattice infrared detectors are prone. This innovation is compatible with common read-out integrated circuits (ROICs).

Alu element insertion in PKLR gene as a novel cause of pyruvate kinase deficiency in Middle Eastern patients.

PubMed

Lesmana, Harry; Dyer, Lisa; Li, Xia; Denton, James; Griffiths, Jenna; Chonat, Satheesh; Seu, Katie G; Heeney, Matthew M; Zhang, Kejian; Hopkin, Robert J; Kalfa, Theodosia A

2018-03-01

Pyruvate kinase deficiency (PKD) is the most frequent red blood cell enzyme abnormality of the glycolytic pathway and the most common cause of hereditary nonspherocytic hemolytic anemia. Over 250 PKLR-gene mutations have been described, including missense/nonsense, splicing and regulatory mutations, small insertions, small and gross deletions, causing PKD and hemolytic anemia of variable severity. Alu retrotransposons are the most abundant mobile DNA sequences in the human genome, contributing to almost 11% of its mass. Alu insertions have been associated with a number of human diseases either by disrupting a coding region or a splice signal. Here, we report on two unrelated Middle Eastern patients, both born from consanguineous parents, with transfusion-dependent hemolytic anemia, where sequence analysis revealed a homozygous insertion of AluYb9 within exon 6 of the PKLR gene, causing precipitous decrease of PKLR RNA levels. This Alu element insertion consists a previously unrecognized mechanism underlying pathogenesis of PKD. © 2017 Wiley Periodicals, Inc.

Computer Aided Design of Ka-Band Waveguide Power Combining Architectures for Interplanetary Spacecraft

NASA Technical Reports Server (NTRS)

Vaden, Karl R.

2006-01-01

Communication systems for future NASA interplanetary spacecraft require transmitter power ranging from several hundred watts to kilowatts. Several hybrid junctions are considered as elements within a corporate combining architecture for high power Ka-band space traveling-wave tube amplifiers (TWTAs). This report presents the simulated transmission characteristics of several hybrid junctions designed for a low loss, high power waveguide based power combiner.

Histomorphometrical analysis following augmentation of infected extraction sites exhibiting severe bone loss and primarily closed by intrasocket reactive soft tissue.

PubMed

Mardinger, Ofer; Vered, Marilena; Chaushu, Gavriel; Nissan, Joseph

2012-06-01

Intrasocket reactive soft tissue can be used for primary closure during augmentation of infected extraction sites exhibiting severe bone loss prior to implant placement. The present study evaluated the histological characteristics of the initially used intrasocket reactive soft tissue, the overlying soft tissue, and the histomorphometry of the newly formed bone during implant placement. Thirty-six consecutive patients (43 sites) were included in the study. Extraction sites demonstrating extensive bone loss on preoperative periapical and panoramic radiographs served as inclusion criteria. Forty-three implants were inserted after a healing period of 6 months. Porous bovine xenograft bone mineral was used as a single bone substitute. The intrasocket reactive soft tissue was sutured over the grafting material to seal the coronal portion of the socket. Biopsies of the intrasocket reactive soft tissue at augmentation, healed mucosa, and bone cores at implant placement were retrieved and evaluated. The intrasocket reactive soft tissue demonstrated features compatible with granulation tissue and long junctional epithelium. The mucosal samples at implant placement demonstrated histopathological characteristics of keratinized mucosa with no residual elements of granulation tissue. Histomorphometrically, the mean composition of the bone cores was - vital bone 40 ± 19% (13.7-74.8%); bone substitute 25.7 ± 13% (0.6-51%); connective tissue 34.3 ± 15% (13.8-71.9%). Intrasocket reactive soft tissue used for primary closure following ridge augmentation is composed of granulation tissue and long junctional epithelium. At implant placement, clinical and histological results demonstrate its replacement by keratinized gingiva. The histomorphometrical results reveal considerable bone formation. Fresh extraction sites of hopeless teeth demonstrating chronic infection and severe bone loss may be grafted simultaneously with their removal. © 2010 Wiley Periodicals, Inc.

Compensation of the impact of low-cost manufacturing techniques in the design of E-plane multiport waveguide junctions

NASA Astrophysics Data System (ADS)

San-Blas, A. A.; Roca, J. M.; Cogollos, S.; Morro, J. V.; Boria, V. E.; Gimeno, B.

2016-06-01

In this work, a full-wave tool for the accurate analysis and design of compensated E-plane multiport junctions is proposed. The implemented tool is capable of evaluating the undesired effects related to the use of low-cost manufacturing techniques, which are mostly due to the introduction of rounded corners in the cross section of the rectangular waveguides of the device. The obtained results show that, although stringent mechanical effects are imposed, it is possible to compensate for the impact of the cited low-cost manufacturing techniques by redesigning the matching elements considered in the original device. Several new designs concerning a great variety of E-plane components (such as right-angled bends, T-junctions and magic-Ts) are presented, and useful design guidelines are provided. The implemented tool, which is mainly based on the boundary integral-resonant mode expansion technique, has been successfully validated by comparing the obtained results to simulated data provided by a commercial software based on the finite element method.

A Dual Polarized Quasi-Optical SIS Mixer at 550-GHz

NASA Technical Reports Server (NTRS)

Chattopadhyay, Goutam; Miller, David; LeDuc, Henry G.; Zmuidzinas, Jonas

2000-01-01

We describe the design, fabrication, and the performance of a low-noise dual-polarized quasi-optical superconductor insulator superconductor (SIS) mixer at 550 GHz. The mixer utilizes a novel cross-slot antenna on a hyperhemispherical substrate lens, two junction tuning circuits, niobium trilayer junctions, and an IF circuit containing a lumped element 180 deg hybrid. The antenna consists of an orthogonal pair of twin-slot antennas, and has four feed points, two for each polarization. Each feed point is coupled to a two-junction SIS mixer. The 180 deg IF hybrid is implemented using a lumped element/microstrip circuit located inside the mixer block. Fourier transform spectrometer (FTS) measurements of the mixer frequency response show good agreement with computer simulations. The measured co-polarized and cross-polarized patterns for both polarizations also agree with the theoretical predictions. The noise performance of the dual-polarized mixer is excellent, giving uncorrected receiver noise temperature of better than 115 K (DSB) at 528 GHz for both the polarizations.

Transcriptome-wide effects of inverted SINEs on gene expression and their impact on RNA polymerase II activity.

PubMed

Tajaddod, Mansoureh; Tanzer, Andrea; Licht, Konstantin; Wolfinger, Michael T; Badelt, Stefan; Huber, Florian; Pusch, Oliver; Schopoff, Sandy; Janisiw, Michael; Hofacker, Ivo; Jantsch, Michael F

2016-10-25

Short interspersed elements (SINEs) represent the most abundant group of non-long-terminal repeat transposable elements in mammalian genomes. In primates, Alu elements are the most prominent and homogenous representatives of SINEs. Due to their frequent insertion within or close to coding regions, SINEs have been suggested to play a crucial role during genome evolution. Moreover, Alu elements within mRNAs have also been reported to control gene expression at different levels. Here, we undertake a genome-wide analysis of insertion patterns of human Alus within transcribed portions of the genome. Multiple, nearby insertions of SINEs within one transcript are more abundant in tandem orientation than in inverted orientation. Indeed, analysis of transcriptome-wide expression levels of 15 ENCODE cell lines suggests a cis-repressive effect of inverted Alu elements on gene expression. Using reporter assays, we show that the negative effect of inverted SINEs on gene expression is independent of known sensors of double-stranded RNAs. Instead, transcriptional elongation seems impaired, leading to reduced mRNA levels. Our study suggests that there is a bias against multiple SINE insertions that can promote intramolecular base pairing within a transcript. Moreover, at a genome-wide level, mRNAs harboring inverted SINEs are less expressed than mRNAs harboring single or tandemly arranged SINEs. Finally, we demonstrate a novel mechanism by which inverted SINEs can impact on gene expression by interfering with RNA polymerase II.

Microwave Photon Detector in Circuit QED

NASA Astrophysics Data System (ADS)

Garcia-Ripoll, Juan Jose; Romero, Guillermo; Solano, Enrique

2009-03-01

In this work we propose a design for a microwave photodetector based on elements from circuit QED such as the ones used in qubit designs. Our proposal consists on a microwave guide in which we embed circuital elements that can absorb photons and irreversibly change state. These incoherent absorption processes constitute the measurement itself. We first model this design using a general master equation for the propagating photons and the absorbing elements. We find that the detection efficiency for a single absorber is limited to 50%, and that this efficiency can be quickly increased by adding more elements with a moderate separation, obtaining 80% and 90% for two and three absorbers. Our abstract design has at least one possible implementation in which the absorbers are current biased Josephson junction. We demonstrate that the coupling between the guide and the junctions is strong enough, irrespectively of the microwave guide size, and derivate realistic parameters for high fidelity operation with current experiments. Patent pending No. 200802933, Oficina Espanola de Patentes y Marcas, 17/10/2008.

Read count-based method for high-throughput allelic genotyping of transposable elements and structural variants.

PubMed

Kuhn, Alexandre; Ong, Yao Min; Quake, Stephen R; Burkholder, William F

2015-07-08

Like other structural variants, transposable element insertions can be highly polymorphic across individuals. Their functional impact, however, remains poorly understood. Current genome-wide approaches for genotyping insertion-site polymorphisms based on targeted or whole-genome sequencing remain very expensive and can lack accuracy, hence new large-scale genotyping methods are needed. We describe a high-throughput method for genotyping transposable element insertions and other types of structural variants that can be assayed by breakpoint PCR. The method relies on next-generation sequencing of multiplex, site-specific PCR amplification products and read count-based genotype calls. We show that this method is flexible, efficient (it does not require rounds of optimization), cost-effective and highly accurate. This method can benefit a wide range of applications from the routine genotyping of animal and plant populations to the functional study of structural variants in humans.

Factor IX[sub Madrid 2]: A deletion/insertion in Facotr IX gene which abolishes the sequence of the donor junction at the exon IV-intron d splice site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Solera, J.; Magallon, M.; Martin-Villar, J.

1992-02-01

DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends ofmore » the deleted DNA fragment.« less

A mutation in the LAMC2 gene causes the Herlitz junctional epidermolysis bullosa (H-JEB) in two French draft horse breeds.

PubMed

Milenkovic, Dragan; Chaffaux, Stéphane; Taourit, Sead; Guérin, Gérard

2003-01-01

Epidermolysis bullosa (EB) is a heterogeneous group of inherited diseases characterised by skin blistering and fragility. In humans, one of the most severe forms of EB known as Herlitz-junctional EB (H-JEB), is caused by mutations in the laminin 5 genes. EB has been described in several species, like cattle, sheep, dogs, cats and horses where the mutation, a cytosine insertion in exon 10 of the LAMC2 gene, was very recently identified in Belgian horses as the mutation responsible for JEB. In this study, the same mutation was found to be totally associated with the JEB phenotype in two French draft horse breeds, Trait Breton and Trait Comtois. This result provides breeders a molecular test to better manage their breeding strategies by genetic counselling.

Experimental demonstration of a broadband two-mode multi/demultiplexer based on asymmetric Y-junctions

NASA Astrophysics Data System (ADS)

Li, Haiqin; Wang, Pengjun; Yang, Tianjun; Dai, Tingge; Wang, Gencheng; Li, Shiqi; Chen, Weiwei; Yang, Jianyi

2018-03-01

A broadband two-mode multi/demultiplexer using asymmetric Y-junctions is designed and experimentally demonstrated on a silicon-on-insulator platform for on-chip mode-division multiplexing applications. Within a bandwidth from 1513 to 1619 nm, the fabricated device, which consists of a two-mode multiplexer, a multimode straight waveguide, and a two-mode demultiplexer, exhibits demultiplexing crosstalk of less than -9.1 dB. The demultiplexing crosstalk as low as -42.1 dB, lower than -12.8 dB over the C band can be obtained. The measured insertion loss varies from 0.40 to 0.56 dB at a wavelength of 1550 nm. A transmission experiment of 10 Gbit/s electrical signals carried on TE0 and TE1 modes is successfully achieved with open and clear eye diagrams.

Laparoscopic transgastric gastroplasty: a novel technique for a large esophagogastric fistula.

PubMed

McKenna, Daniel T; Ziegler, Kathryn; Selzer, Don

2014-08-01

Esophagogastric fistula is a rare complication related to severe inflammation at the gastroesophageal junction. Most causes are related to severe gastroesophageal reflux disease, previous surgery, or malignancy. This is the case of a 72-year-old man who had a laparoscopic Nissen fundoplication. He developed an esophageal obstruction from an intraesophageal pledget. It was removed laparoscopically, and the esophagotomy was buttressed with a Nissen fundoplication. Two months later he developed severe dysphagia, and an esophagogastric fistula was diagnosed. This was a large fistula measuring 20 mm in diameter. A novel hybrid technique was used to divide the fundoplication. Under endoscopic guidance, a 12-mm balloon-tipped trocar was inserted transgastrically. A linear-cutting surgical stapler was used to divide the fundoplication and reopen the gastroesophageal junction. The patient had no further dysphagia or gastroesophageal reflux.

Traveling wave parametric amplifier with Josephson junctions using minimal resonator phase matching

DOE Office of Scientific and Technical Information (OSTI.GOV)

White, T. C.; Mutus, J. Y.; Hoi, I.-C.

Josephson parametric amplifiers have become a critical tool in superconducting device physics due to their high gain and quantum-limited noise. Traveling wave parametric amplifiers (TWPAs) promise similar noise performance, while allowing for significant increases in both bandwidth and dynamic range. We present a TWPA device based on an LC-ladder transmission line of Josephson junctions and parallel plate capacitors using low-loss amorphous silicon dielectric. Crucially, we have inserted λ/4 resonators at regular intervals along the transmission line in order to maintain the phase matching condition between pump, signal, and idler and increase gain. We achieve an average gain of 12 dB acrossmore » a 4 GHz span, along with an average saturation power of −92 dBm with noise approaching the quantum limit.« less

A simple molecular orbital treatment of current distributions in quantum transport through molecular junctions

NASA Astrophysics Data System (ADS)

Jhan, Sin-Mu; Jin, Bih-Yaw

2017-11-01

A simple molecular orbital treatment of local current distributions inside single molecular junctions is developed in this paper. Using the first-order perturbation theory and nonequilibrium Green's function techniques in the framework of Hückel theory, we show that the leading contributions to local current distributions are directly proportional to the off-diagonal elements of transition density matrices. Under the orbital approximation, the major contributions to local currents come from a few dominant molecular orbital pairs which are mixed by the interactions between the molecule and electrodes. A few simple molecular junctions consisting of single- and multi-ring conjugated systems are used to demonstrate that local current distributions inside molecular junctions can be decomposed by partial sums of a few leading contributing transition density matrices.

Self-Validating Thermocouple

NASA Technical Reports Server (NTRS)

Perotti, Jose M. (Inventor); Mata, Carlos T. (Inventor); Santiago, Josephine B. (Inventor); Vokrot, Peter (Inventor); Zavala, Carlos E. (Inventor); Burns, Bradley M. (Inventor)

2010-01-01

Self-Validating Thermocouple (SVT) Systems capable of detecting sensor probe open circuits, short circuits, and unnoticeable faults such as a probe debonding and probe degradation are useful in the measurement of temperatures. SVT Systems provide such capabilities by incorporating a heating or excitation element into the measuring junction of the thermocouple. By heating the measuring junction and observing the decay time for the detected DC voltage signal, it is possible to indicate whether the thermocouple is bonded or debonded. A change in the thermal transfer function of the thermocouple system causes a change in the rise and decay times of the thermocouple output. Incorporation of the excitation element does not interfere with normal thermocouple operation, thus further allowing traditional validation procedures as well.

Optimized Lentiviral Vector Design Improves Titer and Transgene Expression of Vectors Containing the Chicken β-Globin Locus HS4 Insulator Element

PubMed Central

Hanawa, Hideki; Yamamoto, Motoko; Zhao, Huifen; Shimada, Takashi; Persons, Derek A

2009-01-01

Hematopoietic cell gene therapy using retroviral vectors has achieved success in clinical trials. However, safety issues regarding vector insertional mutagenesis have emerged. In two different trials, vector insertion resulted in the transcriptional activation of proto-oncogenes. One strategy for potentially diminishing vector insertional mutagenesis is through the use of self-inactivating lentiviral vectors containing the 1.2-kb insulator element derived from the chicken β-globin locus. However, use of this element can dramatically decrease both vector titer and transgene expression, thereby compromising its practical use. Here, we studied lentiviral vectors containing either the full-length 1.2-kb insulator or the smaller 0.25-kb core element in both orientations in the partially deleted long-terminal repeat. We show that use of the 0.25-kb core insulator rescued vector titer by alleviating a postentry block to reverse transcription associated with the 1.2-kb element. In addition, in an orientation-dependent manner, the 0.25-kb core element significantly increased transgene expression from an internal promoter due to improved transcriptional termination. This element also demonstrated barrier activity, reducing variability of expression due to position effects. As it is known that the 0.25-kb core insulator has enhancer-blocking activity, this particular insulated lentiviral vector design may be useful for clinical application. PMID:19223867

Remote detection of electronic devices

DOEpatents

Judd, Stephen L [Los Alamos, NM; Fortgang, Clifford M [Los Alamos, NM; Guenther, David C [Los Alamos, NM

2012-09-25

An apparatus and method for detecting solid-state electronic devices are described. Non-linear junction detection techniques are combined with spread-spectrum encoding and cross correlation to increase the range and sensitivity of the non-linear junction detection and to permit the determination of the distances of the detected electronics. Nonlinear elements are detected by transmitting a signal at a chosen frequency and detecting higher harmonic signals that are returned from responding devices.

The site-specific ribosomal insertion element type II of Bombyx mori (R2Bm) contains the coding sequence for a reverse transcriptase-like enzyme.

PubMed Central

Burke, W D; Calalang, C C; Eickbush, T H

1987-01-01

Two classes of DNA elements interrupt a fraction of the rRNA repeats of Bombyx mori. We have analyzed by genomic blotting and sequence analysis one class of these elements which we have named R2. These elements occupy approximately 9% of the rDNA units of B. mori and appear to be homologous to the type II rDNA insertions detected in Drosophila melanogaster. Approximately 25 copies of R2 exist within the B. mori genome, of which at least 20 are located at a precise location within otherwise typical rDNA units. Nucleotide sequence analysis has revealed that the 4.2-kilobase-pair R2 element has a single large open reading frame, occupying over 82% of the total length of the element. The central region of this 1,151-amino-acid open reading frame shows homology to the reverse transcriptase enzymes found in retroviruses and certain transposable elements. Amino acid homology of this region is highest to the mobile line 1 elements of mammals, followed by the mitochondrial type II introns of fungi, and the pol gene of retroviruses. Less homology exists with transposable elements of D. melanogaster and Saccharomyces cerevisiae. Two additional regions of sequence homology between L1 and R2 elements were also found outside the reverse transcriptase region. We suggest that the R2 elements are retrotransposons that are site specific in their insertion into the genome. Such mobility would enable these elements to occupy a small fraction of the rDNA units of B. mori despite their continual elimination from the rDNA locus by sequence turnover. Images PMID:2439905

Telomeric P elements associated with cytotype regulation of the P transposon family in Drosophila melanogaster.

PubMed Central

Stuart, Jeremy R; Haley, Kevin J; Swedzinski, Douglas; Lockner, Samuel; Kocian, Paul E; Merriman, Peter J; Simmons, Michael J

2002-01-01

P elements inserted at the left end of the Drosophila X chromosome were isolated genetically from wild-type P strains. Stocks carrying these elements were tested for repression of P-strain-induced gonadal dysgenesis in females and for repression of transposase-catalyzed P-element excision in males and females. Both traits were repressed by stocks carrying either complete or incomplete P elements inserted near the telomere of the X chromosome in cytological region 1A, but not by stocks carrying only nontelomeric X-linked P elements. All three of the telomeric P elements that were analyzed at the molecular level were inserted in one of the 1.8-kb telomere-associated sequence (TAS) repeats near the end of the X chromosome. Stocks with these telomeric P elements strongly repressed P-element excision induced in the male germline by a P strain or by the transposase-producing transgenes H(hsp/CP)2, H(hsp/CP)3, a combination of these two transgenes, and P(ry(+), delta2-3)99B. For H(hsp/CP)2 and P(ry(+), delta2-3)99B, the repression was also effective when the flies were subjected to heat-shock treatments. However, these stocks did not repress the somatic transposase activity of P(ry(+), delta2-3)99B. Repression of transposase activity in the germline required maternal transmission of the telomeric P elements themselves. Paternal transmission of these elements, or maternal transmission of the cytoplasm from carriers, both were insufficient to repress transposase activity. Collectively, these findings indicate that the regulatory abilities of telomeric P elements are similar to those of the P cytotype. PMID:12524339

Quantitative Mapping of Matrix Content and Distribution across the Ligament-to-Bone Insertion

PubMed Central

Spalazzi, Jeffrey P.; Boskey, Adele L.; Pleshko, Nancy; Lu, Helen H.

2013-01-01

The interface between bone and connective tissues such as the Anterior Cruciate Ligament (ACL) constitutes a complex transition traversing multiple tissue regions, including non-calcified and calcified fibrocartilage, which integrates and enables load transfer between otherwise structurally and functionally distinct tissue types. The objective of this study was to investigate region-dependent changes in collagen, proteoglycan and mineral distribution, as well as collagen orientation, across the ligament-to-bone insertion site using Fourier transform infrared spectroscopic imaging (FTIR-I). Insertion site-related differences in matrix content were also evaluated by comparing tibial and femoral entheses. Both region- and site-related changes were observed. Collagen content was higher in the ligament and bone regions, while decreasing across the fibrocartilage interface. Moreover, interfacial collagen fibrils were aligned parallel to the ligament-bone interface near the ligament region, assuming a more random orientation through the bulk of the interface. Proteoglycan content was uniform on average across the insertion, while its distribution was relatively less variable at the tibial compared to the femoral insertion. Mineral was only detected in the calcified interface region, and its content increased exponentially across the mineralized fibrocartilage region toward bone. In addition to new insights into matrix composition and organization across the complex multi-tissue junction, findings from this study provide critical benchmarks for the regeneration of soft tissue-to-bone interfaces and integrative soft tissue repair. PMID:24019964

Population and clinical genetics of human transposable elements in the (post) genomic era

PubMed Central

Rishishwar, Lavanya; Wang, Lu; Clayton, Evan A.; Mariño-Ramírez, Leonardo; McDonald, John F.; Jordan, I. King

2017-01-01

ABSTRACT Recent technological developments—in genomics, bioinformatics and high-throughput experimental techniques—are providing opportunities to study ongoing human transposable element (TE) activity at an unprecedented level of detail. It is now possible to characterize genome-wide collections of TE insertion sites for multiple human individuals, within and between populations, and for a variety of tissue types. Comparison of TE insertion site profiles between individuals captures the germline activity of TEs and reveals insertion site variants that segregate as polymorphisms among human populations, whereas comparison among tissue types ascertains somatic TE activity that generates cellular heterogeneity. In this review, we provide an overview of these new technologies and explore their implications for population and clinical genetic studies of human TEs. We cover both recent published results on human TE insertion activity as well as the prospects for future TE studies related to human evolution and health. PMID:28228978

Genome-Wide Estimates of Transposable Element Insertion and Deletion Rates in Drosophila Melanogaster

PubMed Central

Adrion, Jeffrey R.; Song, Michael J.; Schrider, Daniel R.; Hahn, Matthew W.

2017-01-01

Abstract Knowing the rate at which transposable elements (TEs) insert and delete is critical for understanding their role in genome evolution. We estimated spontaneous rates of insertion and deletion for all known, active TE superfamilies present in a set of Drosophila melanogaster mutation-accumulation (MA) lines using whole genome sequence data. Our results demonstrate that TE insertions far outpace TE deletions in D. melanogaster. We found a significant effect of background genotype on TE activity, with higher rates of insertions in one MA line. We also found significant rate heterogeneity between the chromosomes, with both insertion and deletion rates elevated on the X relative to the autosomes. Further, we identified significant associations between TE activity and chromatin state, and tested for associations between TE activity and other features of the local genomic environment such as TE content, exon content, GC content, and recombination rate. Our results provide the most detailed assessment of TE mobility in any organism to date, and provide a useful benchmark for both addressing theoretical predictions of TE dynamics and for exploring large-scale patterns of TE movement in D. melanogaster and other species. PMID:28338986

Congenital Spondylolytic Spondylolisthesis of C2 Vertebra Associated With Atlanto-Axial Dislocation, Chiari Type I Malformation, and Anomalous Vertebral Artery: Case Report With Review Literature.

PubMed

Sardhara, Jayesh; Pavaman, Sindgikar; Das, Kuntal; Srivastava, Arun; Mehrotra, Anant; Behari, Sanjay

2016-11-01

Congenital spondylolytic spondylolisthesis of C2 vertebra resulting from deficient posterior element of the axis is rarely described in the literature. We describe a unique case of agenesis of posterior elements of C2 with craniovertebral junction anomalies consisting of osseous, vascular, and soft tissue anomalies. A 26-year-old man presented with symptoms of upper cervical myelopathy of 12 months' duration. A computed tomography scan of the cervical spine including the craniovertebral junction revealed spondylolisthesis of C2 over C3, atlantoaxial dislocation, occipitalization of the atlas, hypoplasia of the odontoid, and cleft posterior C1 arch. Additionally, the axis vertebra was found devoid of its posterior elements except bilaterally rudimentary pedicles. Magnetic resonance imaging revealed tonsilar herniation, suggesting associated Chiari type I malformation. CT angiogram of the vertebral arteries displayed persistent bilateral first intersegmental arteries crossing the posterior aspect of the C1/2 facet joint. This patient underwent foramen magnum decompression, C3 laminectomy with occipito-C3/C4 posterior fusion using screw and rod to maintain the cervical alignment and stability. We report this rare constellation of congenital craniovertebral junction anomaly and review the relevant literature. Copyright © 2016 Elsevier Inc. All rights reserved.

Trypanosome RNA Editing Mediator Complex proteins have distinct functions in gRNA utilization.

PubMed

Simpson, Rachel M; Bruno, Andrew E; Chen, Runpu; Lott, Kaylen; Tylec, Brianna L; Bard, Jonathan E; Sun, Yijun; Buck, Michael J; Read, Laurie K

2017-07-27

Uridine insertion/deletion RNA editing is an essential process in kinetoplastid parasites whereby mitochondrial mRNAs are modified through the specific insertion and deletion of uridines to generate functional open reading frames, many of which encode components of the mitochondrial respiratory chain. The roles of numerous non-enzymatic editing factors have remained opaque given the limitations of conventional methods to interrogate the order and mechanism by which editing progresses and thus roles of individual proteins. Here, we examined whole populations of partially edited sequences using high throughput sequencing and a novel bioinformatic platform, the Trypanosome RNA Editing Alignment Tool (TREAT), to elucidate the roles of three proteins in the RNA Editing Mediator Complex (REMC). We determined that the factors examined function in the progression of editing through a gRNA; however, they have distinct roles and REMC is likely heterogeneous in composition. We provide the first evidence that editing can proceed through numerous paths within a single gRNA and that non-linear modifications are essential, generating commonly observed junction regions. Our data support a model in which RNA editing is executed via multiple paths that necessitate successive re-modification of junction regions facilitated, in part, by the REMC variant containing TbRGG2 and MRB8180. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Enhancement of tunneling magnetoresistance by inserting a diffusion barrier in L10-FePd perpendicular magnetic tunnel junctions

NASA Astrophysics Data System (ADS)

Zhang, De-Lin; Schliep, Karl B.; Wu, Ryan J.; Quarterman, P.; Reifsnyder Hickey, Danielle; Lv, Yang; Chao, Xiaohui; Li, Hongshi; Chen, Jun-Yang; Zhao, Zhengyang; Jamali, Mahdi; Mkhoyan, K. Andre; Wang, Jian-Ping

2018-04-01

We studied the tunnel magnetoresistance (TMR) of L10-FePd perpendicular magnetic tunnel junctions (p-MTJs) with an FePd free layer and an inserted diffusion barrier. The diffusion barriers studied here (Ta and W) were shown to enhance the TMR ratio of the p-MTJs formed using high-temperature annealing, which are necessary for the formation of high quality L10-FePd films and MgO barriers. The L10-FePd p-MTJ stack was developed with an FePd free layer with a stack of FePd/X/Co20Fe60B20, where X is the diffusion barrier, and patterned into micron-sized MTJ pillars. The addition of the diffusion barrier was found to greatly enhance the magneto-transport behavior of the L10-FePd p-MTJ pillars such that those without a diffusion barrier exhibited negligible TMR ratios (<1.0%), whereas those with a Ta (W) diffusion barrier exhibited TMR ratios of 8.0% (7.0%) at room temperature and 35.0% (46.0%) at 10 K after post-annealing at 350 °C. These results indicate that diffusion barriers could play a crucial role in realizing high TMR ratios in bulk p-MTJs such as those based on FePd and Mn-based perpendicular magnetic anisotropy materials for spintronic applications.

Passive On-Chip Superconducting Circulator Using a Ring of Tunnel Junctions

NASA Astrophysics Data System (ADS)

Müller, Clemens; Guan, Shengwei; Vogt, Nicolas; Cole, Jared H.; Stace, Thomas M.

2018-05-01

We present the design of a passive, on-chip microwave circulator based on a ring of superconducting tunnel junctions. We investigate two distinct physical realizations, based on Josephson junctions (JJs) or quantum phase slip elements (QPS), with microwave ports coupled either capacitively (JJ) or inductively (QPS) to the ring structure. A constant bias applied to the center of the ring provides an effective symmetry breaking field, and no microwave or rf bias is required. We show that this design offers high isolation, robustness against fabrication imperfections and bias fluctuations, and a bandwidth in excess of 500 MHz for realistic device parameters.

Reduced junction temperature and enhanced performance of high power light-emitting diodes using reduced graphene oxide pattern

NASA Astrophysics Data System (ADS)

Han, Nam; Jung, Eunjin; Han, Min; Deul Ryu, Beo; Bok Ko, Kang; Park, Young Jae; Cuong, TranViet; Cho, Jaehee; Kim, Hyunsoo; Hong, Chang-Hee

2015-07-01

Thermal management has become a crucial area for further development of high-power light-emitting didoes (LEDs) due to the high operating current densities that are required and result in additional joule heating. This increased joule heating negatively affects the performance of the LEDs since it greatly decreases both the optical performance and the lifetime. To circumvent this problem, a reduced graphene oxide (rGO) layer can be inserted to act as a heat spreader. In this study, current-voltage and light-output-current measurements are systematically performed at different temperatures from 30 to 190 °C to investigate the effect that the embedded rGO pattern has on the device performance. At a high temperature and high operating current, the junction temperature (Tj) is 23% lower and the external quantum efficiency (EQE) is 24% higher for the rGO embedded LEDs relative to those of conventional LEDs. In addition, the thermal activation energy of the rGO embedded LEDs exhibits a 30% enhancement as a function of the temperature at a bias of  -5 V. This indicates that the rGO pattern plays an essential role in decreasing the junction temperature and results in a favorable performance in terms of the temperature of the high power GaN-based LED junction.

Characterization of the Fb-Nof Transposable Element of Drosophila Melanogaster

PubMed Central

Harden, N.; Ashburner, M.

1990-01-01

FB-NOF is a composite transposable element of Drosophila melanogaster. It is composed of foldback sequences, of variable length, which flank a 4-kb NOF sequence with 308-bp inverted repeat termini. The NOF sequence could potentially code for a 120-kD polypeptide. The FB-NOF element is responsible for unstable mutations of the white gene (w(c) and w(DZL)) and is associated with the large TEs of G. Ising. Although most strains of D. melanogaster have 20-30 sites of FB insertion, FB-NOF elements are usually rare, many strains lack this composite element or have only one copy of it. A few strains, including w(DZL) and Basc have many (8-21) copies of FB-NOF, and these show a tendency to insert at ``hot-spots.'' These strains also have an increased number of FB elements. The DNA sequence of the NOF region associated with TE146(Z) has been determined. PMID:2174013

The central element of the synaptonemal complex in mice is organized as a bilayered junction structure.

PubMed

Hernández-Hernández, Abrahan; Masich, Sergej; Fukuda, Tomoyuki; Kouznetsova, Anna; Sandin, Sara; Daneholt, Bertil; Höög, Christer

2016-06-01

The synaptonemal complex transiently stabilizes pairing interactions between homologous chromosomes during meiosis. Assembly of the synaptonemal complex is mediated through integration of opposing transverse filaments into a central element, a process that is poorly understood. We have, here, analyzed the localization of the transverse filament protein SYCP1 and the central element proteins SYCE1, SYCE2 and SYCE3 within the central region of the synaptonemal complex in mouse spermatocytes using immunoelectron microscopy. Distribution of immuno-gold particles in a lateral view of the synaptonemal complex, supported by protein interaction data, suggest that the N-terminal region of SYCP1 and SYCE3 form a joint bilayered central structure, and that SYCE1 and SYCE2 localize in between the two layers. We find that disruption of SYCE2 and TEX12 (a fourth central element protein) localization to the central element abolishes central alignment of the N-terminal region of SYCP1. Thus, our results show that all four central element proteins, in an interdependent manner, contribute to stabilization of opposing N-terminal regions of SYCP1, forming a bilayered transverse-filament-central-element junction structure that promotes synaptonemal complex formation and synapsis. © 2016. Published by The Company of Biologists Ltd.

Rates and patterns of great ape retrotransposition.

PubMed

Hormozdiari, Fereydoun; Konkel, Miriam K; Prado-Martinez, Javier; Chiatante, Giorgia; Herraez, Irene Hernando; Walker, Jerilyn A; Nelson, Benjamin; Alkan, Can; Sudmant, Peter H; Huddleston, John; Catacchio, Claudia R; Ko, Arthur; Malig, Maika; Baker, Carl; Marques-Bonet, Tomas; Ventura, Mario; Batzer, Mark A; Eichler, Evan E

2013-08-13

We analyzed 83 fully sequenced great ape genomes for mobile element insertions, predicting a total of 49,452 fixed and polymorphic Alu and long interspersed element 1 (L1) insertions not present in the human reference assembly and assigning each retrotransposition event to a different time point during great ape evolution. We used these homoplasy-free markers to construct a mobile element insertions-based phylogeny of humans and great apes and demonstrate their differential power to discern ape subspecies and populations. Within this context, we find a good correlation between L1 diversity and single-nucleotide polymorphism heterozygosity (r(2) = 0.65) in contrast to Alu repeats, which show little correlation (r(2) = 0.07). We estimate that the "rate" of Alu retrotransposition has differed by a factor of 15-fold in these lineages. Humans, chimpanzees, and bonobos show the highest rates of Alu accumulation--the latter two since divergence 1.5 Mya. The L1 insertion rate, in contrast, has remained relatively constant, with rates differing by less than a factor of three. We conclude that Alu retrotransposition has been the most variable form of genetic variation during recent human-great ape evolution, with increases and decreases occurring over very short periods of evolutionary time.

The Tc1/mariner transposable element family shapes genetic variation and gene expression in the protist Trichomonas vaginalis

PubMed Central

2014-01-01

Background Trichomonas vaginalis is the most prevalent non-viral sexually transmitted parasite. Although the protist is presumed to reproduce asexually, 60% of its haploid genome contains transposable elements (TEs), known contributors to genome variability. The availability of a draft genome sequence and our collection of >200 global isolates of T. vaginalis facilitate the study and analysis of TE population dynamics and their contribution to genomic variability in this protist. Results We present here a pilot study of a subset of class II Tc1/mariner TEs that belong to the T. vaginalis Tvmar1 family. We report the genetic structure of 19 Tvmar1 loci, their ability to encode a full-length transposase protein, and their insertion frequencies in 94 global isolates from seven regions of the world. While most of the Tvmar1 elements studied exhibited low insertion frequencies, two of the 19 loci (locus 1 and locus 9) show high insertion frequencies of 1.00 and 0.96, respectively. The genetic structuring of the global populations identified by principal component analysis (PCA) of the Tvmar1 loci is in general agreement with published data based on genotyping, showing that Tvmar1 polymorphisms are a robust indicator of T. vaginalis genetic history. Analysis of expression of 22 genes flanking 13 Tvmar1 loci indicated significantly altered expression of six of the genes next to five Tvmar1 insertions, suggesting that the insertions have functional implications for T. vaginalis gene expression. Conclusions Our study is the first in T. vaginalis to describe Tvmar1 population dynamics and its contribution to genetic variability of the parasite. We show that a majority of our studied Tvmar1 insertion loci exist at very low frequencies in the global population, and insertions are variable between geographical isolates. In addition, we observe that low frequency insertion is related to reduced or abolished expression of flanking genes. While low insertion frequencies might be expected, we identified two Tvmar1 insertion loci that are fixed across global populations. This observation indicates that Tvmar1 insertion may have differing impacts and fitness costs in the host genome and may play varying roles in the adaptive evolution of T. vaginalis. PMID:24834134

Photovoltaic radiation detector element

DOEpatents

Agouridis, Dimitrios C.

1983-01-01

A radiation detector element is formed of a body of semiconductor material, a coating on the body which forms a photovoltaic junction therewith, and a current collector consisting of narrow metallic strips, the aforesaid coating having an opening therein the edge of which closely approaches but is spaced from the current collector strips.

New connecting elements for cascade photoelectric converters based on InP

NASA Astrophysics Data System (ADS)

Marichev, A. E.; Pushnyi, B. V.; Levin, R. V.; Lebedeva, N. M.; Prasolov, N. D.; Kontrosh, E. V.

2018-03-01

In this paper, we report on the initial studies of connecting elements for cascade photodetectors. The heterostructures used in this work are based on InP. As a connecting element, it is proposed to use nanocrystalline inclusions instead of the tunnel junction. GaP nanocrystals are most suitable for this purpose because this material does not cause absorption of the incident radiation.

Interface thermal conductance characterization by infrared thermography: A tool for the study of insertions in bronze ancient Statuary

NASA Astrophysics Data System (ADS)

Mercuri, F.; Caruso, G.; Orazi, N.; Zammit, U.; Cicero, C.; Colacicchi Alessandri, O.; Ferretti, M.; Paoloni, S.

2018-05-01

In this paper, a new method based on the use of infrared thermography is proposed for the characterization of repairs and inserted parts on ancient bronzes. In particular, the quality of the contact between different kind of insertions and the main body of bronze statues is investigated by analysing the heat conduction process occurring across the interface between them. The thermographic results have been used to establish the nature of these inserted elements and the way they have been coupled to the main body of the statue during and after the manufacturing process. A model for the heat conduction based on the numerical finite elements method has been applied to compare the obtained results to the theoretical predictions. Measurements have been first carried out on test samples and then in the field on the Boxer at Rest (Museo Nazionale Romano in Rome), a masterpiece of the Greek Statuary, which contains a large variety of inserted items and repairs which are typical of the manufacturing process of bronze artefacts in general.

Droplet Traffic Control at a simple T junction

NASA Astrophysics Data System (ADS)

Panizza, Pascal; Engl, Wilfried; Colin, Annie; Ajdari, Armand

2006-03-01

A basic yet essential element of every traffic flow control is the effect of a junction where the flow is separated into several streams. How do pedestrians, vehicles or blood cells divide when they reach a junction? How does the outcome depend on their density? Similar fundamental questions hold for much simpler systems: in this paper, we have studied the behaviour of periodic trains of water droplets flowing in oil through a channel as they reach a simple, locally symmetric, T junction. Depending on their dilution, we observe that the droplets are either alternately partitioned between both outlets or sorted exclusively into the shortest one. We show that this surprising behaviour results from the hydrodynamic feed-back of drops in the two outlets on the selection process occurring at the junction. Our results offer a first guide for the design and modelling of droplet traffic in complex branched networks, a necessary step towards parallelized droplet-based ``lab-on-chip'' devices.

Histopathology of tympanic membranes from patients with ventilation tubes.

PubMed

Oktay, Mehmet Faruk; Tansuker, Hasan Deniz; Fukushima, Hisaki; Paparella, Michael M; Schachern, Patricia A; Cureoglu, Sebahattin

2018-06-01

To evaluate the histopathologic changes in tympanic membranes (TMs) with ventilation tubes (VTs). In this retrospective human temporal bone study our overall study group included 4 subgroups of TMs from deceased donors as follows: 24 with a history of VT insertion for chronic otitis media with effusion (COME-VT); 5 with a history of VT insertion for Meniere's disease (MD-VT); 33 without a history of VT insertion for chronic otitis media with effusion (COME); and 14 without a history of VT insertion for Meniere's disease (MD). We classified the extent of migration of the outer keratinized squamous epithelium onto the inner surface of TM perforations and noted the presence and location of tympanosclerosis, of atrophy, of perforation, and/or of cholesteatoma formation. Tympanosclerosis occurred in 14/24 TMs in the COME-VT subgroup; 2/5, MD-VT; 7/33, COME; and 0/14, MD. The VT insertion site was mostly in the anteroinferior (63%) quadrant of the TM; tympanosclerosis occurred more frequently in the posteroinferior (42%) and posterosuperior (33%) quadrants. We found no significant correlation between the location of tympanosclerosis and the VT insertion site (P>0.05). Atrophy occurred in 7/24 TMs in the COME-VT subgroup; 3/5, MD-VT; 8/33, COME; and 2/14, MD. We found no significant correlation between the location of atrophy and the VT insertion site; however, atrophy was located mostly in the anteroinferior quadrant (one of the most common VT insertion sites) of the TM. Regarding the ingrowth of keratinized epithelium, the mucocutanous junction was detected at any point at the inner surface of the TM in 50% of the specimens. We observed intratympanic cholesteatoma formation in 2/24 TMs in the COME-VT subgroup. TM changes due to VT insertion are more common than previously realized. Meticulous otomicroscopic evaluation of the TM is necessary during tympanomastoidectomies in order to prevent the intratympanic inclusion pearls and squamous epithelial ingrowth to prevent any further cholesteatoma formation. Copyright © 2017. Published by Elsevier B.V.

Development of High Temperature Superconducting Josephson Junction Device Technology

DTIC Science & Technology

1998-07-09

neodymium gallate , cerium oxide-buffered sapphire, and lanthanum aluminate, are not ideal for an in situ thallium cuprate junction technology. Moreover...determined that the standard HTS substrates, neodymium gallate , cerium oxide-buffered sapphire, and lanthanum aluminate, are not ideal for an in situ...2.2.1. Deposition Uniformity 10 2.2.2. Radiative Element 12 2.3. SUBSTRATES 13 2.3.1. Neodymium gallate 14 2.3.2. Cerium Oxide-Buffered Sapphire 16

The Role(s) of Heparan Sulfate Proteoglycan(s) in the wnt-1 Signaling Pathway

DTIC Science & Technology

1998-08-01

First , the sequence of the cDNA, when compared to the genomic site of insertion of the P-element, revealed that the P-element is inserted 686 bp...stages 8 to 13 (Yoffe et al. 1995). We first examined whether ectopic expression of Wgts effectively restores the naked cuticle as it does in wg and...by Kjell~n and Lindahl, 1991) . HS/heparin N-deacetylase/N-sulfotransferase catalyzes N-deacetylation and N-sulfation that is the first and key step

Identification of elemental mercury in the subsurface

DOEpatents

Jackson, Dennis G

2015-01-06

An apparatus and process is provided for detecting elemental mercury in soil. A sacrificial electrode of aluminum is inserted below ground to a desired location using direct-push/cone-penetrometer based equipment. The insertion process removes any oxides or previously found mercury from the electrode surface. Any mercury present adjacent the electrode can be detected using a voltmeter which indicates the presence or absence of mercury. Upon repositioning the electrode within the soil, a fresh surface of the aluminum electrode is created allowing additional new measurements.

A VNTR element associated with steroid sulfatase gene deletions stimulates recombination in cultured cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gong, Y.; Li, X.M.; Shapiro, L.J.

1994-09-01

Steroid sulfatase deficiency is a common genetic disorder, with a prevalence of approximately one in every 3500 males world wide. About 90% of these patients have complete gene deletions, which appear to result from recombination between members of a low-copy repeat family (CRI-232 is the prototype) that flank the gene. RU1 and RU2 are two VNTR elements found within each of these family members. RU1 consists of 30 bp repeating units and its length shows minimal variation among individuals. The RU2 element consists of repeating sequences which are highly asymmetric, with about 90% purines and no C`s on one strand,more » and range from 0.6 kb to over 23 kb among different individuals. We conducted a study to determine if the RU1 or RU2 elements can promote recombination in an in vivo test system. We inserted these elements adjacent to the neo gene in each of two pSV2neo derivatives, one of which has a deletion in the 5{prime} portion of the neo gene and the other having a deletion in the 3{prime} portion. These plasmids were combined and used to transfect EJ cells. Survival of cells in G418 indicates restoration of a functional neo gene by recombination between two deletion constructs. Thus counting G418 resistant colonies gives a quantitative measure of the enhancement of recombination by the inserted VNTR elements. The results showed no effect on recombination by the inserted RU1 element (compared to the insertion of a nonspecific sequence), while the RU2 element stimulated recombination by 3.5-fold (P<0.01). A separate set of constructs placed RU1 or RU2 within the intron of an exon trapping vector. Following tranfection of cells, recombination events were monitored by a PCR assay that detected the approximation of primer binding sites (as a result of recombination). These studies showed that, as in the first set of experiments, the highly variable RU2 element is capable of stimulating somatic recombination in mammalian cells.« less

InGaP Heterojunction Barrier Solar Cells

NASA Technical Reports Server (NTRS)

Welser, Roger E. (Inventor)

2014-01-01

A new solar cell structure called a heterojunction barrier solar cell is described. As with previously reported quantum-well and quantum-dot solar cell structures, a layer of narrow band-gap material, such as GaAs or indium-rich InGaP, is inserted into the depletion region of a wide band-gap PN junction. Rather than being thin, however, the layer of narrow band-gap material is about 400-430 nm wide and forms a single, ultrawide well in the depletion region. Thin (e.g., 20-50 nm), wide band-gap InGaP barrier layers in the depletion region reduce the diode dark current. Engineering the electric field and barrier profile of the absorber layer, barrier layer, and p-type layer of the PN junction maximizes photogenerated carrier escape. This new twist on nanostructured solar cell design allows the separate optimization of current and voltage to maximize conversion efficiency.

Left arm/left leg lead reversals at the cable junction box: A cause for an epidemic of errors.

PubMed

Velagapudi, Poonam; Turagam, Mohit K; Ritter, Sherry; Dohrmann, Mary L

Medical errors, especially due to misinterpretation of electrocardiograms (ECG), are extremely common in patients admitted to the hospital and significantly account for increased morbidity, mortality and health care costs in the United States. Inaccurate performance of an ECG can lead to invalid interpretation and in turn may lead to costly cardiovascular evaluation. We report a retrospective series of 58 sequential cases of ECG limb lead reversals in the ER due to inadvertent interchange in the lead cables at the point where they insert into the cable junction box of one ECG machine. This case series highlights recognition of ECG lead reversal originating in the ECG machine itself. This case series also demonstrates an ongoing need for education regarding standardization of ECG testing and for recognizing technical anomalies to deliver appropriate care for the patient. Copyright © 2016. Published by Elsevier Inc.

Chromosome catastrophes involve replication mechanisms generating complex genomic rearrangements

PubMed Central

Liu, Pengfei; Erez, Ayelet; Sreenath Nagamani, Sandesh C.; Dhar, Shweta U.; Kołodziejska, Katarzyna E.; Dharmadhikari, Avinash V.; Cooper, M. Lance; Wiszniewska, Joanna; Zhang, Feng; Withers, Marjorie A.; Bacino, Carlos A.; Campos-Acevedo, Luis Daniel; Delgado, Mauricio R.; Freedenberg, Debra; Garnica, Adolfo; Grebe, Theresa A.; Hernández-Almaguer, Dolores; Immken, LaDonna; Lalani, Seema R.; McLean, Scott D.; Northrup, Hope; Scaglia, Fernando; Strathearn, Lane; Trapane, Pamela; Kang, Sung-Hae L.; Patel, Ankita; Cheung, Sau Wai; Hastings, P. J.; Stankiewicz, Paweł; Lupski, James R.; Bi, Weimin

2011-01-01

SUMMARY Complex genomic rearrangements (CGR) consisting of two or more breakpoint junctions have been observed in genomic disorders. Recently, a chromosome catastrophe phenomenon termed chromothripsis, in which numerous genomic rearrangements are apparently acquired in one single catastrophic event, was described in multiple cancers. Here we show that constitutionally acquired CGRs share similarities with cancer chromothripsis. In the 17 CGR cases investigated we observed localization and multiple copy number changes including deletions, duplications and/or triplications, as well as extensive translocations and inversions. Genomic rearrangements involved varied in size and complexities; in one case, array comparative genomic hybridization revealed 18 copy number changes. Breakpoint sequencing identified characteristic features, including small templated insertions at breakpoints and microhomology at breakpoint junctions, which have been attributed to replicative processes. The resemblance between CGR and chromothripsis suggests similar mechanistic underpinnings. Such chromosome catastrophic events appear to reflect basic DNA metabolism operative throughout an organism’s life cycle. PMID:21925314

Hot Fusion: an efficient method to clone multiple DNA fragments as well as inverted repeats without ligase.

PubMed

Fu, Changlin; Donovan, William P; Shikapwashya-Hasser, Olga; Ye, Xudong; Cole, Robert H

2014-01-01

Molecular cloning is utilized in nearly every facet of biological and medical research. We have developed a method, termed Hot Fusion, to efficiently clone one or multiple DNA fragments into plasmid vectors without the use of ligase. The method is directional, produces seamless junctions and is not dependent on the availability of restriction sites for inserts. Fragments are assembled based on shared homology regions of 17-30 bp at the junctions, which greatly simplifies the construct design. Hot Fusion is carried out in a one-step, single tube reaction at 50 °C for one hour followed by cooling to room temperature. In addition to its utility for multi-fragment assembly Hot Fusion provides a highly efficient method for cloning DNA fragments containing inverted repeats for applications such as RNAi. The overall cloning efficiency is in the order of 90-95%.

Hot Fusion: An Efficient Method to Clone Multiple DNA Fragments as Well as Inverted Repeats without Ligase

PubMed Central

Fu, Changlin; Donovan, William P.; Shikapwashya-Hasser, Olga; Ye, Xudong; Cole, Robert H.

2014-01-01

Molecular cloning is utilized in nearly every facet of biological and medical research. We have developed a method, termed Hot Fusion, to efficiently clone one or multiple DNA fragments into plasmid vectors without the use of ligase. The method is directional, produces seamless junctions and is not dependent on the availability of restriction sites for inserts. Fragments are assembled based on shared homology regions of 17–30 bp at the junctions, which greatly simplifies the construct design. Hot Fusion is carried out in a one-step, single tube reaction at 50°C for one hour followed by cooling to room temperature. In addition to its utility for multi-fragment assembly Hot Fusion provides a highly efficient method for cloning DNA fragments containing inverted repeats for applications such as RNAi. The overall cloning efficiency is in the order of 90–95%. PMID:25551825

Tool Releases Optical Elements From Spring Brackets

NASA Technical Reports Server (NTRS)

Gum, J. S.

1984-01-01

Threaded hooks retract bracket arms holding element. Tool uses three hooks with threaded shanks mounted in ring-shaped holder to pull on tabs to release optical element. One person can easily insert or remove optical element (such as prism or lens) from spring holder or bracket with minimal risk of damage.

The underlying micro-mechanism of performance enhancement of non-polar n-ZnO/p-AlGaN ultraviolet light emitting diode with i-ZnO inserted layer

NASA Astrophysics Data System (ADS)

Jiang, Fan; Chen, Jingwen; Bi, Han; Li, Luying; Jing, Wenkui; Zhang, Jun; Dai, Jiangnan; Che, Renchao; Chen, Changqing; Gao, Yihua

2018-01-01

Non-polar a-plane n-ZnO/p-AlGaN and n-ZnO/i-ZnO/p-AlGaN heterojunction film light-emitting diodes (LEDs) are fabricated with good crystalline quality. The optical measurements show obvious performance enhancement with i-ZnO layer insertion. Off-axis electron holography reveals a potential drop of ˜1.5 V across the heterojunctions with typical p-n junction characteristics. It is found that the electrostatic potentials are inclined and the corresponding electrostatic fields are opposite to each other in n-ZnO and p-AlGaN regions. The electrostatic fields are mainly attributed to strain induced piezoelectric polarizations. After an insertion of an i-ZnO layer into the p-n heterojunction, comparatively flat electrostatic potential generates in the intrinsic ZnO region and contributes to faster movements of the injected electrons and holes, making the i-ZnO layer more conductive to the radiative recombination with enhanced exciton recombination possibilities and at last the LED performance enhancement.

Ultrasonic studies of high-temperature superconductors

NASA Astrophysics Data System (ADS)

Feller, Jeffrey Robert

1997-09-01

This dissertation consists roughly of two parts. The first part deals with YBa2Cu3O7-δ (YBCO) films deposited on piezoelectric (LiNbO3) substrates. Interdigital surface acoustic wave (SAW) devices (delay lines operating at center frequencies of 50 and 100 MHz) fabricated from YBCO films are examined; insertion loss measurements are presented, and electrode resistance effects are analyzed using equivalent circuit models. Sheet resistance and 168 MHz SAW attenuation measurements of a granular YBCO film on LiNbO3 are also presented. The experimental data are discussed in terms of a percolation theory that models the film as an array of identical YBCO grains connected by resistive junctions which, in the superconducting state behave as Josephson junctions. The normal state resistances of the junctions are assumed to be randomly distributed. In the second part of the dissertation, a number of novel techniques (SAW 'bridges,' the high frequency interdigital proximity probe, and weak acoustic coupling sampled continuous wave spectrometry), used in the study of the vortex state and structural transitions in the normal state of YBCO films and single crystals, are described. Evidence of the existence of a first order structural transition in the vicinity of 220 K is provided.

Chromosome arm-specific BAC end sequences permit comparative analysis of homoeologous chromosomes and genomes of polyploid wheat

PubMed Central

2012-01-01

Background Bread wheat, one of the world’s staple food crops, has the largest, highly repetitive and polyploid genome among the cereal crops. The wheat genome holds the key to crop genetic improvement against challenges such as climate change, environmental degradation, and water scarcity. To unravel the complex wheat genome, the International Wheat Genome Sequencing Consortium (IWGSC) is pursuing a chromosome- and chromosome arm-based approach to physical mapping and sequencing. Here we report on the use of a BAC library made from flow-sorted telosomic chromosome 3A short arm (t3AS) for marker development and analysis of sequence composition and comparative evolution of homoeologous genomes of hexaploid wheat. Results The end-sequencing of 9,984 random BACs from a chromosome arm 3AS-specific library (TaaCsp3AShA) generated 11,014,359 bp of high quality sequence from 17,591 BAC-ends with an average length of 626 bp. The sequence represents 3.2% of t3AS with an average DNA sequence read every 19 kb. Overall, 79% of the sequence consisted of repetitive elements, 1.38% as coding regions (estimated 2,850 genes) and another 19% of unknown origin. Comparative sequence analysis suggested that 70-77% of the genes present in both 3A and 3B were syntenic with model species. Among the transposable elements, gypsy/sabrina (12.4%) was the most abundant repeat and was significantly more frequent in 3A compared to homoeologous chromosome 3B. Twenty novel repetitive sequences were also identified using de novo repeat identification. BESs were screened to identify simple sequence repeats (SSR) and transposable element junctions. A total of 1,057 SSRs were identified with a density of one per 10.4 kb, and 7,928 junctions between transposable elements (TE) and other sequences were identified with a density of one per 1.39 kb. With the objective of enhancing the marker density of chromosome 3AS, oligonucleotide primers were successfully designed from 758 SSRs and 695 Insertion Site Based Polymorphisms (ISBPs). Of the 96 ISBP primer pairs tested, 28 (29%) were 3A-specific and compared to 17 (18%) for 96 SSRs. Conclusion This work reports on the use of wheat chromosome arm 3AS-specific BAC library for the targeted generation of sequence data from a particular region of the huge genome of wheat. A large quantity of sequences were generated from the A genome of hexaploid wheat for comparative genome analysis with homoeologous B and D genomes and other model grass genomes. Hundreds of molecular markers were developed from the 3AS arm-specific sequences; these and other sequences will be useful in gene discovery and physical mapping. PMID:22559868

An Accessory Muscle of Pectoral Region: A Case Report

PubMed Central

Bannur, B.M.; Mallashetty, Nagaraj; Endigeri, Preetish

2013-01-01

Among the variations of pectoral muscles, this case appears to be unique in the literature. This was a case of an accessory pectoral muscle which was located between pectoralis major and pectoralis minor muscles, which was discovered during a routine anatomy dissection. The accessory muscle originated from 6th and 7th ribs at costo-chondral junction, which travelled supero-laterally and inserted by fusing with fibres of pectoralis minor. This unusual muscle holds importance for surgeons while they perform dissectomies, in avoiding complications. PMID:24179919

Integrated Cryogenic Electronics Testbed (ICE-T) for Evaluation of Superconductor and Cryo-Semiconductor Integrated Circuits

NASA Astrophysics Data System (ADS)

Dotsenko, V. V.; Sahu, A.; Chonigman, B.; Tang, J.; Lehmann, A. E.; Gupta, V.; Talalevskii, A.; Ruotolo, S.; Sarwana, S.; Webber, R. J.; Gupta, D.

2017-02-01

Research and development of cryogenic application-specific integrated circuits (ASICs), such as high-frequency (tens of GHz) semiconductor and superconductor mixed-signal circuits and large-scale (>10,000 Josephson Junctions) superconductor digital circuits, have long been hindered by the absence of specialized cryogenic test apparatus. During their iterative development phase, most ASICs require many additional input-output lines for applying independent bias controls, injecting test signals, and monitoring outputs of different sub-circuits. We are developing a full suite of modular test apparatus based on cryocoolers that do not consume liquid helium, and support extensive electrical interfaces to standard and custom test equipment. Our design separates the cryogenics from electrical connections, allowing even inexperienced users to conduct testing by simply mounting their ASIC on a removable electrical insert. Thermal connections between the cold stages and the inserts are made with robust thermal links. ICE-T accommodates two independent electrical inserts at the same time. We have designed various inserts, such as universal ones with all 40 or 80 coaxial cables and those with customized wiring and temperature-controlled stages. ICE-T features fast thermal cycling for rapid testing, enables detailed testing over long periods (days to months, if necessary), and even supports automated testing of digital ICs with modular additions.

A bioinformatics approach for identifying transgene insertion sites using whole genome sequencing data.

PubMed

Park, Doori; Park, Su-Hyun; Ban, Yong Wook; Kim, Youn Shic; Park, Kyoung-Cheul; Kim, Nam-Soo; Kim, Ju-Kon; Choi, Ik-Young

2017-08-15

Genetically modified crops (GM crops) have been developed to improve the agricultural traits of modern crop cultivars. Safety assessments of GM crops are of paramount importance in research at developmental stages and before releasing transgenic plants into the marketplace. Sequencing technology is developing rapidly, with higher output and labor efficiencies, and will eventually replace existing methods for the molecular characterization of genetically modified organisms. To detect the transgenic insertion locations in the three GM rice gnomes, Illumina sequencing reads are mapped and classified to the rice genome and plasmid sequence. The both mapped reads are classified to characterize the junction site between plant and transgene sequence by sequence alignment. Herein, we present a next generation sequencing (NGS)-based molecular characterization method, using transgenic rice plants SNU-Bt9-5, SNU-Bt9-30, and SNU-Bt9-109. Specifically, using bioinformatics tools, we detected the precise insertion locations and copy numbers of transfer DNA, genetic rearrangements, and the absence of backbone sequences, which were equivalent to results obtained from Southern blot analyses. NGS methods have been suggested as an effective means of characterizing and detecting transgenic insertion locations in genomes. Our results demonstrate the use of a combination of NGS technology and bioinformatics approaches that offers cost- and time-effective methods for assessing the safety of transgenic plants.

Isolation and molecular characterization of dTnp1, a mobile and defective transposable element of Nicotiana plumbaginifolia.

PubMed

Meyer, C; Pouteau, S; Rouzé, P; Caboche, M

1994-01-01

By Northern blot analysis of nitrate reductase-deficient mutants of Nicotiana plumbaginifolia, we identified a mutant (mutant D65), obtained after gamma-ray irradiation of protoplasts, which contained an insertion sequence in the nitrate reductase (NR) mRNA. This insertion sequence was localized by polymerase chain reaction (PCR) in the first exon of NR and was also shown to be present in the NR gene. The mutant gene contained a 565 bp insertion sequence that exhibits the sequence characteristics of a transposable element, which was thus named dTnp1. The dTnp1 element has 14 bp terminal inverted repeats and is flanked by an 8-bp target site duplication generated upon transposition. These inverted repeats have significant sequence homology with those of other transposable elements. Judging by its size and the absence of a long open reading frame, dTnp1 appears to represent a defective, although mobile, transposable element. The octamer motif TTTAGGCC was found several times in direct orientation near the 5' and 3' ends of dTnp1 together with a perfect palindrome located after the 5' inverted repeat. Southern blot analysis using an internal probe of dTnp1 suggested that this element occurs as a single copy in the genome of N. plumbaginifolia. It is also present in N. tabacum, but absent in tomato or petunia. The dTnp1 element is therefore of potential use for gene tagging in Nicotiana species.

A hobo transgene that encodes the P-element transposase in Drosophila melanogaster: autoregulation and cytotype control of transposase activity.

PubMed Central

Simmons, Michael J; Haley, Kevin J; Grimes, Craig D; Raymond, John D; Niemi, Jarad B

2002-01-01

Drosophila were genetically transformed with a hobo transgene that contains a terminally truncated but otherwise complete P element fused to the promoter from the Drosophila hsp70 gene. Insertions of this H(hsp/CP) transgene on either of the major autosomes produced the P transposase in both the male and female germlines, but not in the soma. Heat-shock treatments significantly increased transposase activity in the female germline; in the male germline, these treatments had little effect. The transposase activity of two insertions of the H(hsp/CP) transgene was not significantly greater than their separate activities, and one insertion of this transgene reduced the transposase activity of P(ry(+), Delta2-3)99B, a stable P transgene, in the germline as well as in the soma. These observations suggest that, through alternate splicing, the H(hsp/CP) transgene produces a repressor that feeds back negatively to regulate transposase expression or function in both the somatic and germline tissues. The H(hsp/CP) transgenes are able to induce gonadal dysgenesis when the transposase they encode has P-element targets to attack. However, this ability and the ability to induce P-element excisions are repressed by the P cytotype, a chromosomal/cytoplasmic state that regulates P elements in the germline. PMID:12019234

Dissection of neuronal gap junction circuits that regulate social behavior in Caenorhabditis elegans.

PubMed

Jang, Heeun; Levy, Sagi; Flavell, Steven W; Mende, Fanny; Latham, Richard; Zimmer, Manuel; Bargmann, Cornelia I

2017-02-14

A hub-and-spoke circuit of neurons connected by gap junctions controls aggregation behavior and related behavioral responses to oxygen, pheromones, and food in Caenorhabditis elegans The molecular composition of the gap junctions connecting RMG hub neurons with sensory spoke neurons is unknown. We show here that the innexin gene unc-9 is required in RMG hub neurons to drive aggregation and related behaviors, indicating that UNC-9-containing gap junctions mediate RMG signaling. To dissect the circuit in detail, we developed methods to inhibit unc-9 -based gap junctions with dominant-negative unc-1 transgenes. unc-1(dn) alters a stomatin-like protein that regulates unc-9 electrical signaling; its disruptive effects can be rescued by a constitutively active UNC-9::GFP protein, demonstrating specificity. Expression of unc-1(dn) in RMG hub neurons, ADL or ASK pheromone-sensing neurons, or URX oxygen-sensing neurons disrupts specific elements of aggregation-related behaviors. In ADL, unc-1(dn) has effects opposite to those of tetanus toxin light chain, separating the roles of ADL electrical and chemical synapses. These results reveal roles of gap junctions in a complex behavior at cellular resolution and provide a tool for similar exploration of other gap junction circuits.

Dissection of neuronal gap junction circuits that regulate social behavior in Caenorhabditis elegans

PubMed Central

Jang, Heeun; Levy, Sagi; Flavell, Steven W.; Mende, Fanny; Latham, Richard; Zimmer, Manuel; Bargmann, Cornelia I.

2017-01-01

A hub-and-spoke circuit of neurons connected by gap junctions controls aggregation behavior and related behavioral responses to oxygen, pheromones, and food in Caenorhabditis elegans. The molecular composition of the gap junctions connecting RMG hub neurons with sensory spoke neurons is unknown. We show here that the innexin gene unc-9 is required in RMG hub neurons to drive aggregation and related behaviors, indicating that UNC-9–containing gap junctions mediate RMG signaling. To dissect the circuit in detail, we developed methods to inhibit unc-9–based gap junctions with dominant-negative unc-1 transgenes. unc-1(dn) alters a stomatin-like protein that regulates unc-9 electrical signaling; its disruptive effects can be rescued by a constitutively active UNC-9::GFP protein, demonstrating specificity. Expression of unc-1(dn) in RMG hub neurons, ADL or ASK pheromone-sensing neurons, or URX oxygen-sensing neurons disrupts specific elements of aggregation-related behaviors. In ADL, unc-1(dn) has effects opposite to those of tetanus toxin light chain, separating the roles of ADL electrical and chemical synapses. These results reveal roles of gap junctions in a complex behavior at cellular resolution and provide a tool for similar exploration of other gap junction circuits. PMID:28143932

Membrane Insertion Profiles of Peptides Probed by Molecular Dynamics Simulations

DTIC Science & Technology

2008-07-17

Membrane insertion profiles of peptides probed by molecular dynamics simulations In-Chul Yeh,* Mark A. Olson,# Michael S. Lee,*#§ and Anders...a methodology based on molecular dynamics simulation techniques to probe the insertion profiles of small peptides across the membrane interface. The...profiles of peptides probed by molecular dynamics simulations 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d

Gift from statistical learning: Visual statistical learning enhances memory for sequence elements and impairs memory for items that disrupt regularities.

PubMed

Otsuka, Sachio; Saiki, Jun

2016-02-01

Prior studies have shown that visual statistical learning (VSL) enhances familiarity (a type of memory) of sequences. How do statistical regularities influence the processing of each triplet element and inserted distractors that disrupt the regularity? Given that increased attention to triplets induced by VSL and inhibition of unattended triplets, we predicted that VSL would promote memory for each triplet constituent, and degrade memory for inserted stimuli. Across the first two experiments, we found that objects from structured sequences were more likely to be remembered than objects from random sequences, and that letters (Experiment 1) or objects (Experiment 2) inserted into structured sequences were less likely to be remembered than those inserted into random sequences. In the subsequent two experiments, we examined an alternative account for our results, whereby the difference in memory for inserted items between structured and random conditions is due to individuation of items within random sequences. Our findings replicated even when control letters (Experiment 3A) or objects (Experiment 3B) were presented before or after, rather than inserted into, random sequences. Our findings suggest that statistical learning enhances memory for each item in a regular set and impairs memory for items that disrupt the regularity. Copyright © 2015 Elsevier B.V. All rights reserved.

Electromechanical resistive switching via back-to-back Schottky junctions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Lijie, E-mail: L.Li@swansea.ac.uk

The physics of the electromechanical resistive switching is uncovered using the theory of back-to-back Schottky junctions combined with the quantum domain space charge transport. A theoretical model of the basic element of resistive switching devices realized by the metal-ZnO nanowires-metal structure has been created and analyzed. Simulation results show that the reverse biased Schottky junction and the air gap impedance dominate the current-voltage relation at higher external voltages; thereby electromechanically varying the air gap thickness causes the device exhibit resistive tuning characteristics. As the device dimension is in nanometre scale, investigation of the model based on quantum mechanics has alsomore » been conducted.« less

Optimization of Phase Change Memory with Thin Metal Inserted Layer on Material Properties

NASA Astrophysics Data System (ADS)

Harnsoongnoen, Sanchai; Sa-Ngiamsak, Chiranut; Siritaratiwat, Apirat

This works reports, for the first time, the thorough study and optimisation of Phase Change Memory (PCM) structure with thin metal inserted chalcogenide via electrical resistivity (ρ) using finite element modeling. PCM is one of the best candidates for next generation non-volatile memory. It has received much attention recently due to its fast write speed, non-destructive readout, superb scalability, and great compatibility with current silicon-based mass fabrication. The setback of PCM is a high reset current typically higher than 1mA based on 180nm lithography. To reduce the reset current and to solve the over-programming failure, PCM with thin metal inserted chalcogenide (bottom chalcogenide/metal inserted/top chalcogenide) structure has been proposed. Nevertheless, reports on optimisation of the electrical resistivity using the finite element method for this new PCM structure have never been published. This work aims to minimize the reset current of this PCM structure by optimizing the level of the electrical resistivity of the PCM profile using the finite element approach. This work clearly shows that PCM characteristics are strongly affected by the electrical resistivity. The 2-D simulation results reveal clearly that the best thermal transfer of and self-joule-heating at the bottom chalcogenide layer can be achieved under conditions; ρ_bottom chalcogenide > ρ_metal inserted > ρ_top chalcogenide More specifically, the optimized electrical resistivity of PCMTMI is attained with ρ_top chalcogenide: ρ_metal inserted: ρ_bottom chalcogenide ratio of 1:6:16 when ρ_top chalcogenide is 10-3 Ωm. In conclusion, high energy efficiency can be obtained with the reset current as low as 0.3mA and with high speed operation of less than 30ns.

Efficiency analysis of betavoltaic elements

NASA Astrophysics Data System (ADS)

Sachenko, A. V.; Shkrebtii, A. I.; Korkishko, R. M.; Kostylyov, V. P.; Kulish, M. R.; Sokolovskyi, I. O.

2015-09-01

The conversion of energy of electrons produced by a radioactive β-source into electricity in a Si and SiC p- n junctions is modeled. The features of the generation function that describes the electron-hole pair production by an electron flux and the emergence of a "dead layer" are discussed. The collection efficiency Q that describes the rate of electron-hole pair production by incident beta particles, is calculated taking into account the presence of the dead layer. It is shown that in the case of high-grade Si p- n junctions, the collection efficiency of electron-hole pairs created by a high-energy electrons flux (such as, e.g., Pm-147 beta flux) is close or equal to unity in a wide range of electron energies. For SiC p-n junctions, Q is near unity only for electrons with relatively low energies of about 5 keV (produced, e.g., by a tritium source) and decreases rapidly with further increase of electron energy. The conditions, under which the influence of the dead layer on the collection efficiency is negligible, are determined. The open-circuit voltage is calculated for realistic values of the minority carriers' diffusion coefficients and lifetimes in Si and SiC p- n junctions, irradiated by a high-energy electrons flux. Our calculations allow to estimate the attainable efficiency of betavoltaic elements.

Simulation and parametric analysis of graphene p-n junctions with two rectangular top gates and a single back gate

NASA Astrophysics Data System (ADS)

Nikiforidis, Ioannis; Karafyllidis, Ioannis G.; Dimitrakis, Panagiotis

2018-02-01

Graphene p-n junctions could be the building blocks of future nanoelectronic circuits. While the conductance modulation of graphene p-n junctions formed in devices with one bottom and one top gate have received much attention, there is comparatively little work done on devices with two top gates. Here, we employ tight-bind Hamiltonians and non-equilibrium Green function method to compute in a systematic way the dependence of the conductance of graphene p-n junctions, formed in a device with two top gates, on the device parameters. We present our results in a compact and systematic way, so that the effect of each parameter is clearly shown. Our results show that the device conductance can be effectively modulated, and that graphene devices with two top gates may be used as basic elements in future carbon-based nanoelectronic circuits.

Dissipation in microwave quantum circuits with hybrid nanowire Josephson elements

NASA Astrophysics Data System (ADS)

Mugnai, D.; Ranfagni, A.; Agresti, A.

2017-04-01

Recent experiments on hybrid Josephson junctions have made the argument a topical subject. However, a quantity which remains still unknown is the tunneling (or response) time, which is strictly connected to the role that dissipation plays in the dynamics of the complete system. A simple way for evaluating dissipation in microwave circuits, previously developed for describing the dynamics of conventional Josephson junctions, is now presented as suitable for application even to non-conventional junctions. The method is based on a stochastic model, as derived from the telegrapher's equation, and is particularly devoted to the case of junctions loaded by real transmission lines. When the load is constituted by lumped-constant circuits, a connection with the stochastic model is also maintained. The theoretical model demonstrated its ability to analyze both classically-allowed and forbidden processes, and has found a wide field of applicability, namely in all cases in which dissipative effects cannot be ignored.

Transposable elements generate population-specific insertional patterns and allelic variation in genes of wild emmer wheat (Triticum turgidum ssp. dicoccoides).

PubMed

Domb, Katherine; Keidar, Danielle; Yaakov, Beery; Khasdan, Vadim; Kashkush, Khalil

2017-10-27

Natural populations of the tetraploid wild emmer wheat (genome AABB) were previously shown to demonstrate eco-geographically structured genetic and epigenetic diversity. Transposable elements (TEs) might make up a significant part of the genetic and epigenetic variation between individuals and populations because they comprise over 80% of the wild emmer wheat genome. In this study, we performed detailed analyses to assess the dynamics of transposable elements in 50 accessions of wild emmer wheat collected from 5 geographically isolated sites. The analyses included: the copy number variation of TEs among accessions in the five populations, population-unique insertional patterns, and the impact of population-unique/specific TE insertions on structure and expression of genes. We assessed the copy numbers of 12 TE families using real-time quantitative PCR, and found significant copy number variation (CNV) in the 50 wild emmer wheat accessions, in a population-specific manner. In some cases, the CNV difference reached up to 6-fold. However, the CNV was TE-specific, namely some TE families showed higher copy numbers in one or more populations, and other TE families showed lower copy numbers in the same population(s). Furthermore, we assessed the insertional patterns of 6 TE families using transposon display (TD), and observed significant population-specific insertional patterns. The polymorphism levels of TE-insertional patterns reached 92% among all wild emmer wheat accessions, in some cases. In addition, we observed population-specific/unique TE insertions, some of which were located within or close to protein-coding genes, creating allelic variations in a population-specific manner. We also showed that those genes are differentially expressed in wild emmer wheat. For the first time, this study shows that TEs proliferate in wild emmer wheat in a population-specific manner, creating new alleles of genes, which contribute to the divergent evolution of homeologous genes from the A and B subgenomes.

[Three dimensional finite element analysis of maxillary anterior teeth retraction with micro-implant anchorage and sliding mechanics].

PubMed

Zhang, Yi; Zhang, Lei; Fan, Yu-bo; Song, Jin-lin; Deng, Feng

2009-10-01

To investigate the biomechanical effects of micro-implant anchorage technique with sliding mechanics on maxillary anterior teeth retraction under different implant insertion heights and different retraction hook heights. The three dimensional finite element model of maxillary anterior teeth retraction force system was constructed with CT scanning and MIMICS software and the relationships between brackets, teeth, wire and micro-implant were simulating the clinical factions. Then the initial tooth displacement was calculated when the insertion heights were 4 mm and 8 mm and the retraction hook heights were 1, 4, 7, 10 mm respectively. With retraction hook height added, the anterior teeth movement changed from lingual crown tipping to labial crown tipping and the intrusion movement was more apparent when the micro-implant was inserted in a higher location. The ideal teeth movement control could be achieved by different insertion heights of micro-implant and different retraction hook heights in straight wire retraction force system.

Verification of the numerical model of insert-type joint of scaffolding in relation to experimental research

NASA Astrophysics Data System (ADS)

Pieńko, Michał; Błazik-Borowa, Ewa

2018-01-01

This paper presents the problem of comparing the results of computer simulations with the results of laboratory tests. The subject of the study was the insert-type joint of scaffolding loaded with a bending moment. The research was carried out on the real elements of the scaffolding. Due to the complexity of the connection different friction coefficients and depths of wedge insertion were taken into account in the analysis. The aim of conducting the series of analyses was to determine the sensitivity of the model to the mentioned characteristics. Since laboratory tests were carried out on the real samples, there were no preparations of surface involved in the load transfer. This approach caused many problems with the clear definition of the nature of work of individual node elements during the load. The analysis consist of two stages: the stage in which the connection is defined (the wedge is inserted into the rosette), and the loading stage (the node is loaded by the bending moment).

Physiological impact of transposable elements encoding DDE transposases in the environmental adaptation of Streptococcus agalactiae.

PubMed

Fléchard, Maud; Gilot, Philippe

2014-07-01

We have referenced and described Streptococcus agalactiae transposable elements encoding DDE transposases. These elements belonged to nine families of insertion sequences (ISs) and to a family of conjugative transposons (TnGBSs). An overview of the physiological impact of the insertion of all these elements is provided. DDE-transposable elements affect S. agalactiae in a number of aspects of its capability to adapt to various environments and modulate the expression of several virulence genes, the scpB-lmB genomic region and the genes involved in capsule expression and haemolysin transport being the targets of several different mobile elements. The referenced mobile elements modify S. agalactiae behaviour by transferring new gene(s) to its genome, by modifying the expression of neighbouring genes at the integration site or by promoting genomic rearrangements. Transposition of some of these elements occurs in vivo, suggesting that by dynamically regulating some adaptation and/or virulence genes, they improve the ability of S. agalactiae to reach different niches within its host and ensure the 'success' of the infectious process. © 2014 The Authors.

Non-blocking four-port optical router based on thermooptic silicon microrings

NASA Astrophysics Data System (ADS)

Dang, Pei-pei; Li, Cui-ting; Zheng, Wen-xue; Zheng, Chuan-tao; Wang, Yi-ding

2016-07-01

By using silicon-on-insulator (SOI) platform, 12 channel waveguides, and four parallel-coupling one-microring resonator routing elements, a non-blocking four-port optical router is proposed. Structure design and optimization are performed on the routing elements at 1 550 nm. At drop state with a power consumption of 0 mW, the insertion loss of the drop port is less than 1.12 dB, and the crosstalk between the two output ports is less than -28 dB; at through state with a power consumption of 22 mW, the insertion loss of the through port is less than 0.45 dB, and the crosstalk between the two output ports is below -21 dB. Routing topology and function are demonstrated for the four-port optical router. The router can work at nine non-blocking routing states using the thermo-optic (TO) effect of silicon for tuning the resonance of each switching element. Detailed characterizations are presented, including output spectrum, insertion loss, and crosstalk. According to the analysis on all the data links of the router, the insertion loss is within the range of 0.13—3.36 dB, and the crosstalk is less than -19.46 dB. The router can meet the need of large-scale optical network-on-chip (ONoC).

Rates and patterns of great ape retrotransposition

PubMed Central

Hormozdiari, Fereydoun; Konkel, Miriam K.; Prado-Martinez, Javier; Chiatante, Giorgia; Herraez, Irene Hernando; Walker, Jerilyn A.; Nelson, Benjamin; Alkan, Can; Sudmant, Peter H.; Huddleston, John; Catacchio, Claudia R.; Ko, Arthur; Malig, Maika; Baker, Carl; Genome Project, Great Ape; Marques-Bonet, Tomas; Ventura, Mario; Batzer, Mark A.; Eichler, Evan E.

2013-01-01

We analyzed 83 fully sequenced great ape genomes for mobile element insertions, predicting a total of 49,452 fixed and polymorphic Alu and long interspersed element 1 (L1) insertions not present in the human reference assembly and assigning each retrotransposition event to a different time point during great ape evolution. We used these homoplasy-free markers to construct a mobile element insertions-based phylogeny of humans and great apes and demonstrate their differential power to discern ape subspecies and populations. Within this context, we find a good correlation between L1 diversity and single-nucleotide polymorphism heterozygosity (r2 = 0.65) in contrast to Alu repeats, which show little correlation (r2 = 0.07). We estimate that the “rate” of Alu retrotransposition has differed by a factor of 15-fold in these lineages. Humans, chimpanzees, and bonobos show the highest rates of Alu accumulation—the latter two since divergence 1.5 Mya. The L1 insertion rate, in contrast, has remained relatively constant, with rates differing by less than a factor of three. We conclude that Alu retrotransposition has been the most variable form of genetic variation during recent human–great ape evolution, with increases and decreases occurring over very short periods of evolutionary time. PMID:23884656

Experimental characterization and numerical simulation of riveted lap-shear joints using Rivet Element

NASA Astrophysics Data System (ADS)

Vivio, Francesco; Fanelli, Pierluigi; Ferracci, Michele

2018-03-01

In aeronautical and automotive industries the use of rivets for applications requiring several joining points is now very common. In spite of a very simple shape, a riveted junction has many contact surfaces and stress concentrations that make the local stiffness very difficult to be calculated. To overcome this difficulty, commonly finite element models with very dense meshes are performed for single joint analysis because the accuracy is crucial for a correct structural analysis. Anyhow, when several riveted joints are present, the simulation becomes computationally too heavy and usually significant restrictions to joint modelling are introduced, sacrificing the accuracy of local stiffness evaluation. In this paper, we tested the accuracy of a rivet finite element presented in previous works by the authors. The structural behaviour of a lap joint specimen with a rivet joining is simulated numerically and compared to experimental measurements. The Rivet Element, based on a closed-form solution of a reference theoretical model of the rivet joint, simulates local and overall stiffness of the junction combining high accuracy with low degrees of freedom contribution. In this paper the Rivet Element performances are compared to that of a FE non-linear model of the rivet, built with solid elements and dense mesh, and to experimental data. The promising results reported allow to consider the Rivet Element able to simulate, with a great accuracy, actual structures with several rivet connections.

Novel insertion sequence- and transposon-mediated genetic rearrangements in genomic island SGI1 of Salmonella enterica serovar Kentucky.

PubMed

Doublet, Benoît; Praud, Karine; Bertrand, Sophie; Collard, Jean-Marc; Weill, François-Xavier; Cloeckaert, Axel

2008-10-01

Salmonella genomic island 1 (SGI1) is an integrative mobilizable element that harbors a multidrug resistance (MDR) gene cluster. Since its identification in epidemic Salmonella enterica serovar Typhimurium DT104 strains, variant SGI1 MDR gene clusters conferring different MDR phenotypes have been identified in several S. enterica serovars and classified as SGI1-A to -O. A study was undertaken to characterize SGI1 from serovar Kentucky strains isolated from travelers returning from Africa. Several strains tested were found to contain the partially characterized variant SGI1-K, recently described in a serovar Kentucky strain isolated in Australia. This variant contained only one cassette array, aac(3)-Id-aadA7, and an adjacent mercury resistance module. Here, the uncharacterized part of SGI1-K was sequenced. Downstream of the mer module similar to that found in Tn21, a mosaic genetic structure was found, comprising (i) part of Tn1721 containing the tetracycline resistance genes tetR and tet(A); (ii) part of Tn5393 containing the streptomycin resistance genes strAB, IS1133, and a truncated tnpR gene; and (iii) a Tn3-like region containing the tnpR gene and the beta-lactamase bla(TEM-1) gene flanked by two IS26 elements in opposite orientations. The rightmost IS26 element was shown to be inserted into the S044 open reading frame of the SGI1 backbone. This variant MDR region was named SGI1-K1 according to the previously described variant SGI1-K. Other SGI1-K MDR regions due to different IS26 locations, inversion, and partial deletions were characterized and named SGI1-K2 to -K5. Two new SGI1 variants named SGI1-P1 and -P2 contained only the Tn3-like region comprising the beta-lactamase bla(TEM-1) gene flanked by the two IS26 elements inserted into the SGI1 backbone. Three other new variants harbored only one IS26 element inserted in place of the MDR region of SGI1 and were named SGI1-Q1 to -Q3. Thus, in serovar Kentucky, the SGI1 MDR region undergoes recombinational and insertional events of transposon and insertion sequences, resulting in a higher diversity of MDR gene clusters than previously reported and consequently a higher diversity of MDR phenotypes.

The Peptidoglycan-Binding Protein SjcF1 Influences Septal Junction Function and Channel Formation in the Filamentous Cyanobacterium Anabaena.

PubMed

Rudolf, Mareike; Tetik, Nalan; Ramos-León, Félix; Flinner, Nadine; Ngo, Giang; Stevanovic, Mara; Burnat, Mireia; Pernil, Rafael; Flores, Enrique; Schleiff, Enrico

2015-06-30

Filamentous, heterocyst-forming cyanobacteria exchange nutrients and regulators between cells for diazotrophic growth. Two alternative modes of exchange have been discussed involving transport either through the periplasm or through septal junctions linking adjacent cells. Septal junctions and channels in the septal peptidoglycan are likely filled with septal junction complexes. While possible proteinaceous factors involved in septal junction formation, SepJ (FraG), FraC, and FraD, have been identified, little is known about peptidoglycan channel formation and septal junction complex anchoring to the peptidoglycan. We describe a factor, SjcF1, involved in regulation of septal junction channel formation in the heterocyst-forming cyanobacterium Anabaena sp. strain PCC 7120. SjcF1 interacts with the peptidoglycan layer through two peptidoglycan-binding domains and is localized throughout the cell periphery but at higher levels in the intercellular septa. A strain with an insertion in sjcF1 was not affected in peptidoglycan synthesis but showed an altered morphology of the septal peptidoglycan channels, which were significantly wider in the mutant than in the wild type. The mutant was impaired in intercellular exchange of a fluorescent probe to a similar extent as a sepJ deletion mutant. SjcF1 additionally bears an SH3 domain for protein-protein interactions. SH3 binding domains were identified in SepJ and FraC, and evidence for interaction of SjcF1 with both SepJ and FraC was obtained. SjcF1 represents a novel protein involved in structuring the peptidoglycan layer, which links peptidoglycan channel formation to septal junction complex function in multicellular cyanobacteria. Nonetheless, based on its subcellular distribution, this might not be the only function of SjcF1. Cell-cell communication is central not only for eukaryotic but also for multicellular prokaryotic systems. Principles of intercellular communication are well established for eukaryotes, but the mechanisms and components involved in bacteria are just emerging. Filamentous heterocyst-forming cyanobacteria behave as multicellular organisms and represent an excellent model to study prokaryotic cell-cell communication. A path for intercellular metabolite exchange appears to involve transfer through molecular structures termed septal junctions. They are reminiscent of metazoan gap junctions that directly link adjacent cells. In cyanobacteria, such structures need to traverse the peptidoglycan layers in the intercellular septa of the filament. Here we describe a factor involved in the formation of channels across the septal peptidoglycan layers, thus contributing to the multicellular behavior of these organisms. Copyright © 2015 Rudolf et al.

Experimental and Numerical Study on the Tensile Behaviour of UACS/Al Fibre Metal Laminate

NASA Astrophysics Data System (ADS)

Xue, Jia; Wang, Wen-Xue; Zhang, Jia-Zhen; Wu, Su-Jun; Li, Hang

2015-10-01

A new fibre metal laminate fabricated with aluminium sheets and unidirectionally arrayed chopped strand (UACS) plies is proposed. The UACS ply is made by cutting parallel slits into a unidirectional carbon fibre prepreg. The UACS/Al laminate may be viewed as aluminium laminate reinforced by highly aligned, discontinuous carbon fibres. The tensile behaviour of UACS/Al laminate, including thermal residual stress and failure progression, is investigated through experiments and numerical simulation. Finite element analysis was used to simulate the onset and propagation of intra-laminar fractures occurring within slits of the UACS plies and delamination along the interfaces. The finite element models feature intra-laminar cohesive elements inserted into the slits and inter-laminar cohesive elements inserted at the interfaces. Good agreement are obtained between experimental results and finite element analysis, and certain limitations of the finite element models are observed and discussed. The combined experimental and numerical studies provide a detailed understanding of the tensile behaviour of UACS/Al laminates.

The 3'-end region of the human PDGFR-β core promoter nuclease hypersensitive element forms a mixture of two unique end-insertion G-quadruplexes.

PubMed

Onel, Buket; Carver, Megan; Agrawal, Prashansa; Hurley, Laurence H; Yang, Danzhou

2018-04-01

While the most stable G-quadruplex formed in the human PDGFR-β promoter nuclease hypersensitive element (NHE) is the 5'-mid G-quadruplex, the 3'-end sequence that contains a 3'-GGA run forms a less stable G-quadruplex. Recently, the 3'-end G-quadruplex was found to be a transcriptional repressor and can be selectively targeted by a small molecule for PDGFR-β downregulation. We use 1D and 2D high-field NMR, in combination with Dimethylsulfate Footprinting, Circular Dichroism Spectroscopy, and Electrophoretic Mobility Shift Assay. We determine that the PDGFR-β extended 3'-end NHE sequence forms two novel end-insertion intramolecular G-quadruplexes that co-exist in equilibrium under physiological salt conditions. One G-quadruplex has a 3'-non-adjacent flanking guanine inserted into the 3'-external tetrad (3'-insertion-G4), and another has a 5'-non-adjacent flanking guanine inserted into the 5'-external tetrad (5'-insertion-G4). The two guanines in the GGA-run move up or down within the G-quadruplex to accommodate the inserted guanine. Each end-insertion G-quadruplex has a low thermal stability as compared to the 5'-mid G-quadruplex, but the selective stabilization of GSA1129 shifts the equilibrium toward the 3'-end G-quadruplex in the PDGFR-β NHE. An equilibrium mixture of two unique end-insertion intramolecular G-quadruplexes forms in the PDGFR-β NHE 3'-end sequence that contains a GGA-run and non-adjacent guanines in both the 3'- and 5'- flanking segments; the novel end-insertion structures of the 3'-end G-quadruplex are selectively stabilized by GSA1129. We show for the first time that an equilibrium mixture of two unusual end-insertion G-quadruplexes forms in a native promoter sequence and appears to be the molecular recognition for PDGFR-β downregulation. Copyright © 2017 Elsevier B.V. All rights reserved.

Phylogenetic Conflict in Bears Identified by Automated Discovery of Transposable Element Insertions in Low-Coverage Genomes

PubMed Central

Gallus, Susanne; Janke, Axel

2017-01-01

Abstract Phylogenetic reconstruction from transposable elements (TEs) offers an additional perspective to study evolutionary processes. However, detecting phylogenetically informative TE insertions requires tedious experimental work, limiting the power of phylogenetic inference. Here, we analyzed the genomes of seven bear species using high-throughput sequencing data to detect thousands of TE insertions. The newly developed pipeline for TE detection called TeddyPi (TE detection and discovery for Phylogenetic Inference) identified 150,513 high-quality TE insertions in the genomes of ursine and tremarctine bears. By integrating different TE insertion callers and using a stringent filtering approach, the TeddyPi pipeline produced highly reliable TE insertion calls, which were confirmed by extensive in vitro validation experiments. Analysis of single nucleotide substitutions in the flanking regions of the TEs shows that these substitutions correlate with the phylogenetic signal from the TE insertions. Our phylogenomic analyses show that TEs are a major driver of genomic variation in bears and enabled phylogenetic reconstruction of a well-resolved species tree, despite strong signals for incomplete lineage sorting and introgression. The analyses show that the Asiatic black, sun, and sloth bear form a monophyletic clade, in which phylogenetic incongruence originates from incomplete lineage sorting. TeddyPi is open source and can be adapted to various TE and structural variation callers. The pipeline makes it possible to confidently extract thousands of TE insertions even from low-coverage genomes (∼10×) of nonmodel organisms. This opens new possibilities for biologists to study phylogenies and evolutionary processes as well as rates and patterns of (retro-)transposition and structural variation. PMID:28985298

Turnover of R1 (Type I) and R2 (Type Ii) Retrotransposable Elements in the Ribosomal DNA of Drosophila Melanogaster

PubMed Central

Jakubczak, J. L.; Zenni, M. K.; Woodruff, R. C.; Eickbush, T. H.

1992-01-01

R1 and R2 are distantly related non-long terminal repeat retrotransposable elements each of which inserts into a specific site in the 28S rRNA genes of most insects. We have analyzed aspects of R1 and R2 abundance and sequence variation in 27 geographical isolates of Drosophila melanogaster. The fraction of 28S rRNA genes containing these elements varied greatly between strains, 17-67% for R1 elements and 2-28% for R2 elements. The total percentage of the rDNA repeats inserted ranged from 32 to 77%. The fraction of the rDNA repeats that contained both of these elements suggested that R1 and R2 exhibit neither an inhibition of nor preference for insertion into a 28S gene already containing the other type of element. Based on the conservation of restriction sites in the elements of all strains, and sequence analysis of individual elements from three strains, nucleotide divergence is very low for R1 and R2 elements within or between strains (<0.6%). This sequence uniformity is the expected result of the forces of concerted evolution (unequal crossovers and gene conversion) which act on the rRNA genes themselves. Evidence for the role of retrotransposition in the turnover of R1 and R2 was obtained by using naturally occurring 5' length polymorphisms of the elements as markers for independent transposition events. The pattern of these different length 5' truncations of R1 and R2 was found to be diverse and unique to most strains analyzed. Because recombination can only, with time, amplify or eliminate those length variants already present, the diversity found in each strain suggests that retrotransposition has played a critical role in maintaining these elements in the rDNA repeats of D. melanogaster. PMID:1317313

Role of acellular collagen matrix surgisis in the endoscopic management of ureteropelvic junction obstruction.

PubMed

Yohannes, Paulos; Rotariu, Paul; Liatsikos, Evangelos; Malik, Aftab; Alexianu, Mihai; Pinkasov, David; Morgenstern, Nora; Lee, Benjamin R; Smith, Arthur D

2002-10-01

To investigate the role of acellular collagen matrix (Surgisis during endopyelotomy. Nine female pigs (25-35 kg) were enrolled in our protocol. The pigs were categorized as follows. Group I (N = 3) had endopyelotomy + insertion of SIS, Group II (N = 3) creation of UPJ stricture + endopyelotomy + insertion of SIS, and Group III (N = 3) Davis intubated ureterotomy using SIS. The contralateral side served as a control for each group (one pig in each group). In three pigs (two in Group III and one in Group II), Surgisis was treated with India ink prior to insertion at the endopyelotomy site. An endopyelotomy stent (14/8 F x 24 cm) was used to stent the ureteropelvic junction (UPJ) for 4 weeks. Four weeks after the stent was removed, laparoscopic nephroureterectomy was performed, and the animals were euthanized. Histopathologic analysis of the Surgisis-regenerated segment of the UPJ was performed using hematoxylin and eosin, reticular (collagen), smooth muscle actin, and S-100 (nerve) stains. All animals tolerated the procedure. The mean operative time was 162 minutes. One pig (Group II) developed pyonephrosis; one pig (Group III) developed significant ascites and was sacrificed 2 week before the end of the experiment. Histopathologic analysis showed complete epithelializaton at 8 weeks. Reticular stain demonstrated abundant collagen matrix in the submucosa. Smooth muscle staining revealed myofibroblastic proliferation within the SIS-regenerated tissue adjacent to disorganized smooth muscle cells. India ink-stained SIS-regenerated tissue did not show smooth muscle cells. The S-100 stain did not demonstrate neurons at 8 weeks; however, in three pigs, peristaltic activity was noted across the UPJ. The use of acellular collagen matrix in the endoscopic management of UPJ obstruction is a promising technique. The abundance of myofibroblasts and absence of abundant smooth muscle regeneration indicates a need to investigate the role of growth factors in SIS regeneration of host tissue.

Retrotransposon insertion targeting: a mechanism for homogenization of centromere sequences on nonhomologous chromosomes.

PubMed

Birchler, James A; Presting, Gernot G

2012-04-01

The centromeres of most eukaryotic organisms consist of highly repetitive arrays that are similar across nonhomologous chromosomes. These sequences evolve rapidly, thus posing a mystery as to how such arrays can be homogenized. Recent work in species in which centromere-enriched retrotransposons occur indicates that these elements preferentially insert into the centromeric regions. In two different Arabidopsis species, a related element was recognized in which the specificity for such targeting was altered. These observations provide a partial explanation for how homogenization of centromere DNA sequences occurs.

Insertional mutagenesis using Tnt1 retrotransposon in potato

USDA-ARS?s Scientific Manuscript database

Potato is the third most important food crop in the world. However, genetics and genomics research of potato has lagged behind many major crop species due to its autotetraploidy and a highly heterogeneous genome. Insertional mutagenesis using T-DNA or transposable elements, which is available in sev...

The precipitation of aluminum, iron and manganese at the junction of Deer Creek with the Snake River in Summit County, Colorado

USGS Publications Warehouse

Theobald, P.K.; Lakin, H.W.; Hawkins, D.B.

1963-01-01

The oxidation of disseminated pyrite in relatively acid schists and gneisses of the Snake River drainage basin provides abundant iron sulfate and sulfuric acid to ground and surface water. This acid water dissolves large quantities of many elements, particularly aluminum and surprisingly large quantities of elements, such as magnesium and zinc, not expected to be abundant in the drainage basin. The adjoining drainage to the west, Deer Creek, is underlain by basic rocks, from which the water inherits a high pH. Despite the presence of base- and precious- metal veins in the drainage basin of Deer Creek, it carries less metal than the Snake River. The principal precipitate on the bed of the Snake River is hydrated iron oxide with small quantities of the other metals. In Deer Creek manganese oxide is precipitated with iron oxide and large quantities of other metals are carried down with this precipitate. Below the junction of these streams the pH stabilizes at a near-neutral value. Iron is removed from the Snake River water at the junction, and aluminum is precipitated for some distance downstream. The aluminum precipitate carries down other metals in concentrations slightly less than that in the manganese precipitate on Deer Creek. The natural processes observed in this junction if carried to a larger scale could provide the mechanism described by Ansheles (1927) for the formation of bauxite. In the environment described, geochemical exploration by either water or stream sediment techniques is difficult because of (1) the extreme pH differential between the streams above their junction and (2) the difference in the precipitates formed on the streambeds. ?? 1963.

Molecular characterization and genomic distribution of Isis: a new retrotransposon of Drosophila buzzatii.

PubMed

García Guerreiro, M P; Fontdevila, A

2007-01-01

A new transposable element, Isis, is identified as a LTR retrotransposon in Drosophila buzzatii. DNA sequence analysis shows that Isis contains three long ORFs similar to gag, pol and env genes of retroviruses. The ORF1 exhibits sequence homology to matrix, capsid and nucleocapsid gag proteins and ORF2 encodes a putative protease (PR), a reverse transcriptase (RT), an Rnase H (RH) and an integrase (IN) region. The analysis of a putative env product, encoded by the env ORF3, shows a degenerated protein containing several stop codons. The molecular study of the putative proteins coded by this new element shows striking similarities to both Ulysses and Osvaldo elements, two LTR retrotransposons, present in D. virilis and D. buzzatii, respectively. Comparisons of the predicted Isis RT to several known retrotransposons show strong phylogenetic relationships to gypsy-like elements, particulary to Ulysses retrotransposon. Studies of Isis chromosomal distribution show a strong hybridization signal in centromeric and pericentromeric regions, and a scattered distribution along all chromosomal arms. The existence of insertional polymorphisms between different strains and high molecular weight bands by Southern blot suggests the existence of full-sized copies that have been active recently. The presence of euchromatic insertion sites coincident between Isis and Osvaldo could indicate preferential insertion sites of Osvaldo element into Isis sequence or vice versa. Moreover, the presence of Isis in different species of the buzzatii complex indicates the ancient origin of this element.

Automated fiber tracking and tissue characterization of the anterior cruciate ligament with optical coherence tomography

NASA Astrophysics Data System (ADS)

Balasubramanian, Priya S.; Guo, Jiaqi; Yao, Xinwen; Qu, Dovina; Lu, Helen H.; Hendon, Christine P.

2017-02-01

The directionality of collagen fibers across the anterior cruciate ligament (ACL) as well as the insertion of this key ligament into bone are important for understanding the mechanical integrity and functionality of this complex tissue. Quantitative analysis of three-dimensional fiber directionality is of particular interest due to the physiological, mechanical, and biological heterogeneity inherent across the ACL-to-bone junction, the behavior of the ligament under mechanical stress, and the usefulness of this information in designing tissue engineered grafts. We have developed an algorithm to characterize Optical Coherence Tomography (OCT) image volumes of the ACL. We present an automated algorithm for measuring ligamentous fiber angles, and extracting attenuation and backscattering coefficients of ligament, interface, and bone regions within mature and immature bovine ACL insertion samples. Future directions include translating this algorithm for real time processing to allow three-dimensional volumetric analysis within dynamically moving samples.

Quick and clean cloning.

PubMed

Thieme, Frank; Marillonnet, Sylvestre

2014-01-01

Identification of unknown sequences that flank known sequences of interest requires PCR amplification of DNA fragments that contain the junction between the known and unknown flanking sequences. Since amplified products often contain a mixture of specific and nonspecific products, the quick and clean (QC) cloning procedure was developed to clone specific products only. QC cloning is a ligation-independent cloning procedure that relies on the exonuclease activity of T4 DNA polymerase to generate single-stranded extensions at the ends of the vector and insert. A specific feature of QC cloning is the use of vectors that contain a sequence called catching sequence that allows cloning specific products only. QC cloning is performed by a one-pot incubation of insert and vector in the presence of T4 DNA polymerase at room temperature for 10 min followed by direct transformation of the incubation mix in chemo-competent Escherichia coli cells.

Vertical Transmission of the Retrotransposable Elements R1 and R2 during the Evolution of the Drosophila Melanogaster Species Subgroup

PubMed Central

Eickbush, D. G.; Eickbush, T. H.

1995-01-01

R1 and R2 are non-long-terminal repeat retrotransposable elements that insert into specific sequences of insect 28S ribosomal RNA genes. These elements have been extensively described in Drosophila melanogaster. To determine whether these elements have been horizontally or vertically transmitted, we characterized R1 and R2 elements from the seven other members of the melanogaster species subgroup by genomic blotting and nucleotide sequencing. Each species was found to have homogeneous families of R1 and R2 elements with the exception of erecta and orena, which have no R2 elements. The DNA sequences of multiple R1 and R2 copies from each species indicated nucleotide divergence within each species averaged only 0.48% for R1 and 0.35% for R2, well below the level of divergence among the species. Most copies of R1 and R2 (40 of 47) sequenced from the seven species were potentially functional, as indicated by the absence of premature termination codons or translational frameshifts that would destroy the open reading frame of the element. The sequence relationships of both the R1 and R2 elements from the various members of the melanogaster subgroup closely followed that of the species phylogeny, suggesting that R1 and R2 have been stably maintained by vertical transmission since the origin of this species subgroup 17-20 million years ago. The remarkable stability of R1 and R2, compared to what has been suggested for transposable elements that insert at multiple locations in these same species, may be due to their unique specificity for sites in the rRNA gene locus. Under low copy number conditions, when it is essential for any mobile element to transpose, the insertion specificities of R1 and R2 ensure uniform developmentally regulated target sites that can be occupied with little or no detrimental effect on the host. PMID:7713424

Resonant Transmission of Air-Coupled Ultrasound Through Metallic Inserts in Honeycomb Sandwich Structures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peters, J.J.; Barnard, D.J.; Hsu, D.K.

2005-04-09

Metallic inserts are embedded into composite honeycomb sandwiches as hard points for mechanical connections. Air-coupled ultrasound can be used for detecting disbonds between the insert and the facesheet. It was discovered in such inspections that a surprisingly large amplitude could be transmitted through thick metallic inserts (e.g. 0.75'' thick and 1.5'' diameter), whereas a thin plate of the same material will transmit a much weaker signal. This paper reports an experimental and analytic study of the geometrical effect of inserts on transmitted UT signals. Modal analyses of cylindrical inserts were made using the finite element code ANSYS. The transmission efficiencymore » or air-coupled ultrasound correlated well with the longitudinal vibration mode of the cylinder.« less

Miniature Transposable Sequences Are Frequently Mobilized in the Bacterial Plant Pathogen Pseudomonas syringae pv. phaseolicola

PubMed Central

Bardaji, Leire; Añorga, Maite; Jackson, Robert W.; Martínez-Bilbao, Alejandro; Yanguas-Casás, Natalia; Murillo, Jesús

2011-01-01

Mobile genetic elements are widespread in Pseudomonas syringae, and often associate with virulence genes. Genome reannotation of the model bean pathogen P. syringae pv. phaseolicola 1448A identified seventeen types of insertion sequences and two miniature inverted-repeat transposable elements (MITEs) with a biased distribution, representing 2.8% of the chromosome, 25.8% of the 132-kb virulence plasmid and 2.7% of the 52-kb plasmid. Employing an entrapment vector containing sacB, we estimated that transposition frequency oscillated between 2.6×10−5 and 1.1×10−6, depending on the clone, although it was stable for each clone after consecutive transfers in culture media. Transposition frequency was similar for bacteria grown in rich or minimal media, and from cells recovered from compatible and incompatible plant hosts, indicating that growth conditions do not influence transposition in strain 1448A. Most of the entrapped insertions contained a full-length IS801 element, with the remaining insertions corresponding to sequences smaller than any transposable element identified in strain 1448A, and collectively identified as miniature sequences. From these, fragments of 229, 360 and 679-nt of the right end of IS801 ended in a consensus tetranucleotide and likely resulted from one-ended transposition of IS801. An average 0.7% of the insertions analyzed consisted of IS801 carrying a fragment of variable size from gene PSPPH_0008/PSPPH_0017, showing that IS801 can mobilize DNA in vivo. Retrospective analysis of complete plasmids and genomes of P. syringae suggests, however, that most fragments of IS801 are likely the result of reorganizations rather than one-ended transpositions, and that this element might preferentially contribute to genome flexibility by generating homologous regions of recombination. A further miniature sequence previously found to affect host range specificity and virulence, designated MITEPsy1 (100-nt), represented an average 2.4% of the total number of insertions entrapped in sacB, demonstrating for the first time the mobilization of a MITE in bacteria. PMID:22016774

Miniature transposable sequences are frequently mobilized in the bacterial plant pathogen Pseudomonas syringae pv. phaseolicola.

PubMed

Bardaji, Leire; Añorga, Maite; Jackson, Robert W; Martínez-Bilbao, Alejandro; Yanguas-Casás, Natalia; Murillo, Jesús

2011-01-01

Mobile genetic elements are widespread in Pseudomonas syringae, and often associate with virulence genes. Genome reannotation of the model bean pathogen P. syringae pv. phaseolicola 1448A identified seventeen types of insertion sequences and two miniature inverted-repeat transposable elements (MITEs) with a biased distribution, representing 2.8% of the chromosome, 25.8% of the 132-kb virulence plasmid and 2.7% of the 52-kb plasmid. Employing an entrapment vector containing sacB, we estimated that transposition frequency oscillated between 2.6×10(-5) and 1.1×10(-6), depending on the clone, although it was stable for each clone after consecutive transfers in culture media. Transposition frequency was similar for bacteria grown in rich or minimal media, and from cells recovered from compatible and incompatible plant hosts, indicating that growth conditions do not influence transposition in strain 1448A. Most of the entrapped insertions contained a full-length IS801 element, with the remaining insertions corresponding to sequences smaller than any transposable element identified in strain 1448A, and collectively identified as miniature sequences. From these, fragments of 229, 360 and 679-nt of the right end of IS801 ended in a consensus tetranucleotide and likely resulted from one-ended transposition of IS801. An average 0.7% of the insertions analyzed consisted of IS801 carrying a fragment of variable size from gene PSPPH_0008/PSPPH_0017, showing that IS801 can mobilize DNA in vivo. Retrospective analysis of complete plasmids and genomes of P. syringae suggests, however, that most fragments of IS801 are likely the result of reorganizations rather than one-ended transpositions, and that this element might preferentially contribute to genome flexibility by generating homologous regions of recombination. A further miniature sequence previously found to affect host range specificity and virulence, designated MITEPsy1 (100-nt), represented an average 2.4% of the total number of insertions entrapped in sacB, demonstrating for the first time the mobilization of a MITE in bacteria.

CONCENTRIC TUBE FUEL ELEMENT SPRING ALIGNMENT SPACER DEVICE

DOEpatents

Weems, S.J.

1963-09-24

A rib construction for a nuclear-fuel element is described, in which one of three peripherally spaced ribs adjacent to each end of the fuel element is mounted on a radially yielding spring that embraces the fuel element. This spring enables the fuel element to have a good fit with a coolant tube and yet to be easily inserted in and withdrawn from the tube. (AEC)

Analysis of the 227 bp short interspersed nuclear element (SINE) insertion of the promoter of the myostatin (MSTN) gene in different horse breeds.

PubMed

Dall'Olio, Stefania; Scotti, Emilio; Fontanesi, Luca; Tassinari, Marco

2014-01-01

The myostatin (MSTN) gene encodes a protein known to be a negative regulator of muscle mass in mammalian species. Different polymorphisms of the horse (Equus caballus) MSTN gene have been identified, including single nucleotide polymorphisms and a short interspersed nuclear element (SINE) insertion of 227 bp within the promoter of the gene. The SINE insertion has been associated with performance traits in Thoroughbred racehorses and it was proposed as a predictor of optimum racing distance. The aims of this study were to perform in silico analysis to identify putative gains or abrogation of transcription-factor binding sites (TFBSs) generated by the SINE allele of the promoter and to analyse the frequency of the SINE insertion in horses used for racing (gallop and trot) and other purposes. The SINE insertion was genotyped in 227 horses from 10 breeds belonging to different morphological types (brachimorphic, mesomorphic, meso-dolichomorphic and dolichomorphic). The presence of the insertion was confirmed in the Quarter Horse (SINE allele frequency of 0.81) and in the Thoroughbred (0.51), whereas the SINE allele did not segregate in any of the other analysed breeds. As the SINE MSTN gene polymorphism may be population or breed specific, it is not a useful marker for association studies in all breeds.

A mobile threat to genome stability: The impact of non-LTR retrotransposons upon the human genome

PubMed Central

Konkel, Miriam K.; Batzer, Mark A.

2010-01-01

It is now commonly agreed that the human genome is not the stable entity originally presumed. Deletions, duplications, inversions, and insertions are common, and contribute significantly to genomic structural variations (SVs). Their collective impact generates much of the inter-individual genomic diversity observed among humans. Not only do these variations change the structure of the genome; they may also have functional implications, e.g. altered gene expression. Some SVs have been identified as the cause of genetic disorders, including cancer predisposition. Cancer cells are notorious for their genomic instability, and often show genomic rearrangements at the microscopic and submicroscopic level to which transposable elements (TEs) contribute. Here, we review the role of TEs in genome instability, with particular focus on non-LTR retrotransposons. Currently, three non-LTR retrotransposon families – long interspersed element 1 (L1), SVA (short interspersed element (SINE-R), variable number of tandem repeats (VNTR), and Alu), and Alu (a SINE) elements – mobilize in the human genome, and cause genomic instability through both insertion- and post-insertion-based mutagenesis. Due to the abundance and high sequence identity of TEs, they frequently mislead the homologous recombination repair pathway into non-allelic homologous recombination, causing deletions, duplications, and inversions. While less comprehensively studied, non-LTR retrotransposon insertions and TE-mediated rearrangements are probably more common in cancer cells than in healthy tissue. This may be at least partially attributed to the commonly seen global hypomethylation as well as general epigenetic dysfunction of cancer cells. Where possible, we provide examples that impact cancer predisposition and/or development. PMID:20307669

Mobile elements reveal small population size in the ancient ancestors of Homo sapiens.

PubMed

Huff, Chad D; Xing, Jinchuan; Rogers, Alan R; Witherspoon, David; Jorde, Lynn B

2010-02-02

The genealogies of different genetic loci vary in depth. The deeper the genealogy, the greater the chance that it will include a rare event, such as the insertion of a mobile element. Therefore, the genealogy of a region that contains a mobile element is on average older than that of the rest of the genome. In a simple demographic model, the expected time to most recent common ancestor (TMRCA) is doubled if a rare insertion is present. We test this expectation by examining single nucleotide polymorphisms around polymorphic Alu insertions from two completely sequenced human genomes. The estimated TMRCA for regions containing a polymorphic insertion is two times larger than the genomic average (P < <10(-30)), as predicted. Because genealogies that contain polymorphic mobile elements are old, they are shaped largely by the forces of ancient population history and are insensitive to recent demographic events, such as bottlenecks and expansions. Remarkably, the information in just two human DNA sequences provides substantial information about ancient human population size. By comparing the likelihood of various demographic models, we estimate that the effective population size of human ancestors living before 1.2 million years ago was 18,500, and we can reject all models where the ancient effective population size was larger than 26,000. This result implies an unusually small population for a species spread across the entire Old World, particularly in light of the effective population sizes of chimpanzees (21,000) and gorillas (25,000), which each inhabit only one part of a single continent.

RNA from the 5' end of the R2 retrotransposon controls R2 protein binding to and cleavage of its DNA target site.

PubMed

Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H

2006-11-21

Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.

Joining Tubes With Adhesive

NASA Technical Reports Server (NTRS)

Bateman, W. A.

1984-01-01

Cylindrical tubes joined together, end to end, by method employing adhesive, tapered ends, and spacing wires. Tapered joint between tubular structural elements provides pressure between bonding surfaces during adhesive curing. Spacing wires prevent adhesive from being scraped away when one element inserted in other. Method developed for assembling structural elements made of composite materials.

Structure and Expression of Hybrid Dysgenesis-Induced Alleles of the Ovarian Tumor (Otu) Gene in Drosophila Melanogaster

PubMed Central

Sass, G. L.; Mohler, J. D.; Walsh, R. C.; Kalfayan, L. J.; Searles, L. L.

1993-01-01

Mutations at the ovarian tumor (otu) gene of Drosophila melanogaster cause female sterility and generate a range of ovarian phenotypes. Quiescent (QUI) mutants exhibit reduced germ cell proliferation; in oncogenic (ONC) mutants germ cells undergo uncontrolled proliferation generating excessive numbers of undifferentiated cells; the egg chambers of differentiated (DIF) mutants differentiate to variable degrees but fail to complete oogenesis. We have examined mutations caused by insertion and deletion of P elements at the otu gene. The P element insertion sites are upstream of the major otu transcription start sites. In deletion derivatives, the P element, regulatory regions and/or protein coding sequences have been removed. In both insertion and deletion mutants, the level of otu expression correlates directly with the severity of the phenotype: the absence of otu function produces the most severe QUI phenotype while the ONC mutants express lower levels of otu than those which are DIF. The results of this study demonstrate that the diverse mutant phenotypes of otu are the consequence of different levels of otu function. PMID:8436274

Seedling lethality in Nicotiana plumbaginifolia conferred by Ds transposable element insertion into a plant-specific gene.

PubMed

Majira, Amel; Domin, Monique; Grandjean, Olivier; Gofron, Krystyna; Houba-Hérin, Nicole

2002-10-01

A seedling lethal mutant of Nicotiana plumbaginifolia (sdl-1) was isolated by transposon tagging using a maize Dissociation (Ds) element. The insertion mutation was produced by direct co-transformation of protoplasts with two plasmids: one containing Ds and a second with an Ac transposase gene. sdl-1 seedlings exhibit several phenotypes: swollen organs, short hypocotyls in light and dark conditions, and enlarged and multinucleated cells, that altogether suggest cell growth defects. Mutant cells are able to proliferate under in vitro culture conditions. Genomic DNA sequences bordering the transposon were used to recover cDNA from the normal allele. Complementation of the mutant phenotype with the cDNA confirmed that the transposon had caused the mutation. The Ds element was inserted into the first exon of the open reading frame and the homozygous mutant lacked detectable transcript. Phenocopies of the mutant were obtained by an antisense approach. SDL-1 encodes a novel protein found in several plant genomes but apparently missingfrom animal and fungal genomes; the protein is highly conserved and has a potential plastid targeting motif.

Thermodynamic Analysis of TEG-TEC Device Including Influence of Thomson Effect

NASA Astrophysics Data System (ADS)

Feng, Yuanli; Chen, Lingen; Meng, Fankai; Sun, Fengrui

2018-01-01

A thermodynamic model of a thermoelectric cooler driven by thermoelectric generator (TEG-TEC) device is established considering Thomson effect. The performance is analyzed and optimized using numerical calculation based on non-equilibrium thermodynamic theory. The influence characteristics of Thomson effect on the optimal performance and variable selection are investigated by comparing the condition with and without Thomson effect. The results show that Thomson effect degrades the performance of TEG-TEC device, it decreases the cooling capacity by 27 %, decreases the coefficient of performance (COP) by 19 %, decreases the maximum cooling temperature difference by 11 % when the ratio of thermoelectric elements number is 0.6, the cold junction temperature of thermoelectric cooler (TEC) is 285 K and the hot junction temperature of thermoelectric generator (TEG) is 450 K. Thomson effect degrades the optimal performance of TEG-TEC device, it decreases the maximum cooling capacity by 28 % and decreases the maximum COP by 28 % under the same junction temperatures. Thomson effect narrows the optimal variable range and optimal working range. In the design of the devices, limited-number thermoelectric elements should be more allocated appropriately to TEG when consider Thomson effect. The results may provide some guidelines for the design of TEG-TEC devices.

Frequency Combs in a Lumped-Element Josephson-Junction Circuit

NASA Astrophysics Data System (ADS)

Khan, Saeed; Türeci, Hakan E.

2018-04-01

We investigate the dynamics of a microwave-driven Josephson junction capacitively coupled to a lumped-element L C oscillator. In the regime of driving where the Josephson junction can be approximated as a Kerr oscillator, this minimal nonlinear system has been previously shown to exhibit a bistability in phase and amplitude. In the present study, we characterize the full phase diagram and show that besides a parameter regime exhibiting bistability, there is also a regime of self-oscillations characterized by a frequency comb in its spectrum. We discuss the mechanism of comb generation which appears to be different from those studied in microcavity frequency combs and mode-locked lasers. We then address the fate of the comblike spectrum in the regime of strong quantum fluctuations, reached when nonlinearity becomes the dominant scale with respect to dissipation. We find that the nonlinearity responsible for the emergence of the frequency combs also leads to its dephasing, leading to broadening and ultimate disappearance of sharp spectral peaks. Our study explores the fundamental question of the impact of quantum fluctuations for quantum systems which do not possess a stable fixed point in the classical limit.

Phylogenetic Conflict in Bears Identified by Automated Discovery of Transposable Element Insertions in Low-Coverage Genomes.

PubMed

Lammers, Fritjof; Gallus, Susanne; Janke, Axel; Nilsson, Maria A

2017-10-01

Phylogenetic reconstruction from transposable elements (TEs) offers an additional perspective to study evolutionary processes. However, detecting phylogenetically informative TE insertions requires tedious experimental work, limiting the power of phylogenetic inference. Here, we analyzed the genomes of seven bear species using high-throughput sequencing data to detect thousands of TE insertions. The newly developed pipeline for TE detection called TeddyPi (TE detection and discovery for Phylogenetic Inference) identified 150,513 high-quality TE insertions in the genomes of ursine and tremarctine bears. By integrating different TE insertion callers and using a stringent filtering approach, the TeddyPi pipeline produced highly reliable TE insertion calls, which were confirmed by extensive in vitro validation experiments. Analysis of single nucleotide substitutions in the flanking regions of the TEs shows that these substitutions correlate with the phylogenetic signal from the TE insertions. Our phylogenomic analyses show that TEs are a major driver of genomic variation in bears and enabled phylogenetic reconstruction of a well-resolved species tree, despite strong signals for incomplete lineage sorting and introgression. The analyses show that the Asiatic black, sun, and sloth bear form a monophyletic clade, in which phylogenetic incongruence originates from incomplete lineage sorting. TeddyPi is open source and can be adapted to various TE and structural variation callers. The pipeline makes it possible to confidently extract thousands of TE insertions even from low-coverage genomes (∼10×) of nonmodel organisms. This opens new possibilities for biologists to study phylogenies and evolutionary processes as well as rates and patterns of (retro-)transposition and structural variation. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

New technique for correcting mild types of cryptotia: elevate cavum conchae cartilage and suture to cranial periosteum.

PubMed

Shen, Weimin; Cui, Jie; Chen, Jianbin; Chen, Haini; Zou, Jijun; Ji, Yi

2012-11-01

We have developed a new technique for the treatment of mild types of cryptotia in which the cavum conchae cartilage was pulled superiorly and sutured it to the temporal bone to the temporal parietal junction periosteum securely. Then, the stitches for bolster fixation were inserted parallel to the auricular temporal sulcus and temporarily left untied. Our technique is easy to use and secures a firm bolster fixation, and the scar is hidden. We recommend it for the treatment of mild types of cryptotia.

A Compact Low-loss Magic-T using Microstrip-Slotline Transitions

NASA Technical Reports Server (NTRS)

U-yen, Kongpop; Wollack, Edward J.; Moseley, Samuel H.; Papapolymerou, John; Laskar, Joy

2007-01-01

The design of a compact low-loss magic-T is proposed. The planar magic-T incorporates the compact microstrip-slotline tee junction and small microstrip-slotline transition area to reduce slotline radiation. The experimental results show that the magic-T produces broadband in-phase and out-of-phase power combiner/divider responses, has an average in-band insertion loss of 0.3 dB and small in-band phase and amplitude imbalance of less than plus or minus 1.6 deg. and plus or minus 0.3 dB, respectively.

Superlattice structure modeling and simulation of High Electron Mobility Transistor for improved performance

NASA Astrophysics Data System (ADS)

Munusami, Ravindiran; Yakkala, Bhaskar Rao; Prabhakar, Shankar

2013-12-01

Magnetic tunnel junction were made by inserting the magnetic materials between the source, channel and the drain of the High Electron Mobility Transistor (HEMT) to enhance the performance. Material studio software package was used to design the superlattice layers. Different cases were analyzed to optimize the performance of the device by placing the magnetic material at different positions of the device. Simulation results based on conductivity reveals that the device has a very good electron transport due to the magnetic materials and will amplify very low frequency signals.

Experimental system for in-situ measurement of temperature rise in animal tissue under exposure to acoustic radiation force impulse.

PubMed

Nitta, Naotaka; Ishiguro, Yasunao; Sasanuma, Hideki; Taniguchi, Nobuyuki; Akiyama, Iwaki

2015-01-01

Acoustic radiation force impulse (ARFI) has recently been used for tissue elasticity measurement and imaging. On the other hand, it is predicted that a rise in temperature occurs. In-situ measurement of temperature rise in animal experiments is important, yet measurement using thermocouples has some problems such as position mismatch of the temperature measuring junction of the thermocouple and the focal point of ultrasound. Therefore, an in-situ measurement system for solving the above problems was developed in this study. The developed system is composed mainly of an ultrasound irradiation unit including a custom-made focused transducer with a through hole for inserting a thin-wire thermocouple, and a temperature measurement unit including the thermocouple. The feasibility of the developed system was evaluated by means of experiments using a tissue-mimicking material (TMM), a TMM containing a bone model or a chicken bone, and an extracted porcine liver. The similarity between the experimental results and the results of simulation using a finite element method (FEM) implied the reasonableness of in-situ temperature rise measured by the developed system. The developed system will become a useful tool for measuring in-situ temperature rise in animal experiments and obtaining findings with respect to the relationship between ultrasound irradiation conditions and in-situ temperature rise.

Is spin transport through molecules really occurring in organic spin valves? A combined magnetoresistance and inelastic electron tunnelling spectroscopy study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Galbiati, Marta; Tatay, Sergio; Delprat, Sophie

2015-02-23

Molecular and organic spintronics is an emerging research field which combines the versatility of chemistry with the non-volatility of spintronics. Organic materials have already proved their potential as tunnel barriers (TBs) or spacers in spintronics devices showing sizable spin valve like magnetoresistance effects. In the last years, a large effort has been focused on the optimization of these organic spintronics devices. Insertion of a thin inorganic tunnel barrier (Al{sub 2}O{sub 3} or MgO) at the bottom ferromagnetic metal (FM)/organic interface seems to improve the spin transport efficiency. However, during the top FM electrode deposition, metal atoms are prone to diffusemore » through the organic layer and potentially short-circuit it. This may lead to the formation of a working but undesired FM/TB/FM magnetic tunnel junction where the organic plays no role. Indeed, establishing a protocol to demonstrate the effective spin dependent transport through the organic layer remains a key issue. Here, we focus on Co/Al{sub 2}O{sub 3}/Alq{sub 3}/Co junctions and show that combining magnetoresistance and inelastic electron tunnelling spectroscopy measurements one can sort out working “organic” and short-circuited junctions fabricated on the same wafer.« less

Worldwide distribution of transposable element copy number in natural populations of Drosophila simulans.

PubMed

Biémont, Christian; Nardon, Christiane; Deceliere, Grégory; Lepetit, David; Loevenbruck, Catherine; Vieira, Cristina

2003-01-01

Transposable elements (TEs), which promote various kinds of mutations, constitute a large fraction of the genome. How they invade natural populations and species is therefore of fundamental importance for understanding the dynamics of genetic diversity and genome composition. On the basis of 85 samples of natural populations of Drosophila simulans, we report the distributions of the genome insertion site numbers of nine TEs that were chosen because they have a low average number of sites. Most populations were found to have 0-3 insertion sites, but some of them had a significantly higher number of sites for a given TE. The populations located in regions outside Africa had the highest number of sites for all elements except HMS Beagle and Coral, suggesting a recent increase in the activity of some TEs associated with the colonization patterns of Drosophila simulans. The element Tirant had a very distinctive pattern of distribution: it was identified mainly in populations from East Africa and some islands in the Indian Ocean, and its insertion site number was low in all these populations. The data suggest that the genome of the entire species of Drosophila simulans may be being invaded by TEs from populations in which they are present in high copy number.

An experimental system for the evaluation of retroviral vector design to diminish the risk for proto-oncogene activation

PubMed Central

Ryu, Byoung Y.; Evans-Galea, Marguerite V.; Gray, John T.; Bodine, David M.; Persons, Derek A.

2008-01-01

Pathogenic activation of the LMO2 proto-oncogene by an oncoretroviral vector insertion in a clinical trial for X-linked severe combined immunodeficiency (X-SCID) has prompted safety concerns. We used an adeno-associated virus vector to achieve targeted insertion of a γ-retroviral long terminal repeat (LTR) driving a GFP expression cassette with flanking loxP sites in a human T-cell line at the precise location of vector integration in one of the patients with X-SCID. The LTR-GFP cassette was inserted into the first intron of the LMO2 gene, resulting in strong activation of LMO2. Cre-mediated cassette exchange was used to replace the original LTR-GFP cassette with one flanked by insulator elements leading to a several fold reduction in LMO2 expression. The LTR-GFP cassette was also replaced with a globin gene regulatory cassette that failed to activate the LMO2 gene in lymphoid cells. A γ-retroviral vector with 2 intact LTRs resulted in activation of the LMO2 gene when inserted into the first intron, but a self-inactivating lentiviral vector with an internal cellular promoter and flanking insulator elements did not activate the LMO2 gene. Thus, this system is useful for comparing the safety profiles of vector cassettes with various regulatory elements for their potential for proto-oncogene activation. PMID:17991809

Dissemination of streptococcal pyrogenic exotoxin G (spegg) with an IS-like element in fish isolates of Streptococcus dysgalactiae.

PubMed

Abdelsalam, Mohamed; Chen, Shih-Chu; Yoshida, Terutoyo

2010-08-01

The Lancefield group C alpha-hemolytic Streptococcus dysgalactiae ssp. dysgalactiae (GCSD) causes systemic granulomatous inflammatory disease and high mortality rates in infected fish. Superantigen and streptolysin S genes are the most important virulence factors contributing to an invasive streptococcal infection. PCR amplification revealed that all strains isolated from moribund fish harbored the streptolysin S structural gene (sagA). GCSD fish isolates were PCR negative for emm, speA, speB, speC, speM, smeZ, and ssa. However, the size of the streptococcal pyrogenic exotoxin G (spegg) locus, a superantigen, in positive S. dysgalactiae fish and pig strains was variable. The ORF of the spegg locus of 26 GCSD fish strains and one GCSD pig strain was inserted with IS981SC. Interestingly, the ORF of the spegg locus of two fish strains of GCSD collected in Malaysia was inserted with an IS981SC-IS1161 hybrid IS element. The hybrid IS element was found in all of the GCSD fish isolates and one GCSD pig through PCR screening. Although no insertion sequence (IS) was detected in the spegg locus of S. dysgalactiae ssp. equisimilis (GCSE) strains, a five-nucleotide deletion mutation was detected in the ORF of the spegg locus of one GCSE strain at the supposed site of IS981SC insertion, resulting in a frameshift mutation.

pTC Plasmids from Sulfolobus Species in the Geothermal Area of Tengchong, China: Genomic Conservation and Naturally-Occurring Variations as a Result of Transposition by Mobile Genetic Elements

PubMed Central

Xiang, Xiaoyu; Huang, Xiaoxing; Wang, Haina; Huang, Li

2015-01-01

Plasmids occur frequently in Archaea. A novel plasmid (denoted pTC1) containing typical conjugation functions has been isolated from Sulfolobus tengchongensis RT8-4, a strain obtained from a hot spring in Tengchong, China, and characterized. The plasmid is a circular double-stranded DNA molecule of 20,417 bp. Among a total of 26 predicted pTC1 ORFs, 23 have homologues in other known Sulfolobus conjugative plasmids (CPs). pTC1 resembles other Sulfolobus CPs in genome architecture, and is most highly conserved in the genomic region encoding conjugation functions. However, attempts to demonstrate experimentally the capacity of the plasmid for conjugational transfer were unsuccessful. A survey revealed that pTC1 and its closely related plasmid variants were widespread in the geothermal area of Tengchong. Variations of the plasmids at the target sites for transposition by an insertion sequence (IS) and a miniature inverted-repeat transposable element (MITE) were readily detected. The IS was efficiently inserted into the pTC1 genome, and the inserted sequence was inactivated and degraded more frequently in an imprecise manner than in a precise manner. These results suggest that the host organism has evolved a strategy to maintain a balance between the insertion and elimination of mobile genetic elements to permit genomic plasticity while inhibiting their fast spreading. PMID:25686154

pTC Plasmids from Sulfolobus Species in the Geothermal Area of Tengchong, China: Genomic Conservation and Naturally-Occurring Variations as a Result of Transposition by Mobile Genetic Elements.

PubMed

Xiang, Xiaoyu; Huang, Xiaoxing; Wang, Haina; Huang, Li

2015-02-12

Plasmids occur frequently in Archaea. A novel plasmid (denoted pTC1) containing typical conjugation functions has been isolated from Sulfolobus tengchongensis RT8-4, a strain obtained from a hot spring in Tengchong, China, and characterized. The plasmid is a circular double-stranded DNA molecule of 20,417 bp. Among a total of 26 predicted pTC1 ORFs, 23 have homologues in other known Sulfolobus conjugative plasmids (CPs). pTC1 resembles other Sulfolobus CPs in genome architecture, and is most highly conserved in the genomic region encoding conjugation functions. However, attempts to demonstrate experimentally the capacity of the plasmid for conjugational transfer were unsuccessful. A survey revealed that pTC1 and its closely related plasmid variants were widespread in the geothermal area of Tengchong. Variations of the plasmids at the target sites for transposition by an insertion sequence (IS) and a miniature inverted-repeat transposable element (MITE) were readily detected. The IS was efficiently inserted into the pTC1 genome, and the inserted sequence was inactivated and degraded more frequently in an imprecise manner than in a precise manner. These results suggest that the host organism has evolved a strategy to maintain a balance between the insertion and elimination of mobile genetic elements to permit genomic plasticity while inhibiting their fast spreading.

Modeling the Insertion Mechanics of Flexible Neural Probes Coated with Sacrificial Polymers for Optimizing Probe Design

PubMed Central

Singh, Sagar; Lo, Meng-Chen; Damodaran, Vinod B.; Kaplan, Hilton M.; Kohn, Joachim; Zahn, Jeffrey D.; Shreiber, David I.

2016-01-01

Single-unit recording neural probes have significant advantages towards improving signal-to-noise ratio and specificity for signal acquisition in brain-to-computer interface devices. Long-term effectiveness is unfortunately limited by the chronic injury response, which has been linked to the mechanical mismatch between rigid probes and compliant brain tissue. Small, flexible microelectrodes may overcome this limitation, but insertion of these probes without buckling requires supporting elements such as a stiff coating with a biodegradable polymer. For these coated probes, there is a design trade-off between the potential for successful insertion into brain tissue and the degree of trauma generated by the insertion. The objective of this study was to develop and validate a finite element model (FEM) to simulate insertion of coated neural probes of varying dimensions and material properties into brain tissue. Simulations were performed to predict the buckling and insertion forces during insertion of coated probes into a tissue phantom with material properties of brain. The simulations were validated with parallel experimental studies where probes were inserted into agarose tissue phantom, ex vivo chick embryonic brain tissue, and ex vivo rat brain tissue. Experiments were performed with uncoated copper wire and both uncoated and coated SU-8 photoresist and Parylene C probes. Model predictions were found to strongly agree with experimental results (<10% error). The ratio of the predicted buckling force-to-predicted insertion force, where a value greater than one would ideally be expected to result in successful insertion, was plotted against the actual success rate from experiments. A sigmoidal relationship was observed, with a ratio of 1.35 corresponding to equal probability of insertion and failure, and a ratio of 3.5 corresponding to a 100% success rate. This ratio was dubbed the “safety factor”, as it indicated the degree to which the coating should be over-designed to ensure successful insertion. Probability color maps were generated to visually compare the influence of design parameters. Statistical metrics derived from the color maps and multi-variable regression analysis confirmed that coating thickness and probe length were the most important features in influencing insertion potential. The model also revealed the effects of manufacturing flaws on insertion potential. PMID:26959021

Active shape control of composite blades using shape memory actuation

NASA Astrophysics Data System (ADS)

Chandra, Ramesh

2001-10-01

This paper presents active shape control of composite beams using shape memory actuation. Shape memory alloy (SMA) bender elements trained to memorize bending shape were used to induce bending and twisting deformations in composite beams. Bending-torsion coupled graphite-epoxy and kevlar-epoxy composite beams with Teflon inserts were manufactured using an autoclave-molding technique. Teflon inserts were replaced by trained SMA bender elements. Composite beams with SMA bender elements were activated by heating these using electrical resistive heating and the bending and twisting deformations of the beams were measured using a mirror and laser system. The structural response of the composite beams activated by SMA elements was predicted using the Vlasov theory, where these beams were modeled as open sections with many branches. The bending moment induced by a SMA bender element was calculated from its experimentally determined memorized shape. The bending, torsion, and bending-torsion coupling stiffness coefficients of these beams were obtained using analytical formulation of an open-section composite beam with many branches (Vlasov theory).

Structural basis for the selective permeability of channels made of communicating junction proteins.

PubMed

Ek-Vitorin, Jose F; Burt, Janis M

2013-01-01

The open state(s) of gap junction channels is evident from their permeation by small ions in response to an applied intercellular (transjunctional/transchannel) voltage gradient. That an open channel allows variable amounts of current to transit from cell-to-cell in the face of a constant intercellular voltage difference indicates channel open/closing can be complete or partial. The physiological significance of such open state options is, arguably, the main concern of junctional regulation. Because gap junctions are permeable to many substances, it is sensible to inquire whether and how each open state influences the intercellular diffusion of molecules as valuable as, but less readily detected than current-carrying ions. Presumably, structural changes perceived as shifts in channel conductivity would significantly alter the transjunctional diffusion of molecules whose limiting diameter approximates the pore's limiting diameter. Moreover, changes in junctional permeability to some molecules might occur without evident changes in conductivity, either at macroscopic or single channel level. Open gap junction channels allow the exchange of cytoplasmic permeants between contacting cells by simple diffusion. The identity of such permeants, and the functional circumstances and consequences of their junctional exchange presently constitute the most urgent (and demanding) themes of the field. Here, we consider the necessity for regulating this exchange, the possible mechanism(s) and structural elements likely involved in such regulation, and how regulatory phenomena could be perceived as changes in chemical vs. electrical coupling; an overall reflection on our collective knowledge of junctional communication is then applied to suggest new avenues of research. This article is part of a Special Issue entitled: The Communicating junctions, roles and dysfunctions. Copyright © 2012 Elsevier B.V. All rights reserved.

Characterization of the NEXT Hollow Cathode Inserts After Long-Duration Testing

NASA Technical Reports Server (NTRS)

Mackey, J.; Shastry, R.; Soulas, G.

2017-01-01

Hollow dispenser cathode inserts are a critical element of electric propulsion systems, and should therefore be well understood during long term operation to ensure reliable system performance. This work destructively investigated cathode inserts from the NEXT long-duration test which demonstrated 51,184 hours of high-voltage operation, 918 kg of propellant throughput, and 35.5 MN-s of total impulse. The characterization methods used include scanning electron microscopy with energy dispersive spectroscopy and X-ray diffraction. Microscopy analysis has been performed on fractured surfaces, emission surfaces, and metallographically polished cross-sections of post-test inserts and unused inserts. Impregnate distribution, etch region thickness, impregnate chemical content, emission surface topography, and emission surface phase identification are the primary factors investigated.

Germline Transformation of Drosophila Virilis Mediated by the Transposable Element Hobo

PubMed Central

Lozovskaya, E. R.; Nurminsky, D. I.; Hartl, D. L.; Sullivan, D. T.

1996-01-01

A laboratory strain of Drosophila virilis was genetically transformed with a hobo vector carrying the miniwhite cassette using a helper plasmid with an hsp70-driven hobo transposase-coding sequence. The rate of transformation was 0.5% per fertile G0 animal. Three transgenic insertions were cloned and characterized and found to be authentic hobo insertions. These results, together with the known wide-spread distribution of hobo in diverse insect species, suggest that hobo and related transposable elements may be of considerable utility in the germline transformation of insects other than D. melanogaster. PMID:8770594

Finite element simulation of cutting grey iron HT250 by self-prepared Si3N4 ceramic insert

NASA Astrophysics Data System (ADS)

Wang, Bo; Wang, Li; Zhang, Enguang

2017-04-01

The finite element method has been able to simulate and solve practical machining problems, achieve the required accuracy and the highly reliability. In this paper, the simulation models based on the material properties of the self-prepared Si3N4 insert and HT250 were created. Using these models, the results of cutting force, cutting temperature and tool wear rate were obtained, and tool wear mode was predicted after cutting simulation. These approaches may develop as the new method for testing new cutting-tool materials, shortening development cycle and reducing the cost.

Structural basis for the selective permeability of channels made of communicating junction proteins

PubMed Central

Ek-Vitorin, Jose F.; Burt, Janis M.

2012-01-01

The open state(s) of gap junction channels is evident from their permeation by small ions in response to an applied intercellular (transjunctional/transchannel) voltage gradient. That an open channel allows variable amounts of current to transit from cell-to-cell in the face of a constant intercellular voltage difference indicates channel open/closing can be complete or partial. The physiological significance of such open state options is, arguably, the main concern of junctional regulation. Because gap junctions are permeable to many substances, it is sensible to inquire whether and how each open state influences the intercellular diffusion of molecules as valuable as, but less readily detected than current-carrying ions. Presumably, structural changes perceived as shifts in channel conductivity would significantly alter the transjunctional diffusion of molecules whose limiting diameter approximates the pore’s limiting diameter. Moreover, changes in junctional permeability to some molecules might occur without evident changes in conductivity, either at macroscopic or single channel level. Open gap junction channels allow the exchange of cytoplasmic permeants between contacting cells by simple diffusion. The identity of such permeants, and the functional circumstances and consequences of their junctional exchange presently constitute the most urgent (and demanding) themes of the field. Here, we consider the necessity for regulating this exchange, the possible mechanism(s) and structural elements likely involved in such regulation, and how regulatory phenomena could be perceived as changes in chemical vs. electrical coupling; an overall reflection on our collective knowledge of junctional communication is then applied to suggest new avenues of research. PMID:22342665

The Diversity of Prokaryotic DDE Transposases of the Mutator Superfamily, Insertion Specificity, and Association with Conjugation Machineries

PubMed Central

Guérillot, Romain; Siguier, Patricia; Gourbeyre, Edith; Chandler, Michael; Glaser, Philippe

2014-01-01

Transposable elements (TEs) are major components of both prokaryotic and eukaryotic genomes and play a significant role in their evolution. In this study, we have identified new prokaryotic DDE transposase families related to the eukaryotic Mutator-like transposases. These genes were retrieved by cascade PSI-Blast using as initial query the transposase of the streptococcal integrative and conjugative element (ICE) TnGBS2. By combining secondary structure predictions and protein sequence alignments, we predicted the DDE catalytic triad and the DNA-binding domain recognizing the terminal inverted repeats. Furthermore, we systematically characterized the organization and the insertion specificity of the TEs relying on these prokaryotic Mutator-like transposases (p-MULT) for their mobility. Strikingly, two distant TE families target their integration upstream σA dependent promoters. This allowed us to identify a transposase sequence signature associated with this unique insertion specificity and to show that the dissymmetry between the two inverted repeats is responsible for the orientation of the insertion. Surprisingly, while DDE transposases are generally associated with small and simple transposons such as insertion sequences (ISs), p-MULT encoding TEs show an unprecedented diversity with several families of IS, transposons, and ICEs ranging in size from 1.1 to 52 kb. PMID:24418649

Lambda Red Mediated Gap Repair Utilizes a Novel Replicative Intermediate in Escherichia coli

PubMed Central

Reddy, Thimma R.; Fevat, Léna M. S.; Munson, Sarah E.; Stewart, A. Francis; Cowley, Shaun M.

2015-01-01

The lambda phage Red recombination system can mediate efficient homologous recombination in Escherichia coli, which is the basis of the DNA engineering technique termed recombineering. Red mediated insertion of DNA requires DNA replication, involves a single-stranded DNA intermediate and is more efficient on the lagging strand of the replication fork. Lagging strand recombination has also been postulated to explain the Red mediated repair of gapped plasmids by an Okazaki fragment gap filling model. Here, we demonstrate that gap repair involves a different strand independent mechanism. Gap repair assays examining the strand asymmetry of recombination did not show a lagging strand bias. Directly testing an ssDNA plasmid showed lagging strand recombination is possible but dsDNA plasmids did not employ this mechanism. Insertional recombination combined with gap repair also did not demonstrate preferential lagging strand bias, supporting a different gap repair mechanism. The predominant recombination route involved concerted insertion and subcloning though other routes also operated at lower frequencies. Simultaneous insertion of DNA resulted in modification of both strands and was unaffected by mutations to DNA polymerase I, responsible for Okazaki fragment maturation. The lower efficiency of an alternate Red mediated ends-in recombination pathway and the apparent lack of a Holliday junction intermediate suggested that gap repair does not involve a different Red recombination pathway. Our results may be explained by a novel replicative intermediate in gap repair that does not involve a replication fork. We exploited these observations by developing a new recombineering application based on concerted insertion and gap repair, termed SPI (subcloning plus insertion). SPI selected against empty vector background and selected for correct gap repair recombinants. We used SPI to simultaneously insert up to four different gene cassettes in a single recombineering reaction. Consequently, our findings have important implications for the understanding of E. coli replication and Red recombination. PMID:25803509

A geometric approach to aortic root surgical anatomy.

PubMed

Contino, Monica; Mangini, Andrea; Lemma, Massimo Giovanni; Romagnoni, Claudia; Zerbi, Pietro; Gelpi, Guido; Antona, Carlo

2016-01-01

The aim of this study was the analysis of the geometrical relationships between the different structures constituting the aortic root, with particular attention to interleaflet triangles, haemodynamic ventriculo-arterial junction and functional aortic annulus in normal subjects. Sixteen formol-fixed human hearts with normal aortic roots were studied. The aortic root was isolated, sectioned at the midpoint of the non-coronary sinus, spread apart and photographed by a high-resolution digital camera. After calibration and picture resizing, the software AutoCAD 2004 was used to identify and measure all the elements of the interleaflets triangles and of the aortic root that were objects of our analysis. Multiple comparisons were performed with one-way analysis of variance for continuous data and with Kruskal-Wallis analysis for non-continuous data. Linear regression and Pearson's product correlation were used to correlate root element dimensions when appropriate. Student's t-test was used to compare means for unpaired data. Heron's formula was applied to estimate the functional aortic annular diameters. The non coronary-left coronary interleaflets triangles were larger, followed by inter-coronary and right-non-coronary ones. The apical angle is <60° and its standard deviation can be considered an asymmetry index. The sinu-tubular junction was shown to be 10% larger than the virtual basal ring (VBR). The mathematical relationship between the haemodynamic ventriculo-arterial junction and the VBR calculated by linear regression and expressed in terms of the diameter was: haemodynamic ventriculo-arterial junction = 2.29 VBR (diameter) + 47. Conservative aortic surgery is based on a better understanding of aortic root anatomy and physiology. The relationships among its elements are of paramount importance during aortic valve repair/sparing procedures and they can be useful also in echocardiographic analysis and in computed tomography reconstruction. © The Author 2015. Published by Oxford University Press on behalf of the European Association for Cardio-Thoracic Surgery. All rights reserved.

Effect of interfacial structures on spin dependent tunneling in epitaxial L1 0-FePt/MgO/FePt perpendicular magnetic tunnel junctions

DOE PAGES

Yang, G.; Li, D. L.; Wang, S. G.; ...

2015-02-24

In this study, epitaxial FePt(001)/MgO/FePt magnetic tunnel junctions with L1 0-FePt electrodes showing perpendicular magnetic anisotropy were fabricated by molecular beam epitaxial growth. Tunnel magnetoresistance ratios of 21% and 53% were obtained at 300 K and 10 K, respectively. Our previous work, based on transmission electron microscopy, confirmed a semi-coherent interfacial structure with atomic steps (Kohn et al., APL 102, 062403 (2013)). Here, we show by x-ray photoemission spectroscopy and first-principles calculation that the bottom FePt/MgO interface is either Pt-terminated for regular growth or when an Fe layer is inserted at the interface, it is chemically bonded to O. Finally,more » both these structures have a dominant role in spin dependent tunneling across the MgO barrier resulting in a decrease of the tunneling magnetoresistance ratio compared with previous predictions.« less

Traumatic Pulmonary Herniation at the Diaphragmatic Junction in a Pediatric Patient: A Rare Complication of Blunt Chest Trauma.

PubMed

Orlik, Kseniya; Simon, Erin Leslie; Hemmer, Carrie; Ramundo, Maria

2016-07-01

We present a case of traumatic intercostal pulmonary herniation in an 11-year-old boy after blunt trauma to the chest, without associated chest wall disruption or pneumothorax. This condition is especially uncommon in children, with only 5 previously reported cases and most occurring after penetrating chest trauma. To date, there are no reports in literature describing traumatic intercostal lung herniation at the diaphragmatic junction with a closed chest cavity in a child. The number of traumatic lung herniation diagnoses may be expanded by a more liberal use of computed tomography when serious injury is suspected. Computed tomography and advanced imaging should be considered in pediatric trauma patients presenting with concern for intrathoracic injury that may not be seen on plain film. Traumatic blunt intrathoracic and intra-abdominal injuries in the pediatric population that are within proximity of diaphragmatic insertion should be thoroughly evaluated to rule out diaphragmatic injury. As in our case, invasive surgical intervention such as thoracoscopy may be necessary.

Ring modulators with enhanced efficiency based on standing-wave operation on a field-matched, interdigitated p-n junction.

PubMed

Pavanello, Fabio; Zeng, Xiaoge; Wade, Mark T; Popović, Miloš A

2016-11-28

We propose ring modulators based on interdigitated p-n junctions that exploit standing rather than traveling-wave resonant modes to improve modulation efficiency, insertion loss and speed. Matching the longitudinal nodes and antinodes of a standing-wave mode with high (contacts) and low (depletion regions) carrier density regions, respectively, simultaneously lowers loss and increases sensitivity significantly. This approach permits further to relax optical constraints on contacts placement and can lead to lower device capacitance. Such structures are well-matched to fabrication in advanced microelectronics CMOS processes. Device architectures that exploit this concept are presented along with their benefits and drawbacks. A temporal coupled mode theory model is used to investigate the static and dynamic response. We show that modulation efficiencies or loss Q factors up to 2 times higher than in previous traveling-wave geometries can be achieved leading to much larger extinction ratios. Finally, we discuss more complex doping geometries that can improve carrier dynamics for higher modulation speeds in this context.

5.0 kV breakdown-voltage vertical GaN p-n junction diodes

NASA Astrophysics Data System (ADS)

Ohta, Hiroshi; Hayashi, Kentaro; Horikiri, Fumimasa; Yoshino, Michitaka; Nakamura, Tohru; Mishima, Tomoyoshi

2018-04-01

A high breakdown voltage of 5.0 kV has been achieved for the first time in vertical GaN p-n junction diodes by using our newly developed guard-ring structures. A resistance device was inserted between the main diode portion and the guard-ring portion in a ring-shaped p-n diode to generate a voltage drop over the resistance device by leakage current flowing through the guard-ring portion under negatively biased conditions before breakdown. The voltage at the outer mesa edge of the guard-ring portion, where the electric field intensity is highest and the destructive breakdown usually occurs, is decreased by the voltage drop, so the electric field concentration in the portion is reduced. By adopting this structure, the breakdown voltage (V B) is raised by about 200 V. Combined with a low measured on-resistance (R on) of 1.25 mΩ cm2, Baliga’s figure of merit (V\\text{B}2/R\\text{on}) was as high as 20 GW/cm2.

Effect of interfacial structures on spin dependent tunneling in epitaxial L1{sub 0}-FePt/MgO/FePt perpendicular magnetic tunnel junctions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, G.; Li, D. L.; Wang, S. G., E-mail: Sgwang@iphy.ac.cn

2015-02-28

Epitaxial FePt(001)/MgO/FePt magnetic tunnel junctions with L1{sub 0}-FePt electrodes showing perpendicular magnetic anisotropy were fabricated by molecular beam epitaxial growth. Tunnel magnetoresistance ratios of 21% and 53% were obtained at 300 K and 10 K, respectively. Our previous work, based on transmission electron microscopy, confirmed a semi-coherent interfacial structure with atomic steps (Kohn et al., APL 102, 062403 (2013)). Here, we show by x-ray photoemission spectroscopy and first-principles calculation that the bottom FePt/MgO interface is either Pt-terminated for regular growth or when an Fe layer is inserted at the interface, it is chemically bonded to O. Both these structures have a dominantmore » role in spin dependent tunneling across the MgO barrier resulting in a decrease of the tunneling magnetoresistance ratio compared with previous predictions.« less

Spin-orbit torques from interfacial spin-orbit coupling for various interfaces

NASA Astrophysics Data System (ADS)

Kim, Kyoung-Whan; Lee, Kyung-Jin; Sinova, Jairo; Lee, Hyun-Woo; Stiles, M. D.

2017-09-01

We use a perturbative approach to study the effects of interfacial spin-orbit coupling in magnetic multilayers by treating the two-dimensional Rashba model in a fully three-dimensional description of electron transport near an interface. This formalism provides a compact analytic expression for current-induced spin-orbit torques in terms of unperturbed scattering coefficients, allowing computation of spin-orbit torques for various contexts, by simply substituting scattering coefficients into the formulas. It applies to calculations of spin-orbit torques for magnetic bilayers with bulk magnetism, those with interface magnetism, a normal-metal/ferromagnetic insulator junction, and a topological insulator/ferromagnet junction. It predicts a dampinglike component of spin-orbit torque that is distinct from any intrinsic contribution or those that arise from particular spin relaxation mechanisms. We discuss the effects of proximity-induced magnetism and insertion of an additional layer and provide formulas for in-plane current, which is induced by a perpendicular bias, anisotropic magnetoresistance, and spin memory loss in the same formalism.

Spin-orbit torques from interfacial spin-orbit coupling for various interfaces.

PubMed

Kim, Kyoung-Whan; Lee, Kyung-Jin; Sinova, Jairo; Lee, Hyun-Woo; Stiles, M D

2017-09-01

We use a perturbative approach to study the effects of interfacial spin-orbit coupling in magnetic multilayers by treating the two-dimensional Rashba model in a fully three-dimensional description of electron transport near an interface. This formalism provides a compact analytic expression for current-induced spin-orbit torques in terms of unperturbed scattering coefficients, allowing computation of spin-orbit torques for various contexts, by simply substituting scattering coefficients into the formulas. It applies to calculations of spin-orbit torques for magnetic bilayers with bulk magnetism, those with interface magnetism, a normal metal/ferromagnetic insulator junction, and a topological insulator/ferromagnet junction. It predicts a dampinglike component of spin-orbit torque that is distinct from any intrinsic contribution or those that arise from particular spin relaxation mechanisms. We discuss the effects of proximity-induced magnetism and insertion of an additional layer and provide formulas for in-plane current, which is induced by a perpendicular bias, anisotropic magnetoresistance, and spin memory loss in the same formalism.

Spin-orbit torques from interfacial spin-orbit coupling for various interfaces

PubMed Central

Kim, Kyoung-Whan; Lee, Kyung-Jin; Sinova, Jairo; Lee, Hyun-Woo; Stiles, M. D.

2017-01-01

We use a perturbative approach to study the effects of interfacial spin-orbit coupling in magnetic multilayers by treating the two-dimensional Rashba model in a fully three-dimensional description of electron transport near an interface. This formalism provides a compact analytic expression for current-induced spin-orbit torques in terms of unperturbed scattering coefficients, allowing computation of spin-orbit torques for various contexts, by simply substituting scattering coefficients into the formulas. It applies to calculations of spin-orbit torques for magnetic bilayers with bulk magnetism, those with interface magnetism, a normal metal/ferromagnetic insulator junction, and a topological insulator/ferromagnet junction. It predicts a dampinglike component of spin-orbit torque that is distinct from any intrinsic contribution or those that arise from particular spin relaxation mechanisms. We discuss the effects of proximity-induced magnetism and insertion of an additional layer and provide formulas for in-plane current, which is induced by a perpendicular bias, anisotropic magnetoresistance, and spin memory loss in the same formalism. PMID:29333523

Pilot study on preventing anastomotic leakage in stapled gastroesophageal anastomosis

PubMed Central

Huang, Weiming; Liu, Xiangzheng; Li, Jian

2017-01-01

Background This study explored how to improve the surgical technique to reduce or avoid anastomotic leakage. Methods From January 2012 to December 2016, 101 consecutive patients with cancer of the esophagus or gastroesophageal junction underwent stapled gastroesophageal anastomosis. The procedure included creating a tube‐type stomach, fixing an inserted anvil, inspecting mucosa‐to‐mucosa alignment in the lumen under direct vision after firing the stapler, and, if found, manually repairing a rupture of the mucous membrane of the anastomosis. Results A rupture of the mucous membrane of the anastomosis was found in four out of the 101 patients and manually repaired. No postsurgical anastomotic leakage occurred. All patients recovered well and the average postoperative stay was 10.4 days. There was no mortality within 30 days after surgery. Conclusion It is critical to inspect the integrality of the luminal mucous membrane of the anastomosis under direct vision in order to prevent anastomotic leakage in surgical resection of esophageal and gastroesophageal junction malignancies. PMID:29130643

Metalliclike behavior of the exchange coupling in (001) Fe/MgO/Fe junctions

NASA Astrophysics Data System (ADS)

Bellouard, C.; Duluard, A.; Snoeck, E.; Lu, Y.; Negulescu, B.; Lacour, D.; Senet, C.; Robert, S.; Maloufi, N.; Andrieu, S.; Hehn, M.; Tiusan, C.

2017-10-01

Exchange magnetic coupling between Fe electrodes through a thin MgO interlayer in epitaxial junctions has been investigated as a function of temperature, MgO thickness, and interface quality. Depending on the MgO thickness, which has been varied from 1.5 to 4 monolayers, two opposite temperature dependences are clearly disentangled. For a thin MgO spacer, the main component decreases with temperature following a metalliclike behavior. On the contrary, for the thickest MgO layers, the main component increases with temperature, following an Arrhenius law. Moreover, the insertion of a monoatomic roughness at the bottom MgO interface, induced by the addition of a fraction of a Fe monolayer, exacerbates the metallic features as an oscillatory behavior from antiferromagnetic to ferromagnetic is observed. These results allow questioning the simple tunneling mechanism usually invoked for MgO coupling, and suggest a crossover behavior of the thin MgO spacer from metallic to insulating with a progressive opening of the gap.

Method and apparatus for measuring temperatures in fabrics and flexible thermal insulations

NASA Technical Reports Server (NTRS)

Kourtides, Demetrius A. (Inventor)

1995-01-01

A temperature sensor uses a type R thermocouple wire element in a ceramic sheath to sense temperatures up to 3,200 deg F., and is particularly suitable for flexible insulations. The sensor includes a thermocouple wire embedded in a sheath having two sections disposed at right angles to each other. The junction of the thermocouple is located at one end of one of the sections and the lead wires extend from the other section. The section which includes the junction is secured to a flexible surface with ceramic cement.

Theoretical study of piezo-phototronic nano-LEDs.

PubMed

Liu, Ying; Niu, Simiao; Yang, Qing; Klein, Benjamin D B; Zhou, Yu Sheng; Wang, Zhong Lin

2014-11-12

Two-dimensional finite-element simulation of the piezo-phototronic effect in p-n-junction-based devices is carried out for the first time. A charge channel can be induced at the p-n junction interface when strain is applied, given the n-side is a piezoelectric semiconductor and the p-type side is non-piezoelectric semiconductor. This provides the first simulated evidence supporting the previously suggested mechanism responsible for the experimentally observed gigantic change of light-emission efficiency in piezo-phototronic light-emitting devices. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A Versatile Transposon-Based Activation Tag Vector System for Functional Genomics in Cereals and Other Monocot Plants1[OA

PubMed Central

Qu, Shaohong; Desai, Aparna; Wing, Rod; Sundaresan, Venkatesan

2008-01-01

Transposon insertional mutagenesis is an effective alternative to T-DNA mutagenesis when transformation through tissue culture is inefficient as is the case for many crop species. When used as activation tags, transposons can be exploited to generate novel gain-of-function phenotypes without transformation and are of particular value in the study of polyploid plants where gene knockouts will not have phenotypes. We have developed an in cis-activation-tagging Ac-Ds transposon system in which a T-DNA vector carries a Dissociation (Ds) element containing 4× cauliflower mosaic virus enhancers along with the Activator (Ac) transposase gene. Stable Ds insertions were selected using green fluorescent protein and red fluorescent protein genes driven by promoters that are functional in maize (Zea mays) and rice (Oryza sativa). The system has been tested in rice, where 638 stable Ds insertions were selected from an initial set of 26 primary transformants. By analysis of 311 flanking sequences mapped to the rice genome, we could demonstrate the wide distribution of the elements over the rice chromosomes. Enhanced expression of rice genes adjacent to Ds insertions was detected in the insertion lines using semiquantitative reverse transcription-PCR method. The in cis-two-element vector system requires minimal number of primary transformants and eliminates the need for crossing, while the use of fluorescent markers instead of antibiotic or herbicide resistance increases the applicability to other plants and eliminates problems with escapes. Because Ac-Ds has been shown to transpose widely in the plant kingdom, the activation vector system developed in this study should be of utility more generally to other monocots. PMID:17993541

Multi-plug insole design to reduce peak plantar pressure on the diabetic foot during walking

PubMed Central

Actis, Ricardo L.; Ventura, Liliana B.; Lott, Donovan J.; Smith, Kirk E.; Commean, Paul K.; Hastings, Mary K.; Mueller, Michael J.

2009-01-01

There is evidence that appropriate footwear is an important factor in the prevention of foot pain in otherwise healthy people or foot ulcers in people with diabetes and peripheral neuropathy. A standard care for reducing forefoot plantar pressure is the utilization of orthotic devices such as total contact inserts (TCI) with therapeutic footwear. Most neuropathic ulcers occur under the metatarsal heads, and foot deformity combined with high localized plantar pressure, appear to be the most significant factors contributing to these ulcers. In this study, patient-specific finite element models of the second ray of the foot were developed to study the influence of TCI design on peak plantar pressure (PPP) under the metatarsal heads. A typical full contact insert was modified based on the results of finite element analyses, by inserting 4 mm diameter cylindrical plugs of softer material in the regions of high pressure. Validation of the numerical model was addressed by comparing the numerical results obtained by the finite element method with measured pressure distribution in the region of the metatarsal heads for a shoe and TCI condition. Two subjects, one with a history of forefoot pain and one with diabetes and peripheral neuropathy, were tested in the laboratory while wearing therapeutic shoes and customized inserts. The study showed that customized inserts with softer plugs distributed throughout the regions of high plantar pressure reduced the PPP over that of the TCI alone. This supports the outcome as predicted by the numerical model, without causing edge effects as reported by other investigators using different plug designs, and provides a greater degree of flexibility for customizing orthotic devices than current practice allows. PMID:18266017

Multi-plug insole design to reduce peak plantar pressure on the diabetic foot during walking.

PubMed

Actis, Ricardo L; Ventura, Liliana B; Lott, Donovan J; Smith, Kirk E; Commean, Paul K; Hastings, Mary K; Mueller, Michael J

2008-04-01

There is evidence that appropriate footwear is an important factor in the prevention of foot pain in otherwise healthy people or foot ulcers in people with diabetes and peripheral neuropathy. A standard care for reducing forefoot plantar pressure is the utilization of orthotic devices such as total contact inserts (TCI) with therapeutic footwear. Most neuropathic ulcers occur under the metatarsal heads, and foot deformity combined with high localized plantar pressure, appear to be the most significant factors contributing to these ulcers. In this study, patient-specific finite element models of the second ray of the foot were developed to study the influence of TCI design on peak plantar pressure (PPP) under the metatarsal heads. A typical full contact insert was modified based on the results of finite element analyses, by inserting 4 mm diameter cylindrical plugs of softer material in the regions of high pressure. Validation of the numerical model was addressed by comparing the numerical results obtained by the finite element method with measured pressure distribution in the region of the metatarsal heads for a shoe and TCI condition. Two subjects, one with a history of forefoot pain and one with diabetes and peripheral neuropathy, were tested in the laboratory while wearing therapeutic shoes and customized inserts. The study showed that customized inserts with softer plugs distributed throughout the regions of high plantar pressure reduced the PPP over that of the TCI alone. This supports the outcome as predicted by the numerical model, without causing edge effects as reported by other investigators using different plug designs, and provides a greater degree of flexibility for customizing orthotic devices than current practice allows.

Analysis of the attainable efficiency of a direct-bandgap betavoltaic element

NASA Astrophysics Data System (ADS)

Sachenko, A. V.; Shkrebtii, A. I.; Korkishko, R. M.; Kostylyov, V. P.; Kulish, M. R.; Sokolovskyi, I. O.; Evstigneev, M.

2015-11-01

Conversion of energy of beta-particles into electric energy in a p-n junction based on direct-bandgap semiconductors, such as GaAs, is analyzed considering realistic semiconductor system parameters. An expression for the collection coefficient, Q, of the electron-hole pairs generated by beta-electrons is derived taking into account the existence of the dead layer. We show that the collection coefficient of beta-electrons emitted by a 3H-source to a GaAs p-n junction is close to 1 in a broad range of electron lifetimes in the junction, ranging from 10-9to 10-7 s. For the combination 147Pm/GaAs, Q is relatively large (≥slant 0.4) only for quite long lifetimes (about 10-7 s) and large thicknesses (about 100 μm) of GaAs p-n junctions. For realistic lifetimes of minority carriers and their diffusion coefficients, the open-circuit voltage realized due to the irradiation of a GaAs p-n junction by beta-particles is obtained. The attainable beta-conversion efficiency η in the case of a 3H/GaAs combination is found to exceed that of the 147Pm/GaAs combination.

Optimal slot dimension for skirt support structure of coke drums

NASA Astrophysics Data System (ADS)

Wang, Edward; Xia, Zihui

2018-03-01

The skirt-to-shell junction weld on coke drums is susceptible to fatigue failure due to severe thermal cyclic stresses. One method to decrease junction stress is to add slots near the top of the skirt, thereby reducing the local stiffness close to the weld. The most common skirt slot design is thin relative to its circumferential spacing. A new slot design, which is significantly wider, is proposed. In this study, thermal-mechanical elastoplastic 3-D finite element models of coke drums are created to analyze the effect of different skirt designs on the stress/strain field near the shell-to-skirt junction weld, as well as any other critical stress locations in the overall skirt design. The results confirm that the inclusion of the conventional slot design effectively reduces stress in the junction weld. However, it has also been found that the critical stress location migrates from the shell-to-skirt junction weld to the slot ends. A method is used to estimate the fatigue life near the critical areas of each skirt slot design. It is found that wider skirt slots provide a significant improvement on fatigue life in the weld and slot area.

Interlocked positive and negative feedback network motifs regulate β-catenin activity in the adherens junction pathway

PubMed Central

Klinke, David J.; Horvath, Nicholas; Cuppett, Vanessa; Wu, Yueting; Deng, Wentao; Kanj, Rania

2015-01-01

The integrity of epithelial tissue architecture is maintained through adherens junctions that are created through extracellular homotypic protein–protein interactions between cadherin molecules. Cadherins also provide an intracellular scaffold for the formation of a multiprotein complex that contains signaling proteins, including β-catenin. Environmental factors and controlled tissue reorganization disrupt adherens junctions by cleaving the extracellular binding domain and initiating a series of transcriptional events that aim to restore tissue homeostasis. However, it remains unclear how alterations in cell adhesion coordinate transcriptional events, including those mediated by β-catenin in this pathway. Here were used quantitative single-cell and population-level in vitro assays to quantify the endogenous pathway dynamics after the proteolytic disruption of the adherens junctions. Using prior knowledge of isolated elements of the overall network, we interpreted these data using in silico model-based inference to identify the topology of the regulatory network. Collectively the data suggest that the regulatory network contains interlocked network motifs consisting of a positive feedback loop, which is used to restore the integrity of adherens junctions, and a negative feedback loop, which is used to limit β-catenin–induced gene expression. PMID:26224311

Broadband attenuation of Lamb waves through a periodic array of thin rectangular junctions

NASA Astrophysics Data System (ADS)

Moiseyenko, Rayisa P.; Pennec, Yan; Marchal, Rémi; Bonello, Bernard; Djafari-Rouhani, Bahram

2014-10-01

We study theoretically subwavelength physical phenomena, such as resonant transmission and broadband sound shielding for Lamb waves propagating in an acoustic metamaterial made of a thin plate drilled with one or two row(s) of rectangular holes. The resonances and antiresonances of periodically arranged rectangular junctions separated by holes are investigated as a function of the geometrical parameters of the junctions. With one and two row(s) of holes, high frequency specific features in the transmission coefficient are explained in terms of a coupling of incident waves with both Fabry-Perot oscillations inside the junctions and induced surface acoustic waves between the homogeneous part of the plate and the row of holes. With two rows of holes, low frequency peaks and dips appear in the transmission spectrum. The choice of the distance between the two rows of holes allows the realization of a broadband low frequency acoustic shielding with attenuation over 99% for symmetric waves in a wide low frequency range and over 90% for antisymmetric ones. The origin of the transmission gap is discussed in terms of localized modes of the "H" element made by the junctions, connecting the two homogeneous parts of the plate.

Updates to Simulation of a Single-Element Lean-Direct Injection Combustor Using a Polyhedral Mesh Derived From Hanging-Node Elements

NASA Technical Reports Server (NTRS)

Wey, Changju Thomas; Liu, Nan-Suey

2014-01-01

This paper summarizes the procedures of inserting a thin-layer mesh to existing inviscid polyhedral mesh either with or without hanging-node elements as well as presents sample results from its applications to the numerical solution of a single-element LDI combustor using a releasable edition of the National Combustion Code (NCC).

Updates to Simulation of a Single-Element Lean-Direct Injection Combustor Using a Polyhedral Mesh Derived from Hanging-Node Elements

NASA Technical Reports Server (NTRS)

Wey, Thomas; Liu, Nan-Suey

2014-01-01

This paper summarizes the procedures of inserting a thin-layer mesh to existing inviscid polyhedral mesh either with or without hanging-node elements as well as presents sample results from its applications to the numerical solution of a single-element LDI combustor using a releasable edition of the National Combustion Code (NCC).

A mobile threat to genome stability: The impact of non-LTR retrotransposons upon the human genome.

PubMed

Konkel, Miriam K; Batzer, Mark A

2010-08-01

It is now commonly agreed that the human genome is not the stable entity originally presumed. Deletions, duplications, inversions, and insertions are common, and contribute significantly to genomic structural variations (SVs). Their collective impact generates much of the inter-individual genomic diversity observed among humans. Not only do these variations change the structure of the genome; they may also have functional implications, e.g. altered gene expression. Some SVs have been identified as the cause of genetic disorders, including cancer predisposition. Cancer cells are notorious for their genomic instability, and often show genomic rearrangements at the microscopic and submicroscopic level to which transposable elements (TEs) contribute. Here, we review the role of TEs in genome instability, with particular focus on non-LTR retrotransposons. Currently, three non-LTR retrotransposon families - long interspersed element 1 (L1), SVA (short interspersed element (SINE-R), variable number of tandem repeats (VNTR), and Alu), and Alu (a SINE) elements - mobilize in the human genome, and cause genomic instability through both insertion- and post-insertion-based mutagenesis. Due to the abundance and high sequence identity of TEs, they frequently mislead the homologous recombination repair pathway into non-allelic homologous recombination, causing deletions, duplications, and inversions. While less comprehensively studied, non-LTR retrotransposon insertions and TE-mediated rearrangements are probably more common in cancer cells than in healthy tissue. This may be at least partially attributed to the commonly seen global hypomethylation as well as general epigenetic dysfunction of cancer cells. Where possible, we provide examples that impact cancer predisposition and/or development. Copyright © 2010 Elsevier Ltd. All rights reserved.

Transposable elements are enriched within or in close proximity to xenobiotic-metabolizing cytochrome P450 genes

PubMed Central

Chen, Song; Li, Xianchun

2007-01-01

Background Transposons, i.e. transposable elements (TEs), are the major internal spontaneous mutation agents for the variability of eukaryotic genomes. To address the general issue of whether transposons mediate genomic changes in environment-adaptation genes, we scanned two alleles per each of the six xenobiotic-metabolizing Helicoverpa zea cytochrome P450 loci, including CYP6B8, CYP6B27, CYP321A1, CYP321A2, CYP9A12v3 and CYP9A14, for the presence of transposon insertions by genome walking and sequence analysis. We also scanned thirteen Drosophila melanogaster P450s genes for TE insertions by in silico mapping and literature search. Results Twelve novel transposons, including LINEs (long interspersed nuclear elements), SINEs (short interspersed nuclear elements), MITEs (miniature inverted-repeat transposable elements), one full-length transib-like transposon, and one full-length Tcl-like DNA transpson, are identified from the alleles of the six H. zea P450 genes. The twelve transposons are inserted into the 5'flanking region, 3'flanking region, exon, or intron of the six environment-adaptation P450 genes. In D. melanogaster, seven out of the eight Drosophila P450s (CYP4E2, CYP6A2, CYP6A8, CYP6A9, CYP6G1, CYP6W1, CYP12A4, CYP12D1) implicated in insecticide resistance are associated with a variety of transposons. By contrast, all the five Drosophila P450s (CYP302A1, CYP306A1, CYP307A1, CYP314A1 and CYP315A1) involved in ecdysone biosynthesis and developmental regulation are free of TE insertions. Conclusion These results indicate that TEs are selectively retained within or in close proximity to xenobiotic-metabolizing P450 genes. PMID:17381843

Thermoelectric module

DOEpatents

Kortier, William E.; Mueller, John J.; Eggers, Philip E.

1980-07-08

A thermoelectric module containing lead telluride as the thermoelectric mrial is encapsulated as tightly as possible in a stainless steel canister to provide minimum void volume in the canister. The lead telluride thermoelectric elements are pressure-contacted to a tungsten hot strap and metallurgically bonded at the cold junction to iron shoes with a barrier layer of tin telluride between the iron shoe and the p-type lead telluride element.

Two different types of double-strand breaks in Saccharomyces cerevisiae are repaired by similar RAD52-independent, nonhomologous recombination events.

PubMed Central

Kramer, K M; Brock, J A; Bloom, K; Moore, J K; Haber, J E

1994-01-01

In haploid rad52 Saccharomyces cerevisiae strains unable to undergo homologous recombination, a chromosomal double-strand break (DSB) can be repaired by imprecise rejoining of the broken chromosome ends. We have used two different strategies to generate broken chromosomes: (i) a site-specific DSB generated at the MAT locus by HO endonuclease cutting or (ii) a random DSB generated by mechanical rupture during mitotic segregation of a conditionally dicentric chromosome. Broken chromosomes were repaired by deletions that were highly variable in size, all of which removed more sequences than was required either to prevent subsequent HO cleavage or to eliminate a functional centromere, respectively. The junction of the deletions frequently occurred where complementary strands from the flanking DNA could anneal to form 1 to 5 bp, although 12% (4 of 34) of the events appear to have occurred by blunt-end ligation. These types of deletions are very similar to the junctions observed in the repair of DSBs by mammalian cells (D. B. Roth and J. H. Wilson, Mol. Cell. Biol. 6:4295-4304, 1986). When a high level of HO endonuclease, expressed in all phases of the cell cycle, was used to create DSBs, we also recovered a large class of very small (2- or 3-bp) insertions in the HO cleavage site. These insertions appear to represent still another mechanism of DSB repair, apparently by annealing and filling in the overhanging 3' ends of the cleavage site. These types of events have also been well documented for vertebrate cells. PMID:8289808

[Palisade endings of extraocular muscles in eyes with congenital nystagmus].

PubMed

Shang, Yan-feng; Zhang, Jing; Gong, Hua-qing; Chen, Xia

2012-09-01

To evaluate the morphology, distribution and function of palisade endings (PE) in human extraocular muscles (EOM), and observe the alterations in eyes with congenital nystagmus (CN). The etiology and pathogenesis of CN were also investigated. It was a experimental study. The distal myotendinous junctions of the EOM were obtained during operation for CN (CN group) and concomitant strabismus (control group). The samples from patients with similar age and same extraction sites in the two groups were compared. The muscles cut during operation were immediately put into 4% glutaraldehyde fixative solution. And 1-2 transverse bands of tissue were cut every 1 mm from tendon insertion for specimens processing. The ultrastructure of EOM and PE in the two groups was observed by transmission electron microscopy. The distal parts of EOM cut during operation were put into 4% paraformaldehyde promptly. Myotendinous junction region whole mounts were labeled with antibodies against choline acetyltransferase (ChAT). Muscle fibers were counterstained with phalloidin. And longitudinal and transverse cryostat serial sections were cut at 25 µm and analyzed by confocal laser scanning microscopy. The ChAT expression, morphology and distribution of PE were observed. The same fragment of myotendinous junction in the two groups was selected. After the total protein was extracted, ChAT was detected by western blot. The expression level of ChAT was analyzed. Compared with the controls, the ultrastructure in the CN group had considerable variations. The axon of PE was swelled and deformed partly. The electron density was increased and presented as addicted to osmic acid. In the muscle cells, mitochondria was swelled, and sarcoplasmic reticulum was dilated. All PE exhibited ChAT immunoreactivity in human EOM. In the longitudinal section, nerve fibers extended from the muscle into the tendon, looped back and divided into several terminal arborizations (palisade endings) around the muscle fiber tip. The PE of medial rectus were richest at the location 3 - 4 mm from tendon insertion. In the cross section, the amount of PE in the CN group was higher than the control group (t = -5.613, P < 0.05). The expression level of ChAT in the CN group was higher than the control group (t = -3.730, P < 0.05). Palisade endings in myotendinous junction of human EOM are cholinergic nerves, which might innervate the contraction of EOM. Significant changes of palisade endings in the EOM of the CN subjects may affect eye movement.

Hexahedral finite element mesh coarsening using pillowing technique

DOEpatents

Staten, Matthew L [Pittsburgh, PA; Woodbury, Adam C [Provo, UT; Benzley, Steven E [Provo, UT; Shepherd, Jason F [Edgewood, NM

2012-06-05

A techniques for coarsening a hexahedral mesh is described. The technique includes identifying a coarsening region within a hexahedral mesh to be coarsened. A boundary sheet of hexahedral elements is inserted into the hexahedral mesh around the coarsening region. A column of hexahedral elements is identified within the boundary sheet. The column of hexahedral elements is collapsed to create an extraction sheet of hexahedral elements contained within the coarsening region. Then, the extraction sheet of hexahedral elements is extracted to coarsen the hexahedral mesh.

Global-Local Finite Element Analysis for Thermo-Mechanical Stresses in Bonded Joints

NASA Technical Reports Server (NTRS)

Shkarayev, S.; Madenci, Erdogan; Camarda, C. J.

1997-01-01

An analysis of adhesively bonded joints using conventional finite elements does not capture the singular behavior of the stress field in regions where two or three dissimilar materials form a junction with or without free edges. However, these regions are characteristic of the bonded joints and are prone to failure initiation. This study presents a method to capture the singular stress field arising from the geometric and material discontinuities in bonded composites. It is achieved by coupling the local (conventional) elements with global (special) elements whose interpolation functions are constructed from the asymptotic solution.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nehm, F., E-mail: frederik.nehm@iapp.de; Müller-Meskamp, L.; Klumbies, H.

A major failure mechanism is identified in electrical calcium corrosion tests for quality assessment of high-end application moisture barriers. Accelerated calcium corrosion is found at the calcium/electrode junction, leading to an electrical bottleneck. This causes test failure not related to overall calcium loss. The likely cause is a difference in electrochemical potential between the aluminum electrodes and the calcium sensor, resulting in a corrosion element. As a solution, a thin, full-area copper layer is introduced below the calcium, shifting the corrosion element to the calcium/copper junction and inhibiting bottleneck degradation. Using the copper layer improves the level of sensitivity formore » the water vapor transmission rate (WVTR) by over one order of magnitude. Thin-film encapsulated samples with 20 nm of atomic layer deposited alumina barriers this way exhibit WVTRs of 6 × 10{sup −5} g(H{sub 2}O)/m{sup 2}/d at 38 °C, 90% relative humidity.« less

Highly efficient on-chip direct electronic-plasmonic transducers

NASA Astrophysics Data System (ADS)

Du, Wei; Wang, Tao; Chu, Hong-Son; Nijhuis, Christian A.

2017-10-01

Photonic elements can carry information with a capacity exceeding 1,000 times that of electronic components, but, due to the optical diffraction limit, these elements are large and difficult to integrate with modern-day nanoelectronics or upcoming packages, such as three-dimensional integrated circuits or stacked high-bandwidth memories1-3. Surface plasmon polaritons can be confined to subwavelength dimensions and can carry information at high speeds (>100 THz)4-6. To combine the small dimensions of nanoelectronics with the fast operating speed of optics via plasmonics, on-chip electronic-plasmonic transducers that directly convert electrical signals into plasmonic signals (and vice versa) are required. Here, we report electronic-plasmonic transducers based on metal-insulator-metal tunnel junctions coupled to plasmonic waveguides with high-efficiency on-chip generation, manipulation and readout of plasmons. These junctions can be readily integrated into existing technologies, and we thus believe that they are promising for applications in on-chip integrated plasmonic circuits.

Semiconductor laser insert with uniform illumination for use in photodynamic therapy

NASA Astrophysics Data System (ADS)

Charamisinau, Ivan; Happawana, Gemunu; Evans, Gary; Rosen, Arye; Hsi, Richard A.; Bour, David

2005-08-01

A low-cost semiconductor red laser light delivery system for esophagus cancer treatment is presented. The system is small enough for insertion into the patient's body. Scattering elements with nanoscale particles are used to achieve uniform illumination. The scattering element optimization calculations, with Mie theory, provide scattering and absorption efficiency factors for scattering particles composed of various materials. The possibility of using randomly deformed spheres and composite particles instead of perfect spheres is analyzed using an extension to Mie theory. The measured radiation pattern from a prototype light delivery system fabricated using these design criteria shows reasonable agreement with the theoretically predicted pattern.

On the development of an intrinsic hybrid composite

NASA Astrophysics Data System (ADS)

Kießling, R.; Ihlemann, J.; Riemer, M.; Drossel, W.-G.; Scharf, I.; Lampke, T.; Sharafiev, S.; Pouya, M.; F-X Wagner, M.

2016-03-01

Hybrid parts, which combine low weight with high strength, are moving into the focus of the automotive industry, due to their high potential for usage in the field of crash-relevant structures. In this contribution, the development of an intrinsic hybrid composite is presented, with a focus on the manufacturing process, complex simulations of the material behaviour and material testing. The hybrid composite is made up of a continuous fibre- reinforced plastic (FRP), in which a metallic insert is integrated. The mechanical behaviour of the individual components is characterised. For material modelling, an approach is pointed out that enables modelling at large strains by directly connected rheological elements. The connection between the FRP and the metallic insert is realised by a combination of form fit and adhesive bonds. On the one hand, adhesive bonds are generated within a sol gel process. On the other hand, local form elements of the metallic insert are pressed into the FRP. We show how these form elements are generated during the macroscopic forming process. In addition, the applied sol gel process is explained. Finally, we consider design concepts for a specimen type for high strain testing of the resulting interfaces.

A Forward Genetic Screening for Prostate Cancer Progression Genes

DTIC Science & Technology

2012-10-01

sequence  reads. For verifying  the  prevalence of insertions in tumors, PCR was  performed on  genomic  DNA corresponding to 15 insertional mutations using...and has been utilized with great effect in many organisms, from the bacterium to the fruit fly Drosophila melanogaster [1,2]. The Sleeping Beauty (SB...TX SL JC TN. References 1. Cooley L, Kelley R, Spradling A (1988) Insertional mutagenesis of the Drosophila genome with single P elements. Science

LINE dancing in the human genome: transposable elements and disease.

PubMed

Belancio, Victoria P; Deininger, Prescott L; Roy-Engel, Astrid M

2009-10-27

Transposable elements (TEs) have been consistently underestimated in their contribution to genetic instability and human disease. TEs can cause human disease by creating insertional mutations in genes, and also contributing to genetic instability through non-allelic homologous recombination and introduction of sequences that evolve into various cis-acting signals that alter gene expression. Other outcomes of TE activity, such as their potential to cause DNA double-strand breaks or to modulate the epigenetic state of chromosomes, are less fully characterized. The currently active human transposable elements are members of the non-LTR retroelement families, LINE-1, Alu (SINE), and SVA. The impact of germline insertional mutagenesis by TEs is well established, whereas the rate of post-insertional TE-mediated germline mutations and all forms of somatic mutations remain less well quantified. The number of human diseases discovered to be associated with non-allelic homologous recombination between TEs, and particularly between Alu elements, is growing at an unprecedented rate. Improvement in the technology for detection of such events, as well as the mounting interest in the research and medical communities in resolving the underlying causes of the human diseases with unknown etiology, explain this increase. Here, we focus on the most recent advances in understanding of the impact of the active human TEs on the stability of the human genome and its relevance to human disease.

The distribution of a phage-related insertion sequence element in the cyanobacterium, Microcystis aeruginosa.

PubMed

Kuno, Sotaro; Yoshida, Takashi; Kamikawa, Ryoma; Hosoda, Naohiko; Sako, Yoshihiko

2010-01-01

The cyanophage Ma-LMM01, specifically-infecting Microcystis aeruginosa, has an insertion sequence (IS) element that we named IS607-cp showing high nucleotide similarity to a counterpart in the genome of the cyanobacterium Cyanothece sp. We tested 21 strains of M. aeruginosa for the presence of IS607-cp using PCR and detected the element in strains NIES90, NIES112, NIES604, and RM6. Thermal asymmetric interlaced PCR (TAIL-PCR) revealed each of these strains has multiple copies of IS607-cp. Some of the ISs were classified into three types based on their inserted positions; IS607-cp-1 is common in strains NIES90, NIES112 and NIES604, whereas IS607-cp-2 and IS607-cp-3 are specific to strains NIES90 and RM6, respectively. This multiplicity may reflect the replicative transposition of IS607-cp. The sequence of IS607-cp in Ma-LMM01 showed robust affinity to those found in M. aeruginosa and Cyanothece spp. in a phylogenetic tree inferred from counterparts of various bacteria. This suggests the transfer of IS607-cp between the cyanobacterium and its cyanophage. We discuss the potential role of Ma-LMM01-related phages as donors of IS elements that may mediate the transfer of IS607-cp; and thereby partially contribute to the genome plasticity of M. aeruginosa.

Dead Element Replicating: Degenerate R2 Element Replication and rDNA Genomic Turnover in the Bacillus rossius Stick Insect (Insecta: Phasmida)

PubMed Central

Martoni, Francesco; Eickbush, Danna G.; Scavariello, Claudia; Luchetti, Andrea; Mantovani, Barbara

2015-01-01

R2 is an extensively investigated non-LTR retrotransposon that specifically inserts into the 28S rRNA gene sequences of a wide range of metazoans, disrupting its functionality. During R2 integration, first strand synthesis can be incomplete so that 5’ end deleted copies are occasionally inserted. While active R2 copies repopulate the locus by retrotransposing, the non-functional truncated elements should frequently be eliminated by molecular drive processes leading to the concerted evolution of the rDNA array(s). Although, multiple R2 lineages have been discovered in the genome of many animals, the rDNA of the stick insect Bacillus rossius exhibits a peculiar situation: it harbors both a canonical, functional R2 element (R2Brfun) as well as a full-length but degenerate element (R2Brdeg). An intensive sequencing survey in the present study reveals that all truncated variants in stick insects are present in multiple copies suggesting they were duplicated by unequal recombination. Sequencing results also demonstrate that all R2Brdeg copies are full-length, i. e. they have no associated 5' end deletions, and functional assays indicate they have lost the active ribozyme necessary for R2 RNA maturation. Although it cannot be completely ruled out, it seems unlikely that the degenerate elements replicate via reverse transcription, exploiting the R2Brfun element enzymatic machinery, but rather via genomic amplification of inserted 28S by unequal recombination. That inactive copies (both R2Brdeg or 5'-truncated elements) are not eliminated in a short term in stick insects contrasts with findings for the Drosophila R2, suggesting a widely different management of rDNA loci and a lower efficiency of the molecular drive while achieving the concerted evolution. PMID:25799008

In vitro study of stem cell communication via gap junctions for fibrocartilage regeneration at entheses.

PubMed

Nayak, Bibhukalyan Prasad; Goh, James Cho Hong; Toh, Siew Lok; Satpathy, Gyan Ranjan

2010-03-01

Entheses are fibrocartilaginous organs that bridge ligament with bone at their interface and add significant insertional strength. To replace a severely damaged ligament, a tissue-engineered graft preinstalled with interfacial fibrocartilage, which is being regenerated from stem cells, appears to be more promising than ligament-alone graft. Such a concept can be realized by a biomimetic approach of establishing a dynamic communication of stem cells with bone cells and/or ligament fibroblasts in vitro. The current study has two objectives. The first objective is to demonstrate functional coculture of bone marrow-derived stem cells (BMSCs) with mature bone cells/ligament fibroblasts as evidenced by gap-junctional communication in vitro. The second objective is to investigate the role of BMSCs in the regeneration of fibrocartilage within the coculture. Rabbit bone/ligament fibroblasts were dual-stained with DiI-Red and calcein (gap-junction permeable dye), and cocultured with unlabeled BMSCs at fixed ratio (1:10). The functional gap junction was demonstrated by the transfer of calcein from donor to recipient cells that was confirmed and quantified by flow cytometry. Type 2 collagen (cartilage extracellular matrix-specific protein) expressed by the mixed cell lines in the cocultures were estimated by real-time reverse transcription PCR and compared with that of the ligament-bone coculture (control). Significant transfer of calcein into BMSCs was observed and flow cytometry analyses showed a gradual increase in the percentage of BMSCs acquiring calcein with time. Cocultures that included BMSCs expressed significantly more type 2 collagen compared with the control. The current study, for the first time, reported the expression of gap-junctional communication of BMSCs with two adherent cell lines of musculoskeletal system in vitro and also confirmed that incorporation of stem cells augments fibrocartilage regeneration. The results open up a path to envisage a composite graft preinstalled with enthesial fibrocartilage using a stem cell-based coculture system.

Using an optimization approach to design an insole for lowering plantar fascia stress--a finite element study.

PubMed

Hsu, Yu-Chun; Gung, Yih-Wen; Shih, Shih-Liang; Feng, Chi-Kuang; Wei, Shun-Hwa; Yu, Chung-Huang; Chen, Chen-Sheng

2008-08-01

Plantar heel pain is a commonly encountered orthopedic problem and is most often caused by plantar fasciitis. In recent years, different shapes of insole have been used to treat plantar fasciitis. However, little research has been focused on the junction stress between the plantar fascia and the calcaneus when wearing different shapes of insole. Therefore, this study aimed to employ a finite element (FE) method to investigate the relationship between different shapes of insole and the junction stress, and accordingly design an optimal insole to lower fascia stress.A detailed 3D foot FE model was created using ANSYS 9.0 software. The FE model calculation was compared to the Pedar device measurements to validate the FE model. After the FE model validation, this study conducted parametric analysis of six different insoles and used optimization analysis to determine the optimal insole which minimized the junction stress between plantar fascia and calcaneus. This FE analysis found that the plantar fascia stress and peak pressure when using the optimal insole were lower by 14% and 38.9%, respectively, than those when using the flat insole. In addition, the stress variation in plantar fascia was associated with the different shapes of insole.

A Low-noise Micromachined Millimeter-Wave Heterodyne Mixer using Nb Superconducting Tunnel Junctions

NASA Technical Reports Server (NTRS)

DeLange, Gert; Jacobson, Brian R.; Hu, Qing

1996-01-01

A heterodyne mixer with a micromachined horn antenna and a superconductor-insulator-superconductor (SIS) tunnel junction as mixing element is tested in the W-band (75-115 GHz) frequency range. Micromachined integrated horn antennas consist of a dipole antenna suspended on a thin Si3N4 dielectric membrane inside a pyramidal cavity etched in silicon. The mixer performance is optimized by using a backing plane behind the dipole antenna to tune out the capacitance of the tunnel junction. The lowest receiver noise temperature of 30 +/- 3 K (without any correction) is measured at 106 GHz with a 3-dB bandwidth of 8 GHz. This sensitivity is comparable to the state-of-the-art waveguide and quasi-optical SIS receivers, showing the potential use of micromachined horn antennas in imaging arrays.

Branchpoint expansion in a fully complementary three-way DNA junction.

PubMed

Sabir, Tara; Toulmin, Anita; Ma, Long; Jones, Anita C; McGlynn, Peter; Schröder, Gunnar F; Magennis, Steven W

2012-04-11

Branched nucleic acid molecules serve as key intermediates in DNA replication, recombination, and repair; architectural elements in RNA; and building blocks and functional components for nanoscience applications. Using a combination of high-resolution single-molecule FRET, time-resolved spectroscopy, and molecular modeling, we have probed the local and global structure of a DNA three-way junction (3WJ) in solution. We found that it adopts a Y-shaped, pyramidal structure, in which the bases adjacent to the branchpoint are unpaired, despite the full Watson-Crick complementarity of the molecule. The unpairing allows a nanoscale cavity to form at the junction center. Our structure accounts for earlier observations made of the structure, flexibility, and reactivity of 3WJs. We anticipate that these results will guide the development of new DNA-based supramolecular receptors and nanosystems. © 2012 American Chemical Society

High-Power X-Band Semiconductor RF Switch for Pulse Compression Systems of Future Colliders

NASA Astrophysics Data System (ADS)

Tantawi, Sami G.; Tamura, Fumihiko

2000-04-01

We describe the potential of semiconductor X-band RF switch arrays as a means of developing high power RF pulse compression systems for future linear colliders. The switch systems described here have two designs. Both designs consist of two 3dB hybrids and active modules. In the first design the module is composed of a cascaded active phase shifter. In the second design the module uses arrays of SPST (Single Pole Single Throw) switches. Each cascaded element of the phase shifter and the SPST switch has similar design. The active element consists of symmetrical three-port tee-junctions and an active waveguide window in the symmetrical arm of the tee-junction. The design methodology of the elements and the architecture of the whole switch system are presented. We describe the scaling law that governs the relation between power handling capability and number of elements. The design of the active waveguide window is presented. The waveguide window is a silicon wafer with an array of four hundred PIN/NIP diodes covering the surface of the window. This waveguide window is located in an over-moded TE01 circular waveguide. The results of high power RF measurements of the active waveguide window are presented. The experiment is performed at power levels of tens of megawatts at X-band.

CONSTRUCTION OF NUCLEAR FUEL ELEMENTS

DOEpatents

Weems, S.J.

1963-09-24

>A rib arrangement and an end construction for nuclearfuel elements laid end to end in a coolant tube are described. The rib arrangement is such that each fuel element, when separated from other fuel elements, fits loosely in the coolant tube and so can easily be inserted or withdrawn from the tube. The end construction of the fuel elements is such that the fuel elements when assembled end to end are keyed against relative rotation, and the ribs of each fuel element cooperate with the ribs of the adjacent fuel elements to give the assembled fuel elements a tight fit with the coolant tube. (AEC)

The mid-sternal length, a practical anatomical landmark for optimal positioning of long-term central venous catheters

PubMed Central

Salimi, Fereshte; Imani, Mohammad Reza; Ghasemi, Navab; Keshavarzian, Amir; Jazi, Amir Hosein Davarpanah

2013-01-01

Background: Long-term tunneled catheters are used for the hemodialysis or chemotherapy in many patients. Proper placement of the catheter tip could reduce early and late catheter related complications. Aim of the present study was to evaluate a new formula for proper placement of tunneled hemodialysis or infusion port device by using an external anatomic landmark. Materials and Methods: A total of 64 adult patients undergoing elective placement of tunneled Central Venous Catheter (CVC) requiring hemodialysis or chemotherapy were enrolled in this prospective study during 2011-2012 in the university hospital. The catheter length to be inserted in the right internal jugular vein (IJV) was calculated by adding two measurements (the shortest straight length between the insertion point of the needle and the suprasternal notch plus and half of sternal length). The catheter position was considered correct if the tip was positioned in the right atrium (RA) or Superior vena cava (SVC)-RA junction. Results: The patients were 55.28 ± 19.85 years of age, weighed 5.78 ± 16.62 kg and were 166.07 ± 10.27 cm tall. Catheters were inserted successfully in 88% of patients (n = 56). Catheter tip positions in the failures were SVC (n = 5), tricuspid valve (n = 2), and right ventricle (n = 1) in our patients. Conclusion: Long-term hemodialysis or port CVC could easily insert in the right IJV by using half of the sternal length as an external land marks among adult patients. PMID:24174941

METHOD FOR MAKING FUEL ELEMENTS

DOEpatents

Kates, L.W.; Campbell, R.W.; Heartel, R.H.W.

1960-08-01

A method is given for making zirconium-clad uranium wire. A tube of zirconium is closed with a zirconium plug, after which a chilled uranium core is inserted in the tube to rest against the plug. Additional plugs and cores are inserted alternately as desired. The assembly is then sheathed with iron, hot worked to the desired size, and the iron sheath removed.

Transposable elements and insecticide resistance.

PubMed

Rostant, Wayne G; Wedell, Nina; Hosken, David J

2012-01-01

Transposable elements (TEs) are mobile DNA sequences that are able to copy themselves within a host genome. They were initially characterized as selfish genes because of documented or presumed costs to host fitness, but it has become increasingly clear that not all TEs reduce host fitness. A good example of TEs benefiting hosts is seen with insecticide resistance, where in a number of cases, TE insertions near specific genes confer resistance to these man-made products. This is particularly true of Accord and associated TEs in Drosophila melanogaster and Doc insertions in Drosophila simulans. The first of these insertions also has sexually antagonistic fitness effects in the absence of insecticides, and although the magnitude of this effect depends on the genetic background in which Accord finds itself, this represents an excellent example of intralocus sexual conflict where the precise allele involved is well characterized. We discuss this finding and the role of TEs in insecticide resistance. We also highlight areas for further research, including the need for surveys of the prevalence and fitness consequences of the Doc insertion and how Drosophila can be used as models to investigate resistance in pest species. Copyright © 2012 Elsevier Inc. All rights reserved.

37. DETAIL OF CYANIDE LEACHING TANK DRAIN DOOR AND PIPING ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

37. DETAIL OF CYANIDE LEACHING TANK DRAIN DOOR AND PIPING SYSTEM. NOTE SPIGOT UNDER BOARD AT UPPER LEFT INSERTS INTO HOLE IN PIPE AT BOTTOM OF FRAME. CYANIDE SOLUTION WAS PUMPED INTO THE TANKS AND THE PREGNANT SOLUTION DRAINED OUT OF THE TANKS THROUGH THIS PIPE, AND BACK INTO A SEPARATE HOLDING TANK ON THE EAST SIDE OF THE MILL. TAILINGS WERE REMOVED FROM THE TANKS THROUGH THE ROUND DRAIN DOOR IN THE BOTTOM OF THE TANK (MISSING) SEEN AT TOP CENTER. - Skidoo Mine, Park Route 38 (Skidoo Road), Death Valley Junction, Inyo County, CA

Effects of Fe-Oxide and Mg Layer Insertion on Tunneling Magnetoresistance Properties of CoFeB/MgO/CoFeB Magnetic Tunnel Junctions

NASA Astrophysics Data System (ADS)

Lou, Yong-Le; Zhang, Yu-Ming; Guo, Hui; Xu, Da-Qing; Zhang, Yi-Men

2016-11-01

Not Available Supported by the National Defense Advance Research Foundation under Grant No 9140A08XXXXXX0DZ106, the Basic Research Program of Ministry of Education of China under Grant No JY10000925005, the Scientific Research Program Funded by Shaanxi Provincial Education Department under Grant No 11JK0912, the Scientific Research Foundation of Xi'an University of Science and Technology under Grant No 2010011, and the Doctoral Research Startup Fund of Xi'an University of Science and Technology under Grant No 2010QDJ029.

Gingival microleakage of class V composite restorations with fiber inserts.

PubMed

Ahmed, Walaa; El-Badrawy, Wafa; Kulkarni, Gajanan; Prakki, Anuradha; El-Mowafy, Omar

2013-07-01

This study investigated the effect of different fiber inserts (glass and polyethylene), bonding agents, and resin composites on the gingival margin microleakage of class V composite restorations. Sixty premolars were sterilized and mounted in acrylic resin bases. Class V cavities were prepared buccally and lingually, 1 mm below the cementoenamel junction, comprising 12 groups (n = 10). In the experimental groups fiber inserts were cut and placed at the gingival seat, while the control groups had no inserts. Combinations of two composite materials, Filtek-Z250 and Filtek-LS (3M-ESPE), and four bonding agents, Clearfil SE bond (Kuraray) (C), Scotch Bond Multipurpose (3M-ESPE) (SB), Prime and Bond NT (Dentsply) (PB), and Filtek-LS (3M-ESPE) (LS) were used. Restorations were incrementally inserted and polymerized for 40s. Specimens were then stored in distilled water for 7 days and thermocycled for 500 cycles. Teeth surfaces were sealed with nail polish except for 1 mm around restoration margins and immersed in 2% red procion dye. Teeth were then sectioned buccolingually and dye penetration was assessed with five-point scale. Data were statistically-analyzed by Kruskal-Wallis, ANOVA and Tukey's tests (α = 5%). Mean microleakage scores varied from 0.40 (Groups C, C with polyethylene, LS, LS with polyethylene) to 1.50 (SB). Different bonding agents led to differences in microleakage scores where C and LS showed significantly lower microleakage than PB. SB had highest mean microleakage score, however, incorporation of fibers resulted in significant reduction in microleakage. Class V resin composite restorations bonded with a total-etch adhesive had a significant reduction in mean microleakage scores when glass or polyethylene fibers were placed at the gingival cavo-surface margin. In contrast, for two self-etch adhesive systems, the incorporation of fibers had no significant effect on mean microleakage scores.

Modified C1 lateral mass screw insertion using a high entry point to avoid postoperative occipital neuralgia.

PubMed

Lee, Sun-Ho; Kim, Eun-Sang; Eoh, Whan

2013-01-01

For the past decade, a screw-rod construct has been used commonly to stabilize the atlantoaxial joint, but the insertion of the screw through the C1 lateral mass (LM) can cause several complications. We evaluated whether using a higher screw entry point for C1 lateral mass (LM) fixation than in the standard procedure could prevent screw-induced occipital neuralgia. We enrolled 12 consecutive patients who underwent bilateral C1 LM fixation, with the modified screw insertion point at the junction of the C1 posterior arch and the midpoint of the posterior inferior portion of the C1 LM. We measured postoperative clinical and radiological parameters and recorded intraoperative complications, postoperative neurological deficits and the occurrence of occipital neuralgia. Postoperative plain radiographs were used to check for malpositioning of the screw or failure of the construct. Four patients underwent atlantoaxial stabilization for a transverse ligament injury or a C1 or C2 fracture, six patients for os odontoideum, and two patients for C2 metastasis. No patient experienced vertebral artery injury or cerebrospinal fluid leak, and all had minimal blood loss. No patient suffered significant occipital neuralgia, although one patient developed mild, transient unilateral neuralgia. There was also no radiographic evidence of construct failure. Twenty screws were positioned correctly through the intended entry points, but three screws were placed inferiorly (that is, below the arch), and one screw was inserted too medially. When performing C1-C2 fixation using the standard (Harms) construct, surgeons should be aware of the possible development of occipital neuralgia. A higher entry point may prevent this complication; therefore, we recommend that the screw should be inserted into the arch of C1 if it can be accommodated. Copyright © 2012 Elsevier Ltd. All rights reserved.

Transient bradycardia induced by thiopentone sodium: a unique challenge in the management of refractory status epilepticus

PubMed Central

Sharma, Sushma; Nair, Pradeep P; Murgai, Aditya; Selvaraj, Raja J

2013-01-01

Thiopentone sodium is one of the important drugs in the armamentarium for terminating refractory status epilepticus, a neurological emergency. We report a case of thiopentone-related bradycardia during the management of the new onset refractory status epilepticus in a young man, which was circumvented by prophylactic insertion of temporary pacemaker while thiopentone infusion was continued. A systematic approach was employed to manage the status epilepticus, including infusion of thiamine and glucose followed by antiepileptic drugs. The patient was ventilated and infused with lorazepam, phenytoin, sodium valproate, levetiracetam and midazolam followed by thiopentone sodium. With the introduction of thiopentone the seizures could be controlled but the patient developed severe bradycardia and junctional rhythm. The bradycardia disappeared when thiopentone was withdrawn and reappeared when the drug was reintroduced. Propofol infusion was tried with no respite in seizures. Later thiopentone sodium was reintroduced after inserting temporary cardiac pacemaker. Seizure was controlled and patient was weaned off the ventilator. PMID:24130206

Transient bradycardia induced by thiopentone sodium: a unique challenge in the management of refractory status epilepticus.

PubMed

Sharma, Sushma; Nair, Pradeep P; Murgai, Aditya; Selvaraj, Raja J

2013-10-15

Thiopentone sodium is one of the important drugs in the armamentarium for terminating refractory status epilepticus, a neurological emergency. We report a case of thiopentone-related bradycardia during the management of the new onset refractory status epilepticus in a young man, which was circumvented by prophylactic insertion of temporary pacemaker while thiopentone infusion was continued. A systematic approach was employed to manage the status epilepticus, including infusion of thiamine and glucose followed by antiepileptic drugs. The patient was ventilated and infused with lorazepam, phenytoin, sodium valproate, levetiracetam and midazolam followed by thiopentone sodium. With the introduction of thiopentone the seizures could be controlled but the patient developed severe bradycardia and junctional rhythm. The bradycardia disappeared when thiopentone was withdrawn and reappeared when the drug was reintroduced. Propofol infusion was tried with no respite in seizures. Later thiopentone sodium was reintroduced after inserting temporary cardiac pacemaker. Seizure was controlled and patient was weaned off the ventilator.

Graphene/h-BN/GaAs sandwich diode as solar cell and photodetector.

PubMed

Li, Xiaoqiang; Lin, Shisheng; Lin, Xing; Xu, Zhijuan; Wang, Peng; Zhang, Shengjiao; Zhong, Huikai; Xu, Wenli; Wu, Zhiqian; Fang, Wei

2016-01-11

In graphene/semiconductor heterojunction, the statistic charge transfer between graphene and semiconductor leads to decreased junction barrier height and limits the Fermi level tuning effect in graphene, which greatly affects the final performance of the device. In this work, we have designed a sandwich diode for solar cells and photodetectors through inserting 2D hexagonal boron nitride (h-BN) into graphene/GaAs heterostructure to suppress the static charge transfer. The barrier height of graphene/GaAs heterojunction can be increased from 0.88 eV to 1.02 eV by inserting h-BN. Based on the enhanced Fermi level tuning effect with interface h-BN, through adopting photo-induced doping into the device, power conversion efficiency (PCE) of 10.18% has been achieved for graphene/h-BN/GaAs compared with 8.63% of graphene/GaAs structure. The performance of graphene/h-BN/GaAs based photodetector is also improved with on/off ratio increased by one magnitude compared with graphene/GaAs structure.

ISEScan: automated identification of insertion sequence elements in prokaryotic genomes.

PubMed

Xie, Zhiqun; Tang, Haixu

2017-11-01

The insertion sequence (IS) elements are the smallest but most abundant autonomous transposable elements in prokaryotic genomes, which play a key role in prokaryotic genome organization and evolution. With the fast growing genomic data, it is becoming increasingly critical for biology researchers to be able to accurately and automatically annotate ISs in prokaryotic genome sequences. The available automatic IS annotation systems are either providing only incomplete IS annotation or relying on the availability of existing genome annotations. Here, we present a new IS elements annotation pipeline to address these issues. ISEScan is a highly sensitive software pipeline based on profile hidden Markov models constructed from manually curated IS elements. ISEScan performs better than existing IS annotation systems when tested on prokaryotic genomes with curated annotations of IS elements. Applying it to 2784 prokaryotic genomes, we report the global distribution of IS families across taxonomic clades in Archaea and Bacteria. ISEScan is implemented in Python and released as an open source software at https://github.com/xiezhq/ISEScan. hatang@indiana.edu. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Testing of dual-junction SCARLET modules and cells plus lessons learned

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eskenazi, M.I.; Murphy, D.M.; Ralph, E.L.

1997-12-31

Key simulator test methods and results for Solar Concentrator Array with Refractive Linear Element Technology (SCARLET) cells, modules, and module strings are presented from the NASA/JPL New Millennium DS1 program. Important observations and lessons learned are discussed. These findings include: (1) a significant efficiency increase for shunted low performing 1 sun cells at SCARLET`s {approximately}7 sun concentration, (2) a decrease in temperature coefficient under SCARLET concentration, and (3) the importance of active germanium (third junction) screening during GaInP{sub 2}/GaAs/Ge cell production especially when red reflecting covers are used.

Neuronal Target Identification Requires AHA-1-Mediated Fine-Tuning of Wnt Signaling in C. elegans

PubMed Central

Zhang, Jingyan; Li, Xia; Jevince, Angela R.; Guan, Liying; Wang, Jiaming; Hall, David H.; Huang, Xun; Ding, Mei

2013-01-01

Electrical synaptic transmission through gap junctions is a vital mode of intercellular communication in the nervous system. The mechanism by which reciprocal target cells find each other during the formation of gap junctions, however, is poorly understood. Here we show that gap junctions are formed between BDU interneurons and PLM mechanoreceptors in C. elegans and the connectivity of BDU with PLM is influenced by Wnt signaling. We further identified two PAS-bHLH family transcription factors, AHA-1 and AHR-1, which function cell-autonomously within BDU and PLM to facilitate the target identification process. aha-1 and ahr-1 act genetically upstream of cam-1. CAM-1, a membrane-bound receptor tyrosine kinase, is present on both BDU and PLM cells and likely serves as a Wnt antagonist. By binding to a cis-regulatory element in the cam-1 promoter, AHA-1 enhances cam-1 transcription. Our study reveals a Wnt-dependent fine-tuning mechanism that is crucial for mutual target cell identification during the formation of gap junction connections. PMID:23825972

Direct determination of minority carrier diffusion lengths at axial GaAs nanowire p-n junctions.

PubMed

Gutsche, Christoph; Niepelt, Raphael; Gnauck, Martin; Lysov, Andrey; Prost, Werner; Ronning, Carsten; Tegude, Franz-Josef

2012-03-14

Axial GaAs nanowire p-n diodes, possibly one of the core elements of future nanowire solar cells and light emitters, were grown via the Au-assisted vapor-liquid-solid mode, contacted by electron beam lithography, and investigated using electron beam induced current measurements. The minority carrier diffusion lengths and dynamics of both, electrons and holes, were determined directly at the vicinity of the p-n junction. The generated photocurrent shows an exponential decay on both sides of the junction and the extracted diffusion lengths are about 1 order of magnitude lower compared to bulk material due to surface recombination. Moreover, the observed strong diameter-dependence is well in line with the surface-to-volume ratio of semiconductor nanowires. Estimating the surface recombination velocities clearly indicates a nonabrupt p-n junction, which is in essential agreement with the model of delayed dopant incorporation in the Au-assisted vapor-liquid-solid mechanism. Surface passivation using ammonium sulfide effectively reduces the surface recombination and thus leads to higher minority carrier diffusion lengths. © 2012 American Chemical Society

A Developmental Framework for Complex Plasmodesmata Formation Revealed by Large-Scale Imaging of the Arabidopsis Leaf Epidermis[W

PubMed Central

Fitzgibbon, Jessica; Beck, Martina; Zhou, Ji; Faulkner, Christine; Robatzek, Silke; Oparka, Karl

2013-01-01

Plasmodesmata (PD) form tubular connections that function as intercellular communication channels. They are essential for transporting nutrients and for coordinating development. During cytokinesis, simple PDs are inserted into the developing cell plate, while during wall extension, more complex (branched) forms of PD are laid down. We show that complex PDs are derived from existing simple PDs in a pattern that is accelerated when leaves undergo the sink–source transition. Complex PDs are inserted initially at the three-way junctions between epidermal cells but develop most rapidly in the anisocytic complexes around stomata. For a quantitative analysis of complex PD formation, we established a high-throughput imaging platform and constructed PDQUANT, a custom algorithm that detected cell boundaries and PD numbers in different wall faces. For anticlinal walls, the number of complex PDs increased with increasing cell size, while for periclinal walls, the number of PDs decreased. Complex PD insertion was accelerated by up to threefold in response to salicylic acid treatment and challenges with mannitol. In a single 30-min run, we could derive data for up to 11k PDs from 3k epidermal cells. This facile approach opens the door to a large-scale analysis of the endogenous and exogenous factors that influence PD formation. PMID:23371949

Detection and characterization of miniature inverted-repeat transposable elements in “Candidatus Liberibacter asiaticus”

USDA-ARS?s Scientific Manuscript database

Miniature inverted-repeat transposable elements (MITEs) are non-autonomous transposons (devoid a transposase gene, tps) involving insertion/deletion of genomic DNA in bacterial genomes influencing gene functions. No transposon has yet been reported in “Candidatus Liberibacter asiaticus”, an alpha-pr...

Selective Tuning of Gilbert Damping in Spin-Valve Trilayer by Insertion of Rare-Earth Nanolayers.

PubMed

Zhang, Wen; Zhang, Dong; Wong, Ping Kwan Johnny; Yuan, Honglei; Jiang, Sheng; van der Laan, Gerrit; Zhai, Ya; Lu, Zuhong

2015-08-12

Selective tuning of the Gilbert damping constant, α, in a NiFe/Cu/FeCo spin-valve trilayer has been achieved by inserting different rare-earth nanolayers adjacent to the ferromagnetic layers. Frequency dependent analysis of the ferromagnetic resonances shows that the initially small magnitude of α in the NiFe and FeCo layers is improved by Tb and Gd insertions to various amounts. Using the element-specific technique of X-ray magnetic circular dichroism, we find that the observed increase in α can be attributed primarily to the orbital moment enhancement of Ni and Co, rather than that of Fe. The amplitude of the enhancement depends on the specific rare-earth element, as well as on the lattice and electronic band structure of the transition metals. Our results demonstrate an effective way for individual control of the magnetization dynamics in the different layers of the spin-valve sandwich structures, which will be important for practical applications in high-frequency spintronic devices.

A transposable element in a NAC gene is associated with drought tolerance in maize seedlings

PubMed Central

Mao, Hude; Wang, Hongwei; Liu, Shengxue; Li, Zhigang; Yang, Xiaohong; Yan, Jianbing; Li, Jiansheng; Tran, Lam-Son Phan; Qin, Feng

2015-01-01

Drought represents a major constraint on maize production worldwide. Understanding the genetic basis for natural variation in drought tolerance of maize may facilitate efforts to improve this trait in cultivated germplasm. Here, using a genome-wide association study, we show that a miniature inverted-repeat transposable element (MITE) inserted in the promoter of a NAC gene (ZmNAC111) is significantly associated with natural variation in maize drought tolerance. The 82-bp MITE represses ZmNAC111 expression via RNA-directed DNA methylation and H3K9 dimethylation when heterologously expressed in Arabidopsis. Increasing ZmNAC111 expression in transgenic maize enhances drought tolerance at the seedling stage, improves water-use efficiency and induces upregulation of drought-responsive genes under water stress. The MITE insertion in the ZmNAC111 promoter appears to have occurred after maize domestication and spread among temperate germplasm. The identification of this MITE insertion provides insight into the genetic basis for natural variation in maize drought tolerance. PMID:26387805

Minority carrier device comprising a passivating layer including a Group 13 element and a chalcogenide component

NASA Technical Reports Server (NTRS)

Barron, Andrew R. (Inventor); Hepp, Aloysius F. (Inventor); Jenkins, Phillip P. (Inventor); MacInnes, Andrew N. (Inventor)

1999-01-01

A minority carrier device includes at least one junction of at least two dissimilar materials, at least one of which is a semiconductor, and a passivating layer on at least one surface of the device. The passivating layer includes a Group 13 element and a chalcogenide component. Embodiments of the minority carrier device include, for example, laser diodes, light emitting diodes, heterojunction bipolar transistors, and solar cells.

Osvaldo and Isis retrotransposons as markers of the Drosophila buzzatii colonisation in Australia.

PubMed

Guerreiro, María Pilar García; Fontdevila, Antonio

2011-04-24

Transposable elements (TEs) constitute an important source of genetic variability owing to their jumping and regulatory properties, and are considered to drive species evolution. Several factors that are able to induce TE transposition in genomes have been documented (for example environmental stress and inter- and intra-specific crosses) but in many instances the reasons for TE mobilisation have yet to be elucidated. Colonising populations constitute an ideal model for studying TE behaviour and distribution as they are exposed to different environmental and new demographic conditions. In this study, the distribution of two TEs, Osvaldo and Isis, was examined in two colonising populations of D. buzzatii from Australia. Comparing Osvaldo copy numbers between Australian and Old World (reported in previous studies) colonisations provides a valuable tool for elucidating the colonisation process and the effect of new conditions encountered by colonisers on TEs. The chromosomal distributions of Osvaldo and Isis retrotransposons in two colonising populations of D. buzzatii from Australia revealed sites of high insertion frequency (>10%) and low frequency sites. Comparisons between Osvaldo insertion profiles in colonising populations from the Old World and Australia demonstrate a tendency towards a higher number of highly occupied sites with higher insertion frequency in the Old World than in Australian populations. Tests concerning selection against deleterious TE insertions indicate that Isis is more controlled by purifying selection than Osvaldo. The distribution of both elements on chromosomal arms follows a Poisson distribution and there are non-significant positive correlations between highly occupied sites and chromosomal inversions. The occupancy profile of Osvaldo and Isis retrotransposons is characterised by the existence of high and low insertion frequency sites in the populations. These results demonstrate that Australian D. buzzatii populations were subjected to a founder effect during the colonisation process. Moreover, there are more sites with high insertion frequency in the Old World colonisation than in the Australian colonisation, indicating a probable stronger bottleneck effect in Australia. The results suggest that selection does not seem to play a major role, compared to demography, in the distribution of transposable elements in the Australian populations.

Osvaldo and Isis retrotransposons as markers of the Drosophila buzzatii colonisation in Australia

PubMed Central

2011-01-01

Background Transposable elements (TEs) constitute an important source of genetic variability owing to their jumping and regulatory properties, and are considered to drive species evolution. Several factors that are able to induce TE transposition in genomes have been documented (for example environmental stress and inter- and intra-specific crosses) but in many instances the reasons for TE mobilisation have yet to be elucidated. Colonising populations constitute an ideal model for studying TE behaviour and distribution as they are exposed to different environmental and new demographic conditions. In this study, the distribution of two TEs, Osvaldo and Isis, was examined in two colonising populations of D. buzzatii from Australia. Comparing Osvaldo copy numbers between Australian and Old World (reported in previous studies) colonisations provides a valuable tool for elucidating the colonisation process and the effect of new conditions encountered by colonisers on TEs. Results The chromosomal distributions of Osvaldo and Isis retrotransposons in two colonising populations of D. buzzatii from Australia revealed sites of high insertion frequency (>10%) and low frequency sites. Comparisons between Osvaldo insertion profiles in colonising populations from the Old World and Australia demonstrate a tendency towards a higher number of highly occupied sites with higher insertion frequency in the Old World than in Australian populations. Tests concerning selection against deleterious TE insertions indicate that Isis is more controlled by purifying selection than Osvaldo. The distribution of both elements on chromosomal arms follows a Poisson distribution and there are non-significant positive correlations between highly occupied sites and chromosomal inversions. Conclusions The occupancy profile of Osvaldo and Isis retrotransposons is characterised by the existence of high and low insertion frequency sites in the populations. These results demonstrate that Australian D. buzzatii populations were subjected to a founder effect during the colonisation process. Moreover, there are more sites with high insertion frequency in the Old World colonisation than in the Australian colonisation, indicating a probable stronger bottleneck effect in Australia. The results suggest that selection does not seem to play a major role, compared to demography, in the distribution of transposable elements in the Australian populations. PMID:21513573

Phylogenetic relationships among cetartiodactyls based on insertions of short and long interpersed elements: Hippopotamuses are the closest extant relatives of whales

PubMed Central

Nikaido, Masato; Rooney, Alejandro P.; Okada, Norihiro

1999-01-01

Insertion analysis of short and long interspersed elements is a powerful method for phylogenetic inference. In a previous study of short interspersed element data, it was found that cetaceans, hippopotamuses, and ruminants form a monophyletic group. To further resolve the relationships among these taxa, we now have isolated and characterized 10 additional loci. A phylogenetic analysis of these data was able to resolve relationships among the major cetartiodactyl groups, thereby shedding light on the origin of whales. The results indicated (i) that cetaceans are deeply nested within Artiodactyla, (ii) that cetaceans and hippopotamuses form a monophyletic group, (iii) that pigs and peccaries form a monophyletic group to the exclusion of hippopotamuses, (iv) that chevrotains diverged first among ruminants, and (v) that camels diverged first among cetartiodactyls. These findings lead us to conclude that cetaceans evolved from an immediate artiodactyl, not mesonychian, ancestor. PMID:10468596

Human Alu insertion polymorphisms in North African populations.

PubMed

Cherni, Loth; Frigi, Sabeh; Ennafaa, Hajer; Mtiraoui, Nabil; Mahjoub, Touhami; Benammar-Elgaaied, Amel

2011-10-01

Several features make Alu insertions a powerful tool used in population genetic studies: the polymorphic nature of many Alu insertions, the stability of an Alu insertion event and, furthermore, the ancestral state of an Alu insertion is known to be the absence of the Alu element at a particular locus and the presence of an Alu insertion at the site that forward mutational change. This study analyses seven Alu insertion polymorphisms in a sample of 297 individuals from the autochthonous population of Tunisia (Thala, Smar, Zarzis, and Bou Salem) and Libya with the aim of studying their genetic structure with respect to the populations of North Africa, Western, Eastern and Central Europe. The comparative analyses carried out using the MDS and AMOVA methods reveal the existence of spatial heterogeneity, and identify four population groups. Study populations (Libya, Smar, Zarzis, and Bou Salem) are closest to North African populations whereas Thala is isolated and is closest to Western European populations. In conclusion, Results of the present study support the important role that migratory movements have played in the North African gene pool, at least since the Neolithic period.

Linewidth dependence of coherent terahertz emission from Bi2Sr2CaCu2O8 intrinsic Josephson junction stacks in the hot-spot regime

NASA Astrophysics Data System (ADS)

Li, Mengyue; Yuan, Jie; Kinev, Nickolay; Li, Jun; Gross, Boris; Guénon, Stefan; Ishii, Akira; Hirata, Kazuto; Hatano, Takeshi; Koelle, Dieter; Kleiner, Reinhold; Koshelets, Valery P.; Wang, Huabing; Wu, Peiheng

2012-08-01

We report on measurements of the linewidth Δf of terahertz radiation emitted from intrinsic Josephson junction stacks, using a Nb/AlN/NbN integrated receiver for detection. Previous resolution-limited measurements indicated that Δf may be below 1 GHz—much smaller than expected from a purely cavity-induced synchronization. While at low bias we found Δf to be not smaller than ˜500 MHz, at high bias, where a hot spot coexists with regions which are still superconducting, Δf turned out to be as narrow as 23 MHz. We attribute this to the hot spot acting as a synchronizing element. Δf decreases with increasing bath temperature, a behavior reminiscent of motional narrowing in NMR or electron spin resonance (ESR), but hard to explain in standard electrodynamic models of Josephson junctions.

Superconducting Memristors

NASA Astrophysics Data System (ADS)

di Ventra, Massimiliano; Peotta, Sebastiano

2014-03-01

In his original work Josephson [Phys. Lett. 1, 251 (1962)] predicted that a phase-dependent conductance should be present in superconductor tunnel junctions. This effect attracted considerable attention in the past but is difficult to detect, mainly because it is hard to single it out from the background pair current. Here, we propose to isolate it by using a two-junction interferometer where the junctions have the same critical currents but different conductances. The pair current is completely suppressed when the magnetic flux in the loop is half of a flux quantum and the device is characterized by a pure phase-dependent conductance. According to the theory of nonlinear circuit elements this is in fact an ideal voltage-controlled memristor. Possible applications of this memristive device are memories and neuromorphic computing within the framework of ultrafast and low-energy superconducting digital circuits. This work has been supported by DOE under Grant No. DE-FG02-05ER46204.

Thermo-voltage measurements of atomic contacts at low temperature

PubMed Central

Ofarim, Ayelet; Kopp, Bastian; Möller, Thomas; Martin, León; Boneberg, Johannes; Leiderer, Paul

2016-01-01

Summary We report the development of a novel method to determine the thermopower of atomic-sized gold contacts at low temperature. For these measurements a mechanically controllable break junction (MCBJ) system is used and a laser source generates a temperature difference of a few kelvins across the junction to create a thermo-voltage. Since the temperature difference enters directly into the Seebeck coefficient S = −ΔV/ΔT, the determination of the temperature plays an important role. We present a method for the determination of the temperature difference using a combination of a finite element simulation, which reveals the temperature distribution of the sample, and the measurement of the resistance change due to laser heating of sensor leads on both sides next to the junction. Our results for the measured thermopower are in agreement with recent reports in the literature. PMID:27335765

Non-linear wave phenomena in Josephson elements for superconducting electronics

NASA Astrophysics Data System (ADS)

Christiansen, P. L.; Parmentier, R. D.; Skovgaard, O.

1985-07-01

The long and intermediate length Josephson tunnel junction oscillator with overlap geometry of linear and circular configuration, is investigated by computational solution of the perturbed sine-Gordon equation model and by experimental measurements. The model predicts the experimental results very well. Line oscillators as well as ring oscillators are treated. For long junctions soliton perturbation methods are developed and turn out to be efficient prediction tools, also providing physical understanding of the dynamics of the oscillator. For intermediate length junctions expansions in terms of linear cavity modes reduce computational costs. The narrow linewidth of the electromagnetic radiation (typically 1 kHz of a line at 10 GHz) is demonstrated experimentally. Corresponding computer simulations requiring a relative accuracy of less than 10 to the -7th power are performed on supercomputer CRAY-1-S. The broadening of linewidth due to external microradiation and internal thermal noise is determined.

A concept of wireless and passive very-high temperature sensor

NASA Astrophysics Data System (ADS)

Nicolay, P.; Matloub, R.; Bardong, J.; Mazzalai, A.; Muralt, P.

2017-05-01

There is a need for sensors capable operating at temperatures above 1000 °C. We describe an innovative sensor that might achieve this goal. The sensor comprises two main elements: a thermocouple and a surface acoustic wave (SAW) strain sensor. The cold junction of the thermocouple is electrically connected to a highly piezoelectric thin layer, deposited on top of a SAW substrate. In operation, the voltage generated by the temperature gradient between the hot (>1000 °C) and cold junction (<350 °C) generates a strain field in the layer, which is mechanically transmitted to the substrate. This modifies the SAW propagation conditions and therefore the sensors' radiofrequency response. The change depends on the applied voltage and thus on the hot junction temperature. As SAW devices are passive elements that can be remotely interrogated, it becomes possible to infer the hot junction temperature from the radiofrequency response, i.e., to remotely read temperatures above 1000 °C, without embedded electronics. In this paper, we demonstrate the feasibility of this concept, using AlN layers deposited on Y-Z Lithium Niobate (LN). The achieved sensitivity of 80 Hz/V at 400 MHz is constant over a wide voltage range. Numerical simulations were performed to compute the main properties of the demonstrators and suggest optimization strategies. Improvements are expected from the use of stronger piezoelectric layers, such as AlScN or Pb(Ti,Zr)O3 (PZT), which could increase the sensitivity by factors of 3 and 20, as estimated from their transverse piezoelectric coefficients. As a first step in this direction, thin PZT layers have been deposited on Y-Z LN.

Fatigue delamination onset prediction in tapered composite laminates

NASA Technical Reports Server (NTRS)

Murri, Gretchen Bostaph; Salpekar, Satish A.; Obrien, T. Kevin

1989-01-01

Tapered (0 deg) laminates of S2/CE9000 and S2/SP250 glass/epoxies, and IM6/1827I graphite/epoxy were tested in cyclic tension. The specimens usually showed some initial stable delaminations in the tapered region, but these did not affect the stiffness of the specimens, and loading was continued until the specimens either delaminated unstably, or reached 10(exp 6) to 2 x 10(exp 7) million cycles with no unstable delamination. The final unstable delamination originated at the junction of the thin and tapered regions. A finite-element model was developed for the tapered laminate with and without the initial stable delaminations observed in the tests. The analysis showed that for both cases the most likely place for an opening (Mode 1) delamination to originate is at the junction of the taper and thin regions. For each material type, the models were used to calculate the strain energy release rate, G, associated with delaminations originating at that junction and growing either into the thin region or tapered region. For the materials tested, cyclic G(sub Imax) values from DCB tests were used with the maximum strain energy release rates calculated from the finite-element analysis to predict the onset of unstable delamination at the junction as a function of fatigue cycles. The predictions were compared to experimental values of maximum cyclic load as a function of cycles to unstable delamination from fatigue tests in tapered laminates. For the IM6/1827I and S2/SP250 laminates, the predictions agreed very well with the test data. Predicted values for the S2/CE9000 were conservative compared to the test data.

Arynes and Heteroarynes in the Synthesis of Dibenzocinnolines, Diazaxanthyledenes, and Triptycenes

NASA Astrophysics Data System (ADS)

Suh, Sung-Eun

Arynes are known as useful synthons in organic synthesis. In particular, reactions accompanying multiple arynes have been employed for the construction of arenes and heteroarenes of complex molecules. Employing known reactivity modes of arynes such as cycloadditions, nucleophilic addition, bond insertion, Alder-ene, annulation, desaturation, and polymerization, a wide variety of transformation of reactive starting materials led to the development of novel fluorophores and energy materials, as well as the synthesis of natural products. Harnessing the highly reactive arynes, the triple aryne-tetrazine (TAT) reaction was disclosed as a novel metal-free synthetic method for the preparation of dibenzo[de,g]cinnoline derivatives in a single operation. Dibenzo[de,g]cinnolines have been shown as potential fluorescent probes in cells. For the mechanism, multiple mechanistic steps of the TAT reaction were scrutinized by isolation of intermediates and byproducts as well as a computational study on the transition states and the competitive reactions pathways. A facile two-step synthesis of the reported structure of xylopyridine A was developed from a pyridyne precursor and 2-fluorobenzoic acid utilizing a pyridyne insertion reaction followed by reductive coupling. Simple transformation of the reported xylopyridine A structure have given photoactivatable dyes and specific organelle staining probes in either live or fixed cells and tissues, exhibiting high quantum yields, photostability, cell permeability and low toxicity. On the basis of these results, the synthesis of multistage photoactivatable dyes was designed and studied. Utilization of arynes allowed access to the synthesis of 9-substituted triptycene derivatives which have been recognized as three-way junction binders. Accompanying solid-phase peptide synthesis, the rapid diversification of the triptycene scaffold was achieved for screening in a nucleic acid junction binding assay.

Accuracy of Intravenous Electrocardiography Confirmation of Peripherally Inserted Central Catheter for Parenteral Nutrition.

PubMed

Mundi, Manpreet S; Edakkanambeth Varayil, Jithinraj; McMahon, Megan T; Okano, Akiko; Vallumsetla, Nishanth; Bonnes, Sara L; Andrews, James C; Hurt, Ryan T

2016-04-01

Parenteral nutrition (PN) is a life-saving therapy for patients with intestinal failure. Safe delivery of hyperosmotic solution requires a central venous catheter (CVC) with tip in the lower superior vena cava (SVC) or at the SVC-right atrium (RA) junction. To reduce cost and delay in use of CVC, new techniques such as intravascular electrocardiogram (ECG) are being used for tip confirmation in place of chest x-ray (CXR). The present study assessed for accuracy of ECG confirmation in home PN (HPN). Records for all patients consulted for HPN from December 17, 2014, to June 16, 2015, were reviewed for patient demographics, diagnosis leading to HPN initiation, and ECG and CXR confirmation. CXRs were subsequently reviewed by a radiologist to reassess location of the CVC tip and identify those that should be adjusted. Seventy-three patients were eligible, and after assessment for research authorization and postplacement CXR, 17 patients (30% male) with an age of 54 ± 14 years were reviewed. In all patients, postplacement intravascular ECG reading stated tip in the SVC. However, based on CXR, the location of the catheter tip was satisfactory (low SVC or SVC-RA junction) in 10 of 17 patients (59%). Due to the high osmolality of PN, CVC tip location is of paramount importance. After radiology review of CXR, we noted that 7 of 17 (41%) peripherally inserted central catheter lines were in an unsatisfactory position despite ECG confirmation. With current data available, intravenous ECG confirmation should not be used as the sole source of tip confirmation in patients receiving HPN. © 2016 American Society for Parenteral and Enteral Nutrition.

Export of a Toxoplasma gondii Rhoptry Neck Protein Complex at the Host Cell Membrane to Form the Moving Junction during Invasion

PubMed Central

Poncet, Joël; Dubremetz, Jean-François; Lebrun, Maryse

2009-01-01

One of the most conserved features of the invasion process in Apicomplexa parasites is the formation of a moving junction (MJ) between the apex of the parasite and the host cell membrane that moves along the parasite and serves as support to propel it inside the host cell. The MJ was, up to a recent period, completely unknown at the molecular level. Recently, proteins originated from two distinct post-Golgi specialised secretory organelles, the micronemes (for AMA1) and the neck of the rhoptries (for RON2/RON4/RON5 proteins), have been shown to form a complex. AMA1 and RON4 in particular, have been localised to the MJ during invasion. Using biochemical approaches, we have identified RON8 as an additional member of the complex. We also demonstrated that all RON proteins are present at the MJ during invasion. Using metabolic labelling and immunoprecipitation, we showed that RON2 and AMA1 were able to interact in the absence of the other members. We also discovered that all MJ proteins are subjected to proteolytic maturation during trafficking to their respective organelles and that they could associate as non-mature forms in vitro. Finally, whereas AMA1 has previously been shown to be inserted into the parasite membrane upon secretion, we demonstrated, using differential permeabilization and loading of RON-specific antibodies into the host cell, that the RON complex is targeted to the host cell membrane, where RON4/5/8 remain associated with the cytoplasmic face. Globally, these results point toward a model of MJ organization where the parasite would be secreting and inserting interacting components on either side of the MJ, both at the host and at its own plasma membranes. PMID:19247437

Tunneling spin polarization in planar tunnel junctions: measurements using NbN superconducting electrodes and evidence for Kondo-assisted tunneling

NASA Astrophysics Data System (ADS)

Yang, Hyunsoo

2006-03-01

The fundamental origin of tunneling magnetoresistance in magnetic tunnel junctions (MTJs) is the spin-polarized tunneling current, which can be measured directly using superconducting tunneling spectroscopy (STS). The STS technique was first developed by Meservey and Tedrow using aluminum superconducting electrodes. Al has been widely used because of its low spin orbit scattering. However, measurements must be made at low temperatures (<0.4 K) because of the low superconducting transition temperature of Al. Here, we demonstrate that superconducting electrodes formed from NbN can be used to measure tunneling spin polarization (TSP) at higher temperatures up to ˜1.2K. The tunneling magnetoresistance and polarization of the tunneling current in MTJs is highly sensitive to the detailed structure of the tunneling barrier. Using MgO tunnel barriers we find TSP values as high as 90% at 0.25K. The TMR is, however, depressed by insertion of ultra thin layers of both non-magnetic and magnetic metals in the middle of the MgO barrier. For ultra-thin, discontinuous magnetic layers of CoFe, we find evidence of Kondo assisted tunneling, from increased conductance at low temperatures (<50K) and bias voltage (<20 mV). Over the same temperature and bias voltage regimes the tunneling magnetoresistance is strongly depressed. We present other evidence of Kondo resonance including the logarithmic temperature dependence of the zero bias conductance peak. We infer the Kondo temperature from both the spectra width of this conductance peak as well as the temperature dependence of the TMR depression. The Kondo temperature is sensitive to the thickness of the inserted CoFe layer and decreases with increased CoFe thickness. * performed in collaboration with S-H. Yang, C. Kaiser, and S. Parkin.

Distinct patterns of alteration of myc genes associated with integration of human papillomavirus type 16 or type 45 DNA in two genital tumours.

PubMed

Sastre-Garau, X; Favre, M; Couturier, J; Orth, G

2000-08-01

We previously described two genital carcinomas (IC2, IC4) containing human papillomavirus type 16 (HPV-16)- or HPV-18-related sequences integrated in chromosomal bands containing the c-myc (8q24) or N-myc (2p24) gene, respectively. The c-myc gene was rearranged and amplified in IC2 cells without evidence of overexpression. The N-myc gene was amplified and highly transcribed in IC4 cells. Here, the sequence of an 8039 bp IC4 DNA fragment containing the integrated viral sequences and the cellular junctions is reported. A 3948 bp segment of the genome of HPV-45 encompassing the upstream regulatory region and the E6 and E7 ORFs was integrated into the untranslated part of N-myc exon 3, upstream of the N-myc polyadenylation signal. Both N-myc and HPV-45 sequences were amplified 10- to 20-fold. The 3' ends of the major N-myc transcript were mapped upstream of the 5' junction. A minor N-myc/HPV-45 fusion transcript was also identified, as well as two abundant transcripts from the HPV-45 E6-E7 region. Large amounts of N-myc protein were detected in IC4 cells. A major alteration of c-myc sequences in IC2 cells involved the insertion of a non-coding sequence into the second intron and their co-amplification with the third exon, without any evidence for the integration of HPV-16 sequences within or close to the gene. Different patterns of myc gene alterations may thus be associated with integration of HPV DNA in genital tumours, including the activation of the protooncogene via a mechanism of insertional mutagenesis and/or gene amplification.

Characterisation of IS153, an IS3-family insertion sequence isolated from Lactobacillus sanfranciscensis and its use for strain differentiation.

PubMed

Ehrmann, M A; Vogel, R E

2001-11-01

An insertion sequence has been identified in the genome of Lactobacillus sanfranciscensis DSM 20451T as segment of 1351 nucleotides containing 37-bp imperfect terminal inverted repeats. The sequence of this element encodes two out of phase, overlapping open reading frames, orfA and orfB, from which three putative proteins are produced. OrfAB is a transframe protein produced by -1 translational frame shifting between orf A and orf B that is presumed to be the transposase. The large orfAB of this element encodes a 342 amino acid protein that displays similarities with transposases encoded by bacterial insertion sequences belonging to the IS3 family. In L. sanfranciscensis type strain DSM 20451T multiple truncated IS elements were identified. Inverse PCR was used to analyze target sites of four of these elements, but except of their highly AT rich character not any sequence specificity was identified so far. Moreover, no flanking direct repeats were identified. Multiple copies of IS153 were detected by hybridization in other strains of L. sanfranciscensis. Resulting hybridization patterns were shown to differentiate between organisms at strain level rather than a probe targeted against the 16S rDNA. With a PCR based approach IS153 or highly similar sequences were detected in L. acidophilus, L. casei, L. malefermentans, L. plantarum, L. hilgardii, L. collinoides L. farciminis L. sakei and L. salivarius, L. reuteri as well as in Enterococcus faecium, Pediococcus acidilactici and P. pentosaceus.

Exception to the Rule: Genomic Characterization of Naturally Occurring Unusual Vibrio cholerae Strains with a Single Chromosome

DOE PAGES

Xie, Gary; Johnson, Shannon Lyn; Davenport, Karen Walston; ...

2017-08-29

Here, the genetic make-up of most bacteria is encoded in a single chromosome while about 10% have more than one chromosome. Among these, Vibrio cholerae, with two chromosomes, has served as a model system to study various aspects of chromosome maintenance, mainly replication, and faithful partitioning of multipartite genomes. Here, we describe the genomic characterization of strains that are an exception to the two chromosome rules: naturally occurring single-chromosome V. cholerae. Whole genome sequence analyses of NSCV1 and NSCV2 (natural single-chromosome vibrio) revealed that the Chr1 and Chr2 fusion junctions contain prophages, IS elements, and direct repeats, in addition tomore » large-scale chromosomal rearrangements such as inversions, insertions, and long tandem repeats elsewhere in the chromosome compared to prototypical two chromosome V. cholerae genomes. Many of the known cholera virulence factors are absent. The two origins of replication and associated genes are generally intact with synonymous mutations in some genes, as arerecAand mismatch repair (MMR) genes dam, mutH, and mutL; MutS function is probably impaired in NSCV2. These strains are ideal tools for studying mechanistic aspects of maintenance of chromosomes with multiple origins and other rearrangements and the biological, functional, and evolutionary significance of multipartite genome architecture in general.« less

Exception to the Rule: Genomic Characterization of Naturally Occurring Unusual Vibrio cholerae Strains with a Single Chromosome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xie, Gary; Johnson, Shannon Lyn; Davenport, Karen Walston

Here, the genetic make-up of most bacteria is encoded in a single chromosome while about 10% have more than one chromosome. Among these, Vibrio cholerae, with two chromosomes, has served as a model system to study various aspects of chromosome maintenance, mainly replication, and faithful partitioning of multipartite genomes. Here, we describe the genomic characterization of strains that are an exception to the two chromosome rules: naturally occurring single-chromosome V. cholerae. Whole genome sequence analyses of NSCV1 and NSCV2 (natural single-chromosome vibrio) revealed that the Chr1 and Chr2 fusion junctions contain prophages, IS elements, and direct repeats, in addition tomore » large-scale chromosomal rearrangements such as inversions, insertions, and long tandem repeats elsewhere in the chromosome compared to prototypical two chromosome V. cholerae genomes. Many of the known cholera virulence factors are absent. The two origins of replication and associated genes are generally intact with synonymous mutations in some genes, as arerecAand mismatch repair (MMR) genes dam, mutH, and mutL; MutS function is probably impaired in NSCV2. These strains are ideal tools for studying mechanistic aspects of maintenance of chromosomes with multiple origins and other rearrangements and the biological, functional, and evolutionary significance of multipartite genome architecture in general.« less

Mycobacterium smegmatis strain for detection of Mycobacterium tuberculosis by PCR used as internal control for inhibition of amplification and for quantification of bacteria.

PubMed Central

Kolk, A H; Noordhoek, G T; de Leeuw, O; Kuijper, S; van Embden, J D

1994-01-01

For the detection of Mycobacterium tuberculosis by PCR, the IS6110 sequence was used. A modified target was constructed by insertion of 56 nucleotides in the IS6110 insertion element of Mycobacterium bovis BCG. This modified insertion sequence was integrated into the genome of Mycobacterium smegmatis, a mycobacterium species which does not contain the IS6110 element. When DNA from the modified M. smegmatis 1008 strain was amplified with IS6110-specific primers INS1 and INS2, a band of 301 bp was seen on agarose gel, whereas the PCR product of M. tuberculosis complex DNA was a 245-bp fragment with these primers. The addition of a small number of M. smegmatis 1008 cells to clinical samples before DNA purification enables the detection of problems which may be due to the loss of DNA in the isolation procedure or to the presence of inhibitors. The presence of inhibitors of the amplification reaction can be confirmed by the addition of M. smegmatis 1008 DNA after the DNA isolation procedure. Furthermore, competition between the different target DNAs of M. smegmatis 1008 DNA and M. tuberculosis complex DNA enables the estimation of the number of IS6110 elements in the clinical sample. Images PMID:8051267

New bioinformatic tool for quick identification of functionally relevant endogenous retroviral inserts in human genome.

PubMed

Garazha, Andrew; Ivanova, Alena; Suntsova, Maria; Malakhova, Galina; Roumiantsev, Sergey; Zhavoronkov, Alex; Buzdin, Anton

2015-01-01

Endogenous retroviruses (ERVs) and LTR retrotransposons (LRs) occupy ∼8% of human genome. Deep sequencing technologies provide clues to understanding of functional relevance of individual ERVs/LRs by enabling direct identification of transcription factor binding sites (TFBS) and other landmarks of functional genomic elements. Here, we performed the genome-wide identification of human ERVs/LRs containing TFBS according to the ENCODE project. We created the first interactive ERV/LRs database that groups the individual inserts according to their familial nomenclature, number of mapped TFBS and divergence from their consensus sequence. Information on any particular element can be easily extracted by the user. We also created a genome browser tool, which enables quick mapping of any ERV/LR insert according to genomic coordinates, known human genes and TFBS. These tools can be used to easily explore functionally relevant individual ERV/LRs, and for studying their impact on the regulation of human genes. Overall, we identified ∼110,000 ERV/LR genomic elements having TFBS. We propose a hypothesis of "domestication" of ERV/LR TFBS by the genome milieu including subsequent stages of initial epigenetic repression, partial functional release, and further mutation-driven reshaping of TFBS in tight coevolution with the enclosing genomic loci.

Chemotherapy versus self-expanding metal stent as primary treatment of severe dysphagia from unresectable oesophageal or gastro-oesophageal junction cancer.

PubMed

Touchefeu, Yann; Archambeaud, Isabelle; Landi, Bruno; Lièvre, Astrid; Lepère, Céline; Rougier, Philippe; Mitry, Emmanuel

2014-03-01

To compare chemotherapy first (group 1) versus self-expanding metal stent first (group 2) for the management of malignant dysphagia in unresectable oesophageal or gastro-oesophageal junction cancer. Patients from two university hospitals with severe malignant dysphagia (dysphagia score ≥ 2) uneligible for surgery or radiochemotherapy were evaluated retrospectively. Forty-two patients were included in group 1, and 29 in group 2. After 4 weeks, dysphagia scores improved by at least 1 point in 67% of patients in group 1 versus 93% in group 2 (p=0.01); 48% of patients in group 1 were able to eat solid food versus 68% in group 2 (p=0.054). In group 1, a self-expanding metal stent was secondarily placed in 18 patients (42.9%), whereas in group 2 dysphagia required a second self-expanding metal stent placement in 33.3% of patients. Chemotherapy as the first treatment may be a valid option, avoiding self-expanding metal stent insertion in half of the patients. Copyright © 2013 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.

The moving junction of apicomplexan parasites: a key structure for invasion.

PubMed

Besteiro, Sébastien; Dubremetz, Jean-François; Lebrun, Maryse

2011-06-01

Most Apicomplexa are obligate intracellular parasites and many are important pathogens of human and domestic animals. For a successful cell invasion, they rely on their own motility and on a firm anchorage to their host cell, depending on the secretion of proteins and the establishment of a structure called the moving junction (MJ). The MJ moves from the apical to the posterior end of the parasite, leading to the internalization of the parasite into a parasitophorous vacuole. Based on recent data obtained in Plasmodium and Toxoplasma, an emerging model emphasizes a cooperative role of secreted parasitic proteins in building the MJ and driving this crucial invasive process. More precisely, the parasite exports the microneme protein AMA1 to its own surface and the rhoptry neck RON2 protein as a receptor inserted into the host cell together with other RON partners. Ongoing and future research will certainly help refining the model by characterizing the molecular organization within the MJ and its interactions with both host and parasite cytoskeleton for anchoring of the complex. © 2011 Blackwell Publishing Ltd.

Integrated genome-wide Alu methylation and transcriptome profiling analyses reveal novel epigenetic regulatory networks associated with autism spectrum disorder.

PubMed

Saeliw, Thanit; Tangsuwansri, Chayanin; Thongkorn, Surangrat; Chonchaiya, Weerasak; Suphapeetiporn, Kanya; Mutirangura, Apiwat; Tencomnao, Tewin; Hu, Valerie W; Sarachana, Tewarit

2018-01-01

Alu elements are a group of repetitive elements that can influence gene expression through CpG residues and transcription factor binding. Altered gene expression and methylation profiles have been reported in various tissues and cell lines from individuals with autism spectrum disorder (ASD). However, the role of Alu elements in ASD remains unclear. We thus investigated whether Alu elements are associated with altered gene expression profiles in ASD. We obtained five blood-based gene expression profiles from the Gene Expression Omnibus database and human Alu-inserted gene lists from the TranspoGene database. Differentially expressed genes (DEGs) in ASD were identified from each study and overlapped with the human Alu-inserted genes. The biological functions and networks of Alu-inserted DEGs were then predicted by Ingenuity Pathway Analysis (IPA). A combined bisulfite restriction analysis of lymphoblastoid cell lines (LCLs) derived from 36 ASD and 20 sex- and age-matched unaffected individuals was performed to assess the global DNA methylation levels within Alu elements, and the Alu expression levels were determined by quantitative RT-PCR. In ASD blood or blood-derived cells, 320 Alu-inserted genes were reproducibly differentially expressed. Biological function and pathway analysis showed that these genes were significantly associated with neurodevelopmental disorders and neurological functions involved in ASD etiology. Interestingly, estrogen receptor and androgen signaling pathways implicated in the sex bias of ASD, as well as IL-6 signaling and neuroinflammation signaling pathways, were also highlighted. Alu methylation was not significantly different between the ASD and sex- and age-matched control groups. However, significantly altered Alu methylation patterns were observed in ASD cases sub-grouped based on Autism Diagnostic Interview-Revised scores compared with matched controls. Quantitative RT-PCR analysis of Alu expression also showed significant differences between ASD subgroups. Interestingly, Alu expression was correlated with methylation status in one phenotypic ASD subgroup. Alu methylation and expression were altered in LCLs from ASD subgroups. Our findings highlight the association of Alu elements with gene dysregulation in ASD blood samples and warrant further investigation. Moreover, the classification of ASD individuals into subgroups based on phenotypes may be beneficial and could provide insights into the still unknown etiology and the underlying mechanisms of ASD.

Derepression of the Plant Chromovirus LORE1 Induces Germline Transposition in Regenerated Plants

PubMed Central

Fukai, Eigo; Umehara, Yosuke; Sato, Shusei; Endo, Makoto; Kouchi, Hiroshi; Hayashi, Makoto; Stougaard, Jens; Hirochika, Hirohiko

2010-01-01

Transposable elements represent a large proportion of the eukaryotic genomes. Long Terminal Repeat (LTR) retrotransposons are very abundant and constitute the predominant family of transposable elements in plants. Recent studies have identified chromoviruses to be a widely distributed lineage of Gypsy elements. These elements contain chromodomains in their integrases, which suggests a preference for insertion into heterochromatin. In turn, this preference might have contributed to the patterning of heterochromatin observed in host genomes. Despite their potential importance for our understanding of plant genome dynamics and evolution, the regulatory mechanisms governing the behavior of chromoviruses and their activities remain largely uncharacterized. Here, we report a detailed analysis of the spatio-temporal activity of a plant chromovirus in the endogenous host. We examined LORE1a, a member of the endogenous chromovirus LORE1 family from the model legume Lotus japonicus. We found that this chromovirus is stochastically de-repressed in plant populations regenerated from de-differentiated cells and that LORE1a transposes in the male germline. Bisulfite sequencing of the 5′ LTR and its surrounding region suggests that tissue culture induces a loss of epigenetic silencing of LORE1a. Since LTR promoter activity is pollen specific, as shown by the analysis of transgenic plants containing an LTR::GUS fusion, we conclude that male germline-specific LORE1a transposition in pollen grains is controlled transcriptionally by its own cis-elements. New insertion sites of LORE1a copies were frequently found in genic regions and show no strong insertional preferences. These distinctive novel features of LORE1 indicate that this chromovirus has considerable potential for generating genetic and epigenetic diversity in the host plant population. Our results also define conditions for the use of LORE1a as a genetic tool. PMID:20221264

CHARACTERIZATION AND NUCLEOTIDE SEQUENCE DETERMINATION OF A REPEAT ELEMENT ISOLATED FROM A 2,4,5,-T DEGRADING STRAIN OF PSEUDOMONAS CEPACIA

EPA Science Inventory

Pseudomonas cepacia strain AC1100, capable of growth on 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), was mutated to the 2,4,5-T− strain PT88 by a ColE1 :: Tn5 chromosomal insertion. Using cloned DNA from the region flanking the insertion, a 1477-bp sequence (designated RS1100) wa...

Damping element for reducing the vibration of an airfoil

DOEpatents

Campbell, Christian X; Marra, John J

2013-11-12

An airfoil (10) is provided with a tip (12) having an opening (14) to a center channel (24). A damping element (16) is inserted within the opening of the center channel, to reduce an induced vibration of the airfoil. The mass of the damping element, a spring constant of the damping element within the center channel, and/or a mounting location (58) of the damping element within the center channel may be adjustably varied, to shift a resonance frequency of the airfoil outside a natural operating frequency of the airfoil.

Global positioning system recorder and method

DOEpatents

Hayes, D.W.; Hofstetter, K.J.; Eakle, R.F. Jr.; Reeves, G.E.

1998-12-22

A global positioning system recorder (GPSR) is disclosed in which operational parameters and recorded positional data are stored on a transferable memory element. Through this transferrable memory element, the user of the GPSR need have no knowledge of GPSR devices other than that the memory element needs to be inserted into the memory element slot and the GPSR must be activated. The use of the data element also allows for minimal downtime of the GPSR and the ability to reprogram the GPSR and download data therefrom, without having to physically attach it to another computer. 4 figs.

Global positioning system recorder and method government rights

DOEpatents

Hayes, David W.; Hofstetter, Kenneth J.; Eakle, Jr., Robert F.; Reeves, George E.

1998-01-01

A global positioning system recorder (GPSR) is disclosed in which operational parameters and recorded positional data are stored on a transferable memory element. Through this transferrable memory element, the user of the GPSR need have no knowledge of GPSR devices other than that the memory element needs to be inserted into the memory element slot and the GPSR must be activated. The use of the data element also allows for minimal downtime of the GPSR and the ability to reprogram the GPSR and download data therefrom, without having to physically attach it to another computer.

Low exchange element for nuclear reactor

DOEpatents

Brogli, Rudolf H.; Shamasunder, Bangalore I.; Seth, Shivaji S.

1985-01-01

A flow exchange element is presented which lowers temperature gradients in fuel elements and reduces maximum local temperature within high temperature gas-cooled reactors. The flow exchange element is inserted within a column of fuel elements where it serves to redirect coolant flow. Coolant which has been flowing in a hotter region of the column is redirected to a cooler region, and coolant which has been flowing in the cooler region of the column is redirected to the hotter region. The safety, efficiency, and longevity of the high temperature gas-cooled reactor is thereby enhanced.

Talua SINE biology in the genome of the Reticulitermes subterranean termites (Isoptera, Rhinotermitidae).

PubMed

Luchetti, Andrea; Mantovani, Barbara

2009-12-01

Studies on transposable elements in termites are of interest because their genome is in a permanent condition of inbreeding. In this situation, an increase in transposon copy number should be mainly due to a Muller's ratchet effect, with selection against deleterious insertions playing a major role. Short INterspersed Elements (SINEs) are non-autonomous retrotransposons, known to be stable components of eukaryotic genomes. The SINE Talua, first isolated from Reticulitermes lucifugus (Rhinotermitidae), is the only mobile element described so far in termites. In the present survey, Talua has been found widespread in the Isoptera order. In comparison with other non-termite SINEs, Talua diversity and distribution in the Reticulitermes genome demonstrate that Talua is an ancient component of termite genome and that it is significantly associated with other repeats. In particular, the element is found to be involved with microsatellite motifs either as their generator or because inserted in their nearby. Further, two new SINEs and a putative retrotranscriptase-like sequence were found linked to Talua. Talua's genomic distribution is discussed in the light of the available models on transposable element dynamics within inbred genomes, also taking into account SINE role as drivers of genetic diversity in counteracting inbreeding depression.

Finite element simulations of electrostatic dopant potentials in thin semiconductor specimens for electron holography.

PubMed

Somodi, P K; Twitchett-Harrison, A C; Midgley, P A; Kardynał, B E; Barnes, C H W; Dunin-Borkowski, R E

2013-11-01

Two-dimensional finite element simulations of electrostatic dopant potentials in parallel-sided semiconductor specimens that contain p-n junctions are used to assess the effect of the electrical state of the surface of a thin specimen on projected potentials measured using off-axis electron holography in the transmission electron microscope. For a specimen that is constrained to have an equipotential surface, the simulations show that the step in the projected potential across a p-n junction is always lower than would be predicted from the properties of the bulk device, but is relatively insensitive to the value of the surface state energy, especially for thicker specimens and higher dopant concentrations. The depletion width measured from the projected potential, however, has a complicated dependence on specimen thickness. The results of the simulations are of broader interest for understanding the influence of surfaces and interfaces on electrostatic potentials in nanoscale semiconductor devices. © 2013 Elsevier B.V. All rights reserved.

Micromachined Millimeter- and Submillimeter-wave SIS Heterodyne Receivers for Remote Sensing

NASA Technical Reports Server (NTRS)

Hu, Qing

1997-01-01

This is a progress report for the second year of a NASA-sponsored project. The report discusses the design and fabrication of micromachined Superconductor Insulator Superconductor (SIS) heterodyne receivers with integrated tuning elements. These receivers tune out the functional capacitance at desired frequencies, resulting in less noise, lower temperatures and broader bandwidths. The report also discusses the design and fabrication of the first monolithic 3x3 focal-plane arrays for a frequency range of 170-210 GHz. Also addressed is the construction of a 9-channel bias and read-out system, as well as the redesign of the IF connections to reduce cross talk between SIS junctions, which become significant a frequency of 1.5 GHz IF. Uniformity of the junction arrays were measured and antenna beam patterns of several array elements under operating conditions also were measured. Finally, video and heterodyne responses of our focal-plane arrays were measured as well. Attached is a paper on: 'Development of a 170-210 GHz 3x3 micromachined SIS imaging array'.

Raney nickel catalytic device

DOEpatents

O'Hare, Stephen A.

1978-01-01

A catalytic device for use in a conventional coal gasification process which includes a tubular substrate having secured to its inside surface by expansion a catalytic material. The catalytic device is made by inserting a tubular catalytic element, such as a tubular element of a nickel-aluminum alloy, into a tubular substrate and heat-treating the resulting composite to cause the tubular catalytic element to irreversibly expand against the inside surface of the substrate.

Mechanically and optically reliable folding structure with a hyperelastic material for seamless foldable displays

NASA Astrophysics Data System (ADS)

Kwon, Hyuk-Jun; Shim, HongShik; Kim, Sunkook; Choi, Woong; Chun, Youngtea; Kee, InSeo; Lee, SangYoon

2011-04-01

We report a mechanically and optically robust folding structure to realize a foldable active matrix organic-light-emitting-diode (AMOLED) display without a visible crease at the junction. A nonlinear stress analysis, based on a finite element method, provided an optimized design. The folding-unfolding test on the structure exhibited negligible deterioration of the relative brightness at the junction of the individual panels up to 105 cycles at a folding radius of 1 mm, indicating highly reliable mechanical and optical tolerances. These results demonstrate the feasibility of seamless foldable AMOLED displays, with potentially important technical implications on fabricating large size flexible displays.

Evolutionary Significance of Wolbachia-to-Animal Horizontal Gene Transfer: Female Sex Determination and the f Element in the Isopod Armadillidium vulgare.

PubMed

Cordaux, Richard; Gilbert, Clément

2017-07-21

An increasing number of horizontal gene transfer (HGT) events from bacteria to animals have been reported in the past years, many of which involve Wolbachia bacterial endosymbionts and their invertebrate hosts. Most transferred Wolbachia genes are neutrally-evolving fossils embedded in host genomes. A remarkable case of Wolbachia HGT for which a clear evolutionary significance has been demonstrated is the " f element", a nuclear Wolbachia insert involved in female sex determination in the terrestrial isopod Armadillidium vulgare . The f element represents an instance of bacteria-to-animal HGT that has occurred so recently that it was possible to infer the donor (feminizing Wolbachia closely related to the w VulC Wolbachia strain of A. vulgare ) and the mechanism of integration (a nearly complete genome inserted by micro-homology-mediated recombination). In this review, we summarize our current knowledge of the f element and discuss arising perspectives regarding female sex determination, unstable inheritance, population dynamics and the molecular evolution of the f element. Overall, the f element unifies three major areas in evolutionary biology: symbiosis, HGT and sex determination. Its characterization highlights the tremendous impact sex ratio distorters can have on the evolution of sex determination mechanisms and sex chromosomes in animals and plants.

Vecuum: identification and filtration of false somatic variants caused by recombinant vector contamination.

PubMed

Kim, Junho; Maeng, Ju Heon; Lim, Jae Seok; Son, Hyeonju; Lee, Junehawk; Lee, Jeong Ho; Kim, Sangwoo

2016-10-15

Advances in sequencing technologies have remarkably lowered the detection limit of somatic variants to a low frequency. However, calling mutations at this range is still confounded by many factors including environmental contamination. Vector contamination is a continuously occurring issue and is especially problematic since vector inserts are hardly distinguishable from the sample sequences. Such inserts, which may harbor polymorphisms and engineered functional mutations, can result in calling false variants at corresponding sites. Numerous vector-screening methods have been developed, but none could handle contamination from inserts because they are focusing on vector backbone sequences alone. We developed a novel method-Vecuum-that identifies vector-originated reads and resultant false variants. Since vector inserts are generally constructed from intron-less cDNAs, Vecuum identifies vector-originated reads by inspecting the clipping patterns at exon junctions. False variant calls are further detected based on the biased distribution of mutant alleles to vector-originated reads. Tests on simulated and spike-in experimental data validated that Vecuum could detect 93% of vector contaminants and could remove up to 87% of variant-like false calls with 100% precision. Application to public sequence datasets demonstrated the utility of Vecuum in detecting false variants resulting from various types of external contamination. Java-based implementation of the method is available at http://vecuum.sourceforge.net/ CONTACT: swkim@yuhs.acSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Hypersurface Insertion Window for Long Term Orbital Stability of Artificial Satellites About the Planet Venus

DTIC Science & Technology

1988-12-01

Conversion of the Geopotential into the Modified Orbital Elements 83 Appendix C: Useful Derivatives for the Geopotential Calculations 87 Appendix D...replaced by two equinoctial elements , h and k (from a coordinate system with singularities at i = x and for rectilinear orbits ). Also, for long term 3...0. 10 and 0.55 i 15.5) a more well behaved set of variables will be used: two of the equinoctial elements , h and k. These elements eliminate the

Three new insertion sequence elements ISLdl2, ISLdl3, and ISLdl4 in Lactobacillus delbrueckii: isolation, molecular characterization, and potential use for strain identification.

PubMed

Ravin, Victor; Alatossava, Tapani

2003-05-01

A group of new insertion sequence (IS) elements, ISLdl2, ISLdl3, and ISLdl4, from Lactobacillus delbrueckii subsp. lactis ATCC 15808 was isolated, characterized, and used for strain identification together with ISLdl1, recently characterized as an L. delbrueckii IS element belonging to the ISL3 family. ISLdl2 was 1367 bp in size and had a 24 bp IR and an 8 bp DR. The single ORF of ISLdl2 encoded a protein of 392 aa similar to transposases of the IS256 family. ISLdl3 had a single ORF encoding a protein of 343 aa similar to transposases of the IS30 family. Finally, ISLdl4 had a single ORF encoding a protein of 406 aa and displayed homology to the transposases of the IS110 family. ISLdl4 was only slight different from ISL4 (Accession No. AY040213). ISLdl1, ISLdl2, and ISLdl4 were present in all of the 10 L. delbrueckii subsp. lactis and subsp. delbrueckii strains tested, as well as in three of the 11 L. delbrueckii subsp. bulgaricus strains tested. ISLdl3 was present only in four closely related strains of L. delbrueckii subsp. lactis. These IS elements were not observed in Lactobacillus rhamnosus, Lactobacillus acidophilus, Lactobacillus helveticus, or Lactobacillus plantarum. A cluster of IS elements, ISLdl1, ISLdl2, ISLdl3, ISLdl4, and ISL6, was observed in L. delbrueckii subsp. lactis strain ATCC 15808. Within this cluster, ISLdl4 was inserted into ISLdl1 between the left IR and the start codon of ORF455, encoding a putative transposase. Most of the integration sites of the IS elements were strain-specific. We have observed that IS elements can migrate from one strain to another as integral parts of bacterial DNA by using phage LL-H as a vehicle. We demonstrate for the first time that inverse PCR and vectorette PCR methods with primers based on sequences of the IS elements could be used for identification of L. delbrueckii strains.

A ribosomal orphon sequence from Xenopus laevis flanked by novel low copy number repetitive elements.

PubMed

Guimond, A; Moss, T

1999-02-01

We have used a differential cloning approach to isolate ribosomal/non-ribosomal frontier sequences from Xenopus laevis. A ribosomal intergenic spacer sequence (IGS) was cloned and shown not to be physically linked with the ribosomal locus. This ribosomal orphon contained the IGS sequences found immediately downstream of the 28S gene and included an array of enhancer repetitions and a non-functional spacer promoter. The orphon sequence was flanked by a member of the novel 'Frt' low copy repetitive element family. Three individual Frt repeats were sequenced and all members of this family were shown to lie clustered at two chromosomal sites, one of which contained the ribosomal orphon. One of the Frt elements contained an insertion of 297 bp that showed extensive homology to sequences within at least three other Xenopus genes. Each homology region was flanked by members of the T2 family of short interspersed repetitive elements, (SINEs), and by its target insertion sequence, suggesting multiple translocation events. The data are discussed in terms of the evolution of the ribosomal gene locus.

Magnetotransport properties of spin-valve structures with Mg spacer layers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinez-Boubeta, C., E-mail: cboubeta@gmail.com; Ferrante, Y.; Graduate School of Excellence, Materials Science in Mainz, 55128 Mainz

2015-01-19

A theoretical prediction by Wang et al. [Phys. Rev. B 82, 054405 (2010)] suggests the preferential transmission of majority-spin states with Δ{sub 1} symmetry across a magnesium interlayer in Fe/Mg/MgO/Fe based magnetic tunnel junctions. Here, we report experiments to probe this question in CoFe/Mg/CoFe structures. We find that the strength of the interlayer coupling decays exponentially with increasing the spacer thickness, however, a non-monotonic variation of the magnetoresistance as a function of the Mg layer is observed. These data may help revisit the role of the insertion of a Mg interface layer in MgO-based devices.

Coax-to-channelised coplanar waveguide in-phase N-way, radial power divider

NASA Technical Reports Server (NTRS)

Simons, R. N.; Ponchak, G. E.

1990-01-01

A novel nonplanar, wideband power divider which makes use of a coax-to-CCPW transition is demonstrated. The transition utilizes a coaxial transformer whose outer conductor is slotted along the length for RF power division and also for exciting the CCPWs in equal amplitude and phase at the radial junction. The measured (8-16 GHz) excess insertion loss at the output ports is 0.5 dB for a four-way divider. The amplitude and phase balance are within 0.5 dB and 5 deg, respectively. The power divider should find applications in the feed network of phased arrays.

Huge maternal hydronephrosis: a rare complication in pregnancy.

PubMed

Peng, Hsiu-Huei; Wang, Chin-Jung; Yen, Chih-Feng; Chou, Chien-Chung; Lee, Chyi-Long

2003-06-10

A huge maternal hydronephrosis is uncommon in pregnancy and might be mistaken as a pelvic mass. A 21-year-old primigravida was noted at 25th week of gestation to have a visible bulging mass on her left flank. The mass was originally mistaken as a large ovarian cyst but later proved to be a huge hydronephrosis. Retrograde insertion of ureteroscope and a ureteric stent failed, so we performed repeated ultrasound-guided needle aspiration to decompress the huge hydronephrosis, which enabled the patient to proceed to a successful term vaginal delivery. Nephrectomy was performed after delivery and proved the diagnosis of congenital ureteropelvic junction obstruction.

High voltage load resistor array

DOEpatents

Lehmann, Monty Ray [Smithfield, VA

2005-01-18

A high voltage resistor comprising an array of a plurality of parallel electrically connected resistor elements each containing a resistive solution, attached at each end thereof to an end plate, and about the circumference of each of the end plates, a corona reduction ring. Each of the resistor elements comprises an insulating tube having an electrode inserted into each end thereof and held in position by one or more hose clamps about the outer periphery of the insulating tube. According to a preferred embodiment, the electrode is fabricated from stainless steel and has a mushroom shape at one end, that inserted into the tube, and a flat end for engagement with the end plates that provides connection of the resistor array and with a load.

Statistics of the quantized microwave electromagnetic field in mesoscopic elements at low temperature

NASA Astrophysics Data System (ADS)

Virally, Stéphane; Olivier Simoneau, Jean; Lupien, Christian; Reulet, Bertrand

2018-03-01

The quantum behavior of the electromagnetic field in mesoscopic elements is intimately linked to the quantization of the charge. In order to probe nonclassical aspects of the field in those elements, it is essential that thermal noise be reduced to the quantum level, i.e. to scales where kT ≲ hν. This is easily achieved in dilution refrigerators for frequencies of a few GHz, i.e. in the microwave domain. Several recent experiments have highlighted the link between discrete charge transport and discrete photon emission in simple mesoscopic elements such as a tunnel junction. Photocount statistics are inferred from the measurement of continuous variables such as the quadratures of the field.

The end of the LINE?: lack of recent L1 activity in a group of South American rodents.

PubMed Central

Casavant, N C; Scott, L; Cantrell, M A; Wiggins, L E; Baker, R J; Wichman, H A

2000-01-01

L1s (LINE-1: Long Interspersed Nuclear Element 1) are present in all mammals examined to date. They occur in both placental mammals and marsupials and thus are thought to have been present in the genome prior to the mammalian radiation. This unusual conservation of a transposable element family for over 100 million years has led to speculation that these elements provide an advantage to the genomes they inhabit. We have recently identified a group of South American rodents, including rice rats (Oryzomys), in which L1s appear to be quiescent or extinct. Several observations support this conclusion. First, genomic Southern blot analysis fails to reveal genus-specific bands in Oryzomys. Second, we were unable to find recently inserted elements. Procedures to enrich for young elements did not yield any with an intact open reading frame for reverse transcriptase; all elements isolated had numerous insertions, deletions, and stop codons. Phylogenetic analysis failed to yield species-specific clusters among the L1 elements isolated, and all Oryzomys sequences had numerous private mutations. Finally, in situ hybridization of L1 to Oryzomys chromosomes failed to reveal the characteristic L1 distribution in Oryzomys with either a homologous or heterologous probe. Thus, Oryzomys is a viable candidate for L1 extinction from a mammalian host. PMID:10747071

Carbon Nanotube Based Molecular Electronics

NASA Technical Reports Server (NTRS)

Srivastava, Deepak; Saini, Subhash; Menon, Madhu

1998-01-01

Carbon nanotubes and the nanotube heterojunctions have recently emerged as excellent candidates for nanoscale molecular electronic device components. Experimental measurements on the conductivity, rectifying behavior and conductivity-chirality correlation have also been made. While quasi-one dimensional simple heterojunctions between nanotubes with different electronic behavior can be generated by introduction of a pair of heptagon-pentagon defects in an otherwise all hexagon graphene sheet. Other complex 3- and 4-point junctions may require other mechanisms. Structural stability as well as local electronic density of states of various nanotube junctions are investigated using a generalized tight-binding molecular dynamics (GDBMD) scheme that incorporates non-orthogonality of the orbitals. The junctions investigated include straight and small angle heterojunctions of various chiralities and diameters; as well as more complex 'T' and 'Y' junctions which do not always obey the usual pentagon-heptagon pair rule. The study of local density of states (LDOS) reveal many interesting features, most prominent among them being the defect-induced states in the gap. The proposed three and four pointjunctions are one of the smallest possible tunnel junctions made entirely of carbon atoms. Furthermore the electronic behavior of the nanotube based device components can be taylored by doping with group III-V elements such as B and N, and BN nanotubes as a wide band gap semiconductor has also been realized in experiments. Structural properties of heteroatomic nanotubes comprising C, B and N will be discussed.

Characterization of a new high copy Stowaway family MITE, BRAMI-1 in Brassica genome

PubMed Central

2013-01-01

Background Miniature inverted-repeat transposable elements (MITEs) are expected to play important roles in evolution of genes and genome in plants, especially in the highly duplicated plant genomes. Various MITE families and their roles in plants have been characterized. However, there have been fewer studies of MITE families and their potential roles in evolution of the recently triplicated Brassica genome. Results We identified a new MITE family, BRAMI-1, belonging to the Stowaway super-family in the Brassica genome. In silico mapping revealed that 697 members are dispersed throughout the euchromatic regions of the B. rapa pseudo-chromosomes. Among them, 548 members (78.6%) are located in gene-rich regions, less than 3 kb from genes. In addition, we identified 516 and 15 members in the 470 Mb and 15 Mb genomic shotgun sequences currently available for B. oleracea and B. napus, respectively. The resulting estimated copy numbers for the entire genomes were 1440, 1464 and 2490 in B. rapa, B. oleracea and B. napus, respectively. Concurrently, only 70 members of the related Arabidopsis ATTIRTA-1 MITE family were identified in the Arabidopsis genome. Phylogenetic analysis revealed that BRAMI-1 elements proliferated in the Brassica genus after divergence from the Arabidopsis lineage. MITE insertion polymorphism (MIP) was inspected for 50 BRAMI-1 members, revealing high levels of insertion polymorphism between and within species of Brassica that clarify BRAMI-1 activation periods up to the present. Comparative analysis of the 71 genes harbouring the BRAMI-1 elements with their non-insertion paralogs (NIPs) showed that the BRAMI-1 insertions mainly reside in non-coding sequences and that the expression levels of genes with the elements differ from those of their NIPs. Conclusion A Stowaway family MITE, named as BRAMI-1, was gradually amplified and remained present in over than 1400 copies in each of three Brassica species. Overall, 78% of the members were identified in gene-rich regions, and it is assumed that they may contribute to the evolution of duplicated genes in the highly duplicated Brassica genome. The resulting MIPs can serve as a good source of DNA markers for Brassica crops because the insertions are highly dispersed in the gene-rich euchromatin region and are polymorphic between or within species. PMID:23547712

CAVEOLIN-1 REGULATES HIV-1 TAT-INDUCED ALTERATIONS OF TIGHT JUNCTION PROTEIN EXPRESSION VIA MODULATION OF THE RAS SIGNALING

PubMed Central

Zhong, Yu; Smart, Eric J.; Weksler, Babette; Couraud, Pierre-Olivier; Hennig, Bernhard; Toborek, Michal

2009-01-01

The blood-brain barrier (BBB) is the critical structure for preventing HIV trafficking into the brain. Specific HIV proteins, such as Tat protein, can contribute to the dysfunction of tight junctions at the BBB and HIV entry into the brain. Tat is released by HIV-1 infected cells and can interact with a variety of cell surface receptors activating several signal transduction pathways, including those localized in caveolae. The present study focused on the mechanisms of Tat-induced caveolae-associated Ras signaling at the level of the BBB. Treatment with Tat activated the Ras pathway in human brain microvascular endothelial cells (HBMEC). However, caveolin-1 silencing markedly attenuated these effects. Because the integrity of the brain endothelium is regulated by intercellular tight junctions, these structural elements of the BBB were also evaluated in the present study. Exposure to Tat diminished the expression of several tight junction proteins, namely, occludin, zonula occludens (ZO)-1, and ZO-2 in the caveolar fraction of HBMEC. These effects were effectively protected by pharmacological inhibition of the Ras signaling and by silencing of caveolin-1. The present data indicate the importance of caveolae-associated signaling in the disruption of tight junctions upon Tat exposure. They also demonstrate that caveolin-1 may constitute an early and critical modulator that controls signaling pathways leading to the disruption of tight junction proteins. Thus, caveolin-1 may provide an effective target to protect against Tat-induced HBMEC dysfunction and the disruption of the BBB in HIV-1-infected patients. PMID:18667611

Catheter ablation as a treatment of atrioventricular block.

PubMed

Tuohy, Stephen; Saliba, Walid; Pai, Manjunath; Tchou, Patrick

2018-01-01

Symptomatic second-degree atrioventricular (AV) block is typically treated by implantation of a pacemaker. An otherwise healthy AV conduction system can nevertheless develop AV block due to interference from junctional extrasystoles. When present with a high burden, these can produce debilitating symptoms from AV block despite an underlying normal AV node and His-Purkinje system properties. The purpose of this study was to describe a catheter ablation approach for alleviating symptomatic AV block due to a ventricular nodal pathway interfering with AV conduction. Common clinical monitoring techniques such as Holter and event recorders were used. Standard electrophysiological study techniques using multipolar recording and ablation catheters were utilized during procedures. A 55-year-old woman presented with highly symptomatic, high-burden second-degree AV block due to concealed and manifest junctional premature beats. Electrophysiological characteristics indicated interference of AV conduction due to a concealed ventricular nodal pathway as the cause of the AV block. The patient's AV nodal and His-Purkinje system conduction characteristics were otherwise normal. Radiofrequency catheter ablation of the pathway was successful in restoring normal AV conduction and eliminating her clinical symptoms. Pathways inserting into the AV junction can interfere with AV conduction. When present at a high burden, this type of AV block can be highly symptomatic. Catheter ablation techniques can be used to alleviate this type of AV block and restore normal AV conduction. Copyright © 2017 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

Examination of Msh6- and Msh3-deficient mice in class switching reveals overlapping and distinct roles of MutS homologues in antibody diversification.

PubMed

Li, Ziqiang; Scherer, Stefan J; Ronai, Diana; Iglesias-Ussel, Maria D; Peled, Jonathan U; Bardwell, Philip D; Zhuang, Min; Lee, KyeRyoung; Martin, Alberto; Edelmann, Winfried; Scharff, Matthew D

2004-07-05

Somatic hypermutation and class switch recombination (CSR) contribute to the somatic diversification of antibodies. It has been shown that MutS homologue (Msh)6 (in conjunction with Msh2) but not Msh3 is involved in generating A/T base substitutions in somatic hypermutation. However, their roles in CSR have not yet been reported. Here we show that Msh6(-)(/)(-) mice have a decrease in CSR, whereas Msh3(-)(/)(-) mice do not. When switch regions were analyzed for mutations, deficiency in Msh6 was associated with an increase in transition mutations at G/C basepairs, mutations at RGYW/WRCY hotspots, and a small increase in the targeting of G/C bases. In addition, Msh6(-)(/)(-) mice exhibited an increase in the targeting of recombination sites to GAGCT/GGGGT consensus repeats and hotspots in Sgamma3 but not in Smicro. In contrast to Msh2(-)(/)(-) mice, deficiency in Msh6 surprisingly did not change the characteristics of Smicro-Sgamma3 switch junctions. However, Msh6(-)(/)(-) mice exhibited a change in the positioning of Smicro and Sgamma3 junctions. Although none of these changes were seen in Msh3(-)(/)(-) mice, they had a higher percentage of large inserts in their switch junctions. Together, our data suggest that MutS homologues Msh2, Msh3, and Msh6 play overlapping and distinct roles during antibody diversification processes.

Cell Geometry Guides the Dynamic Targeting of Apoplastic GPI-Linked Lipid Transfer Protein to Cell Wall Elements and Cell Borders in Arabidopsis thaliana

PubMed Central

Wasteneys, Geoffrey

2013-01-01

During cellular morphogenesis, changes in cell shape and cell junction topology are fundamental to normal tissue and organ development. Here we show that apoplastic Glycophosphatidylinositol (GPI)-anchored Lipid Transfer Protein (LTPG) is excluded from cell junctions and flat wall regions, and passively accumulates around their borders in the epidermal cells of Arabidopsis thaliana. Beginning with intense accumulation beneath highly curved cell junction borders, this enrichment is gradually lost as cells become more bulbous during their differentiation. In fully mature epidermal cells, YFP-LTPG often shows a fibrous cellulose microfibril-like pattern within the bulging outer faces. Physical contact between a flat glass surface and bulbous cell surface induces rapid and reversible evacuation from contact sites and accumulation to the curved wall regions surrounding the contact borders. Thus, LTPG distribution is dynamic, responding to changes in cell shape and wall curvature during cell growth and differentiation. We hypothesize that this geometry-based mechanism guides wax-carrying LTPG to functional sites, where it may act to “seal” the vulnerable border surrounding cell-cell junctions and assist in cell wall fortification and cuticular wax deposition. PMID:24260561

Fully porous GaN p-n junction diodes fabricated by chemical vapor deposition.

PubMed

Bilousov, Oleksandr V; Carvajal, Joan J; Geaney, Hugh; Zubialevich, Vitaly Z; Parbrook, Peter J; Martínez, Oscar; Jiménez, Juan; Díaz, Francesc; Aguiló, Magdalena; O'Dwyer, Colm

2014-10-22

Porous GaN based LEDs produced by corrosion etching techniques demonstrated enhanced light extraction efficiency in the past. However, these fabrication techniques require further postgrown processing steps, which increases the price of the final system. Also, the penetration depth of these etching techniques is limited, and affects not only the semiconductor but also the other elements constituting the LED when applied to the final device. In this paper, we present the fabrication of fully porous GaN p-n junctions directly during growth, using a sequential chemical vapor deposition (CVD) process to produce the different layers that form the p-n junction. We characterized their diode behavior from room temperature to 673 K and demonstrated their ability as current rectifiers, thus proving the potential of these fully porous p-n junctions for diode and LEDs applications. The electrical and luminescence characterization confirm that high electronic quality porous structures can be obtained by this method, and we believe this investigation can be extended to other III-N materials for the development of white light LEDs, or to reduce reflection losses and narrowing the output light cone for improved LED external quantum efficiencies.

Research on the method of establishing the total radiation meter calibration device

NASA Astrophysics Data System (ADS)

Gao, Jianqiang; Xia, Ming; Xia, Junwen; Zhang, Dong

2015-10-01

Pyranometer is an instrument used to measure the solar radiation, according to pyranometer differs as installation state, can be respectively measured total solar radiation, reflected radiation, or with the help of shading device for measuring scattering radiation. Pyranometer uses the principle of thermoelectric effect, inductive element adopts winding plating type multi junction thermopile, its surface is coated with black coating with high absorption rate. Hot junction in the induction surface, while the cold junction is located in the body, the cold and hot junction produce thermoelectric potential. In the linear range, the output signal is proportional to the solar irradiance. Traceability to national meteorological station, as the unit of the national legal metrology organizations, the responsibility is to transfer value of the sun and the earth radiation value about the national meteorological industry. Using the method of comparison, with indoor calibration of solar simulator, at the same location, standard pyranometer and measured pyranometer were alternately measured radiation irradiance, depending on the irradiation sensitivity standard pyranometer were calculated the radiation sensitivity of measured pyranometer. This paper is mainly about the design and calibration method of the pyranometer indoor device. The uncertainty of the calibration result is also evaluated.

Experiments with BECs in a Painted Potential: Atom SQUID, Matter Wave Bessel Beams, and Matter Wave Circuits

NASA Astrophysics Data System (ADS)

Boshier, Malcolm; Ryu, Changhyun; Blackburn, Paul; Blinova, Alina; Henderson, Kevin

2014-05-01

The painted potential is a time-averaged optical dipole potential which is able to create arbitrary and dynamic two dimensional potentials for Bose Einstein condensates (BECs). This poster reports three recent experiments using this technique. First, we have realized the dc atom SQUID geometry of a BEC in a toroidal trap with two Josephson junctions. We observe Josephson effects, measure the critical current of the junctions, and find dynamic behavior that is in good agreement with the simple Josephson equations for a tunnel junction with the ideal sinusoidal current-phase relation expected for the parameters of the experiment. Second, we have used free expansion of a rotating toroidal BEC to create matter wave Bessel beams, which are of interest because perfect Bessel beams (plane waves with amplitude profiles described by Bessel functions) propagate without diffraction. Third, we have realized the basic circuit elements necessary to create complex matter wave circuits. We launch BECs at arbitrary velocity along straight waveguides, propagate them around curved waveguides and stadium-shaped waveguide traps, and split them coherently at y-junctions that can also act as switches. Supported by LANL/LDRD.

Genome-wide analysis of short interspersed nuclear elements SINES revealed high sequence conservation, gene association and retrotranspositional activity in wheat

PubMed Central

Ben-David, Smadar; Yaakov, Beery; Kashkush, Khalil

2013-01-01

Short interspersed nuclear elements (SINEs) are non-autonomous non-LTR retroelements that are present in most eukaryotic species. While SINEs have been intensively investigated in humans and other animal systems, they are poorly studied in plants, especially in wheat (Triticum aestivum). We used quantitative PCR of various wheat species to determine the copy number of a wheat SINE family, termed Au SINE, combined with computer-assisted analyses of the publicly available 454 pyrosequencing database of T. aestivum. In addition, we utilized site-specific PCR on 57 Au SINE insertions, transposon methylation display and transposon display on newly formed wheat polyploids to assess retrotranspositional activity, epigenetic status and genetic rearrangements in Au SINE, respectively. We retrieved 3706 different insertions of Au SINE from the 454 pyrosequencing database of T. aestivum, and found that most of the elements are inserted in A/T-rich regions, while approximately 38% of the insertions are associated with transcribed regions, including known wheat genes. We observed typical retrotransposition of Au SINE in the second generation of a newly formed wheat allohexaploid, and massive hypermethylation in CCGG sites surrounding Au SINE in the third generation. Finally, we observed huge differences in the copy numbers in diploid Triticum and Aegilops species, and a significant increase in the copy numbers in natural wheat polyploids, but no significant increase in the copy number of Au SINE in the first four generations for two of three newly formed allopolyploid species used in this study. Our data indicate that SINEs may play a prominent role in the genomic evolution of wheat through stress-induced activation. PMID:23855320

Genome-wide analysis of short interspersed nuclear elements SINES revealed high sequence conservation, gene association and retrotranspositional activity in wheat.

PubMed

Ben-David, Smadar; Yaakov, Beery; Kashkush, Khalil

2013-10-01

Short interspersed nuclear elements (SINEs) are non-autonomous non-LTR retroelements that are present in most eukaryotic species. While SINEs have been intensively investigated in humans and other animal systems, they are poorly studied in plants, especially in wheat (Triticum aestivum). We used quantitative PCR of various wheat species to determine the copy number of a wheat SINE family, termed Au SINE, combined with computer-assisted analyses of the publicly available 454 pyrosequencing database of T. aestivum. In addition, we utilized site-specific PCR on 57 Au SINE insertions, transposon methylation display and transposon display on newly formed wheat polyploids to assess retrotranspositional activity, epigenetic status and genetic rearrangements in Au SINE, respectively. We retrieved 3706 different insertions of Au SINE from the 454 pyrosequencing database of T. aestivum, and found that most of the elements are inserted in A/T-rich regions, while approximately 38% of the insertions are associated with transcribed regions, including known wheat genes. We observed typical retrotransposition of Au SINE in the second generation of a newly formed wheat allohexaploid, and massive hypermethylation in CCGG sites surrounding Au SINE in the third generation. Finally, we observed huge differences in the copy numbers in diploid Triticum and Aegilops species, and a significant increase in the copy numbers in natural wheat polyploids, but no significant increase in the copy number of Au SINE in the first four generations for two of three newly formed allopolyploid species used in this study. Our data indicate that SINEs may play a prominent role in the genomic evolution of wheat through stress-induced activation. © 2013 Ben-Gurion University The Plant Journal © 2013 John Wiley & Sons Ltd.

Evolutionary genomics of miniature inverted-repeat transposable elements (MITEs) in Brassica.

PubMed

Nouroz, Faisal; Noreen, Shumaila; Heslop-Harrison, J S

2015-12-01

Miniature inverted-repeat transposable elements (MITEs) are truncated derivatives of autonomous DNA transposons, and are dispersed abundantly in most eukaryotic genomes. We aimed to characterize various MITEs families in Brassica in terms of their presence, sequence characteristics and evolutionary activity. Dot plot analyses involving comparison of homoeologous bacterial artificial chromosome (BAC) sequences allowed identification of 15 novel families of mobile MITEs. Of which, 5 were Stowaway-like with TA Target Site Duplications (TSDs), 4 Tourist-like with TAA/TTA TSDs, 5 Mutator-like with 9-10 bp TSDs and 1 novel MITE (BoXMITE1) flanked by 3 bp TSDs. Our data suggested that there are about 30,000 MITE-related sequences in Brassica rapa and B. oleracea genomes. In situ hybridization showed one abundant family was dispersed in the A-genome, while another was located near 45S rDNA sites. PCR analysis using primers flanking sequences of MITE elements detected MITE insertion polymorphisms between and within the three Brassica (AA, BB, CC) genomes, with many insertions being specific to single genomes and others showing evidence of more recent evolutionary insertions. Our BAC sequence comparison strategy enables identification of evolutionarily active MITEs with no prior knowledge of MITE sequences. The details of MITE families reported in Brassica enable their identification, characterization and annotation. Insertion polymorphisms of MITEs and their transposition activity indicated important mechanism of genome evolution and diversification. MITE families derived from known Mariner, Harbinger and Mutator DNA transposons were discovered, as well as some novel structures. The identification of Brassica MITEs will have broad applications in Brassica genomics, breeding, hybridization and phylogeny through their use as DNA markers.

Contribution of transposable elements in the plant's genome.

PubMed

Sahebi, Mahbod; Hanafi, Mohamed M; van Wijnen, Andre J; Rice, David; Rafii, M Y; Azizi, Parisa; Osman, Mohamad; Taheri, Sima; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat; Noor, Yusuf Muhammad

2018-07-30

Plants maintain extensive growth flexibility under different environmental conditions, allowing them to continuously and rapidly adapt to alterations in their environment. A large portion of many plant genomes consists of transposable elements (TEs) that create new genetic variations within plant species. Different types of mutations may be created by TEs in plants. Many TEs can avoid the host's defense mechanisms and survive alterations in transposition activity, internal sequence and target site. Thus, plant genomes are expected to utilize a variety of mechanisms to tolerate TEs that are near or within genes. TEs affect the expression of not only nearby genes but also unlinked inserted genes. TEs can create new promoters, leading to novel expression patterns or alternative coding regions to generate alternate transcripts in plant species. TEs can also provide novel cis-acting regulatory elements that act as enhancers or inserts within original enhancers that are required for transcription. Thus, the regulation of plant gene expression is strongly managed by the insertion of TEs into nearby genes. TEs can also lead to chromatin modifications and thereby affect gene expression in plants. TEs are able to generate new genes and modify existing gene structures by duplicating, mobilizing and recombining gene fragments. They can also facilitate cellular functions by sharing their transposase-coding regions. Hence, TE insertions can not only act as simple mutagens but can also alter the elementary functions of the plant genome. Here, we review recent discoveries concerning the contribution of TEs to gene expression in plant genomes and discuss the different mechanisms by which TEs can affect plant gene expression and reduce host defense mechanisms. Copyright © 2018 Elsevier B.V. All rights reserved.

Investigation of the structure and properties of a composite insert applied at laser welding of steel with titanium

NASA Astrophysics Data System (ADS)

Pugacheva, N. B.; Cherepanov, A. N.; Orishich, A. M.; Malikov, A. G.; Drozdov, V. O.; Mali, V. I.; Senaeva, E. I.

2017-10-01

Production of welded bimetallic structures of titanium and steel using a laser beam is a very urgent and important task in the shipbuilding, airspace and power engineering. Laser welding using an intermediate insert is one of the ways to solve this problem. In this paper, we present the results of experimental studies of formation of the structure and properties of composite insert, obtained by explosion welding, after its application at laser welding steel with titanium. A study of a four-layer composite insert obtained by explosion welding showed that it has no brittle intermetallic phases and defects in the form of cracks and pores. The boundaries between the plates to be welded in the composite insert have a characteristic wavy structure with narrow zones of mutual diffusion penetration of elements of the adjacent metals. It is established that the strength of the composite insert is comparable with the maximum strength of Grade 4 alloy, and the destruction of the product during the tensile tests in most cases occurred along the weakest component of the composite insert, i.e. the copper layer, whose strength was significantly increased due to the hardening that took place in the explosion welding.

Gene leopard nuclei (len P103) participating in control of disjunction and coiling of chromosomes in Drosophila

DOE Office of Scientific and Technical Information (OSTI.GOV)

Omel`yanchuk, L.V.

1995-12-01

A lethal insertion of an element P[lArB], which caused nondisjunction and structural abnormalities in chromosomes in the neuroblasts of homozygous larvae, was found. The insertion was mapped to region 57B1-12 of the polytene map of chromosome 2 of Drosophila. The expression of the corresponding gene was found in testes, ovaries, and neural ganglia. 8 refs., 6 figs.

Shingle system

DOEpatents

Dinwoodie, Thomas L [Piedmont, CA

2008-02-12

A barrier, such as a PV module, is secured to a base by a support to create a shingle assembly with a venting region defined between the barrier and base for temperature regulation. Water resistant junctions may be formed between the bases of adjacent shingle assemblies of an array of shingle assemblies. The base may include an insulation layer underlying a water barrier. The base may also include a waterproofing element; the width and height of the barrier may be shorter than the width and height of the waterproofing element.

New Insights into the Classification and Integration Specificity of Streptococcus Integrative Conjugative Elements through Extensive Genome Exploration

PubMed Central

Ambroset, Chloé; Coluzzi, Charles; Guédon, Gérard; Devignes, Marie-Dominique; Loux, Valentin; Lacroix, Thomas; Payot, Sophie; Leblond-Bourget, Nathalie

2016-01-01

Recent genome analyses suggest that integrative and conjugative elements (ICEs) are widespread in bacterial genomes and therefore play an essential role in horizontal transfer. However, only a few of these elements are precisely characterized and correctly delineated within sequenced bacterial genomes. Even though previous analysis showed the presence of ICEs in some species of Streptococci, the global prevalence and diversity of ICEs was not analyzed in this genus. In this study, we searched for ICEs in the completely sequenced genomes of 124 strains belonging to 27 streptococcal species. These exhaustive analyses revealed 105 putative ICEs and 26 slightly decayed elements whose limits were assessed and whose insertion site was identified. These ICEs were grouped in seven distinct unrelated or distantly related families, according to their conjugation modules. Integration of these streptococcal ICEs is catalyzed either by a site-specific tyrosine integrase, a low-specificity tyrosine integrase, a site-specific single serine integrase, a triplet of site-specific serine integrases or a DDE transposase. Analysis of their integration site led to the detection of 18 target-genes for streptococcal ICE insertion including eight that had not been identified previously (ftsK, guaA, lysS, mutT, rpmG, rpsI, traG, and ebfC). It also suggests that all specificities have evolved to minimize the impact of the insertion on the host. This overall analysis of streptococcal ICEs emphasizes their prevalence and diversity and demonstrates that exchanges or acquisitions of conjugation and recombination modules are frequent. PMID:26779141

New Insights into the Classification and Integration Specificity of Streptococcus Integrative Conjugative Elements through Extensive Genome Exploration.

PubMed

Ambroset, Chloé; Coluzzi, Charles; Guédon, Gérard; Devignes, Marie-Dominique; Loux, Valentin; Lacroix, Thomas; Payot, Sophie; Leblond-Bourget, Nathalie

2015-01-01

Recent genome analyses suggest that integrative and conjugative elements (ICEs) are widespread in bacterial genomes and therefore play an essential role in horizontal transfer. However, only a few of these elements are precisely characterized and correctly delineated within sequenced bacterial genomes. Even though previous analysis showed the presence of ICEs in some species of Streptococci, the global prevalence and diversity of ICEs was not analyzed in this genus. In this study, we searched for ICEs in the completely sequenced genomes of 124 strains belonging to 27 streptococcal species. These exhaustive analyses revealed 105 putative ICEs and 26 slightly decayed elements whose limits were assessed and whose insertion site was identified. These ICEs were grouped in seven distinct unrelated or distantly related families, according to their conjugation modules. Integration of these streptococcal ICEs is catalyzed either by a site-specific tyrosine integrase, a low-specificity tyrosine integrase, a site-specific single serine integrase, a triplet of site-specific serine integrases or a DDE transposase. Analysis of their integration site led to the detection of 18 target-genes for streptococcal ICE insertion including eight that had not been identified previously (ftsK, guaA, lysS, mutT, rpmG, rpsI, traG, and ebfC). It also suggests that all specificities have evolved to minimize the impact of the insertion on the host. This overall analysis of streptococcal ICEs emphasizes their prevalence and diversity and demonstrates that exchanges or acquisitions of conjugation and recombination modules are frequent.

LINEs, SINEs and other retroelements: do birds of a feather flock together?

PubMed

Roy-Engel, Astrid M

2012-01-01

Mobile elements account for almost half of the mass of the human genome. Only the retroelements from the non-LTR (long terminal repeat) retrotransposon family, which include the LINE-1 (L1) and its non-autonomous partners, are currently active and contributing to new insertions. Although these elements seem to share the same basic amplification mechanism, the activity and success of the different types of retroelements varies. For example, Alu-induced mutagenesis is responsible for the majority of the documented instances of human disease induced by insertion of retroelements. Using copy number in mammals as an indicator, some SINEs have been vastly more successful than other retroelements, such as the retropseudogenes and even L1, likely due to differences in post-insertion selection and ability to overcome cellular controls. SINE and LINE integration can be differentially influenced by cellular factors, indicating some differences between in their amplification mechanisms. We focus on the known aspects of this group of retroelements and highlight their similarities and differences that may significantly influence their biological impact.

LINEs, SINEs and other retroelements: do birds of a feather flock together?

PubMed Central

Roy-Engel, Astrid M.

2012-01-01

Mobile elements account for almost half of the mass of the human genome. Only the retroelements from the non-LTR (long terminal repeat) retrotransposon family, which include the LINE-1 (L1) and its non-autonomous partners, are currently active and contributing to new insertions. Although these elements seem to share the same basic amplification mechanism, the activity and success of the different types of retroelements varies. For example, Alu-induced mutagenesis is responsible for the majority of the documented instances of human disease induced by insertion of retroelements. Using copy number in mammals as an indicator, some SINEs have been vastly more successful than other retroelements, such as the retropseudogenes and even L1, likely due to differences in post-insertion selection and ability to overcome cellular controls. SINE and LINE integration can be differentially influenced by cellular factors, indicating some differences between in their amplification mechanisms. We focus on the known aspects of this group of retroelements and highlight their similarities and differences that may significantly influence their biological impact. PMID:22201808

Targeted gene insertion for molecular medicine.

PubMed

Voigt, Katrin; Izsvák, Zsuzsanna; Ivics, Zoltán

2008-11-01

Genomic insertion of a functional gene together with suitable transcriptional regulatory elements is often required for long-term therapeutical benefit in gene therapy for several genetic diseases. A variety of integrating vectors for gene delivery exist. Some of them exhibit random genomic integration, whereas others have integration preferences based on attributes of the targeted site, such as primary DNA sequence and physical structure of the DNA, or through tethering to certain DNA sequences by host-encoded cellular factors. Uncontrolled genomic insertion bears the risk of the transgene being silenced due to chromosomal position effects, and can lead to genotoxic effects due to mutagenesis of cellular genes. None of the vector systems currently used in either preclinical experiments or clinical trials displays sufficient preferences for target DNA sequences that would ensure appropriate and reliable expression of the transgene and simultaneously prevent hazardous side effects. We review in this paper the advantages and disadvantages of both viral and non-viral gene delivery technologies, discuss mechanisms of target site selection of integrating genetic elements (viruses and transposons), and suggest distinct molecular strategies for targeted gene delivery.

Expression of homing endonuclease gene and insertion-like element in sea anemone mitochondrial genomes: Lesson learned from Anemonia viridis.

PubMed

Chi, Sylvia Ighem; Urbarova, Ilona; Johansen, Steinar D

2018-04-30

The mitochondrial genomes of sea anemones are dynamic in structure. Invasion by genetic elements, such as self-catalytic group I introns or insertion-like sequences, contribute to sea anemone mitochondrial genome expansion and complexity. By using next generation sequencing we investigated the complete mtDNAs and corresponding transcriptomes of the temperate sea anemone Anemonia viridis and its closer tropical relative Anemonia majano. Two versions of fused homing endonuclease gene (HEG) organization were observed among the Actiniidae sea anemones; in-frame gene fusion and pseudo-gene fusion. We provided support for the pseudo-gene fusion organization in Anemonia species, resulting in a repressed HEG from the COI-884 group I intron. orfA, a putative protein-coding gene with insertion-like features, was present in both Anemonia species. Interestingly, orfA and COI expression were significantly up-regulated upon long-term environmental stress corresponding to low seawater pH conditions. This study provides new insights to the dynamics of sea anemone mitochondrial genome structure and function. Copyright © 2018 Elsevier B.V. All rights reserved.

Shielded resistive electromagnets of arbitrary surface geometry using the boundary element method and a minimum energy constraint.

PubMed

Harris, Chad T; Haw, Dustin W; Handler, William B; Chronik, Blaine A

2013-09-01

Eddy currents are generated in MR by the use of rapidly switched electromagnets, resulting in time varying and spatially varying magnetic fields that must be either minimized or corrected. This problem is further complicated when non-cylindrical insert magnets are used for specialized applications. Interruption of the coupling between an insert coil and the MR system is typically accomplished using active magnetic shielding. A new method of actively shielding insert gradient and shim coils of any surface geometry by use of the boundary element method for coil design with a minimum energy constraint is presented. This method was applied to shield x- and z-gradient coils for two separate cases: a traditional cylindrical primary gradient with cylindrical shield and, to demonstrate its versatility in surface geometry, the same cylindrical primary gradients with a rectangular box-shaped shield. For the cylindrical case this method produced shields that agreed with analytic solutions. For the second case, the rectangular box-shaped shields demonstrated very good shielding characteristics despite having a different geometry than the primary coils. Copyright © 2013 Elsevier Inc. All rights reserved.

Cloning of a CACTA transposon-like insertion in intron I of tomato invertase Lin5 gene and identification of transposase-like sequences of Solanaceae species.

PubMed

Proels, Reinhard K; Roitsch, Thomas

2006-03-01

Very few CACTA transposon-like sequences have been described in Solanaceae species. Sequence information has been restricted to partial transposase (TPase)-like fragments, and no target gene of CACTA-like transposon insertion has been described in tomato to date. In this manuscript, we report on a CACTA transposon-like insertion in intron I of tomato (Lycopersicon esculentum) invertase gene Lin5 and TPase-like sequences of several Solanaceae species. Consensus primers deduced from the TPase region of the tomato CACTA transposon-like element allowed the amplification of similar sequences from various Solanaceae species of different subfamilies including Solaneae (Solanum tuberosum), Cestreae (Nicotiana tabacum) and Datureae (Datura stramonium). This demonstrates the ubiquitous presence of CACTA-like elements in Solanaceae genomes. The obtained partial sequences are highly conserved, and allow further detection and detailed analysis of CACTA-like transposons throughout Solanaceae species. CACTA-like transposon sequences make possible the evaluation of their use for genome analysis, functional studies of genes and the evolutionary relationships between plant species.

The mechano-sensing role of the unique SH3 insertion in plakin domains revealed by Molecular Dynamics simulations.

PubMed

Daday, Csaba; Kolšek, Katra; Gräter, Frauke

2017-09-15

The plakin family of proteins, important actors in cross-linking force-bearing structures in the cell, contain a curious SH3 domain insertion in their chain of spectrin repeats (SRs). While SH3 domains are known to mediate protein-protein interactions, here, its canonical binding site is autoinhibited by the preceding SR. Under force, however, this SH3 domain could be released, and possibly launch a signaling cascade. We performed large-scale force-probe molecular dynamics simulations, across two orders of magnitude of loading rates, to test this hypothesis, on two prominent members of the plakin family: desmoplakin and plectin, obligate proteins at desmosomes and hemidesmosomes, respectively. Our simulations show that force unravels the SRs and abolishes the autoinhibition of the SH3 domain, an event well separated from the unfolding of this domain. The SH3 domain is free and fully functional for a significant portion of the unfolding trajectories. The rupture forces required for the two proteins significantly decrease when the SH3 domain is removed, which implies that the SH3 domain also stabilizes this junction. Our results persist across all simulations, and support a force-sensing as well as a stabilizing role of the unique SH3 insertion, putting forward this protein family as a new class of mechano-sensors.

Cross-sectional evaluation of the prevalence and factors associated with soft tissue scarring after the removal of miniscrews.

PubMed

Jung, Sung-ah; Choi, Yoon Jeong; Lee, Dong-Won; Kim, Kyung-Ho; Chung, Chooryung J

2015-05-01

To investigate the prevalence of distinguishable soft tissue scarring after the removal of temporary anchorage devices (TADs) such as orthodontic miniscrews and to analyze the factors associated with scar formation. The prevalence of soft tissue scarring in 66 patients (202 miniscrew removal sites) was clinically investigated at least 1 year after miniscrew removal. To determine the clinical factors associated with soft tissue scar formation, miniscrew stability; host factors including age, gender, and gingival biotype; and miniscrew-related factors such as insertion site, vertical position, and insertion period were evaluated. The prevalence of a distinguishable scar remaining at least 1 year after miniscrew removal was 44.6%. Patients with flat gingiva showed a significantly higher prevalence of soft tissue scar formation than did those with pronounced scalloped gingiva (P < .05). Maxillary buccal removal sites showed a significantly higher prevalence of soft tissue scar formation than did those in the mandible or palatal slope (P < .05). Miniscrew sites at the alveolar mucosa showed a significantly lower prevalence of soft tissue scar formation than did those in the mucogingival junction or the attached gingiva (P < .01). The prevalence of distinguishable scarring after miniscrew removal was fairly high. On the basis of our results, patients with flat gingiva and buccal interdental gingival insertion sites are more susceptible to scar formation.

Transposable element junctions in marker development and genomic characterization of barley

USDA-ARS?s Scientific Manuscript database

Barley is a model plant in genomic studies of Triticeae species. A complete barley genome sequence will facilitate not only barley breeding programs, but also those for related species. However, the large genome size and high repetitive sequence content complicate the barley genome assembly. The ma...

Genetic and molecular studies of a composite chromosomal element (Tn3705) containing a Tn916-modified structure (Tn3704) in Streptococcus anginosus F22.

PubMed

Clermont, D; Horaud, T

1994-01-01

The plasmid-free Streptococcus anginosus F22 contained a conjugative element, Tn3705, encoding resistance to erythromycin (Emr) and tetracycline-minocycline (Tcr-Mnr). We mapped a chromosomal region (> 52 kb) of F22, corresponding to the internal part of Tn3705. Molecular analysis of Tn3705 revealed it to be a composite structure: it included in its central part a transposon designated Tn3704 (20.3 kb +/- 0.5 kb), which had a modified structure in comparison with that of Tn916 and on which the Emr Tcr-Mn4 markers were localized. Tn3705 inserted from F22 into the chromosome of various streptococcal transconjugants as well as that of Enterococcus faecalis transconjugants without changing its structure. In contrast, from the chromosome of an E. faecalis::Tn3705 transconjugant only Tn3704 inserted, at various sites, into another E. faecalis chromosome. Sugar fermentations occurred after the insertion of Tn3704 into the chromosome of an asaccharolytic E. faecalis strain. Transposition of only Tn3704 from the chromosome of E. faecalis::Tn3705 onto pIP964, an E. faecalis hemolysin plasmid, yielded two different pIP964 derivatives. The size of the entire element Tn3705 was estimated to be about 70.0 kb by pulsed-field electrophoresis.

Drosophila mini-white model system: new insights into positive position effects and the role of transcriptional terminators and gypsy insulator in transgene shielding

PubMed Central

Silicheva, Margarita; Golovnin, Anton; Pomerantseva, Ekaterina; Parshikov, Aleksander; Georgiev, Pavel; Maksimenko, Oksana

2010-01-01

The white gene, which is responsible for eye pigmentation, is widely used to study position effects in Drosophila. As a result of insertion of P-element vectors containing mini-white without enhancers into random chromosomal sites, flies with different eye color phenotypes appear, which is usually explained by the influence of positive/negative regulatory elements located around the insertion site. We found that, in more than 70% of cases when mini-white expression was subject to positive position effects, deletion of the white promoter had no effect on eye pigmentation; in these cases, the transposon was inserted into the transcribed regions of genes. Therefore, transcription through the mini-white gene could be responsible for high levels of its expression in most of chromosomal sites. Consistently with this conclusion, transcriptional terminators proved to be efficient in protecting mini-white expression from positive position effects. On the other hand, the best characterized Drosophila gypsy insulator was poorly effective in terminating transcription and, as a consequence, only partially protected mini-white expression from these effects. Thus, to ensure maximum protection of a transgene from position effects, a perfect boundary/insulator element should combine three activities: to block enhancers, to provide a barrier between active and repressed chromatin, and to terminate transcription. PMID:19854952

Epitaxial insertion of gold silicide nanodisks during the growth of silicon nanowires.

PubMed

Um, Han-Don; Jee, Sang-Won; Park, Kwang-Tae; Jung, Jin-Young; Guo, Zhongyi; Lee, Jung-Ho

2011-07-01

Nanodisk-shaped, single-crystal gold silicide heterojunctions were inserted into silicon nanowires during vapor-liquid-solid growth using Au as a catalyst within a specific range of chlorine-to-hydrogen atomic ratio. The mechanism of nanodisk formation has been investigated by changing the source gas ratio of SiCl4 to H2. We report that an over-supply of silicon into the Au-Si liquid alloy leads to highly supersaturated solution and enhances the precipitation of Au in the silicon nanowires due to the formation of unstable phases within the liquid alloy. It is shown that the gold precipitates embedded in the silicon nanowires consisted of a metastable gold silicide. Interestingly, faceting of gold silicide was observed at the Au/Si interfaces, and silicon nanowires were epitaxially grown on the top of the nanodisk by vapor-liquid-solid growth. High resolution transmission electron microscopy confirmed that gold silicide nanodisks are epitaxially connected to the silicon nanowires in the direction of growth direction. These gold silicide nanodisks would be useful as nanosized electrical junctions for future applications in nanowire interconnections.

Research of the value of linear distortion of renewable surface of part during rotary processing of bulky items without dismantling unit

NASA Astrophysics Data System (ADS)

Bondarenko, J. A.; Fedorenko, M. A.; Pogonin, A. A.

2018-03-01

The loading and unloading units and grinding mills of raw devices have internal cone type or pipe screw perceive load of incoming and outgoing material. The main part of the support assembly is a pin. Mounting seats for the pipe screws cone have traces of deformation and work hardening, while they themselves have wear of pins and deformation of the inner and outer cylindrical working surface. In the mill body, there are constantly acting dynamic forces causing vibration, which are transmitted to the stud and inner accelerating elements. Under the influence of stress and vibration, the housing spigot is in the stress-compressed state and stretched vertically and horizontally. As a result, the insertion element is deformed and weakened in the fixture. A moving element appears in the gap leading to the fact that it drops lfeedstock and under the influence of variable loads it is destroyed, as well as the seating surfaces of the insert pin member.

Evidence for an RNA pseudoknot loop-helix interaction essential for efficient -1 ribosomal frameshifting.

PubMed

Liphardt, J; Napthine, S; Kontos, H; Brierley, I

1999-05-07

RNA pseudoknots are structural elements that participate in a variety of biological processes. At -1 ribosomal frameshifting sites, several types of pseudoknot have been identified which differ in their organisation and functionality. The pseudoknot found in infectious bronchitis virus (IBV) is typical of those that possess a long stem 1 of 11-12 bp and a long loop 2 (30-164 nt). A second group of pseudoknots are distinguishable that contain stems of only 5 to 7 bp and shorter loops. The NMR structure of one such pseudoknot, that of mouse mammary tumor virus (MMTV), has revealed that it is kinked at the stem 1-stem 2 junction, and that this kinked conformation is essential for efficient frameshifting. We recently investigated the effect on frameshifting of modulating stem 1 length and stability in IBV-based pseudoknots, and found that a stem 1 with at least 11 bp was needed for efficient frameshifting. Here, we describe the sequence manipulations that are necessary to bypass the requirement for an 11 bp stem 1 and to convert a short non-functional IBV-derived pseudoknot into a highly efficient, kinked frameshifter pseudoknot. Simple insertion of an adenine residue at the stem 1-stem 2 junction (an essential feature of a kinked pseudoknot) was not sufficient to create a functional pseudoknot. An additional change was needed: efficient frameshifting was recovered only when the last nucleotide of loop 2 was changed from a G to an A. The requirement for an A at the end of loop 2 is consistent with a loop-helix contact similar to those described in other RNA tertiary structures. A mutational analysis of both partners of the proposed interaction, the loop 2 terminal adenine residue and two G.C pairs near the top of stem 1, revealed that the interaction was essential for efficient frameshifting. The specific requirement for a 3'-terminal A residue was lost when loop 2 was increased from 8 to 14 nt, suggesting that the loop-helix contact may be required only in those pseudoknots with a short loop 2. Copyright 1999 Academic Press.

Sequences spanning the leader-repeat junction mediate CRISPR adaptation to phage in Streptococcus thermophilus

PubMed Central

Wei, Yunzhou; Chesne, Megan T.; Terns, Rebecca M.; Terns, Michael P.

2015-01-01

CRISPR-Cas systems are RNA-based immune systems that protect prokaryotes from invaders such as phages and plasmids. In adaptation, the initial phase of the immune response, short foreign DNA fragments are captured and integrated into host CRISPR loci to provide heritable defense against encountered foreign nucleic acids. Each CRISPR contains a ∼100–500 bp leader element that typically includes a transcription promoter, followed by an array of captured ∼35 bp sequences (spacers) sandwiched between copies of an identical ∼35 bp direct repeat sequence. New spacers are added immediately downstream of the leader. Here, we have analyzed adaptation to phage infection in Streptococcus thermophilus at the CRISPR1 locus to identify cis-acting elements essential for the process. We show that the leader and a single repeat of the CRISPR locus are sufficient for adaptation in this system. Moreover, we identified a leader sequence element capable of stimulating adaptation at a dormant repeat. We found that sequences within 10 bp of the site of integration, in both the leader and repeat of the CRISPR, are required for the process. Our results indicate that information at the CRISPR leader-repeat junction is critical for adaptation in this Type II-A system and likely other CRISPR-Cas systems. PMID:25589547

Factors influencing initial cup stability in total hip arthroplasty.

PubMed

Amirouche, Farid; Solitro, Giovanni; Broviak, Stefanie; Gonzalez, Mark; Goldstein, Wayne; Barmada, Riad

2014-12-01

One of the main goals in total hip replacement is to preserve the integrity of the hip kinematics, by well positioning the cup and to make sure its initial stability is congruent and attained. Achieving the latter is not trivial. A finite element model of the cup-bone interface simulating a realistic insertion and analysis of different scenarios of cup penetration, insertion, under-reaming and loading is investigated to determine certain measurable factors sensitivity to stress-strain outcome. The insertion force during hammering and its relation to the cup penetration during implantation is also investigated with the goal of determining the initial stability of the acetabular cup during total hip arthroplasty. The mathematical model was run in various configurations to simulate 1 and 2mm of under-reaming at various imposed insertion distances to mimic hammering and insertion of cup insertion into the pelvis. Surface contact and micromotion at the cup-bone interface were evaluated after simulated cup insertion and post-operative loading conditions. The results suggest a direct correlation between under-reaming and insertion force used to insert the acetabular cup on the micromotion and fixation at the cup-bone interface. While increased under-reaming and insertion force result in an increase amount of stability at the interface, approximately the same percentage of surface contact and micromotion reduction can be achieved with less insertion force. We need to exercise caution to determine the optimal configuration which achieves a good conformity without approaching the yield strength for bone. Copyright © 2014 Elsevier Ltd. All rights reserved.

Interrelated striated elements in vestibular hair cells of the rat

NASA Technical Reports Server (NTRS)

Ross, M. D.; Bourne, C.

1983-01-01

A series of interrelated striated organelles in types I and II vestibular hair cells of the rat which appear to be less developed in cochlear hair cells have been revealed by unusual fixation procedures, suggesting that contractile elements may play a role in sensory transduction in the inner ear, especially in the vestibular system. Included in the series of interrelated striated elements are the cuticular plate and its basal attachments to the hair cell margins, the connections of the strut array of the kinociliary basal body to the cuticular plate, and striated organelles associated with the plasma membrane and extending below the apical junctional complexes.

A NEUTRONIC REACTOR

DOEpatents

Luebke, E.A.; Vandenberg, L.B.

1959-09-01

A nuclear reactor for producing thermoelectric power is described. The reactor core comprises a series of thermoelectric assemblies, each assembly including fissionable fuel as an active element to form a hot junction and a thermocouple. The assemblies are disposed parallel to each other to form spaces and means are included for Introducing an electrically conductive coolant between the assemblies to form cold junctions of the thermocouples. An electromotive force is developed across the entire series of the thermoelectric assemblies due to fission heat generated in the fuel causing a current to flow perpendicular to the flow of coolant and is distributed to a load outside of the reactor by means of bus bars electrically connected to the outermost thermoelectric assembly.

Ultrastructural blood-brain barrier alterations and edema formation in acute spinal cord trauma.

PubMed

Goodman, J H; Bingham, W G; Hunt, W E

1976-04-01

Endothelial changes leading to edema formation are examined in the primate spinal cord (Macaca mulatta) following a lesion created by a 20-gm weight falling 15 cm onto the exposed dura. Intravascular perfusion of a paraformaldehydeglutaraldehyde solution followed by carbon black provides adequate fixation of vascular structures and glial elements. Myelin is poorly preserved. Ultrastructural alterations of the blood-brain barrier consist of loss of integrity of the endothelial tight junctions. Edema caused by vascular disruption and parenchymatous extravasation of intravascular contents is observed along with glial swelling. Interglial gap junctions persist in areas of marked cellular seperation and do not impede the migration of edema fluid.

Magnetic Tunnel Junction Mimics Stochastic Cortical Spiking Neurons

NASA Astrophysics Data System (ADS)

Sengupta, Abhronil; Panda, Priyadarshini; Wijesinghe, Parami; Kim, Yusung; Roy, Kaushik

2016-07-01

Brain-inspired computing architectures attempt to mimic the computations performed in the neurons and the synapses in the human brain in order to achieve its efficiency in learning and cognitive tasks. In this work, we demonstrate the mapping of the probabilistic spiking nature of pyramidal neurons in the cortex to the stochastic switching behavior of a Magnetic Tunnel Junction in presence of thermal noise. We present results to illustrate the efficiency of neuromorphic systems based on such probabilistic neurons for pattern recognition tasks in presence of lateral inhibition and homeostasis. Such stochastic MTJ neurons can also potentially provide a direct mapping to the probabilistic computing elements in Belief Networks for performing regenerative tasks.

Comparison of measured and predicted performance of a SIS waveguide mixer at 345 GHz

NASA Technical Reports Server (NTRS)

Honingh, C. E.; Delange, G.; Dierichs, M. M. T. M.; Schaeffer, H. H. A.; Wezelman, J.; Vandekuur, J.; Degraauw, T.; Klapwijk, T. M.

1992-01-01

The measured gain and noise of a SIS waveguide mixer at 345 GHz have been compared with theoretical values, calculated from the quantum mixer theory using a three port model. As a mixing element, we use a series array of two Nb-Al2O3-Nb SIS junctions. The area of each junction is 0.8 sq microns and the normal state resistance is 52 omega. The embedding impedance of the mixer has been determined from the pumped DC-IV curves of the junction and is compared to results from scale model measurements (105 x). Good agreement was obtained. The measured mixer gain, however, is a factor of 0.45 plus or minus 0.5 lower than the theoretical predicted gain. The measured mixer noise temperature is a factor of 4-5 higher than the calculated one. These discrepancies are independent on pump power and are valid for a broad range of tuning conditions.

Molecular electronics--resonant transport through single molecules.

PubMed

Lörtscher, Emanuel; Riel, Heike

2010-01-01

The mechanically controllable break-junction technique (MCBJ) enables us to investigate charge transport through an individually contacted and addressed molecule in ultra-high vacuum (UHV) environment at variable temperature ranging from room temperature down to 4 K. Using a statistical measurement and analysis approach, we acquire current-voltage (I-V) characteristics during the repeated formation, manipulation, and breaking of a molecular junction. At low temperatures, voltages accessing the first molecular orbitals in resonance can be applied, providing spectroscopic information about the junction's energy landscape, in particular about the molecular level alignment in respect to the Fermi energy of the electrodes. Thereby, we can investigate the non-linear transport properties of various types of functional molecules and explore their potential use as functional building blocks for future nano-electronics. An example will be given by the reversible and controllable switching between two distinct conductive states of a single molecule. As a proof-of-principle for functional molecular devices, a single-molecule memory element will be demonstrated.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuprat, A.P.; Glasser, A.H.

The authors discuss unstructured grids for application to transport in the tokamak edge SOL. They have developed a new metric with which to judge element elongation and resolution requirements. Using this method, the authors apply a standard moving finite element technique to advance the SOL equations while inserting/deleting dynamically nodes that violate an elongation criterion. In a tokamak plasma, this method achieves a more uniform accuracy, and results in highly stretched triangular finite elements, except near separatrix X-point where transport is more isotropic.

Gene-breaking: A new paradigm for human retrotransposon-mediated gene evolution

PubMed Central

Wheelan, Sarah J.; Aizawa, Yasunori; Han, Jeffrey S.; Boeke, Jef D.

2005-01-01

The L1 retrotransposon is the most highly successful autonomous retrotransposon in mammals. This prolific genome parasite may on occasion benefit its host through genome rearrangements or adjustments of host gene expression. In examining possible effects of L1 elements on host gene expression, we investigated whether a full-length L1 element inserted in the antisense orientation into an intron of a cellular gene may actually split the gene's transcript into two smaller transcripts: (1) a transcript containing the upstream exons and terminating in the major antisense polyadenylation site (MAPS) of the L1, and (2) a transcript derived from the L1 antisense promoter (ASP) that includes the downstream exons of the gene. Bioinformatic analysis and experimental follow-up provide evidence for this L1 “gene-breaking” hypothesis. We identified three human genes apparently “broken” by L1 elements, as well as 12 more candidate genes. Most of the inserted L1 elements in our 15 candidate genes predate the human/chimp divergence. If indeed split, the transcripts of these genes may in at least one case encode potentially interacting proteins, and in another case may encode novel proteins. Gene-breaking represents a new mechanism through which L1 elements remodel mammalian genomes. PMID:16024818

Internally folded expanded metal electrode for battery construction

NASA Technical Reports Server (NTRS)

Pierce, Doug C. (Inventor); Korinek, Paul D. (Inventor); Morgan, Maurice C. (Inventor)

1993-01-01

A battery system is disclosed which includes folded grids of expanded metal inserted through non-conductive substrates and pasted with electrochemically active materials. In the most preferred embodiment, a frame is provided with a plastic insert, and slots are provided in the latter to receive the expanded metal grid. After suitable coinage of the grid and insertion through the plastic film, the grid is sealed and pasted on opposite sides with positive and negative active material. A battery is assembled using one or a plurality of the resulting electrode elements, with separators, to produce a high-power, lead-acid battery. The folded grid provides many of the design benefits of standard bipolar construction.

Tol2 transposon-mediated transgenesis in Xenopus tropicalis.

PubMed

Hamlet, Michelle R Johnson; Yergeau, Donald A; Kuliyev, Emin; Takeda, Masatoshi; Taira, Masanori; Kawakami, Koichi; Mead, Paul E

2006-09-01

The diploid frog Xenopus tropicalis is becoming a powerful developmental genetic model system. Sequencing of the X. tropicalis genome is nearing completion and several labs are embarking on mutagenesis screens. We are interested in developing insertional mutagenesis strategies in X. tropicalis. Transposon-mediated insertional mutagenesis, once used exclusively in plants and invertebrate systems, is now more widely applicable to vertebrates. The first step in developing transposons as tools for mutagenesis is to demonstrate that these mobile elements function efficiently in the target organism. Here, we show that the Medaka fish transposon, Tol2, is able to stably integrate into the X. tropicalis genome and will serve as a powerful tool for insertional mutagenesis strategies in the frog.

Biomechanical properties of double- and single-row suture anchor repair for surgical treatment of insertional Achilles tendinopathy.

PubMed

Beitzel, Knut; Mazzocca, Augustus D; Obopilwe, Elifho; Boyle, James W; McWilliam, James; Rincon, Lina; Dhar, Yasmin; Arciero, Robert A; Amendola, Annunziato

2013-07-01

Because of intratendinous ossifications, retrocalcaneal bursitis, or intratendinous necrosis commonly found in insertional tendinosis, it is often necessary to detach the tendon partially or entirely from its tendon-to-bone junction. Double-row repair for insertional Achilles tendinopathy will generate an increased contact area and demonstrate higher biomechanical stability. Controlled laboratory study. Eighteen cadaver Achilles tendons were split longitudinally and detached, exposing the calcaneus; an ostectomy was performed and the tendon was reattached to the calcaneus in 1 of 2 ways: 2 suture anchors (single row) or a 4-anchor (double row) construct. Footprint area measurements over time, displacement after cyclic loading (2000 cycles), and final load to failure were measured. The double-row refixation technique was statistically superior to the single-row technique in footprint area measurement initially and 5 minutes after repair (P = .009 and P = .01, respectively) but not after 24 hours (P = .713). The double-row construct demonstrated significantly improved measures for peak load (433.9 ± 84.3 N vs 212.0 ± 49.7 N; P = .042), load at yield (354.7 ± 106.2 N vs 198.7 ± 39.5 N; P = .01), and slope (51.8 ± 9.9 N/mm vs 66.7 ± 16.2 N/mm; P = .021). Cyclic loading did not demonstrate significant differences between the 2 constructs. Double-row construct for reinsertion of a completely detached Achilles tendon using proximal and distal rows resulted in significantly larger contact area initially and 5 minutes after repair and led to significantly higher peak load to failure on destructive testing. In treatment for insertional Achilles tendinosis, the tendon often has to be detached and anatomically reattached to its insertion at the calcaneus. To our knowledge there is a lack of biomechanical studies supporting either a number or a pattern of suture anchor fixation. Because the stresses going across the insertion site of the Achilles tendon are significant during rehabilitation and weightbearing activities, it is imperative to have a strong construct that allows satisfactory healing during the early postoperative process.

INNULs: A novel design amplification strategy for retrotransposable elements for studying population variation.

PubMed

LaRue, Bobby L; Sinha, Sudhir K; Montgomery, Anne H; Thompson, Robyn; Klaskala, Lauren; Ge, Jianye; King, Jonathan; Turnbough, Meredith; Budowle, Bruce

2012-01-01

Retrotransposable elements (REs), consisting of long interspersed nuclear elements (LINEs) and short interspersed nuclear elements (SINEs), are a group of markers that can be useful for human identity testing. Until now, however, due to the inherent size difference (up to 6 kb in some instances) associated with insertion and null alleles (or INNULs), the use of REs for facilitated population studies has not been sought or practical. The size of the insertion elements (from a few hundred to several thousand bp) has proven to limit their utility as a marker because of the inefficient amplicon yield with PCR. A novel primer design now facilitates INNUL marker testing. A preliminary panel of single-locus markers was developed to evaluate the potential of typing these insertion elements. Nine INNULs (5 Alu and 4 LINEs) were typed in three major North American populations and analyzed for population genetic features. In addition, the variation of each marker among the sample populations provides insight of its potential use as individual identification or ancestral marker. INNUL markers were developed into fluorescently labeled single-loci PCR. Nine markers were developed with amplicons that were less than 180 bp in length, and, depending on the locus amplicons of the INNULs, alleles varied in size from 50 to 1 bp. This allele size is noteworthy because the insertion alleles of the 9 loci range in size from 297 to 6,195 bp. The allele distribution of the INNULs was assessed and analyzed in three major North American populations. Upon observation of the distribution of the alleles in three major North American populations, the markers generally met Hardy-Weinberg expectations, and there was little evidence of detectable levels of linkage disequilibrium. Due to varying distributions of the alleles in the major population groups tested, some of the markers might be better suited for use as an individual identification marker, while others are better suited for bio-ancestral studies. Using the primer design strategy described in our work, SINEs and (for the first time, to our knowledge) LINEs can be utilized as markers for studying population genetic variation that is more amenable to the limitations of the PCR technique. This study lays the foundation for future work of developing a multiplex panel of INNUL markers that can be used as a single-tube assay for human identity testing utilizing small amplicons (<180 bp), which could be useful for ancient or degraded forensic DNA samples. Copyright © 2012 S. Karger AG, Basel.

Entire plastid phylogeny of the carrot genus (Daucus, Apiaceae): Concordance with nuclear data and mitochondrial and nuclear DNA insertions to the plastid.

PubMed

Spooner, David M; Ruess, Holly; Iorizzo, Massimo; Senalik, Douglas; Simon, Philipp

2017-02-01

We explored the phylogenetic utility of entire plastid DNA sequences in Daucus and compared the results with prior phylogenetic results using plastid and nuclear DNA sequences. We used Illumina sequencing to obtain full plastid sequences of 37 accessions of 20 Daucus taxa and outgroups, analyzed the data with phylogenetic methods, and examined evidence for mitochondrial DNA transfer to the plastid ( Dc MP). Our phylogenetic trees of the entire data set were highly resolved, with 100% bootstrap support for most of the external and many of the internal clades, except for the clade of D. carota and its most closely related species D. syrticus . Subsets of the data, including regions traditionally used as phylogenetically informative regions, provide various degrees of soft congruence with the entire data set. There are areas of hard incongruence, however, with phylogenies using nuclear data. We extended knowledge of a mitochondrial to plastid DNA insertion sequence previously named Dc MP and identified the first instance in flowering plants of a sequence of potential nuclear genome origin inserted into the plastid genome. There is a relationship of inverted repeat junction classes and repeat DNA to phylogeny, but no such relationship with nonsynonymous mutations. Our data have allowed us to (1) produce a well-resolved plastid phylogeny of Daucus , (2) evaluate subsets of the entire plastid data for phylogeny, (3) examine evidence for plastid and nuclear DNA phylogenetic incongruence, and (4) examine mitochondrial and nuclear DNA insertion into the plastid. © 2017 Spooner et al. Published by the Botanical Society of America. This work is licensed under a Creative Commons public domain license (CC0 1.0).

Not only … but also: REM sleep creates and NREM Stage 2 instantiates landmark junctions in cortical memory networks.

PubMed

Llewellyn, Sue; Hobson, J Allan

2015-07-01

This article argues both rapid eye movement (REM) and non-rapid eye movement (NREM) sleep contribute to overnight episodic memory processes but their roles differ. Episodic memory may have evolved from memory for spatial navigation in animals and humans. Equally, mnemonic navigation in world and mental space may rely on fundamentally equivalent processes. Consequently, the basic spatial network characteristics of pathways which meet at omnidirectional nodes or junctions may be conserved in episodic brain networks. A pathway is formally identified with the unidirectional, sequential phases of an episodic memory. In contrast, the function of omnidirectional junctions is not well understood. In evolutionary terms, both animals and early humans undertook tours to a series of landmark junctions, to take advantage of resources (food, water and shelter), whilst trying to avoid predators. Such tours required memory for emotionally significant landmark resource-place-danger associations and the spatial relationships amongst these landmarks. In consequence, these tours may have driven the evolution of both spatial and episodic memory. The environment is dynamic. Resource-place associations are liable to shift and new resource-rich landmarks may be discovered, these changes may require re-wiring in neural networks. To realise these changes, REM may perform an associative, emotional encoding function between memory networks, engendering an omnidirectional landmark junction which is instantiated in the cortex during NREM Stage 2. In sum, REM may preplay associated elements of past episodes (rather than replay individual episodes), to engender an unconscious representation which can be used by the animal on approach to a landmark junction in wake. Copyright © 2015 Elsevier Inc. All rights reserved.

Quantum Dynamics of a d-wave Josephson Junction

NASA Astrophysics Data System (ADS)

Bauch, Thilo

2007-03-01

Thilo Bauch ^1, Floriana Lombardi ^1, Tobias Lindstr"om ^2, Francesco Tafuri ^3, Giacomo Rotoli ^4, Per Delsing ^1, Tord Claeson ^1 1 Quantum Device Physics Laboratory, Department of Microtechnology and Nanoscience, MC2, Chalmers University of Technology, S-412 96 G"oteborg, Sweden. 2 National Physical Laboratory, Queens Road, Teddington, Middlesex TW11 0LW, UK. 3 Istituto Nazionale per la Fisica della Materia-Dipartimento Ingegneria dell'Informazione, Seconda Universita di Napoli, Aversa (CE), Italy. 4 Dipartimento di Ingegneria Meccanica, Energetica e Gestionale, Universita of L'Aquila, Localita Monteluco, L'Aquila, Italy. We present direct observation of macroscopic quantum properties in an all high critical temperature superconductor d-wave Josephson junction. Although dissipation caused by low energy excitations is expected to strongly suppress quantum effects we demonstrate macroscopic quantum tunneling [1] and energy level quantization [2] in our d-wave Josephson junction. The results clearly indicate that the role of dissipation mechanisms in high temperature superconductors has to be revised, and may also have consequences for a new class of solid state ``quiet'' quantum bit with superior coherence time. We show that the dynamics of the YBCO grain boundary Josephson junctions fabricated on a STO substrate are strongly affected by their environment. As a first approximation we model the environment by the stray capacitance and stray inductance of the junction electrodes. The total system consisting of the junction and stray elements has two degrees of freedom resulting in two characteristic resonance frequencies. Both frequencies have to be considered to describe the quantum mechanical behavior of the Josephson circuit. [1] T. Bauch et al, Phys. Rev. Lett. 94, 087003 (2005). [2] T. Bauch et al, Science 311, 57 (2006).

Parafunctional loading and occlusal device on stress distribution around implants: A 3D finite element analysis.

PubMed

Borges Radaelli, Manuel Tomás; Idogava, Henrique Takashi; Spazzin, Aloisio Oro; Noritomi, Pedro Yoshito; Boscato, Noéli

2018-04-30

An occlusal device is frequently recommended for patients with bruxism to protect implant-supported restorations and prevent marginal bone loss. Scientific evidence to support this treatment is lacking. The purpose of this 3-dimensional (3D) finite element study was to evaluate the influence of an acrylic resin occlusal device, implant length, and insertion depth on stress distribution with functional and parafunctional loadings. Computer-aided design software was used to construct 8 models. The models were composed of a mandibular bone section including the second premolar and first and second molars. Insertion depths (bone level and 2 mm subcrestal) were simulated at the first molar. Three natural antagonist maxillary teeth and the placement or not of an occlusal device were simulated. Functional (200-N axial and 10-N oblique) and parafunctional (1000-N axial and 25-N oblique) forces were applied. Finite element analysis (FEA) was used to determine the maximum principal stress for the cortical and trabecular bone and von Mises for implant and prosthetic abutment. Stress concentration was observed at the abutment-implant and the implant-bone interfaces. Occlusal device placement changed the pattern of stress distribution and reduced stress levels from parafunctional loading in all structures, except in the trabecular bone. Implants with subcrestal insertion depths had reduced stress at the implant-abutment interface and cortical bone around the implant abutment, while the stress increased in the bone in contact with the implant. Parafunctional loading increased the stress levels in all structures when compared with functional loading. An occlusal device resulted in the lowest stress levels at the abutment and implant and the most favorable stress distribution between the cortical and trabecular bone. Under parafunctional loading, an occlusal device was more effective in reducing stress distribution for longer implants inserted at bone level. Subcrestally, implant insertion yielded the most favorable biomechanical conditions at the abutment-implant interface and at the coronal surface of the cortical bone, mainly when there was no occlusal device. Copyright © 2018 Editorial Council for the Journal of Prosthetic Dentistry. Published by Elsevier Inc. All rights reserved.

Ac-immobilized, a stable source of Activator transposase that mediates sporophytic and gametophytic excision of Dissociation elements in maize.

PubMed

Conrad, Liza J; Brutnell, Thomas P

2005-12-01

We have identified and characterized a novel Activator (Ac) element that is incapable of excision yet contributes to the canonical negative dosage effect of Ac. Cloning and sequence analysis of this immobilized Ac (Ac-im) revealed that it is identical to Ac with the exception of a 10-bp deletion of sequences at the left end of the element. In screens of approximately 6800 seeds, no germinal transpositions of Ac-im were detected. Importantly, Ac-im catalyzes germinal excisions of a Ds element resident at the r1 locus resulting in the recovery of independent transposed Ds insertions in approximately 4.5% of progeny kernels. Many of these transposition events occur during gametophytic development. Furthermore, we demonstrate that Ac-im transactivates multiple Ds insertions in somatic tissues including those in reporter alleles at bronze1, anthocyaninless1, and anthocyaninless2. We propose a model for the generation of Ac-im as an aberrant transposition event that failed to generate an 8-bp target site duplication and resulted in the deletion of Ac end sequences. We also discuss the utility of Ac-im in two-component Ac/Ds gene-tagging programs in maize.

Albinism due to transposable element insertion in fish.

PubMed

Koga, A; Hori, H

1997-12-01

The i locus of the medaka fish, Oryzias latipes, is responsible for tyrosinase expression, and several mutant alleles have been identified. The genotype i1/i1 exhibits a complete albino phenotype, having pale orange-red skin and red eyes. This mutant lacks in vivo tyrosinase activity. The genotype i4/i4, on the other hand, shows a quasi-albino phenotype with skin as bright as that of i1/i1 but with red-wine-colored eyes. At the light microscope level, reduced pigmentation is observed both in the skin and eyes of this mutant. The tyrosinase genes for the i1 and the i4 alleles were cloned and sequenced, and compared with that of the wild-type tyrosinase gene. The i1 allele was found to contain a 1.9-kb transposable element in the 1st exon, and the i4 allele was found to contain a 4.7-kb transposable element in the 5th exon. Both i1 and i4 are alleles that were found in a commercial breeding population. The insertion of a transposable element thus appears to constitute a natural cause of mutations that cause albinism in this organism.

Transcriptional activation of rat creatine kinase B by 17beta-estradiol in MCF-7 cells involves an estrogen responsive element and GC-rich sites.

PubMed

Wang, F; Samudio, I; Safe, S

2001-01-01

The rat creatine kinase B (CKB) gene is induced by estrogen in the uterus, and constructs containing rat CKB gene promoter inserts are highly estrogen-responsive in cell culture. Analysis of the upstream -568 to -523 region of the promoter in HeLa cells has identified an imperfect palindromic estrogen response element (ERE) that is required for hormone inducibility. Analysis of the CKB gene promoter in MCF-7 breast cancer cells confirmed that pCKB7 (containing the -568 to -523 promoter insert) was estrogen-responsive in transient transfection studies. However, mutation and deletion analysis of this region of the promoter showed that two GC-rich sites and the concensus ERE were functional cis-elements that bound estrogen receptor alpha (ERalpha)/Sp1 and ERalpha proteins, respectively. The role of these elements was confirmed in gel mobility shift and chromatin immunoprecipitation assays and transfection studies in MDA-MB-231 and Schneider Drosophila SL-2 cells. These results show that transcriptional activation of CKB by estrogen is dependent, in part, on ERalpha/Sp1 action which is cell context-dependent. Copyright 2001 Wiley-Liss, Inc.

Widespread and evolutionary analysis of a MITE family Monkey King in Brassicaceae.

PubMed

Dai, Shutao; Hou, Jinna; Long, Yan; Wang, Jing; Li, Cong; Xiao, Qinqin; Jiang, Xiaoxue; Zou, Xiaoxiao; Zou, Jun; Meng, Jinling

2015-06-19

Miniature inverted repeat transposable elements (MITEs) are important components of eukaryotic genomes, with hundreds of families and many copies, which may play important roles in gene regulation and genome evolution. However, few studies have investigated the molecular mechanisms involved. In our previous study, a Tourist-like MITE, Monkey King, was identified from the promoter region of a flowering time gene, BnFLC.A10, in Brassica napus. Based on this MITE, the characteristics and potential roles on gene regulation of the MITE family were analyzed in Brassicaceae. The characteristics of the Tourist-like MITE family Monkey King in Brassicaceae, including its distribution, copies and insertion sites in the genomes of major Brassicaceae species were analyzed in this study. Monkey King was actively amplified in Brassica after divergence from Arabidopsis, which was indicated by the prompt increase in copy number and by phylogenetic analysis. The genomic variations caused by Monkey King insertions, both intra- and inter-species in Brassica, were traced by PCR amplification. Genomic sequence analysis showed that most complete Monkey King elements are located in gene-rich regions, less than 3kb from genes, in both the B. rapa and A. thaliana genomes. Sixty-seven Brassica expressed sequence tags carrying Monkey King fragments were also identified from the NCBI database. Bisulfite sequencing identified specific DNA methylation of cytosine residues in the Monkey King sequence. A fragment containing putative TATA-box motifs in the MITE sequence could bind with nuclear protein(s) extracted from leaves of B. napus plants. A Monkey King-related microRNA, bna-miR6031, was identified in the microRNA database. In transgenic A. thaliana, when the Monkey King element was inserted upstream of 35S promoter, the promoter activity was weakened. Monkey King, a Brassicaceae Tourist-like MITE family, has amplified relatively recently and has induced intra- and inter-species genomic variations in Brassica. Monkey King elements are most abundant in the vicinity of genes and may have a substantial effect on genome-wide gene regulation in Brassicaceae. Monkey King insertions potentially regulate gene expression and genome evolution through epigenetic modification and new regulatory motif production.

Optical Device for Converting a Laser Beam into Two Co-aligned but Oppositely Directed Beams

NASA Technical Reports Server (NTRS)

Jennings, Donald

2013-01-01

Optical systems consisting of a series of optical elements require alignment from the input end to the output end. The optical elements can be mirrors, lenses, sources, detectors, or other devices. Complex optical systems are often difficult to align from end-to-end because the alignment beam must be inserted at one end in order for the beam to traverse the entire optical path to the other end. The ends of the optical train may not be easily accessible to the alignment beam. Typically, when a series of optical elements is to be aligned, an alignment laser beam is inserted into the optical path with a pick-off mirror at one end of the series of elements. But it may be impossible to insert the beam at an end-point. It can be difficult to locate the pick-off mirror at the desired position because there is not enough space, there is no mounting surface, or the location is occupied by a source, detector, or other component. Alternatively, the laser beam might be inserted at an intermediate location (not at an end-point) and sent, first in one direction and then the other, to the opposite ends of the optical system for alignment. However, in this case, alignment must be performed in two directions and extra effort is required to co-align the two beams to make them parallel and coincident, i.e., to follow the same path as an end-to-end beam. An optical device has been developed that accepts a laser beam as input and produces two co-aligned, but counter-propagating beams. In contrast to a conventional alignment laser placed at one end of the optical path, this invention can be placed at a convenient position within the optical train and aligned to send its two beams simultaneously along precisely opposite paths that, taken together, trace out exactly the same path as the conventional alignment laser. This invention allows the user the freedom to choose locations within the optical train for placement of the alignment beam. It is also self-aligned by design and requires almost no adjustment.

Retrotransposon Capture Sequencing (RC-Seq): A Targeted, High-Throughput Approach to Resolve Somatic L1 Retrotransposition in Humans.

PubMed

Sanchez-Luque, Francisco J; Richardson, Sandra R; Faulkner, Geoffrey J

2016-01-01

Mobile genetic elements (MGEs) are of critical importance in genomics and developmental biology. Polymorphic and somatic MGE insertions have the potential to impact the phenotype of an individual, depending on their genomic locations and functional consequences. However, the identification of polymorphic and somatic insertions among the plethora of copies residing in the genome presents a formidable technical challenge. Whole genome sequencing has the potential to address this problem; however, its efficacy depends on the abundance of cells carrying the new insertion. Robust detection of somatic insertions present in only a subset of cells within a given sample can also be prohibitively expensive due to a requirement for high sequencing depth. Here, we describe retrotransposon capture sequencing (RC-seq), a sequence capture approach in which Illumina libraries are enriched for fragments containing the 5' and 3' termini of specific MGEs. RC-seq allows the detection of known polymorphic insertions present in an individual, as well as the identification of rare or private germline insertions not previously described. Furthermore, RC-seq can be used to detect and characterize somatic insertions, providing a valuable tool to elucidate the extent and characteristics of MGE activity in healthy tissues and in various disease states.

Alu repeat discovery and characterization within human genomes

PubMed Central

Hormozdiari, Fereydoun; Alkan, Can; Ventura, Mario; Hajirasouliha, Iman; Malig, Maika; Hach, Faraz; Yorukoglu, Deniz; Dao, Phuong; Bakhshi, Marzieh; Sahinalp, S. Cenk; Eichler, Evan E.

2011-01-01

Human genomes are now being rapidly sequenced, but not all forms of genetic variation are routinely characterized. In this study, we focus on Alu retrotransposition events and seek to characterize differences in the pattern of mobile insertion between individuals based on the analysis of eight human genomes sequenced using next-generation sequencing. Applying a rapid read-pair analysis algorithm, we discover 4342 Alu insertions not found in the human reference genome and show that 98% of a selected subset (63/64) experimentally validate. Of these new insertions, 89% correspond to AluY elements, suggesting that they arose by retrotransposition. Eighty percent of the Alu insertions have not been previously reported and more novel events were detected in Africans when compared with non-African samples (76% vs. 69%). Using these data, we develop an experimental and computational screen to identify ancestry informative Alu retrotransposition events among different human populations. PMID:21131385

A reappraisal of the anatomy of the human lumbar erector spinae.

PubMed Central

Bogduk, N

1980-01-01

In the lumbar region the longissimus thoracis and iliocostalis lumborum are separated by the erector spinae aponeurosis and its ventral reflection--the lumbar intermuscular aponeurosis. Lumbar fibres of the longissimus arise from the ilium and the lumbar intermuscular aponeurosis and insert into the accessory processes and proximal ends of the transverse processes of the lumbar vertebrae. Lumbar fibres of iliocostalis insert into the costal elements of the first four lumbar vertebrae. The lumbar insertions of these muscles are homologous to their thoracic insertions. The lumbar intermuscular aponeurosis is homologous to the lumbar intermuscular septum in the dog, cat and monkey. The details of attachment of the lumbar fibres of the erector spinae and of the lumbar intermuscular aponeurosis should be taken into account in biomechanical analyses of the lumbar vertebral column. Images Fig. 1(cont.) Fig. 1 Fig. 3 Fig. 4 Fig. 5 PMID:7216917

Alu repeats: A source for the genesis of primate microsatellites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Arcot, S.S.; Batzer, M.A.; Wang, Zhenyuan

1995-09-01

As a result of their abundance, relatively uniform distribution, and high degree of polymorphism, microsatellites and minisatellites have become valuable tools in genetic mapping, forensic identity testing, and population studies. In recent years, a number of microsatellite repeats have been found to be associated with Alu interspersed repeated DNA elements. The association of an Alu element with a microsatellite repeat could result from the integration of an Alu element within a preexisting microsatellite repeat. Alternatively, Alu elements could have a direct role in the origin of microsatellite repeats. Errors introduced during reverse transcription of the primary transcript derived from anmore » Alu {open_quotes}master{close_quote} gene or the accumulation of random mutations in the middle A-rich regions and oligo(dA)-rich tails of Alu elements after insertion and subsequent expansion and contraction of these sequences could result in the genesis of a microsatellite repeat. We have tested these hypotheses by a direct evolutionary comparison of the sequences of some recent Alu elements that are found only in humans and are absent from nonhuman primates, as well as some older Alu elements that are present at orthologous positions in a number of nonhuman primates. The origin of {open_quotes}young{close_quotes} Alu insertions, absence of sequences that resemble microsatellite repeats at the orthologous loci in chimpanzees, and the gradual expansion of microsatellite repeats in some old Alu repeats at orthologous positions within the genomes of a number of nonhuman primates suggest that Alu elements are a source for the genesis of primate microsatellite repeats. 48 refs., 5 figs., 3 tabs.« less

Perpendicular magnetic tunnel junctions with Mn-modified ultrathin MnGa layer

NASA Astrophysics Data System (ADS)

Suzuki, K. Z.; Miura, Y.; Ranjbar, R.; Bainsla, L.; Ono, A.; Sasaki, Y.; Mizukami, S.

2018-02-01

Perpendicular magnetic tunnel junctions (p-MTJs) with a MgO barrier and a 1-nm-thick MnGa electrode were investigated by inserting several monolayers (MLs) of Mn. The tunnel magnetoresistance (TMR) ratio systematically increased when increasing the Mn layer thickness with a maximum of 18 (38.4)% at 300 (5) K for a Mn layer thickness of 0.6-0.8 nm. This ratio is five times higher compared to that without the Mn layer. The perpendicular magnetic anisotropy (PMA) field and the PMA constant of the ultrathin MnGa layer also increased up to 62-90 kOe and 6.2-11.3 Merg/cm3, respectively, with an increase in the Mn interlayer thickness, even for the ultrathin regime of the MnGa layer. For p-MTJs showing a high TMR and PMA, electron microscopy indicated the presence of 3-4 MLs of Mn at the MnGa/MgO interface; thus, the Mn modification enhanced the TMR as well as improved the PMA. This may be a promising finding to develop a Mn-based free layer for spin-transfer-torque devices for high-recording-density magnetoresistive random access memory and a sub-THz oscillator/detector.

Screening charge localization at LiNbO{sub 3} surface with Schottky junction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nagata, Takahiro, E-mail: NAGATA.Takahiro@nims.go.jp; Chikyow, Toyohiro; Kitamura, Kenji

2016-04-25

Screening charge localization was demonstrated by using a Schottky contact with LiNbO{sub 3} (LN). A Cr/LN stack structure with a 2 μm diameter hole array penetrating the Cr layer localized the screening charge of LN in the hole, although the Al/LN stack structure exhibited no surface charge localization behavior. X-ray photoelectron spectroscopy revealed that Cr formed a Schottky contact with LN, which prevents the screening charge from escaping from the hole arrays. The screening charge localization was enhanced by inserting SiO{sub 2} between the metal and LN, which moved the position of the Fermi level to mid gap.

Application of memory metallic stents to urinary tract disorders in pediatric patients.

PubMed

Kamata, Shinkichi; Usui, Noriaki; Kamiyama, Masafumi; Yoneda, Akihiro; Tazuke, Yuko; Ooue, Takaharu

2005-03-01

The use of memory metallic stents for the urinary tract in pediatric patients has not been reported. The authors report on 2 patients with urinary tract disorders who were successfully treated with a memory metallic stent. A thermoexpandable, nickel-titanium alloy stent was placed at the urethroureteral junction of a 4-year-old boy with ureteral stenosis associated with cloacal exstrophy for 18 months and at the urethra of a 2-year-old girl with ischuria after a repair of cloacal anomaly for 6 months. Temporary insertion of a memory metallic stent is a safe and effective alternative for organic stricture or functional obstruction of the urinary tract in pediatric patients.

Paucity and preferential suppression of transgenes in late replication domains of the D. melanogaster genome.

PubMed

Babenko, Vladimir N; Makunin, Igor V; Brusentsova, Irina V; Belyaeva, Elena S; Maksimov, Daniil A; Belyakin, Stepan N; Maroy, Peter; Vasil'eva, Lyubov A; Zhimulev, Igor F

2010-05-21

Eukaryotic genomes are organized in extended domains with distinct features intimately linking genome structure, replication pattern and chromatin state. Recently we identified a set of long late replicating euchromatic regions that are underreplicated in salivary gland polytene chromosomes of D. melanogaster. Here we demonstrate that these underreplicated regions (URs) have a low density of P-element and piggyBac insertions compared to the genome average or neighboring regions. In contrast, Minos-based transposons show no paucity in URs but have a strong bias to testis-specific genes. We estimated the suppression level in 2,852 stocks carrying a single P-element by analysis of eye color determined by the mini-white marker gene and demonstrate that the proportion of suppressed transgenes in URs is more than three times higher than in the flanking regions or the genomic average. The suppressed transgenes reside in intergenic, genic or promoter regions of the annotated genes. We speculate that the low insertion frequency of P-elements and piggyBacs in URs partially results from suppression of transgenes that potentially could prevent identification of transgenes due to complete suppression of the marker gene. In a similar manner, the proportion of suppressed transgenes is higher in loci replicating late or very late in Kc cells and these loci have a lower density of P-elements and piggyBac insertions. In transgenes with two marker genes suppression of mini-white gene in eye coincides with suppression of yellow gene in bristles. Our results suggest that the late replication domains have a high inactivation potential apparently linked to the silenced or closed chromatin state in these regions, and that such inactivation potential is largely maintained in different tissues.

An active ac/ds transposon system for activation tagging in tomato cultivar m82 using clonal propagation.

PubMed

Carter, Jared D; Pereira, Andy; Dickerman, Allan W; Veilleux, Richard E

2013-05-01

Tomato (Solanum lycopersicum) is a model organism for Solanaceae in both molecular and agronomic research. This project utilized Agrobacterium tumefaciens transformation and the transposon-tagging construct Activator (Ac)/Dissociator (Ds)-ATag-Bar_gosGFP to produce activation-tagged and knockout mutants in the processing tomato cultivar M82. The construct carried hygromycin resistance (hyg), green fluorescent protein (GFP), and the transposase (TPase) of maize (Zea mays) Activator major transcript X054214.1 on the stable Ac element, along with a 35S enhancer tetramer and glufosinate herbicide resistance (BAR) on the mobile Ds-ATag element. An in vitro propagation strategy was used to produce a population of 25 T0 plants from a single transformed plant regenerated in tissue culture. A T1 population of 11,000 selfed and cv M82 backcrossed progeny was produced from the functional T0 line. This population was screened using glufosinate herbicide, hygromycin leaf painting, and multiplex polymerase chain reaction (PCR). Insertion sites of transposed Ds-ATag elements were identified through thermal asymmetric interlaced PCR, and resulting product sequences were aligned to the recently published tomato genome. A population of 509 independent, Ds-only transposant lines spanning all 12 tomato chromosomes has been developed. Insertion site analysis demonstrated that more than 80% of these lines harbored Ds insertions conducive to activation tagging. The capacity of the Ds-ATag element to alter transcription was verified by quantitative real-time reverse transcription-PCR in two mutant lines. The transposon-tagged lines have been immortalized in seed stocks and can be accessed through an online database, providing a unique resource for tomato breeding and analysis of gene function in the background of a commercial tomato cultivar.

Molecular Population Genetics of the Alcohol Dehydrogenase Gene Region of DROSOPHILA MELANOGASTER

PubMed Central

Aquadro, Charles F.; Desse, Susan F.; Bland, Molly M.; Langley, Charles H.; Laurie-Ahlberg, Cathy C.

1986-01-01

Variation in the DNA restriction map of a 13-kb region of chromosome II including the alcohol dehydrogenase structural gene (Adh) was examined in Drosophila melanogaster from natural populations. Detailed analysis of 48 D. melanogaster lines representing four eastern United States populations revealed extensive DNA sequence variation due to base substitutions, insertions and deletions. Cloning of this region from several lines allowed characterization of length variation as due to unique sequence insertions or deletions [nine sizes; 21–200 base pairs (bp)] or transposable element insertions (several sizes, 340 bp to 10.2 kb, representing four different elements). Despite this extensive variation in sequences flanking the Adh gene, only one length polymorphism is clearly associated with altered Adh expression (a copia element approximately 250 bp 5' to the distal transcript start site). Nonetheless, the frequency spectra of transposable elements within and between Drosophila species suggests they are slightly deleterious. Strong nonrandom associations are observed among Adh region sequence variants, ADH allozyme (Fast vs. Slow), ADH enzyme activity and the chromosome inversion ln(2L) t. Phylogenetic analysis of restriction map haplotypes suggest that the major twofold component of ADH activity variation (high vs. low, typical of Fast and Slow allozymes, respectively) is due to sequence variation tightly linked to and possibly distinct from that underlying the allozyme difference. The patterns of nucleotide and haplotype variation for Fast and Slow allozyme lines are consistent with the recent increase in frequency and spread of the Fast haplotype associated with high ADH activity. These data emphasize the important role of evolutionary history and strong nonrandom associations among tightly linked sequence variation as determinants of the patterns of variation observed in natural populations. PMID:3026893

Silicide/Silicon Hetero-Junction Structure for Thermoelectric Applications.

PubMed

Jun, Dongsuk; Kim, Soojung; Choi, Wonchul; Kim, Junsoo; Zyung, Taehyoung; Jang, Moongyu

2015-10-01

We fabricated silicide/silicon hetero-junction structured thermoelectric device by CMOS process for the reduction of thermal conductivity with the scatterings of phonons at silicide/silicon interfaces. Electrical conductivities, Seebeck coefficients, power factors, and temperature differences are evaluated using the steady state analysis method. Platinum silicide/silicon multilayered structure showed an enhanced Seebeck coefficient and power factor characteristics, which was considered for p-leg element. Also, erbium silicide/silicon structure showed an enhanced Seebeck coefficient, which was considered for an n-leg element. Silicide/silicon multilayered structure is promising for thermoelectric applications by reducing thermal conductivity with an enhanced Seebeck coefficient. However, because of the high thermal conductivity of the silicon packing during thermal gradient is not a problem any temperature difference. Therefore, requires more testing and analysis in order to overcome this problem. Thermoelectric generators are devices that based on the Seebeck effect, convert temperature differences into electrical energy. Although thermoelectric phenomena have been used for heating and cooling applications quite extensively, it is only in recent years that interest has increased in energy generation.

Isolation of an insertion sequence (IS1051) from Xanthomonas campestris pv. dieffenbachiae with potential use for strain identification and characterization.

PubMed Central

Berthier, Y; Thierry, D; Lemattre, M; Guesdon, J L

1994-01-01

A new insertion sequence was isolated from Xanthomonas campestris pv. dieffenbachiae. Sequence analysis showed that this element is 1,158 bp long and has 15-bp inverted repeat ends containing two mismatches. Comparison of this sequence with sequences in data bases revealed significant homology with Escherichia coli IS5. IS1051, which detected multiple restriction fragment length polymorphisms, was used as a probe to characterize strains from the pathovar dieffenbachiae. Images PMID:7906933

Conserved DNA motifs in the type II-A CRISPR leader region.

PubMed

Van Orden, Mason J; Klein, Peter; Babu, Kesavan; Najar, Fares Z; Rajan, Rakhi

2017-01-01

The Clustered Regularly Interspaced Short Palindromic Repeats associated (CRISPR-Cas) systems consist of RNA-protein complexes that provide bacteria and archaea with sequence-specific immunity against bacteriophages, plasmids, and other mobile genetic elements. Bacteria and archaea become immune to phage or plasmid infections by inserting short pieces of the intruder DNA (spacer) site-specifically into the leader-repeat junction in a process called adaptation. Previous studies have shown that parts of the leader region, especially the 3' end of the leader, are indispensable for adaptation. However, a comprehensive analysis of leader ends remains absent. Here, we have analyzed the leader, repeat, and Cas proteins from 167 type II-A CRISPR loci. Our results indicate two distinct conserved DNA motifs at the 3' leader end: ATTTGAG (noted previously in the CRISPR1 locus of Streptococcus thermophilus DGCC7710) and a newly defined CTRCGAG, associated with the CRISPR3 locus of S. thermophilus DGCC7710. A third group with a very short CG DNA conservation at the 3' leader end is observed mostly in lactobacilli. Analysis of the repeats and Cas proteins revealed clustering of these CRISPR components that mirrors the leader motif clustering, in agreement with the coevolution of CRISPR-Cas components. Based on our analysis of the type II-A CRISPR loci, we implicate leader end sequences that could confer site-specificity for the adaptation-machinery in the different subsets of type II-A CRISPR loci.

Conserved DNA motifs in the type II-A CRISPR leader region

PubMed Central

Babu, Kesavan; Najar, Fares Z.

2017-01-01

The Clustered Regularly Interspaced Short Palindromic Repeats associated (CRISPR-Cas) systems consist of RNA-protein complexes that provide bacteria and archaea with sequence-specific immunity against bacteriophages, plasmids, and other mobile genetic elements. Bacteria and archaea become immune to phage or plasmid infections by inserting short pieces of the intruder DNA (spacer) site-specifically into the leader-repeat junction in a process called adaptation. Previous studies have shown that parts of the leader region, especially the 3′ end of the leader, are indispensable for adaptation. However, a comprehensive analysis of leader ends remains absent. Here, we have analyzed the leader, repeat, and Cas proteins from 167 type II-A CRISPR loci. Our results indicate two distinct conserved DNA motifs at the 3′ leader end: ATTTGAG (noted previously in the CRISPR1 locus of Streptococcus thermophilus DGCC7710) and a newly defined CTRCGAG, associated with the CRISPR3 locus of S. thermophilus DGCC7710. A third group with a very short CG DNA conservation at the 3′ leader end is observed mostly in lactobacilli. Analysis of the repeats and Cas proteins revealed clustering of these CRISPR components that mirrors the leader motif clustering, in agreement with the coevolution of CRISPR-Cas components. Based on our analysis of the type II-A CRISPR loci, we implicate leader end sequences that could confer site-specificity for the adaptation-machinery in the different subsets of type II-A CRISPR loci. PMID:28392985

IS30-related transposon mediated insertional inactivation of bile salt hydrolase (bsh1) gene of Lactobacillus plantarum strain Lp20.

PubMed

Kumar, Rajesh; Grover, Sunita; Kaushik, Jai K; Batish, Virender Kumar

2014-01-01

Lactobacillus plantarum is a flexible and versatile microorganism that inhabits a variety of niches, and its genome may express up to four bsh genes to maximize its survival in the mammalian gut. However, the ecological significance of multiple bsh genes in L. plantarum is still not clearly understood. Hence, this study demonstrated the disruption of bile salt hydrolase (bsh1) gene due to the insertion of a transposable element in L. plantarum Lp20 - a wild strain of human fecal origin. Surprisingly, L. plantarum strain Lp20 produced a ∼2.0 kb bsh1 amplicon against the normal size (∼1.0 kb) bsh1 amplicon of Bsh(+)L. plantarum Lp21. Strain Lp20 exhibited minimal Bsh activity in spite of having intact bsh2, bsh3 and bsh4 genes in its genome and hence had a Bsh(-) phenotype. Cloning and sequence characterization of Lp20 bsh1 gene predicted four individual open reading frames (ORFs) within this region. BLAST analysis of ORF1 and ORF2 revealed significant sequence similarity to the L. plantarum bsh1 gene while ORF3 and ORF4 showed high sequence homology to IS30-family transposases. Since, IS30-related transposon element was inserted within Lp20 bsh1 gene in reverse orientation (3'-5'), it introduced several stop codons and disrupted the protein reading frames of both Bsh1 and transposase. Inverted terminal repeats (GGCAGATTG) of transposon, mediated its insertion at 255-263 nt and 1301-1309 nt positions of Lp20 bsh1 gene. In conclusion, insertion of IS30 related-transposon within the bsh1 gene sequence of L. plantarum strain Lp20 demolished the integrity and functionality of Bsh1 enzyme. Additionally, this transposon DNA sequence remains active among various Lactobacillus spp. and hence harbors the potential to be explored in the development of efficient insertion mutagenesis system. Copyright © 2013 Elsevier GmbH. All rights reserved.

Characterization of three active transposable elements recently inserted in three independent DFR-A alleles and one high-copy DNA transposon isolated from the Pink allele of the ANS gene in onion (Allium cepa L.).

PubMed

Kim, Sunggil; Park, Jee Young; Yang, Tae-Jin

2015-06-01

Intact retrotransposon and DNA transposons inserted in a single gene were characterized in onions (Allium cepa) and their transcription and copy numbers were estimated in this study. While analyzing diverse onion germplasm, large insertions in the DFR-A gene encoding dihydroflavonol 4-reductase (DFR) involved in the anthocyanin biosynthesis pathway were found in two accessions. A 5,070-bp long terminal repeat (LTR) retrotransposon inserted in the active DFR-A (R4) allele was identified from one of the large insertions and designated AcCOPIA1. An intact ORF encoded typical domains of copia-like LTR retrotransposons. However, AcCOPIA1 contained atypical 'TG' and 'TA' dinucleotides at the ends of the LTRs. A 4,615-bp DNA transposon was identified in the other large insertion. This DNA transposon, designated AcCACTA1, contained an ORF coding for a transposase showing homology with the CACTA superfamily transposable elements (TEs). Another 5,073-bp DNA transposon was identified from the DFR-A (TRN) allele. This DNA transposon, designated AchAT1, belonged to the hAT superfamily with short 4-bp terminal inverted repeats (TIRs). Finally, a 6,258-bp non-autonomous DNA transposon, designated AcPINK, was identified in the ANS-p allele encoding anthocyanidin synthase, the next downstream enzyme to DFR in the anthocyanin biosynthesis pathway. AcPINK also possessed very short 3-bp TIRs. Active transcription of AcCOPIA1, AcCACTA1, and AchAT1 was observed through RNA-Seq analysis and RT-PCR. The copy numbers of AcPINK estimated by mapping the genomic DNA reads produced by NextSeq 500 were predominantly high compared with the other TEs. A series of evidence indicated that these TEs might have transposed in these onion genes very recently, providing a stepping stone for elucidation of enormously large-sized onion genome structure.

Disruption of tetR type regulator adeN by mobile genetic element confers elevated virulence in Acinetobacter baumannii.

PubMed

Saranathan, Rajagopalan; Pagal, Sudhakar; Sawant, Ajit R; Tomar, Archana; Madhangi, M; Sah, Suresh; Satti, Annapurna; Arunkumar, K P; Prashanth, K

2017-10-03

Acinetobacter baumannii is an important human pathogen and considered as a major threat due to its extreme drug resistance. In this study, the genome of a hyper-virulent MDR strain PKAB07 of A. baumannii isolated from an Indian patient was sequenced and analyzed to understand its mechanisms of virulence, resistance and evolution. Comparative genome analysis of PKAB07 revealed virulence and resistance related genes scattered throughout the genome, instead of being organized as an island, indicating the highly mosaic nature of the genome. Many intermittent horizontal gene transfer events, insertion sequence (IS) element insertions identified were augmenting resistance machinery and elevating the SNP densities in A. baumannii eventually aiding in their swift evolution. ISAba1, the most widely distributed insertion sequence in A. baumannii was found in multiple sites in PKAB07. Out of many ISAba1 insertions, we identified novel insertions in 9 different genes wherein insertional inactivation of adeN (tetR type regulator) was significant. To assess the significance of this disruption in A. baumannii, adeN mutant and complement strains were constructed in A. baumannii ATCC 17978 strain and studied. Biofilm levels were abrogated in the adeN knockout when compared with the wild type and complemented strain of adeN knockout. Virulence of the adeN knockout mutant strain was observed to be high, which was validated by in vitro experiments and Galleria mellonella infection model. The overexpression of adeJ, a major component of AdeIJK efflux pump observed in adeN knockout strain could be the possible reason for the elevated virulence in adeN mutant and PKB07 strain. Knocking out of adeN in ATCC strain led to increased resistance and virulence at par with the PKAB07. Disruption of tetR type regulator adeN by ISAba1 consequently has led to elevated virulence in this pathogen.

TACT1- TRANSIENT THERMAL ANALYSIS OF A COOLED TURBINE BLADE OR VANE EQUIPPED WITH A COOLANT INSERT

NASA Technical Reports Server (NTRS)

Gaugler, R. E.

1994-01-01

As turbine-engine core operating conditions become more severe, designers must develop more effective means of cooling blades and vanes. In order to design reliable, cooled turbine blades, advanced transient thermal calculation techniques are required. The TACT1 computer program was developed to perform transient and steady-state heat-transfer and coolant-flow analyses for cooled blades, given the outside hot-gas boundary condition, the coolant inlet conditions, the geometry of the blade shell, and the cooling configuration. TACT1 can analyze turbine blades, or vanes, equipped with a central coolant-plenum insert from which coolant-air impinges on the inner surface of the blade shell. Coolant-side heat-transfer coefficients are calculated with the heat transfer mode at each station being user specified as either impingement with crossflow, forced convection channel flow, or forced convection over pin fins. A limited capability to handle film cooling is also available in the program. The TACT1 program solves for the blade temperature distribution using a transient energy equation for each node. The nodal energy balances are linearized, one-dimensional, heat-conduction equations which are applied at the wall-outer-surface node, at the junction of the cladding and the metal node, and at the wall-inner-surface node. At the mid-metal node a linear, three-dimensional, heat-conduction equation is used. Similarly, the coolant pressure distribution is determined by solving the set of transfer momentum equations for the one-dimensional flow between adjacent fluid nodes. In the coolant channel, energy and momentum equations for one-dimensional compressible flow, including friction and heat transfer, are used for the elemental channel length between two coolant nodes. The TACT1 program first obtains a steady-state solution using iterative calculations to obtain convergence of stable temperatures, pressures, coolant-flow split, and overall coolant mass balance. Transient calculations are based on the steady-state solutions obtained. Input to the TACT1 program includes a geometrical description of the blade and insert, the nodal spacing to be used, and the boundary conditions describing the outside hot-gas and the coolant-inlet conditions. The program output includes the value of nodal temperatures and pressures at each iteration. The final solution output includes the temperature at each coolant node, and the coolant flow rates and Reynolds numbers. This program is written in FORTRAN IV for batch execution and has been implemented on an IBM 360 computer with a central memory requirement of approximately 480K of 8 bit bytes. The TACT1 program was developed in 1978.

Quantum-limited detection of millimeter waves using superconducting tunnel junctions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mears, Carl Atherton

1991-09-01

The quasiparticle tunneling current in a superconductor-insulator- superconductor (SIS) tunnel junction is highly nonlinear. Such a nonlinearity can be used to mix two millimeter wave signals to produce a signal at a much lower intermediate frequency. We have constructed several millimeter and sub-millimeter wave SIS mixers in order to study high frequency response of the quasiparticle tunneling current and the physics of high frequency mixing. We have made the first measurement of the out-of-phase tunneling currents in an SIS tunnel junction. We have developed a method that allows us to determine the parameters of the high frequency embedding circuit bymore » studying the details of the pumped I-V curve. We have constructed a 80--110 GHz waveguide-based mixer test apparatus that allows us to accurately measure the gain and added noise of the SIS mixer under test. Using extremely high quality tunnel junctions, we have measured an added mixer noise of 0.61 ± 0.36 quanta, which is within 25 percent of the quantum limit imposed by the Heisenberg uncertainty principle. This measured performance is in excellent agreement with that predicted by Tucker`s theory of quantum mixing. We have also studied quasioptically coupled millimeter- and submillimeter-wave mixers using several types of integrated tuning elements. 83 refs.« less

Quantum-limited detection of millimeter waves using superconducting tunnel junctions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mears, C.A.

1991-09-01

The quasiparticle tunneling current in a superconductor-insulator- superconductor (SIS) tunnel junction is highly nonlinear. Such a nonlinearity can be used to mix two millimeter wave signals to produce a signal at a much lower intermediate frequency. We have constructed several millimeter and sub-millimeter wave SIS mixers in order to study high frequency response of the quasiparticle tunneling current and the physics of high frequency mixing. We have made the first measurement of the out-of-phase tunneling currents in an SIS tunnel junction. We have developed a method that allows us to determine the parameters of the high frequency embedding circuit bymore » studying the details of the pumped I-V curve. We have constructed a 80--110 GHz waveguide-based mixer test apparatus that allows us to accurately measure the gain and added noise of the SIS mixer under test. Using extremely high quality tunnel junctions, we have measured an added mixer noise of 0.61 {plus minus} 0.36 quanta, which is within 25 percent of the quantum limit imposed by the Heisenberg uncertainty principle. This measured performance is in excellent agreement with that predicted by Tucker's theory of quantum mixing. We have also studied quasioptically coupled millimeter- and submillimeter-wave mixers using several types of integrated tuning elements. 83 refs.« less

Protective effects of chebulic acid on alveolar epithelial damage induced by urban particulate matter.

PubMed

Lee, Kyung-Won; Nam, Mi-Hyun; Lee, Hee-Ra; Hong, Chung-Oui; Lee, Kwang-Won

2017-07-19

Chebulic acid (CA) isolated from T. chebula, which has been reported for treating asthma, as a potent anti-oxidant resources. Exposure to ambient urban particulate matter (UPM) considered as a risk for cardiopulmonary vascular dysfunction. To investigate the protective effect of CA against UPM-mediated collapse of the pulmonary alveolar epithelial (PAE) cell (NCI-H441), barrier integrity parameters, and their elements were evaluated in PAE. CA was acquired from the laboratory previous reports. UPM was obtained from the National Institutes of Standards and Technology, and these were collected in St. Louis, MO, over a 24-month period and used as a standard reference. To confirm the protection of PAE barrier integrity, paracellular permeability and the junctional molecules were estimated with determination of transepithelial electrical resistance, Western Blotting, RT-PCR, and fluorescent staining. UPM aggravated the generation of reactive oxygen species (ROS) in PAE and also decreased mRNA and protein levels of junction molecules and barrier integrity in NCI-H441. However, CA repressed the ROS in PAE, also improved barrier integrity by protecting the junctional parameters in NCI-H411. These data showed that CA resulted in decreased UPM-induced ROS formation, and the protected the integrity of the tight junctions against UPM exposure to PAE barrier.