Science.gov

Sample records for elements alpha hib

  1. Hib Photos

    MedlinePlus

    ... fluid culture positive for Haemophilus influenzae , type b (Gram stain) www.vaccineinformation.org/photos/hib_aap001.jpg ... Pediatrics Inferior view of a brain infected with gram-negative Haemophilus influenzae bacteria www.vaccineinformation.org/photos/ ...

  2. Haemophilus influenzae type b (Hib) Vaccine

    MedlinePlus

    ... among children under 5 years old in the United States. Meningitis is an infection of the lining of ... Hib vaccine, about 20,000 children in the United States under 5 years old got Hib disease each ...

  3. Hibbing Community College's Community Computer Center.

    ERIC Educational Resources Information Center

    Regional Technology Strategies, Inc., Carrboro, NC.

    This paper reports on the development of the Community Computer Center (CCC) at Hibbing Community College (HCC) in Minnesota. HCC is located in the largest U.S. iron mining area in the United States. Closures of steel-producing plants are affecting the Hibbing area. Outmigration, particularly of younger workers and their families, has been…

  4. Facts about Hib Disease. ARC Facts.

    ERIC Educational Resources Information Center

    Association for Retarded Citizens, Arlington, TX.

    The fact sheet provides basic information about Hib Disease in young children, which may involve a bacterial meningitis causing mental retardation, hearing loss, partial blindness, speech disorders, partial paralysis, behavioral problems, or seizures. Stressed is prevention of Hib Disease through immunization. The question and answer format…

  5. {alpha} decay of even-even superheavy elements

    SciTech Connect

    Denisov, V. Yu.; Khudenko, A. A.

    2010-03-15

    The {alpha}-decay half-lives of even-even superheavy elements within the range of proton number 104<=Z<=126, which can be formed by possible cold and hot fusion reactions, are calculated in the framework of various approaches for {alpha}-decay half-life evaluation and by using the Q values of {alpha} transitions obtained within different approximations for atomic masses. The dependencies of {alpha}-decay half-lives of superheavy elements on model approaches for both the Q values and half-life calculations are discussed in detail.

  6. Oxidation of element 102, nobelium, with flow electrolytic column chromatography on an atom-at-a-time scale.

    PubMed

    Toyoshima, Atsushi; Kasamatsu, Yoshitaka; Tsukada, Kazuaki; Asai, Masato; Kitatsuji, Yoshihiro; Ishii, Yasuo; Toume, Hayato; Nishinaka, Ichiro; Haba, Hiromitsu; Ooe, Kazuhiro; Sato, Wataru; Shinohara, Atsushi; Akiyama, Kazuhiko; Nagame, Yuichiro

    2009-07-01

    We report here on the successful oxidation of element 102, nobelium (No), on an atom-at-a-time scale in 0.1 M alpha-hydroxyisobutyric acid (alpha-HIB) solution using a newly developed technique, flow electrolytic column chromatography. It is found that the most stable ion, No(2+), is oxidized to No(3+) within 3 min and that the oxidized No complex with alpha-HIB holds the trivalent state in the column above an applied potential of 1.0 V.

  7. Oxidation of element 102, nobelium, with flow electrolytic column chromatography on an atom-at-a-time scale.

    PubMed

    Toyoshima, Atsushi; Kasamatsu, Yoshitaka; Tsukada, Kazuaki; Asai, Masato; Kitatsuji, Yoshihiro; Ishii, Yasuo; Toume, Hayato; Nishinaka, Ichiro; Haba, Hiromitsu; Ooe, Kazuhiro; Sato, Wataru; Shinohara, Atsushi; Akiyama, Kazuhiko; Nagame, Yuichiro

    2009-07-01

    We report here on the successful oxidation of element 102, nobelium (No), on an atom-at-a-time scale in 0.1 M alpha-hydroxyisobutyric acid (alpha-HIB) solution using a newly developed technique, flow electrolytic column chromatography. It is found that the most stable ion, No(2+), is oxidized to No(3+) within 3 min and that the oxidized No complex with alpha-HIB holds the trivalent state in the column above an applied potential of 1.0 V. PMID:19514720

  8. Hib Vaccines: Past, Present, and Future Perspectives

    PubMed Central

    Zarei, Adi Essam; Almehdar, Hussein A.; Redwan, Elrashdy M.

    2016-01-01

    Haemophilus influenzae type b (Hib) causes many severe diseases, including epiglottitis, pneumonia, sepsis, and meningitis. In developed countries, the annual incidence of meningitis caused by bacteria is approximately 5–10 cases per population of 100,000. The Hib conjugate vaccine is considered protective and safe. Adjuvants, molecules that can enhance and/or regulate the fundamental immunogenicity of an antigen, comprise a wide range of diverse compounds. While earlier developments of adjuvants created effective products, there is still a need to create new generations, rationally designed based on recent discoveries in immunology, mainly in innate immunity. Many factors may play a role in the immunogenicity of Hib conjugate vaccines, such as the polysaccharides and proteins carrier used in vaccine construction, as well as the method of conjugation. A Hib conjugate vaccine has been constructed via chemical synthesis of a Hib saccharide antigen. Two models of carbohydrate-protein conjugate have been established, the single ended model (terminal amination-single method) and cross-linked lattice matrix (dual amination method). Increased knowledge in the fields of immunology, molecular biology, glycobiology, glycoimmunology, and the biology of infectious microorganisms has led to a dramatic increase in vaccine efficacy. PMID:26904695

  9. Stability against {alpha} decay of some recently observed superheavy elements

    SciTech Connect

    Roy Chowdhury, Partha; Gangopadhyay, G.; Bhattacharyya, Abhijit

    2011-02-15

    The probability of {alpha}-particle emission for some recently observed superheavy nuclei (SHN) are investigated. The {alpha}-decay half-lives of SHN are calculated in a quantum tunneling model with density-dependent M3Y (DDM3Y) effective nuclear interaction using theoretical and measured Q{sub {alpha}} values. We determine the density distribution of {alpha} and daughter nuclei from the relativistic mean-field (RMF) theory using FSUGold force, NL3, and TM1 parameter sets. The double-folded nuclear potential is numerically calculated in a more microscopic manner using these density distributions. The estimated values of {alpha}-decay half-lives are in good agreement with the recent data. We compare our results with recently detected {alpha}-decay chains from a new element with atomic number Z=117 reported by the Joint Institute for Nuclear Research, Dubna. Finally, we determine the half-lives of superheavy elements with Z=108-120 and neutron number N=152-190 to explore the long-standing predictions of the existence of an 'island of stability' due to possible spherical proton (Z{approx}114) and neutron (N{approx}184) shell closures.

  10. Protect Your Child against Hib Disease

    MedlinePlus

    ... 722 KB] View the Hib Vaccine Information Statement ( English ) or other languages ) Call 1-800-232-4636 (1-800-CDC- ... this? Submit What's this? Submit Button Past Emails Language: English Español (Spanish) File Formats Help: How do I ...

  11. Crystallization of hepatocyte nuclear factor 4 alpha (HNF4 alpha) in complex with the HNF1 alpha promoter element.

    PubMed

    Lu, Peng; Liu, Jianguo; Melikishvili, Manana; Fried, Michael G; Chi, Young-In

    2008-04-01

    Hepatocyte nuclear factor 4alpha (HNF4alpha) is a member of the nuclear receptor superfamily that plays a central role in organ development and metabolic functions. Mutations on HNF4alpha cause maturity-onset diabetes of the young (MODY), a dominant monogenic cause of diabetes. In order to understand the molecular mechanism of promoter recognition and the molecular basis of disease-causing mutations, the recombinant HNF4alpha DNA-binding domain was prepared and used in a study of its binding properties and in crystallization with a 21-mer DNA fragment that contains the promoter element of another MODY gene, HNF1alpha. The HNF4alpha protein displays a cooperative and specific DNA-binding activity towards its target gene-recognition elements. Crystals of the complex diffract to 2.0 A using a synchrotron-radiation source under cryogenic (100 K) conditions and belong to space group C2, with unit-cell parameters a = 121.63, b = 35.43, c = 70.99 A, beta = 119.36 degrees . A molecular-replacement solution has been obtained and structure refinement is in progress. This structure and the binding studies will provide the groundwork for detailed functional and biochemical studies of the MODY mutants. PMID:18391435

  12. Sandia Higher Order Elements (SHOE) v 0.5 alpha

    SciTech Connect

    2013-09-24

    SHOE is research code for characterizing and visualizing higher-order finite elements; it contains a framework for defining classes of interpolation techniques and element shapes; methods for interpolating triangular, quadrilateral, tetrahedral, and hexahedral cells using Lagrange and Legendre polynomial bases of arbitrary order; methods to decompose each element into domains of constant gradient flow (using a polynomial solver to identify critical points); and an isocontouring technique that uses this decomposition to guarantee topological correctness. Please note that this is an alpha release of research software and that some time has passed since it was actively developed; build- and run-time issues likely exist.

  13. Sandia Higher Order Elements (SHOE) v 0.5 alpha

    2013-09-24

    SHOE is research code for characterizing and visualizing higher-order finite elements; it contains a framework for defining classes of interpolation techniques and element shapes; methods for interpolating triangular, quadrilateral, tetrahedral, and hexahedral cells using Lagrange and Legendre polynomial bases of arbitrary order; methods to decompose each element into domains of constant gradient flow (using a polynomial solver to identify critical points); and an isocontouring technique that uses this decomposition to guarantee topological correctness. Please notemore » that this is an alpha release of research software and that some time has passed since it was actively developed; build- and run-time issues likely exist.« less

  14. Haemophilus influenzae Type b (Hib) vaccine - what you need to know

    MedlinePlus

    ... taken in its entirety from the CDC Hib (Haemophilus Influenzae Type b) Vaccine Information Statement (VIS): www.cdc. ... statements/hib.pdf . CDC review information for Hib (Haemophilus Influenzae Type b) VIS: Page last reviewed: April 2, ...

  15. H. influenzae type b (Hib) vaccine--controversies.

    PubMed

    Shah, Nitin K

    2003-06-01

    Hib vaccine is the 8th vaccine knocking at the door to be included in the EPI the world over. However there are some controversies that need to be addressed, especially when it comes to use of this vaccine in India. It is difficult to culture Hib unless one uses sheep blood enriched media for culture. There is a lack of good community based data on Hib burden in India. This makes many feel that Hib is rare in India. However this is not true. There are many studies that have looked at this closely. Hib is a common cause of meningitis and pneumonitis in children less than 5 years old in India. There is wide spread problem of multi-drug resistance by Hib in India. Mortality of meningitis is as high as 100% if third generation cephalosporins are not used in time. Of the survivors of meningitis, 60% develop long-term sequelae. Hib vaccine is very effective and can lead to 99% reduction with mass vaccination in just 2-3 years. It is also a very safe vaccine. Of the conjugated vaccines available in India all are equally effective and safe and there is nothing to choose one over the other. There is a need to give a booster dose at 15-18 months of age. Even UK, which never gave the booster dose, is seriously thinking of changing their practice and give a booster dose. Lastly the combination vaccines of Hib with IPV, DPwT/DPaT, and Hepatitis B are safe and effective and should be encouraged to improve the compliance. The use of Hib vaccine is recommended in India, for those who can afford the vaccine. PMID:12921318

  16. Haemophilus Influenzae Type B (Hib): Questions and Answers

    MedlinePlus

    ... five cases of invasive Hib disease in children younger than 5 years from 2008, the largest number ... the leading cause of bacterial meningitis among children younger than age five years in the United States. ...

  17. Alpha Virginis: line-profile variations and orbital elements

    NASA Astrophysics Data System (ADS)

    Harrington, David; Koenigsberger, Gloria; Olguín, Enrique; Ilyin, Ilya; Berdyugina, Svetlana V.; Lara, Bruno; Moreno, Edmundo

    2016-05-01

    Context. Alpha Virginis (Spica) is a B-type binary system whose proximity and brightness allow detailed investigations of the internal structure and evolution of stars undergoing time-variable tidal interactions. Previous studies have led to the conclusion that the internal structure of Spica's primary star may be more centrally condensed than predicted by theoretical models of single stars, raising the possibility that the interactions could lead to effects that are currently neglected in structure and evolution calculations. The key parameters in confirming this result are the values of the orbital eccentricity e, the apsidal period U, and the primary star's radius, R1. Aims: The aim of this paper is to analyze the impact that Spica's line profile variability has on the derivation of its orbital elements and to explore the use of the variability for constraining R1. Methods: We use high signal-to-noise and high spectral resolution observations obtained in 2000, 2008, and 2013 to derive the orbital elements from fits to the radial velocity curves. We produce synthetic line profiles using an ab initio tidal interaction model. Results: The general variations in the line profiles can be understood in terms of the tidal flows, whose large-scale structure is relatively fixed in the rotating binary system reference frame. Fits to the radial velocity curves yield e = 0.108 ± 0.014. However, the analogous RV curves from theoretical line profiles indicate that the distortion in the lines causes the fitted value of e to depend on the argument of periastron; i.e., on the epoch of observation. As a result, the actual value of e may be as high as 0.125. We find that U = 117.9 ± 1.8, which is in agreement with previous determinations. Using the value R1 = 6.8 R⊙ derived by Palate et al. (2013) the value of the observational internal structure constant k2,obs is consistent with theory. We confirm the presence of variability in the line profiles of the secondary star. RV

  18. The distribution of alpha elements in Andromeda dwarf galaxies

    SciTech Connect

    Vargas, Luis C.; Geha, Marla C.; Tollerud, Erik J.

    2014-07-20

    We present alpha to iron abundance ratios for 226 individual red giant branch stars in nine dwarf galaxies of the Andromeda (M31) satellite system. The abundances are measured from the combined signal of Mg, Si, Ca, and Ti lines in Keck/DEIMOS medium-resolution spectra. This constitutes the first large sample of alpha abundance ratios measured in the M31 satellite system. The dwarf galaxies in our sample exhibit a variety of alpha abundance ratios, with the average values in each galaxy ranging from approximately solar ([α/Fe] ∼ + 0.0) to alpha-enhanced ([α/Fe] ∼ + 0.5). These variations do not show a correlation with internal kinematics, environment, or stellar density. We confirm radial gradients in the iron abundance of two galaxies out of the five with sufficient data (NGC 185 and And II). There is only tentative evidence for an alpha abundance radial gradient in NGC 185. We homogeneously compare our results to the Milky Way classical dwarf spheroidals, finding evidence for wider variation in average alpha abundance. In the absence of chemical abundances for the M31 stellar halo, we compare to the Milky Way stellar halo. A stellar halo comprised of disrupted M31 satellites is too metal-rich and inconsistent with the Milky Way halo alpha abundance distribution even if considering only satellites with predominantly old stellar populations. The M31 satellite population provides a second system in which to study chemical abundances of dwarf galaxies and reveals a wider variety of abundance patterns than the Milky Way.

  19. Stability of HIB-Cul3 E3 ligase adaptor HIB Is Regulated by Self-degradation and Availability of Its Substrates

    PubMed Central

    Zhou, Zizhang; Xu, Congyu; Chen, Ping; Liu, Chen; Pang, Shu; Yao, Xia; Zhang, Qing

    2015-01-01

    The HIB-Cul3 complex E3 ligase regulates physiological homeostasis through regulating its substrate stability and its activity can be modulated by changing HIB abundance. However, regulation of HIB remains elusive. Here we provide evidence that HIB is degraded through the proteasome by Cul3-mediated polyubiquitination in K48 manner in Drosophila. Strikingly, HIB is targeted for degradation by itself. We further identify that three degrons (52LKSS56T, 76LDEE80S and 117MESQ121R) and K185 and K198 of HIB are essential for its auto-degradation. Finally, we demonstrate that HIB-Cul3 substrates, Ci and Puc, can effectively protect HIB from HIB-Cul3-mediated degradation. Taken together, our study indicates that there is an exquisite equilibrium between the adaptor and targets to achieve the tight control of the HIB, which is essential for maintaining suitable Hh and JNK signaling. And the mechanism of adaptor self-degradation and reciprocal control of the abundance between adaptor and its substrates is also applied to BTB-Cul3 E3 ligase adaptor dKeap1, dDiablo and dKLHL18. PMID:26263855

  20. Children with Haemophilus influenzae type b (Hib) vaccine failure have long-term bactericidal antibodies against virulent Hib strains with multiple capsular loci.

    PubMed

    Townsend-Payne, Kelly; Ladhani, Shamez N; Findlow, Helen; Slack, Mary; Borrow, Ray

    2016-07-25

    Children who develop invasive Haemophilus influenzae serotype b (Hib) disease after immunisation with a highly-effective conjugate vaccine are more likely to have been infected with Hib strains possessing multiple copies of the capsulation locus. Using a recently-validated serum bactericidal antibody (SBA) assay, we tested convalescent sera from 127 Hib vaccine failure cases against clinical Hib strains expressing 1-5 copies of the capsulation locus. SBA titres correlated weakly with anti-capsular IgG antibody concentrations and there was no association between SBA geometric mean titres and number of capsulation locus copies. After infection, children with Hib vaccine failure were equally protected against Hib strains with 1-5 copies of the capsulation locus.

  1. Heavy element abundances in Ap stars from ultraviolet data. I - The bright reference stars Alpha Lyrae and Alpha Canis Majoris A

    NASA Technical Reports Server (NTRS)

    Boiarchuk, A. A.; Snow, T. P., Jr.

    1978-01-01

    Curve-of-growth analysis is used to derive chemical abundances in Alpha Lyr and Alpha CMa, based on ultraviolet spectra obtained with Copernicus. This analysis is part of a program to study the abundances of the heavy elements mercury and platinum and the short-lived element technetium in the atmospheres of Ap and Am stars. Ultraviolet Fe II lines are used to establish the curves of growth for Alpha Lyr and Alpha CMa A; abundances of a variety of elements, along with upper limits on Hg, Pt, and Tc, are derived. In cases where previous studies based on visual spectra have included elements in common with the present analysis, the agreement is good within the known uncertainties. One new element, cadmium, is observed for these two stars. The upper limits on Pt and Hg, as well as Tc, show that these elements are probably not enhanced in Alpha CMa A by more than about one order of magnitude.

  2. Quality of the Haemophilus influenzae type b (Hib) antibody response induced by diphtheria-tetanus-acellular pertussis/Hib combination vaccines.

    PubMed

    Denoël, Philippe A; Goldblatt, David; de Vleeschauwer, Isabel; Jacquet, Jeanne-Marie; Pichichero, Michael E; Poolman, Jan T

    2007-10-01

    It has been repeatedly observed that mixing Haemophilus influenzae type b (Hib) conjugate vaccines with acellular pertussis-containing vaccines (diphtheria-tetanus-acellular pertussis [DTPa]) resulted in a reduced magnitude of the anti-polyriboseribitolphosphate antibody response compared to that obtained when Hib vaccines were administered separately and not mixed. Nevertheless, the quality and functionality of the immune responses have been shown to be the same. With the purpose of investigating the quality of the anti-Hib immune responses that are elicited under different vaccination regimens, we report here four primary and booster-based pediatric clinical trials in which Hib vaccine was either mixed with DTPa or diphtheria-tetanus-whole-cell pertussis (DTPw)-based vaccines or was coadministered. Our results show that avidity maturation of the antibodies was lower when primary vaccination involved DTPa mixed with Hib compared to when DTPa and Hib were coadministered. No such difference was observed between mixed and separately administered Hib when associated with DTPa-hepatitis B virus-inactivated poliovirus or DTPw-based vaccines. All different combinations and regimens elicited the same opsonophagocytic and bactericidal activity as well as the same ability to protect in a passive infant rat protection assay. The functional activity of mixed DTPa-based and Hib vaccines was similar to that of mixed DTPw-based/Hib combinations. In conclusion, in vitro and in vivo data as well as postmarketing vaccine effectiveness data attest to the ability of DTPa-based/Hib combination vaccines to effectively prevent Hib-induced disease in children.

  3. Application of alpha spectrometry to the discovery of new elements by heavy-ion-beam bombardment

    SciTech Connect

    Nitschke, J.M.

    1983-05-01

    Starting with polonium in 1898, ..cap alpha..-spectrometry has played a decisive role in the discovery of new, heavy elements. For even-even nuclei, ..cap alpha..-spectra have proved simple to interpret and exhibit systematic trends that allow extrapolation to unknown isotopes. The early discovery of the natural ..cap alpha..-decay series led to the very powerful method of genetically linking the decay of new elements to the well-established ..cap alpha..-emission of daughter and granddaughter nuclei. This technique has been used for all recent discoveries of new elements including Z = 109. Up to mendelevium (Z = 101), thin samples suitable for ..cap alpha..-spectrometry were prepared by chemical methods. With the advent of heavy-ion accelerators new sample preparation methods emerged. These were based on the large momentum transfer associated with heavy-ion reactions, which produced energetic target recoils that, when ejected from the target, could be thermalized in He gas. Subsequent electrical deposition or a He-jet technique yielded samples that were not only thin enough for ..cap alpha..-spectroscopy, but also for ..cap alpha..- and ..beta..-recoil experiments. Many variations of these methods have been developed and are discussed. For the synthesis of element 106 an aerosol-based recoil transport technique was devised. In the most recent experiments, ..cap alpha..-spectrometry has been coupled with the magnetic analysis of the recoils. The time from production to analysis of an isotope has thereby been reduced to 10/sup -6/ s; while it was 10/sup -1/ to 10/sup 0/ s for He-jets and 10/sup 1/ to 10/sup 3/ s for rapid chemical separations. Experiments are now in progress to synthesize super heavy elements (SHE) and to analyze them with these latest techniques. Again, ..cap alpha..-spectrometry will play a major role since the expected signature for the decay of a SHE is a sequence of ..cap alpha..-decays followed by spontaneous fission.

  4. Retinoic acid activates human inducible nitric oxide synthase gene through binding of RAR{alpha}/RXR{alpha} heterodimer to a novel retinoic acid response element in the promoter

    SciTech Connect

    Zou Fang; Liu Yan; Liu Li; Wu Kailang; Wei Wei; Zhu Ying . E-mail: yingzhu@whu.edu.cn; Wu Jianguo . E-mail: wu9988@vip.sina.com

    2007-04-06

    Human inducible nitric oxide synthase (hiNOS) catalyzes nitric oxide (NO) which has a significant effect on tumor suppression and cancer therapy. Here we revealed the detailed molecular mechanism involved in the regulation of hiNOS expression induced by retinoic acid (RA). We showed that RAR{alpha}/RXR{alpha} heterodimer was important in hiNOS promoter activation, hiNOS protein expression, and NO production. Serial deletion and site-directed mutation analysis revealed two half-sites of retinoic acid response element (RARE) spaced by 5 bp located at -172 to -156 in the hiNOS promoter. EMSA and ChIP assays demonstrated that RAR{alpha}/RXR{alpha} directly bound to this RARE of hiNOS promoter. Our results suggested the identification of a novel RARE in the hiNOS promoter and the roles of the nuclear receptors (RAR{alpha}/RXR{alpha}) in the induction of hiNOS by RA.

  5. The {alpha}-induced thick-target {gamma}-ray yield from light elements

    SciTech Connect

    Heaton, R.K. |

    1994-10-01

    The {alpha}-induced thick-target {gamma}-ray yield from light elements has been measured in the energy range 5.6 MeV {le} E{sub {alpha}} {le} 10 MeV. The {gamma}-ray yield for > 2.1 MeV from thick targets of beryllium, boron nitride, sodium fluoride, magnesium, aluminum and silicon were measured using the {alpha}-particle beam from the Lawrence Berkeley Laboratories 88 in. cyclotron. The elemental yields from this experiment were used to construct the {alpha}-induced direct production {gamma}-ray spectrum from materials in the SNO detector, a large volume ultra-low background neutrino detector located in the Creighton mine near Sudbury, Canada. This background source was an order of magnitude lower than predicted by previous calculations. These measurements are in good agreement with theoretical calculations of this spectrum based on a statistical nuclear model of the reaction, with the gross high energy spectrum structure being reproduced to within a factor of two. Detailed comparison of experimental and theoretical excitation population distribution of several residual nuclei indicate the same level of agreement within experimental uncertainties.

  6. DNA elements regulating alpha1-tubulin gene induction during regeneration of eukaryotic flagella.

    PubMed

    Periz, G; Keller, L R

    1997-07-01

    Eukaryotic flagella are complex organelles composed of more than 200 polypeptides. Little is known about the regulatory mechanisms governing synthesis of the flagellar protein subunits and their assembly into this complex organelle. The unicellular green alga Chlamydomonas reinhardtii is the premier experimental model system for studying such cellular processes. When acid shocked, C. reinhardtii excises its flagella, rapidly and coordinately activates transcription of a set of flagellar genes, and ultimately regenerates a new flagellar pair. To define functionally the regulatory sequences that govern induction of the set of genes after acid shock, we analyzed the alpha1-tubulin gene promoter. To simplify transcriptional analysis in vivo, we inserted the selectable marker gene ARG7 on the same plasmid with a tagged alpha1-tubulin gene and stably introduced it into C. reinhardtii cells. By deletion of various sequences, two promoter regions (-176 to -122 and -85 to -16) were identified as important for induction of the tagged alpha1-tubulin gene. Deleting the region between -176 and -122 from the transcription start site resulted in an induction level which was only 45 to 70% of that of the resident gene. Deleting the region upstream of -56 resulted in a complete loss of inducibility without affecting basal expression. The alpha1-tubulin promoter region from -85 to -16 conferred partial acid shock inducibility to an arylsulfatase (ARS) reporter gene. These results show that induction of the alpha1-tubulin gene after acid shock is a complex response that requires diverse sequence elements.

  7. DNA elements regulating alpha1-tubulin gene induction during regeneration of eukaryotic flagella.

    PubMed Central

    Periz, G; Keller, L R

    1997-01-01

    Eukaryotic flagella are complex organelles composed of more than 200 polypeptides. Little is known about the regulatory mechanisms governing synthesis of the flagellar protein subunits and their assembly into this complex organelle. The unicellular green alga Chlamydomonas reinhardtii is the premier experimental model system for studying such cellular processes. When acid shocked, C. reinhardtii excises its flagella, rapidly and coordinately activates transcription of a set of flagellar genes, and ultimately regenerates a new flagellar pair. To define functionally the regulatory sequences that govern induction of the set of genes after acid shock, we analyzed the alpha1-tubulin gene promoter. To simplify transcriptional analysis in vivo, we inserted the selectable marker gene ARG7 on the same plasmid with a tagged alpha1-tubulin gene and stably introduced it into C. reinhardtii cells. By deletion of various sequences, two promoter regions (-176 to -122 and -85 to -16) were identified as important for induction of the tagged alpha1-tubulin gene. Deleting the region between -176 and -122 from the transcription start site resulted in an induction level which was only 45 to 70% of that of the resident gene. Deleting the region upstream of -56 resulted in a complete loss of inducibility without affecting basal expression. The alpha1-tubulin promoter region from -85 to -16 conferred partial acid shock inducibility to an arylsulfatase (ARS) reporter gene. These results show that induction of the alpha1-tubulin gene after acid shock is a complex response that requires diverse sequence elements. PMID:9199320

  8. Proton NMR assignment and secondary structural elements of human transforming growth factor. alpha

    SciTech Connect

    Brown, S.C.; Mueller, L.; Jeffs, P.W. )

    1989-01-24

    The {sup 1}H NMR spectrum of human transforming growth factor {alpha} (hTGF-{alpha}) has been completely assigned, and secondary structural elements have been identified as a preliminary step in determining the structure of this protein by distance geometry methods. Many of these structural elements closely correspond to those previously found in a truncated human EGF and murine EGF. These include the presence of an antiparallel {beta}-sheet between residues G19 and C34 with a type I {beta}-turn at V25-D28, a type II {beta}-turn at H35-Y38, and another short {beta}-sheet between residues Y38-V39 and H45-A46.

  9. Implications of private sector Hib vaccine coverage for the introduction of public sector Hib-containing pentavalent vaccine in India: evidence from retrospective time series data

    PubMed Central

    Sharma, Abhishek; Kaplan, Warren A; Chokshi, Maulik; Hasan Farooqui, Habib; Zodpey, Sanjay P

    2015-01-01

    Objective Haemophilus influenzae type b (Hib) vaccine has been available in India's private sector market since 1997. It was not until 14 December 2011 that the Government of India initiated the phased public sector introduction of a Hib (and DPT, diphtheria, pertussis, tetanus)-containing pentavalent vaccine. Our objective was to investigate the state-specific coverage and behaviour of Hib vaccine in India when it was available only in the private sector market but not in the public sector. This baseline information can act as a guide to determine how much coverage the public sector rollout of pentavalent vaccine (scheduled April 2015) will need to bear in order to achieve complete coverage. Setting 16 of 29 states in India, 2009–2012. Design Retrospective descriptive secondary data analysis. Data (1) Annual sales of Hib vaccines, by volume, from private sector hospitals and retail pharmacies collected by IMS Health and (2) national household surveys. Outcome measures State-specific Hib vaccine coverage (%) and its associations with state-specific socioeconomic status. Results The overall private sector Hib vaccine coverage among the 2009–2012 birth cohort was low (4%) and varied widely among the studied Indian states (minimum 0.3%; maximum 4.6%). We found that private sector Hib vaccine coverage depends on urban areas with good access to the private sector, parent's purchasing capacity and private paediatricians’ prescribing practices. Per capita gross domestic product is a key explanatory variable. The annual Hib vaccine uptake and the 2009–2012 coverage levels were several times higher in the capital/metropolitan cities than the rest of the state, suggesting inequity in access to Hib vaccine delivered by the private sector. Conclusions If India has to achieve high and equitable Hib vaccine coverage levels, nationwide public sector introduction of the pentavalent vaccine is needed. However, the role of private sector in universal Hib vaccine coverage is

  10. Analysis of particulates for very light elements by forward scattering of alpha particles

    SciTech Connect

    Wolfe, G.W.

    1980-09-01

    PIXE analysis is limited to elements heavier than sodium. A technique has been developed for obtaining quantitative information about the levels of elements hydrogen through flourine by forward scattering of 18 MeV alphas, and may be obtained simultaneously with PIXE. Using substrate thicknesses less than 1 mg/cm/sup 2/, sensitivities from 2.7 ..mu..g/cm/sup 2/ for hydrogen to 124 ..mu..g/cm/sup 2/ for carbon, may be obtained after corrections, with determinations accurate to +- 15%, in 200 second irradiation times. Substantial corrections must be made.

  11. ALPHA ELEMENT ABUNDANCES IN A LARGE SAMPLE OF GALACTIC PLANETARY NEBULAE

    SciTech Connect

    Milingo, J. B.; Kwitter, K. B.; Souza, S. P.; Henry, R. B. C. E-mail: kkwitter@williams.ed E-mail: henry@mail.nhn.ou.ed

    2010-03-10

    In this paper, we present emission line strengths, abundances, and element ratios (X/O for Ne, S, Cl, and Ar) for a sample of 38 Galactic disk planetary nebulae (PNe) consisting primarily of Peimbert classification Type I. Spectrophotometry for these PNe incorporates an extended optical/near-IR range of lambdalambda3600-9600 A including the [S III] lines at 9069 A and 9532 A, setting this relatively large sample apart from typical spectral coverage. We have utilized Emission Line Spectrum Analyzer, a five-level atom abundance routine, to determine T{sub e} , N{sub e} , ionization correction factors, and total element abundances, thereby continuing our work toward a uniformly processed set of data. With a compilation of data from >120 Milky Way PNe, we present results from our most recent analysis of abundance patterns in Galactic disk PNe. With a wide range of metallicities, galactocentric distances, and both Type I and non-Type I objects, we have examined the alpha elements against H II regions and blue compact galaxies (H2BCGs) to discern signatures of depletion or enhancement in PNe progenitor stars, particularly the destruction or production of O and Ne. We present evidence that many PNe have higher Ne/O and lower Ar/Ne ratios compared to H2BCGs within the range of 8.5-9.0 for 12 + log(O/H). This suggests that Ne is being synthesized in the low- and intermediate-mass progenitors. Sulfur abundances in PNe continue to show great scatter and are systematically lower than those found in H2BCG at a given metallicity. Although we find that PNe do show some distinction in alpha elements when compared to H2BCG, within the Peimbert classification types studied, PNe do not show significant differences in alpha elements amongst themselves, at least to an extent that would distinguish in situ nucleosynthesis from the observed dispersion in abundance ratios.

  12. Individual alpha elements, C, N, and Ba in early-type galaxies

    SciTech Connect

    Worthey, Guy; Tang, Baitian; Serven, Jedidiah

    2014-03-01

    Spectral data on early-type galaxies are analyzed for chemical abundance with an emphasis on obtaining detailed abundances for the elements O and Si in addition to C, N, Na, Mg, Ca, Fe, and Ba. The abundance trends with velocity dispersion fit preconceptions based upon previous Mg conclusions, namely, that larger galaxies have a higher alpha element to iron peak ratio indicative of a higher ratio of Type II to Type Ia supernova products. The heaviest alpha elements, Ca and Ti, do not participate in this trend, although this fact does not necessarily alter the basic picture given the uncertainties in nucleosynthetic yields. Elements that likely have significant contributions from intermediate-mass stars, namely, C, N, and Ba, also gain ground relative to Fe in massive galaxies at a modest level, with the Ba conclusion uncertain from our data alone. After the velocity dispersion trend is subtracted, [M/H], [N/Fe], [Na/Fe], [Mg/Fe], and [Ca/Fe] probably have cosmic scatter, and no quantity can be shown to not have cosmic scatter.

  13. A Xenopus laevis gene encoding EF-1 alpha S, the somatic form of elongation factor 1 alpha: sequence, structure, and identification of regulatory elements required for embryonic transcription.

    PubMed

    Johnson, A D; Krieg, P A

    1995-01-01

    Transcription of the Xenopus laevis EF-1 alpha S gene commences at the mid-blastula stage of embryonic development and then continues constitutively in all somatic tissues. The EF-1 alpha S promoter is extremely active in the early Xenopus embryo where EF-1 alpha S transcripts account for as much as 40% of all new polyadenylated transcripts. We have isolated the Xenopus EF-1 alpha S gene and used microinjection techniques to identify promoter elements responsible for embryonic transcription. These in vivo expression studies have identified an enhancer fragment, located approximately 4.4 kb upstream of the transcription start site, that is required for maximum expression from the EF-1 alpha S promoter. The enhancer fragment contains both an octamer and a G/C box sequence, but mutation studies indicate that the octamer plays no significant role in regulation of EF-1 alpha S expression in the embryo. The presence of a G/C element in the enhancer and of multiple G/C boxes in the proximal promoter region suggests that the G/C box binding protein, Sp1, plays a major role in the developmental regulation of EF-1 alpha S promoter activity. PMID:8565334

  14. Impact of conjugate Haemophilus influenzae type b (Hib) vaccine introduction in South Africa.

    PubMed Central

    von Gottberg, A.; de Gouveia, L.; Madhi, S. A.; du Plessis, M.; Quan, V.; Soma, K.; Huebner, R.; Flannery, B.; Schuchat, A.; Klugman, Kp

    2006-01-01

    OBJECTIVE: To analyse trends in reported invasive Haemophilus influenzae disease in South Africa within the first five years of introduction of conjugate Haemophilus influenzae type b (Hib) vaccine in the routine child immunization schedule. METHODS: We used national laboratory-based surveillance data to identify cases of invasive H. influenzae disease between July 1999 and June 2004, and submitted isolates for serotyping and antimicrobial susceptibility testing. FINDINGS: The absolute number of Hib cases (reported to the national surveillance system) among children below one year of age decreased by 65%, from 55 cases in 1999-2000 to 19 cases in 2003-04. Enhanced surveillance initiated in 2003, identified human immunodeficiency virus (HIV)-infection and incomplete vaccination as contributing factors for Hib transmission. The total number of laboratory-confirmed cases of H. influenzae remained unchanged because non-type b disease was being increasingly reported to the surveillance system concomitant with system enhancements. Children with non-typable disease were more likely to be HIV-positive (32 of 34, 94%) than children with Hib disease (10 of 14, 71%), P = 0.051. Recent Hib isolates were more likely to be multidrug resistant (2% in 1999-2000 versus 19% in 2003-04, P = 0.001). CONCLUSION: Data from a newly established national laboratory-based surveillance system showed a decrease in Hib disease burden among South African children following conjugate vaccine introduction and identified cases of non-typable disease associated with HIV infection. PMID:17128361

  15. Theoretical and experimental {alpha} decay half-lives of the heaviest odd-Z elements and general predictions

    SciTech Connect

    Zhang, H. F.; Royer, G.

    2007-10-15

    Theoretical {alpha} decay half-lives of the heaviest odd-Z nuclei are calculated using the experimental Q{sub {alpha}} value. The barriers in the quasimolecular shape path are determined within a Generalized Liquid Drop Model (GLDM) and the WKB approximation is used. The results are compared with calculations using the Density-Dependent M3Y (DDM3Y) effective interaction and the Viola-Seaborg-Sobiczewski (VSS) formulas. The calculations provide consistent estimates for the half-lives of the {alpha} decay chains of these superheavy elements. The experimental data stand between the GLDM calculations and VSS ones in the most time. Predictions are provided for the {alpha} decay half-lives of other superheavy nuclei within the GLDM and VSS approaches using the recent extrapolated Q{sub {alpha}} of Audi, Wapstra, and Thibault [Nucl. Phys. A729, 337 (2003)], which may be used for future experimental assignment and identification.

  16. A constitutive decay element promotes tumor necrosis factor alpha mRNA degradation via an AU-rich element-independent pathway.

    PubMed

    Stoecklin, Georg; Lu, Min; Rattenbacher, Bernd; Moroni, Christoph

    2003-05-01

    Tumor necrosis factor alpha (TNF-alpha) expression is regulated by transcriptional as well as posttranscriptional mechanisms, the latter including the control of mRNA decay through an AU-rich element (ARE) in the 3' untranslated region (UTR). Using two mutant cell lines deficient for ARE-mediated mRNA decay, we provide evidence for a second element, the constitutive decay element (CDE), which is also located in the 3' UTR of TNF-alpha. In stably transfected RAW 264.7 macrophages stimulated with lipopolysaccharide (LPS), the CDE continues to target a reporter transcript for rapid decay, whereas ARE-mediated decay is blocked. Similarly, the activation of p38 kinase and phosphatidylinositol 3-kinase in NIH 3T3 cells inhibits ARE-mediated but not CDE-mediated mRNA decay. The CDE was mapped to an 80-nucleotide (nt) segment downstream of the ARE, and point mutation analysis identified within the CDE a conserved sequence of 15 nt that is required for decay activity. We propose that the CDE represses TNF-alpha expression by maintaining the mRNA short-lived, thereby preventing excessive induction of TNF-alpha after LPS stimulation. Thus, CDE-mediated mRNA decay is likely to be an important mechanism limiting LPS-induced pathologic processes.

  17. Clear and present danger: in childhood meningitis. The importance of Hib immunisation in infancy and high-risk groups.

    PubMed

    Paul, Siba Prosad; Lamont, Lilias Susan

    2012-01-01

    The incidence of Haemophilus influenzae type b (Hib) invasive disease has declined significantly in the United Kingdom since the introduction of routine Hib immunisation. However life-threatening Hib infections such as meningitis and epiglottitis may still occur, especially in the unimmunised and immigrant children. A case of Hib meningitis is a reminder that the threat of invasive Hib disease has not been totally eliminated. Early diagnosis and treatment of bacterial meningitis (including Hib meningitis) is essential to prevent death and serious neurological sequelae. Health visitors play a vital role in encouraging parents to have their children immunised without any avoidable delays and in providing reliable information as necessary to back up this advice. Enquiring about immunisation status of all children new to a practice and addressing any omissions, should be routine; immigrant children (and their parents) may be particularly vulnerable and more likely to be inadequately immunised. PMID:22685975

  18. Lessons learned during the development and transfer of technology related to a new Hib conjugate vaccine to emerging vaccine manufacturers.

    PubMed

    Hamidi, A; Boog, C; Jadhav, S; Kreeftenberg, H

    2014-07-16

    The incidence of Haemophilus Influenzae type b (Hib) disease in developed countries has decreased since the introduction of Hib conjugate vaccines in their National Immunization Programs (NIP). In countries where Hib vaccination is not applied routinely, due to limited availability and high cost of the vaccines, invasive Hib disease is still a cause of mortality. Through the development of a production process for a Hib conjugate vaccine and related quality control tests and the transfer of this technology to emerging vaccine manufacturers in developing countries, a substantial contribution was made to the availability and affordability of Hib conjugate vaccines in these countries. Technology transfer is considered to be one of the fastest ways to get access to the technology needed for the production of vaccines. The first Hib conjugate vaccine based on the transferred technology was licensed in 2007, since then more Hib vaccines based on this technology were licensed. This paper describes the successful development and transfer of Hib conjugate vaccine technology to vaccine manufacturers in India, China and Indonesia. By describing the lessons learned in this process, it is hoped that other technology transfer projects can benefit from the knowledge and experience gained.

  19. alpha-decay half-lives of superheavy elements with the Dirac-Brueckner-Hartree-Fock (DBHF) nucleon effective interaction

    SciTech Connect

    Zhang Dida; Ma Zhongyu; Chen Baoqiu; Shen Shuifa

    2010-04-15

    The nucleon effective interaction is calculated in the framework of the Dirac-Brueckner-Hartree-Fock approach, which has been illustrated to reproduce well the ground-state properties and the experimental data of proton and alpha particle scattering off nuclei. The nuclear potential of the alpha-nucleus is obtained by doubly folding the nucleon effective interaction with respect to the density distributions of both the alpha particle and daughter nucleus. We apply this new nuclear potential of the alpha-nucleus to investigate the alpha-decay half-lives of superheavy elements in the preformed cluster model along with the experimental decay energies Q{sub exp}. Good agreement with the experimental data is achieved. We also systematically calculate the alpha-decay half-lives for 19 isotope chains (Z=102-120) in this framework using the theoretical alpha-decay energies Q{sub th} extracted from the Moeller-Nix-Kratz mass table. The predicted results are compared with those obtained by using the same Q{sub th} but the nuclear potentials evaluated with M3Y effective interaction and also with the results calculated in the empirical formulas of the Viola-Seaberg-Sobiczewski formula.

  20. The Immunogenicity and Safety of a Combined DTaP-IPV//Hib Vaccine Compared with Individual DTaP-IPV and Hib (PRP~T) Vaccines: a Randomized Clinical Trial in South Korean Infants

    PubMed Central

    2016-01-01

    Recommended infant vaccination in Korea includes DTaP-IPV and Hib vaccines administered as separate injections. In this randomized, open, controlled study we assessed the non-inferiority of immunogenicity of DTaP-IPV//Hib pentavalent combination vaccine (Pentaxim™) compared with licensed DTaP-IPV and Hib (PRP~T) vaccines. We enrolled 418 healthy Korean infants to receive either separate DTaP-IPV and Hib vaccines (n = 206) or the pentavalent DTaP-IPV//Hib (n = 208) vaccine at 2, 4, 6 months of age. Antibodies to all components were measured before the first vaccination and one month after the third, and safety was assessed after each vaccination including recording of reactions by parents. We confirmed the non-inferiority of DTaP-IPV//Hib compared with DTaP-IPV and Hib vaccines; 100% of both groups achieved seroprotection against D, T, IPV and PRP~T, and 97.5%–99.0% demonstrated seroresponses to pertussis antigens. Antibody levels were similar in both groups, except for those to the Hib component, PRP~T. In separate and combined groups geometric mean concentrations of anti-PRP~T antibodies were 23.9 and 11.0 µg/mL, respectively, but 98.3% and 97.4% had titers ≥ 1 µg/mL, indicative of long-term protection. All vaccines were well tolerated, with no vaccine-related serious adverse event. Both groups had similar safety profiles, but the combined vaccine group had fewer injection site reactions. The immunological non-inferiority and similar safety profile of DTaP-IPV//Hib vaccine to separate DTaP-IPV and Hib vaccines, with the advantage of fewer injections and injection site reactions, supports the licensure and incorporation of DTaP-IPV//Hib into the Korean national vaccination schedule (Clinical trial registry, NCT01214889). PMID:27510380

  1. The Immunogenicity and Safety of a Combined DTaP-IPV//Hib Vaccine Compared with Individual DTaP-IPV and Hib (PRP~T) Vaccines: a Randomized Clinical Trial in South Korean Infants.

    PubMed

    Kang, Jin Han; Lee, Hoan Jong; Kim, Kyung Hyo; Oh, Sung Hee; Cha, Sung Ho; Lee, Jin; Kim, Nam Hee; Eun, Byung Wook; Kim, Chang Hwi; Hong, Young Jin; Kim, Hyun Hee; Lee, Kyung Yil; Kim, Yae Jean; Cho, Eun Young; Kim, Hee Soo; Guitton, Fabrice; Ortiz, Esteban

    2016-09-01

    Recommended infant vaccination in Korea includes DTaP-IPV and Hib vaccines administered as separate injections. In this randomized, open, controlled study we assessed the non-inferiority of immunogenicity of DTaP-IPV//Hib pentavalent combination vaccine (Pentaxim™) compared with licensed DTaP-IPV and Hib (PRP~T) vaccines. We enrolled 418 healthy Korean infants to receive either separate DTaP-IPV and Hib vaccines (n = 206) or the pentavalent DTaP-IPV//Hib (n = 208) vaccine at 2, 4, 6 months of age. Antibodies to all components were measured before the first vaccination and one month after the third, and safety was assessed after each vaccination including recording of reactions by parents. We confirmed the non-inferiority of DTaP-IPV//Hib compared with DTaP-IPV and Hib vaccines; 100% of both groups achieved seroprotection against D, T, IPV and PRP~T, and 97.5%-99.0% demonstrated seroresponses to pertussis antigens. Antibody levels were similar in both groups, except for those to the Hib component, PRP~T. In separate and combined groups geometric mean concentrations of anti-PRP~T antibodies were 23.9 and 11.0 μg/mL, respectively, but 98.3% and 97.4% had titers ≥ 1 μg/mL, indicative of long-term protection. All vaccines were well tolerated, with no vaccine-related serious adverse event. Both groups had similar safety profiles, but the combined vaccine group had fewer injection site reactions. The immunological non-inferiority and similar safety profile of DTaP-IPV//Hib vaccine to separate DTaP-IPV and Hib vaccines, with the advantage of fewer injections and injection site reactions, supports the licensure and incorporation of DTaP-IPV//Hib into the Korean national vaccination schedule (Clinical trial registry, NCT01214889). PMID:27510380

  2. K{alpha} satellite transitions in elements with 12{<=}Z{<=}30 produced by electron incidence

    SciTech Connect

    Limandri, Silvina P.; Carreras, Alejo C.; Trincavelli, Jorge C.; Bonetto, Rita D.

    2010-09-15

    The emission of x-ray satellite lines in the K{alpha} region of Mg, Si, Sc, Ti, Cr, Fe, Ni, and Zn induced by electron incidence was studied by means of wavelength dispersive spectroscopy. The satellite lines studied were K{alpha}{sup '}, K{alpha}{sub 3}, K{alpha}{sub 4}, K{alpha}{sub 5}, K{alpha}{sub 6}, and two transitions denoted here as K{alpha}{sub 22} and K{alpha}{sub 12}. Energy shifts with respect to the main K{alpha}{sub 1} diagram line and transition probabilities relative to the whole K{alpha} group were determined for a number of lines through a careful spectral processing. The dependence of these parameters, as well as of the K{beta}:K{alpha} intensity ratio, on the atomic number was compared with previous experimental and theoretical determinations when available. A discussion about the different mechanisms responsible for vacancy creation involved in the production of double-ionization satellites was performed in the light of the results obtained. Finally, the behavior of the satellite intensities as a function of the incidence energy was discussed for silicon.

  3. IRON AND {alpha}-ELEMENT PRODUCTION IN THE FIRST ONE BILLION YEARS AFTER THE BIG BANG

    SciTech Connect

    Becker, George D.; Carswell, Robert F.; Sargent, Wallace L. W.; Rauch, Michael E-mail: acalver@ast.cam.ac.uk E-mail: mr@obs.carnegiescience.edu

    2012-01-10

    We present measurements of carbon, oxygen, silicon, and iron in quasar absorption systems existing when the universe was roughly one billion years old. We measure column densities in nine low-ionization systems at 4.7 < z < 6.3 using Keck, Magellan, and Very Large Telescope optical and near-infrared spectra with moderate to high resolution. The column density ratios among C II, O I, Si II, and Fe II are nearly identical to sub-damped Ly{alpha} systems (sub-DLAs) and metal-poor ([M/H] {<=} -1) DLAs at lower redshifts, with no significant evolution over 2 {approx}< z {approx}< 6. The estimated intrinsic scatter in the ratio of any two elements is also small, with a typical rms deviation of {approx}< 0.1 dex. These facts suggest that dust depletion and ionization effects are minimal in our z > 4.7 systems, as in the lower-redshift DLAs, and that the column density ratios are close to the intrinsic relative element abundances. The abundances in our z > 4.7 systems are therefore likely to represent the typical integrated yields from stellar populations within the first gigayear of cosmic history. Due to the time limit imposed by the age of the universe at these redshifts, our measurements thus place direct constraints on the metal production of massive stars, including iron yields of prompt supernovae. The lack of redshift evolution further suggests that the metal inventories of most metal-poor absorption systems at z {approx}> 2 are also dominated by massive stars, with minimal contributions from delayed Type Ia supernovae or winds from asymptotic giant branch stars. The relative abundances in our systems broadly agree with those in very metal-poor, non-carbon-enhanced Galactic halo stars. This is consistent with the picture in which present-day metal-poor stars were potentially formed as early as one billion years after the big bang.

  4. Unstable amplification of two extrachromosomal elements in alpha-difluoromethylornithine-resistant Leishmania donovani.

    PubMed Central

    Hanson, S; Beverley, S M; Wagner, W; Ullman, B

    1992-01-01

    We describe the first example of unstable gene amplification consisting of linear extrachromosomal DNAs in drug-resistant eukaryotic cells. alpha-Difluoromethylornithine (DFMO)-resistant Leishmania donovani with an amplified ornithine decarboxylase (ODC) gene copy number contained two new extrachromosomal DNAs, both present in 10 to 20 copies. One of these was a 140-kb linear DNA (ODC140-L) on which all of the amplified copies of the odc gene were located. The second was a 70-kb circular DNA (ODC70-C) containing an inverted repeat but lacking the odc gene. Both ODC140-L and ODC70-C were derived from a preexisting wild-type chromosome, probably by a conservative amplification mechanism. Both elements were unstable in the absence of DFMO, and their disappearance coincided with a decrease in ODC activity and an increase in DFMO growth sensitivity. These results suggest the possibility that ODC70-C may play a role in DFMO resistance. These data expand the diversity of known amplification mechanisms in eukaryotes to include the simultaneous unstable amplification of both linear and circular DNAs. Further characterization of these molecules will provide insights into the molecular mechanisms underlying gene amplification, including the ability of linear amplified DNAs to acquire telomeres and the determinants of chromosomal stability. Images PMID:1448081

  5. A new statistical modeling and detection method for rolling element bearing faults based on alpha-stable distribution

    NASA Astrophysics Data System (ADS)

    Yu, Gang; Li, Changning; Zhang, Jianfeng

    2013-12-01

    Due to limited information given by traditional local statistics, a new statistical modeling method for rolling element bearing fault signals is proposed based on alpha-stable distribution. In order to fully take advantages of complete information provided by alpha-stable distribution, this paper focuses on testing the validity of the proposed statistical model. A number of hypothetical test methods were applied to practical bearing fault vibration signals with different fault types and degrees. Through testing on the consistency of three alpha-stable parameter estimation methods, and the probability density function fitting level between fault signals and their corresponding hypothetical alpha-stable distributions, it can be concluded that such a non-Gaussian model is sufficient to thoroughly describe the statistical characteristics of bearing fault signals with impulsive behaviors, and consequently the alpha-stable hypothesis is verified. In the meantime, a new bearing fault detection method based on kurtogram and α parameter of the alpha-stable model is proposed, experimental results have shown that the proposed method has better performance on detecting incipient bearing faults than that based on the traditional kurtogram.

  6. Identification of a novel cyclosporin-sensitive element in the human tumor necrosis factor alpha gene promoter

    PubMed Central

    1993-01-01

    Tumor necrosis factor alpha (TNF-alpha), a cytokine with pleiotropic biological effects, is produced by a variety of cell types in response to induction by diverse stimuli. In this paper, TNF-alpha mRNA is shown to be highly induced in a murine T cell clone by stimulation with T cell receptor (TCR) ligands or by calcium ionophores alone. Induction is rapid, does not require de novo protein synthesis, and is completely blocked by the immunosuppressant cyclosporin A (CsA). We have identified a human TNF-alpha promoter element, kappa 3, which plays a key role in the calcium-mediated inducibility and CsA sensitivity of the gene. In electrophoretic mobility shift assays, an oligonucleotide containing kappa 3 forms two DNA protein complexes with proteins that are present in extracts from unstimulated T cells. These complexes appear in nuclear extracts only after T cell stimulation. Induction of the inducible nuclear complexes is rapid, independent of protein synthesis, and blocked by CsA, and thus, exactly parallels the induction of TNF-alpha mRNA by TCR ligands or by calcium ionophore. Our studies indicate that the kappa 3 binding factor resembles the preexisting component of nuclear factor of activated T cells. Thus, the TNF-alpha gene is an immediate early gene in activated T cells and provides a new model system in which to study CsA-sensitive gene induction in activated T cells. PMID:8376940

  7. Impact of the Haemophilus influenzae type b vaccination program on HIB meningitis in Brazil.

    PubMed

    Miranzi, Sybelle de Souza Castro; de Moraes, Suzana Alves; de Freitas, Isabel Cristina Martins

    2007-07-01

    This study aimed to evaluate the impact of vaccination against Haemophilus influenzae type b (HIB) in Brazil on the morbidity, mortality, and case fatality of HIB meningitis, using the Ministry of Health database and population data from the Brazilian Institute of Geography and Statistics (Instituto Brasileiro de Geografia e Estatística--IBGE). Impact was evaluated through a time series analysis (1983-2002), using regression forecasting (RF) by dividing the time series into two periods: (a) historical (1983-1998) and (b) validation (1999-2002). Impact of the vaccination was positive, although more significant for incidence and mortality than for case fatality rates.

  8. Contrasting effects of alpha and beta globin regulatory elements on chromatin structure may be related to their different chromosomal environments.

    PubMed Central

    Craddock, C F; Vyas, P; Sharpe, J A; Ayyub, H; Wood, W G; Higgs, D R

    1995-01-01

    Expression of the human alpha and beta globin gene clusters is regulated by remote sequences, referred to as HS -40 and the beta-locus control region (beta-LCR) that lie 5-40 kb upstream of the genes they activate. Because of their common ancestry, similar organization and coordinate expression it has often been assumed that regulation of the globin gene clusters by HS -40 and the beta-LCR occurs via similar mechanisms. Using interspecific hybrids containing chromosomes with naturally occurring deletions of HS -40 we have shown that, in contrast to the beta-LCR, this element exerts no discernible effect on long-range chromatin structure and in addition does not influence formation of DNase I hypersensitive sites at the alpha globin promoters. These differences in the behaviour of HS -40 and the beta-LCR may reflect their contrasting influence on gene expression in transgenic mice and may result from the differing requirements of these elements in their radically different, natural chromosomal environments; the alpha cluster lying within a region of constitutively 'open' chromatin and the beta cluster in a segment of chromatin which opens in a tissue-specific manner. Differences in the hierarchical control of the alpha and beta globin clusters may exemplify more general differences in the regulation of eukaryotic genes which lie in similar open or closed chromosomal regions. Images PMID:7737123

  9. BERYLLIUM AND ALPHA-ELEMENT ABUNDANCES IN A LARGE SAMPLE OF METAL-POOR STARS

    SciTech Connect

    Boesgaard, Ann Merchant; Rich, Jeffrey A.; Levesque, Emily M.; Bowler, Brendan P. E-mail: jrich@ifa.hawaii.edu E-mail: bpbowler@ifa.hawaii.edu

    2011-12-20

    The light elements, Li, Be, and B, provide tracers for many aspects of astronomy including stellar structure, Galactic evolution, and cosmology. We have made observations of Be in 117 metal-poor stars ranging in metallicity from [Fe/H] = -0.5 to -3.5 with Keck I/HIRES. Our spectra are high resolution ({approx}42,000) and high signal to noise (the median is 106 per pixel). We have determined the stellar parameters spectroscopically from lines of Fe I, Fe II, Ti I, and Ti II. The abundances of Be and O were derived by spectrum synthesis techniques, while abundances of Fe, Ti, and Mg were found from many spectral line measurements. There is a linear relationship between [Fe/H] and A(Be) with a slope of +0.88 {+-} 0.03 over three orders of magnitude in [Fe/H]. We find that Be is enhanced relative to Fe; [Be/Fe] is +0.40 near [Fe/H] {approx}-3.3 and drops to 0.0 near [Fe/H] {approx}-1.7. For the relationship between A(Be) and [O/H], we find a gradual change in slope from 0.69 {+-} 0.13 for the Be-poor/O-poor stars to 1.13 {+-} 0.10 for the Be-rich/O-rich stars. Inasmuch as the relationship between [Fe/H] and [O/H] seems robustly linear (slope = +0.75 {+-} 0.03), we conclude that the slope change in Be versus O is due to the Be abundance. Much of the Be would have been formed in the vicinity of Type II supernova (SN II) in the early history of the Galaxy and by Galactic cosmic-ray (GCR) spallation in the later eras. Although Be is a by-product of CNO, we have used Ti and Mg abundances as alpha-element surrogates for O in part because O abundances are rather sensitive to both stellar temperature and surface gravity. We find that A(Be) tracks [Ti/H] very well with a slope of 1.00 {+-} 0.04. It also tracks [Mg/H] very well with a slope of 0.88 {+-} 0.03. We have kinematic information on 114 stars in our sample and they divide equally into dissipative and accretive stars. Almost the full range of [Fe/H] and [O/H] is covered in each group. There are distinct differences in

  10. A delta T-cell receptor deleting element transgenic reporter construct is rearranged in alpha beta but not gamma delta T-cell lineages.

    PubMed Central

    Shutter, J; Cain, J A; Ledbetter, S; Rogers, M D; Hockett, R D

    1995-01-01

    T cells can be divided into two groups on the basis of the expression of either alpha beta or gamma delta T-cell receptors (TCRs). Because the TCR delta chain locus lies within the larger TCR alpha chain locus, control of the utilization of these two receptors is important in T-cell development, specifically for determination of T-cell type: rearrangement of the alpha locus results in deletion of the delta coding segments and commitment to the alpha beta lineage. In the developing thymus, a relative site-specific recombination occurs by which the TCR delta chain gene segments are deleted. This deletion removes all D delta, J delta, and C delta genes and occurs on both alleles. This delta deletional mechanism is evolutionarily conserved between mice and humans. Transgenic mice which contain the human delta deleting elements and as much internal TCR delta chain coding sequence as possible without allowing the formation of a complete delta chain gene were developed. Several transgenic lines showing recombinations between deleting elements within the transgene were developed. These lines demonstrate that utilization of the delta deleting elements occurs in alpha beta T cells of the spleen and thymus. These recombinations are rare in the gamma delta population, indicating that the machinery for utilization of delta deleting elements is functional in alpha beta T cells but absent in gamma delta T cells. Furthermore, a discrete population of early thymocytes containing delta deleting element recombinations but not V alpha-to-J alpha rearrangements has been identified. These data are consistent with a model in which delta deletion contributes to the implementation of a signal by which the TCR alpha chain locus is rearranged and expressed and thus becomes an alpha beta T cell. PMID:8524269

  11. Development of an alpha scattering instrument for heavy element detection in surface materials

    NASA Technical Reports Server (NTRS)

    Turkevich, A. L.; Economou, T.; Blume, E.; Anderson, W.

    1974-01-01

    The development and characteristics of a portable instrument for detecting and measuring the amounts of lead in painted surfaces are discussed. The instrument is based on the ones used with the alpha scattering experiment on the Surveyor lunar missions. The principles underlying the instrument are described. It is stated that the performance tests of the instrument were satisfactory.

  12. THE DISTRIBUTION OF ALPHA ELEMENTS IN ULTRA-FAINT DWARF GALAXIES

    SciTech Connect

    Vargas, Luis C.; Geha, Marla; Kirby, Evan N.; Simon, Joshua D.

    2013-04-20

    The Milky Way ultra-faint dwarf (UFD) galaxies contain some of the oldest, most metal-poor stars in the universe. We present [Mg/Fe], [Si/Fe], [Ca/Fe], [Ti/Fe], and mean [{alpha}/Fe] abundance ratios for 61 individual red giant branch stars across eight UFDs. This is the largest sample of alpha abundances published to date in galaxies with absolute magnitudes M{sub V} > -8, including the first measurements for Segue 1, Canes Venatici II, Ursa Major I, and Leo T. Abundances were determined via medium-resolution Keck/DEIMOS spectroscopy and spectral synthesis. The sample spans the metallicity range -3.4 <[Fe/H] < -1.1. With the possible exception of Segue 1 and Ursa Major II, the individual UFDs show on average lower [{alpha}/Fe] at higher metallicities, consistent with enrichment from Type Ia supernovae. Thus, even the faintest galaxies have undergone at least a limited level of chemical self-enrichment. Together with recent photometric studies, this suggests that star formation in the UFDs was not a single burst, but instead lasted at least as much as the minimum time delay of the onset of Type Ia supernovae ({approx}100 Myr) and less than {approx}2 Gyr. We further show that the combined population of UFDs has an [{alpha}/Fe] abundance pattern that is inconsistent with a flat, Galactic halo-like alpha abundance trend, and is also qualitatively different from that of the more luminous CVn I dSph, which does show a hint of a plateau at very low [Fe/H].

  13. A polymorphic autoregulatory hormone response element in the human estrogen-related receptor alpha (ERRalpha) promoter dictates peroxisome proliferator-activated receptor gamma coactivator-1alpha control of ERRalpha expression.

    PubMed

    Laganière, Josée; Tremblay, Gilles B; Dufour, Catherine R; Giroux, Sylvie; Rousseau, François; Giguère, Vincent

    2004-04-30

    The orphan nuclear estrogen-related receptor alpha (ERRalpha) and transcriptional cofactor peroxisome proliferator-activated receptor gamma coactivator-1alpha (PGC-1alpha) are involved in the regulation of energy metabolism. Recently, extensive cross-talk between PGC-1alpha and ERRalpha has been demonstrated. The presence of PGC-1alpha is associated with an elevated expression of ERRalpha, and the two proteins can influence the transcriptional activities of one another. Using a candidate gene approach to detect regulatory variants within genes encoding nuclear receptors, we have identified a 23-bp sequence (ESRRA23) containing two nuclear receptor recognition half-site motifs that is present in 1-4 copies within the promoter of the human ESRRA gene encoding ERRalpha. The ESRRA23 sequence contains a functional ERR response element that is specifically bound by ERRalpha, and chromatin immunoprecipitation shows that endogenous ERRalpha occupies its own promoter in vivo. Strikingly, introduction of PGC-1alpha in HeLa cells by transient transfection induces the activity of the ESRRA promoter in a manner that is dependent on the presence of the ESRRA23 element and on its dosage. Coexpression of ERRalpha and PGC-1alpha results in a synergistic activation of the ESRRA promoter. In experiments using ERRalpha null fibroblasts, the ability of PGC-1alpha to stimulate the ESRRA promoter is considerably reduced but can be restored by addition of ERRalpha. Taken together, these results demonstrate that an interdependent ERRalpha/PGC-1alpha-based transcriptional pathway targets the ESRRA23 element to dictate the level of ERRalpha expression. This study further suggests that this regulatory polymorphism may provide differential responses to ERRalpha/PGC-1alpha-mediated metabolic cues in the human population.

  14. [Introduction of a conjugate vaccine against Hib in Chile and Uruguay].

    PubMed

    Landaverde, M; Di Fabio, J L; Ruocco, G; Leal, I; de Quadros, C

    1999-03-01

    In some countries, the invasive disease caused by Haemophilus influenzae type b (Hib) has been practically eliminated thanks to vaccination. However, in much of the developing world, meningitides and pneumonias caused by these bacteria continue to be a major cause of childhood morbidity and mortality, as well as high hospitalization costs. Because safe and effective conjugate vaccines are now available, the Special Program for Vaccines and Immunization of the Pan American Health Organization has recommended introducing them into the regular vaccination regimen of as many countries as possible. This has been done in Chile and Uruguay, where the Hib vaccine now forms part of the regular vaccination routine. When the vaccine was being introduced, both countries had difficulties they could have avoided if they had known of the experiences of other nations. Therefore, these two countries now offer the lessons they learned to other nations considering introducing the vaccine into their immunization programs. The most important lessons were to: strengthen the epidemiological surveillance system sufficiently in advance of introducing the vaccine; with the support of scientific societies, present the technical information that justifies introducing the vaccine; seek community backing and acceptance; precisely establish in advance the presentation and dosage of the vaccine that is most appropriate for the country; and be certain to have the political and legal decisions needed to ensure the continuity of Hib vaccination in the future.

  15. ''Magic'' Energies for Detecting Light Elements with Resonant Alpha Particle Backscattering

    SciTech Connect

    Wetteland, C.J.; Maggiore, C.J.; Tesmer, J.R.; He, X-M.; Lee, D-H.

    1998-11-04

    Resonant backscattering is widely used to improve the detection limit of the light elements such as B, C, N and O. One disadvantage, however, is that several incident energies are normally needed if the sample contains a number of the light elements. There are ''magic'' energies at which several light elements can be detected simultaneously with suitable sensitivities. When these energies are used along with the elastic recoil detection of hydrogen, multiple elements can be detected without changing the beam energy, and the analysis time is greatly reduced. These reactions along with examples will be discussed.

  16. Anti-lymphoproliferative activity of alpha-2-macroglobulin in the plasma of hibernating 13-lined ground squirrels and woodchucks.

    PubMed

    Sieckmann, Donna G; Jaffe, Howard; Golech, Susanne; Cai, DeCheng; Hallenbeck, John M; McCarron, Richard M

    2014-09-15

    Plasma from hibernating (HIB) woodchucks (Marmota monax) or 13-lined ground squirrels (Ictidomys tridecemlineatus) suppressed (3)H-thymidine uptake in mouse spleen cell cultures stimulated with Concanavalin A (ConA); plasma from non-hibernating animals were only slightly inhibitory. Maximum inhibition occurred when HIB plasma was added to the cultures prior to ConA. After HPLC size exclusion chromatography of the HIB ground squirrel plasma, a single fraction (fraction-14) demonstrated inhibitory activity. Assay of fraction-14 from 8 HIB squirrels showed inhibition ranging from 13 to 95%; inhibition was correlated to the time the squirrels were exposed to cold prior to hibernation. Western blot analysis showed the factor to be a large molecular weight protein (>300 kDa), and mass spectrometry identified sequences that were 100% homologous with alpha-2-macroglobulin from humans and other species. These findings indicate a hibernation-related protein that may be responsible for immune system down regulation.

  17. Regulatory elements required for the activation and repression of the protocadherin-alpha gene cluster.

    PubMed

    Kehayova, Polina; Monahan, Kevin; Chen, Weisheng; Maniatis, Tom

    2011-10-11

    The mouse protocadherin (Pcdh) -α, -β, and -γ gene clusters encode more than 50 protein isoforms, the combinatorial expression of which generates vast single-cell diversity in the brain. At present, the mechanisms by which this diversity is expressed are not understood. Here we show that two transcriptional enhancer elements, HS5-1 and HS7, play a critical role in Pcdhα gene expression in mice. We show that the HS5-1 element functions as an enhancer in neurons and a silencer in nonneuronal cells. The enhancer activity correlates with the binding of zinc finger DNA binding protein CTCF to the target promoters, and the silencer activity requires the binding of the REST/NRSF repressor complex in nonneuronal cells. Thus, the HS5-1 element functions as a neuron-specific enhancer and nonneuronal cell repressor. In contrast, the HS7 element functions as a Pcdhα cluster-wide transcription enhancer element. These studies reveal a complex organization of regulatory elements required for generating single cell Pcdh diversity. PMID:21949399

  18. Meningococcal groups C and Y and haemophilus B tetanus toxoid conjugate vaccine (HibMenCY-TT; MenHibrix(®)): a review.

    PubMed

    Perry, Caroline M

    2013-05-01

    The meningococcal groups C and Y and Haemophilus b (Hib) tetanus toxoid conjugate vaccine (HibMenCY-TT) contains Neisseria meningitidis serogroup C and Y capsular polysaccharide antigens, and Hib capsular polysaccharide [polyribosyl-ribitol-phosphate (PRP)]. The HibMenCY-TT vaccine is available in the USA for use as active immunization to prevent invasive disease caused by N. meningitidis serogroups C (MenC) and Y (MenY), and Hib in children 6 weeks-18 months of age. HibMenCY-TT is the first meningococcal vaccine available for use in the USA that can be administered to infants as young as 6 weeks of age. In a randomized, controlled, phase III clinical trial, the HibMenCY-TT vaccine, administered to infants at 2, 4, 6 and 12-15 months of age, was immunogenic against MenC and MenY, and met the prespecified criteria for immunogenicity. Anti-PRP antibodies, which have been shown to correlate with protection against Hib invasive disease, were also induced in the infants who received the HibMenCY-TT vaccine, with induced levels of this antibody noninferior to those occurring in the control group of infants who received a Hib tetanus toxoid conjugate vaccine at 2, 4, and 6 months and a single dose of Hib conjugated to N. meningitidis outer membrane protein at 12-15 months. In several randomized, controlled clinical trials, HibMenCY-TT was coadministered with vaccines that are routinely administered to infants and toddlers in the USA. These vaccines included: diphtheria and tetanus toxoids and acellular pertussis adsorbed, hepatitis B (recombinant) and inactivated poliovirus vaccine combined; 7-valent Streptococcus pneumoniae polysaccharide conjugate vaccine; measles, mumps and rubella vaccine; and varicella vaccine. Coadministration of these vaccines did not interfere with the immunogenicity of the HibMenCY-TT vaccine. Similarly, immune responses to the coadministered vaccines were not affected by the HibMenCY-TT vaccine. The tolerability profile of the Hib

  19. Tumor necrosis factor alpha induces proteins that bind specifically to kappa B-like enhancer elements and regulate interleukin 2 receptor alpha-chain gene expression in primary human T lymphocytes.

    PubMed Central

    Lowenthal, J W; Ballard, D W; Böhnlein, E; Greene, W C

    1989-01-01

    We have investigated the biochemical basis for the activation of interleukin 2 receptor alpha-subunit (IL-2R alpha) gene expression in primary human T lymphocytes by a cytokine (tumor necrosis factor alpha), a T-cell mitogen (phorbol 12-myristate 13-acetate), and the transactivator protein (Tax) from the type I human T-cell leukemia virus. Using in vivo transfection techniques specificially designed for these primary T cells in conjunction with in vitro gel retardation and DNA footprinting assays, we found that activation of the IL-2R alpha promoter by each of these agents involves the induction of nuclear proteins that specifically interact with a kappa B-like enhancer element (i.e., an element resembling the immunoglobulin kappa-chain enhancer sequence recognized by transcription factor NF-kappa B). DNA-protein crosslinking studies revealed that primary T cells express at least three different inducible DNA-binding proteins (50-55, 70-75, and 80-90 kDa) that specifically interact with this IL-2R alpha kappa B element. Images PMID:2494663

  20. THE DETAILED CHEMICAL PROPERTIES OF M31 STAR CLUSTERS. I. Fe, ALPHA AND LIGHT ELEMENTS

    SciTech Connect

    Colucci, Janet E.; Bernstein, Rebecca A.; Cohen, Judith G.

    2014-12-20

    We present ages, [Fe/H] and abundances of the α elements Ca I, Si I, Ti I, Ti II, and light elements Mg I, Na I, and Al I for 31 globular clusters (GCs) in M31, which were obtained from high-resolution, high signal-to-noise ratio >60 echelle spectra of their integrated light (IL). All abundances and ages are obtained using our original technique for high-resolution IL abundance analysis of GCs. This sample provides a never before seen picture of the chemical history of M31. The GCs are dispersed throughout the inner and outer halo, from 2.5 kpc < R {sub M31} < 117 kpc. We find a range of [Fe/H] within 20 kpc of the center of M31, and a constant [Fe/H] ∼ – 1.6 for the outer halo clusters. We find evidence for at least one massive GC in M31 with an age between 1 and 5 Gyr. The α-element ratios are generally similar to the Milky Way GC and field star ratios. We also find chemical evidence for a late-time accretion origin for at least one cluster, which has a different abundance pattern than other clusters at similar metallicity. We find evidence for star-to-star abundance variations in Mg, Na, and Al in the GCs in our sample, and find correlations of Ca, Mg, Na, and possibly Al abundance ratios with cluster luminosity and velocity dispersion, which can potentially be used to constrain GC self-enrichment scenarios. Data presented here were obtained with the HIRES echelle spectrograph on the Keck I telescope.

  1. Evaluation of Haemophilus influenzae type b carrier status among children 10 years after the introduction of Hib vaccine in Brazil

    PubMed Central

    Zanella, Rosemeire Cobo; Brandileone, Maria Cristina de Cunto; Andrade, Ana Lúcia; Ogassavara, Cinthya Terumi; Fiório, Cleiton Eduardo; Brandão, Angela Pires; Almeida, Samanta Cristine Grassi; Lemos, Ana Paula Silva; Gorla, Maria Cecília; Carvalhanas, Telma Regina; Sato, Helena; Liphaus, Bernadete; Nerger, Maria Lígia; Conde, Monica; Ribeiro, Ana Freitas

    2015-01-01

    The aim of the present study was to assess the prevalence of Haemophilus influenzae type b (Hib) nasopharyngeal (NP) colonisation among healthy children where Hib vaccination using a 3p+0 dosing schedule has been routinely administered for 10 years with sustained coverage (> 90%). NP swabs were collected from 2,558 children who had received the Hib vaccine, of whom 1,379 were 12-< 24 months (m) old and 1,179 were 48-< 60 m old. Hi strains were identified by molecular methods. Hi carriage prevalence was 45.1% (1,153/2,558) and the prevalence in the 12-< 24 m and 48-< 60 m age groups were 37.5% (517/1,379) and 53.9% (636/1,179), respectively. Hib was identified in 0.6% (16/2,558) of all children in the study, being 0.8% (11/1,379) and 0.4% (5/1,179) among the 12-< 24 m and 48-< 60 m age groups, respectively. The nonencapsulate Hi colonisation was 43% (n = 1,099) and was significantly more frequent at 48-< 60 m of age (51.6%, n = 608) compared with that at 12-< 24 m of age (35.6%, n = 491). The overall resistance rates to ampicillin and chloramphenicol were 16.5% and 3.7%, respectively; the co-resistance was detected in 2.6%. Our findings showed that the Hib carrier rate in healthy children under five years was very low after 10 years of the introduction of the Hib vaccine. PMID:26517654

  2. Light, Alpha, and Fe-peak Element Abundances in the Galactic Bulge

    NASA Astrophysics Data System (ADS)

    Johnson, Christian I.; Rich, R. Michael; Kobayashi, Chiaki; Kunder, Andrea; Koch, Andreas

    2014-10-01

    We present radial velocities and chemical abundances of O, Na, Mg, Al, Si, Ca, Cr, Fe, Co, Ni, and Cu for a sample of 156 red giant branch stars in two Galactic bulge fields centered near (l, b) = (+5.25,-3.02) and (0,-12). The (+5.25,-3.02) field also includes observations of the bulge globular cluster NGC 6553. The results are based on high-resolution (R ~ 20,000), high signal-to-noise ration (S/N >~ 70) FLAMES-GIRAFFE spectra obtained through the European Southern Observatory archive. However, we only selected a subset of the original observations that included spectra with both high S/N and that did not show strong TiO absorption bands. This work extends previous analyses of this data set beyond Fe and the α-elements Mg, Si, Ca, and Ti. While we find reasonable agreement with past work, the data presented here indicate that the bulge may exhibit a different chemical composition than the local thick disk, especially at [Fe/H] >~ -0.5. In particular, the bulge [α/Fe] ratios may remain enhanced to a slightly higher [Fe/H] than the thick disk, and the Fe-peak elements Co, Ni, and Cu appear enhanced compared to the disk. There is also some evidence that the [Na/Fe] (but not [Al/Fe]) trends between the bulge and local disk may be different at low and high metallicity. We also find that the velocity dispersion decreases as a function of increasing [Fe/H] for both fields, and do not detect any significant cold, high-velocity populations. A comparison with chemical enrichment models indicates that a significant fraction of hypernovae may be required to explain the bulge abundance trends, and that initial mass functions that are steep, top-heavy (and do not include strong outflow), or truncated to avoid including contributions from stars >40 M ⊙ are ruled out, in particular because of disagreement with the Fe-peak abundance data. For most elements, the NGC 6553 stars exhibit abundance trends nearly identical to comparable metallicity bulge field stars. However, the

  3. Light, alpha, and Fe-peak element abundances in the galactic bulge

    SciTech Connect

    Johnson, Christian I.; Rich, R. Michael; Kobayashi, Chiaki; Kunder, Andrea; Koch, Andreas E-mail: rmr@astro.ucla.edu E-mail: akunder@aip.de

    2014-10-01

    We present radial velocities and chemical abundances of O, Na, Mg, Al, Si, Ca, Cr, Fe, Co, Ni, and Cu for a sample of 156 red giant branch stars in two Galactic bulge fields centered near (l, b) = (+5.25,–3.02) and (0,–12). The (+5.25,–3.02) field also includes observations of the bulge globular cluster NGC 6553. The results are based on high-resolution (R ∼ 20,000), high signal-to-noise ration (S/N ≳ 70) FLAMES-GIRAFFE spectra obtained through the European Southern Observatory archive. However, we only selected a subset of the original observations that included spectra with both high S/N and that did not show strong TiO absorption bands. This work extends previous analyses of this data set beyond Fe and the α-elements Mg, Si, Ca, and Ti. While we find reasonable agreement with past work, the data presented here indicate that the bulge may exhibit a different chemical composition than the local thick disk, especially at [Fe/H] ≳ –0.5. In particular, the bulge [α/Fe] ratios may remain enhanced to a slightly higher [Fe/H] than the thick disk, and the Fe-peak elements Co, Ni, and Cu appear enhanced compared to the disk. There is also some evidence that the [Na/Fe] (but not [Al/Fe]) trends between the bulge and local disk may be different at low and high metallicity. We also find that the velocity dispersion decreases as a function of increasing [Fe/H] for both fields, and do not detect any significant cold, high-velocity populations. A comparison with chemical enrichment models indicates that a significant fraction of hypernovae may be required to explain the bulge abundance trends, and that initial mass functions that are steep, top-heavy (and do not include strong outflow), or truncated to avoid including contributions from stars >40 M {sub ☉} are ruled out, in particular because of disagreement with the Fe-peak abundance data. For most elements, the NGC 6553 stars exhibit abundance trends nearly identical to comparable metallicity bulge field

  4. Identification and characterization of cis-acting elements conferring insulin responsiveness on hamster cholesterol 7alpha-hydroxylase gene promoter.

    PubMed Central

    De Fabiani, E; Crestani, M; Marrapodi, M; Pinelli, A; Golfieri, V; Galli, G

    2000-01-01

    Bile acid biosynthesis occurs primarily through a pathway initiated by the 7alpha-hydroxylation of cholesterol, catalysed by cholesterol 7alpha-hydroxylase (encoded by CYP7A1). Insulin down-regulates CYP7A1 transcription. The aim of our study was to characterize the sequences of hamster CYP7A1 promoter, mediating the response to insulin. We therefore performed transient transfection assays with CYP7A1 promoter/luciferase chimaeras mutated at putative response elements and studied protein-DNA interactions by means of gel electrophoresis mobility-shift assay. Here we show that two sequences confer insulin responsiveness on hamster CYP7A1 promoter: a canonical insulin response sequence TGTTTTG overlapping a binding site for hepatocyte nuclear factor 3 (HNF-3) (at nt -235 to -224) and a binding site for HNF-4 at nt -203 to -191. In particular we show that the hamster CYP7A1 insulin response sequence is part of a complex unit involved in specific interactions with multiple transcription factors such as members of the HNF-3 family; this region does not bind very strongly to HNF-3 and as a consequence partly contributes to the transactivation of the gene. Another sequence located at nt -138 to -128 binds to HNF-3 and is involved in the tissue-specific regulation of hamster CYP7A1. The sequence at nt -203 to -191 is not only essential for insulin effect but also has a major role in the liver-specific expression of CYP7A1; it is the target of HNF-4. Therefore the binding sites for liver-enriched factors, present in the hamster CYP7A1 proximal promoter in close vicinity and conserved between species, constitute a regulatory unit important for basal hepatic expression and tissue restriction of the action of hormones such as insulin. PMID:10727413

  5. Regulated tissue-specific alternative splicing of enhanced green fluorescent protein transgenes conferred by alpha-tropomyosin regulatory elements in transgenic mice.

    PubMed

    Ellis, Peter D; Smith, Christopher W J; Kemp, Paul

    2004-08-27

    The mutually exclusive exons 2 and 3 of alpha-tropomyosin (alphaTM) have been used as a model system for strictly regulated alternative splicing. Exon 2 inclusion is only observed at high levels in smooth muscle (SM) tissues, whereas striated muscle and non-muscle cells use predominantly exon 3. Experiments in cell culture have shown that exon 2 selection results from repression of exon 3 and that this repression is mediated by regulatory elements flanking exon 3. We have now tested the cell culture-derived model in transgenic mice. We show that by harnessing the intronic splicing regulatory elements, expression of an enhanced green fluorescent protein transgene with a constitutively active promoter can be restricted to SM cells. Splicing of both endogenous alphaTM and a series of transgenes carrying regulatory element mutations was analyzed by reverse transcriptasePCR. These studies indicated that although SM-rich tissues are equipped to regulate splicing of high levels of endogenous or transgene alphaTM RNA, other non-SM tissues such as spleen, which express lower amounts of alphaTM, also splice significant proportions of exon 2, and this splicing pattern can be recapitulated by transgenes expressed at low levels. We confirm the importance in vivo of the negatively acting regulatory elements for regulated skipping of exon 3. Moreover, we provide evidence that some of the regulatory factors responsible for exon 3 skipping appear to be titratable, with loss of regulated splicing sometimes being associated with high transgene expression levels. PMID:15194683

  6. alpha-Tocopherol decreases the somatostatin receptor-effector system and increases the cyclic AMP/cyclic AMP response element binding protein pathway in the rat dentate gyrus.

    PubMed

    Hernández-Pinto, A M; Puebla-Jiménez, L; Arilla-Ferreiro, E

    2009-08-01

    Neuronal survival has been shown to be enhanced by alpha-tocopherol and modulated by cyclic AMP (cAMP). Somatostatin (SST) receptors couple negatively to adenylyl cyclase (AC), thus leading to decreased cAMP levels. Whether alpha-tocopherol can stimulate neuronal survival via regulation of the somatostatinergic system, however, is unknown. The aim of this study was to investigate the effects of alpha-tocopherol on the SST signaling pathway in the rat dentate gyrus. To that end, 15-week-old male Sprague-Dawley rats were treated daily for 1 week with (+)-alpha-tocopherol or vehicle and sacrificed on the day following the last administration. No changes in either SST-like immunoreactivity (SST-LI) content or SST mRNA levels were detected in the dentate gyrus as a result of alpha-tocopherol treatment. A significant decrease in the density of the SST binding sites and an increase in the dissociation constant, however, were detected. The lower SST receptor density in the alpha-tocopherol-treated rats correlated with a significant decrease in the protein levels of the SST receptor subtypes SSTR1-SSTR4, whereas the corresponding mRNA levels were unaltered. G-protein-coupled-receptor kinase 2 expression was decreased by alpha-tocopherol treatment. This vitamin induced a significant increase in both basal and forskolin-stimulated AC activity, as well as a decrease in the inhibitory effect of SST on AC. Whereas the protein levels of AC type V/VI were not modified by alpha-tocopherol administration, ACVIII expression was significantly enhanced, suggesting it might account for the increase in AC activity. In addition, this treatment led to a reduction in Gialpha1-3 protein levels and in Gi functionality. alpha-Tocopherol did not affect the expression of the regulator of G-protein signaling 6/7 (RGS6/7). Finally, alpha-tocopherol induced an increase in the levels of phosphorylated cAMP response element binding protein (p-CREB) and total CREB in the dentate gyrus. Since CREB

  7. Transcriptional regulation of the human acid alpha-glucosidase gene. Identification of a repressor element and its transcription factors Hes-1 and YY1.

    PubMed

    Yan, B; Heus, J; Lu, N; Nichols, R C; Raben, N; Plotz, P H

    2001-01-19

    Acid alpha-glucosidase, the product of a housekeeping gene, is a lysosomal enzyme that degrades glycogen. A deficiency of this enzyme is responsible for a recessively inherited myopathy and cardiomyopathy, glycogenesis type II. We have previously demonstrated that the human acid alpha-glucosidase gene expression is regulated by a silencer within intron 1, which is located in the 5'-untranslated region. In this study, we have used deletion analysis, electrophoretic mobility shift assay, and footprint analysis to further localize the silencer to a 25-base pair element. The repressive effect on the TK promoter was about 50% in both orientations in expression plasmid, and two transcriptional factors were identified with antibodies binding specifically to the element. Mutagenesis and functional analyses of the element demonstrated that the mammalian homologue 1 of Drosophila hairy and Enhancer of split (Hes-1) binding to an E box (CACGCG) and global transcription factor-YY1 binding to its core site function as a transcriptional repressor. Furthermore, the overexpression of Hes-1 significantly enhanced the repressive effect of the silencer element. The data should be helpful in understanding the expression and regulation of the human acid alpha-glucosidase gene as well as other lysosomal enzyme genes.

  8. T cell receptor gene usage in the response to lambda repressor cI protein. An apparent bias in the usage of a V alpha gene element

    PubMed Central

    1988-01-01

    The T cell response to the lambda repressor cI protein is directed to the same region of the protein (residues 12-26) in both BALB/c and A/J mice. A panel of T cell hybridomas specific for P12-26 in the context of either I-Ek or I-Ad have been isolated To further understand the molecular interaction between the TCR and the Ia-P12-26 complex, the primary structures of the TCR of five T cell hybridomas have been determined. Southern and Northern analyses indicate that two members of the V alpha 3 gene family are used by 13 out of 14 I-Ek-restricted T cells. Four different V beta genes are used by these T cell hybridomas, while the majority (8 out of 13) express V beta 1 in combination with the J beta 2.1 element. No clear correlation can be seen in this system between gene usage and MHC restriction. In addition, the fine specificity of I-Ek-restricted T cells to a single amino acid substitution [Phe22/His22]P12-26 is not attributed to the usage of particular V alpha and V beta elements. The V alpha 3 family gene is also used by a few I-Ad-restricted T cells. Interestingly, these I-Ad T cells share a reactivity pattern more similar to that of I-Ek- restricted T cells than other I-Ad-restricted T cells. The nonrandom selection V alpha 3 is also demonstrated by the fact that V alpha 3 is used by P12-26-specific, but not by cytochrome c- or staphylococcal nucleus-specific, I-Ek-restricted T cells. This suggests that although antigen specificity may not be accounted for by either chain of the TCR, the members of V alpha 3 genes may be selected by the antigen (P12- 26). PMID:2971753

  9. Identification and characterization of cis elements in the STAT3 gene regulating STAT3 alpha and STAT3 beta messenger RNA splicing.

    PubMed

    Shao, H; Quintero, A J; Tweardy, D J

    2001-12-15

    Signal transducer and activator of transcription 3 (STAT3) is an oncogene and a critical regulator of multiple cell-fate decisions, including myeloid cell differentiation. Two isoforms of STAT3 have been identified: alpha (p92) and beta (p83). These differ structurally in their C-terminal transactivation domains, resulting in distinct functional activities. The cis genetic elements that regulate the ratio of alpha to beta messenger RNA (mRNA) are unknown. In this study, cloning, sequencing, and splicing analysis of the human and murine STAT3 genes revealed a highly conserved 5' donor site for generation of both alpha and beta mRNA and distinct branch-point sequences, polypyrimidine tracts, and 3' acceptor sites (ASs) for each. The beta 3' AS was found to be located 50 nucleotides downstream of the alpha 3' AS in exon 23. Two additional cryptic 3' ASs (delta and epsilon) were also identified. Thus, we identified for the first time the cis regulatory sequences responsible for generation of STAT3 alpha and STAT3 beta mRNA.

  10. Elemental Analysis of the Surface of Comet 67p/Churyumov-Gerasimenko with the Alpha Particle X-Ray Spectrometer APXS on the Rosetta Lander Philae: Preliminary Results

    NASA Astrophysics Data System (ADS)

    Klingelhoefer, G.; Schmanke, D.; Girones-Lopez, J.; Brueckner, J.; d'Uston, C.; Economou, T.; Gellert, R.; Markovski, C.

    2014-12-01

    After a 10 years cruise the Rosetta probe has reached its final target, the comet 67P/Churyumov-Gerasimenko. The main objectives of the mission are to gain more knowledge of the composition, the origin and formation of comets and the solar system. After extensive remote exploration of the comet the lander Philae will be separated to land on the comet surface, starting immediately examining its landing site with its scientific payload. Part of this payload is the APXS (Alpha Particle X-Ray Spectrometer). It will measure in situ the chemical composition of the comet's surface and it's changes during the journey of the comet towards the sun. APXS is a combination of two spectrometers in one single instrument. It will irradiate the comet surface using Curium 244 sources, which are emitting alpha-particle and X-rays. In the alpha-mode the instrument uses alpha backscattering spectroscopy to detect lower Z elements like C, N and O and groups of elements with higher Z. In the X-ray mode alpha particle / X-ray induced X-ray spectroscopy (XRF) will allow the detection of most of the higher Z elements from Na up to Ni and above. Both modes will be always run in parallel allowing to determine lower and higher Z elements simultaneously. For 3 years the solar powered Rosetta probe had to pass a hibernation phase because of a long passage far away to the sun. After wakeup in January 2014 an extensive test phase of all instruments and subsystems has been performed, including the APXS. After landing on the comet an intense initial measurement phase of all instruments is planned, the First Science Sequence (FSS). It will be followed by a long term science phase (LTS). As long as possible APXS and the other instruments will continue to measure and monitor the changes and increasing activity of the comet during its journey towards the inner region of the solar system.The project is funded by the German Space Agency DLR under contracts 50 QP 0404 and 50 QP 0902. References: G

  11. In Vitro Selection of Single-Stranded DNA Molecular Recognition Elements against S. aureus Alpha Toxin and Sensitive Detection in Human Serum

    PubMed Central

    Hong, Ka L.; Battistella, Luisa; Salva, Alysia D.; Williams, Ryan M.; Sooter, Letha J.

    2015-01-01

    Alpha toxin is one of the major virulence factors secreted by Staphylococcus aureus, a bacterium that is responsible for a wide variety of infections in both community and hospital settings. Due to the prevalence of S. aureus related infections and the emergence of methicillin-resistant S. aureus, rapid and accurate diagnosis of S. aureus infections is crucial in benefiting patient health outcomes. In this study, a rigorous Systematic Evolution of Ligands by Exponential Enrichment (SELEX) variant previously developed by our laboratory was utilized to select a single-stranded DNA molecular recognition element (MRE) targeting alpha toxin with high affinity and specificity. At the end of the 12-round selection, the selected MRE had an equilibrium dissociation constant (Kd) of 93.7 ± 7.0 nM. Additionally, a modified sandwich enzyme-linked immunosorbent assay (ELISA) was developed by using the selected ssDNA MRE as the toxin-capturing element and a sensitive detection of 200 nM alpha toxin in undiluted human serum samples was achieved. PMID:25633102

  12. Atom-at-a-time radiochemical separations of the heaviest elements: Lawrencium chemistry

    SciTech Connect

    Hoffman, D.C.; Henderson, R.A.; Gregorich, K.E.; Bennett, D.A.; Chasteler, R.M.; Gannett, C.M.; Hall, H.L.; Lee, D.M.; Nurmia, M.J.; Silva, R.J.

    1987-04-01

    The isotope /sup 260/Lr produced in reactions of /sup 18/O with /sup 249/Bk was used to perform chemical experiments on lawrencium to learn more about its chemical properties. These experiments involved extractions with thenoyl trifluoroacetate (TTA), ammonium alpha-hydroxyisobutyrate (HIB) elution from a cation exchange resin column, and reverse-phase chromatography using hydrogen di(2-ethylhexyl)orthophosphoric acid (HDEHP) to investigate the chemical properties of Lr. The results from the HIB elutions also give information about the ionic radius of Lr(III) which was found to elute very close to Er. An attempt to reduce Lr(III) was also made.

  13. Combined Haemophilus influenzae type b and Neisseria meningitidis serogroup C (HibMenC) or serogroup C and Y-tetanus toxoid conjugate (and HibMenCY) vaccines are well-tolerated and immunogenic when administered according to the 2,3,4 months schedule with a fourth dose at 12-18 months of age.

    PubMed

    Habermehl, Pirmin; Leroux-Roels, Geert; Sänger, Roland; Mächler, Gudrun; Boutriau, Dominique

    2010-08-01

    Combined HibMenCY and HibMenC conjugate vaccines may facilitate inclusion of vaccination against MenC and MenY into routine vaccination schedules, without additional injections. Immunogenicity and reactogenicity of vaccination with three different formulations of a novel HibMenCY-conjugate vaccine, or a HibMenC-conjugate vaccine was assessed. Infants were randomized to receive either Hib(2.5 µg)-MenC(5 µg)-MenY(5 µg)-TT, Hib(5 µg)-MenC(10 µg)-MenY(10 µg)-TT, Hib(5 µg)-MenC(5 µg)-MenY(5 µg)-TT or Hib(5 µg)-MenC(5 µg)-TT vaccines co-administered with DTPa-HBV-IPV at 2-3-4 months of age. Controls received licensed conjugate MenC-CRM197 vaccine co-administered with DTPa-HBV-IPV/Hib. A fourth dose was administered to a subset of children at age 12-18 months. Anti-PRP concentrations and meningococcal bactericidal (rSBA-MenC/Y) titres were measured prior to and one month post third and fourth vaccination dose. Solicited local, general symptoms and unsolicited adverse events were recorded for 7 and 30 days after each vaccination, respectively. Post dose 3, all subjects had anti-PRP antibody levels ≥ 0.15 µg/ml and rSBA-MenC ≥ 1:8. 97.0%-98.6% of HibMenCY recipients had rSBA-MenY ≥ 1:8. Pre-dose-4, 95.6%-100% of HibMenCY and HibMenC recipients had anti-PRP ≥ 0.15 µg/ml and 90.7%-97.6% recipients had rSBA-MenC titres ≥ 1:8. In HibMenCY groups, 78.6%-86.7% had persisting rSBA-MenY ≥ 1:8. The post-dose-4 response was robust after all vaccines with all subjects having anti-PRP ≥ 1 µg/ml and 92.3%-100% rSBA-MenC ≥ 1:128. All HibMenCY recipients had rSBA-MenY ≥ 1:128. Vaccination with the novel Hib-meningococcal vaccines had a safety profile similar to control. HibMenCY and HibMenC conjugate vaccine formulations given at 2-3-4 months of age with a fourth dose in the second year of life were immunogenic and had a comparable safety profile to licensed vaccines. (study 792014 and 100381;www.clinicaltrial.govID:NCT00129116)

  14. A TGACGT motif in the 5'-upstream region of alpha-amylase gene from Vigna mungo is a cis-element for expression in cotyledons of germinated seeds.

    PubMed

    Yamauchi, D

    2001-06-01

    Alpha-amylase is expressed at high levels in cotyledons of germinated seeds of Vigna mungo. The mRNA for alpha-amylase appeared in cotyledons of the seeds at 1 d after imbibition started (DAI). Two TGACGT motifs at -445 and at -125 in the promoter region of the gene interacted with nuclear proteins from cotyledons of dry seeds and the activities were detected until 3 DAI. A transient assay with particle bombardment showed that the downstream region from -135 in the promoter was required for high level expression in the cotyledons and the activity was reduced by mutation of the TGACGT motif at -125. The activities to bind the TGACGT motifs were detected in the axes of the seeds at 1 DAI but disappeared at 4 DAI, although the mRNA for alpha-amylase in the axes appeared at 4 DAI and increased in level by 6 DAI. A transient assay experiment showed that a positive regulatory element for the expression in the axes was located in the region from -630 to -453. These results indicated that the TGACGT motif at -125 was required for high level expression of the gene in the cotyledons of the germinated seeds.

  15. EFFECTS OF alpha-ELEMENT ENHANCEMENT AND THE THERMALLY PULSING-ASYMPTOTIC GIANT BRANCH ON SURFACE BRIGHTNESS FLUCTUATION MAGNITUDES AND BROADBAND COLORS

    SciTech Connect

    Lee, Hyun-chul; Worthey, Guy; Blakeslee, John P.

    2010-02-10

    We investigate the effects of alpha-element enhancement and the thermally pulsing-asymptotic giant branch (TP-AGB) stars on the surface brightness fluctuation (SBF) magnitudes and broadband colors of simple stellar populations and compare to the empirical calibrations. We consider a broad range of ages and metallicities using the recently updated Teramo BaSTI isochrones. We find that the alpha-element-enhanced I-band SBF magnitudes are about 0.35 mag brighter and their integrated V - I colors are about 0.02 mag redder, mostly because of oxygen-enhancement effects on the upper red giant branch and AGB. We also demonstrate, using both the Teramo BaSTI and Padova isochrones, the acute sensitivity of SBF magnitudes to the presence of TP-AGB stars, particularly in the near-IR, but in the I band as well. Empirical SBF trends therefore hold great promise for constraining this important but still highly uncertain stage of stellar evolution. In a similar vein, non-negligible disparities are found among several different models available in the literature due to intrinsic model uncertainties.

  16. Cis and trans-acting elements involved in the activation of Arabidopsis thaliana A1 gene encoding the translation elongation factor EF-1 alpha.

    PubMed Central

    Curie, C; Liboz, T; Bardet, C; Gander, E; Médale, C; Axelos, M; Lescure, B

    1991-01-01

    In A. thaliana the translation elongation factor EF-1 alpha is encoded by a small multigenic family of four members (A1-A4). The A1 gene promoter has been dissected and examined in a transient expression system using the GUS reporter gene. Deletion analysis has shown that several elements are involved in the activation process. One cis-acting domain, the TEF 1 box, has been accurately mapped 100 bp upstream of the transcription initiation site. This domain is the target for trans-acting factors identified in nuclear extracts prepared from A. thaliana. Homologies are found between the TEF 1 box and sequences present at the same location within the A2, A3 and A4 promoters. This observation, together with those obtained from gel retardation assays performed using DNA fragments from the A4 promoter, suggest that the activation process mediated by the TEF 1 element is conserved among the A. thaliana EF-1 alpha genes. Analysis of nearly full length cDNA clones has shown that in addition to a single intron located within the coding region, the A1 gene contains a second intron located within the 5' non coding region. Such an intron is also present within the A2, A3 and A4 genes. This 5' intervening sequence appears to be essential to obtain a maximum GUS activity driven by the A1 gene promoter. Images PMID:1840652

  17. Expression of the human granulocyte-macrophage colony stimulating factor (hGM-CSF) gene under control of the 5'-regulatory sequence of the goat alpha-S1-casein gene with and without a MAR element in transgenic mice.

    PubMed

    Burkov, I A; Serova, I A; Battulin, N R; Smirnov, A V; Babkin, I V; Andreeva, L E; Dvoryanchikov, G A; Serov, O L

    2013-10-01

    Expression of the human granulocyte-macrophage colony-stimulating factor (hGM-CSF) gene under the control of the 5'-regulatory sequence of the goat alpha-S1-casein gene with and without a matrix attachment region (MAR) element from the Drosophila histone 1 gene was studied in four and eight transgenic mouse lines, respectively. Of the four transgenic lines carrying the transgene without MAR, three had correct tissues-specific expression of the hGM-CSF gene in the mammary gland only and no signs of cell mosaicism. The concentration of hGM-CSF in the milk of transgenic females varied from 1.9 to 14 μg/ml. One line presented hGM-CSF in the blood serum, indicating ectopic expression. The values of secretion of hGM-CSF in milk of 6 transgenic lines carrying the transgene with MAR varied from 0.05 to 0.7 μg/ml, and two of these did not express hGM-CSF. Three of the four examined animals from lines of this group showed ectopic expression of the hGM-CSF gene, as determined by RT-PCR and immunofluorescence analyses, as well as the presence of hGM-CSF in the blood serum. Mosaic expression of the hGM-CSF gene in mammary epithelial cells was specific to all examined transgenic mice carrying the transgene with MAR but was never observed in the transgenic mice without MAR. The mosaic expression was not dependent on transgene copy number. Thus, the expected "protective or enhancer effect" from the MAR element on the hGM-CSF gene expression was not observed.

  18. Molecular cloning and characterization of interferon alpha/beta response element binding factors of the murine (2'-5')oligoadenylate synthetase ME-12 gene.

    PubMed Central

    Yan, C; Tamm, I

    1991-01-01

    Seven clones encoding interferon response element binding factors have been isolated from a mouse fibroblast lambda gt11 cDNA library by using a 32P end-labeled tandem trimer of the mouse (2'-5')oligoadenylate synthetase gene interferon response element as a probe. Clone 16 shares strong similarity (95%) at both DNA and amino acid level with YB-1, a human major histocompatibility complex class II Y-box DNA-binding protein, and with dbpB, a human epidermal growth factor receptor gene enhancer region binding protein. The product of the gene represented by clone 16 may represent a factor that regulates multiple genes by binding to a variety of 5' regulatory elements. Clone 25 is a 2407-base-pair-long cDNA and contains a putative 311-amino acid open reading frame corresponding to an estimated mass of 35.5 kDa. This putative protein, designated as interferon response element binding factor 1 (IREBF-1), contains an acidic domain, three heptad repeat leucine arrays, and a region that shares similarity with the yeast transcriptional factor GAL4 DNA-binding domain. Furthermore, the C terminus of IREBF-1 shows an unusual amphipathic property: within a 79-amino acid range, one side of the alpha-helical region contains a preponderance of hydrophobic amino acids and the other side contains hydrophilic amino acids. This type of structure provides a strong hydrophobic force for protein-protein interaction. Images PMID:1986360

  19. Refinement of the Compton-Rayleigh scatter ratio method for use on the Mars Science Laboratory alpha particle X-ray spectrometer: II - Extraction of invisible element content

    NASA Astrophysics Data System (ADS)

    Perrett, Glynis M.; Campbell, John L.; Gellert, Ralf; King, Penelope L.; Nield, Emily; O'Meara, Joanne M.; Pradler, Irina

    2016-02-01

    The intensity ratio C/R between Compton and Rayleigh scatter peaks of the exciting Pu L X-rays in the alpha particle X-ray spectrometer (APXS) is strongly affected by the presence of very light elements such as oxygen which cannot be detected directly by the APXS. C/R values are determined along with element concentrations by fitting APXS spectra of geochemical reference materials (GRMs) with the GUAPX code. A quantity K is defined as the ratio between the C/R value determined by Monte Carlo simulation based on the measured element concentrations and the fitted C/R value from the spectrum. To ensure optimally accurate K values, the choice of appropriate GRMs is explored in detail, with attention paid to Rb and Sr, whose characteristic Kα X-ray peaks overlap the Pu Lα scatter peaks. The resulting relationship between the ratio K and the overall oxygen fraction is linear. This provides a calibration from which the concentration of additional light invisible constituents (ALICs) such as water may be estimated in unknown rock and conglomerate samples. Several GRMs are used as 'unknowns' in order to evaluate the accuracy of ALIC concentrations derived in this manner.

  20. Physiological and Pathological Role of Alpha-synuclein in Parkinson’s Disease Through Iron Mediated Oxidative Stress; The Role of a Putative Iron-responsive Element

    PubMed Central

    Olivares, David; Huang, Xudong; Branden, Lars; Greig, Nigel H.; Rogers, Jack T.

    2009-01-01

    Parkinson’s disease (PD) is the second most common progressive neurodegenerative disorder after Alzheimer’s disease (AD) and represents a large health burden to society. Genetic and oxidative risk factors have been proposed as possible causes, but their relative contribution remains unclear. Dysfunction of alpha-synuclein (α-syn) has been associated with PD due to its increased presence, together with iron, in Lewy bodies. Brain oxidative damage caused by iron may be partly mediated by α-syn oligomerization during PD pathology. Also, α-syn gene dosage can cause familial PD and inhibition of its gene expression by blocking translation via a newly identified Iron Responsive Element-like RNA sequence in its 5’-untranslated region may provide a new PD drug target. PMID:19399246

  1. Competition between alpha-decay and spontaneous fission at isotopes of superheavy elements Rf, Db, and Sg

    SciTech Connect

    Anghel, Claudia Ioana; Silisteanu, Andrei Octavian

    2015-12-07

    The most important decay modes for heavy and superheavy nuclei are their α-decay and spontaneous fission. This work investigates the evolution and the competition of these decay modes in long isotopic sequences. The partial half-lives are given by minimal sets of parameters extracted from the fit of experimental data and theoretical results. A summary of the experimental and calculated α-decay and spontaneous fission half-lives of the isotopes of elements Rf, Db, and Sg is presented. Some half-life extrapolations for nuclides not yet known are also obtained.

  2. Immunogenicity and safety of 3-dose primary vaccination with combined DTPa-HBV-IPV/Hib vaccine in Canadian Aboriginal and non-Aboriginal infants.

    PubMed

    Scheifele, David W; Ferguson, Murdo; Predy, Gerald; Dawar, Meena; Assudani, Deepak; Kuriyakose, Sherine; Van Der Meeren, Olivier; Han, Htay-Htay

    2015-04-15

    This study compared immune responses of healthy Aboriginal and non-Aboriginal infants to Haemophilus influenzae type b (Hib) and hepatitis B virus (HBV) components of a DTaP-HBV-IPV/Hib combination vaccine, 1 month after completing dosing at 2, 4 and 6 months of age. Of 112 infants enrolled in each group, 94 Aboriginal and 107 non-Aboriginal infants qualified for the immunogenicity analysis. Anti-PRP concentrations exceeded the protective minimum (≥0.15 μg/ml) in ≥97% of infants in both groups but geometric mean concentrations (GMCs) were higher in Aboriginal infants (6.12 μg/ml versus 3.51 μg/ml). All subjects were seroprotected (anti-HBs ≥10 mIU/mL) against HBV, with groups having similar GMCs (1797.9 versus 1544.4 mIU/mL, Aboriginal versus non-Aboriginal, respectively). No safety concerns were identified. We conclude that 3-dose primary vaccination with DTaP-HBV-IPV/Hib combination vaccine elicited immune responses to Hib and HBV components that were at least as high in Aboriginal as in non-Aboriginal Canadian infants. Clinical Trial Registration NCT00753649.

  3. Childhood very severe pneumonia and meningitis-related hospitalization and death in Yemen, before and after introduction of H. influenzae type b (Hib) vaccine.

    PubMed

    Banajeh, S M; Ashoor, O; Al-Magramy, A S

    2014-07-08

    Haemophilus influenzae type b (Hib) vaccine was included in the Yemen immunization programme in 2005. This study compared the rates of very severe pneumonia and all-cause meningitis hospitalization and death, before and after introduction of conjugate Hib vaccine, and reports the results of the 2010 bacterial meningitis surveillance. A retrospective analysis was made of data collected for 2000-2010 for all children aged 2-60 months in the main children's hospital in Sana'a. Compared with the pre-Hib vaccination period, the post-Hib period showed significant and impressive reductions in the rates of hospitalization and death for all-cause meningitis. However, hospitalization and death for very severe pneumonia improved only modestly, and there was evidence of a decreasing but non-significant trend indicting that very severe pneumonia was a non-specific endpoint with multi-etiologies (both viral and bacterial). Very severe pneumonia remains the leading cause of severe morbidity and death for young children, particularly those aged < 12 months.

  4. Primary structure determination of five sialylated oligosaccharides derived from bronchial mucus glycoproteins of patients suffering from cystic fibrosis. The occurrence of the NeuAc alpha(2----3)Gal beta(1----4)[Fuc alpha(1----3)] GlcNAc beta(1----.) structural element revealed by 500-MHz 1H NMR spectroscopy.

    PubMed

    Lamblin, G; Boersma, A; Klein, A; Roussel, P; van Halbeek, H; Vliegenthart, J F

    1984-07-25

    The structure of sialylated carbohydrate units of bronchial mucins obtained from cystic fibrosis patients was investigated by 500-MHz 1H NMR spectroscopy in conjunction with sugar analysis. After subjecting the mucins to alkaline borohydride degradation, sialylated oligosaccharide-alditols were isolated by anion-exchange chromatography and fractionated by high performance liquid chromatography. Five compounds could be obtained in a rather pure state; their structures were established as the following: A-1, NeuAc alpha(2----3)Gal beta(1----4) [Fuc alpha(1----3)]GlcNAc beta(1----3)Gal-NAc-ol; A-2, NeuAc alpha(2----3)Gal beta(1----4)GlcNAc beta(1----6)-[GlcNAc beta (1----3)]GalNAc-o1; A-3, NeuAc alpha(2----3)Gal beta-(1----4)[Fuc alpha(1----3)]GlcNAc beta(1----3)Gal beta(1----3) GalNAc-o1; A-4, NeuAc alpha(2----3)Gal beta(1----4)[Fuc alpha(1----3)]Glc-NAc NAc beta(1----6)[GlcNAc beta(1----3)]GalNAc-o1; A-6,NeuAc alpha-(2----3) Gal beta(1----4)[Fuc alpha(1----3)]GlcNAc beta(1----6)[Gal beta-(1----4) GlcNAc beta(1----3)]GalNAc-o1. The simultaneous presence of sialic acid in alpha(2----3)-linkage to Gal and fucose in alpha(1----3)-linkage to GlcNAc of the same N-acetyllactosamine unit could be adequately proved by high resolution 1H NMR spectroscopy. This sequence constitutes a novel structural element for mucins. PMID:6746638

  5. Primary structure determination of five sialylated oligosaccharides derived from bronchial mucus glycoproteins of patients suffering from cystic fibrosis. The occurrence of the NeuAc alpha(2----3)Gal beta(1----4)[Fuc alpha(1----3)] GlcNAc beta(1----.) structural element revealed by 500-MHz 1H NMR spectroscopy.

    PubMed

    Lamblin, G; Boersma, A; Klein, A; Roussel, P; van Halbeek, H; Vliegenthart, J F

    1984-07-25

    The structure of sialylated carbohydrate units of bronchial mucins obtained from cystic fibrosis patients was investigated by 500-MHz 1H NMR spectroscopy in conjunction with sugar analysis. After subjecting the mucins to alkaline borohydride degradation, sialylated oligosaccharide-alditols were isolated by anion-exchange chromatography and fractionated by high performance liquid chromatography. Five compounds could be obtained in a rather pure state; their structures were established as the following: A-1, NeuAc alpha(2----3)Gal beta(1----4) [Fuc alpha(1----3)]GlcNAc beta(1----3)Gal-NAc-ol; A-2, NeuAc alpha(2----3)Gal beta(1----4)GlcNAc beta(1----6)-[GlcNAc beta (1----3)]GalNAc-o1; A-3, NeuAc alpha(2----3)Gal beta-(1----4)[Fuc alpha(1----3)]GlcNAc beta(1----3)Gal beta(1----3) GalNAc-o1; A-4, NeuAc alpha(2----3)Gal beta(1----4)[Fuc alpha(1----3)]Glc-NAc NAc beta(1----6)[GlcNAc beta(1----3)]GalNAc-o1; A-6,NeuAc alpha-(2----3) Gal beta(1----4)[Fuc alpha(1----3)]GlcNAc beta(1----6)[Gal beta-(1----4) GlcNAc beta(1----3)]GalNAc-o1. The simultaneous presence of sialic acid in alpha(2----3)-linkage to Gal and fucose in alpha(1----3)-linkage to GlcNAc of the same N-acetyllactosamine unit could be adequately proved by high resolution 1H NMR spectroscopy. This sequence constitutes a novel structural element for mucins.

  6. A novel Galerkin-like weakform and a superconvergent alpha finite element method (S αFEM) for mechanics problems using triangular meshes

    NASA Astrophysics Data System (ADS)

    Liu, G. R.; Nguyen-Xuan, H.; Nguyen-Thoi, T.; Xu, X.

    2009-06-01

    A carefully designed procedure is presented to modify the piecewise constant strain field of linear triangular FEM models, and to reconstruct a strain field with an adjustable parameter α. A novel Galerkin-like weakform derived from the Hellinger-Reissner variational principle is proposed for establishing the discretized system equations. The new weak form is very simple, possesses the same good properties of the standard Galerkin weakform, and works particularly well for strain construction methods. A superconvergent alpha finite element method (S αFEM) is then formulated by using the constructed strain field and the Galerkin-like weakform for solid mechanics problems. The implementation of the S αFEM is straightforward and no additional parameters are used. We prove theoretically and show numerically that the S αFEM always achieves more accurate and higher convergence rate than the standard FEM of triangular elements (T3) and even more accurate than the four-node quadrilateral elements (Q4) when the same sets of nodes are used. The S αFEM can always produce both lower and upper bounds to the exact solution in the energy norm for all elasticity problems by properly choosing an α. In addition, a preferable- α approach has also been devised to produce very accurate solutions for both displacement and energy norms and a superconvergent rate in the energy error norm. Furthermore, a model-based selective scheme is proposed to formulate a combined S αFEM/NS-FEM model that handily overcomes the volumetric locking problems. Intensive numerical studies including singularity problems have been conducted to confirm the theory and properties of the S αFEM.

  7. The GIRAFFE Inner Bulge Survey (GIBS). II. Metallicity distributions and alpha element abundances at fixed Galactic latitude

    NASA Astrophysics Data System (ADS)

    Gonzalez, O. A.; Zoccali, M.; Vasquez, S.; Hill, V.; Rejkuba, M.; Valenti, E.; Rojas-Arriagada, A.; Renzini, A.; Babusiaux, C.; Minniti, D.; Brown, T. M.

    2015-12-01

    Aims: We investigate metallicity and α-element abundance gradients along a Galactic longitude strip, at latitude b ~ -4°, with the aim of providing observational constraints for the structure and origin of the Milky Way bulge. Methods: High-resolution (R ~ 22 500) spectra for 400 K giants, in four fields within -4.8° ≲ b ≲ -3.4° and -10° ≲ l ≲ +10°, were obtained within the GIRAFFE Inner Bulge Survey (GIBS) project. To this sample we added another ~400 stars in Baade's Window at (l,b) = (1°,-4°), observed with the identical instrumental configuration: FLAMES GIRAFFE in Medusa mode with HR13 setup. All target stars lie within the red clump of the bulge colour-magnitude diagram, thus minimising contamination from the disc or halo stars. The spectroscopic stellar surface parameters were derived with an automatic method based on the GALA code, while the [Ca/Fe] and [Mg/Fe] abundances as a function of [Fe/H] were derived through a comparison with the synthetic spectra using MOOG. We constructed the metallicity distributions for the entire sample, and for each field individually, in order to investigate the presence of gradients or field-to-field variations in the shape of the distributions. Results: The metallicity distributions in the five fields are consistent with being drawn from a single parent population, indicating the absence of a gradient along the major axis of the Galactic bar. The global metallicity distribution is nicely fitted by two Gaussians. The metal-poor component is rather broad, with a mean at ⟨ [Fe/H] ⟩ = -0.31 dex and σ = 0.31 dex. The metal-rich component is narrower, with mean ⟨ [Fe/H] ⟩ = + 0.26 and σ = 0.2 dex. The [Mg/Fe] ratio follows a tight trend with [Fe/H], with enhancement with respect to solar in the metal-poor regime similar to the value observed for giant stars in the local thick disc. [Ca/Fe] abundances follow a similar trend, but with a considerably larger scatter than [Mg/Fe]. A decrease in [Mg/Fe] is

  8. In silico selection of an aptamer to estrogen receptor alpha using computational docking employing estrogen response elements as aptamer-alike molecules

    PubMed Central

    Ahirwar, Rajesh; Nahar, Smita; Aggarwal, Shikha; Ramachandran, Srinivasan; Maiti, Souvik; Nahar, Pradip

    2016-01-01

    Aptamers, the chemical-antibody substitute to conventional antibodies, are primarily discovered through SELEX technology involving multi-round selections and enrichment. Circumventing conventional methodology, here we report an in silico selection of aptamers to estrogen receptor alpha (ERα) using RNA analogs of human estrogen response elements (EREs). The inverted repeat nature of ERE and the ability to form stable hairpins were used as criteria to obtain aptamer-alike sequences. Near-native RNA analogs of selected single stranded EREs were modelled and their likelihood to emerge as ERα aptamer was examined using AutoDock Vina, HADDOCK and PatchDock docking. These in silico predictions were validated by measuring the thermodynamic parameters of ERα -RNA interactions using isothermal titration calorimetry. Based on the in silico and in vitro results, we selected a candidate RNA (ERaptR4; 5′-GGGGUCAAGGUGACCCC-3′) having a binding constant (Ka) of 1.02 ± 0.1 × 108 M−1 as an ERα-aptamer. Target-specificity of the selected ERaptR4 aptamer was confirmed through cytochemistry and solid-phase immunoassays. Furthermore, stability analyses identified ERaptR4 resistant to serum and RNase A degradation in presence of ERα. Taken together, an efficient ERα-RNA aptamer is identified using a non-SELEX procedure of aptamer selection. The high-affinity and specificity can be utilized in detection of ERα in breast cancer and related diseases. PMID:26899418

  9. Transcriptional regulation of the human glycoprotein hormone common alpha subunit gene by cAMP-response-element-binding protein (CREB)-binding protein (CBP)/p300 and p53.

    PubMed Central

    Zhang, Xian; Grand, Roger J A; McCabe, Christopher J; Franklyn, Jayne A; Gallimore, Phillip H; Turnell, Andrew S

    2002-01-01

    We have investigated the functional interactions between adenovirus early region 1A (AdE1A) protein, the co-activators cAMP-response-element-binding protein (CREB)-binding protein (CBP)/p300 and SUG1, and the transcriptional repressor retinoblastoma (Rb) in mediating T3-dependent repression. Utilizing the human glycoprotein hormone common alpha-subunit (alpha-subunit) promoter and AdE1A mutants with selective binding capacity to these molecules we have determined an essential role for CBP/p300. In normal circumstances, wild-type 12 S AdE1A inhibited alpha-subunit activity. In contrast, adenovirus mutants that retain both the SUG1- and Rb-binding sites, but lack the CBP/p300-binding site, were unable to repress promoter activity. We have also identified a role for the tumour-suppressor gene product p53 in regulation of the alpha-subunit promoter. Akin to 12 S AdE1A, exogenous p53 expression repressed alpha-subunit activity. This function resided in the ability of p53 to interact with CBP/p300; an N-terminal mutant incapable of interacting with CBP/p300 did not inhibit alpha-subunit activity. Stabilization of endogenous p53 by UV irradiation also correlated positively with reduced alpha-subunit activity. Intriguingly, T3 stimulated endogenous p53 transcriptional activity, implicating p53 in T3-dependent signalling pathways. These data indicate that CBP/p300 and p53 are key regulators of alpha-subunit activity. PMID:12164786

  10. GLOBULAR CLUSTER ABUNDANCES FROM HIGH-RESOLUTION, INTEGRATED-LIGHT SPECTROSCOPY. IV. THE LARGE MAGELLANIC CLOUD: {alpha}, Fe-PEAK, LIGHT, AND HEAVY ELEMENTS

    SciTech Connect

    Colucci, Janet E.; Bernstein, Rebecca A.; McWilliam, Andrew E-mail: rab@ucolick.org E-mail: andy@ociw.edu

    2012-02-10

    We present detailed chemical abundances in eight clusters in the Large Magellanic Cloud (LMC). We measure abundances of 22 elements for clusters spanning a range in age of 0.05-12 Gyr, providing a comprehensive picture of the chemical enrichment and star formation history of the LMC. The abundances were obtained from individual absorption lines using a new method for analysis of high-resolution (R {approx} 25,000), integrated-light (IL) spectra of star clusters. This method was developed and presented in Papers I, II, and III of this series. In this paper, we develop an additional IL {chi}{sup 2}-minimization spectral synthesis technique to facilitate measurement of weak ({approx}15 mA) spectral lines and abundances in low signal-to-noise ratio data (S/N {approx} 30). Additionally, we supplement the IL abundance measurements with detailed abundances that we measure for individual stars in the youngest clusters (age < 2 Gyr) in our sample. In both the IL and stellar abundances we find evolution of [{alpha}/Fe] with [Fe/H] and age. Fe-peak abundance ratios are similar to those in the Milky Way (MW), with the exception of [Cu/Fe] and [Mn/Fe], which are sub-solar at high metallicities. The heavy elements Ba, La, Nd, Sm, and Eu are significantly enhanced in the youngest clusters. Also, the heavy to light s-process ratio is elevated relative to the MW ([Ba/Y] >+0.5) and increases with decreasing age, indicating a strong contribution of low-metallicity asymptotic giant branch star ejecta to the interstellar medium throughout the later history of the LMC. We also find a correlation of IL Na and Al abundances with cluster mass in the sense that more massive, older clusters are enriched in the light elements Na and Al with respect to Fe, which implies that these clusters harbor star-to-star abundance variations as is common in the MW. Lower mass, intermediate-age, and young clusters have Na and Al abundances that are lower and more consistent with LMC field stars. Our

  11. The Ages, Metallicities, and Alpha Element Enhancements of Globular Clusters in the Elliptical NGC 5128: A Homogeneous Spectroscopic Study with Gemini/Gemini Multi-Object Spectrograph

    NASA Astrophysics Data System (ADS)

    Woodley, Kristin A.; Harris, William E.; Puzia, Thomas H.; Gómez, Matías; Harris, Gretchen L. H.; Geisler, Doug

    2010-01-01

    We present new integrated light spectroscopy of globular clusters (GCs) in NGC 5128, a nearby giant elliptical galaxy less than 4 Mpc away, in order to measure radial velocities and derive ages, metallicities, and alpha-element abundance ratios. Using the Gemini South 8 meter telescope with the instrument Gemini Multi-Object Spectrograph, we obtained spectroscopy in the range of ~3400-5700 Å for 72 GCs with a signal-to-noise ratio greater than 30 Å-1 and we have also discovered 35 new GCs within NGC 5128 from our radial velocity measurements. We measured and compared the Lick indices from Hδ A through Fe5406 with the single stellar population models of Thomas et al. in order to derive age, metallicity, and [α/Fe] values. We also measure Lick indices for 41 Milky Way GCs from Puzia et al. and Schiavon et al. with the same methodology for direct comparison. Our results show that 68% of the NGC 5128 GCs have old ages (>8 Gyr), 14% have intermediate ages (5-8 Gyr), and 18% have young ages (<5 Gyr). However, when we look at the metallicity of the GCs as a function of age, we find 92% of metal-poor GCs and 56% of metal-rich GCs in NGC 5128 have ages >8 Gyr, indicating that the majority of both metallicity subpopulations of GCs formed earlier, with a significant population of young and metal-rich GCs forming later. Our metallicity distribution function generated directly from spectroscopic Lick indices is clearly bimodal, as is the color distribution of the same set of GCs. Thus, the metallicity bimodality is real and not an artifact of the color to metallicity conversion. However, the metallicity distribution function obtained from comparison with the single stellar population models is consistent with a unimodal, bimodal, or multimodal shape. The [α/Fe] values are supersolar with a mean value of 0.14 ± 0.04, indicating a fast formation timescale. However, the GCs in NGC 5128 are not as [α/Fe] enhanced as the Milky Way GCs also examined in this study. Our measured

  12. Temporal expression of the human alcohol dehydrogenase gene family during liver development correlates with differential promoter activation by hepatocyte nuclear factor 1, CCAAT/enhancer-binding protein alpha, liver activator protein, and D-element-binding protein.

    PubMed Central

    van Ooij, C; Snyder, R C; Paeper, B W; Duester, G

    1992-01-01

    The human class I alcohol dehydrogenase (ADH) gene family consists of ADH1, ADH2, and ADH3, which are sequentially activated in early fetal, late fetal, and postnatal liver, respectively. Analysis of ADH promoters revealed differential activation by several factors previously shown to control liver transcription. In cotransfection assays, the ADH1 promoter, but not the ADH2 or ADH3 promoter, was shown to respond to hepatocyte nuclear factor 1 (HNF-1), which has previously been shown to regulate transcription in early liver development. The ADH2 promoter, but not the ADH1 or ADH3 promoter, was shown to respond to CCAAT/enhancer-binding protein alpha (C/EBP alpha), a transcription factor particularly active during late fetal liver and early postnatal liver development. The ADH1, ADH2, and ADH3 promoters all responded to the liver transcription factors liver activator protein (LAP) and D-element-binding protein (DBP), which are most active in postnatal liver. For all three promoters, the activation by LAP or DBP was higher than that seen by HNF-1 or C/EBP alpha, and a significant synergism between C/EBP alpha and LAP was noticed for the ADH2 and ADH3 promoters when both factors were simultaneously cotransfected. A hierarchy of ADH promoter responsiveness to C/EBP alpha and LAP homo- and heterodimers is suggested. In all three ADH genes, LAP bound to the same four sites previously reported for C/EBP alpha (i.e., -160, -120, -40, and -20 bp), but DBP bound strongly only to the site located at -40 bp relative to the transcriptional start. Mutational analysis of ADH2 indicated that the -40 bp element accounts for most of the promoter regulation by the bZIP factors analyzed. These studies suggest that HNF-1 and C/EBP alpha help establish ADH gene family transcription in fetal liver and that LAP and DBP help maintain high-level ADH gene family transcription in postnatal liver. Images PMID:1620113

  13. Substrate evokes translocation of both domains in the mitochondrial processing peptidase alpha-subunit during which the C-terminus acts as a stabilizing element.

    PubMed

    Janata, Jirí; Holá, Klára; Kubala, Martin; Gakh, Oleksandr; Parkhomenko, Natalya; Matusková, Anna; Kutejová, Eva; Amler, Evzen

    2004-03-26

    All three tryptophan residues in alpha-subunit of mitochondrial processing peptidase (MPP) were subsequently substituted. While substitutions of Trp223 led to misfolded non-functional protein, mutations of Trp147 and/or Trp481 did not affect the enzyme processing activity. Thus, fluorescence properties of the mutants with fewer tryptophans were used for observation of both alpha-MPP domain translocation and visualization of conformational changes in the interdomain linker evoked by substrate. We found that in the presence of substrate the C-terminal penultimate Trp481 was approaching Trp223, which is localized at the border of N-terminal domain and interdomain linker. Also, excision of the alpha-MPP C-terminal 30 amino acid residues (DeltaC30) led to a complete loss of protein function. Even shorter deletions of the alpha-MPP C-terminus destabilized the protein slightly (DeltaC2) or dramatically (DeltaC17). It suggests that the extreme C-terminus of alpha-MPP provides mechanical support to the C-terminal domain during its extensive conformational change accompanying the substrate recognition process.

  14. Food and Drug Administration Approval for Use of Hiberix as a 3-Dose Primary Haemophilus influenzae Type b (Hib) Vaccination Series.

    PubMed

    Briere, Elizabeth C

    2016-04-29

    On January 14, 2016, GlaxoSmithKline Biologicals (Research Triangle Park, North Carolina) received approval from the Food and Drug Administration (FDA) to expand use of Hiberix (Haemophilus b Conjugate Vaccine [Tetanus Toxoid Conjugate]) for a 3-dose infant primary vaccination series at ages 2, 4, and 6 months. Hiberix was first licensed in the United States in August 2009 for use as a booster dose in children aged 15 months through 4 years under the Accelerated Approval Regulations, in response to a Haemophilus influenzae type b (Hib) vaccine shortage that lasted from December 2007 to July 2009 (1). Expanding the age indication to include infants provides another vaccine option in addition to other currently licensed monovalent or combination Hib vaccines recommended for the primary vaccination series.* Hiberix contains 10 μg purified capsular polyribosyl ribitolphosphate (PRP) conjugated to 25 μg tetanus toxoid (PRP-T) and is supplied as a single-dose vial of lyophilized vaccine to be reconstituted with saline diluent. For the 3-dose primary series, a single (0.5 mL) dose should be given by intramuscular injection at ages 2, 4, and 6 months; the first dose may be given as early as age 6 weeks. The recommended catch-up schedule for PRP-T vaccines (http://www.cdc.gov/vaccines/schedules/hcp/child-adolescent.html) should be followed. As previously recommended, a single booster dose should be administered to children aged 15 months through 18 months; to facilitate timely booster vaccination, Hiberix can be administered as early as age 12 months, in accordance with Hib vaccination schedules for routine and catch-up immunization (1-3).

  15. Economic aspects of a general vaccination against invasive disease caused by Haemophilus influenzae type b (Hib) via the experience of the Children's Hospital La Fe, Valencia, Spain.

    PubMed

    Asensi, F; Otero, M C; Pérez-Tamarit, D; Miranda, J; Picó, L; Nieto, A

    1995-11-01

    With the aim of studying whether a general vaccination against invasive disease caused by Haemophilus influenzae type b (Hib) is economically profitable bearing in mind the efficacy and safety of the vaccine, its price and the global cost that this disease has in our area, a review is conducted of patients admitted due to invasive disease caused by Hib in the Children's Hospital La Fe, Valencia, born between 1984 and 1993. They total 100, 63 who have meningitis. In the 81 cases (56 with meningitis) born between 1984 and 1990 (years that can be regarded as "closed" since all the patients were younger than 5 years of age) the total cost has been calculated for hospitalization, care during the acute phase, care for the sequelae (6 severe and 7 mild) and death (5 cases). The mean annual cost of care can be calculated at 62 million pesetas, without making an economic valuation of the loss of life, and at 205 million pesetas taking this factor into account. The annual cost of vaccinating the 7000 babies under one year of age and falling within the Hospital's catchment area, on the basis of a vaccination pattern of three doses (at 2, 4 and 6 months) or four doses (at 2, 4, 6 and 15 months) would amount to 63 or 84 million pesetas, normal price to public (not covered by National Health Service), and 40 or 51 million pesetas if acquired by National Health Service. As a conclusion we can state that, even from the economic point of view, without quantifying the cost of the loss of life, a public general anti-Hib vaccination would be profitable in our area since it would mean an administration cost lower than that of the care required by patients. This is without taking into account the fact that emotional, family and social serious disturbances would also be avoided due to hospitalization, sequelae and deaths caused by a disease which is today perfectly preventable.

  16. Food and Drug Administration Approval for Use of Hiberix as a 3-Dose Primary Haemophilus influenzae Type b (Hib) Vaccination Series.

    PubMed

    Briere, Elizabeth C

    2016-01-01

    On January 14, 2016, GlaxoSmithKline Biologicals (Research Triangle Park, North Carolina) received approval from the Food and Drug Administration (FDA) to expand use of Hiberix (Haemophilus b Conjugate Vaccine [Tetanus Toxoid Conjugate]) for a 3-dose infant primary vaccination series at ages 2, 4, and 6 months. Hiberix was first licensed in the United States in August 2009 for use as a booster dose in children aged 15 months through 4 years under the Accelerated Approval Regulations, in response to a Haemophilus influenzae type b (Hib) vaccine shortage that lasted from December 2007 to July 2009 (1). Expanding the age indication to include infants provides another vaccine option in addition to other currently licensed monovalent or combination Hib vaccines recommended for the primary vaccination series.* Hiberix contains 10 μg purified capsular polyribosyl ribitolphosphate (PRP) conjugated to 25 μg tetanus toxoid (PRP-T) and is supplied as a single-dose vial of lyophilized vaccine to be reconstituted with saline diluent. For the 3-dose primary series, a single (0.5 mL) dose should be given by intramuscular injection at ages 2, 4, and 6 months; the first dose may be given as early as age 6 weeks. The recommended catch-up schedule for PRP-T vaccines (http://www.cdc.gov/vaccines/schedules/hcp/child-adolescent.html) should be followed. As previously recommended, a single booster dose should be administered to children aged 15 months through 18 months; to facilitate timely booster vaccination, Hiberix can be administered as early as age 12 months, in accordance with Hib vaccination schedules for routine and catch-up immunization (1-3). PMID:27124887

  17. [Postvaccinal immunity and immunological aspects of Haemophilus influenzae carrier state in children of different age groups after the administration of "Act-HIB" vaccine].

    PubMed

    Gorbunov, S G; Bondarenko, V M; Demina, A A; Spirikhina, L V; Iastrebova, N E; Vaneeva, N P; Orlova, E V; Tamazian, G V; Zakharova, N I

    2003-01-01

    The article deals with H. influenzae (different serotypes) carrier state and immune response before and after the administration of the vaccine "Act-HIB" to children of different age groups. Children aged up to 1 year and over 1 year have been found to differ in the dynamics of carrier state and in the concentration of antibodies of different classes to the antigens of this infective agent, which makes it necessary to carry out their early immunization with a view to ensure their protection from H. influenzae infection.

  18. Safety and reactogenicity of the combined diphtheria-tetanus-acellular pertussis-inactivated poliovirus-Haemophilus influenzae type b (DTPa-IPV/Hib) vaccine in healthy Vietnamese toddlers: An open-label, phase III study.

    PubMed

    Anh, Dang Duc; Van Der Meeren, Olivier; Karkada, Naveen; Assudani, Deepak; Yu, Ta-Wen; Han, Htay Htay

    2016-03-01

    The introduction of combination vaccines plays a significant role in increasing vaccine acceptance and widening vaccine coverage. Primary vaccination against diphtheria, tetanus, pertussis, poliomyelitis and Haemophilus influenza type b (Hib) diseases has been implemented in Vietnam. In this study we evaluated the safety and reactogenicity of combined diphtheria-tetanus-pertussis-inactivated polio (DTPa-IPV)/Hib vaccine when administered as a booster dose in 300 healthy Vietnamese children <2 years of age (mean age: 15.8 months). During the 4-day follow-up period, pain (31.7%) and redness (27.3%) were the most frequent solicited local symptoms. Pain (2%) was also the most frequent grade 3 local symptom. One subject reported 2 serious adverse events that were not causally related to the study vaccine. DTPa-IPV/Hib conjugate vaccine was well tolerated as a booster dose in healthy Vietnamese children aged <2 years.

  19. Safety and reactogenicity of the combined diphtheria-tetanus-acellular pertussis-inactivated poliovirus-Haemophilus influenzae type b (DTPa-IPV/Hib) vaccine in healthy Vietnamese toddlers: An open-label, phase III study

    PubMed Central

    Anh, Dang Duc; Van Der Meeren, Olivier; Karkada, Naveen; Assudani, Deepak; Yu, Ta-Wen; Han, Htay Htay

    2016-01-01

    abstract The introduction of combination vaccines plays a significant role in increasing vaccine acceptance and widening vaccine coverage. Primary vaccination against diphtheria, tetanus, pertussis, poliomyelitis and Haemophilus influenza type b (Hib) diseases has been implemented in Vietnam. In this study we evaluated the safety and reactogenicity of combined diphtheria-tetanus-pertussis-inactivated polio (DTPa-IPV)/Hib vaccine when administered as a booster dose in 300 healthy Vietnamese children <2 years of age (mean age: 15.8 months). During the 4-day follow-up period, pain (31.7%) and redness (27.3%) were the most frequent solicited local symptoms. Pain (2%) was also the most frequent grade 3 local symptom. One subject reported 2 serious adverse events that were not causally related to the study vaccine. DTPa-IPV/Hib conjugate vaccine was well tolerated as a booster dose in healthy Vietnamese children aged <2 years. PMID:26337197

  20. Alpha Thalassemia

    MedlinePlus

    ... an apparently normal individual has a child with hemoglobin H disease or alpha thalassemia minor. It can ... gene on one chromosome 25% 25% 25% 25% hemoglobin H disease there is a 25% chance with ...

  1. Alpha proton x ray spectrometer

    NASA Technical Reports Server (NTRS)

    Rieder, Rudi; Waeke, H.; Economou, T.

    1994-01-01

    Mars Pathfinder will carry an alpha-proton x ray spectrometer (APX) for the determination of the elemental chemical composition of Martian rocks and soils. The instrument will measure the concentration of all major and some minor elements, including C, N, and O at levels above typically 1 percent.

  2. An evaluation of the effects of thimerosal on neurodevelopmental disorders reported following DTP and Hib vaccines in comparison to DTPH vaccine in the United States.

    PubMed

    Geier, David A; Geier, Mark R

    2006-08-01

    Thimerosal is an ethylmercury (49.55% mercury by weight) preservative historically added to some vaccines. Toxicokinetic studies showed children in the United States received doses of mercury from Thimerosal-containing vaccines (TCVs) in excess of safety guidelines. In the United States during the 1990s, diphtheria-tetanus-pertussis (DTP) and Haemophilus influenzae type b (Hib) vaccines (maximally, 50 mug mercury per joint administration) and diphtheria-tetanus-pertussis-Haemophilus influenzae type b (DTPH) vaccines (25 mug mercury per administration) were given to children in the same childhood vaccination schedule at 2, 4, 6, and 15-18 mo, so that children receiving DTP and Hib vaccines may have maximally received an additional 100 mug more mercury exposure from TCVs than children administered DTPH vaccines. A case-control epidemiological study of neurodevelopmental disorders (NDs) reported to the Vaccine Adverse Event Reporting System (VAERS) (online public access version; updated 31 August 2004) following administration of DTP vaccines in comparison DTPH vaccines manufactured by Lederle Laboratories (Pearl River, NY) from 1994 through 1998 was undertaken. Significantly increased odds ratios for autism, speech disorders, mental retardation, infantile spasms, and thinking abnormalities reported to VAERS were found following DTP vaccines in comparison to DTPH vaccines with minimal bias or systematic error. Additional ND research should be undertaken in the context of evaluating mercury-associated exposures, especially since in 2005 the Institute of Medicine issued a report calling into question handling of vaccine safety data by the National Immunization Program of the Centers for Disease Control and Prevention. PMID:16766480

  3. Nuclear-structure dependence of O (. alpha. ) corrections to Fermi decays and the value of the Kobayashi-Maskawa matrix element V sub ud

    SciTech Connect

    Jaus, W.; Rasche, G. )

    1990-01-01

    We calculate nuclear-structure corrections to the {ital ft} values of the eight accurately measured superallowed {beta}{sup +} decays. The statistical fit for the average {ital ft} value is very good. The resulting new value for the matrix element of the Kobayashi-Maskawa (KM) matrix is {vert bar}{ital V}{sub {ital ud}}{vert bar}=0.9735(5). The error in {vert bar}{ital V}{sub {ital ud}}{vert bar} has thus been reduced by 50%. Combining this value for {vert bar}{ital V}{sub {ital ud}}{vert bar} with the presently accepted results from kaon-, hyperon-, and {ital B}-decay constraints, the unitarity of the KM matrix for three generations of quarks seems to be violated.

  4. Alpha-1 Antitrypsin Deficiency

    MedlinePlus

    ... Liver Disease Information > Alpha-1 Antitrypsin Deficiency Alpha-1 Antitrypsin Deficiency Explore this section to learn more about alpha-1 antitrypsin deficiency, including a description of the disorder ...

  5. Finite Element Method (FEM) Calculations of Stress-Strain Behavior of Alpha-Beta Ti-Mn Alloys: Part I. Stress-Strain Relations

    NASA Astrophysics Data System (ADS)

    Ankem, Sreeramamurthy; Margolin, Harold

    1982-04-01

    By use of a NASTRAN18 Computer Program, the Finite Element Method (FEM) has been employed to calculate the effect of particle size, matrix, and volume fraction on the stress-strain relations of α -β titanium alloys. It was found that for a given volume fraction, the calculated stress-strain curve was higher for a finer particle size than for a coarse particle size within the range of the strains considered, and this behavior was seen for all the different volume fraction alloys considered. For a 50:50 vol pct α -β alloy, the stress-strain curve with β, the stronger phase, as the matrix was higher than that with α, the softer phase, as the matrix. The calculated stress-strain curves for four different vol pct α alloys were compared with their corresponding experimental curves, and in general, good agreement was found. Whenever there were discrepancies, they were discussed by comparing the morphology of the mesh used in the calculations with the morphology of the actual materials.

  6. Protein and DNA elements involved in transactivation of the promoter of the bovine herpesvirus (BHV) 1 IE-1 transcription unit by the BHV alpha gene trans-inducing factor.

    PubMed Central

    Misra, V; Bratanich, A C; Carpenter, D; O'Hare, P

    1994-01-01

    In herpes simplex virus (HSV)-infected cells, the transcription of immediate-early (alpha) genes is regulated by a virion component, the alpha gene trans-inducing factor (alpha TIF). This protein forms a complex with cellular factors and TAATGARAT motifs present in one or more copies in the promoters of all alpha genes. We have characterized the bovine herpesvirus 1 (BHV-1) homolog of this protein. Like its HSV counterpart, the BHV alpha TIF was synthesized in the later stages of infection and could be demonstrated to be a component of purified virions. In transient expression assays, BHV alpha TIF was a strong transactivator and stimulated the activity of IE-1, the major BHV-1 alpha gene promoter, with an efficiency comparable to that of HSV alpha TIF. This stimulation was largely dependent on a TAATGAGCT sequence present in a single copy in IE-1, and BHV alpha TIF, in conjunction with cellular factors, formed a complex with oligonucleotides containing this sequence. Despite these similarities between the two alpha TIFs, our preliminary observations suggest that the proteins may activate transcription by different mechanisms. Although BHV alpha TIF strongly transactivated IE-1, it differed from its HSV counterpart in that the carboxyl terminus of BHV alpha TIF, when fused to the DNA-binding domain of GAL4, was a relatively poor stimulator of a promoter containing GAL4-binding sites. Also unlike HSV alpha TIF, removal of the carboxyl terminus of BHV alpha TIF reduced but did not eliminate the ability of the protein to transactivate IE-1. These results are discussed in view of the structural similarities and differences among the alpha TIFs of alphaherpes-viruses. Images PMID:8035488

  7. Persistence of antibodies in 4-8 year old Austrian children after vaccination with hexavalent DTaP-HBV-IPV/Hib and MMR vaccines.

    PubMed

    Paulke-Korinek, Maria; Fischmeister, Gustav; Grac, Ana; Rendi-Wagner, Pamela; Kundi, Michael; Mohsenzadeh-Rabbani, Afsaneh; Moritz, Katharina; Fenninger, Beate; Jarisch, Reinhart; Jasinska, Joanna; Holzmann, Heidemarie; Wiedermann, Ursula; Kollaritsch, Herwig

    2011-07-18

    To determine the proficiency of the Austrian childhood vaccination schedule to induce long lasting seroprotection against vaccine preventable diseases a seroepidemiological study in 348 children between four and eight years of age was conducted. Antibodies against diphtheria, tetanus, pertussis, hepatitis B, measles, mumps and rubella antigens were assessed in children, who had been vaccinated with hexavalent DTaP-HBV-IPV/Hib vaccines at three, four, five months and in the second year of life and/or MMR vaccines in the second year of life at least once, but mostly twice. High seroprotection rates (SPRs) were detected for tetanus (96%) and measles (90%). SPRs regarding diphtheria and mumps were 81% and 72%, respectively. Rubella-SPRs were 68% in females and 58% in males. Hepatitis B-antibody levels ≥10 mIU/mL were present in 52%; antibodies against pertussis were detected in 27% of the children. SPRs for measles and rubella depended on the interval since last vaccination; mumps-antibodies were significantly lower after one MMR-vaccination only. Antibodies against diphtheria, tetanus and pertussis depended on the interval since last vaccination while HBs-antibodies did not. The low levels of antibodies 1-7 years after vaccination against pertussis, rubella and mumps after only one vaccination should be considered when recommending new vaccination schedules.

  8. Safety, immune lot-to-lot consistency and non-inferiority of a fully liquid pentavalent DTwp-HepB-Hib vaccine in healthy Indian toddlers and infants

    PubMed Central

    Gandhi, Dulari J.; Dhaded, Sangappa M.; Ravi, Mandyam D.; Dubey, Anand P.; Kundu, Ritabrata; Lalwani, Sanjay K.; Chhatwal, Jugesh; Mathew, Leni G.; Gupta, Madhu; Sharma, Shiv D.; Bavdekar, Sandeep B.; Jayanth, Midde V.; Ravinuthala, Suresh; Sil, Arijit; Dhingra, Mandeep S.

    2016-01-01

    ABSTRACT Pentavalent combination vaccines are important tools to strengthen the immunization programs in numerous countries throughout the world. A large number of countries have recognized the value of combination vaccines and have introduced whole cell pentavalent vaccines into their immunization programs. A phase III, multi-center, randomized, single blinded study of a fully liquid pentavalent DTwP-HepB-Hib investigational vaccine (Shan5™) was conducted across India in 2 cohorts: 15 toddlers were evaluated for safety and immunogenicity following a single booster dose (Cohort 1) followed by 1085 infants (Cohort 2) evaluated for immunogenicity and safety following 3-dose primary immunization of the investigational vaccine or a locally licensed comparator vaccine (Pentavac SD). Immune consistency analysis among 3 lots of the investigational vaccine, and immune non-inferiority analysis of pooled (3 lots) data of investigational vaccine vs. comparator vaccine were carried out in cohort 2. The vaccines demonstrated comparable safety and immune responses in cohort 1. In cohort 2, equivalent immune consistency among 3 lots was observed for all antigens except whole cell pertussis antigens, where a marginal variation was observed which was linked to the low power of the test and concluded to not have any clinical significance. Immune non-inferiority against the comparator vaccine was demonstrated for all 5 antigens. Safety results were comparable between vaccine groups. This investigational, fully-liquid, whole-cell pertussis (wP) containing new pentavalent vaccine was found to be safe and immunologically non-inferior to the licensed comparator vaccine. PMID:26580093

  9. Bezafibrate at clinically relevant doses decreases serum/liver triglycerides via down-regulation of sterol regulatory element-binding protein-1c in mice: a novel peroxisome proliferator-activated receptor alpha-independent mechanism.

    PubMed

    Nakajima, Takero; Tanaka, Naoki; Kanbe, Hiroki; Hara, Atsushi; Kamijo, Yuji; Zhang, Xiaowei; Gonzalez, Frank J; Aoyama, Toshifumi

    2009-04-01

    The triglyceride-lowering effect of bezafibrate in humans has been attributed to peroxisome proliferator-activated receptor (PPAR) alpha activation based on results from rodent studies. However, the bezafibrate dosages used in conventional rodent experiments are typically higher than those in clinical use (> or =50 versus < or =10 mg/kg/day), and thus it remains unclear whether such data can be translated to humans. Furthermore, because bezafibrate is a pan-PPAR activator, the actual contribution of PPARalpha to its triglyceride-lowering properties remains undetermined. To address these issues, bezafibrate at clinically relevant doses (10 mg/kg/day; low) was administered to wild-type and Ppara-null mice, and its effects were compared with those from conventionally used doses (100 mg/kg/day; high). Pharmacokinetic analyses showed that maximum plasma concentration and area under the concentration-time curve in bezafibrate-treated mice were similar to those in humans at low doses, but not at high doses. Low-dose bezafibrate decreased serum/liver triglycerides in a PPARalpha-independent manner by attenuation of hepatic lipogenesis and triglyceride secretion. It is noteworthy that instead of PPAR activation, down-regulation of sterol regulatory element-binding protein (SREBP)-1c was observed in mice undergoing low-dose treatment. High-dose bezafibrate decreased serum/liver triglycerides by enhancement of hepatic fatty acid uptake and beta-oxidation via PPARalpha activation, as expected. In conclusion, clinically relevant doses of bezafibrate exert a triglyceride-lowering effect by suppression of the SREBP-1c-regulated pathway in mice and not by PPARalpha activation. Our results may provide novel information about the pharmacological mechanism of bezafibrate action and new insights into the treatment of disorders involving SREBP-1c. PMID:19124612

  10. Alpha-1 Antitrypsin Deficiency

    MedlinePlus

    ... from the NHLBI on Twitter. What Is Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (an-tee-TRIP-sin) deficiency, or AAT ... as it relates to lung disease. Overview Alpha-1 antitrypsin, also called AAT, is a protein made ...

  11. A Rainbow of Martian Elements

    NASA Technical Reports Server (NTRS)

    2004-01-01

    This graph or spectrum taken by the alpha particle X-ray spectrometer onboard the Mars Exploration Rover Spirit shows the variety of elements present in the soil at the rover's landing site. In agreement with past missions to Mars, iron and silicon make up the majority of the martian soil. Sulfur and chlorine were also observed as expected. Trace elements detected for the first time include zinc and nickel. These latter observations demonstrate the power of the alpha particle X-ray spectrometer to pick up the signatures of elements too faint to be seen before. The alpha particle X-ray spectrometer uses alpha particles and X-rays to measure the presence and abundance of all major rock-forming elements except hydrogen.

  12. Ab initio alpha-alpha scattering.

    PubMed

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  13. Ab initio alpha-alpha scattering.

    PubMed

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G

    2015-12-01

    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  14. alpha-Hexachlorocyclohexane (alpha-HCH)

    Integrated Risk Information System (IRIS)

    alpha - Hexachlorocyclohexane ( alpha - HCH ) ; CASRN 319 - 84 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Ass

  15. Alpha-1 Antitrypsin Test

    MedlinePlus

    ... measures the level of the protein AAT in blood. Alpha-1 antitrypsin phenotype testing evaluates the amount and type of AAT being produced and compares it to normal patterns. Alpha-1 antitrypsin genotype testing ( DNA testing) can ...

  16. Alpha-1 antitrypsin test

    MedlinePlus

    ... page: //medlineplus.gov/ency/article/003715.htm Alpha-1 antitrypsin test To use the sharing features on this page, please enable JavaScript. Alpha-1 antitrypsin is a laboratory test to measure the ...

  17. The Alpha Centauri System.

    ERIC Educational Resources Information Center

    Soderblom, David R.

    1987-01-01

    Describes the Alpha Centauri star system, which is the closest star system to the sun. Discusses the difficulties associated with measurements involving Alpha Centauri, along with some of the recent advances in stellar seismology. Raises questions about the possibilities of planets around Alpha Centauri. (TW)

  18. Discovery of element 112

    SciTech Connect

    Hofmann, S.

    1996-12-31

    The new elements 110, 111, and 112 were synthesized and unambiguously identified in experiments at SHIP. Due to strong shell effects the dominant decay mode is not fission, but emission of alpha particles. Theoretical investigations predict that maximum shell effects should exist in nuclei near proton number 114 and neutron number 184. Measurements give hope that isotopes of element 114 close to the island of spherical Superheavy Elements could be produced by fusion reactions using {sup 118}Pb as target. systematic studies of the reaction cross-sections indicate that transfer of nucleons is the important process to initiate the fusion.

  19. alpha-decay half-lives and Q{sub a}lpha values of superheavy nuclei

    SciTech Connect

    Dong Jianmin; Zuo Wei; Gu Jianzhong; Wang Yanzhao; Peng Bangbao

    2010-06-15

    The alpha-decay half-lives of recently synthesized superheavy nuclei (SHN) are investigated by employing a unified fission model (UFM) where a new method to calculate the assault frequency of alpha emission is used. The excellent agreement with the experimental data indicates the UFM is a useful tool to investigate these alpha decays. It is found that the alpha-decay half-lives become more and more insensitive to the Q{sub a}lpha values as the atomic number increases on the whole, which is favorable for us to predict the half-lives of SHN. In addition, a formula is proposed to compute the Q{sub a}lpha values for the nuclei with Z>=92 and N>=140 with a good accuracy, according to which the long-lived SHN should be neutron rich. Several weeks ago, two isotopes of a new element with atomic number Z=117 were synthesized and their alpha-decay chains have been observed. The Q{sub a}lpha formula is found to work well for these nuclei, confirming its predictive power. The experimental half-lives are well reproduced by employing the UFM with the experimental Q{sub a}lpha values. This fact that the experimental half-lives are compatible with experimental Q{sub a}lpha values supports the synthesis of a new element 117 and the experimental measurements to a certain extent.

  20. Alternate Alpha Induced Reactions for NIF Radiochemistry

    SciTech Connect

    Shaughnessy, D A; Moody, K J; Bernstein, L A

    2010-02-26

    Radiochemical analysis of NIF capsule residues has been identified as a potential diagnostic of NIF capsule performance. In particular, alpha-induced nuclear reactions that occur on tracer elements added to the NIF capsule have been shown through simulation to be a very sensitive diagnostic for mix. The short range of the alpha particles makes them representative of the hot spot where they are created through the fusion of deuterium and tritium. Reactions on elements doped into the innermost part of the capsule ablator would therefore be sensitive to material that had mixed into the hot spot. Radiochemical determinations of activated detector elements may perhaps be the only true measure of mix that occurs in a NIF capsule, particularly in cases when the capsule fails.

  1. Determination of Alpha

    NASA Astrophysics Data System (ADS)

    Chmeissani, Mokhtar Abdallah

    The determination of the strong coupling constant alpha_ s, using Energy-Energy Correlation Asymmetry and jet mass difference with Mark II data at SLC (91 GeV) is presented. In Energy-Energy Correlation Asymmetry (EECA), we used the same systematic procedure used to determine alpha_ s with MARK II data at PEP (29 GeV). The chi^2 fit suggests that alpha_ s = 0.119 +/- 0.007(stat.) +/- 0.007(syst.). In addition, we used the EECA method to determine the QCD scale parameter Lambda_{LLA}. The chi^2 fit suggests that Lambda _{LLA} = 420 +/- 90(stat.) MeV. In the jet mass difference method, the determination of alpha_ s is based on QCD calculations up to 2nd order. We showed that in this method we are able to reproduce the value of alpha _ s from a Monte Carlo sample to a very high accuracy. The result with this method is alpha _ s = 0.134 +/- 0.085(stat.) +/- 0.004(syst.). The two values of alpha_ s presented in this work are in agreement within the error bars and in a good agreement with recent results of alpha_ s published from other e^+e^- experiments.

  2. Event counting alpha detector

    DOEpatents

    Bolton, R.D.; MacArthur, D.W.

    1996-08-27

    An electrostatic detector is disclosed for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure. 6 figs.

  3. Event counting alpha detector

    DOEpatents

    Bolton, Richard D.; MacArthur, Duncan W.

    1996-01-01

    An electrostatic detector for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure.

  4. Imaging alpha particle detector

    DOEpatents

    Anderson, D.F.

    1980-10-29

    A method and apparatus for detecting and imaging alpha particles sources is described. A dielectric coated high voltage electrode and a tungsten wire grid constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source to be quantitatively or qualitatively analyzed. A thin polyester film window allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  5. Imaging alpha particle detector

    DOEpatents

    Anderson, David F.

    1985-01-01

    A method and apparatus for detecting and imaging alpha particles sources is described. A conducting coated high voltage electrode (1) and a tungsten wire grid (2) constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source (3) to be quantitatively or qualitatively analyzed. A thin polyester film window (4) allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  6. Entropy-Alpha Classification Alternative for Polarimetric SAR Image

    NASA Astrophysics Data System (ADS)

    Praks, J.; Hallikainen, M.

    2003-04-01

    In this work we discuss SAR target entropy and alpha angle relations to other scattering covariance matrix characteristics and similarity invariants. It is shown that the sum of squared elements of the coherency matrix, normalized by its trace and determinant, has many common features with target entropy parameter. The first element of the matrix is very similar to alpha angle parameter describing scattering mechanism. Possibilities to use the sum of squared elements, determinant and first element of normalized coherency matrix for classification are studied. It appears that classification schemes very similar to entropy-alpha can be established. However, classification results differ slightly from those of entropy-alpha classification as here discussed two-parameter classifications depend on three variables, although parameters are in all cases the same. As an example, NASA/JPL AIRSAR L-Band image of the San Francisco Bay was classified with both proposed schemes and original entropy-alpha classification. The size of the used image was 224 x 256 pixels. The new algorithms classified 97% and 96%, respectively, of pixels to the same classes as entropy-alpha classification. The discussed similarity invariants are straightforward to calculate and they have been used to describe covariance matrix properties in statistics. Virtually are proposed classification algorithms equivalent with entropy-alpha classification because all three use the same amount of information from covariance matrix. However, proposed parameter pairs are much easier to calculate, as they do not require the computation of eigenvalues and eigenvectors.

  7. The alpha channeling effect

    SciTech Connect

    Fisch, N. J.

    2015-12-10

    Alpha particles born through fusion reactions in a tokamak reactor tend to slow down on electrons, but that could take up to hundreds of milliseconds. Before that happens, the energy in these alpha particles can destabilize on collisionless timescales toroidal Alfven modes and other waves, in a way deleterious to energy confinement. However, it has been speculated that this energy might be instead be channeled into useful energy, so as to heat fuel ions or to drive current. Such a channeling needs to be catalyzed by waves Waves can produce diffusion in energy of the alpha particles in a way that is strictly coupled to diffusion in space. If these diffusion paths in energy-position space point from high energy in the center to low energy on the periphery, then alpha particles will be cooled while forced to the periphery. The energy from the alpha particles is absorbed by the wave. The amplified wave can then heat ions or drive current. This process or paradigm for extracting alpha particle energy collisionlessly has been called alpha channeling. While the effect is speculative, the upside potential for economical fusion is immense. The paradigm also operates more generally in other contexts of magnetically confined plasma.

  8. Proceedings of transuranium elements

    SciTech Connect

    Not Available

    1992-01-01

    The identification of the first synthetic elements was established by chemical evidence. Conclusive proof of the synthesis of the first artificial element, technetium, was published in 1937 by Perrier and Segre. An essential aspect of their achievement was the prediction of the chemical properties of element 43, which had been missing from the periodic table and which was expected to have properties similar to those of manganese and rhenium. The discovery of other artificial elements, astatine and francium, was facilitated in 1939-1940 by the prediction of their chemical properties. A little more than 50 years ago, in the spring of 1940, Edwin McMillan and Philip Abelson synthesized element 93, neptunium, and confirmed its uniqueness by chemical means. On August 30, 1940, Glenn Seaborg, Arthur Wahl, and the late Joseph Kennedy began their neutron irradiations of uranium nitrate hexahydrate. A few months later they synthesized element 94, later named plutonium, by observing the alpha particles emitted from uranium oxide targets that had been bombarded with deuterons. Shortly thereafter they proved that is was the second transuranium element by establishing its unique oxidation-reduction behavior. The symposium honored the scientists and engineers whose vision and dedication led to the discovery of the transuranium elements and to the understanding of the influence of 5f electrons on their electronic structure and bonding. This volume represents a record of papers presented at the symposium.

  9. ON THE ORIGINS OF THE DIFFUSE H{alpha} EMISSION: IONIZED GAS OR DUST-SCATTERED H{alpha} HALOS?

    SciTech Connect

    Seon, Kwang-Il; Witt, Adolf N.

    2012-10-20

    It is known that the diffuse H{alpha} emission outside of bright H II regions not only are very extended, but also can occur in distinct patches or filaments far from H II regions, and the line ratios of [S II] {lambda}6716/H{alpha} and [N II] {lambda}6583/H{alpha} observed far from bright H II regions are generally higher than those in the H II regions. These observations have been regarded as evidence against the dust-scattering origin of the diffuse H{alpha} emission (including other optical lines), and the effect of dust scattering has been neglected in studies on the diffuse H{alpha} emission. In this paper, we reexamine the arguments against dust scattering and find that the dust-scattering origin of the diffuse H{alpha} emission cannot be ruled out. As opposed to the previous contention, the expected dust-scattered H{alpha} halos surrounding H II regions are, in fact, in good agreement with the observed H{alpha} morphology. We calculate an extensive set of photoionization models by varying elemental abundances, ionizing stellar types, and clumpiness of the interstellar medium (ISM) and find that the observed line ratios of [S II]/H{alpha}, [N II]/H{alpha}, and He I {lambda}5876/H{alpha} in the diffuse ISM accord well with the dust-scattered halos around H II regions, which are photoionized by late O- and/or early B-type stars. We also demonstrate that the H{alpha} absorption feature in the underlying continuum from the dust-scattered starlight ({sup d}iffuse galactic light{sup )} and unresolved stars is able to substantially increase the [S II]/H{alpha} and [N II]/H{alpha} line ratios in the diffuse ISM.

  10. Cobalt inhibits the interaction between hypoxia-inducible factor-alpha and von Hippel-Lindau protein by direct binding to hypoxia-inducible factor-alpha.

    PubMed

    Yuan, Yong; Hilliard, George; Ferguson, Tsuneo; Millhorn, David E

    2003-05-01

    The hypoxia-inducible factor (HIF) activates the expression of genes that contain a hypoxia response element. The alpha-subunits of the HIF transcription factors are degraded by proteasomal pathways during normoxia but are stabilized under hypoxic conditions. The von Hippel-Lindau protein (pVHL) mediates the ubiquitination and rapid degradation of HIF-alpha (including HIF-1alpha and HIF-2alpha). Post-translational hydroxylation of a proline residue in the oxygen-dependent degradation (ODD) domain of HIF-alpha is required for the interaction between HIF and VHL. It has previously been established that cobalt mimics hypoxia and causes accumulation of HIF-1alpha and HIF-2alpha. However, little is known about the mechanism by which this occurs. In an earlier study, we demonstrated that cobalt binds directly to the ODD domain of HIF-2alpha. Here we provide the first evidence that cobalt inhibits pVHL binding to HIF-alpha even when HIF-alpha is hydroxylated. Deletion of 17 amino acids within the ODD domain of HIF-2alpha that are required for pVHL binding prevented the binding of cobalt and stabilized HIF-2alpha during normoxia. These findings show that cobalt mimics hypoxia, at least in part, by occupying the VHL-binding domain of HIF-alpha and thereby preventing the degradation of HIF-alpha. PMID:12606543

  11. Alpha One Foundation

    MedlinePlus

    ... related programs More News Our Number One Goal: Find a cure for Alpha-1. Website Sponsors Helpful Links 3300 Ponce de Leon Blvd. Coral Gables, FL 33134 Phone: (877) 228-7321 Email: info@alphaone.org Copyright ...

  12. Alpha Particle Diagnostic

    SciTech Connect

    Fisher, Ray, K.

    2009-05-13

    The study of burning plasmas is the next frontier in fusion energy research, and will be a major objective of the U.S. fusion program through U.S. collaboration with our international partners on the ITER Project. For DT magnetic fusion to be useful for energy production, it is essential that the energetic alpha particles produced by the fusion reactions be confined long enough to deposit a significant fraction of their initial ~3.5 MeV energy in the plasma before they are lost. Development of diagnostics to study the behavior of energetic confined alpha particles is a very important if not essential part of burning plasma research. Despite the clear need for these measurements, development of diagnostics to study confined the fast confined alphas to date has proven extremely difficult, and the available techniques remain for the most part unproven and with significant uncertainties. Research under this grant had the goal of developing diagnostics of fast confined alphas, primarily based on measurements of the neutron and ion tails resulting from alpha particle knock-on collisions with the plasma deuterium and tritium fuel ions. One of the strengths of this approach is the ability to measure the alphas in the hot plasma core where the interesting ignition physics will occur.

  13. Cancer radioimmunotherapy with alpha-emitting nuclides.

    PubMed

    Couturier, Olivier; Supiot, Stéphane; Degraef-Mougin, Marie; Faivre-Chauvet, Alain; Carlier, Thomas; Chatal, Jean-François; Davodeau, François; Cherel, Michel

    2005-05-01

    In lymphoid malignancies and in certain solid cancers such as medullary thyroid carcinoma, somewhat mixed success has been achieved when applying radioimmunotherapy (RIT) with beta-emitters for the treatment of refractory cases. The development of novel RIT with alpha-emitters has created new opportunities and theoretical advantages due to the high linear energy transfer (LET) and the short path length in biological tissue of alpha-particles. These physical properties offer the prospect of achieving selective tumoural cell killing. Thus, RIT with alpha-emitters appears particularly suited for the elimination of circulating single cells or cell clusters or for the treatment of micrometastases at an early stage. However, to avoid non-specific irradiation of healthy tissues, it is necessary to identify accessible tumoural targets easily and rapidly. For this purpose, a small number of alpha-emitters have been investigated, among which only a few have been used for in vivo preclinical studies. Another problem is the availability and cost of these radionuclides; for instance, the low cost and the development of a reliable actinium-225/bismuth-213 generator were probably determining elements in the choice of bismuth-213 in the only human trial of RIT with an alpha-emitter. This article reviews the literature concerning monoclonal antibodies radiolabelled with alpha-emitters that have been developed for possible RIT in cancer patients. The principal radio-immunoconjugates are considered, starting with physical and chemical properties of alpha-emitters, their mode of production, the possibilities and difficulties of labelling, in vitro studies and finally, when available, in vivo preclinical and clinical studies. PMID:15841373

  14. Summary of alpha-neutron sources in GADRAS.

    SciTech Connect

    Mitchell, Dean James; Thoreson, Gregory G.; Harding, Lee T.

    2012-05-01

    A common source of neutrons for calibration and testing is alpha-neutron material, named for the alpha-neutron nuclear reaction that occurs within. This material contains a long-lived alpha-emitter and a lighter target element. When the alpha particle from the emitter is absorbed by the target, neutrons and gamma rays are released. Gamma Detector Response and Analysis Software (GADRAS) includes built-in alpha-neutron source definitions for AcC, AmB, AmBe, AmF, AmLi, CmC, and PuC. In addition, GADRAS users may create their own alpha-neutron sources by placing valid alpha-emitters and target elements in materials within their one-dimensional models (1DModel). GADRAS has the ability to use pre-built alpha-neutron sources for plotting or as trace-sources in 1D models. In addition, if any material (existing or user-defined) specified in a 1D model contains both an alpha emitter in conjunction with a target nuclide, or there is an interface between such materials, then the appropriate neutron-emission rate from the alpha-neutron reaction will be computed. The gamma-emissions from these sources are also computed, but are limited to a subset of nine target nuclides. If a user has experimental data to contribute to the alpha-neutron gamma emission database, it may be added directly or submitted to the GADRAS developers for inclusion. The gadras.exe.config file will be replaced when GADRAS updates are installed, so sending the information to the GADRAS developers is the preferred method for updating the database. This is also preferable because it enables other users to benefit from your efforts.

  15. It's elemental

    NASA Astrophysics Data System (ADS)

    The Periodic Table of the elements will now have to be updated. An international team of researchers has added element 110 to the Earth's armory of elements. Though short-lived—of the order of microseconds, element 110 bottoms out the list as the heaviest known element on the planet. Scientists at the Heavy Ion Research Center in Darmstadt, Germany, made the 110-proton element by colliding a lead isotope with nickel atoms. The element, which is yet to be named, has an atomic mass of 269.

  16. ALPHA MIS: Reference manual

    SciTech Connect

    Lovin, J.K.; Haese, R.L.; Heatherly, R.D.; Hughes, S.E.; Ishee, J.S.; Pratt, S.M.; Smith, D.W.

    1992-02-01

    ALPHA is a powerful and versatile management information system (MIS) initiated and sponsored and by the Finance and Business Management Division of Oak Ridge National Laboratory, who maintain and develop it in concert with the Business Systems Division for its Information Center. A general-purpose MIS, ALPHA allows users to access System 1022 and System 1032 databases to obtain and manage information. From a personal computer or a data terminal, Energy Systems employees can use ALPHA to control their own report reprocessing. Using four general commands (Database, Select, Sort, and Report) they can (1) choose a mainframe database, (2) define subsets within it, (3) sequentially order a subset by one or more variables, and (4) generate a report with their own or a canned format.

  17. Portable alpha spectrometer.

    PubMed

    Martín Sánchez, A; de la Torre Pérez, J

    2012-09-01

    Many portable devices have been designed to detect γ-rays or alpha and beta particles. Most of the α-particle detectors give the total count as a result, without identifying the radionuclides existing in the sample. The development of a device allowing rapid and straightforward α-particle spectrometry would be very useful for detecting the radioactive contents of unknown samples. This work describes the construction of a portable device using silicon semiconductor detectors designed to rapidly detect and possibly identify alpha-emitting radionuclides.

  18. The Apollo Alpha Spectrometer.

    NASA Technical Reports Server (NTRS)

    Jagoda, N.; Kubierschky, K.; Frank, R.; Carroll, J.

    1973-01-01

    Located in the Science Instrument Module of Apollo 15 and 16, the Alpha Particle Spectrometer was designed to detect and measure the energy of alpha particles emitted by the radon isotopes and their daughter products. The spectrometer sensor consisted of an array of totally depleted silicon surface barrier detectors. Biased amplifier and linear gate techniques were utilized to reduce resolution degradation, thereby permitting the use of a single 512 channel PHA. Sensor identification and in-flight radioactive calibration were incorporated to enhance data reduction.

  19. [alpha]-Oxocarboxylic Acids

    ERIC Educational Resources Information Center

    Kerber, Robert C.; Fernando, Marian S.

    2010-01-01

    Several [alpha]-oxocarboxylic acids play key roles in metabolism in plants and animals. However, there are inconsistencies between the structures as commonly portrayed and the reported acid ionization constants, which result because the acids are predominantly hydrated in aqueous solution; that is, the predominant form is RC(OH)[subscript 2]COOH…

  20. From Alpha to Omega

    ERIC Educational Resources Information Center

    Czaja, Paul Clement

    2006-01-01

    The Alpha point of the authors' life as a Montessori educator began in 1959, when he was a graduate student studying philosophy at Fordham University in the Bronx, New York. While studying the works of the great American philosopher William James, the author came across the writings of Maria Montessori and immediately became captivated by her…

  1. Elemental ZOO

    NASA Astrophysics Data System (ADS)

    Helser, Terry L.

    2003-04-01

    This puzzle uses the symbols of 39 elements to spell the names of 25 animals found in zoos. Underlined spaces and the names of the elements serve as clues. To solve the puzzle, students must find the symbols that correspond to the elemental names and rearrange them into the animals' names.

  2. Summary of Alpha Particle Transport

    SciTech Connect

    Medley, S.S.; White, R.B.; Zweben, S.J.

    1998-08-19

    This paper summarizes the talks on alpha particle transport which were presented at the 5th International Atomic Energy Agency's Technical Committee Meeting on "Alpha Particles in Fusion Research" held at the Joint European Torus, England in September 1997.

  3. Repression of the murine interferon alpha 11 gene: identification of negatively acting sequences.

    PubMed Central

    Civas, A; Dion, M; Vodjdani, G; Doly, J

    1991-01-01

    The uninducible murine interferon alpha 11 gene (Mu IFN-alpha 11) shows strong homology with the highly inducible Mu IFN-alpha 4 gene in the promoter region. Negative regulatory sequences located between positions -470 and -145 were characterized in the Mu IFN-alpha 11 promoter. The removal of these sequences leads to virus-inducibility of Mu IFN-alpha 11 while their insertion in Mu IFN-alpha 4 corresponding region significantly reduced the inducibility of Mu IFN-alpha 4 promoter. On the other hand, the virus-responsive element (VRE) of the Mu IFN-alpha 11 differs by a single nucleotide substitution at position -78 from the VRE alpha 4. Constructions carrying either VRE alpha 11 or VRE alpha 4 upstream a heterologous promoter displayed different virus inducibilities. The -78 A/G substitution affects the inducibility by decreasing the affinity of VRE-binding trans-regulators. Our results suggest that the combined effect of the negative regulatory sequences and of the mutation in the VRE alpha 11, completely silences the Mu IFN-alpha 11 gene. PMID:1886773

  4. {alpha}-Decay half-lives, {alpha}-capture, and {alpha}-nucleus potential

    SciTech Connect

    Denisov, V. Yu. Khudenko, A.A.

    2009-11-15

    {alpha}-Decay half-lives and {alpha}-capture cross sections are evaluated in the framework of a unified model for {alpha}-decay and {alpha}-capture. In this model {alpha}-decay and {alpha}-capture are considered as penetration of the {alpha}-particle through the potential barrier formed by the nuclear, Coulomb, and centrifugal interactions between the {alpha}-particle and nucleus. The spins and parities of the parent and daughter nuclei as well as the quadrupole and hexadecapole deformations of the daughter nuclei are taken into account for evaluation of the {alpha}-decay half-lives. The {alpha}-decay half-lives for 344 nuclei and the {alpha}-capture cross sections of {sup 40}Ca, {sup 44}Ca, {sup 59}Co, {sup 208}Pb, and {sup 209}Bi agree well with the experimental data. The evaluated {alpha}-decay half-lives within the range of 10{sup -9}{<=}T{sub 1/2}{<=}10{sup 38} s for 1246 {alpha}-emitters are tabulated.

  5. New elements produced at GSI

    SciTech Connect

    Hofmann, Sigurd

    1998-12-21

    In two series of experiments at SHIP, six new elements (Z=107-112) were synthesized via fusion reactions using lead or bismuth targets and 1n-deexcitation channels. The isotopes were unambiguously identified by means of {alpha}-{alpha} correlations. Not fission, but alpha decay is the dominant decay mode. Cross-sections decrease by two orders of magnitude from bohrium (Z=107) to element 112, for which a cross-section of 1 pb was measured. Based on our results, it is likely that the production of isotopes of element 114 close to the island of spherical SuperHeavy Elements (SHE) could be achieved by fusion reactions using {sup 208}Pb targets. Systematic studies of the reaction cross-sections indicate that the transfer of nucleons is an important process for the initiation of fusion. The data allow for the fixing of a narrow energy window for the production of SHE using 1n-emission channels. The likelihood of broadening the energy window by investigation of radiative capture reactions, use of neutron deficient projectile isotopes and use of actinide targets is discussed.

  6. Superheavy Elements - Achievements and Challenges

    SciTech Connect

    Ackermann, Dieter

    2009-03-04

    The search for superheavy elements (SHE) has yielded exciting results for both the 'cold fusion' approach with reactions employing Pb and Bi targets and the ''hot fusion'' reactions with {sup 48}Ca beams on actinide targets. The most recent activities at GSI were the successful production of a more neutron rich isotope of element 112 in the reaction {sup 48}Ca+{sup 238}U confirming earlier result from FLNR, and the attempt to synthesize an isotope with Z 120 in the reaction {sup 64}Ni+{sup 238}U. Apart from the synthesis of new elements, advanced nuclear structure studies for heavy and super heavy elements promise a detailed insight in the properties of nuclear matter under the extreme conditions of high Z and A. The means are evaporation residue(ER)-{alpha}-{alpha} and -{alpha}-{gamma} coincidence techniques applied after separation of the reaction products from the beam. Recent examples of interesting physics to be discovered in this region of the chart of nuclides are the investigation of K-isomers observed for {sup 252,254}No and indicated for {sup 270}Ds. Fast chemistry and precision mass measurements deliver in addition valuable information on the fundamental properties of the SHE.

  7. Simultaneous quantification of GABAergic 3alpha,5alpha/3alpha,5beta neuroactive steroids in human and rat serum.

    PubMed

    Porcu, Patrizia; O'Buckley, Todd K; Alward, Sarah E; Marx, Christine E; Shampine, Lawrence J; Girdler, Susan S; Morrow, A Leslie

    2009-01-01

    The 3alpha,5alpha- and 3alpha,5beta-reduced derivatives of progesterone, deoxycorticosterone, dehydroepiandrosterone and testosterone enhance GABAergic neurotransmission and produce inhibitory neurobehavioral and anti-inflammatory effects. Despite substantial information on the progesterone derivative (3alpha,5alpha)-3-hydroxypregnan-20-one (3alpha,5alpha-THP, allopregnanolone), the physiological significance of the other endogenous GABAergic neuroactive steroids has remained elusive. Here, we describe the validation of a method using gas chromatography-mass spectrometry to simultaneously identify serum levels of the eight 3alpha,5alpha- and 3alpha,5beta-reduced derivatives of progesterone, deoxycorticosterone, dehydroepiandrosterone and testosterone. The method shows specificity, sensitivity and enhanced throughput compared to other methods already available for neuroactive steroid quantification. Administration of pregnenolone to rats and progesterone to women produced selective effects on the 3alpha,5alpha- and 3alpha,5beta-reduced neuroactive steroids, indicating differential regulation of their biosynthetic pathways. Pregnenolone administration increased serum levels of 3alpha,5alpha-THP (+1488%, p<0.001), (3alpha,5alpha)-3,21-dihydroxypregnan-20-one (3alpha,5alpha-THDOC, +205%, p<0.01), (3alpha,5alpha)-3-hydroxyandrostan-17-one (3alpha,5alpha-A, +216%, p<0.001), (3alpha,5alpha,17beta)-androstane-3,17-diol (3alpha,5alpha-A-diol, +190%, p<0.01). (3alpha,5beta)-3-hydroxypregnan-20-one (3alpha,5beta-THP) and (3alpha,5beta)-3-hydroxyandrostan-17-one (3alpha,5beta-A) were not altered, while (3alpha,5beta)-3,21-dihydroxypregnan-20-one (3alpha,5beta-THDOC) and (3alpha,5beta,17beta)-androstane-3,17-diol (3alpha,5beta-A-diol) were increased from undetectable levels to 271+/-100 and 2.4+/-0.9 pg+/-SEM, respectively (5/8 rats). Progesterone administration increased serum levels of 3alpha,5alpha-THP (+1806%, p<0.0001), 3alpha,5beta-THP (+575%, p<0.001), 3alpha,5alpha

  8. Superheavy Element Synthesis And Nuclear Structure

    SciTech Connect

    Ackermann, D.; Block, M.; Burkhard, H.-G.; Heinz, S.; Hessberger, F. P.; Khuyagbaatar, J.; Kojouharov, I.; Mann, R.; Maurer, J.; Antalic, S.; Saro, S.; Venhart, M.; Hofmann, S.; Leino, M.; Uusitalo, J.; Nishio, K.; Popeko, A. G.; Yeremin, A. V.

    2009-08-26

    After the successful progress in experiments to synthesize superheavy elements (SHE) throughout the last decades, advanced nuclear structure studies in that region have become feasible in recent years thanks to improved accelerator, separation and detection technology. The means are evaporation residue(ER)-alpha-alpha and ER-alpha-gamma coincidence techniques complemented by conversion electron (CE) studies, applied after a separator. Recent examples of interesting physics to be discovered in this region of the chart of nuclides are the studies of K-isomers observed in {sup 252,254}No and in {sup 270}Ds.

  9. Chemical characterization of element 112.

    PubMed

    Eichler, R; Aksenov, N V; Belozerov, A V; Bozhikov, G A; Chepigin, V I; Dmitriev, S N; Dressler, R; Gäggeler, H W; Gorshkov, V A; Haenssler, F; Itkis, M G; Laube, A; Lebedev, V Ya; Malyshev, O N; Oganessian, Yu Ts; Petrushkin, O V; Piguet, D; Rasmussen, P; Shishkin, S V; Shutov, A V; Svirikhin, A I; Tereshatov, E E; Vostokin, G K; Wegrzecki, M; Yeremin, A V

    2007-05-01

    The heaviest elements to have been chemically characterized are seaborgium (element 106), bohrium (element 107) and hassium (element 108). All three behave according to their respective positions in groups 6, 7 and 8 of the periodic table, which arranges elements according to their outermost electrons and hence their chemical properties. However, the chemical characterization results are not trivial: relativistic effects on the electronic structure of the heaviest elements can strongly influence chemical properties. The next heavy element targeted for chemical characterization is element 112; its closed-shell electronic structure with a filled outer s orbital suggests that it may be particularly susceptible to strong deviations from the chemical property trends expected within group 12. Indeed, first experiments concluded that element 112 does not behave like its lighter homologue mercury. However, the production and identification methods used cast doubt on the validity of this result. Here we report a more reliable chemical characterization of element 112, involving the production of two atoms of (283)112 through the alpha decay of the short-lived (287)114 (which itself forms in the nuclear fusion reaction of 48Ca with 242Pu) and the adsorption of the two atoms on a gold surface. By directly comparing the adsorption characteristics of (283)112 to that of mercury and the noble gas radon, we find that element 112 is very volatile and, unlike radon, reveals a metallic interaction with the gold surface. These adsorption characteristics establish element 112 as a typical element of group 12, and its successful production unambiguously establishes the approach to the island of stability of superheavy elements through 48Ca-induced nuclear fusion reactions with actinides.

  10. Chemical characterization of element 112.

    PubMed

    Eichler, R; Aksenov, N V; Belozerov, A V; Bozhikov, G A; Chepigin, V I; Dmitriev, S N; Dressler, R; Gäggeler, H W; Gorshkov, V A; Haenssler, F; Itkis, M G; Laube, A; Lebedev, V Ya; Malyshev, O N; Oganessian, Yu Ts; Petrushkin, O V; Piguet, D; Rasmussen, P; Shishkin, S V; Shutov, A V; Svirikhin, A I; Tereshatov, E E; Vostokin, G K; Wegrzecki, M; Yeremin, A V

    2007-05-01

    The heaviest elements to have been chemically characterized are seaborgium (element 106), bohrium (element 107) and hassium (element 108). All three behave according to their respective positions in groups 6, 7 and 8 of the periodic table, which arranges elements according to their outermost electrons and hence their chemical properties. However, the chemical characterization results are not trivial: relativistic effects on the electronic structure of the heaviest elements can strongly influence chemical properties. The next heavy element targeted for chemical characterization is element 112; its closed-shell electronic structure with a filled outer s orbital suggests that it may be particularly susceptible to strong deviations from the chemical property trends expected within group 12. Indeed, first experiments concluded that element 112 does not behave like its lighter homologue mercury. However, the production and identification methods used cast doubt on the validity of this result. Here we report a more reliable chemical characterization of element 112, involving the production of two atoms of (283)112 through the alpha decay of the short-lived (287)114 (which itself forms in the nuclear fusion reaction of 48Ca with 242Pu) and the adsorption of the two atoms on a gold surface. By directly comparing the adsorption characteristics of (283)112 to that of mercury and the noble gas radon, we find that element 112 is very volatile and, unlike radon, reveals a metallic interaction with the gold surface. These adsorption characteristics establish element 112 as a typical element of group 12, and its successful production unambiguously establishes the approach to the island of stability of superheavy elements through 48Ca-induced nuclear fusion reactions with actinides. PMID:17476264

  11. A search for Lyman-alpha emission in beta Lyrae from Copernicus

    NASA Technical Reports Server (NTRS)

    Kondo, Y.; Mccluskey, G. E., Jr.

    1974-01-01

    High-resolution (0.2 A) spectrophotometric observations of the complex eclipsing binary beta Lyrae were obtained with the Princeton Telescope Spectrometer on the Copernicus satellite. We discuss the search for L-alpha emission in beta Lyrae and compare the Copernicus results with the OAO-2 observations of the same binary system. The possible L-alpha emission features observed from OAO-2 are identified as blends of the emission lines of other elements in the vicinity of L-alpha.

  12. A High-Throughput Screen for Alpha Particle Radiation Protectants

    PubMed Central

    Seideman, Jonathan H.; Shum, David; Djaballah, Hakim

    2010-01-01

    Abstract Alpha-particle-emitting elements are of increasing importance as environmental and occupational carcinogens, toxic components of radiation dispersal devices and accidents, and potent therapeutics in oncology. Alpha particle radiation differs from radiations of lower linear energy transfer in that it predominantly damages DNA via direct action. Because of this, radical scavengers effective for other radiations have had only limited effect in mitigating alpha particle toxicity. We describe here a simple assay and a pilot screen of 3,119 compounds in a high-throughput screen (HTS), using the alpha-particle-emitting isotope, 225Ac, for the discovery of compounds that might protect mammalian cells from alpha particles through novel mechanisms. The assay, which monitored the viability of a myeloid leukemic cell line upon alpha particle exposure, was robust and reproducible, yielding a Z' factor of 0.66 and a signal-to-noise ratio of nearly 10 to 1. Surprisingly, 1 compound emerged from this screen, epoxy-4,5-α-dihydroxysantonin (EDHS), that showed considerable protective activity. While the value of EDHS remains to be determined, its discovery is a proof of concept and validation of the utility of this HTS methodology. Further application of the described assay could yield compounds useful in minimizing the toxicity and carcinogenesis associated with alpha particle exposure. PMID:20658946

  13. IGFBP-3, hypoxia and TNF-{alpha} inhibit adiponectin transcription

    SciTech Connect

    Zappala, Giovanna; Rechler, Matthew M.

    2009-05-15

    The thiazolidinedione rosiglitazone, an agonist ligand for the nuclear receptor PPAR-{gamma}, improves insulin sensitivity in part by stimulating transcription of the insulin-sensitizing adipokine adiponectin. It activates PPAR-{gamma}-RXR-{alpha} heterodimers bound to PPAR-{gamma} response elements in the adiponectin promoter. Rosiglitazone-stimulated adiponectin protein synthesis in 3T3-L1 mouse adipocytes has been shown to be inhibited by IGFBP-3, which can be induced by hypoxia and the proinflammatory cytokine, TNF-{alpha}, two inhibitors of adiponectin transcription. The present study demonstrates that IGFBP-3, the hypoxia-mimetic agent cobalt chloride, and TNF-{alpha} inhibit rosiglitazone-induced adiponectin transcription in mouse embryo fibroblasts that stably express PPAR-{gamma}2. Native IGFBP-3 can bind RXR-{alpha} and inhibited rosiglitazone stimulated promoter activity, whereas an IGFBP-3 mutant that does not bind RXR-{alpha} did not. These results suggest that IGFBP-3 may mediate the inhibition of adiponectin transcription by hypoxia and TNF-{alpha}, and that IGFBP-3 binding to RXR-{alpha} may be required for the observed inhibition.

  14. Elemental health

    SciTech Connect

    Tonneson, L.C.

    1997-01-01

    Trace elements used in nutritional supplements and vitamins are discussed in the article. Relevant studies are briefly cited regarding the health effects of selenium, chromium, germanium, silicon, zinc, magnesium, silver, manganese, ruthenium, lithium, and vanadium. The toxicity and food sources are listed for some of the elements. A brief summary is also provided of the nutritional supplements market.

  15. DNA Repair, Redox Regulation and Modulation of Estrogen Receptor Alpha Mediated Transcription

    ERIC Educational Resources Information Center

    Curtis-Ducey, Carol Dianne

    2009-01-01

    Interaction of estrogen receptor [alpha] (ER[alpha]) with 17[beta]-estradiol (E[subscript 2]) facilitates binding of the receptor to estrogen response elements (EREs) in target genes, which in turn leads to recruitment of coregulatory proteins. To better understand how estrogen-responsive genes are regulated, our laboratory identified a number of…

  16. A Comparison of Type I Error Rates of Alpha-Max with Established Multiple Comparison Procedures.

    ERIC Educational Resources Information Center

    Barnette, J. Jackson; McLean, James E.

    J. Barnette and J. McLean (1996) proposed a method of controlling Type I error in pairwise multiple comparisons after a significant omnibus F test. This procedure, called Alpha-Max, is based on a sequential cumulative probability accounting procedure in line with Bonferroni inequality. A missing element in the discussion of Alpha-Max was the…

  17. Proteinaceous alpha-amylase inhibitors.

    PubMed

    Svensson, Birte; Fukuda, Kenji; Nielsen, Peter K; Bønsager, Birgit C

    2004-02-12

    Proteins that inhibit alpha-amylases have been isolated from plants and microorganisms. These inhibitors can have natural roles in the control of endogenous alpha-amylase activity or in defence against pathogens and pests; certain inhibitors are reported to be antinutritional factors. The alpha-amylase inhibitors belong to seven different protein structural families, most of which also contain evolutionary related proteins without inhibitory activity. Two families include bifunctional inhibitors acting both on alpha-amylases and proteases. High-resolution structures are available of target alpha-amylases in complex with inhibitors from five families. These structures indicate major diversity but also some similarity in the structural basis of alpha-amylase inhibition. Mutational analysis of the mechanism of inhibition was performed in a few cases and various protein engineering and biotechnological approaches have been outlined for exploitation of the inhibitory function. PMID:14871655

  18. Background canceling surface alpha detector

    DOEpatents

    MacArthur, Duncan W.; Allander, Krag S.; Bounds, John A.

    1996-01-01

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone.

  19. Background canceling surface alpha detector

    DOEpatents

    MacArthur, D.W.; Allander, K.S.; Bounds, J.A.

    1996-06-11

    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone. 5 figs.

  20. Haemophilus influenzae Disease (Including Hib) Symptoms

    MedlinePlus

    ... is considered invasive. Symptoms of pneumonia usually include: Fever and chills Cough Shortness of breath or difficulty breathing Sweating ... the blood. It can cause symptoms such as: Fever and chills Excessive tiredness Pain in the belly Nausea with ...

  1. Murine laminin alpha3A and alpha3B isoform chains are generated by usage of two promoters and alternative splicing.

    PubMed

    Ferrigno, O; Virolle, T; Galliano, M F; Chauvin, N; Ortonne, J P; Meneguzzi, G; Aberdam, D

    1997-08-15

    We already identified two distinct laminin alpha3A and alpha3B chain isoforms which differ in their amino-terminal ends and display different tissue-specific expression patterns. In this study we have investigated whether these two different isoforms are products of the same laminin alpha3 (lama3) gene and transcribed from one or two separate promoters. Genomic clones were isolated that encompass the sequences upstream to the 5' ends of both the alpha3A and the alpha3B cDNAs. Sequence analysis of the region upstream to the alpha3A open reading frame revealed the presence of a TATA box and potential binding sites for responsive elements. By primer extension analysis, the transcription start site of the alpha3B mRNA isoform was defined. The sequences upstream to the alpha3B mRNA transcription start site do not contain a TATA box near the transcription initiation sites, but AP-1, AP-2, and Sp1 consensus binding site sequences were identified. The genomic regions located immediately upstream of the alpha3A and alpha3B transcription start sites were shown to possess promoter activities in transfection experiments. In the promoter regions, response elements for the acute phase reactant signal and NF-interleukin 6 were found, and their possible relevance in the context of inflammation and wound healing is discussed. Our results demonstrate that the lama3 gene produces the two polypeptides by alternative splicing and contains two promoters, which regulate the production of the two isoforms alpha3A and alpha3B. PMID:9252362

  2. Long range alpha particle detector

    DOEpatents

    MacArthur, D.W.; Wolf, M.A.; McAtee, J.L.; Unruh, W.P.; Cucchiara, A.L.; Huchton, R.L.

    1993-02-02

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  3. Lorentz violation and {alpha} decay

    SciTech Connect

    Altschul, Brett

    2009-01-01

    Relating the effective Lorentz violation coefficients for composite particles to the coefficients for their constituent fields is a challenging problem. We calculate the Lorentz violation coefficients relevant to the dynamics of an {alpha} particle in terms of proton and neutron coefficients. The {alpha}-particle coefficients would lead to anisotropies in the {alpha} decays of nuclei, and because the decay process involves quantum tunneling, the effects of any Lorentz violations could be exponentially enhanced.

  4. Long range alpha particle detector

    DOEpatents

    MacArthur, Duncan W.; Wolf, Michael A.; McAtee, James L.; Unruh, Wesley P.; Cucchiara, Alfred L.; Huchton, Roger L.

    1993-01-01

    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  5. Modeling Solar Lyman Alpha Irradiance

    NASA Technical Reports Server (NTRS)

    Pap, J.; Hudson, H. S.; Rottman, G. J.; Willson, R. C.; Donnelly, R. F.; London, J.

    1990-01-01

    Solar Lyman alpha irradiance is estimated from various solar indices using linear regression analyses. Models developed with multiple linear regression analysis, including daily values and 81-day running means of solar indices, predict reasonably well both the short- and long-term variations observed in Lyman alpha. It is shown that the full disk equivalent width of the He line at 1083 nm offers the best proxy for Lyman alpha, and that the total irradiance corrected for sunspot effect also has a high correlation with Lyman alpha.

  6. ISS Update: Alpha Magnetic Spectrometer

    NASA Video Gallery

    NASA Public Affairs Officer Kelly Humphries interviews Trent Martin, Johnson Space Center project manager for the Alpha Magnetic Spectrometer (AMS) aboard the International Space Station. Questions...

  7. Superheavy Elements

    ERIC Educational Resources Information Center

    Tsang, Chin Fu

    1975-01-01

    Discusses the possibility of creating elements with an atomic number of around 114. Describes the underlying physics responsible for the limited extent of the periodic table and enumerates problems that must be overcome in creating a superheavy nucleus. (GS)

  8. Elemental Education.

    ERIC Educational Resources Information Center

    Daniel, Esther Gnanamalar Sarojini; Saat, Rohaida Mohd.

    2001-01-01

    Introduces a learning module integrating three disciplines--physics, chemistry, and biology--and based on four elements: carbon, oxygen, hydrogen, and silicon. Includes atomic model and silicon-based life activities. (YDS)

  9. Rhesus monkey alpha7 nicotinic acetylcholine receptors: comparisons to human alpha7 receptors expressed in Xenopus oocytes.

    PubMed

    Papke, Roger L; McCormack, Thomas J; Jack, Brian A; Wang, Daguang; Bugaj-Gaweda, Bozena; Schiff, Hillary C; Buhr, Joshua D; Waber, Amanda J; Stokes, Clare

    2005-11-01

    An alpha7 nicotinic acetylcholine receptor sequence was cloned from Rhesus monkey (Macaca mulatta). This clone differs from the mature human alpha7 nicotinic acetylcholine receptor in only four amino acids, two of which are in the extracellular domain. The monkey alpha7 nicotinic receptor was characterized in regard to its functional responses to acetylcholine, choline, cytisine, and the experimental alpha7-selective agonists 4OH-GTS-21, TC-1698, and AR-R17779. For all of these agonists, the EC(50) for activation of monkey receptors was uniformly higher than for human receptors. In contrast, the potencies of mecamylamine and MLA for inhibiting monkey and human alpha7 were comparable. Acetylcholine and 4OH-GTS-21 were used to probe the significance of the single point differences in the extracellular domain. Mutants with the two different amino acids in the extracellular domain of the monkey receptor changed to the corresponding sequence of the human receptor had responses to these agonists that were not significantly different in EC(50) from wild-type human alpha7 nicotinic receptors. Monkey alpha7 nicotinic receptors have a serine at residue 171, while the human receptors have an asparagine at this site. Monkey S171N mutants were more like human alpha7 nicotinic receptors, while mutations at the other site (K186R) had relatively little effect. These experiments point toward the basic utility of the monkey receptor as a model for the human alpha7 nicotinic receptor, albeit with the caveat that these receptors will vary in their agonist concentration dependency. They also point to the potential importance of a newly identified sequence element for modeling the specific amino acids involved with receptor activation. PMID:16266703

  10. Resting alpha activity predicts learning ability in alpha neurofeedback

    PubMed Central

    Wan, Feng; Nan, Wenya; Vai, Mang I.; Rosa, Agostinho

    2014-01-01

    Individuals differ in their ability to learn how to regulate the brain activity by neurofeedback. This study aimed to investigate whether the resting alpha activity can predict the learning ability in alpha neurofeedback. A total of 25 subjects performed 20 sessions of individualized alpha neurofeedback and the learning ability was assessed by three indices respectively: the training parameter changes between two periods, within a short period and across the whole training time. It was found that the resting alpha amplitude measured before training had significant positive correlations with all learning indices and could be used as a predictor for the learning ability prediction. This finding would help the researchers in not only predicting the training efficacy in individuals but also gaining further insight into the mechanisms of alpha neurofeedback. PMID:25071528

  11. Alpha Magnetic Spectrometer

    NASA Astrophysics Data System (ADS)

    Ting, Samuel

    2012-07-01

    The Alpha Magnetic Spectrometer (AMS) is a precision particle physics magnetic spectrometer designed to measure electrons, positrons, gamma rays and various nuclei and anti-nuclei from the cosmos up to TeV energy ranges. AMS weighs 7.5 tons and measures 5 meters by 4 meters by 3 meters. It contains 300,000 channels of electronics and 650 onboard microprocessors. It was delivered to the International Space Station onboard space shuttle Endeavour and installed on May 19, 2011. Since that time, more than 14 billion cosmic ray events have been collected. All the detectors function properly. At this moment, we are actively engaged in data analysis. AMS is an international collaboration involving 16 countries and 60 institutes. It took 16 years to construct and test. AMS is the only major physical science experiment on the International Space Station and will continue to collect data over the entire lifetime of the Space Station (10-20 years).

  12. Microscopic cluster model of {alpha}+n, {alpha}+p, {alpha}+ {sup 3}He, and {alpha}+{alpha} elastic scattering from a realistic effective nuclear interaction

    SciTech Connect

    Dohet-Eraly, J.; Baye, D.

    2011-07-15

    An effective nucleon-nucleon interaction adapted to cluster-model calculations of collisions is derived from the realistic Argonne potential AV18 with the unitary correlation operator method. The unitary correlation is determined from the {alpha}+{alpha} elastic phase shifts calculated in a cluster approach by the generator coordinate method coupled with the microscopic R-matrix method. With this interaction, the elastic phase shifts for the {alpha}+n, {alpha}+p, and {alpha}+{sup 3}He collisions are calculated within the same model. Without further adjustment, a good agreement with experimental data is obtained with a small model space.

  13. Alpha self-irradiation effects in ternary oxides of actinides elements: The zircon-like phases Am{sup III}VO{sub 4} and A{sup II}Np{sup IV}(VO{sub 4}){sub 2} (A=Sr, Pb)

    SciTech Connect

    Goubard, F. . E-mail: fabrice.goubard@chim.u-cergy.fr; Griesmar, P.; Tabuteau, A.

    2005-06-15

    We report the experimental studies of irradiation damage from alpha decay in neptunium and americium vanadates versus cumulative dose. The isotopes used were the transuranium {alpha}-emitter {sup 237}Np and the {alpha},{gamma}-emitter {sup 241}Am. Neptunium and americium vanadates self-irradiation was studied by X-ray diffraction method (XRD). The comparison of the powder diffraction patterns reveal that the irradiation has no apparent effect on the neptunium phases while the americium vanadate swells and becomes metamict as a function of cumulative dose.

  14. Alpha Solarco`s Photovoltaic Concentrator Development program

    SciTech Connect

    Anderson, A.; Bailor, B.; Carroll, D.

    1995-10-01

    This report details the work done under Sandia`s Photovoltaic Concentrator Development contract, funded jointly by Alpha Solarco and the US Department of Energy. It discusses improvements made to the cell assembly and module design of Alpha Solarco`s point-focus, high-concentration photovoltaic module. The goals of this effort were to increase the module efficiency, reduce the manufacturing cost of the cell assembly, and increase product reliability. Redesign of the secondary optical element achieved a 4 percent increase in efficiency due to better cell fill factors and offtrack performance. New, lower cost materials were identified for the secondary optical element, the optical couple between the secondary optical element and the cell, and the cell assembly electrical insulator. Manufacturing process improvements and test equipment are also discussed.

  15. Alpha particle emitters in medicine

    SciTech Connect

    Fisher, D.R.

    1989-09-01

    Radiation-induced cancer of bone, liver and lung has been a prominent harmful side-effect of medical applications of alpha emitters. In recent years, however, the potential use of antibodies labeled with alpha emitting radionuclides against cancer has seemed promising because alpha particles are highly effective in cell killing. High dose rates at high LET, effectiveness under hypoxic conditions, and minimal expectancy of repair are additional advantages of alpha emitters over antibodies labeled with beta emitting radionuclides for cancer therapy. Cyclotron-produced astatine-211 ({sup 211}At) and natural bismuth-212 ({sup 212}Bi) have been proposed and are under extensive study in the United States and Europe. Radium-223 ({sup 223}Ra) also has favorable properties as a potential alpha emitting label, including a short-lived daughter chain with four alpha emissions. The radiation dosimetry of internal alpha emitters is complex due to nonuniformly distributed sources, short particle tracks, and high relative specific ionization. The variations in dose at the cellular level may be extreme. Alpha-particle radiation dosimetry, therefore, must involve analysis of statistical energy deposition probabilities for cellular level targets. It must also account fully for nonuniform distributions of sources in tissues, source-target geometries, and particle-track physics. 18 refs., 4 figs.

  16. Superconducting calorimetric alpha particle sensors for nuclear nonproliferation applications

    SciTech Connect

    Horansky, Robert D.; Ullom, Joel N.; Beall, James A.; Hilton, Gene C.; Irwin, Kent D.; Dry, Donald E.; Hastings, Elizabeth P.; Lamont, Stephen P.; Rudy, Clifford R.; Rabin, Michael W.

    2008-09-22

    Identification of trace nuclear materials is usually accomplished by alpha spectrometry. Current detectors cannot distinguish critical elements and isotopes. We have developed a detector called a microcalorimeter, which achieves a resolution of 1.06 keV for 5.3 MeV alphas, the highest resolving power of any energy dispersive measurement. With this exquisite resolution, we can unambiguously identify the {sup 240}Pu/{sup 239}Pu ratio in Pu, a critical measurement for ascertaining the intended use of nuclear material. Furthermore, we have made a direct measurement of the {sup 209}Po ground state decay.

  17. FUEL ELEMENT

    DOEpatents

    Bean, R.W.

    1963-11-19

    A ceramic fuel element for a nuclear reactor that has improved structural stability as well as improved cooling and fission product retention characteristics is presented. The fuel element includes a plurality of stacked hollow ceramic moderator blocks arranged along a tubular raetallic shroud that encloses a series of axially apertured moderator cylinders spaced inwardly of the shroud. A plurality of ceramic nuclear fuel rods are arranged in the annular space between the shroud and cylinders of moderator and appropriate support means and means for directing gas coolant through the annular space are also provided. (AEC)

  18. Prevalence of -alpha(3.7) and alpha alpha alpha(anti3.7) alleles in sickle cell trait and beta-thalassemia patients in Mexico.

    PubMed

    Nava, María Paulina; Ibarra, Bertha; Magaña, María Teresa; de la Luz Chávez, María; Perea, F Javier

    2006-01-01

    The aim of this study was to determine the frequency of alpha-globin gene mutations in three groups of Mexican unrelated individuals. The first two groups were normal and sickle cell trait individuals from the Costa Chica region, a place with a 12.8% frequency of HbS carriers, and the third group comprised of Mexican mestizo patients with beta-thalassemia. We searched for -alpha(3.7) and -alpha(4.2) alpha(+)-thalassemia deletion alleles, as well as the alpha alpha alpha(anti3.7) triplication through long-gap PCR. The alleles -alpha(3.7) and alpha alpha alpha(anti3.7) were found in the heterozygote state only; 19% of the normal subjects had the -alpha(3.7) allele, and 2% showed the alpha alpha alpha(anti3.7) allele. In individuals with the sickle cell trait, 17% had the -alpha(3.7) deletion, and the alpha alpha alpha(anti3.7) triplication was observed in 3% of these individuals. We revealed that 16% of the subjects with beta-thalassemia showed the -alpha(3.7) deletion and 28% the alpha alpha alpha(anti3.7) triplication. The -alpha(4.2) deletion was not detected in any individual. The frequency of the -alpha(3.7) allele was roughly the same in the three groups studied; this can be explained by the fact that the three groups have common genes from Africa and the Mediterranean, where a high prevalence of alpha(+)-thalassemia has been observed. To our knowledge, the frequency of alpha alpha alpha(anti3.7) triplication observed in the Mexican beta-thalassemia patients is the highest reported. As the -alpha(3.7) and alpha alpha alpha(anti3.7) alleles are very common in our selected populations, we believe that there is a need to investigate systematically the alpha-globin gene mutations in all hemoglobinopathies in the Mexican population.

  19. Effects on the long term storage container by thermal cycling alpha plutonium

    SciTech Connect

    Flamm, B.F.; Prenger, F.C.; Veirs, D.K.; Hill, D.D.; Isom, G.M.

    1998-03-01

    Experiments were conducted to determine the validity of the steady state temperature limit of 100 C established by the DOE-STD-3013-96 for storing alpha plutonium metal. Studies with an alpha plutonium ingot combined with strain gauge measurements indicate that the stainless steel storage container, yields very little (0.005 in.) to the expanding plutonium metal as it undergoes alpha beta phase transformation at temperatures above 112 C. Another experiment using an alpha plutonium rod for point loading of the container wall showed no measured deformation of the container. The results of strain measurements for alpha beta and beta alpha transformations for twenty five thermal cycles are reported. Finite element modeling using the measured data predicts that the compressive yield strength is 3,500 psi versus the literature value of 13,000 psi.

  20. Genetics Home Reference: alpha-mannosidosis

    MedlinePlus

    ... Me Understand Genetics Home Health Conditions alpha-mannosidosis alpha-mannosidosis Enable Javascript to view the expand/collapse boxes. Download PDF Open All Close All Description Alpha-mannosidosis is a rare inherited disorder that causes ...

  1. Element Research.

    ERIC Educational Resources Information Center

    Herald, Christine

    2001-01-01

    Describes a research assignment for 8th grade students on the elements of the periodic table. Students use web-based resources and a chemistry handbook to gather information, construct concept maps, and present the findings to the full class using the mode of their choice: a humorous story, a slideshow or gameboard, a brochure, a song, or skit.…

  2. Mercury, elemental

    Integrated Risk Information System (IRIS)

    Mercury , elemental ; CASRN 7439 - 97 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinoge

  3. Effect of the feeding system on the fatty acid composition, expression of the Δ9-desaturase, Peroxisome Proliferator-Activated Receptor Alpha, Gamma, and Sterol Regulatory Element Binding Protein 1 genes in the semitendinous muscle of light lambs of the Rasa Aragonesa breed

    PubMed Central

    2010-01-01

    Background Conjugated linoleic acids (CLAs) are receiving increasing attention because of their beneficial effects on human health, with milk and meat products derived from ruminants as important sources of CLA in the human diet. SCD gene is responsible for some of the variation in CLA concentration in adipose tissues, and PPARγ, PPARα and SREBP1 genes are regulator of SCD gene. The aim of this work was to evaluate the effect of the feeding system on fatty acid composition, CLA content and relative gene expression of Δ9-desaturase (SCD), Peroxisome Proliferator-Activated Receptor Gamma (PPARγ), Peroxisome Proliferator-Activated Receptor Alpha, (PPARα) and Sterol Regulatory Element Binding Protein (SREBP1) in Rasa Aragonesa light lambs in semitendinous muscle. Forty-four single-born male lambs were used to evaluate the effect of the feeding system, varying on an intensity gradient according to the use of concentrates: 1. grazing alfalfa, 2. grazing alfalfa with a supplement for lambs, 3. indoor lambs with grazing ewes and 4. drylot. Results Both grazing systems resulted in a higher concentration of vaccenic acid (VA), CLA, CLA/VA acid ratio, and a lower oleic content, oleic acid (C18:1)/stearic acid (C18:0) ratio, PUFA n-6/n-3 ratio and SCD expression compared to other diets. In addition feeding system affected the fatty acid composition and SCD expression, possibly due to CLA concentration or the PUFA n-6/n-3 ratio. Both expression of the SCD gene and the feeding system were important factors affecting CLA concentration in the animal's semitendinous muscle. PPARγ, PPARα and SREBP1 expression seemed to be unaffected by the feeding system. Although no significant results were found, PPARγ, PPARα and SREBP1 showed similar expression pattern as SCD. Moreover, the correlation results between SCD expression and PPARγ (p < 0.01), as well as SREBP1 (p < 0.01) expression, may suggest that these genes were affecting SCD expression in a different way. Conclusions

  4. Superheavy Elements

    NASA Astrophysics Data System (ADS)

    Hofmann, S.

    The nuclear shell model predicts that the next doubly magic shell closure beyond 208Pb is at a proton number Z=114, 120, or 126 and at a neutron number N=172 or 184. The outstanding aim of experimental investigations is the exploration of this region of spherical `SuperHeavy Elements' (SHEs). Experimental methods have been developed which allowed for the identification of new elements at production rates of one atom per month. Using cold fusion reactions which are based on lead and bismuth targets, relatively neutron-deficient isotopes of the elements from 107 to 113 were synthesized at GSI in Darmstadt, Germany, and/or at RIKEN in Wako, Japan. In hot fusion reactions of 48Ca projectiles with actinide targets more neutron-rich isotopes of the elements from 112 to 116 and even 118 were produced at the Flerov Laboratory of Nuclear Reactions (FLNR) at the Joint Institute for Nuclear Research (JINR) in Dubna, Russia. Recently, part of these data which represent the first identification of nuclei located on the predicted island of SHEs were confirmed in two independent experiments. The decay data reveal that for the heaviest elements, the dominant decay mode is α emission rather than fission. Decay properties as well as reaction cross-sections are compared with results of theoretical studies. Finally, plans are presented for the further development of the experimental set-up and the application of new techniques. At a higher sensitivity, the detailed exploration of the region of spherical SHEs will be in the center of interest of future experimental work. New data will certainly challenge theoretical studies on the mechanism of the synthesis, on the nuclear decay properties, and on the chemical behavior of these heaviest atoms at the limit of stability.

  5. Alpha-particle spectrometer experiment

    NASA Technical Reports Server (NTRS)

    Gorenstein, P.; Bjorkholm, P.

    1972-01-01

    Mapping the radon emanation of the moon was studied to find potential areas of high activity by detection of radon isotopes and their daughter products. It was felt that based on observation of regions overflown by Apollo spacecraft and within the field of view of the alpha-particle spectrometer, a radon map could be constructed, identifying and locating lunar areas of outgassing. The basic theory of radon migration from natural concentrations of uranium and thorium is discussed in terms of radon decay and the production of alpha particles. The preliminary analysis of the results indicates no significant alpha emission.

  6. Regulation of the murine alpha B-crystallin/small heat shock protein gene in cardiac muscle.

    PubMed Central

    Gopal-Srivastava, R; Haynes, J I; Piatigorsky, J

    1995-01-01

    The murine alpha B-crystallin/small heat shock protein gene is expressed at high levels in the lens and at lower levels in the heart, skeletal muscle, and numerous other tissues. Previously we have found a skeletal-muscle-preferred enhancer at positions -427 to -259 of the alpha B-crystallin gene containing at least four cis-acting regulatory elements (alpha BE-1, alpha BE-2, alpha BE-3, and MRF, which has an E box). Here we show that in transgenic mice, the alpha B-crystallin enhancer directs the chloramphenicol acetyltransferase reporter gene driven by the alpha B-crystallin promoter specifically to myocardiocytes of the heart. The alpha B-crystallin enhancer was active in conjugation with the herpes simplex virus thymidine kinase promoter/human growth hormone reporter gene in transfected rat myocardiocytes. DNase I footprinting and site-specific mutagenesis experiments showed that alpha BE-1, alpha BE-2, alpha BE-3, MRF, and a novel, heart-specific element called alpha BE-4 are required for alpha B-crystallin enhancer activity in transfected myocardiocytes. By contrast, alpha BE-4 is not utilized for enhancer activity in transfected lens or skeletal muscle cell lines. Alpha BE-4 contains an overlapping heat shock sequence and a reverse CArG box [5'-GG(A/T)6CC-3']. Electrophoretic mobility shift assays with an antibody to serum response factor and a CArG-box-competing sequence from the c-fos promoter indicated that a cardiac-specific protein with DNA-binding and antigenic similarities to serum response factor binds to alpha BE-4 via the reverse CArG box; electrophoretic mobility shift assays and antibody experiments with anti-USF antiserum and heart nuclear extract also raised the possibility that the MRF E box utilizes USF or an antigenically related protein. We conclude that the activity of the alpha B-crystallin enhancer in the heart utilizes a reverse CArG box and an E-box-dependent pathway. PMID:8524275

  7. FUEL ELEMENT

    DOEpatents

    Fortescue, P.; Zumwalt, L.R.

    1961-11-28

    A fuel element was developed for a gas cooled nuclear reactor. The element is constructed in the form of a compacted fuel slug including carbides of fissionable material in some cases with a breeder material carbide and a moderator which slug is disposed in a canning jacket of relatively impermeable moderator material. Such canned fuel slugs are disposed in an elongated shell of moderator having greater gas permeability than the canning material wherefore application of reduced pressure to the space therebetween causes gas diffusing through the exterior shell to sweep fission products from the system. Integral fission product traps and/or exterior traps as well as a fission product monitoring system may be employed therewith. (AEC)

  8. Alpha--College for Exploring

    ERIC Educational Resources Information Center

    Leppert, William; Koenig, Joan

    1976-01-01

    Describes Alpha, the experimental college of individualized instruction at the College of DuPage (Illinois). At this college, students design their own curricula and work in an open classroom situation, and teachers start with students instead of subjects. (DC)

  9. Genetics Home Reference: alpha thalassemia

    MedlinePlus

    ... in each cell. Each copy is called an allele. For each gene, one allele is inherited from a person's father, and the ... person's mother. As a result, there are four alleles that produce alpha-globin. The different types of ...

  10. Detecting Alpha-1 Antitrypsin Deficiency.

    PubMed

    Stoller, James K

    2016-08-01

    Alpha-1 antitrypsin deficiency is a widely underrecognized condition, with evidence of persisting long diagnostic delays and patients' frequent need to see multiple physicians before initial diagnosis. Reasons for underrecognition include inadequate understanding of alpha-1 antitrypsin deficiency by physicians and allied health care providers; failure to implement available, guideline-based practice recommendations; and the belief that effective therapy is unavailable. Multiple studies have described both the results of screening and targeted detection of individuals with alpha-1 antitrypsin deficiency, with both varying strategies employed to identify at-risk individuals and varying results of testing. Also, various strategies to enhance detection of affected individuals have been examined, including use of the electronic medical record to prompt testing and empowerment of allied health providers, especially respiratory therapists, to promote testing for alpha-1 antitrypsin deficiency. Such efforts are likely to enhance detection with the expected result that the harmful effects of delayed diagnosis can be mitigated. PMID:27564667

  11. Alpha Magnetic Spectrometer (AMS) Overview

    NASA Video Gallery

    The Alpha Magnetic Spectrometer (AMS) is flying to the station on STS-134. The AMS experiment is a state-of-the-art particle physics detector being operated by an international team composed of 60 ...

  12. Synthesis and herbicidal activity of novel alpha,alpha,alpha-trifluoro-m-tolyl pyridazinone derivatives.

    PubMed

    Xu, Han; Zou, Xiao-Mao; Zhu, You-Quan; Liu, Bin; Tao, Han-Lin; Hu, Xu-Hong; Song, Hai-Bin; Hu, Fang-Zhong; Wang, Yong; Yang, Hua-Zheng

    2006-06-01

    A series of novel alpha,alpha,alpha-trifluoro-m-tolyl pyridazinone derivatives was synthesised. Herbicidal activities of the two intermediate compounds and 15 pyridazinone derivatives were evaluated through barnyardgrass and rape cup tests and Spirodela polyrrhiza (L.) Schleiden tests. Selected compounds were also evaluated under greenhouse conditions. Bleaching activities were observed at 10 microg ml(-1) and some compounds exhibited herbicidal activities at a rate of 300 g ha(-1). The relationship between crystal structures and herbicidal activities is discussed through a comparison of two compounds (5a and 5f). PMID:16602079

  13. Alpha decay in electron surrounding

    SciTech Connect

    Igashov, S. Yu.; Tchuvil’sky, Yu. M.

    2013-12-15

    The influence of atomic electron shells on the constant of alpha decay of heavy and mediummass nuclei was considered in detail. A method for simultaneously taking into account the change in the potential-barrier shape and the effect of reflection of a diverging Coulomb wave in the classically allowed region was developed. The ratios of decay probabilities per unit time for a bare nucleus and the respective neutral atom were found for some alpha-decaying isotopes.

  14. Organization of the human alpha 2-plasmin inhibitor gene.

    PubMed Central

    Hirosawa, S; Nakamura, Y; Miura, O; Sumi, Y; Aoki, N

    1988-01-01

    We have isolated overlapping phage genomic clones covering an area of 26 kilobases that encodes the human alpha 2-plasmin inhibitor. The alpha 2-plasmin inhibitor gene contains 10 exons and 9 introns distributed over approximately 16 kilobases of DNA. To our knowledge, the number of introns is the highest yet reported for a member of the serine protease inhibitor (serpin) superfamily. All introns are located in the 5'-half of the corresponding mRNA. The 5'-untranslated region and the leader sequence are interrupted by 3 introns totaling approximately equal to 6 kilobases. A "TATA box" sequence is located 17 nucleotides upstream from the proposed transcription initiation site. Multiple "GC box" sequences, G + C-rich sequences, and "CCAAT box"-like sequence, the hepatitis B virus enhancer element-like sequence and the human immunodeficiency virus enhancer-like sequence appear in the 5'-flanking region. The NH2-terminal region, which implements factor XIII-catalyzed cross-linking of alpha 2-plasmin inhibitor to fibrin, is encoded by the 4th exon. The reactive site and plasminogen-binding site, both located in the COOH-terminal region, are encoded by the 10th exon. When similar amino acids of alpha 2-plasmin inhibitor and other members of the serpin gene superfamily are aligned, the position of the 7th intron of the alpha 2-plasmin inhibitor gene aligns precisely with that of the second intron of the genes for rat angiotensinogen and human alpha 1-antitrypsin genes and is misaligned by only one nucleotide with that of the third intron of antithrombin III, suggesting that the alpha 2-plasmin inhibitor gene originates from the common ancestor of these serine protease inhibitors. Images PMID:3166140

  15. Microbial metabolism of steviol and steviol-16alpha,17-epoxide.

    PubMed

    Yang, Li-Ming; Hsu, Feng-Lin; Chang, Shwu-Fen; Cheng, Juei-Tang; Hsu, Ju-Yin; Hsu, Chung-Yi; Liu, Pan-Chun; Lin, Shwu-Jiuan

    2007-02-01

    Steviol (2) possesses a blood glucose-lowering property. In order to produce potentially more- or less-active, toxic, or inactive metabolites compared to steviol (2), its microbial metabolism was investigated. Incubation of 2 with the microorganisms Bacillus megaterium ATCC 14581, Mucor recurvatus MR 36, and Aspergillus niger BCRC 32720 yielded one new metabolite, ent-7alpha,11beta,13-trihydroxykaur-16-en-19-oic acid (7), together with four known related biotransformation products, ent-7alpha,13-dihydroxykaur-16-en-19-oic acid (3), ent-13-hydroxykaur-16-en-19-alpha-d-glucopyranosyl ester (4), ent-13,16beta,17-trihydroxykauran-19-oic acid (5), and ent-13-hydroxy-7-ketokaur-16-en-19-oic acid (6). The preliminary testing of antihyperglycemic effects showed that 5 was more potent than the parent compound (2). Thus, the microbial metabolism of steviol-16alpha,17-epoxide (8) with M. recurvatus MR 36 was continued to produce higher amounts of 5 for future study of its action mechanism. Preparative-scale fermentation of 8 yielded 5, ent-11alpha,13,16alpha,17-tetrahydroxykauran-19-oic acid (10), ent-1beta,17-dihydroxy-16-ketobeyeran-19-oic acid (11), and ent-7alpha,17-dihydroxy-16-ketobeyeran-19-oic acid (13), together with three new metabolites: ent-13,16beta-dihydroxykauran-17-acetoxy-19-oic acid (9), ent-11beta,13-dihydroxy-16beta,17-epoxykauran-19-oic acid (12), and ent-11beta,13,16beta,17-tetrahydroxykauran-19-oic acid (14). The structures of the compounds were fully elucidated using 1D and 2D NMR spectroscopic techniques, as well as HRFABMS. In addition, a GRE (glucocorticoid responsive element)-mediated luciferase reporter assay was used to initially screen the compounds 3-5, and 7 as glucocorticoid agonists. Compounds 4, 5 and 7 showed significant effects. PMID:17207824

  16. An Alpha-p-x Analytical Instrument for Lunar Resource Investigations

    NASA Technical Reports Server (NTRS)

    Economou, T. E.; Turkevich, A. L.

    1992-01-01

    An instrument using alpha backscattering, alpha-proton nuclear reactions, and x-ray production by alpha particles and other auxiliary sources can be used on lunar landers to provide detailed analytical information concerning the lunar surface material. This information is important scientifically and can be the basis for utilizing efficiently lunar resources to build lunar colonies in the future. This alpha particle instrument uses radioactive isotopes, silicon detectors for the alpha and proton modes, and mercuric iodide detectors operating at room temperature for the x-ray mode. The alpha and proton modes of the instrument can provide an analysis for all elements (except hydrogen) present in amounts greater than about 1 percent by atom. These modes have excellent sensitivity and accuracy for the lighter elements, in particular, directly determining the amount of oxygen in the lunar soil. This is an element of paramount significance for the lunar resource mission. The x-ray mode makes possible a determination of Ti, Fe, and other important metals with even greater accuracy. In general, the x-ray mode provides increased sensitivity for heavier elements, in many cases achieving a sensitivity of several hundred ppm.

  17. Mapping of a cholinergic binding site by means of synthetic peptides, monoclonal antibodies, and. alpha. -bungarotoxin

    SciTech Connect

    Conti-Tronconi, B.M.; Tang, Fen; Diethelm, B.M.; Spencer, S.R. ); Reinhardt-Maelicke, S.; Maelicke, A. )

    1990-07-03

    Previous studies by several laboratories have identified a narrow sequence region of the nicotinic acetylcholine receptor (AChR) {alpha} subunit, flanking the cysteinyl residues at positions 192 and 193, as containing major elements of, if not all, the binding site for cholinergic ligands. In the present study, the authors used a panel of synthetic peptides as representative structural elements of the AChR to investigate whether additional segments of the AChR sequences are able to bind {alpha}-bungarotoxin ({alpha}-BTX) and several {alpha}-BTX-competitive monoclonal antibodies (mAbs). The mAbs used (WF6, WF5, and W2) were raised against native Torpedo AChR, specifically recognize the {alpha}-subunit, and bind to AChR in a mutually exclusive fashion with {alpha}-BTX. The binding of WF5 and W2 to Torpedo AChR is inhibited by all cholinergic ligands. WF6 competes with agonists, but not with low mol. wt. antagonists, for AChR binding. Peptides {alpha}181-200 and {alpha}55-74 both inhibited binding of {sup 125}I-{alpha}-BTX to native Torpedo AChR. None of the peptides corresponding to sequence segments from other subunits bound {alpha}-BTX or WF6, or interfered with their binding. Therefore, the cholinergic binding site is not a single narrow sequence region, but rather two or more discontinuous sequence segments within the N-terminal extracellular region of the AChR {alpha} subunit, folded together in the native structure of the receptor, contribute to form a cholinergic binding region.

  18. FUEL ELEMENT

    DOEpatents

    Howard, R.C.; Bokros, J.C.

    1962-03-01

    A fueled matrlx eontnwinlng uncomblned carbon is deslgned for use in graphlte-moderated gas-cooled reactors designed for operatlon at temperatures (about 1500 deg F) at which conventional metallic cladding would ordlnarily undergo undesired carburization or physical degeneratlon. - The invention comprlses, broadly a fuel body containlng uncombined earbon, clad with a nickel alloy contalning over about 28 percent by' weight copper in the preferred embodlment. Thls element ls supporirted in the passageways in close tolerance with the walls of unclad graphite moderator materlal. (AEC)

  19. Analytical expressions for vibrational matrix elements of Morse oscillators

    SciTech Connect

    Zuniga, J.; Hidalgo, A.; Frances, J.M.; Requena, A.; Lopez Pineiro, A.; Olivares del Valle, F.J.

    1988-10-15

    Several exact recursion relations connecting different Morse oscillator matrix elements associated with the operators q/sup ..cap alpha../e/sup -//sup ..beta..//sup aq/ and q/sup ..cap alpha../e/sup -//sup ..beta..//sup aq/(d/dr) are derived. Matrix elements of the other useful operators may then be obtained easily. In particular, analytical expressions for (y/sup k/d/dr) and (y/sup k/d/dr+(d/dr)y/sup k/), matrix elements of interest in the study of the internuclear motion in polyatomic molecules, are obtained.

  20. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  1. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  2. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  3. Binding of actin to lens alpha crystallins

    NASA Technical Reports Server (NTRS)

    Gopalakrishnan, S.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1992-01-01

    Actin has been coupled to a cyanogen bromide-activated Sepharose 4B column, then tested for binding to alpha, beta, and gamma crystallin preparations from the bovine lens. Alpha, but not beta or gamma, crystallins bound to the actin affinity column in a time dependent and saturable manner. Subfractionation of the alpha crystallin preparation into the alpha-A and alpha-B species, followed by incubation with the affinity column, demonstrated that both species bound approximately the same. Together, these studies demonstrate a specific and saturable binding of lens alpha-A and alpha-B with actin.

  4. [Alpha-Synuclein in blood and cerebrospinal fluid of patients with alpha-synucleinopathy].

    PubMed

    Ono, Kenjiro; Yamada, Masahito

    2014-03-01

    Alpha-Synuclein protein(alphaS) aggregates from a monomer to assemblies such as oligomers, protofibrils, and mature fibrils. The early intermediate aggregate, that is, the oligomer, has been reported to be the most toxic species. We recently reported that melatonin inhibits alphaS aggregation, including protofibril and oligomer formations. While the alphaS concentration in cerebrospinal fluid was reported to significantly decrease in patients with Parkinson's disease (PD) and dementia with Lewy bodies, there have been reports that the alphaS oligomer concentration was elevated in the cerebrospinal fluid of PD patients. Moreover, it was reported that the alphaS oligomer concentration was also elevated in the blood of PD patients. Further studies may establish alphaS in cerebrospinal fluid and blood as a biomarker of alpha-synucleinopathies, including PD.

  5. Hypoxia-inducible factor 2alpha binds to cobalt in vitro.

    PubMed

    Yuan, Y; Beitner-Johnson, D; Millhorn, D E

    2001-11-01

    The hypoxia-inducible factor (HIF) activates the expression of genes that contain a hypoxia response element (HRE). The alpha subunit of the HIF transcription factors is degraded by proteasome pathways during normoxia, but stabilized under hypoxic conditions. It has previously been established that cobalt causes accumulation of HIF-2alpha and HIF-1alpha. However, little is known about the mechanism by which cobalt mimics hypoxia and stabilizes these transcription factors. We show here that cobalt binds directly to HIF-2alpha in vitro with a high affinity and in an oxygen-dependent manner. We found that HIF-2alpha, which had been stabilized with a proteasome inhibitor, could bind to cobalt, whereas hypoxia-stabilized HIF-2alpha could not. Mutations within the oxygen-dependent degradation domain of HIF-2alpha prevented cobalt binding and led to accumulation of HIF-2alpha during normoxia. This suggests that transition metal such as iron may play a role in regulation of HIF-2alpha in vivo. PMID:11688986

  6. Mechanism of alpha-tocopheryl-phosphate (alpha-TP) transport across the cell membrane

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have reported that alpha-TP is synthesized and hydrolyzed in animal cells and tissues; it modulates also several cell functions (FRBM 39:970, and UBMB Life, 57:23, 2005). While it is similar to alpha-tocopherol (alpha-T), alpha-TP appears to be more potent than alpha-T in inhibiting cell prolifer...

  7. Workshop on Precision Measurements of $\\alpha_s$

    SciTech Connect

    Bethke, Siegfried; Hoang, Andre H.; Kluth, Stefan; Schieck, Jochen; Stewart, Iain W.; Aoki, S.; Beneke, M.; Bethke, S.; Blumlein, J.; Brambilla, N.; Brodsky, S.; /MIT, LNS

    2011-10-01

    These are the proceedings of the Workshop on Precision Measurements of {alpha}{sub s} held at the Max-Planck-Institute for Physics, Munich, February 9-11, 2011. The workshop explored in depth the determination of {alpha}{sub s}(m{sub Z}) in the {ovr MS} scheme from the key categories where high precision measurements are currently being made, including DIS and global PDF fits, {tau}-decays, electro-weak precision observables and Z-decays, event-shapes, and lattice QCD. These proceedings contain a short summary contribution from the speakers, as well as the lists of authors, conveners, participants, and talks.

  8. Heavy Elements and Cool Stars

    NASA Technical Reports Server (NTRS)

    Wahlgren, Glenn M.; Carpenter, Kenneth G.; Norris, Ryan P.

    2008-01-01

    We report on progress in the analysis of high-resolution near-IR spectra of alpha Orionis (M2 Iab) and other cool, luminous stars. Using synthetic spectrum techniques, we search for atomic absorption lines in the stellar spectra and evaluate the available line parameter data for use in our abundance analyses. Our study concentrates on the post iron-group elements copper through zirconium as a means of investigating the slow neutron-capture process of nucleosynthesis in massive stars and the mechanisms that transport recently processed material up into the photospheric region. We discuss problems with the atomic data and model atmospheres that need to be addressed before theoretically derived elemental abundances from pre-supernova nucleosynthesis calculations can be tested by comparison with abundances determined from observations of cool, massive stars.

  9. AXUV bolometer and Lyman-{alpha} camera systems on the TCV tokamak

    SciTech Connect

    Degeling, A.W.; Weisen, H.; Zabolotsky, A.; Duval, B.P.; Pitts, R.A.; Wischmeier, M.; Lavanchy, P.; Marmillod, Ph.; Pochon, G.

    2004-10-01

    A set of seven twin slit cameras, each containing two 20-element linear absolute extreme ultraviolet photodiode arrays, has been installed on the Tokamak a Configuration Variable. One array in each camera will operate as a bolometer and the second as a Lyman-alpha (L{sub {alpha}}) emission monitor for estimating the recycled neutral flux. The camera configuration was optimized by simulations of tomographic reconstructions of the expected L{sub {alpha}} emission. The diagnostic will provide spatial and temporal resolution (10 {mu}s) of the radiated power and the L{sub {alpha}} emission that is considerably higher than previously achieved. This optimism is justified by extensive experience with prototype systems, which include first measurements of L{sub {alpha}} light from the divertor.

  10. Alpha particle losses from Tokamak Fusion Test Reactor deuterium{endash}tritium plasmas

    SciTech Connect

    Darrow, D.S.; Zweben, S.J.; Batha, S.; Budny, R.V.; Bush, C.E.; Chang, Z.; Cheng, C.Z.; Duong, H.H.; Fang, J.; Fisch, N.J.; Fischer, R.; Fredrickson, E.D.; Fu, G.Y.; Heeter, R.F.; Heidbrink, W.W.; Herrmann, H.W.; Herrmann, M.C.; Hill, K.; Jaeger, E.F.; James, R.; Majeski, R.; Medley, S.S.; Murakami, M.; Petrov, M.; Phillips, C.K.; Redi, M.H.; Ruskov, E.; Spong, D.A.; Strait, E.J.; Taylor, G.; White, R.B.; Wilson, J.R.; Wong, K.; Zarnstorff, M.C.

    1996-05-01

    Because alpha particle losses can have a significant influence on tokamak reactor viability, the loss of deuterium{endash}tritium alpha particles from the Tokamak Fusion Test Reactor (TFTR) [K. M. McGuire {ital et} {ital al}., Phys. Plasmas {bold 2}, 2176 (1995)] has been measured under a wide range of conditions. In TFTR, first orbit loss and stochastic toroidal field ripple diffusion are always present. Other losses can arise due to magnetohydrodynamic instabilities or due to waves in the ion cyclotron range of frequencies. No alpha particle losses have yet been seen due to collective instabilities driven by alphas. Ion Bernstein waves can drive large losses of fast ions from TFTR, and details of those losses support one element of the alpha energy channeling scenario. {copyright} {ital 1996 American Institute of Physics.}

  11. alpha-Thalassemia caused by an unstable alpha-globin mutant.

    PubMed Central

    Liebhaber, S A; Kan, Y W

    1983-01-01

    In a previous study, molecular cloning of the alpha-globin genes from a patient with nondeletion Hb-H disease (genotype--/alpha alpha) showed that a single nucleotide mutation (CTG to CCG) in one of the genes resulted in a leucine to proline substitution. This paper describes the approach we used to detect the abnormal alpha-globin chain. The chain was identified using a cell-free translation system. It turned over rapidly both in vitro and in vivo in the patient's reticulocytes. The unusual feature of this unstable alpha-globin is that the alpha-globin deficiency causes alpha-thalassemia. Simple heterozygotes for this lesion (alpha Pro alpha/alpha alpha) resemble alpha-thalassemia carriers and do not exhibit the hemolytic anemia usually associated with unstable hemoglobins. Images PMID:6826718

  12. Bremsstrahlung in {alpha} Decay Reexamined

    SciTech Connect

    Boie, H.; Scheit, H.; Jentschura, U. D.; Koeck, F.; Lauer, M.; Schwalm, D.; Milstein, A. I.; Terekhov, I. S.

    2007-07-13

    A high-statistics measurement of bremsstrahlung emitted in the {alpha} decay of {sup 210}Po has been performed, which allows us to follow the photon spectra up to energies of {approx}500 keV. The measured differential emission probability is in good agreement with our theoretical results obtained within the quasiclassical approximation as well as with the exact quantum mechanical calculation. It is shown that, due to the small effective electric dipole charge of the radiating system, a significant interference between the electric dipole and quadrupole contributions occurs, which is altering substantially the angular correlation between the {alpha} particle and the emitted photon.

  13. NACA Physicist Studying Alpha Rays

    NASA Technical Reports Server (NTRS)

    1957-01-01

    NACA Physicits studying Alpha Rays in a continuous cloud chamber. A cloud chamber is used by Lewis scientists to obtain information aimed at minimizing undesirable effects of radiation on nuclear-powered aircraft components. Here, alpha particles from a polonium source emit in a flower-like pattern at the cloud chamber's center. The particles are made visible by means of alcohol vapor diffusing from an area at room temperature to an area at minus -78 deg. Centigrade. Nuclear-powered aircraft were never developed and aircraft nuclear propulsion systems were canceled in the early 1960s.

  14. Bremsstrahlung in alpha decay reexamined.

    PubMed

    Boie, H; Scheit, H; Jentschura, U D; Köck, F; Lauer, M; Milstein, A I; Terekhov, I S; Schwalm, D

    2007-07-13

    A high-statistics measurement of bremsstrahlung emitted in the alpha decay of (210)Po has been performed, which allows us to follow the photon spectra up to energies of approximately 500 keV. The measured differential emission probability is in good agreement with our theoretical results obtained within the quasiclassical approximation as well as with the exact quantum mechanical calculation. It is shown that, due to the small effective electric dipole charge of the radiating system, a significant interference between the electric dipole and quadrupole contributions occurs, which is altering substantially the angular correlation between the alpha particle and the emitted photon.

  15. Test chamber for alpha spectrometry

    DOEpatents

    Larsen, Robert P.

    1977-01-01

    Alpha emitters for low-level radiochemical analysis by measurement of alpha spectra are positioned precisely with respect to the location of a surface-barrier detector by means of a chamber having a removable threaded planchet holder. A pedestal on the planchet holder holds a specimen in fixed engagement close to the detector. Insertion of the planchet holder establishes an O-ring seal that permits the chamber to be pumped to a desired vacuum. The detector is protected against accidental contact and resulting damage.

  16. Application of the space-time conservation element and solution element method to two-dimensional advection-diffusion problems

    NASA Technical Reports Server (NTRS)

    Wang, Xiao-Yen; Chow, Chuen-Yen; Chang, Sin-Chung

    1995-01-01

    The existing 2-D alpha-mu scheme and alpha-epsilon scheme based on the method of space-time conservation element and solution element, which were constructed for solving the linear 2-D unsteady advection-diffusion equation and unsteady advection equation, respectively, are tested. Also, the alpha-epsilon scheme is modified to become the V-E scheme for solving the nonlinear 2-D inviscid Burgers equation. Numerical solutions of six test problems are presented in comparison with their exact solutions or numerical solutions obtained by traditional finite-difference or finite-element methods. It is demonstrated that the 2-D alpha-mu, alpha-epsilon, and nu-epsilon schemes can be used to obtain numerical results which are more accurate than those based on some of the traditional methods but without using any artificial tuning in the computation. Similar to the previous 1-D test problems, the high accuracy and simplicity features of the space-time conservation element and solution element method have been revealed again in the present 2-D test results.

  17. Structural Basis of Natural Promoter Recognition by a Unique Nuclear Receptor, HNF4[alpha

    SciTech Connect

    Lu, Peng; Rha, Geun Bae; Melikishvili, Manana; Wu, Guangteng; Adkins, Brandon C.; Fried, Michael G.; Chi, Young-In

    2010-11-09

    HNF4{alpha} (hepatocyte nuclear factor 4{alpha}) plays an essential role in the development and function of vertebrate organs, including hepatocytes and pancreatic {beta}-cells by regulating expression of multiple genes involved in organ development, nutrient transport, and diverse metabolic pathways. As such, HNF4{alpha} is a culprit gene product for a monogenic and dominantly inherited form of diabetes, known as maturity onset diabetes of the young (MODY). As a unique member of the nuclear receptor superfamily, HNF4{alpha} recognizes target genes containing two hexanucleotide direct repeat DNA-response elements separated by one base pair (DR1) by exclusively forming a cooperative homodimer. We describe here the 2.0 {angstrom} crystal structure of human HNF4{alpha} DNA binding domain in complex with a high affinity promoter element of another MODY gene, HNF1{alpha}, which reveals the molecular basis of unique target gene selection/recognition, DNA binding cooperativity, and dysfunction caused by diabetes-causing mutations. The predicted effects of MODY mutations have been tested by a set of biochemical and functional studies, which show that, in contrast to other MODY gene products, the subtle disruption of HNF4{alpha} molecular function can cause significant effects in afflicted MODY patients.

  18. Alcoholism, Alpha Production, and Biofeedback

    ERIC Educational Resources Information Center

    Jones, Frances W.; Holmes, David S.

    1976-01-01

    Electroencephalograms of 20 alcoholics and 20 nonalcoholics were obtained. Data indicated that alcoholics produced less alpha than nonalcoholics. In one training condition subjects were given accurate biofeedback, whereas in the other condition subjects were given random (noncontingent) feedback. Accurate biofeedback did not result in greater…

  19. Targeted therapy using alpha emitters.

    PubMed

    Vaidyanathan, G; Zalutsky, M R

    1996-10-01

    Radionuclides such as 211At and 212Bi which decay by the emission of alpha-particles are attractive for certain applications of targeted radiotherapy. The tissue penetration of 212Bi and 211At alpha-particles is equivalent to only a few cell diameters, offering the possibility of combining cell-specific targeting with radiation of similar range. Unlike the beta-particles emitted by radionuclides such as 131I and 90Y, alpha-particles are radiation of high linear energy transfer and thus greater biological effectiveness. Several approaches have been explored for targeted radiotherapy with 212Bi- and 211At-labelled substances including colloids, monoclonal antibodies, metabolic precursors, receptor-avid ligands and other lower molecular weight molecules. An additional agent which exemplifies the promise of alpha-emitting radiopharmaceuticals is meta-[211At]astatobenzylguanidine. The toxicity of this compound under single-cell conditions, determined both by [3H]thymidine incorporation and by limiting dilution clonogenic assays, for human neuroblastoma cells is of the order of 1000 times higher than that of meta-[131I] iodobenzylguanidine. For meta-[211At] astatobenzylguanidine, the Do value was equivalent to only 6-7 211At atoms bound per cell. These results suggest that meta-[211At] astatobenzylguanidine might be valuable for the targeted radiotherapy of micrometastatic neuroblastomas.

  20. Meet the Alpha-Pets.

    ERIC Educational Resources Information Center

    Zitlaw, Jo Ann Bruce; Frank, Cheryl Standish

    1985-01-01

    "Alpha-Pets" are the focal point of an integrated, multidisciplinary curriculum. Each pet is featured for a week in a vocabulary-rich story and introduces related activities beginning with the featured letter, such as the four food groups during Freddie Fish's week or universe during Ulysses Unicorn's week. (MT)

  1. Postnatal changes of nicotinic acetylcholine receptor alpha 2, alpha 3, alpha 4, alpha 7 and beta 2 subunits genes expression in rat brain.

    PubMed

    Zhang, X; Liu, C; Miao, H; Gong, Z H; Nordberg, A

    1998-10-01

    Postnatal changes of nicotinic acetylcholine receptor (nAChR) alpha 2, alpha 3, alpha 4, alpha 7 and beta 2 subunits mRNAs were investigated in rat brain using ribonuclease protection assay. Multiple developmental patterns were observed: (1) transient expression during the first few postnatal weeks; alpha 2 in the hippocampus and brain stem, alpha 3 in the striatum, cerebellum and cortex, alpha 4 in the hippocampus, striatum and cerebellum, alpha 7 in the cerebellum and beta 2 in the striatum. (2) Constant expression across development; alpha 2 and alpha 3 in the thalamus, alpha 4 in the cortex, thalamus and brain stem, alpha 7 in the thalamus and brain stem and beta 2 in all brain regions except striatum. (3) Non-detection across development; alpha 2 in the cortex, striatum and cerebellum. (4) Increase with age; alpha 7 in the cortex and hippocampus. (5) Bell-shaped development; alpha 7 in the striatum. Postnatal changes of nAChR isoforms in different brain regions of rat were investigated by receptor binding assays. The developmental patterns of [3H]epibatidine and (-)-[3H]nicotine binding sites were similar to each other in each brain region, but different from that of [3H] alpha-bungarotoxin binding sites. No obvious correlation was observed between the developmental patterns of [3H] alpha-bungarotoxin, [3H]epibatidine and (-)-[3H]nicotine binding sites and corresponding subunits mRNAs. These results indicate that multiple mechanisms are involved in changes of gene expression of nAChRs subunits in the brain of developing rats.

  2. PPAR{alpha} is a key regulator of hepatic FGF21

    SciTech Connect

    Lundasen, Thomas; Hunt, Mary C.; Nilsson, Lisa-Mari; Sanyal, Sabyasachi; Angelin, Bo; Alexson, Stefan E.H.; Rudling, Mats . E-mail: mats.rudling@cnt.ki.se

    2007-08-24

    The metabolic regulator fibroblast growth factor 21 (FGF21) has antidiabetic properties in animal models of diabetes and obesity. Using quantitative RT-PCR, we here show that the hepatic gene expression of FGF21 is regulated by the peroxisome proliferator-activated receptor alpha (PPAR{alpha}). Fasting or treatment of mice with the PPAR{alpha} agonist Wy-14,643 induced FGF21 mRNA by 10-fold and 8-fold, respectively. In contrast, FGF21 mRNA was low in PPAR{alpha} deficient mice, and fasting or treatment with Wy-14,643 did not induce FGF21. Obese ob/ob mice, known to have increased PPAR{alpha} levels, displayed 12-fold increased hepatic FGF21 mRNA levels. The potential importance of PPAR{alpha} for FGF21 expression also in human liver was shown by Wy-14,643 induction of FGF21 mRNA in human primary hepatocytes, and PPAR{alpha} response elements were identified in both the human and mouse FGF21 promoters. Further studies on the mechanisms of regulation of FGF21 by PPAR{alpha} in humans will be of great interest.

  3. Identification and characterization of an alternative promoter of the human PGC-1{alpha} gene

    SciTech Connect

    Yoshioka, Toyo; Inagaki, Kenjiro; Noguchi, Tetsuya; Sakai, Mashito; Ogawa, Wataru; Hosooka, Tetsuya; Iguchi, Haruhisa; Watanabe, Eijiro; Matsuki, Yasushi; Hiramatsu, Ryuji; Kasuga, Masato

    2009-04-17

    The transcriptional regulator peroxisome proliferator-activated receptor-{gamma} coactivator-1{alpha} (PGC-1{alpha}) controls mitochondrial biogenesis and energy homeostasis. Although physical exercise induces PGC-1{alpha} expression in muscle, the underlying mechanism of this effect has remained incompletely understood. We recently identified a novel muscle-enriched isoform of PGC-1{alpha} transcript (designated PGC-1{alpha}-b) that is derived from a previously unidentified first exon. We have now cloned and characterized the human PGC-1{alpha}-b promoter. The muscle-specific transcription factors MyoD and MRF4 transactivated this promoter through interaction with a proximal E-box motif. Furthermore, either forced expression of Ca{sup 2+}- and calmodulin-dependent protein kinase IV (CaMKIV), calcineurin A, or the p38 mitogen-activated protein kinase (p38 MAPK) kinase MKK6 or the intracellular accumulation of cAMP activated the PGC-1{alpha}-b promoter in cultured myoblasts through recruitment of cAMP response element (CRE)-binding protein (CREB) to a putative CRE located downstream of the E-box. Our results thus reveal a potential molecular basis for isoform-specific regulation of PGC-1{alpha} expression in contracting muscle.

  4. Hepatic effects of a methionine-choline-deficient diet in hepatocyte RXR{alpha}-null mice

    SciTech Connect

    Gyamfi, Maxwell Afari; Tanaka, Yuji; He Lin; Klaassen, Curtis D.; Wan, Y.-J.Y.

    2009-01-15

    Retinoid X receptor-{alpha} (RXR{alpha}) is an obligate partner for several nuclear hormone receptors that regulate important physiological processes in the liver. In this study the impact of hepatocyte RXR{alpha} deficiency on methionine and choline deficient (MCD) diet-induced steatosis, oxidative stress, inflammation, and hepatic transporters gene expression were examined. The mRNA of sterol regulatory element-binding protein (SREBP)-regulated genes, important for lipid synthesis, were not altered in wild type (WT) mice, but were increased 2.0- to 5.4-fold in hepatocyte RXR{alpha}-null (H-RXR{alpha}-null) mice fed a MCD diet for 14 days. Furthermore, hepatic mRNAs and proteins essential for fatty acid {beta}-oxidation were not altered in WT mice, but were decreased in the MCD diet-fed H-RXR{alpha}-null mice, resulting in increased hepatic free fatty acid levels. Cyp2e1 enzyme activity and lipid peroxide levels were induced only in MCD-fed WT mice. In contrast, hepatic mRNA levels of pro-inflammatory factors were increased only in H-RXR{alpha}-null mice fed the MCD diet. Hepatic uptake transporters Oatp1a1 and Oatp1b2 mRNA levels were decreased in WT mice fed the MCD diet, whereas the efflux transporter Mrp4 was increased. However, in the H-RXR{alpha}-null mice, the MCD diet only moderately decreased Oatp1a1 and induced both Oatp1a4 and Mrp4 gene expression. Whereas the MCD diet increased serum bile acid levels and alkaline phosphatase activity in both WT and H-RXR{alpha}-null mice, serum ALT levels were induced (2.9-fold) only in the H-RXR{alpha}-null mice. In conclusion, these data suggest a critical role for RXR{alpha} in hepatic fatty acid homeostasis and protection against MCD-induced hepatocyte injury.

  5. Coexistence of {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in {sup 10}Be

    SciTech Connect

    Itagaki, N.; Ito, M.; Milin, M.; Hashimoto, T.; Ishiyama, H.; Miyatake, H.

    2008-06-15

    The coexistence of the {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in the excited states of {sup 10}Be has been discussed. In the previous analysis, all the low-lying states of {sup 10}Be were found to be well described by the motion of the two valence neutrons around two {alpha} clusters. However, the {alpha}+t+t cluster structure was found to coexist with the {alpha}+{alpha}+n+n structure around E{sub x}=15 MeV, close to the corresponding threshold. We have introduced a microscopic model to solve the coupling effect between these two configurations. The K=0 and K=1 states are generated from the {alpha}+t+t configurations due to the spin coupling of two triton clusters. The present case of {sup 10}Be is one of the few examples in which completely different configurations of triton-type ({alpha}+t+t three-center) and {alpha}-type ({alpha}+{alpha}+n+n two-center) clusters coexist in a single nucleus in the same energy region.

  6. A synopsis of collective alpha effects and implications for ITER

    SciTech Connect

    Sigmar, D.J.

    1990-10-01

    This paper discusses the following: Alpha Interaction with Toroidal Alfven Eigenmodes; Alpha Interaction with Ballooning Modes; Alpha Interaction with Fishbone Oscillations; and Implications for ITER.

  7. Calcification provides mechanical reinforcement to whale baleen alpha-keratin.

    PubMed

    Szewciw, L J; de Kerckhove, D G; Grime, G W; Fudge, D S

    2010-09-01

    Hard alpha-keratins such as hair, nail, wool and horn are stiff epidermal appendages used by mammals in a variety of functions including thermoregulation, feeding and intraspecific competition. Hard alpha-keratins are fibre-reinforced structures consisting of cytoskeletal elements known as 'intermediate filaments' embedded in an amorphous protein matrix. Recent research has shown that intermediate filaments are soft and extensible in living keratinocytes but become far stiffer and less extensible in keratinized cells, and this stiffening may be mediated by air-drying. Baleen, the keratinous plates used by baleen whales during filter feeding, is an unusual mammalian keratin in that it never air dries, and in some species, it represents the most heavily calcified of all the hard alpha-keratins. We therefore tested the hypothesis that whale baleen is stiffened by calcification. Here, we provide, to our knowledge, the first comprehensive description of baleen material properties and show that calcification contributes to overcoming the shortcomings of stiffening this hard alpha-keratin without the benefit of air-drying. We also demonstrate striking interspecies differences in the calcification patterns among three species of baleen whales and provide novel insights into the function and evolution of this unusual biomaterial.

  8. Genetics Home Reference: 5-alpha reductase deficiency

    MedlinePlus

    ... gene provides instructions for making an enzyme called steroid 5-alpha reductase 2. This enzyme is involved ... external genitalia. Mutations in the SRD5A2 gene prevent steroid 5-alpha reductase 2 from effectively converting testosterone ...

  9. What Causes Alpha-1 Antitrypsin Deficiency?

    MedlinePlus

    ... from the NHLBI on Twitter. What Causes Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (AAT) deficiency is an inherited disease. "Inherited" ... have AAT deficiency inherit two faulty AAT genes, one from each parent. These genes tell cells in ...

  10. How Is Alpha-1 Antitrypsin Deficiency Treated?

    MedlinePlus

    ... from the NHLBI on Twitter. How Is Alpha-1 Antitrypsin Deficiency Treated? Alpha-1 antitrypsin (AAT) deficiency has no cure, but its ... of these treatments are the same as the ones used for a lung disease called COPD (chronic ...

  11. Q (Alpha) Function and Squeezing Effect

    NASA Technical Reports Server (NTRS)

    Yunjie, Xia; Xianghe, Kong; Kezhu, Yan; Wanping, Chen

    1996-01-01

    The relation of squeezing and Q(alpha) function is discussed in this paper. By means of Q function, the squeezing of field with gaussian Q(alpha) function or negative P(a)function is also discussed in detail.

  12. Association of actin with alpha crystallins

    NASA Technical Reports Server (NTRS)

    Gopalakrishnan, S.; Boyle, D.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    The alpha crystallins are cytosolic proteins that co-localize and co-purify with actin-containing microfilaments. Affinity column chromatography employing both covalently-coupled actin or alpha crystallin was used to demonstrate specific and saturable binding of actin with alpha crystallin. This conclusion was confirmed by direct visualization of alpha aggregates bound to actin polymerized in vitro. The significance of this interaction in relation to the functional properties of these two polypeptides will be discussed.

  13. The ultraviolet spectra of Alpha Aquilae and Alpha Canis Minoris

    NASA Technical Reports Server (NTRS)

    Morton, D. C.; Bruzual A., G.; Kurucz, R. L.; Spinrad, H.

    1977-01-01

    Scans of Alpha Aql (A7 IV, V) and Alpha CMi (F5 IV-V) obtained with the Copernicus satellite spectrometer over the wavelength range from 2100 to 3200 A are presented along with a spectrum of the integrated solar disk over the same range procured during a calibrated rocket flight. About 1500 fairly strong absorption lines in the Alpha CMi spectrum between 2400 and 2961 A are identified by comparison with a solar atlas and by using a theoretical spectrum synthesized from a blanketed LTE model with an effective temperature of 6500 K and a surface gravity of 10,000 cm/sec per sec. The Mg II resonance doublet at 2795.528 and 2802.704 A is found to be present in all three stars together with a discontinuity at 2635 A due to Fe II, Fe I, Cr I, and Mn II. It is concluded that the Mg II resonance lines and the 2635-A continuum break would be the best spectral features for estimating the redshift of a galaxy observed at low resolution provided the redshift is not less than about 0.75.

  14. Effectiveness of Alpha Biofeedback Therapy: Negative Results.

    ERIC Educational Resources Information Center

    Watson, Charles G.; Herder, Joseph

    1980-01-01

    Assessed the utility of alpha biofeedback training in the treatment of patients (N=66). Biofeedback and placebo biofeedback groups were given alpha or mock-alpha training sessions. Improvement on 54 variables was compared to that of no-treatment controls. Only a chance number of significant changes appeared among the groups. (Author)

  15. Recent Results on the CKM Angle Alpha

    SciTech Connect

    Mihalyi, A.; /Wisconsin U., Madison

    2005-10-18

    The method to measure the CKM angle {alpha} and the modes sensitive to it are discussed. It is shown that the B {yields} {rho}{rho} decays provide the most stringent constraint on {alpha}, which is found to be {alpha} = 96{sup o} {+-} 10{sup o}(stat) {+-} 4{sup o}(syst){+-} 13{sup o}(penguin).

  16. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha monitor is a device with electrodes that are placed on a patient's scalp to monitor that portion of...

  17. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha monitor is a device with electrodes that are placed on a patient's scalp to monitor that portion of...

  18. Volvox carteri alpha 2- and beta 2-tubulin-encoding genes: regulatory signals and transcription.

    PubMed

    Mages, W; Cresnar, B; Harper, J F; Brüderlein, M; Schmitt, R

    1995-07-01

    Microtubules (MT) carry out several specialized morphogenetic functions in the multicellular green alga Volvox carteri (Vc), in addition to functions also executed in its closest unicellular relative, Chlamydomonas reinhardtii (Cr). To find out if these differences in morphogenetic complexity are reflected in tubulin (Tub) differences, we have compared the Vc alpha tub and beta tub genes with their Cr counterparts. The Vc genome contains two alpha tub and two beta tub genes. We report here the sequences of the alpha 2tub and beta 2tub genes, and thus complete the set of four tub sequences. The two alpha tub and two beta tub genes code for identical 451 (alpha) and 443 (beta) amino acid (aa) polypeptides; they differ from the Cr homologs in two (alpha) and one (beta) residues, respectively. Silent nucleotide (nt) exchanges between sibling genes are much more frequent in Vc than in Cr (12 vs. 2%), probably owing to a more stringent codon bias in the latter alga. Transcription of alpha 2tub and beta 2tub starts with an A, 26 bp (alpha 2) or 25 bp (beta 2) downstream from the TATA box. A 16-bp promoter element upstream and a G + C-rich sequence downstream from the TATA box are conserved in all tub of both species. Moreover, a 28-bp element of conserved sequence, and hence of possible functional significance, was found at similar locations in the 5' untranslated region (UTR) of all four alpha tub. A conserved TGTAA downstream from the translation stop codon represents the algal poly(A)-addition signal (in both Vc and Cr).(ABSTRACT TRUNCATED AT 250 WORDS) PMID:7628715

  19. 6 alpha-Fluoro- and 6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione: synthesis and evaluation of activity and kinetics of their C-22 epimers.

    PubMed

    Thalén, B A; Axelsson, B I; Andersson, P H; Brattsand, R L; Nylander, B; Wickström, L I

    1998-01-01

    It is generally accepted that the anti-inflammatory effect of glucocorticosteroids cannot be separated from their adverse effects at the receptor level. However, modification of the pharmacokinetics through structural alterations could provide steroids with a better therapeutic index than those currently used. Thus, new 16 alpha,17 alpha-acetals between butyraldehyde and 6 alpha-fluoro- or 6 alpha,9 alpha-difluoro-16 alpha-hydroxycortisol were synthesized and studied. Acetalization of the corresponding 16 alpha,17 alpha-diols or transacetalization of their 16 alpha,17 alpha-acetonides in dioxane produced mixtures of C-22 epimers, which were resolved by preparative chromatography. Alternatively, an efficient method was used to produce the 22R-epimer stereoselectively through performing the acetalization and transacetalization in a hydrocarbon with an inert material present. The C-22 configuration of (22R)-6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione was unambiguously established by single crystal X-ray diffraction. The present compounds, especially the 22R-epimer just mentioned, bind to the rat thymus glucocorticoid receptor with high potency. The C-22 epimers of the 6 alpha,9 alpha-difluoro derivatives showed a 10-fold higher biotransformation rate than the budesonide 22R-epimer when incubated with human liver S9 subcellular fraction. The high receptor affinity in combination with the high biotransformation rate indicates that (22R)-6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione may be an improved 16 alpha,17 alpha-acetal glucocorticosteroid for therapy of inflammatory diseases, in which the mucous membranes are involved, such as those in the intestinal tract as well in the respiratory tract. PMID:9437793

  20. A small segment of the MAT alpha 1 transcript promotes mRNA decay in Saccharomyces cerevisiae: a stimulatory role for rare codons.

    PubMed Central

    Caponigro, G; Muhlrad, D; Parker, R

    1993-01-01

    Differences in decay rates of eukaryotic transcripts can be determined by discrete sequence elements within mRNAs. Through the analysis of chimeric transcripts and internal deletions, we have identified a 65-nucleotide segment of the MAT alpha 1 mRNA coding region, termed the MAT alpha 1 instability element, that is sufficient to confer instability to a stable PGK1 reporter transcript and that accelerates turnover of the unstable MAT alpha 1 mRNA. This 65-nucleotide element is composed of two parts, one located within the 5' 33 nucleotides and the second located in the 3' 32 nucleotides. The first part, which can be functionally replaced by sequences containing rare codons, is unable to promote rapid decay by itself but can enhance the action of the 3' 32 nucleotides (positions 234 to 266 in the MAT alpha 1 mRNA) in accelerating turnover. A second portion of the MAT alpha 1 mRNA (nucleotides 265 to 290) is also sufficient to destabilize the PGK1 reporter transcript when positioned 3' of rare codons, suggesting that the 3' half of the MAT alpha 1 instability element is functionally reiterated within the MAT alpha 1 mRNA. The observation that rare codons are part of the 65-nucleotide MAT alpha 1 instability element suggests possible mechanisms through which translation and mRNA decay may be linked. Images PMID:8355674

  1. Raw materials influence the alpha-particle emission rate of AlN

    SciTech Connect

    Fawcett, T.G.; Knudsen, A.K.; Guiton, T.A.; Quinn, T.J. III; Mills, L.K.; Dunmead, S.D.; Rigot, W.L.; Wijeyesekera, S.D.

    1996-10-01

    Most electronic devices are packaged in plastic, generally epoxy-based molding compounds. Organic compounds serve as effective barriers for alpha particles. However, sensitive or thermally stressed devices often must be packaged in ceramic packages, including Al{sub 2}O{sub 3}, glass ceramics, BeO and AlN. Therefore, the concentration of alpha-particle-generating elements and the tendency of the material to induce soft errors in the device must be considered when selecting a ceramic package option. AlN is a relatively new packaging material. It offers high thermal conductivity ({ge}170 W/(m{center_dot}K)), dielectric and mechanical properties comparable to Al{sub 2}O{sub 3} and a coefficient of thermal expansion similar to silicon. AlN substrates and packages are produced via pressureless sintering or hot pressing, using high-purity powders and sintering aids, generally alkaline- and/or rare-earth oxides. The concentration of alpha-particle-emitting elements in AlN ceramics depends on the concentration of these elements in the AlN and additive powders. In the present work, the concentration of alpha-particle-generating elements uranium and thorium in AlN powders is shown to be related to the levels of these elements in the raw materials used in AlN powder synthesis.

  2. alpha-tubulin minichromosome promoters in the stichotrichous ciliate Stylonychia lemnae.

    PubMed

    Skovorodkin, Ilya; Pimenov, Alexander; Raykhel, Irina; Schimanski, Bernd; Ammermann, Dieter; Günzl, Arthur

    2007-01-01

    Ciliated protists are model organisms for a number of molecular phenomena including telomerase function, self-splicing introns, and an RNA interference-related mechanism in programmed DNA elimination. Despite this relevance, our knowledge about promoters and transcriptional regulation in these organisms is very limited. The macronuclear genome of stichotrichous ciliates consists of minichromosomes which typically encode a single gene. The 5' nontranscribed spacers are usually no longer than 400 bp and highly suitable for promoter characterizations. We used microinjection of two artificial and differently tagged alpha1 tubulin minichromosomes into the macronucleus of Stylonychia lemnae as a means to characterize in detail the corresponding promoter. Clonal cell lines that stably maintained both minichromosomes were generated, enabling comparative expression analysis by primer extension assays. Deletion and block substitution mutations of one of the minichromosomes revealed a TATA-like element, a putative initiator element, and two distinct upstream sequence elements (USEs). Determination of transcription initiation sites and a sequence alignment indicated that both TATA-like and initiator elements are conserved components of S. lemnae minichromosomes, whereas the USEs appear to be specific for the alpha1 tubulin minichromosome. The alpha2 tubulin minichromosome promoter is very short, comprising the two proximal elements but not the USEs. Despite the latter finding, up-regulation of alpha-tubulin expression in cells treated with concanavalin A activated the alpha2 but not the alpha1 tubulin promoter. These results therefore show that gene expression regulation in S. lemnae occurs at the level of transcription initiation on the basis of structurally different promoters.

  3. Alpha voltaic batteries and methods thereof

    NASA Technical Reports Server (NTRS)

    Raffaelle, Ryne P. (Inventor); Jenkins, Phillip (Inventor); Wilt, David (Inventor); Scheiman, David (Inventor); Chubb, Donald (Inventor); Castro, Stephanie (Inventor)

    2011-01-01

    An alpha voltaic battery includes at least one layer of a semiconductor material comprising at least one p/n junction, at least one absorption and conversion layer on the at least one layer of semiconductor layer, and at least one alpha particle emitter. The absorption and conversion layer prevents at least a portion of alpha particles from the alpha particle emitter from damaging the p/n junction in the layer of semiconductor material. The absorption and conversion layer also converts at least a portion of energy from the alpha particles into electron-hole pairs for collection by the one p/n junction in the layer of semiconductor material.

  4. THE LYMAN ALPHA REFERENCE SAMPLE: EXTENDED LYMAN ALPHA HALOS PRODUCED AT LOW DUST CONTENT

    SciTech Connect

    Hayes, Matthew; Oestlin, Goeran; Duval, Florent; Guaita, Lucia; Melinder, Jens; Sandberg, Andreas; Schaerer, Daniel; Verhamme, Anne; Orlitova, Ivana; Mas-Hesse, J. Miguel; Oti-Floranes, Hector; Adamo, Angela; Atek, Hakim; Cannon, John M.; Herenz, E. Christian; Kunth, Daniel; Laursen, Peter

    2013-03-10

    We report on new imaging observations of the Lyman alpha emission line (Ly{alpha}), performed with the Hubble Space Telescope, that comprise the backbone of the Lyman alpha Reference Sample. We present images of 14 starburst galaxies at redshifts 0.028 < z < 0.18 in continuum-subtracted Ly{alpha}, H{alpha}, and the far ultraviolet continuum. We show that Ly{alpha} is emitted on scales that systematically exceed those of the massive stellar population and recombination nebulae: as measured by the Petrosian 20% radius, R{sub P20}, Ly{alpha} radii are larger than those of H{alpha} by factors ranging from 1 to 3.6, with an average of 2.4. The average ratio of Ly{alpha}-to-FUV radii is 2.9. This suggests that much of the Ly{alpha} light is pushed to large radii by resonance scattering. Defining the Relative Petrosian Extension of Ly{alpha} compared to H{alpha}, {xi}{sub Ly{alpha}} = R {sup Ly{alpha}}{sub P20}/R {sup H{alpha}}{sub P20}, we find {xi}{sub Ly{alpha}} to be uncorrelated with total Ly{alpha} luminosity. However, {xi}{sub Ly{alpha}} is strongly correlated with quantities that scale with dust content, in the sense that a low dust abundance is a necessary requirement (although not the only one) in order to spread Ly{alpha} photons throughout the interstellar medium and drive a large extended Ly{alpha} halo.

  5. Subjective pain perception mediated by alpha rhythms.

    PubMed

    Peng, Weiwei; Babiloni, Claudio; Mao, Yanhui; Hu, Yong

    2015-07-01

    Suppression of spontaneous alpha oscillatory activities, interpreted as cortical excitability, was observed in response to both transient and tonic painful stimuli. The changes of alpha rhythms induced by pain could be modulated by painful sensory inputs, experimental tasks, and top-down cognitive regulations such as attention. The temporal and spatial characteristics, as well as neural functions of pain induced alpha responses, depend much on how these factors contribute to the observed alpha event-related desynchronization/synchronization (ERD/ERS). How sensory-, task-, and cognitive-related changes of alpha oscillatory activities interact in pain perception process is reviewed in the current study, and the following conclusions are made: (1) the functional inhibition hypothesis that has been proposed in auditory and visual modalities could be applied also in pain modality; (2) the neural functions of pain induced alpha ERD/ERS were highly dependent on the cortical regions where it is observed, e.g., somatosensory cortex alpha ERD/ERS in pain perception for painful stimulus processing; (3) the attention modulation of pain perception, i.e., influences on the sensory and affective dimensions of pain experience, could be mediated by changes of alpha rhythms. Finally, we propose a model regarding the determinants of pain related alpha oscillatory activity, i.e., sensory-discriminative, affective-motivational, and cognitive-modulative aspects of pain experience, would affect and determine pain related alpha oscillatory activities in an integrated way within the distributed alpha system. PMID:26026894

  6. {sup 17}O({alpha},{gamma}){sup 21}Ne and {sup 17}O({alpha},n){sup 20}Ne for the weak s process

    SciTech Connect

    Best, A.; Goerres, J.; Beard, M.; Couder, M.; Boer, R. de; Falahat, S.; Gueray, R. T.; Kontos, A.; Kratz, K.-L.; LeBlanc, P. J.; Li, Q.; O'Brien, S.; Oezkan, N.; Pignatari, M.; Sonnabend, K.; Talwar, R.; Tan, W.; Uberseder, E.; Wiescher, M.

    2012-11-20

    The ratio of the reaction rates of the competing channels {sup 17}O({alpha}{gamma}){sup 21}Ne and {sup 17}O({alpha},n){sup 20}Ne determines the efficiency of {sup 16}O as a neutron poison in the s process in low metallicity rotating stars. It has a large impact on the element production, either producing elements to the mass range of A=90 in case of a significant poisoning effect or extending the mass range up to the region of A=150 if the {gamma} channel is of negligible strength. We present an improved study of the reaction {sup 17}O({alpha},n){sup 20}Ne, including an independent measurement of the {sup 17}O({alpha},n{sub 1}){sup 20}Ne channel. A simultaneous R-Matrix fit to both the n{sub 0} and the n{sub 1} channels has been performed. New reaction rates, including recent data on the {sup 17}O({alpha},{gamma}){sup 21}Ne reaction, have been calculated and used as input for stellar network calculations and their impact on the s process in rotating massive stars is discussed.

  7. Neuronal specificity of the alpha 7 nicotinic acetylcholine receptor promoter develops during morphogenesis of the central nervous system.

    PubMed Central

    Matter-Sadzinski, L; Hernandez, M C; Roztocil, T; Ballivet, M; Matter, J M

    1992-01-01

    A transient transfection assay has been developed to analyse promoter activity in neuronal cells freshly dissociated from the chick central nervous system. The assay enabled us to identify cis-acting regulatory elements within the 5'-flanking region of the alpha 7 nicotinic acetylcholine receptor gene. In differentiated retina, regulatory elements direct reporter gene expression to a small subset of neurons which has been identified as ganglion cells, i.e. to the population of neurons in which alpha 7 transcripts were localized by in situ hybridization. However, these promoter elements exhibit ubiquitous activity in undifferentiated neural cells and in mesodermal stem cells. Our study supports the idea that alpha 7 regulatory elements acquire their neuronal specificity in the course of embryogenesis. Images PMID:1425587

  8. Diabetes mutations delineate an atypical POU domain in HNF-1alpha.

    PubMed

    Chi, Young-In; Frantz, J Daniel; Oh, Byung-Chul; Hansen, Lone; Dhe-Paganon, Sirano; Shoelson, Steven E

    2002-11-01

    Mutations in Hnf-1alpha are the most common Mendelian cause of diabetes mellitus. To elucidate the molecular function of a mutational hotspot, we cocrystallized human HNF-1alpha 83-279 with a high-affinity promoter and solved the structure of the complex. Two identical protein molecules are bound to the promoter. Each contains a homeodomain and a second domain structurally similar to POU-specific domains that was not predicted on the basis of amino acid sequence. Atypical elements in both domains create a stable interface that further distinguishes HNF-1alpha from other flexible POU-homeodomain proteins. The numerous diabetes-causing mutations in HNF-1alpha thus identified a previously unrecognized POU domain which was used as a search model to identify additional POU domain proteins in sequence databases. PMID:12453420

  9. Calculations of {alpha}-decay half-lives for heavy and superheavy nuclei

    SciTech Connect

    Qian Yibin; Ni Dongdong; Ren, Zhongzhou

    2011-04-15

    Systematic calculations on the {alpha}-decay half-lives of heavy and superheavy nuclei are performed within a deformed version of the cluster model, using the modified two-potential approach. The deformed Woods-Saxon potential is employed to calculate the {alpha}-decay width through a deformed barrier. For comparison the calculated {alpha}-decay half-lives in the empirical relations are also presented. The present study is initially restricted to even-even nuclei in the heavy mass region with N>126. Then the study is extended to the recently observed heaviest nuclei, including synthesized superheavy elements and isotopes. The {alpha}-decay half-lives obtained are found to be in good agreement with the experimental data.

  10. {alpha}-Lipoic acid prevents lipotoxic cardiomyopathy in acyl CoA-synthase transgenic mice

    SciTech Connect

    Lee, Young; Naseem, R. Haris; Park, Byung-Hyun; Garry, Daniel J.; Richardson, James A.; Schaffer, Jean E.; Unger, Roger H. . E-mail: roger.unger@utsouthwestern.edu

    2006-05-26

    {alpha}-Lipoic acid ({alpha}-LA) mimics the hypothalamic actions of leptin on food intake, energy expenditure, and activation of AMP-activated protein kinase (AMPK). To determine if, like leptin, {alpha}-LA protects against cardiac lipotoxicity, {alpha}-LA was fed to transgenic mice with cardiomyocyte-specific overexpression of the acyl CoA synthase (ACS) gene. Untreated ACS-transgenic mice died prematurely with increased triacylglycerol content and dilated cardiomyopathy, impaired systolic function and myofiber disorganization, apoptosis, and interstitial fibrosis on microscopy. In {alpha}-LA-treated ACS-transgenic mice heart size, echocardiogram and TG content were normal. Plasma TG fell 50%, hepatic-activated phospho-AMPK rose 6-fold, sterol regulatory element-binding protein-1c declined 50%, and peroxisome proliferator-activated receptor-{gamma} cofactor-1{alpha} mRNA rose 4-fold. Since food restriction did not prevent lipotoxicity, we conclude that {alpha}-LA treatment, like hyperleptinemia, protects the heart of ACS-transgenic mice from lipotoxicity.

  11. Detection and quantification of residual alpha-phase in delta-stabilized plutonium

    SciTech Connect

    Schwartz, Daniel S; Mitchell, Jeremy N; Pereyra, Ramiro A

    2009-01-01

    The temperature range of the {delta}-phase field of plutonium can be expanded by alloying with Group IIIA elements. Ga is a particularly potent {delta}-stabilizer and effectively stabilizes the {delta}-phase to room temperature. Due to a strong propensity towards solute redistribution during cooling through the {var_epsilon} {yields} {delta} phase field, regions of the material often do not contain enough solute to stabilize the {delta}-phase even after extensive homogenization annealing in the {delta}-phase field . The result is a small but persistent, fraction of {alpha}-phase in the material. A technique using differential scanning calorimetry to measure the enthalpy of transformation of the plutonium {alpha} {yields} {beta} transformation is described which can detect and quantify {alpha}-phase in a {delta}-phase matrix at levels as low as {approx} 0.1 wt. %. A set of Pu-1.7 atomic % Ga alloys was examined using the technique and found to contain 0.32 {+-} 0.06 weight % {alpha}-phase. Complications arise due to interference from the pressure-induced {alpha}{prime}-phase, and a peak separation method was developed to accurately measure the heat signal from each phase. Due to the presence of Ga in the {alpha}-phase, the onset temperature of the {alpha} {yields} {beta} transformation in these specimens was found to be 140.2 C, significantly higher than that for the transformation in pure plutonium, 126.2 C.

  12. PKC{alpha} expression regulated by Elk-1 and MZF-1 in human HCC cells

    SciTech Connect

    Hsieh, Y.-H.; Wu, T.-T.; Tsai, J.-H.; Huang, C.-Y.; Hsieh, Y.-S.; Liu, J.-Y. . E-mail: jyl@csmu.edu.tw

    2006-01-06

    Our previous study found that PKC{alpha} was highly expressed in the poor-differentiated human HCC cells and associated with cell migration and invasion. In this study, we further investigated the gene regulation of this enzyme. We showed that PKC{alpha} expression enhancement in the poor-differentiated human HCC cells was found neither by DNA amplification nor by increasing mRNA stability using differential PCR and mRNA decay assays. After screening seven transcription factors in the putative cis-acting regulatory elements of human PKC{alpha} promoters, only Elk-1 and MZF-1 antisense oligonucleotide showed a significant reduction in the PKC{alpha} mRNA level. They also reduced cell proliferation, cell migratory and invasive capabilities, and DNA binding activities in the PKC{alpha} promoter region. Over-expression assay confirmed that the PKC{alpha} expression may be modulated by these two factors at the transcriptional level. Therefore, these results may provide a novel mechanism for PKC{alpha} expression regulation in human HCC cells.

  13. Controls for agility research in the NASA High-Alpha Technology Program

    NASA Technical Reports Server (NTRS)

    Foster, John V.; Bundick, W. T.; Pahle, Joseph W.

    1991-01-01

    The research process being used to develop control law design methodologies and guidelines in the NASA High-Alpha Technology Program are discussed. This step-by-step process consists of four basic elements: (1) control law architecture definition and linear synthesis, (2) nonlinear batch simulation, (3) piloted simulation evaluation, and (4) flight test validation. This paper discusses the research tools being used in this effort and provides a status report on design methodologies and guidelines being developed for each of these elements.

  14. Synthesis of 16 alpha-3H androgen and estrogen substrates for 16 alpha-hydroxylase.

    PubMed

    Cantineau, R; Kremers, P; De Graeve, J; Cornelis, A; Laszlo, P; Gielen, J E; Lambotte, R

    1981-02-01

    The synthesis of 16 alpha-3H androgens and estrogens is described. 1-(3H)-Acetic acid in the presence of zinc dust reacts with 16 alpha-bromo-17-ketosteroids to produce 16 alpha-3H-17-ketosteroids. This chemical reaction was used to prepare 16 alpha-3H-dehydroepiandrosterone (I) and 16 alpha-3H-estrone acetate (XI) from 16 alpha-bromo-dehydroepiandrosterone (X) and from 16 alpha-bromo-estrone acetate (XII), respectively. Using appropriate microbiological techniques, it was possible to convert these radiolabelled substrates into 16 alpha-3H-androstenedione (II) and 16 alpha-3H-estradiol-17 beta (VII). 16 alpha-3H-Estrone (VI) was obtained by the chemical hydrolysis of 16 alpha-3H-estrone acetate. The label distribution as determined by microbiological 16 alpha-hydroxylations indicated a specific labelling of 77% for androgens and 65% for estrogens in the 16 alpha position. These substrates can be used for measuring the 16 alpha hydroxylase activity, an important step in the biosynthesis of estriol (VIII) and estetrol (IX). PMID:7013160

  15. Synthesis, in vitro antibacterial and antifungal evaluations of new alpha-hydroxyphosphonate and new alpha-acetoxyphosphonate derivatives of tetrazolo [1, 5-a] quinoline.

    PubMed

    Kategaonkar, Amol H; Pokalwar, Rajkumar U; Sonar, Swapnil S; Gawali, Vaibhav U; Shingate, Bapurao B; Shingare, Murlidhar S

    2010-03-01

    A series of new alpha-hydroxyphosphonate and alpha-acetoxyphosphonate derivatives have been synthesized for the first time of tetrazolo [1, 5-a] quinoline derivatives. Elemental analysis, IR, (1)H NMR, (13)C NMR and mass spectral data elucidated the structures of the all newly synthesized compounds. In vitro antimicrobial activities of the synthesized compounds were investigated against Gram-positive Bacillus subtilis, Gram-negative Escherichia coli and fungi Candida albicans and Aspergillus niger. Some of the tested compounds showed significant antimicrobial activity.

  16. A study of presynaptic alpha2-autoreceptors in alpha2A/D-, alpha2B- and alpha2C-adrenoceptor-deficient mice.

    PubMed

    Trendelenburg, A U; Klebroff, W; Hein, L; Starke, K

    2001-08-01

    The function of presynaptic alpha2-autoreceptors was studied in the hippocampus, occipito-parietal cortex, atria and vas deferens of NMRI mice, mice in which the alpha2A/D-, the alpha2B- or alpha2c-adrenoceptor gene had been disrupted (alpha2A/DKO, alpha2BKO and alpha2CKO, respectively), and the wildtype mice from which the knockout animals had been generated. Tissue pieces were preincubated with 3H-noradrenaline and then superfused and stimulated electrically. The alpha2-adrenoceptor agonist medetomidine reduced the electrically evoked overflow of tritium in all tissues from all mouse strains (stimulation with single pulses or single high-frequency pulse trains, called POPs, i.e. pulse patterns leading to minimal autoinhibition). The effects of medetomidine did not differ in NMRI, wildtype, alpha2BKO and alpha2CKO mice but were greatly reduced in alpha2A/DKO brain preparations and to a lesser extent in alpha2A/DKO atria and vasa deferentia. Six drugs were tested as antagonists against medetomidine. Their pKd values indicated that the hippocampal and occipito-parietal alpha2-autoreceptors in NMRI and wildtype mice were alpha2D (the rodent variant of the alpha2A/D-adrenoceptor) whereas the atrial and vas deferens alpha2-autoreceptors in NMRI and wildtype mice could not be identified with a single alpha2 subtype. Deletion of the alpha2A/D gene changed the pKd values in all tissues so that they now reflected alpha2C properties, whereas deletion of the alpha2C gene changed the pKd values in atria and vasa deferentia so that they now had alpha2D properties (as they had in NMRI and wildtype brain preparations). Autoinhibition by released noradrenaline was created using trains of up to 64 pulses or up to 4 POPs, and the overflow-enhancing effect of the alpha2 antagonist rauwolscine was determined. Results did not differ, irrespective of whether preparations were obtained from NMRI, wildtype, alpha2BKO or alpha2CKO mice: the overflow of tritium elicited by p pulses or POPs

  17. High gas flow alpha detector

    DOEpatents

    Bolton, Richard D.; Bounds, John A.; Rawool-Sullivan, Mohini W.

    1996-01-01

    An alpha detector for application in areas of high velocity gas flows, such as smokestacks and air vents. A plurality of spaced apart signal collectors are placed inside an enclosure, which would include smokestacks and air vents, in sufficient numbers to substantially span said enclosure so that gas ions generated within the gas flow are electrostatically captured by the signal collector means. Electrometer means and a voltage source are connected to the signal collectors to generate an electrical field between adjacent signal collectors, and to indicate a current produced through collection of the gas ions by the signal collectors.

  18. High gas flow alpha detector

    DOEpatents

    Bolton, R.D.; Bounds, J.A.; Rawool-Sullivan, M.W.

    1996-05-07

    An alpha detector for application in areas of high velocity gas flows, such as smokestacks and air vents. A plurality of spaced apart signal collectors are placed inside an enclosure, which would include smokestacks and air vents, in sufficient numbers to substantially span said enclosure so that gas ions generated within the gas flow are electrostatically captured by the signal collector means. Electrometer means and a voltage source are connected to the signal collectors to generate an electrical field between adjacent signal collectors, and to indicate a current produced through collection of the gas ions by the signal collectors. 4 figs.

  19. Failure Analysis in Space: International Space Station (ISS) Starboard Solar Alpha Rotary Joint (SARJ) Debris Analysis

    NASA Technical Reports Server (NTRS)

    Long, V. S.; Wright, M. C.; McDanels, S. J.; Lubas, D.; Tucker, B.; Marciniak, P. J.

    2010-01-01

    This slide presentation reviews the debris analysis of the Starboard Solar Alpha Rotary Joint (SARJ), a mechanism that is designed to keep the solar arrays facing the sun. The goal of this was to identify the failure mechanism based on surface morphology and to determine the source of debris through elemental and particle analysis.

  20. Reliability of {alpha}{sub 1} and {alpha}{sub 2} from lattice codes

    SciTech Connect

    Ng, K.Y.

    1996-10-01

    Whether the higher-order terms in the momentum-compaction factor, {alpha}{sub 1} and {alpha}{sub 2}, can be obtained reliably from lattice codes is an important issue for some quasi-isochronous rings. A FODO lattice consisting of thin quadrupoles, dipoles filling all spaces, and two families of thin sextupoles is solved and {alpha}{sub 1} and {alpha}{sub 2} are derived analytically. We find accurate agreement with SYNCH is examined. Some methods of measurement of {alpha}{sub 1} and {alpha}{sub 2} are discussed.

  1. alpha-DNA. VII. Solid phase synthesis of alpha-anomeric oligodeoxyribonucleotides.

    PubMed Central

    Morvan, F; Rayner, B; Leonetti, J P; Imbach, J L

    1988-01-01

    An efficient procedure for the synthesis of unnatural alpha-anomeric oligodeoxyribonucleotides is described. This solid-phase procedure is based on the use of alpha-nucleoside phosphoramidites and alpha-nucleoside derivatized solid supports corresponding to the four natural bases and allow rapid synthesis of oligonucleotides up to 20 alpha-deoxynucleotide units in length. After HPLC purification, a 15-mer: alpha-d(CCTCTCGTTCTTTAC) and a 20-mer: alpha-d(ATACTTGAGGAAGAGGTGTT) were obtained respectively in 27 and 29% overall yields. Their purity, nucleoside composition and primary structure were ascertained by HPLC and Maxam-Gilbert sequence analyses. Images PMID:3344220

  2. CACCC and GATA-1 sequences make the constitutively expressed alpha-globin gene erythroid-responsive in mouse erythroleukemia cells.

    PubMed Central

    Ren, S; Li, J; Atweh, G F

    1996-01-01

    Although the human alpha-globin and beta-globin genes are co-regulated in adult life, they achieve the same end by very different mechanisms. For example, a transfected beta-globin gene is expressed in an inducible manner in mouse erythroleukemia (MEL) cells while a transfected alpha-globin gene is constitutively expressed at a high level in induced and uninduced MEL cells. Interestingly, when the alpha-globin gene is transferred into MEL cells as part of human chromosome 16, it is appropriately expressed in an inducible manner. We explored the basis for the lack of erythroid-responsiveness of the proximal regulatory elements of the human alpha-globin gene. Since the alpha-globin gene is the only functional human globin gene that lacks CACCC and GATA-1 motifs, we asked whether their addition to the alpha-globin promoter would make the gene erythroid-responsive in MEL cells. The addition of each of these binding sites to the alpha-globin promoter separately did not result in inducibility in MEL cells. However, when both sites were added together, the alpha-globin gene became inducible in MEL cells. This suggests that erythroid non-responsiveness of the alpha-globin gene results from the lack of erythroid binding sites and is not necessarily a function of the constitutively active, GC rich promoter. PMID:8628660

  3. Rolling-Element Bearings

    NASA Technical Reports Server (NTRS)

    Hamrock, B. J.; Anderson, W. J.

    1983-01-01

    Rolling element bearings are a precision, yet simple, machine element of great utility. A brief history of rolling element bearings is reviewed and the type of rolling element bearings, their geometry and kinematics, as well as the materials they are made from and the manufacturing processes they involve are described. Unloaded and unlubricated rolling element bearings, loaded but unlubricated rolling element bearings and loaded and lubricated rolling element bearings are considered. The recognition and understanding of elastohydrodynamic lubrication covered, represents one of the major development in rolling element bearings.

  4. Effects of interferon-alpha (IFN-alpha) administration on leucocytes in healthy humans.

    PubMed

    Corssmit, E P; Heijligenberg, R; Hack, C E; Endert, E; Sauerwein, H P; Romijn, J A

    1997-02-01

    Plasma concentrations of IFN-alpha are increased in several inflammatory conditions. Several lines of evidence indicate that IFN-alpha has anti-inflammatory properties. To study the effects of IFN-alpha on leucocyte subsets and activation and on cytokines, we administered IFN-alpha (rhIFN-alpha2b; 5 x 10(6) U/m2) to eight healthy human subjects in a randomized controlled cross-over study and analysed changes in circulating leucocytes and parameters for neutrophil and monocyte activation. After administration of IFN-alpha, neutrophil counts increased, monocyte counts decreased transiently, whereas the number of lymphocytes, basophils and eosinophils showed a sustained decrease. IFN-alpha administration was also associated with neutrophil activation, reflected in an increase in the plasma concentrations of elastase-alpha1-antitrypsin complexes and lactoferrin. Serum neopterin, a marker for monocyte activation, was significantly increased 10 h after administration of IFN-alpha. IFN-alpha significantly increased plasma concentrations of IL-6, IL-8 and IL-10. Although IL-1 and tumour necrosis factor (TNF) remained undetectable, plasma concentrations of soluble TNF receptors p55 and p75 increased after IFN-alpha administration. We conclude that IFN-alpha induces multiple alterations in the distribution and functional properties of leucocytes. IFN-alpha exerts pro- as well as anti-inflammatory effects within the cytokine network.

  5. The Mimetic Finite Element Method and the Virtual Element Method for elliptic problems with arbitrary regularity.

    SciTech Connect

    Manzini, Gianmarco

    2012-07-13

    We develop and analyze a new family of virtual element methods on unstructured polygonal meshes for the diffusion problem in primal form, that use arbitrarily regular discrete spaces V{sub h} {contained_in} C{sup {alpha}} {element_of} N. The degrees of freedom are (a) solution and derivative values of various degree at suitable nodes and (b) solution moments inside polygons. The convergence of the method is proven theoretically and an optimal error estimate is derived. The connection with the Mimetic Finite Difference method is also discussed. Numerical experiments confirm the convergence rate that is expected from the theory.

  6. Beta/alpha continuous air monitor

    DOEpatents

    Becker, G.K.; Martz, D.E.

    1988-06-27

    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinquishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts. 7 figs.

  7. Beta/alpha continuous air monitor

    DOEpatents

    Becker, Gregory K.; Martz, Dowell E.

    1989-01-01

    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinguishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts.

  8. Human GATA-3: a lineage-restricted transcription factor that regulates the expression of the T cell receptor alpha gene.

    PubMed Central

    Ho, I C; Vorhees, P; Marin, N; Oakley, B K; Tsai, S F; Orkin, S H; Leiden, J M

    1991-01-01

    In addition to its role in the recognition of foreign antigens, the T cell receptor (TCR) alpha gene serves as a model system for studies of developmentally-regulated, lineage-specific gene expression in T cells. TCR alpha gene expression is restricted to cells of the TCR alpha/beta+ lineage, and is controlled by a T cell-specific transcriptional enhancer located 4.5 kb 3' to the C alpha gene segment. The TCR alpha enhancer contains four nuclear protein binding sites called T alpha 1-T alpha 4. In this report we describe the identification and characterization of a novel human cDNA, hGATA-3 that binds to the T alpha 3 element of the human TCR alpha enhancer. hGATA-3 contains a zinc finger domain that is highly related to the DNA-binding domain of the erythroid-specific transcription factor, GATA-1, and binds to a region of T alpha 3 that contains a consensus GATA binding site (AGATAG). Northern blot analyses of hematopoietic cell lines demonstrate that hGATA-3 is expressed exclusively in T cells. Overexpression of hGATA-3 in HeLa cells or human B cells specifically activated transcription from a co-transfected reporter plasmid containing two copies of the T alpha 3 binding site located upstream of the minimal SV40 promoter. Taken together these results demonstrate that hGATA-3 is a novel lineage-specific hematopoietic transcription factor that appears to play an important role in regulating the T cell-specific expression of the TCR alpha gene. Images PMID:1827068

  9. Discrete Element Modeling

    SciTech Connect

    Morris, J; Johnson, S

    2007-12-03

    The Distinct Element Method (also frequently referred to as the Discrete Element Method) (DEM) is a Lagrangian numerical technique where the computational domain consists of discrete solid elements which interact via compliant contacts. This can be contrasted with Finite Element Methods where the computational domain is assumed to represent a continuum (although many modern implementations of the FEM can accommodate some Distinct Element capabilities). Often the terms Discrete Element Method and Distinct Element Method are used interchangeably in the literature, although Cundall and Hart (1992) suggested that Discrete Element Methods should be a more inclusive term covering Distinct Element Methods, Displacement Discontinuity Analysis and Modal Methods. In this work, DEM specifically refers to the Distinct Element Method, where the discrete elements interact via compliant contacts, in contrast with Displacement Discontinuity Analysis where the contacts are rigid and all compliance is taken up by the adjacent intact material.

  10. Hemoglobin Evanston (alpha 14 Trp----Arg). An unstable alpha-chain variant expressed as alpha-thalassemia.

    PubMed Central

    Honig, G R; Shamsuddin, M; Vida, L N; Mompoint, M; Valcourt, E; Bowie, L J; Jones, E C; Powers, P A; Spritz, R A; Guis, M

    1984-01-01

    A new hematologic syndrome with phenotypic features of mild Hb H disease was identified in three children from two unrelated black American families. Erythrocytes from each of these children contained Hb H (beta 4) and Hb Barts (gamma 4), as well as a slowly migrating hemoglobin fraction that made up 7-10% of the total hemoglobin. The parents of the affected children all showed mild thalassemia-like changes, with one of the parents in each family also expressing the variant hemoglobin; in the latter individuals the mutant alpha-chains made up less than 2% of the total, and were present mainly or exclusively in combination with delta-chains in the form of a slowly migrating Hb A2. Purified Hb Evanston showed an increased oxygen affinity, but its Bohr effect, cooperativity, and 2,3-diphosphoglycerate effect were normal. The mutant hemoglobin appeared to have normal stability to heat and to isopropanol, and the stability of its alpha-chain in an extended time course synthesis study also appeared to be similar to that of alpha A. However, the results from short-term globin synthesis studies, and from mRNA translation in vitro, suggest that the two types of alpha-chains were synthesized at relatively equal rates, with a major fraction of the newly synthesized variant alpha-chains undergoing rapid catabolism. The hematologic data taken in combination with DNA hybridization and globin synthesis findings indicate that the proposita in each of these families has the genotype--, alpha A/--, alpha Ev. These observations suggest that two separate mechanisms are contributing to the alpha-thalassemia-like expression of Hb Evanston : the newly synthesized alpha EV-chains are unstable and are subject to early proteolytic destruction; and the mutant alpha-allele is linked to an alpha-globin gene deletion. Images PMID:6725558

  11. Teaching calculus with Wolfram|Alpha

    NASA Astrophysics Data System (ADS)

    Dimiceli, Vincent E.; Lang, Andrew S. I. D.; Locke, LeighAnne

    2010-12-01

    This article describes the benefits and drawbacks of using Wolfram|Alpha as the platform for teaching calculus concepts in the lab setting. It is a result of our experiences designing and creating an entirely new set of labs using Wolfram|Alpha. We present the reasoning behind our transition from using a standard computer algebra system (CAS) to Wolfram|Alpha in our differential and integral calculus labs, together with the positive results from our experience. We also discuss the current limitations of Wolfram|Alpha, including a discussion on why we still use a CAS for our multivariate calculus labs.

  12. Gene transfer mediated by alpha2-macroglobulin.

    PubMed Central

    Schneider, H; Huse, K; Birkenmeier, G; Otto, A; Scholz, G H

    1996-01-01

    alpha2-Macroglobulin covalently linked to poly(L)-lysine can be used as a vehicle for receptor-mediated gene transfer. This modified alpha2-macroglobulin maintains its ability to bind to the alpha2-macroglobulin receptor, and was shown to introduce a luciferase reporter gene plasmid into HepG2 human hepatoma cells in vitro. The alpha2-macroglobulin receptor is a very large and multifunctional cell surface receptor, whose rapid and efficient internalization rate makes it attractive for gene therapy, e.g. for hepatic gene targeting via injection into the portal vein. PMID:8871570

  13. Prospects for alpha particle studies on TFTR

    SciTech Connect

    Zweben, S.J.

    1987-05-01

    TFTR is expected to produce approximately 5 MW of alpha heating during the D/T Q approx. = 1 phase of operation in 1990. At that point the collective confinement properties and the heating effects of alpha particles become accessible for study for the first time. This paper outlines the potential performance of TFTR with respect to alpha particle production, the diagnostics which will be available for alpha particle measurements, and the physics issues which can be studied both before and during D/T operation.

  14. 5 alpha-reductase deficiency without hypospadias.

    PubMed Central

    Ng, W K; Taylor, N F; Hughes, I A; Taylor, J; Ransley, P G; Grant, D B

    1990-01-01

    A boy aged 4 with penoscrotal hypospadias and his brother aged 12 with micropenis had typical changes of homozygous 5 alpha-reductase deficiency. After three injections of chorionic gonadotrophin there was a trivial rise in plasma dihydrotestosterone with a normal increase in plasma testosterone. Urine steroid chromatography showed abnormally high 5 beta: 5 alpha ratios and 5 alpha-reductase activity was appreciably reduced in genital skin fibroblasts. The results indicate that 5 alpha-reductase deficiency is not invariably associated with genital ambiguity. PMID:2248513

  15. Element by Element Abundances in Spheroidal Galaxies

    NASA Astrophysics Data System (ADS)

    Worthey, Guy; Serven, Jedidiah

    2006-02-01

    Element-by-element abundances will be derived from high quality long slit KPNO 4m spectra of nearby elliptical galaxies that span the range of velocity dispersion. Analysis of these spectra will give the abundances of 18 individual elements to bring to extragalactic astronomy the same luxurious situation now enjoyed only by stellar spectroscopists. These spectra will reveal the basic element ratio behavior as a function of galaxy velocity dispersion. For example, [Mg/Fe] is seen to be enhanced in large galaxies, but not small ones. We propose to expand our purview from 2 elements (Mg and Fe) to 18 elements. This, in turn, will tie directly to chemical evolution and chemical enrichment mechanisms. As a byproduct, we also decrease the stellar population age uncertainty by about a factor of ten from today's Balmer-metal index diagram techniques.

  16. Isolation, characterization and structure-elicitor activity relationships of hibernalin and its two oxidized forms from Phytophthora hibernalis Carne 1925.

    PubMed

    Capasso, Renato; Di Maro, Antimo; Cristinzio, Gennaro; De Martino, Antonio; Chambery, Angela; Daniele, Addolorata; Sannino, Filomena; Testa, Antonino; Parente, Augusto

    2008-01-01

    Three alpha-elicitins, named hibernalin1, hibernalin2 and hibernalin3 (hib1, hib2 and hib3, respectively), were isolated by reverse phase-low-pressure liquid chromatography from culture filtrates of Phytophthora hibernalis Carne 1925, the causal agent of citrus lemon brown rot. Hib1 proved to be identical to syringicin previously isolated from culture filtrates of Phytophthora syringae. Hib2 and hib3 shared the same primary structure with hib1, but contained, at position 50, Met sulphoxide or sulphone, respectively. By SDS-PAGE, the three proteins showed the same electrophoretic mobility, corresponding to about 10 kDa. Exact M(r) values were obtained by MALDI-TOF-MS (10,194.82 for hib1, 10,209.33 for hib2 and 10,223.80 for hib3), while by ESI-MS an M(r) value of 10,194.90 was found for hib1 and no results for hib2 and hib3. The hibernalin forms showed a high propensity to self-association, after exposure to acetonitrile. Hib1 showed to be active in both the hypersensitivity response and electrolytes leakage assays; the sample containing hib1 and hib2 was only weakly active in the first assay and inactive in the second assay, while the sample containing all three hibernalin forms proved to be inactive in both tests. It is proposed that the different activities of the three hibernalin samples could be very likely attributed to both Met50 oxidation and aggregation.

  17. HMGI(Y) and Sp1 in addition to NF-kappa B regulate transcription of the MGSA/GRO alpha gene.

    PubMed Central

    Wood, L D; Farmer, A A; Richmond, A

    1995-01-01

    Expression of the chemokine MGSA/GRO is upregulated as melanocytes progress to melanoma cells. We demonstrate that constitutive and cytokine induced MGSA/GRO alpha expression requires multiple DNA regulatory regions between positions -143 to -62. We have previously shown that the NF-kappa B element at -83 to -65 is essential for basal and cytokine induced MGSA/GRO alpha promoter activity in the Hs294T melanoma and normal retinal pigment epithelial (RPE) cells, respectively. Here, we have determined that the Sp1 binding element located approximately 42 base pairs upstream from the NF-kappa B element binds Sp1 and Sp3 constitutively and this element is necessary for basal MGSA/GRO alpha promoter activity. We demonstrate that the high mobility group proteins HMGI(Y) recognize the AT-rich motif nested within the NF-kappa B element in the MGSA/GRO alpha promoter. Loss of either NF-kappa B or HMGI(Y) complex binding by selected point mutations in the NF-kappa B element results in decreased basal and cytokine induced MGSA/GRO alpha promoter activity. Thus, these results indicate that transcriptional regulation of the chemokine MGSA/GRO alpha requires at least three transcription factors: Sp1, NF-kappa B and HMGI(Y). Images PMID:7479086

  18. Elements of Film.

    ERIC Educational Resources Information Center

    Bobker, Lee R.

    A film is the successful combination of two distinct groups of elements: (1) the technical elements by which the film is made (camera, lighting, sound and editing) and (2) the esthetic elements that transform the craft into an art. This book attempts to combine the study of these elements by providing technical information about the process of…

  19. Organic Elemental Analysis.

    ERIC Educational Resources Information Center

    Ma, T. S.; Wang, C. Y.

    1984-01-01

    Presents a literature review on methods used to analyze organic elements. Topic areas include methods for: (1) analyzing carbon, hydrogen, and nitrogen; (2) analyzing oxygen, sulfur, and halogens; (3) analyzing other elements; (4) simultaneously determining several elements; and (5) determing trace elements. (JN)

  20. ALPHA ENHANCEMENT AND THE METALLICITY DISTRIBUTION FUNCTION OF PLAUT'S WINDOW

    SciTech Connect

    Johnson, Christian I.; Michael Rich, R.; Fulbright, Jon P.; Valenti, Elena; McWilliam, Andrew E-mail: rmr@astro.ucla.edu E-mail: evalenti@eso.org

    2011-05-10

    We present Fe, Si, and Ca abundances for 61 giants in Plaut's window (l = -1{sup 0}, b = -8.{sup 0}5) and Fe abundances for an additional 31 giants in a second, nearby field (l = 0{sup 0}, b = -8{sup 0}) derived from high-resolution (R {approx} 25,000) spectra obtained with the Blanco 4 m telescope and Hydra multifiber spectrograph. The median metallicity of red giant branch (RGB) stars in the Plaut's field is {approx}0.4 dex lower than those in Baade's window, and confirms the presence of an iron abundance gradient along the bulge minor axis. The full metallicity range of our (biased) RGB sample spans -1.5 < [Fe/H] < +0.3, which is similar to that found in other bulge fields. We also derive a photometric metallicity distribution function for RGB stars in the (l = -1{sup 0}, b = -8{sup 0}.5) field and find very good agreement with the spectroscopic metallicity distribution. The radial velocity (RV) and dispersion data for the bulge RGB stars are in agreement with previous results of the Bulge Radial Velocity Assay survey, and we find evidence for a decreasing velocity dispersion with increasing [Fe/H]. The [{alpha}/Fe] enhancement in Plaut field stars is nearly identical to that observed in Baade's window, and suggests that an [{alpha}/Fe] gradient does not exist between b = -4{sup 0} and -8{sup 0}. Additionally, a subset of our sample (23 stars) appears to be foreground red clump stars that are very metal rich, exhibit small metallicity and RV dispersions, and are enhanced in {alpha} elements. While these stars likely belong to the Galactic inner disk population, they exhibit [{alpha}/Fe] ratios that are enhanced above the thin and thick disk.

  1. Synthesis of anticholinergic agents: N-methyl-4-piperidinyl alpha-benzoyloxy-alpha-cyclopentylphenylacetate salts.

    PubMed

    Oroshnik, W; Soldati, G

    1978-05-01

    The synthesis of a new anticholinergic agent, N-methyl-4-piperidinyl alpha-benzoyloxy-alpha-cyclopentylphenylacetate, obtained by reacting N-methyl-4-piperidinyl alpha-cyclopentylmandelate with benzoyl chloride in the presence of methyllithium, is reported. This material may be useful as an antiperspirant.

  2. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ...-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL....-phenyl-, ethyl ester. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  3. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ...-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL....-phenyl-, ethyl ester. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  4. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ...-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL....-phenyl-, ethyl ester. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester (PMN...

  5. Resting-State Alpha in Autism Spectrum Disorder and Alpha Associations with Thalamic Volume

    ERIC Educational Resources Information Center

    Edgar, J. Christopher; Heiken, Kory; Chen, Yu-Han; Herrington, John D.; Chow, Vivian; Liu, Song; Bloy, Luke; Huang, Mingxiong; Pandey, Juhi; Cannon, Katelyn M.; Qasmieh, Saba; Levy, Susan E.; Schultz, Robert T.; Roberts, Timothy P. L.

    2015-01-01

    Alpha circuits (8-12 Hz), necessary for basic and complex brain processes, are abnormal in autism spectrum disorder (ASD). The present study obtained estimates of resting-state (RS) alpha activity in children with ASD and examined associations between alpha activity, age, and clinical symptoms. Given that the thalamus modulates cortical RS alpha…

  6. Quantum Criticality and the (alpha)/(delta) Puzzle

    SciTech Connect

    Chapline, G

    2008-10-06

    In an overview of the elemental actinides Np and Pu stand out because of their anomalously low melting temperatures and the variety of complex phase transitions that occur in these elements and their alloys as a result of relatively modest changes in temperature and pressure. In this paper we suggest a novel explanation based on an analogy between the evolution of the actinide ground state as a function of spin orbit coupling and the behavior of thin film superconductors in a magnetic field. The key point is that in 'bad metals' spin orbit interactions give rise to low energy monopole-like solitons with quantized spin currents, which play much the same role as Abrikosov vortices in thin film superconductors. In Np and {alpha}-Pu these solitons form an ordered solid, while in impurity stabilized {delta}-Pu they form a pair condensate. This provides a simple explanation for the heretofore unexplained phenomenology of {alpha}/{delta} transition. Near room temperature {delta}-Pu represents a novel form of condensed matter: a 'Planckian metal' analogous to the quark-gluon plasma.

  7. High-alpha space trucks

    SciTech Connect

    Cook, L.M.; Ball, J.

    1997-01-01

    Vertically-landing Reusable Launch Vehicles (RLVs) are the best hope of building a true {open_quotes}Space Truck{close_quotes} with current technology. Because they do not require a low angle-of-attack (AOA, or alpha) horizontal landing, they can be designed to operate exclusively at very high angles-of-attack. This offers savings in vehicle dry weight and complexity, which can be traded for significantly heavier payload, more ascent velocity, or extra design margin. The price for abandoning low angle-of-attack flight is reduced crossrange. To quantify the potential weight reduction, a trade study was performed to determine the relationship between a vehicle{close_quote}s maximum crossrange (angle-of-attack) and it{close_quote}s dry weight (payload margin). At the study conclusion, three vertically-landing (VL) vehicles provided multiple points on a payload weight vs. maximum crossrange curve, showing significant payload increases as crossrange is sacrificed. This is primarily the result of being able to simplify the structure, fly a cooler entry trajectory, and be aerodynamically stable through the entire flight. This reduces subsystem requirements and complexity, enhancing reliability. Further benefits are realized in reduced landing propellant requirements and simplifying or eliminating the {open_quotes}rotation{close_quotes} maneuver. This paper also suggests unique operability solutions that adapt high-alpha vehicles to traditional high-crossrange missions such as the polar {open_quotes}once-around{close_quotes} flight, and proposes a small scale drop-test program to prove the subsonic and landing portion of the flight envelope. {copyright} {ital 1997 American Institute of Physics.}

  8. Targeted alpha therapy: evidence for potential efficacy of alpha-immunoconjugates in the management of micrometastatic cancer.

    PubMed

    Allen, B J

    1999-11-01

    There can be little doubt that one of the most important problems in the management of cancer is control of metastatic disease. This objective must be achieved ideally with a systemic therapeutic modality that targets cancer cells and gives minimal collateral damage to critical normal cells. The efficacy of targeted cancer therapy relies on the ability of a toxin to be located in the target cancer cell. The ideal toxin is one that is active only in the cancer cell, and not in critical normal cells. Failing this, the next best approach is a toxin with a short effective lifetime to target early stage micrometastatic disease. This rules out chemical toxins, given that they remain effective until excreted from the body, and localization of dose to the cancer cell rules out beta-emitting radio-isotopes (RI). Alpha-emitting RI, however, are much more appropriate toxins because they are short-lived and because their cytotoxicity is the result of their high rate of energy loss and short range of the alpha particles. These radionuclides have properties that are particularly suited for the elimination of single cells in transit or small nests of cancer cells. In vitro and in vivo experiments with alpha RI show dramatic superiority over beta RI. Only a few nuclear hits are needed to kill cells, and the formation of metastatic lung lesions and subcutaneous lesions in mice can be inhibited by systemic administration of alpha emitters. But alpha RI have not been able to control solid tumours, for which beta RI are better suited. A small number of alpha-emitting radionuclides are currently under investigation. These are terbium (Tb)-149, astatine (At)-211, bismuth (Bi)-212 and Bi-213. Terbium-149 and At-211 both require accelerators in close proximity to the place of application. The Bi isotopes are produced by long-lived parents and, as such, can be obtained from generators. The first phase-1 dose escalation trial with Bi-213 radioimmunoconjugate (RIC) commenced in New York in

  9. Arrangements of alpha-globin gene cluster in Taiwan.

    PubMed

    Peng, H W; Choo, K B; Ho, C H; Yen, M S; Liung, W Y; Lin, C K; Yang, Z L; Ng, H T; Ching, K N; Han, S H

    1989-01-01

    In a gene mapping study on 217 newborn babies in Taiwan with alpha- and zeta-globin probes, we have observed 4 cases (1.84%) of alpha-thalassemia-2 heterozygotes (zeta zeta-alpha/zeta zeta alpha alpha) without increased levels of hemoglobin (Hb) Bart's in the cord blood. Eleven subjects (5.07%) were found to have the South East Asian alpha-thalassemia-1 haplotype (zeta zeta--SEA/zeta zeta alpha alpha) with increased Hb Bart's levels ranging from 2.2 to 9%. One case, with Hb Bart's level of 14% in the cord blood, was found to have the genotype of zeta zeta--SEA/zeta zeta alpha alpha T (0.46%). Four heterozygotes (1.84%) were found with the triple alpha gene anti-rightward arrangement (zeta zeta alpha alpha alpha 3.7/zeta zeta alpha alpha). Twenty-one heterozygotes (9.68%) were found to have the triple zeta-globin gene arrangement (zeta zeta zeta alpha alpha/zeta zeta alpha alpha). A new triple zeta-globin gene variant with a BamHI polymorphism was also observed in this study.

  10. Alpha Biofeedback Conditioning and Retarded Subjects.

    ERIC Educational Resources Information Center

    Martin, Walter; And Others

    1981-01-01

    An experimental group of three institutionalized severely retarded adult males received binary tone feedback for alpha production while a control group (3) followed identical procedures without feedback. Analysis revealed significant difference between groups in alpha percentage increase over baseline, encouraging research on applications for…

  11. Elementary Processes Underlying Alpha Channeling in Tokamaks

    SciTech Connect

    NM.J. Fisch

    2012-06-15

    Alpha channeling in tokamaks is speculative, but also extraordinarily attractive. Waves that can accomplish this effect have been identified. Key aspects of the theory now enjoy experimental confirmation. This paper will review the elementary processes of wave-particle interactions in plasma that underlie the alpha channeling effect

  12. Alpha-1 Antitrypsin Deficiency (Inherited Emphysema)

    MedlinePlus

    ... 1 protein in the blood with normal alpha-1 antitrypsin from healthy plasma donors. It is given in a vein (IV). The dose is adjusted based on body weight. This treatment is often given once a week. There are three ... the management of Alpha-1 related emphysema includes: • Exercise and a healthy lifestyle ...

  13. Psychiatric Symptoms in Alpha-Mannosidosis

    ERIC Educational Resources Information Center

    Malm, D.; Pantel, J.; Linaker, O. M.

    2005-01-01

    Alpha-mannosidosis is characterized by mild to moderate intellectual disability (ID), moderate to severe neurosensory hearing loss, frequent infections, psychomotor disturbances and skeletal dysmorphism. For the first time, a panel of nine alpha-mannosidosis patients with psychiatric symptoms is presented. The clinical picture has several…

  14. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2014-04-01 2014-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY ALCOHOL FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  15. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2012-04-01 2012-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  16. Remote Associates Test and Alpha Brain Waves

    ERIC Educational Resources Information Center

    Haarmann, Henk J.; George, Timothy; Smaliy, Alexei; Dien, Joseph

    2012-01-01

    Previous studies found that performance on the remote associates test (RAT) improves after a period of incubation and that increased alpha brain waves over the right posterior brain predict the emergence of RAT insight solutions. We report an experiment that tested whether increased alpha brain waves during incubation improve RAT performance.…

  17. Atypical Alpha Asymmetry in Adults with ADHD

    ERIC Educational Resources Information Center

    Hale, T. Sigi; Smalley, Susan L.; Hanada, Grant; Macion, James; McCracken, James T.; McGough, James J.; Loo, Sandra K.

    2009-01-01

    Introduction: A growing body of literature suggests atypical cerebral asymmetry and interhemispheric interaction in ADHD. A common means of assessing lateralized brain function in clinical populations has been to examine the relative proportion of EEG alpha activity (8-12 Hz) in each hemisphere (i.e., alpha asymmetry). Increased rightward alpha…

  18. Commentary on Coefficient Alpha: A Cautionary Tale

    ERIC Educational Resources Information Center

    Green, Samuel B.; Yang, Yanyun

    2009-01-01

    The general use of coefficient alpha to assess reliability should be discouraged on a number of grounds. The assumptions underlying coefficient alpha are unlikely to hold in practice, and violation of these assumptions can result in nontrivial negative or positive bias. Structural equation modeling was discussed as an informative process both to…

  19. Teaching Calculus with Wolfram|Alpha

    ERIC Educational Resources Information Center

    Dimiceli, Vincent E.; Lang, Andrew S. I. D.; Locke, LeighAnne

    2010-01-01

    This article describes the benefits and drawbacks of using Wolfram|Alpha as the platform for teaching calculus concepts in the lab setting. It is a result of our experiences designing and creating an entirely new set of labs using Wolfram|Alpha. We present the reasoning behind our transition from using a standard computer algebra system (CAS) to…

  20. Coefficient Alpha Bootstrap Confidence Interval under Nonnormality

    ERIC Educational Resources Information Center

    Padilla, Miguel A.; Divers, Jasmin; Newton, Matthew

    2012-01-01

    Three different bootstrap methods for estimating confidence intervals (CIs) for coefficient alpha were investigated. In addition, the bootstrap methods were compared with the most promising coefficient alpha CI estimation methods reported in the literature. The CI methods were assessed through a Monte Carlo simulation utilizing conditions…

  1. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2013-04-01 2013-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY ALCOHOL FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  2. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  3. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2011-04-01 2011-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  4. Inhibitory spectrum of alpha 2-plasmin inhibitor.

    PubMed

    Saito, H; Goldsmith, G H; Moroi, M; Aoki, N

    1979-04-01

    alpha 2-Plasmin inhibitor (alpha 2PI) has been recently characterized as a fast-reacting inhibitor of plasmin in human plasma and appears to play an important role in the regulation of fibrinolysis in vivo. We have studied the effect of purified alpha 2PI upon various proteases participating in human blood coagulation and kinin generation. At physiological concentration (50 microgram/ml), alpha 2PI inhibited the clot-promoting and prekallikrein-activating activity of Hageman factor fragments, the amidolytic, kininogenase, and clot-promoting activities of plasma kallikrein, and the clot-promoting properties of activated plasma thromboplastin antecedent (PTA, Factor XIa) and thrombin. alpha 2PI had minimal inhibitory effect on surface-bound activated PTA and activated Stuart factor (Factor Xa). alpha 2PI did not inhibit the activity of activated Christmas factor (Factor IXa) or urinary kallikrein. Heparin (1.5-2.0 units/ml) did not enhance the inhibitory function of alpha 2PI. These results suggest that, like other plasma protease inhibitors, alpha 2PI possesses a broad in vitro spectrum of inhibitory properties.

  5. Two distinct alpha-interferon-dependent signal transduction pathways may contribute to activation of transcription of the guanylate-binding protein gene

    SciTech Connect

    Decker, T.; Lew, D.J.; Darnell, J.E. Jr. )

    1991-10-01

    The promoter of the gene encoding a cytoplasmic guanylate-binding (GBP) contains two overlapping elements: the interferon stimulation response element (ISRE), which mediates alpha interferon (IFN-{alpha})-dependent transcription, and the IFN-{gamma} activation site (GAS), which is required for INF-{gamma}-mediated stimulation. The ISRE binds a factor called ISGF-3 that is activated by IFN-{alpha} but not by IFN-{gamma}. The GAS binds a protein that is activated by IFN-{gamma}, which the authors have termed GAF. The authors now find that the GAS is also an IFN-{alpha}-responsive element in vivo and that IFN-{alpha} (in addition to activating ISGF-3) rapidly activates a GAS-binding factor, the IFN-{alpha} activation factor (AAF). The AAF has characteristics very similar to those of the previously described GAF. Through the use of inhibitors of protein synthesis and inhibitors of protein kinases, the activation conditions of AAF, GAF, and ISGF-3 could be distinguished. Therefore, not only do IFN-{alpha} and IFN-{gamma} stimulate transcription of GBP through different receptors linked to different signaling molecules, but occupation of the IFN-{alpha} receptor apparently leads to the rapid activation of two different DNA-binding proteins through the use of different intracellular pathways.

  6. Suppression of hepatic prostaglandin F2 alpha in rats by dietary alpha-tocopherol acetate is independent of total hepatic alpha-tocopherol.

    PubMed

    Duitsman, P K; Chen, H W; Cook, L R; Hendrich, S

    1992-09-01

    Groups of eight weanling female F344/N rats were fed semipurified diets that supplied 0, 50, 500, 5000, or 15,000 mg alpha-tocopherol acetate/kg diet, with and without 0.05% phenobarbital (PB) for 9 weeks. Both plasma and hepatic alpha-tocopherol levels, measured by HPLC, strongly correlated with alpha-tocopherol intake (r greater than 0.73, p less than 0.0001). Phenobarbital both depleted hepatic alpha-tocopherol and increased plasma alpha-tocopherol significantly. Although treatment with PB for 9 weeks significantly increased GST activity, PB did not affect hepatic prostaglandin (PG)F2 alpha status, as determined by radioimmunoassay. PGF2 alpha was significantly greater (by 52%) in rats fed no alpha-tocopherol than in rats fed 15,000 mg alpha-tocopherol acetate/kg diet. Hepatic PGF2 alpha status was correlated inversely but weakly with dietary alpha-tocopherol (r = -0.24, p less than 0.05). Hepatic PGF2 alpha status was not correlated with hepatic or plasma alpha-tocopherol status. This finding suggests either that there is a small depletion-resistant subcellular alpha-tocopherol pool which regulates PGF2 alpha production or that alpha-tocopherol alters PGF2 alpha production in vivo by an indirect mechanism.

  7. Local Structure and Vibrational Properties of alpha-Pu, alpha-U, and the alpha-U Charge Density Wave

    SciTech Connect

    Nelson, E J; Allen, P G; Blobaum, K M; Wall, M A; Booth, C H

    2004-08-10

    The local atomic environment and vibrational properties of atoms in monoclinic pure {alpha}-plutonium as well as orthorhombic pure {alpha}-uranium and its low-temperature charge-density-wave (CDW) modulation are examined by extended x-ray absorption fine structure spectroscopy (EXAFS). Pu L{sub III}-edge and U L{sub III}-edge EXAFS data measured at low temperatures verify the crystal structures of {alpha}-U and {alpha}-Pu samples previously determined by x-ray diffraction and neutron scattering. Debye-Waller factors from temperature-dependent EXAFS measurements are fit with a correlated Debye model. The observed Pu-Pu bond correlated Debye temperature of {theta}{sub cD}({alpha}-Pu) = 162 {+-} 5 K for the pure {alpha}-Pu phase agrees with our previous measurement of the correlated Debye temperature of the gallium-containing {alpha}'-Pu phase in a mixed phase 1.9 at% Ga-doped {alpha}'-Pu/{delta}-Pu alloy. The temperature dependence of the U-U nearest neighbor Debye-Waller factor exhibits a sharp discontinuity in slope near T{sub CDW} = 43 K, the transition temperature at which the charge-density wave (CDW) in {alpha}-U condenses from a soft phonon mode along the (100) direction. Our measurement of the CDW using EXAFS is the first observation of the structure of the CDW in polycrystalline {alpha}-U. The different temperature dependence of the Debye-Waller factor for T < T{sub CDW} can be modeled by the change in bond length distributions resulting from condensation of the charge density wave. For T > T{sub CDW}, the observed correlated Debye temperature of {theta}{sub cD}({alpha}-U) = 199 {+-} 3 K is in good agreement with other measurements of the Debye temperature for polycrystalline {alpha}-U. CDW structural models fit to the {alpha}-U EXAFS data support a squared CDW at the lowest temperatures, with a displacement amplitude of {var_epsilon} = 0.05 {+-} 0.02 {angstrom}.

  8. Cloning and comparative analysis of gene structure in promoter site of alpha-s1 casein gene in Naeinian goat and sheep

    PubMed Central

    Najafi, Mojtaba; Rahimi Mianji, Ghodrat; Ansari Pirsaraie, Zarbakht

    2014-01-01

    The 5′ end or alpha-S1 casein promoter has a significant role in milk protein gene expression. The understanding of the translation process of alpha-S1 casein mutants will provide us an opportunity to make the best selection in livestock providing more proteins in milk. Blood samples were taken from three hundred of Naeinian goats and sheep, and DNA extraction was done using modified salting out method. Polymerase chain reactions (PCR) were carried out using a specific primer pairs for amplification a fragment of 1133 bp from part of 5′-UTR and exon 1 of alpha s1 casein gene. The AluI and HinfI restriction enzyme treatment of all samples provided the same homozygous AA genotype in both species. Subsequently, one sample of each species was selected and cloned, and the final sequences were analyzed by BioEdit, CLC genomic, Mega4 and DNASIS MAX software. Several polymorphisms are recognized between Naeinian goat and sheep that are presented on motif sites. In this research, the interested location, including exon I and a part of 5′, was analyzed, and genetic element comparisons were done between Naeinian goat and sheep. The number and location of probable binding sites can have a crucial role as a result of antagonistic and synergistic effects on gene regulation activities. PMID:25606467

  9. Improved peak shape fitting in alpha spectra.

    PubMed

    Pommé, S; Caro Marroyo, B

    2015-02-01

    Peak overlap is a recurrent issue in alpha-particle spectrometry, not only in routine analyses but also in the high-resolution spectra from which reference values for alpha emission probabilities are derived. In this work, improved peak shape formulae are presented for the deconvolution of alpha-particle spectra. They have been implemented as fit functions in a spreadsheet application and optimum fit parameters were searched with built-in optimisation routines. Deconvolution results are shown for a few challenging spectra with high statistical precision. The algorithm outperforms the best available routines for high-resolution spectrometry, which may facilitate a more reliable determination of alpha emission probabilities in the future. It is also applicable to alpha spectra with inferior energy resolution. PMID:25497323

  10. Homomers of alpha 8 and alpha 7 subunits of nicotinic receptors exhibit similar channel but contrasting binding site properties.

    PubMed

    Gerzanich, V; Anand, R; Lindstrom, J

    1994-02-01

    alpha 8 subunits of alpha-bungarotoxin-sensitive chick neuronal nicotinic acetylcholine receptors expressed in Xenopus oocytes from cRNA are shown to form homomeric, acetylcholine-gated, rapidly desensitizing, inwardly rectifying, Ca(2+)-permeable cation channels similar to those of alpha 7 homomers. alpha 8 forms oligomers of several sizes, of which < 14% are expressed on the oocyte surface, which is less efficient than for alpha 7 homomers. alpha 8 homomers are more sensitive to agonists but less sensitive to antagonists than are alpha 7 homomers, and some agonists for alpha 8 homomers are partial agonists or antagonists for alpha 7 homomers. The pharmacological properties of homomers of alpha 8 and alpha 7 subunits generally reflect those of native alpha 8 and alpha 7 receptors.

  11. Catalytic Mechanism of Human Alpha-galactosidase

    SciTech Connect

    Guce, A.; Clark, N; Salgado, E; Ivanen, D; Kulinskaya, A; Brumer, H; Garman, S

    2010-01-01

    The enzyme {alpha}-galactosidase ({alpha}-GAL, also known as {alpha}-GAL A; E.C. 3.2.1.22) is responsible for the breakdown of {alpha}-galactosides in the lysosome. Defects in human {alpha}-GAL lead to the development of Fabry disease, a lysosomal storage disorder characterized by the buildup of {alpha}-galactosylated substrates in the tissues. {alpha}-GAL is an active target of clinical research: there are currently two treatment options for Fabry disease, recombinant enzyme replacement therapy (approved in the United States in 2003) and pharmacological chaperone therapy (currently in clinical trials). Previously, we have reported the structure of human {alpha}-GAL, which revealed the overall structure of the enzyme and established the locations of hundreds of mutations that lead to the development of Fabry disease. Here, we describe the catalytic mechanism of the enzyme derived from x-ray crystal structures of each of the four stages of the double displacement reaction mechanism. Use of a difluoro-{alpha}-galactopyranoside allowed trapping of a covalent intermediate. The ensemble of structures reveals distortion of the ligand into a {sup 1}S{sub 3} skew (or twist) boat conformation in the middle of the reaction cycle. The high resolution structures of each step in the catalytic cycle will allow for improved drug design efforts on {alpha}-GAL and other glycoside hydrolase family 27 enzymes by developing ligands that specifically target different states of the catalytic cycle. Additionally, the structures revealed a second ligand-binding site suitable for targeting by novel pharmacological chaperones.

  12. Zinc deficiency and the Euglena gracilis chromatin: formation of an alpha-amanitin-resistant RNA polymerase II.

    PubMed

    Falchuk, K H; Mazus, B; Ber, E; Ulpino-Lobb, L; Vallee, B L

    1985-05-01

    Both the single DNA-dependent RNA polymerase found in zinc-deficient (-Zn) Euglena gracilis and the RNA polymerase III from zinc-sufficient (+Zn) cells have been isolated by methods previously used to purify polymerases I and II [Falchuk, K. H., Mazus, B., Ulpino, L., & Vallee, B. L. (1976) Biochemistry 15, 4468; Falchuk, K. H., Mazus, B., Ulpino, L., & Vallee, B. L. (1977) Biochem. Biophys. Res. Commun. 74, 1206]. Like class II polymerases, the enzyme from -Zn organisms elutes from DNA-cellulose and phosphocellulose with 0.6 M NaCl and 0.35 M NH4Cl, respectively. It is inhibited by 8-hydroxyquinoline, 8-hydroxyquinoline-5-sulfonic acid, alpha,alpha'-bipyridyl, dipicolinic acid, and 1,10-phenanthroline (OP); 4,7-phenanthroline, the nonchelating analogue, does not inhibit. The pKI(OP) of this enzyme is identical with that of polymerase II but distinct from those of polymerases I and III. Elemental analysis confirms that zinc is the functional metal while copper, manganese, iron, and magnesium are absent. However, the -Zn enzyme is at least 4 orders of magnitude more resistant to alpha-amanitin (alpha-A) than the class II polymerase. Further, its response to alpha-A is unlike that of either polymerase I or polymerase III. Thus, -Zn cells contain a single, alpha-amanitin-resistant (alpha-Ar) RNA polymerase, whose behavior otherwise resembles that of the alpha-amanitin-sensitive polymerase II.

  13. Coactivator PGC-1{alpha} regulates the fasting inducible xenobiotic-metabolizing enzyme CYP2A5 in mouse primary hepatocytes

    SciTech Connect

    Arpiainen, Satu; Jaervenpaeae, Sanna-Mari; Manninen, Aki; Viitala, Pirkko; Lang, Matti A.; Pelkonen, Olavi; Hakkola, Jukka

    2008-10-01

    The nutritional state of organisms and energy balance related diseases such as diabetes regulate the metabolism of xenobiotics such as drugs, toxins and carcinogens. However, the mechanisms behind this regulation are mostly unknown. The xenobiotic-metabolizing cytochrome P450 (CYP) 2A5 enzyme has been shown to be induced by fasting and by glucagon and cyclic AMP (cAMP), which mediate numerous fasting responses. Peroxisome proliferator-activated receptor {gamma} coactivator (PGC)-1{alpha} triggers many of the important hepatic fasting effects in response to elevated cAMP levels. In the present study, we were able to show that cAMP causes a coordinated induction of PGC-1{alpha} and CYP2A5 mRNAs in murine primary hepatocytes. Furthermore, the elevation of the PGC-1{alpha} expression level by adenovirus mediated gene transfer increased CYP2A5 transcription. Co-transfection of Cyp2a5 5' promoter constructs with the PGC-1{alpha} expression vector demonstrated that PGC-1{alpha} is able to activate Cyp2a5 transcription through the hepatocyte nuclear factor (HNF)-4{alpha} response element in the proximal promoter of the Cyp2a5 gene. Chromatin immunoprecipitation assays showed that PGC-1{alpha} binds, together with HNF-4{alpha}, to the same region at the Cyp2a5 proximal promoter. In conclusion, PGC-1{alpha} mediates the expression of CYP2A5 induced by cAMP in mouse hepatocytes through coactivation of transcription factor HNF-4{alpha}. This strongly suggests that PGC-1{alpha} is the major factor mediating the fasting response of CYP2A5.

  14. Sumoylation and the function of CCAAT enhancer binding protein alpha (C/EBP alpha).

    PubMed

    Khanna-Gupta, Arati

    2008-01-01

    CCAAT enhancer binding protein alpha (C/EBP alpha) is the founding member of a family of basic region/leucine zipper (bZIP) transcription factors and is a master regulator of granulopoiesis. It is expressed at high levels throughout myeloid differentiation and binds to the promoters of multiple myeloid-specific genes at different stages of myeloid maturation. Profound hematopoietic abnormalities occur in mice nullizygous for C/EBP alpha including a selective early block in the differentiation of granulocytes. Mutations in C/EBP alpha are present in a subset of patients with AML presenting with a normal karyotype. These mutations can result in the expression of a 30 kDa dominant negative C/EBP alpha isoform, which contributes to loss of C/EBP alpha function. The molecular basis for this observation remains unknown. In addition to phosphorylation, C/EBP alpha is modified, post-translationally by a small ubiquitin-related modifier (SUMO) at a lysine residue (K159), which lies within the growth inhibitory region of the C/EBP alpha protein. Sumoylation at K159 in the C/EBP alpha protein prevents association of the SWI/SNF chromatin remodeling complex with C/EBP alpha, thereby hampering transactivation. In this review, the functional implications of post-translational modification, particularly sumoylation, of C/EBP alpha in normal granulopoiesis and leukemia are considered. PMID:18406180

  15. Folate receptor {alpha} regulates cell proliferation in mouse gonadotroph {alpha}T3-1 cells

    SciTech Connect

    Yao, Congjun; Evans, Chheng-Orn; Stevens, Victoria L.; Owens, Timothy R.; Oyesiku, Nelson M.

    2009-11-01

    We have previously found that the mRNA and protein levels of the folate receptor alpha (FR{alpha}) are uniquely over-expressed in clinically human nonfunctional (NF) pituitary adenomas, but the mechanistic role of FR{alpha} has not fully been determined. We investigated the effect of FR{alpha} over-expression in the mouse gonadotroph {alpha}T3-1 cell line as a model for NF pituitary adenomas. We found that the expression and function of FR{alpha} were strongly up-regulated, by Western blotting and folic acid binding assay. Furthermore, we found a higher cell growth rate, an enhanced percentage of cells in S-phase by BrdU assay, and a higher PCNA staining. These observations indicate that over-expression of FR{alpha} promotes cell proliferation. These effects were abrogated in the same {alpha}T3-1 cells when transfected with a mutant FR{alpha} cDNA that confers a dominant-negative phenotype by inhibiting folic acid binding. Finally, by real-time quantitative PCR, we found that mRNA expression of NOTCH3 was up-regulated in FR{alpha} over-expressing cells. In summary, our data suggests that FR{alpha} regulates pituitary tumor cell proliferation and mechanistically may involve the NOTCH pathway. Potentially, this finding could be exploited to develop new, innovative molecular targeted treatment for human NF pituitary adenomas.

  16. Alpha1 and Alpha2 Integrins Mediate Invasive Activity of Mouse Mammary Carcinoma Cells through Regulation of Stromelysin-1 Expression

    SciTech Connect

    Lochter, Andre; Navre, Marc; Werb, Zena; Bissell, Mina J

    1998-06-29

    Tumor cell invasion relies on cell migration and extracellular matrix proteolysis. We investigated the contribution of different integrins to the invasive activity of mouse mammary carcinoma cells. Antibodies against integrin subunits {alpha}6 and {beta}1, but not against {alpha}1 and {alpha}2, inhibited cell locomotion on a reconstituted basement membrane in two-dimensional cell migration assays, whereas antibodies against {beta}1, but not against a6 or {alpha}2, interfered with cell adhesion to basement membrane constituents. Blocking antibodies against {alpha}1 integrins impaired only cell adhesion to type IV collagen. Antibodies against {alpha}1, {alpha}2, {alpha}6, and {beta}1, but not {alpha}5, integrin subunits reduced invasion of a reconstituted basement membrane. Integrins {alpha}1 and {alpha}2, which contributed only marginally to motility and adhesion, regulated proteinase production. Antibodies against {alpha}1 and {alpha}2, but not {alpha}6 and {beta}1, integrin subunits inhibited both transcription and protein expression of the matrix metalloproteinase stromelysin-1. Inhibition of tumor cell invasion by antibodies against {alpha}1 and {alpha}2 was reversed by addition of recombinant stromelysin-1. In contrast, stromelysin-1 could not rescue invasion inhibited by anti-{alpha}6 antibodies. Our data indicate that {alpha}1 and {alpha}2 integrins confer invasive behavior by regulating stromelysin-1 expression, whereas {alpha}6 integrins regulate cell motility. These results provide new insights into the specific functions of integrins during tumor cell invasion.

  17. G alpha 12 and G alpha 13 subunits define a fourth class of G protein alpha subunits.

    PubMed Central

    Strathmann, M P; Simon, M I

    1991-01-01

    Heterotrimeric guanine nucleotide-binding regulatory proteins (G proteins) are central to the signaling processes of multicellular organisms. We have explored the diversity of the G protein subunits in mammals and found evidence for a large family of genes that encode the alpha subunits. Amino acid sequence comparisons show that the different alpha subunits fall into at least three classes. These classes have been conserved in animals separated by considerable evolutionary distances; they are present in mammals, Drosophila, and nematodes. We have now obtained cDNA clones encoding two murine alpha subunits, G alpha 12 and G alpha 13, that define a fourth class. The translation products are predicted to have molecular masses of 44 kDa and to be insensitive to ADP-ribosylation by pertussis toxin. They share 67% amino acid sequence identity with each other and less than 45% identity with other alpha subunits. Their transcripts can be detected in every tissue examined, although the relative levels of the G alpha 13 message appear somewhat variable. Images PMID:1905812

  18. Sensitivity to alpha-amylcinnamic aldehyde and alpha-amylcinnamic alcohol.

    PubMed

    Guin, J D; Haffley, P

    1983-01-01

    Sensitivity to alpha-amylcinnamic aldehyde (alpha-AcAld) is apparently uncommon, but, like allergy to alpha-amylcinnamic alcohol (alpha-AcAlc), it often accompanies allergy to the perfume in Mycolog cream. Although alpha-AcAlc is a known ingredient, alpha-AcAld is not. However, gas-liquid chromatographic analysis shows alpha-AcAld to be present. Of fourteen persons sensitive to either chemical, ten reacted to both. Of these, one man and three women were markedly sensitive, and all three women had chronic recalcitrant vulvar eczema. That condition might have been the cause as well as the result of sensitization, but reexposure to a suspected product reproduced the eruption in both persons tested. Its use with other potent sensitizers, e.g., ethylenediamine, to treat irritations and chronic eczemas in an area of high absorption may partly explain development of allergy to a relatively weak sensitizer.

  19. Effect of UVB on hydrolysis of alpha-tocopherol acetate to alpha-tocopherol in mouse skin.

    PubMed

    Kramer-Stickland, K; Liebler, D C

    1998-08-01

    We have assessed the hydrolysis of alpha-tocopherol acetate (alpha-TAc) to the active antioxidant alpha-tocopherol (alpha-TH) in mouse epidermis and in supernatant from epidermal homogenates. Topically administered alpha-TH prevents UVB photocarcinogenesis in C3H mice, whereas alpha-TAc does not. Hydrolysis in skin was monitored in mice treated topically with deuterium labeled alpha-TAc (d3-alpha-TAc). Epidermal samples were isolated from mice and analyzed for endogenous (d0-alpha-TAc) and d3-alpha-TH by gas chromatography-mass spectrometry. Within 24 h, the levels of d3-alpha-TH increased up to 10-fold over endogenous d0-alpha-TH levels; however, in mice irradiated with UVB prior to the application of d3-alpha-TAc, levels of d3-alpha-TH increased up to 30-40-fold over endogenous d0-alpha-TH. This enhancement of alpha-TAc hydrolysis increased with increasing UVB dose. Prior UVB exposure may increase hydrolysis of alpha-TAc by increasing epidermal esterase activity. Nonspecific esterase activity was measured in the 2000 x g supernatant from epidermis of unirradiated and irradiated mice. Alpha-napthyl acetate, a nonspecific esterase substrate, was converted to alpha-napthol in supernatants from unirradiated mice. Hydrolysis to alpha-napthol increased approximately 3-fold in supernatants from irradiated mice. Hydrolysis of alpha-TAc to alpha-TH also occurred in supernatant from unirradiated mice, and this hydrolysis increased approximately 3-fold in supernatant from irradiated animals. These data indicate that nonspecific esterase activity was increased by UVB in the skin, that alpha-TAc is converted to alpha-TH in the homogenate fraction containing nonspecific esterase, and that UVB exposure modulates the metabolism of alpha-TAc to alpha-TH in vivo.

  20. The gastrointestinal absorption of the actinide elements.

    PubMed

    Harrison, J D

    1991-03-01

    The greatest uncertainty in dose estimates for the ingestion of long-lived, alpha-emitting isotopes of the actinide elements is in the values used for their fractional absorption from the gastrointestinal tract (f1 values). Recent years have seen a large increase in the available data on actinide absorption. Human data are reviewed here, together with animal data, to illustrate the effect on absorption of chemical form, incorporation into food materials, fasting and other dietary factors, and age at ingestion. The f1 values recommended by the International Commission on Radiological Protection, by an Expert Group of the Nuclear Energy Agency and by the National Radiological Protection Board are discussed.

  1. The genes for the alpha 1(IV) and alpha 2(IV) chains of human basement membrane collagen type IV are arranged head-to-head and separated by a bidirectional promoter of unique structure.

    PubMed Central

    Pöschl, E; Pollner, R; Kühn, K

    1988-01-01

    The human basement membrane specific collagen type IV is a heterotrimer composed of two alpha 1(IV) chains and one alpha 2(IV) chain. A partial genomic EcoRI library was screened with cDNA clones representing the 5' end regions of the alpha 1(IV) and the alpha 2(IV) mRNA. A 2.2-kb genomic fragment was isolated and sequenced, which contains the 5' terminal exons of both genes located in close vicinity. The two genes were found to be arranged in opposite direction, head-to-head, separated only by a short region of 127 bp, apparently representing promoters of both genes as indicated by the existence of typical sequence motifs (CAT-box, SP1 consensus sequence). These data suggest that the alpha 1(IV) and alpha 2(IV) genes use a common, bidirectional promoter. The striking symmetrical arrangement of sequence elements within the promoter may be of basic importance for the coordination of bidirectional transcription. The promoter region had no detectable transcriptional activity in transient gene expression assays after fusion to the chloramphenicol acetylase (CAT) gene in either direction, indicating the necessity of additional elements for efficient and tissue-specific expression of both genes. Constructs containing different segments of both genes failed to identify regions with enhancing activity for the homologous collagen type IV promoter. When the heterologous HSV thymidine kinase promoter was used, a negatively acting region was identified. This indicates that the alpha 1(IV) and alpha 2(IV) promoter activity is controlled by additional regulatory elements present on distant portions of both genes. Images PMID:2846280

  2. Mapping High-Velocity H-alpha and Lyman-alpha Emission from Supernova 1987A

    NASA Technical Reports Server (NTRS)

    France, Kevin; McCray, Richard; Fransson, Claes; Larsson, Josefin; Frank, Kari A.; Burrows, David N.; Challis, Peter; Kirshner, Robert P.; Chevalier, Roger A.; Garnavich, Peter; Heng, Kevin; Lawrence, Stephen S.; Lundqvist, Peter; Smith, Nathan; Sonneborn, George

    2015-01-01

    We present new Hubble Space Telescope images of high-velocity H-alpha and Lyman-alpha emission in the outer debris of SN 1987A. The H-alpha images are dominated by emission from hydrogen atoms crossing the reverse shock. For the first time we observe emission from the reverse shock surface well above and below the equatorial ring, suggesting a bipolar or conical structure perpendicular to the ring plane. Using the H-alpha imaging, we measure the mass flux of hydrogen atoms crossing the reverse shock front, in the velocity intervals (-7,500 < V(sub obs) < -2,800 km/s) and (1,000 < V(sub obs) < 7,500 km/s), ?M(sub H) = 1.2 × 10(exp -3) M/ y. We also present the first Lyman-alpha imaging of the whole remnant and new Chandra X-ray observations. Comparing the spatial distribution of the Lyman-alpha and X-ray emission, we observe that the majority of the high-velocity Lyman-alpha emission originates interior to the equatorial ring. The observed Lyman-alpha/H-alpha photon ratio, R(L-alpha/H-alpha) approx. = 17, is significantly higher than the theoretically predicted ratio of approx. = 5 for neutral atoms crossing the reverse shock front. We attribute this excess to Lyman-alpha emission produced by X-ray heating of the outer debris. The spatial orientation of the Lyman-alpha and X-ray emission suggests that X-ray heating of the outer debris is the dominant Lyman-alpha production mechanism in SN 1987A at this phase in its evolution.

  3. [Contents and its change during storage of alpha-solanine and alpha-chaconine in potatoes].

    PubMed

    Shindo, Tetsuya; Ushiyama, Hirofumi; Kan, Kimiko; Yasuda, Kazuo; Saito, Kazuo

    2004-10-01

    Contents of alpha-solanine and alpha-chaconine in native species of potato (May Queen, Danshaku and Waseshiro), and in species (Jagakids Red '90 (Red) and Jagakids Purple '90 (Purple)) on the market, and their change during storage at room temparature were investigated. alpha-Solanine and alpha-chaconine were extracted from potatoes with methanol, cleaned up by using a Sep-Pak Plus C18 cartridge, and then subjected to HPLC. The recoveries of alpha-solanine and alpha-chaconine from potatoes were both more than 96%, and the quantitation limits were both 2 microg/g. alpha-Solanine and alpha-chaconine were detected in periderm in all samples at the levels of 260-320 microg/g in May Queen,190-240 microg/g in Danshaku, 43-63 microg/g in Waseshiro, 140-200 microg/g in Red and 84-130 microg/g in Purple, respectively. alpha-Solanine and alpha-chaconine were detected in the cortex in all samples of May Queen and Danshaku at the levels of 2.7-12 microg/g and 5.8-31 microg/g, respectively. Contents of alpha-solanine and alpha-chaconine in the cortex of May Queen and Danshaku were less than 10% of those in the periderm. When potatoes were stored for 90 days at room temparature in a dark place, no marked change in the contents of alpha-solanine and alpha-chaconine was observed in any of the potato samples.

  4. [Contents and its change during storage of alpha-solanine and alpha-chaconine in potatoes].

    PubMed

    Shindo, Tetsuya; Ushiyama, Hirofumi; Kan, Kimiko; Yasuda, Kazuo; Saito, Kazuo

    2004-10-01

    Contents of alpha-solanine and alpha-chaconine in native species of potato (May Queen, Danshaku and Waseshiro), and in species (Jagakids Red '90 (Red) and Jagakids Purple '90 (Purple)) on the market, and their change during storage at room temparature were investigated. alpha-Solanine and alpha-chaconine were extracted from potatoes with methanol, cleaned up by using a Sep-Pak Plus C18 cartridge, and then subjected to HPLC. The recoveries of alpha-solanine and alpha-chaconine from potatoes were both more than 96%, and the quantitation limits were both 2 microg/g. alpha-Solanine and alpha-chaconine were detected in periderm in all samples at the levels of 260-320 microg/g in May Queen,190-240 microg/g in Danshaku, 43-63 microg/g in Waseshiro, 140-200 microg/g in Red and 84-130 microg/g in Purple, respectively. alpha-Solanine and alpha-chaconine were detected in the cortex in all samples of May Queen and Danshaku at the levels of 2.7-12 microg/g and 5.8-31 microg/g, respectively. Contents of alpha-solanine and alpha-chaconine in the cortex of May Queen and Danshaku were less than 10% of those in the periderm. When potatoes were stored for 90 days at room temparature in a dark place, no marked change in the contents of alpha-solanine and alpha-chaconine was observed in any of the potato samples. PMID:15678944

  5. A new alpha chain hemoglobin variant: Hb Al-Hammadi Riyadh [alpha75(EF4)Asp-->Val (alpha2)].

    PubMed

    Burnichon, Nelly; Lacan, Philippe; Becchi, Michel; Zanella-Cleon, Isabelle; Aubry, Martine; Mowafy, Mohammed; Couprie, Nicole; Francina, Alain

    2006-01-01

    A new hemoglobin (Hb) variant in the heterozygous state, Hb Al-Hammadi Riyadh [codon 75 (GAC-->GTC); alpha75(EF4)Asp-->Val (alpha2)] corresponding to an A-->T transversion on the second exon of the alpha2-globin gene, is described. The variant was characterized by DNA sequencing and mass spectrometry (MS). The variant was found during a routine Hb analysis for anemia in a 16-month-old boy who lived in Riyadh, Kingdom of Saudi Arabia.

  6. Genetics Home Reference: mucolipidosis III alpha/beta

    MedlinePlus

    ... Health Conditions mucolipidosis III alpha/beta mucolipidosis III alpha/beta Enable Javascript to view the expand/collapse ... PDF Open All Close All Description Mucolipidosis III alpha/beta is a slowly progressive disorder that affects ...

  7. Genetics Home Reference: mucolipidosis II alpha/beta

    MedlinePlus

    ... Health Conditions mucolipidosis II alpha/beta mucolipidosis II alpha/beta Enable Javascript to view the expand/collapse ... PDF Open All Close All Description Mucolipidosis II alpha/beta (also known as I-cell disease) is ...

  8. 24xi-Methyl 5 alpha-cholestane-3 alpha,6 beta,9 alpha,25-tetrol 24-monoacetate, a novel polyhydroxylated steroid from the soft coral Sarcophyton tortuosum.

    PubMed

    Su, J Y; Peng, T S; Long, K H; Zeng, L M

    1986-01-01

    A novel polyhydroxylated steroid, named sartortuosterol A, with rare 3 alpha- and 6-hydroxyl groups, was isolated from the South China Sea soft coral Sarcophyton tortuosum Tixier-Durivault, and its structure was established as 24xi-methyl 5 alpha-cholestane-3 alpha, 6 beta, 9 alpha,25-tetrol 25-monoacetate from spectroscopic data and chemical conversions.

  9. Application of neural network method to detect type of uranium contamination by estimation of activity ratio in environmental alpha spectra.

    PubMed

    Einian, M R; Aghamiri, S M R; Ghaderi, R

    2016-01-01

    The discrimination of the composition of environmental and non-environmental materials by the estimation of the (234)U/(238)U activity ratio in alpha-particle spectrometry is important in many applications. If the interfering elements are not completely separated from the uranium, they can interfere with the determination of (234)U. Thickness as a result of the existence of iron in the source preparation phase and their alpha lines can broaden the alpha line of (234)U in alpha spectra. Therefore, the asymmetric broadening of the alpha line of (234)U and overlapping of peaks make the analysis of the alpha particle spectra and the interpretation of the results difficult. Applying Artificial Neural Network (ANN) to a spectrometry system is a good idea because it eliminates limitations of classical approaches by extracting the desired information from the input data. In this work, the average of a partial uranium raw spectrum, were considered. Each point that its slope was of the order of 0-1% per 10 channels, was used as input to the multi-layer feed forward error-back propagation network. The network was trained by an alpha spectrum library which has been developed in the present work. The training data in this study was actual spectral data with any reasonable thickness and interfering elements. According to the results, the method applied to estimate the activity ratio in this work, can examine the alpha spectrum for peaks which would not be expected for a source of given element and provide the clues about composition of uranium contamination in the environmental samples in a fast screening and classifying procedures.

  10. Lucid dreaming and alpha activity: a preliminary report.

    PubMed

    Ogilvie, R D; Hunt, H T; Tyson, P D; Lucescu, M L; Jeakins, D B

    1982-12-01

    10 good dream recallers spent 2 nights in the sleep lab during which they were awakened 4 times per night from REM sleep, twice during their highest alpha activity in REM, and twice during low REM alpha. 5 were given alpha feedback training prior to sleep onset. Arousals from high alpha REM sleep yielded significantly higher lucidity ratings. Alpha feedback had no effect upon lucidity or REM alpha levels. Similarities between lucid dreams and meditative phenomena are discussed. PMID:7162915

  11. Lucid dreaming and alpha activity: a preliminary report.

    PubMed

    Ogilvie, R D; Hunt, H T; Tyson, P D; Lucescu, M L; Jeakins, D B

    1982-12-01

    10 good dream recallers spent 2 nights in the sleep lab during which they were awakened 4 times per night from REM sleep, twice during their highest alpha activity in REM, and twice during low REM alpha. 5 were given alpha feedback training prior to sleep onset. Arousals from high alpha REM sleep yielded significantly higher lucidity ratings. Alpha feedback had no effect upon lucidity or REM alpha levels. Similarities between lucid dreams and meditative phenomena are discussed.

  12. Applying alpha-channeling to mirror machines

    SciTech Connect

    Zhmoginov, A. I.; Fisch, N. J.

    2012-05-15

    The {alpha}-channeling effect entails the use of radio-frequency waves to expel and cool high-energetic {alpha} particles born in a fusion reactor; the device reactivity can then be increased even further by redirecting the extracted energy to fuel ions. Originally proposed for tokamaks, this technique has also been shown to benefit open-ended fusion devices. Here, the fundamental theory and practical aspects of {alpha} channeling in mirror machines are reviewed, including the influence of magnetic field inhomogeneity and the effect of a finite wave region on the {alpha}-channeling mechanism. For practical implementation of the {alpha}-channeling effect in mirror geometry, suitable contained weakly damped modes are identified. In addition, the parameter space of candidate waves for implementing the {alpha}-channeling effect can be significantly extended through the introduction of a suitable minority ion species that has the catalytic effect of moderating the transfer of power from the {alpha}-channeling wave to the fuel ions.

  13. Lyman alpha radiation in external galaxies

    NASA Technical Reports Server (NTRS)

    Neufeld, David A.; Mckee, Christopher F.

    1990-01-01

    The Ly alpha line of atomic hydrogen is often a luminous component of the radiation emitted by distant galaxies. Except for those galaxies which have a substantial central source of non-stellar ionizing radiation, most of the Ly alpha radiation emitted by galaxies is generated within regions of the interstellar medium which are photoionized by starlight. Conversely, much of the energy radiated by photoionized regions is carried by the Ly alpha line. Only hot, massive stars are capable of ionizing hydrogen in the interstellar medium which surrounds them, and because such stars are necessarily short-lived, Ly alpha emission traces regions of active star formation. Researchers argue that the strength of the Ly alpha emission observed from external galaxies may be used to estimate quantitatively the dust content of the emitting region, while the Ly alpha line profile is sensitive to the presence of shock waves. Interstellar dust particles and shock waves are intimately associated with the process of star formation in two senses. First, both dust particles and shock waves owe their existence to stellar activity; second, they may both serve as agents which facilitate the formation of stars, shocks by triggering gravitational instabilities in the interstellar gas that they compress, and dust by shielding star-forming molecular clouds from the ionizing and dissociative effects of external UV radiation. By using Ly alpha observations as a probe of the dust content in diffuse gas at high redshift, we might hope to learn about the earliest epochs of star formation.

  14. Element-ary Development.

    ERIC Educational Resources Information Center

    Schamp, Homer W., Jr.

    1989-01-01

    Describes the historic development of the periodic table from the four-element theory to the Lavoisier's table. Presents a table listing the old and new names of chemicals and the Lavoisier's table of elements. Lists two references. (YP)

  15. Trace Elements and Health

    ERIC Educational Resources Information Center

    Pettyjohn, Wayne A.

    1972-01-01

    Summarizes the effects of arsenic, lead, zinc, mercury, and cadmium on human health, indicates the sources of the elements in water, and considers the possibility of students in high schools analyzing water for trace amounts of the elements. (AL)

  16. Diagnostics for PLX-alpha

    NASA Astrophysics Data System (ADS)

    Gilmore, Mark; Hsu, Scott

    2015-11-01

    The goal of the Plasma Liner eXperiment PLX-alpha at Los Alamos National Laboratory is to establish the viability of creating a spherically imploding plasma liner for MIF and HED applications, using a spherical array of supersonic plasma jets launched by innovative contoured-gap coaxial plasma guns. PLX- α experiments will focus in particular on establishing the ram pressure and uniformity scalings of partial and fully spherical plasma liners. In order to characterize these parameters experimentally, a suite of diagnostics is planned, including multi-camera fast imaging, a 16-channel visible interferometer (upgraded from 8 channels) with reconfigurable, fiber-coupled front end, and visible and VUV high-resolution and survey spectroscopy. Tomographic reconstruction and data fusion techniques will be used in conjunction with interferometry, imaging, and synthetic diagnostics from modeling to characterize liner uniformity in 3D. Diagnostic and data analysis design, implementation, and status will be presented. Supported by the Advanced Research Projects Agency - Energy - U.S. Department of Energy.

  17. Lyman Alpha Spicule Observatory (LASO)

    NASA Technical Reports Server (NTRS)

    Chamberlin, Phillip C.

    2011-01-01

    The Lyman Alpha Spicule Observatory (LASO) sounding rocket will observe smallscale eruptive events called "Rapid Blue-shifted Events" (RBEs) [Rouppe van der Voort et al., 2009], the on-disk equivalent of Type-II spicules, and extend observations that explore their role in the solar coronal heating problem [De Pontieu et al., 2011]. LASO utilizes a new and novel optical design to simultaneously observe two spatial dimensions at 4.2" spatial resolution (2.1" pixels) over a 2'x2' field of view with high spectral resolution of 66mAngstroms (33mAngstroms pixels) across a broad 20Angstrom spectral window. This spectral window contains three strong chromospheric and transition region emissions and is centered on the strong Hydrogen Lyman-a emission at 1216Angstroms. This instrument makes it possible to obtain new data crucial to the physical understanding of these phenomena and their role in the overall energy and momentum balance from the upper chromosphere to lower corona. LASO was submitted March 2011 in response to the ROSES SHP-LCAS call.

  18. Diabetes and Alpha Lipoic Acid

    PubMed Central

    Golbidi, Saeid; Badran, Mohammad; Laher, Ismail

    2011-01-01

    Diabetes mellitus is a multi-faceted metabolic disorder where there is increased oxidative stress that contributes to the pathogenesis of this debilitating disease. This has prompted several investigations into the use of antioxidants as a complementary therapeutic approach. Alpha lipoic acid, a naturally occurring dithiol compound which plays an essential role in mitochondrial bioenergetic reactions, has gained considerable attention as an antioxidant for use in managing diabetic complications. Lipoic acid quenches reactive oxygen species, chelates metal ions, and reduces the oxidized forms of other antioxidants such as vitamin C, vitamin E, and glutathione. It also boosts antioxidant defense system through Nrf-2-mediated antioxidant gene expression and by modulation of peroxisome proliferator activated receptors-regulated genes. ALA inhibits nuclear factor kappa B and activates AMPK in skeletal muscles, which in turn have a plethora of metabolic consequences. These diverse actions suggest that lipoic acid acts by multiple mechanisms, many of which have only been uncovered recently. In this review we briefly summarize the known biochemical properties of lipoic acid and then discussed the oxidative mechanisms implicated in diabetic complications and the mechanisms by which lipoic acid may ameliorate these reactions. The findings of some of the clinical trials in which lipoic acid administration has been tested in diabetic patients during the last 10 years are summarized. It appears that the clearest benefit of lipoic acid supplementation is in patients with diabetic neuropathy. PMID:22125537

  19. Lyman Alpha Spicule Observatory (LASO)

    NASA Astrophysics Data System (ADS)

    Chamberlin, Phillip C.; Allred, J.; Airapetian, V.; Gong, Q.; Fontenla, J.; McIntosh, S.; de Pontieu, B.

    2011-05-01

    The Lyman Alpha Spicule Observatory (LASO) sounding rocket will observe small-scale eruptive events called "Rapid Blue-shifted Events” (RBEs), the on-disk equivalent of Type-II spicules, and extend observations that explore their role in the solar coronal heating problem. LASO utilizes a new and novel optical design to simultaneously observe two spatial dimensions at 4.2" spatial resolution (2.1” pixels) over a 2'x2' field of view with high spectral resolution of 66mÅ (33mÅ pixels) across a broad 20Å spectral window. This spectral window contains three strong chromospheric and transition region emissions and is centered on the strong Hydrogen Lyman-α emission at 1216Å. This instrument makes it possible to obtain new data crucial to the physical understanding of these phenomena and their role in the overall energy and momentum balance from the upper chromosphere to lower corona. LASO was submitted March 2011 in response to the ROSES SHP-LCAS call.

  20. Lyman Alpha Spicule Observatory (LASO)

    NASA Astrophysics Data System (ADS)

    Chamberlin, P. C.; Allred, J. C.; Airapetian, V.; Gong, Q.; Mcintosh, S. W.; De Pontieu, B.; Fontenla, J. M.

    2011-12-01

    The Lyman Alpha Spicule Observatory (LASO) sounding rocket will observe small-scale eruptive events called "Rapid Blue-shifted Events" (RBEs) [Rouppe van der Voort et al., 2009], the on-disk equivalent of Type-II spicules, and extend observations that explore their role in the solar coronal heating problem [De Pontieu et al., 2011]. LASO utilizes a new and novel optical design to simultaneously observe two spatial dimensions at 4.2" spatial resolution (2.1" pixels) over a 2'x2' field of view with high spectral resolution of 66mÅ (33mÅ pixels) across a broad 20Å spectral window. This spectral window contains three strong chromospheric and transition region emissions and is centered on the strong Hydrogen Lyman-α emission at 1216Å. This instrument makes it possible to obtain new data crucial to the physical understanding of these phenomena and their role in the overall energy and momentum balance from the upper chromosphere to lower corona. LASO was submitted March 2011 in response to the ROSES SHP-LCAS call.

  1. Orthotropic hole element

    NASA Technical Reports Server (NTRS)

    Markham, J. W.; Smith, C. V.

    1983-01-01

    A finite element was developed to adequately represent the state of stress in the region around a circular hole in orthotropic material experiencing reasonably general loading. This has been achieved through a complementary virtual work formulation of the stiffness and stress matrices for a square element with a center circular hole. The element has been incorporated into COSMIC/NASTRAN as a dummy element. Sample problems have been solved and these results are presented.

  2. Human cancers converge at the HIF-2alpha oncogenic axis.

    PubMed

    Franovic, Aleksandra; Holterman, Chet E; Payette, Josianne; Lee, Stephen

    2009-12-15

    Cancer development is a multistep process, driven by a series of genetic and environmental alterations, that endows cells with a set of hallmark traits required for tumorigenesis. It is broadly accepted that growth signal autonomy, the first hallmark of malignancies, can be acquired through multiple genetic mutations that activate an array of complex, cancer-specific growth circuits [Hanahan D, Weinberg RA (2000) The hallmarks of cancer. Cell 100:57-70; Vogelstein B, Kinzler KW (2004) Cancer genes and the pathways they control. Nat Med 10:789-799]. The superfluous nature of these pathways is thought to severely limit therapeutic approaches targeting tumor proliferation, and it has been suggested that this strategy be abandoned in favor of inhibiting more systemic hallmarks, including angiogenesis (Ellis LM, Hicklin DJ (2008) VEGF-targeted therapy: Mechanisms of anti-tumor activity. Nat Rev Cancer 8:579-591; Stommel JM, et al. (2007) Coactivation of receptor tyrosine kinases affects the response of tumor cells to targeted therapies. Science 318:287-290; Kerbel R, Folkman J (2002) Clinical translation of angiogenesis inhibitors. Nat Rev Cancer 2:727-739; Kaiser J (2008) Cancer genetics: A detailed genetic portrait of the deadliest human cancers. Science 321:1280-1281]. Here, we report the unexpected observation that genetically diverse cancers converge at a common and obligatory growth axis instigated by HIF-2alpha, an element of the oxygen-sensing machinery. Inhibition of HIF-2alpha prevents the in vivo growth and tumorigenesis of highly aggressive glioblastoma, colorectal, and non-small-cell lung carcinomas and the in vitro autonomous proliferation of several others, regardless of their mutational status and tissue of origin. The concomitant deactivation of select receptor tyrosine kinases, including the EGFR and IGF1R, as well as downstream ERK/Akt signaling, suggests that HIF-2alpha exerts its proliferative effects by endorsing these major pathways. Consistently

  3. Elemental Chemical Puzzlers

    ERIC Educational Resources Information Center

    Thomas, Nicholas C.

    2009-01-01

    This paper provides nine short chemically based puzzles or problems extensible for use with students from middle school to college. Some of these will strengthen students' recognition of individual elements and element names. Others require students to focus on the salient properties of given chemical elements.

  4. Organic Elemental Analysis.

    ERIC Educational Resources Information Center

    Ma, T. S.; Gutterson, Milton

    1980-01-01

    Reviews general developments in computerization and data processing of organic elemental analyses; carbon, hydrogen, and nitrogen analyzers; procedures for determining oxygen, sulfur, and halogens, as well as other nometallic elements and organometallics. Selected papers on trace analysis of nonmetals and determination of metallic elements are…

  5. Divergence of human [alpha]-chain constant region gene sequences: A novel recombinant [alpha]2 gene

    SciTech Connect

    Chintalacharuvu, K. R.; Morrison, S.L. ); Raines, M. )

    1994-06-01

    IgA is the major Ig synthesized in humans and provides the first line of defense at the mucosal surfaces. The constant region of IgA heavy chain is encoded by the [alpha] gene on chromosome 14. Previous studies have indicated the presence of two [alpha] genes, [alpha]1 and [alpha]2 existing in two allotypic forms, [alpha]2 m(1) and [alpha]2 m(2). Here the authors report the cloning and complete nucleotide sequence determination of a novel human [alpha] gene. Nucleotide sequence comparison with the published [alpha] sequences suggests that the gene arose as a consequence of recombination or gene conversion between the two [alpha]2 alleles. The authors have expressed the gene as a chimeric protein in myeloma cells indicating that it encodes a functional protein. The novel IgA resembles IgA2 m(2) in that disulfide bonds link H and L chains. This novel recombinant gene provides insights into the mechanisms of generation of different constant regions and suggests that within human populations, multiple alleles of [alpha] may be present providing IgAs of different structures.

  6. Fibrinogen {alpha} genes: Conservation of bipartite transcripts and carboxy-terminal-extended {alpha} subunits in vertebrates

    SciTech Connect

    Fu, Y.; Cao, Y.; Hertzberg, K.M.; Grieninger, G.

    1995-11-01

    All three well-studied subunits of the clotting protein fibrinogen ({alpha}, {beta}, {gamma}) share N-terminal structural homologies, but until recently only the {beta} and {gamma} chains were recognized as having similar globular C-termini. With the discovery of an extra exon in the human fibrinogen {alpha} gene (exon VI), a minor form of the {alpha} subunit ({alpha}{sub E}) with an extended {beta}- and {gamma}-like C-terminus has been identified. In the present study, the polymerase chain reaction has been used to identify sequences that encode counterparts to {alpha}{sub E} in chicken, rabbit, rat, and baboon. The basic six-exon structure of the fibrinogen {alpha} genes is shown to be conserved among mammals and birds, as are the intron positions. Bipartite transcripts - still bearing an intron prior to the last exon - are found among the products of the various vertebrate fibrinogen {alpha} genes. The last exon represents the largest conserved segment of the gene and, in each species examined, encodes exactly 236 amino acids. The C-termini of these {alpha}{sub E} chains align without a single gap and are between 76 and 99% identical. Since the exon VI-encoded domain of {alpha}{sub E} is as well conserved as the corresponding regions of the {beta} and {gamma} chains, it follows that it is equally important and that {alpha}{sub E}-fibrinogen plays a vital, if as-yet unrecognized physiological role. 21 refs., 7 figs., 1 tab.

  7. Variable displacement alpha-type Stirling engine

    NASA Astrophysics Data System (ADS)

    Homutescu, V. M.; Bălănescu, D. T.; Panaite, C. E.; Atanasiu, M. V.

    2016-08-01

    The basic design and construction of an alpha-type Stirling engine with on load variable displacement is presented. The variable displacement is obtained through a planar quadrilateral linkage with one on load movable ground link. The physico-mathematical model used for analyzing the variable displacement alpha-type Stirling engine behavior is an isothermal model that takes into account the real movement of the pistons. Performances and power adjustment capabilities of such alpha-type Stirling engine are calculated and analyzed. An exemplification through the use of the numerical simulation was performed in this regard.

  8. Alpha spectral analysis via artificial neural networks

    SciTech Connect

    Kangas, L.J.; Hashem, S.; Keller, P.E.; Kouzes, R.T.; Troyer, G.L.

    1994-10-01

    An artificial neural network system that assigns quality factors to alpha particle energy spectra is discussed. The alpha energy spectra are used to detect plutonium contamination in the work environment. The quality factors represent the levels of spectral degradation caused by miscalibration and foreign matter affecting the instruments. A set of spectra was labeled with a quality factor by an expert and used in training the artificial neural network expert system. The investigation shows that the expert knowledge of alpha spectra quality factors can be transferred to an ANN system.

  9. Determining cellular role of G alpha 12.

    PubMed

    Dermott, Jonathan M; Dhanasekaran, N

    2002-01-01

    Using the expression strategies described here, we have demonstrated a model system whereby the sequential signaling events involved in cell proliferation and subsequent transformation regulated by G alpha 12 can be investigated. The model system presented here can also be used to study the temporal interrelationships between small GTPases, kinases, and other signaling proteins involved in G alpha 12-signaling pathways. Further analyses using this model system and the strategies presented here should provide valuable clues in defining the signaling network regulated by G alpha 12 in stimulating cell proliferation and oncogenic transformation. PMID:11771390

  10. Cholesteryl ester hydroperoxides increase macrophage CD36 gene expression via PPAR{alpha}

    SciTech Connect

    Jedidi, Iness; Couturier, Martine; Therond, Patrice; Gardes-Albert, Monique; Legrand, Alain; Barouki, Robert; Bonnefont-Rousselot, Dominique; Aggerbeck, Martine . E-mail: Martine.Aggerbeck@univ-paris5.fr

    2006-12-22

    The uptake of oxidized LDL by macrophages is a key event in the development of atherosclerosis. The scavenger receptor CD36 is one major receptor that internalizes oxidized LDL. In differentiated human macrophages, we compared the regulation of CD36 expression by copper-oxidized LDL or their products. Only oxidized derivatives of cholesteryl ester (CEOOH) increased the amount of CD36 mRNA (2.5-fold). Both oxidized LDL and CEOOH treatment increased two to fourfold the transcription of promoters containing peroxisome-proliferator-activated-receptor responsive elements (PPRE) in the presence of PPAR{alpha} or {gamma}. Electrophoretic-mobility-shift-assays with nuclear extracts prepared from macrophages treated by either oxidized LDL or CEOOH showed increased binding of PPAR{alpha} to the CD36 gene promoter PPRE. In conclusion, CEOOH present in oxidized LDL increase CD36 gene expression in a pathway involving PPAR{alpha}.

  11. Combustion synthesis and effects of processing parameters on physical properties of {alpha}-alumina

    SciTech Connect

    Collins, M.V.; Hirschfeld, D.A.; Shea, L.E.

    2000-01-04

    Fine particle porous {alpha}-alumina has been prepared by a wet chemical method of combustion synthesis using an aqueous precursor containing aluminum nitrate (oxidizer) and carbohydrazide, an organic fuel as starting materials. The aluminum nitrate and carbohydrazide were reacted exothermically at 400--600 C. The synthesis of {alpha}-alumina ({alpha}-Al{sub 2}O{sub 3}) was used as a model for understanding the effects of processing parameters on physical properties such as surface area, average pore size, and residual carbon content. The porous powders were characterized using x-ray diffraction (XRD), scanning electron microscopy (SEM), BET surface area analysis and elemental analysis. The decomposition of the starting materials was investigated using differential thermal and thermogravimetric analyses (DTA/TGA). It has been shown that the furnace temperature, fuel/oxidizer ratio, and precursor water content can be tailored to produce powders with different physical properties.

  12. Coronae of Stars with Supersolar Elemental Abundances

    NASA Technical Reports Server (NTRS)

    Peretz, Uria; Behar, Ehud; Drake, Stephen A.

    2015-01-01

    Coronal elemental abundances are known to deviate from the photospheric values of their parent star, with the degree of deviation depending on the first ionization potential (FIP). This study focuses on the coronal composition of stars with supersolar photospheric abundances. We present the coronal abundances of six such stars: 11 LMi, iota Hor, HR 7291, tau Boo, and alpha Cen A and B. These stars all have high-statistics X-ray spectra, three of which are presented for the first time. The abundances we measured were obtained using the line-resolved spectra of the Reflection Grating Spectrometer (RGS) in conjunction with the higher throughput EPIC-pn camera spectra onboard the XMM-Newton observatory. A collisionally ionized plasma model with two or three temperature components is found to represent the spectra well. All elements are found to be consistently depleted in the coronae compared to their respective photospheres. For 11 LMi and tau Boo no FIP effect is present, while iota Hor, HR 7291, and alpha Cen A and B show a clear FIP trend. These conclusions hold whether the comparison is made with solar abundances or the individual stellar abundances. Unlike the solar corona, where low-FIP elements are enriched, in these stars the FIP effect is consistently due to a depletion of high-FIP elements with respect to actual photospheric abundances. A comparison with solar (instead of stellar) abundances yields the same fractionation trend as on the Sun. In both cases, a similar FIP bias is inferred, but different fractionation mechanisms need to be invoked.

  13. Production of tumor necrosis factor alpha, interleukin-1 alpha, and interleukin-6 during murine coccidioidomycosis.

    PubMed Central

    Cox, R A; Magee, D M

    1995-01-01

    The proinflammatory cytokines tumor necrosis factor alpha (TNF-alpha), interleukin-1 alpha (IL-1 alpha), and interleukin-6 (IL-6) were induced in mice infected with Coccidioides immitis. Analyses of the cytokine profiles of two inbred mouse strains which differ in their susceptibility to pulmonary challenge with C. immitis revealed higher levels of IL-6 in lungs from DBA/2 mice (resistant strain) than in those from BALB/c mice (susceptible strain) beginning at day 6 and continuing through day 15 postinfection. Spleen cells from both mouse strains secreted TNF-alpha, IL-1 alpha, and IL-6 in vitro in response to stimulation with killed spherules but differed in that spleen cells from the resistant strain produced increased levels of these cytokines earlier after pulmonary challenge and at increased levels throughout the course of the disease. PMID:7558338

  14. Influence of fast alpha diffusion and thermal alpha buildup on tokamak reactor performance

    SciTech Connect

    Uckan, N.A.; Tolliver, J.S.; Houlberg, W.A.; Attenberger, S.E.

    1987-11-01

    The effect of fast alpha diffusion and thermal alpha accumulation on the confinement capability of a candidate Engineering Test Reactor (ETR) plasma (Tokamak Ignition/Burn Experimental Reactor (TIBER-II)) in achieving ignition and steady-state driven operation has been assessed using both global and 1-1/2-D transport models. Estimates are made of the threshold for radial diffusion of fast alphas and thermal alpha buildup. It is shown that a relatively low level of radial transport, when combined with large gradients in the fast alpha density, leads to a significant radial flow with a deleterious effect on plasma performance. Similarly, modest levels of thermal alpha concentration significantly influence the ignition and steady-state burn capability. 23 refs., 9 figs., 4 tabs.

  15. Radioimmunotherapy with alpha-particle emitting radionuclides.

    PubMed

    Zalutsky, M R; Pozzi, O R

    2004-12-01

    An important consideration in the development of effective strategies for radioimmunotherapy is the nature of the radiation emitted by the radionuclide. Radionuclides decaying by the emission of alpha-particles offer the possibility of matching the cell specific reactivity of monoclonal antibodies with radiation with a range of only a few cell diameters. Furthermore, alpha-particles have important biological advantages compared with external beam radiation and beta-particles including a higher biological effectiveness, which is nearly independent of oxygen concentration, dose rate and cell cycle position. In this review, the clinical settings most likely to benefit from alpha-particle radioimmunotherapy will be discussed. The current status of preclinical and clinical research with antibodies labeled with 3 promising alpha-particle emitting radionuclides - (213)Bi, (225)Ac, and (211)At - also will be summarized.

  16. Radioimmunotherapy with alpha-particle emitting radionuclides.

    PubMed

    Zalutsky, M R; Pozzi, O R

    2004-12-01

    An important consideration in the development of effective strategies for radioimmunotherapy is the nature of the radiation emitted by the radionuclide. Radionuclides decaying by the emission of alpha-particles offer the possibility of matching the cell specific reactivity of monoclonal antibodies with radiation with a range of only a few cell diameters. Furthermore, alpha-particles have important biological advantages compared with external beam radiation and beta-particles including a higher biological effectiveness, which is nearly independent of oxygen concentration, dose rate and cell cycle position. In this review, the clinical settings most likely to benefit from alpha-particle radioimmunotherapy will be discussed. The current status of preclinical and clinical research with antibodies labeled with 3 promising alpha-particle emitting radionuclides - (213)Bi, (225)Ac, and (211)At - also will be summarized. PMID:15640792

  17. Alpha Coincidence Spectroscopy studied with GEANT4

    SciTech Connect

    Dion, Michael P.; Miller, Brian W.; Tatishvili, Gocha; Warren, Glen A.

    2013-11-02

    Abstract The high-energy side of peaks in alpha spectra, e.g. 241Am, as measured with a silicon detector has structure caused mainly by alpha-conversion electron and to some extent alphagamma coincidences. We compare GEANT4 simulation results to 241Am alpha spectroscopy measurements with a passivated implanted planar silicon detector. A large discrepancy between the measurements and simulations suggest that the GEANT4 photon evaporation database for 237Np (daughter of 241Am decay) does not accurately describe the conversion electron spectrum and therefore was found to have large discrepancies with experimental measurements. We describe how to improve the agreement between GEANT4 and alpha spectroscopy for actinides of interest by including experimental measurements of conversion electron spectroscopy into the photon evaporation database.

  18. Radioimmunotherapy with alpha-emitting nuclides.

    PubMed

    McDevitt, M R; Sgouros, G; Finn, R D; Humm, J L; Jurcic, J G; Larson, S M; Scheinberg, D A

    1998-09-01

    This review discusses the application of alpha particle-emitting radionuclides in targeted radioimmunotherapy. It will outline the production and chemistry of astatine-211, bismuth-212, lead-212, actinium-225, bismuth-213, fermium-255, radium-223 and terbium-149, which at present are the most promising alpha-emitting isotopes available for human clinical use. The selective cytotoxicity offered by alpha particle-emitting radioimmunoconstructs is due to the high linear energy transfer and short particle path length of these radionuclides. Based upon the pharmacokinetics of alpha particle-emitting radioimmunoconstructs, both stochastic and conventional dosimetric methodology is discussed, as is the preclinical and initial clinical use of these radionuclides conjugated to monoclonal antibodies for the treatment of human neoplasia. PMID:9724387

  19. Genetics Home Reference: alpha-1 antitrypsin deficiency

    MedlinePlus

    ... and genetic modifiers of emphysema risk. Thorax. 2004 Mar;59(3):259-64. Review. Citation on PubMed ... alpha}1-antitrypsin deficiency. Arch Intern Med. 2009 Mar 23;169(6):546-50. doi: 10.1001/ ...

  20. Nuclear diagnostic for fast alpha particles

    DOEpatents

    Grisham, L.R.; Post, D.E. Jr.; Dawson, J.M.

    1983-11-23

    This invention relates generally to high energy confined plasmas and more particularly is directed to measuring the velocity distribution of confined energetic alpha particles resulting from deuterium-tritium fusion reactions in a confined energetic plasma.

  1. Note on Two Generalizations of Coefficient Alpha.

    ERIC Educational Resources Information Center

    Raju, Nambury S.

    1979-01-01

    An important relationship is given for two generalizations of coefficient alpha: (1) Rajaratnam, Cronbach, and Gleser's generalizability formula for stratified-parallel tests, and (2) Raju's coefficient beta. (Author/CTM)

  2. Uncoupling protein-2 up-regulation and enhanced cyanide toxicity are mediated by PPAR{alpha} activation and oxidative stress

    SciTech Connect

    Zhang, X.; Li, L.; Prabhakaran, K.; Zhang, L.; Leavesley, H.B.; Borowitz, J.L.; Isom, G.E.

    2007-08-15

    Uncoupling protein 2 (UCP-2) is an inner mitochondrial membrane proton carrier that modulates mitochondrial membrane potential ({delta}{psi}{sub m}) and uncouples oxidative phosphorylation. We have shown that up-regulation of UCP-2 by Wy14,643, a selective peroxisome proliferator-activated receptor-{alpha} (PPAR{alpha}) agonist, enhances cyanide cytotoxicity. The pathway by which Wy14,643 up-regulates UCP-2 was determined in a dopaminergic cell line (N27 cells). Since dopaminergic mesencephalic cells are a primary brain target of cyanide, the N27 immortalized mesencephalic cell was used in this study. Wy14,643 produced a concentration- and time-dependent up-regulation of UCP-2 that was linked to enhanced cyanide-induced cell death. MK886 (PPAR{alpha} antagonist) or PPAR{alpha} knock-down by RNA interference (RNAi) inhibited PPAR{alpha} activity as shown by the peroxisome proliferator response element-luciferase reporter assay, but only partially decreased up-regulation of UCP-2. The role of oxidative stress as an alternative pathway to UCP-2 up-regulation was determined. Wy14,643 induced a rapid surge of ROS generation and loading cells with glutathione ethyl ester (GSH-EE) or pre-treatment with vitamin E attenuated up-regulation of UCP-2. On the other hand, RNAi knockdown of PPAR{alpha} did not alter ROS generation, suggesting a PPAR{alpha}-independent component to the response. Co-treatment with PPAR{alpha}-RNAi and GSH-EE blocked both the up-regulation of UCP-2 by Wy14,643 and the cyanide-induced cell death. It was concluded that a PPAR{alpha}-mediated pathway and an oxidative stress pathway independent of PPAR{alpha} mediate the up-regulation of UCP-2 and subsequent increased vulnerability to cyanide-induced cytotoxicity.

  3. [Multiplex PCR for detecting genotypes of deletional alpha-thalassemia].

    PubMed

    Wu, Jie-Ying; Liao, Can; Li, Jian; Huang, Yi-Ning

    2004-08-01

    To investigate the clinical application of multiplex PCR in detecting genotypes of deletional alpha-thalassemia in South China and observe the distribution frequency of alpha-globin gene deletion, 145 patients with silent carrier, alpha thalassemia trait or HbH were identified by M-PCR and 1.2% agarose gel electrophoresis. There are 1.3, 1.6, 1.8 and 2.0 kb bands which indicate --(SEA), -alpha(4.2), alphaalpha and -alpha(3.7), respectively. The results showed that among 145 patients, 100 patients with --(SEA)/alphaalpha (68.9%), 15 with -alpha(3.7)/alphaalpha (10.3%), 8 with -alpha(4.2)/alphaalpha (5.52%), 2 with -alpha(3.7)/-alpha(4.2) (1.38%), 1 with -alpha(3.7)/-alpha(3.7) (0.69%), 1 with -alpha(4.2)/-alpha(4.2) (0.69%), 14 with --(SEA)/-alpha(3.7) (9.65%), 2 with --(SEA)/-alpha(4.2) (1.38%) were found. Two patients prenatal diagnosed were confirmed with Bart's hydrops fetuses. In conclusion, M-PCR analysis is a simple, rapid and accurate method for detection of alpha-thalassemia gene deletion. This technique is helpful in screening, carrier identification and prenatal diagnosis of deletional alpha-thalassemia.

  4. Hormonal induction and antihormonal inhibition of tracheary element differentiation in Zinnia cell cultures

    NASA Technical Reports Server (NTRS)

    Church, D. L.; Galston, A. W.

    1988-01-01

    Mechanically isolated mesophyll cells of Zinnia elegans L. cv Envy differentiate to tracheary elements when cultured in inductive medium containing sufficient auxin and cytokinin. Tracheary element differentiation was induced by the three auxins (alpha-naphthaleneacetic acid, indole-3-acetic acid, and 2,4-dichlorophenoxyacetic acid) and four cytokinins (6-benzyladenine, kinetin, 2-isopentenyladenine and zeatin) tested. Tracheary element formation is inhibited or delayed if the inductive medium is supplemented with an anticytokinin, antiauxin, or inhibitor of auxin transport.

  5. A Family Portrait of the Alpha Centauri System

    NASA Astrophysics Data System (ADS)

    2003-03-01

    siderostats on the observing platform at the Paranal summit were used. These two small test telescopes were placed at distances of 16 and 66 metres, respectively (PR Photo 07c/03). They captured the light from the two stars and sent it on via a series of reflecting mirrors to the common focus in the commissioning instrument VINCI. Although they were obtained only a few days after the successful accomplishment of "First Fringes" with the VLTI (ESO PR 06/01), the 16-m measurements were found to be scientifically very useful and helped to improve the measurement of the angular diameter of Alpha Centauri A. The 66-m baseline measurements provided the most accurate values of "calibrated visibilities" (PR Photo 07d/03) - from these, the angular diameters were then derived. The VLTI measurements provided high-quality angular diameter values for both stars, 8.512 ± 0.022 milliarcsec and 6.002 ± 0.048 milliarcsec for A and B, respectively. With the distance measured earlier by the Hipparcos satellite of the European Space Agency (ESA), 4.36 light-years or 41 million million km, the true radii were then found to be 854,000 km and 602,000 km, or 1.227 ± 0.005 and 0.865 ± 0.007 times the radius of the Sun, respectively. Stellar models ESO PR Photo 07e/03 ESO PR Photo 07e/03 [Preview - JPEG: 400 x 478 pix - 288k] [Normal - JPEG: 800 x 956 pix - 992k] Caption: PR Photo 07e/03 shows the location of Alpha Centauri A and B, Proxima Centauri and the Sun in the Hertzsprung-Russell (HR) diagram [4]. During the past years, a number of more distant binary stellar systems like Alpha Centauri A and B have been observed with different methods, including spectrophotometry (emission at different wavelengths) and astrometry (position in the sky; motions). When compared with theoretical models of the stars, such measurements determine the main stellar parameters, including the masses of each component, their ages, their luminosities, effective temperatures and content of various chemical elements. At

  6. The ALPHA Experiment: A Cold Antihydrogen Trap

    SciTech Connect

    Bertsche, W.; Chapman, S.; Deutsch, A.; Fajans, J.; Gomberoff, K.; Wurtele, J.; Boston, A.; Chartier, M.; Nolan, P.; Page, R.D.; Bowe, P.D.; Hangst, J.S.; Madsen, N.; Cesar, C.L.; Miranda, D.; Charlton, M.; Jenkins, M.; Joergensen, L.V.; Telle, H.H.; Werf, D.P. van der

    2005-10-26

    The ALPHA experiment aims to trap antihydrogen as the next crucial step towards a precise CPT test, by a spectroscopic comparison of antihydrogen with hydrogen. The experiment will retain the salient techniques developed by the ATHENA collaboration during the previous phase of antihydrogen experiments at the antiproton decelerator (AD) at CERN. The collaboration has identified the key problems in adding a neutral antiatom trap to the previously developed experimental configuration. The solutions identified by ALPHA are described in this paper.

  7. Transport of Radioactive Material by Alpha Recoil

    SciTech Connect

    Icenhour, A.S.

    2005-05-19

    The movement of high-specific-activity radioactive particles (i.e., alpha recoil) has been observed and studied since the early 1900s. These studies have been motivated by concerns about containment of radioactivity and the protection of human health. Additionally, studies have investigated the potential advantage of alpha recoil to effect separations of various isotopes. This report provides a review of the observations and results of a number of the studies.

  8. Measurement of the angle alpha at BABAR

    SciTech Connect

    Perez, A.; /Orsay, LAL

    2009-06-25

    The authors present recent measurements of the CKM angle {alpha} using data collected by the BABAR detector at the PEP-II asymmetric-energy e{sup +}e{sup -} collider at the SLAC National Accelerator Laboratory, operating at the {Upsilon}(4S) resonance. They present constraints on {alpha} from B {yields} {pi}{pi}, B {yields} {rho}{rho} and B {yields} {rho}{pi} decays.

  9. Alpha-emitters for medical therapy workshop

    SciTech Connect

    Feinendegen, L.E.; McClure, J.J.

    1996-12-31

    A workshop on ``Alpha-Emitters for Medical Therapy`` was held May 30-31, 1996 in Denver Colorado to identify research goals and potential clinical needs for applying alpha-particle emitters and to provide DOE with sufficient information for future planning. The workshop was attended by 36 participants representing radiooncology, nuclear medicine, immunotherapy, radiobiology, molecular biology, biochemistry, radiopharmaceutical chemistry, dosimetry, and physics. This report provides a summary of the key points and recommendations arrived at during the conference.

  10. Different polyphenolic components of soft fruits inhibit alpha-amylase and alpha-glucosidase.

    PubMed

    McDougall, Gordon J; Shpiro, Faina; Dobson, Patricia; Smith, Pauline; Blake, Alison; Stewart, Derek

    2005-04-01

    Polyphenol-rich extracts from soft fruits were tested for their ability to inhibit alpha-amylase and alpha-glucosidase. All extracts tested caused some inhibition of alpha-amylase, but there was a 10-fold difference between the least and most effective extracts. Strawberry and raspberry extracts were more effective alpha-amylase inhibitors than blueberry, blackcurrant, or red cabbage. Conversely, alpha-glucosidase was more readily inhibited by blueberry and blackcurrant extracts. The extent of inhibition of alpha-glucosidase was related to their anthocyanin content. For example, blueberry and blackcurrant extracts, which have the highest anthocyanin content, were the most effective inhibitors of alpha-glucosidase. The extracts most effective in inhibiting alpha-amylase (strawberry and raspberry) contain appreciable amounts of soluble tannins. Other tannin-rich extracts (red grape, red wine, and green tea) were also effective inhibitors of alpha-amylase. Indeed, removing tannins from strawberry extracts with gelatin also removed inhibition. Fractionation of raspberry extracts on Sephadex LH-20 produced an unbound fraction enriched in anthocyanins and a bound fraction enriched in tannin-like polyphenols. The unbound anthocyanin-enriched fraction was more effective against alpha-glucosidase than the original extract, whereas the alpha-amylase inhibitors were concentrated in the bound fraction. The LH-20 bound sample was separated by preparative HPLC, and fractions were assayed for inhibition of alpha-amylase. The inhibitory components were identified as ellagitannins using LC-MS-MS. This study suggests that different polyphenolic components of fruits may influence different steps in starch digestion in a synergistic manner. PMID:15796622

  11. The binary weight distribution of the extended (2 sup m, 2 sup m-4) code of Reed-Solomon code over GF(2 sup m) with generator polynomial (x-alpha sup 2) (x-alpha sup 3)

    NASA Technical Reports Server (NTRS)

    Lin, Shu

    1987-01-01

    Consider an (n,k) linear code with symbols from GF(2 sup m). If each code symbol is represented by a binary m-tuple using a certain basis for GF(2 sup m), a binary (nm,km) linear code called a binary image of the original code is obtained. A lower bound is presented on the minimum weight enumerator for a binary image of the extended (2 sup m, 2 sup m -4) code of Reed-Solomon code over GF(2 sup m) with generator polynomical (x - alpha)(x- alpha squared)(x - alpha cubed) and its dual code, where alpha is a primitive element in GF(2 sup m).

  12. Superheavy Element Nuclear Chemistry at RIKEN

    SciTech Connect

    Haba, Hiromitsu; Kaji, Daiya; Kasamatsu, Yoshitaka; Kudou, Yuki; Morimoto, Kouji; Morita, Kosuke; Ozeki, Kazutaka; Yoneda, Akira; Kikunaga, Hidetoshi; Komori, Yukiko; Ooe, Kazuhiro; Shinohara, Atsushi; Yoshimura, Takashi; Sato, Nozomi; Toyoshima, Atsushi; Yokoyama, Akihiko

    2010-05-12

    A gas-jet transport system has been coupled to the RIKEN gas-filled recoil ion separator GARIS to startup superheavy element (SHE) chemistry at RIKEN. The performance of the system was appraised using an isotope of element 104, {sup 261}Rf, produced in the {sup 248}Cm({sup 18}O,5n){sup 261}Rf reaction. Alpha-particles of {sup 261}Rf separated with GARIS and extracted to a chemistry laboratory were successfully identified with a rotating wheel apparatus for alpha spectrometry. The setting parameters such as the magnetic field of the separator and the gas-jet conditions were optimized. The present results suggest that the GARIS/gas-jet system is a promising approach for exploring new frontiers in SHE chemistry: (i) the background radioactivities of unwanted reaction products are strongly suppressed, (ii) the intense beam is absent in the gas-jet chamber and hence high gas-jet efficiency is achieved, and (iii) the beam-free condition also allows for investigations of new chemical systems.

  13. HETDEX: Evolution of Lyman Alpha Emitters

    NASA Astrophysics Data System (ADS)

    Blanc, Guillermo A.; Gebhardt, K.; Hill, G. J.; Gronwall, C.; Ciardullo, R.; Finkelstein, S.; Gawiser, E.; HETDEX Collaboration

    2012-01-01

    The Hobby Eberly Telescope Dark Energy Experiment (HETDEX) will produce a sample of 800,000 Lyman Alpha Emitters (LAEs) over the 1.9Alpha photon escape fraction. Our results show a strong evolution in the Lyman Alpha escape fraction with redshift, most likely associated with the buildup of dust in the ISM. Dust is shown to be the main parameter setting the escape of Lyman Alpha photons. The observed relation between E(B-V) and the escape fraction indicates that radiative transfer effects in LAEs promote the escape of Lyman Alpha photons, but only up to the point of them suffering similar amounts of extinction as continuum photons. Enhancement of the Lyman Alpha EW (e.g. due to the presence of a clumpy medium) seems not to be a common process in these objects. We also discuss the potential of the full HETDEX sample to study the evolution of LAE properties.

  14. Alpha-dispersion in human tissue

    NASA Astrophysics Data System (ADS)

    Grimnes, Sverre; Martinsen, Ørjan G.

    2010-04-01

    Beta dispersion is found in living tissue in the kilohertz - megahertz range and is caused by the cellular structure of biological materials with low frequency properties caused by cell membranes. Alpha dispersion is found in the hertz range and the causes are not so well known. Alpha dispersions are the first to disappear when tissue dies. Tissue data have often been based upon excised specimen from animals and are therefore not necessarily representative for human tissue alpha dispersions. Here we present data obtained with non-invasive skin surface electrodes for different segments of the living human body. We found alpha dispersions in all cases; the ankle-wrist results had the smallest. Large alpha dispersions were found where the distance between the electrodes and muscle masses was small, e.g. on the calf. Further studies on electrode technique and reciprocity, electrode positioning, statistical variations, gender, age and bodily constitutions are necessary in order to reveal more about the alpha dispersion, its appearance and disappearance.

  15. [Alpha-1 antitrypsin deficiency: diagnosis and treatment].

    PubMed

    Camelier, Aquiles A; Winter, Daniel Hugo; Jardim, José Roberto; Barboza, Carlos Eduardo Galvão; Cukier, Alberto; Miravitlles, Marc

    2008-07-01

    Alpha-1 antitrypsin deficiency is a recently identified genetic disease that occurs almost as frequently as cystic fibrosis. It is caused by various mutations in the SERPINA1 gene, and has numerous clinical implications. Alpha-1 antitrypsin is mainly produced in the liver and acts as an antiprotease. Its principal function is to inactivate neutrophil elastase, preventing tissue damage. The mutation most commonly associated with the clinical disease is the Z allele, which causes polymerization and accumulation within hepatocytes. The accumulation of and the consequent reduction in the serum levels of alpha-1 antitrypsin cause, respectively, liver and lung disease, the latter occurring mainly as early emphysema, predominantly in the lung bases. Diagnosis involves detection of low serum levels of alpha-1 antitrypsin as well as phenotypic confirmation. In addition to the standard treatment of chronic obstructive pulmonary disease, specific therapy consisting of infusion of purified alpha-1 antitrypsin is currently available. The clinical efficacy of this therapy, which appears to be safe, has yet to be definitively established, and its cost-effectiveness is also a controversial issue that is rarely addressed. Despite its importance, in Brazil, there are no epidemiological data on the prevalence of the disease or the frequency of occurrence of deficiency alleles. Underdiagnosis has also been a significant limitation to the study of the disease as well as to appropriate treatment of patients. It is hoped that the creation of the Alpha One International Registry will resolve these and other important issues. PMID:18695797

  16. Alpha particle analysis using PEARLS spectrometry

    SciTech Connect

    McKlveen, J.W.; Klingler, G.W.; McDowell, W.J.; Case, G.N.

    1984-01-01

    Alpha particle assay by conventional plate-counting methods is difficult because chemical separation, tracer techniques, and/or self-absorption losses in the final sample may cause either non-reproducible results or create unacceptable errors. PEARLS (Photon-Electron Rejecting Alpha Liquid Scintillation) Spectrometry is an attractive alternative since radionuclides may be extracted into a scintillator in which there would be no self-absorption or geometry problems and in which up to 100% chemical recovery and counting efficiency is possible. Sample preparation may include extraction of the alpha emitter of interest by a specific organic-phase-soluble compound directly into the liquid scintillator. Detection electronics use energy and pulse-shape discrimination to provide discrete alpha spectra and virtual absence of beta and gamma backgrounds. Backgrounds on the order of 0.01 cpm are readily achievable. Accuracy and reproducibility are typically in the 100 +-1% range. Specific procedures have been developed for gross alpha, uranium, plutonium, thorium, and polonium assay. This paper will review liquid scintillation alpha counting methods and reference some of the specific applications. 8 refs., 1 fig.

  17. Enzymic conversion of alpha-oxyprotohaem IX into biliverdin IX alpha by haem oxygenase.

    PubMed Central

    Yoshinaga, T; Sudo, Y; Sano, S

    1990-01-01

    Conversion of four isomers of meso-oxyprotohaem IX into the corresponding biliverdin IX was attempted with a reconstituted haem oxygenase system in the presence of NADPH-cytochrome c reductase and NADPH. Only the alpha-isomer of meso-oxyprotohaem IX was converted effectively into biliverdin IX alpha, which was further reduced to bilirubin IX alpha by biliverdin reductase. Only trace amounts of biliverdins IX beta, IX gamma and IX delta were respectively formed from the incubation mixture of the corresponding oxyprotohaemin IX isomers with the complete haem oxygenase system under the same conditions. In a kinetic study, the Km for alpha-meso-oxyprotohaem IX was 3.6 microM, which was 2-fold higher than that for protohaem IX. The maximum velocity (Vmax.) of the conversion of alpha-meso-oxyprotohaem IX into biliverdin IX alpha was twice as fast as that of protohaem IX. These results demonstrate that alpha-meso-oxyprotohaem IX is an intermediate of haem degradation and it was converted stereospecifically into biliverdin IX alpha via verdohaem IX alpha. PMID:2122884

  18. Assembly of an alpha-gamma coincidence measuring device for checking alpha decay schemes.

    PubMed

    Martín Sánchez, A; Caro Marroyo, B

    2012-09-01

    Two new chambers for measuring alpha-particle emissions have been made: a low-geometry chamber with a powerful magnet to eliminate conversion electrons, and an alpha-gamma coincidence chamber. Both devices incorporate a high-resolution Si detector, and the second chamber, a low-energy Ge detector as well. A dual parameter multichannel analyzer was used to register coincidences in the second device. Alpha-particle and gamma-ray detectors work simultaneously in both individual and dual modes, providing single and coincidence spectra. Some preliminary alpha-gamma coincidence spectra have been obtained.

  19. Methods for the synthesis and polymerization of .alpha.,.alpha.'-dihalo-p-xylenes

    DOEpatents

    Ferraris, John P.; Neef, Charles J.

    2002-07-30

    The present invention describes an improved method for the polymerization of .alpha.,.alpha.-dihalo-p-xylene's such as the .alpha.,.alpha.'-dihalo-2-methoxy-5-(2-ethylhexyloxy)-xylene's. The procedure for synthesis is based on the specific order of addition of reagents and the use of an anionic initiator that allows control of the molecular weight of the polymer. The molecular weight control allows processability of the polymer which is important for its utility in applications including in light-emitting-diodes, field effect transistors and photovoltaic devices.

  20. Polyomavirus origin for DNA replication comprises multiple genetic elements.

    PubMed Central

    Muller, W J; Mueller, C R; Mes, A M; Hassell, J A

    1983-01-01

    To define the minimal cis-acting sequences required for polyomavirus DNA replication (ori), we constructed a number of polyomavirus-plasmid recombinants and measured their replicative capacity after transfection of a permissive mouse cell line capable of providing polyomavirus large T antigen in trans (MOP cells). Recombinant plasmids containing a 251-base-pair fragment of noncoding viral DNA replicate efficiently in MOP cells. Mutational analyses of these viral sequences revealed that they can be physically separated into two genetic elements. One of these elements, termed the core, contains an adenine-thymine-rich area, a 32-base-pair guanine-cytosine-rich palindrome, and a large T antigen binding site, and likely includes the site from which bidirectional DNA replication initiates. The other, termed beta, is located adjacent to the core near the late region and is devoid of outstanding sequence features. Surprisingly, another sequence element named alpha, located adjacent to beta but outside the borders of the 251-base-pair fragment, can functionally substitute for beta. This sequence too contains no readily recognized sequence features and possesses no obvious homology to the beta element. The three elements together occupy a contiguous noncoding stretch of DNA no more than 345 base pairs in length in the order alpha, beta, and core. These results indicate that the polyomavirus origin for DNA replication comprises multiple genetic elements. Images PMID:6312083

  1. Neutron Diffraction Study On Gamma To Alpha Phase Transition In Ce0.9th0.1 Alloy

    SciTech Connect

    Lashley, Jason C1; Heffner, Robert H; Llobet, A; Darling, T W; Jeong, I K

    2008-01-01

    Comprehensive neutron diffraction measurements were performed to study the isostructural {gamma} {leftrightarrow} {alpha} phase transition in Ce{sub 0.9}Th{sub 0.1} alloy. Using Rietveld refinements, we obtained lattice and thermal parameters as a function of temperature. From the temperature slope of the thermal parameters, we determined Debye temperatures {Theta}{sup {gamma}}{sub D} = 133(1) K and {Theta}{sup {alpha}}{sub D} = 140(1) K for the {gamma} phase and the {alpha} phase, respectively. This result implies that the vibrational entropy change is not significant at the {gamma} {leftrightarrow} {alpha} transition, contrary to that from elemental Cerium [Phys. Rev. Lett. 92, 105702, 2004].

  2. Sample pretreatment in the determination of specific alpha emitters in drinking water using [Ba+Fe]-coprecipitation method.

    PubMed

    Suarez-Navarro, J A; Pujol, Ll; Suarez-Navarro, M J

    2015-02-01

    The [Ba+Fe]-coprecipitation method is applied to measure gross alpha activity for radiological examination of drinking water in the laboratory. This method collects all the alpha-emitting radionuclides of interest (natural alpha emitters and transuranium elements) in a precipitate on a filter. This paper describes an investigation of sample pretreatment of the precipitate collected by the [Ba+Fe]-coprecipitation method for gross alpha activity determination. The aim of this preliminary work is to be a starting point to develop simple and rapid radiochemical procedures for specific alpha emitters (polonium, radium, thorium, uranium, plutonium and americium), in contrast to the sophisticated, expensive and time-consuming alpha spectrometry method. The sample pretreatment aspects considered include quantitative [Ba+Fe]-coprecipitation, two methods for precipitate treatment (leaching and complete destruction of the filter), and the determination of the alpha-emitting proportions present in the barium sulfate precipitate and acid solution obtained after precipitate treatment. Furthermore, a radiochemical procedure for (226)Ra determination was performed and finally, the sample pretreatment proposed in this work was summarized.

  3. Sample pretreatment in the determination of specific alpha emitters in drinking water using [Ba+Fe]-coprecipitation method.

    PubMed

    Suarez-Navarro, J A; Pujol, Ll; Suarez-Navarro, M J

    2015-02-01

    The [Ba+Fe]-coprecipitation method is applied to measure gross alpha activity for radiological examination of drinking water in the laboratory. This method collects all the alpha-emitting radionuclides of interest (natural alpha emitters and transuranium elements) in a precipitate on a filter. This paper describes an investigation of sample pretreatment of the precipitate collected by the [Ba+Fe]-coprecipitation method for gross alpha activity determination. The aim of this preliminary work is to be a starting point to develop simple and rapid radiochemical procedures for specific alpha emitters (polonium, radium, thorium, uranium, plutonium and americium), in contrast to the sophisticated, expensive and time-consuming alpha spectrometry method. The sample pretreatment aspects considered include quantitative [Ba+Fe]-coprecipitation, two methods for precipitate treatment (leaching and complete destruction of the filter), and the determination of the alpha-emitting proportions present in the barium sulfate precipitate and acid solution obtained after precipitate treatment. Furthermore, a radiochemical procedure for (226)Ra determination was performed and finally, the sample pretreatment proposed in this work was summarized. PMID:25474768

  4. Structural organization of the human cardiac [alpha]-myosin heavy chain gene (MYH6)

    SciTech Connect

    Epp, T.A.; Dixon, I.M.C.; Wang, H.Y.; Sole, M.J.; Liew, C.C. )

    1993-12-01

    The human myocardium expresses two cardiac myosin heavy chain (MyHC) isoforms, [alpha] and [beta], that exist in tandem array on chromosome 14q12. The authors have previously sequenced the entire human cardiac [beta]-MyHC gene and now report the complete nucleotide sequence of the human cardiac [alpha]-MyHC, encompassing 26,159 bp as well as the entire 4484-bp 5'-flanking intergenic region. The gene (MYH6) consists of 39 exons, 37 of which contain coding information. The 5'-untranslated region is split into 3 exons, with the third exon containing the AUG translocation initiation codon. With the exception of the 13th intron of the human cardiac [beta]-MyHC, which is not present within the [alpha]-isogene, all exon/intron boundaries are conserved. Conspicuous sequence motifs contained within the [alpha]-MyHC gene include four Alu repeats, a single (GT)[sub n] element, and a homopurine-homopyrimidine tract containing 23 GAA repeating units followed by 10 GAG repeating units. Comparison of the encoded amino acid sequence with a previously reported human [alpha]-MyHC cDNA sequence reveals several potential polymorphisms. 29 refs., 1 fig., 1 tab.

  5. Interferon-. alpha. selectively activates the. beta. isoform of protein kinase C through phosphatidylcholine hydrolysis

    SciTech Connect

    Pfeffer, L.M.; Saltiel, A.R. ); Strulovici, B. )

    1990-09-01

    The early events that occur after interferon binds to discrete cell surface receptors remain largely unknown. Human leukocyte interferon (interferon-{alpha}) rapidly increases the binding of ({sup 3}H)phorbol dibutyrate to intact HeLa cells a measure of protein kinase C activation, and induces the selective translocation of the {beta} isoform of protein kinase C from the cytosol to the particulate fraction of HeLa cells. The subcellular distribution of the {alpha} and {epsilon} isoforms is unaffected by interferon-{alpha} treatment. Activation of protein kinase C by phorbol esters mimics the inhibitory action of interferon-{alpha} on HeLa cell proliferation and down-regulation of protein kinase C blocks the induction of antiviral activity by interferon-{alpha} in HeLa cells. Increased phosphatidylcholine hydrolysis and phosphorylcholine production is accompanied by diacylglycerol production in response to interferon. However, inositol phospholipid turnover and free intracellular calcium concentration are unaffected. These results suggest that the transient increase in diacylglycerol, resulting from phosphatidylcholine hydrolysis, may selectively activate the {beta} isoform of protein kinase C. Moreover, the activation of protein kinase C is a necessary element in interferon action on cells.

  6. Analysis of the human alpha-globin gene cluster in transgenic mice.

    PubMed Central

    Sharpe, J A; Wells, D J; Whitelaw, E; Vyas, P; Higgs, D R; Wood, W G

    1993-01-01

    A 350-bp segment of DNA associated with an erythroid-specific DNase I-hypersensitive site (HS-40), upstream of the alpha-globin gene cluster, has been identified as the major tissue-specific regulator of the alpha-globin genes. However, this element does not direct copy number-dependent or developmentally stable expression of the human genes in transgenic mice. To determine whether additional upstream hypersensitive sites could provide more complete regulation of alpha gene expression we have studied 17 lines of transgenic mice bearing various DNA fragments containing HSs -33, -10, -8, and -4, in addition to HS -40. Position-independent, high-level expression of the human zeta- and alpha-globin genes was consistently observed in embryonic erythroid cells. However, the additional HSs did not confer copy-number dependence, alter the level of expression, or prevent the variable down-regulation of expression in adults. These results suggest that the region upstream of the human alpha-globin genes is not equivalent to that upstream of the beta locus and that although the two clusters are coordinately expressed, there may be differences in their regulation. Images Fig. 2 Fig. 4 Fig. 6 PMID:8248238

  7. AP-2{alpha} suppresses skeletal myoblast proliferation and represses fibroblast growth factor receptor 1 promoter activity

    SciTech Connect

    Mitchell, Darrion L.; DiMario, Joseph X.

    2010-01-15

    Skeletal muscle development is partly characterized by myoblast proliferation and subsequent differentiation into postmitotic muscle fibers. Developmental regulation of expression of the fibroblast growth factor receptor 1 (FGFR1) gene is required for normal myoblast proliferation and muscle formation. As a result, FGFR1 promoter activity is controlled by multiple transcriptional regulatory proteins during both proliferation and differentiation of myogenic cells. The transcription factor AP-2{alpha} is present in nuclei of skeletal muscle cells and suppresses myoblast proliferation in vitro. Since FGFR1 gene expression is tightly linked to myoblast proliferation versus differentiation, the FGFR1 promoter was examined for candidate AP-2{alpha} binding sites. Mutagenesis studies indicated that a candidate binding site located at - 1035 bp functioned as a repressor cis-regulatory element. Furthermore, mutation of this site alleviated AP-2{alpha}-mediated repression of FGFR1 promoter activity. Chromatin immunoprecipitation studies demonstrated that AP-2{alpha} interacted with the FGFR1 promoter in both proliferating myoblasts and differentiated myotubes. In total, these results indicate that AP-2{alpha} is a transcriptional repressor of FGFR1 gene expression during skeletal myogenesis.

  8. Alpha-plutonium's Grüneisen parameter

    NASA Astrophysics Data System (ADS)

    Ledbetter, Hassel; Lawson, Andrew; Migliori, Albert

    2010-04-01

    Reported Grüneisen parameters γ of alpha-plutonium range from 3.0 to 9.6, which is remarkable because typical Grüneisen parameter uncertainty seldom exceeds ± 0.5. Our six new estimates obtained by different methods range from 3.2 to 9.6. The new estimates arise from Grüneisen's rule, from Einstein model and Debye model fits to low-temperature ΔV/V, from the bulk modulus temperature dependence, from the zero-point-energy contribution to the bulk modulus, and from another Grüneisen relationship whereby γ is estimated from only the bulk modulus and volume changes with temperature (or pressure). We disregard several high estimates because of the itinerant-localized 5f-electron changes during temperature changes and pressure changes. Considering all these estimates, for alpha-plutonium, we recommend γ = 3.7 ± 0.4, slightly high compared with values for all elemental metals.

  9. Alpha-emitting nuclides in the marine environment

    NASA Astrophysics Data System (ADS)

    Pentreath, R. J.

    1984-06-01

    The occurrence of alpha-emitting nuclides and their daughter products in the marine environment continues to be a subject of study for many reasons. Those nuclides which occur naturally, in the uranium, thorium and actinium series, are of interest because of their value in determining the rates of geological and geochemical processes in the oceans. Studies of them address such problems as the determination of rates of transfer of particulate matter, deposition rates, bioturbation rates, and so on. Two of the natural alpha-series nuclides in which a different interest has been expressed are 210Po and 226Ra, because their concentrations in marine organisms are such that they contribute to a significant fraction of the background dose rates sustained both by the organisms themselves and by consumers of marine fish and shellfish. To this pool of naturally-occurring nuclides, human activities have added the transuranium nuclides, both from the atmospheric testing of nuclear devices and from the authorized discharges of radioactive wastes into coastal waters and the deep sea. Studies have therefore been made to understand the chemistry of these radionuclides in sea water, their association with sedimentary materials, and their accumulation by marine organisms, the last of these being of particular interest because the transuranics are essentially "novel" elements to the marine fauna and flora. The need to predict the long-term behaviour of these nuclides has, in turn, stimulated research on those naturally-occurring nuclides which may behave in a similar manner.

  10. Development of Flight Slit-Jaw Optics for Chromospheric Lyman-Alpha SpectroPolarimeter

    NASA Technical Reports Server (NTRS)

    Kubo, Masahito; Suematsu, Yoshinori; Kano, Ryohei; Bando, Takamasa; Hara, Hirohisa; Narukage, Noriyuki; Katsukawa, Yukio; Ishikawa, Ryoko; Ishikawa, Shin-nosuke; Kobiki, Toshihiko; Tsuneta, Saku; Kobayashi, Ken; Winebarger, Amy; Takeyama, Norihide; Kanai, Yoshikazu; Sakakibara, Yoshiko

    2015-01-01

    In sounding rocket experiment CLASP, I have placed a slit a mirror-finished around the focal point of the telescope. The light reflected by the mirror surface surrounding the slit is then imaged in Slit-jaw optical system, to obtain the alpha-ray Lyman secondary image. This image, not only to use the real-time image in rocket flight rocket oriented direction selection, and also used as a scientific data showing the spatial structure of the Lyman alpha emission line intensity distribution and solar chromosphere around the observation area of the polarimetric spectroscope. Slit-jaw optical system is a two off-axis mirror unit part including a parabolic mirror and folding mirror, Lyman alpha transmission filter, the optical system magnification 1x consisting camera. The camera is supplied from the United States, and the other was carried out fabrication and testing in all the Japanese side. Slit-jaw optical system, it is difficult to access the structure, it is necessary to install the low place clearance. Therefore, influence the optical performance, the fine adjustment is necessary optical elements are collectively in the form of the mirror unit. On the other hand, due to the alignment of the solar sensor in the US launch site, must be removed once the Lyman alpha transmission filter holder including a filter has a different part from the mirror unit. In order to make the structure simple, stray light measures Aru to concentrate around Lyman alpha transmission filter. To overcome the difficulties of performing optical alignment in Lyman alpha wavelength absorbed by the atmosphere, it was planned following four steps in order to reduce standing time alignment me. 1: is measured in advance refractive index at Lyman alpha wavelength of Lyman alpha transmission filter (121.567nm), to prepare a visible light Firuwo having the same optical path length in the visible light (630nm). 2: The mirror structure CLASP before mounting unit standing, dummy slit and camera standing

  11. Chemistry of superheavy elements.

    PubMed

    Schädel, Matthias

    2006-01-01

    The number of chemical elements has increased considerably in the last few decades. Most excitingly, these heaviest, man-made elements at the far-end of the Periodic Table are located in the area of the long-awaited superheavy elements. While physical techniques currently play a leading role in these discoveries, the chemistry of superheavy elements is now beginning to be developed. Advanced and very sensitive techniques allow the chemical properties of these elusive elements to be probed. Often, less than ten short-lived atoms, chemically separated one-atom-at-a-time, provide crucial information on basic chemical properties. These results place the architecture of the far-end of the Periodic Table on the test bench and probe the increasingly strong relativistic effects that influence the chemical properties there. This review is focused mainly on the experimental work on superheavy element chemistry. It contains a short contribution on relativistic theory, and some important historical and nuclear aspects.

  12. Cohesive Elements for Shells

    NASA Technical Reports Server (NTRS)

    Davila, Carlos G.; Camanho, Pedro P.; Turon, Albert

    2007-01-01

    A cohesive element for shell analysis is presented. The element can be used to simulate the initiation and growth of delaminations between stacked, non-coincident layers of shell elements. The procedure to construct the element accounts for the thickness offset by applying the kinematic relations of shell deformation to transform the stiffness and internal force of a zero-thickness cohesive element such that interfacial continuity between the layers is enforced. The procedure is demonstrated by simulating the response and failure of the Mixed Mode Bending test and a skin-stiffener debond specimen. In addition, it is shown that stacks of shell elements can be used to create effective models to predict the inplane and delamination failure modes of thick components. The results indicate that simple shell models can retain many of the necessary predictive attributes of much more complex 3D models while providing the computational efficiency that is necessary for design.

  13. The synthetic elements

    SciTech Connect

    Hoffman, D.C.

    1990-05-01

    Prior to 1940, the heaviest element known was uranium, discovered in 1789. Since that time the elements 93 through 109 have been synthesized and identified and the elements 43, 61, 85, and 87 which were missing form the periodic tables of the 1930's have been discovered. The techniques and problems involved in these discoveries and the placement of the transuranium elements in the periodic table will be discussed. The production and positive identification of elements heavier than Md (Z=101), which have very short half-lives and can only be produced an atom-at-a-time, are very difficult and there have been controversies concerning their discovery. Some of the new methods which have been developed and used in these studies will be described. The prospects for production of still heavier elements will be considered.

  14. Catastrophic Failure Modes Assessment of the International Space Station Alpha

    NASA Technical Reports Server (NTRS)

    Lutz, B. E. P.; Goodwin, C. J.

    1996-01-01

    This report summarizes a series of analyses to quantify the hazardous effects of meteoroid/debris penetration of Space Station Alpha manned module protective structures. These analyses concentrate on determining (a) the critical crack length associated with six manned module pressure wall designs that, if exceeded, would lead to unstopped crack propagation and rupture of manned modules, and (b) the likelihood of crew or station loss following penetration of unsymmetrical di-methyl hydrazine tanks aboard the proposed Russian FGB ('Tug') propulsion module and critical elements aboard the control moment gyro module (SPP-1). Results from these quantified safety analyses are useful in improving specific design areas, thereby reducing the overall likelihood of crew or station loss following orbital debris penetration.

  15. Overview Of Suborbital Human Transportation Concept Alpha

    NASA Astrophysics Data System (ADS)

    Adirim, H.; Pilz, N.; Marini, M.; Hendrick, P.; Schmid, M.; Behr, R.; Barth, T.; Tarfeld, F.; Wiegand, A.; Charbonnier, D.; Haya Ramos, R.; Steeland, J.; Mack, A.

    2011-05-01

    Within the EC co-funded project FAST20XX (Future high-Altitude high-Speed Transport 20XX), the European suborbital passenger transportation system concept ALPHA (Airplane Launched PHoenix Aircraft), which shall be based to a maximum extent on existing technologies and capabilities, is currently being investigated as collaborative project by a European consortium under coordination of ESA. The ALPHA concept incorporates an air-launch from a carrier aircraft, which shall be used as first stage. The ALPHA vehicle shall be capable of transporting up to four passengers plus one pilot to an altitude of at least 100 km. The ALPHA vehicle is a down-scaled version of the suborbital space transportation concept Hopper, which was already deeply investigated within the European FESTIP System Study and the German ASTRA program including the successfully flown experimental landing demonstrator Phoenix. This approach has allowed the use of existing aerodynamic vehicle data and has led to the adaptation of the external Hopper/Phoenix configuration for ALPHA. In FESTIP and ASTRA, the Hopper configuration showed sufficient stability margins. Due to the geometric similarity of the ALPHA and Hopper vehicles, a trimable and flyable configuration could be derived by means of ALPHA flight trajectory calculations. In its current configuration, the ALPHA vehicle has a length of ca. 9 m and a gross take-off mass of ca. 3.5 Mg. The launch, staging and separation of ALPHA shall be performed either as internal air-launch from the cargo bay of the carrier aircraft, as under-wing air-launch or as towed air-launch. After separation from the carrier aircraft, the ALPHA vehicle ignites its onboard rocket propulsion system. Since conventional liquid and solid propulsion did not seem suitable for ALPHA due to Their high cost, limited safety and toxicity, a low-cost, “green” and non-hazardous hybrid propulsion system based on liquid nitrous oxide in combination with a solid polymer fuel was

  16. Recent advances in the discovery of alpha1-adrenoceptor agonists.

    PubMed

    Bishop, Michael J

    2007-01-01

    The alpha(1) adrenoceptors are three of nine well-characterized receptors that are activated by epinephrine and norepinephrine. Agonists acting at the alpha(1) adrenoceptors produce numerous physiological effects, and are used therapeutically for several indications. Many known alpha(1) adrenoceptor agonists are alpha(1A) selective, but the discovery of highly selective alpha(1B) and alpha(1D) adrenoceptor agonists has proven to be an extremely difficult goal to achieve. This review will focus on recent advances in the discovery, development and clinical utility of subtype-specific alpha(1) agonists as well as contributions to our understanding of agonist-receptor interactions.

  17. NEUTRONIC REACTOR CONTROL ELEMENT

    DOEpatents

    Newson, H.W.

    1960-09-13

    A novel composite neutronic reactor control element is offered. The element comprises a multiplicity of sections arranged in end-to-end relationship, each of the sections having a markedly different neutron-reactive characteristic. For example, a three-section control element could contain absorber, moderator, and fuel sections. By moving such an element longitudinally through a reactor core, reactivity is decreased by the absorber, increased slightly by the moderator, or increased substantially by the fuel. Thus, control over a wide reactivity range is provided.

  18. Progress in net shape fabrication of alpha SiC turbine components

    NASA Technical Reports Server (NTRS)

    Storm, R. S.; Naum, R. G.

    1983-01-01

    The development status of component technology in an automotive gas turbine Ceramic Applications in Turbine Engines program is discussed, with attention to such materials and processes having a low cost, net shape fabrication potential as sintered alpha-SiC that has been fashioned by means of injection molding, slip casting, and isostatic pressing. The gas turbine elements produced include a gasifier turbine rotor, a turbine wheel, a connecting duct, a combustor baffle, and a transition duct.

  19. Strong return of the December alpha-Bootids (IAU#497, DAB)

    NASA Astrophysics Data System (ADS)

    Jenniskens, P.

    2016-06-01

    The CAMS network detected a stronger than usual return of bright meteors from the compact December alpha-Bootids meteor shower in 2015. The observed activity was spread over three nights. The shower is detected at a weaker level in other years by CAMS and by the SonotaCo network. Orbital elements show a gradual increase in longitude of perihelion with solar longitude from Pi = 12 deg to 25 deg. This behavior is currently not understood.

  20. Pharmacologic specificity of alpha-2 adrenergic receptor subtypes

    SciTech Connect

    Petrash, A.; Bylund, D.

    1986-03-01

    The authors have defined alpha-2 adrenergic receptor subtypes in human and rat tissues using prazosin as a subtype selective drug. Prazosin has a lower affinity (250 nM) at alpha-2A receptor and a higher affinity (5 nM) at alpha-2B receptors. In order to determine if other adrenergic drugs are selective for one or the other subtypes, the authors performed (/sup 3/H)yohimbine inhibition experiments with various adrenergic drugs in tissues containing alpha-2A, alpha-2B or both subtypes. Oxymetazoline, WB4101 and yohimbine were found to be 80-, 20- and 10-fold more potent at alpha-2A receptors than at alpha-2B receptors. Phentolamine, adazoxan, (+)- and (-)-mianserin, clonidine, (+)-butaclamol, (-)- and (+)-norepinephrine, epinephrine, dopamine and thioridazine were found to have equal affinities for the two subtypes. These results further validate the subdivision of alpha-2 adrenergic receptors into alpha-2A and alpha-2B subtypes.

  1. Experiments on synthesis of the heaviest elements at RIKEN

    SciTech Connect

    Morimoto, K.; Morita, K.; Kaji, D.; Yoneda, A.; Haba, H.; Katori, K.; Kikunaga, H.; Ohnishi, T.; Suda, T.; Yoshida, A.; Akiyama, T.; Sato, N.; Goto, S.; Kudo, H.; Ideguchi, E.; Koura, H.; Ozawa, A.; Sueki, K.; Tokanai, F.; Yamaguchi, T.

    2006-08-14

    In the Institute of Physical and Chemical Research (RIKEN), using high intensity heavy ion beams from the RIKEN Linear Accelerator, productions and decays of isotopes of the heaviest elements have been investigated by using the gas-filled recoil separator, GARIS. The isotopes studied were 265Hs, 271Ds, 272Rg, 277112, and 278113, respectively. Based on the observed decay chains consisting of consecutive alpha decays connected to the previously known alpha decays or spontaneous fissions, assignments of the initially produced isotopes were done. Our data with the atomic number from 108 to 112, agree well with the data previously taken. The production cross section of the isotope 278113 of the 113th element have reached around 32 fb which shows the simple decrease of the cross section with the increase of the atomic number. The isotopes were produced, for the first time in the 1n evaporation channel from heavy-ion induced fusion reaction.

  2. Alpha Channeling in Rotating Plasma with Stationary Waves

    SciTech Connect

    A. Fetterman and N.J. Fisch

    2010-02-15

    An extension of the alpha channeling effect to supersonically rotating mirrors shows that the rotation itself can be driven using alpha particle energy. Alpha channeling uses radiofrequency waves to remove alpha particles collisionlessly at low energy. We show that stationary magnetic fields with high nθ can be used for this purpose, and simulations show that a large fraction of the alpha energy can be converted to rotation energy.

  3. Experimental and Theoretical Electron Density Distribution of Alpha,Alpha-Trehalose Dihydrate

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Alpha,alpha-rehalose is of interest because of its cryoprotective and antidessicant properties, and because it possesses various technical anomalies such as 13C NMR spectra that give misleading indications of intramolecular structural symmetry. It is a non-reducing disaccharide, with the glycosidic...

  4. Correcting Coefficient Alpha for Correlated Errors: Is [alpha][K]a Lower Bound to Reliability?

    ERIC Educational Resources Information Center

    Rae, Gordon

    2006-01-01

    When errors of measurement are positively correlated, coefficient alpha may overestimate the "true" reliability of a composite. To reduce this inflation bias, Komaroff (1997) has proposed an adjusted alpha coefficient, ak. This article shows that ak is only guaranteed to be a lower bound to reliability if the latter does not include correlated…

  5. Amyloid formation and disaggregation of {alpha}-synuclein and its tandem repeat ({alpha}-TR)

    SciTech Connect

    Bae, Song Yi; Kim, Seulgi; Hwang, Heejin; Kim, Hyun-Kyung; Yoon, Hyun C.; Kim, Jae Ho; Lee, SangYoon; Kim, T. Doohun

    2010-10-01

    Research highlights: {yields} Formation of the {alpha}-synuclein amyloid fibrils by [BIMbF{sub 3}Im]. {yields} Disaggregation of amyloid fibrils by epigallocatechin gallate (EGCG) and baicalein. {yields} Amyloid formation of {alpha}-synuclein tandem repeat ({alpha}-TR). -- Abstract: The aggregation of {alpha}-synuclein is clearly related to the pathogenesis of Parkinson's disease. Therefore, detailed understanding of the mechanism of fibril formation is highly valuable for the development of clinical treatment and also of the diagnostic tools. Here, we have investigated the interaction of {alpha}-synuclein with ionic liquids by using several biochemical techniques including Thioflavin T assays and transmission electron microscopy (TEM). Our data shows a rapid formation of {alpha}-synuclein amyloid fibrils was stimulated by 1-butyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide [BIMbF{sub 3}Im], and these fibrils could be disaggregated by polyphenols such as epigallocatechin gallate (EGCG) and baicalein. Furthermore, the effect of [BIMbF{sub 3}Im] on the {alpha}-synuclein tandem repeat ({alpha}-TR) in the aggregation process was studied.

  6. Prestimulus EEG alpha activity reflects temporal expectancy.

    PubMed

    Min, Byoung-Kyong; Park, Jin Young; Kim, Eun Joo; Kim, Joong Il; Kim, Jae-Jin; Park, Hae-Jeong

    2008-06-27

    Since prestimulus EEG alpha activity has recently been considered to convey prestimulus top-down processing, we investigated whether prestimulus alpha activity reflects temporal expectancy of upcoming stimulation even under the non-classical contingent negative variation (CNV) paradigm. EEG was recorded from 16 subjects performing a color and a shape discrimination task manipulated with constant and variable inter-stimulus interval (ISI) conditions. The power of oscillatory activity was investigated by convolving the EEG signals with Morlet wavelets. The constant ISI condition yielded significantly shorter reaction times than the variable ISI condition, indicating more efficient preparation for upcoming stimuli during the constant ISI. We found significantly higher prestimulus alpha activity in the constant ISI condition than in the variable ISI condition, but no significant CNV even in the constant ISI condition. Such a reflection of temporal expectancy in the prestimulus alpha activity corroborates that the prestimulus top-down mental state for preparing upcoming task-performance is considerably reflected in the prestimulus ongoing alpha activity. PMID:18486342

  7. Role of Frontal Alpha Oscillations in Creativity

    PubMed Central

    Lustenberger, Caroline; Boyle, Michael R.; Foulser, A. Alban; Mellin, Juliann M.; Fröhlich, Flavio

    2015-01-01

    Creativity, the ability to produce innovative ideas, is a key higher-order cognitive function that is poorly understood. At the level of macroscopic cortical network dynamics, recent EEG data suggests that cortical oscillations in the alpha frequency band (8 – 12 Hz) are correlated with creative thinking. However, whether alpha oscillations play a fundamental role in creativity has remained unknown. Here we show that creativity is increased by enhancing alpha power using 10 Hz transcranial alternating current stimulation (10Hz-tACS) of the frontal cortex. In a study of 20 healthy participants with a randomized, balanced cross-over design, we found a significant improvement of 7.4% in the Creativity Index measured by the Torrance Test of Creative Thinking, a comprehensive and most frequently used assay of creative potential and strengths. In a second similar study with 20 subjects, 40Hz-tACS was used in instead of 10Hz-tACS to rule out a general “electrical stimulation” effect. No significant change in the Creativity Index was found for such frontal gamma stimulation. Our results suggest that alpha activity in frontal brain areas is selectively involved in creativity; this enhancement represents the first demonstration of specific neuronal dynamics that drive creativity and can be modulated by non-invasive brain stimulation. Our findings agree with the model that alpha recruitment increases with internal processing demands and is involved in inhibitory top-down control, which is an important requirement for creative ideation. PMID:25913062

  8. Alpha-particle sensitive test SRAMs

    NASA Technical Reports Server (NTRS)

    Buehler, M. G.; Blaes, B. R.

    1990-01-01

    A bench-level test is being developed to evaluate memory-cell upsets in a test SRAM designed with a cell offset voltage. This offset voltage controls the critical charge needed to upset the cell. The effect is demonstrated using a specially designed 2-micron n-well CMOS 4-kb test SRAM and a Po-208 5.1-MeV 0.61-LET alpha-particle source. This test SRAM has been made sensitive to alpha particles through the use of a cell offset voltage, and this has allowed a bench-level characterization in a laboratory setting. The experimental data are linked to a alpha-particle interaction physics and to SPICE circuit simulations through the alpha-particle collection depth. The collection depth is determined by two methods and found to be about 7 micron. In addition, alpha particles that struck outside the bloated drain were able to flip the SRAM cells. This lateral charge collection was observed to be more than 6 micron.

  9. H-alpha Observations of MKW10

    NASA Astrophysics Data System (ADS)

    Johnson, Harold; Coble, Kimberly A.; Koopmann, Rebecca A.; Durbala, Adriana; Undergraduate ALFALFA Team

    2016-01-01

    As part of the Undergraduate ALFALFA Team project looking at clusters and groups of galaxies to investigate the effects of environment on star formation, we analyzed H-alpha and R-band observations of the group MKW10 from the WIYN 0.9-m telescope with MOSAIC camera at Kitt Peak. We continuum-subtract the H-alpha images by scaling and subtracting the broadband R images. This process includes: determining the seeing of each image by calculating the FWHM values of several stars in the image; convolving all images to the worst seeing; stacking images for each filter; subtracting sky background; scaling the R image to H-alpha; and subtracting the scaled R from H-alpha. We then use the H-alpha-continuum-subtracted image to perform surface photometry of individual galaxies in MKW10. The data will be used to determine star formation rates and distributions of galaxies in this group environment and will be compared to results for galaxies in other UAT group and cluster environments. Analysis is ongoing.This work has been supported by NSF grant AST-1211005 and the Illinois Space Grant Consortium.

  10. Venus - False Color Image of Alpha Regio

    NASA Technical Reports Server (NTRS)

    1991-01-01

    This Magellan radar image shows Alpha Regio, a topographic upland approximately 1,300 kilometers (806 miles) across which is centered on 25 degrees south latitude, 4 degrees east longitude. In 1963 Alpha Regio was the first feature on Venus to be identified from Earth based radar. The radar bright area of Alpha Regio is characterized by multiple sets of intersecting trends of structural features such as ridges, troughs and flat floored fault valleys that together form a polygonal outline. Circular to oblong dark patches within the complex terrain are local topographic lows that are filled with smooth volcanic lava. Complex ridged terrains such as Alpha, formerly called 'tessera' in the Soviet Venera 15 and 16 radar missions and the Arecibo radar data, appear to be widespread and common surface expressions of Venusian tectonic processes. Directly south of the complex ridged terrain is a large ovoid shaped feature named Eve. The radar bright spot located centrally within Eve marks the location of the prime meridian of Venus. Magellan radar data reveals that relatively young lava flows emanate from Eve and extends into the southern margin of the ridged terrain at Alpha. The mosaic was produced by Eric de Jong and Myche McAuley in the JPL Multimission Image Processing Laboratory.

  11. ALPHA ATTENUATION DUE TO DUST LOADING

    SciTech Connect

    Dailey, A; Dennis Hadlock, D

    2007-08-09

    Previous studies had been done in order to show the attenuation of alpha particles in filter media. These studies provided an accurate correction for this attenuation, but there had not yet been a study with sufficient results to properly correct for attenuation due to dust loading on the filters. At the Savannah River Site, filter samples are corrected for attenuation due to dust loading at 20%. Depending on the facility the filter comes from and the duration of the sampling period, the proper correction factor may vary. The objective of this study was to determine self-absorption curves for each of three counting instruments. Prior work indicated significant decreases in alpha count rate (as much as 38%) due to dust loading, especially on filters from facilities where sampling takes place over long intervals. The alpha count rate decreased because of a decrease in the energy of the alpha. The study performed resulted in a set of alpha absorption curves for each of three detectors. This study also took into account the affects of the geometry differences in the different counting equipment used.

  12. Benchmarking the External Surrogate Ratio Method using the (alpha,alpha' f) reaction at STARS

    SciTech Connect

    Lesher, S R; Bernstein, L A; Ai, H; Beausang, C W; Bleuel, D; Burke, J T; Clark, R M; Fallon, P; Gibelin, J; Lee, I Y; Lyles, B F; Macchiavelli, A O; McMahan, M A; Moody, K J; Norman, E B; Phair, L; Rodriguez-Vieitez, E; Wiedeking, M

    2008-01-09

    We measured the ratio of the fission probabilities of {sup 234}U* relative to {sup 236}U* formed via an ({alpha},{alpha}{prime}) direct reactions using the STARS array at the 88-inch cyclotron at the Lawrence Berkeley National Laboratory. This ratio has a shape similar to the ratio of neutron capture probabilities from {sup 233}U(n; f) and {sup 235}U(n; f), indicating the alpha reactions likely formed a compound nucleus. This result indicates that the ratios of fission exit channel probabilities for two actinide nuclei populated via ({alpha}, {alpha}{prime}) can be used to determine an unknown fission cross section relative to a known one. The validity of the External Surrogate Ratio Method (ESRM) is tested and the results support the conclusions of Burke et al. [1].

  13. Attempts to chemically investigate element 112

    SciTech Connect

    Eichler, R.; Bruchle, W.; Buda, R.; Burger, S.; Dressler, R.; Dullmann, C.E.; Dvorak, J.; Eberhardt, K.; Eichler, B.; Folden, C.M.; Gaggeler, H.W.; Gregorich, K.E.; Haenssler, F.; Hoffman, D.C.; Hummrich,H.; Jager, E.; Kratz, J.V.; Kuczewski, B.; Liebe, D.; Nayak, D.; Nitsche,H.; Piguet, D.; Qin, Z.; Rieth, U.; Schadel, M.; Schausten, B.; Schimpf,E.; Semchenkov, A.; Soverna, S.; Sudowe, R.; Trautmann, N.; Thorle, P.; Turler, A.; Wierczinski, B.; Wiehl, N.; Wilk, P.A.; Wirth, G.; Yakushev,A.B.; von Zweidorf, A.

    2005-09-15

    Two experiments aiming at the chemical investigation of element 112 produced in the heavy ion induced nuclear fusion reaction of Ca-48 with U-238 were performed at the Geselischaft fur Schwerionenforschung (GSI), Darmstadt, Germany. Both experiments were designed to determine the adsorption enthalpy of element 112 on a gold surface using a thermochromatography setup. The temperature range covered in the thermochromatography experiments allowed the adsorption of Hg at about 35 degrees C and of Rn at about -180 degrees C. Reports from the Flerov Laboratory for Nuclear Reactions (FLNR), Dubna, Russia claim production of a 5-min spontaneous fission (SF) activity assigned to 211112 for the U-238 (Ca-48,3n) (283)112 reaction. Hence, Experiment I was designed to detect spontaneously fissioning (SF) isotopes of element 112 with half-lives (t(1/2)) longer than about 20 s. 11 high-energy events were detected. 7 events exhibit a deposition pattern resembling a chromatographic peak in the vicinity of Rn deposition. However, the energy of the events observed in Experiment I was lower than expected for a SF-decay of (283)112. Therefore, these events could not be unambiguously attributed to the decay of (283)112. In contradiction with earlier publications newer reports from FLNR Dubna claim that (283)12 decays by a-particle emission (E-alpha = 9.5 MeV) with t(1/2) = 4 s followed by a SF-decay of (279)Ds (t(1/2) = 0.2 s). Therefore, Experiment II was designed to be sensitive to both claimed decay properties of (283)112. However, during this experiment neither short alpha-SF correlations nor SF coincidences were detected. The conclusion is that (283)112 was not unambiguously detected, neither in Experiment I nor in Experiment II.

  14. Elemental Food for Thought

    ERIC Educational Resources Information Center

    Cady, Susan

    2005-01-01

    One of the first tasks students learn in chemistry is to pronounce and spell the names of elements and learn their corresponding chemical symbols. Repetitive oral recitation is commonly used to learn this information, but games and puzzles can make this task creative, variable, and fun. Elemental Food for Thought is a puzzlelike activity that…

  15. MOLDED SEALING ELEMENT

    DOEpatents

    Bradford, B.W.; Skinner, W.J.

    1959-03-24

    Molded sealing elements suitable for use under conditions involving exposure to uranium hexafluoride vapor are described. Such sealing elements are made by subjecting graphitic carbons to a preliminary treatment with uranium hexafluoride vapor, and then incorporating polytetrafluorethylene in them. The resulting composition has good wear resistant and frictional properties and is resistant to disintegration by uranium hexafluoride over long periods of exposure.

  16. The Elements Drawing.

    ERIC Educational Resources Information Center

    Dkeidek, Iyad M.

    2003-01-01

    Presents an educational game designed for first- or second-year high school students who have already studied themes related to the periodic table elements, such as their symbols, electronic configurations, properties, and uses. The game is designed to help students learn the symbols of the elements and their properties or uses in a fun, engaging…

  17. Automatic finite element generators

    NASA Technical Reports Server (NTRS)

    Wang, P. S.

    1984-01-01

    The design and implementation of a software system for generating finite elements and related computations are described. Exact symbolic computational techniques are employed to derive strain-displacement matrices and element stiffness matrices. Methods for dealing with the excessive growth of symbolic expressions are discussed. Automatic FORTRAN code generation is described with emphasis on improving the efficiency of the resultant code.

  18. Movies and Literary Elements.

    ERIC Educational Resources Information Center

    Keller, Rodney D.

    Showing ten-minute movie clips can be an effective way to motivate students to read literature and to teach elements of fiction, namely plot, character, setting, symbol, irony, and theme. A clip from "And Then There Were None" may be used to teach various elements of plot, including conflict and the four types of conflict (man vs. man, man vs.…

  19. Trace element emissions

    SciTech Connect

    Benson, S.A.; Erickson, T.A.; Steadman, E.N.; Zygarlicke, C.J.; Hauserman, W.B.; Hassett, D.J.

    1994-10-01

    The Energy & Environmental Research Center (EERC) is carrying out an investigation that will provide methods to predict the fate of selected trace elements in integrated gasification combined cycle (IGCC) and integrated gasification fuel cell (IGFC) systems to aid in the development of methods to control the emission of trace elements determined to be air toxics. The goal of this project is to identify the effects of critical chemical and physical transformations associated with trace element behavior in IGCC and IGFC systems. The trace elements included in this project are arsenic, chromium, cadmium, mercury, nickel, selenium, and lead. The research seeks to identify and fill, experimentally and/or theoretically, data gaps that currently exist on the fate and composition of trace elements. The specific objectives are to (1) review the existing literature to identify the type and quantity of trace elements from coal gasification systems, (2) perform laboratory-scale experimentation and computer modeling to enable prediction of trace element emissions, and (3) identify methods to control trace element emissions.

  20. Results from the Lunar Prospector Alpha Particle Spectrometer: Detection of Radon-222 Over Craters Aristarchus and Kepler

    NASA Astrophysics Data System (ADS)

    Lawson, S. L.; Feldman, W. C.; Lawrence, D. J.; Moore, K. R.; Belian, R. D.; Maurice, S.; Binder, A. B.

    2001-11-01

    The Lunar Prospector Alpha Particle Spectrometer (LP APS) searched for lunar surface gas release events and mapped their distribution by detecting alpha particles produced by the decay of gaseous radon-222 (5.5 MeV, 3.8 day half-life), solid polonium-218 (6.0 MeV, 3 minute half-life), and solid polonium-210 (5.3 MeV, 138 day half-life, but held up in production by the 21 year half-life of lead-210). These three nuclides are radioactive daughters from the decay of uranium-238. Radon reaches the lunar surface either at areas of high soil porosity or where fissures release the trapped gases in which radon is entrained. We have examined APS data within +/- 45 degrees of the equator acquired during periods of low interplanetary alpha particle flux. The spectra were summed over all LP mapping cycles when the instrument was turned on (approximately 229 days over 16 months). To yield lunar alpha particle maps, we summed over a 0.2 MeV energy range centered on each of the three alpha particle energies noted above. The LP APS found only a faint indication of alpha particles resulting from the decay of polonium-218 and only a marginal detection of alpha particles from polonium-210. However, our radon-222 alpha particle map indicates that radon gas is presently emanating from the vicinity of craters Aristarchus and Kepler. The LP gamma-ray spectrometer, which effectively has significantly higher spatial resolution than the APS, identified thorium enrichments at these two craters. Thorium and uranium are both incompatible elements whose lunar surface abundances are highly correlated; thus, it is likely that the radon-222 alpha particles measured using the LP APS originate from Kepler and Aristarchus. Our detection of radon over Aristarchus is consistent with the results of the Apollo 15 APS.

  1. Monolithic freeform element

    NASA Astrophysics Data System (ADS)

    Kiontke, Sven R.

    2015-09-01

    For 10 years there has been the asphere as one of the new products to be accepted by the market. All parts of the chain design, production and measurement needed to learn how to treat the asphere and what it is helpful for. The aspheric optical element now is established and accepted as an equal optical element between other as a fast growing part of all the optical elements. Now we are focusing onto the next new element with a lot of potential, the optical freeform surface. Manufacturing results will be shown for fully tolerance optic including manufacturing, setup and optics configurations including measurement setup. The element itself is a monolith consisting of several optical surfaces that have to be aligned properly to each other. The freeform surface is measured for surface form tolerance (irregularity, slope, Zernike, PV).

  2. NUCLEAR REACTOR FUEL ELEMENT

    DOEpatents

    Wheelock, C.W.; Baumeister, E.B.

    1961-09-01

    A reactor fuel element utilizing fissionable fuel materials in plate form is described. This fuel element consists of bundles of fuel-bearing plates. The bundles are stacked inside of a tube which forms the shell of the fuel element. The plates each have longitudinal fins running parallel to the direction of coolant flow, and interspersed among and parallel to the fins are ribs which position the plates relative to each other and to the fuel element shell. The plate bundles are held together by thin bands or wires. The ex tended surface increases the heat transfer capabilities of a fuel element by a factor of 3 or more over those of a simple flat plate.

  3. Active element pattern

    NASA Astrophysics Data System (ADS)

    Pozar, D. M.

    1994-08-01

    This review article will discuss the use of the active element pattern for prediction of the scan performance of large phased array antennas. The introduction and application of the concept of the active element pattern goes back at least 30 years (1) -(6) , but the subject is generally not covered in modern antenna engineering textbooks or handbooks, and many contemporary workers are unfamiliar with this simple but powerful idea. In addition, early references on this subject do not provide a rigorous discussion or derivation of the active element pattern, relying instead on a more qualitative interpretation. The purpose of this communication is to make the technique of active element patterns more accessible to antenna engineers, and to provide a new derivation of the basic active element pattern relations in terms of scattering parameters.

  4. Dominant negative mutant of retinoic acid receptor alpha inhibits retinoic acid-induced P19 cell differentiation by binding to DNA.

    PubMed

    Costa, S L; McBurney, M W

    1996-05-25

    Retinoic acid (RA) is a potent inducer of P19 cell differentiation. RA activity is thought to be mediated by nuclear RA receptors (RARs), transcription factors whose activity is dependent on RA. There are three RARs called alpha, beta, and gamma. We created truncated versions of the three RARs and compared their activities as inhibitors of RA-mediated gene transcription and of P19 cell differentiation. Only mutants of the RAR alpha were inhibitory in these assays. A mutant of RAR alpha carrying a 10-amino-acid insert was able to heterodimerize with RXRbeta or with the normal RAR alpha and the inhibitory activity of this mutant was dependent on an intact DNA binding domain. We conclude that dominant negative mutants of RAR alpha act by heterodimerizing with RXRs or RARs and binding to RA response elements on DNA, thereby preventing binding of the normal receptors to those sites. PMID:8635515

  5. Structure of alpha-glycerophosphate Oxidase from Streptococcus sp.: a Template for the Mitochondrial alpha-glycerophosphate Dehydrogenase

    SciTech Connect

    T Colussi; D Parsonage; W Boles; T Matsuoka; T Mallett; P Karplus; A Claiborne

    2011-12-31

    The FAD-dependent {alpha}-glycerophosphate oxidase (GlpO) from Enterococcus casseliflavus and Streptococcus sp. was originally studied as a soluble flavoprotein oxidase; surprisingly, the GlpO sequence is 30-43% identical to those of the {alpha}-glycerophosphate dehydrogenases (GlpDs) from mitochondrial and bacterial sources. The structure of a deletion mutant of Streptococcus sp. GlpO (GlpO{Delta}, lacking a 50-residue insert that includes a flexible surface region) has been determined using multiwavelength anomalous dispersion data and refined at 2.3 {angstrom} resolution. Using the GlpO{Delta} structure as a search model, we have also determined the intact GlpO structure, as refined at 2.4 {angstrom} resolution. The first two domains of the GlpO fold are most closely related to those of the flavoprotein glycine oxidase, where they function in FAD binding and substrate binding, respectively; the GlpO C-terminal domain consists of two helix bundles and is not closely related to any known structure. The flexible surface region in intact GlpO corresponds to a segment of missing electron density that links the substrate-binding domain to a {beta}{beta}{alpha} element of the FAD-binding domain. In accordance with earlier biochemical studies (stabilizations of the covalent FAD-N5-sulfite adduct and p-quinonoid form of 8-mercapto-FAD), Ile430-N, Thr431-N, and Thr431-OG are hydrogen bonded to FAD-O2{alpha} in GlpO{Delta}, stabilizing the negative charge in these two modified flavins and facilitating transfer of a hydride to FAD-N5 (from Glp) as well. Active-site overlays with the glycine oxidase-N-acetylglycine and d-amino acid oxidase-d-alanine complexes demonstrate that Arg346 of GlpO{Delta} is structurally equivalent to Arg302 and Arg285, respectively; in both cases, these residues interact directly with the amino acid substrate or inhibitor carboxylate. The structural and functional divergence between GlpO and the bacterial and mitochondrial GlpDs is also discussed.

  6. Alpha-decay of light protactinium isotopes

    SciTech Connect

    Faestermann, T.; Gillitzer, A.; Hartel, K.; Henning, W.; Kienle, P.

    1987-12-10

    Light protactinium isotopes have been produced with /sup 204/Pb (/sup 19/F,xn) reactions. ..cap alpha..-activities with E/sub ..cap alpha../ = 9.90(5) MeV, T/sub 1/2/ = 53(10) ns and E/sub ..cap alpha../ = 9.65(5) MeV, T/sub 1/2/ = 0.78(16) ..mu..s could be attributed to the previously unobserved nuclei /sup 219/Pa and /sup 220/Pa with the help of excitation functions. The peak cross sections for the 4n and 3n evaporation channels are on the order of 10 ..mu..b. The decay energies as well as the halflives fit well into the systematics of these nuclei close to the magic neutron number N = 126. /sup 219/Pa is the shortest lived nuclide known with directly measured halflife.

  7. Coefficient alpha and interculture test selection.

    PubMed

    Thurber, Steven; Kishi, Yasuhiro

    2014-04-01

    The internal consistency reliability of a measure can be a focal point in an evaluation of the potential adequacy of an instrument for adaptation to another cultural setting. Cronbach's alpha (α) coefficient is often used as the statistical index for such a determination. However, alpha presumes a tau-equivalent test and may constitute an inaccurate population estimate for multidimensional tests. These notions are expanded and examined with a Japanese version of a questionnaire on nursing attitudes toward suicidal patients, originally constructed in Sweden using the English language. The English measure was reported to have acceptable internal consistency (α) albeit the dimensionality of the questionnaire was not addressed. The Japanese scale was found to lack tau-equivalence. An alternative to alpha, "composite reliability," was computed and found to be below acceptable standards in magnitude and precision. Implications for research application of the Japanese instrument are discussed. PMID:22523134

  8. Radiation risks from inhaled alpha emitters

    NASA Astrophysics Data System (ADS)

    Simmons, Jack A.

    2001-06-01

    The alpha emitter that gives rise to the greatest concern over its link to the induction of lung cancer is radon. As noted by the ICRP, attempts to relate the risk of cancer induction to the dose delivered by the alpha particles result in a value for this risk which is unrealistically high. Instead, an estimate based on the epidemiology of radon in mines is preferred. The logical result, that the weighting factor for these alpha particles should be very much lesser than the recommended value of 20, appears to have been ignored. It will be shown that there are two fundamental reasons for this large discrepancy. The first is that the implied "linear non-threshold" hypothesis is not supported by recent investigations. The second is that the concept of "dose" is meaningless at the levels of exposure considered in this context. Alternative proposals in terms of fluence and the effect cross-section will be presented.

  9. Synthesis of peptide .alpha.-thioesters

    DOEpatents

    Camarero, Julio A.; Mitchell, Alexander R.; De Yoreo, James J.

    2008-08-19

    Disclosed herein is a new method for the solid phase peptide synthesis (SPPS) of C-terminal peptide .alpha. thioesters using Fmoc/t-Bu chemistry. This method is based on the use of an aryl hydrazine linker, which is totally stable to conditions required for Fmoc-SPPS. When the peptide synthesis has been completed, activation of the linker is achieved by mild oxidation. The oxidation step converts the acyl-hydrazine group into a highly reactive acyl-diazene intermediate which reacts with an .alpha.-amino acid alkylthioester (H-AA-SR) to yield the corresponding peptide .alpha.-thioester in good yield. A variety of peptide thioesters, cyclic peptides and a fully functional Src homology 3 (SH3) protein domain have been successfully prepared.

  10. ALPHA MIS: Reference manual. Revision 2

    SciTech Connect

    Lovin, J.K.; Haese, R.L.; Heatherly, R.D.; Hughes, S.E.; Ishee, J.S.; Pratt, S.M.; Smith, D.W.

    1992-02-01

    ALPHA is a powerful and versatile management information system (MIS) initiated and sponsored and by the Finance and Business Management Division of Oak Ridge National Laboratory, who maintain and develop it in concert with the Business Systems Division for its Information Center. A general-purpose MIS, ALPHA allows users to access System 1022 and System 1032 databases to obtain and manage information. From a personal computer or a data terminal, Energy Systems employees can use ALPHA to control their own report reprocessing. Using four general commands (Database, Select, Sort, and Report) they can (1) choose a mainframe database, (2) define subsets within it, (3) sequentially order a subset by one or more variables, and (4) generate a report with their own or a canned format.

  11. Nuclear diagnostic for fast alpha particles

    DOEpatents

    Grisham, Larry R.; Post Jr., Douglass E.; Dawson, John M.

    1986-06-03

    Measurement of the velocity distribution of confined energetic alpha particles resulting from deuterium-tritium fusion reactions in a magnetically contained plasma is provided. The fusion plasma is seeded with energetic boron neutrals for producing, by means of the reaction .sup.10 B (.alpha.,n) .sup.13 N reaction, radioactive nitrogen nuclei which are then collected by a probe. The radioactivity of the probe is then measured by conventional techniques in determining the energy distribution of the alpha particles in the plasma. In a preferred embodiment, diborane gas (B.sub.2 H.sub.6) is the source of the boron neutrals to produce .sup.13 N which decays almost exclusively by positron emission with a convenient half-life of 10 minutes.

  12. Nuclear diagnostic for fast alpha particles

    DOEpatents

    Grisham, Larry R.; Post, Jr., Douglass E.; Dawson, John M.

    1986-01-01

    Measurement of the velocity distribution of confined energetic alpha particles resulting from deuterium-tritium fusion reactions in a magnetically contained plasma is provided. The fusion plasma is seeded with energetic boron neutrals for producing, by means of the reaction .sup.10 B (.alpha.,n) .sup.13 N reaction, radioactive nitrogen nuclei which are then collected by a probe. The radioactivity of the probe is then measured by conventional techniques in determining the energy distribution of the alpha particles in the plasma. In a preferred embodiment, diborane gas (B.sub.2 H.sub.6) is the source of the boron neutrals to produce .sup.13 N which decays almost exclusively by positron emission with a convenient half-life of 10 minutes.

  13. Microdosimetry for Targeted Alpha Therapy of Cancer

    PubMed Central

    Huang, Chen-Yu; Guatelli, Susanna; Oborn, Bradley M.; Allen, Barry J.

    2012-01-01

    Targeted alpha therapy (TAT) has the advantage of delivering therapeutic doses to individual cancer cells while reducing the dose to normal tissues. TAT applications relate to hematologic malignancies and now extend to solid tumors. Results from several clinical trials have shown efficacy with limited toxicity. However, the dosimetry for the labeled alpha particle is challenging because of the heterogeneous antigen expression among cancer cells and the nature of short-range, high-LET alpha radiation. This paper demonstrates that it is inappropriate to investigate the therapeutic efficacy of TAT by macrodosimetry. The objective of this work is to review the microdosimetry of TAT as a function of the cell geometry, source-target configuration, cell sensitivity, and biological factors. A detailed knowledge of each of these parameters is required for accurate microdosimetric calculations. PMID:22988479

  14. Ultraviolet observations of alpha Aurigae from Copernicus

    NASA Technical Reports Server (NTRS)

    Dupree, A. K.

    1975-01-01

    Emission lines of L-alpha (1215.67 A) and O VI (1031.94 A) were detected in the spectroscopic binary alpha Aur (Capella) with the Princeton experiment on Copernicus. Temperatures of the emitting regions are inferred to be in excess of 300,000 K. The temperature and emission measure are consistent with a variable source of soft X-rays. If the emission is attributed to the primary star (G5 III), the atmosphere is expanding with velocities of about 20-100 km/s. Such expansion can lead to material within the binary system. The density of interstellar hydrogen inferred from absorption of stellar L-alpha appears to be approximately 0.01 hydrogen atoms per cu cm.

  15. The evolutionary conservation of DNA polymerase. alpha

    SciTech Connect

    Miller, M.A.; Korn, D.; Wang, T.S.F. )

    1988-08-25

    The evolutionary conservation of DNA polymerase {alpha} was assessed by immunological and molecular genetic approaches. Four anti-human KB cell DNA polymerase {alpha} monoclonal antibodies were tested for their ability to recognize a phylogenetically broad array of eukaryotic DNA polymerases. While the single non-neutralizing antibody used in this study recognizes higher mammalian (human, simian, canine, and bovine) polymerases only, three neutralizing antibodies exhibit greater, but variable, extents of cross-reactivity among vertebrate species. Genomic Southern hybridization studies with the cDNA of the human DNA polymerase {alpha} catalytic polypeptide identify the existence of many consensus DNA sequences within the DNA polymerase genes of vertebrate, invertebrate, plant and unicellular organisms. These findings illustrate the differential evolutionary conservation of four unique epitopes on DNA sequences, presumably reflective of critical functional domains, in the DNA polymerase genes from a broad diversity of living forms.

  16. Alternating current long range alpha particle detector

    DOEpatents

    MacArthur, D.W.; McAtee, J.L.

    1993-02-16

    An alpha particle detector, utilizing alternating currents, which is capable of detecting alpha particles from distinct sources. The use of alternating currents allows use of simpler ac circuits which, in turn, are not susceptible to dc error components. It also allows the benefit of gas gain, if desired. In the invention, a voltage source creates an electric field between two conductive grids, and between the grids and a conductive enclosure. Air containing air ions created by collision with alpha particles is drawn into the enclosure and detected. In some embodiments, the air flow into the enclosure is interrupted, creating an alternating flow of ions. In another embodiment, a modulated voltage is applied to the grid, also modulating the detection of ions.

  17. Alternating current long range alpha particle detector

    DOEpatents

    MacArthur, Duncan W.; McAtee, James L.

    1993-01-01

    An alpha particle detector, utilizing alternating currents, whcih is capable of detecting alpha particles from distinct sources. The use of alternating currents allows use of simpler ac circuits which, in turn, are not susceptible to dc error components. It also allows the benefit of gas gain, if desired. In the invention, a voltage source creates an electric field between two conductive grids, and between the grids and a conductive enclosure. Air containing air ions created by collision with alpha particles is drawn into the enclosure and detected. In some embodiments, the air flow into the enclosure is interrupted, creating an alternating flow of ions. In another embodiment, a modulated voltage is applied to the grid, also modulating the detection of ions.

  18. Lyman-alpha imagery of Comet Kohoutek

    NASA Technical Reports Server (NTRS)

    Carruthers, G. R.; Opal, C. B.; Page, T. L.; Meier, R. R.; Prinz, D. K.

    1974-01-01

    Electrographic imagery of Comet Kohoutek in the 1100-1500 A wavelength range was obtained from a sounding rocket on Jan. 8, 1974, and from the Skylab space station on 13 occasions between Nov. 26, 1973 and Feb. 2, 1974. These images are predominantly due to Lyman-alpha (1216 A) emission from the hydrogen coma of the comet. The rocket pictures have been calibrated for absolute sensitivity and a hydrogen production rate has been determined. However, the Skylab camera suffered degradation of its sensitivity during the mission, and its absolute sensitivity for each observation can only be estimated by comparison of the comet images with those taken by the rocket camera, with imagery of the geocoronal Lyman-alpha glow, of the moon in reflected Lyman-alpha, and of ultraviolet-bright stars. The rocket and geocoronal comparisons are used to derive a preliminary, qualitative history of the development of the cometary hydrogen coma and the associated hydrogen production rate.

  19. Solution structure of {alpha}-conotoxin PIA, a novel antagonist of {alpha}6 subunit containing nicotinic acetylcholine receptors

    SciTech Connect

    Chi, Seung-Wook; Lee, Si-Hyung; Kim, Do-Hyoung; Kim, Jae-Sung; Olivera, Baldomero M.; McIntosh, J. Michael; Han, Kyou-Hoon . E-mail: khhan600@kribb.re.kr

    2005-12-30

    {alpha}-Conotoxin PIA is a novel nicotinic acetylcholine receptor (nAChR) antagonist isolated from Conus purpurascens that targets nAChR subtypes containing {alpha}6 and {alpha}3 subunits. {alpha}-conotoxin PIA displays 75-fold higher affinity for rat {alpha}6/{alpha}3{beta}2{beta}3 nAChRs than for rat {alpha}3{beta}2 nAChRs. We have determined the three-dimensional structure of {alpha}-conotoxin PIA by nuclear magnetic resonance spectroscopy. The {alpha}-conotoxin PIA has an '{omega}-shaped' overall topology as other {alpha}4/7 subfamily conotoxins. Yet, unlike other neuronally targeted {alpha}4/7-conotoxins, its N-terminal tail Arg{sup 1}-Asp{sup 2}-Pro{sup 3} protrudes out of its main molecular body because Asp{sup 2}-Pro{sup 3}-Cys{sup 4}-Cys{sup 5} forms a stable type I {beta}-turn. In addition, a kink introduced by Pro{sup 15} in the second loop of this toxin provides a distinct steric and electrostatic environment from those in {alpha}-conotoxins MII and GIC. By comparing the structure of {alpha}-conotoxin PIA with other functionally related {alpha}-conotoxins we suggest structural features in {alpha}-conotoxin PIA that may be associated with its unique receptor recognition profile.

  20. Low-valent niobium-mediated double activation of C-F/C-H bonds: fluorene synthesis from o-arylated alpha,alpha,alpha-trifluorotoluene derivatives.

    PubMed

    Fuchibe, Kohei; Akiyama, Takahiko

    2006-02-01

    By the treatment of 0.3 molar amount of NbCl5 and LiAlH4, o-arylated alpha,alpha,alpha-trifluorotoluenes afforded fluorene derivatives in good yields. C-F bonds of the CF3 group and the neighboring ortho C-H bond were doubly activated to give the coupling products. PMID:16448098

  1. Development of Flight Slit-Jaw Optics for Chromospheric Lyman-Alpha SpectroPolarimeter

    NASA Technical Reports Server (NTRS)

    Kubo, Masahito; Suematsu, Yoshinori; Kano, Ryohei; Bando, Takamasa; Hara, Hirohisa; Narukage, Noriyuki; Katsukawa, Yukio; Ishikawa, Ryoko; Ishikawa, Shin-nosuke; Kobiki, Toshihiko; Tsuneta, Saku; Kobayashi, Ken; Winebarger, Amy; Takeyama, Norihide; Kanai, Yoshikazu; Sakakibara, Yoshiko

    2015-01-01

    In sounding rocket experiment CLASP, I have placed a slit a mirror-finished around the focal point of the telescope. The light reflected by the mirror surface surrounding the slit is then imaged in Slit-jaw optical system, to obtain the a-ray Lyman secondary image. This image, not only to use the real-time image in rocket flight rocket oriented direction selection, and also used as a scientific data showing the spatial structure of the Lyman alpha emission line intensity distribution and solar chromosphere around the observation area of the polarimetric spectroscope. Slit-jaw optical system is a two off-axis mirror unit part including a parabolic mirror and folding mirror, Lyman alpha transmission filter, the optical system magnification 1x consisting camera. The camera is supplied from the United States, and the other was carried out fabrication and testing in all the Japanese side. Slit-jaw optical system, it is difficult to access the structure, it is necessary to install the low place clearance. Therefore, influence the optical performance, the fine adjustment is necessary optical elements are collectively in the form of the mirror unit. On the other hand, due to the alignment of the solar sensor in the US launch site, must be removed once the Lyman alpha transmission filter holder including a filter has a different part from the mirror unit. In order to make the structure simple, stray light measures Aru to concentrate around Lyman alpha transmission filter. To overcome the difficulties of performing optical alignment in Lyman alpha wavelength absorbed by the atmosphere, it was planned 'following four steps in order to reduce standing time alignment me. 1. is measured in advance refractive index at Lyman alpha wavelength of Lyman alpha transmission filter (121.567nm), to prepare a visible light Firuwo having the same optical path length in the visible light (630nm).2. The mirror structure CLASP before mounting unit standing, dummy slit and camera standing

  2. Opposite effects of the acute promyelocytic leukemia PML-retinoic acid receptor alpha (RAR alpha) and PLZF-RAR alpha fusion proteins on retinoic acid signalling.

    PubMed Central

    Ruthardt, M; Testa, U; Nervi, C; Ferrucci, P F; Grignani, F; Puccetti, E; Grignani, F; Peschle, C; Pelicci, P G

    1997-01-01

    Fusion proteins involving the retinoic acid receptor alpha (RAR alpha) and the PML or PLZF nuclear protein are the genetic markers of acute promyelocytic leukemias (APLs). APLs with the PML-RAR alpha or the PLZF-RAR alpha fusion protein are phenotypically indistinguishable except that they differ in their sensitivity to retinoic acid (RA)-induced differentiation: PML-RAR alpha blasts are sensitive to RA and patients enter disease remission after RA treatment, while patients with PLZF-RAR alpha do not. We here report that (i) like PML-RAR alpha expression, PLZF-RAR alpha expression blocks terminal differentiation of hematopoietic precursor cell lines (U937 and HL-60) in response to different stimuli (vitamin D3, transforming growth factor beta1, and dimethyl sulfoxide); (ii) PML-RAR alpha, but not PLZF-RAR alpha, increases RA sensitivity of hematopoietic precursor cells and restores RA sensitivity of RA-resistant hematopoietic cells; (iii) PML-RAR alpha and PLZF-RAR alpha have similar RA binding affinities; and (iv) PML-RAR alpha enhances the RA response of RA target genes (those for RAR beta, RAR gamma, and transglutaminase type II [TGase]) in vivo, while PLZF-RAR alpha expression has either no effect (RAR beta) or an inhibitory activity (RAR gamma and type II TGase). These data demonstrate that PML-RAR alpha and PLZF-RAR alpha have similar (inhibitory) effects on RA-independent differentiation and opposite (stimulatory or inhibitory) effects on RA-dependent differentiation and that they behave in vivo as RA-dependent enhancers or inhibitors of RA-responsive genes, respectively. Their different activities on the RA signalling pathway might underlie the different responses of PML-RAR alpha and PLZF-RAR alpha APLs to RA treatment. The PLZF-RAR alpha fusion protein contains an approximately 120-amino-acid N-terminal motif (called the POZ domain), which is also found in a variety of zinc finger proteins and a group of poxvirus proteins and which mediates protein

  3. Lunar surface outgassing and alpha particle measurements

    SciTech Connect

    Lawson, S. L.; Feldman, W. C.; Lawrence, David J. ,; Moore, K. R.; Elphic, R. C.; Maurice, S.; Belian, Richard D.; Binder, Alan B.

    2002-01-01

    The Lunar Prospector Alpha Particle Spectrometer (LP APS) searched for lunar surface gas release events and mapped their distribution by detecting alpha particle?; produced by the decay of gaseous radon-222 (5.5 MeV, 3.8 day half-life), solid polonium-2 18 (6.0 MeV, 3 minute half-life), and solid polonium-210 (5.3 MeV, 138 day half-life, but held up in production by the 21 year half-life of lead-210). These three nuclides are radioactive daughters from the decay of uranium-238.

  4. HETDEX: Diffuse Lyman-Alpha Emission

    NASA Astrophysics Data System (ADS)

    Tuttle, Sarah E.; Finkelstein, S.; Gebhardt, K.; HETDEX Collaboration

    2012-01-01

    The intermediate redshift universe probed by HETDEX, 1.8 < z < 3.0, holds a great deal of information about star formation and the evolution of galaxies. Although simulations reveal a regime active with gas accretion and feeding of galaxies via filaments, observational evidence for this accretion from the Intergalactic Medium (IGM) at any redshift has been very limited. Here we use data from VIRUS-P across several well-characterized fields to put limits on diffuse emission of Lyman-Alpha at the outskirts of galaxies. This work is done in preparation for a similar program with the full HETDEX sample of Lyman-Alpha Emitters (LAEs).

  5. Hydrogen Lyman-alpha coronagraph/polarimeter

    NASA Technical Reports Server (NTRS)

    Fineschi, Silvano; Hoover, Richard B.; Walker, Arthur B. C., Jr.

    1992-01-01

    The present treatment of vector magnetic field measurement in coronas by means of the Hanle effect of the Lyman-alpha line uses data from all-reflecting imaging coronagraph/polarimeters. The polarization sensitivity, bandpass, and spatial resolution of these instruments are defined through a modeling of the Hanle-effect signature in Lyman-alpha emission from coronal magnetic loops; the line-of-sight integration through an inhomogeneous coronal medium is taken into account. The use of the Hanle effect to measure solar corona vector magnetic fields is verified.

  6. Alpha particles in effective field theory

    SciTech Connect

    Caniu, C.

    2014-11-11

    Using an effective field theory for alpha (α) particles at non-relativistic energies, we calculate the strong scattering amplitude modified by Coulomb corrections for a system of two αs. For the strong interaction, we consider a momentum-dependent interaction which, in contrast to an energy dependent interaction alone [1], could be more useful in extending the theory to systems with more than two α particles. We will present preliminary results of our EFT calculations for systems with two alpha particles.

  7. Parallel Genetic Algorithm for Alpha Spectra Fitting

    NASA Astrophysics Data System (ADS)

    García-Orellana, Carlos J.; Rubio-Montero, Pilar; González-Velasco, Horacio

    2005-01-01

    We present a performance study of alpha-particle spectra fitting using parallel Genetic Algorithm (GA). The method uses a two-step approach. In the first step we run parallel GA to find an initial solution for the second step, in which we use Levenberg-Marquardt (LM) method for a precise final fit. GA is a high resources-demanding method, so we use a Beowulf cluster for parallel simulation. The relationship between simulation time (and parallel efficiency) and processors number is studied using several alpha spectra, with the aim of obtaining a method to estimate the optimal processors number that must be used in a simulation.

  8. Has iprindole an alpha adrenergic activity?

    PubMed

    Ganry, H; Bourin, M

    1993-05-01

    1. Acute administration of iprindole potentiated the toxicity of 1-norepinephrine and increased the intensity of oxotremorine-induced tremors. 2. On the forced swimming test combination iprindole with imipramine reduced the duration of immobility. 3. The action of yohimbine on the locomotor activity was antagonized by a pre-injection of iprindole. 4. Iprindole increased and prolonged exophthalmia and loss of righting reflex induced by xylazine. 5 All these results seems indicate that iprindole has an indirect alpha 1 and alpha 2 adrenergic activity.

  9. Fan-less long range alpha detector

    DOEpatents

    MacArthur, Duncan W.; Bounds, John A.

    1994-01-01

    A fan-less long range alpha detector which operates by using an electrical field between a signal plane and the surface or substance to be monitored for air ions created by collisions with alpha radiation. Without a fan, the detector can operate without the possibility of spreading dust and potential contamination into the atmosphere. A guard plane between the signal plane and the electrically conductive enclosure and maintained at the same voltage as the signal plane, reduces leakage currents. The detector can easily monitor soil, or other solid or liquid surfaces.

  10. Fan-less long range alpha detector

    DOEpatents

    MacArthur, D.W.; Bounds, J.A.

    1994-05-10

    A fan-less long range alpha detector is disclosed which operates by using an electrical field between a signal plane and the surface or substance to be monitored for air ions created by collisions with alpha radiation. Without a fan, the detector can operate without the possibility of spreading dust and potential contamination into the atmosphere. A guard plane between the signal plane and the electrically conductive enclosure and maintained at the same voltage as the signal plane, reduces leakage currents. The detector can easily monitor soil, or other solid or liquid surfaces. 2 figures.

  11. The heaviest elements

    SciTech Connect

    Hoffman, D.C. Lawrence Berkeley Lab., CA )

    1994-05-02

    How long does an atom need to exist before it's possible to do any meaningful chemistry on it Is it possible to learn anything at all about the reactions of an element for which no more than a few dozen atoms have ever existed simultaneously These are some of the questions colleagues in a few laboratories worldwide attempt to answer as they investigate the chemistry of the heaviest elements--elements produced one atom at a time in accelerators by bombarding radioactive targets with high-intensity beams of heavy ions. All of these elements spontaneously decay; the most stable of them have half-lives of only a few minutes, some that are less stable exist for only milliseconds. So far, no chemical studies have been performed on elements whose longest lived isotopes last only milliseconds because the difficulties of doing chemistry on this time scale under highly radioactive conditions are enormous. Over the past 10 years, however, nuclear chemists have developed new techniques or adapted existing ones to begin to probe the chemical properties of those very heavy elements that have half-lives in the range of seconds to minutes. Although the classic experiments are now nearly 40 years old, they are worth describing, as they were the first of their kind and illustrate many of the techniques that are still used and essential in studying these very short-lived, radioactive elements.

  12. Identification and quantification of alphaS1, alphaS2, beta, and kappa-caseins in water buffalo milk by reverse phase-high performance liquid chromatography and mass spectrometry.

    PubMed

    Feligini, Maria; Bonizzi, Ivan; Buffoni, Joanna Natalia; Cosenza, Gianfranco; Ramunno, Luigi

    2009-04-01

    A method for the simultaneous quantitation of alpha(S1), alpha(S2), beta, and kappa-caseins in water buffalo (Bubalus bubalis) milk using reverse phase high-performance liquid chromatography was developed. The molecular masses of the peaks separated by the described chromatographic protocol were determined by ESI-MS. alpha(S1)- and kappa-caseins were found to be heteromorphic in several individual milk samples. In particular, alpha(S1)-casein showed two peaks with a molecular mass of 23,490 Da and 23,516 Da, and kappa-casein showed three peaks with molecular masses of 19,165 Da, 19,177 Da, and 19,247 Da. Only one form for beta-casein (24,033 Da) and alpha(S2)-casein (22,741 Da) were detected. The mean values of casein fraction concentration observed throughout the individual samples were 8.89 gL(-1) with a relative standard deviation (RSD) of 20% for alpha(S1)-casein, 5.08 gL(-1) with a RSD of 25% for alpha(S2)-casein, 20.91 gL(-1) with a RSD of 16% for beta-casein, and 4.13 gL(-1) with a RSD of 24% for kappa-casein. Linear and second-order polynomial correlations with total nitrogen were calculated for all casein fractions.

  13. Characterization of the 5'-flanking region of the gene for the alpha chain of human fibrinogen.

    PubMed

    Hu, C H; Harris, J E; Davie, E W; Chung, D W

    1995-11-24

    The 5'-flanking region of the gene coding for the alpha chain of human fibrinogen was isolated, sequenced, and characterized. The principal site of transcription initiation was determined by primer extension analysis and the RNase protection assay and shown to be at an adenine residue located 55 nucleotides upstream from the initiator methionine codon, or 13,399 nucleotides down-stream from the polyadenylation site of the gene coding for the gamma chain. Transient expression of constructs containing sequentially deleted 5'-flanking sequences of the alpha chain gene fused to the chloramphenicol acetyltransferase reporter gene showed that the promoter was liver-specific and inducible by interleukin 6 (IL-6). The shortest DNA fragment with significant promoter activity and full response to IL-6 stimulation encompassed the region from -217 to +1 base pairs (bp). Although six potential IL-6 responsive sequences homologous to the type II IL-6 responsive element were present, a single sequence of CTGGGA localized from -122 to -127 bp was shown to be a functional element in IL-6 induction. A hepatocyte nuclear factor 1 (HNF-1) binding site, present from -47 to -59 bp, in combination with other upstream elements, was essential for liver-specific expression of the gene. A functional CCAAT/enhancer binding protein site (C/EBP, -134 to -142 bp) was also identified within 217 bp from the transcription initiation site. An additional positive element (-1393 to -1133 bp) and a negative element (-1133 to -749 bp) were also found in the upstream region of the alpha-fibrinogen gene. PMID:7499335

  14. Neutronic fuel element fabrication

    DOEpatents

    Korton, George

    2004-02-24

    This disclosure describes a method for metallurgically bonding a complete leak-tight enclosure to a matrix-type fuel element penetrated longitudinally by a multiplicity of coolant channels. Coolant tubes containing solid filler pins are disposed in the coolant channels. A leak-tight metal enclosure is then formed about the entire assembly of fuel matrix, coolant tubes and pins. The completely enclosed and sealed assembly is exposed to a high temperature and pressure gas environment to effect a metallurgical bond between all contacting surfaces therein. The ends of the assembly are then machined away to expose the pin ends which are chemically leached from the coolant tubes to leave the coolant tubes with internal coolant passageways. The invention described herein was made in the course of, or under, a contract with the U.S. Atomic Energy Commission. It relates generally to fuel elements for neutronic reactors and more particularly to a method for providing a leak-tight metal enclosure for a high-performance matrix-type fuel element penetrated longitudinally by a multiplicity of coolant tubes. The planned utilization of nuclear energy in high-performance, compact-propulsion and mobile power-generation systems has necessitated the development of fuel elements capable of operating at high power densities. High power densities in turn require fuel elements having high thermal conductivities and good fuel retention capabilities at high temperatures. A metal clad fuel element containing a ceramic phase of fuel intimately mixed with and bonded to a continuous refractory metal matrix has been found to satisfy the above requirements. Metal coolant tubes penetrate the matrix to afford internal cooling to the fuel element while providing positive fuel retention and containment of fission products generated within the fuel matrix. Metal header plates are bonded to the coolant tubes at each end of the fuel element and a metal cladding or can completes the fuel-matrix enclosure

  15. alpha(1A)- and alpha(1B)-adrenergic receptors differentially modulate antidepressant-like behavior in the mouse.

    PubMed

    Doze, Van A; Handel, Evelyn M; Jensen, Kelly A; Darsie, Belle; Luger, Elizabeth J; Haselton, James R; Talbot, Jeffery N; Rorabaugh, Boyd R

    2009-08-18

    Tricyclic antidepressant (TCA) drugs are used for the treatment of chronic depression, obsessive-compulsive disorder (OCD), and anxiety-related disorders. Chronic use of TCA drugs increases the expression of alpha(1)-adrenergic receptors (alpha(1)-ARs). Yet, it is unclear whether increased alpha(1)-AR expression contributes to the antidepressant effects of these drugs or if this effect is unrelated to their therapeutic benefit. In this study, mice expressing constitutively active mutant alpha(1A)-ARs (CAM alpha(1A)-AR) or CAM alpha(1B)-ARs were used to examine the effects of alpha(1A)- and alpha(1B)-AR signaling on rodent behavioral models of depression, OCD, and anxiety. CAM alpha(1A)-AR mice, but not CAM alpha(1B)-AR mice, exhibited antidepressant-like behavior in the tail suspension test and forced swim test. This behavior was reversed by prazosin, a selective alpha(1)-AR inverse agonist, and mimicked by chronically treating wild type mice with cirazoline, an alpha(1A)-AR agonist. Marble burying behavior, commonly used to model OCD in rodents, was significantly decreased in CAM alpha(1A)-AR mice but not in CAM alpha(1B)-AR mice. In contrast, no significant differences in anxiety-related behavior were observed between wild type, CAM alpha(1A)-AR, and CAM alpha(1B)-AR animals in the elevated plus maze and light/dark box. This is the first study to demonstrate that alpha(1A)- and alpha(1B)-ARs differentially modulate antidepressant-like behavior in the mouse. These data suggest that alpha(1A)-ARs may be a useful therapeutic target for the treatment of depression.

  16. A practical alpha particle irradiator for studying internal alpha particle exposure.

    PubMed

    Lee, Ki-Man; Lee, Ui-Seob; Kim, Eun-Hee

    2016-09-01

    An alpha particle irradiator has been built in the Radiation Bioengineering Laboratory at Seoul National University (SNU) to investigate the cellular responses to alpha emissions from radon and the progeny. This irradiator is designed to have the energy of alpha particles entering target cells similar to that of alpha emissions from the radon progeny Po-218 and Po-214 residing in the human respiratory tract. For the SNU alpha particle irradiator, an irradiation system is equipped with cell dishes of 4µm thick Mylar bottom and a special setup of cells on slide for gamma-H2AX assay. Dose calibration for the alpha particle irradiator was performed by dual approaches, detection and computer simulation, in consideration of the source-to-target distance (STD) and the size of a cell dish. The uniformity of dose among cells in a dish is achieved by keeping the STD and the size of cell dish in certain ranges. The performance of the SNU alpha particle irradiator has been proven to be reliable through the gamma-H2AX assay with the human lung epithelial cells irradiated. PMID:27475622

  17. Injector element characterization methodology

    NASA Technical Reports Server (NTRS)

    Cox, George B., Jr.

    1988-01-01

    Characterization of liquid rocket engine injector elements is an important part of the development process for rocket engine combustion devices. Modern nonintrusive instrumentation for flow velocity and spray droplet size measurement, and automated, computer-controlled test facilities allow rapid, low-cost evaluation of injector element performance and behavior. Application of these methods in rocket engine development, paralleling their use in gas turbine engine development, will reduce rocket engine development cost and risk. The Alternate Turbopump (ATP) Hot Gas Systems (HGS) preburner injector elements were characterized using such methods, and the methodology and some of the results obtained will be shown.

  18. Elements of discovery.

    PubMed

    Toledo-Pereyra, Luis H

    2008-01-01

    I understand discovery as the essence of thinking man, or to paraphrase the notable French philosopher René Descartes, "I think, therefore I discover." In this study, I introduce discovery as the foundation of modern science. Discovery consists of six stages or elements, including: concept, belief, ability, support, proof, and protection. Each element is discussed within the context of the whole discovery enterprise. Fundamental tenets for understanding discovery are given throughout the paper, and a few examples illustrate the significance of some of the most important elements. I invite clinicians, researchers, and/or clinical researchers to integrate themselves into the active process of discovery. Remember--I think, therefore I discover.

  19. Elements in biological AMS

    SciTech Connect

    Vogel, J.S.; McAninch, J.; Freeman, S.

    1996-08-01

    AMS (Accelerator Mass Spectrometry) provides high detection sensitivity for isotopes whose half-lives are between 10 years and 100 million years. {sup 14}C is the most developed of such isotopes and is used in tracing natural and anthropogenic organic compounds in the Earth`s biosphere. Thirty-three elements in the main periodic table and 17 lanthanides or actinides have long lived isotopes, providing potential tracers for research in elemental biochemistry. Overlap of biologically interesting heavy elements and possible AMS tracers is discussed.

  20. NEUTRONIC REACTOR FUEL ELEMENT

    DOEpatents

    Shackleford, M.H.

    1958-12-16

    A fuel element possessing good stability and heat conducting properties is described. The fuel element comprises an outer tube formed of material selected from the group consisting of stainhess steel, V, Ti. Mo. or Zr, a fuel tube concentrically fitting within the outer tube and containing an oxide of an isotope selected from the group consisting of U/sup 235/, U/sup 233/, and Pu/sup 239/, and a hollow, porous core concentrically fitting within the fuel tube and formed of an oxide of an element selected from the group consisting of Mg, Be, and Zr.

  1. Quantification of functional and inactivated alpha 2-macroglobulin in sepsis.

    PubMed

    Abbink, J J; Nuijens, J H; Eerenberg, A J; Huijbregts, C C; Strack van Schijndel, R J; Thijs, L G; Hack, C E

    1991-01-23

    Alpha 2-macroglobulin (alpha 2 M) in vitro inhibits numerous proteinases that are generated during inflammatory reactions and therefore, probably plays an important role in diseases such as sepsis. To monitor the state of alpha 2 M in sepsis, we developed novel assays for functional and inactive alpha 2M. Functional alpha 2M in plasma was measured by quantitating the binding of alpha 2M to solid-phase trypsin. Inactive alpha 2M (i alpha 2M) was assessed with a monoclonal antibody, mcAb M1, that specifically reacts with a neodeterminant exposed on i alpha 2M. This mcAb in combination with chromogenic substrates was used to detect alpha 2M-proteinase complexes. Functional alpha 2M was reduced in plasma from 48 patients with clinical sepsis compared to healthy controls (p less than 0.0001). Levels of functional alpha 2M on admission and the lowest levels encountered in 23 patients with shock were lower than in 25 normotensive patients (p = 0.023 and p = 0.009, respectively). Increased levels of i alpha 2M (greater than 30 nM) at least on one occasion were found in only 4 of the 48 patients, being not different in hypotensive compared with normotensive patients, and not in patients who died compared with those who survived. Levels of functional alpha 2M correlated significantly with levels of factor XII and prekallikrein suggesting that decreases in alpha 2M at least in part were due to contact activation. Indeed, in two patients with increased i alpha 2M, complexes between alpha 2M and kallikrein were demonstrated in addition to plasmin- and thrombin-alpha 2M complexes.

  2. Substrate specificity of human liver neutral alpha-mannosidase.

    PubMed Central

    al Daher, S; De Gasperi, R; Daniel, P; Hirani, S; Warren, C; Winchester, B

    1992-01-01

    The digestion of radiolabelled natural oligosaccharide substrates by human liver neutral alpha-mannosidase has been studied by h.p.l.c. and h.p.t.l.c. The high-mannose oligosaccharides Man9GlcNAc and Man8GlcNAc are hydrolysed by the enzyme by two distinct non-random routes to a common product of composition Man6GlcNAc, which is then slowly converted into a unique Man5GlcNAc oligosaccharide, Man alpha(1----2)Man alpha(1----2)Man alpha(1----3)[Man alpha (1----6)] Man beta(1----4)GlcNAc. These pathways are different from the processing and lysosomal catabolic pathways for these structures. In particular, the alpha(1----2)-linked mannose residues attached to the core alpha(1----3)-linked mannose residue are resistant to hydrolysis. The key processing intermediate, Man alpha(1----3)[Man alpha(1----6)]Man alpha(1----6)[Man alpha(1----3)] Man beta(1----4)GlcNAc, is not produced in the digestion of high-mannose glycans by the neutral alpha-mannosidase, but it is hydrolysed by the enzyme by a non-random route to Man beta(1----4)GlcNAc via the core structure Man alpha(1----3)[Man alpha(1----6)]Man beta(1----4)GlcNAc. In contrast with its ready hydrolysis by lysosomal alpha-mannosidase, the core alpha(1----3)-mannosidic linkage is quite resistant to hydrolysis by neutral alpha-mannosidase. The precise specificity of neutral alpha-mannosidase towards high-mannose oligosaccharides suggests that it has a role in the modification of such structures in the cytosol. Images Fig. 4. PMID:1520283

  3. Sequence analysis of frog alpha B-crystallin cDNA: sequence homology and evolutionary comparison of alpha A, alpha B and heat shock proteins.

    PubMed

    Lu, S F; Pan, F M; Chiou, S H

    1995-11-22

    alpha-Crystallin is a major lens protein present in the lenses of all vertebrate species. Recent studies have revealed that bovine alpha-crystallins possess genuine chaperone activity similar to small heat-shock proteins. In order to facilitate the determination of the primary sequence of amphibian alpha B-crystallin, cDNA encoding alpha B subunit chain was amplified using a new "Rapid Amplification of cDNA Ends" (RACE) protocol of Polymerase Chain Reaction (PCR). PCR-amplified product corresponding to alpha B subunit was then subcloned into pUC18 vector and transformed into E. coli strain JM109. Plasmids purified from the positive clones were prepared for nucleotide sequencing by the automatic fluorescence-based dideoxynucleotide chain-termination method. Sequencing more than five clones containing DNA inserts coding for alpha B-crystallin subunit constructed only one complete full-length reading frame of 522 base pairs similar to that of alpha A subunit, covering a deduced protein sequence of 173 amino acids including the universal translation-initiating methionine. The frog alpha B crystallin shows 69, 66 and 56% whereas alpha A crystallin shows 83, 81 and 69% sequence similarity to the homologous chains of bovine, chicken and dogfish, respectively, revealing a more divergent structural relationship among these alpha B subunits as compared to alpha A subunits. Structural analysis and comparison of alpha A- and alpha B-crystallin subunits from eye lenses of different classes of vertebrates also shed some light on the evolutionary relatedness between alpha B/alpha A crystallins and the small heat-shock proteins.

  4. Synergistic alpha-1 and alpha-2 adrenergic stimulation of rat proximal nephron Na+/H+ exchange

    SciTech Connect

    Gesek, F.A.; Cragoe, E.J. Jr.; Strandhoy, J.W.

    1989-06-01

    Both alpha-1 and alpha-2 adrenoceptors have been localized to the renal cortex, with the majority of binding sites on the proximal tubule. Because the major regulator of Na+ uptake into the proximal tubule is the Na+/H+ exchanger, and because alpha-1 and alpha-2 adrenoceptors stimulate it in other tissues, we tested the hypothesis that both alpha adrenoceptor subtypes can increase Na+ uptake into the proximal nephron by stimulating the Na+/H+ antiporter. Enhancement of Na+ transport by agonists was studied in isolated rat proximal tubules by determining the uptake of 22Na that was suppressible by the Na+/H+ inhibitor, 5-(N-ethyl-N-isopropyl)amiloride (EIPA). The phorbol ester, phorbol-12-myristate-13-acetate, (0.1 microM), directly stimulated the antiporter through protein kinase C and increased EIPA-suppressible 22Na uptake 250% above control. The alpha-1 adrenoceptor agonists, cirazoline and phenylephrine, in addition to the mixed agonist, norepinephrine, maximally stimulated uptake by 226 to 232% at 1 microM concentrations. alpha-2 agonists produced a range of maximal stimulations at 1 microM from 65% with guanabenz to 251% with B-HT 933. Increases in 22Na uptake by agonists were inhibited by selective adrenergic antagonists and by EIPA. The drugs did not change the EIPA-resistant component of 22Na uptake. Inasmuch as the adrenoceptor subtypes likely stimulated Na+/H+ exchange by differing intracellular pathways impinging upon common transport steps, we examined whether simultaneous stimulation of both pathways was additive. Submaximal concentrations (5 nM each) of alpha-1 and alpha-2 adrenoceptor agonists in combination synergistically enhanced 22Na uptake to a level similar to 1 microM concentrations of adrenoceptor agonists alone or in combination.

  5. Plant alpha-amylase inhibitors and their interaction with insect alpha-amylases.

    PubMed

    Franco, Octávio L; Rigden, Daniel J; Melo, Francislete R; Grossi-De-Sá, Maria F

    2002-01-01

    Insect pests and pathogens (fungi, bacteria and viruses) are responsible for severe crop losses. Insects feed directly on the plant tissues, while the pathogens lead to damage or death of the plant. Plants have evolved a certain degree of resistance through the production of defence compounds, which may be aproteic, e.g. antibiotics, alkaloids, terpenes, cyanogenic glucosides or proteic, e.g. chitinases, beta-1,3-glucanases, lectins, arcelins, vicilins, systemins and enzyme inhibitors. The enzyme inhibitors impede digestion through their action on insect gut digestive alpha-amylases and proteinases, which play a key role in the digestion of plant starch and proteins. The natural defences of crop plants may be improved through the use of transgenic technology. Current research in the area focuses particularly on weevils as these are highly dependent on starch for their energy supply. Six different alpha-amylase inhibitor classes, lectin-like, knottin-like, cereal-type, Kunitz-like, gamma-purothionin-like and thaumatin-like could be used in pest control. These classes of inhibitors show remarkable structural variety leading to different modes of inhibition and different specificity profiles against diverse alpha-amylases. Specificity of inhibition is an important issue as the introduced inhibitor must not adversely affect the plant's own alpha-amylases, nor the nutritional value of the crop. Of particular interest are some bifunctional inhibitors with additional favourable properties, such as proteinase inhibitory activity or chitinase activity. The area has benefited from the recent determination of many structures of alpha-amylases, inhibitors and complexes. These structures highlight the remarkable variety in structural modes of alpha-amylase inhibition. The continuing discovery of new classes of alpha-amylase inhibitor ensures that exciting discoveries remain to be made. In this review, we summarize existing knowledge of insect alpha-amylases, plant alpha

  6. Interaction of per 3,6-anhydro-alpha cyclodextrins (alpha 36CD) and lead-alpha 36CD complex with biological systems.

    PubMed

    Debouzy, J C; Fauvelle, F; Gadelle, A; Baudin, C; Richard, M; Perly, B; Chouteau, F; Joets, J; Tazz, J J; Daveloose, D

    1998-05-01

    The interactions of per (3,6 anhydro) alpha cyclodextrin (alpha 36CD) and of lead-alpha 36CD complex with biological systems were tested by NMR, ESR and electronic microscopy using erythrocytes and model membranes. It was found that the haemolytic activity of alpha 36CD alone was seven fold lower than that of natural alpha cyclodextrin (evaluated by the concentration inducing 50% haemolysis, DH50 = 35 mM). Conversely, the formation of the complex resulted in an increase of haemolytic properties, with DH50 of 1 mM. The mechanism proposed was an increased membrane diffusion by endocytosis of the complex, leading to higher amounts of intracellular lead.

  7. Determining the alpha dynamo parameter in incompressible homogeneous magnetohydrodynamic turbulence

    NASA Technical Reports Server (NTRS)

    Matthaeus, W. H.; Goldstein, M. L.; Lantz, S. R.

    1983-01-01

    Alpha, an important parameter in dynamo theory, is proportional to either the kinetic, current, magnetic, or velocity helicity of the fluctuating magnetic field and fluctuating velocity field. The particular helicity to which alpha is proportional depends on the assumptions used in deriving the first order smoothed equations that describe the alpha effect. In two cases, when alpha is proportional to either the magnetic helicity or velocity helicity, alpha is determined experimentally from two point measurements of the fluctuating fields in incompressible, homogeneous turbulence having arbitrary symmetry. For the other two possibilities, alpha is determined if the turbulence is isotropic.

  8. The alpha-form of the hydroxides of bivalent metals

    NASA Technical Reports Server (NTRS)

    Feitknecht, W.

    1984-01-01

    X-ray analyses were made of the hydroxides of the bivalent metals. The freshly pptd. hydroxide is usually in the alpha-form, which on standing is converted to another form or other forms. The alpha and c grating dimensions of the alpha-form and the C6-type of Co, Zn, C, Co-Zn and Ni-Zn hydroxides are tabulated. Ni hydroxide does not exhibit an alpha-form. The alpha-Co(OH)2, the blue form, is stabilized by sugar or by the higher alcohols: these compounds do not stabilize alpha-Zn(OH)2.

  9. Multi-Element Airfoil System

    NASA Technical Reports Server (NTRS)

    Turner, Travis L. (Inventor); Khorrami, Mehdi R. (Inventor); Lockard, David P. (Inventor); McKenney, Martin J. (Inventor); Atherley, Raymond D. (Inventor); Kidd, Reggie T. (Inventor)

    2014-01-01

    A multi-element airfoil system includes an airfoil element having a leading edge region and a skin element coupled to the airfoil element. A slat deployment system is coupled to the slat and the skin element, and is capable of deploying and retracting the slat and the skin element. The skin element substantially fills the lateral gap formed between the slat and the airfoil element when the slat is deployed. The system further includes an uncoupling device and a sensor to remove the skin element from the gap based on a critical angle-of-attack of the airfoil element. The system can alternatively comprise a trailing edge flap, where a skin element substantially fills the lateral gap between the flap and the trailing edge region of the airfoil element. In each case, the skin element fills a gap between the airfoil element and the deployed flap or slat to reduce airframe noise.

  10. Aspergillus nidulans alpha-galactosidase of glycoside hydrolase family 36 catalyses the formation of alpha-galacto-oligosaccharides by transglycosylation.

    PubMed

    Nakai, Hiroyuki; Baumann, Martin J; Petersen, Bent O; Westphal, Yvonne; Hachem, Maher Abou; Dilokpimol, Adiphol; Duus, Jens Ø; Schols, Henk A; Svensson, Birte

    2010-09-01

    The alpha-galactosidase from Aspergillus nidulans (AglC) belongs to a phylogenetic cluster containing eukaryotic alpha-galactosidases and alpha-galacto-oligosaccharide synthases of glycoside hydrolase family 36 (GH36). The recombinant AglC, produced in high yield (0.65 g.L(-1) culture) as His-tag fusion in Escherichia coli, catalysed efficient transglycosylation with alpha-(1-->6) regioselectivity from 40 mm 4-nitrophenol alpha-d-galactopyranoside, melibiose or raffinose, resulting in a 37-74% yield of 4-nitrophenol alpha-D-Galp-(1-->6)-D-Galp, alpha-D-Galp-(1-->6)-alpha-D-Galp-(1-->6)-D-Glcp and alpha-D-Galp-(1-->6)-alpha-D-Galp-(1-->6)-D-Glcp-(alpha1-->beta2)-d-Fruf (stachyose), respectively. Furthermore, among 10 monosaccharide acceptor candidates (400 mm) and the donor 4-nitrophenol alpha-D-galactopyranoside (40 mm), alpha-(1-->6) linked galactodisaccharides were also obtained with galactose, glucose and mannose in high yields of 39-58%. AglC did not transglycosylate monosaccharides without the 6-hydroxymethyl group, i.e. xylose, L-arabinose, L-fucose and L-rhamnose, or with axial 3-OH, i.e. gulose, allose, altrose and L-rhamnose. Structural modelling using Thermotoga maritima GH36 alpha-galactosidase as the template and superimposition of melibiose from the complex with human GH27 alpha-galactosidase supported that recognition at subsite +1 in AglC presumably requires a hydrogen bond between 3-OH and Trp358 and a hydrophobic environment around the C-6 hydroxymethyl group. In addition, successful transglycosylation of eight of 10 disaccharides (400 mm), except xylobiose and arabinobiose, indicated broad specificity for interaction with the +2 subsite. AglC thus transferred alpha-galactosyl to 6-OH of the terminal residue in the alpha-linked melibiose, maltose, trehalose, sucrose and turanose in 6-46% yield and the beta-linked lactose, lactulose and cellobiose in 28-38% yield. The product structures were identified using NMR and ESI-MS and five of the 13

  11. Rock in Its Elements

    ERIC Educational Resources Information Center

    MacCluskey, Thomas

    1969-01-01

    A discussion of the following musical elements of rock: rhythm, melody, harmony, and form. A impromptu analysis made at a session of the Youth Music Symposium, July 25, 1969. Remarks transcribed from tape. (Author/AP)

  12. Synthesis of 16 alpha-/sub 3/H androgen and estrogen substrates for 16 alpha-hydroxylase

    SciTech Connect

    Cantineau, R.; Kremers, P.; De Graeve, J.; Cornelis, A.; Laszlo, P.; Gielen, J.E.; Lambotte, R.

    1981-02-01

    The synthesis of 16 alpha-/sup 3/H androgens and estrogens is described. 1-(/sup 3/H)-Acetic acid in the presence of zinc dust reacts with 16 alpha-bromo-17-ketosteroids to produce 16 alpha-/sup 3/H-17-ketosteroids. This chemical reaction was used to prepare 16 alpha-/sup 3/H-dehydroepiandrosterone (I) and 16 alpha-/sub 4/H-estrone acetate (XI) from 16 alpha-bromo-dehydroepiandrosterone (X) and from 16 alpha-bromo-estrone acetate (XII), respectively. Using appropriate microbiological techniques, it was possible to convert these radiolabelled substrates into 16 alpha-/sup 3/H-androstenedione (II) and 16 alpha-/sup 3/H-estradiol-17 beta (VII). 16 alpha-/sup 3/H-Estrone (VI) was obtained by the chemical hydrolysis of 16 alpha-/sup 3/H-estrone acetate. The label distribution as determined by microbiological 16 alpha-hydroxylations indicated a specific labelling of 77% for androgens and 65% for estrogens in the 16 alpha position. These substrates can be used for measuring the 16 alpha hydroxylase activity, an important step in the biosynthesis of estriol (VIII) and estetrol (IX).

  13. COMPOSITE FUEL ELEMENT

    DOEpatents

    Hurford, W.J.; Gordon, R.B.; Johnson, W.A.

    1962-12-25

    A sandwich-type fuel element for a reactor is described. This fuel element has the shape of an elongated flat plate and includes a filler plate having a plurality of compartments therein in which the fuel material is located. The filler plate is clad on both sides with a thin cladding material which is secured to the filler plate only to completely enclose the fuel material in each compartment. (AEC)

  14. JACKETED FUEL ELEMENT

    DOEpatents

    Wigner, E.P.; Szilard, L.; Creutz, E.C.

    1959-02-01

    These fuel elements are comprised of a homogeneous metallic uranium body completely enclosed and sealed in an aluminum cover. The uranium body and aluminum cover are bonded together by a layer of zinc located between them. The bonding layer serves to improve transfer of heat, provides an additional protection against corrosion of the uranium by the coolant, and also localizes any possible corrosion by preventing travel of corrosive material along the surface of the fuel element.

  15. Inhibition of laminin alpha 1-chain expression leads to alteration of basement membrane assembly and cell differentiation

    PubMed Central

    1996-01-01

    The expression of the constituent alpha 1 chain of laminin-1, a major component of basement membranes, is markedly regulated during development and differentiation. We have designed an antisense RNA strategy to analyze the direct involvement of the alpha 1 chain in laminin assembly, basement membrane formation, and cell differentiation. We report that the absence of alpha 1-chain expression, resulting from the stable transfection of the human colonic cancer Caco2 cells with an eukaryotic expression vector comprising a cDNA fragment of the alpha 1 chain inserted in an antisense orientation, led to (a) an incorrect secretion of the two other constituent chains of laminin-1, the beta 1/gamma 1 chains, (b) the lack of basement membrane assembly when Caco2-deficient cells were cultured on top of fibroblasts, assessed by the absence of collagen IV and nidogen deposition, and (c) changes in the structural polarity of cells accompanied by the inhibition of an apical digestive enzyme, sucrase-isomaltase. The results demonstrate that the alpha 1 chain is required for secretion of laminin-1 and for the assembly of basement membrane network. Furthermore, expression of the laminin alpha 1-chain gene may be a regulatory element in determining cell differentiation. PMID:8609173

  16. Prediction of {alpha}-decay half-lives and Q{sub {alpha}} values of superheavy nuclei by a global potential for {alpha} + nucleus systems

    SciTech Connect

    Sahu, Basudeb

    2011-09-15

    An approach we have proposed recently for calculation of Q{sub {alpha}} energy and decay half-life T{sub 1/2}{sup {alpha}} on the {alpha} decay of radioactive heavy ions is applied to the evaluation of these two important parameters for the nuclei in the superheavy region Z = 112-118 for which experimental data are not available. It is shown that the {alpha} + nucleus potential represented by an exactly solvable potential used in the calculation could be expressed in terms of proton (Z) and neutron (N) numbers of the {alpha} emitter so that varieties of {alpha}-emitting nuclei differing in their Z and N values could be addressed for their decay properties without the help of any adjustable parameter and the results of Q{sub {alpha}} and T{sub 1/2}{sup {alpha}} for a nucleus are estimated without any prior knowledge of any one of these quantities. This procedure to obtain the values of Q{sub {alpha}} and T{sub 1/2}{sup {alpha}} works well to reproduce the known experimental results for superheavy nuclei and hence, the procedure is expected to provide proper information about these parameters in experiments on {alpha} decay of new nuclei in the superheavy region.

  17. Understanding a Widely Misunderstood Statistic: Cronbach's "Alpha"

    ERIC Educational Resources Information Center

    Ritter, Nicola L.

    2010-01-01

    It is important to explore score reliability in virtually all studies, because tests are not reliable. The present paper explains the most frequently used reliability estimate, coefficient alpha, so that the coefficient's conceptual underpinnings will be understood. Researchers need to understand score reliability because of the possible impact…

  18. Systemic Targeted Alpha Radiotherapy for Cancer

    PubMed Central

    Allen, BJ

    2013-01-01

    Background: The fundamental principles of internal targeted alpha therapy forcancer were established many decades ago.The high linear energy transfer (LET) ofalpha radiation to the targeted cancer cellscauses double strand breaks in DNA. Atthe same time, the short range radiation spares adjacent normal tissues. This targeted approach complements conventional external beam radiotherapy and chemotherapy. Such therapies fail on several fronts, such as lack of control of some primary cancers (e.g. glioblastoma multiforme) and to inhibit the development of lethal metastaticcancer after successful treatment of the primary cancer. Objective: This review charts the developing role of systemic high LET, internalradiation therapy. Method: Targeted alpha therapy is a rapidly advancing experimental therapy thatholds promise to deliver high cytotoxicity to targeted cancer cells. Initially thoughtto be indicated for leukemia and micrometastases, there is now evidence that solidtumors can also be regressed. Results: Alpha therapy may be molecular or physiological in its targeting. Alphaemitting radioisotopes such as Bi-212, Bi-213, At-211 and Ac-225 are used to labelmonoclonal antibodies or proteins that target specific cancer cells. Alternatively, Radium-233 is used for palliative therapy of breast and prostate cancers because of its bone seeking properties. Conclusion: Preclinical studies and clinical trials of alpha therapy are discussedfor leukemia, lymphoma, melanoma, glioblastoma multiforme, bone metastases, ovarian cancer, pancreatic cancer and other cancers. PMID:25505750

  19. Cosmetic use of alpha-hydroxy acids.

    PubMed

    Vidt, D G; Bergfeld, W F

    1997-06-01

    Frequent and daily use of cosmetic and skin-care products that contain alpha-hydroxy acids (AHAs) moisturizes the skin and produces smoother, less-wrinkled skin surfaces. The cosmetic products developed as astringents and exfoliants diminish skin scales and remove excess skin oil. New studies suggest that photodamaged skin improves with AHA treatment. PMID:9188214

  20. Production of alpha-amylase by yeast

    SciTech Connect

    Thomse, K.K.

    1987-01-01

    The enzyme alpha-amylase confers to an organism the enzymatic activity for the degradation of polyglucosides with alpha-1,4 glycosidic bonds such as starch and glycogen which are among the major storage compounds in plants and animals. Most alpha-amylases are single polypeptides of molecular weights around 50,000 dalton. They are generally found in the digestive tract of animals and in germinating seeds. Among the products released upon enzymatic degradation of polyglucosides maltose, a sugar that can be utilized as carbon source by yeast, is a major constituent. A cDNA segment complementary to mouse salivary amylase messenger RNA has been inserted into the yeast expression vector pMA56 behind the promoter of the gene encoding alcohol dehydrogenase I of yeast. Yeast transformants harboring plasmids with the normal orientation of the promoter and the mouse amylase cDNA gene produce amylase and release the enzyme in free form into the culture medium. Approximately 90% of the amylase activity is found in the medium. Yeast strains carrying MAL allele and transformed with a plasmid which directed the synthesis of mouse alpha-amylase were tested on plates containing starch and in batch fermentations using different high molecular weight sugars and oligosaccharides as carbon source. The results of these experiments will be discussed. (Refs. 21).

  1. Electron Screening Effects on {alpha}-decay

    SciTech Connect

    Musumarra, A.; Bonasera, A.; Del Zoppo, A.; Di Pietro, A.; Figuera, P.; Kimura, S.; Lattuada, M.; Pellegriti, M. G.; Scuderi, V.; Torresi, D.; Farinon, F.; Geissel, H.; Knoebel, R.; Prochazka, A.; Scheidenberger, C.; Nociforo, C.; Behr, K.-H.; Bosch, F.; Boutin, D.; Bruenle, A.

    2009-08-26

    An open problem in Nuclear Astrophysics concerns the understanding of electron-screening effects on nuclear reaction rates at stellar energies. In this framework, we have proposed to investigate the influence of the electron cloud on {alpha}-decay by measuring Q-values and {alpha}-decay half-lives of fully stripped, H-like and He-like ions. These kinds of measurements have been feasible just recently for highly-charged radioactive nuclides by fragmentation of {sup 238}U at relativistic energies at the FRS-ESR facility at GSI. In this way it is possible to produce, efficiently separate and store highly-charged {alpha}-emitters. Candidates for the proposed investigation were carefully selected and will be studied by using the Schottky Mass Spectroscopy technique. In order to establish a solid reference data set, lifetimes and Q{sub {alpha}}-value measurements of the corresponding neutrals have been performed directly at the FRS, by implanting the separated ions into an active Silicon stopper.

  2. E-PERM alpha surface monitor

    SciTech Connect

    Fricke, V.

    1999-12-16

    Innovative Technology Summary Reports are designed to provide potential users with the information they need to quickly determine if a technology would apply to a particular environmental management problem. They are also designed for readers who may recommend that a technology be considered by prospective users. Each report describes a technology, system, or process that has been developed and tested with funding from DOE's Office of Science and Technology (OST). The E-PERM{reg{underscore}sign} Alpha Surface Monitor is an integrating electret ion chamber innovative technology used to measure alpha radiation on surfaces of materials. The technology is best used on surfaces with low contamination levels such as areas with potential for free release, but can also be used in areas with higher levels of contamination. Measurement accuracy and production of the E-PERM {reg{underscore}sign} Alpha Surface Monitor compared favorably with the baseline technology. The innovative technology cost is approximately 28% higher than the baseline with an average unit cost per reading costing %6.04 vs. $4.36; however, the flexibility of the E-PERM{reg{underscore}sign} Alpha Surface Monitor may offer advantages in ALARA, reduction of operator error, waste minimization, and measurement accuracy.

  3. Alpha particles diffusion due to charge changes

    SciTech Connect

    Clauser, C. F. Farengo, R.

    2015-12-15

    Alpha particles diffusion due to charge changes in a magnetized plasma is studied. Analytical calculations and numerical simulations are employed to show that this process can be very important in the pedestal-edge-SOL regions. This is the first study that presents clear evidence of the importance of atomic processes on the diffusion of alpha particles. A simple 1D model that includes inelastic collisions with plasma species, “cold” neutrals, and partially ionized species was employed. The code, which follows the exact particle orbits and includes the effect of inelastic collisions via a Monte Carlo type random process, runs on a graphic processor unit (GPU). The analytical and numerical results show excellent agreement when a uniform background (plasma and cold species) is assumed. The simulations also show that the gradients in the density of the plasma and cold species, which are large and opposite in the edge region, produce an inward flux of alpha particles. Calculations of the alpha particles flux reaching the walls or divertor plates should include these processes.

  4. Cytokine therapeutics: lessons from interferon alpha.

    PubMed Central

    Gutterman, J U

    1994-01-01

    Cytokines are soluble proteins that allow for communication between cells and the external environment. Interferon (IFN) alpha, the first cytokine to be produced by recombinant DNA technology, has emerged as an important regulator of growth and differentiation, affecting cellular communication and signal transduction pathways as well as immunological control. This review focuses on the biological and clinical activities of the cytokine. Originally discovered as an antiviral substance, the efficacy of IFN-alpha in malignant, viral, immunological, angiogenic, inflammatory, and fibrotic diseases suggests a spectrum of interrelated pathophysiologies. The principles learned from in vivo studies will be discussed, particularly hairy cell leukemia, chronic myelogenous leukemia, certain angiogenic diseases, and hepatitis. After the surprising discovery of activity in a rare B-cell neoplasm, IFN-alpha emerged as a prototypic tumor suppressor protein that represses the clinical tumorigenic phenotype in some malignancies capable of differentiation. Regulatory agencies throughout the world have approved IFN-alpha for treatment of 13 malignant and viral disorders. The principles established with this cytokine serve as a paradigm for future development of natural proteins for human disease. PMID:8108387

  5. Alpha 97: Basic Education and Institutional Environments.

    ERIC Educational Resources Information Center

    Hautecoeur, Jean-Paul, Ed.

    This document was published by Alpha, a research program specializing in alternative, experimental approaches to adult basic education. It is an attempt to widen the field and examine the relationship between the micro and macro levels, between the diversity of different practices and the major policy orientations that foster or limit this…

  6. H. cap alpha. in RS CVn binaries

    SciTech Connect

    Bopp, B.W.; Talcott, J.C.

    1980-01-01

    The 1976--78 results of a spectroscopic program to monitor H..cap alpha.. in several RS CVn-type binaries are reported. For six objects well observed over orbital phase, four (HR 4665, HR 5110, sigma Gem, Z Her) show H..cap alpha.. as an absorption feature having a constant ( +- 15%) equivalent width (EW). AR Lac exhibits an absorption profile also, but the EW varies by a factor of three due to partial filling by emission. This variation is sporadic and not phase dependent. The H..cap alpha.. feature in HK Lac shows the most extreme variation: normally seen as an absorption feature with variable EW, it has been observed as a pure emission feature on three spectrograms, showing a blueshift with respect to the photosphere of approx.50--100 km sec/sup -1/. On a single occasion HK Lac showed double H..cap alpha.. emission with a separation of the peaks of approx.300 km sec/sup -1/. These high velocity features are interpreted in terms of prominence-like structure in the atmosphere of the active star.

  7. Method of making nanocrystalline alpha alumina

    DOEpatents

    Siegel, Richard W.; Hahn, Horst; Eastman, Jeffrey A.

    1992-01-01

    Method of making selected phases of nanocrystalline ceramic materials. Various methods of controlling the production of nanocrystalline alpha alumina and titanium oxygen phases are described. Control of the gas atmosphere and use of particular oxidation treatments give rise to the ability to control the particular phases provided in the aluminum/oxygen and titanium/oxygen system.

  8. Alpha and Beta at the B Factories

    SciTech Connect

    Finocchiaro, Giuseppe; /Frascati

    2007-10-15

    We review recent experimental results on time-dependent CP asymmetries in the B system from the BABAR and Belle experiments. Measurements of the {alpha} and {beta} angles of the Unitarity Triangle of the CKM matrix are discussed. These measurements constitute stringent tests of the Standard Model, and are also used to search for new physics.

  9. Coefficient Alpha and Reliability of Scale Scores

    ERIC Educational Resources Information Center

    Almehrizi, Rashid S.

    2013-01-01

    The majority of large-scale assessments develop various score scales that are either linear or nonlinear transformations of raw scores for better interpretations and uses of assessment results. The current formula for coefficient alpha (a; the commonly used reliability coefficient) only provides internal consistency reliability estimates of raw…

  10. MCNP S(. alpha. beta. ) detector scheme

    SciTech Connect

    Hendricks, J.S.; Prael, R.E.

    1990-10-01

    An approximate method to allow S({alpha},{Beta}) thermal collision contributions to point detectors and DXTRAN by Prael has been implemented in MCNP4. The method is described and test results are presented, including some results that indicate inadequacies in the NJOY processing of the nuclear data. 9 refs., 53 figs., 6 tabs.

  11. The Ups and Downs of Alpha Centauri

    NASA Astrophysics Data System (ADS)

    Ayres, Thomas R.

    2013-07-01

    The nearby Alpha Centauri triple system has two solar-type stars in a relatively close orbit (20 au separation), and a dim red dwarf companion -- Proxima -- about 10,000 au away, on the Sun-ward side of the group. The heaviest star -- Alpha Cen A -- is a close twin of the Sun. Its slightly less massive companion -- Alpha Cen B -- is a K-type dwarf, and is the closest star thought to host an exoplanet (Earth-sized, but in a much tighter orbit). The close pair has been scrutinized for more than a decade in X-rays by XMM and Chandra, on a semiannual basis since 2003 and 2005, respectively. However, in recent years only Chandra has been able to cleanly separate the pair, which are approaching closest separation on the sky (only a few arcseconds) in their 80-year orbit. For the past 3 years, the HST STIS spectrograph has joined the crowd, also capturing FUV snapshots of the pair every six months. The Alpha Cen stars provide an important complement to long-term studies of the Sun at high energies. The K-star has displayed a clear 8-year cycle in recent years, while the G-star remains mired in a Maunder-like minimum.

  12. Alpha particles diffusion due to charge changes

    NASA Astrophysics Data System (ADS)

    Clauser, C. F.; Farengo, R.

    2015-12-01

    Alpha particles diffusion due to charge changes in a magnetized plasma is studied. Analytical calculations and numerical simulations are employed to show that this process can be very important in the pedestal-edge-SOL regions. This is the first study that presents clear evidence of the importance of atomic processes on the diffusion of alpha particles. A simple 1D model that includes inelastic collisions with plasma species, "cold" neutrals, and partially ionized species was employed. The code, which follows the exact particle orbits and includes the effect of inelastic collisions via a Monte Carlo type random process, runs on a graphic processor unit (GPU). The analytical and numerical results show excellent agreement when a uniform background (plasma and cold species) is assumed. The simulations also show that the gradients in the density of the plasma and cold species, which are large and opposite in the edge region, produce an inward flux of alpha particles. Calculations of the alpha particles flux reaching the walls or divertor plates should include these processes.

  13. Spectral Element Agglomerate AMGe

    SciTech Connect

    Chartier, T; Falgout, R; Henson, V E; Jones, J E; Vassilevski, P S; Manteuffel, T A; McCormick, S F; Ruge, J W

    2005-05-20

    The purpose of this note is to describe an algorithm resulting from the uniting of two ideas introduced and applied elsewhere. For many problems, AMG has always been difficult due to complexities whose natures are difficult to discern from the entries of matrix A alone. Element-based interpolation has been shown to be an effective method for some of these problems, but it requires access to the element matrices on all levels. One way to obtain these has been to perform element agglomeration to form coarse elements, but in complicated situations defining the coarse degrees of freedom (dofs) is not easy. The spectral approach to coarse dof selection is very attractive due to its elegance and simplicity. The algorithm presented here combines the robustness of element interpolation, the ease of coarsening by element agglomeration, and the simplicity of defining coarse dofs through the spectral approach. As demonstrated in the numerical results, the method does yield a reasonable solver for the problems described. It can, however, be an expensive method due to the number and cost of the local, small dense linear algebra problems; making it a generally competitive method remains an area for further research.

  14. Activation of P2 late transcription by P2 Ogr protein requires a discrete contact site on the C terminus of the alpha subunit of Escherichia coli RNA polymerase.

    PubMed

    Wood, L F; Tszine, N Y; Christie, G E

    1997-11-21

    Bacteriophage P2 late transcription requires the product of the P2 ogr gene. Ogr-dependent transcription from P2 late promoters is blocked by certain point mutations affecting the alpha subunits of the host RNA polymerase. An alanine scan spanning the putative activation target in the alpha C-terminal domain (alphaCTD) was carried out to identify individual residues essential for Ogr-dependent transcription from P2 late promoters. In addition, the effects of alanine substitutions in the regions of the alphaCTD previously reported to affect CAP-dependent activation of the lac promoter and UP-element DNA binding were examined. Residues E286, V287, L289 and L290 in helix 3, and residue L300 at the beginning of helix 4, define a surface-exposed patch on the alphaCTD important for Ogr-dependent activation. These residues, adjacent to the recently identified DNA-binding determinants, constitute a newly identified activation surface for protein:protein contact. Alanine substitutions at some of the residues that affect UP-element DNA binding also impaired activation. This suggests that upstream DNA-alpha contacts, in addition to alpha-Ogr contacts, may be important in P2 late transcription. Other residues implicated in the interaction of alpha with CAP are not required for activation by Ogr, consistent with previous genetic evidence suggesting that these activators contact different sites on the alphaCTD. PMID:9398509

  15. The alpha(3) Scheme - A Fourth-Order Neutrally Stable CESE Solver

    NASA Technical Reports Server (NTRS)

    Chang, Sin-Chung

    2007-01-01

    The conservation element and solution element (CESE) development is driven by a belief that a solver should (i) enforce conservation laws in both space and time, and (ii) be built from a non-dissipative (i.e., neutrally stable) core scheme so that the numerical dissipation can be controlled effectively. To provide a solid foundation for a systematic CESE development of high order schemes, in this paper we describe a new 4th-order neutrally stable CESE solver of the advection equation Theta u/Theta + alpha Theta u/Theta x = 0. The space-time stencil of this two-level explicit scheme is formed by one point at the upper time level and three points at the lower time level. Because it is associated with three independent mesh variables u(sup n) (sub j), (u(sub x))(sup n) (sub j) , and (uxz)(sup n) (sub j) (the numerical analogues of u, Theta u/Theta x, and Theta(exp 2)u/Theta x(exp 2), respectively) and four equations per mesh point, the new scheme is referred to as the alpha(3) scheme. As in the case of other similar CESE neutrally stable solvers, the alpha(3) scheme enforces conservation laws in space-time locally and globally, and it has the basic, forward marching, and backward marching forms. These forms are equivalent and satisfy a space-time inversion (STI) invariant property which is shared by the advection equation. Based on the concept of STI invariance, a set of algebraic relations is developed and used to prove that the alpha(3) scheme must be neutrally stable when it is stable. Moreover it is proved rigorously that all three amplification factors of the alpha(3) scheme are of unit magnitude for all phase angles if |v| <= 1/2 (v = alpha delta t/delta x). This theoretical result is consistent with the numerical stability condition |v| <= 1/2. Through numerical experiments, it is established that the alpha(3) scheme generally is (i) 4th-order accurate for the mesh variables u(sup n) (sub j) and (ux)(sup n) (sub j); and 2nd-order accurate for (uxx)(sup n) (sub

  16. Human alpha 2-adrenergic receptor subtype distribution: widespread and subtype-selective expression of alpha 2C10, alpha 2C4, and alpha 2C2 mRNA in multiple tissues.

    PubMed

    Eason, M G; Liggett, S B

    1993-07-01

    At present, molecular cloning and pharmacological studies have delineated three human alpha 2-adrenergic receptor (alpha 2AR) subtypes, alpha 2C10, alpha 2C4, and alpha 2C2. Assignment of the alpha 2AR subtypes to specific functions has been limited by an unclear definition of tissue alpha 2AR expression outside of the central nervous system. It has been suggested that alpha 2C4 expression is confined to the brain, that alpha 2C2 expression is only in the liver and kidney, and that there is nearly ubiquitous expression of alpha 2C10. However, this is based on studies of a limited number of rat tissues or on studies using non-species-specific approaches. Therefore, to define alpha 2C10, alpha 2C4, and alpha 2C2 tissue expression, we used reverse transcription of total RNA isolated from 20 human tissues, followed by amplification of alpha 2AR cDNA using the polymerase chain reaction. This technique provided two advantages: high sensitivity and, with the use of subtype-specific oligonucleotide primers and probes, differentiation between the alpha 2AR subtypes. The tissues studied were aorta, vena cava, heart (epicardium and endocardium), lung, skeletal muscle, liver, pancreas (head and tail), fat (perinephric and subcutaneous), kidney (cortex and medulla), prostate, stomach, ileum, jejunum, colon, adrenal gland, and spleen. We found that the majority of these tissues expressed alpha 2C10, with the exceptions being the head of the pancreas, subcutaneous fat, colon, and spleen. In marked distinction to other studies, however, we found a prolific expression of the alpha 2C4 and alpha 2C2 subtypes. Expression of alpha 2C4 was found in all tissues with the exception of liver, fat, stomach, and colon, and a virtually ubiquitous expression of alpha 2C2 was found, with the exception of epicardium. Of all tissues studied, only colon and subcutaneous fat expressed a single alpha 2AR subtype, which was alpha 2C2. Thus, the alpha 2AR subtypes do not have a confined expression but

  17. Human alpha 2-adrenergic receptor subtype distribution: widespread and subtype-selective expression of alpha 2C10, alpha 2C4, and alpha 2C2 mRNA in multiple tissues.

    PubMed

    Eason, M G; Liggett, S B

    1993-07-01

    At present, molecular cloning and pharmacological studies have delineated three human alpha 2-adrenergic receptor (alpha 2AR) subtypes, alpha 2C10, alpha 2C4, and alpha 2C2. Assignment of the alpha 2AR subtypes to specific functions has been limited by an unclear definition of tissue alpha 2AR expression outside of the central nervous system. It has been suggested that alpha 2C4 expression is confined to the brain, that alpha 2C2 expression is only in the liver and kidney, and that there is nearly ubiquitous expression of alpha 2C10. However, this is based on studies of a limited number of rat tissues or on studies using non-species-specific approaches. Therefore, to define alpha 2C10, alpha 2C4, and alpha 2C2 tissue expression, we used reverse transcription of total RNA isolated from 20 human tissues, followed by amplification of alpha 2AR cDNA using the polymerase chain reaction. This technique provided two advantages: high sensitivity and, with the use of subtype-specific oligonucleotide primers and probes, differentiation between the alpha 2AR subtypes. The tissues studied were aorta, vena cava, heart (epicardium and endocardium), lung, skeletal muscle, liver, pancreas (head and tail), fat (perinephric and subcutaneous), kidney (cortex and medulla), prostate, stomach, ileum, jejunum, colon, adrenal gland, and spleen. We found that the majority of these tissues expressed alpha 2C10, with the exceptions being the head of the pancreas, subcutaneous fat, colon, and spleen. In marked distinction to other studies, however, we found a prolific expression of the alpha 2C4 and alpha 2C2 subtypes. Expression of alpha 2C4 was found in all tissues with the exception of liver, fat, stomach, and colon, and a virtually ubiquitous expression of alpha 2C2 was found, with the exception of epicardium. Of all tissues studied, only colon and subcutaneous fat expressed a single alpha 2AR subtype, which was alpha 2C2. Thus, the alpha 2AR subtypes do not have a confined expression but

  18. Alpha decay of {sup 181}Pb

    SciTech Connect

    Davids, C.N.; Henderson, D.J.; Hermann, R.

    1995-08-01

    The {alpha}-decay energy of {sup 181}Pb was measured as 7211(10) keV and 7044(15). In the first study the isotope was produced in {sup 90}Zr bombardments of {sup 94}Mo and, after traversing a velocity filter, implanted in a position-sensitive Si detector; no half life for {sup 181}Pb was reported. In the second study the isotope was produced in {sup 40}Ca bombardments of {sup 144}Sm and transported to a position in front of a Si(Au) surface barrier detector with a fast He-gas-jet capillary system; an estimate of 50 ms was determined for the {sup 181}Pb half life. Recently we investigated {sup 181}Pb {alpha} decay at ATLAS as part of a survey experiment in which a l-pnA beam of 400-MeV {sup 92}Mo was used to irradiate targets of {sup 89}Y, {sup 90,92,94}Zr, and {sup 92}Mo to examine yields for one- and two-nucleon evaporation products from symmetric cold-fusion reactions. Recoiling nuclei of interest were passed through the Fragment Mass Analyzer and implanted in a double-sided silicon strip detector for {alpha}-particle assay. With the {sup 90}Zr target we observed a group at 7065(20) keV which was correlated with A = 181 recoils and had a half life of 45(20) ms. Our new results for {sup 181}Pb therefore agreed with those of the second study. There was no indication in the {sup 90}Zr + {sup 92}Mo data of the 7211(10)-keV {alpha} particles seen by Keller et al. The interested reader is referred to the 1993 atomic mass evaluation wherein the input {alpha}-decay energies and resultant masses of the light Pb isotopes (including {sup 181}Pb) are discussed.

  19. Alpha-particle emission probabilities of ²³⁶U obtained by alpha spectrometry.

    PubMed

    Marouli, M; Pommé, S; Jobbágy, V; Van Ammel, R; Paepen, J; Stroh, H; Benedik, L

    2014-05-01

    High-resolution alpha-particle spectrometry was performed with an ion-implanted silicon detector in vacuum on a homogeneously electrodeposited (236)U source. The source was measured at different solid angles subtended by the detector, varying between 0.8% and 2.4% of 4π sr, to assess the influence of coincidental detection of alpha-particles and conversion electrons on the measured alpha-particle emission probabilities. Additional measurements were performed using a bending magnet to eliminate conversion electrons, the results of which coincide with normal measurements extrapolated to an infinitely small solid angle. The measured alpha emission probabilities for the three main peaks - 74.20 (5)%, 25.68 (5)% and 0.123 (5)%, respectively - are consistent with literature data, but their precision has been improved by at least one order of magnitude in this work.

  20. Mechanism of release of active alpha subunit from dimeric alpha beta avian myeloblastosis virus DNA polymerase.

    PubMed Central

    Papas, T S; Marciani, D J; Samuel, K; Chirikjian, J G

    1976-01-01

    Storage of the dimeric (alphabeta) form of avian myeloblastosis virus (AMV) DNA polymerase in glycerol resulted in the release of the smaller alpha subunit, as detected by glycerol gradient sedimentation. Analysis by sodium dodecyl sulfate-polyacrylamide gel electrophoresis of enzyme stored in glycerol showed the concomitant appearance of several polypeptides and a lowering in the level of both beta and alpha components. This reduction appears to be the result of cleavages introduced by traces of hydrolytic activity present in glycerol samples. An enhancement of alpha subunit released, as detected by activity profile, was also achieved upon direct but limited exposure of purified avian myeloblastosis virus DNA polymerase to carboxymethyl-cellulose-bound trypsin matrix. Electrophoretic analysis of digested enzyme revealed a progressive fragmentation, with simultaneous increase in the alpha subunit and decrease in the beta subunit. PMID:58080