Sample records for elements alpha hib

  1. Hib Photos


    ... fluid culture positive for Haemophilus influenzae , type b (Gram stain) ... Pediatrics Inferior view of a brain infected with gram-negative Haemophilus influenzae bacteria ...

  2. Haemophilus influenzae type b (Hib) Vaccine


    ... influenzae type b (Hib) disease is a serious disease caused by bacteria. It usually affects children under 5 years old. It can also affect adults with certain medical conditions.Your child can get Hib disease by being around other children or adults who ...

  3. Facts about Hib Disease. ARC Facts.

    ERIC Educational Resources Information Center

    Association for Retarded Citizens, Arlington, TX.

    The fact sheet provides basic information about Hib Disease in young children, which may involve a bacterial meningitis causing mental retardation, hearing loss, partial blindness, speech disorders, partial paralysis, behavioral problems, or seizures. Stressed is prevention of Hib Disease through immunization. The question and answer format…

  4. Hib Disease (Haemophilus Influenzae Type b)


    ... Making a Change – Your Personal Plan Hot Topics Meningitis Choosing Your Mood Prescription Drug Abuse Healthy School ... to more serious problems like blood infections or meningitis. Hib disease usually isn't a big worry ...

  5. {alpha} decay of even-even superheavy elements

    SciTech Connect

    Denisov, V. Yu.; Khudenko, A. A.


    The {alpha}-decay half-lives of even-even superheavy elements within the range of proton number 104<=Z<=126, which can be formed by possible cold and hot fusion reactions, are calculated in the framework of various approaches for {alpha}-decay half-life evaluation and by using the Q values of {alpha} transitions obtained within different approximations for atomic masses. The dependencies of {alpha}-decay half-lives of superheavy elements on model approaches for both the Q values and half-life calculations are discussed in detail.

  6. Hib Vaccines: Past, Present, and Future Perspectives.


    Zarei, Adi Essam; Almehdar, Hussein A; Redwan, Elrashdy M


    Haemophilus influenzae type b (Hib) causes many severe diseases, including epiglottitis, pneumonia, sepsis, and meningitis. In developed countries, the annual incidence of meningitis caused by bacteria is approximately 5-10 cases per population of 100,000. The Hib conjugate vaccine is considered protective and safe. Adjuvants, molecules that can enhance and/or regulate the fundamental immunogenicity of an antigen, comprise a wide range of diverse compounds. While earlier developments of adjuvants created effective products, there is still a need to create new generations, rationally designed based on recent discoveries in immunology, mainly in innate immunity. Many factors may play a role in the immunogenicity of Hib conjugate vaccines, such as the polysaccharides and proteins carrier used in vaccine construction, as well as the method of conjugation. A Hib conjugate vaccine has been constructed via chemical synthesis of a Hib saccharide antigen. Two models of carbohydrate-protein conjugate have been established, the single ended model (terminal amination-single method) and cross-linked lattice matrix (dual amination method). Increased knowledge in the fields of immunology, molecular biology, glycobiology, glycoimmunology, and the biology of infectious microorganisms has led to a dramatic increase in vaccine efficacy. PMID:26904695

  7. Hib Vaccines: Past, Present, and Future Perspectives

    PubMed Central

    Zarei, Adi Essam; Almehdar, Hussein A.; Redwan, Elrashdy M.


    Haemophilus influenzae type b (Hib) causes many severe diseases, including epiglottitis, pneumonia, sepsis, and meningitis. In developed countries, the annual incidence of meningitis caused by bacteria is approximately 5–10 cases per population of 100,000. The Hib conjugate vaccine is considered protective and safe. Adjuvants, molecules that can enhance and/or regulate the fundamental immunogenicity of an antigen, comprise a wide range of diverse compounds. While earlier developments of adjuvants created effective products, there is still a need to create new generations, rationally designed based on recent discoveries in immunology, mainly in innate immunity. Many factors may play a role in the immunogenicity of Hib conjugate vaccines, such as the polysaccharides and proteins carrier used in vaccine construction, as well as the method of conjugation. A Hib conjugate vaccine has been constructed via chemical synthesis of a Hib saccharide antigen. Two models of carbohydrate-protein conjugate have been established, the single ended model (terminal amination-single method) and cross-linked lattice matrix (dual amination method). Increased knowledge in the fields of immunology, molecular biology, glycobiology, glycoimmunology, and the biology of infectious microorganisms has led to a dramatic increase in vaccine efficacy. PMID:26904695

  8. Haemophilus influenzae Disease (Including Hib) Diagnosis and Treatment


    ... Multimedia Related Links Global Hib Vaccination Hib Vaccination Meningitis Pneumonia Sepsis Diagnosis, Treatment, and Complications Recommend on ... the bacteria. For example, if H. influenzae cause meningitis (infection of the covering of the brain and ...

  9. Protect Your Child against Hib Disease


    ... 722 KB] View the Hib Vaccine Information Statement ( English ) or other languages ) Call 1-800-232-4636 (1-800-CDC- ... this? Submit What's this? Submit Button Past Emails Language: English Español (Spanish) File Formats Help: How do I ...

  10. Haemophilus influenzae Disease (Including Hib) Complications


    ... Z Index MENU CDC A-Z SEARCH A B C D E F G H I J K L M N O P Q R S T U V W X Y Z # Start of Search Controls Search Form Controls Search The CDC Cancel Submit Search The CDC Haemophilus influenzae Disease (Including Hib) Note: Javascript is disabled or ...

  11. Stability against {alpha} decay of some recently observed superheavy elements

    SciTech Connect

    Roy Chowdhury, Partha; Gangopadhyay, G.; Bhattacharyya, Abhijit


    The probability of {alpha}-particle emission for some recently observed superheavy nuclei (SHN) are investigated. The {alpha}-decay half-lives of SHN are calculated in a quantum tunneling model with density-dependent M3Y (DDM3Y) effective nuclear interaction using theoretical and measured Q{sub {alpha}} values. We determine the density distribution of {alpha} and daughter nuclei from the relativistic mean-field (RMF) theory using FSUGold force, NL3, and TM1 parameter sets. The double-folded nuclear potential is numerically calculated in a more microscopic manner using these density distributions. The estimated values of {alpha}-decay half-lives are in good agreement with the recent data. We compare our results with recently detected {alpha}-decay chains from a new element with atomic number Z=117 reported by the Joint Institute for Nuclear Research, Dubna. Finally, we determine the half-lives of superheavy elements with Z=108-120 and neutron number N=152-190 to explore the long-standing predictions of the existence of an 'island of stability' due to possible spherical proton (Z{approx}114) and neutron (N{approx}184) shell closures.

  12. Sandia Higher Order Elements (SHOE) v 0.5 alpha

    SciTech Connect


    SHOE is research code for characterizing and visualizing higher-order finite elements; it contains a framework for defining classes of interpolation techniques and element shapes; methods for interpolating triangular, quadrilateral, tetrahedral, and hexahedral cells using Lagrange and Legendre polynomial bases of arbitrary order; methods to decompose each element into domains of constant gradient flow (using a polynomial solver to identify critical points); and an isocontouring technique that uses this decomposition to guarantee topological correctness. Please note that this is an alpha release of research software and that some time has passed since it was actively developed; build- and run-time issues likely exist.

  13. Sandia Higher Order Elements (SHOE) v 0.5 alpha


    SHOE is research code for characterizing and visualizing higher-order finite elements; it contains a framework for defining classes of interpolation techniques and element shapes; methods for interpolating triangular, quadrilateral, tetrahedral, and hexahedral cells using Lagrange and Legendre polynomial bases of arbitrary order; methods to decompose each element into domains of constant gradient flow (using a polynomial solver to identify critical points); and an isocontouring technique that uses this decomposition to guarantee topological correctness. Please notemore » that this is an alpha release of research software and that some time has passed since it was actively developed; build- and run-time issues likely exist.« less

  14. H. influenzae type b (Hib) vaccine--controversies.


    Shah, Nitin K


    Hib vaccine is the 8th vaccine knocking at the door to be included in the EPI the world over. However there are some controversies that need to be addressed, especially when it comes to use of this vaccine in India. It is difficult to culture Hib unless one uses sheep blood enriched media for culture. There is a lack of good community based data on Hib burden in India. This makes many feel that Hib is rare in India. However this is not true. There are many studies that have looked at this closely. Hib is a common cause of meningitis and pneumonitis in children less than 5 years old in India. There is wide spread problem of multi-drug resistance by Hib in India. Mortality of meningitis is as high as 100% if third generation cephalosporins are not used in time. Of the survivors of meningitis, 60% develop long-term sequelae. Hib vaccine is very effective and can lead to 99% reduction with mass vaccination in just 2-3 years. It is also a very safe vaccine. Of the conjugated vaccines available in India all are equally effective and safe and there is nothing to choose one over the other. There is a need to give a booster dose at 15-18 months of age. Even UK, which never gave the booster dose, is seriously thinking of changing their practice and give a booster dose. Lastly the combination vaccines of Hib with IPV, DPwT/DPaT, and Hepatitis B are safe and effective and should be encouraged to improve the compliance. The use of Hib vaccine is recommended in India, for those who can afford the vaccine. PMID:12921318

  15. Haemophilus Influenzae Type B (Hib): Questions and Answers


    ... five cases of invasive Hib disease in children younger than 5 years from 2008, the largest number ... the leading cause of bacterial meningitis among children younger than age five years in the United States. ...

  16. Stability of HIB-Cul3 E3 ligase adaptor HIB Is Regulated by Self-degradation and Availability of Its Substrates

    PubMed Central

    Zhou, Zizhang; Xu, Congyu; Chen, Ping; Liu, Chen; Pang, Shu; Yao, Xia; Zhang, Qing


    The HIB-Cul3 complex E3 ligase regulates physiological homeostasis through regulating its substrate stability and its activity can be modulated by changing HIB abundance. However, regulation of HIB remains elusive. Here we provide evidence that HIB is degraded through the proteasome by Cul3-mediated polyubiquitination in K48 manner in Drosophila. Strikingly, HIB is targeted for degradation by itself. We further identify that three degrons (52LKSS56T, 76LDEE80S and 117MESQ121R) and K185 and K198 of HIB are essential for its auto-degradation. Finally, we demonstrate that HIB-Cul3 substrates, Ci and Puc, can effectively protect HIB from HIB-Cul3-mediated degradation. Taken together, our study indicates that there is an exquisite equilibrium between the adaptor and targets to achieve the tight control of the HIB, which is essential for maintaining suitable Hh and JNK signaling. And the mechanism of adaptor self-degradation and reciprocal control of the abundance between adaptor and its substrates is also applied to BTB-Cul3 E3 ligase adaptor dKeap1, dDiablo and dKLHL18. PMID:26263855

  17. Alpha Virginis: line-profile variations and orbital elements

    NASA Astrophysics Data System (ADS)

    Harrington, David; Koenigsberger, Gloria; Olguín, Enrique; Ilyin, Ilya; Berdyugina, Svetlana V.; Lara, Bruno; Moreno, Edmundo


    Context. Alpha Virginis (Spica) is a B-type binary system whose proximity and brightness allow detailed investigations of the internal structure and evolution of stars undergoing time-variable tidal interactions. Previous studies have led to the conclusion that the internal structure of Spica's primary star may be more centrally condensed than predicted by theoretical models of single stars, raising the possibility that the interactions could lead to effects that are currently neglected in structure and evolution calculations. The key parameters in confirming this result are the values of the orbital eccentricity e, the apsidal period U, and the primary star's radius, R1. Aims: The aim of this paper is to analyze the impact that Spica's line profile variability has on the derivation of its orbital elements and to explore the use of the variability for constraining R1. Methods: We use high signal-to-noise and high spectral resolution observations obtained in 2000, 2008, and 2013 to derive the orbital elements from fits to the radial velocity curves. We produce synthetic line profiles using an ab initio tidal interaction model. Results: The general variations in the line profiles can be understood in terms of the tidal flows, whose large-scale structure is relatively fixed in the rotating binary system reference frame. Fits to the radial velocity curves yield e = 0.108 ± 0.014. However, the analogous RV curves from theoretical line profiles indicate that the distortion in the lines causes the fitted value of e to depend on the argument of periastron; i.e., on the epoch of observation. As a result, the actual value of e may be as high as 0.125. We find that U = 117.9 ± 1.8, which is in agreement with previous determinations. Using the value R1 = 6.8 R⊙ derived by Palate et al. (2013) the value of the observational internal structure constant k2,obs is consistent with theory. We confirm the presence of variability in the line profiles of the secondary star. RV

  18. Children with Haemophilus influenzae type b (Hib) vaccine failure have long-term bactericidal antibodies against virulent Hib strains with multiple capsular loci.


    Townsend-Payne, Kelly; Ladhani, Shamez N; Findlow, Helen; Slack, Mary; Borrow, Ray


    Children who develop invasive Haemophilus influenzae serotype b (Hib) disease after immunisation with a highly-effective conjugate vaccine are more likely to have been infected with Hib strains possessing multiple copies of the capsulation locus. Using a recently-validated serum bactericidal antibody (SBA) assay, we tested convalescent sera from 127 Hib vaccine failure cases against clinical Hib strains expressing 1-5 copies of the capsulation locus. SBA titres correlated weakly with anti-capsular IgG antibody concentrations and there was no association between SBA geometric mean titres and number of capsulation locus copies. After infection, children with Hib vaccine failure were equally protected against Hib strains with 1-5 copies of the capsulation locus. PMID:27317452

  19. New and effective multi-element alpha-hematite systems for reduction of trichloroethylene.


    Ghorpade, Praveen A; Kim, Jung-Hwan; Choi, Won-Ho; Park, Joo-Yang


    The reactivity of different alpha-hematite (alpha-Fe203) systems for dechlorination of trichloroethylene (TCE) in the presence of Fe(II) and CaO was investigated. Initially different experiments were conducted to investigate the reactivity of pure and doped alpha-Fe203. It was found that the presence of elements such as Si, Cu, and Mn in alpha-Fe203 had a significant effect on TCE reduction potential of alpha-Fe203; however, the reduction potential was less than that of alpha-Fe203 (Bayferrox- 110 M, used in a previous study). Further studies were carried out and alpha-Fe203 was synthesized in a manner similar to that of Bayferrox-110 M. This synthetic alpha-Fe203 showed improved reactivity and was found to follow pseudo-first-order kinetics when used in TCE reduction experiments. The preliminary end products analysis showed that TCE degradation was probably via beta-elimination pathway. Detailed investigations ofa-Fe203 systems were carried out using X-ray diffraction, X-ray fluorescence, and scanning electron microscopy with energy-dispersive spectrometry. The results demonstrated that the TCE reduction capacity of alpha-Fe203 was strongly dependent on the other elements present in iron powder used to synthesize alpha-Fe203. It was suspected that these multi-elements in alpha-Fe203 helped to improve its conduction property. Current findings suggest that alpha-Fe203 not in the pure but combined with other elements could be thought as a potential system for TCE reduction. PMID:24600837

  20. The distribution of alpha elements in Andromeda dwarf galaxies

    SciTech Connect

    Vargas, Luis C.; Geha, Marla C.; Tollerud, Erik J.


    We present alpha to iron abundance ratios for 226 individual red giant branch stars in nine dwarf galaxies of the Andromeda (M31) satellite system. The abundances are measured from the combined signal of Mg, Si, Ca, and Ti lines in Keck/DEIMOS medium-resolution spectra. This constitutes the first large sample of alpha abundance ratios measured in the M31 satellite system. The dwarf galaxies in our sample exhibit a variety of alpha abundance ratios, with the average values in each galaxy ranging from approximately solar ([α/Fe] ∼ + 0.0) to alpha-enhanced ([α/Fe] ∼ + 0.5). These variations do not show a correlation with internal kinematics, environment, or stellar density. We confirm radial gradients in the iron abundance of two galaxies out of the five with sufficient data (NGC 185 and And II). There is only tentative evidence for an alpha abundance radial gradient in NGC 185. We homogeneously compare our results to the Milky Way classical dwarf spheroidals, finding evidence for wider variation in average alpha abundance. In the absence of chemical abundances for the M31 stellar halo, we compare to the Milky Way stellar halo. A stellar halo comprised of disrupted M31 satellites is too metal-rich and inconsistent with the Milky Way halo alpha abundance distribution even if considering only satellites with predominantly old stellar populations. The M31 satellite population provides a second system in which to study chemical abundances of dwarf galaxies and reveals a wider variety of abundance patterns than the Milky Way.

  1. The generalized liquid drop model alpha-decay formula: Predictability analysis and superheavy element alpha half-lives

    SciTech Connect

    Dasgupta-Schubert, N. Reyes, M.A.


    The predictive accuracy of the generalized liquid drop model (GLDM) formula for alpha-decay half-lives has been investigated in a detailed manner and a variant of the formula with improved coefficients is proposed. The method employs the experimental alpha half-lives of the well-known alpha standards to obtain the coefficients of the analytical formula using the experimental Q{sub {alpha}} values (the DSR-E formula), as well as the finite range droplet model (FRDM) derived Q{sub {alpha}} values (the FRDM-FRDM formula). The predictive accuracy of these formulae was checked against the experimental alpha half-lives of an independent set of nuclei (TEST) that span approximately the same Z, A region as the standards and possess reliable alpha spectroscopic data, and were found to yield good results for the DSR-E formula but not for the FRDM-FRDM formula. The two formulae were used to obtain the alpha half-lives of superheavy elements (SHE) and heavy nuclides where the relative accuracy was found to be markedly improved for the FRDM-FRDM formula, which corroborates the appropriateness of the FRDM masses and the GLDM prescription for high Z, A nuclides. Further improvement resulted, especially for the FRDM-FRDM formula, after a simple linear optimization over the calculated and experimental half-lives of TEST was used to re-calculate the half-lives of the SHE and heavy nuclides. The advantage of this optimization was that it required no re-calculation of the coefficients of the basic DSR-E or FRDM-FRDM formulae. The half-lives for 324 medium-mass to superheavy alpha decaying nuclides, calculated using these formulae and the comparison with experimental half-lives, are presented.

  2. Heavy element abundances in Ap stars from ultraviolet data. I - The bright reference stars Alpha Lyrae and Alpha Canis Majoris A

    NASA Technical Reports Server (NTRS)

    Boiarchuk, A. A.; Snow, T. P., Jr.


    Curve-of-growth analysis is used to derive chemical abundances in Alpha Lyr and Alpha CMa, based on ultraviolet spectra obtained with Copernicus. This analysis is part of a program to study the abundances of the heavy elements mercury and platinum and the short-lived element technetium in the atmospheres of Ap and Am stars. Ultraviolet Fe II lines are used to establish the curves of growth for Alpha Lyr and Alpha CMa A; abundances of a variety of elements, along with upper limits on Hg, Pt, and Tc, are derived. In cases where previous studies based on visual spectra have included elements in common with the present analysis, the agreement is good within the known uncertainties. One new element, cadmium, is observed for these two stars. The upper limits on Pt and Hg, as well as Tc, show that these elements are probably not enhanced in Alpha CMa A by more than about one order of magnitude.

  3. Neutron-capture element and Sc abundances in low- and high-alpha Galactic halo stars

    NASA Astrophysics Data System (ADS)

    Yong, David; Fishlock, Cherie; Karakas, Amanda


    Nissen & Schuster (2010) identified two samples of Galactic halo stars with distinct kinematic and chemical properties. The "high-alpha" population is associated with the dissipative monolithic collapse of a proto-Galactic gas cloud while the "low-alpha" population was likely accreted from dwarf galaxies having experienced slower star formation rates. For a subset of these stars, we measured precise abundances of Sc, Zr, La, Ce, Nd and Eu. We find differences in the abundance ratios of [Sc/Fe], [Zr/Fe], and [La/Zr] between the low- and high-alpha groups. The most intriguing result is that the low-alpha stars appear to have higher [Eu/Fe] ratios than the high-alpha stars, in contrast to the expectation that Eu should follow the alpha elements. These data challenge the hypothesis that the high-alpha stars formed in regions only enriched by massive stars and that the low-alpha received additional enrichment from SNeIa and low-mass AGB stars. This work has three main consequences for galaxy halos: 1. The new Eu data could be explained by different IMFs for the two halo populations; 2. The low [alpha/Fe] ratios in some, and perhaps all, dwarf galaxies may be driven (in part of in whole) by different IMFs rather than SNeIa contributions; 3. These data may provide important new constraints on the origin of Eu.

  4. Hedgehog signaling downregulates suppressor of fused through the HIB/SPOP-Crn axis in Drosophila.


    Liu, Chen; Zhou, Zizhang; Yao, Xia; Chen, Ping; Sun, Man; Su, Miya; Chang, Cunjie; Yan, Jun; Jiang, Jin; Zhang, Qing


    Hedgehog (Hh) signaling plays vital roles in animal development and tissue homeostasis, and its misregulation causes congenital diseases and several types of cancer. Suppressor of Fused (Su(fu)) is a conserved inhibitory component of the Hh signaling pathway, but how it is regulated remains poorly understood. Here we demonstrate that in Drosophila Hh signaling promotes downregulation of Su(fu) through its target protein HIB (Hh-induced BTB protein). Interestingly, although HIB-mediated downregulation of Su(fu) depends on the E3 ubiquitin ligase Cul3, HIB does not directly regulate Su(fu) protein stability. Through an RNAi-based candidate gene screen, we identify the spliceosome factor Crooked neck (Crn) as a regulator of Su(fu) level. Epistasis analysis indicates that HIB downregulates Su(fu) through Crn. Furthermore, we provide evidence that HIB retains Crn in the nucleus, leading to reduced Su(fu) protein level. Finally, we show that SPOP, the mammalian homologue of HIB, can substitute HIB to downregulate Su(fu) level in Drosophila. Our study suggests that Hh regulates both Ci and Su(fu) levels through its target HIB, thus uncovering a novel feedback mechanism that regulates Hh signal transduction. The dual function of HIB may provide a buffering mechanism to fine-tune Hh pathway activity. PMID:24603360

  5. Naturally Acquired and Conjugate Vaccine-Induced Antibody to Haemophilus influenzae Type b (Hib) Polysaccharide in Malian Children: Serological Assessment of the Hib Immunization Program in Mali

    PubMed Central

    Hutter, Julia; Pasetti, Marcela F.; Sanogo, Doh; Tapia, Milagritos D.; Sow, Samba O.; Levine, Myron M.


    Haemophilus influenzae type b (Hib) conjugate vaccine for infants (6, 10, and 14 weeks of age) was introduced into the Malian Expanded Program on Immunization in July 2005, to diminish invasive Hib disease in young children. Antibodies to Hib capsular polysaccharide (PRP) were measured in infants and toddlers from an area already served by the Hib immunization program (Bamako) and in unimmunized children of the same age in a district (Kangaba) where Hib immunization had not yet begun. Among vaccinated Bamako children 6–23 months of age, 77–93% exhibited PRP titers ≥ 1.0 μg/mL, indicating long-term protection, versus only 10–23% of Kangaba children of that age. High PRP antibody titers in immunized children persisted through 2 years of age. Moreover, ∼50% of Bamako children exhibited anti-PRP titers ≥ 5.0 μg/mL; a level that impedes Hib upper respiratory carriage, and may thereby diminish the Hib transmission to the unimmunized susceptible population (i.e., providing indirect protection). PMID:22665612

  6. Application of alpha spectrometry to the discovery of new elements by heavy-ion-beam bombardment

    SciTech Connect

    Nitschke, J.M.


    Starting with polonium in 1898, ..cap alpha..-spectrometry has played a decisive role in the discovery of new, heavy elements. For even-even nuclei, ..cap alpha..-spectra have proved simple to interpret and exhibit systematic trends that allow extrapolation to unknown isotopes. The early discovery of the natural ..cap alpha..-decay series led to the very powerful method of genetically linking the decay of new elements to the well-established ..cap alpha..-emission of daughter and granddaughter nuclei. This technique has been used for all recent discoveries of new elements including Z = 109. Up to mendelevium (Z = 101), thin samples suitable for ..cap alpha..-spectrometry were prepared by chemical methods. With the advent of heavy-ion accelerators new sample preparation methods emerged. These were based on the large momentum transfer associated with heavy-ion reactions, which produced energetic target recoils that, when ejected from the target, could be thermalized in He gas. Subsequent electrical deposition or a He-jet technique yielded samples that were not only thin enough for ..cap alpha..-spectroscopy, but also for ..cap alpha..- and ..beta..-recoil experiments. Many variations of these methods have been developed and are discussed. For the synthesis of element 106 an aerosol-based recoil transport technique was devised. In the most recent experiments, ..cap alpha..-spectrometry has been coupled with the magnetic analysis of the recoils. The time from production to analysis of an isotope has thereby been reduced to 10/sup -6/ s; while it was 10/sup -1/ to 10/sup 0/ s for He-jets and 10/sup 1/ to 10/sup 3/ s for rapid chemical separations. Experiments are now in progress to synthesize super heavy elements (SHE) and to analyze them with these latest techniques. Again, ..cap alpha..-spectrometry will play a major role since the expected signature for the decay of a SHE is a sequence of ..cap alpha..-decays followed by spontaneous fission.

  7. Alpha-element enhancement in a lambda-CDM Universe

    NASA Astrophysics Data System (ADS)

    Gargiulo, I. D.; Muñoz Arancibia, A. M.; Cora, S. A.; Padilla, N.

    We study the chemical enrichment of elliptical galaxies using a semi-analytic model of galaxy formation combined with a cosmological N-body simula- tion of dark matter particles. In particular, we study the a-element abun- dances with respect to the iron content of galaxies. The main modification to the previous models (Cora 2006; Lagos et al. 2008; Tecce et al. 2010) was the implementation of a top heavy variable initial mass function with a theoretical basis (Weidner & Kroupa 2004, 2005, 2006; Weidner et al. 2011). We find that with a single initial mass function at all epochs the observed trend of [a/Fe] with the stellar mass of elliptical galaxies can be hardly reproduced. We propound that a top heavy integrated galactic mass function can be a plausible solution for this problem. FULL TEXT IN SPANISH

  8. Implications of private sector Hib vaccine coverage for the introduction of public sector Hib-containing pentavalent vaccine in India: evidence from retrospective time series data

    PubMed Central

    Sharma, Abhishek; Kaplan, Warren A; Chokshi, Maulik; Hasan Farooqui, Habib; Zodpey, Sanjay P


    Objective Haemophilus influenzae type b (Hib) vaccine has been available in India's private sector market since 1997. It was not until 14 December 2011 that the Government of India initiated the phased public sector introduction of a Hib (and DPT, diphtheria, pertussis, tetanus)-containing pentavalent vaccine. Our objective was to investigate the state-specific coverage and behaviour of Hib vaccine in India when it was available only in the private sector market but not in the public sector. This baseline information can act as a guide to determine how much coverage the public sector rollout of pentavalent vaccine (scheduled April 2015) will need to bear in order to achieve complete coverage. Setting 16 of 29 states in India, 2009–2012. Design Retrospective descriptive secondary data analysis. Data (1) Annual sales of Hib vaccines, by volume, from private sector hospitals and retail pharmacies collected by IMS Health and (2) national household surveys. Outcome measures State-specific Hib vaccine coverage (%) and its associations with state-specific socioeconomic status. Results The overall private sector Hib vaccine coverage among the 2009–2012 birth cohort was low (4%) and varied widely among the studied Indian states (minimum 0.3%; maximum 4.6%). We found that private sector Hib vaccine coverage depends on urban areas with good access to the private sector, parent's purchasing capacity and private paediatricians’ prescribing practices. Per capita gross domestic product is a key explanatory variable. The annual Hib vaccine uptake and the 2009–2012 coverage levels were several times higher in the capital/metropolitan cities than the rest of the state, suggesting inequity in access to Hib vaccine delivered by the private sector. Conclusions If India has to achieve high and equitable Hib vaccine coverage levels, nationwide public sector introduction of the pentavalent vaccine is needed. However, the role of private sector in universal Hib vaccine coverage is

  9. Haemophilus influenzae Type b (Hib) vaccine - what you need to know


    ... influenzae type b (Hib) disease is a serious disease caused by bacteria. It usually affects children under 5 years old. It can also affect adults with certain medical conditions. Your child can get Hib disease by being around other children or adults who ...

  10. Haemophilus Influenzae Type b (Hib) Vaccine: What You Need to Know


    ... influenzae type b (Hib) disease is a serious disease caused by bacteria. It usually affects children under 5 years old. It can also affect adults with certain medical conditions. Your child can get Hib disease by being around other children or adults who ...

  11. Localisation of cis elements in the promoter of a wheat alpha-Amy2 gene.


    Huttly, A K; Phillips, A L; Tregear, J W


    A functional analysis of the promoter from the wheat alpha-amylase gene alpha-Amy2/54 is described. Mutant alpha-Amy2/54 promoters containing replacements or deletions were constructed and their ability to direct expression of the reporter gene beta-glucuronidase (GUS) in gibberellin-responsive oat aleurone protoplasts analysed. Chimaeric promoters using regions of the cauliflower mosaic virus (CaMV) 35S and alpha-Amy2/54 promoters were also analysed. The results suggest that at least three regions within the alpha-Amy2/54 promoter contain cis elements that are necessary for high-level gibberellin-regulated transcription. Fusion of 1.8 kb of promoter sequence upstream from -117 bp to a minimal (-55 CaMV 35S) promoter gave rise to hormone-independent expression implying that the region 3' to -117 bp contains an element which represses transcription in the absence of gibberellin or presence of abscisic acid. PMID:1511136

  12. Retinoic acid activates human inducible nitric oxide synthase gene through binding of RAR{alpha}/RXR{alpha} heterodimer to a novel retinoic acid response element in the promoter

    SciTech Connect

    Zou Fang; Liu Yan; Liu Li; Wu Kailang; Wei Wei; Zhu Ying . E-mail:; Wu Jianguo . E-mail:


    Human inducible nitric oxide synthase (hiNOS) catalyzes nitric oxide (NO) which has a significant effect on tumor suppression and cancer therapy. Here we revealed the detailed molecular mechanism involved in the regulation of hiNOS expression induced by retinoic acid (RA). We showed that RAR{alpha}/RXR{alpha} heterodimer was important in hiNOS promoter activation, hiNOS protein expression, and NO production. Serial deletion and site-directed mutation analysis revealed two half-sites of retinoic acid response element (RARE) spaced by 5 bp located at -172 to -156 in the hiNOS promoter. EMSA and ChIP assays demonstrated that RAR{alpha}/RXR{alpha} directly bound to this RARE of hiNOS promoter. Our results suggested the identification of a novel RARE in the hiNOS promoter and the roles of the nuclear receptors (RAR{alpha}/RXR{alpha}) in the induction of hiNOS by RA.

  13. The {alpha}-induced thick-target {gamma}-ray yield from light elements

    SciTech Connect

    Heaton, R.K. |


    The {alpha}-induced thick-target {gamma}-ray yield from light elements has been measured in the energy range 5.6 MeV {le} E{sub {alpha}} {le} 10 MeV. The {gamma}-ray yield for > 2.1 MeV from thick targets of beryllium, boron nitride, sodium fluoride, magnesium, aluminum and silicon were measured using the {alpha}-particle beam from the Lawrence Berkeley Laboratories 88 in. cyclotron. The elemental yields from this experiment were used to construct the {alpha}-induced direct production {gamma}-ray spectrum from materials in the SNO detector, a large volume ultra-low background neutrino detector located in the Creighton mine near Sudbury, Canada. This background source was an order of magnitude lower than predicted by previous calculations. These measurements are in good agreement with theoretical calculations of this spectrum based on a statistical nuclear model of the reaction, with the gross high energy spectrum structure being reproduced to within a factor of two. Detailed comparison of experimental and theoretical excitation population distribution of several residual nuclei indicate the same level of agreement within experimental uncertainties.

  14. The relationship between structural stability and electrochemical performance of multi-element doped alpha nickel hydroxide

    NASA Astrophysics Data System (ADS)

    Miao, Chengcheng; Zhu, Yanjuan; Huang, Liangguo; Zhao, Tengqi


    The multi-element doped alpha nickel hydroxide has been prepared by supersonic co-precipitation method. Three kinds of samples A, B and C are prepared by chemically coprecipitating Ni/Al, Ni/Al/Mn and Ni/Al/Mn/Yb, respectively. Inductively coupled plasma atomic emission spectroscopy (ICP-AES), Particle size distribution (PSD) measurement, X-ray diffraction (XRD), scanning electron microscope (SEM) and Fourier transform infrared spectroscopy (FT-IR) are used to characterize the physical properties of the synthesized α-Ni(OH)2 samples, such as chemical composition, morphology, structural stability of the crystal. The results show that all samples are nano-sized materials and the interlayer spacing becomes larger and the structural stability becomes better with the increase of doped elements and doped ratio. The prepared alpha nickel hydroxide samples are added into micro-sized beta nickel hydroxide to form biphase electrode materials for Ni-MH battery. The electrochemical characterization of the biphase electrodes, including cyclic voltammetry (CV) and charge/discharge test, are also performed. The results demonstrate that the biphase electrode with sample C exhibits better electrochemical reversibility and cyclic stability, higher charge efficient and discharge potential, larger proton diffusion coefficient (5.81 × 10-12 cm2 s-1) and discharge capacity (309.0 mAh g-1). Hence, it indicates that all doped elements can produce the synergic effect and further improve the electrochemical properties of the alpha nickel hydroxide.


    SciTech Connect

    Kirby, Evan N.; Cohen, Judith G.; Smith, Graeme H.; Guhathakurta, Puragra; Sohn, Sangmo Tony


    We derive the star formation histories of eight dwarf spheroidal (dSph) Milky Way satellite galaxies from their alpha element abundance patterns. Nearly 3000 stars from our previously published catalog comprise our data set. The average [{alpha}/Fe] ratios for all dSphs follow roughly the same path with increasing [Fe/H]. We do not observe the predicted knees in the [{alpha}/Fe] versus [Fe/H] diagram, corresponding to the metallicity at which Type Ia supernovae begin to explode. Instead, we find that Type Ia supernova ejecta contribute to the abundances of all but the most metal-poor ([Fe/H] < -2.5) stars. We have also developed a chemical evolution model that tracks the star formation rate, Types II and Ia supernova explosions, and supernova feedback. Without metal enhancement in the supernova blowout, massive amounts of gas loss define the history of all dSphs except Fornax, the most luminous in our sample. All six of the best-fit model parameters correlate with dSph luminosity but not with velocity dispersion, half-light radius, or Galactocentric distance.


    SciTech Connect

    Milingo, J. B.; Kwitter, K. B.; Souza, S. P.; Henry, R. B. C. E-mail: kkwitter@williams.ed E-mail: henry@mail.nhn.ou.ed


    In this paper, we present emission line strengths, abundances, and element ratios (X/O for Ne, S, Cl, and Ar) for a sample of 38 Galactic disk planetary nebulae (PNe) consisting primarily of Peimbert classification Type I. Spectrophotometry for these PNe incorporates an extended optical/near-IR range of lambdalambda3600-9600 A including the [S III] lines at 9069 A and 9532 A, setting this relatively large sample apart from typical spectral coverage. We have utilized Emission Line Spectrum Analyzer, a five-level atom abundance routine, to determine T{sub e} , N{sub e} , ionization correction factors, and total element abundances, thereby continuing our work toward a uniformly processed set of data. With a compilation of data from >120 Milky Way PNe, we present results from our most recent analysis of abundance patterns in Galactic disk PNe. With a wide range of metallicities, galactocentric distances, and both Type I and non-Type I objects, we have examined the alpha elements against H II regions and blue compact galaxies (H2BCGs) to discern signatures of depletion or enhancement in PNe progenitor stars, particularly the destruction or production of O and Ne. We present evidence that many PNe have higher Ne/O and lower Ar/Ne ratios compared to H2BCGs within the range of 8.5-9.0 for 12 + log(O/H). This suggests that Ne is being synthesized in the low- and intermediate-mass progenitors. Sulfur abundances in PNe continue to show great scatter and are systematically lower than those found in H2BCG at a given metallicity. Although we find that PNe do show some distinction in alpha elements when compared to H2BCG, within the Peimbert classification types studied, PNe do not show significant differences in alpha elements amongst themselves, at least to an extent that would distinguish in situ nucleosynthesis from the observed dispersion in abundance ratios.

  17. Individual alpha elements, C, N, and Ba in early-type galaxies

    SciTech Connect

    Worthey, Guy; Tang, Baitian; Serven, Jedidiah


    Spectral data on early-type galaxies are analyzed for chemical abundance with an emphasis on obtaining detailed abundances for the elements O and Si in addition to C, N, Na, Mg, Ca, Fe, and Ba. The abundance trends with velocity dispersion fit preconceptions based upon previous Mg conclusions, namely, that larger galaxies have a higher alpha element to iron peak ratio indicative of a higher ratio of Type II to Type Ia supernova products. The heaviest alpha elements, Ca and Ti, do not participate in this trend, although this fact does not necessarily alter the basic picture given the uncertainties in nucleosynthetic yields. Elements that likely have significant contributions from intermediate-mass stars, namely, C, N, and Ba, also gain ground relative to Fe in massive galaxies at a modest level, with the Ba conclusion uncertain from our data alone. After the velocity dispersion trend is subtracted, [M/H], [N/Fe], [Na/Fe], [Mg/Fe], and [Ca/Fe] probably have cosmic scatter, and no quantity can be shown to not have cosmic scatter.

  18. Impact of conjugate Haemophilus influenzae type b (Hib) vaccine introduction in South Africa.

    PubMed Central

    von Gottberg, A.; de Gouveia, L.; Madhi, S. A.; du Plessis, M.; Quan, V.; Soma, K.; Huebner, R.; Flannery, B.; Schuchat, A.; Klugman, Kp


    OBJECTIVE: To analyse trends in reported invasive Haemophilus influenzae disease in South Africa within the first five years of introduction of conjugate Haemophilus influenzae type b (Hib) vaccine in the routine child immunization schedule. METHODS: We used national laboratory-based surveillance data to identify cases of invasive H. influenzae disease between July 1999 and June 2004, and submitted isolates for serotyping and antimicrobial susceptibility testing. FINDINGS: The absolute number of Hib cases (reported to the national surveillance system) among children below one year of age decreased by 65%, from 55 cases in 1999-2000 to 19 cases in 2003-04. Enhanced surveillance initiated in 2003, identified human immunodeficiency virus (HIV)-infection and incomplete vaccination as contributing factors for Hib transmission. The total number of laboratory-confirmed cases of H. influenzae remained unchanged because non-type b disease was being increasingly reported to the surveillance system concomitant with system enhancements. Children with non-typable disease were more likely to be HIV-positive (32 of 34, 94%) than children with Hib disease (10 of 14, 71%), P = 0.051. Recent Hib isolates were more likely to be multidrug resistant (2% in 1999-2000 versus 19% in 2003-04, P = 0.001). CONCLUSION: Data from a newly established national laboratory-based surveillance system showed a decrease in Hib disease burden among South African children following conjugate vaccine introduction and identified cases of non-typable disease associated with HIV infection. PMID:17128361

  19. The Immunogenicity and Safety of a Combined DTaP-IPV//Hib Vaccine Compared with Individual DTaP-IPV and Hib (PRP~T) Vaccines: a Randomized Clinical Trial in South Korean Infants.


    Kang, Jin Han; Lee, Hoan Jong; Kim, Kyung Hyo; Oh, Sung Hee; Cha, Sung Ho; Lee, Jin; Kim, Nam Hee; Eun, Byung Wook; Kim, Chang Hwi; Hong, Young Jin; Kim, Hyun Hee; Lee, Kyung Yil; Kim, Yae Jean; Cho, Eun Young; Kim, Hee Soo; Guitton, Fabrice; Ortiz, Esteban


    Recommended infant vaccination in Korea includes DTaP-IPV and Hib vaccines administered as separate injections. In this randomized, open, controlled study we assessed the non-inferiority of immunogenicity of DTaP-IPV//Hib pentavalent combination vaccine (Pentaxim™) compared with licensed DTaP-IPV and Hib (PRP~T) vaccines. We enrolled 418 healthy Korean infants to receive either separate DTaP-IPV and Hib vaccines (n = 206) or the pentavalent DTaP-IPV//Hib (n = 208) vaccine at 2, 4, 6 months of age. Antibodies to all components were measured before the first vaccination and one month after the third, and safety was assessed after each vaccination including recording of reactions by parents. We confirmed the non-inferiority of DTaP-IPV//Hib compared with DTaP-IPV and Hib vaccines; 100% of both groups achieved seroprotection against D, T, IPV and PRP~T, and 97.5%-99.0% demonstrated seroresponses to pertussis antigens. Antibody levels were similar in both groups, except for those to the Hib component, PRP~T. In separate and combined groups geometric mean concentrations of anti-PRP~T antibodies were 23.9 and 11.0 μg/mL, respectively, but 98.3% and 97.4% had titers ≥ 1 μg/mL, indicative of long-term protection. All vaccines were well tolerated, with no vaccine-related serious adverse event. Both groups had similar safety profiles, but the combined vaccine group had fewer injection site reactions. The immunological non-inferiority and similar safety profile of DTaP-IPV//Hib vaccine to separate DTaP-IPV and Hib vaccines, with the advantage of fewer injections and injection site reactions, supports the licensure and incorporation of DTaP-IPV//Hib into the Korean national vaccination schedule (Clinical trial registry, NCT01214889). PMID:27510380

  20. The Immunogenicity and Safety of a Combined DTaP-IPV//Hib Vaccine Compared with Individual DTaP-IPV and Hib (PRP~T) Vaccines: a Randomized Clinical Trial in South Korean Infants

    PubMed Central


    Recommended infant vaccination in Korea includes DTaP-IPV and Hib vaccines administered as separate injections. In this randomized, open, controlled study we assessed the non-inferiority of immunogenicity of DTaP-IPV//Hib pentavalent combination vaccine (Pentaxim™) compared with licensed DTaP-IPV and Hib (PRP~T) vaccines. We enrolled 418 healthy Korean infants to receive either separate DTaP-IPV and Hib vaccines (n = 206) or the pentavalent DTaP-IPV//Hib (n = 208) vaccine at 2, 4, 6 months of age. Antibodies to all components were measured before the first vaccination and one month after the third, and safety was assessed after each vaccination including recording of reactions by parents. We confirmed the non-inferiority of DTaP-IPV//Hib compared with DTaP-IPV and Hib vaccines; 100% of both groups achieved seroprotection against D, T, IPV and PRP~T, and 97.5%–99.0% demonstrated seroresponses to pertussis antigens. Antibody levels were similar in both groups, except for those to the Hib component, PRP~T. In separate and combined groups geometric mean concentrations of anti-PRP~T antibodies were 23.9 and 11.0 µg/mL, respectively, but 98.3% and 97.4% had titers ≥ 1 µg/mL, indicative of long-term protection. All vaccines were well tolerated, with no vaccine-related serious adverse event. Both groups had similar safety profiles, but the combined vaccine group had fewer injection site reactions. The immunological non-inferiority and similar safety profile of DTaP-IPV//Hib vaccine to separate DTaP-IPV and Hib vaccines, with the advantage of fewer injections and injection site reactions, supports the licensure and incorporation of DTaP-IPV//Hib into the Korean national vaccination schedule (Clinical trial registry, NCT01214889). PMID:27510380

  1. Theoretical and experimental {alpha} decay half-lives of the heaviest odd-Z elements and general predictions

    SciTech Connect

    Zhang, H. F.; Royer, G.


    Theoretical {alpha} decay half-lives of the heaviest odd-Z nuclei are calculated using the experimental Q{sub {alpha}} value. The barriers in the quasimolecular shape path are determined within a Generalized Liquid Drop Model (GLDM) and the WKB approximation is used. The results are compared with calculations using the Density-Dependent M3Y (DDM3Y) effective interaction and the Viola-Seaborg-Sobiczewski (VSS) formulas. The calculations provide consistent estimates for the half-lives of the {alpha} decay chains of these superheavy elements. The experimental data stand between the GLDM calculations and VSS ones in the most time. Predictions are provided for the {alpha} decay half-lives of other superheavy nuclei within the GLDM and VSS approaches using the recent extrapolated Q{sub {alpha}} of Audi, Wapstra, and Thibault [Nucl. Phys. A729, 337 (2003)], which may be used for future experimental assignment and identification.

  2. PGC-1alpha induces dynamic protein interactions on the ERRalpha gene multi-hormone response element nucleosome in kidney cells.


    Wang, Liangli; Li, Yin; Hu, Peng; Teng, Christina T


    ERR (oestrogen-related receptor)-alpha modulates the oestrogen signalling pathway and regulates genes participating in the physiological energy balance programme. Oestrogen and PGC-1alpha (peroxisome proliferator-activated receptor-gamma coactivator-1alpha), the master regulator of the energy homoeostasis programme, both regulate the expression of ERRalpha through the MHRE (multi-hormone response element) of the ERRalpha gene. Although the molecular mechanism of oestrogen action on ERRalpha regulation is well characterized, the mechanism of PGC-1alpha induction is unclear. In this study, we examine chromatin structural changes and protein interactions at the MHRE nucleosome in response to PGC-1alpha expression in HK2 human kidney cells. We mapped the nucleosome positions of the ERRalpha gene promoter and examined the changes of histone acetylation in response to PGC-1alpha expression. The interactions of DNA-binding proteins, ERRalpha and ERRgamma, co-activators {CBP [CREB (cAMP-response-element-binding protein)-binding protein], p300, PCAF (p300/CBP-associated factor)}, co-repressor [RIP140 (receptor-interacting protein of 140 kDa)] and RNA polymerase II at the MHRE nucleosome region were investigated over time before and after PGC-1alpha expression in the HK2 cells. We found a dynamic cyclic interaction of these proteins shortly after PGC-1alpha expression and a slower cycling interaction, with fewer proteins involved, 20 h later. By using the siRNA (small interfering RNA) knockdown approach, we discovered that ERRgamma was involved in the initial phase, but not in the later phase, of PGC-1alpha-induced ERRalpha expression. PMID:18673300

  3. alpha-decay half-lives of superheavy elements with the Dirac-Brueckner-Hartree-Fock (DBHF) nucleon effective interaction

    SciTech Connect

    Zhang Dida; Ma Zhongyu; Chen Baoqiu; Shen Shuifa


    The nucleon effective interaction is calculated in the framework of the Dirac-Brueckner-Hartree-Fock approach, which has been illustrated to reproduce well the ground-state properties and the experimental data of proton and alpha particle scattering off nuclei. The nuclear potential of the alpha-nucleus is obtained by doubly folding the nucleon effective interaction with respect to the density distributions of both the alpha particle and daughter nucleus. We apply this new nuclear potential of the alpha-nucleus to investigate the alpha-decay half-lives of superheavy elements in the preformed cluster model along with the experimental decay energies Q{sub exp}. Good agreement with the experimental data is achieved. We also systematically calculate the alpha-decay half-lives for 19 isotope chains (Z=102-120) in this framework using the theoretical alpha-decay energies Q{sub th} extracted from the Moeller-Nix-Kratz mass table. The predicted results are compared with those obtained by using the same Q{sub th} but the nuclear potentials evaluated with M3Y effective interaction and also with the results calculated in the empirical formulas of the Viola-Seaberg-Sobiczewski formula.

  4. Aleurone nuclear proteins bind to similar elements in the promoter regions of two gibberellin-regulated alpha-amylase genes.


    Rushton, P J; Hooley, R; Lazarus, C M


    Binding of nuclear proteins from wild oat aleurone protoplasts to the promoter regions of two gibberellin-regulated wheat alpha-amylase genes (alpha-Amy1/18 and alpha-Amy2/54) has been studied by gel retardation and DNase 1 footprinting. Gel retardation studies using 300-430 bp fragments of the promoters showed similar binding characteristics with nuclear extracts from both gibberellin A1-treated and untreated protoplasts. DNase 1 footprints localised binding of nuclear proteins from gibberellin A1-treated aleurone protoplasts to regions in both promoters. Similar sequence elements in the promoter regions of both genes were protected from digestion although the location and number of footprints in each promoter region were different. Each footprint contained either a sequence similar to the cAMP and/or phorbol ester response elements, or a hyphenated palindrome sequence. The presence of cAMP and/or phorbol ester response element-like sequences in the footprints suggests that transcription factors of the bZIP type may be involved in the expression of alpha-amylase genes in aleurone cells. Footprints containing hyphenated palindrome sequences, found in the promoter regions of both genes, suggest the possible involvement of other classes of transcription factor. The conserved alpha-amylase promoter sequence TAA-CAGA was also shown to bind nuclear protein in the alpha-Amy2/54 promoter. These observations are discussed in relation to alpha-amylase gene expression in aleurone and to functional data concerning these genes. PMID:1511135

  5. Haemophilus influenzae serotype B (Hib) seroprevalence in England and Wales in 2009.


    Ladhani, Sn; Ramsay, Me; Flood, Js; Campbell, H; Slack, Mp; Pebody, R; Findlow, J; Newton, E; Wilding, M; Warrington, R; Crawford, H; Min, Sy; Gray, K; Martin, S; Frankland, S; Bokuvha, N; Laher, G; Borrow, R


    A national seroprevalence study was performed to determine the prevalence of Haemophilus influenzae type b (Hib) antibodies in England and Wales in 2009, when Hib disease incidence was the lowest ever recorded. A total of 2,693 anonymised residual sera from routine diagnostic testing submitted by participating National Health Service hospital laboratories were tested for Hib anti-polyribosyl-ribitol phosphate (PRP) IgG antibodies using a fluorescent bead assay. Median anti-PRP IgG concentrations were highest in toddlers aged 1–4 years (2.65 μg/ml), followed by children aged 5–9 years (1.95 μg/ml). Antibody concentrations were significantly lower after this age, but were still significantly higher among 10–19 year-olds (0.54 μg/ml) compared with adults aged >20 years (0.16 μg/ ml; p<0.0001). Half of the adults (51%) did not have Hib antibody concentrations ≥0.15 μg/ml, the level considered to confer short-term protection. Thus, the current excellent Hib control appears to be the result of high anti-PRP antibody concentrations in children aged up to 10 years, achieved through the various childhood vaccination campaigns offering booster immunisation. The lack of seroprotection in adults emphasises the importance of maintaining control of the disease and, most probably carriage, in children, therefore raising the question as to whether long-term routine boosting of either pre-school children or adolescents may be required. PMID:23171823

  6. Global reduction of Hib disease: what are the next steps? Proceedings of the meeting Scottsdale, Arizona, September 22-25, 2002.


    Watt, James P; Levine, Orin S; Santosham, Mathuram


    On September 22 to 25, 2002, a group of infectious disease specialists, public health officials, and vaccine experts from 33 countries gathered in Scottsdale, Arizona, to discuss the epidemiology and control of disease caused by Haemophilus influenzae type b (Hib) in the era of Hib conjugate vaccines. This supplement is a synthesis of the major themes and key lessons identified at the meeting. The objectives of the conference were to review the 10-year experience with Hib conjugate vaccines, discuss strategies to reduce Hib disease rates to lowest possible levels in industrialized countries, review impediments to the introduction of Hib vaccine in developing countries, and discuss strategies for disseminating lessons learned from countries using to those not using Hib conjugate vaccines. Over 10 years of international experience with Hib conjugate vaccines has demonstrated that they are safe and effective. Routine use of Hib conjugate vaccine has consistently led to decreases in the incidence of invasive Hib disease of 90% or more across a wide range of epidemiologic situations in industrialized countries. In some countries, the vaccine has caused a near-disappearance of invasive Hib disease through a combination of direct protection and herd immunity. Developing countries that have implemented routine vaccination (eg, The Gambia, Chile) have also had substantial disease reduction. In countries where Hib conjugate vaccine is being used, reducing Hib disease incidence to the lowest possible level will depend on maintaining high vaccine coverage levels, conducting surveillance for Hib disease, and investigating Hib disease cases. The optimal Hib vaccination strategy will depend on many factors, including local epidemiology and programmatic considerations. In countries that are not using Hib conjugate vaccine, information on the local burden of Hib disease will be essential for leaders considering vaccine introduction. Where disease burden is high, a multifaceted


    SciTech Connect

    Becker, George D.; Carswell, Robert F.; Sargent, Wallace L. W.; Rauch, Michael E-mail: E-mail:


    We present measurements of carbon, oxygen, silicon, and iron in quasar absorption systems existing when the universe was roughly one billion years old. We measure column densities in nine low-ionization systems at 4.7 < z < 6.3 using Keck, Magellan, and Very Large Telescope optical and near-infrared spectra with moderate to high resolution. The column density ratios among C II, O I, Si II, and Fe II are nearly identical to sub-damped Ly{alpha} systems (sub-DLAs) and metal-poor ([M/H] {<=} -1) DLAs at lower redshifts, with no significant evolution over 2 {approx}< z {approx}< 6. The estimated intrinsic scatter in the ratio of any two elements is also small, with a typical rms deviation of {approx}< 0.1 dex. These facts suggest that dust depletion and ionization effects are minimal in our z > 4.7 systems, as in the lower-redshift DLAs, and that the column density ratios are close to the intrinsic relative element abundances. The abundances in our z > 4.7 systems are therefore likely to represent the typical integrated yields from stellar populations within the first gigayear of cosmic history. Due to the time limit imposed by the age of the universe at these redshifts, our measurements thus place direct constraints on the metal production of massive stars, including iron yields of prompt supernovae. The lack of redshift evolution further suggests that the metal inventories of most metal-poor absorption systems at z {approx}> 2 are also dominated by massive stars, with minimal contributions from delayed Type Ia supernovae or winds from asymptotic giant branch stars. The relative abundances in our systems broadly agree with those in very metal-poor, non-carbon-enhanced Galactic halo stars. This is consistent with the picture in which present-day metal-poor stars were potentially formed as early as one billion years after the big bang.

  8. Catalytic oxidation of elemental mercury over the modified catalyst Mn/alpha-Al2O3 at lower temperatures.


    Li, Jianfeng; Yan, Naiqiang; Qu, Zan; Qiao, Shaohua; Yang, Shijian; Guo, Yongfu; Liu, Ping; Jia, Jinping


    In order to facilitate the removal of elemental mercury (Hg(0)) from coal-fired flue gas, catalytic oxidation of Hg(0) with manganese oxides supported on inert alumina (alpha-Al2O3) was investigated at lower temperatures (373-473 K). To improve the catalytic activity and the sulfur-tolerance of the catalysts at lower temperatures, several metal elements were employed as dopants to modify the catalyst of Mn/alpha-Al2O3. The best performance among the tested elements was achieved with molybdenum (Mo) as the dopant in the catalysts. It can work even better than the noble metal catalyst Pd/alpha-Al2O3. Additionally, the Mo doped catalyst displayed excellent sulfur-tolerance performance at lower temperatures, and the catalytic oxidation efficiency for Mo(0.03)-Mn/alpha-Al2O3 was over 95% in the presence of 500 ppm SO2 versus only about 48% for the unmodified catalyst. The apparent catalytic reaction rate constant increased by approximately 5.5 times at 423 K. In addition, the possible mechanisms involved in Hg(0) oxidation and the reaction with the Mo modified catalyst have been discussed. PMID:19950921

  9. Regulatory elements in the first intron contribute to transcriptional control of the human. cap alpha. 1(I) collagen gene

    SciTech Connect

    Bornstein, P.; McKay, J.; Morishima, J.K.; Devarayalu, S.; Gelinas, R.E.


    Several lines of evidence have suggested that the regulation of type I collagen gene transcription is complex and that important regulatory elements reside 5' to, and within, the first intron of the ..cap alpha..1(I) gene. The authors therefore sequenced a 2.3-kilobase HindIII fragment that encompasses 804 base pairs of 5' flanking sequence, the first exon, and most of the first intron of the ..cap alpha..1(I) human collagen gene. A 274-base-pair intronic sequence, flanked by Ava I sites (A274), contained a sequence identical to a high-affinity decanucleotide binding site for transcription factor Sp1 and a viral core enhancer sequence. DNase I protection experiments indicated zones of protection that corresponded to these motifs. When A274 was cloned 5' to the chloramphenicol acetyltransferase (CAT) gene, driven by an ..cap alpha..1(I) collagen promoter sequence, and expression was assessed by transfection, significant orientation-specific inhibition of CAT activity was observed. This effect was most apparent in chicken tendon fibroblasts, which modulate their level of collagen synthesis in culture. They propose that normal regulation of ..cap alpha..1(I) collagen gene transcription results from an interplay of positive and negative elements present in the promoter region and within the first intron.

  10. Immunological persistence in 5 y olds previously vaccinated with hexavalent DTPa-HBV-IPV/Hib at 3, 5, and 11 months of age.


    Silfverdal, Sven A; Assudani, Deepak; Kuriyakose, Sherine; Van Der Meeren, Olivier


    The combined diphtheria-tetanus-acellular pertussis-hepatitis B-poliomyelitis/Haemophilus influenza vaccine (DTPa-HBV-IPV/Hib: Infanrix™ hexa, GlaxoSmithKline Vaccines) is used for primary vaccination of infants in a range of schedules world-wide. Antibody persistence after 4 DTPa-HBV-IPV/Hib doses in the first 2 y of life has been documented, but long-term persistence data following the 3, 5, 11-12 months (3-5-11) infant vaccination schedule, employed for example in Nordic countries, are limited. We assessed antibody persistence in 57 5-year-old children who had received either DTPa-HBV-IPV/Hib or DTPa-IPV/Hib (Infanrix™-IPV/Hib, GlaxoSmithKline Vaccines) in the 3-5-11 schedule. Among DTPa-HBV-IPV/Hib recipients, 7/12 retained seroprotective antibody concentrations for diphtheria, 10/12 for tetanus, 5/12 for hepatitis and 10/12 for Hib. Detectable antibodies were observed for 0/12 children for pertussis toxin (PT), 12/12 for filamentous haemagglutinin (FHA) and 8/12 for pertactin (PRN). Among DTPa-IPV/Hib recipients, 28/45 retained seroprotective anti-diphtheria concentrations, 34/44 for tetanus and 40/45 for Hib. Detectable antibodies were observed for 9/45 children for PT, 41/45 for FHA and 34/45 for PRN. Antibody persistence in DTPa-HBV-IPV/Hib and DTPa-IPV/Hib-vaccinees appeared similar in 5 y olds to that previously observed in children of a similar age who had received 4 prior doses of DTPa-HBV-IPV/Hib (or DTPa-IPV/Hib). As in subjects primed with 4 prior doses, we observed that antibodies markedly declined by 5 y of age, calling for the administration of a pre-school booster dose in order to ensure continued protection against pertussis. PMID:25483640

  11. Anti-lymphoproliferative activity of alpha-2-macroglobulin in the plasma of hibernating 13-lined ground squirrels and woodchucks.


    Sieckmann, Donna G; Jaffe, Howard; Golech, Susanne; Cai, DeCheng; Hallenbeck, John M; McCarron, Richard M


    Plasma from hibernating (HIB) woodchucks (Marmota monax) or 13-lined ground squirrels (Ictidomys tridecemlineatus) suppressed (3)H-thymidine uptake in mouse spleen cell cultures stimulated with Concanavalin A (ConA); plasma from non-hibernating animals were only slightly inhibitory. Maximum inhibition occurred when HIB plasma was added to the cultures prior to ConA. After HPLC size exclusion chromatography of the HIB ground squirrel plasma, a single fraction (fraction-14) demonstrated inhibitory activity. Assay of fraction-14 from 8 HIB squirrels showed inhibition ranging from 13 to 95%; inhibition was correlated to the time the squirrels were exposed to cold prior to hibernation. Western blot analysis showed the factor to be a large molecular weight protein (>300 kDa), and mass spectrometry identified sequences that were 100% homologous with alpha-2-macroglobulin from humans and other species. These findings indicate a hibernation-related protein that may be responsible for immune system down regulation. PMID:25113962

  12. Influence of a cap site element on tissue-restricted expression of the glycoprotein hormone alpha-subunit gene.


    Cox, G S; Xiong, W


    Little is known of the transcriptional regulators important for expression of the glycoprotein hormone alpha-subunit (GPHalpha) gene in nonendocrine tumors, which secrete free alpha-subunit at an incidence of 25-80%. Consequently, attempts were made to define cis-regulatory elements and their cognate trans-acting factors that modulate promoter activity in epithelial cell types that do not normally express the glycoprotein hormones. DNA-mediated transient expression of promoter-reporter constructs was used to identify a novel negative regulatory element located at the GPHalpha gene transcription start site. Mutagenesis of this element produced a 2- to 10-fold increase in promoter activity, depending on the particular mutation and the transfected tumor cell line. Electrophoretic mobility shift analysis detected a protein that binds specifically to a DNA motif encompassing the cap site. It was present at different levels in a variety of cell types. Significantly, the degree to which activity of the wild-type promoter was suppressed relative to that of the mutant promoter was proportional to the level of cap site binding protein in the collection of cell lines examined. These results indicate that a negative regulatory element centered at the GPHalpha gene cap site and its cognate DNA-binding protein make a significant contribution to the production of alpha-subunit in a variety of tumor tissues. A detailed understanding of this cis/trans pair may further suggest a mechanism to explain, at least in part, how this gene becomes activated in nonendocrine tumors. PMID:10403838

  13. A delta T-cell receptor deleting element transgenic reporter construct is rearranged in alpha beta but not gamma delta T-cell lineages.

    PubMed Central

    Shutter, J; Cain, J A; Ledbetter, S; Rogers, M D; Hockett, R D


    T cells can be divided into two groups on the basis of the expression of either alpha beta or gamma delta T-cell receptors (TCRs). Because the TCR delta chain locus lies within the larger TCR alpha chain locus, control of the utilization of these two receptors is important in T-cell development, specifically for determination of T-cell type: rearrangement of the alpha locus results in deletion of the delta coding segments and commitment to the alpha beta lineage. In the developing thymus, a relative site-specific recombination occurs by which the TCR delta chain gene segments are deleted. This deletion removes all D delta, J delta, and C delta genes and occurs on both alleles. This delta deletional mechanism is evolutionarily conserved between mice and humans. Transgenic mice which contain the human delta deleting elements and as much internal TCR delta chain coding sequence as possible without allowing the formation of a complete delta chain gene were developed. Several transgenic lines showing recombinations between deleting elements within the transgene were developed. These lines demonstrate that utilization of the delta deleting elements occurs in alpha beta T cells of the spleen and thymus. These recombinations are rare in the gamma delta population, indicating that the machinery for utilization of delta deleting elements is functional in alpha beta T cells but absent in gamma delta T cells. Furthermore, a discrete population of early thymocytes containing delta deleting element recombinations but not V alpha-to-J alpha rearrangements has been identified. These data are consistent with a model in which delta deletion contributes to the implementation of a signal by which the TCR alpha chain locus is rearranged and expressed and thus becomes an alpha beta T cell. PMID:8524269

  14. Development of an alpha scattering instrument for heavy element detection in surface materials

    NASA Technical Reports Server (NTRS)

    Turkevich, A. L.; Economou, T.; Blume, E.; Anderson, W.


    The development and characteristics of a portable instrument for detecting and measuring the amounts of lead in painted surfaces are discussed. The instrument is based on the ones used with the alpha scattering experiment on the Surveyor lunar missions. The principles underlying the instrument are described. It is stated that the performance tests of the instrument were satisfactory.


    SciTech Connect

    Vargas, Luis C.; Geha, Marla; Kirby, Evan N.; Simon, Joshua D.


    The Milky Way ultra-faint dwarf (UFD) galaxies contain some of the oldest, most metal-poor stars in the universe. We present [Mg/Fe], [Si/Fe], [Ca/Fe], [Ti/Fe], and mean [{alpha}/Fe] abundance ratios for 61 individual red giant branch stars across eight UFDs. This is the largest sample of alpha abundances published to date in galaxies with absolute magnitudes M{sub V} > -8, including the first measurements for Segue 1, Canes Venatici II, Ursa Major I, and Leo T. Abundances were determined via medium-resolution Keck/DEIMOS spectroscopy and spectral synthesis. The sample spans the metallicity range -3.4 <[Fe/H] < -1.1. With the possible exception of Segue 1 and Ursa Major II, the individual UFDs show on average lower [{alpha}/Fe] at higher metallicities, consistent with enrichment from Type Ia supernovae. Thus, even the faintest galaxies have undergone at least a limited level of chemical self-enrichment. Together with recent photometric studies, this suggests that star formation in the UFDs was not a single burst, but instead lasted at least as much as the minimum time delay of the onset of Type Ia supernovae ({approx}100 Myr) and less than {approx}2 Gyr. We further show that the combined population of UFDs has an [{alpha}/Fe] abundance pattern that is inconsistent with a flat, Galactic halo-like alpha abundance trend, and is also qualitatively different from that of the more luminous CVn I dSph, which does show a hint of a plateau at very low [Fe/H].

  16. Concomitant use of VAQTA with PedvaxHIB and Infanrix in 12 to 17 month old children.


    Petrecz, Maria; Ramsey, Keith P; Stek, Jon E; Martin, Jason C; Klopfer, Stephanie O; Kuter, Barbara; Schödel, Florian P; Lee, Andrew W


    Open-label, multicenter, randomized study (NCT00289913) evaluated immunogenicity, safety, and tolerability of Vaqta (hepatitis A vaccine) administered with PedvaxHIB (Haemophilus b conjugate vaccine [Meningococcal protein conjugate]) & Infanrix (diphtheria/tetanus/acellular pertussis vaccine) in healthy, 15-month-old children. Five groups were evaluated: Group 1 received Vaqta/Infanrix PedvaxHIB on Day-1 and Vaqta at Week-24; Group 2 received Infanrix PedvaxHIB on Day-1, Vaqta at Week-4, and Vaqta at Week-28; Group 3 received Vaqta/PedvaxHIB on Day-1 and Vaqta Week-24; Group 4 received PedvaxHIB on Day-1, Vaqta at Week-4, and Vaqta at Week-28; and Group 5 (safety only) received Vaqta on Day-1 and Vaqta at Week-24. Hepatitis A seropositivity rate (SPR: ≥10 mIU/mL), Hib capsular polyribosylribitol phosphate (PRP) antibody response (>1.0 μg/mL), and geometric mean titers (GMT) to pertussis toxin (PT), pertussis filamentous hemagglutinin antibody (FHA), and pertactin were examined. Non-inferiority statistical criteria required a difference >10% in Hepatitis A SPR, PRP >1.0 μg/mL, and a GMT ratio of >0.67 for pertussis antigens. Injection-site and systemic adverse events (AEs) and daily temperatures were collected. Hepatitis A SPRs were 100% for Groups 1-4, regardless of initial serostatus. Anti-PRP titers were comparable (98.1% - 97.0%) for Groups 1-4. GMT and mean fold-rise were comparable for all 3 pertussis antigen components between concomitant and nonconcomitant groups. Criteria for non-inferiority of immune responses for concomitant vs nonconcomitant administration were met for Hepatitis A, Hib, and pertussis antigens. No statistically significant incidence differences of individual AEs were found between concomitant and nonconcomitant groups. No serious vaccine-related AEs or deaths were reported; no subject discontinued due to an AE. Immune responses to Vaqta, PedvaxHIB, and Infanrix given concomitantly were non-inferior to nonconcomitant responses. Vaqta

  17. ''Magic'' Energies for Detecting Light Elements with Resonant Alpha Particle Backscattering

    SciTech Connect

    Wetteland, C.J.; Maggiore, C.J.; Tesmer, J.R.; He, X-M.; Lee, D-H.


    Resonant backscattering is widely used to improve the detection limit of the light elements such as B, C, N and O. One disadvantage, however, is that several incident energies are normally needed if the sample contains a number of the light elements. There are ''magic'' energies at which several light elements can be detected simultaneously with suitable sensitivities. When these energies are used along with the elastic recoil detection of hydrogen, multiple elements can be detected without changing the beam energy, and the analysis time is greatly reduced. These reactions along with examples will be discussed.

  18. Enhancer and promoter elements directing activation and glucocorticoid repression of the. cap alpha. /sub 1/-fetoprotein gene in hepatocytes

    SciTech Connect

    Guertin, M.; La Rue, H.; Bernier, D.; Wrange, O.; Chevrette, M.; Gingras, M.C.; Belanger, L.


    Mutations were introduced in 7 kilobases of 5'-flanking rat ..cap alpha../sub 1/-fetoprotein (AFP) genomic DNA, linked to the chloramphenicol acetyltransferase gene. AFP promoter activity and its repression by a glucocorticoid hormone were assessed by stable and transient expression assays. Stable transfection assays were more sensitive and accurate than transient expression assays in a Morris 7777 rat hepatoma recipient (Hepa7.6), selected for its strong AFP repression by dexamethasone. The segment of DNA encompassing a hepatocyte-constitutive chromatin DNase I-hypersensitive site at -3.7 kilobases and a liver developmental stage-specific site at -2.5 kilobases contains interacting enhancer elements sufficient for high AFP promoter activity in Hepa7.6 or HepG2 cells. Deletions and point mutations define an upstream promoter domain of AFP gene activation, operating with at least three distinct promoter-activating elements, PEI at -65 base pairs, PEII at -120 base pairs, and DE at -160 base pairs. PEI and PEII share homologies with albumin promoter sequences, PEII is a near-consensus nuclear factor I recognition sequence, and DE overlaps a glucocorticoid receptor recognition sequence. An element conferring glucocorticoid repression of AFP gene activity is located in the upstream AFP promoter domain. Receptor-binding assays indicate that this element is the glucocorticoid receptor recognition sequence which overlaps with promoter-activating element DE.

  19. Use of 4.7 MeV alpha particles in elemental analysis and fusion reactor materials studies

    NASA Astrophysics Data System (ADS)

    Constantinescu, B.; Dima, S.; Florescu, V.; Ivanov, E. A.; Ploştinaru, D.; Sârbu, C.


    The possibilities for using 4.7 MeV alpha particles produced at the U-120 CIP Cyclotron for charged particle induced X- and gamma-ray emission applications (PIXE and PIGE, respectively) and for fast neutron radiation damage simulation are presented. The combined analysis using PIGE and PIXE methods either separately or simultaneously is an excellent means of determining the relative abundances of lighter elements with gamma-ray spectra and of heavier elements ( Z ⩾ 16) with X-ray spectra. Some aspects of surface deformation effects by neutrons were simulated by means of medium-energy helium ions. An investigation of three types of commercial stainless steel (Romanian W 4016, Soviet 12KH18N10T and Japanese W 4541) was started using 3.0 [1], 4.7 and 6.8 MeV helium ions. The main post-irradiation effects observed are discussed.

  20. A comparative clinical study to assess safety and reactogenicity of a DTwP-HepB+Hib vaccine

    PubMed Central

    Dalvi, Shashank; Kulkarni, Prasad S; Phadke, MA; More, SS; Lalwani, Sanjay K; Jain, Dipty; Manglani, Mamta; Garg, BS; Doibale, Mohan K; Deshmukh, CT; Author Group, SIIL DTwP-HepB+Hib


    Hepatitis B and Haemophilus influenzae type b (Hib) infections are major public health problems in developing countries, including India. Hence, combination vaccines containing DTwP, recombinant hepatitis B and Hib conjugate vaccines have been developed. Here, we report a Phase IV study which assessed safety and reactogenicity of a new DTwP-HepB+Hib vaccine. Three doses of DTwP-HepB+Hib vaccine (Pentavac, Serum Institute of India Ltd) or Tritanrix-HB+Hib (GlaxoSmithKline Beecham) were administered to infants at 6, 10 and 14 weeks of age in 2:1 ratio. The subjects were followed till one month after the third dose for safety assessment. Adverse events were captured in structured diaries and physical examinations were performed on each visit. The study was conducted in 1510 infants. Both vaccines caused injection site local and systemic reactions and the incidence was similar in both the groups. The incidence of local solicited reactions was: tenderness 35.9 %–33.6 %; redness 18.1 %–17.2 %; swelling 23.7 %–22.4 %; induration 12.8 % –13.7 %. The percentage of systemic solicited reactions were: diarrhea 2.2 %–2.2 %; drowsiness 3.3 %–3.4 %; fever 14.0 %–11.2 %; irritability 28.1 %–25.4 %; loss of appetite 6.6 %–5.6 %; persistent crying 17.7 %–15.7 %; vomiting 3.5 %–3.0 %. No serious adverse event was caused by the vaccines. The new DTwP-HepB+Hib combination vaccine showed similar safety profile to that of an imported vaccine in Indian infants. PMID:25933183

  1. Evaluation of Haemophilus influenzae type b carrier status among children 10 years after the introduction of Hib vaccine in Brazil.


    Zanella, Rosemeire Cobo; Brandileone, Maria Cristina de Cunto; Andrade, Ana Lúcia; Ogassavara, Cinthya Terumi; Fiório, Cleiton Eduardo; Brandão, Angela Pires; Almeida, Samanta Cristine Grassi; Lemos, Ana Paula Silva; Gorla, Maria Cecília; Carvalhanas, Telma Regina; Sato, Helena; Liphaus, Bernadete; Nerger, Maria Lígia; Conde, Monica; Ribeiro, Ana Freitas


    The aim of the present study was to assess the prevalence of Haemophilus influenzae type b (Hib) nasopharyngeal (NP) colonisation among healthy children where Hib vaccination using a 3p+0 dosing schedule has been routinely administered for 10 years with sustained coverage (> 90%). NP swabs were collected from 2,558 children who had received the Hib vaccine, of whom 1,379 were 12-< 24 months (m) old and 1,179 were 48-< 60 m old. Hi strains were identified by molecular methods. Hi carriage prevalence was 45.1% (1,153/2,558) and the prevalence in the 12-< 24 m and 48-< 60 m age groups were 37.5% (517/1,379) and 53.9% (636/1,179), respectively. Hib was identified in 0.6% (16/2,558) of all children in the study, being 0.8% (11/1,379) and 0.4% (5/1,179) among the 12-< 24 m and 48-< 60 m age groups, respectively. The nonencapsulate Hi colonisation was 43% (n = 1,099) and was significantly more frequent at 48-< 60 m of age (51.6%, n = 608) compared with that at 12-< 24 m of age (35.6%, n = 491). The overall resistance rates to ampicillin and chloramphenicol were 16.5% and 3.7%, respectively; the co-resistance was detected in 2.6%. Our findings showed that the Hib carrier rate in healthy children under five years was very low after 10 years of the introduction of the Hib vaccine. PMID:26517654

  2. Characterization of a novel positive transcription regulatory element that differentially regulates the alpha-2-macroglobulin gene in replicative senescence.


    Li, Renzhong; Ma, Liwei; Huang, Yu; Zhang, Zongyu; Tong, Tanjun


    Alpha-2-macroglobulin (α2M), a protease inhibitor, is implicated in Alzheimer's disease, atherosclerosis, and other age-related diseases. The elevated level of α2M mRNA has been described in replicative senescence and it could be used as a biomarker of the aging cells. However, the mechanism responsible for the up-regulation of its expression is still unclear. This report identified a novel transcriptional regulatory element, the α2M transcription enhancement element (ATEE), within the α2M promoter. This element differentially activates α2M expression in senescent versus young fibroblasts. Electrophoretic mobility shift assays revealed abundant complexes in senescent cell nuclear extracts compared with young cell nuclear extracts. The DNase I footprint revealed the protein-binding core sequence through which the protein binds the ATEE. Mutation within ATEE selectively abolished α2M promoter activity in senescent (but not young) cells. These results indicated the ATEE, as a positive transcription regulatory element, contributes to the up-regulation of α2M during replicative senescence. PMID:21541797

  3. Expression of the glycoprotein hormone alpha-subunit gene in the placenta requires a functional cyclic AMP response element, whereas a different cis-acting element mediates pituitary-specific expression.

    PubMed Central

    Bokar, J A; Keri, R A; Farmerie, T A; Fenstermaker, R A; Andersen, B; Hamernik, D L; Yun, J; Wagner, T; Nilson, J H


    The single-copy gene encoding the alpha subunit of glycoprotein hormones is expressed in the pituitaries of all mammals and in the placentas of only primates and horses. We have systematically analyzed the promoter-regulatory elements of the human and bovine alpha-subunit genes to elucidate the molecular mechanisms underlying their divergent patterns of tissue-specific expression. This analysis entailed the use of transient expression assays in a chorionic gonadotropin-secreting human choriocarcinoma cell line, protein-DNA binding assays, and expression of chimeric forms of human or bovine alpha subunit genes in transgenic mice. From the results, we conclude that placental expression of the human alpha-subunit gene requires a functional cyclic AMP response element (CRE) that is present as a tandem repeat in the promoter-regulatory region. In contrast, the promoter-regulatory region of the bovine alpha-subunit gene, as well as of the rat and mouse genes, was found to contain a single CRE homolog that differed from its human counterpart by a single nucleotide. This difference substantially reduced the binding affinity of the bovine CRE homolog for the nuclear protein that bound to the human alpha CRE and thereby rendered the bovine alpha-subunit promoter inactive in human choriocarcinoma cells. However, conversion of the bovine alpha CRE homolog to an authentic alpha CRE restored activity to the bovine alpha-subunit promoter in choriocarcinoma cells. Similarly, a human but not a bovine alpha transgene was expressed in placenta in transgenic mice. Thus, placenta-specific expression of the human alpha-subunit gene may be the consequence of the recent evolution of a functional CRE. Expression of the human alpha transgene in mouse placenta further suggests that evolution of placenta-specific trans-acting factors preceded the appearance of this element. Finally, in contrast to their divergent patterns of placental expression, both the human and bovine alpha

  4. The Detailed Chemical Properties of M31 Star Clusters. I. Fe, Alpha and Light Elements

    NASA Astrophysics Data System (ADS)

    Colucci, Janet E.; Bernstein, Rebecca A.; Cohen, Judith G.


    We present ages, [Fe/H] and abundances of the α elements Ca I, Si I, Ti I, Ti II, and light elements Mg I, Na I, and Al I for 31 globular clusters (GCs) in M31, which were obtained from high-resolution, high signal-to-noise ratio >60 echelle spectra of their integrated light (IL). All abundances and ages are obtained using our original technique for high-resolution IL abundance analysis of GCs. This sample provides a never before seen picture of the chemical history of M31. The GCs are dispersed throughout the inner and outer halo, from 2.5 kpc < R M31 < 117 kpc. We find a range of [Fe/H] within 20 kpc of the center of M31, and a constant [Fe/H] ~ - 1.6 for the outer halo clusters. We find evidence for at least one massive GC in M31 with an age between 1 and 5 Gyr. The α-element ratios are generally similar to the Milky Way GC and field star ratios. We also find chemical evidence for a late-time accretion origin for at least one cluster, which has a different abundance pattern than other clusters at similar metallicity. We find evidence for star-to-star abundance variations in Mg, Na, and Al in the GCs in our sample, and find correlations of Ca, Mg, Na, and possibly Al abundance ratios with cluster luminosity and velocity dispersion, which can potentially be used to constrain GC self-enrichment scenarios. Data presented here were obtained with the HIRES echelle spectrograph on the Keck I telescope. The data presented herein were obtained at the W. M. Keck Observatory, which is operated as a scientific partnership among the California Institute of Technology, the University of California and the National Aeronautics and Space Administration. The Observatory was made possible by the generous financial support of the W. M. Keck Foundation.


    SciTech Connect

    Colucci, Janet E.; Bernstein, Rebecca A.; Cohen, Judith G.


    We present ages, [Fe/H] and abundances of the α elements Ca I, Si I, Ti I, Ti II, and light elements Mg I, Na I, and Al I for 31 globular clusters (GCs) in M31, which were obtained from high-resolution, high signal-to-noise ratio >60 echelle spectra of their integrated light (IL). All abundances and ages are obtained using our original technique for high-resolution IL abundance analysis of GCs. This sample provides a never before seen picture of the chemical history of M31. The GCs are dispersed throughout the inner and outer halo, from 2.5 kpc < R {sub M31} < 117 kpc. We find a range of [Fe/H] within 20 kpc of the center of M31, and a constant [Fe/H] ∼ – 1.6 for the outer halo clusters. We find evidence for at least one massive GC in M31 with an age between 1 and 5 Gyr. The α-element ratios are generally similar to the Milky Way GC and field star ratios. We also find chemical evidence for a late-time accretion origin for at least one cluster, which has a different abundance pattern than other clusters at similar metallicity. We find evidence for star-to-star abundance variations in Mg, Na, and Al in the GCs in our sample, and find correlations of Ca, Mg, Na, and possibly Al abundance ratios with cluster luminosity and velocity dispersion, which can potentially be used to constrain GC self-enrichment scenarios. Data presented here were obtained with the HIRES echelle spectrograph on the Keck I telescope.

  6. Light, Alpha, and Fe-peak Element Abundances in the Galactic Bulge

    NASA Astrophysics Data System (ADS)

    Johnson, Christian I.; Rich, R. Michael; Kobayashi, Chiaki; Kunder, Andrea; Koch, Andreas


    We present radial velocities and chemical abundances of O, Na, Mg, Al, Si, Ca, Cr, Fe, Co, Ni, and Cu for a sample of 156 red giant branch stars in two Galactic bulge fields centered near (l, b) = (+5.25,-3.02) and (0,-12). The (+5.25,-3.02) field also includes observations of the bulge globular cluster NGC 6553. The results are based on high-resolution (R ~ 20,000), high signal-to-noise ration (S/N >~ 70) FLAMES-GIRAFFE spectra obtained through the European Southern Observatory archive. However, we only selected a subset of the original observations that included spectra with both high S/N and that did not show strong TiO absorption bands. This work extends previous analyses of this data set beyond Fe and the α-elements Mg, Si, Ca, and Ti. While we find reasonable agreement with past work, the data presented here indicate that the bulge may exhibit a different chemical composition than the local thick disk, especially at [Fe/H] >~ -0.5. In particular, the bulge [α/Fe] ratios may remain enhanced to a slightly higher [Fe/H] than the thick disk, and the Fe-peak elements Co, Ni, and Cu appear enhanced compared to the disk. There is also some evidence that the [Na/Fe] (but not [Al/Fe]) trends between the bulge and local disk may be different at low and high metallicity. We also find that the velocity dispersion decreases as a function of increasing [Fe/H] for both fields, and do not detect any significant cold, high-velocity populations. A comparison with chemical enrichment models indicates that a significant fraction of hypernovae may be required to explain the bulge abundance trends, and that initial mass functions that are steep, top-heavy (and do not include strong outflow), or truncated to avoid including contributions from stars >40 M ⊙ are ruled out, in particular because of disagreement with the Fe-peak abundance data. For most elements, the NGC 6553 stars exhibit abundance trends nearly identical to comparable metallicity bulge field stars. However, the

  7. Light, alpha, and Fe-peak element abundances in the galactic bulge

    SciTech Connect

    Johnson, Christian I.; Rich, R. Michael; Kobayashi, Chiaki; Kunder, Andrea; Koch, Andreas E-mail: E-mail:


    We present radial velocities and chemical abundances of O, Na, Mg, Al, Si, Ca, Cr, Fe, Co, Ni, and Cu for a sample of 156 red giant branch stars in two Galactic bulge fields centered near (l, b) = (+5.25,–3.02) and (0,–12). The (+5.25,–3.02) field also includes observations of the bulge globular cluster NGC 6553. The results are based on high-resolution (R ∼ 20,000), high signal-to-noise ration (S/N ≳ 70) FLAMES-GIRAFFE spectra obtained through the European Southern Observatory archive. However, we only selected a subset of the original observations that included spectra with both high S/N and that did not show strong TiO absorption bands. This work extends previous analyses of this data set beyond Fe and the α-elements Mg, Si, Ca, and Ti. While we find reasonable agreement with past work, the data presented here indicate that the bulge may exhibit a different chemical composition than the local thick disk, especially at [Fe/H] ≳ –0.5. In particular, the bulge [α/Fe] ratios may remain enhanced to a slightly higher [Fe/H] than the thick disk, and the Fe-peak elements Co, Ni, and Cu appear enhanced compared to the disk. There is also some evidence that the [Na/Fe] (but not [Al/Fe]) trends between the bulge and local disk may be different at low and high metallicity. We also find that the velocity dispersion decreases as a function of increasing [Fe/H] for both fields, and do not detect any significant cold, high-velocity populations. A comparison with chemical enrichment models indicates that a significant fraction of hypernovae may be required to explain the bulge abundance trends, and that initial mass functions that are steep, top-heavy (and do not include strong outflow), or truncated to avoid including contributions from stars >40 M {sub ☉} are ruled out, in particular because of disagreement with the Fe-peak abundance data. For most elements, the NGC 6553 stars exhibit abundance trends nearly identical to comparable metallicity bulge field

  8. Cyclic AMP regulation of the human glycoprotein hormone. cap alpha. -subunit gene is mediated by an 18-base-pair element

    SciTech Connect

    Silver, B.J.; Bokar, J.A.; Virgin, J.B.; Vallen, E.A.; Milsted, A.; Nilson, J.H.


    cAMP regulates transcription of the gene encoding the ..cap alpha..-subunit of human chorionic gonadotropin (hCG) in the choriocarcinoma cells (BeWo). To define the sequences required for regulation by cAMP, the authors inserted fragments from the 5' flanking region of the ..cap alpha..-subunit gene into a test vector containing the simian virus 40 early promoter (devoid of its enhancer) linked to the bacterial chloramphenicol acetyltransferase (CAT) gene. Results from transient expression assays in BeWo cells indicated that a 1500-base-pair (bp) fragment conferred cAMP responsiveness on the CAT gene regardless of position or orientation of the insert relative to the viral promoter. A subfragment extending from position -169 to position -100 had the same effect on cAMP-induced expression. Furthermore, the entire stimulatory effect could be achieved with an 18-bp synthetic oligodeoxynucleotide corresponding to a direct repeat between position -146 and -111. In the absence of cAMP, the ..cap alpha..-subunit 5' flanking sequence also enhanced transcription from the simian virus 40 early promoter. They localized this enhancer activity to the same -169/-100 fragment containing the cAMP response element. The 18-bp element alone, however, had no effect on basal expression. Thus, this short DNA sequence serves as a cAMP response element and also functions independently of other promoter-regulatory elements located in the 5' flanking sequence of the ..cap alpha..-subunit gene.

  9. The SEGUE Stellar Parameter Pipeline and the alpha elements of stars in the Milky Way

    NASA Astrophysics Data System (ADS)

    Lee, Young Sun

    comparison of the color-magnitude diagrams with stellar evolution models; satisfactory agreement (s( T eff ) < 200 K and s(logg) <= 0.4 dex) is found. >From the above considerations it is concluded that the SSPP is able to determine radial velocities and atmospheric parameters for stars (in the range 4500 K <= T eff <= 7500 K) with sufficient accuracy and precision to enable detailed explorations of the chemical compositions and kinematics of the disk and halo populations of the Galaxy. A method for determining the abundance ratio of the a-elements (O, Mg, Si, Ca, Ti) with respect to Fe (collectively parameterized as "[a/Fe]") is also explored. Results of a comparison with the ELODIE spectral library and from a noise injection experiment suggest that an accuracy in [a/Fe] of about 0.1 dex for spectra with S/N > 20/1 is achievable. This technique is used to estimate [a/Fe] for a total of 39,167 spectrophotometric and telluric calibration stars from the most recent public release (DR-6; Adelman-McCarthy et al. 2008), in order to study the a-abundance patterns in stars of the Galactic halo. Local space velocities ( U, V, W ) and orbital parameters (such as Z max , R apo , R peri , V [straight phi] , and eccentricity) were calculated for this sample, and a total of 7590 potential halo stars were selected by applying cuts of V [straight phi] <= 80 km s -1 , Z max > 1 kpc, and [Fe/H] <= -1.0. Furthermore, the sample was divided into two groups: a "dissipative component (or inner halo)" with stars having 40 <= V [straight phi] <= 80 km s -1 and R apo< 16 kpc and an "accreted component (or outer halo)" with stars having V [straight phi] < 40 km s -1 or R apo >= 16 kpc, or both. Results for the comparison of these two samples are presented as a first step toward understanding the assembly history of the halos of the Galaxy.

  10. Regulated tissue-specific alternative splicing of enhanced green fluorescent protein transgenes conferred by alpha-tropomyosin regulatory elements in transgenic mice.


    Ellis, Peter D; Smith, Christopher W J; Kemp, Paul


    The mutually exclusive exons 2 and 3 of alpha-tropomyosin (alphaTM) have been used as a model system for strictly regulated alternative splicing. Exon 2 inclusion is only observed at high levels in smooth muscle (SM) tissues, whereas striated muscle and non-muscle cells use predominantly exon 3. Experiments in cell culture have shown that exon 2 selection results from repression of exon 3 and that this repression is mediated by regulatory elements flanking exon 3. We have now tested the cell culture-derived model in transgenic mice. We show that by harnessing the intronic splicing regulatory elements, expression of an enhanced green fluorescent protein transgene with a constitutively active promoter can be restricted to SM cells. Splicing of both endogenous alphaTM and a series of transgenes carrying regulatory element mutations was analyzed by reverse transcriptasePCR. These studies indicated that although SM-rich tissues are equipped to regulate splicing of high levels of endogenous or transgene alphaTM RNA, other non-SM tissues such as spleen, which express lower amounts of alphaTM, also splice significant proportions of exon 2, and this splicing pattern can be recapitulated by transgenes expressed at low levels. We confirm the importance in vivo of the negatively acting regulatory elements for regulated skipping of exon 3. Moreover, we provide evidence that some of the regulatory factors responsible for exon 3 skipping appear to be titratable, with loss of regulated splicing sometimes being associated with high transgene expression levels. PMID:15194683

  11. Fully liquid DTaP-IPV-Hib pediatric combination vaccine (Pediacel): a review of 18 years of clinical experience.


    Reynolds, Donna L; Vidor, Emmanuel


    Safe and effective combination pediatric vaccines are necessary to simplify complex immunization schedules and to improve coverage and protection for children worldwide. We provide an overview of the 18 years of clinical and worldwide experience with DTaP-IPV-Hib (Pediacel(®)), a unique fully liquid pentavalent vaccine (diphtheria [D], tetanus [T], acellular pertussis, inactivated poliovirus [IPV], Haemophilus influenzae type b [Hib]). Pediacel has demonstrated good and lasting immunogenicity in many populations, with differing primary series and booster schedules, and with a variety of coadministered vaccines. The acellular pertussis antigens have proven efficacy and real-world effectiveness. Clinical and post-marketing studies confirm the safety of Pediacel. Pediacel can be used for primary series and toddler booster doses, as well as in mixed pediatric vaccine schedules. PMID:24985159

  12. {alpha}-decay properties of superheavy elements Z=113-125 in the relativistic mean-field theory with vector self-coupling of {omega} meson

    SciTech Connect

    Sharma, M.M.; Farhan, A.R.; Muenzenberg, G.


    We have investigated properties of {alpha}-decay chains of recently produced superheavy elements Z=115 and Z=113 using the new Lagrangian model NL-SV1 with inclusion of the vector self-coupling of the {omega} meson in the framework of relativistic mean-field theory. It is shown that the experimentally observed {alpha}-decay energies and half-lives are reproduced well by this Lagrangian model. Further calculations for the heavier elements with Z=117-125 show that these nuclei are superdeformed with a prolate shape in the ground state. A superdeformed shell closure at Z=118 lends an additional binding and an extra stability to nuclei in this region. Consequently, it is predicted that the corresponding Q{sub {alpha}} values provide {alpha}-decay half-lives for heavier superheavy nuclei within experimentally feasible conditions. The results are compared with those of macroscopic-microscopic approaches. A perspective of the difference in shell effects among various approaches is presented and its consequences for superheavy nuclei are discussed.

  13. K{beta}/K{alpha} X-Ray Transition-Probability Ratios for 8 Elements in the range 69 {<=} Z {<=} 76

    SciTech Connect

    Kaya, N.; Tirasoglu, E.; Aylikci, V.; Cengiz, E.


    K{beta}/K{alpha} X-ray transition-probabilitiy ratios for 8 elements in the range 69 {<=} Z {<=} 76 were measured with an Ultra-LEGe solid state detector with a resolution of 150 eV at 5.9 keV. The characteristic K X-rays were produced by a 25 mCi 57Co annular source. Experimental results have been compared with theoretically calculated values and other available experimental results.

  14. Elemental Analysis of the Surface of Comet 67p/Churyumov-Gerasimenko with the Alpha Particle X-Ray Spectrometer APXS on the Rosetta Lander Philae: Preliminary Results

    NASA Astrophysics Data System (ADS)

    Klingelhoefer, G.; Schmanke, D.; Girones-Lopez, J.; Brueckner, J.; d'Uston, C.; Economou, T.; Gellert, R.; Markovski, C.


    After a 10 years cruise the Rosetta probe has reached its final target, the comet 67P/Churyumov-Gerasimenko. The main objectives of the mission are to gain more knowledge of the composition, the origin and formation of comets and the solar system. After extensive remote exploration of the comet the lander Philae will be separated to land on the comet surface, starting immediately examining its landing site with its scientific payload. Part of this payload is the APXS (Alpha Particle X-Ray Spectrometer). It will measure in situ the chemical composition of the comet's surface and it's changes during the journey of the comet towards the sun. APXS is a combination of two spectrometers in one single instrument. It will irradiate the comet surface using Curium 244 sources, which are emitting alpha-particle and X-rays. In the alpha-mode the instrument uses alpha backscattering spectroscopy to detect lower Z elements like C, N and O and groups of elements with higher Z. In the X-ray mode alpha particle / X-ray induced X-ray spectroscopy (XRF) will allow the detection of most of the higher Z elements from Na up to Ni and above. Both modes will be always run in parallel allowing to determine lower and higher Z elements simultaneously. For 3 years the solar powered Rosetta probe had to pass a hibernation phase because of a long passage far away to the sun. After wakeup in January 2014 an extensive test phase of all instruments and subsystems has been performed, including the APXS. After landing on the comet an intense initial measurement phase of all instruments is planned, the First Science Sequence (FSS). It will be followed by a long term science phase (LTS). As long as possible APXS and the other instruments will continue to measure and monitor the changes and increasing activity of the comet during its journey towards the inner region of the solar system.The project is funded by the German Space Agency DLR under contracts 50 QP 0404 and 50 QP 0902. References: G

  15. Ovarian Sertoli-Leydig cell tumor with heterologous elements of gastrointestinal type associated with elevated serum alpha-fetoprotein level: an unusual case and literature review

    PubMed Central

    Horta, Mariana; Cunha, Teresa Margarida; Marques, Rita Canas; Félix, Ana


    Here we describe the case of a 19-year-old woman with a poorly differentiated ovarian Sertoli-Leydig cell tumor and an elevated serum alpha-fetoprotein level. The patient presented with diffuse abdominal pain and bloating. Physical examination, ultrasound, and magnetic resonance imaging revealed a right ovarian tumor that was histopathologically diagnosed as a poorly differentiated Sertoli-Leydig cell tumor with heterologous elements. Her alpha-fetoprotein serum level was undetectable after tumor resection. Sertoli-Leydig cell tumors are rare sex cord-stromal tumors that account for 0.5% of all ovarian neoplasms. Sertoli-Leydig cell tumors tend to be unilateral and occur in women under 30 years of age. Although they are the most common virilizing tumor of the ovary, about 60% are endocrine-inactive tumors. Elevated serum levels of alpha-fetoprotein are rarely associated with Sertoli-Leydig cell tumors, with only approximately 30 such cases previously reported in the literature. The differential diagnosis should include common alpha-fetoprotein-producing ovarian entities such as germ cell tumors, as well as other non-germ cell tumors that have been rarely reported to produce this tumor marker. PMID:25926909

  16. In Vitro Selection of Single-Stranded DNA Molecular Recognition Elements against S. aureus Alpha Toxin and Sensitive Detection in Human Serum

    PubMed Central

    Hong, Ka L.; Battistella, Luisa; Salva, Alysia D.; Williams, Ryan M.; Sooter, Letha J.


    Alpha toxin is one of the major virulence factors secreted by Staphylococcus aureus, a bacterium that is responsible for a wide variety of infections in both community and hospital settings. Due to the prevalence of S. aureus related infections and the emergence of methicillin-resistant S. aureus, rapid and accurate diagnosis of S. aureus infections is crucial in benefiting patient health outcomes. In this study, a rigorous Systematic Evolution of Ligands by Exponential Enrichment (SELEX) variant previously developed by our laboratory was utilized to select a single-stranded DNA molecular recognition element (MRE) targeting alpha toxin with high affinity and specificity. At the end of the 12-round selection, the selected MRE had an equilibrium dissociation constant (Kd) of 93.7 ± 7.0 nM. Additionally, a modified sandwich enzyme-linked immunosorbent assay (ELISA) was developed by using the selected ssDNA MRE as the toxin-capturing element and a sensitive detection of 200 nM alpha toxin in undiluted human serum samples was achieved. PMID:25633102

  17. Production of inflammatory cytokines in response to diphtheria-pertussis-tetanus (DPT), haemophilus influenzae type b (Hib), and 7-valent pneumococcal (PCV7) vaccines

    PubMed Central

    Kashiwagi, Yasuyo; Miyata, Akiko; Kumagai, Takuji; Maehara, Kouji; Suzuki, Eitarou; Nagai, Takao; Ozaki, Takao; Nishimura, Naoko; Okada, Kenji; Kawashima, Hisashi; Nakayama, Tetsuo


    Haemophilus influenzae type b (Hib) and 7-valent pneumococcal (PCV7) vaccines both became recommended in Japan in 2010. In this study, cytokine production was investigated in peripheral blood mononuclear cells (PBMCs) cultures stimulated with diphtheria and tetanus toxoids combined with acellular pertussis vaccine (DPT), Hib, and PCV7 separately or concurrent different combinations, all as final off-the-shelf vaccines without the individual vaccine components as controls. Higher IL-1β levels were produced when cultures were stimulated with PCV than with DPT or Hib, and the concurrent stimulation including PCV7 enhanced the production of IL-1β. Although Hib induced higher levels of IL-6, no significant difference was observed in IL-6 production with the concurrent stimulation. The concurrent stimulation with Hib/PCV7 and DPT/Hib/PCV7 produced higher levels of TNF-α and human G-CSF. Cytokine profiles were examined in serum samples obtained from 61 vaccine recipients with febrile reactions and 18 recipients without febrile illness within 24 h of vaccination. No significant difference was observed in cytokine levels of IL-1β, IL-4, IL-6, IL-10, IL-12, IFN-γ, MIP-1, TNF-α, and prostaglandin E2 (PGE2) in sera between the two groups. However, significantly higher levels of human G-CSF were observed in recipients with febrile illness than in those without febrile reactions. Further investigations of the significance of elevated serum G-CSF levels are required in vaccine recipients with febrile illness. PMID:24589970

  18. Cis and trans-acting elements involved in the activation of Arabidopsis thaliana A1 gene encoding the translation elongation factor EF-1 alpha.


    Curie, C; Liboz, T; Bardet, C; Gander, E; Médale, C; Axelos, M; Lescure, B


    In A. thaliana the translation elongation factor EF-1 alpha is encoded by a small multigenic family of four members (A1-A4). The A1 gene promoter has been dissected and examined in a transient expression system using the GUS reporter gene. Deletion analysis has shown that several elements are involved in the activation process. One cis-acting domain, the TEF 1 box, has been accurately mapped 100 bp upstream of the transcription initiation site. This domain is the target for trans-acting factors identified in nuclear extracts prepared from A. thaliana. Homologies are found between the TEF 1 box and sequences present at the same location within the A2, A3 and A4 promoters. This observation, together with those obtained from gel retardation assays performed using DNA fragments from the A4 promoter, suggest that the activation process mediated by the TEF 1 element is conserved among the A. thaliana EF-1 alpha genes. Analysis of nearly full length cDNA clones has shown that in addition to a single intron located within the coding region, the A1 gene contains a second intron located within the 5' non coding region. Such an intron is also present within the A2, A3 and A4 genes. This 5' intervening sequence appears to be essential to obtain a maximum GUS activity driven by the A1 gene promoter. PMID:1840652

  19. Cis and trans-acting elements involved in the activation of Arabidopsis thaliana A1 gene encoding the translation elongation factor EF-1 alpha.

    PubMed Central

    Curie, C; Liboz, T; Bardet, C; Gander, E; Médale, C; Axelos, M; Lescure, B


    In A. thaliana the translation elongation factor EF-1 alpha is encoded by a small multigenic family of four members (A1-A4). The A1 gene promoter has been dissected and examined in a transient expression system using the GUS reporter gene. Deletion analysis has shown that several elements are involved in the activation process. One cis-acting domain, the TEF 1 box, has been accurately mapped 100 bp upstream of the transcription initiation site. This domain is the target for trans-acting factors identified in nuclear extracts prepared from A. thaliana. Homologies are found between the TEF 1 box and sequences present at the same location within the A2, A3 and A4 promoters. This observation, together with those obtained from gel retardation assays performed using DNA fragments from the A4 promoter, suggest that the activation process mediated by the TEF 1 element is conserved among the A. thaliana EF-1 alpha genes. Analysis of nearly full length cDNA clones has shown that in addition to a single intron located within the coding region, the A1 gene contains a second intron located within the 5' non coding region. Such an intron is also present within the A2, A3 and A4 genes. This 5' intervening sequence appears to be essential to obtain a maximum GUS activity driven by the A1 gene promoter. Images PMID:1840652

  20. TFII-I down-regulates a subset of estrogen-responsive genes through its interaction with an initiator element and estrogen receptor alpha.


    Ogura, Yuji; Azuma, Motoki; Tsuboi, Yasunori; Kabe, Yasuaki; Yamaguchi, Yuki; Wada, Tadashi; Watanabe, Hajime; Handa, Hiroshi


    TFII-I was initially identified as the general transcription factor that binds to initiator (Inr) elements in vitro. Subsequent studies have shown that TFII-I activates transcription of various genes either through Inr elements or through other upstream elements in vivo. Since, however, most studies so far on TFII-I have been limited to over-expression and reporter gene assays, we reevaluated the role of TFII-I in vivo by using stable knockdown with siRNA and by examining the expression of endogenous genes. Contrary to the widely accepted view, here we show that TFII-I is not important for cell viability in general but rather inhibits the growth of MCF-7 human breast cancer cells. MCF-7 cells are known to proliferate in an estrogen-dependent manner. Through analysis of TFII-I's cell-type specific growth inhibitory effect, we show evidence that TFII-I down-regulates a subset of estrogen-responsive genes, only those containing Inr elements, by recruiting estrogen receptor (ER) alpha and corepressors to these promoters. Thus, this study has revealed an unexpected new role of TFII-I as a negative regulator of transcription and cell proliferation. PMID:16611241

  1. Refinement of the Compton-Rayleigh scatter ratio method for use on the Mars Science Laboratory alpha particle X-ray spectrometer: II - Extraction of invisible element content

    NASA Astrophysics Data System (ADS)

    Perrett, Glynis M.; Campbell, John L.; Gellert, Ralf; King, Penelope L.; Nield, Emily; O'Meara, Joanne M.; Pradler, Irina


    The intensity ratio C/R between Compton and Rayleigh scatter peaks of the exciting Pu L X-rays in the alpha particle X-ray spectrometer (APXS) is strongly affected by the presence of very light elements such as oxygen which cannot be detected directly by the APXS. C/R values are determined along with element concentrations by fitting APXS spectra of geochemical reference materials (GRMs) with the GUAPX code. A quantity K is defined as the ratio between the C/R value determined by Monte Carlo simulation based on the measured element concentrations and the fitted C/R value from the spectrum. To ensure optimally accurate K values, the choice of appropriate GRMs is explored in detail, with attention paid to Rb and Sr, whose characteristic Kα X-ray peaks overlap the Pu Lα scatter peaks. The resulting relationship between the ratio K and the overall oxygen fraction is linear. This provides a calibration from which the concentration of additional light invisible constituents (ALICs) such as water may be estimated in unknown rock and conglomerate samples. Several GRMs are used as 'unknowns' in order to evaluate the accuracy of ALIC concentrations derived in this manner.

  2. Estrogen response element and the promoter context of the human and mouse lactoferrin genes influence estrogen receptor alpha-mediated transactivation activity in mammary gland cells.


    Stokes, Kenya; Alston-Mills, Brenda; Teng, Christina


    A critical step in estrogen action is the recognition of estrogen responsive elements (EREs) by liganded estrogen receptor. Our current studies were designed to determine whether an extended estrogen response element half-site (ERRE) contributes to the differential estrogen responses of the human and mouse lactoferrin overlapping chicken ovalbumin upstream promoter/ERE sequences (estrogen response modules, ERMs) in the context of their natural promoters. Transient transfections of MCF-7 cells show that liganded estrogen receptor alpha (ERalpha) activates transcription of the human lactoferrin ERM fourfold higher than the mouse lactoferrin ERM in the context of their natural promoters. Since the ERRE of the human lactoferrin gene naturally occurs 18 bp upstream from the ERM and is absent in the mouse lactoferrin gene promoter, we created a chimeric mouse lactoferrin CAT reporter, which now encodes the ERRE in the identical location as in the human lactoferrin gene. The addition of the ERRE in the mouse lactoferrin gene rendered this reporter extremely responsive to estrogen stimulation. Using limited protease digestions and electrophoretic mobility shift assays, we showed that the binding and protease sensitivity of ERalpha bound to the mouse ERM with or without the ERRE, differed. Importantly, occupancy of additional nuclear receptors at the ERRE may contribute to ERalpha binding and activation. Furthermore, the presence of ERRE influences the selectivity of coactivators in liganded ERalpha-mediated transcriptional activity. When the receptor is bound to human and mouse plus genes, which contain the ERRE, steroid receptor coactivator (SRC)-2 was preferred, while SRC-1 and SRC-3 coactivators selectively enhanced the mouse lactoferrin gene activity. Moreover, peroxisome proliferator activated receptor-gamma coactivator-1 (PGC-1alpha) and PGC-1-related estrogen receptor coactivator (PERC) robustly increase the transcriptional function of ERalpha in the presence of the

  3. Role of an inhibitory pyrimidine element and polypyrimidine tract binding protein in repression of a regulated alpha-tropomyosin exon.


    Gooding, C; Roberts, G C; Smith, C W


    Splicing of exons 2 and 3 of a-tropomyosin (TM) involves mutually exclusive selection of either exon 3, which occurs in most cells, or of exon 2 in smooth muscle (SM) cells. The SM-specific selection of exon 2 results from the inhibition of exon 3. At least two essential cis-acting elements are required for exon 3 inhibition, the upstream and downstream regulatory elements (URE and DRE). These elements are essential for repression of TM exon 3 in SM cells, and also mediate a low level of repression of exon 3 in an in vitro 5' splice site competition assay in HeLa extracts. Here, we show that the DRE consists of at least two discrete components, a short region containing a number of UGC motifs, and an essential pyrimidine-rich tract (DY). We show that the specific sequence of the DY element is important and that DY is able to bind to factors in HeLa nuclear extracts that mediate a low background level of exon 3 skipping. Deletion of a sequence within DY identified as an optimal binding site for PTB impairs (1) regulation of splicing in vivo, (2) skipping of exon 3 in an in vitro 5' splice site competition, (3) the ability of DY competitors to affect the 5' splice site competition in vitro, and (4) binding of PTB to DY. Addition of recombinant PTB to in vitro splicing reactions is able to partially reverse the effects of the DY competitor RNA. The data are consistent with a model for regulation of TM splicing that involves the participation of both tissue-specific and general inhibitory factors and in which PTB plays a role in repressing both splice sites of exon 3. PMID:9436911

  4. Single-stranded DNA-binding proteins PURalpha and PURbeta bind to a purine-rich negative regulatory element of the alpha-myosin heavy chain gene and control transcriptional and translational regulation of the gene expression. Implications in the repression of alpha-myosin heavy chain during heart failure.


    Gupta, Madhu; Sueblinvong, Viranuj; Raman, Jai; Jeevanandam, Valluvan; Gupta, Mahesh P


    The alpha-myosin heavy chain is a principal molecule of the thick filament of the sarcomere, expressed primarily in cardiac myocytes. The mechanism for its cardiac-restricted expression is not yet fully understood. We previously identified a purine-rich negative regulatory (PNR) element in the first intron of the gene, which is essential for its cardiac-specific expression (Gupta, M., Zak, R., Libermann, T. A., and Gupta, M. P. (1998) Mol. Cell. Biol. 18, 7243-7258). In this study we cloned and characterized muscle and non-muscle factors that bind to this element. We show that two single-stranded DNA-binding proteins of the PUR family, PURalpha and PURbeta, which are derived from cardiac myocytes, bind to the plus strand of the PNR element. In functional assays, PURalpha and PURbeta repressed alpha-myosin heavy chain (alpha-MHC) gene expression in the presence of upstream regulatory sequences of the gene. However, from HeLa cells an Ets family of protein, Ets-related protein (ERP), binds to double-stranded PNR element. The ERP.PNR complex inhibited the activity of the basal transcription complex from homologous as well as heterologous promoters in a PNR position-independent manner, suggesting that ERP acts as a silencer of alpha-MHC gene expression in non-muscle cells. We also show that PUR proteins are capable of binding to alpha-MHC mRNA and attenuate its translational efficiency. Furthermore, we show robust expression of PUR proteins in failing hearts where alpha-MHC mRNA levels are suppressed. Together, these results reveal that (i) PUR proteins participate in transcriptional as well as translational regulation of alpha-MHC expression in cardiac myocytes and (ii) ERP may be involved in cardiac-restricted expression of the alpha-MHC gene by preventing its expression in non-muscle cells. PMID:12933792

  5. Competition between alpha-decay and spontaneous fission at isotopes of superheavy elements Rf, Db, and Sg

    SciTech Connect

    Anghel, Claudia Ioana; Silisteanu, Andrei Octavian


    The most important decay modes for heavy and superheavy nuclei are their α-decay and spontaneous fission. This work investigates the evolution and the competition of these decay modes in long isotopic sequences. The partial half-lives are given by minimal sets of parameters extracted from the fit of experimental data and theoretical results. A summary of the experimental and calculated α-decay and spontaneous fission half-lives of the isotopes of elements Rf, Db, and Sg is presented. Some half-life extrapolations for nuclides not yet known are also obtained.

  6. Primary structure determination of five sialylated oligosaccharides derived from bronchial mucus glycoproteins of patients suffering from cystic fibrosis. The occurrence of the NeuAc alpha(2----3)Gal beta(1----4)[Fuc alpha(1----3)] GlcNAc beta(1----.) structural element revealed by 500-MHz 1H NMR spectroscopy.


    Lamblin, G; Boersma, A; Klein, A; Roussel, P; van Halbeek, H; Vliegenthart, J F


    The structure of sialylated carbohydrate units of bronchial mucins obtained from cystic fibrosis patients was investigated by 500-MHz 1H NMR spectroscopy in conjunction with sugar analysis. After subjecting the mucins to alkaline borohydride degradation, sialylated oligosaccharide-alditols were isolated by anion-exchange chromatography and fractionated by high performance liquid chromatography. Five compounds could be obtained in a rather pure state; their structures were established as the following: A-1, NeuAc alpha(2----3)Gal beta(1----4) [Fuc alpha(1----3)]GlcNAc beta(1----3)Gal-NAc-ol; A-2, NeuAc alpha(2----3)Gal beta(1----4)GlcNAc beta(1----6)-[GlcNAc beta (1----3)]GalNAc-o1; A-3, NeuAc alpha(2----3)Gal beta-(1----4)[Fuc alpha(1----3)]GlcNAc beta(1----3)Gal beta(1----3) GalNAc-o1; A-4, NeuAc alpha(2----3)Gal beta(1----4)[Fuc alpha(1----3)]Glc-NAc NAc beta(1----6)[GlcNAc beta(1----3)]GalNAc-o1; A-6,NeuAc alpha-(2----3) Gal beta(1----4)[Fuc alpha(1----3)]GlcNAc beta(1----6)[Gal beta-(1----4) GlcNAc beta(1----3)]GalNAc-o1. The simultaneous presence of sialic acid in alpha(2----3)-linkage to Gal and fucose in alpha(1----3)-linkage to GlcNAc of the same N-acetyllactosamine unit could be adequately proved by high resolution 1H NMR spectroscopy. This sequence constitutes a novel structural element for mucins. PMID:6746638

  7. Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of alpha-Amy2 genes.


    Rushton, P J; Macdonald, H; Huttly, A K; Lazarus, C M; Hooley, R


    The promoters of wheat, barley and wild oat alpha-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56-58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4-5-C-X22-23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins. PMID:8541496

  8. Measurement of the L. beta. to L. cap alpha. intensity ratio through a selective excitation of L/sub III/ subshell in elements of Zgreater than or equal to70

    SciTech Connect

    Murty, G.S.K.; Chandrasekhar Rao, M.V.S.; Raghavaiah, C.V.; Reddy, S.B.; Satyanarayana, G.; Sastry, D.L.


    The intensity ratio of L..beta../sub 2/+L..beta../sub 5/+L..beta../sub 6/ to L..cap alpha../sub 1/+L..cap alpha../sub 2/ was measured in seven elements (Zgreater than or equal to70) through a selective excitation of the L/sub III/ subshell using an x-ray tube. A high-resolution Si(Li) detector system coupled to a computer controlled multichannel analyzer was used in these measurements. The results show that the relative transition probabilities L..beta.. and L..cap alpha.. agree with the relativistic Hartree-Fock-Slater calculations in the case of Yb and U, while a discrepancy of 3.1--8.7 % between experiment and theory is found for the other elements.

  9. Regulation of steroid 5-{alpha} reductase type 2 (Srd5a2) by sterol regulatory element binding proteins and statin

    SciTech Connect

    Seo, Young-Kyo; Zhu, Bing; Jeon, Tae-Il; Osborne, Timothy F.


    In this study, we show that sterol regulatory element binding proteins (SREBPs) regulate expression of Srd5a2, an enzyme that catalyzes the irreversible conversion of testosterone to dihydroxytestosterone in the male reproductive tract and is highly expressed in androgen-sensitive tissues such as the prostate and skin. We show that Srd5a2 is induced in livers and prostate from mice fed a chow diet supplemented with lovastatin plus ezitimibe (L/E), which increases the activity of nuclear SREBP-2. The three fold increase in Srd5a2 mRNA mediated by L/E treatment was accompanied by the induction of SREBP-2 binding to the Srd5a2 promoter detected by a ChIP-chip assay in liver. We identified a SREBP-2 responsive region within the first 300 upstream bases of the mouse Srd5a2 promoter by co-transfection assays which contain a site that bound SREBP-2 in vitro by an EMSA. Srd5a2 protein was also induced in cells over-expressing SREBP-2 in culture. The induction of Srd5a2 through SREBP-2 provides a mechanistic explanation for why even though statin therapy is effective in reducing cholesterol levels in treating hypercholesterolemia it does not compromise androgen production in clinical studies.

  10. The GIRAFFE Inner Bulge Survey (GIBS). II. Metallicity distributions and alpha element abundances at fixed Galactic latitude

    NASA Astrophysics Data System (ADS)

    Gonzalez, O. A.; Zoccali, M.; Vasquez, S.; Hill, V.; Rejkuba, M.; Valenti, E.; Rojas-Arriagada, A.; Renzini, A.; Babusiaux, C.; Minniti, D.; Brown, T. M.


    Aims: We investigate metallicity and α-element abundance gradients along a Galactic longitude strip, at latitude b ~ -4°, with the aim of providing observational constraints for the structure and origin of the Milky Way bulge. Methods: High-resolution (R ~ 22 500) spectra for 400 K giants, in four fields within -4.8° ≲ b ≲ -3.4° and -10° ≲ l ≲ +10°, were obtained within the GIRAFFE Inner Bulge Survey (GIBS) project. To this sample we added another ~400 stars in Baade's Window at (l,b) = (1°,-4°), observed with the identical instrumental configuration: FLAMES GIRAFFE in Medusa mode with HR13 setup. All target stars lie within the red clump of the bulge colour-magnitude diagram, thus minimising contamination from the disc or halo stars. The spectroscopic stellar surface parameters were derived with an automatic method based on the GALA code, while the [Ca/Fe] and [Mg/Fe] abundances as a function of [Fe/H] were derived through a comparison with the synthetic spectra using MOOG. We constructed the metallicity distributions for the entire sample, and for each field individually, in order to investigate the presence of gradients or field-to-field variations in the shape of the distributions. Results: The metallicity distributions in the five fields are consistent with being drawn from a single parent population, indicating the absence of a gradient along the major axis of the Galactic bar. The global metallicity distribution is nicely fitted by two Gaussians. The metal-poor component is rather broad, with a mean at ⟨ [Fe/H] ⟩ = -0.31 dex and σ = 0.31 dex. The metal-rich component is narrower, with mean ⟨ [Fe/H] ⟩ = + 0.26 and σ = 0.2 dex. The [Mg/Fe] ratio follows a tight trend with [Fe/H], with enhancement with respect to solar in the metal-poor regime similar to the value observed for giant stars in the local thick disc. [Ca/Fe] abundances follow a similar trend, but with a considerably larger scatter than [Mg/Fe]. A decrease in [Mg/Fe] is

  11. In silico selection of an aptamer to estrogen receptor alpha using computational docking employing estrogen response elements as aptamer-alike molecules

    PubMed Central

    Ahirwar, Rajesh; Nahar, Smita; Aggarwal, Shikha; Ramachandran, Srinivasan; Maiti, Souvik; Nahar, Pradip


    Aptamers, the chemical-antibody substitute to conventional antibodies, are primarily discovered through SELEX technology involving multi-round selections and enrichment. Circumventing conventional methodology, here we report an in silico selection of aptamers to estrogen receptor alpha (ERα) using RNA analogs of human estrogen response elements (EREs). The inverted repeat nature of ERE and the ability to form stable hairpins were used as criteria to obtain aptamer-alike sequences. Near-native RNA analogs of selected single stranded EREs were modelled and their likelihood to emerge as ERα aptamer was examined using AutoDock Vina, HADDOCK and PatchDock docking. These in silico predictions were validated by measuring the thermodynamic parameters of ERα -RNA interactions using isothermal titration calorimetry. Based on the in silico and in vitro results, we selected a candidate RNA (ERaptR4; 5′-GGGGUCAAGGUGACCCC-3′) having a binding constant (Ka) of 1.02 ± 0.1 × 108 M−1 as an ERα-aptamer. Target-specificity of the selected ERaptR4 aptamer was confirmed through cytochemistry and solid-phase immunoassays. Furthermore, stability analyses identified ERaptR4 resistant to serum and RNase A degradation in presence of ERα. Taken together, an efficient ERα-RNA aptamer is identified using a non-SELEX procedure of aptamer selection. The high-affinity and specificity can be utilized in detection of ERα in breast cancer and related diseases. PMID:26899418

  12. Transcriptional regulation of the human glycoprotein hormone common alpha subunit gene by cAMP-response-element-binding protein (CREB)-binding protein (CBP)/p300 and p53.

    PubMed Central

    Zhang, Xian; Grand, Roger J A; McCabe, Christopher J; Franklyn, Jayne A; Gallimore, Phillip H; Turnell, Andrew S


    We have investigated the functional interactions between adenovirus early region 1A (AdE1A) protein, the co-activators cAMP-response-element-binding protein (CREB)-binding protein (CBP)/p300 and SUG1, and the transcriptional repressor retinoblastoma (Rb) in mediating T3-dependent repression. Utilizing the human glycoprotein hormone common alpha-subunit (alpha-subunit) promoter and AdE1A mutants with selective binding capacity to these molecules we have determined an essential role for CBP/p300. In normal circumstances, wild-type 12 S AdE1A inhibited alpha-subunit activity. In contrast, adenovirus mutants that retain both the SUG1- and Rb-binding sites, but lack the CBP/p300-binding site, were unable to repress promoter activity. We have also identified a role for the tumour-suppressor gene product p53 in regulation of the alpha-subunit promoter. Akin to 12 S AdE1A, exogenous p53 expression repressed alpha-subunit activity. This function resided in the ability of p53 to interact with CBP/p300; an N-terminal mutant incapable of interacting with CBP/p300 did not inhibit alpha-subunit activity. Stabilization of endogenous p53 by UV irradiation also correlated positively with reduced alpha-subunit activity. Intriguingly, T3 stimulated endogenous p53 transcriptional activity, implicating p53 in T3-dependent signalling pathways. These data indicate that CBP/p300 and p53 are key regulators of alpha-subunit activity. PMID:12164786


    SciTech Connect

    Colucci, Janet E.; Bernstein, Rebecca A.; McWilliam, Andrew E-mail: E-mail:


    We present detailed chemical abundances in eight clusters in the Large Magellanic Cloud (LMC). We measure abundances of 22 elements for clusters spanning a range in age of 0.05-12 Gyr, providing a comprehensive picture of the chemical enrichment and star formation history of the LMC. The abundances were obtained from individual absorption lines using a new method for analysis of high-resolution (R {approx} 25,000), integrated-light (IL) spectra of star clusters. This method was developed and presented in Papers I, II, and III of this series. In this paper, we develop an additional IL {chi}{sup 2}-minimization spectral synthesis technique to facilitate measurement of weak ({approx}15 mA) spectral lines and abundances in low signal-to-noise ratio data (S/N {approx} 30). Additionally, we supplement the IL abundance measurements with detailed abundances that we measure for individual stars in the youngest clusters (age < 2 Gyr) in our sample. In both the IL and stellar abundances we find evolution of [{alpha}/Fe] with [Fe/H] and age. Fe-peak abundance ratios are similar to those in the Milky Way (MW), with the exception of [Cu/Fe] and [Mn/Fe], which are sub-solar at high metallicities. The heavy elements Ba, La, Nd, Sm, and Eu are significantly enhanced in the youngest clusters. Also, the heavy to light s-process ratio is elevated relative to the MW ([Ba/Y] >+0.5) and increases with decreasing age, indicating a strong contribution of low-metallicity asymptotic giant branch star ejecta to the interstellar medium throughout the later history of the LMC. We also find a correlation of IL Na and Al abundances with cluster mass in the sense that more massive, older clusters are enriched in the light elements Na and Al with respect to Fe, which implies that these clusters harbor star-to-star abundance variations as is common in the MW. Lower mass, intermediate-age, and young clusters have Na and Al abundances that are lower and more consistent with LMC field stars. Our

  14. Food and Drug Administration Approval for Use of Hiberix as a 3-Dose Primary Haemophilus influenzae Type b (Hib) Vaccination Series.


    Briere, Elizabeth C


    On January 14, 2016, GlaxoSmithKline Biologicals (Research Triangle Park, North Carolina) received approval from the Food and Drug Administration (FDA) to expand use of Hiberix (Haemophilus b Conjugate Vaccine [Tetanus Toxoid Conjugate]) for a 3-dose infant primary vaccination series at ages 2, 4, and 6 months. Hiberix was first licensed in the United States in August 2009 for use as a booster dose in children aged 15 months through 4 years under the Accelerated Approval Regulations, in response to a Haemophilus influenzae type b (Hib) vaccine shortage that lasted from December 2007 to July 2009 (1). Expanding the age indication to include infants provides another vaccine option in addition to other currently licensed monovalent or combination Hib vaccines recommended for the primary vaccination series.* Hiberix contains 10 μg purified capsular polyribosyl ribitolphosphate (PRP) conjugated to 25 μg tetanus toxoid (PRP-T) and is supplied as a single-dose vial of lyophilized vaccine to be reconstituted with saline diluent. For the 3-dose primary series, a single (0.5 mL) dose should be given by intramuscular injection at ages 2, 4, and 6 months; the first dose may be given as early as age 6 weeks. The recommended catch-up schedule for PRP-T vaccines ( should be followed. As previously recommended, a single booster dose should be administered to children aged 15 months through 18 months; to facilitate timely booster vaccination, Hiberix can be administered as early as age 12 months, in accordance with Hib vaccination schedules for routine and catch-up immunization (1-3). PMID:27124887

  15. Safety and reactogenicity of the combined diphtheria-tetanus-acellular pertussis-inactivated poliovirus-Haemophilus influenzae type b (DTPa-IPV/Hib) vaccine in healthy Vietnamese toddlers: An open-label, phase III study

    PubMed Central

    Anh, Dang Duc; Van Der Meeren, Olivier; Karkada, Naveen; Assudani, Deepak; Yu, Ta-Wen; Han, Htay Htay


    abstract The introduction of combination vaccines plays a significant role in increasing vaccine acceptance and widening vaccine coverage. Primary vaccination against diphtheria, tetanus, pertussis, poliomyelitis and Haemophilus influenza type b (Hib) diseases has been implemented in Vietnam. In this study we evaluated the safety and reactogenicity of combined diphtheria-tetanus-pertussis-inactivated polio (DTPa-IPV)/Hib vaccine when administered as a booster dose in 300 healthy Vietnamese children <2 years of age (mean age: 15.8 months). During the 4-day follow-up period, pain (31.7%) and redness (27.3%) were the most frequent solicited local symptoms. Pain (2%) was also the most frequent grade 3 local symptom. One subject reported 2 serious adverse events that were not causally related to the study vaccine. DTPa-IPV/Hib conjugate vaccine was well tolerated as a booster dose in healthy Vietnamese children aged <2 years. PMID:26337197

  16. Safety and reactogenicity of the combined diphtheria-tetanus-acellular pertussis-inactivated poliovirus-Haemophilus influenzae type b (DTPa-IPV/Hib) vaccine in healthy Vietnamese toddlers: An open-label, phase III study.


    Anh, Dang Duc; Van Der Meeren, Olivier; Karkada, Naveen; Assudani, Deepak; Yu, Ta-Wen; Han, Htay Htay


    The introduction of combination vaccines plays a significant role in increasing vaccine acceptance and widening vaccine coverage. Primary vaccination against diphtheria, tetanus, pertussis, poliomyelitis and Haemophilus influenza type b (Hib) diseases has been implemented in Vietnam. In this study we evaluated the safety and reactogenicity of combined diphtheria-tetanus-pertussis-inactivated polio (DTPa-IPV)/Hib vaccine when administered as a booster dose in 300 healthy Vietnamese children <2 years of age (mean age: 15.8 months). During the 4-day follow-up period, pain (31.7%) and redness (27.3%) were the most frequent solicited local symptoms. Pain (2%) was also the most frequent grade 3 local symptom. One subject reported 2 serious adverse events that were not causally related to the study vaccine. DTPa-IPV/Hib conjugate vaccine was well tolerated as a booster dose in healthy Vietnamese children aged <2 years. PMID:26337197

  17. The Ages, Metallicities, and Alpha Element Enhancements of Globular Clusters in the Elliptical NGC 5128: A Homogeneous Spectroscopic Study with Gemini/Gemini Multi-Object Spectrograph

    NASA Astrophysics Data System (ADS)

    Woodley, Kristin A.; Harris, William E.; Puzia, Thomas H.; Gómez, Matías; Harris, Gretchen L. H.; Geisler, Doug


    We present new integrated light spectroscopy of globular clusters (GCs) in NGC 5128, a nearby giant elliptical galaxy less than 4 Mpc away, in order to measure radial velocities and derive ages, metallicities, and alpha-element abundance ratios. Using the Gemini South 8 meter telescope with the instrument Gemini Multi-Object Spectrograph, we obtained spectroscopy in the range of ~3400-5700 Å for 72 GCs with a signal-to-noise ratio greater than 30 Å-1 and we have also discovered 35 new GCs within NGC 5128 from our radial velocity measurements. We measured and compared the Lick indices from Hδ A through Fe5406 with the single stellar population models of Thomas et al. in order to derive age, metallicity, and [α/Fe] values. We also measure Lick indices for 41 Milky Way GCs from Puzia et al. and Schiavon et al. with the same methodology for direct comparison. Our results show that 68% of the NGC 5128 GCs have old ages (>8 Gyr), 14% have intermediate ages (5-8 Gyr), and 18% have young ages (<5 Gyr). However, when we look at the metallicity of the GCs as a function of age, we find 92% of metal-poor GCs and 56% of metal-rich GCs in NGC 5128 have ages >8 Gyr, indicating that the majority of both metallicity subpopulations of GCs formed earlier, with a significant population of young and metal-rich GCs forming later. Our metallicity distribution function generated directly from spectroscopic Lick indices is clearly bimodal, as is the color distribution of the same set of GCs. Thus, the metallicity bimodality is real and not an artifact of the color to metallicity conversion. However, the metallicity distribution function obtained from comparison with the single stellar population models is consistent with a unimodal, bimodal, or multimodal shape. The [α/Fe] values are supersolar with a mean value of 0.14 ± 0.04, indicating a fast formation timescale. However, the GCs in NGC 5128 are not as [α/Fe] enhanced as the Milky Way GCs also examined in this study. Our measured

  18. Alpha Particle

    NASA Astrophysics Data System (ADS)

    Murdin, P.


    Term that is sometimes used to describe a helium nucleus, a positively charged particle that consists of two protons and two neutrons, bound together. Alpha particles, which were discovered by Ernest Rutherford (1871-1937) in 1898, are emitted by atomic nuclei that are undergoing alpha radioactivity. During this process, an unstable heavy nucleus spontaneously emits an alpha particle and transmut...


    SciTech Connect

    Lee, Young Sun; Beers, Timothy C.; Prieto, Carlos Allende; Lai, David K.; Rockosi, Constance M.; Johnson, Jennifer A.; An, Deokkeun; Sivarani, Thirupathi; Yanny, Brian E-mail: E-mail: E-mail: E-mail: E-mail:


    We present a method for the determination of [{alpha}/Fe] ratios from low-resolution (R = 2000) SDSS/SEGUE stellar spectra. By means of a star-by-star comparison with degraded spectra from the ELODIE spectral library and with a set of moderately high-resolution (R = 15, 000) and medium-resolution (R = 6000) spectra of SDSS/SEGUE stars, we demonstrate that we are able to measure [{alpha}/Fe] from SDSS/SEGUE spectra (with S/N>20/1) to a precision of better than 0.1 dex, for stars with atmospheric parameters in the range T{sub eff} = [4500, 7000] K, log g = [1.5, 5.0], and [Fe/H] = [-1.4, +0.3], over the range [{alpha}/Fe] = [-0.1, +0.6]. For stars with [Fe/H] <-1.4, our method requires spectra with slightly higher signal-to-noise to achieve this precision (S/N>25/1). Over the full temperature range considered, the lowest metallicity star for which a confident estimate of [{alpha}/Fe] can be obtained from our approach is [Fe/H] {approx}-2.5; preliminary tests indicate that a metallicity limit as low as [Fe/H] {approx}-3.0 may apply to cooler stars. As a further validation of this approach, weighted averages of [{alpha}/Fe] obtained for SEGUE spectra of likely member stars of Galactic globular clusters (M15, M13, and M71) and open clusters (NGC 2420, M67, and NGC 6791) exhibit good agreement with the values of [{alpha}/Fe] from previous studies. The results of the comparison with NGC 6791 imply that the metallicity range for the method may extend to {approx}+0.5.

  20. An element in the alpha1-tubulin promoter is necessary for retinal expression during optic nerve regeneration but not after eye injury in the adult zebrafish.


    Senut, Marie-Claude; Gulati-Leekha, Abhilasha; Goldman, Daniel


    We have shown previously that a 1.696 kb upstream fragment of the goldfish alpha1-tubulin promoter was capable of driving green fluorescent protein (GFP) expression in the developing and regenerating zebrafish CNS in a pattern closely mimicking the endogenous alpha1-tubulin gene. Comparison of fish and rat alpha1-tubulin promoters identified a 64 bp region with a conserved repetitive homeodomain (HD) consensus sequence core (TAAT) and a nearby basic helix-loop-helix binding E-box sequence (CANNTG), which led us to speculate that it could be of importance for regulating alpha1-tubulin gene transcription. To address this issue, we examined the ability of deletion mutants of the 1.696 kb promoter to drive expression of GFP in zebrafish retinal cells under normal conditions and after injury. Interestingly, although wild-type 1.696 kb and mutant promoters, lacking the E-box and/or HD sequences, exhibited rather similar patterns of GFP expression in the developing retina, significant differences were noticed in the mature retina. First, although the 1.696 kb promoter directed transgene expression to retinal neurons and progenitor cells, the activity of mutant promoters was drastically reduced. Second, we found that the E-box and HD sequences were necessary for transgene reinduction during optic nerve regeneration, but were not as important for transgene expression in regenerating retinal neurons after eye injury. In this latter lesion model, remarkably, both 1.696 kb and mutant promoters targeted GFP expression to Müller glia-like cells, some of which re-entered the cell cycle. These new findings will be useful for identifying the molecular signals necessary for successful CNS regeneration. PMID:15342733

  1. Human Infant Memory B Cell and CD4+ T Cell Responses to HibMenCY-TT Glyco-Conjugate Vaccine

    PubMed Central

    Fuery, Angela; Richmond, Peter C.; Currie, Andrew J.


    Carrier-specific T cell and polysaccharide-specific B cell memory responses are not well characterised in infants following glyco-conjugate vaccination. We aimed to determine if the number of Meningococcal (Men) C- and Y- specific memory B cells and; number and quality of Tetanus Toxoid (TT) carrier-specific memory CD4+ T cells are associated with polysaccharide-specific IgG post HibMenCY-TT vaccination. Healthy infants received HibMenCY-TT vaccine at 2, 4 and 6 months with a booster at 12 months. Peripheral blood mononuclear cells were isolated and polysaccharide-specific memory B cells enumerated using ELISpot. TT-specific memory CD4+ T cells were detected and phenotyped based on CD154 expression and intracellular TNF-α, IL-2 and IFN-γ expression following stimulation. Functional polysaccharide-specific IgG titres were measured using the serum bactericidal activity (SBA) assay. Polysaccharide-specific Men C- but not Men Y- specific memory B cell frequencies pre-boost (12 months) were significantly associated with post-boost (13 months) SBA titres. Regression analysis showed no association between memory B cell frequencies post-priming (at 6 or 7 months) and SBA at 12 months or 13 months. TT-specific CD4+ T cells were detected at frequencies between 0.001 and 0.112 as a percentage of CD3+ T cells, but their numbers were not associated with SBA titres. There were significant negative associations between SBA titres at M13 and cytokine expression at M7 and M12. Conclusion: Induction of persistent polysaccharide-specific memory B cells prior to boosting is an important determinant of secondary IgG responses in infants. However, polysaccharide-specific functional IgG responses appear to be independent of the number and quality of circulating carrier-specific CD4+ T cells after priming. PMID:26191794

  2. Alpha Thalassemia


    ... an apparently normal individual has a child with hemoglobin H disease or alpha thalassemia minor. It can ... gene on one chromosome 25% 25% 25% 25% hemoglobin H disease there is a 25% chance with ...

  3. Alpha proton x ray spectrometer

    NASA Technical Reports Server (NTRS)

    Rieder, Rudi; Waeke, H.; Economou, T.


    Mars Pathfinder will carry an alpha-proton x ray spectrometer (APX) for the determination of the elemental chemical composition of Martian rocks and soils. The instrument will measure the concentration of all major and some minor elements, including C, N, and O at levels above typically 1 percent.

  4. Expression of the standard scorpion alpha-toxin AaH II and AaH II mutants leading to the identification of some key bioactive elements.


    Legros, Christian; Céard, Brigitte; Vacher, Hélène; Marchot, Pascale; Bougis, Pierre E; Martin-Eauclaire, Marie-France


    The AaH II toxin from the scorpion Androctonus australis Hector is considered to be the standard alpha-toxin because it selectively binds with the highest known affinity to site 3 of mammalian voltage-activated Na+ channels (Na(v)) on rat brain synaptosomes but does not bind to insect synaptosomes. We generated two different constructs in pMALp allowing us to produce AaH II fused with the maltose-binding protein (MBP) in E. coli. We obtained reasonable amounts of recombinant AaH II after cleavage by enterokinase at the site DDDDK. We show that the introduction of a net negative charge at the C-terminus by the suppression of H64 amidation and the addition of an extra residue to the C-terminus (G65) led to fully active AaH II mutants, exhibiting exactly the same affinity as the native toxin for its target on rat brain synaptosomes. In contrast, the mutation of residue K58 into V, I or E residues drastically reduced toxin activity. PMID:15725394

  5. Alpha-1 Antitrypsin Deficiency


    ... Liver Disease Information > Alpha-1 Antitrypsin Deficiency Alpha-1 Antitrypsin Deficiency Explore this section to learn more about alpha-1 antitrypsin deficiency, including a description of the disorder ...

  6. Nuclear-structure dependence of O (. alpha. ) corrections to Fermi decays and the value of the Kobayashi-Maskawa matrix element V sub ud

    SciTech Connect

    Jaus, W.; Rasche, G. )


    We calculate nuclear-structure corrections to the {ital ft} values of the eight accurately measured superallowed {beta}{sup +} decays. The statistical fit for the average {ital ft} value is very good. The resulting new value for the matrix element of the Kobayashi-Maskawa (KM) matrix is {vert bar}{ital V}{sub {ital ud}}{vert bar}=0.9735(5). The error in {vert bar}{ital V}{sub {ital ud}}{vert bar} has thus been reduced by 50%. Combining this value for {vert bar}{ital V}{sub {ital ud}}{vert bar} with the presently accepted results from kaon-, hyperon-, and {ital B}-decay constraints, the unitarity of the KM matrix for three generations of quarks seems to be violated.

  7. Finite Element Method (FEM) Calculations of Stress-Strain Behavior of Alpha-Beta Ti-Mn Alloys: Part I. Stress-Strain Relations

    NASA Astrophysics Data System (ADS)

    Ankem, Sreeramamurthy; Margolin, Harold


    By use of a NASTRAN18 Computer Program, the Finite Element Method (FEM) has been employed to calculate the effect of particle size, matrix, and volume fraction on the stress-strain relations of α -β titanium alloys. It was found that for a given volume fraction, the calculated stress-strain curve was higher for a finer particle size than for a coarse particle size within the range of the strains considered, and this behavior was seen for all the different volume fraction alloys considered. For a 50:50 vol pct α -β alloy, the stress-strain curve with β, the stronger phase, as the matrix was higher than that with α, the softer phase, as the matrix. The calculated stress-strain curves for four different vol pct α alloys were compared with their corresponding experimental curves, and in general, good agreement was found. Whenever there were discrepancies, they were discussed by comparing the morphology of the mesh used in the calculations with the morphology of the actual materials.

  8. The HIF1alpha-inducible pro-cell death gene BNIP3 is a novel target of SIM2s repression through cross-talk on the hypoxia response element.


    Farrall, A L; Whitelaw, M L


    The short isoform of single-minded 2 (SIM2s), a basic helix-loop-helix/PAS (bHLH/PAS) transcription factor, is upregulated in pancreatic and prostate tumours; however, a mechanistic role for SIM2s in these cancers is unknown. Microarray studies in prostate DU145 cells identified the pro-cell death gene, BNIP3 (Bcl-2/adenovirus E1B 19 kDa interacting protein 3), as a novel putative target of SIM2s repression. Further validation showed BNIP3 repression in several prostate and pancreatic carcinoma-derived cell lines with ectopic expression of human SIM2s. BNIP3 levels are enhanced in prostate carcinoma cells upon short interfering (si)RNA-mediated knockdown of endogenous SIM2s. Chromatin immunoprecipitation and promoter studies show that SIM2s represses BNIP3 through its activities at the proximal promoter hypoxia response element (HRE), the site through which the bHLH/PAS family member, hypoxia-inducible factor 1alpha (HIF1alpha), induces BNIP3. SIM2s attenuates BNIP3 hypoxic induction via the HRE, and increased hypoxic induction of BNIP3 occurs with siRNA knockdown of endogenous SIM2s in prostate PC3AR+ cells. BNIP3 is implicated in hypoxia-induced cell death processes. Prolonged treatment of PC3AR+ cells with hypoxia mimetics, DP and DMOG, confers hypoxia-induced autophagy, measured by enhanced LC3-II levels and SQSTM1/p62 turnover. We show that PC3AR+ cells expressing ectopic SIM2s have enhanced survival in these conditions. Induction of LC3-II and turnover of SQSTM1/p62 are attenuated in PC3AR+/SIM2s DMOG and hypoxia-treated cells, suggesting that SIM2s may attenuate autophagic cell death processes, perhaps through BNIP3 repression. These data show, for the first time, SIM2s cross-talk on an endogenous HRE. SIM2s' functional interference with HIF1alpha activities on BNIP3 may indicate a novel role for SIM2s in promoting tumourigenesis. PMID:19668230

  9. Protein and DNA elements involved in transactivation of the promoter of the bovine herpesvirus (BHV) 1 IE-1 transcription unit by the BHV alpha gene trans-inducing factor.

    PubMed Central

    Misra, V; Bratanich, A C; Carpenter, D; O'Hare, P


    In herpes simplex virus (HSV)-infected cells, the transcription of immediate-early (alpha) genes is regulated by a virion component, the alpha gene trans-inducing factor (alpha TIF). This protein forms a complex with cellular factors and TAATGARAT motifs present in one or more copies in the promoters of all alpha genes. We have characterized the bovine herpesvirus 1 (BHV-1) homolog of this protein. Like its HSV counterpart, the BHV alpha TIF was synthesized in the later stages of infection and could be demonstrated to be a component of purified virions. In transient expression assays, BHV alpha TIF was a strong transactivator and stimulated the activity of IE-1, the major BHV-1 alpha gene promoter, with an efficiency comparable to that of HSV alpha TIF. This stimulation was largely dependent on a TAATGAGCT sequence present in a single copy in IE-1, and BHV alpha TIF, in conjunction with cellular factors, formed a complex with oligonucleotides containing this sequence. Despite these similarities between the two alpha TIFs, our preliminary observations suggest that the proteins may activate transcription by different mechanisms. Although BHV alpha TIF strongly transactivated IE-1, it differed from its HSV counterpart in that the carboxyl terminus of BHV alpha TIF, when fused to the DNA-binding domain of GAL4, was a relatively poor stimulator of a promoter containing GAL4-binding sites. Also unlike HSV alpha TIF, removal of the carboxyl terminus of BHV alpha TIF reduced but did not eliminate the ability of the protein to transactivate IE-1. These results are discussed in view of the structural similarities and differences among the alpha TIFs of alphaherpes-viruses. Images PMID:8035488

  10. Safety, immune lot-to-lot consistency and non-inferiority of a fully liquid pentavalent DTwp-HepB-Hib vaccine in healthy Indian toddlers and infants

    PubMed Central

    Gandhi, Dulari J.; Dhaded, Sangappa M.; Ravi, Mandyam D.; Dubey, Anand P.; Kundu, Ritabrata; Lalwani, Sanjay K.; Chhatwal, Jugesh; Mathew, Leni G.; Gupta, Madhu; Sharma, Shiv D.; Bavdekar, Sandeep B.; Jayanth, Midde V.; Ravinuthala, Suresh; Sil, Arijit; Dhingra, Mandeep S.


    ABSTRACT Pentavalent combination vaccines are important tools to strengthen the immunization programs in numerous countries throughout the world. A large number of countries have recognized the value of combination vaccines and have introduced whole cell pentavalent vaccines into their immunization programs. A phase III, multi-center, randomized, single blinded study of a fully liquid pentavalent DTwP-HepB-Hib investigational vaccine (Shan5™) was conducted across India in 2 cohorts: 15 toddlers were evaluated for safety and immunogenicity following a single booster dose (Cohort 1) followed by 1085 infants (Cohort 2) evaluated for immunogenicity and safety following 3-dose primary immunization of the investigational vaccine or a locally licensed comparator vaccine (Pentavac SD). Immune consistency analysis among 3 lots of the investigational vaccine, and immune non-inferiority analysis of pooled (3 lots) data of investigational vaccine vs. comparator vaccine were carried out in cohort 2. The vaccines demonstrated comparable safety and immune responses in cohort 1. In cohort 2, equivalent immune consistency among 3 lots was observed for all antigens except whole cell pertussis antigens, where a marginal variation was observed which was linked to the low power of the test and concluded to not have any clinical significance. Immune non-inferiority against the comparator vaccine was demonstrated for all 5 antigens. Safety results were comparable between vaccine groups. This investigational, fully-liquid, whole-cell pertussis (wP) containing new pentavalent vaccine was found to be safe and immunologically non-inferior to the licensed comparator vaccine. PMID:26580093

  11. Safety, immune lot-to-lot consistency and non-inferiority of a fully liquid pentavalent DTwp-HepB-Hib vaccine in healthy Indian toddlers and infants.


    Gandhi, Dulari J; Dhaded, Sangappa M; Ravi, Mandyam D; Dubey, Anand P; Kundu, Ritabrata; Lalwani, Sanjay K; Chhatwal, Jugesh; Mathew, Leni G; Gupta, Madhu; Sharma, Shiv D; Bavdekar, Sandeep B; Jayanth, Midde V; Ravinuthala, Suresh; Sil, Arijit; Dhingra, Mandeep S


    Pentavalent combination vaccines are important tools to strengthen the immunization programs in numerous countries throughout the world. A large number of countries have recognized the value of combination vaccines and have introduced whole cell pentavalent vaccines into their immunization programs. A phase III, multi-center, randomized, single blinded study of a fully liquid pentavalent DTwP-HepB-Hib investigational vaccine (Shan5™) was conducted across India in 2 cohorts: 15 toddlers were evaluated for safety and immunogenicity following a single booster dose (Cohort 1) followed by 1085 infants (Cohort 2) evaluated for immunogenicity and safety following 3-dose primary immunization of the investigational vaccine or a locally licensed comparator vaccine (Pentavac SD). Immune consistency analysis among 3 lots of the investigational vaccine, and immune non-inferiority analysis of pooled (3 lots) data of investigational vaccine vs. comparator vaccine were carried out in cohort 2. The vaccines demonstrated comparable safety and immune responses in cohort 1. In cohort 2, equivalent immune consistency among 3 lots was observed for all antigens except whole cell pertussis antigens, where a marginal variation was observed which was linked to the low power of the test and concluded to not have any clinical significance. Immune non-inferiority against the comparator vaccine was demonstrated for all 5 antigens. Safety results were comparable between vaccine groups. This investigational, fully-liquid, whole-cell pertussis (wP) containing new pentavalent vaccine was found to be safe and immunologically non-inferior to the licensed comparator vaccine. PMID:26580093

  12. Alpha-1 Antitrypsin Deficiency


    ... from the NHLBI on Twitter. What Is Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (an-tee-TRIP-sin) deficiency, or AAT ... as it relates to lung disease. Overview Alpha-1 antitrypsin, also called AAT, is a protein made ...

  13. Bezafibrate at clinically relevant doses decreases serum/liver triglycerides via down-regulation of sterol regulatory element-binding protein-1c in mice: a novel peroxisome proliferator-activated receptor alpha-independent mechanism.


    Nakajima, Takero; Tanaka, Naoki; Kanbe, Hiroki; Hara, Atsushi; Kamijo, Yuji; Zhang, Xiaowei; Gonzalez, Frank J; Aoyama, Toshifumi


    The triglyceride-lowering effect of bezafibrate in humans has been attributed to peroxisome proliferator-activated receptor (PPAR) alpha activation based on results from rodent studies. However, the bezafibrate dosages used in conventional rodent experiments are typically higher than those in clinical use (> or =50 versus < or =10 mg/kg/day), and thus it remains unclear whether such data can be translated to humans. Furthermore, because bezafibrate is a pan-PPAR activator, the actual contribution of PPARalpha to its triglyceride-lowering properties remains undetermined. To address these issues, bezafibrate at clinically relevant doses (10 mg/kg/day; low) was administered to wild-type and Ppara-null mice, and its effects were compared with those from conventionally used doses (100 mg/kg/day; high). Pharmacokinetic analyses showed that maximum plasma concentration and area under the concentration-time curve in bezafibrate-treated mice were similar to those in humans at low doses, but not at high doses. Low-dose bezafibrate decreased serum/liver triglycerides in a PPARalpha-independent manner by attenuation of hepatic lipogenesis and triglyceride secretion. It is noteworthy that instead of PPAR activation, down-regulation of sterol regulatory element-binding protein (SREBP)-1c was observed in mice undergoing low-dose treatment. High-dose bezafibrate decreased serum/liver triglycerides by enhancement of hepatic fatty acid uptake and beta-oxidation via PPARalpha activation, as expected. In conclusion, clinically relevant doses of bezafibrate exert a triglyceride-lowering effect by suppression of the SREBP-1c-regulated pathway in mice and not by PPARalpha activation. Our results may provide novel information about the pharmacological mechanism of bezafibrate action and new insights into the treatment of disorders involving SREBP-1c. PMID:19124612

  14. p53-independent activation of the hdm2-P2 promoter through multiple transcription factor response elements results in elevated hdm2 expression in estrogen receptor alpha-positive breast cancer cells.


    Phelps, Monika; Darley, Matthew; Primrose, John N; Blaydes, Jeremy P


    The negative-regulatory feedback loop between p53 and hdm2 forms part of a finely balanced regulatory network of proteins that controls cell cycle progression and commitment to apoptosis. Expression of hdm2, and its mouse orthologue mdm2, is known to be induced by p53, but recent evidence has demonstrated mdm2 expression can also be regulated via p53-independent pathways. However the p53 independent mechanisms that control transcription of the human hdm2 gene have not been studied. Differential levels of hdm2 mRNA and protein expression have been reported in several types of human malignancy, including breast cancers in which hdm2 expression correlates with positive estrogen receptor alpha (ERalpha) status. Experimental models have demonstrated that hdm2 overexpression can promote breast cancer development. Here, we show that the elevated level of hdm2 protein in ERalpha(+ve) breast cancer cell lines such as MCF-7 and T47D is because of transcription from the p53-inducible P2 promoter of hdm2. The P2 promoter is inactive in ERalpha(-ve) cell lines such as SKBr3. Hdm2-P2 promoter activity in T47D cells is independent of p53, as well as of known regulators of the mouse mdm2-P2 promoter, including ERalpha and ras-raf-mitogen-activated protein/extracellular signal-regulated kinase (MEK) mitogen-activated protein kinase (MAPK) signaling. We show that hdm2-P2 activity in T47D cells is dependent on the integrity of both an evolutionarily conserved composite binding site for AP1 and ETS family transcription factors (AP1-ETS) and a nonconserved upstream (nnGGGGC)(5) repeat sequence. Lack of hdm2-P2 activity in ERalpha(-ve) cells is shown to be a consequence of reduced transcriptional activation through the AP1-ETS element. Overexpression of ETS2 in SKBr3 cells reconstitutes AP1-ETS element-dependent hdm2-P2 promoter activity, resulting in increased levels of hdm2 protein in the cells. Our findings support the hypothesis that the elevated levels of hdm2 expression reported

  15. Space Station alpha joint bearing

    NASA Technical Reports Server (NTRS)

    Everman, Michael R.; Jones, P. Alan; Spencer, Porter A.


    Perhaps the most critical structural system aboard the Space Station is the Solar Alpha Rotary Joint which helps align the power generation system with the sun. The joint must provide structural support and controlled rotation to the outboard transverse booms as well as power and data transfer across the joint. The Solar Alpha Rotary Joint is composed of two transition sections and an integral, large diameter bearing. Alpha joint bearing design presents a particularly interesting problem because of its large size and need for high reliability, stiffness, and on orbit maintability. The discrete roller bearing developed is a novel refinement to cam follower technology. It offers thermal compensation and ease of on-orbit maintenance that are not found in conventional rolling element bearings. How the bearing design evolved is summarized. Driving requirements are reviewed, alternative concepts assessed, and the selected design is described.

  16. A Rainbow of Martian Elements

    NASA Technical Reports Server (NTRS)


    This graph or spectrum taken by the alpha particle X-ray spectrometer onboard the Mars Exploration Rover Spirit shows the variety of elements present in the soil at the rover's landing site. In agreement with past missions to Mars, iron and silicon make up the majority of the martian soil. Sulfur and chlorine were also observed as expected. Trace elements detected for the first time include zinc and nickel. These latter observations demonstrate the power of the alpha particle X-ray spectrometer to pick up the signatures of elements too faint to be seen before. The alpha particle X-ray spectrometer uses alpha particles and X-rays to measure the presence and abundance of all major rock-forming elements except hydrogen.

  17. Beteigeuze (Alpha Orionis) und Mintaka (Delta Orionis)

    NASA Astrophysics Data System (ADS)

    Vollmann, Wolfgang


    Magnitude measures transformed to Johnson V of Alpha Orionis (Betelgeuse) and Delta Orionis with a wide-angle lens and DSLR are presented and discussed. Alpha Orionis light changes are shown clearly. The primary and secondary eclipses of Delta Orionis with amplitudes of 0.12 and 0.05 mag respectively are clearly recorded. They occur near phase 0.00 and 0.50 respectively of current elements from VSX (2).

  18. Ab initio alpha-alpha scattering

    NASA Astrophysics Data System (ADS)

    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A.; Luu, Thomas; Meißner, Ulf-G.


    Processes such as the scattering of alpha particles (4He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei—nuclei with even and equal numbers of protons and neutrons—is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the ‘adiabatic projection method’ to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  19. Ab initio alpha-alpha scattering.


    Elhatisari, Serdar; Lee, Dean; Rupak, Gautam; Epelbaum, Evgeny; Krebs, Hermann; Lähde, Timo A; Luu, Thomas; Meißner, Ulf-G


    Processes such as the scattering of alpha particles ((4)He), the triple-alpha reaction, and alpha capture play a major role in stellar nucleosynthesis. In particular, alpha capture on carbon determines the ratio of carbon to oxygen during helium burning, and affects subsequent carbon, neon, oxygen, and silicon burning stages. It also substantially affects models of thermonuclear type Ia supernovae, owing to carbon detonation in accreting carbon-oxygen white-dwarf stars. In these reactions, the accurate calculation of the elastic scattering of alpha particles and alpha-like nuclei--nuclei with even and equal numbers of protons and neutrons--is important for understanding background and resonant scattering contributions. First-principles calculations of processes involving alpha particles and alpha-like nuclei have so far been impractical, owing to the exponential growth of the number of computational operations with the number of particles. Here we describe an ab initio calculation of alpha-alpha scattering that uses lattice Monte Carlo simulations. We use lattice effective field theory to describe the low-energy interactions of protons and neutrons, and apply a technique called the 'adiabatic projection method' to reduce the eight-body system to a two-cluster system. We take advantage of the computational efficiency and the more favourable scaling with system size of auxiliary-field Monte Carlo simulations to compute an ab initio effective Hamiltonian for the two clusters. We find promising agreement between lattice results and experimental phase shifts for s-wave and d-wave scattering. The approximately quadratic scaling of computational operations with particle number suggests that it should be possible to compute alpha scattering and capture on carbon and oxygen in the near future. The methods described here can be applied to ultracold atomic few-body systems as well as to hadronic systems using lattice quantum chromodynamics to describe the interactions of

  20. alpha-Hexachlorocyclohexane (alpha-HCH)

    Integrated Risk Information System (IRIS)

    alpha - Hexachlorocyclohexane ( alpha - HCH ) ; CASRN 319 - 84 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Ass

  1. Alpha-1 Antitrypsin Test


    ... measures the level of the protein AAT in blood. Alpha-1 antitrypsin phenotype testing evaluates the amount and type of AAT being produced and compares it to normal patterns. Alpha-1 antitrypsin genotype testing ( DNA testing) can ...

  2. Alpha-1 antitrypsin test


    ... page: // Alpha-1 antitrypsin test To use the sharing features on this page, please enable JavaScript. Alpha-1 antitrypsin is a laboratory test to measure the ...

  3. The Alpha Centauri System.

    ERIC Educational Resources Information Center

    Soderblom, David R.


    Describes the Alpha Centauri star system, which is the closest star system to the sun. Discusses the difficulties associated with measurements involving Alpha Centauri, along with some of the recent advances in stellar seismology. Raises questions about the possibilities of planets around Alpha Centauri. (TW)

  4. Discovery of element 112

    SciTech Connect

    Hofmann, S.


    The new elements 110, 111, and 112 were synthesized and unambiguously identified in experiments at SHIP. Due to strong shell effects the dominant decay mode is not fission, but emission of alpha particles. Theoretical investigations predict that maximum shell effects should exist in nuclei near proton number 114 and neutron number 184. Measurements give hope that isotopes of element 114 close to the island of spherical Superheavy Elements could be produced by fusion reactions using {sup 118}Pb as target. systematic studies of the reaction cross-sections indicate that transfer of nucleons is the important process to initiate the fusion.

  5. Calibration issues in delta alpha /alpha .

    NASA Astrophysics Data System (ADS)

    Molaro, Paolo; Centurión, Miriam; Levshakov, Sergei

    Laser Comb Wavelength calibration shows that the ThAr one is locally unreliable with possible deviations of up to 100 {m s}-1 within one order range, while delivering an overall 1 {m s}-1 accuracy (Wilken et al 2009). Such deviation corresponds to delta alpha /alpha ≈ 7* 10-6 for a Fe II-Mg II pair. Comparison of line shifts among the 5 Fe II lines, with almost identical sensitivity to fine structure constant changes, offers a clean way to directly test the presence of possible local wavelength calibration errors of whatever origin. We analyzed 5 absorption systems, with zabs ranging from 1.15 to 2.19 towards 3 bright QSOs. The results show that while some lines are aligned within 20 {m s}-1, others reveal large deviations reaching 200 {m s}-1 or higher and corresponding to a delta alpha /alpha > 10-5 level. The origin of these deviations is not clearly identified but could be related to the adaptation of wavelength calibration to CCD manufacturing irregularities. These results suggest that to draw conclusions from delta alpha /alpha analysis based on one or only few lines must be done with extreme care.

  6. alpha-decay half-lives and Q{sub a}lpha values of superheavy nuclei

    SciTech Connect

    Dong Jianmin; Zuo Wei; Gu Jianzhong; Wang Yanzhao; Peng Bangbao


    The alpha-decay half-lives of recently synthesized superheavy nuclei (SHN) are investigated by employing a unified fission model (UFM) where a new method to calculate the assault frequency of alpha emission is used. The excellent agreement with the experimental data indicates the UFM is a useful tool to investigate these alpha decays. It is found that the alpha-decay half-lives become more and more insensitive to the Q{sub a}lpha values as the atomic number increases on the whole, which is favorable for us to predict the half-lives of SHN. In addition, a formula is proposed to compute the Q{sub a}lpha values for the nuclei with Z>=92 and N>=140 with a good accuracy, according to which the long-lived SHN should be neutron rich. Several weeks ago, two isotopes of a new element with atomic number Z=117 were synthesized and their alpha-decay chains have been observed. The Q{sub a}lpha formula is found to work well for these nuclei, confirming its predictive power. The experimental half-lives are well reproduced by employing the UFM with the experimental Q{sub a}lpha values. This fact that the experimental half-lives are compatible with experimental Q{sub a}lpha values supports the synthesis of a new element 117 and the experimental measurements to a certain extent.

  7. [Alpha1-adrenoceptor subtypes and alpha1-adrenoceptor antagonists].


    Muramatsu, Ikunobu; Suzuki, Fumiko; Tanaka, Takashi; Yamamoto, Hatsumi; Morishima, Shigeru


    Alpha(1)-adrenoceptors are widely distributed in the human body and play important physiologic roles. Three alpha(1)-adrenoceptor subtypes (alpha(1A), alpha(1B) and alpha(1D)) have been cloned and show different pharmacologic profiles. In addition, a putative alpha(1)-adrenoceptor (alpha(1L) subtype) has also been proposed. Recently, three drugs (tamsulosin, naftopidil, and silodosin) have been developed in Japan for the treatment of urinary obstruction in patients with benign prostatic hyperplasia. In this review, we describe recent alpha(1)-adrenoceptor subclassifications and the pharmacologic characteristics (subtype selectivity and clinical relevance) of alpha(1)-adrenoceptor antagonists. PMID:16518082

  8. Molecular cloning and characterization of the Xenopus hypoxia-inducible factor 1alpha (xHIF1alpha).


    de Beaucourt, Arnaud; Coumailleau, Pascal


    We report the molecular cloning and the characterization of the Xenopus homolog of mammalian hypoxia-inducible factor 1alpha (HIF1alpha), a member of the bHLH/PAS transcription factor family. Searches in Xenopus genome sequences and phylogenetic analysis reveal the existence of HIF1alpha and HIF2alpha paralogs in the Xenopus laevis species. Sequence data analyses indicate that the organization of protein domains in Xenopus HIF1alpha (xHIF1alpha) is strongly conserved. We also show that xHIF1alpha heterodimerizes with the Xenopus Arnt1 protein (xArnt1) with the proteic complex being mediated by the HLH and PAS domains. Subcellular analysis in a Xenopus XTC cell line using chimeric GFP constructs show that over-expression of xHIF1alpha and xArnt1 allows us to detect the xHIF1alpha/xArnt1 complex in the nucleus, but only in the presence of both partners. Further analyses in XTC cell line show that over-producing xHIF1alpha and xArnt1 mediates trans-activation of the hypoxia response element (HRE) reporter. The trans-activation level can be increased in hypoxia conditions. Interestingly such trans-activation properties can be also observed when human Arnt1 is used together with the xHIF1alpha. PMID:17471499

  9. Alternate Alpha Induced Reactions for NIF Radiochemistry

    SciTech Connect

    Shaughnessy, D A; Moody, K J; Bernstein, L A


    Radiochemical analysis of NIF capsule residues has been identified as a potential diagnostic of NIF capsule performance. In particular, alpha-induced nuclear reactions that occur on tracer elements added to the NIF capsule have been shown through simulation to be a very sensitive diagnostic for mix. The short range of the alpha particles makes them representative of the hot spot where they are created through the fusion of deuterium and tritium. Reactions on elements doped into the innermost part of the capsule ablator would therefore be sensitive to material that had mixed into the hot spot. Radiochemical determinations of activated detector elements may perhaps be the only true measure of mix that occurs in a NIF capsule, particularly in cases when the capsule fails.

  10. Event counting alpha detector


    Bolton, Richard D.; MacArthur, Duncan W.


    An electrostatic detector for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure.

  11. Alpha-particle diagnostics

    SciTech Connect

    Young, K.M.


    This paper will focus on the state of development of diagnostics which are expected to provide the information needed for {alpha}- physics studies in the future. Conventional measurement of detailed temporal and spatial profiles of background plasma properties in DT will be essential for such aspects as determining heating effectiveness, shaping of the plasma profiles and effects of MHD, but will not be addressed here. This paper will address (1) the measurement of the neutron source, and hence {alpha}-particle birth profile, (2) measurement of the escaping {alpha}-particles and (3) measurement of the confined {alpha}-particles over their full energy range. There will also be a brief discussion of (4) the concerns about instabilities being generated by {alpha}-particles and the methods necessary for measuring these effects. 51 refs., 10 figs.

  12. Imaging alpha particle detector


    Anderson, D.F.


    A method and apparatus for detecting and imaging alpha particles sources is described. A dielectric coated high voltage electrode and a tungsten wire grid constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source to be quantitatively or qualitatively analyzed. A thin polyester film window allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  13. Imaging alpha particle detector


    Anderson, David F.


    A method and apparatus for detecting and imaging alpha particles sources is described. A conducting coated high voltage electrode (1) and a tungsten wire grid (2) constitute a diode configuration discharge generator for electrons dislodged from atoms or molecules located in between these electrodes when struck by alpha particles from a source (3) to be quantitatively or qualitatively analyzed. A thin polyester film window (4) allows the alpha particles to pass into the gas enclosure and the combination of the glass electrode, grid and window is light transparent such that the details of the source which is imaged with high resolution and sensitivity by the sparks produced can be observed visually as well. The source can be viewed directly, electronically counted or integrated over time using photographic methods. A significant increase in sensitivity over other alpha particle detectors is observed, and the device has very low sensitivity to gamma or beta emissions which might otherwise appear as noise on the alpha particle signal.

  14. Event counting alpha detector


    Bolton, R.D.; MacArthur, D.W.


    An electrostatic detector is disclosed for atmospheric radon or other weak sources of alpha radiation. In one embodiment, nested enclosures are insulated from one another, open at the top, and have a high voltage pin inside and insulated from the inside enclosure. An electric field is produced between the pin and the inside enclosure. Air ions produced by collision with alpha particles inside the decay volume defined by the inside enclosure are attracted to the pin and the inner enclosure. With low alpha concentrations, individual alpha events can be measured to indicate the presence of radon or other alpha radiation. In another embodiment, an electrical field is produced between parallel plates which are insulated from a single decay cavity enclosure. 6 figs.

  15. Nuclear localization signal receptor importin alpha associates with the cytoskeleton.

    PubMed Central

    Smith, H M; Raikhel, N V


    Importin alpha is the nuclear localization signal (NLS) receptor that is involved in the nuclear import of proteins containing basic NLSs. Using importin alpha as a tool, we were interested in determining whether the cytoskeleton could function in the transport of NLS-containing proteins from the cytoplasm to the nucleus. Double-labeling immunofluorescence studies showed that most of the cytoplasmic importin alpha coaligned with microtubules and microfilaments in tobacco protoplasts. Treatment of tobacco protoplasts with microtubule- or microfilament-depolymerizing agents disrupted the strands of importin alpha in the cytoplasm, whereas a microtubule-stabilizing agent had no effect. Biochemical analysis showed that importin alpha associated with microtubules and microfilaments in vitro in an NLS-dependent manner. The interaction of importin alpha with the cytoskeleton could be an essential element of protein transport from the cytoplasm to the nucleus in vivo. PMID:9811789

  16. The alpha channeling effect

    SciTech Connect

    Fisch, N. J.


    Alpha particles born through fusion reactions in a tokamak reactor tend to slow down on electrons, but that could take up to hundreds of milliseconds. Before that happens, the energy in these alpha particles can destabilize on collisionless timescales toroidal Alfven modes and other waves, in a way deleterious to energy confinement. However, it has been speculated that this energy might be instead be channeled into useful energy, so as to heat fuel ions or to drive current. Such a channeling needs to be catalyzed by waves Waves can produce diffusion in energy of the alpha particles in a way that is strictly coupled to diffusion in space. If these diffusion paths in energy-position space point from high energy in the center to low energy on the periphery, then alpha particles will be cooled while forced to the periphery. The energy from the alpha particles is absorbed by the wave. The amplified wave can then heat ions or drive current. This process or paradigm for extracting alpha particle energy collisionlessly has been called alpha channeling. While the effect is speculative, the upside potential for economical fusion is immense. The paradigm also operates more generally in other contexts of magnetically confined plasma.


    SciTech Connect

    Seon, Kwang-Il; Witt, Adolf N.


    It is known that the diffuse H{alpha} emission outside of bright H II regions not only are very extended, but also can occur in distinct patches or filaments far from H II regions, and the line ratios of [S II] {lambda}6716/H{alpha} and [N II] {lambda}6583/H{alpha} observed far from bright H II regions are generally higher than those in the H II regions. These observations have been regarded as evidence against the dust-scattering origin of the diffuse H{alpha} emission (including other optical lines), and the effect of dust scattering has been neglected in studies on the diffuse H{alpha} emission. In this paper, we reexamine the arguments against dust scattering and find that the dust-scattering origin of the diffuse H{alpha} emission cannot be ruled out. As opposed to the previous contention, the expected dust-scattered H{alpha} halos surrounding H II regions are, in fact, in good agreement with the observed H{alpha} morphology. We calculate an extensive set of photoionization models by varying elemental abundances, ionizing stellar types, and clumpiness of the interstellar medium (ISM) and find that the observed line ratios of [S II]/H{alpha}, [N II]/H{alpha}, and He I {lambda}5876/H{alpha} in the diffuse ISM accord well with the dust-scattered halos around H II regions, which are photoionized by late O- and/or early B-type stars. We also demonstrate that the H{alpha} absorption feature in the underlying continuum from the dust-scattered starlight ({sup d}iffuse galactic light{sup )} and unresolved stars is able to substantially increase the [S II]/H{alpha} and [N II]/H{alpha} line ratios in the diffuse ISM.

  18. Alpha-thalassaemia.


    Harteveld, Cornelis L; Higgs, Douglas R


    Alpha-thalassaemia is inherited as an autosomal recessive disorder characterised by a microcytic hypochromic anaemia, and a clinical phenotype varying from almost asymptomatic to a lethal haemolytic anaemia.It is probably the most common monogenic gene disorder in the world and is especially frequent in Mediterranean countries, South-East Asia, Africa, the Middle East and in the Indian subcontinent. During the last few decades the incidence of alpha thalassaemia in North-European countries and Northern America has increased because of demographic changes. Compound heterozygotes and some homozygotes have a moderate to severe form of alpha thalassaemia called HbH disease. Hb Bart's hydrops foetalis is a lethal form in which no alpha-globin is synthesized. Alpha thalassaemia most frequently results from deletion of one or both alpha genes from the chromosome and can be classified according to its genotype/phenotype correlation. The normal complement of four functional alpha-globin genes may be decreased by 1, 2, 3 or all 4 copies of the genes, explaining the clinical variation and increasing severity of the disease. All affected individuals have a variable degree of anaemia (low Hb), reduced mean corpuscular haemoglobin (MCH/pg), reduced mean corpuscular volume (MCV/fl) and a normal/slightly reduced level of HbA2. Molecular analysis is usually required to confirm the haematological observations (especially in silent alpha-thalassaemia and alpha-thalassaemia trait). The predominant features in HbH disease are anaemia with variable amounts of HbH (0.8-40%). The type of mutation influences the clinical severity of HbH disease. The distinguishing features of the haemoglobin Bart's hydrops foetalis syndrome are the presence of Hb Bart's and the total absence of HbF. The mode of transmission of alpha thalassaemia is autosomal recessive. Genetic counselling is offered to couples at risk for HbH disease or haemoglobin Bart's Hydrops Foetalis Syndrome. Carriers of alpha+- or

  19. Cobalt inhibits the interaction between hypoxia-inducible factor-alpha and von Hippel-Lindau protein by direct binding to hypoxia-inducible factor-alpha.


    Yuan, Yong; Hilliard, George; Ferguson, Tsuneo; Millhorn, David E


    The hypoxia-inducible factor (HIF) activates the expression of genes that contain a hypoxia response element. The alpha-subunits of the HIF transcription factors are degraded by proteasomal pathways during normoxia but are stabilized under hypoxic conditions. The von Hippel-Lindau protein (pVHL) mediates the ubiquitination and rapid degradation of HIF-alpha (including HIF-1alpha and HIF-2alpha). Post-translational hydroxylation of a proline residue in the oxygen-dependent degradation (ODD) domain of HIF-alpha is required for the interaction between HIF and VHL. It has previously been established that cobalt mimics hypoxia and causes accumulation of HIF-1alpha and HIF-2alpha. However, little is known about the mechanism by which this occurs. In an earlier study, we demonstrated that cobalt binds directly to the ODD domain of HIF-2alpha. Here we provide the first evidence that cobalt inhibits pVHL binding to HIF-alpha even when HIF-alpha is hydroxylated. Deletion of 17 amino acids within the ODD domain of HIF-2alpha that are required for pVHL binding prevented the binding of cobalt and stabilized HIF-2alpha during normoxia. These findings show that cobalt mimics hypoxia, at least in part, by occupying the VHL-binding domain of HIF-alpha and thereby preventing the degradation of HIF-alpha. PMID:12606543

  20. Direct correlation between a negative autoregulatory response element at the cap site of the herpes simplex virus type 1 IE175 (alpha 4) promoter and a specific binding site for the IE175 (ICP4) protein.

    PubMed Central

    Roberts, M S; Boundy, A; O'Hare, P; Pizzorno, M C; Ciufo, D M; Hayward, G S


    In transient-expression assays, the IE175 (alpha 4) promoter region of herpes simple virus is down-regulated after cotransfection with DNA encoding its own protein product (IE175 or ICP4). The inhibition by IE175 proved to be highly specific for its own promoter region and did not act on either the herpes simplex virus type 1 IE110 (alpha 0) or human cytomegalovirus major immediate-early promoters. Furthermore, the inhibition was still exhibited by IE175 effector plasmids driven by strong heterologous promoters and therefore must be a direct autoregulatory response that cannot be explained by promoter competition effects. In gel mobility retardation assays with infected-cell nuclear extracts, a prominent and specific DNA-protein complex was formed with DNA fragments containing sequences from -108 to +30 in the IE175 promoter region. This activity was not present in mock-infected samples. Even stronger binding occurred with a fragment containing sequences from -128 to +120 in the IE110 promoter, but this second locus was not associated with any detectable response phenotype in cotransfection assays. Supershift experiments with an anti-IE175 monoclonal antibody confirmed the presence of the IE175 protein in both DNA-protein complexes. In the IE175 promoter, specific binding correlated closely with the presence of an intact autoregulatory signal near the cap site as judged by the loss of both activities in a 3'-deleted promoter fragment lacking sequences from -7 to +30. Insertion of a cloned 30-mer synthetic oligonucleotide sequence from positions -8 to +18 in IE175 restored both IE175 binding activity and the down-regulation phenotype. Direct shift-up assays with a similar 30-base-pair (bp) oligonucleotide containing 21 bp from positions -75 to -55 of IE110 (which encompasses a consensus ATCGTC motif) also produced a specific DNA-protein complex containing the IE175 protein. This ATCGTC motif proved to be a necessary component of both the IE110 and IE175 binding

  1. An alpha particle instrument with alpha, proton, and X-ray modes for planetary chemical analyses

    NASA Technical Reports Server (NTRS)

    Economou, T. E.; Turkevich, A. L.


    The interaction of alpha particles with matter is employed in a compact instrument that could provide rather complete in-situ chemical analyses of surfaces and thin atmospheres of extraterrestrial bodies. The instrument is a miniaturized and improved version of the Surveyor lunar instrument. The backscattering of alpha particles and (alpha, p) reactions provide analytical data on the light elements (carbon-iron). An X-ray mode that detects the photons produced by the alpha sources provides sensitivity and resolution for the chemical elements heavier than about silicon. The X-rays are detected by semiconductor detectors having a resolution between 150 and 250 eV at 5.9 keV. Such an instrument can identify and determine with good accuracy 99 percent of the atoms (except hydrogen) in rocks. For many trace elements, the detecting sensitivity is a few ppm. Auxiliary sources could be used to enhance the sensitivities for elements of special interest. The instrument could probably withstand the acceleration involved in semi-hard landings.

  2. Proceedings of transuranium elements

    SciTech Connect

    Not Available


    The identification of the first synthetic elements was established by chemical evidence. Conclusive proof of the synthesis of the first artificial element, technetium, was published in 1937 by Perrier and Segre. An essential aspect of their achievement was the prediction of the chemical properties of element 43, which had been missing from the periodic table and which was expected to have properties similar to those of manganese and rhenium. The discovery of other artificial elements, astatine and francium, was facilitated in 1939-1940 by the prediction of their chemical properties. A little more than 50 years ago, in the spring of 1940, Edwin McMillan and Philip Abelson synthesized element 93, neptunium, and confirmed its uniqueness by chemical means. On August 30, 1940, Glenn Seaborg, Arthur Wahl, and the late Joseph Kennedy began their neutron irradiations of uranium nitrate hexahydrate. A few months later they synthesized element 94, later named plutonium, by observing the alpha particles emitted from uranium oxide targets that had been bombarded with deuterons. Shortly thereafter they proved that is was the second transuranium element by establishing its unique oxidation-reduction behavior. The symposium honored the scientists and engineers whose vision and dedication led to the discovery of the transuranium elements and to the understanding of the influence of 5f electrons on their electronic structure and bonding. This volume represents a record of papers presented at the symposium.

  3. Alpha Particle Diagnostic

    SciTech Connect

    Fisher, Ray, K.


    The study of burning plasmas is the next frontier in fusion energy research, and will be a major objective of the U.S. fusion program through U.S. collaboration with our international partners on the ITER Project. For DT magnetic fusion to be useful for energy production, it is essential that the energetic alpha particles produced by the fusion reactions be confined long enough to deposit a significant fraction of their initial ~3.5 MeV energy in the plasma before they are lost. Development of diagnostics to study the behavior of energetic confined alpha particles is a very important if not essential part of burning plasma research. Despite the clear need for these measurements, development of diagnostics to study confined the fast confined alphas to date has proven extremely difficult, and the available techniques remain for the most part unproven and with significant uncertainties. Research under this grant had the goal of developing diagnostics of fast confined alphas, primarily based on measurements of the neutron and ion tails resulting from alpha particle knock-on collisions with the plasma deuterium and tritium fuel ions. One of the strengths of this approach is the ability to measure the alphas in the hot plasma core where the interesting ignition physics will occur.

  4. In situ trace element microanalysis

    NASA Technical Reports Server (NTRS)

    Burnett, D. S.; Woolum, D. S.


    The use of particle-track-radiography and X-ray- fluorescence techniques in the in situ measurement of trace (less than 1000 ppm) elements in single mineral phases of polished sections is surveyed, and examples of their application to ordinary, carbonaceous and enstatite chondrites are provided. Radiographic methods surveyed include fission-track radiography (for U, Th, and Pu-244), alpha radiography using nuclear reactions (for Li and B), alpha autoradiography (for Bi and Pb), and beta autoradiography (for several elements in synthetic or biological samples). Two X-ray-fluorescence methods are compared: (1) photon-induced X-ray emission (PIXE), and (2) the potential use of synchrotron radiation. The latter is shown to allow much greater sensitivity than current PIXE technology and a much broader range of elements than particle-track radiography: the ppm analysis of 10-micron grains for all elements heavier than Na. These advantages are seen as balancing the high cost of accelerator use.

  5. Cancer radioimmunotherapy with alpha-emitting nuclides.


    Couturier, Olivier; Supiot, Stéphane; Degraef-Mougin, Marie; Faivre-Chauvet, Alain; Carlier, Thomas; Chatal, Jean-François; Davodeau, François; Cherel, Michel


    In lymphoid malignancies and in certain solid cancers such as medullary thyroid carcinoma, somewhat mixed success has been achieved when applying radioimmunotherapy (RIT) with beta-emitters for the treatment of refractory cases. The development of novel RIT with alpha-emitters has created new opportunities and theoretical advantages due to the high linear energy transfer (LET) and the short path length in biological tissue of alpha-particles. These physical properties offer the prospect of achieving selective tumoural cell killing. Thus, RIT with alpha-emitters appears particularly suited for the elimination of circulating single cells or cell clusters or for the treatment of micrometastases at an early stage. However, to avoid non-specific irradiation of healthy tissues, it is necessary to identify accessible tumoural targets easily and rapidly. For this purpose, a small number of alpha-emitters have been investigated, among which only a few have been used for in vivo preclinical studies. Another problem is the availability and cost of these radionuclides; for instance, the low cost and the development of a reliable actinium-225/bismuth-213 generator were probably determining elements in the choice of bismuth-213 in the only human trial of RIT with an alpha-emitter. This article reviews the literature concerning monoclonal antibodies radiolabelled with alpha-emitters that have been developed for possible RIT in cancer patients. The principal radio-immunoconjugates are considered, starting with physical and chemical properties of alpha-emitters, their mode of production, the possibilities and difficulties of labelling, in vitro studies and finally, when available, in vivo preclinical and clinical studies. PMID:15841373

  6. Summary of alpha-neutron sources in GADRAS.

    SciTech Connect

    Mitchell, Dean James; Thoreson, Gregory G.; Harding, Lee T.


    A common source of neutrons for calibration and testing is alpha-neutron material, named for the alpha-neutron nuclear reaction that occurs within. This material contains a long-lived alpha-emitter and a lighter target element. When the alpha particle from the emitter is absorbed by the target, neutrons and gamma rays are released. Gamma Detector Response and Analysis Software (GADRAS) includes built-in alpha-neutron source definitions for AcC, AmB, AmBe, AmF, AmLi, CmC, and PuC. In addition, GADRAS users may create their own alpha-neutron sources by placing valid alpha-emitters and target elements in materials within their one-dimensional models (1DModel). GADRAS has the ability to use pre-built alpha-neutron sources for plotting or as trace-sources in 1D models. In addition, if any material (existing or user-defined) specified in a 1D model contains both an alpha emitter in conjunction with a target nuclide, or there is an interface between such materials, then the appropriate neutron-emission rate from the alpha-neutron reaction will be computed. The gamma-emissions from these sources are also computed, but are limited to a subset of nine target nuclides. If a user has experimental data to contribute to the alpha-neutron gamma emission database, it may be added directly or submitted to the GADRAS developers for inclusion. The gadras.exe.config file will be replaced when GADRAS updates are installed, so sending the information to the GADRAS developers is the preferred method for updating the database. This is also preferable because it enables other users to benefit from your efforts.

  7. International Space Station (ISS) Alpha Concept

    NASA Technical Reports Server (NTRS)


    An artist's concept of what the International Space Station (ISS)Alpha will look like in its completed and fully operational state. All the elements of the Station are shown - the United States, European, Japanese, and Russian. The artist also included the Space Shuttle in the docked position. Sixteen countries are cooperating to provide a multidisciplinary laboratory, technology test bed, and observatory that will provide an unprecedented undertaking in scientific, technological, and international experimentation.

  8. ALPHA MIS: Reference manual

    SciTech Connect

    Lovin, J.K.; Haese, R.L.; Heatherly, R.D.; Hughes, S.E.; Ishee, J.S.; Pratt, S.M.; Smith, D.W.


    ALPHA is a powerful and versatile management information system (MIS) initiated and sponsored and by the Finance and Business Management Division of Oak Ridge National Laboratory, who maintain and develop it in concert with the Business Systems Division for its Information Center. A general-purpose MIS, ALPHA allows users to access System 1022 and System 1032 databases to obtain and manage information. From a personal computer or a data terminal, Energy Systems employees can use ALPHA to control their own report reprocessing. Using four general commands (Database, Select, Sort, and Report) they can (1) choose a mainframe database, (2) define subsets within it, (3) sequentially order a subset by one or more variables, and (4) generate a report with their own or a canned format.

  9. Biological activity profiles of 1alpha,25-dihydroxyvitamin D2, D3, D4, D7, and 24-epi-1alpha,25-dihydroxyvitamin D2.


    Tsugawa, N; Nakagawa, K; Kawamoto, Y; Tachibana, Y; Hayashi, T; Ozono, K; Okano, T


    We have synthesized several 1alpha,25-dihydroxyvitamin D [1alpha,25(OH)2D] derivatives and evaluated their biological activity in terms of their binding affinity for the vitamin D receptor (VDR) and vitamin D-binding protein (DBP), antiproliferative or differentiation-inducing effects on human promyelocytic leukemic HL-60 cells, and transcriptional activity on a rat 25-hydroxyvitamin D3-24-hydroxylase gene promoter, including two vitamin D-responsive elements (VDREs), and human osteocalcin gene promoter, including a VDRE in transfected human osteosarcoma MG-63 cells. Furthermore, human VDR- or retinoic acid X receptor alpha (RXR alpha)-mediated luciferase activities of the derivatives were also measured by a one-hybrid system in human epitheloid carcinoma, cervix HeLa cells and African green monkey kidney CV-1 cells. Binding affinity for VDR, bone-resorbing activity, antiproliferative and cell-differentiating effects, transactivation potencies on target genes and VDR- or RXR alpha-mediated gene regulations of 1alpha,25(OH)2D2 and 1alpha,25(OH)2D4 were almost comparable to the effects of 1alpha,25(OH)2D3 while 24-epi-1alpha,25(OH)2D2 and 1alpha,25(OH)2D7 were much less active than 1alpha,25(OH)2D3 in these respects. This is the first report concerning biological assessment of 1alpha,25(OH)2D2, 1alpha,25(OH)2D3, 1alpha,25(OH)2D4, 24-epi-1alpha,25(OH)2D2 and 1alpha,25(OH)2D7 at the molecular level, especially with regards to the structural differences at the 24R- or 24S-methyl group and a double bond between carbons 22 and 23 in the side chain of 1alpha,25(OH)2D derivatives. PMID:10328556

  10. Functional specificity of two hormone response elements present on the human apoA-II promoter that bind retinoid X receptor alpha/thyroid receptor beta heterodimers for retinoids and thyroids: synergistic interactions between thyroid receptor beta and upstream stimulatory factor 2a.

    PubMed Central

    Hatzivassiliou, Eudoxia; Koukos, George; Ribeiro, Agnes; Zannis, Vassilis; Kardassis, Dimitris


    DNA binding and mutagenesis in vitro established that the -67/-55 region of the apoA-II (apolipoprotein A-II) promoter contains a thyroid HRE (hormone response element), which strongly binds RXRalpha (retinoid X receptor alpha)/T(3)Rbeta (thyroid receptor beta) heterodimers and weakly T(3)Rbeta homodimers, but does not bind other homo- or heterodimers of RXRalpha or orphan nuclear receptors. Transactivation was abolished by point mutations in the thyroid HRE. In co-transfection experiments of HEK-293 (human embryonic kidney 293) cells, the -911/+29 human apoA-II promoter was transactivated strongly by RXRalpha/T(3)Rbeta heterodimers in the presence of RA (9- cis retinoic acid) or T(3) (tri-iodothyronine). Homopolymeric promoters containing either three copies of the -73/-40 (element AIIAB) or four copies of the -738/-712 (element AIIJ) apoA-II promoter could be transactivated by RXRalpha/T(3)Rbeta heterodimers in COS-7 cells only in the presence of T(3) or RA respectively. RXRalpha/T(3)Rbeta heterodimers and USF2a (upstream stimulatory factor 2a) synergistically transactivated the -911/+29 apoA-II promoter in the presence of T(3). USF2a also enhanced the activity of a GAL4-T(3)Rbeta fusion protein in the presence of T(3) and suppressed the activity of a GAL4-RXRalpha fusion protein in the presence of RA. These findings suggest a functional specificity of the two HREs of the apoA-II promoter for retinoids and thyroids, which is modulated by synergistic or antagonistic interactions between RXRalpha/T(3)Rbeta heterodimers and the ubiquitous transcription factor USF2a. PMID:12959642

  11. The Apollo Alpha Spectrometer.

    NASA Technical Reports Server (NTRS)

    Jagoda, N.; Kubierschky, K.; Frank, R.; Carroll, J.


    Located in the Science Instrument Module of Apollo 15 and 16, the Alpha Particle Spectrometer was designed to detect and measure the energy of alpha particles emitted by the radon isotopes and their daughter products. The spectrometer sensor consisted of an array of totally depleted silicon surface barrier detectors. Biased amplifier and linear gate techniques were utilized to reduce resolution degradation, thereby permitting the use of a single 512 channel PHA. Sensor identification and in-flight radioactive calibration were incorporated to enhance data reduction.

  12. The Lyman alpha coronagraph

    NASA Technical Reports Server (NTRS)

    Kohl, J. L.; Reeves, E. M.; Kirkham, B.


    The rocket-borne Lyman alpha coronagraph (RLAC) is to be used in the absence of a natural solar eclipse to determine coronal temperatures from measurements of the line width of Lyman-alpha and to determine neutral hydrogen densities of coronal material from the absolute intensity. The coronagraph consists of a 75-cm Fastie-Ebert scanning spectrometer with an AMR 641 photoelectric detection system, an off-axis parabolic primary mirror, and an occulting system. A special optical arrangement achieves rejection of radiation from the solar disk.

  13. It's elemental

    NASA Astrophysics Data System (ADS)

    The Periodic Table of the elements will now have to be updated. An international team of researchers has added element 110 to the Earth's armory of elements. Though short-lived—of the order of microseconds, element 110 bottoms out the list as the heaviest known element on the planet. Scientists at the Heavy Ion Research Center in Darmstadt, Germany, made the 110-proton element by colliding a lead isotope with nickel atoms. The element, which is yet to be named, has an atomic mass of 269.

  14. [alpha]-Oxocarboxylic Acids

    ERIC Educational Resources Information Center

    Kerber, Robert C.; Fernando, Marian S.


    Several [alpha]-oxocarboxylic acids play key roles in metabolism in plants and animals. However, there are inconsistencies between the structures as commonly portrayed and the reported acid ionization constants, which result because the acids are predominantly hydrated in aqueous solution; that is, the predominant form is RC(OH)[subscript 2]COOH…

  15. From Alpha to Omega

    ERIC Educational Resources Information Center

    Czaja, Paul Clement


    The Alpha point of the authors' life as a Montessori educator began in 1959, when he was a graduate student studying philosophy at Fordham University in the Bronx, New York. While studying the works of the great American philosopher William James, the author came across the writings of Maria Montessori and immediately became captivated by her…

  16. Alpha particle losses from Tokamak Fusion Test Reactor deuterium-tritium plasmas

    SciTech Connect

    Darrow, D.S.; Zweben, S.J.; Batha, S.


    Because alpha particle losses can have a significant influence on tokamak reactor viability, the loss of deuterium-tritium alpha particles from the Tokamak Fusion Test Reactor (TFTR) has been measured under a wide range of conditions. In TFTR, first orbit loss and stochastic toroidal field ripple diffusion are always present. Other losses can arise due to magnetohydrodynamic instabilities or due to waves in the ion cyclotron range of frequencies. No alpha particle losses have yet been seen due to collective instabilities driven by alphas. Ion Bernstein waves can drive large losses of fast ions from TFTR, and details of those losses support one element of the alpha energy channeling scenario.

  17. Summary of Alpha Particle Transport

    SciTech Connect

    Medley, S.S.; White, R.B.; Zweben, S.J.


    This paper summarizes the talks on alpha particle transport which were presented at the 5th International Atomic Energy Agency's Technical Committee Meeting on "Alpha Particles in Fusion Research" held at the Joint European Torus, England in September 1997.

  18. Alpha Condensates in Atomic Nuclei

    SciTech Connect

    Suzuki, Y.; Matsumura, H.


    Recent issues on Bose-Einstein condensation (BEC) of {alpha}-particles in nuclei are reviewed. A candidate of condensates is discussed for some states in 12C and 16O by defining the amount of {alpha} condensation.

  19. Development and identification of monoclonal antibodies against meso-Tetra (alpha,alpha,alpha,alpha,-O-phenylacetamide benzene) porphyrin.


    Wang, Fengyang; Huang, Xueying; Du, Li; Li, Weiguo; Qi, Chao


    The small molecule meso-Tetra (alpha,alpha,alpha,alpha-o-phenylacetamide benzene) porphyrin was synthesized through the condensation of o-nitrobenzaldehyde and pyrrole followed by reduction of the meso-tetra (o-nitrophenyl) porphyrin. The small molecule, without carrier, was used as complete antigen to immunize BALB/ C mice. Spleen cells producing high titer antibody were removed and fused with myeloma cells of SP2/0 origin. Using a conventional immunization protocol, stable murine monoclonal antibodies (MAbs) producing cell lines to meso-Tetra (alpha,alpha,alpha,alpha-o-phenylacetamide benzene) porphyrin 1F2 were obtained. Subclass determination showed that the clones produce IgG2a types of MAbs. The analytical results of HPLC and MALDI/TOFMS suggest that the purity of MAb 1F2 is 100%, and MAb 1F2 has a relative molecular weight of 156678.8 Da. Our results demonstrated that small molecule meso-Tetra (alpha,alpha,alpha,alpha-o-phenylacetamide benzene) porphyrin, as semiantigen without carrier, can elicit the formation of MAbs. PMID:17451352

  20. New elements produced at GSI

    SciTech Connect

    Hofmann, Sigurd


    In two series of experiments at SHIP, six new elements (Z=107-112) were synthesized via fusion reactions using lead or bismuth targets and 1n-deexcitation channels. The isotopes were unambiguously identified by means of {alpha}-{alpha} correlations. Not fission, but alpha decay is the dominant decay mode. Cross-sections decrease by two orders of magnitude from bohrium (Z=107) to element 112, for which a cross-section of 1 pb was measured. Based on our results, it is likely that the production of isotopes of element 114 close to the island of spherical SuperHeavy Elements (SHE) could be achieved by fusion reactions using {sup 208}Pb targets. Systematic studies of the reaction cross-sections indicate that the transfer of nucleons is an important process for the initiation of fusion. The data allow for the fixing of a narrow energy window for the production of SHE using 1n-emission channels. The likelihood of broadening the energy window by investigation of radiative capture reactions, use of neutron deficient projectile isotopes and use of actinide targets is discussed.

  1. Superheavy Elements - Achievements and Challenges

    SciTech Connect

    Ackermann, Dieter


    The search for superheavy elements (SHE) has yielded exciting results for both the 'cold fusion' approach with reactions employing Pb and Bi targets and the ''hot fusion'' reactions with {sup 48}Ca beams on actinide targets. The most recent activities at GSI were the successful production of a more neutron rich isotope of element 112 in the reaction {sup 48}Ca+{sup 238}U confirming earlier result from FLNR, and the attempt to synthesize an isotope with Z 120 in the reaction {sup 64}Ni+{sup 238}U. Apart from the synthesis of new elements, advanced nuclear structure studies for heavy and super heavy elements promise a detailed insight in the properties of nuclear matter under the extreme conditions of high Z and A. The means are evaporation residue(ER)-{alpha}-{alpha} and -{alpha}-{gamma} coincidence techniques applied after separation of the reaction products from the beam. Recent examples of interesting physics to be discovered in this region of the chart of nuclides are the investigation of K-isomers observed for {sup 252,254}No and indicated for {sup 270}Ds. Fast chemistry and precision mass measurements deliver in addition valuable information on the fundamental properties of the SHE.

  2. Haemophilus influenzae Disease (Including Hib) Symptoms


    ... is considered invasive. Symptoms of pneumonia usually include: Fever and chills Cough Shortness of breath or difficulty breathing Sweating ... the blood. It can cause symptoms such as: Fever and chills Excessive tiredness Pain in the belly Nausea with ...

  3. New elements - approaching ?

    NASA Astrophysics Data System (ADS)

    Hofmann, S.


    The search for new elements is part of the broader field of investigations of nuclei at the limits of stability. In two series of experiments at SHIP, six new elements 0034-4885/61/6/002/img2 were synthesized via fusion reactions using 1n-deexcitation channels and lead or bismuth targets. The isotopes were unambiguously identified by means of 0034-4885/61/6/002/img3 correlations. Alpha decay, not fission, is the dominant decay mode. The collected decay data establish a means of comparison with theoretical data. This aids in the selection of appropriate models that describe the properties of known nuclei. Predictions based on these models are useful in the preparation of the next generation of experiments. Cross sections decrease by two orders of magnitude from bohrium (Z = 107) to element 112, for which a cross section of 1 pb was measured. The development of intense beam currents and sensitive detection methods is essential for the production and identification of still heavier elements and new isotopes of already known elements, as well as the measurement of small 0034-4885/61/6/002/img4-, 0034-4885/61/6/002/img5- and fission-branching ratios. An equally sensitive set-up is needed for the measurement of excitation functions at low cross sections. Based on our results, it is likely that the production of isotopes of element 114 close to the island of spherical superheavy elements (SHEs) could be achieved by fusion reactions using 0034-4885/61/6/002/img6 targets. Systematic studies of the reaction cross sections indicate that the transfer of nucleons is an important process for the initiation of fusion. The data allow for the fixing of a narrow energy window for the production of SHEs using 1n-emission channels. The likelihood of broadening the energy window by investigation of radiative capture reactions, use of neutron deficient projectile isotopes and use of actinide targets is discussed.

  4. Alpha-globin loci in homozygous beta-thalassemia intermedia.


    Triadou, P; Lapoumeroulie, C; Girot, R; Labie, D


    Homozygous beta-thalassemia intermediate (TI) differs from thalassemia major (TM) in being less severe clinically. Associated alpha-thalassemia could account for the TI phenotype by reducing the alpha/non-alpha chain imbalance. We have analyzed the alpha loci of 9 TI and 11 TM patients by restriction endonuclease mapping. All the TM and 7 of the TI patients have the normal complement of four alpha-globin genes (alpha alpha/alpha alpha). One TI patient has three alpha-globin genes (alpha alpha/-alpha), and another TI patient has five alpha genes (alpha alpha/alpha alpha alpha). PMID:6305827

  5. A search for Lyman-alpha emission in beta Lyrae from Copernicus

    NASA Technical Reports Server (NTRS)

    Kondo, Y.; Mccluskey, G. E., Jr.


    High-resolution (0.2 A) spectrophotometric observations of the complex eclipsing binary beta Lyrae were obtained with the Princeton Telescope Spectrometer on the Copernicus satellite. We discuss the search for L-alpha emission in beta Lyrae and compare the Copernicus results with the OAO-2 observations of the same binary system. The possible L-alpha emission features observed from OAO-2 are identified as blends of the emission lines of other elements in the vicinity of L-alpha.

  6. Superheavy Element Synthesis And Nuclear Structure

    SciTech Connect

    Ackermann, D.; Block, M.; Burkhard, H.-G.; Heinz, S.; Hessberger, F. P.; Khuyagbaatar, J.; Kojouharov, I.; Mann, R.; Maurer, J.; Antalic, S.; Saro, S.; Venhart, M.; Hofmann, S.; Leino, M.; Uusitalo, J.; Nishio, K.; Popeko, A. G.; Yeremin, A. V.


    After the successful progress in experiments to synthesize superheavy elements (SHE) throughout the last decades, advanced nuclear structure studies in that region have become feasible in recent years thanks to improved accelerator, separation and detection technology. The means are evaporation residue(ER)-alpha-alpha and ER-alpha-gamma coincidence techniques complemented by conversion electron (CE) studies, applied after a separator. Recent examples of interesting physics to be discovered in this region of the chart of nuclides are the studies of K-isomers observed in {sup 252,254}No and in {sup 270}Ds.

  7. Contemporary Issues in Ultra-Low Alpha Particle Counting

    NASA Astrophysics Data System (ADS)

    Gordon, Michael

    Single-Event Upsets (SEU) in CMOS devices are caused by the passage of ionizing radiation either from terrestrial neutrons or from the natural alpha particle radiation within the materials surrounding the transistors. Interactions of the neutrons with the silicon cause spallation reactions which emit energetic highly ionizing elements. Alpha particles, on the other hand, can upset the devices through direct ionization rather than through a nuclear reaction as in the case of the neutrons. In order to minimize the alpha-particle component of SEU, the radiation from the materials within a distance 100 μm of the transistors, currently needs to have an alpha particle emissivity of less than 2 alpha particles per khr per square centimeter. Many alpha particle detectors have background levels that are larger than this, which can make these measurements inaccurate and time consuming. This talk will discuss what is involved in making alpha particle emissivity measurements of materials used in the semiconductor industry using an ultra-low background commercially-available ionization detector. Detector calibration and efficiency, radon adsorption on the samples, and the effect of surface charge on electrically insulating samples will be discussed.

  8. IGFBP-3, hypoxia and TNF-{alpha} inhibit adiponectin transcription

    SciTech Connect

    Zappala, Giovanna; Rechler, Matthew M.


    The thiazolidinedione rosiglitazone, an agonist ligand for the nuclear receptor PPAR-{gamma}, improves insulin sensitivity in part by stimulating transcription of the insulin-sensitizing adipokine adiponectin. It activates PPAR-{gamma}-RXR-{alpha} heterodimers bound to PPAR-{gamma} response elements in the adiponectin promoter. Rosiglitazone-stimulated adiponectin protein synthesis in 3T3-L1 mouse adipocytes has been shown to be inhibited by IGFBP-3, which can be induced by hypoxia and the proinflammatory cytokine, TNF-{alpha}, two inhibitors of adiponectin transcription. The present study demonstrates that IGFBP-3, the hypoxia-mimetic agent cobalt chloride, and TNF-{alpha} inhibit rosiglitazone-induced adiponectin transcription in mouse embryo fibroblasts that stably express PPAR-{gamma}2. Native IGFBP-3 can bind RXR-{alpha} and inhibited rosiglitazone stimulated promoter activity, whereas an IGFBP-3 mutant that does not bind RXR-{alpha} did not. These results suggest that IGFBP-3 may mediate the inhibition of adiponectin transcription by hypoxia and TNF-{alpha}, and that IGFBP-3 binding to RXR-{alpha} may be required for the observed inhibition.

  9. Chemical characterization of element 112.


    Eichler, R; Aksenov, N V; Belozerov, A V; Bozhikov, G A; Chepigin, V I; Dmitriev, S N; Dressler, R; Gäggeler, H W; Gorshkov, V A; Haenssler, F; Itkis, M G; Laube, A; Lebedev, V Ya; Malyshev, O N; Oganessian, Yu Ts; Petrushkin, O V; Piguet, D; Rasmussen, P; Shishkin, S V; Shutov, A V; Svirikhin, A I; Tereshatov, E E; Vostokin, G K; Wegrzecki, M; Yeremin, A V


    The heaviest elements to have been chemically characterized are seaborgium (element 106), bohrium (element 107) and hassium (element 108). All three behave according to their respective positions in groups 6, 7 and 8 of the periodic table, which arranges elements according to their outermost electrons and hence their chemical properties. However, the chemical characterization results are not trivial: relativistic effects on the electronic structure of the heaviest elements can strongly influence chemical properties. The next heavy element targeted for chemical characterization is element 112; its closed-shell electronic structure with a filled outer s orbital suggests that it may be particularly susceptible to strong deviations from the chemical property trends expected within group 12. Indeed, first experiments concluded that element 112 does not behave like its lighter homologue mercury. However, the production and identification methods used cast doubt on the validity of this result. Here we report a more reliable chemical characterization of element 112, involving the production of two atoms of (283)112 through the alpha decay of the short-lived (287)114 (which itself forms in the nuclear fusion reaction of 48Ca with 242Pu) and the adsorption of the two atoms on a gold surface. By directly comparing the adsorption characteristics of (283)112 to that of mercury and the noble gas radon, we find that element 112 is very volatile and, unlike radon, reveals a metallic interaction with the gold surface. These adsorption characteristics establish element 112 as a typical element of group 12, and its successful production unambiguously establishes the approach to the island of stability of superheavy elements through 48Ca-induced nuclear fusion reactions with actinides. PMID:17476264

  10. Chemical characterization of element 112

    NASA Astrophysics Data System (ADS)

    Eichler, R.; Aksenov, N. V.; Belozerov, A. V.; Bozhikov, G. A.; Chepigin, V. I.; Dmitriev, S. N.; Dressler, R.; Gäggeler, H. W.; Gorshkov, V. A.; Haenssler, F.; Itkis, M. G.; Laube, A.; Lebedev, V. Ya.; Malyshev, O. N.; Oganessian, Yu. Ts.; Petrushkin, O. V.; Piguet, D.; Rasmussen, P.; Shishkin, S. V.; Shutov, A. V.; Svirikhin, A. I.; Tereshatov, E. E.; Vostokin, G. K.; Wegrzecki, M.; Yeremin, A. V.


    The heaviest elements to have been chemically characterized are seaborgium (element 106), bohrium (element 107) and hassium (element 108). All three behave according to their respective positions in groups 6, 7 and 8 of the periodic table, which arranges elements according to their outermost electrons and hence their chemical properties. However, the chemical characterization results are not trivial: relativistic effects on the electronic structure of the heaviest elements can strongly influence chemical properties. The next heavy element targeted for chemical characterization is element 112; its closed-shell electronic structure with a filled outer s orbital suggests that it may be particularly susceptible to strong deviations from the chemical property trends expected within group 12. Indeed, first experiments concluded that element 112 does not behave like its lighter homologue mercury. However, the production and identification methods used cast doubt on the validity of this result. Here we report a more reliable chemical characterization of element 112, involving the production of two atoms of 283112 through the alpha decay of the short-lived 287114 (which itself forms in the nuclear fusion reaction of 48Ca with 242Pu) and the adsorption of the two atoms on a gold surface. By directly comparing the adsorption characteristics of 283112 to that of mercury and the noble gas radon, we find that element 112 is very volatile and, unlike radon, reveals a metallic interaction with the gold surface. These adsorption characteristics establish element 112 as a typical element of group 12, and its successful production unambiguously establishes the approach to the island of stability of superheavy elements through 48Ca-induced nuclear fusion reactions with actinides.

  11. DNA Repair, Redox Regulation and Modulation of Estrogen Receptor Alpha Mediated Transcription

    ERIC Educational Resources Information Center

    Curtis-Ducey, Carol Dianne


    Interaction of estrogen receptor [alpha] (ER[alpha]) with 17[beta]-estradiol (E[subscript 2]) facilitates binding of the receptor to estrogen response elements (EREs) in target genes, which in turn leads to recruitment of coregulatory proteins. To better understand how estrogen-responsive genes are regulated, our laboratory identified a number of…

  12. A Comparison of Type I Error Rates of Alpha-Max with Established Multiple Comparison Procedures.

    ERIC Educational Resources Information Center

    Barnette, J. Jackson; McLean, James E.

    J. Barnette and J. McLean (1996) proposed a method of controlling Type I error in pairwise multiple comparisons after a significant omnibus F test. This procedure, called Alpha-Max, is based on a sequential cumulative probability accounting procedure in line with Bonferroni inequality. A missing element in the discussion of Alpha-Max was the…

  13. Hepatocyte nuclear factor-3 alpha (HNF-3{alpha}) negatively regulates androgen receptor transactivation in prostate cancer cells

    SciTech Connect

    Lee, Hyun Joo; Hwang, Miok; Chattopadhyay, Soma; Choi, Hueng-Sik; Lee, Keesook


    The androgen receptor (AR) is involved in the development and progression of prostate cancers. However, the mechanisms by which this occurs remain incompletely understood. In previous reports, hepatocyte nuclear factor-3{alpha} (HNF-3{alpha}) has been shown to be expressed in the epithelia of the prostate gland, and has been determined to regulate the transcription of prostate-specific genes. In this study, we report that HNF-3{alpha} functions as a novel corepressor of AR in prostatic cells. HNF-3{alpha} represses AR transactivation on target promoters containing the androgen response element (ARE) in a dose-dependent manner. HNF-3{alpha} interacts physically with AR, and negatively regulates AR transactivation via competition with AR coactivators, including GRIP1. Furthermore, HNF-3{alpha} overexpression reduces the androgen-induced expression of prostate-specific antigen (PSA) in LNCaP cells. Taken together, our findings indicate that HNF-3{alpha} is a novel corepressor of AR, and predict its effects on the proliferation of prostate cancer cells.

  14. The Alpha Centauri binary system. Atmospheric parameters and element abundances

    NASA Astrophysics Data System (ADS)

    Porto de Mello, G. F.; Lyra, W.; Keller, G. R.


    Context: The α Centauri binary system, owing to its duplicity, proximity and brightness, and its components' likeness to the Sun, is a fundamental calibrating object for the theory of stellar structure and evolution and the determination of stellar atmospheric parameters. This role, however, is hindered by a considerable disagreement in the published analyses of its atmospheric parameters and abundances. Aims: We report a new spectroscopic analysis of both components of the α Centauri system, compare published analyses of the system, and attempt to quantify the discrepancies still extant in the determinations of the atmospheric parameters and abundances of these stars. Methods: The analysis is differential with respect to the Sun, based on spectra with R = 35 000 and signal-to-noise ratio ≥1000, and employed spectroscopic and photometric methods to obtain as many independent T_eff determinations as possible. We also check the atmospheric parameters for consistency against the results of the dynamical analysis and the positions of the components in a theoretical HR diagram. Results: The spectroscopic atmospheric parameters of the system are found to be T_eff = (5847 ± 27) K, [Fe/H] = +0.24 ± 0.03, log g = 4.34 ± 0.12, and ξt = 1.46 ± 0.03 km s-1, for α Cen A, and T_eff = (5316 ± 28) K, [Fe/H] = +0.25 ± 0.04, log g = 4.44 ± 0.15, and ξt = 1.28 ± 0.15 km s^-1 for α Cen B. The parameters were derived from the simultaneous excitation & ionization equilibria of Fe I and Fe II lines. T_effs were also obtained by fitting theoretical profiles to the Hα line and from photometric calibrations. Conclusions: We reached good agreement between the three criteria for α Cen A. For α Cen B the spectroscopic T_eff is ~140 K higher than the other two determinations. We discuss possible origins of this inconsistency, concluding that the presence of non-local thermodynamic equilibrium effects is a probable candidate, but we note that there is as yet no consensus on the existence and cause of an offset between the spectroscopic and photometric T_eff scales of cool dwarfs. The spectroscopic surface gravities also agree with those derived from directly measured masses and radii. An average of three independent T_eff criteria leads to T_eff (A) = (5824 ± 26) K and T_eff (B) = (5223 ± 62) K. The abundances of Na, Mg, Si, Mn, Co, and Ni and, possibly, Cu are significantly enriched in the system, which also seems to be deficient in Y and Ba. This abundance pattern can be deemed normal in the context of recent data on metal-rich stars. The position of α Cen A in an up-to-date theoretical evolutionary diagram yields a good match of the evolutionary mass and age (in the 4.5 to 5.3 Gyr range) with those from the dynamical solution and seismology, but only marginal agreement for α Cen B, taking into account its more uncertain T_eff. Based on observations collected at Observatório do Pico dos Dias (OPD), operated by the Laboratório Nacional de Astrofísica, CNPq, Brazil. Table 2 is only available in electronic form at

  15. Alpha-mannosidosis

    PubMed Central

    Malm, Dag; Nilssen, Øivind


    Alpha-mannosidosis is an inherited lysosomal storage disorder characterized by immune deficiency, facial and skeletal abnormalities, hearing impairment, and intellectual disability. It occurs in approximately 1 of 500,000 live births. The children are often born apparently normal, and their condition worsens progressively. Some children are born with ankle equinus or develop hydrocephalus in the first year of life. Main features are immune deficiency (manifested by recurrent infections, especially in the first decade of life), skeletal abnormalities (mild-to-moderate dysostosis multiplex, scoliosis and deformation of the sternum), hearing impairment (moderate-to-severe sensorineural hearing loss), gradual impairment of mental functions and speech, and often, periods of psychosis. Associated motor function disturbances include muscular weakness, joint abnormalities and ataxia. The facial trait include large head with prominent forehead, rounded eyebrows, flattened nasal bridge, macroglossia, widely spaced teeth, and prognathism. Slight strabismus is common. The clinical variability is significant, representing a continuum in severity. The disorder is caused by lysosomal alpha-mannosidase deficiency. Alpha-mannosidosis is inherited in an autosomal recessive fashion and is caused by mutations in the MAN2B1 gene located on chromosome 19 (19 p13.2-q12). Diagnosis is made by measuring acid alpha-mannosidase activity in leukocytes or other nucleated cells and can be confirmed by genetic testing. Elevated urinary secretion of mannose-rich oligosaccharides is suggestive, but not diagnostic. Differential diagnoses are mainly the other lysosomal storage diseases like the mucopolysaccharidoses. Genetic counseling should be given to explain the nature of the disease and to detect carriers. Antenatal diagnosis is possible, based on both biochemical and genetic methods. The management should be pro-active, preventing complications and treating manifestations. Infections must be

  16. Background canceling surface alpha detector


    MacArthur, Duncan W.; Allander, Krag S.; Bounds, John A.


    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone.

  17. Background canceling surface alpha detector


    MacArthur, D.W.; Allander, K.S.; Bounds, J.A.


    A background canceling long range alpha detector which is capable of providing output proportional to both the alpha radiation emitted from a surface and to radioactive gas emanating from the surface. The detector operates by using an electrical field between first and second signal planes, an enclosure and the surface or substance to be monitored for alpha radiation. The first and second signal planes are maintained at the same voltage with respect to the electrically conductive enclosure, reducing leakage currents. In the presence of alpha radiation and radioactive gas decay, the signal from the first signal plane is proportional to both the surface alpha radiation and to the airborne radioactive gas, while the signal from the second signal plane is proportional only to the airborne radioactive gas. The difference between these two signals is proportional to the surface alpha radiation alone. 5 figs.

  18. Proteinaceous alpha-amylase inhibitors.


    Svensson, Birte; Fukuda, Kenji; Nielsen, Peter K; Bønsager, Birgit C


    Proteins that inhibit alpha-amylases have been isolated from plants and microorganisms. These inhibitors can have natural roles in the control of endogenous alpha-amylase activity or in defence against pathogens and pests; certain inhibitors are reported to be antinutritional factors. The alpha-amylase inhibitors belong to seven different protein structural families, most of which also contain evolutionary related proteins without inhibitory activity. Two families include bifunctional inhibitors acting both on alpha-amylases and proteases. High-resolution structures are available of target alpha-amylases in complex with inhibitors from five families. These structures indicate major diversity but also some similarity in the structural basis of alpha-amylase inhibition. Mutational analysis of the mechanism of inhibition was performed in a few cases and various protein engineering and biotechnological approaches have been outlined for exploitation of the inhibitory function. PMID:14871655

  19. Elemental health

    SciTech Connect

    Tonneson, L.C.


    Trace elements used in nutritional supplements and vitamins are discussed in the article. Relevant studies are briefly cited regarding the health effects of selenium, chromium, germanium, silicon, zinc, magnesium, silver, manganese, ruthenium, lithium, and vanadium. The toxicity and food sources are listed for some of the elements. A brief summary is also provided of the nutritional supplements market.

  20. Murine laminin alpha3A and alpha3B isoform chains are generated by usage of two promoters and alternative splicing.


    Ferrigno, O; Virolle, T; Galliano, M F; Chauvin, N; Ortonne, J P; Meneguzzi, G; Aberdam, D


    We already identified two distinct laminin alpha3A and alpha3B chain isoforms which differ in their amino-terminal ends and display different tissue-specific expression patterns. In this study we have investigated whether these two different isoforms are products of the same laminin alpha3 (lama3) gene and transcribed from one or two separate promoters. Genomic clones were isolated that encompass the sequences upstream to the 5' ends of both the alpha3A and the alpha3B cDNAs. Sequence analysis of the region upstream to the alpha3A open reading frame revealed the presence of a TATA box and potential binding sites for responsive elements. By primer extension analysis, the transcription start site of the alpha3B mRNA isoform was defined. The sequences upstream to the alpha3B mRNA transcription start site do not contain a TATA box near the transcription initiation sites, but AP-1, AP-2, and Sp1 consensus binding site sequences were identified. The genomic regions located immediately upstream of the alpha3A and alpha3B transcription start sites were shown to possess promoter activities in transfection experiments. In the promoter regions, response elements for the acute phase reactant signal and NF-interleukin 6 were found, and their possible relevance in the context of inflammation and wound healing is discussed. Our results demonstrate that the lama3 gene produces the two polypeptides by alternative splicing and contains two promoters, which regulate the production of the two isoforms alpha3A and alpha3B. PMID:9252362

  1. Cooperative interaction of hypoxia-inducible factor-2alpha (HIF-2alpha ) and Ets-1 in the transcriptional activation of vascular endothelial growth factor receptor-2 (Flk-1).


    Elvert, Gerd; Kappel, Andreas; Heidenreich, Regina; Englmeier, Ursula; Lanz, Stephan; Acker, Till; Rauter, Manuel; Plate, Karl; Sieweke, Michael; Breier, Georg; Flamme, Ingo


    Interactions between Ets family members and a variety of other transcription factors serve important functions during development and differentiation processes, e.g. in the hematopoietic system. Here we show that the endothelial basic helix-loop-helix PAS domain transcription factor, hypoxia-inducible factor-2alpha (HIF-2alpha) (but not its close relative HIF-1alpha), cooperates with Ets-1 in activating transcription of the vascular endothelial growth factor receptor-2 (VEGF-2) gene (Flk-1). The receptor tyrosine kinase Flk-1 is indispensable for angiogenesis, and its expression is closely regulated during development. Consistent with the hypothesis that HIF-2alpha controls the expression of Flk-1 in vivo, we show here that HIF-2alpha and Flk-1 are co-regulated in postnatal mouse brain capillaries. A tandem HIF-2alpha/Ets binding site was identified within the Flk-1 promoter that acted as a strong enhancer element. Based on the analysis of transgenic mouse embryos, these motifs are essential for endothelial cell-specific reporter gene expression. A single HIF-2alpha/Ets element conferred strong cooperative induction by HIF-2alpha and Ets-1 when fused to a heterologous promoter and was most active in endothelial cells. The physical interaction of HIF-2alpha with Ets-1 was demonstrated and localized to the HIF-2alpha carboxyl terminus and the autoinhibitory exon VII domain of Ets-1, respectively. The deletion of the DNA binding and carboxyl-terminal transactivation domains of HIF-2alpha, respectively, created dominant negative mutants that suppressed transactivation by the wild type protein and failed to synergize with Ets-1. These results suggest that the interaction between HIF-2alpha and endothelial Ets factors is required for the full transcriptional activation of Flk-1 in endothelial cells and may therefore represent a future target for the manipulation of angiogenesis. PMID:12464608

  2. Long range alpha particle detector


    MacArthur, Duncan W.; Wolf, Michael A.; McAtee, James L.; Unruh, Wesley P.; Cucchiara, Alfred L.; Huchton, Roger L.


    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  3. Long range alpha particle detector


    MacArthur, D.W.; Wolf, M.A.; McAtee, J.L.; Unruh, W.P.; Cucchiara, A.L.; Huchton, R.L.


    An alpha particle detector capable of detecting alpha radiation from distant sources. In one embodiment, a high voltage is generated in a first electrically conductive mesh while a fan draws air containing air molecules ionized by alpha particles through an air passage and across a second electrically conductive mesh. The current in the second electrically conductive mesh can be detected and used for measurement or alarm. The detector can be used for area, personnel and equipment monitoring.

  4. Modeling Solar Lyman Alpha Irradiance

    NASA Technical Reports Server (NTRS)

    Pap, J.; Hudson, H. S.; Rottman, G. J.; Willson, R. C.; Donnelly, R. F.; London, J.


    Solar Lyman alpha irradiance is estimated from various solar indices using linear regression analyses. Models developed with multiple linear regression analysis, including daily values and 81-day running means of solar indices, predict reasonably well both the short- and long-term variations observed in Lyman alpha. It is shown that the full disk equivalent width of the He line at 1083 nm offers the best proxy for Lyman alpha, and that the total irradiance corrected for sunspot effect also has a high correlation with Lyman alpha.

  5. ISS Update: Alpha Magnetic Spectrometer

    NASA Video Gallery

    NASA Public Affairs Officer Kelly Humphries interviews Trent Martin, Johnson Space Center project manager for the Alpha Magnetic Spectrometer (AMS) aboard the International Space Station. Questions...

  6. Alpha Kappa Alpha Sorority's Reading Improvement Program for Minorities.

    ERIC Educational Resources Information Center

    Marable, June Morehead

    This document discusses the founding and establishment of Alpha Kappa Alpha Sorority's reading experience pilot project. The efforts of this project were aligned with those of Right to Read and Reading Is Fundamental (RIF). Because of the response from parents and children, plans are being made to increase present operations within the next…

  7. Microscopic cluster model of {alpha}+n, {alpha}+p, {alpha}+ {sup 3}He, and {alpha}+{alpha} elastic scattering from a realistic effective nuclear interaction

    SciTech Connect

    Dohet-Eraly, J.; Baye, D.


    An effective nucleon-nucleon interaction adapted to cluster-model calculations of collisions is derived from the realistic Argonne potential AV18 with the unitary correlation operator method. The unitary correlation is determined from the {alpha}+{alpha} elastic phase shifts calculated in a cluster approach by the generator coordinate method coupled with the microscopic R-matrix method. With this interaction, the elastic phase shifts for the {alpha}+n, {alpha}+p, and {alpha}+{sup 3}He collisions are calculated within the same model. Without further adjustment, a good agreement with experimental data is obtained with a small model space.

  8. Alpha glucosidase inhibitors.


    Kalra, Sanjay


    Alpha glucosidase inhibitors (AGIs) are a unique class of anti-diabetic drugs. Derived from bacteria, these oral drugs are enzyme inhibitors which do not have a pancreato -centred mechanism of action. Working to delay carbohydrate absorption in the gastrointestinal tract, they control postprandial hyperglycaemia and provide unquestioned cardiovascular benefit. Specially suited for a traditional Pakistani carbohydrate-rich diet, AGIs have been termed the 'untapped diamonds' of diabetology. The use of these oral antidiabetic drugs (OADs) that target pathophysiology in the early stages of type 2 diabetes, notably to reduce postprandial hyperglycaemia and hyperinsulinaemia will inevitably increase with time. This review describes the history of their development, mechanism of action, basic and clinical pharmacology, and suggests practical, evidence-based guidance for their optimal use. PMID:24864650

  9. Elemental Education.

    ERIC Educational Resources Information Center

    Daniel, Esther Gnanamalar Sarojini; Saat, Rohaida Mohd.


    Introduces a learning module integrating three disciplines--physics, chemistry, and biology--and based on four elements: carbon, oxygen, hydrogen, and silicon. Includes atomic model and silicon-based life activities. (YDS)

  10. Superheavy Elements

    ERIC Educational Resources Information Center

    Tsang, Chin Fu


    Discusses the possibility of creating elements with an atomic number of around 114. Describes the underlying physics responsible for the limited extent of the periodic table and enumerates problems that must be overcome in creating a superheavy nucleus. (GS)


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Recent DFT optimization studies on alpha-maltose improved our understanding of the preferred conformations of alpha-maltose and the present study extends these studies to alpha-maltotriose with three alpha-D-glucopyranose residues linked by two alpha-[1-4] bridges, denoted herein as DP-3's. Combina...

  12. Alpha Solarco`s Photovoltaic Concentrator Development program

    SciTech Connect

    Anderson, A.; Bailor, B.; Carroll, D.


    This report details the work done under Sandia`s Photovoltaic Concentrator Development contract, funded jointly by Alpha Solarco and the US Department of Energy. It discusses improvements made to the cell assembly and module design of Alpha Solarco`s point-focus, high-concentration photovoltaic module. The goals of this effort were to increase the module efficiency, reduce the manufacturing cost of the cell assembly, and increase product reliability. Redesign of the secondary optical element achieved a 4 percent increase in efficiency due to better cell fill factors and offtrack performance. New, lower cost materials were identified for the secondary optical element, the optical couple between the secondary optical element and the cell, and the cell assembly electrical insulator. Manufacturing process improvements and test equipment are also discussed.

  13. Alpha self-irradiation effects in ternary oxides of actinides elements: The zircon-like phases Am{sup III}VO{sub 4} and A{sup II}Np{sup IV}(VO{sub 4}){sub 2} (A=Sr, Pb)

    SciTech Connect

    Goubard, F. . E-mail:; Griesmar, P.; Tabuteau, A.


    We report the experimental studies of irradiation damage from alpha decay in neptunium and americium vanadates versus cumulative dose. The isotopes used were the transuranium {alpha}-emitter {sup 237}Np and the {alpha},{gamma}-emitter {sup 241}Am. Neptunium and americium vanadates self-irradiation was studied by X-ray diffraction method (XRD). The comparison of the powder diffraction patterns reveal that the irradiation has no apparent effect on the neptunium phases while the americium vanadate swells and becomes metamict as a function of cumulative dose.

  14. Alpha particle emitters in medicine

    SciTech Connect

    Fisher, D.R.


    Radiation-induced cancer of bone, liver and lung has been a prominent harmful side-effect of medical applications of alpha emitters. In recent years, however, the potential use of antibodies labeled with alpha emitting radionuclides against cancer has seemed promising because alpha particles are highly effective in cell killing. High dose rates at high LET, effectiveness under hypoxic conditions, and minimal expectancy of repair are additional advantages of alpha emitters over antibodies labeled with beta emitting radionuclides for cancer therapy. Cyclotron-produced astatine-211 ({sup 211}At) and natural bismuth-212 ({sup 212}Bi) have been proposed and are under extensive study in the United States and Europe. Radium-223 ({sup 223}Ra) also has favorable properties as a potential alpha emitting label, including a short-lived daughter chain with four alpha emissions. The radiation dosimetry of internal alpha emitters is complex due to nonuniformly distributed sources, short particle tracks, and high relative specific ionization. The variations in dose at the cellular level may be extreme. Alpha-particle radiation dosimetry, therefore, must involve analysis of statistical energy deposition probabilities for cellular level targets. It must also account fully for nonuniform distributions of sources in tissues, source-target geometries, and particle-track physics. 18 refs., 4 figs.

  15. Prothymosin alpha in human blood.

    PubMed Central

    Panneerselvam, C; Haritos, A A; Caldarella, J; Horecker, B L


    The major cross-reacting peptide in human plasma detected with a radioimmunoassay (RIA) for thymosin alpha 1 was identified as prothymosin alpha, based on its elution properties in gel-filtration chromatography and its amino acid composition after purification by HPLC. A small quantity (less than 10%) of the total cross-reacting material was recovered in fractions corresponding to lower molecular weight thymosin alpha 1-like peptides. The total quantity of cross-reacting material detected in human blood, expressed as thymosin alpha 1 equivalents, was 11-14 pmol/ml (approximately 90% was recovered in the leukocyte fraction, approximately 10% was in the plasma fraction, and 1-2% was in the erythrocyte fraction). The peptide present in leukocytes was also identified as prothymosin alpha. After correction for the 5-times lower molar reactivity of prothymosin alpha in the thymosin alpha 1 RIA employed in these experiments, we estimate that the content of prothymosin alpha in human blood is 55-70 pmol/ml (0.6-0.8 microgram/ml). The relatively small quantities recovered in the erythrocyte and plasma fractions may be attributed to contamination of the former by leukocytes or to leakage from leukocytes into the plasma. PMID:3474615

  16. EEG Alpha Power and Intelligence.

    ERIC Educational Resources Information Center

    Doppelmayr, M.; Klimesch, W.; Stadler, W.; Pollhuber, D.; Heine, C.


    Tested whether alpha power in different sub-bands is selectively related to intelligence. For 74 Austrian subjects, the EEG was recorded during a resting session and 2 different intelligence tests were performed. Findings show a strong positive correlation between intelligence and alpha power. (SLD)

  17. Alpha Schottky junction energy source

    NASA Astrophysics Data System (ADS)

    Litz, Marc S.; Fan, Zhaoyang; Carroll, James J.; Bayne, Stephen


    Isotope batteries offer solutions for long-lived low-power sensor requirements. Alpha emitting isotopes have energy per decay 103 times that of beta emitters. Alpha particles are absorbed within 20 μm of most materials reducing shielding mitigation. However, damage to materials from the alphas limits their practical use. A Schottky Barrier Diode (SBD) geometry is considered with an alpha emitting contact-layer on a diamond-like crystal semiconductor region. The radiation tolerance of diamond, the safety of alpha particles, combined with the internal field of the SBD is expected to generate current useful for low-power electronic devices over decades. Device design parameters and calculations of the expected current are described.

  18. Superconducting calorimetric alpha particle sensors for nuclear nonproliferation applications

    SciTech Connect

    Horansky, Robert D.; Ullom, Joel N.; Beall, James A.; Hilton, Gene C.; Irwin, Kent D.; Dry, Donald E.; Hastings, Elizabeth P.; Lamont, Stephen P.; Rudy, Clifford R.; Rabin, Michael W.


    Identification of trace nuclear materials is usually accomplished by alpha spectrometry. Current detectors cannot distinguish critical elements and isotopes. We have developed a detector called a microcalorimeter, which achieves a resolution of 1.06 keV for 5.3 MeV alphas, the highest resolving power of any energy dispersive measurement. With this exquisite resolution, we can unambiguously identify the {sup 240}Pu/{sup 239}Pu ratio in Pu, a critical measurement for ascertaining the intended use of nuclear material. Furthermore, we have made a direct measurement of the {sup 209}Po ground state decay.

  19. Genetics Home Reference: alpha-mannosidosis


    ... Me Understand Genetics Home Health Conditions alpha-mannosidosis alpha-mannosidosis Enable Javascript to view the expand/collapse boxes. Download PDF Open All Close All Description Alpha-mannosidosis is a rare inherited disorder that causes ...



    Bean, R.W.


    A ceramic fuel element for a nuclear reactor that has improved structural stability as well as improved cooling and fission product retention characteristics is presented. The fuel element includes a plurality of stacked hollow ceramic moderator blocks arranged along a tubular raetallic shroud that encloses a series of axially apertured moderator cylinders spaced inwardly of the shroud. A plurality of ceramic nuclear fuel rods are arranged in the annular space between the shroud and cylinders of moderator and appropriate support means and means for directing gas coolant through the annular space are also provided. (AEC)

  1. Alpha-particle spectrometer experiment

    NASA Technical Reports Server (NTRS)

    Gorenstein, P.; Bjorkholm, P.


    Mapping the radon emanation of the moon was studied to find potential areas of high activity by detection of radon isotopes and their daughter products. It was felt that based on observation of regions overflown by Apollo spacecraft and within the field of view of the alpha-particle spectrometer, a radon map could be constructed, identifying and locating lunar areas of outgassing. The basic theory of radon migration from natural concentrations of uranium and thorium is discussed in terms of radon decay and the production of alpha particles. The preliminary analysis of the results indicates no significant alpha emission.

  2. Element Research.

    ERIC Educational Resources Information Center

    Herald, Christine


    Describes a research assignment for 8th grade students on the elements of the periodic table. Students use web-based resources and a chemistry handbook to gather information, construct concept maps, and present the findings to the full class using the mode of their choice: a humorous story, a slideshow or gameboard, a brochure, a song, or skit.…

  3. Mercury, elemental

    Integrated Risk Information System (IRIS)

    Mercury , elemental ; CASRN 7439 - 97 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinoge

  4. Indirect Measurements for (p,{alpha}) Reactions Involving Boron Isotopes

    SciTech Connect

    Lamia, L.; Spitaleri, C.; Romano, S.; Cherubini, S.; Crucilla, V.; Gulino, M.; La Cognata, M.; Pizzone, R. G.; Puglia, S. M. R.; Sergi, M. L.; Tudisco, S.; Tumino, A.; Carlin, N.; Szanto, M. G. del; Liguori Neto, R.; Moura, M. M. de; Munhoz, M. G.; Souza, F. A.; Suaide, A. A. P.; Szanto, E.


    Light elements lithium, beryllium and boron (LiBeB) were used in the last years as 'possible probe' for a deeper understanding of some extra-mixing phenomena occurring in young Main-Sequence stars. They are mainly destroyed by (p,{alpha}) reactions and cross section measurements for such channels are then needed. The Trojan Horse Method (THM) allows one to extract the astrophysical S(E)-factor without the experience of tunneling through the Coulomb barrier. In this work a resume of the recent results about the {sup 11}B(p,{alpha}{sub 0}){sup 8}Be and {sup 10}B(p,{alpha}){sup 7}Be reactions is shown.

  5. Superheavy Elements

    NASA Astrophysics Data System (ADS)

    Hofmann, S.

    The nuclear shell model predicts that the next doubly magic shell closure beyond 208Pb is at a proton number Z=114, 120, or 126 and at a neutron number N=172 or 184. The outstanding aim of experimental investigations is the exploration of this region of spherical `SuperHeavy Elements' (SHEs). Experimental methods have been developed which allowed for the identification of new elements at production rates of one atom per month. Using cold fusion reactions which are based on lead and bismuth targets, relatively neutron-deficient isotopes of the elements from 107 to 113 were synthesized at GSI in Darmstadt, Germany, and/or at RIKEN in Wako, Japan. In hot fusion reactions of 48Ca projectiles with actinide targets more neutron-rich isotopes of the elements from 112 to 116 and even 118 were produced at the Flerov Laboratory of Nuclear Reactions (FLNR) at the Joint Institute for Nuclear Research (JINR) in Dubna, Russia. Recently, part of these data which represent the first identification of nuclei located on the predicted island of SHEs were confirmed in two independent experiments. The decay data reveal that for the heaviest elements, the dominant decay mode is α emission rather than fission. Decay properties as well as reaction cross-sections are compared with results of theoretical studies. Finally, plans are presented for the further development of the experimental set-up and the application of new techniques. At a higher sensitivity, the detailed exploration of the region of spherical SHEs will be in the center of interest of future experimental work. New data will certainly challenge theoretical studies on the mechanism of the synthesis, on the nuclear decay properties, and on the chemical behavior of these heaviest atoms at the limit of stability.

  6. Binding of tumor necrosis factor alpha to activated forms of human plasma alpha 2 macroglobulin.

    PubMed Central

    Wollenberg, G. K.; LaMarre, J.; Rosendal, S.; Gonias, S. L.; Hayes, M. A.


    We tested the hypothesis that human plasma alpha 2 macroglobulin (alpha 2M) is a latent binding glycoprotein for human tumor necrosis factor alpha (TNF-alpha). Human recombinant 125I-TNF-alpha was incubated for 2 hours (37 degrees C) with purified native alpha 2M and with alpha 2M that was modified by reaction with methylamine or various proteinases. 125I-TNF-alpha/alpha 2M complexes were detected by nondenaturing polyacrylamide gel electrophoresis after autoradiography or by liquid chromatography on Superose-6. 125I-TNF-alpha bound strongly but noncovalently to alpha 2M-plasmin and alpha 2M-methylamine. There was minimal binding of 125I-TNF-alpha to native alpha 2M, alpha 2M-trypsin, or alpha 2M-thrombin. A 10(6) molar excess of porcine heparin did not reduce the binding of 125I-TNF-alpha to alpha 2M-methylamine or alpha 2M-plasmin. alpha 2M-plasmin or alpha 2M-methylamine added to human plasma or serum preferentially bound 125I-TNF-alpha in the presence of native alpha 2M. 125I-TNF-alpha also bound to 'fast' alpha-macroglobulins in methylamine-reacted human, rat, mouse, swine, equine, and bovine plasma. However, TNF-alpha, preincubated with either alpha 2M-plasmin or alpha 2M-methylamine, remained a potent necrogen for cultured L929 cells. Purified 125I-TNF-alpha/alpha 2M-plasmin complex injected intravenously in CD-1 mice rapidly cleared from the circulation, unless the alpha 2M-receptor pathway was blocked by coinjection of excess alpha 2M-trypsin. These findings demonstrate that alpha 2M is a latent plasmin-activated binding glycoprotein for TNF-alpha and that TNF-alpha/alpha 2M-plasmin complexes can be removed from the circulation by the alpha 2M-receptor pathway. This suggests that alpha 2M may be an important regulator of the activity and distribution of TNF-alpha in vivo. Images Figure 1 Figure 3 PMID:1704186

  7. Alpha Magnetic Spectrometer (AMS) Overview

    NASA Video Gallery

    The Alpha Magnetic Spectrometer (AMS) is flying to the station on STS-134. The AMS experiment is a state-of-the-art particle physics detector being operated by an international team composed of 60 ...

  8. Genetics Home Reference: alpha thalassemia


    ... in each cell. Each copy is called an allele. For each gene, one allele is inherited from a person's father, and the ... person's mother. As a result, there are four alleles that produce alpha-globin. The different types of ...

  9. International Space Station (ISS) Alpha

    NASA Technical Reports Server (NTRS)


    An artist's concept of a fully deployed International Space Station (ISS) Alpha. The ISS-A is a multidisciplinary laboratory, technology test bed, and observatory that will provide an unprecedented undertaking in scientific, technological, and international experiments.

  10. Detecting Alpha-1 Antitrypsin Deficiency.


    Stoller, James K


    Alpha-1 antitrypsin deficiency is a widely underrecognized condition, with evidence of persisting long diagnostic delays and patients' frequent need to see multiple physicians before initial diagnosis. Reasons for underrecognition include inadequate understanding of alpha-1 antitrypsin deficiency by physicians and allied health care providers; failure to implement available, guideline-based practice recommendations; and the belief that effective therapy is unavailable. Multiple studies have described both the results of screening and targeted detection of individuals with alpha-1 antitrypsin deficiency, with both varying strategies employed to identify at-risk individuals and varying results of testing. Also, various strategies to enhance detection of affected individuals have been examined, including use of the electronic medical record to prompt testing and empowerment of allied health providers, especially respiratory therapists, to promote testing for alpha-1 antitrypsin deficiency. Such efforts are likely to enhance detection with the expected result that the harmful effects of delayed diagnosis can be mitigated. PMID:27564667

  11. Alpha decay in electron surrounding

    SciTech Connect

    Igashov, S. Yu.; Tchuvil’sky, Yu. M.


    The influence of atomic electron shells on the constant of alpha decay of heavy and mediummass nuclei was considered in detail. A method for simultaneously taking into account the change in the potential-barrier shape and the effect of reflection of a diverging Coulomb wave in the classically allowed region was developed. The ratios of decay probabilities per unit time for a bare nucleus and the respective neutral atom were found for some alpha-decaying isotopes.

  12. Elemental evidence

    NASA Astrophysics Data System (ADS)

    Carlowicz, Michael

    He set out to prove that ocean sediments contain elevated levels of the rare element iridium because of the natural weathering of the continents. Instead, what Ariel Anbar found was new evidence that a meteorite may have had a role in the mass extinctions that marked the end of the Cretaceous era.By studying the geochemical properties of iridium, Anbar, a professor of earth and environmental sciences and chemistry at the University of Rochester, found that the residence time—a measure of the rate at which an element settles out of water into sediments—of iridium in ocean water is 2000 to 20,000 years. That finding suggests that a large deposit of iridium could have lingered in the world's oceans long enough to explain the thickness of the iridium-rich sediment layers at the K-T boundary.



    Fortescue, P.; Zumwalt, L.R.


    A fuel element was developed for a gas cooled nuclear reactor. The element is constructed in the form of a compacted fuel slug including carbides of fissionable material in some cases with a breeder material carbide and a moderator which slug is disposed in a canning jacket of relatively impermeable moderator material. Such canned fuel slugs are disposed in an elongated shell of moderator having greater gas permeability than the canning material wherefore application of reduced pressure to the space therebetween causes gas diffusing through the exterior shell to sweep fission products from the system. Integral fission product traps and/or exterior traps as well as a fission product monitoring system may be employed therewith. (AEC)

  14. Expression of the mRNA encoding truncated PPAR alpha does not correlate with hepatic insensitivity to peroxisome proliferators.


    Hanselman, J C; Vartanian, M A; Koester, B P; Gray, S A; Essenburg, A D; Rea, T J; Bisgaier, C L; Pape, M E


    Two alternatively spliced forms of human PPAR alpha mRNA, PPAR alpha1 and PPAR alpha2, have been identified. PPAR alpha1 mRNA gives rise to an active PPAR alpha protein while PPAR alpha2 mRNA gives rise to a form of PPAR which lacks the ligand-binding domain. PPAR alpha2 is unable to activate a peroxisome proliferator response element (PPRE) reporter gene construct in transient transfection assays. Both PPAR alpha1 and PPAR alpha2 mRNA are present in human liver, kidney, testes, heart, small intestine, and smooth muscle. In human liver, PPAR alpha2 mRNA abundance is approximately half that of PPAR alpha1 mRNA; a correlation analysis of PPAR alpha1 and PPAR alpha2 mRNA mass revealed an r-value of 0.75 (n = 18). Additional studies with intact liver from various species, showed that the PPAR alpha2/PPAR alpha1 mRNA ratios in rat, rabbit, and mouse liver were less than 0.10; significantly lower than the 0.3 and 0.5 ratios observed in monkey and human livers, respectively. To determine if a high PPAR alpha2/PPAR alpha1 mRNA ratio was associated with insensitivity to peroxisome proliferators, we treated human, rat, and rabbit hepatocytes with WY14643, a potent PPAR alpha activator, and measured acyl CoA oxidase (ACO) mRNA levels. Rat ACO mRNA levels increased markedly in response to WY14643 while human and rabbit hepatocytes were unresponsive. Thus, although the PPAR alpha2/PPAR alpha1 mRNA ratio is low in rabbits, this species is not responsive to peroxisome proliferators. Further studies with male and female rats, which vary significantly in their response to peroxisome proliferators, showed little difference in the ratio of PPAR alpha2/PPAR alpha1 mRNA. These data suggest that selective PPAR alpha2 mRNA expression is not the basis for differential species or gender responses to peroxisome proliferators. PMID:11269670

  15. An Alpha-p-x Analytical Instrument for Lunar Resource Investigations

    NASA Technical Reports Server (NTRS)

    Economou, T. E.; Turkevich, A. L.


    An instrument using alpha backscattering, alpha-proton nuclear reactions, and x-ray production by alpha particles and other auxiliary sources can be used on lunar landers to provide detailed analytical information concerning the lunar surface material. This information is important scientifically and can be the basis for utilizing efficiently lunar resources to build lunar colonies in the future. This alpha particle instrument uses radioactive isotopes, silicon detectors for the alpha and proton modes, and mercuric iodide detectors operating at room temperature for the x-ray mode. The alpha and proton modes of the instrument can provide an analysis for all elements (except hydrogen) present in amounts greater than about 1 percent by atom. These modes have excellent sensitivity and accuracy for the lighter elements, in particular, directly determining the amount of oxygen in the lunar soil. This is an element of paramount significance for the lunar resource mission. The x-ray mode makes possible a determination of Ti, Fe, and other important metals with even greater accuracy. In general, the x-ray mode provides increased sensitivity for heavier elements, in many cases achieving a sensitivity of several hundred ppm.

  16. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  17. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  18. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  19. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  20. 21 CFR 882.1610 - Alpha monitor.

    Code of Federal Regulations, 2011 CFR


    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Alpha monitor. 882.1610 Section 882.1610 Food and... NEUROLOGICAL DEVICES Neurological Diagnostic Devices § 882.1610 Alpha monitor. (a) Identification. An alpha... electroencephalogram which is referred to as the alpha wave. (b) Classification. Class II (performance standards)....

  1. Binding of actin to lens alpha crystallins

    NASA Technical Reports Server (NTRS)

    Gopalakrishnan, S.; Takemoto, L.; Spooner, B. S. (Principal Investigator)


    Actin has been coupled to a cyanogen bromide-activated Sepharose 4B column, then tested for binding to alpha, beta, and gamma crystallin preparations from the bovine lens. Alpha, but not beta or gamma, crystallins bound to the actin affinity column in a time dependent and saturable manner. Subfractionation of the alpha crystallin preparation into the alpha-A and alpha-B species, followed by incubation with the affinity column, demonstrated that both species bound approximately the same. Together, these studies demonstrate a specific and saturable binding of lens alpha-A and alpha-B with actin.

  2. Analytical expressions for vibrational matrix elements of Morse oscillators

    SciTech Connect

    Zuniga, J.; Hidalgo, A.; Frances, J.M.; Requena, A.; Lopez Pineiro, A.; Olivares del Valle, F.J.


    Several exact recursion relations connecting different Morse oscillator matrix elements associated with the operators q/sup ..cap alpha../e/sup -//sup ..beta..//sup aq/ and q/sup ..cap alpha../e/sup -//sup ..beta..//sup aq/(d/dr) are derived. Matrix elements of the other useful operators may then be obtained easily. In particular, analytical expressions for (y/sup k/d/dr) and (y/sup k/d/dr+(d/dr)y/sup k/), matrix elements of interest in the study of the internuclear motion in polyatomic molecules, are obtained.

  3. A nuclear pathway for alpha 1-adrenergic receptor signaling in cardiac cells.

    PubMed Central

    Ardati, A; Nemer, M


    alpha 1-Adrenergic agonists and antagonists constitute an important class of therapeutic agents commonly used for the treatment of various cardiovascular diseases like hypertension, congestive heart failure and supraventricular tachycardia. At the heart level, activation of alpha 1-adrenergic receptors is associated with marked morphological and genetic changes. These include enhancement of contractility, myocardial growth (hypertrophy) and release of the heart major secretory product, atrial natriuretic factor (ANF). However, the signal transduction pathways which link extracellular activation of the receptors to cellular and genetic changes are not well understood. Using primary cardiocyte cultures from neonate rat hearts, an alpha 1-adrenergic regulatory sequence has been identified in the 5' flanking region of the ANF gene. This sequence, which is necessary and sufficient for transcriptional activation in response to the alpha 1-specific agonist phenylephrine, interacts with novel zinc-dependent proteins which are induced by alpha 1-adrenergic stimulation. Consistent with a conserved regulatory mechanism, the alpha 1 response element is highly conserved between rodent, bovine and human ANF genes, and is also present in the promoter region of other alpha 1-responsive cardiac genes. The identification of a nuclear pathway for alpha 1-receptor signaling will be useful for elucidating the intracellular effectors of alpha 1-adrenergic receptors. Images PMID:8262057

  4. Hypoxia-inducible factor 2alpha binds to cobalt in vitro.


    Yuan, Y; Beitner-Johnson, D; Millhorn, D E


    The hypoxia-inducible factor (HIF) activates the expression of genes that contain a hypoxia response element (HRE). The alpha subunit of the HIF transcription factors is degraded by proteasome pathways during normoxia, but stabilized under hypoxic conditions. It has previously been established that cobalt causes accumulation of HIF-2alpha and HIF-1alpha. However, little is known about the mechanism by which cobalt mimics hypoxia and stabilizes these transcription factors. We show here that cobalt binds directly to HIF-2alpha in vitro with a high affinity and in an oxygen-dependent manner. We found that HIF-2alpha, which had been stabilized with a proteasome inhibitor, could bind to cobalt, whereas hypoxia-stabilized HIF-2alpha could not. Mutations within the oxygen-dependent degradation domain of HIF-2alpha prevented cobalt binding and led to accumulation of HIF-2alpha during normoxia. This suggests that transition metal such as iron may play a role in regulation of HIF-2alpha in vivo. PMID:11688986

  5. Modulation of gene expression by alpha-tocopherol and alpha-tocopheryl phosphate

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The naturally occurring vitamin E analogue, alpha-tocopheryl phosphate (alphaTP), has been reported to be more potent in reducing cell proliferation and the expression of the CD36 scavenger receptor than the un-phosphorylated alpha-tocopherol (alpha T). We have now assessed the effects of alpha T an...

  6. Mechanism of alpha-tocopheryl-phosphate (alpha-TP) transport across the cell membrane

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have reported that alpha-TP is synthesized and hydrolyzed in animal cells and tissues; it modulates also several cell functions (FRBM 39:970, and UBMB Life, 57:23, 2005). While it is similar to alpha-tocopherol (alpha-T), alpha-TP appears to be more potent than alpha-T in inhibiting cell prolifer...



    Howard, R.C.; Bokros, J.C.


    A fueled matrlx eontnwinlng uncomblned carbon is deslgned for use in graphlte-moderated gas-cooled reactors designed for operatlon at temperatures (about 1500 deg F) at which conventional metallic cladding would ordlnarily undergo undesired carburization or physical degeneratlon. - The invention comprlses, broadly a fuel body containlng uncombined earbon, clad with a nickel alloy contalning over about 28 percent by' weight copper in the preferred embodlment. Thls element ls supporirted in the passageways in close tolerance with the walls of unclad graphite moderator materlal. (AEC)

  8. Workshop on Precision Measurements of $\\alpha_s$

    SciTech Connect

    Bethke, Siegfried; Hoang, Andre H.; Kluth, Stefan; Schieck, Jochen; Stewart, Iain W.; Aoki, S.; Beneke, M.; Bethke, S.; Blumlein, J.; Brambilla, N.; Brodsky, S.; /MIT, LNS


    These are the proceedings of the Workshop on Precision Measurements of {alpha}{sub s} held at the Max-Planck-Institute for Physics, Munich, February 9-11, 2011. The workshop explored in depth the determination of {alpha}{sub s}(m{sub Z}) in the {ovr MS} scheme from the key categories where high precision measurements are currently being made, including DIS and global PDF fits, {tau}-decays, electro-weak precision observables and Z-decays, event-shapes, and lattice QCD. These proceedings contain a short summary contribution from the speakers, as well as the lists of authors, conveners, participants, and talks.

  9. Immunodiagnosis of alpha chain disease.

    PubMed Central

    Doe, W F; Danon, F; Seligmann, M


    Since the early diagnosis of alpha chain disease (alphaCD)) is essential to successful treatment and to epidemiological studies, the available immunodiagnostic techniques were compared for their sensitivity, specificity and ease of performance on a panel of sixteen sera, comprising ten alphaCD sera and six control sera containing either IgA myeloma protein or high levels of polyclonal IgA. Immunoselection by immunoelectrophoresis into gel containing a specially developed anti-Fabalpha antiserum provided the most sensitive and specific detection system for alphaCD protein. The same technique using anti-light chain antiserum for immunoselection was also highly sensitive, but proved less specific, being prone to false positives with difficult IgA myeloma proteins. Somewhat less sensitive, but specific and simple to perform, was immunoelectrophoresis using an antiserum recognizing the conformational specificities of Fabalpha as well as those of the constant region of alpha chains. Immunoselection using the Ouchterlony or rocket techniques proved to be less sensitive and prone to false positives when some IgA myeloma sera were tested. Images FIG. 1 FIG. 2 FIG. 3 FIG. 4 FIG. 5 FIG. 6 FIG. 7 PMID:113152

  10. Interstitial solubility in {gamma} and {alpha}{sub 2} phases of TiAl-based alloys

    SciTech Connect

    Menand, A.; Huguet, A.; Nerac-Partaix, A.


    Measurements of interstitial concentrations were performed on ({alpha}{sub 2} + {gamma}) two-phase TiAl alloys and on {gamma} single-phase TiAl alloys. This study allowed the determination of the maximum solubility of oxygen and carbon in the {gamma} phase. The influence on this solubility of various parameters such as temperature, {alpha}{sub 2} and {gamma} phase stoichiometry and the alloying addition of a third element will be discussed. This paper also presents an explanation for the higher solubility of oxygen in {alpha}{sub 2} phase compared to {gamma} phase. From the results it is shown unambiguously that the better ductility of ({alpha}{sub 2} + {gamma}) two-phase alloys can no longer fit with the widespread idea of a scavenging effect of the {alpha}{sub 2} phase which would lower in that way the interstitial level in {gamma} phase.

  11. alpha-Thalassemia caused by an unstable alpha-globin mutant.

    PubMed Central

    Liebhaber, S A; Kan, Y W


    In a previous study, molecular cloning of the alpha-globin genes from a patient with nondeletion Hb-H disease (genotype--/alpha alpha) showed that a single nucleotide mutation (CTG to CCG) in one of the genes resulted in a leucine to proline substitution. This paper describes the approach we used to detect the abnormal alpha-globin chain. The chain was identified using a cell-free translation system. It turned over rapidly both in vitro and in vivo in the patient's reticulocytes. The unusual feature of this unstable alpha-globin is that the alpha-globin deficiency causes alpha-thalassemia. Simple heterozygotes for this lesion (alpha Pro alpha/alpha alpha) resemble alpha-thalassemia carriers and do not exhibit the hemolytic anemia usually associated with unstable hemoglobins. Images PMID:6826718

  12. Heavy Elements and Cool Stars

    NASA Technical Reports Server (NTRS)

    Wahlgren, Glenn M.; Carpenter, Kenneth G.; Norris, Ryan P.


    We report on progress in the analysis of high-resolution near-IR spectra of alpha Orionis (M2 Iab) and other cool, luminous stars. Using synthetic spectrum techniques, we search for atomic absorption lines in the stellar spectra and evaluate the available line parameter data for use in our abundance analyses. Our study concentrates on the post iron-group elements copper through zirconium as a means of investigating the slow neutron-capture process of nucleosynthesis in massive stars and the mechanisms that transport recently processed material up into the photospheric region. We discuss problems with the atomic data and model atmospheres that need to be addressed before theoretically derived elemental abundances from pre-supernova nucleosynthesis calculations can be tested by comparison with abundances determined from observations of cool, massive stars.

  13. Test chamber for alpha spectrometry


    Larsen, Robert P.


    Alpha emitters for low-level radiochemical analysis by measurement of alpha spectra are positioned precisely with respect to the location of a surface-barrier detector by means of a chamber having a removable threaded planchet holder. A pedestal on the planchet holder holds a specimen in fixed engagement close to the detector. Insertion of the planchet holder establishes an O-ring seal that permits the chamber to be pumped to a desired vacuum. The detector is protected against accidental contact and resulting damage.

  14. Bremsstrahlung in {alpha} Decay Reexamined

    SciTech Connect

    Boie, H.; Scheit, H.; Jentschura, U. D.; Koeck, F.; Lauer, M.; Schwalm, D.; Milstein, A. I.; Terekhov, I. S.


    A high-statistics measurement of bremsstrahlung emitted in the {alpha} decay of {sup 210}Po has been performed, which allows us to follow the photon spectra up to energies of {approx}500 keV. The measured differential emission probability is in good agreement with our theoretical results obtained within the quasiclassical approximation as well as with the exact quantum mechanical calculation. It is shown that, due to the small effective electric dipole charge of the radiating system, a significant interference between the electric dipole and quadrupole contributions occurs, which is altering substantially the angular correlation between the {alpha} particle and the emitted photon.

  15. NACA Physicist Studying Alpha Rays

    NASA Technical Reports Server (NTRS)


    NACA Physicits studying Alpha Rays in a continuous cloud chamber. A cloud chamber is used by Lewis scientists to obtain information aimed at minimizing undesirable effects of radiation on nuclear-powered aircraft components. Here, alpha particles from a polonium source emit in a flower-like pattern at the cloud chamber's center. The particles are made visible by means of alcohol vapor diffusing from an area at room temperature to an area at minus -78 deg. Centigrade. Nuclear-powered aircraft were never developed and aircraft nuclear propulsion systems were canceled in the early 1960s.

  16. Thiazolidinediones inhibit REG I{alpha} gene transcription in gastrointestinal cancer cells

    SciTech Connect

    Yamauchi, Akiyo; Takahashi, Iwao; Takasawa, Shin; Nata, Koji; Noguchi, Naoya; Ikeda, Takayuki; Yoshikawa, Takeo; Shervani, Nausheen J.; Suzuki, Iwao; Uruno, Akira; Unno, Michiaki; Okamoto, Hiroshi Sugawara, Akira


    REG (Regenerating gene) I{alpha} protein functions as a growth factor for gastrointestinal cancer cells, and its mRNA expression is strongly associated with a poor prognosis in gastrointestinal cancer patients. We here demonstrated that PPAR{gamma}-agonist thiazolidinediones (TZDs) inhibited cell proliferation and REG I{alpha} protein/mRNA expression in gastrointestinal cancer cells. TZDs inhibited the REG I{alpha} gene promoter activity, via its cis-acting element which lacked PPAR response element and could not bind to PPAR{gamma}, in PPAR{gamma}-expressing gastrointestinal cancer cells. The inhibition was reversed by co-treatment with a specific PPAR{gamma}-antagonist GW9662. Although TZDs did not inhibit the REG I{alpha} gene promoter activity in PPAR{gamma}-non-expressing cells, PPAR{gamma} overexpression in the cells recovered their inhibitory effect. Taken together, TZDs inhibit REG I{alpha} gene transcription through a PPAR{gamma}-dependent pathway. The TZD-induced REG I{alpha} mRNA reduction was abolished by cycloheximide, indicating the necessity of novel protein(s) synthesis. TZDs may therefore be a candidate for novel anti-cancer drugs for patients with gastrointestinal cancer expressing both REG I{alpha} and PPAR{gamma}.

  17. Structural Basis of Natural Promoter Recognition by a Unique Nuclear Receptor, HNF4[alpha

    SciTech Connect

    Lu, Peng; Rha, Geun Bae; Melikishvili, Manana; Wu, Guangteng; Adkins, Brandon C.; Fried, Michael G.; Chi, Young-In


    HNF4{alpha} (hepatocyte nuclear factor 4{alpha}) plays an essential role in the development and function of vertebrate organs, including hepatocytes and pancreatic {beta}-cells by regulating expression of multiple genes involved in organ development, nutrient transport, and diverse metabolic pathways. As such, HNF4{alpha} is a culprit gene product for a monogenic and dominantly inherited form of diabetes, known as maturity onset diabetes of the young (MODY). As a unique member of the nuclear receptor superfamily, HNF4{alpha} recognizes target genes containing two hexanucleotide direct repeat DNA-response elements separated by one base pair (DR1) by exclusively forming a cooperative homodimer. We describe here the 2.0 {angstrom} crystal structure of human HNF4{alpha} DNA binding domain in complex with a high affinity promoter element of another MODY gene, HNF1{alpha}, which reveals the molecular basis of unique target gene selection/recognition, DNA binding cooperativity, and dysfunction caused by diabetes-causing mutations. The predicted effects of MODY mutations have been tested by a set of biochemical and functional studies, which show that, in contrast to other MODY gene products, the subtle disruption of HNF4{alpha} molecular function can cause significant effects in afflicted MODY patients.

  18. Application of the space-time conservation element and solution element method to two-dimensional advection-diffusion problems

    NASA Technical Reports Server (NTRS)

    Wang, Xiao-Yen; Chow, Chuen-Yen; Chang, Sin-Chung


    The existing 2-D alpha-mu scheme and alpha-epsilon scheme based on the method of space-time conservation element and solution element, which were constructed for solving the linear 2-D unsteady advection-diffusion equation and unsteady advection equation, respectively, are tested. Also, the alpha-epsilon scheme is modified to become the V-E scheme for solving the nonlinear 2-D inviscid Burgers equation. Numerical solutions of six test problems are presented in comparison with their exact solutions or numerical solutions obtained by traditional finite-difference or finite-element methods. It is demonstrated that the 2-D alpha-mu, alpha-epsilon, and nu-epsilon schemes can be used to obtain numerical results which are more accurate than those based on some of the traditional methods but without using any artificial tuning in the computation. Similar to the previous 1-D test problems, the high accuracy and simplicity features of the space-time conservation element and solution element method have been revealed again in the present 2-D test results.

  19. Alcoholism, Alpha Production, and Biofeedback

    ERIC Educational Resources Information Center

    Jones, Frances W.; Holmes, David S.


    Electroencephalograms of 20 alcoholics and 20 nonalcoholics were obtained. Data indicated that alcoholics produced less alpha than nonalcoholics. In one training condition subjects were given accurate biofeedback, whereas in the other condition subjects were given random (noncontingent) feedback. Accurate biofeedback did not result in greater…

  20. Meet the Alpha-Pets.

    ERIC Educational Resources Information Center

    Zitlaw, Jo Ann Bruce; Frank, Cheryl Standish


    "Alpha-Pets" are the focal point of an integrated, multidisciplinary curriculum. Each pet is featured for a week in a vocabulary-rich story and introduces related activities beginning with the featured letter, such as the four food groups during Freddie Fish's week or universe during Ulysses Unicorn's week. (MT)

  1. Sparse Coding for Alpha Matting

    NASA Astrophysics Data System (ADS)

    Johnson, Jubin; Varnousfaderani, Ehsan Shahrian; Cholakkal, Hisham; Rajan, Deepu


    Existing color sampling based alpha matting methods use the compositing equation to estimate alpha at a pixel from pairs of foreground (F) and background (B) samples. The quality of the matte depends on the selected (F,B) pairs. In this paper, the matting problem is reinterpreted as a sparse coding of pixel features, wherein the sum of the codes gives the estimate of the alpha matte from a set of unpaired F and B samples. A non-parametric probabilistic segmentation provides a certainty measure on the pixel belonging to foreground or background, based on which a dictionary is formed for use in sparse coding. By removing the restriction to conform to (F,B) pairs, this method allows for better alpha estimation from multiple F and B samples. The same framework is extended to videos, where the requirement of temporal coherence is handled effectively. Here, the dictionary is formed by samples from multiple frames. A multi-frame graph model, as opposed to a single image as for image matting, is proposed that can be solved efficiently in closed form. Quantitative and qualitative evaluations on a benchmark dataset are provided to show that the proposed method outperforms current state-of-the-art in image and video matting.

  2. Alpha Testing Escape from Diab

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Alpha testing was conducted of sessions 2 and 3 from Diab to assess whether the activities worked as expected, and whether children in the target ages enjoyed it. Data include both RA observations of child performance while playing the games and cognitive interview responses from the players after t...

  3. Hepatic effects of a methionine-choline-deficient diet in hepatocyte RXR{alpha}-null mice

    SciTech Connect

    Gyamfi, Maxwell Afari; Tanaka, Yuji; He Lin; Klaassen, Curtis D.; Wan, Y.-J.Y.


    Retinoid X receptor-{alpha} (RXR{alpha}) is an obligate partner for several nuclear hormone receptors that regulate important physiological processes in the liver. In this study the impact of hepatocyte RXR{alpha} deficiency on methionine and choline deficient (MCD) diet-induced steatosis, oxidative stress, inflammation, and hepatic transporters gene expression were examined. The mRNA of sterol regulatory element-binding protein (SREBP)-regulated genes, important for lipid synthesis, were not altered in wild type (WT) mice, but were increased 2.0- to 5.4-fold in hepatocyte RXR{alpha}-null (H-RXR{alpha}-null) mice fed a MCD diet for 14 days. Furthermore, hepatic mRNAs and proteins essential for fatty acid {beta}-oxidation were not altered in WT mice, but were decreased in the MCD diet-fed H-RXR{alpha}-null mice, resulting in increased hepatic free fatty acid levels. Cyp2e1 enzyme activity and lipid peroxide levels were induced only in MCD-fed WT mice. In contrast, hepatic mRNA levels of pro-inflammatory factors were increased only in H-RXR{alpha}-null mice fed the MCD diet. Hepatic uptake transporters Oatp1a1 and Oatp1b2 mRNA levels were decreased in WT mice fed the MCD diet, whereas the efflux transporter Mrp4 was increased. However, in the H-RXR{alpha}-null mice, the MCD diet only moderately decreased Oatp1a1 and induced both Oatp1a4 and Mrp4 gene expression. Whereas the MCD diet increased serum bile acid levels and alkaline phosphatase activity in both WT and H-RXR{alpha}-null mice, serum ALT levels were induced (2.9-fold) only in the H-RXR{alpha}-null mice. In conclusion, these data suggest a critical role for RXR{alpha} in hepatic fatty acid homeostasis and protection against MCD-induced hepatocyte injury.

  4. PPAR{alpha} is a key regulator of hepatic FGF21

    SciTech Connect

    Lundasen, Thomas; Hunt, Mary C.; Nilsson, Lisa-Mari; Sanyal, Sabyasachi; Angelin, Bo; Alexson, Stefan E.H.; Rudling, Mats . E-mail:


    The metabolic regulator fibroblast growth factor 21 (FGF21) has antidiabetic properties in animal models of diabetes and obesity. Using quantitative RT-PCR, we here show that the hepatic gene expression of FGF21 is regulated by the peroxisome proliferator-activated receptor alpha (PPAR{alpha}). Fasting or treatment of mice with the PPAR{alpha} agonist Wy-14,643 induced FGF21 mRNA by 10-fold and 8-fold, respectively. In contrast, FGF21 mRNA was low in PPAR{alpha} deficient mice, and fasting or treatment with Wy-14,643 did not induce FGF21. Obese ob/ob mice, known to have increased PPAR{alpha} levels, displayed 12-fold increased hepatic FGF21 mRNA levels. The potential importance of PPAR{alpha} for FGF21 expression also in human liver was shown by Wy-14,643 induction of FGF21 mRNA in human primary hepatocytes, and PPAR{alpha} response elements were identified in both the human and mouse FGF21 promoters. Further studies on the mechanisms of regulation of FGF21 by PPAR{alpha} in humans will be of great interest.

  5. Identification and characterization of an alternative promoter of the human PGC-1{alpha} gene

    SciTech Connect

    Yoshioka, Toyo; Inagaki, Kenjiro; Noguchi, Tetsuya; Sakai, Mashito; Ogawa, Wataru; Hosooka, Tetsuya; Iguchi, Haruhisa; Watanabe, Eijiro; Matsuki, Yasushi; Hiramatsu, Ryuji; Kasuga, Masato


    The transcriptional regulator peroxisome proliferator-activated receptor-{gamma} coactivator-1{alpha} (PGC-1{alpha}) controls mitochondrial biogenesis and energy homeostasis. Although physical exercise induces PGC-1{alpha} expression in muscle, the underlying mechanism of this effect has remained incompletely understood. We recently identified a novel muscle-enriched isoform of PGC-1{alpha} transcript (designated PGC-1{alpha}-b) that is derived from a previously unidentified first exon. We have now cloned and characterized the human PGC-1{alpha}-b promoter. The muscle-specific transcription factors MyoD and MRF4 transactivated this promoter through interaction with a proximal E-box motif. Furthermore, either forced expression of Ca{sup 2+}- and calmodulin-dependent protein kinase IV (CaMKIV), calcineurin A, or the p38 mitogen-activated protein kinase (p38 MAPK) kinase MKK6 or the intracellular accumulation of cAMP activated the PGC-1{alpha}-b promoter in cultured myoblasts through recruitment of cAMP response element (CRE)-binding protein (CREB) to a putative CRE located downstream of the E-box. Our results thus reveal a potential molecular basis for isoform-specific regulation of PGC-1{alpha} expression in contracting muscle.

  6. Modulation of gene expression by alpha-tocopherol and alpha-tocopheryl phosphate in thp-1 monocytes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The naturally occurring vitamin E analogue, alpha-tocopheryl phosphate (alphaTP), has been reported to be more potent than the un-phosphorylated alpha alpha-tocopherol (alphaT). We have now measured plasma levels of alphaTP and compared the cellular effects of alphaTP and gamma-tocopheryl phosphate ...

  7. Coexistence of {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in {sup 10}Be

    SciTech Connect

    Itagaki, N.; Ito, M.; Milin, M.; Hashimoto, T.; Ishiyama, H.; Miyatake, H.


    The coexistence of the {alpha}+{alpha}+n+n and {alpha}+t+t cluster structures in the excited states of {sup 10}Be has been discussed. In the previous analysis, all the low-lying states of {sup 10}Be were found to be well described by the motion of the two valence neutrons around two {alpha} clusters. However, the {alpha}+t+t cluster structure was found to coexist with the {alpha}+{alpha}+n+n structure around E{sub x}=15 MeV, close to the corresponding threshold. We have introduced a microscopic model to solve the coupling effect between these two configurations. The K=0 and K=1 states are generated from the {alpha}+t+t configurations due to the spin coupling of two triton clusters. The present case of {sup 10}Be is one of the few examples in which completely different configurations of triton-type ({alpha}+t+t three-center) and {alpha}-type ({alpha}+{alpha}+n+n two-center) clusters coexist in a single nucleus in the same energy region.

  8. New elements produced at GSI

    NASA Astrophysics Data System (ADS)

    Hofmann, Sigurd


    In two series of experiments at SHIP, six new elements (Z=107-112) were synthesized via fusion reactions using lead or bismuth targets and 1n-deexcitation channels. The isotopes were unambiguously identified by means of α-α correlations. Not fission, but alpha decay is the dominant decay mode. Cross-sections decrease by two orders of magnitude from bohrium (Z=107) to element 112, for which a cross-section of 1 pb was measured. Based on our results, it is likely that the production of isotopes of element 114 close to the island of spherical SuperHeavy Elements (SHE) could be achieved by fusion reactions using 208Pb targets. Systematic studies of the reaction cross-sections indicate that the transfer of nucleons is an important process for the initiation of fusion. The data allow for the fixing of a narrow energy window for the production of SHE using 1n-emission channels. The likelihood of broadening the energy window by investigation of radiative capture reactions, use of neutron deficient projectile isotopes and use of actinide targets is discussed.

  9. The RNA polymerase II trigger loop functions in substrate selection and is directly targeted by alpha-amanitin.


    Kaplan, Craig D; Larsson, Karl-Magnus; Kornberg, Roger D


    Structural, biochemical, and genetic studies have led to proposals that a mobile element of multisubunit RNA polymerases, the Trigger Loop (TL), plays a critical role in catalysis and can be targeted by antibiotic inhibitors. Here we present evidence that the Saccharomyces cerevisiae RNA Polymerase II (Pol II) TL participates in substrate selection. Amino acid substitutions within the Pol II TL preferentially alter substrate usage and enzyme fidelity, as does inhibition of transcription by alpha-amanitin. Finally, substitution of His1085 in the TL specifically renders Pol II highly resistant to alpha-amanitin, indicating a functional interaction between His1085 and alpha-amanitin that is supported by rerefinement of an alpha-amanitin-Pol II crystal structure. We propose that alpha-amanitin-inhibited Pol II elongation, which is slow and exhibits reduced substrate selectivity, results from direct alpha-amanitin interference with the TL. PMID:18538653

  10. DNase1 footprints suggest the involvement of at least three types of transcription factors in the regulation of alpha-Amy2/A by gibberellin.


    Willmott, R L; Rushton, P J; Hooley, R; Lazarus, C M


    To elucidate the mechanisms by which alpha-amylase genes are expressed in wild oat aleurone, two genes, alpha-Amy2/A and alpha-Amy2/D, were isolated. Both were shown to be positively regulated by gibberellin (GA) during germination and both contain the conserved cis-acting elements Box 2, GA-response element (TAACAGA) and TATCSATSS (where S is C or G). In addition, they possess a conserved initiator element (CATCA) that is present in both alpha-Amy2 and alpha-Amy1 genes, and also in a number of other plant TATA-containing and TATA-less promoters. DNase 1 footprint analysis showed the alpha-Amy2/A promoter to be a complex array of binding sites for a number of different classes of DNA-binding proteins. Our data suggest that the area around the initiator element (Inr) is bound by a large complex of general transcription factors, that the TATA box is bound by the TFIID complex, that Box 2 is bound by one or more WRKY proteins and that the GA-response element is bound by one or more MYBs. Two other elements containing the core sequence CCATGG/C are bound by nuclear protein and this sequence is the core of the Sph element. The regulation of alpha-Amy2 genes by GA therefore involves an interplay of at least three different types of transcription factor. PMID:9862499

  11. Genetics Home Reference: 5-alpha reductase deficiency


    ... gene provides instructions for making an enzyme called steroid 5-alpha reductase 2. This enzyme is involved ... external genitalia. Mutations in the SRD5A2 gene prevent steroid 5-alpha reductase 2 from effectively converting testosterone ...

  12. Aversive Situational Effects on Alpha Feedback Training

    ERIC Educational Resources Information Center

    Orne, Martin T.; Paskeqitz, David A.


    Anticipation of electric shock did not depress alpha activity in a feedback situation. Contrary to previous reports, a reduction in alpha activity is not a necessary consequence of apprehension or heightened arousal. (Author)

  13. What Causes Alpha-1 Antitrypsin Deficiency?


    ... from the NHLBI on Twitter. What Causes Alpha-1 Antitrypsin Deficiency? Alpha-1 antitrypsin (AAT) deficiency is an inherited disease. "Inherited" ... have AAT deficiency inherit two faulty AAT genes, one from each parent. These genes tell cells in ...

  14. How Is Alpha-1 Antitrypsin Deficiency Treated?


    ... from the NHLBI on Twitter. How Is Alpha-1 Antitrypsin Deficiency Treated? Alpha-1 antitrypsin (AAT) deficiency has no cure, but its ... of these treatments are the same as the ones used for a lung disease called COPD (chronic ...

  15. Q (Alpha) Function and Squeezing Effect

    NASA Technical Reports Server (NTRS)

    Yunjie, Xia; Xianghe, Kong; Kezhu, Yan; Wanping, Chen


    The relation of squeezing and Q(alpha) function is discussed in this paper. By means of Q function, the squeezing of field with gaussian Q(alpha) function or negative P(a)function is also discussed in detail.

  16. Association of actin with alpha crystallins

    NASA Technical Reports Server (NTRS)

    Gopalakrishnan, S.; Boyle, D.; Takemoto, L.; Spooner, B. S. (Principal Investigator)


    The alpha crystallins are cytosolic proteins that co-localize and co-purify with actin-containing microfilaments. Affinity column chromatography employing both covalently-coupled actin or alpha crystallin was used to demonstrate specific and saturable binding of actin with alpha crystallin. This conclusion was confirmed by direct visualization of alpha aggregates bound to actin polymerized in vitro. The significance of this interaction in relation to the functional properties of these two polypeptides will be discussed.

  17. The ultraviolet spectra of Alpha Aquilae and Alpha Canis Minoris

    NASA Technical Reports Server (NTRS)

    Morton, D. C.; Bruzual A., G.; Kurucz, R. L.; Spinrad, H.


    Scans of Alpha Aql (A7 IV, V) and Alpha CMi (F5 IV-V) obtained with the Copernicus satellite spectrometer over the wavelength range from 2100 to 3200 A are presented along with a spectrum of the integrated solar disk over the same range procured during a calibrated rocket flight. About 1500 fairly strong absorption lines in the Alpha CMi spectrum between 2400 and 2961 A are identified by comparison with a solar atlas and by using a theoretical spectrum synthesized from a blanketed LTE model with an effective temperature of 6500 K and a surface gravity of 10,000 cm/sec per sec. The Mg II resonance doublet at 2795.528 and 2802.704 A is found to be present in all three stars together with a discontinuity at 2635 A due to Fe II, Fe I, Cr I, and Mn II. It is concluded that the Mg II resonance lines and the 2635-A continuum break would be the best spectral features for estimating the redshift of a galaxy observed at low resolution provided the redshift is not less than about 0.75.

  18. Recent Results on the CKM Angle Alpha

    SciTech Connect

    Mihalyi, A.; /Wisconsin U., Madison


    The method to measure the CKM angle {alpha} and the modes sensitive to it are discussed. It is shown that the B {yields} {rho}{rho} decays provide the most stringent constraint on {alpha}, which is found to be {alpha} = 96{sup o} {+-} 10{sup o}(stat) {+-} 4{sup o}(syst){+-} 13{sup o}(penguin).

  19. Effectiveness of Alpha Biofeedback Therapy: Negative Results.

    ERIC Educational Resources Information Center

    Watson, Charles G.; Herder, Joseph


    Assessed the utility of alpha biofeedback training in the treatment of patients (N=66). Biofeedback and placebo biofeedback groups were given alpha or mock-alpha training sessions. Improvement on 54 variables was compared to that of no-treatment controls. Only a chance number of significant changes appeared among the groups. (Author)

  20. 6 alpha-Fluoro- and 6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione: synthesis and evaluation of activity and kinetics of their C-22 epimers.


    Thalén, B A; Axelsson, B I; Andersson, P H; Brattsand, R L; Nylander, B; Wickström, L I


    It is generally accepted that the anti-inflammatory effect of glucocorticosteroids cannot be separated from their adverse effects at the receptor level. However, modification of the pharmacokinetics through structural alterations could provide steroids with a better therapeutic index than those currently used. Thus, new 16 alpha,17 alpha-acetals between butyraldehyde and 6 alpha-fluoro- or 6 alpha,9 alpha-difluoro-16 alpha-hydroxycortisol were synthesized and studied. Acetalization of the corresponding 16 alpha,17 alpha-diols or transacetalization of their 16 alpha,17 alpha-acetonides in dioxane produced mixtures of C-22 epimers, which were resolved by preparative chromatography. Alternatively, an efficient method was used to produce the 22R-epimer stereoselectively through performing the acetalization and transacetalization in a hydrocarbon with an inert material present. The C-22 configuration of (22R)-6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione was unambiguously established by single crystal X-ray diffraction. The present compounds, especially the 22R-epimer just mentioned, bind to the rat thymus glucocorticoid receptor with high potency. The C-22 epimers of the 6 alpha,9 alpha-difluoro derivatives showed a 10-fold higher biotransformation rate than the budesonide 22R-epimer when incubated with human liver S9 subcellular fraction. The high receptor affinity in combination with the high biotransformation rate indicates that (22R)-6 alpha,9 alpha-difluoro-11 beta,21-dihydroxy-16 alpha,17 alpha-propylmethylenedioxypregn-4-ene-3,20-dione may be an improved 16 alpha,17 alpha-acetal glucocorticosteroid for therapy of inflammatory diseases, in which the mucous membranes are involved, such as those in the intestinal tract as well in the respiratory tract. PMID:9437793


    SciTech Connect

    Hayes, Matthew; Oestlin, Goeran; Duval, Florent; Guaita, Lucia; Melinder, Jens; Sandberg, Andreas; Schaerer, Daniel; Verhamme, Anne; Orlitova, Ivana; Mas-Hesse, J. Miguel; Oti-Floranes, Hector; Adamo, Angela; Atek, Hakim; Cannon, John M.; Herenz, E. Christian; Kunth, Daniel; Laursen, Peter


    We report on new imaging observations of the Lyman alpha emission line (Ly{alpha}), performed with the Hubble Space Telescope, that comprise the backbone of the Lyman alpha Reference Sample. We present images of 14 starburst galaxies at redshifts 0.028 < z < 0.18 in continuum-subtracted Ly{alpha}, H{alpha}, and the far ultraviolet continuum. We show that Ly{alpha} is emitted on scales that systematically exceed those of the massive stellar population and recombination nebulae: as measured by the Petrosian 20% radius, R{sub P20}, Ly{alpha} radii are larger than those of H{alpha} by factors ranging from 1 to 3.6, with an average of 2.4. The average ratio of Ly{alpha}-to-FUV radii is 2.9. This suggests that much of the Ly{alpha} light is pushed to large radii by resonance scattering. Defining the Relative Petrosian Extension of Ly{alpha} compared to H{alpha}, {xi}{sub Ly{alpha}} = R {sup Ly{alpha}}{sub P20}/R {sup H{alpha}}{sub P20}, we find {xi}{sub Ly{alpha}} to be uncorrelated with total Ly{alpha} luminosity. However, {xi}{sub Ly{alpha}} is strongly correlated with quantities that scale with dust content, in the sense that a low dust abundance is a necessary requirement (although not the only one) in order to spread Ly{alpha} photons throughout the interstellar medium and drive a large extended Ly{alpha} halo.

  2. Alpha channeling in a rotating plasma.


    Fetterman, Abraham J; Fisch, Nathaniel J


    The wave-particle alpha-channeling effect is generalized to include rotating plasma. Specifically, radio frequency waves can resonate with alpha particles in a mirror machine with ExB rotation to diffuse the alpha particles along constrained paths in phase space. Of major interest is that the alpha-particle energy, in addition to amplifying the rf waves, can directly enhance the rotation energy which in turn provides additional plasma confinement in centrifugal fusion reactors. An ancillary benefit is the rapid removal of alpha particles, which increases the fusion reactivity. PMID:19113347

  3. Alpha voltaic batteries and methods thereof

    NASA Technical Reports Server (NTRS)

    Raffaelle, Ryne P. (Inventor); Jenkins, Phillip (Inventor); Wilt, David (Inventor); Scheiman, David (Inventor); Chubb, Donald (Inventor); Castro, Stephanie (Inventor)


    An alpha voltaic battery includes at least one layer of a semiconductor material comprising at least one p/n junction, at least one absorption and conversion layer on the at least one layer of semiconductor layer, and at least one alpha particle emitter. The absorption and conversion layer prevents at least a portion of alpha particles from the alpha particle emitter from damaging the p/n junction in the layer of semiconductor material. The absorption and conversion layer also converts at least a portion of energy from the alpha particles into electron-hole pairs for collection by the one p/n junction in the layer of semiconductor material.

  4. Sequence heterogeneity and differential expression of the alpha-Amy2 gene family in wheat.


    Huttly, A K; Martienssen, R A; Baulcombe, D C


    The alpha-Amy2 genes of wheat are a multigene family which is expressed in the aleurone cells of germinating grain under control of the plant hormone gibberellin. A subset of the genes are also expressed in developing grain. Comparison of five genomic clones containing alpha-Amy2 genes, using DNA sequence analysis and Southern hybridisation, showed that the extent of similarity between genes differed. Two of the most heterogeneous genes compared were located to the same group 7 chromosome while the most similar genes alpha-Amy2/54 and alpha-Amy2/8 were located to different ones; hence sequence variation could not be correlated to the ancestry of the alpha-Amy2 genes during the separate existence of the constituent genomes of hexaploid wheat. Expression of the cloned genes was measured using an S1 nuclease protection assay and this identified alpha-Amy2/54 and alpha-Amy2/8 as part of the subset of alpha-Amy2 genes expressed in both the developing grain and in aleurone cells. Comparison of the 5' upstream regions of all five genes showed high similarity, with the exception of one gene, up to -280 nucleotides from the transcriptional start, while similarity between alpha-Amy2/54 and alpha-Amy2/8 extended a further 90 bp upstream of this point. It is suggested that regulatory elements responsible for tissue specificity and gibberellin regulation may be located within these regions of similarity. PMID:2467183

  5. Dynamic charge interactions create surprising rigidity in the ER/K [alpha]-helical protein motif

    SciTech Connect

    Sivaramakrishnan, Sivaraj; Spink, Benjamin J.; Sim, Adelene Y.L.; Doniach, Sebastian; Spudich, James A.


    Protein {alpha}-helices are ubiquitous secondary structural elements, seldom considered to be stable without tertiary contacts. However, amino acid sequences in proteins that are based on alternating repeats of four glutamic acid (E) residues and four positively charged residues, a combination of arginine (R) and lysine (K), have been shown to form stable {alpha}-helices in a few proteins, in the absence of tertiary interactions. Here, we find that this ER/K motif is more prevalent than previously reported, being represented in proteins of diverse function from archaea to humans. By using molecular dynamics (MD) simulations, we characterize a dynamic pattern of side-chain interactions that extends along the backbone of ER/K {alpha}-helices. A simplified model predicts that side-chain interactions alone contribute substantial bending rigidity (0.5 pN/nm) to ER/K {alpha}-helices. Results of small-angle x-ray scattering (SAXS) and single-molecule optical-trap analyses are consistent with the high bending rigidity predicted by our model. Thus, the ER/K {alpha}-helix is an isolated secondary structural element that can efficiently span long distances in proteins, making it a promising tool in designing synthetic proteins. We propose that the significant rigidity of the ER/K {alpha}-helix can help regulate protein function, as a force transducer between protein subdomains.

  6. Subjective pain perception mediated by alpha rhythms.


    Peng, Weiwei; Babiloni, Claudio; Mao, Yanhui; Hu, Yong


    Suppression of spontaneous alpha oscillatory activities, interpreted as cortical excitability, was observed in response to both transient and tonic painful stimuli. The changes of alpha rhythms induced by pain could be modulated by painful sensory inputs, experimental tasks, and top-down cognitive regulations such as attention. The temporal and spatial characteristics, as well as neural functions of pain induced alpha responses, depend much on how these factors contribute to the observed alpha event-related desynchronization/synchronization (ERD/ERS). How sensory-, task-, and cognitive-related changes of alpha oscillatory activities interact in pain perception process is reviewed in the current study, and the following conclusions are made: (1) the functional inhibition hypothesis that has been proposed in auditory and visual modalities could be applied also in pain modality; (2) the neural functions of pain induced alpha ERD/ERS were highly dependent on the cortical regions where it is observed, e.g., somatosensory cortex alpha ERD/ERS in pain perception for painful stimulus processing; (3) the attention modulation of pain perception, i.e., influences on the sensory and affective dimensions of pain experience, could be mediated by changes of alpha rhythms. Finally, we propose a model regarding the determinants of pain related alpha oscillatory activity, i.e., sensory-discriminative, affective-motivational, and cognitive-modulative aspects of pain experience, would affect and determine pain related alpha oscillatory activities in an integrated way within the distributed alpha system. PMID:26026894

  7. {sup 17}O({alpha},{gamma}){sup 21}Ne and {sup 17}O({alpha},n){sup 20}Ne for the weak s process

    SciTech Connect

    Best, A.; Goerres, J.; Beard, M.; Couder, M.; Boer, R. de; Falahat, S.; Gueray, R. T.; Kontos, A.; Kratz, K.-L.; LeBlanc, P. J.; Li, Q.; O'Brien, S.; Oezkan, N.; Pignatari, M.; Sonnabend, K.; Talwar, R.; Tan, W.; Uberseder, E.; Wiescher, M.


    The ratio of the reaction rates of the competing channels {sup 17}O({alpha}{gamma}){sup 21}Ne and {sup 17}O({alpha},n){sup 20}Ne determines the efficiency of {sup 16}O as a neutron poison in the s process in low metallicity rotating stars. It has a large impact on the element production, either producing elements to the mass range of A=90 in case of a significant poisoning effect or extending the mass range up to the region of A=150 if the {gamma} channel is of negligible strength. We present an improved study of the reaction {sup 17}O({alpha},n){sup 20}Ne, including an independent measurement of the {sup 17}O({alpha},n{sub 1}){sup 20}Ne channel. A simultaneous R-Matrix fit to both the n{sub 0} and the n{sub 1} channels has been performed. New reaction rates, including recent data on the {sup 17}O({alpha},{gamma}){sup 21}Ne reaction, have been calculated and used as input for stellar network calculations and their impact on the s process in rotating massive stars is discussed.

  8. Identification of noncollagenous sites encoding specific interactions and quaternary assembly of alpha 3 alpha 4 alpha 5(IV) collagen: implications for Alport gene therapy.


    Kang, Jeong Suk; Colon, Selene; Hellmark, Thomas; Sado, Yoshikazu; Hudson, Billy G; Borza, Dorin-Bogdan


    Defective assembly of alpha 3 alpha 4 alpha 5(IV) collagen in the glomerular basement membrane causes Alport syndrome, a hereditary glomerulonephritis progressing to end-stage kidney failure. Assembly of collagen IV chains into heterotrimeric molecules and networks is driven by their noncollagenous (NC1) domains, but the sites encoding the specificity of these interactions are not known. To identify the sites directing quaternary assembly of alpha 3 alpha 4 alpha 5(IV) collagen, correctly folded NC1 chimeras were produced, and their interactions with other NC1 monomers were evaluated. All alpha1/alpha 5 chimeras containing alpha 5 NC1 residues 188-227 replicated the ability of alpha 5 NC1 to bind to alpha3NC1 and co-assemble into NC1 hexamers. Conversely, substitution of alpha 5 NC1 residues 188-227 by alpha1NC1 abolished these quaternary interactions. The amino-terminal 58 residues of alpha3NC1 encoded binding to alpha 5 NC1, but this interaction was not sufficient for hexamer co-assembly. Because alpha 5 NC1 residues 188-227 are necessary and sufficient for assembly into alpha 3 alpha 4 alpha 5 NC1 hexamers, whereas the immunodominant alloantigenic sites of alpha 5 NC1 do not encode specific quaternary interactions, the findings provide a basis for the rational design of less immunogenic alpha 5(IV) collagen constructs for the gene therapy of X-linked Alport patients. PMID:18930919

  9. alpha-Tocopheryl phosphate – an active lipid mediator?

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The vitamin E (alpha-tocopherol, alphaT) derivative, alpha-tocopheryl phosphate (alphaTP), is detectable in small amounts in plasma, tissues, and cultured cells. Studies done in vitro and in vivo suggest that alphaT can become phosphorylated and alphaTP dephosphorylated, suggesting the existence of ...

  10. Preclinical pharmacology of alpha1-adrenoceptor antagonists.


    Martin, D J


    The implication of a single adrenoceptor subtype in the contractility of prostatic and urethral smooth muscle cells led to the concept that drugs with selectivity for this subtype may exhibit functional uroselectivity. Comparison of the affinities of the alpha1-adrenoceptor antagonists revealed that few compounds show selectivity for one of the three cloned alpha1-adrenoceptor subtypes (alpha1a/A, alpha1b/B, alpha1d/D) whereas most of them had a similar affinity for the three subtypes. Moreover, data supporting a relationship between selectivity for the alpha1a/A-adrenoceptor subtype and functional uroselectivity are still lacking and recent data challenged the relevance of the selectivity for a given cloned alpha1-adrenoceptor subtype in predicting functional uroselectivity. In vivo data showed that alpha1-adrenoceptor antagonists without adrenoceptor subtype selectivity, like alfuzosin or to a minor extent doxazosin, showed functional uroselectivity whereas prazosin and terazosin were not shown to be uroselective. Compounds considered to be selective for the alpha1a/A-adrenoceptor, like tamsulosin or 5-Me-urapidil, did not show functional uroselectivity since they modified urethral and blood pressures in a manner which was not correlated to their selectivity for the cloned alpha1-adrenoceptor subtypes. Meanwhile, the identification in prostatic tissue, of a new sub-family of alpha1-adrenoceptors with low affinity for prazosin and denominated alpha1L gave rise to numerous studies. However, its functional role as well as the affinity of the known antagonists for this receptor subtype remains to be clarified. In conclusion, the existing alpha1-adrenoceptor antagonists have different pharmacological profiles in vivo which are yet not predictable from their receptor pharmacology based on the actual state of knowledge of the alpha1-adrenoceptor classification. PMID:10393471

  11. Resting-state alpha in autism spectrum disorder and alpha associations with thalamic volume.


    Edgar, J Christopher; Heiken, Kory; Chen, Yu-Han; Herrington, John D; Chow, Vivian; Liu, Song; Bloy, Luke; Huang, Mingxiong; Pandey, Juhi; Cannon, Katelyn M; Qasmieh, Saba; Levy, Susan E; Schultz, Robert T; Roberts, Timothy P L


    Alpha circuits (8-12 Hz), necessary for basic and complex brain processes, are abnormal in autism spectrum disorder (ASD). The present study obtained estimates of resting-state (RS) alpha activity in children with ASD and examined associations between alpha activity, age, and clinical symptoms. Given that the thalamus modulates cortical RS alpha rhythms, associations between thalamic structure and alpha activity were examined. RS magnetoencephalography was obtained from 47 typically-developing children (TDC) and 41 children with ASD. RS alpha activity was measured using distributed source localization. Left and right thalamic volume measurements were also obtained. In both groups, the strongest alpha activity was observed in Calcarine Sulcus regions. In Calcarine regions, only TDC showed the expected association between age and alpha peak frequency. ASD had more alpha activity than TDC in regions bordering the Central Sulcus as well as parietal association cortices. In ASD, whereas greater left Central Sulcus relative alpha activity was associated with higher Social Responsiveness Scale (SRS) scores, greater Calcarine region relative alpha activity was associated with lower SRS scores. Although thalamic volume group differences were not observed, relationships between thalamic volume and Calcarine alpha power were unique to TDC. The present study also identified a failure to shift peak alpha frequency as a function of age in primary alpha-generating areas in children with ASD. Findings suggested that increased RS alpha activity in primary motor and somatosensory as well as parietal multimodal areas-with increased alpha thought to reflect greater inhibition-might impair the ability to identify or interpret social cues. Finally, to our knowledge, this is the first study to report associations between thalamic volume and alpha power, an association observed only in TDC. The lack of thalamic and alpha associations in ASD suggests thalamic contributions to RS alpha

  12. Calculations of {alpha}-decay half-lives for heavy and superheavy nuclei

    SciTech Connect

    Qian Yibin; Ni Dongdong; Ren, Zhongzhou


    Systematic calculations on the {alpha}-decay half-lives of heavy and superheavy nuclei are performed within a deformed version of the cluster model, using the modified two-potential approach. The deformed Woods-Saxon potential is employed to calculate the {alpha}-decay width through a deformed barrier. For comparison the calculated {alpha}-decay half-lives in the empirical relations are also presented. The present study is initially restricted to even-even nuclei in the heavy mass region with N>126. Then the study is extended to the recently observed heaviest nuclei, including synthesized superheavy elements and isotopes. The {alpha}-decay half-lives obtained are found to be in good agreement with the experimental data.

  13. {alpha}-Lipoic acid prevents lipotoxic cardiomyopathy in acyl CoA-synthase transgenic mice

    SciTech Connect

    Lee, Young; Naseem, R. Haris; Park, Byung-Hyun; Garry, Daniel J.; Richardson, James A.; Schaffer, Jean E.; Unger, Roger H. . E-mail:


    {alpha}-Lipoic acid ({alpha}-LA) mimics the hypothalamic actions of leptin on food intake, energy expenditure, and activation of AMP-activated protein kinase (AMPK). To determine if, like leptin, {alpha}-LA protects against cardiac lipotoxicity, {alpha}-LA was fed to transgenic mice with cardiomyocyte-specific overexpression of the acyl CoA synthase (ACS) gene. Untreated ACS-transgenic mice died prematurely with increased triacylglycerol content and dilated cardiomyopathy, impaired systolic function and myofiber disorganization, apoptosis, and interstitial fibrosis on microscopy. In {alpha}-LA-treated ACS-transgenic mice heart size, echocardiogram and TG content were normal. Plasma TG fell 50%, hepatic-activated phospho-AMPK rose 6-fold, sterol regulatory element-binding protein-1c declined 50%, and peroxisome proliferator-activated receptor-{gamma} cofactor-1{alpha} mRNA rose 4-fold. Since food restriction did not prevent lipotoxicity, we conclude that {alpha}-LA treatment, like hyperleptinemia, protects the heart of ACS-transgenic mice from lipotoxicity.

  14. PKC{alpha} expression regulated by Elk-1 and MZF-1 in human HCC cells

    SciTech Connect

    Hsieh, Y.-H.; Wu, T.-T.; Tsai, J.-H.; Huang, C.-Y.; Hsieh, Y.-S.; Liu, J.-Y. . E-mail:


    Our previous study found that PKC{alpha} was highly expressed in the poor-differentiated human HCC cells and associated with cell migration and invasion. In this study, we further investigated the gene regulation of this enzyme. We showed that PKC{alpha} expression enhancement in the poor-differentiated human HCC cells was found neither by DNA amplification nor by increasing mRNA stability using differential PCR and mRNA decay assays. After screening seven transcription factors in the putative cis-acting regulatory elements of human PKC{alpha} promoters, only Elk-1 and MZF-1 antisense oligonucleotide showed a significant reduction in the PKC{alpha} mRNA level. They also reduced cell proliferation, cell migratory and invasive capabilities, and DNA binding activities in the PKC{alpha} promoter region. Over-expression assay confirmed that the PKC{alpha} expression may be modulated by these two factors at the transcriptional level. Therefore, these results may provide a novel mechanism for PKC{alpha} expression regulation in human HCC cells.

  15. Expression of an alpha-galactosidase from Saccharomyces cerevisiae in Aspergillus awamori and Aspergillus oryzae.


    Murphy, R A; Power, R F G


    A gene encoding alpha-galactosidase activity was isolated by polymerase chain reaction (PCR) from Saccharomyces cerevisiae NCYC686 and separately placed under the control of transcriptional elements regulating alpha-amylase expression in Aspergillus oryzae and glucoamylase expression in A. awamori. Following transformation of both A. oryzae and A. awamori with their respective expression vectors, induction of heterologous alpha-galactosidase from positively selected clones was effected through the addition of soluble starch (10% wt/vol) to the growth medium. Upon induction in A. oryzae, a transcriptional instability resulted in degradation of mRNA encoding heterologous alpha-galactosidase, thus preventing expression of the active enzyme. The use of a gene fusion strategy in A. awamori overcame this instability and resulted in stable expression of S. cerevisiae alpha-galactosidase. Subsequent to initial (shake flask) experiments, a series of scale-up and optimisation studies led to heterologous expression of the recombinant enzyme in batch fermentation at 51 U mg(-1) total extracellular protein. This was higher than previously published works, which reported extracellular levels of heterologous alpha-galactosidase up to 38 U mg(-1) total protein. Analysis of crude extracts of the fermentation medium revealed significant differences between the activity parameters reported previously in the literature for this enzyme and those observed here. The recombinant enzyme exhibited thermostability properties not previously reported for S. cerevisiae alpha-galactosidase, a trait which would make it suitable for use in processes requiring high temperatures. PMID:12074058

  16. Neuronal specificity of the alpha 7 nicotinic acetylcholine receptor promoter develops during morphogenesis of the central nervous system.

    PubMed Central

    Matter-Sadzinski, L; Hernandez, M C; Roztocil, T; Ballivet, M; Matter, J M


    A transient transfection assay has been developed to analyse promoter activity in neuronal cells freshly dissociated from the chick central nervous system. The assay enabled us to identify cis-acting regulatory elements within the 5'-flanking region of the alpha 7 nicotinic acetylcholine receptor gene. In differentiated retina, regulatory elements direct reporter gene expression to a small subset of neurons which has been identified as ganglion cells, i.e. to the population of neurons in which alpha 7 transcripts were localized by in situ hybridization. However, these promoter elements exhibit ubiquitous activity in undifferentiated neural cells and in mesodermal stem cells. Our study supports the idea that alpha 7 regulatory elements acquire their neuronal specificity in the course of embryogenesis. Images PMID:1425587

  17. Controls for agility research in the NASA High-Alpha Technology Program

    NASA Technical Reports Server (NTRS)

    Foster, John V.; Bundick, W. T.; Pahle, Joseph W.


    The research process being used to develop control law design methodologies and guidelines in the NASA High-Alpha Technology Program are discussed. This step-by-step process consists of four basic elements: (1) control law architecture definition and linear synthesis, (2) nonlinear batch simulation, (3) piloted simulation evaluation, and (4) flight test validation. This paper discusses the research tools being used in this effort and provides a status report on design methodologies and guidelines being developed for each of these elements.

  18. The solar Ly-alpha line profile

    NASA Technical Reports Server (NTRS)

    Woods, Thomas N.; Rottman, Gary J.; White, O. R.; Fontenla, Juan; Avrett, E. H.


    Solar Ly-alpha irradiance measurements from the SOLar STellar Irradiance Comparison Experiment (SOLSTICE) on the Upper Atmosphere Research Satellite (UARS) have been made since 1991 October with a spectral resolution of 0.1 nm. The uniqueness of the small molecular oxygen cross section near Ly-alpha permits the Ly-alpha radiation to penetrate much deeper into the atmosphere than the other emissions near Ly-alpha. We have taken advantage of this phenomenon by performing solar occultation experiments near the Ly-alpha to evaluate precisely the instrument scattered light contribution. After correcting for scattered light, the broad wings of the solar Ly-alpha line can be extracted out to 5 nm from line center with a typical accuracy of +/-20%. The variability in the Ly-alpha wings near 2 nm from line center is about one-half that of the Ly-alpha core emission, defined within 0.1 nm from line center. These Ly-alpha profile measurements are found to be consistent with the Skylab radiance measurements and theoretical models of the Ly-alpha line profiles computed using partial redistribution of photons in the source function.

  19. A study of presynaptic alpha2-autoreceptors in alpha2A/D-, alpha2B- and alpha2C-adrenoceptor-deficient mice.


    Trendelenburg, A U; Klebroff, W; Hein, L; Starke, K


    The function of presynaptic alpha2-autoreceptors was studied in the hippocampus, occipito-parietal cortex, atria and vas deferens of NMRI mice, mice in which the alpha2A/D-, the alpha2B- or alpha2c-adrenoceptor gene had been disrupted (alpha2A/DKO, alpha2BKO and alpha2CKO, respectively), and the wildtype mice from which the knockout animals had been generated. Tissue pieces were preincubated with 3H-noradrenaline and then superfused and stimulated electrically. The alpha2-adrenoceptor agonist medetomidine reduced the electrically evoked overflow of tritium in all tissues from all mouse strains (stimulation with single pulses or single high-frequency pulse trains, called POPs, i.e. pulse patterns leading to minimal autoinhibition). The effects of medetomidine did not differ in NMRI, wildtype, alpha2BKO and alpha2CKO mice but were greatly reduced in alpha2A/DKO brain preparations and to a lesser extent in alpha2A/DKO atria and vasa deferentia. Six drugs were tested as antagonists against medetomidine. Their pKd values indicated that the hippocampal and occipito-parietal alpha2-autoreceptors in NMRI and wildtype mice were alpha2D (the rodent variant of the alpha2A/D-adrenoceptor) whereas the atrial and vas deferens alpha2-autoreceptors in NMRI and wildtype mice could not be identified with a single alpha2 subtype. Deletion of the alpha2A/D gene changed the pKd values in all tissues so that they now reflected alpha2C properties, whereas deletion of the alpha2C gene changed the pKd values in atria and vasa deferentia so that they now had alpha2D properties (as they had in NMRI and wildtype brain preparations). Autoinhibition by released noradrenaline was created using trains of up to 64 pulses or up to 4 POPs, and the overflow-enhancing effect of the alpha2 antagonist rauwolscine was determined. Results did not differ, irrespective of whether preparations were obtained from NMRI, wildtype, alpha2BKO or alpha2CKO mice: the overflow of tritium elicited by p pulses or POPs

  20. Targeted alpha therapy for cancer

    NASA Astrophysics Data System (ADS)

    Allen, Barry J.; Raja, Chand; Rizvi, Syed; Li, Yong; Tsui, Wendy; Zhang, David; Song, Emma; Qu, Chang Fa; Kearsley, John; Graham, Peter; Thompson, John


    Targeted alpha therapy (TAT) offers the potential to inhibit the growth of micrometastases by selectively killing isolated and preangiogenic clusters of cancer cells. The practicality and efficacy of TAT is tested by in vitro and in vivo studies in melanoma, leukaemia, colorectal, breast and prostate cancers, and by a phase 1 trial of intralesional TAT for melanoma. The alpha-emitting radioisotope used is Bi-213, which is eluted from the Ac-225 generator and chelated to a cancer specific monoclonal antibody (mab) or protein (e.g. plasminogen activator inhibitor-2 PAI2) to form the alpha-conjugate (AC). Stable alpha-ACs have been produced which have been tested for specificity and cytotoxicity in vitro against melanoma (9.2.27 mab), leukaemia (WM60), colorectal (C30.6), breast (PAI2, herceptin), ovarian (PAI2, herceptin, C595), prostate (PAI2, J591) and pancreatic (PAI2, C595) cancers. Subcutaneous inoculation of 1-1.5 million human cancer cells into the flanks of nude mice causes tumours to grow in all mice. Tumour growth is compared for untreated controls, nonspecific AC and specific AC, for local (subcutaneous) and systemic (tail vein or intraperitoneal) injection models. The 213Bi-9.2.27 AC is injected into secondary skin melanomas in stage 4 patients in a dose escalation study to determine the effective tolerance dose, and to measure kinematics to obtain the equivalent dose to organs. In vitro studies show that TAT is one to two orders of magnitude more cytotoxic to targeted cells than non-specific ACs, specific beta emitting conjugates or free isotopes. In vivo local TAT at 2 days post-inoculation completely prevents tumour formation for all cancers tested so far. Intra-lesional TAT can completely regress advanced sc melanoma but is less successful for breast and prostate cancers. Systemic TAT inhibits the growth of sc melanoma xenografts and gives almost complete control of breast and prostate cancer tumour growth. Intralesional doses up to 450 µCi in human

  1. High gas flow alpha detector


    Bolton, R.D.; Bounds, J.A.; Rawool-Sullivan, M.W.


    An alpha detector for application in areas of high velocity gas flows, such as smokestacks and air vents. A plurality of spaced apart signal collectors are placed inside an enclosure, which would include smokestacks and air vents, in sufficient numbers to substantially span said enclosure so that gas ions generated within the gas flow are electrostatically captured by the signal collector means. Electrometer means and a voltage source are connected to the signal collectors to generate an electrical field between adjacent signal collectors, and to indicate a current produced through collection of the gas ions by the signal collectors. 4 figs.

  2. High gas flow alpha detector


    Bolton, Richard D.; Bounds, John A.; Rawool-Sullivan, Mohini W.


    An alpha detector for application in areas of high velocity gas flows, such as smokestacks and air vents. A plurality of spaced apart signal collectors are placed inside an enclosure, which would include smokestacks and air vents, in sufficient numbers to substantially span said enclosure so that gas ions generated within the gas flow are electrostatically captured by the signal collector means. Electrometer means and a voltage source are connected to the signal collectors to generate an electrical field between adjacent signal collectors, and to indicate a current produced through collection of the gas ions by the signal collectors.

  3. Reliability of {alpha}{sub 1} and {alpha}{sub 2} from lattice codes

    SciTech Connect

    Ng, K.Y.


    Whether the higher-order terms in the momentum-compaction factor, {alpha}{sub 1} and {alpha}{sub 2}, can be obtained reliably from lattice codes is an important issue for some quasi-isochronous rings. A FODO lattice consisting of thin quadrupoles, dipoles filling all spaces, and two families of thin sextupoles is solved and {alpha}{sub 1} and {alpha}{sub 2} are derived analytically. We find accurate agreement with SYNCH is examined. Some methods of measurement of {alpha}{sub 1} and {alpha}{sub 2} are discussed.

  4. Failure Analysis in Space: International Space Station (ISS) Starboard Solar Alpha Rotary Joint (SARJ) Debris Analysis

    NASA Technical Reports Server (NTRS)

    Long, V. S.; Wright, M. C.; McDanels, S. J.; Lubas, D.; Tucker, B.; Marciniak, P. J.


    This slide presentation reviews the debris analysis of the Starboard Solar Alpha Rotary Joint (SARJ), a mechanism that is designed to keep the solar arrays facing the sun. The goal of this was to identify the failure mechanism based on surface morphology and to determine the source of debris through elemental and particle analysis.


    Technology Transfer Automated Retrieval System (TEKTRAN)

    Elongation factor 1 alpha (EF-1') is a constitutively expressed, abundant protein that is a key element in eukaryotic protein translation. Because of its high level of transcription, the EF-1''promoter has been utilized to drive exogenous gene expression in transfected cells. In this study, we ident...

  6. Microtubule depolymerization potentiates alpha-synuclein oligomerization.


    Esteves, A Raquel; Arduíno, Daniela M; Swerdlow, Russell H; Oliveira, Catarina R; Cardoso, Sandra M


    Parkinson's disease (PD) is associated with perturbed mitochondria function and alpha-synuclein fibrillization. We evaluated potential mechanistic links between mitochondrial dysfunction and alpha-synuclein aggregation. We studied a PD cytoplasmic hybrid (cybrid) cell line in which platelet mitochondria from a PD subject were transferred to NT2 neuronal cells previously depleted of endogenous mitochondrial DNA. Compared to a control cybrid cell line, the PD line showed reduced ATP levels, an increased free/polymerized tubulin ratio, and alpha-synuclein oligomer accumulation. Taxol (which stabilizes microtubules) normalized the PD tubulin ratio and reduced alpha-synuclein oligomerization. A nexus exists between mitochondrial function, cytoskeleton homeostasis, and alpha-synuclein oligomerization. In our model, mitochondrial dysfunction triggers an increased free tubulin, which destabilizes the microtubular network and promotes alpha-synuclein oligomerization. PMID:20552056

  7. Selective sorting of alpha-granule proteins

    PubMed Central

    Italiano, J.E.; Battinelli, E. M.


    Summary One of the main functions of blood platelets is to secrete a variety of substances that can modify a developing thrombus, regulate the growth of the vasculature, promote wound repair, and contribute to cell-adhesive events. The majority of this vast array of secreted proteins is stored in alpha-granules. Until recently, it was assumed that platelets contained one homogeneous population of alpha-granules that undergo complete de-granulation during platelet activation. This review focuses on the mechanisms of alpha-granule biogenesis and secretion, with a particular emphasis on recent findings that clearly demonstrate that platelets contain distinct subpopulations of alpha-granules that undergo differential release during activation. We consider the implications of this new paradigm of platelet secretion, discuss mechanisms of alpha-granule biogenesis, and review the molecular basis of transport and delivery of alpha-granules to assembling platelets. PMID:19630794

  8. Modeling and separation of rare earth elements by countercurrent electromigration: A new separation column

    SciTech Connect

    Correa, S.M. |; Arbilla, G.; Carvalho, M.S.


    The separation of a samarium (90%) and europium (10%) mixture in {alpha}-hydroxy isobutyric acid was performed in a new countercurrent electromigration system. The mobilities of these elements were estimated, and samarium of better than 99.9% purity was obtained. The equilibrium of multicoordinate complexes of these elements with {alpha}-hydroxy isobutyric acid ({alpha}-HIBA) plays an important role in the separation process. The equilibrium concentrations of the involved species were calculated by a computational procedure, and a kinetic study of the complexation reaction was also performed.

  9. Beta/alpha continuous air monitor


    Becker, Gregory K.; Martz, Dowell E.


    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinguishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts.

  10. Beta/alpha continuous air monitor


    Becker, G.K.; Martz, D.E.


    A single deep layer silicon detector in combination with a microcomputer, recording both alpha and beta activity and the energy of each pulse, distinquishing energy peaks using a novel curve fitting technique to reduce the natural alpha counts in the energy region where plutonium and other transuranic alpha emitters are present, and using a novel algorithm to strip out radon daughter contribution to actual beta counts. 7 figs.

  11. Quantum Monte Carlo calculations of {Alpha} = 8 nuclei.

    SciTech Connect

    Wiringa, R. B.; Pieper, S. C.; Carlson, J.; Pandharipande, V. R.; Physics; LANL; Univ. of Illinois


    We report quantum Monte Carlo calculations of ground and low-lying excited states for {Alpha}=8 nuclei using a realistic Hamiltonian containing the Argonne v{sub 18} two-nucleon and Urbana IX three-nucleon potentials. The calculations begin with correlated eight-body wave functions that have a filled {alpha}-like core and four p-shell nucleons LS coupled to the appropriate (J{sup {pi}},T) quantum numbers for the state of interest. After optimization, these variational wave functions are used as input to a Green's function Monte Carlo calculation made with a new constrained path algorithm. We find that the Hamiltonian produces a {sup 8}Be ground state that is within 2 MeV of the experimental resonance, but the other eight-body energies are progressively worse as the neutron-proton asymmetry increases. The {sup 8}Li ground state is stable against breakup into subclusters, but the {sup 8}He ground state is not. The excited state spectra are in fair agreement with experiment, with both the single-particle behavior of {sup 8}He and {sup 8}Li and the collective rotational behavior of {sup 8}Be being reproduced. We also examine energy differences in the T=1,2 isomultiplets and isospin-mixing matrix elements in the excited states of {sup 8}Be. Finally, we present densities, momentum distributions, and studies of the intrinsic shapes of these nuclei, with {sup 8}Be exhibiting a definite 2{alpha} cluster structure.

  12. Alpha-physics and measurement requirements for ITER

    SciTech Connect

    Zweben, S.J.; Young, K.M.; Putvinski, S.; Petrov, M.P.; Sadler, G.; Tobita, K.


    This paper reviews alpha particle physics issues in ITER and their implications for alpha particle measurements. A comparison is made between alpha heating in ITER and NBI and ICRH heating systems in present tokamaks, and alpha particle issues in ITER are discussed in three physics areas: `single particle` alpha effects, `collective` alpha effects, and RF interactions with alpha particles. 29 refs., 4 figs., 4 tabs.

  13. Regulation of the human SLC25A20 expression by peroxisome proliferator-activated receptor alpha in human hepatoblastoma cells

    SciTech Connect

    Tachibana, Keisuke; Takeuchi, Kentaro; Inada, Hirohiko; Yamasaki, Daisuke; The Center for Advanced Medical Engineering and Informatics, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 ; Ishimoto, Kenji; Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871 ; Tanaka, Toshiya; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko; Doi, Takefumi; The Center for Advanced Medical Engineering and Informatics, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871; Graduate School of Medicine, Osaka University, 2-2 Yamadaoka, Suita, Osaka 565-0871


    Solute carrier family 25, member 20 (SLC25A20) is a key molecule that transfers acylcarnitine esters in exchange for free carnitine across the mitochondrial membrane in the mitochondrial {beta}-oxidation. The peroxisome proliferator-activated receptor alpha (PPAR{alpha}) is a ligand-activated transcription factor that plays an important role in the regulation of {beta}-oxidation. We previously established tetracycline-regulated human cell line that can be induced to express PPAR{alpha} and found that PPAR{alpha} induces the SLC25A20 expression. In this study, we analyzed the promoter region of the human slc25a20 gene and showed that PPAR{alpha} regulates the expression of human SLC25A20 via the peroxisome proliferator responsive element.

  14. Teaching calculus with Wolfram|Alpha

    NASA Astrophysics Data System (ADS)

    Dimiceli, Vincent E.; Lang, Andrew S. I. D.; Locke, LeighAnne


    This article describes the benefits and drawbacks of using Wolfram|Alpha as the platform for teaching calculus concepts in the lab setting. It is a result of our experiences designing and creating an entirely new set of labs using Wolfram|Alpha. We present the reasoning behind our transition from using a standard computer algebra system (CAS) to Wolfram|Alpha in our differential and integral calculus labs, together with the positive results from our experience. We also discuss the current limitations of Wolfram|Alpha, including a discussion on why we still use a CAS for our multivariate calculus labs.

  15. Prospects for alpha particle studies on TFTR

    SciTech Connect

    Zweben, S.J.


    TFTR is expected to produce approximately 5 MW of alpha heating during the D/T Q approx. = 1 phase of operation in 1990. At that point the collective confinement properties and the heating effects of alpha particles become accessible for study for the first time. This paper outlines the potential performance of TFTR with respect to alpha particle production, the diagnostics which will be available for alpha particle measurements, and the physics issues which can be studied both before and during D/T operation.

  16. [Alpha-linolenic acid and cardiovascular diseases].


    Ristić-Medić, Danijela; Ristić, Gordana; Tepsić, Vesna


    IMPORTANCE AND METABOLISM OF ALPHA-LINOLENIC ACID: Alpha-linolenic acid is an essential fatty acid which cannot be produced in the body and must be taken by food. Both in animals and humans, alpha-linolenic acid is desaturated and elongated into eicosapentaenoic and docosahexaenoic acid. It is also incorporated into plasma and tissue lipids and its conversion is affected by levels of linoleic acid. POTENTIAL ROLE IN PATHOGENESIS OF CARDIOVASCULAR DISEASES: Diet enriched in n-3 fatty acids, especially alpha-linolenic acid, reduces the incidence of cardiac death. Studies have shown that alpha linolenic acid prevents ventricular fibrillation which is the main cause of cardiac death. Studies in rats suggest that alpha-linolenic acid may be more effective in preventing ventricular fibrillations than eicosapentaenoic and docosahexaenoic acid. Furthermore, alpha-linolenic acid is the main fatty acid decreasing platalet aggregation which is an important step in thrombosis i.e. non-fatal myocardial infarction and stroke. DIETARY SOURCES AND NUTRITION RECOMMENDATIONS: Dietary sources include flaxseed and flaxseed oil, canola oil, soybean and soybean oil, pumpkin seed and pumpkin oil, walnuts and walnut oil. Strong evidence supports beneficial effects of alpha-linolenic acid and its dietary sources should be incorporated into balanced diet for prevention of cardiovascular diseases. The recommended daily intake is 2 g with a ratio of 5/1 for linoleic/alpha-linolenic acid. PMID:15510909

  17. Gene transfer mediated by alpha2-macroglobulin.

    PubMed Central

    Schneider, H; Huse, K; Birkenmeier, G; Otto, A; Scholz, G H


    alpha2-Macroglobulin covalently linked to poly(L)-lysine can be used as a vehicle for receptor-mediated gene transfer. This modified alpha2-macroglobulin maintains its ability to bind to the alpha2-macroglobulin receptor, and was shown to introduce a luciferase reporter gene plasmid into HepG2 human hepatoma cells in vitro. The alpha2-macroglobulin receptor is a very large and multifunctional cell surface receptor, whose rapid and efficient internalization rate makes it attractive for gene therapy, e.g. for hepatic gene targeting via injection into the portal vein. PMID:8871570

  18. Chimerogenesis in estimation of specificity and pathway directions for cytochrome p45017alpha catalyzed reactions.


    Gilep, A A; Estabrook, R W; Usanov, S A


    Cytochrome P45017alpha is a key enzyme in steroid hormone biosynthesis. It catalyzes the reaction of 17alpha-hydroxylation of progesterone (P4) and pregnenolone (P5) and the 17,20-lyase reaction resulting in side chain cleavage of C21 steroids to form C19 steroids. Depending on the activity of cytochrome P45017alpha, steroid hormone biosynthesis pathways are directed either for biosynthesis of mineralocorticoids and glucocorticoids or sex hormones. The formation of sex hormones starts from biosynthesis of androstenedione. Androstenedione formation is a result of two reactions: 17,20-lyase reaction of 17alpha-hydroxyprogesterone (Delta4-pathway) and 3beta-hydroxysteroid dehydrogenase/Delta4,Delta5-isomerase reaction using dehydroepiandrosterone as substrate (Delta5-pathway). In case of exclusive direction of the 17,20-lyase reaction either through the Delta4- or the Delta5-pathway, the formation of sex hormones depends more on specificity and activity of 3beta-hydroxysteroid-dehydrogenase/Delta4,Delta5-isomerase. Depending on species, the cytochromes P45017alpha can utilize as a substrate for 17,20-lyase activity Delta4-steroids, Delta5-steroids, or both types of steroids. To identify the structural elements of cytochrome P45017alpha responsible for substrate recognition, in the present work we used exchange of homologous fragments of cytochrome P45017alpha having different types of activities. We engineered more than 10 different types of chimeric cytochrome P45017alpha. Chimeric cytochromes P45017alpha have been expressed in E. coli and purified. The expression of chimeric cytochrome P45017alpha with the point of exchange between exons III and IV results in inability of the recombinant hemeprotein to properly bind heme. The determination of activity of chimeric cytochromes P45017alpha shows that the structural element responsible for switching activity between Delta4- or Delta5-pathway is located in the region of polypeptide chain coded by exons II-V of CYP17 gene

  19. The Mimetic Finite Element Method and the Virtual Element Method for elliptic problems with arbitrary regularity.

    SciTech Connect

    Manzini, Gianmarco


    We develop and analyze a new family of virtual element methods on unstructured polygonal meshes for the diffusion problem in primal form, that use arbitrarily regular discrete spaces V{sub h} {contained_in} C{sup {alpha}} {element_of} N. The degrees of freedom are (a) solution and derivative values of various degree at suitable nodes and (b) solution moments inside polygons. The convergence of the method is proven theoretically and an optimal error estimate is derived. The connection with the Mimetic Finite Difference method is also discussed. Numerical experiments confirm the convergence rate that is expected from the theory.

  20. Experience with an elemental diet (Vivonex).


    Villaveces, J W; Heiner, D C


    Six patients with intractable atopic dermatitis completed this study which consisted of a baseline week, 1 to 2 weeks on an elemental diet, then sequential specific food additions. Symptom/sign scores, total eosinophil counts, and IgE and IgG4 radioimmunoassays for wheat alpha-gliadin, bovine serum albumin, beta-lactoglobulin, and egg white were carried out as part of the protocol. Symptom/sign scores improved in five of six patients, some dramatically. Total eosinophil counts generally dropped after a week on the elemental diet and then increased as foods were added to the diet. The elemental diet used (Vivonex) appears to be beneficial in the management of at least some adult patients who have severe atopic dermatitis. PMID:3840962

  1. Elemental composition of arctic particulate matter

    NASA Technical Reports Server (NTRS)

    Cahill, T. A.; Eldred, R. A.


    Measurements were made of the elemental composition of particulate matter collected in flights in the Arctic in spring 1983 as part of the Arctic Gas and Aerosol Sampling Program (AGASP). Ten samples of size-selected particles were analyzed by four nondestructive techniques at Davis. Concentrations were determined for H, C, N, and O by Forward Alpha Scattering Techniques (FAST) and for elements heavier than fluorine by Particle Induced X-ray Emission (PIXE). Total mass was measured gravimetrically, and optical absorption was measured using the Laser Integrating Plate Method (LIPM). Results of the analyses show dramatic differences in concentrations and elemental ratios from the Alaskan Arctic to the Norwegian Arctic, with indications of wood smoke and sulfuric acid in the arctic atmosphere.

  2. Rolling-Element Bearings

    NASA Technical Reports Server (NTRS)

    Hamrock, B. J.; Anderson, W. J.


    Rolling element bearings are a precision, yet simple, machine element of great utility. A brief history of rolling element bearings is reviewed and the type of rolling element bearings, their geometry and kinematics, as well as the materials they are made from and the manufacturing processes they involve are described. Unloaded and unlubricated rolling element bearings, loaded but unlubricated rolling element bearings and loaded and lubricated rolling element bearings are considered. The recognition and understanding of elastohydrodynamic lubrication covered, represents one of the major development in rolling element bearings.

  3. Expression of the alpha 1, alpha 2 and alpha 3 isoforms of the GABAA receptor in human alcoholic brain.


    Lewohl, J M; Crane, D I; Dodd, P R


    The expression of the alpha 1, alpha 2 and alpha 3 isoforms of the GABAA receptor was studied in the superior frontal and motor cortices of 10 control, 10 uncomplicated alcoholic and 7 cirrhotic alcoholic cases matched for age and post-mortem delay. The assay was based on competitive RT/PCR using a single set of primers specific to the alpha class of isoform mRNA species, and was normalized against a synthetic cRNA internal standard. The assay was shown to be quantitative for all three isoform mRNA species. Neither the patient's age nor the post-mortem interval significantly affected the expression of any isoform in either cortical area. The profile of expression was shown to be significantly different between the case groups, particularly because alpha 1 expression was raised in both groups of alcoholics of controls. The two groups of alcoholics could be differentiated on the basis of regional variations in alpha 1 expression. In frontal cortex, alpha 1 mRNA expression was significantly increased when uncomplicated alcoholics were compared with control cases whereas alcoholic-cirrhotic cases were not significantly different from either controls or uncomplicated alcoholic cases. In the motor cortex, alpha 1 expression was elevated only when alcoholic-cirrhotic cases were compared with control cases. There was no significant difference between case groups or areas for any other isoform. PMID:9098573

  4. Spacing requirements for interactions between the C-terminal domain of the alpha subunit of Escherichia coli RNA polymerase and the cAMP receptor protein.

    PubMed Central

    Lloyd, G S; Busby, S J; Savery, N J


    During transcription initiation at bacterial promoters, the C-terminal domain of the RNA polymerase alpha subunit (alphaCTD) can interact with DNA-sequence elements (known as UP elements) and with activator proteins. We have constructed a series of semi-synthetic promoters carrying both an UP element and a consensus DNA-binding site for the Escherichia coli cAMP receptor protein (CRP; a factor that activates transcription by making direct contacts with alphaCTD). At these promoters, the UP element was located at a variety of distances upstream of the CRP-binding site, which was fixed at position -41.5 bp upstream of the transcript start. At some positions, the UP element caused enhanced promoter activity whereas, at other positions, it had very little effect. In no case was the CRP-dependence of the promoter relieved. DNase I and hydroxyl-radical footprinting were used to study ternary RNA polymerase-CRP-promoter complexes formed at two of the most active of these promoters, and co-operativity between the binding of CRP and purified alpha subunits was studied. The footprints show that alphaCTD binds to the UP element as it is displaced upstream but that this displacement does not prevent alphaCTD from being contacted by CRP. Models to account for this are discussed. PMID:9461538


    SciTech Connect

    Johnson, Christian I.; Michael Rich, R.; Fulbright, Jon P.; Valenti, Elena; McWilliam, Andrew E-mail: E-mail:


    We present Fe, Si, and Ca abundances for 61 giants in Plaut's window (l = -1{sup 0}, b = -8.{sup 0}5) and Fe abundances for an additional 31 giants in a second, nearby field (l = 0{sup 0}, b = -8{sup 0}) derived from high-resolution (R {approx} 25,000) spectra obtained with the Blanco 4 m telescope and Hydra multifiber spectrograph. The median metallicity of red giant branch (RGB) stars in the Plaut's field is {approx}0.4 dex lower than those in Baade's window, and confirms the presence of an iron abundance gradient along the bulge minor axis. The full metallicity range of our (biased) RGB sample spans -1.5 < [Fe/H] < +0.3, which is similar to that found in other bulge fields. We also derive a photometric metallicity distribution function for RGB stars in the (l = -1{sup 0}, b = -8{sup 0}.5) field and find very good agreement with the spectroscopic metallicity distribution. The radial velocity (RV) and dispersion data for the bulge RGB stars are in agreement with previous results of the Bulge Radial Velocity Assay survey, and we find evidence for a decreasing velocity dispersion with increasing [Fe/H]. The [{alpha}/Fe] enhancement in Plaut field stars is nearly identical to that observed in Baade's window, and suggests that an [{alpha}/Fe] gradient does not exist between b = -4{sup 0} and -8{sup 0}. Additionally, a subset of our sample (23 stars) appears to be foreground red clump stars that are very metal rich, exhibit small metallicity and RV dispersions, and are enhanced in {alpha} elements. While these stars likely belong to the Galactic inner disk population, they exhibit [{alpha}/Fe] ratios that are enhanced above the thin and thick disk.

  6. Resting-State Alpha in Autism Spectrum Disorder and Alpha Associations with Thalamic Volume

    ERIC Educational Resources Information Center

    Edgar, J. Christopher; Heiken, Kory; Chen, Yu-Han; Herrington, John D.; Chow, Vivian; Liu, Song; Bloy, Luke; Huang, Mingxiong; Pandey, Juhi; Cannon, Katelyn M.; Qasmieh, Saba; Levy, Susan E.; Schultz, Robert T.; Roberts, Timothy P. L.


    Alpha circuits (8-12 Hz), necessary for basic and complex brain processes, are abnormal in autism spectrum disorder (ASD). The present study obtained estimates of resting-state (RS) alpha activity in children with ASD and examined associations between alpha activity, age, and clinical symptoms. Given that the thalamus modulates cortical RS alpha…

  7. Optical Model Parameters for the Ar-36+{alpha} and Ca-40+{alpha} Systems

    SciTech Connect

    Generalov, L.; Zvenigorodskii, A.


    For 36Ar+{alpha} and 40Ca+{alpha} systems there are presented the parameters of Woods-Saxon potential with volume absorption in the {alpha}-particle energy range lower and higher than the Coulomb barrier. They were obtained as a result of existing optical potentials modification.

  8. Discrete Element Modeling

    SciTech Connect

    Morris, J; Johnson, S


    The Distinct Element Method (also frequently referred to as the Discrete Element Method) (DEM) is a Lagrangian numerical technique where the computational domain consists of discrete solid elements which interact via compliant contacts. This can be contrasted with Finite Element Methods where the computational domain is assumed to represent a continuum (although many modern implementations of the FEM can accommodate some Distinct Element capabilities). Often the terms Discrete Element Method and Distinct Element Method are used interchangeably in the literature, although Cundall and Hart (1992) suggested that Discrete Element Methods should be a more inclusive term covering Distinct Element Methods, Displacement Discontinuity Analysis and Modal Methods. In this work, DEM specifically refers to the Distinct Element Method, where the discrete elements interact via compliant contacts, in contrast with Displacement Discontinuity Analysis where the contacts are rigid and all compliance is taken up by the adjacent intact material.

  9. Cross-talk between integrins {alpha}1{beta}1 and {alpha}2{beta}1 in renal epithelial cells

    SciTech Connect

    Abair, Tristin D.; Sundaramoorthy, Munirathinam; Chen, Dong; Heino, Jyrki; Ivaska, Johanna; Hudson, Billy G.; Sanders, Charles R.; Pozzi, Ambra; Zent, Roy


    The collagen-binding integrins {alpha}1{beta}1 and {alpha}2{beta}1 have profoundly different functions, yet they are often co-expressed in epithelial cells. When both integrins are expressed in the same cell, it has been suggested that {alpha}1{beta}1 negatively regulates integrin {alpha}2{beta}1-dependent functions. In this study we utilized murine ureteric bud (UB) epithelial cells, which express no functionally detectable levels of endogenous integrins {alpha}1{beta}1 and {alpha}2{beta}1, to determine the mechanism whereby this regulation occurs. We demonstrate that UB cells expressing integrin {alpha}2{beta}1, but not {alpha}1{beta}1 adhere, migrate and proliferate on collagen I as well as form cellular cords in 3D collagen I gels. Substitution of the transmembrane domain of the integrin {alpha}2 subunit with that of {alpha}1 results in decreased cell adhesion, migration and cord formation. In contrast, substitution of the integrin {alpha}2 cytoplasmic tail with that of {alpha}1, decreases cell migration and cord formation, but increases proliferation. When integrin {alpha}1 and {alpha}2 subunits are co-expressed in UB cells, the {alpha}1 subunit negatively regulates integrin {alpha}2{beta}1-dependent cord formation, adhesion and migration and this inhibition requires expression of both {alpha}1 and {alpha}2 tails. Thus, we provide evidence that the transmembrane and cytoplasmic domains of the {alpha}2 integrin subunit, as well as the {alpha}1 integrin subunit, regulate integrin {alpha}2{beta}1 cell function.

  10. Quantum Criticality and the (alpha)/(delta) Puzzle

    SciTech Connect

    Chapline, G


    In an overview of the elemental actinides Np and Pu stand out because of their anomalously low melting temperatures and the variety of complex phase transitions that occur in these elements and their alloys as a result of relatively modest changes in temperature and pressure. In this paper we suggest a novel explanation based on an analogy between the evolution of the actinide ground state as a function of spin orbit coupling and the behavior of thin film superconductors in a magnetic field. The key point is that in 'bad metals' spin orbit interactions give rise to low energy monopole-like solitons with quantized spin currents, which play much the same role as Abrikosov vortices in thin film superconductors. In Np and {alpha}-Pu these solitons form an ordered solid, while in impurity stabilized {delta}-Pu they form a pair condensate. This provides a simple explanation for the heretofore unexplained phenomenology of {alpha}/{delta} transition. Near room temperature {delta}-Pu represents a novel form of condensed matter: a 'Planckian metal' analogous to the quark-gluon plasma.

  11. Solution conformation of a neuronal nicotinic acetylcholine receptor antagonist {alpha}-conotoxin OmIA that discriminates {alpha}3 vs. {alpha}6 nAChR subtypes

    SciTech Connect

    Chi, Seung-Wook; Kim, Do-Hyoung; Olivera, Baldomero M.; McIntosh, J. Michael; Han, Kyou-Hoon . E-mail:


    {alpha}-Conotoxin OmIA from Conus omaria is the only {alpha}-conotoxin that shows a {approx}20-fold higher affinity to the {alpha}3{beta}2 over the {alpha}6{beta}2 subtype of nicotinic acetylcholine receptor. We have determined a three-dimensional structure of {alpha}-conotoxin OmIA by nuclear magnetic resonance spectroscopy. {alpha}-Conotoxin OmIA has an '{omega}-shaped' overall topology with His{sup 5}-Asn{sup 12} forming an {alpha}-helix. Structural features of {alpha}-conotoxin OmIA responsible for its selectivity are suggested by comparing its surface characteristics with other functionally related {alpha}4/7 subfamily conotoxins. Reduced size of the hydrophilic area in {alpha}-conotoxin OmIA seems to be associated with the reduced affinity towards the {alpha}6{beta}2 nAChR subtype.

  12. Particle Leaking, Cross-Section Ratio 10B(n,{alpha})/238U(n,fission), and Excitation Function of the Reaction 10B(n,{alpha})7Li at MeV Energies

    SciTech Connect

    Giorginis, Georgios; Khryachkov, Vitali


    The 10B(n,{alpha})7Li reaction was studied in the energy range between 1.5 MeV and 5.6 MeV at the 7-MV Van de Graaff accelerator of IRMM by using a gridded ionisation chamber, signal digitisation, and an intrinsic 238U neutron monitor. The aim was to obtain accurate data for the IAEA Coordinated Research Project (CRP) on the improvement of standard cross sections for light elements. The effect of particle leaking was discovered and its implications investigated. The determination of the cross section {sigma}({alpha}0+{alpha}1) strongly benefits from it but measurements of angular distributions, individual cross sections {sigma}({alpha}0) and {sigma}({alpha}1), and the branching ratio {alpha}0/{alpha}1 are negatively affected. The correct number of reaction events was obtained by identification of unknown particle signatures in the energy spectra as 10B(n,{alpha})7Li events in the form of quasi 7Li+{alpha} particles created by particle leaking. The cross-section ratio 10B(n,{alpha})7Li/238U(n,fission) was measured and the excitation function of 10B(n,{alpha})7Li determined by simultaneously detecting the charged particles from the boron disintegration in the forward hemisphere and the 238U fission fragments in the backward hemisphere. The IRMM cross sections are compared to experimental data of other groups and to predictions of the ENDF/B-VI.8, JENDL-3.3, and JEF-2.2 evaluations.

  13. Snake acetylcholine receptor: cloning of the domain containing the four extracellular cysteines of the alpha subunit.


    Neumann, D; Barchan, D; Horowitz, M; Kochva, E; Fuchs, S


    The acetylcholine receptor (AcChoR) at the neuromuscular junction of elapid snakes binds cholinergic ligands but unlike other muscle AcChoRs does not bind alpha-bungarotoxin. Numerous studies indicate that the ligand-binding site of the AcChoR includes cysteine residues at positions 192 and 193 of the alpha subunit. We have previously shown that a synthetic dodecapeptide corresponding to residues 185-196 of the Torpedo AcChoR alpha subunit contains the essential elements of the ligand-binding site. In an attempt to elucidate the structural basis for the precise binding properties of snake AcChoR, we sequenced a portion of the snake AcChoR alpha subunit. First, a mouse AcChoR alpha-subunit cDNA probe was used to screen a size-selected snake (Natrix tessellata) genomic library. A genomic clone was isolated and was found to contain sequences homologous to the exon including the first two cysteines (Cys-128 and -142) of AcChoR alpha subunit. The domain of the alpha subunit from Natrix and cobra AcChoR (amino acid residues 119-222), which contains the four extracellular cysteines (128, 142, 192, and 193), was amplified by reverse transcription of mRNA and the polymerase chain reaction and then sequenced. The deduced amino acid sequence showed that the snake alpha subunit contains the two tandem cysteines at positions 192 and 193, resembling all other AcChoR alpha subunits. Sequence comparison revealed that the cloned region of the snake alpha subunit is highly homologous (75-80%) to other muscle AcChoRs and not to neuronal AcChoR, which also does not bind alpha-bungarotoxin. In the presumed ligand-binding site, in the vicinity of Cys-192 and Cys-193, four major substitutions occur in the snake sequence--at positions 184 (Trp----Phe), 185 (Lys----Trp), 187 (Trp----Ser), and 194 (Pro----Leu). In addition, Asn-189 is a putative N-glycosylation site, present only in the snake. These changes, or part of them, may explain the lack of alpha-bungarotoxin-binding to snake Ac

  14. Snake acetylcholine receptor: cloning of the domain containing the four extracellular cysteines of the alpha subunit.

    PubMed Central

    Neumann, D; Barchan, D; Horowitz, M; Kochva, E; Fuchs, S


    The acetylcholine receptor (AcChoR) at the neuromuscular junction of elapid snakes binds cholinergic ligands but unlike other muscle AcChoRs does not bind alpha-bungarotoxin. Numerous studies indicate that the ligand-binding site of the AcChoR includes cysteine residues at positions 192 and 193 of the alpha subunit. We have previously shown that a synthetic dodecapeptide corresponding to residues 185-196 of the Torpedo AcChoR alpha subunit contains the essential elements of the ligand-binding site. In an attempt to elucidate the structural basis for the precise binding properties of snake AcChoR, we sequenced a portion of the snake AcChoR alpha subunit. First, a mouse AcChoR alpha-subunit cDNA probe was used to screen a size-selected snake (Natrix tessellata) genomic library. A genomic clone was isolated and was found to contain sequences homologous to the exon including the first two cysteines (Cys-128 and -142) of AcChoR alpha subunit. The domain of the alpha subunit from Natrix and cobra AcChoR (amino acid residues 119-222), which contains the four extracellular cysteines (128, 142, 192, and 193), was amplified by reverse transcription of mRNA and the polymerase chain reaction and then sequenced. The deduced amino acid sequence showed that the snake alpha subunit contains the two tandem cysteines at positions 192 and 193, resembling all other AcChoR alpha subunits. Sequence comparison revealed that the cloned region of the snake alpha subunit is highly homologous (75-80%) to other muscle AcChoRs and not to neuronal AcChoR, which also does not bind alpha-bungarotoxin. In the presumed ligand-binding site, in the vicinity of Cys-192 and Cys-193, four major substitutions occur in the snake sequence--at positions 184 (Trp----Phe), 185 (Lys----Trp), 187 (Trp----Ser), and 194 (Pro----Leu). In addition, Asn-189 is a putative N-glycosylation site, present only in the snake. These changes, or part of them, may explain the lack of alpha-bungarotoxin-binding to snake Ac

  15. Elementary Processes Underlying Alpha Channeling in Tokamaks

    SciTech Connect

    NM.J. Fisch


    Alpha channeling in tokamaks is speculative, but also extraordinarily attractive. Waves that can accomplish this effect have been identified. Key aspects of the theory now enjoy experimental confirmation. This paper will review the elementary processes of wave-particle interactions in plasma that underlie the alpha channeling effect

  16. Commentary on Coefficient Alpha: A Cautionary Tale

    ERIC Educational Resources Information Center

    Green, Samuel B.; Yang, Yanyun


    The general use of coefficient alpha to assess reliability should be discouraged on a number of grounds. The assumptions underlying coefficient alpha are unlikely to hold in practice, and violation of these assumptions can result in nontrivial negative or positive bias. Structural equation modeling was discussed as an informative process both to…

  17. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2011 CFR


    ... 27 Alcohol, Tobacco Products and Firearms 1 2011-04-01 2011-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT... Alpha terpineol. (a) Boiling point at 752mm 218.8-219.4 °C. (b) Density at 15° 0.9386. (c)...

  18. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2014 CFR


    ... 27 Alcohol, Tobacco Products and Firearms 1 2014-04-01 2014-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT... Alpha terpineol. (a) Boiling point at 752mm 218.8-219.4 °C. (b) Density at 15° 0.9386. (c)...

  19. Teaching Calculus with Wolfram|Alpha

    ERIC Educational Resources Information Center

    Dimiceli, Vincent E.; Lang, Andrew S. I. D.; Locke, LeighAnne


    This article describes the benefits and drawbacks of using Wolfram|Alpha as the platform for teaching calculus concepts in the lab setting. It is a result of our experiences designing and creating an entirely new set of labs using Wolfram|Alpha. We present the reasoning behind our transition from using a standard computer algebra system (CAS) to…

  20. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2013 CFR


    ... 27 Alcohol, Tobacco Products and Firearms 1 2013-04-01 2013-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT... Alpha terpineol. (a) Boiling point at 752mm 218.8-219.4 °C. (b) Density at 15° 0.9386. (c)...

  1. Atypical Alpha Asymmetry in Adults with ADHD

    ERIC Educational Resources Information Center

    Hale, T. Sigi; Smalley, Susan L.; Hanada, Grant; Macion, James; McCracken, James T.; McGough, James J.; Loo, Sandra K.


    Introduction: A growing body of literature suggests atypical cerebral asymmetry and interhemispheric interaction in ADHD. A common means of assessing lateralized brain function in clinical populations has been to examine the relative proportion of EEG alpha activity (8-12 Hz) in each hemisphere (i.e., alpha asymmetry). Increased rightward alpha…

  2. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2012 CFR


    ... 27 Alcohol, Tobacco Products and Firearms 1 2012-04-01 2012-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT... Alpha terpineol. (a) Boiling point at 752mm 218.8-219.4 °C. (b) Density at 15° 0.9386. (c)...

  3. Alpha-1 Antitrypsin Deficiency (Inherited Emphysema)


    ... 1 protein in the blood with normal alpha-1 antitrypsin from healthy plasma donors. It is given in a vein (IV). The dose is adjusted based on body weight. This treatment is often given once a week. There are three ... the management of Alpha-1 related emphysema includes: • Exercise and a healthy lifestyle ...

  4. Psychiatric Symptoms in Alpha-Mannosidosis

    ERIC Educational Resources Information Center

    Malm, D.; Pantel, J.; Linaker, O. M.


    Alpha-mannosidosis is characterized by mild to moderate intellectual disability (ID), moderate to severe neurosensory hearing loss, frequent infections, psychomotor disturbances and skeletal dysmorphism. For the first time, a panel of nine alpha-mannosidosis patients with psychiatric symptoms is presented. The clinical picture has several…

  5. Alpha particle spectrometry using superconducting microcalorimeters

    NASA Astrophysics Data System (ADS)

    Horansky, Robert; Ullom, Joel; Beall, James; Hilton, Gene; Stiehl, Gregory; Irwin, Kent; Plionis, Alexander; Lamont, Stephen; Rudy, Clifford; Rabin, Michael


    Alpha spectrometry is the preferred technique for analyzing trace samples of radioactive material because the alpha particle flux can be significantly higher than the gamma-ray flux from nuclear materials of interest. Traditionally, alpha spectrometry is performed with Si detectors whose resolution is at best 8 keV FWHM. Here, we describe the design and operation of a microcalorimeter alpha detector with an energy resolution of 1.06 keV FWHM at 5 MeV. We demonstrate the ability of the microcalorimeter to clearly resolve the alpha particles from Pu-239 and Pu-240, whose ratio differentiates reactor-grade Pu from weapons-grade. We also show the first direct observation of the decay of Po-209 to the ground state of Pb-205 which has traditionally been obscured by a much stronger alpha line 2 keV away. Finally, the 1.06 keV resolution observed for alpha particles is far worse than the 0.12 keV resolution predicted from thermal fluctuations and measurement of gamma-rays. The cause of the resolution degradation may be ion damage in the tin. Hence, alpha particle microcalorimeters may provide a novel tool for studying ion damage and lattice displacement energies in bulk materials.

  6. 27 CFR 21.95 - Alpha terpineol.

    Code of Federal Regulations, 2010 CFR


    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Alpha terpineol. 21.95 Section 21.95 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS FORMULAS FOR DENATURED ALCOHOL AND RUM Specifications for Denaturants § 21.95 Alpha terpineol. (a) Boiling point at...

  7. Coefficient Alpha Bootstrap Confidence Interval under Nonnormality

    ERIC Educational Resources Information Center

    Padilla, Miguel A.; Divers, Jasmin; Newton, Matthew


    Three different bootstrap methods for estimating confidence intervals (CIs) for coefficient alpha were investigated. In addition, the bootstrap methods were compared with the most promising coefficient alpha CI estimation methods reported in the literature. The CI methods were assessed through a Monte Carlo simulation utilizing conditions…

  8. Elements of Film.

    ERIC Educational Resources Information Center

    Bobker, Lee R.

    A film is the successful combination of two distinct groups of elements: (1) the technical elements by which the film is made (camera, lighting, sound and editing) and (2) the esthetic elements that transform the craft into an art. This book attempts to combine the study of these elements by providing technical information about the process of…

  9. Organic Elemental Analysis.

    ERIC Educational Resources Information Center

    Ma, T. S.; Wang, C. Y.


    Presents a literature review on methods used to analyze organic elements. Topic areas include methods for: (1) analyzing carbon, hydrogen, and nitrogen; (2) analyzing oxygen, sulfur, and halogens; (3) analyzing other elements; (4) simultaneously determining several elements; and (5) determing trace elements. (JN)

  10. Local Structure and Vibrational Properties of alpha-Pu, alpha-U, and the alpha-U Charge Density Wave

    SciTech Connect

    Nelson, E J; Allen, P G; Blobaum, K M; Wall, M A; Booth, C H


    The local atomic environment and vibrational properties of atoms in monoclinic pure {alpha}-plutonium as well as orthorhombic pure {alpha}-uranium and its low-temperature charge-density-wave (CDW) modulation are examined by extended x-ray absorption fine structure spectroscopy (EXAFS). Pu L{sub III}-edge and U L{sub III}-edge EXAFS data measured at low temperatures verify the crystal structures of {alpha}-U and {alpha}-Pu samples previously determined by x-ray diffraction and neutron scattering. Debye-Waller factors from temperature-dependent EXAFS measurements are fit with a correlated Debye model. The observed Pu-Pu bond correlated Debye temperature of {theta}{sub cD}({alpha}-Pu) = 162 {+-} 5 K for the pure {alpha}-Pu phase agrees with our previous measurement of the correlated Debye temperature of the gallium-containing {alpha}'-Pu phase in a mixed phase 1.9 at% Ga-doped {alpha}'-Pu/{delta}-Pu alloy. The temperature dependence of the U-U nearest neighbor Debye-Waller factor exhibits a sharp discontinuity in slope near T{sub CDW} = 43 K, the transition temperature at which the charge-density wave (CDW) in {alpha}-U condenses from a soft phonon mode along the (100) direction. Our measurement of the CDW using EXAFS is the first observation of the structure of the CDW in polycrystalline {alpha}-U. The different temperature dependence of the Debye-Waller factor for T < T{sub CDW} can be modeled by the change in bond length distributions resulting from condensation of the charge density wave. For T > T{sub CDW}, the observed correlated Debye temperature of {theta}{sub cD}({alpha}-U) = 199 {+-} 3 K is in good agreement with other measurements of the Debye temperature for polycrystalline {alpha}-U. CDW structural models fit to the {alpha}-U EXAFS data support a squared CDW at the lowest temperatures, with a displacement amplitude of {var_epsilon} = 0.05 {+-} 0.02 {angstrom}.

  11. An Alpha Schottky Junction Power Source

    NASA Astrophysics Data System (ADS)

    Litz, Marc; Carroll, James; Henriquez, Stan


    Isotope batteries present solutions for long-lived low power sources. Compact sensors, and electronic circuit boards can be powered for the lifetime of infrastructure. Alpha sources are practical for safety reasons because of the limited distance before energy absorption in materials, and the high energy (~5MeV) per particle. Damage to materials from the alphas limits the practical use. A Schottky diode geometry is created from an alpha foil on a diamond-like crystal. A power source is proposed that takes advantage of the radiation damage tolerance of diamond, combined with the short range of the alpha radiation. The internal field of the Schottky barrier creates a current through the diode from electron-hole pairs created by alpha bombardment in the gap. Calculations of the expected current, circuit model results, and design parameters for a device are described.

  12. Coactivator PGC-1{alpha} regulates the fasting inducible xenobiotic-metabolizing enzyme CYP2A5 in mouse primary hepatocytes

    SciTech Connect

    Arpiainen, Satu; Jaervenpaeae, Sanna-Mari; Manninen, Aki; Viitala, Pirkko; Lang, Matti A.; Pelkonen, Olavi; Hakkola, Jukka


    The nutritional state of organisms and energy balance related diseases such as diabetes regulate the metabolism of xenobiotics such as drugs, toxins and carcinogens. However, the mechanisms behind this regulation are mostly unknown. The xenobiotic-metabolizing cytochrome P450 (CYP) 2A5 enzyme has been shown to be induced by fasting and by glucagon and cyclic AMP (cAMP), which mediate numerous fasting responses. Peroxisome proliferator-activated receptor {gamma} coactivator (PGC)-1{alpha} triggers many of the important hepatic fasting effects in response to elevated cAMP levels. In the present study, we were able to show that cAMP causes a coordinated induction of PGC-1{alpha} and CYP2A5 mRNAs in murine primary hepatocytes. Furthermore, the elevation of the PGC-1{alpha} expression level by adenovirus mediated gene transfer increased CYP2A5 transcription. Co-transfection of Cyp2a5 5' promoter constructs with the PGC-1{alpha} expression vector demonstrated that PGC-1{alpha} is able to activate Cyp2a5 transcription through the hepatocyte nuclear factor (HNF)-4{alpha} response element in the proximal promoter of the Cyp2a5 gene. Chromatin immunoprecipitation assays showed that PGC-1{alpha} binds, together with HNF-4{alpha}, to the same region at the Cyp2a5 proximal promoter. In conclusion, PGC-1{alpha} mediates the expression of CYP2A5 induced by cAMP in mouse hepatocytes through coactivation of transcription factor HNF-4{alpha}. This strongly suggests that PGC-1{alpha} is the major factor mediating the fasting response of CYP2A5.

  13. Alpha1 and Alpha2 Integrins Mediate Invasive Activity of Mouse Mammary Carcinoma Cells through Regulation of Stromelysin-1 Expression

    SciTech Connect

    Lochter, Andre; Navre, Marc; Werb, Zena; Bissell, Mina J


    Tumor cell invasion relies on cell migration and extracellular matrix proteolysis. We investigated the contribution of different integrins to the invasive activity of mouse mammary carcinoma cells. Antibodies against integrin subunits {alpha}6 and {beta}1, but not against {alpha}1 and {alpha}2, inhibited cell locomotion on a reconstituted basement membrane in two-dimensional cell migration assays, whereas antibodies against {beta}1, but not against a6 or {alpha}2, interfered with cell adhesion to basement membrane constituents. Blocking antibodies against {alpha}1 integrins impaired only cell adhesion to type IV collagen. Antibodies against {alpha}1, {alpha}2, {alpha}6, and {beta}1, but not {alpha}5, integrin subunits reduced invasion of a reconstituted basement membrane. Integrins {alpha}1 and {alpha}2, which contributed only marginally to motility and adhesion, regulated proteinase production. Antibodies against {alpha}1 and {alpha}2, but not {alpha}6 and {beta}1, integrin subunits inhibited both transcription and protein expression of the matrix metalloproteinase stromelysin-1. Inhibition of tumor cell invasion by antibodies against {alpha}1 and {alpha}2 was reversed by addition of recombinant stromelysin-1. In contrast, stromelysin-1 could not rescue invasion inhibited by anti-{alpha}6 antibodies. Our data indicate that {alpha}1 and {alpha}2 integrins confer invasive behavior by regulating stromelysin-1 expression, whereas {alpha}6 integrins regulate cell motility. These results provide new insights into the specific functions of integrins during tumor cell invasion.

  14. Catalytic Mechanism of Human Alpha-galactosidase

    SciTech Connect

    Guce, A.; Clark, N; Salgado, E; Ivanen, D; Kulinskaya, A; Brumer, H; Garman, S


    The enzyme {alpha}-galactosidase ({alpha}-GAL, also known as {alpha}-GAL A; E.C. is responsible for the breakdown of {alpha}-galactosides in the lysosome. Defects in human {alpha}-GAL lead to the development of Fabry disease, a lysosomal storage disorder characterized by the buildup of {alpha}-galactosylated substrates in the tissues. {alpha}-GAL is an active target of clinical research: there are currently two treatment options for Fabry disease, recombinant enzyme replacement therapy (approved in the United States in 2003) and pharmacological chaperone therapy (currently in clinical trials). Previously, we have reported the structure of human {alpha}-GAL, which revealed the overall structure of the enzyme and established the locations of hundreds of mutations that lead to the development of Fabry disease. Here, we describe the catalytic mechanism of the enzyme derived from x-ray crystal structures of each of the four stages of the double displacement reaction mechanism. Use of a difluoro-{alpha}-galactopyranoside allowed trapping of a covalent intermediate. The ensemble of structures reveals distortion of the ligand into a {sup 1}S{sub 3} skew (or twist) boat conformation in the middle of the reaction cycle. The high resolution structures of each step in the catalytic cycle will allow for improved drug design efforts on {alpha}-GAL and other glycoside hydrolase family 27 enzymes by developing ligands that specifically target different states of the catalytic cycle. Additionally, the structures revealed a second ligand-binding site suitable for targeting by novel pharmacological chaperones.

  15. Folate receptor {alpha} regulates cell proliferation in mouse gonadotroph {alpha}T3-1 cells

    SciTech Connect

    Yao, Congjun; Evans, Chheng-Orn; Stevens, Victoria L.; Owens, Timothy R.; Oyesiku, Nelson M.


    We have previously found that the mRNA and protein levels of the folate receptor alpha (FR{alpha}) are uniquely over-expressed in clinically human nonfunctional (NF) pituitary adenomas, but the mechanistic role of FR{alpha} has not fully been determined. We investigated the effect of FR{alpha} over-expression in the mouse gonadotroph {alpha}T3-1 cell line as a model for NF pituitary adenomas. We found that the expression and function of FR{alpha} were strongly up-regulated, by Western blotting and folic acid binding assay. Furthermore, we found a higher cell growth rate, an enhanced percentage of cells in S-phase by BrdU assay, and a higher PCNA staining. These observations indicate that over-expression of FR{alpha} promotes cell proliferation. These effects were abrogated in the same {alpha}T3-1 cells when transfected with a mutant FR{alpha} cDNA that confers a dominant-negative phenotype by inhibiting folic acid binding. Finally, by real-time quantitative PCR, we found that mRNA expression of NOTCH3 was up-regulated in FR{alpha} over-expressing cells. In summary, our data suggests that FR{alpha} regulates pituitary tumor cell proliferation and mechanistically may involve the NOTCH pathway. Potentially, this finding could be exploited to develop new, innovative molecular targeted treatment for human NF pituitary adenomas.

  16. Human podocytes adhere to the KRGDS motif of the alpha3alpha4alpha5 collagen IV network.


    Borza, Corina M; Borza, Dorin-Bogdan; Pedchenko, Vadim; Saleem, Moin A; Mathieson, Peter W; Sado, Yoshikazu; Hudson, Heather M; Pozzi, Ambra; Saus, Juan; Abrahamson, Dale R; Zent, Roy; Hudson, Billy G


    Podocyte adhesion to the glomerular basement membrane is required for proper function of the glomerular filtration barrier. However, the mechanism whereby podocytes adhere to collagen IV networks, a major component of the glomerular basement membrane, is poorly understood. The predominant collagen IV network is composed of triple helical protomers containing the alpha3alpha4alpha5 chains. The protomers connect via the trimeric noncollagenous (NC1) domains to form hexamers at the interface. Because the NC1 domains of this network can potentially support integrin-dependent cell adhesion, it was determined whether individual NC1 monomers or alpha3alpha4alpha5 hexamers support podocyte adhesion. It was found that, although human podocytes did not adhere to NC1 domains proper, they did adhere via integrin alphavbeta3 to a KRGDS motif located adjacent to alpha3NC1 domains. Because the KRGDS motif is a site of phosphorylation, its interactions with integrin alphavbeta3 may play a critical role in cell signaling in physiologic and pathologic states. PMID:18235087

  17. Structural requirements for the interdomain linker of alpha subunit of Escherichia coli RNA polymerase.


    Fujita, N; Endo, S; Ishihama, A


    The carboxy-terminal domain of the alpha subunit of Escherichia coli RNA polymerase, which is connected with the core part of RNA polymerase through a long flexible linker, plays decisive roles in transcription activation by directly interacting with a large number of transcription factors and upstream (UP) element DNA. Here we constructed a set of mutant RNA polymerases, each containing a mutant alpha subunit with an altered interdomain linker. Deletion of three amino acids from the linker exhibited 50% inhibition of cAMP receptor protein- (CRP-) dependent lac P1 transcription. Deletion of six amino acids completely knocked out the activity. Insertion of three amino acids did not affect the activity, whereas 40-60% inhibition was observed after insertion of one, two, or four amino acids. Substitution of 10 consecutive glycine residues resulted in nearly 90% reduction of the CRP-dependent activity, whereas 50% activity was retained after substitution of 10 proline residues or a sequence expected to form a strong alpha-helix. Essentially the same results were obtained with UP element-dependent rrnB P1 transcription. These observations altogether suggest that (i) sufficient length of the interdomain linker is required for transcription activation mediated by the alpha carboxy-terminal domain, (ii) the linker is not totally unstructured but has structural and torsional preferences to facilitate positioning of the carboxy-terminal domain to a proper location for the interaction with CRP and UP element, and (iii) CRP-dependent activation and UP element-dependent activation share a common intermediary state in which the positioning of the alpha carboxy-terminal domain is of primary importance. PMID:10821700

  18. Mapping High-Velocity H-alpha and Lyman-alpha Emission from Supernova 1987A

    NASA Technical Reports Server (NTRS)

    France, Kevin; McCray, Richard; Fransson, Claes; Larsson, Josefin; Frank, Kari A.; Burrows, David N.; Challis, Peter; Kirshner, Robert P.; Chevalier, Roger A.; Garnavich, Peter; Heng, Kevin; Lawrence, Stephen S.; Lundqvist, Peter; Smith, Nathan; Sonneborn, George


    We present new Hubble Space Telescope images of high-velocity H-alpha and Lyman-alpha emission in the outer debris of SN 1987A. The H-alpha images are dominated by emission from hydrogen atoms crossing the reverse shock. For the first time we observe emission from the reverse shock surface well above and below the equatorial ring, suggesting a bipolar or conical structure perpendicular to the ring plane. Using the H-alpha imaging, we measure the mass flux of hydrogen atoms crossing the reverse shock front, in the velocity intervals (-7,500 < V(sub obs) < -2,800 km/s) and (1,000 < V(sub obs) < 7,500 km/s), ?M(sub H) = 1.2 × 10(exp -3) M/ y. We also present the first Lyman-alpha imaging of the whole remnant and new Chandra X-ray observations. Comparing the spatial distribution of the Lyman-alpha and X-ray emission, we observe that the majority of the high-velocity Lyman-alpha emission originates interior to the equatorial ring. The observed Lyman-alpha/H-alpha photon ratio, R(L-alpha/H-alpha) approx. = 17, is significantly higher than the theoretically predicted ratio of approx. = 5 for neutral atoms crossing the reverse shock front. We attribute this excess to Lyman-alpha emission produced by X-ray heating of the outer debris. The spatial orientation of the Lyman-alpha and X-ray emission suggests that X-ray heating of the outer debris is the dominant Lyman-alpha production mechanism in SN 1987A at this phase in its evolution.

  19. [Contents and its change during storage of alpha-solanine and alpha-chaconine in potatoes].


    Shindo, Tetsuya; Ushiyama, Hirofumi; Kan, Kimiko; Yasuda, Kazuo; Saito, Kazuo


    Contents of alpha-solanine and alpha-chaconine in native species of potato (May Queen, Danshaku and Waseshiro), and in species (Jagakids Red '90 (Red) and Jagakids Purple '90 (Purple)) on the market, and their change during storage at room temparature were investigated. alpha-Solanine and alpha-chaconine were extracted from potatoes with methanol, cleaned up by using a Sep-Pak Plus C18 cartridge, and then subjected to HPLC. The recoveries of alpha-solanine and alpha-chaconine from potatoes were both more than 96%, and the quantitation limits were both 2 microg/g. alpha-Solanine and alpha-chaconine were detected in periderm in all samples at the levels of 260-320 microg/g in May Queen,190-240 microg/g in Danshaku, 43-63 microg/g in Waseshiro, 140-200 microg/g in Red and 84-130 microg/g in Purple, respectively. alpha-Solanine and alpha-chaconine were detected in the cortex in all samples of May Queen and Danshaku at the levels of 2.7-12 microg/g and 5.8-31 microg/g, respectively. Contents of alpha-solanine and alpha-chaconine in the cortex of May Queen and Danshaku were less than 10% of those in the periderm. When potatoes were stored for 90 days at room temparature in a dark place, no marked change in the contents of alpha-solanine and alpha-chaconine was observed in any of the potato samples. PMID:15678944

  20. Genetics Home Reference: mucolipidosis III alpha/beta


    ... Health Conditions mucolipidosis III alpha/beta mucolipidosis III alpha/beta Enable Javascript to view the expand/collapse ... PDF Open All Close All Description Mucolipidosis III alpha/beta is a slowly progressive disorder that affects ...

  1. Genetics Home Reference: mucolipidosis II alpha/beta


    ... Health Conditions mucolipidosis II alpha/beta mucolipidosis II alpha/beta Enable Javascript to view the expand/collapse ... PDF Open All Close All Description Mucolipidosis II alpha/beta (also known as I-cell disease) is ...

  2. Local structure and vibrational properties of alpha-Pu, alpha-Uand the alpha-U charge density wave

    SciTech Connect

    Nelson, E.J.; Allen, P.G.; Blobaum, K.J.M.; Wall, W.A.; Booth, C.H.


    The local atomic environment and vibrational properties of atoms in monoclinic pure {alpha}-plutonium as well as orthorhombic pure a-uranium and its low-temperature charge-density-wave (CDW) modulation are examined by extended x-ray absorption fine structure spectroscopy (EXAFS). Pu L{sub III}-edge and U L{sub III}-edge EXAFS data measured at low temperatures verify the crystal structures of {alpha}-U and {alpha}-Pu samples previously determined by x-ray diffraction and neutron scattering. Debye-Waller factors from temperature-dependent EXAFS measurements are fit with a correlated Debye model. The observed Pu-Pu bond correlated Debye temperature of {theta}{sub cD}({alpha}-Pu) = 162 {+-} 5 K for the pure {alpha}-Pu phase agrees with our previous measurement of the correlated Debye temperature of the gallium-containing {alpha}{prime}-Pu phase in a mixed phase 1.9 at% Ga-doped {alpha}{prime}-Pu/{delta}-Pu alloy. The temperature dependence of the U-U nearest neighbor Debye-Waller factor exhibits a sharp discontinuity in slope near T{sub CDW} = 43 K, the transition temperature at which the charge-density wave (CDW) in {alpha}-U condenses from a soft phonon mode along the (100) direction. Our measurement of the CDW using EXAFS is the first observation of the structure of the CDW in polycrystalline {alpha}-U. The different temperature dependence of the Debye-Waller factor for T < T{sub CDW} can be modeled by the change in bond length distributions resulting from condensation of the charge density wave. For T > T{sub CDW}, the observed correlated Debye temperature of {theta}{sub cD}({alpha}-U) = 199 {+-} 3 K is in good agreement with other measurements of the Debye temperature for polycrystalline {alpha}-U. CDW structural models fit to the {alpha}-U EXAFS data support a squared CDW at the lowest temperatures, with a displacement amplitude of {var_epsilon} = 0.05 {+-} 0.02 {angstrom}.

  3. Lucid dreaming and alpha activity: a preliminary report.


    Ogilvie, R D; Hunt, H T; Tyson, P D; Lucescu, M L; Jeakins, D B


    10 good dream recallers spent 2 nights in the sleep lab during which they were awakened 4 times per night from REM sleep, twice during their highest alpha activity in REM, and twice during low REM alpha. 5 were given alpha feedback training prior to sleep onset. Arousals from high alpha REM sleep yielded significantly higher lucidity ratings. Alpha feedback had no effect upon lucidity or REM alpha levels. Similarities between lucid dreams and meditative phenomena are discussed. PMID:7162915

  4. Incorporation of an internal ribosome entry site-dependent mechanism in arsenic-induced GADD45 alpha expression.


    Chang, Qingshan; Bhatia, Deepak; Zhang, Yadong; Meighan, Terry; Castranova, Vince; Shi, Xianglin; Chen, Fei


    We have previously shown that trivalent arsenic (arsenite, As(3+)) is able to induce GADD45 alpha expression in human bronchial epithelial cells through activation of c-Jun NH(2)-terminal kinase and nucleolin-dependent mRNA stabilization. In the present report, we show that As(3+) is capable of inducing translation of the GADD45 alpha protein through a cap-independent, or rather, an internal ribosome entry site (IRES)-dependent mechanism. In growth-arrested cells, As(3+) elevated the GADD45 alpha protein level in a dose- and time-dependent manner which did not correlate with the GADD45 alpha mRNA expression. Pretreatment of the cells with rapamycin, an inhibitor for the cap-dependent translation machinery through the suppression of mTOR and p70S6 kinase, failed to affect the induction of the GADD45 alpha protein induced by As(3+). Sequence analysis revealed a potential IRES element in the 5'-untranslated region of the GADD45 alpha mRNA. This IRES element in the 5'-untranslated region of the GADD45 alpha mRNA is functional in mediating As(3+)-induced translation of the GADD45 alpha protein in a dicistronic reporter gene activity assay. Immunoprecipitation and proteomic studies suggest that As(3+) impairs the assembly of the cap-dependent initiating complex for general protein translation but increases the association of human elongation factor 2 and human heterogeneous nuclear ribonucleoprotin with this complex. Thus, these results suggest that in growth-arrested cells, As(3+) is still capable of inducing GADD45 alpha expression through an IRES-dependent translational regulation. PMID:17616671

  5. Lyman alpha radiation in external galaxies

    NASA Technical Reports Server (NTRS)

    Neufeld, David A.; Mckee, Christopher F.


    The Ly alpha line of atomic hydrogen is often a luminous component of the radiation emitted by distant galaxies. Except for those galaxies which have a substantial central source of non-stellar ionizing radiation, most of the Ly alpha radiation emitted by galaxies is generated within regions of the interstellar medium which are photoionized by starlight. Conversely, much of the energy radiated by photoionized regions is carried by the Ly alpha line. Only hot, massive stars are capable of ionizing hydrogen in the interstellar medium which surrounds them, and because such stars are necessarily short-lived, Ly alpha emission traces regions of active star formation. Researchers argue that the strength of the Ly alpha emission observed from external galaxies may be used to estimate quantitatively the dust content of the emitting region, while the Ly alpha line profile is sensitive to the presence of shock waves. Interstellar dust particles and shock waves are intimately associated with the process of star formation in two senses. First, both dust particles and shock waves owe their existence to stellar activity; second, they may both serve as agents which facilitate the formation of stars, shocks by triggering gravitational instabilities in the interstellar gas that they compress, and dust by shielding star-forming molecular clouds from the ionizing and dissociative effects of external UV radiation. By using Ly alpha observations as a probe of the dust content in diffuse gas at high redshift, we might hope to learn about the earliest epochs of star formation.

  6. Applying alpha-channeling to mirror machines

    SciTech Connect

    Zhmoginov, A. I.; Fisch, N. J.


    The {alpha}-channeling effect entails the use of radio-frequency waves to expel and cool high-energetic {alpha} particles born in a fusion reactor; the device reactivity can then be increased even further by redirecting the extracted energy to fuel ions. Originally proposed for tokamaks, this technique has also been shown to benefit open-ended fusion devices. Here, the fundamental theory and practical aspects of {alpha} channeling in mirror machines are reviewed, including the influence of magnetic field inhomogeneity and the effect of a finite wave region on the {alpha}-channeling mechanism. For practical implementation of the {alpha}-channeling effect in mirror geometry, suitable contained weakly damped modes are identified. In addition, the parameter space of candidate waves for implementing the {alpha}-channeling effect can be significantly extended through the introduction of a suitable minority ion species that has the catalytic effect of moderating the transfer of power from the {alpha}-channeling wave to the fuel ions.



    Wyman, W.L.


    The described cylindrical fuel element has longitudinally spaced sets of short longitudinal ribs circumferentially spaced from one another. The ribs support the fuel element in a coolant tube so that there is an annular space for coolant flow between the fuel element and the interior of the coolant tube. If the fuel element grows as a result of reactor operation, the circumferential distribution of the ribs maintains the uniformity of the annular space between the coolant tube and the fuel element, and the collapsibility of the ribs prevents the fuel element from becoming jammed in the coolant tube.

  8. Lyman Alpha Spicule Observatory (LASO)

    NASA Technical Reports Server (NTRS)

    Chamberlin, Phillip C.


    The Lyman Alpha Spicule Observatory (LASO) sounding rocket will observe smallscale eruptive events called "Rapid Blue-shifted Events" (RBEs) [Rouppe van der Voort et al., 2009], the on-disk equivalent of Type-II spicules, and extend observations that explore their role in the solar coronal heating problem [De Pontieu et al., 2011]. LASO utilizes a new and novel optical design to simultaneously observe two spatial dimensions at 4.2" spatial resolution (2.1" pixels) over a 2'x2' field of view with high spectral resolution of 66mAngstroms (33mAngstroms pixels) across a broad 20Angstrom spectral window. This spectral window contains three strong chromospheric and transition region emissions and is centered on the strong Hydrogen Lyman-a emission at 1216Angstroms. This instrument makes it possible to obtain new data crucial to the physical understanding of these phenomena and their role in the overall energy and momentum balance from the upper chromosphere to lower corona. LASO was submitted March 2011 in response to the ROSES SHP-LCAS call.

  9. Diagnostics for PLX-alpha

    NASA Astrophysics Data System (ADS)

    Gilmore, Mark; Hsu, Scott


    The goal of the Plasma Liner eXperiment PLX-alpha at Los Alamos National Laboratory is to establish the viability of creating a spherically imploding plasma liner for MIF and HED applications, using a spherical array of supersonic plasma jets launched by innovative contoured-gap coaxial plasma guns. PLX- α experiments will focus in particular on establishing the ram pressure and uniformity scalings of partial and fully spherical plasma liners. In order to characterize these parameters experimentally, a suite of diagnostics is planned, including multi-camera fast imaging, a 16-channel visible interferometer (upgraded from 8 channels) with reconfigurable, fiber-coupled front end, and visible and VUV high-resolution and survey spectroscopy. Tomographic reconstruction and data fusion techniques will be used in conjunction with interferometry, imaging, and synthetic diagnostics from modeling to characterize liner uniformity in 3D. Diagnostic and data analysis design, implementation, and status will be presented. Supported by the Advanced Research Projects Agency - Energy - U.S. Department of Energy.

  10. Scalable encryption using alpha rooting

    NASA Astrophysics Data System (ADS)

    Wharton, Eric J.; Panetta, Karen A.; Agaian, Sos S.


    Full and partial encryption methods are important for subscription based content providers, such as internet and cable TV pay channels. Providers need to be able to protect their products while at the same time being able to provide demonstrations to attract new customers without giving away the full value of the content. If an algorithm were introduced which could provide any level of full or partial encryption in a fast and cost effective manner, the applications to real-time commercial implementation would be numerous. In this paper, we present a novel application of alpha rooting, using it to achieve fast and straightforward scalable encryption with a single algorithm. We further present use of the measure of enhancement, the Logarithmic AME, to select optimal parameters for the partial encryption. When parameters are selected using the measure, the output image achieves a balance between protecting the important data in the image while still containing a good overall representation of the image. We will show results for this encryption method on a number of images, using histograms to evaluate the effectiveness of the encryption.

  11. Diabetes and Alpha Lipoic Acid

    PubMed Central

    Golbidi, Saeid; Badran, Mohammad; Laher, Ismail


    Diabetes mellitus is a multi-faceted metabolic disorder where there is increased oxidative stress that contributes to the pathogenesis of this debilitating disease. This has prompted several investigations into the use of antioxidants as a complementary therapeutic approach. Alpha lipoic acid, a naturally occurring dithiol compound which plays an essential role in mitochondrial bioenergetic reactions, has gained considerable attention as an antioxidant for use in managing diabetic complications. Lipoic acid quenches reactive oxygen species, chelates metal ions, and reduces the oxidized forms of other antioxidants such as vitamin C, vitamin E, and glutathione. It also boosts antioxidant defense system through Nrf-2-mediated antioxidant gene expression and by modulation of peroxisome proliferator activated receptors-regulated genes. ALA inhibits nuclear factor kappa B and activates AMPK in skeletal muscles, which in turn have a plethora of metabolic consequences. These diverse actions suggest that lipoic acid acts by multiple mechanisms, many of which have only been uncovered recently. In this review we briefly summarize the known biochemical properties of lipoic acid and then discussed the oxidative mechanisms implicated in diabetic complications and the mechanisms by which lipoic acid may ameliorate these reactions. The findings of some of the clinical trials in which lipoic acid administration has been tested in diabetic patients during the last 10 years are summarized. It appears that the clearest benefit of lipoic acid supplementation is in patients with diabetic neuropathy. PMID:22125537

  12. Lyman Alpha Spicule Observatory (LASO)

    NASA Astrophysics Data System (ADS)

    Chamberlin, Phillip C.; Allred, J.; Airapetian, V.; Gong, Q.; Fontenla, J.; McIntosh, S.; de Pontieu, B.


    The Lyman Alpha Spicule Observatory (LASO) sounding rocket will observe small-scale eruptive events called "Rapid Blue-shifted Events” (RBEs), the on-disk equivalent of Type-II spicules, and extend observations that explore their role in the solar coronal heating problem. LASO utilizes a new and novel optical design to simultaneously observe two spatial dimensions at 4.2" spatial resolution (2.1” pixels) over a 2'x2' field of view with high spectral resolution of 66mÅ (33mÅ pixels) across a broad 20Å spectral window. This spectral window contains three strong chromospheric and transition region emissions and is centered on the strong Hydrogen Lyman-α emission at 1216Å. This instrument makes it possible to obtain new data crucial to the physical understanding of these phenomena and their role in the overall energy and momentum balance from the upper chromosphere to lower corona. LASO was submitted March 2011 in response to the ROSES SHP-LCAS call.

  13. Lyman Alpha Spicule Observatory (LASO)

    NASA Astrophysics Data System (ADS)

    Chamberlin, P. C.; Allred, J. C.; Airapetian, V.; Gong, Q.; Mcintosh, S. W.; De Pontieu, B.; Fontenla, J. M.


    The Lyman Alpha Spicule Observatory (LASO) sounding rocket will observe small-scale eruptive events called "Rapid Blue-shifted Events" (RBEs) [Rouppe van der Voort et al., 2009], the on-disk equivalent of Type-II spicules, and extend observations that explore their role in the solar coronal heating problem [De Pontieu et al., 2011]. LASO utilizes a new and novel optical design to simultaneously observe two spatial dimensions at 4.2" spatial resolution (2.1" pixels) over a 2'x2' field of view with high spectral resolution of 66mÅ (33mÅ pixels) across a broad 20Å spectral window. This spectral window contains three strong chromospheric and transition region emissions and is centered on the strong Hydrogen Lyman-α emission at 1216Å. This instrument makes it possible to obtain new data crucial to the physical understanding of these phenomena and their role in the overall energy and momentum balance from the upper chromosphere to lower corona. LASO was submitted March 2011 in response to the ROSES SHP-LCAS call.

  14. Fibrinogen {alpha} genes: Conservation of bipartite transcripts and carboxy-terminal-extended {alpha} subunits in vertebrates

    SciTech Connect

    Fu, Y.; Cao, Y.; Hertzberg, K.M.; Grieninger, G.


    All three well-studied subunits of the clotting protein fibrinogen ({alpha}, {beta}, {gamma}) share N-terminal structural homologies, but until recently only the {beta} and {gamma} chains were recognized as having similar globular C-termini. With the discovery of an extra exon in the human fibrinogen {alpha} gene (exon VI), a minor form of the {alpha} subunit ({alpha}{sub E}) with an extended {beta}- and {gamma}-like C-terminus has been identified. In the present study, the polymerase chain reaction has been used to identify sequences that encode counterparts to {alpha}{sub E} in chicken, rabbit, rat, and baboon. The basic six-exon structure of the fibrinogen {alpha} genes is shown to be conserved among mammals and birds, as are the intron positions. Bipartite transcripts - still bearing an intron prior to the last exon - are found among the products of the various vertebrate fibrinogen {alpha} genes. The last exon represents the largest conserved segment of the gene and, in each species examined, encodes exactly 236 amino acids. The C-termini of these {alpha}{sub E} chains align without a single gap and are between 76 and 99% identical. Since the exon VI-encoded domain of {alpha}{sub E} is as well conserved as the corresponding regions of the {beta} and {gamma} chains, it follows that it is equally important and that {alpha}{sub E}-fibrinogen plays a vital, if as-yet unrecognized physiological role. 21 refs., 7 figs., 1 tab.

  15. Divergence of human [alpha]-chain constant region gene sequences: A novel recombinant [alpha]2 gene

    SciTech Connect

    Chintalacharuvu, K. R.; Morrison, S.L. ); Raines, M. )


    IgA is the major Ig synthesized in humans and provides the first line of defense at the mucosal surfaces. The constant region of IgA heavy chain is encoded by the [alpha] gene on chromosome 14. Previous studies have indicated the presence of two [alpha] genes, [alpha]1 and [alpha]2 existing in two allotypic forms, [alpha]2 m(1) and [alpha]2 m(2). Here the authors report the cloning and complete nucleotide sequence determination of a novel human [alpha] gene. Nucleotide sequence comparison with the published [alpha] sequences suggests that the gene arose as a consequence of recombination or gene conversion between the two [alpha]2 alleles. The authors have expressed the gene as a chimeric protein in myeloma cells indicating that it encodes a functional protein. The novel IgA resembles IgA2 m(2) in that disulfide bonds link H and L chains. This novel recombinant gene provides insights into the mechanisms of generation of different constant regions and suggests that within human populations, multiple alleles of [alpha] may be present providing IgAs of different structures.

  16. Methylation of alpha-type embryonic globin gene alpha pi represses transcription in primary erythroid cells.


    Singal, Rakesh; vanWert, Jane M; Ferdinand, Larry


    The inverse relationship between expression and methylation of beta-type globin genes is well established. However, little is known about the relationship between expression and methylation of avian alpha-type globin genes. The embryonic alpha(pi)-globin promoter was unmethylated, and alpha(pi)-globin RNA was easily detected in 5-day chicken erythroid cells. A progressive methylation of the CpG dinucleotides in the alpha(pi) promoter associated with loss of expression of alpha(pi)-globin gene was seen during development in primary erythroid cells. A 315-bp alpha(pi)-globin promoter region was cloned in an expression construct (alpha(pi)pGL3E) containing a luciferase reporter gene and SV40 enhancer. The alpha(pi)pGL3E construct was transfected into primary erythroid cells derived from 5-day-old chicken embryos. Methylation of alpha(pi)pGL3E plasmid and alpha(pi)-globin promoter alone resulted in a 20-fold and 7-fold inhibition of expression, respectively. The fully methylated but not the unmethylated 315-bp alpha(pi)-globin gene promoter fragment formed a methyl cytosine-binding protein complex (MeCPC). Chromatin immunoprecipitation assays were combined with quantitative real-time polymerase chain reaction to assess histone acetylation associated with the alpha(pi)-globin gene promoter. Slight hyperacetylation of histone H3 but a marked hyperacetylation of histone H4 was seen in 5-day when compared with 14-day erythroid cells. These results demonstrate that methylation can silence transcription of an avian alpha-type embryonic globin gene in homologous primary erythroid cells, possibly by interacting with an MeCPC and histone deacetylase complex. PMID:12393573

  17. Lyman alpha airglow observations from SORCE SOLSTICE

    NASA Astrophysics Data System (ADS)

    Dolinar, E.; Snow, M.; Holsclaw, G.; Thomas, G. E.; Woods, T. N.


    The Solar Stellar Irradiance Comparison Experiment (SOLSTICE) instrument on board the Solar Radiation Climate Experiment (SORCE) spacecraft in low Earth orbit observes stars every orbit for in-flight calibration. It also observes several star-free regions of the sky near the wavelength of Lyman alpha to correct for airglow emission in the stellar measurements. Although the airglow measurements are only taken during the eclipse portion of the orbit, the look directions cover nearly the entire anti-sunward hemisphere. This seven-year record of Lyman alpha airglow observations (2003-2010) shows the response of the Hydrogen geocorona to changes in the solar Lyman alpha irradiance over the solar cycle.

  18. alpha-Glucosidase inhibitors from Commelina communis.


    Kim, H S; Kim, Y H; Hong, Y S; Paek, N S; Lee, H S; Kim, T H; Kim, K W; Lee, J J


    A methanolic extract of Commelina communis showed potent inhibitory activity against alpha-glucosidase. One pyrrolidine alkaloid, 2,5-dihydroxymethyl-3,4-dihydroxypyrrolidine (DMDP, 1) and four piperidine alkaloids, 1-deoxymannojirimycin (2), 1-deoxynojirimycin (3), alpha-homonojirimycin (4) and 7-O-beta-D-glucopyranosyl alpha-homonojirimycin (5) were isolated by bioassay-directed fractionation and separation. These compounds have been identified for the first time from Commelina communis, supporting the pharmacological basis of this plant that has been used as a traditional herbal medicine for the treatment of diabetes. PMID:10418330

  19. Alpha particle confinement in tandem mirrors

    SciTech Connect

    Devoto, R.S.; Ohnishi, M.; Kerns, J.; Woo, J.T.


    Mechanisms leading to loss of alpha particles from non-axisymmetric tandem mirrors are considered. Stochastic diffusion due to bounce-drift resonances, which can cause rapid radial losses of high-energy alpha particles, can be suppressed by imposing a 20% rise in axisymmetric fields before the quadrupole transition sections. Alpha particles should then be well-confined until thermal energies when they enter the resonant plateau require. A fast code for computation of drift behavior in reactors is described. Sample calculations are presented for resonant particles in a proposed coil set for the Tandem Mirror Next Step.

  20. Human placenta type V collagens. Evidence for the existence of an alpha 1(V) alpha 2(V) alpha 3(V) collagen molecule.


    Niyibizi, C; Fietzek, P P; van der Rest, M


    Human type V collagen was purified from placenta and found to contain alpha 1(V), alpha 2(V), and alpha 3(V) chains in varying ratios. Using any of three independent nondenaturing methods (phosphocellulose chromatography, high-performance ion-exchange chromatography on IEX-540 DEAE, and ammonium sulfate precipitation), this preparation could be resolved into two fractions. Analysis of the two fractions by sodium dodecyl sulfate-polyacrylamide gel electrophoresis indicated that one fraction contained alpha 1(V) and alpha 2(V) in a 2:1 ratio and the other contained alpha 1(V), alpha 2(V), and alpha 3(V) in a 1:1:1 ratio. When the crude placental type V collagen was electrophoresed under nondenaturing conditions, two bands were observed, one co-migrating with purified (alpha 1(V]2 alpha 2(V) and the other co-migrating with the fractions containing alpha 1(V), alpha 2(V), and alpha 3(V) chains in a 1:1:1 ratio. Electrophoresis in a second dimension under denaturing conditions confirmed that the fast-migrating band contained (alpha 1(V]2 alpha 2(V) and that the slow-migrating band contained the three chains in equimolar ratio. CD spectra of the two fractions and resistance to trypsin-chymotrypsin digestion confirmed that the two fractions contain triple helical collagen. Thermal denaturations were monitored by the changes in CD signal at 221 nm. The two fractions purified by ammonium sulfate precipitation melted at 39.1 and 36.4 degrees C for the (alpha 1(V]2 alpha 2(V) and alpha 1(V) alpha 2(V) alpha 3(V) fractions, respectively. Trypsin cleavage of these two native fractions at temperatures near melting produced completely different fragmentation patterns, indicating different partial unwinding sites of the alpha 1(V) and alpha 2(V) chains in the two preparations and thus different molecular assemblies. Our data demonstrate the existence of two different molecular assemblies of type V collagen in human placenta consisting of (alpha 1(V]2 alpha 2(V) and alpha 1(V


    SciTech Connect

    Yang Yujin; Jahnke, Knud; Zabludoff, Ann; Eisenstein, Daniel; Dave, Romeel; Shectman, Stephen A.; Kelson, Daniel D.


    Exploring the origin of Ly{alpha} nebulae ('blobs') at high redshift requires measurements of their gas kinematics that are impossible with only the resonant, optically thick Ly{alpha} line. To define gas motions relative to the systemic velocity of the blob, the Ly{alpha} line must be compared with an optically thin line like H{alpha} {lambda}6563, which is not much altered by radiative transfer effects and is more concentrated about the galaxies embedded in the nebula's core. We obtain optical and near-IR (NIR) spectra of the two brightest Ly{alpha} blobs (CDFS-LAB01 and CDFS-LAB02) from the Yang et al. sample using the Magellan/Magellan Echellette Spectrograph optical and Very Large Telescope/SINFONI NIR spectrographs. Both the Ly{alpha} and H{alpha} lines confirm that these blobs lie at the survey redshift, z {approx} 2.3. Within each blob, we detect several H{alpha} sources, which roughly correspond to galaxies seen in Hubble Space Telescope rest-frame UV images. The H{alpha} detections show that these galaxies have large internal velocity dispersions ({sigma}{sub v} = 130-190 km s{sup -1}) and that, in the one system (LAB01), where we can reliably extract profiles for two H{alpha} sources, their velocity difference is {Delta}v {approx} 440 km s{sup -1}. The presence of multiple galaxies within the blobs, and those galaxies' large velocity dispersions and large relative motion, is consistent with our previous finding that Ly{alpha} blobs inhabit massive dark matter halos that will evolve into those typical of present-day rich clusters and that the embedded galaxies may eventually become brightest cluster galaxies. To determine whether the gas near the embedded galaxies is predominantly infalling or outflowing, we compare the Ly{alpha} and H{alpha} line centers, finding that Ly{alpha} is not offset ({Delta}v{sub Ly{alpha}} = +0 km s{sup -1}) in LAB01 and redshifted by only +230 km s{sup -1} in LAB02. These offsets are small compared to those of Lyman break

  2. Effects of 12 metal ions on iron regulatory protein 1 (IRP-1) and hypoxia-inducible factor-1 alpha (HIF-1{alpha}) and HIF-regulated genes

    SciTech Connect

    Li Qin; Chen Haobin; Huang Xi; Costa, Max . E-mail:


    Several metal ions that are carcinogenic affect cellular iron homeostasis by competing with iron transporters or iron-regulated enzymes. Some metal ions can mimic a hypoxia response in cells under normal oxygen tension, and induce expression of HIF-1{alpha}-regulated genes. This study investigated whether 12 metal ions altered iron homeostasis in human lung carcinoma A549 cells as measured by an activation of IRP-1 and ferritin level. We also studied hypoxia signaling by measuring HIF-1{alpha} protein levels, hypoxia response element (HRE)-driven luciferase reporter activity, and Cap43 protein level (an HIF-1{alpha} responsive gene). Our results show the following: (i) Ni(II), Co(II), V(V), Mn(II), and to a lesser extent As(III) and Cu(II) activated the binding of IRP-1 to IRE after 24 h, while the other metal ions had no effect; (ii) 10 of 12 metal ions induced HIF-1{alpha} protein but to strikingly different degrees. Two of these metal ions, Al(III) and Cd(II), did not induce HIF-1{alpha} protein; however, as indicated below, only Ni(II), Co (II), and to lesser extent Mn(II) and V(V) activated HIF-1{alpha}-dependent transcription. The combined effects of both [Ni(II) + As(III)] and [Ni(II) + Cr(VI)] on HIF-1{alpha} protein were synergistic; (iii) Addition of Fe(II) with Ni(II), Co(II), and Cr(VI) attenuated the induction of HIF-1{alpha} after 4 h treatment; (iv) Ni(II), Co(II), and Mn(II) significantly decrease ferritin level after 24 h exposure; (v) Ni(II), Co(II), V(V), and Mn(II) activated HRE reporter gene after 20 h treatment; (vi) Ni(II), Co(II), V(V), and Mn(II) increased the HIF-1-dependent Cap43 protein level after 24 h treatment. In conclusion, only Ni (II), Co (II), and to a lesser extent Mn(II) and V(V) significantly stabilized HIF-1{alpha} protein, activated IRP, decreased the levels of ferritin, induced the transcription of HIF-dependent reporter, and increased the expression of Cap43 protein levels (HIF-dependent gene). The mechanism for the

  3. Determination of alpha-bisabolol and d-panthenol in cosmetic products by gas chromatography.


    Andre, D; Verite, P; Duclos, R; Orecchioni, A M; Failly, F


    Synopsis alpha-bisaboloi and d-panthenol are used in many cosmetic preparations, respectively, for their anti-inflammatory and regenerating properties. Their quantitative determination was an important element of their evaluation in these emulsions. Their concentration has been determined by gas chromatographic techniques, using a flame ionization detector. In both cases, the internal standards have been chosen for their compatibility with the analysis of extracted substances. Owing to the complexity of the cosmetic formulations, a preliminary extraction of alpha-bisabolol and d-panthenol was necessary. For the two substances the preparative separation was based on a liquid-liquid extraction. After dissolving the emulsion in methanol and diluting it with an aqueous buffer solution alpha-bisabolol was then extracted by ethyl acetate and d-panthenol by ethyl formate. PMID:19291052

  4. Cholesteryl ester hydroperoxides increase macrophage CD36 gene expression via PPAR{alpha}

    SciTech Connect

    Jedidi, Iness; Couturier, Martine; Therond, Patrice; Gardes-Albert, Monique; Legrand, Alain; Barouki, Robert; Bonnefont-Rousselot, Dominique; Aggerbeck, Martine . E-mail:


    The uptake of oxidized LDL by macrophages is a key event in the development of atherosclerosis. The scavenger receptor CD36 is one major receptor that internalizes oxidized LDL. In differentiated human macrophages, we compared the regulation of CD36 expression by copper-oxidized LDL or their products. Only oxidized derivatives of cholesteryl ester (CEOOH) increased the amount of CD36 mRNA (2.5-fold). Both oxidized LDL and CEOOH treatment increased two to fourfold the transcription of promoters containing peroxisome-proliferator-activated-receptor responsive elements (PPRE) in the presence of PPAR{alpha} or {gamma}. Electrophoretic-mobility-shift-assays with nuclear extracts prepared from macrophages treated by either oxidized LDL or CEOOH showed increased binding of PPAR{alpha} to the CD36 gene promoter PPRE. In conclusion, CEOOH present in oxidized LDL increase CD36 gene expression in a pathway involving PPAR{alpha}.

  5. Combustion synthesis and effects of processing parameters on physical properties of {alpha}-alumina

    SciTech Connect

    Collins, M.V.; Hirschfeld, D.A.; Shea, L.E.


    Fine particle porous {alpha}-alumina has been prepared by a wet chemical method of combustion synthesis using an aqueous precursor containing aluminum nitrate (oxidizer) and carbohydrazide, an organic fuel as starting materials. The aluminum nitrate and carbohydrazide were reacted exothermically at 400--600 C. The synthesis of {alpha}-alumina ({alpha}-Al{sub 2}O{sub 3}) was used as a model for understanding the effects of processing parameters on physical properties such as surface area, average pore size, and residual carbon content. The porous powders were characterized using x-ray diffraction (XRD), scanning electron microscopy (SEM), BET surface area analysis and elemental analysis. The decomposition of the starting materials was investigated using differential thermal and thermogravimetric analyses (DTA/TGA). It has been shown that the furnace temperature, fuel/oxidizer ratio, and precursor water content can be tailored to produce powders with different physical properties.

  6. Element-ary Development.

    ERIC Educational Resources Information Center

    Schamp, Homer W., Jr.


    Describes the historic development of the periodic table from the four-element theory to the Lavoisier's table. Presents a table listing the old and new names of chemicals and the Lavoisier's table of elements. Lists two references. (YP)

  7. Trace Elements and Health

    ERIC Educational Resources Information Center

    Pettyjohn, Wayne A.


    Summarizes the effects of arsenic, lead, zinc, mercury, and cadmium on human health, indicates the sources of the elements in water, and considers the possibility of students in high schools analyzing water for trace amounts of the elements. (AL)

  8. Characterization of a retinoic acid responsive element isolated by whole genome PCR.

    PubMed Central

    Costa-Giomi, M P; Gaub, M P; Chambon, P; Abarzúa, P


    We have used whole PCR in an attempt to isolate novel retinoic acid (RA) responsive genes. We cloned several small genomic fragments from total human DNA containing putative retinoic acid responsive elements (RAREs) selected by direct binding to the retinoic acid receptor alpha (RAR alpha). We report here that an oligonucleotide containing a sequence from one of the cloned human DNA fragments, and referred to as alpha 1, functions as an authentic RARE. It is shown that both RAR alpha and RAR beta produced in Cos cells as well as in vitro translated RAR alpha bind directly and sequence-specifically to the alpha 1RARE. By mutational analysis it is demonstrated that the alpha 1RARE consists of an imperfect direct repeat of the estrogen- and thyroid hormone-related AGGTCA half-site motif separated by a 5 bp spacer. The orientation and spacing of the half-site repeats are shown to play a critical role in RAR recognition. When cloned upstream of a TK-Luc reporter, the alpha 1RARE is shown to confer responsiveness to RA in an orientation-independent fashion in F9 and CV-1 cells. The magnitude of the RA response mediated by the alpha 1RARE differed in these cell lines. Images PMID:1320257

  9. Uncoupling protein-2 up-regulation and enhanced cyanide toxicity are mediated by PPAR{alpha} activation and oxidative stress

    SciTech Connect

    Zhang, X.; Li, L.; Prabhakaran, K.; Zhang, L.; Leavesley, H.B.; Borowitz, J.L.; Isom, G.E.


    Uncoupling protein 2 (UCP-2) is an inner mitochondrial membrane proton carrier that modulates mitochondrial membrane potential ({delta}{psi}{sub m}) and uncouples oxidative phosphorylation. We have shown that up-regulation of UCP-2 by Wy14,643, a selective peroxisome proliferator-activated receptor-{alpha} (PPAR{alpha}) agonist, enhances cyanide cytotoxicity. The pathway by which Wy14,643 up-regulates UCP-2 was determined in a dopaminergic cell line (N27 cells). Since dopaminergic mesencephalic cells are a primary brain target of cyanide, the N27 immortalized mesencephalic cell was used in this study. Wy14,643 produced a concentration- and time-dependent up-regulation of UCP-2 that was linked to enhanced cyanide-induced cell death. MK886 (PPAR{alpha} antagonist) or PPAR{alpha} knock-down by RNA interference (RNAi) inhibited PPAR{alpha} activity as shown by the peroxisome proliferator response element-luciferase reporter assay, but only partially decreased up-regulation of UCP-2. The role of oxidative stress as an alternative pathway to UCP-2 up-regulation was determined. Wy14,643 induced a rapid surge of ROS generation and loading cells with glutathione ethyl ester (GSH-EE) or pre-treatment with vitamin E attenuated up-regulation of UCP-2. On the other hand, RNAi knockdown of PPAR{alpha} did not alter ROS generation, suggesting a PPAR{alpha}-independent component to the response. Co-treatment with PPAR{alpha}-RNAi and GSH-EE blocked both the up-regulation of UCP-2 by Wy14,643 and the cyanide-induced cell death. It was concluded that a PPAR{alpha}-mediated pathway and an oxidative stress pathway independent of PPAR{alpha} mediate the up-regulation of UCP-2 and subsequent increased vulnerability to cyanide-induced cytotoxicity.

  10. Influence of fast alpha diffusion and thermal alpha buildup on tokamak reactor performance

    SciTech Connect

    Uckan, N.A.; Tolliver, J.S.; Houlberg, W.A.; Attenberger, S.E.


    The effect of fast alpha diffusion and thermal alpha accumulation on the confinement capability of a candidate Engineering Test Reactor (ETR) plasma (Tokamak Ignition/Burn Experimental Reactor (TIBER-II)) in achieving ignition and steady-state driven operation has been assessed using both global and 1-1/2-D transport models. Estimates are made of the threshold for radial diffusion of fast alphas and thermal alpha buildup. It is shown that a relatively low level of radial transport, when combined with large gradients in the fast alpha density, leads to a significant radial flow with a deleterious effect on plasma performance. Similarly, modest levels of thermal alpha concentration significantly influence the ignition and steady-state burn capability. 23 refs., 9 figs., 4 tabs.

  11. An alpha-omega-dynamo with an alpha-effect due to magnetostrophic waves

    NASA Astrophysics Data System (ADS)

    Schmitt, D.


    The effects of the latitude dependence of the dynamic alpha-effect on the solution of equations of alpha-omega-dynamos are investigated. The equations of kinematic rotationally symmetric alpha-omega-dynamos are evaluated using the spherical solar dynamo model of Deinzer and Stix (1971), in which the induction effects, differential rotation, and alpha-effect act in two separate infinitesimal thin shells. Butterfly diagrams are derived and analyzed. It is observed that the diagram has two branches: the ordinary sunspot branch, migrating from midlatitudes toward the equator during the cycle, and the polar branch, which migrates from the midlatitudes toward the pole. It is also found that, in order to obtain the correct propagation direction of the two dynamos, the alpha of the magnetostrophic waves requires a rotation decreasing with depth. The influence of various locations of the induction layers of alpha- and omega-effect are examined.

  12. Organic Elemental Analysis.

    ERIC Educational Resources Information Center

    Ma, T. S.; Gutterson, Milton


    Reviews general developments in computerization and data processing of organic elemental analyses; carbon, hydrogen, and nitrogen analyzers; procedures for determining oxygen, sulfur, and halogens, as well as other nometallic elements and organometallics. Selected papers on trace analysis of nonmetals and determination of metallic elements are…



    Beaver, R.J.; Leitten, C.F. Jr.


    A boron-10 containing reactor control element wherein the boron-10 is dispersed in a matrix material is describeri. The concentration of boron-10 in the matrix varies transversely across the element from a minimum at the surface to a maximum at the center of the element, prior to exposure to neutrons. (AEC)

  14. Elemental Chemical Puzzlers

    ERIC Educational Resources Information Center

    Thomas, Nicholas C.


    This paper provides nine short chemically based puzzles or problems extensible for use with students from middle school to college. Some of these will strengthen students' recognition of individual elements and element names. Others require students to focus on the salient properties of given chemical elements.

  15. Nuclear diagnostic for fast alpha particles


    Grisham, L.R.; Post, D.E. Jr.; Dawson, J.M.


    This invention relates generally to high energy confined plasmas and more particularly is directed to measuring the velocity distribution of confined energetic alpha particles resulting from deuterium-tritium fusion reactions in a confined energetic plasma.

  16. Genetics Home Reference: alpha-1 antitrypsin deficiency


    ... and genetic modifiers of emphysema risk. Thorax. 2004 Mar;59(3):259-64. Review. Citation on PubMed ... alpha}1-antitrypsin deficiency. Arch Intern Med. 2009 Mar 23;169(6):546-50. doi: 10.1001/ ...

  17. Five cases of alpha chain disease

    PubMed Central

    Doe, William F.; Henry, K.; Hobbs, J. R.; Jones, F. Avery; Dent, C. E.; Booth, C. C.


    Five patients suffering from alpha chain disease are described. Clinically the patients presented with clubbing and the symptoms of malabsorption. There was a characteristic, predominantly plasma cell infiltrate of the wall of the small intestine. Spread of the plasmacytosis beyond the small intestine to bone marrow (1), peripheral blood (1), and probably the nasopharyngeal lymphoid tissue (1) is described. Fragments of the heavy chain of IgA (alpha chain) were found in serum (5), urine (3), jejunal fluid (2), and saliva (1). The jejunal biopsy of one patient was shown to synthesize free alpha chain in tissue culture. A new and simple immunoselection technique for the identification of free alpha chain is described. Marked clinical remissions were achieved in two patients treated with intermittent cytotoxic and steroid therapy, and in a third patient who received intermittent cytotoxic therapy and tetracycline. ImagesFig. 1Fig. 2Fig. 3Fig. 4Fig. 5Fig. 6Fig. 7Fig. 8 PMID:4119805

  18. Alpha Coincidence Spectroscopy studied with GEANT4

    SciTech Connect

    Dion, Michael P.; Miller, Brian W.; Tatishvili, Gocha; Warren, Glen A.


    Abstract The high-energy side of peaks in alpha spectra, e.g. 241Am, as measured with a silicon detector has structure caused mainly by alpha-conversion electron and to some extent alphagamma coincidences. We compare GEANT4 simulation results to 241Am alpha spectroscopy measurements with a passivated implanted planar silicon detector. A large discrepancy between the measurements and simulations suggest that the GEANT4 photon evaporation database for 237Np (daughter of 241Am decay) does not accurately describe the conversion electron spectrum and therefore was found to have large discrepancies with experimental measurements. We describe how to improve the agreement between GEANT4 and alpha spectroscopy for actinides of interest by including experimental measurements of conversion electron spectroscopy into the photon evaporation database.

  19. International Space Station (ISS) Alpha Concept

    NASA Technical Reports Server (NTRS)


    Artist's concept of the final configuration of the International Space Station (ISS) Alpha. The ISS is a multidisciplinary laboratory, technology test bed, and observatory that will provide an unprecedented undertaking in scientific, technological, and international experimentation.

  20. Radioimmunotherapy with alpha-particle emitting radionuclides.


    Zalutsky, M R; Pozzi, O R


    An important consideration in the development of effective strategies for radioimmunotherapy is the nature of the radiation emitted by the radionuclide. Radionuclides decaying by the emission of alpha-particles offer the possibility of matching the cell specific reactivity of monoclonal antibodies with radiation with a range of only a few cell diameters. Furthermore, alpha-particles have important biological advantages compared with external beam radiation and beta-particles including a higher biological effectiveness, which is nearly independent of oxygen concentration, dose rate and cell cycle position. In this review, the clinical settings most likely to benefit from alpha-particle radioimmunotherapy will be discussed. The current status of preclinical and clinical research with antibodies labeled with 3 promising alpha-particle emitting radionuclides - (213)Bi, (225)Ac, and (211)At - also will be summarized. PMID:15640792

  1. A Family Portrait of the Alpha Centauri System

    NASA Astrophysics Data System (ADS)


    siderostats on the observing platform at the Paranal summit were used. These two small test telescopes were placed at distances of 16 and 66 metres, respectively (PR Photo 07c/03). They captured the light from the two stars and sent it on via a series of reflecting mirrors to the common focus in the commissioning instrument VINCI. Although they were obtained only a few days after the successful accomplishment of "First Fringes" with the VLTI (ESO PR 06/01), the 16-m measurements were found to be scientifically very useful and helped to improve the measurement of the angular diameter of Alpha Centauri A. The 66-m baseline measurements provided the most accurate values of "calibrated visibilities" (PR Photo 07d/03) - from these, the angular diameters were then derived. The VLTI measurements provided high-quality angular diameter values for both stars, 8.512 ± 0.022 milliarcsec and 6.002 ± 0.048 milliarcsec for A and B, respectively. With the distance measured earlier by the Hipparcos satellite of the European Space Agency (ESA), 4.36 light-years or 41 million million km, the true radii were then found to be 854,000 km and 602,000 km, or 1.227 ± 0.005 and 0.865 ± 0.007 times the radius of the Sun, respectively. Stellar models ESO PR Photo 07e/03 ESO PR Photo 07e/03 [Preview - JPEG: 400 x 478 pix - 288k] [Normal - JPEG: 800 x 956 pix - 992k] Caption: PR Photo 07e/03 shows the location of Alpha Centauri A and B, Proxima Centauri and the Sun in the Hertzsprung-Russell (HR) diagram [4]. During the past years, a number of more distant binary stellar systems like Alpha Centauri A and B have been observed with different methods, including spectrophotometry (emission at different wavelengths) and astrometry (position in the sky; motions). When compared with theoretical models of the stars, such measurements determine the main stellar parameters, including the masses of each component, their ages, their luminosities, effective temperatures and content of various chemical elements. At

  2. The binary weight distribution of the extended (2 sup m, 2 sup m-4) code of Reed-Solomon code over GF(2 sup m) with generator polynomial (x-alpha sup 2) (x-alpha sup 3)

    NASA Technical Reports Server (NTRS)

    Lin, Shu


    Consider an (n,k) linear code with symbols from GF(2 sup m). If each code symbol is represented by a binary m-tuple using a certain basis for GF(2 sup m), a binary (nm,km) linear code called a binary image of the original code is obtained. A lower bound is presented on the minimum weight enumerator for a binary image of the extended (2 sup m, 2 sup m -4) code of Reed-Solomon code over GF(2 sup m) with generator polynomical (x - alpha)(x- alpha squared)(x - alpha cubed) and its dual code, where alpha is a primitive element in GF(2 sup m).

  3. Alpha-emitters for medical therapy workshop

    SciTech Connect

    Feinendegen, L.E.; McClure, J.J.


    A workshop on ``Alpha-Emitters for Medical Therapy`` was held May 30-31, 1996 in Denver Colorado to identify research goals and potential clinical needs for applying alpha-particle emitters and to provide DOE with sufficient information for future planning. The workshop was attended by 36 participants representing radiooncology, nuclear medicine, immunotherapy, radiobiology, molecular biology, biochemistry, radiopharmaceutical chemistry, dosimetry, and physics. This report provides a summary of the key points and recommendations arrived at during the conference.

  4. Transport of Radioactive Material by Alpha Recoil

    SciTech Connect

    Icenhour, A.S.


    The movement of high-specific-activity radioactive particles (i.e., alpha recoil) has been observed and studied since the early 1900s. These studies have been motivated by concerns about containment of radioactivity and the protection of human health. Additionally, studies have investigated the potential advantage of alpha recoil to effect separations of various isotopes. This report provides a review of the observations and results of a number of the studies.

  5. Acid-induced dissociation of alpha A- and alpha B-crystallin homopolymers.

    PubMed Central

    Stevens, A; Augusteyn, R C


    Homopolymers were constructed from the alpha A and alpha B polypeptides isolated from the lens protein alpha-crystallin. As the pH is lowered from 7.0 to 3.4, these homopolymers dissociate to smaller species with molecular masses ranging from 80 to 250 kDa for the alpha A and around 140 kDa for the alpha B dissociation products. The pKa for this dissociation was 3.8 +/- 0.2 for alpha A and 4.1 +/- 0.1 for alpha B homopolymers. Further decreases in pH, to 2.5, resulted in the presence of only denatured alpha B polypeptides, whereas the alpha A dissociation products remained intact. Fractionation of the acid dissociation products from the alpha A homopolymer at pH 2.5 yielded stable species with molecular masses of 220 +/- 30, 160 +/- 20, and 90 +/- 10 kDa. The majority of the population at acid pH consisted of the 160 kDa species. Conformational analysis of these species revealed that most of the secondary structure of the original alpha A homopolymer was retained but that the tertiary structure was perturbed. Fluorescence quenching and energy transfer measurements suggested that the molecule had undergone acid expansion, with the greatest perturbation observed in the smallest particles. The results from this work suggest that alpha A homopolymers are heterogeneous populations of aggregates of a "monomeric" molecule with a molecular mass of 160 kDa. This "monomeric" molecule may be formed from the association of two tetrameric units. PMID:8274652

  6. Different polyphenolic components of soft fruits inhibit alpha-amylase and alpha-glucosidase.


    McDougall, Gordon J; Shpiro, Faina; Dobson, Patricia; Smith, Pauline; Blake, Alison; Stewart, Derek


    Polyphenol-rich extracts from soft fruits were tested for their ability to inhibit alpha-amylase and alpha-glucosidase. All extracts tested caused some inhibition of alpha-amylase, but there was a 10-fold difference between the least and most effective extracts. Strawberry and raspberry extracts were more effective alpha-amylase inhibitors than blueberry, blackcurrant, or red cabbage. Conversely, alpha-glucosidase was more readily inhibited by blueberry and blackcurrant extracts. The extent of inhibition of alpha-glucosidase was related to their anthocyanin content. For example, blueberry and blackcurrant extracts, which have the highest anthocyanin content, were the most effective inhibitors of alpha-glucosidase. The extracts most effective in inhibiting alpha-amylase (strawberry and raspberry) contain appreciable amounts of soluble tannins. Other tannin-rich extracts (red grape, red wine, and green tea) were also effective inhibitors of alpha-amylase. Indeed, removing tannins from strawberry extracts with gelatin also removed inhibition. Fractionation of raspberry extracts on Sephadex LH-20 produced an unbound fraction enriched in anthocyanins and a bound fraction enriched in tannin-like polyphenols. The unbound anthocyanin-enriched fraction was more effective against alpha-glucosidase than the original extract, whereas the alpha-amylase inhibitors were concentrated in the bound fraction. The LH-20 bound sample was separated by preparative HPLC, and fractions were assayed for inhibition of alpha-amylase. The inhibitory components were identified as ellagitannins using LC-MS-MS. This study suggests that different polyphenolic components of fruits may influence different steps in starch digestion in a synergistic manner. PMID:15796622

  7. Integrins alpha1beta1 and alpha2beta1 are receptors for the rotavirus enterotoxin.


    Seo, Neung-Seon; Zeng, Carl Q-Y; Hyser, Joseph M; Utama, Budi; Crawford, Sue E; Kim, Kate J; Höök, Magnus; Estes, Mary K


    Rotavirus NSP4 is a viral enterotoxin capable of causing diarrhea in neonatal mice. This process is initiated by the binding of extracellular NSP4 to target molecule(s) on the cell surface that triggers a signaling cascade leading to diarrhea. We now report that the integrins alpha1beta1 and alpha2beta1 are receptors for NSP4. NSP4 specifically binds to the alpha1 and alpha2 I domains with apparent K(d) = 1-2.7 muM. Binding is mediated by the I domain metal ion-dependent adhesion site motif, requires Mg(2+) or Mn(2+), is abolished with EDTA, and an NSP4 point mutant, E(120)A, fails to bind alpha2 integrin I domain. NSP4 has two distinct integrin interaction domains. NSP4 amino acids 114-130 are essential for binding to the I domain, and NSP4 peptide 114-135 blocks binding of the natural ligand, collagen I, to integrin alpha2. NSP4 amino acids 131-140 are not associated with the initial binding to the I domain, but elicit signaling that leads to the spreading of attached C2C12-alpha2 cells, mouse myoblast cells stably expressing the human alpha2 integrin. NSP4 colocalizes with integrin alpha2 on the basolateral surface of rotavirus-infected polarized intestinal epithelial (Caco-2) cells as well as surrounding noninfected cells. NSP4 mutants that fail to bind or signal through integrin alpha2 were attenuated in diarrhea induction in neonatal mice. These results indicate that NSP4 interaction with integrin alpha1 and alpha2 is an important component of enterotoxin function and rotavirus pathogenesis, further distinguishing this viral virulence factor from other microbial enterotoxins. PMID:18587047

  8. Preparation and properties of (R)-(-)-1-azabicyclo(2. 2. 2)oct-3-yl- (R)-(+)-alpha-hydroxy-alpha-(4-( sup 125 I)iodophenyl)-alpha-phenyl acetate and (R)-(-)-1-azabicyclo(2. 2. 2)oct-3-yl-(S)-(-)-alpha-hydroxy-alpha- (4-( sup 125 I)iodophenyl)-alpha-phenyl acetate as potential radiopharmaceuticals

    SciTech Connect

    Cohen, V.I.; Rzeszotarski, W.J.; Gibson, R.E.; Fan, L.H.; Reba, R.C. )


    rac-4-Nitrobenzilic acid was synthesized and resolved with quinidine and quinine to give the corresponding (R)- and (S)-salts. The resolved diastereomeric salts were converted to (R)- and (S)-4-nitrobenzilic acids and subsequent esterification gave their corresponding ethyl esters. Transesterification with (R)-(-)-3-quinuclidinol afforded (R)-(-)-1-azabicyclo(2.2.2)oct-3-yl-(R)-(+)-alpha-hydroxy-alpha- (4-nitrophenyl)-alpha-phenyl acetate and (R)-(-)-1-azabicyclo(2.2.2)oct-3-yl-(S)-(-)-alpha-hydroxy- alpha-(4-nitrophenyl)-alpha-phenyl acetate. After hydrogenation, the (R,R)- and (R,S)-amines were converted to the respective triazene derivatives. The triazene derivatives reacted with sodium ({sup 125}I)iodide to give (R)-(-)-1-azabicyclo(2.2.2)oct-3-yl-(R)-(+)- alpha-hydroxy-alpha-(4-({sup 125}I)iodophenyl)-alpha-phenyl acetate and (R)-(-)-1-azabicyclo(2.2.2)oct-3-yl-(S)-(-)-alpha-hydroxy- alpha-(4-(125I)iodophenyl)-alpha-phenyl acetate. The evaluation of their affinities to muscarinic acetylcholine receptors (MAcChR) shows that (R)-(-)-1-azabicyclo(2.2.2)oct-3-yl-(S)-(-)-alpha-hydroxy-alpha-(4- ({sup 125}I)iodophenyl)-alpha-phenyl acetate exhibits an affinity for the MAcChR from corpus striatum that is approximately threefold lower than that of (R)-(-)-1-azabicyclo(2.2.2)oct-3-yl-(R)-(+)-alpha-hydroxy-alpha-(4- ({sup 125}I)iodophenyl)-alpha-phenyl acetate.

  9. Modular organization and development activity of an Arabidopsis thaliana EF-1 alpha gene promoter.


    Curie, C; Axelos, M; Bardet, C; Atanassova, R; Chaubet, N; Lescure, B


    The activity of the Arabidopsis thalana A1 EF-1 alpha gene promoter was analyzed in transgenic Arabidopsis plants. The 5' upstream sequence of the A1 gene and several promoter deletions were fused to the beta-glucuronidase (GUS) coding region. Promoter activity was monitored by quantitative and histochemical assays of GUS activity. The results show that the A1 promoter exhibits a modular organization. Sequences both upstream and downstream relative to the transcription initiation site are involved in quantitative and tissue-specific expression during vegetative growth. One upstream element may be involved in the activation of expression in meristematic tissues; the downstream region, corresponding to an intron within the 5' non-coding region (5'IVS), is important for expression in roots; both upstream and downstream sequences are required for expression in leaves, suggesting combinatorial properties of EF-1 alpha cis-regulatory elements. This notion of specific combinatorial regulation is reinforced by the results of transient expression experiments in transfected Arabidopsis protoplasts. The deletion of the 5'IVS has much more effect on expression when the promoter activity is under the control of A1 EF-1 alpha upstream sequences than when these upstream sequences were replaced by the 35S enhancer. Similarly, a synthetic oligonucleotide corresponding to an A1 EF-1 alpha upstream cis-acting element (the TEF1 box), is able to restore partially the original activity when fused to a TEF1-less EF1-alpha promoter but has no significant effect when fused to an enhancer-less 35S promoter. PMID:8492811

  10. Coronae of Stars with Supersolar Elemental Abundances

    NASA Technical Reports Server (NTRS)

    Peretz, Uria; Behar, Ehud; Drake, Stephen A.


    Coronal elemental abundances are known to deviate from the photospheric values of their parent star, with the degree of deviation depending on the first ionization potential (FIP). This study focuses on the coronal composition of stars with supersolar photospheric abundances. We present the coronal abundances of six such stars: 11 LMi, iota Hor, HR 7291, tau Boo, and alpha Cen A and B. These stars all have high-statistics X-ray spectra, three of which are presented for the first time. The abundances we measured were obtained using the line-resolved spectra of the Reflection Grating Spectrometer (RGS) in conjunction with the higher throughput EPIC-pn camera spectra onboard the XMM-Newton observatory. A collisionally ionized plasma model with two or three temperature components is found to represent the spectra well. All elements are found to be consistently depleted in the coronae compared to their respective photospheres. For 11 LMi and tau Boo no FIP effect is present, while iota Hor, HR 7291, and alpha Cen A and B show a clear FIP trend. These conclusions hold whether the comparison is made with solar abundances or the individual stellar abundances. Unlike the solar corona, where low-FIP elements are enriched, in these stars the FIP effect is consistently due to a depletion of high-FIP elements with respect to actual photospheric abundances. A comparison with solar (instead of stellar) abundances yields the same fractionation trend as on the Sun. In both cases, a similar FIP bias is inferred, but different fractionation mechanisms need to be invoked.

  11. Alpha-dispersion in human tissue

    NASA Astrophysics Data System (ADS)

    Grimnes, Sverre; Martinsen, Ørjan G.


    Beta dispersion is found in living tissue in the kilohertz - megahertz range and is caused by the cellular structure of biological materials with low frequency properties caused by cell membranes. Alpha dispersion is found in the hertz range and the causes are not so well known. Alpha dispersions are the first to disappear when tissue dies. Tissue data have often been based upon excised specimen from animals and are therefore not necessarily representative for human tissue alpha dispersions. Here we present data obtained with non-invasive skin surface electrodes for different segments of the living human body. We found alpha dispersions in all cases; the ankle-wrist results had the smallest. Large alpha dispersions were found where the distance between the electrodes and muscle masses was small, e.g. on the calf. Further studies on electrode technique and reciprocity, electrode positioning, statistical variations, gender, age and bodily constitutions are necessary in order to reveal more about the alpha dispersion, its appearance and disappearance.

  12. Alpha particle analysis using PEARLS spectrometry

    SciTech Connect

    McKlveen, J.W.; Klingler, G.W.; McDowell, W.J.; Case, G.N.


    Alpha particle assay by conventional plate-counting methods is difficult because chemical separation, tracer techniques, and/or self-absorption losses in the final sample may cause either non-reproducible results or create unacceptable errors. PEARLS (Photon-Electron Rejecting Alpha Liquid Scintillation) Spectrometry is an attractive alternative since radionuclides may be extracted into a scintillator in which there would be no self-absorption or geometry problems and in which up to 100% chemical recovery and counting efficiency is possible. Sample preparation may include extraction of the alpha emitter of interest by a specific organic-phase-soluble compound directly into the liquid scintillator. Detection electronics use energy and pulse-shape discrimination to provide discrete alpha spectra and virtual absence of beta and gamma backgrounds. Backgrounds on the order of 0.01 cpm are readily achievable. Accuracy and reproducibility are typically in the 100 +-1% range. Specific procedures have been developed for gross alpha, uranium, plutonium, thorium, and polonium assay. This paper will review liquid scintillation alpha counting methods and reference some of the specific applications. 8 refs., 1 fig.

  13. [Alpha-1 antitrypsin deficiency: diagnosis and treatment].


    Camelier, Aquiles A; Winter, Daniel Hugo; Jardim, José Roberto; Barboza, Carlos Eduardo Galvão; Cukier, Alberto; Miravitlles, Marc


    Alpha-1 antitrypsin deficiency is a recently identified genetic disease that occurs almost as frequently as cystic fibrosis. It is caused by various mutations in the SERPINA1 gene, and has numerous clinical implications. Alpha-1 antitrypsin is mainly produced in the liver and acts as an antiprotease. Its principal function is to inactivate neutrophil elastase, preventing tissue damage. The mutation most commonly associated with the clinical disease is the Z allele, which causes polymerization and accumulation within hepatocytes. The accumulation of and the consequent reduction in the serum levels of alpha-1 antitrypsin cause, respectively, liver and lung disease, the latter occurring mainly as early emphysema, predominantly in the lung bases. Diagnosis involves detection of low serum levels of alpha-1 antitrypsin as well as phenotypic confirmation. In addition to the standard treatment of chronic obstructive pulmonary disease, specific therapy consisting of infusion of purified alpha-1 antitrypsin is currently available. The clinical efficacy of this therapy, which appears to be safe, has yet to be definitively established, and its cost-effectiveness is also a controversial issue that is rarely addressed. Despite its importance, in Brazil, there are no epidemiological data on the prevalence of the disease or the frequency of occurrence of deficiency alleles. Underdiagnosis has also been a significant limitation to the study of the disease as well as to appropriate treatment of patients. It is hoped that the creation of the Alpha One International Registry will resolve these and other important issues. PMID:18695797

  14. Methods for the synthesis and polymerization of .alpha.,.alpha.'-dihalo-p-xylenes


    Ferraris, John P.; Neef, Charles J.


    The present invention describes an improved method for the polymerization of .alpha.,.alpha.-dihalo-p-xylene's such as the .alpha.,.alpha.'-dihalo-2-methoxy-5-(2-ethylhexyloxy)-xylene's. The procedure for synthesis is based on the specific order of addition of reagents and the use of an anionic initiator that allows control of the molecular weight of the polymer. The molecular weight control allows processability of the polymer which is important for its utility in applications including in light-emitting-diodes, field effect transistors and photovoltaic devices.

  15. Alpha-particle scattering from sup 6 Li near the. alpha. - d breakup threshold

    SciTech Connect

    Samanta, C.; Ghosh, S.; Lahiri, M. ); Ray, S. ); Banerjee, S.R. )


    The {sup 6}Li({alpha},{alpha}{prime}) reaction was studied at {ital E}{sub {alpha}}=50 MeV. The angular distribution of the continuum region near the {sup 6}Li{r arrow}{alpha}+{ital d} breakup threshold (1.475 MeV) was measured for {theta}{sub lab}=7{degree}--40{degree}. The data were analyzed in terms of plane-wave and distorted-wave impulse approximation calculations. To study the possible effects of recombination of the breakup clusters in the exit channel, distorted-wave Born approximation calculations were also performed.

  16. Contribution from 3 alpha-Condensed States to the Triple-Alpha Reaction

    SciTech Connect

    Kato, Kiyoshi; Kurokawa, Chie; Arai, Koji


    The alpha-condensed state in nuclear systems has been proposed by Tohsaki et al. and has given rise to interesting discussions. The Hoyle state of {sup 12}C has been studied as the most typical example of such an alpha-condensed state. A new resonant 0{sub 3}{sup +} state (E{sub r} = 1.66 MeV, GAMMA = 1.48 MeV) is predicted as an excited alpha-condensed state in addition to the second 0{sup +} state of the Hoyle state by calculations of the 3 alpha orthogonality condition model (3 alpha OCM) using the complex scaling method. Based on this result, the breakup strengths of the inversion reaction for sequential ({sup 8}Be+alpha->{sup 12}C+gamma) and direct (alpha+alpha+alpha->{sup 12}C+gamma) processes are calculated. It is discussed that a large reaction strength calculated recently by Ogata et al. in non-resonant energies is considered as a contribution from the excited 0{sub 3}{sup +} state.

  17. Abnormality of glycophorin-alpha on paroxysmal nocturnal hemoglobinuria erythrocytes.

    PubMed Central

    Parker, C J; Soldato, C M; Rosse, W F


    To investigate the greater enzymatic activity of the alternative pathway convertase (and the subsequent greater fixation of C3b) on paroxysmal nocturnal hemoglobinuria (PNH) erythrocytes, we have examined the topography of binding of C3b to PNH and normal erythrocytes. Using sodium dodecyl sulfate-polyacrylamide gel electrophoresis and autoradiography, the alpha-chain of C3b was found to bind via predominantly ester bonds to free hydroxyl groups on glycophorin-alpha, the major erythrocyte sialoglycoprotein. The pattern of binding of nascent C3b was the same for normal and PNH erythrocytes. Thus, although C3b binding to a different membrane constituent did not appear to account for the greater enzymatic activity of the alternative pathway convertase when affixed to PNH erythrocytes, it seemed possible that the glycoproteins to which C3b bound might be qualitatively abnormal on the PNH cells, and that structural differences in these molecules might impose modifications in the enzyme-substrate interactions of the alternative pathway convertase. Using methods for radiolabeling both protein and carbohydrate residues, we therefore compared the electrophoretic pattern of the cell-surface glycoproteins on PNH and normal erythrocytes. The glycophorin-alpha dimer was found to be qualitatively abnormal on the PNH cells as evidenced by its greater susceptibility to trypsin-mediated proteolysis. In addition, the abnormal erythrocytes from patients with PNH had fewer periodate oxidizable constituents than did normal erythrocytes, indicating a relative deficiency of cell-surface sialic acid. These investigations suggest that abnormalities in membrane glycoproteins may underlie the aberrant interactions of complement with the hematopoietic elements of PNH. Images PMID:6231312

  18. Hormonal induction and antihormonal inhibition of tracheary element differentiation in Zinnia cell cultures

    NASA Technical Reports Server (NTRS)

    Church, D. L.; Galston, A. W.


    Mechanically isolated mesophyll cells of Zinnia elegans L. cv Envy differentiate to tracheary elements when cultured in inductive medium containing sufficient auxin and cytokinin. Tracheary element differentiation was induced by the three auxins (alpha-naphthaleneacetic acid, indole-3-acetic acid, and 2,4-dichlorophenoxyacetic acid) and four cytokinins (6-benzyladenine, kinetin, 2-isopentenyladenine and zeatin) tested. Tracheary element formation is inhibited or delayed if the inductive medium is supplemented with an anticytokinin, antiauxin, or inhibitor of auxin transport.

  19. Meperidine, remifentanil and tramadol but not sufentanil interact with alpha(2)-adrenoceptors in alpha(2A)-, alpha(2B)- and alpha(2C)-adrenoceptor knock out mice brain.


    Höcker, Jan; Weber, Bernd; Tonner, Peter H; Scholz, Jens; Brand, Philipp-Alexander; Ohnesorge, Henning; Bein, Berthold


    alpha(2)-adrenoceptor agonists like clonidine or dexmedetomidine increase the sedative and analgesic actions of opioids. Furthermore opioids like meperidine show potent anti-shivering effects like alpha(2)-adrenoceptor agonists. The underlying molecular mechanisms of these effects are still poorly defined. The authors therefore studied the ability of four different opioids (meperidine, remifentanil, sufentanil and tramadol) to interact with different alpha(2)-adrenoceptor subtypes in mice lacking individual alpha(2A)-, alpha(2B)- or alpha(2C)-adrenoceptors (alpha(2)-adrenoceptor knock out (alpha(2)-AR KO) mice)). The interaction of opioids with alpha(2)-adrenoceptors was investigated by quantitative receptor autoradiography in brain slices of alpha(2A)-, alpha(2B)- or alpha(2C)-adrenoceptor deficient mice. Displacement of the radiolabelled alpha(2)-adrenoceptor agonist [(125)I]-paraiodoclonidine ([(125)I]-PIC) from alpha(2)-adrenoceptors in different brain regions by increasing opioid concentrations was measured, and binding affinity of the analysed opioids to alpha(2)-adrenoceptor subtypes in different brain regions was quantified. Meperidine, remifentanil and tramadol but not sufentanil provoked dose dependent displacement of specifically bound [(125)I]-PIC from all alpha(2)-adrenoceptor subtypes in cortex, cerebellum, medulla oblongata, thalamus, hippocampus and pons. Required concentrations of meperidine and remifentanil for [(125)I]-PIC displacement from alpha(2B)- and alpha(2C)-adrenoceptors were lower than from alpha(2A)-adrenoceptors, indicating higher binding affinity for alpha(2B)- and alpha(2C)-adrenoceptors. In contrast, [(125)I]-PIC displacement by tramadol indicated higher binding affinity to alpha(2A)-adrenoceptors than to alpha(2B)- and alpha(2C)-adrenoceptors. Our results indicate that meperidine, remifentanil and tramadol interact with alpha(2)-adrenoceptors in mouse brain showing different affinity for alpha(2A)-, alpha(2B)- and alpha(2C

  20. Alpha-CENTAURI: assessing novel centromeric repeat sequence variation with long read sequencing

    PubMed Central

    Sevim, Volkan; Bashir, Ali; Chin, Chen-Shan; Miga, Karen H.


    Motivation: Long arrays of near-identical tandem repeats are a common feature of centromeric and subtelomeric regions in complex genomes. These sequences present a source of repeat structure diversity that is commonly ignored by standard genomic tools. Unlike reads shorter than the underlying repeat structure that rely on indirect inference methods, e.g. assembly, long reads allow direct inference of satellite higher order repeat structure. To automate characterization of local centromeric tandem repeat sequence variation we have designed Alpha-CENTAURI (ALPHA satellite CENTromeric AUtomated Repeat Identification), that takes advantage of Pacific Bioscience long-reads from whole-genome sequencing datasets. By operating on reads prior to assembly, our approach provides a more comprehensive set of repeat-structure variants and is not impacted by rearrangements or sequence underrepresentation due to misassembly. Results: We demonstrate the utility of Alpha-CENTAURI in characterizing repeat structure for alpha satellite containing reads in the hydatidiform mole (CHM1, haploid-like) genome. The pipeline is designed to report local repeat organization summaries for each read, thereby monitoring rearrangements in repeat units, shifts in repeat orientation and sites of array transition into non-satellite DNA, typically defined by transposable element insertion. We validate the method by showing consistency with existing centromere high order repeat references. Alpha-CENTAURI can, in principle, run on any sequence data, offering a method to generate a sequence repeat resolution that could be readily performed using consensus sequences available for other satellite families in genomes without high-quality reference assemblies. Availability and implementation: Documentation and source code for Alpha-CENTAURI are freely available at Contact: Supplementary information: Supplementary data are available at

  1. Sample pretreatment in the determination of specific alpha emitters in drinking water using [Ba+Fe]-coprecipitation method.


    Suarez-Navarro, J A; Pujol, Ll; Suarez-Navarro, M J


    The [Ba+Fe]-coprecipitation method is applied to measure gross alpha activity for radiological examination of drinking water in the laboratory. This method collects all the alpha-emitting radionuclides of interest (natural alpha emitters and transuranium elements) in a precipitate on a filter. This paper describes an investigation of sample pretreatment of the precipitate collected by the [Ba+Fe]-coprecipitation method for gross alpha activity determination. The aim of this preliminary work is to be a starting point to develop simple and rapid radiochemical procedures for specific alpha emitters (polonium, radium, thorium, uranium, plutonium and americium), in contrast to the sophisticated, expensive and time-consuming alpha spectrometry method. The sample pretreatment aspects considered include quantitative [Ba+Fe]-coprecipitation, two methods for precipitate treatment (leaching and complete destruction of the filter), and the determination of the alpha-emitting proportions present in the barium sulfate precipitate and acid solution obtained after precipitate treatment. Furthermore, a radiochemical procedure for (226)Ra determination was performed and finally, the sample pretreatment proposed in this work was summarized. PMID:25474768

  2. Superheavy Element Nuclear Chemistry at RIKEN

    SciTech Connect

    Haba, Hiromitsu; Kaji, Daiya; Kasamatsu, Yoshitaka; Kudou, Yuki; Morimoto, Kouji; Morita, Kosuke; Ozeki, Kazutaka; Yoneda, Akira; Kikunaga, Hidetoshi; Komori, Yukiko; Ooe, Kazuhiro; Shinohara, Atsushi; Yoshimura, Takashi; Sato, Nozomi; Toyoshima, Atsushi; Yokoyama, Akihiko


    A gas-jet transport system has been coupled to the RIKEN gas-filled recoil ion separator GARIS to startup superheavy element (SHE) chemistry at RIKEN. The performance of the system was appraised using an isotope of element 104, {sup 261}Rf, produced in the {sup 248}Cm({sup 18}O,5n){sup 261}Rf reaction. Alpha-particles of {sup 261}Rf separated with GARIS and extracted to a chemistry laboratory were successfully identified with a rotating wheel apparatus for alpha spectrometry. The setting parameters such as the magnetic field of the separator and the gas-jet conditions were optimized. The present results suggest that the GARIS/gas-jet system is a promising approach for exploring new frontiers in SHE chemistry: (i) the background radioactivities of unwanted reaction products are strongly suppressed, (ii) the intense beam is absent in the gas-jet chamber and hence high gas-jet efficiency is achieved, and (iii) the beam-free condition also allows for investigations of new chemical systems.

  3. AP-2{alpha} suppresses skeletal myoblast proliferation and represses fibroblast growth factor receptor 1 promoter activity

    SciTech Connect

    Mitchell, Darrion L.; DiMario, Joseph X.


    Skeletal muscle development is partly characterized by myoblast proliferation and subsequent differentiation into postmitotic muscle fibers. Developmental regulation of expression of the fibroblast growth factor receptor 1 (FGFR1) gene is required for normal myoblast proliferation and muscle formation. As a result, FGFR1 promoter activity is controlled by multiple transcriptional regulatory proteins during both proliferation and differentiation of myogenic cells. The transcription factor AP-2{alpha} is present in nuclei of skeletal muscle cells and suppresses myoblast proliferation in vitro. Since FGFR1 gene expression is tightly linked to myoblast proliferation versus differentiation, the FGFR1 promoter was examined for candidate AP-2{alpha} binding sites. Mutagenesis studies indicated that a candidate binding site located at - 1035 bp functioned as a repressor cis-regulatory element. Furthermore, mutation of this site alleviated AP-2{alpha}-mediated repression of FGFR1 promoter activity. Chromatin immunoprecipitation studies demonstrated that AP-2{alpha} interacted with the FGFR1 promoter in both proliferating myoblasts and differentiated myotubes. In total, these results indicate that AP-2{alpha} is a transcriptional repressor of FGFR1 gene expression during skeletal myogenesis.

  4. Structural organization of the human cardiac [alpha]-myosin heavy chain gene (MYH6)

    SciTech Connect

    Epp, T.A.; Dixon, I.M.C.; Wang, H.Y.; Sole, M.J.; Liew, C.C. )


    The human myocardium expresses two cardiac myosin heavy chain (MyHC) isoforms, [alpha] and [beta], that exist in tandem array on chromosome 14q12. The authors have previously sequenced the entire human cardiac [beta]-MyHC gene and now report the complete nucleotide sequence of the human cardiac [alpha]-MyHC, encompassing 26,159 bp as well as the entire 4484-bp 5'-flanking intergenic region. The gene (MYH6) consists of 39 exons, 37 of which contain coding information. The 5'-untranslated region is split into 3 exons, with the third exon containing the AUG translocation initiation codon. With the exception of the 13th intron of the human cardiac [beta]-MyHC, which is not present within the [alpha]-isogene, all exon/intron boundaries are conserved. Conspicuous sequence motifs contained within the [alpha]-MyHC gene include four Alu repeats, a single (GT)[sub n] element, and a homopurine-homopyrimidine tract containing 23 GAA repeating units followed by 10 GAG repeating units. Comparison of the encoded amino acid sequence with a previously reported human [alpha]-MyHC cDNA sequence reveals several potential polymorphisms. 29 refs., 1 fig., 1 tab.

  5. Fibronectin receptor functions in embryonic cells deficient in alpha 5 beta 1 integrin can be replaced by alpha V integrins.

    PubMed Central

    Yang, J T; Hynes, R O


    alpha 5 beta 1 integrin mediates cell adhesion to extracellular matrix by interacting with fibronectin (FN). Mouse lines carrying null mutations in genes encoding either the alpha 5 integrin subunit or FN have been generated previously. Both mutations are embryonic lethal with overlapping defects, but the defects of alpha 5-null embryos are less severe. Primary embryonic cells lacking alpha 5 beta 1 are able to adhere to FN, form focal contacts, migrate on FN, and assemble FN matrix. These results suggest the involvement of (an)other FN receptors(s). In this study, we examined functions of alpha 4 beta 1 and alpha V integrins in embryonic cells lacking alpha 5 beta 1. Our analysis of cells lacking both alpha 4 beta 1 and alpha 5 beta 1 showed that alpha 4 beta 1 is also not required for these FN-dependent functions. Using alpha V-specific blocking reagents, we showed that alpha V integrins are required for alpha 5-null cells, but not wild-type cells, to adhere and spread on FN. Our data also showed that, although the expression levels of alpha V integrins on the wild-type and alpha 5-null cells are similar, there is an increase in recruitment of alpha V integrins into focal contacts in alpha 5-null cells plated on FN, indicating that alpha V integrins can compensate functionally for the loss of alpha 5 beta 1 in focal contacts of alpha 5-null cells. Finally, our data suggested possible roles for alpha V integrins in replacing the role of alpha 5 beta 1 in FN matrix assembly in vitro and in FN-dependent embryonic functions in vivo. Images PMID:8930896

  6. alpha-Thalassaemia in Tunisia: some epidemiological and molecular data.


    Siala, H; Ouali, F; Messaoud, T; Bibi, A; Fattoum, S


    Unlike the other haemoglobinopathies, few researches have been published concerning alpha-thalassaemia in Tunisia. The aim of the present work is to acquire further data concerning alpha-thalassaemia prevalence and molecular defects spectrum in Tunisia, by collecting and studying several kinds of samples carrying alpha-thalassaemia. The first survey conducted on 529 cord blood samples using cellulose acetate electrophoresis, have displayed the prevalence of 7.38% Hb Bart's carriers at birth. Molecular analyses were conducted by PCR and DNA sequencing on 20 families' cases from the above survey carrying the Hb Bart's at birth and on 10 Hb H diseased patients. The results showed six alpha-globin gene molecular defects and were responsible for alpha-thalassaemia: -alpha(3.7), - -(MedI), alpha(TSaudi), alpha(2)(cd23GAG->Stop), Hb Greone Hart: alpha(1)(119CCT->TCT) corresponding to 11 genotypes out of which two are responsible for Hb H disease (- -(Med)/-alpha(3.7)) and (alpha(TSaudi)alpha/alpha(TSaudi)alpha) and a newly described polymorphism: alpha+6C->G. The geographical repartition of alpha-thal carriers showed that the -alpha3.7 deletion is distributed all over the country, respectively the alpha(HphI) and alpha(TSaudi) seem to be more frequent in the central region of the northeast region. The haematological and clinical data showed a moderate phenotype with a late age of diagnosis for Hb H disease. This work had permitted, in addition to an overview on alpha-thalassaemia in the country, the optimization of protocols for alpha-thalassaemia detection in our lab, allowing further investigations concerning phenotype-genotype correlation in sickle cell disease or beta-thalassaemia. PMID:19147907

  7. Alpha-emitting nuclides in the marine environment

    NASA Astrophysics Data System (ADS)

    Pentreath, R. J.


    The occurrence of alpha-emitting nuclides and their daughter products in the marine environment continues to be a subject of study for many reasons. Those nuclides which occur naturally, in the uranium, thorium and actinium series, are of interest because of their value in determining the rates of geological and geochemical processes in the oceans. Studies of them address such problems as the determination of rates of transfer of particulate matter, deposition rates, bioturbation rates, and so on. Two of the natural alpha-series nuclides in which a different interest has been expressed are 210Po and 226Ra, because their concentrations in marine organisms are such that they contribute to a significant fraction of the background dose rates sustained both by the organisms themselves and by consumers of marine fish and shellfish. To this pool of naturally-occurring nuclides, human activities have added the transuranium nuclides, both from the atmospheric testing of nuclear devices and from the authorized discharges of radioactive wastes into coastal waters and the deep sea. Studies have therefore been made to understand the chemistry of these radionuclides in sea water, their association with sedimentary materials, and their accumulation by marine organisms, the last of these being of particular interest because the transuranics are essentially "novel" elements to the marine fauna and flora. The need to predict the long-term behaviour of these nuclides has, in turn, stimulated research on those naturally-occurring nuclides which may behave in a similar manner.

  8. Development of Flight Slit-Jaw Optics for Chromospheric Lyman-Alpha SpectroPolarimeter

    NASA Technical Reports Server (NTRS)

    Kubo, Masahito; Suematsu, Yoshinori; Kano, Ryohei; Bando, Takamasa; Hara, Hirohisa; Narukage, Noriyuki; Katsukawa, Yukio; Ishikawa, Ryoko; Ishikawa, Shin-nosuke; Kobiki, Toshihiko; Tsuneta, Saku; Kobayashi, Ken; Winebarger, Amy; Takeyama, Norihide; Kanai, Yoshikazu; Sakakibara, Yoshiko


    In sounding rocket experiment CLASP, I have placed a slit a mirror-finished around the focal point of the telescope. The light reflected by the mirror surface surrounding the slit is then imaged in Slit-jaw optical system, to obtain the alpha-ray Lyman secondary image. This image, not only to use the real-time image in rocket flight rocket oriented direction selection, and also used as a scientific data showing the spatial structure of the Lyman alpha emission line intensity distribution and solar chromosphere around the observation area of the polarimetric spectroscope. Slit-jaw optical system is a two off-axis mirror unit part including a parabolic mirror and folding mirror, Lyman alpha transmission filter, the optical system magnification 1x consisting camera. The camera is supplied from the United States, and the other was carried out fabrication and testing in all the Japanese side. Slit-jaw optical system, it is difficult to access the structure, it is necessary to install the low place clearance. Therefore, influence the optical performance, the fine adjustment is necessary optical elements are collectively in the form of the mirror unit. On the other hand, due to the alignment of the solar sensor in the US launch site, must be removed once the Lyman alpha transmission filter holder including a filter has a different part from the mirror unit. In order to make the structure simple, stray light measures Aru to concentrate around Lyman alpha transmission filter. To overcome the difficulties of performing optical alignment in Lyman alpha wavelength absorbed by the atmosphere, it was planned following four steps in order to reduce standing time alignment me. 1: is measured in advance refractive index at Lyman alpha wavelength of Lyman alpha transmission filter (121.567nm), to prepare a visible light Firuwo having the same optical path length in the visible light (630nm). 2: The mirror structure CLASP before mounting unit standing, dummy slit and camera standing

  9. Inhibition of DNA topoisomerase II alpha gene expression by the p53 tumor suppressor.

    PubMed Central

    Wang, Q; Zambetti, G P; Suttle, D P


    DNA topoisomerase II (topo II) is an essential nuclear enzyme involved in major cellular functions such as DNA replication, transcription, recombination, and mitosis. While an elevated level of topo II alpha is associated with cell proliferation, wild-type (wt) p53 inhibits the expression of various growth-stimulatory genes. To determine if p53 downregulates topo II alpha gene expression, a murine cell line, (10)1val, that expresses a temperature-sensitive p53 was utilized. The (10)1val cells had significantly lower levels of topo II alpha mRNA and protein following incubation for 24 h at 32 degrees C (p53 with wt conformation) than at 39 degrees C (p53 with mutant conformation). The effect of p53 on the human topo II alpha gene promoter was determined by using luciferase reporter plasmids containing varying lengths of the topo II alpha promoter transiently cotransfected into p53-deficient (10)1 cells together with wt or mutant p53 expression plasmids. Transcription from the full-length (bp -557 to +90) topo II alpha promoter was decreased 15-fold by wt p53 in a concentration-dependent manner, whereas mutant p53 exerted much weaker inhibition. Consecutive deletion of the five inverted CCAAT elements (ICEs) from the topo II alpha promoter reduced both the basal promoter activity and wt p53-induced suppression. Transcription of the minimal promoter (-32 to +90), which contains no ICE, was slightly stimulated by wt or mutant p53 expression. When point mutations were introduced into the most proximal ICE (-68), the inhibitory effect of wt p53 was alleviated and stimulation of topo II alpha expression resulted. Our study suggests that wt p53 functions as a transcriptional repressor of topo II alpha gene expression, possibly through a functional interaction with specific ICEs. Inactivation of wt p53 may reduce normal regulatory suppression of topo II alpha and contribute to abortive cell cycle checkpoints, accelerated cell proliferation, and alterations in genomic

  10. A Method for Maximizing the Internal Consistency Coefficient Alpha.

    ERIC Educational Resources Information Center

    Pepin, Michel

    This paper presents three different ways of computing the internal consistency coefficient alpha for a same set of data. The main objective of the paper is the illustration of a method for maximizing coefficient alpha. The maximization of alpha can be achieved with the aid of a principal component analysis. The relation between alpha max. and the…

  11. Alpha Com eclipse observing campaign

    NASA Astrophysics Data System (ADS)

    Waagen, Elizabeth O.


    Drs. Matthew W. Muterspaugh and Gregory W. Henry (Tennessee State University) have requested AAVSO observers' ssistance in monitoring the possible Algol-like binary star alpha Com before, during, and after the eclipse they have predicted for mid-to-late January 2015. The PIs will be using the Fairborn Observatory automated photometric telescopes on Mt. Hopkins, but they are requesting additional observations not only to supplement theirs but also specifically to have good coverage in the event of bad weather at Mt. Hopkins. Alf Com has a 26-year period and is 4.32V at maximum. The expected amplitude of the eclipse is about 0.8 magnitude and the duration somewhere between 28 and 45 hours. The eclipse is predicted for January 25 ± three days (JD 2457047 ± 3). Muterspaugh at al. first calculated the possibility of a 2015 eclipse in 2010 (AJ). Muterspaugh and Henry recently published an article with updated information (arXiv 2014). V and/or R photometry (other bands welcome) is requested, with a minimal cadence of one measurement/2 hours, to make sure the eclipse is caught right as it begins and to ensure having multiple data points on any unseen objects that might eclipse as well. During eclipse, continuous observations are important. Infrared (H-band) observations could be interesting, should the CHARA array image the event. The precision photometry in the weeks before and after the eclipse is requested in order to catch possible evidence for planets or other materials around the eclipsing star. Updated astrometry from the current epoch would greatly improve the eclipse preductions. Charts with comparison star sequence for alf Com may be created using the AAVSO Variable Star Plotter ( The PIs recommend using the comparison stars HD 113848 (39 Com, HR 4946, HIP 63948, V=5.990, B-V=0.39, F4V) and HD 114520 (HIP 64312, V=6.820, B-V=0.46,F2II). Observations should be submitted to the AAVSO International Database. See AAVSO Alert Notice 506

  12. In vitro anti-inflammatory activities of new steroidal antedrugs: [16alpha,17alpha-d] Isoxazoline and [16alpha,17alpha-d]-3'-hydroxy-iminoformyl isoxazoline derivatives of prednisolone and 9alpha-fluoroprednisolone.


    Park, Kwan-K; Ko, Dong-H; You, Z; Khan, M Omar F; Lee, Henry J


    A series of new anti-inflammatory steroidal antedrugs with C-16,17-isoxazoline ring system were synthesized and their pharmacological activities were evaluated. We reported earlier that these compounds are promising antedrugs based on the results of 5-day rat croton oil ear edema assay. In the present study, most of these compounds showed high binding affinities to the glucocorticoid receptor of liver cytosol. 21-acetyloxy-9alpha-fluoro-11beta-hydroxy-3,20-dioxo-1,4-pregnadieno [16alpha,17alpha-d] isoxazoline (FP-ISO-21AC) and 11beta,21-dihydroxy-9alpha-fluoro-3,20-dioxo-1,4-pregnadieno [16alpha,17alpha-d] isoxazoline (FP-ISO-21OH) were found 5.0-, 5.3-fold more potent than prednisolone, respectively. Inhibitory effects of the antedrugs on the nitric oxide (NO) production were assessed using LPS-stimulated RAW 264.7 murine macrophage cells. All these steroidal antedrugs exhibited concentration-dependent inhibition of NO production, but their relative potencies were lower than prednisolone. In vitro metabolism study in rat plasma showed that FP-ISO-21AC and 21-acetyloxy-9alpha-fluoro-11beta-hydroxy-3,20-dioxo-1,4-pregnadieno [16alpha,17alpha-d]-3'-hydroxyiminoformyl isoxazoline (FP-OXIM-21AC) were hydrolyzed rapidly, with the half-lives of 2.1 and 4.2 min, respectively. The half-lives of FP-ISO-21OH and 11beta,21-dihydroxy-9alpha-fluoro-3,20-dioxo-1,4-pregnadieno [16alpha,17alpha-d]-3'-hydroxyiminoformyl isoxazoline (FP-OXIM-21OH) were 92.2 and 110.2 min, respectively. PMID:16309722

  13. Novel intronic promoter in the rat ER alpha gene responsible for the transient transcription of a variant receptor.


    Tiffoche, C; Vaillant, C; Schausi, D; Thieulant, M L


    To analyze the molecular origin of an ER variant, the truncated ER product-1, transiently expressed at the proestrus in lactotrope cells, we generated a 2.5-kb sequence of a genomic region upstream and downstream the specific sequence truncated ER product-1. Genomic Southern blot analysis showed that truncated ER product-1 is spliced from a noncoding leader exon localized within the intron 4 of the ER alpha gene. Analysis of the promoter sequence revealed the presence of a major transcriptional start site, a canonical TATA box and putative cis regulatory elements for pituitary specific expression as well as an E-responsive element. In transient transfection, the truncated ER product-1 promoter was transcriptionally the most active in the lactotrope cell lines (MMQ). Analysis of truncated ER product-1 functionality showed that: 1) the protein inhibited ER alpha binding to the E-responsive element in electromobility shift assays, 2) inhibited the E2 binding to ER alpha in binding assays, 3) the truncated ER product-1/ER alpha complex antagonized the transcriptional activity elicited by E2, 4) nuclear localization of green fluorescent protein-ER alpha was altered in Chinese hamster ovary cell lines stably expressing truncated ER product-1. Collectively, these data demonstrated that the protein exerts full dominant negative activity against ER alpha. Moreover, truncated ER product-1/ER alpha complex also repressed the activity of all promoters tested to date, suggesting a general inhibitory effect toward transcription. In conclusion, the data suggest that truncated ER product-1 could regulate estrogen signaling via a specific promoter in lactotrope cells. PMID:11517190

  14. Repression of the alpha-fetoprotein gene promoter by progesterone and chimeric receptors in the presence of hormones and antihormones.

    PubMed Central

    Turcotte, B; Meyer, M E; Bocquel, M T; Bélanger, L; Chambon, P


    Using transient transfection assays, we showed that repression of the alpha-fetoprotein promoter by intact and deletion mutants of the progesterone receptor and by chimeric progesterone/glucocorticoid-estrogen receptors in the presence of their cognate hormones was closely correlated with their ability to bind to a progesterone/glucocorticoid-responsive element. This negative regulation was also observed in the presence of antihormones, providing evidence that receptor-antihormone complexes can bind to their responsive elements in vivo. Images PMID:1697036

  15. Catastrophic Failure Modes Assessment of the International Space Station Alpha

    NASA Technical Reports Server (NTRS)

    Lutz, B. E. P.; Goodwin, C. J.


    This report summarizes a series of analyses to quantify the hazardous effects of meteoroid/debris penetration of Space Station Alpha manned module protective structures. These analyses concentrate on determining (a) the critical crack length associated with six manned module pressure wall designs that, if exceeded, would lead to unstopped crack propagation and rupture of manned modules, and (b) the likelihood of crew or station loss following penetration of unsymmetrical di-methyl hydrazine tanks aboard the proposed Russian FGB ('Tug') propulsion module and critical elements aboard the control moment gyro module (SPP-1). Results from these quantified safety analyses are useful in improving specific design areas, thereby reducing the overall likelihood of crew or station loss following orbital debris penetration.

  16. Alpha-keto and alpha-hydroxy branched-chain acid interrelationships in normal humans.


    Hoffer, L J; Taveroff, A; Robitaille, L; Mamer, O A; Reimer, M L


    Plasma concentrations of the branched-chain amino acids leucine, isoleucine and valine, and those of leucine's and isoleucine's transamination products alpha-ketoisocaproic acid (KICA) and alpha-keto-beta-methylvaleric acid (KMVA), respectively, are known to increase after a protein meal or during extended fasting, but little or no increase in the concentration of valine's transamination product, alpha-ketoisovaleric acid (KIVA), has been observed under these conditions. To determine whether this could be explained by the conversion of KIVA to its alpha-hydroxy analogue, we measured the plasma concentrations of KICA, KMVA and KIVA, as well as their alpha-hydroxy analogues [alpha-hydroxyisocaproic acid (HICA), alpha-hydroxy-beta-methylvaleric acid (HMVA) and alpha-hydroxyisovaleric acid (HIVA)], in normal volunteers immediately after a protein meal or during a 60-h fast. We also determined the oxidoreduction equilibrium constants for HIVA/KIVA and HICA/KICA and their extent of plasma protein binding. In subjects in the postabsorptive state, the plasma concentrations of KICA and KMVA were 100 times those of HICA and HMVA, whereas that of KIVA was only twice that of HIVA. Shortly after a protein meal, KICA and KMVA concentrations increased significantly by 30 and 60%, respectively, whereas that of KIVA decreased by 25% (P < 0.05). HICA, HMVA and HIVA concentrations did not change. During prolonged fasting the plasma concentrations of all six metabolites increased gradually. The high plasma keto/hydroxy acid ratios were not related to their K(eq), which favored alpha-hydroxy analogue formation. The reduction of the branched-chain alpha-keto acids to their alpha-hydroxy analogues seems to take place too slowly to attain thermodynamic equilibrium.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8360777

  17. Overview Of Suborbital Human Transportation Concept Alpha

    NASA Astrophysics Data System (ADS)

    Adirim, H.; Pilz, N.; Marini, M.; Hendrick, P.; Schmid, M.; Behr, R.; Barth, T.; Tarfeld, F.; Wiegand, A.; Charbonnier, D.; Haya Ramos, R.; Steeland, J.; Mack, A.


    Within the EC co-funded project FAST20XX (Future high-Altitude high-Speed Transport 20XX), the European suborbital passenger transportation system concept ALPHA (Airplane Launched PHoenix Aircraft), which shall be based to a maximum extent on existing technologies and capabilities, is currently being investigated as collaborative project by a European consortium under coordination of ESA. The ALPHA concept incorporates an air-launch from a carrier aircraft, which shall be used as first stage. The ALPHA vehicle shall be capable of transporting up to four passengers plus one pilot to an altitude of at least 100 km. The ALPHA vehicle is a down-scaled version of the suborbital space transportation concept Hopper, which was already deeply investigated within the European FESTIP System Study and the German ASTRA program including the successfully flown experimental landing demonstrator Phoenix. This approach has allowed the use of existing aerodynamic vehicle data and has led to the adaptation of the external Hopper/Phoenix configuration for ALPHA. In FESTIP and ASTRA, the Hopper configuration showed sufficient stability margins. Due to the geometric similarity of the ALPHA and Hopper vehicles, a trimable and flyable configuration could be derived by means of ALPHA flight trajectory calculations. In its current configuration, the ALPHA vehicle has a length of ca. 9 m and a gross take-off mass of ca. 3.5 Mg. The launch, staging and separation of ALPHA shall be performed either as internal air-launch from the cargo bay of the carrier aircraft, as under-wing air-launch or as towed air-launch. After separation from the carrier aircraft, the ALPHA vehicle ignites its onboard rocket propulsion system. Since conventional liquid and solid propulsion did not seem suitable for ALPHA due to Their high cost, limited safety and toxicity, a low-cost, “green” and non-hazardous hybrid propulsion system based on liquid nitrous oxide in combination with a solid polymer fuel was

  18. Novel ring A stereoisomers of 2-methyl-1alpha,25-dihydroxyvitamin D(3) and 2-methyl-20-epi-1alpha,25-dihydroxyvitamin D(3): transactivation of target genes and modulation of differentiation in human promyelocytic leukemia (HL-60) cells.


    Nakagawa, K; Kurobe, M; Ozono, K; Konno, K; Fujishima, T; Takayama, H; Okano, T


    We evaluated the biological activity of two sets of ring A stereoisomers of 2-methyl-1alpha,25-dihydroxyvitamin D(3) (2-methyl-1alpha,25(OH)(2)D(3)) and 2-methyl-20-epi-1alpha, 25-dihydroxyvitamin D(3) (2-methyl-20-epi-1alpha,25(OH)(2)D(3)) in terms of the following: transactivation of a rat 25-hydroxyvitamin D(3)-24-hydroxylase gene promoter including two vitamin D response elements (VDREs) and a human osteocalcin gene promoter including a VDRE in transfected human osteosarcoma (MG-63) cells; a vitamin D receptor (VDR)-mediated response using a VDR-GAL4 one-hybrid luciferase reporter system and a retinoid X receptor alpha (RXRalpha)-mediated response using an expressed VDR/RXRalpha-GAL4 modified two-hybrid luciferase reporter system in transfected human epitheloid carcinoma, cervix (HeLa) cells; and modulation of cell surface CD11b antigen expression in human leukemia (HL-60) cells. All the diastereomers of both analogues exhibited unique biological activity profiles depending upon the configurations of the C-1 and C-3 hydroxyl groups, the C-2 methyl group in ring A, and the C-20 methyl group in the side chain. Of the eight possible diastereomers of the 2-methyl analogues, 2alpha-methyl-1alpha,25(OH)(2)D(3) was the most potent and exhibited comparable or even greater biological potency than 1alpha,25(OH)(2)D(3). Of the eight possible diastereomers of the 2-methyl-20-epi analogues, 2alpha-methyl-20-epi-1alpha,25(OH)(2)D(3) was the most potent and exhibited 100- to 200-fold higher transcriptional potencies than 1alpha,25(OH)(2)D(3) and exceptionally high cell regulatory activities. 2beta-methyl-20-epi-1alpha,25(OH)(2)D(3) was nearly as potent as its 2-epimer, 2alpha-methyl-20-epi-1alpha,25(OH)(2)D(3), whereas its 20-epimer, 2beta-methyl-1alpha,25(OH)(2)D(3), was almost completely biologically inactive. In these respects, it can be postulated that the double modification of 2-methyl substitution and 20-epimerization to 1alpha,25(OH)(2)D(3) induces remarkable changes

  19. Progress in net shape fabrication of alpha SiC turbine components

    NASA Technical Reports Server (NTRS)

    Storm, R. S.; Naum, R. G.


    The development status of component technology in an automotive gas turbine Ceramic Applications in Turbine Engines program is discussed, with attention to such materials and processes having a low cost, net shape fabrication potential as sintered alpha-SiC that has been fashioned by means of injection molding, slip casting, and isostatic pressing. The gas turbine elements produced include a gasifier turbine rotor, a turbine wheel, a connecting duct, a combustor baffle, and a transition duct.

  20. Strong return of the December alpha-Bootids (IAU#497, DAB)

    NASA Astrophysics Data System (ADS)

    Jenniskens, P.


    The CAMS network detected a stronger than usual return of bright meteors from the compact December alpha-Bootids meteor shower in 2015. The observed activity was spread over three nights. The shower is detected at a weaker level in other years by CAMS and by the SonotaCo network. Orbital elements show a gradual increase in longitude of perihelion with solar longitude from Pi = 12 deg to 25 deg. This behavior is currently not understood.

  1. A chimera-like alpha-amylase inhibitor suggesting the evolution of Phaseolus vulgaris alpha-amylase inhibitor.


    Wato, S; Kamei, K; Arakawa, T; Philo, J S; Wen, J; Hara, S; Yamaguchi, H


    White kidney bean (Phaseolus vulgaris) contains two kinds of alpha-amylase inhibitors, one heat-stable (alpha AI-s) and one heat-labile (alpha AI-u). alpha AI-s has recently been revealed to be a tetrameric complex, alpha(2)beta(2), with two active sites [Kasahara et al. (1996) J. Biochem. 120, 177-183]. The present study was undertaken to reveal the molecular features of alpha AI-u, which is composed of three kinds of subunits, alpha, beta, and gamma. The gamma-subunit, in contrast to the alpha- and beta-subunits that are indistinguishable from the alpha- and beta-subunits of alpha AI-s, was found to correspond to a subunit of an alpha-amylase inhibitor-like protein, which has been identified as an inactive, evolutionary intermediate between arcelin and the alpha-amylase inhibitor in a P. vulgaris defense protein family. The polypeptide molecular weight of alpha AI-u determined by the light-scattering technique, together with the polypeptide molecular weights of the subunits, suggests that alpha AI-u is a trimeric complex, alpha beta gamma. The inhibition of alpha AI-u by increasing amounts of porcine pancreatic alpha-amylase (PPA) indicates that an inactive 1:1 complex is formed between alpha AI-u and PPA. Molecular weight estimation of the complex by the light-scattering technique confirmed that it is a complex of alpha AI-u with one PPA molecule. Thus it seems probable that alpha AI-u is an evolutionary intermediate of the P. vulgaris alpha-amylase inhibitor. PMID:10876168

  2. Identification of a novel bile acid in swans, tree ducks, and geese: 3alpha,7alpha,15alpha-trihydroxy-5beta-cholan-24-oic acid.


    Kakiyama, Genta; Iida, Takashi; Goto, Takaaki; Mano, Nariyasu; Goto, Junichi; Nambara, Toshio; Hagey, Lee R; Schteingart, Claudio D; Hofmann, Alan F


    By HPLC, a taurine-conjugated bile acid with a retention time different from that of taurocholate was found to be present in the bile of the black-necked swan, Cygnus melanocoryphus. The bile acid was isolated and its structure, established by (1)H and (13)C NMR and mass spectrometry, was that of the taurine N-acyl amidate of 3alpha,7alpha,15alpha-trihydroxy-5beta-cholan-24-oic acid. The compound was shown to have chromatographic and spectroscopic properties that were identical to those of the taurine conjugate of authentic 3alpha,7alpha,15alpha-trihydroxy-5beta-cholan-24-oic acid, previously synthesized by us from ursodeoxycholic acid. By HPLC, the taurine conjugate of 3alpha,7alpha,15alpha-trihydroxy-5beta-cholan-24-oic acid was found to be present in 6 of 6 species in the subfamily Dendrocygninae (tree ducks) and in 10 of 13 species in the subfamily Anserinae (swans and geese) but not in other subfamilies in the Anatidae family. It was also not present in species from the other two families of the order Anseriformes. 3alpha,7alpha,15alpha-Trihydroxy-5beta-cholan-24-oic acid is a new primary bile acid that is present in the biliary bile acids of swans, tree ducks, and geese and may be termed 15alpha-hydroxy-chenodeoxycholic acid. PMID:16648547

  3. Alpha Channeling in Rotating Plasma with Stationary Waves

    SciTech Connect

    A. Fetterman and N.J. Fisch


    An extension of the alpha channeling effect to supersonically rotating mirrors shows that the rotation itself can be driven using alpha particle energy. Alpha channeling uses radiofrequency waves to remove alpha particles collisionlessly at low energy. We show that stationary magnetic fields with high nθ can be used for this purpose, and simulations show that a large fraction of the alpha energy can be converted to rotation energy.

  4. Correcting Coefficient Alpha for Correlated Errors: Is [alpha][K]a Lower Bound to Reliability?

    ERIC Educational Resources Information Center

    Rae, Gordon


    When errors of measurement are positively correlated, coefficient alpha may overestimate the "true" reliability of a composite. To reduce this inflation bias, Komaroff (1997) has proposed an adjusted alpha coefficient, ak. This article shows that ak is only guaranteed to be a lower bound to reliability if the latter does not include correlated…

  5. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2012 CFR


    ... 40 Protection of Environment 32 2012-07-01 2012-07-01 false Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL... Significant New Uses for Specific Chemical Substances § 721.10300 Benzeneacetic acid,...

  6. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2013 CFR


    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL... Significant New Uses for Specific Chemical Substances § 721.10300 Benzeneacetic acid,...

  7. 40 CFR 721.10300 - Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester.

    Code of Federal Regulations, 2014 CFR


    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Benzeneacetic acid, .alpha.-chloro-.alpha.-phenyl-, ethyl ester. 721.10300 Section 721.10300 Protection of Environment ENVIRONMENTAL... Significant New Uses for Specific Chemical Substances § 721.10300 Benzeneacetic acid,...

  8. Reaction of. cap alpha. ,. cap alpha. ,omega-trihydroperfluoroalkanols with thionyl chloride

    SciTech Connect

    Krolevets, A.A.; Ragulin, L.I.; Popov, A.G.


    The effect of catalysts on the reaction of thionyl chloride with ..cap alpha..,..cap alpha..,omega-trihydroperfluoroalkanols was investigated. It was shown that the use of calcium chloride, aluminum chloride, ferric chloride, and magnesium chloride as catalysts makes it possible to obtain polyfluoroalkyl chlorosulfites and bis(polyfluoroalkyl) sulfites with good yields.

  9. Simultaneous measurements of the hydrogen airglow emissions of Lyman alpha, Lyman beta, and Balmer alpha.

    NASA Technical Reports Server (NTRS)

    Weller, C. S.; Meier, R. R.; Tinsley, B. A.


    Comparison of Lyman-alpha, 740- to 1050-A, and Balmer-alpha airglow measurements made at 134 deg solar-zenith angle on Oct. 13, 1969, with resonance-scattering models of solar radiation. Model comparison with Lyman-alpha data fixes the hydrogen column abundance over 215 km to 2 x 10 to the 13th per cu cm within a factor of 2. Differences between the Lyman-alpha model and data indicate a polar-equatorial departure from spherical symmetry in the hydrogen distribution. A Lyman-beta model based on the hydrogen distribution found to fit the Lyman-alpha data fits the spatial variation of the 740- to 1050-A data well from 100 to 130 km, but it does not fit the data well at higher altitudes; thus the presence of more rapidly absorbed shorter-wavelength radiation is indicated. This same resonance-scattering model yields Balmer-alpha intensities that result in good spatial agreement with the Balmer-alpha measurements, but a fivefold increase in the measured solar line center Lyman-beta flux is required (as required for the Lyman-beta measurement). The intensity ratio of Lyman-beta and Balmer-alpha at night is found to be a simple measure of the hydrogen optical depth if measurements with good accuracy can be made in the visible and ultraviolet spectrum.

  10. Amyloid formation and disaggregation of {alpha}-synuclein and its tandem repeat ({alpha}-TR)

    SciTech Connect

    Bae, Song Yi; Kim, Seulgi; Hwang, Heejin; Kim, Hyun-Kyung; Yoon, Hyun C.; Kim, Jae Ho; Lee, SangYoon; Kim, T. Doohun


    Research highlights: {yields} Formation of the {alpha}-synuclein amyloid fibrils by [BIMbF{sub 3}Im]. {yields} Disaggregation of amyloid fibrils by epigallocatechin gallate (EGCG) and baicalein. {yields} Amyloid formation of {alpha}-synuclein tandem repeat ({alpha}-TR). -- Abstract: The aggregation of {alpha}-synuclein is clearly related to the pathogenesis of Parkinson's disease. Therefore, detailed understanding of the mechanism of fibril formation is highly valuable for the development of clinical treatment and also of the diagnostic tools. Here, we have investigated the interaction of {alpha}-synuclein with ionic liquids by using several biochemical techniques including Thioflavin T assays and transmission electron microscopy (TEM). Our data shows a rapid formation of {alpha}-synuclein amyloid fibrils was stimulated by 1-butyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide [BIMbF{sub 3}Im], and these fibrils could be disaggregated by polyphenols such as epigallocatechin gallate (EGCG) and baicalein. Furthermore, the effect of [BIMbF{sub 3}Im] on the {alpha}-synuclein tandem repeat ({alpha}-TR) in the aggregation process was studied.

  11. Experimental and Theoretical Electron Density Distribution of Alpha,Alpha-Trehalose Dihydrate

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Alpha,alpha-rehalose is of interest because of its cryoprotective and antidessicant properties, and because it possesses various technical anomalies such as 13C NMR spectra that give misleading indications of intramolecular structural symmetry. It is a non-reducing disaccharide, with the glycosidic...

  12. Alpha-7 and alpha-4 nicotinic receptor subunit immunoreactivity in genioglossus muscle motoneurons.


    Dehkordi, Ozra; Millis, Richard M; Dennis, Gary C; Coleman, Bernell R; Johnson, Sheree M; Changizi, Loubat; Ovid Trouth, C


    In the present study, immunohistochemistry combined with retrograde labeling techniques were used to determine if hypoglossal motoneurons (HMNs), retrogradely labeled after cholera toxin B subunit (CTB) injection to the genioglossus muscle in rats, show immunoreactivity for alpha-7 and alpha-4 subunits of nicotinic acetylcholine receptors (nAChRs). CTB-positive HMNs projecting to the genioglossus muscle were consistently labeled throughout the rostrocaudal extent of the hypoglossal nuclei with the greatest labeling at and caudal to area postrema. Alpha-7 subunit immunoreactivity was found in 39.44+/-5.10% of 870 CTB-labeled motoneurons and the alpha-4 subunit in 51.01+/-3.71% of 983 CTB-positive neurons. Rostrally, the number of genioglossal motoneurons demonstrating immunoreactivity for the alpha-7 subunit was 45.85+/-10.04% compared to 34.96+/-5.11% at and caudal to area postrema (P>0.1). The number of genioglossal motoneurons that showed immunoreactivity for the alpha-4 subunit was 55.03+/-4.83% at and caudal to area postrema compared to 42.98+/-3.90% in rostral areas (P=0.074). These results demonstrate that nAChR immunoreactivity is present in genioglossal motoneurons and suggest a role for alpha-7 and alpha-4 subunits containing nAChRs in the regulation of upper airway patency. PMID:15705531

  13. The New Element Californium (Atomic Number 98)

    DOE R&D Accomplishments Database

    Seaborg, G. T.; Thompson, S. G.; Street, K. Jr.; Ghiroso, A.


    Definite identification has been made of an isotope of the element with atomic number 98 through the irradiation of Cm{sup 242} with about 35-Mev helium ions in the Berkeley Crocker Laboratory 60-inch cyclotron. The isotope which has been identified has an observed half-life of about 45 minutes and is thought to have the mass number 244. The observed mode of decay of 98{sup 244} is through the emission of alpha-particles, with energy of about 7.1 Mev, which agrees with predictions. Other considerations involving the systematics of radioactivity in this region indicate that it should also be unstable toward decay by electron capture. The chemical separation and identification of the new element was accomplished through the use of ion exchange adsorption methods employing the resin Dowex-50. The element 98 isotope appears in the eka-dysprosium position on elution curves containing berkelium and curium as reference points--that is, it precedes berkelium and curium off the column in like manner that dysprosium precedes terbium and gadolinium. The experiments so far have revealed only the tripositive oxidation state of eka-dysprosium character and suggest either that higher oxidation states are not stable in aqueous solutions or that the rates of oxidation are slow. The successful identification of so small an amount of an isotope of element 98 was possible only through having made accurate predictions of the chemical and radioactive properties.

  14. Synthesis of novel 21-trifluoropregnane steroids: inhibitors of 17 alpha-hydroxylase/17,20-lyase (17 alpha-lyase).


    Njar, V C; Klus, G T; Johnson, H H; Brodie, A M


    Novel 21-trifluoropregnenolone (6), 21-trifluoroprogesterone (7) and related compounds 4a and 8 have been synthesized in high yields from 3 beta-acetoxyandrost-5-ene-17 beta-carbaldehyde (3). The key reaction was the conversion of 3 into the 21-trifluoromethyl-20-alcohol as a diastereomeric mixture (4) by trifluoromethyltrimethylsilane (TMS-CF3) in the presence of tetrabutylammonium fluoride (TBAF). All compounds, including 6 and 7, were unambiguously characterized by IR, 1H and 19F NMR, high-resolution mass spectrometry (HRMS), and elemental analysis. On this basis, we concluded that the only report of an earlier synthesis of 6 and 7 is erroneous. Enzyme inhibition studies showed that 20 xi-hydroxy-21-trifluoropregn-4-en-3-one (8) is a potent inhibitor (IC50 value = 0.6 microM) of rat 17 alpha-hydroxylase/17,20-lyase. PMID:9185294

  15. The synthetic elements

    SciTech Connect

    Hoffman, D.C.


    Prior to 1940, the heaviest element known was uranium, discovered in 1789. Since that time the elements 93 through 109 have been synthesized and identified and the elements 43, 61, 85, and 87 which were missing form the periodic tables of the 1930's have been discovered. The techniques and problems involved in these discoveries and the placement of the transuranium elements in the periodic table will be discussed. The production and positive identification of elements heavier than Md (Z=101), which have very short half-lives and can only be produced an atom-at-a-time, are very difficult and there have been controversies concerning their discovery. Some of the new methods which have been developed and used in these studies will be described. The prospects for production of still heavier elements will be considered.

  16. Cohesive Elements for Shells

    NASA Technical Reports Server (NTRS)

    Davila, Carlos G.; Camanho, Pedro P.; Turon, Albert


    A cohesive element for shell analysis is presented. The element can be used to simulate the initiation and growth of delaminations between stacked, non-coincident layers of shell elements. The procedure to construct the element accounts for the thickness offset by applying the kinematic relations of shell deformation to transform the stiffness and internal force of a zero-thickness cohesive element such that interfacial continuity between the layers is enforced. The procedure is demonstrated by simulating the response and failure of the Mixed Mode Bending test and a skin-stiffener debond specimen. In addition, it is shown that stacks of shell elements can be used to create effective models to predict the inplane and delamination failure modes of thick components. The results indicate that simple shell models can retain many of the necessary predictive attributes of much more complex 3D models while providing the computational efficiency that is necessary for design.

  17. Experiments on synthesis of the heaviest elements at RIKEN

    SciTech Connect

    Morimoto, K.; Morita, K.; Kaji, D.; Yoneda, A.; Haba, H.; Katori, K.; Kikunaga, H.; Ohnishi, T.; Suda, T.; Yoshida, A.; Akiyama, T.; Sato, N.; Goto, S.; Kudo, H.; Ideguchi, E.; Koura, H.; Ozawa, A.; Sueki, K.; Tokanai, F.; Yamaguchi, T.


    In the Institute of Physical and Chemical Research (RIKEN), using high intensity heavy ion beams from the RIKEN Linear Accelerator, productions and decays of isotopes of the heaviest elements have been investigated by using the gas-filled recoil separator, GARIS. The isotopes studied were 265Hs, 271Ds, 272Rg, 277112, and 278113, respectively. Based on the observed decay chains consisting of consecutive alpha decays connected to the previously known alpha decays or spontaneous fissions, assignments of the initially produced isotopes were done. Our data with the atomic number from 108 to 112, agree well with the data previously taken. The production cross section of the isotope 278113 of the 113th element have reached around 32 fb which shows the simple decrease of the cross section with the increase of the atomic number. The isotopes were produced, for the first time in the 1n evaporation channel from heavy-ion induced fusion reaction.

  18. Syntheses of alpha-tocopheryl glycosides by glucosidases.


    Ponrasu, Thangavel; Charles, Rajachristu Einstein; Sivakumar, Ramaiah; Divakar, Soundar


    Enzymatic syntheses of water-soluble alpha-tocopheryl glycosides were carried out in di-isopropyl ether using amyloglucosidase from Rhizopus mold or beta-glucosidase isolated from sweet almond. Optimum conditions for the amyloglucosidase were: alpha-tocopherol 0.5 mmol, D-glucose 0.5 mmol, 400 activity unit (AU) amyloglucosidase, 0.2 mM pH 7 phosphate buffer and 72 h; and for the beta-glucosidase: alpha-tocopherol 0.5 mmol, D: -glucose 0.5 mmol, 110 AU beta-glucosidase, 0.1 mM pH 6 phosphate buffer and 72 h. Out of 11 carbohydrates employed, amyloglucosidase reacted only with D-glucose to give 50% of 6-O-(alpha-D-glucopyranosyl)alpha-tocopherol. However, the beta-glucosidase gave 6-O-(beta-D-glucopyranosyl)alpha-tocopherol, 6-O-(alpha-D-galactopyranosyl)alpha-tocopherol, 6-O-(beta-D-galactopyranosyl)alpha-tocopherol, 6-O-(alpha-D-mannopyranosyl)alpha-tocopherol and 6-O-(beta-D-mannopyranosyl)alpha-tocopherol in yields ranging from 10-25%. Water solubility of 6-O-(alpha-D-glucopyranosyl)alpha-tocopherol was 26 g/l at 25 degrees C. alpha-Tocopheryl glycosides showed antioxidant activities with IC(50) values from 0.5 to 1 mM and angiotensin-converting enzyme (ACE) inhibitory activity with IC(50) values from 1.3 to 2.6 mM. PMID:18368294

  19. Phosphorylation-independent stimulation of DNA topoisomerase II alpha activity.


    Kimura, K; Saijo, M; Tanaka, M; Enomoto, T


    It has been suggested that casein kinase II phosphorylates DNA topoisomerase II alpha (topo II alpha) in mouse FM3A cells, by comparison of phosphopeptide maps of topo II alpha labeled in intact cells and of topo II alpha phosphorylated by various kinases in vitro. The phosphorylation of purified topo II alpha by casein kinase II, which attached a maximum of two phosphate groups per topo II alpha molecule, had no effect on the activity of topo II alpha. Dephosphorylation of purified topo II alpha by potato acid phosphatase, which almost completely dephosphorylated the topo II alpha, did not reduce the activity of topo II alpha. The incubation itself, regardless of phosphorylation or dephosphorylation status, stimulated the enzyme activity in both reactions. Topo II alpha activity was stimulated by incubation in a medium containing low concentrations of glycerol but not in that containing high concentrations of glycerol, such as the 50% in which purified topo II alpha is stored. The stimulation of topo II alpha activity by incubation was dependent on the concentration of topo II alpha, requiring a relatively high concentration of topo II alpha. PMID:8631919

  20. {alpha}-nucleus potentials, {alpha}-decay half-lives, and shell closures for superheavy nuclei

    SciTech Connect

    Mohr, Peter


    Systematic {alpha}-nucleus folding potentials are used to analyze {alpha}-decay half-lives of superheavy nuclei. Preformation factors of about several percent are found for all nuclei under study. The systematic behavior of the preformation factors and the volume integrals of the potentials allows predictions of {alpha}-decay energies and half-lives for unknown nuclei. Shell closures can be determined from measured {alpha}-decay energies using the discontinuity of the volume integral at shell closures. For the first time a double shell closure is predicted for Z{sub magic}=132,N{sub magic}=194, and A{sub magic}=326 from the systematics of folding potentials. The calculated {alpha}-decay half-lives remain far below 1 ns for superheavy nuclei with double shell closure and masses A>300 independent of the precise knowledge of the magic proton and neutron numbers.

  1. Alpha globin gene analysis in a Sardinian family with interacting alpha and beta thalassaemia genes.


    Melis, M A; Galanello, R; Cao, A


    This paper reports the results of alpha globin gene analysis in a Sardinian family with interacting alpha and beta thalassaemia genes. The propositus, who was identified in a newborn survey as he had 26.0% Hb Bart's and 74.0% Hb F, successively developed the clinical and haematological picture of a transfusion-dependent thalassaemia major. According to the haemoglobin pattern, restriction endonuclease analysis of the DNA from this patient showed the deletion of three of the four alpha-globin structural genes. Thus beta 0-thalassaemia homozygotes with the delection of three alpha-structural genes seem to have a severe clinical phenotype similar to that of patients with a full complement of four alpha-globin structural genes. PMID:6299325


    SciTech Connect

    Dailey, A; Dennis Hadlock, D


    Previous studies had been done in order to show the attenuation of alpha particles in filter media. These studies provided an accurate correction for this attenuation, but there had not yet been a study with sufficient results to properly correct for attenuation due to dust loading on the filters. At the Savannah River Site, filter samples are corrected for attenuation due to dust loading at 20%. Depending on the facility the filter comes from and the duration of the sampling period, the proper correction factor may vary. The objective of this study was to determine self-absorption curves for each of three counting instruments. Prior work indicated significant decreases in alpha count rate (as much as 38%) due to dust loading, especially on filters from facilities where sampling takes place over long intervals. The alpha count rate decreased because of a decrease in the energy of the alpha. The study performed resulted in a set of alpha absorption curves for each of three detectors. This study also took into account the affects of the geometry differences in the different counting equipment used.

  3. Peptide modulators of alpha-glucosidase

    PubMed Central

    Roskar, Irena; Molek, Peter; Vodnik, Miha; Stempelj, Mateja; Strukelj, Borut; Lunder, Mojca


    Aims/Introduction Acute glucose fluctuations during the postprandial period pose great risk for cardiovascular complications and thus represent an important therapeutic approach in type 2 diabetes. In the present study, screening of peptide libraries was used to select peptides with an affinity towards mammalian intestinal alpha-glucosidase as potential leads in antidiabetic agent development. Materials and Methods Three phage-displayed peptide libraries were used in independent selections with different elution strategies to isolate target-binding peptides. Selected peptides displayed on phage were tested to compete for an enzyme-binding site with known competitive inhibitors, acarbose and voglibose. The four best performing peptides were synthesized. Their binding to the mammalian alpha-glucosidase and their effect on enzyme activity were evaluated. Results Two linear and two cyclic heptapeptides with high affinity towards intestinal alpha-glucosidase were selected. Phage-displayed as well as synthetic peptides bind into or to the vicinity of the active site on the enzyme. Both cyclic peptides inhibited enzyme activity, whereas both linear peptides increased enzyme activity. Conclusions Although natural substrates of glycosidase are polysaccharides, in the present study we successfully isolated novel peptide modulators of alpha-glucosidase. Modulatory activity of selected peptides could be further optimized through peptidomimetic design. They represent promising leads for development of efficient alpha-glucosidase inhibitors. PMID:26543535

  4. H-alpha Observations of MKW10

    NASA Astrophysics Data System (ADS)

    Johnson, Harold; Coble, Kimberly A.; Koopmann, Rebecca A.; Durbala, Adriana; Undergraduate ALFALFA Team


    As part of the Undergraduate ALFALFA Team project looking at clusters and groups of galaxies to investigate the effects of environment on star formation, we analyzed H-alpha and R-band observations of the group MKW10 from the WIYN 0.9-m telescope with MOSAIC camera at Kitt Peak. We continuum-subtract the H-alpha images by scaling and subtracting the broadband R images. This process includes: determining the seeing of each image by calculating the FWHM values of several stars in the image; convolving all images to the worst seeing; stacking images for each filter; subtracting sky background; scaling the R image to H-alpha; and subtracting the scaled R from H-alpha. We then use the H-alpha-continuum-subtracted image to perform surface photometry of individual galaxies in MKW10. The data will be used to determine star formation rates and distributions of galaxies in this group environment and will be compared to results for galaxies in other UAT group and cluster environments. Analysis is ongoing.This work has been supported by NSF grant AST-1211005 and the Illinois Space Grant Consortium.

  5. Alpha-particle sensitive test SRAMs

    NASA Technical Reports Server (NTRS)

    Buehler, M. G.; Blaes, B. R.


    A bench-level test is being developed to evaluate memory-cell upsets in a test SRAM designed with a cell offset voltage. This offset voltage controls the critical charge needed to upset the cell. The effect is demonstrated using a specially designed 2-micron n-well CMOS 4-kb test SRAM and a Po-208 5.1-MeV 0.61-LET alpha-particle source. This test SRAM has been made sensitive to alpha particles through the use of a cell offset voltage, and this has allowed a bench-level characterization in a laboratory setting. The experimental data are linked to a alpha-particle interaction physics and to SPICE circuit simulations through the alpha-particle collection depth. The collection depth is determined by two methods and found to be about 7 micron. In addition, alpha particles that struck outside the bloated drain were able to flip the SRAM cells. This lateral charge collection was observed to be more than 6 micron.

  6. Polyfluorinated. cap alpha. ,. beta. -unsaturated ketons

    SciTech Connect

    Latypov, R.R.; Belogai, V.D.; Pashkevich, K.I.


    The ..cap alpha..,..beta..-unsaturated ketones (..cap alpha..,..beta..-UK), particularly those groups containing fluoroalkyl groups, are of interest as highly reactive compounds having two nonequivalent electrophilic centers. In the present investigation, by boiling polyfluorinated aldehydes with methylketones in glacial acetic acid, they have obtained for the first time the polyfluorinated ..beta..-hydroxy-ketones, the dehydration of which has been used to synthesize the corresponding polyfluorinated ..cap alpha..,..beta..-UK, and their structure and reactions with the nucleophiles NH/sub 3/, PhNH/sub 2/, MeOH have been studied. In the PMR spectra of the ..cap alpha..,..beta..-UK (X)-(XVI) two doublets of triplets are observed at 6.9 and 7.9 ppm, caused by the spin-spin coupling of the olefin protons with the CF/sub 2/ group of the substituent. For ..cap alpha..,..beta..-UK, apart from the cis-trans isomerism relative to the C=C bond, a rotational isomerism is possible, caused by rotation around the C-C single bond. The presence in the IR spectra of absorption bands from nonplanar torsion-deformation vibrations of C-H for a double bond (nu = 975-980 cm/sup -1/) and the high value of the spin-spin coupling constant of the olefin protons (J/sub HH/ = 15 Hz) indicate unambiguously the transconfiguration of the olefin protons.

  7. Role of Frontal Alpha Oscillations in Creativity

    PubMed Central

    Lustenberger, Caroline; Boyle, Michael R.; Foulser, A. Alban; Mellin, Juliann M.; Fröhlich, Flavio


    Creativity, the ability to produce innovative ideas, is a key higher-order cognitive function that is poorly understood. At the level of macroscopic cortical network dynamics, recent EEG data suggests that cortical oscillations in the alpha frequency band (8 – 12 Hz) are correlated with creative thinking. However, whether alpha oscillations play a fundamental role in creativity has remained unknown. Here we show that creativity is increased by enhancing alpha power using 10 Hz transcranial alternating current stimulation (10Hz-tACS) of the frontal cortex. In a study of 20 healthy participants with a randomized, balanced cross-over design, we found a significant improvement of 7.4% in the Creativity Index measured by the Torrance Test of Creative Thinking, a comprehensive and most frequently used assay of creative potential and strengths. In a second similar study with 20 subjects, 40Hz-tACS was used in instead of 10Hz-tACS to rule out a general “electrical stimulation” effect. No significant change in the Creativity Index was found for such frontal gamma stimulation. Our results suggest that alpha activity in frontal brain areas is selectively involved in creativity; this enhancement represents the first demonstration of specific neuronal dynamics that drive creativity and can be modulated by non-invasive brain stimulation. Our findings agree with the model that alpha recruitment increases with internal processing demands and is involved in inhibitory top-down control, which is an important requirement for creative ideation. PMID:25913062



    Newson, H.W.


    A novel composite neutronic reactor control element is offered. The element comprises a multiplicity of sections arranged in end-to-end relationship, each of the sections having a markedly different neutron-reactive characteristic. For example, a three-section control element could contain absorber, moderator, and fuel sections. By moving such an element longitudinally through a reactor core, reactivity is decreased by the absorber, increased slightly by the moderator, or increased substantially by the fuel. Thus, control over a wide reactivity range is provided.


    SciTech Connect

    Cheng, Judy Y.; Rockosi, Constance M.; Schlesinger, Katharine J.; Lee, Young Sun; Beers, Timothy C.; Bizyaev, Dmitry; Malanushenko, Elena; Malanushenko, Viktor; Oravetz, Daniel; Pan, Kaike; Simmons, Audrey; Schneider, Donald P.; Weaver, Benjamin A.


    We examine the {alpha}-element abundance ratio, [{alpha}/Fe], of 5620 stars, observed by the Sloan Extension for Galactic Understanding and Exploration survey in the region 6 kpc alpha} thick-disk population has a short scale length (L{sub thick} {approx} 1.8 kpc) compared to the low-{alpha} population, which is typically associated with the thin disk. We find that the fraction of high-{alpha} stars in the inner disk increases at large |Z| and that high-{alpha} stars lag in rotation compared to low-{alpha} stars. In contrast, the fraction of high-{alpha} stars in the outer disk is low at all |Z|, and high- and low-{alpha} stars have similar rotational velocities up to 1.5 kpc from the plane. We interpret these results to indicate that different processes were responsible for the high-{alpha} populations in the inner and outer disk. The high-{alpha} population in the inner disk has a short scale length and large scale height, consistent with a scenario in which the thick disk forms during an early gas-rich accretion phase. Stars far from the plane in the outer disk may have reached their current locations through heating by minor mergers. The lack of high-{alpha} stars at large R and |Z| also places strict constraints on the strength of radial migration via transient spiral structure.

  10. Regulation of alpha o expression by the 5'-flanking region of the alpha o gene.


    Li, Y; Mortensen, R; Neer, E J


    Many responses of cells to external signals require activation of the heterotrimeric G proteins. These responses depend on the type and amount of G proteins that are expressed. Each cell has a characteristic complement of G protein subunits. For example, the alpha o subunit is very abundant in neural tissues. Very little is known about the mechanisms that determine cellular levels of G proteins. In the present study, we have isolated a genomic clone for mouse alpha o gene and identified the promoter region. There are multiple transcription initiation sites located about 750 base pairs upstream of the translational start site. The promoter region is GC-rich and contains neither a TATA-box nor a CAAT box. Transient expression assays using a series of constructs containing various lengths of the 5'-flanking region of the alpha o promoter demonstrated that the region 300-700 base pairs upstream of the transcription initiation sites is responsible for the basic promoter activity. The relative activity of alpha o promoter is 8-12-fold higher in cells expressing alpha o than in cells lacking alpha o. The level of alpha o in cells may also be regulated at the level of protein translation because deletions in the 5'-noncoding region of alpha o gene increase reporter enzyme expression without a corresponding increase in reporter enzyme mRNA level. Our results suggest that both transcriptional and post-transcriptional mechanisms are involved in regulating the expression of alpha o in vivo. Transcriptional regulation probably is important for control of tissue-specific expression, while posttranscriptional mechanisms may be used to regulate the alpha o level in cells. PMID:7961675

  11. L-alpha-glycerylphosphorylcholine inhibits the transfer function of phosphatidylinositol transfer protein alpha.


    Komatsu, Hiroaki; Westerman, Jan; Snoek, Gerry T; Taraschi, Theodore F; Janes, Nathan


    Phosphatidylinositol transfer protein alpha (PITP-alpha) is a bifunctional phospholipid transfer protein that is highly selective for phosphatidylinositol (PtdIns) and phosphatidylcholine (PtdCho). Polar lipid metabolites, including L-alpha-glycerylphosphorylcholine (GroPCho), increasingly have been linked to changes in cellular function and to disease. In this study, polar lipid metabolites of PtdIns and PtdCho were tested for their ability to influence PITP-alpha activity. GroPCho inhibited the ability of PITP-alpha to transfer PtdIns or PtdCho between liposomes. The IC(50) of both processes was dependent on membrane composition. D-myo-inositol 1-phosphate and glycerylphosphorylinositol modestly enhanced PITP-alpha-mediated phospholipid transfer. Choline, phosphorylcholine (PCho), CDP-choline, glyceryl-3-phosphate, myo-inositol and D-myo-inositol 1,4,5-trisphosphate had little effect. Membrane surface charge was a strong determinant of the GroPCho inhibition with the inhibition being greatest for highly anionic membranes. GroPCho was shown to enhance the binding of PITP-alpha to anionic vesicles. In membranes of low surface charge, phosphatidylethanolamine (PtdEtn) was a determinant enabling the GroPCho inhibition. Anionic charge and PtdEtn content appeared to increase the strength of PITP-alpha-membrane interactions. The GroPCho-enhanced PITP-alpha-membrane binding was sufficient to cause inhibition, but not sufficient to account for the extent of inhibition observed. Processes associated with strengthened PITP-alpha-membrane binding in the presence of GroPCho appeared to impair the phospholipid insertion/extraction process. PMID:14729069

  12. G alpha12 interaction with alphaSNAP induces VE-cadherin localization at endothelial junctions and regulates barrier function.


    Andreeva, Alexandra V; Kutuzov, Mikhail A; Vaiskunaite, Rita; Profirovic, Jasmina; Meigs, Thomas E; Predescu, Sanda; Malik, Asrar B; Voyno-Yasenetskaya, Tatyana


    The involvement of heterotrimeric G proteins in the regulation of adherens junction function is unclear. We identified alphaSNAP as an interactive partner of G alpha12 using yeast two-hybrid screening. Glutathione S-transferase pull-down assays showed the selective interaction of alphaSNAP with G alpha12 in COS-7 as well as in human umbilical vein endothelial cells. Using domain swapping experiments, we demonstrated that the N-terminal region of G alpha12 (1-37 amino acids) was necessary and sufficient for its interaction with alphaSNAP. G alpha13 with its N-terminal extension replaced by that of G alpha12 acquired the ability to bind to alphaSNAP, whereas G alpha12 with its N terminus replaced by that of G alpha13 lost this ability. Using four point mutants of alphaSNAP, which alter its ability to bind to the SNARE complex, we determined that the convex rather than the concave surface of alphaSNAP was involved in its interaction with G alpha12. Co-transfection of human umbilical vein endothelial cells with G alpha12 and alphaSNAP stabilized VE-cadherin at the plasma membrane, whereas down-regulation of alphaSNAP with siRNA resulted in the loss of VE-cadherin from the cell surface and, when used in conjunction with G alpha12 overexpression, decreased endothelial barrier function. Our results demonstrate a direct link between the alpha subunit of G12 and alphaSNAP, an essential component of the membrane fusion machinery, and implicate a role for this interaction in regulating the membrane localization of VE-cadherin and endothelial barrier function. PMID:15980433

  13. Structure of alpha-glycerophosphate Oxidase from Streptococcus sp.: a Template for the Mitochondrial alpha-glycerophosphate Dehydrogenase

    SciTech Connect

    T Colussi; D Parsonage; W Boles; T Matsuoka; T Mallett; P Karplus; A Claiborne


    The FAD-dependent {alpha}-glycerophosphate oxidase (GlpO) from Enterococcus casseliflavus and Streptococcus sp. was originally studied as a soluble flavoprotein oxidase; surprisingly, the GlpO sequence is 30-43% identical to those of the {alpha}-glycerophosphate dehydrogenases (GlpDs) from mitochondrial and bacterial sources. The structure of a deletion mutant of Streptococcus sp. GlpO (GlpO{Delta}, lacking a 50-residue insert that includes a flexible surface region) has been determined using multiwavelength anomalous dispersion data and refined at 2.3 {angstrom} resolution. Using the GlpO{Delta} structure as a search model, we have also determined the intact GlpO structure, as refined at 2.4 {angstrom} resolution. The first two domains of the GlpO fold are most closely related to those of the flavoprotein glycine oxidase, where they function in FAD binding and substrate binding, respectively; the GlpO C-terminal domain consists of two helix bundles and is not closely related to any known structure. The flexible surface region in intact GlpO corresponds to a segment of missing electron density that links the substrate-binding domain to a {beta}{beta}{alpha} element of the FAD-binding domain. In accordance with earlier biochemical studies (stabilizations of the covalent FAD-N5-sulfite adduct and p-quinonoid form of 8-mercapto-FAD), Ile430-N, Thr431-N, and Thr431-OG are hydrogen bonded to FAD-O2{alpha} in GlpO{Delta}, stabilizing the negative charge in these two modified flavins and facilitating transfer of a hydride to FAD-N5 (from Glp) as well. Active-site overlays with the glycine oxidase-N-acetylglycine and d-amino acid oxidase-d-alanine complexes demonstrate that Arg346 of GlpO{Delta} is structurally equivalent to Arg302 and Arg285, respectively; in both cases, these residues interact directly with the amino acid substrate or inhibitor carboxylate. The structural and functional divergence between GlpO and the bacterial and mitochondrial GlpDs is also discussed.

  14. Attempts to chemically investigate element 112

    SciTech Connect

    Eichler, R.; Bruchle, W.; Buda, R.; Burger, S.; Dressler, R.; Dullmann, C.E.; Dvorak, J.; Eberhardt, K.; Eichler, B.; Folden, C.M.; Gaggeler, H.W.; Gregorich, K.E.; Haenssler, F.; Hoffman, D.C.; Hummrich,H.; Jager, E.; Kratz, J.V.; Kuczewski, B.; Liebe, D.; Nayak, D.; Nitsche,H.; Piguet, D.; Qin, Z.; Rieth, U.; Schadel, M.; Schausten, B.; Schimpf,E.; Semchenkov, A.; Soverna, S.; Sudowe, R.; Trautmann, N.; Thorle, P.; Turler, A.; Wierczinski, B.; Wiehl, N.; Wilk, P.A.; Wirth, G.; Yakushev,A.B.; von Zweidorf, A.


    Two experiments aiming at the chemical investigation of element 112 produced in the heavy ion induced nuclear fusion reaction of Ca-48 with U-238 were performed at the Geselischaft fur Schwerionenforschung (GSI), Darmstadt, Germany. Both experiments were designed to determine the adsorption enthalpy of element 112 on a gold surface using a thermochromatography setup. The temperature range covered in the thermochromatography experiments allowed the adsorption of Hg at about 35 degrees C and of Rn at about -180 degrees C. Reports from the Flerov Laboratory for Nuclear Reactions (FLNR), Dubna, Russia claim production of a 5-min spontaneous fission (SF) activity assigned to 211112 for the U-238 (Ca-48,3n) (283)112 reaction. Hence, Experiment I was designed to detect spontaneously fissioning (SF) isotopes of element 112 with half-lives (t(1/2)) longer than about 20 s. 11 high-energy events were detected. 7 events exhibit a deposition pattern resembling a chromatographic peak in the vicinity of Rn deposition. However, the energy of the events observed in Experiment I was lower than expected for a SF-decay of (283)112. Therefore, these events could not be unambiguously attributed to the decay of (283)112. In contradiction with earlier publications newer reports from FLNR Dubna claim that (283)12 decays by a-particle emission (E-alpha = 9.5 MeV) with t(1/2) = 4 s followed by a SF-decay of (279)Ds (t(1/2) = 0.2 s). Therefore, Experiment II was designed to be sensitive to both claimed decay properties of (283)112. However, during this experiment neither short alpha-SF correlations nor SF coincidences were detected. The conclusion is that (283)112 was not unambiguously detected, neither in Experiment I nor in Experiment II.

  15. Human eosinophils can express the cytokines tumor necrosis factor-alpha and macrophage inflammatory protein-1 alpha.

    PubMed Central

    Costa, J J; Matossian, K; Resnick, M B; Beil, W J; Wong, D T; Gordon, J R; Dvorak, A M; Weller, P F; Galli, S J


    By in situ hybridization, 44-100% of the blood eosinophils from five patients with hypereosinophilia and four normal subjects exhibited intense hybridization signals for TNF-alpha mRNA. TNF-alpha protein was detectable by immunohistochemistry in blood eosinophils of hypereosinophilic subjects, and purified blood eosinophils from three atopic donors exhibited cycloheximide-inhibitable spontaneous release of TNF-alpha in vitro. Many blood eosinophils (39-91%) from hypereosinophilic donors exhibited intense labeling for macrophage inflammatory protein-1 alpha (MIP-1 alpha) mRNA, whereas eosinophils of normal donors demonstrated only weak or undetectable hybridization signals for MIP-1 alpha mRNA. Most tissue eosinophils infiltrating nasal polyps were strongly positive for both TNF-alpha and MIP-1 alpha mRNA. By Northern blot analysis, highly enriched blood eosinophils from a patient with the idiopathic hypereosinophilic syndrome exhibited differential expression of TNF-alpha and MIP-1 alpha mRNA. These findings indicate that human eosinophils represent a potential source of TNF-alpha and MIP-1 alpha, that levels of expression of mRNA for both cytokines are high in the blood eosinophils of hypereosinophilic donors and in eosinophils infiltrating nasal polyps, that the eosinophils of normal subjects express higher levels of TNF-alpha than MIP-1 alpha mRNA, and that eosinophils purified from the blood of atopic donors can release TNF-alpha in vitro. Images PMID:8514874

  16. Solution structure of {alpha}-conotoxin PIA, a novel antagonist of {alpha}6 subunit containing nicotinic acetylcholine receptors

    SciTech Connect

    Chi, Seung-Wook; Lee, Si-Hyung; Kim, Do-Hyoung; Kim, Jae-Sung; Olivera, Baldomero M.; McIntosh, J. Michael; Han, Kyou-Hoon . E-mail:


    {alpha}-Conotoxin PIA is a novel nicotinic acetylcholine receptor (nAChR) antagonist isolated from Conus purpurascens that targets nAChR subtypes containing {alpha}6 and {alpha}3 subunits. {alpha}-conotoxin PIA displays 75-fold higher affinity for rat {alpha}6/{alpha}3{beta}2{beta}3 nAChRs than for rat {alpha}3{beta}2 nAChRs. We have determined the three-dimensional structure of {alpha}-conotoxin PIA by nuclear magnetic resonance spectroscopy. The {alpha}-conotoxin PIA has an '{omega}-shaped' overall topology as other {alpha}4/7 subfamily conotoxins. Yet, unlike other neuronally targeted {alpha}4/7-conotoxins, its N-terminal tail Arg{sup 1}-Asp{sup 2}-Pro{sup 3} protrudes out of its main molecular body because Asp{sup 2}-Pro{sup 3}-Cys{sup 4}-Cys{sup 5} forms a stable type I {beta}-turn. In addition, a kink introduced by Pro{sup 15} in the second loop of this toxin provides a distinct steric and electrostatic environment from those in {alpha}-conotoxins MII and GIC. By comparing the structure of {alpha}-conotoxin PIA with other functionally related {alpha}-conotoxins we suggest structural features in {alpha}-conotoxin PIA that may be associated with its unique receptor recognition profile.

  17. Nuclear diagnostic for fast alpha particles


    Grisham, Larry R.; Post Jr., Douglass E.; Dawson, John M.


    Measurement of the velocity distribution of confined energetic alpha particles resulting from deuterium-tritium fusion reactions in a magnetically contained plasma is provided. The fusion plasma is seeded with energetic boron neutrals for producing, by means of the reaction .sup.10 B (.alpha.,n) .sup.13 N reaction, radioactive nitrogen nuclei which are then collected by a probe. The radioactivity of the probe is then measured by conventional techniques in determining the energy distribution of the alpha particles in the plasma. In a preferred embodiment, diborane gas (B.sub.2 H.sub.6) is the source of the boron neutrals to produce .sup.13 N which decays almost exclusively by positron emission with a convenient half-life of 10 minutes.

  18. Alternating current long range alpha particle detector


    MacArthur, D.W.; McAtee, J.L.


    An alpha particle detector, utilizing alternating currents, which is capable of detecting alpha particles from distinct sources. The use of alternating currents allows use of simpler ac circuits which, in turn, are not susceptible to dc error components. It also allows the benefit of gas gain, if desired. In the invention, a voltage source creates an electric field between two conductive grids, and between the grids and a conductive enclosure. Air containing air ions created by collision with alpha particles is drawn into the enclosure and detected. In some embodiments, the air flow into the enclosure is interrupted, creating an alternating flow of ions. In another embodiment, a modulated voltage is applied to the grid, also modulating the detection of ions.

  19. Nuclear diagnostic for fast alpha particles


    Grisham, Larry R.; Post, Jr., Douglass E.; Dawson, John M.


    Measurement of the velocity distribution of confined energetic alpha particles resulting from deuterium-tritium fusion reactions in a magnetically contained plasma is provided. The fusion plasma is seeded with energetic boron neutrals for producing, by means of the reaction .sup.10 B (.alpha.,n) .sup.13 N reaction, radioactive nitrogen nuclei which are then collected by a probe. The radioactivity of the probe is then measured by conventional techniques in determining the energy distribution of the alpha particles in the plasma. In a preferred embodiment, diborane gas (B.sub.2 H.sub.6) is the source of the boron neutrals to produce .sup.13 N which decays almost exclusively by positron emission with a convenient half-life of 10 minutes.

  20. Alternating current long range alpha particle detector


    MacArthur, Duncan W.; McAtee, James L.


    An alpha particle detector, utilizing alternating currents, whcih is capable of detecting alpha particles from distinct sources. The use of alternating currents allows use of simpler ac circuits which, in turn, are not susceptible to dc error components. It also allows the benefit of gas gain, if desired. In the invention, a voltage source creates an electric field between two conductive grids, and between the grids and a conductive enclosure. Air containing air ions created by collision with alpha particles is drawn into the enclosure and detected. In some embodiments, the air flow into the enclosure is interrupted, creating an alternating flow of ions. In another embodiment, a modulated voltage is applied to the grid, also modulating the detection of ions.

  1. ALPHA MIS: Reference manual. Revision 2

    SciTech Connect

    Lovin, J.K.; Haese, R.L.; Heatherly, R.D.; Hughes, S.E.; Ishee, J.S.; Pratt, S.M.; Smith, D.W.


    ALPHA is a powerful and versatile management information system (MIS) initiated and sponsored and by the Finance and Business Management Division of Oak Ridge National Laboratory, who maintain and develop it in concert with the Business Systems Division for its Information Center. A general-purpose MIS, ALPHA allows users to access System 1022 and System 1032 databases to obtain and manage information. From a personal computer or a data terminal, Energy Systems employees can use ALPHA to control their own report reprocessing. Using four general commands (Database, Select, Sort, and Report) they can (1) choose a mainframe database, (2) define subsets within it, (3) sequentially order a subset by one or more variables, and (4) generate a report with their own or a canned format.

  2. Iron modulates the alpha chain of fibrinogen.


    Nielsen, Vance G; Jacobsen, Wayne K


    Iron-bound fibrinogen has been noted to accelerate plasmatic coagulation in patients with divergent conditions involving upregulation of heme oxygenase activity, including hemodialysis, Alzheimer's disease, sickle cell anemia, and chronic migraine. Our goal was to determine if a site of iron-fibrinogen interaction was on the alpha chain. Using thrombelastography, we compared the coagulation kinetic profiles of plasma exposed to 0-10 µM ferric chloride after activation of coagulation with thrombin generated by contact activation of plasma with the plastic sample cup or by exposure to 1 µg/ml of Calloselasma rhodostoma venom (rich in ancrod activity), which causes coagulation via polymerization of alpha chain monomers. Venom mediated coagulation always occurred before thrombin activated thrombus formation, and ferric chloride always diminished the time of onset of coagulation and increased the velocity of clot growth. Iron enhances plasmatic coagulation kinetics by modulating the alpha chain of fibrinogen. PMID:26782808

  3. Ultraviolet observations of alpha Aurigae from Copernicus

    NASA Technical Reports Server (NTRS)

    Dupree, A. K.


    Emission lines of L-alpha (1215.67 A) and O VI (1031.94 A) were detected in the spectroscopic binary alpha Aur (Capella) with the Princeton experiment on Copernicus. Temperatures of the emitting regions are inferred to be in excess of 300,000 K. The temperature and emission measure are consistent with a variable source of soft X-rays. If the emission is attributed to the primary star (G5 III), the atmosphere is expanding with velocities of about 20-100 km/s. Such expansion can lead to material within the binary system. The density of interstellar hydrogen inferred from absorption of stellar L-alpha appears to be approximately 0.01 hydrogen atoms per cu cm.

  4. The evolutionary conservation of DNA polymerase. alpha

    SciTech Connect

    Miller, M.A.; Korn, D.; Wang, T.S.F. )


    The evolutionary conservation of DNA polymerase {alpha} was assessed by immunological and molecular genetic approaches. Four anti-human KB cell DNA polymerase {alpha} monoclonal antibodies were tested for their ability to recognize a phylogenetically broad array of eukaryotic DNA polymerases. While the single non-neutralizing antibody used in this study recognizes higher mammalian (human, simian, canine, and bovine) polymerases only, three neutralizing antibodies exhibit greater, but variable, extents of cross-reactivity among vertebrate species. Genomic Southern hybridization studies with the cDNA of the human DNA polymerase {alpha} catalytic polypeptide identify the existence of many consensus DNA sequences within the DNA polymerase genes of vertebrate, invertebrate, plant and unicellular organisms. These findings illustrate the differential evolutionary conservation of four unique epitopes on DNA sequences, presumably reflective of critical functional domains, in the DNA polymerase genes from a broad diversity of living forms.

  5. Lyman-alpha imagery of Comet Kohoutek

    NASA Technical Reports Server (NTRS)

    Carruthers, G. R.; Opal, C. B.; Page, T. L.; Meier, R. R.; Prinz, D. K.


    Electrographic imagery of Comet Kohoutek in the 1100-1500 A wavelength range was obtained from a sounding rocket on Jan. 8, 1974, and from the Skylab space station on 13 occasions between Nov. 26, 1973 and Feb. 2, 1974. These images are predominantly due to Lyman-alpha (1216 A) emission from the hydrogen coma of the comet. The rocket pictures have been calibrated for absolute sensitivity and a hydrogen production rate has been determined. However, the Skylab camera suffered degradation of its sensitivity during the mission, and its absolute sensitivity for each observation can only be estimated by comparison of the comet images with those taken by the rocket camera, with imagery of the geocoronal Lyman-alpha glow, of the moon in reflected Lyman-alpha, and of ultraviolet-bright stars. The rocket and geocoronal comparisons are used to derive a preliminary, qualitative history of the development of the cometary hydrogen coma and the associated hydrogen production rate.

  6. Alpha-decay of light protactinium isotopes

    SciTech Connect

    Faestermann, T.; Gillitzer, A.; Hartel, K.; Henning, W.; Kienle, P.


    Light protactinium isotopes have been produced with /sup 204/Pb (/sup 19/F,xn) reactions. ..cap alpha..-activities with E/sub ..cap alpha../ = 9.90(5) MeV, T/sub 1/2/ = 53(10) ns and E/sub ..cap alpha../ = 9.65(5) MeV, T/sub 1/2/ = 0.78(16) could be attributed to the previously unobserved nuclei /sup 219/Pa and /sup 220/Pa with the help of excitation functions. The peak cross sections for the 4n and 3n evaporation channels are on the order of 10 The decay energies as well as the halflives fit well into the systematics of these nuclei close to the magic neutron number N = 126. /sup 219/Pa is the shortest lived nuclide known with directly measured halflife.

  7. Synthesis of peptide .alpha.-thioesters


    Camarero, Julio A.; Mitchell, Alexander R.; De Yoreo, James J.


    Disclosed herein is a new method for the solid phase peptide synthesis (SPPS) of C-terminal peptide .alpha. thioesters using Fmoc/t-Bu chemistry. This method is based on the use of an aryl hydrazine linker, which is totally stable to conditions required for Fmoc-SPPS. When the peptide synthesis has been completed, activation of the linker is achieved by mild oxidation. The oxidation step converts the acyl-hydrazine group into a highly reactive acyl-diazene intermediate which reacts with an .alpha.-amino acid alkylthioester (H-AA-SR) to yield the corresponding peptide .alpha.-thioester in good yield. A variety of peptide thioesters, cyclic peptides and a fully functional Src homology 3 (SH3) protein domain have been successfully prepared.

  8. The Story of Alpha - In Three Parts

    NASA Astrophysics Data System (ADS)

    Hautecoeur, Jean-Paul


    The article presents a retrospective history of the ALPHA series of publications. This action-research project (later called "cooperative research") on literacy and basic education is divided into three periods of seven years each. The first one, "Construction", involved assisting the nascent literacy movement in Québec and Canada by given it a theoretical, critical and ideological basis. In the second period, "Ruptures", the project distanced itself somewhat from the literacy movement, whose success, according to the author, was dubious. During the same period ALPHA systematised its critical function and internationalised its field of research. The third phase, "Wanderings", involved a different research paradigm, in which the project explored basic education at community level in connection with local development initiatives. This biographical/autobiographical account ends with the last publication ALPHA 2000, evincing an ecological vision for alternative education and sustainable communities, partly documented in the Arab countries.

  9. AlphaCor artificial cornea: clinical outcome

    PubMed Central

    Jirásková, N; Rozsival, P; Burova, M; Kalfertova, M


    Purpose The purpose of this study was to describe the long-term results of AlphaCor implantations, and to evaluate the main complications and risk factors. Methods Retrospective analysis of preoperative and follow-up data from 15 AlphaCor implantations. Analysis of outcomes, trends, and associations was performed and compared with data from published clinical trials and a literature review. Results The survival rate of the device at 1, 2, and 3 years was 87%, 58%, and 42%, respectively. Postoperative visual acuity ranged from hand movement to 0.8. The most significant complications were stromal melt (nine cases), optic deposition (three eyes), and retroprosthetic membrane formation (three eyes). The most common device-unrelated complication was trauma (three patients). All complications were managed without loss of the eye. Conclusion AlphaCor provides a treatment option for patients with corneal blindness in which a donor tissue graft would not succeed. PMID:21681219

  10. Analysis of H-alpha flare spectra

    NASA Technical Reports Server (NTRS)

    Kulander, J. L.


    Spectrographs of the H-alpha line taken at 15 second intervals from the event of 5 Sept. 1973 were interpreted by comparison with synthetic profiles. A sequence of 27 high resolution H alpha profiles was obtained from the second brightest flare kernel. The profiles were generally self reversed with a maximum peak intensity of 1.16 x continuum and a maximum central intensity of .91 x continuum. The line characteristics such as red and violet peak intensities and positions, center shifts and wing intensities were tabulated. Synthetic H-alpha profiles were generated from a finite layer assuming simple parameteric forms for the source function and velocity field. The velocity chosen always decreased with optical depth and had the same sign. For absorption profiles, bisector shifts were calculated for a variety of velocities. The velocity field and source function were derived as a function of optical depth and time.

  11. The status of alpha-particle diagnostics

    SciTech Connect

    Young, K.M.; Johnson, D.W.


    There is a flurry of activity to complete alpha-particle diagnostics so that they can undergo some experimental testing in DT plasmas on JET or TFTR prior to implementation on ITER. Successful measurements of escaping charged fusion products have been made in DD plasmas, and the {alpha}-particle source can be well characterized by neutron profile measurement. These methods can be extrapolated to DT plasmas. Measurement of the confined {alpha}-particles requires a new technique. Collective Thomson scattering, methods involving charge-exchange interactions and nuclear reactions with impurities will be discussed. Some assessment is given of the capabilities of these techniques, bearing in mind the potential for their use in the physics phase of the ITER program.

  12. The status of alpha-particle diagnostics

    SciTech Connect

    Young, K.M.; Johnson, D.W.


    There is a flurry of activity to complete alpha-particle diagnostics so that they can undergo some experimental testing in DT plasmas on JET or TFTR prior to implementation on ITER. Successful measurements of escaping charged fusion products have been made in DD plasmas, and the {alpha}-particle source can be well characterized by neutron profile measurement. These methods can be extrapolated to DT plasmas. Measurement of the confined {alpha}-particles requires a new technique. Collective Thomson scattering, methods involving charge-exchange interactions and nuclear reactions with impurities will be discussed. Some assessment is given of the capabilities of these techniques, bearing in mind the potential for their use in the physics phase of the ITER program.

  13. Microdosimetry for Targeted Alpha Therapy of Cancer

    PubMed Central

    Huang, Chen-Yu; Guatelli, Susanna; Oborn, Bradley M.; Allen, Barry J.


    Targeted alpha therapy (TAT) has the advantage of delivering therapeutic doses to individual cancer cells while reducing the dose to normal tissues. TAT applications relate to hematologic malignancies and now extend to solid tumors. Results from several clinical trials have shown efficacy with limited toxicity. However, the dosimetry for the labeled alpha particle is challenging because of the heterogeneous antigen expression among cancer cells and the nature of short-range, high-LET alpha radiation. This paper demonstrates that it is inappropriate to investigate the therapeutic efficacy of TAT by macrodosimetry. The objective of this work is to review the microdosimetry of TAT as a function of the cell geometry, source-target configuration, cell sensitivity, and biological factors. A detailed knowledge of each of these parameters is required for accurate microdosimetric calculations. PMID:22988479

  14. Low-valent niobium-mediated double activation of C-F/C-H bonds: fluorene synthesis from o-arylated alpha,alpha,alpha-trifluorotoluene derivatives.


    Fuchibe, Kohei; Akiyama, Takahiko


    By the treatment of 0.3 molar amount of NbCl5 and LiAlH4, o-arylated alpha,alpha,alpha-trifluorotoluenes afforded fluorene derivatives in good yields. C-F bonds of the CF3 group and the neighboring ortho C-H bond were doubly activated to give the coupling products. PMID:16448098

  15. Deep H alpha images of interacting galaxies

    NASA Technical Reports Server (NTRS)

    Beck, S. C.; Kovo, O.


    Gravitational interactions between galaxies are believed to increase star formation activity dramatically, and most of the brightest starburst galaxies show clear signs of recent interactions. However, it is still not known how interaction triggers star formation, nor are there models to relate the type or strength of interaction to the location or amount of star formation. We report on a series of deep H alpha images of interacting and post-interaction galaxies which we took with the purpose of finding the young stars and ionized gas in these objects. We were motivated in part by the hope that by studying the very recently formed stars we could see how the interaction process had affected the star formation. We observed the galaxies through 50 A-wide filters, one on the redshifted H alpha line and one off, and a standard R filter. Depending on the galaxy and conditions, images in the B, V, and I filters were also obtained. The images were recorded with a 4x7 ft. or 17 ft. diameter CCD at the 1-meter telescope of the Wise Observatory in Mitzpe Ramon. The H alpha and continuum images are used, together with observations at other wavelengths, to put together as complete a picture as possible of star formation and interactions in each galaxy. The complete observation set is not yet available for all the galaxies but certain results are already clear. There do not seem to be any correlations between H 1 and H alpha structures. In some H 1 plume galaxies H alpha extensions were seen on the other side of the galaxy from the H 1; in others extensive H alpha filaments have been found but not H 1. The preliminary results agree with the simplest model that interaction-induced star formation will be concentrated in the system center, since that is where the mass ends up.

  16. Alpha-adaptin, a marker for endocytosis, is expressed in complex patterns during Drosophila development.

    PubMed Central

    Dornan, S; Jackson, A P; Gay, N J


    A Drosophila cDNA encoding a structural homologue of the mammalian coated vesicle component alpha-adaptin (AP2 adaptor complex) has been cloned and sequenced. The mammalian and invertebrate sequences are highly conserved, especially within the amino terminal region, a domain that mediates interactions with other components within the AP2 complex and with specific receptors tails. Mammalian alpha-adaptins are encoded by two genes; however, Drosophila alpha-adaptin has a single gene locus, within polytene bands 21C2-C3 on the left arm of the chromosome 2, closely adjacent to the paired homeobox gene aristaless. There seem to be at least two Drosophila alpha-adaptin transcripts expressed, plausibly by alternative splicing. One of the transcripts is more abundant during early embryogenesis and may be of maternal origin. We have studied the distribution of the alpha-adaptin protein throughout embryogenesis and at the neuromuscular junction of the third instar larva. During cellularization of the blastoderm embryo, the protein is seen between and ahead of the elongating nuclei, and then redistributes to the cell surface during gastrulation. These observations suggest a role for endocytosis in cellularization and are consistent with the finding that dynamin (the shibire gene product), another component of the endocytic mechanism, is required for cellularization. At later stages of embryogenesis, alpha-adaptin is expressed in complex and dynamic patterns. It is strongly induced in elements of the central and peripheral nervous system (e.g., in neuroblasts, the presumptive stomatogastric nervous system, and the lateral chordotonal sense organs), in the Garland cells, the adult midgut precursors, the antenno-maxillary complex, the endoderm, the fat bodies, and the visceral mesoderm. In the larva, alpha-adaptin is localized at the plasma membrane in the synaptic boutons of the neuromuscular junctions. The cells expressing high levels of alpha-adaptin are known or expected to

  17. Development of Flight Slit-Jaw Optics for Chromospheric Lyman-Alpha SpectroPolarimeter

    NASA Technical Reports Server (NTRS)

    Kubo, Masahito; Suematsu, Yoshinori; Kano, Ryohei; Bando, Takamasa; Hara, Hirohisa; Narukage, Noriyuki; Katsukawa, Yukio; Ishikawa, Ryoko; Ishikawa, Shin-nosuke; Kobiki, Toshihiko; Tsuneta, Saku; Kobayashi, Ken; Winebarger, Amy; Takeyama, Norihide; Kanai, Yoshikazu; Sakakibara, Yoshiko


    In sounding rocket experiment CLASP, I have placed a slit a mirror-finished around the focal point of the telescope. The light reflected by the mirror surface surrounding the slit is then imaged in Slit-jaw optical system, to obtain the a-ray Lyman secondary image. This image, not only to use the real-time image in rocket flight rocket oriented direction selection, and also used as a scientific data showing the spatial structure of the Lyman alpha emission line intensity distribution and solar chromosphere around the observation area of the polarimetric spectroscope. Slit-jaw optical system is a two off-axis mirror unit part including a parabolic mirror and folding mirror, Lyman alpha transmission filter, the optical system magnification 1x consisting camera. The camera is supplied from the United States, and the other was carried out fabrication and testing in all the Japanese side. Slit-jaw optical system, it is difficult to access the structure, it is necessary to install the low place clearance. Therefore, influence the optical performance, the fine adjustment is necessary optical elements are collectively in the form of the mirror unit. On the other hand, due to the alignment of the solar sensor in the US launch site, must be removed once the Lyman alpha transmission filter holder including a filter has a different part from the mirror unit. In order to make the structure simple, stray light measures Aru to concentrate around Lyman alpha transmission filter. To overcome the difficulties of performing optical alignment in Lyman alpha wavelength absorbed by the atmosphere, it was planned 'following four steps in order to reduce standing time alignment me. 1. is measured in advance refractive index at Lyman alpha wavelength of Lyman alpha transmission filter (121.567nm), to prepare a visible light Firuwo having the same optical path length in the visible light (630nm).2. The mirror structure CLASP before mounting unit standing, dummy slit and camera standing

  18. Alpha-adaptin, a marker for endocytosis, is expressed in complex patterns during Drosophila development.


    Dornan, S; Jackson, A P; Gay, N J


    A Drosophila cDNA encoding a structural homologue of the mammalian coated vesicle component alpha-adaptin (AP2 adaptor complex) has been cloned and sequenced. The mammalian and invertebrate sequences are highly conserved, especially within the amino terminal region, a domain that mediates interactions with other components within the AP2 complex and with specific receptors tails. Mammalian alpha-adaptins are encoded by two genes; however, Drosophila alpha-adaptin has a single gene locus, within polytene bands 21C2-C3 on the left arm of the chromosome 2, closely adjacent to the paired homeobox gene aristaless. There seem to be at least two Drosophila alpha-adaptin transcripts expressed, plausibly by alternative splicing. One of the transcripts is more abundant during early embryogenesis and may be of maternal origin. We have studied the distribution of the alpha-adaptin protein throughout embryogenesis and at the neuromuscular junction of the third instar larva. During cellularization of the blastoderm embryo, the protein is seen between and ahead of the elongating nuclei, and then redistributes to the cell surface during gastrulation. These observations suggest a role for endocytosis in cellularization and are consistent with the finding that dynamin (the shibire gene product), another component of the endocytic mechanism, is required for cellularization. At later stages of embryogenesis, alpha-adaptin is expressed in complex and dynamic patterns. It is strongly induced in elements of the central and peripheral nervous system (e.g., in neuroblasts, the presumptive stomatogastric nervous system, and the lateral chordotonal sense organs), in the Garland cells, the adult midgut precursors, the antenno-maxillary complex, the endoderm, the fat bodies, and the visceral mesoderm. In the larva, alpha-adaptin is localized at the plasma membrane in the synaptic boutons of the neuromuscular junctions. The cells expressing high levels of alpha-adaptin are known or expected to

  19. Inhomogeneous chemical evolution of r-process elements

    NASA Astrophysics Data System (ADS)

    Wehmeyer, B.; Pignatari, M.; Thielemann, F.-K.


    We report the results of a galactic chemical evolution (GCE) study for r-process- and alpha elements. For this work, we used the inhomogeneous GCE model "ICE", which allows to keep track of the galactic abundances of elements produced by different astrophysical sites. The main input parameters for this study were: a) The Neutron Star Merger (NSM) coalescence time scale, the probability of NSMs, and for the sub-class of "magneto-rotationally driven Supernovae" ("Jet-SNe"), their occurence rate in comparison to "standard" Supernovae (SNe).

  20. Opposite effects of the acute promyelocytic leukemia PML-retinoic acid receptor alpha (RAR alpha) and PLZF-RAR alpha fusion proteins on retinoic acid signalling.

    PubMed Central

    Ruthardt, M; Testa, U; Nervi, C; Ferrucci, P F; Grignani, F; Puccetti, E; Grignani, F; Peschle, C; Pelicci, P G


    Fusion proteins involving the retinoic acid receptor alpha (RAR alpha) and the PML or PLZF nuclear protein are the genetic markers of acute promyelocytic leukemias (APLs). APLs with the PML-RAR alpha or the PLZF-RAR alpha fusion protein are phenotypically indistinguishable except that they differ in their sensitivity to retinoic acid (RA)-induced differentiation: PML-RAR alpha blasts are sensitive to RA and patients enter disease remission after RA treatment, while patients with PLZF-RAR alpha do not. We here report that (i) like PML-RAR alpha expression, PLZF-RAR alpha expression blocks terminal differentiation of hematopoietic precursor cell lines (U937 and HL-60) in response to different stimuli (vitamin D3, transforming growth factor beta1, and dimethyl sulfoxide); (ii) PML-RAR alpha, but not PLZF-RAR alpha, increases RA sensitivity of hematopoietic precursor cells and restores RA sensitivity of RA-resistant hematopoietic cells; (iii) PML-RAR alpha and PLZF-RAR alpha have similar RA binding affinities; and (iv) PML-RAR alpha enhances the RA response of RA target genes (those for RAR beta, RAR gamma, and transglutaminase type II [TGase]) in vivo, while PLZF-RAR alpha expression has either no effect (RAR beta) or an inhibitory activity (RAR gamma and type II TGase). These data demonstrate that PML-RAR alpha and PLZF-RAR alpha have similar (inhibitory) effects on RA-independent differentiation and opposite (stimulatory or inhibitory) effects on RA-dependent differentiation and that they behave in vivo as RA-dependent enhancers or inhibitors of RA-responsive genes, respectively. Their different activities on the RA signalling pathway might underlie the different responses of PML-RAR alpha and PLZF-RAR alpha APLs to RA treatment. The PLZF-RAR alpha fusion protein contains an approximately 120-amino-acid N-terminal motif (called the POZ domain), which is also found in a variety of zinc finger proteins and a group of poxvirus proteins and which mediates protein



    Bradford, B.W.; Skinner, W.J.


    Molded sealing elements suitable for use under conditions involving exposure to uranium hexafluoride vapor are described. Such sealing elements are made by subjecting graphitic carbons to a preliminary treatment with uranium hexafluoride vapor, and then incorporating polytetrafluorethylene in them. The resulting composition has good wear resistant and frictional properties and is resistant to disintegration by uranium hexafluoride over long periods of exposure.

  2. Elemental Food for Thought

    ERIC Educational Resources Information Center

    Cady, Susan


    One of the first tasks students learn in chemistry is to pronounce and spell the names of elements and learn their corresponding chemical symbols. Repetitive oral recitation is commonly used to learn this information, but games and puzzles can make this task creative, variable, and fun. Elemental Food for Thought is a puzzlelike activity that…

  3. Movies and Literary Elements.

    ERIC Educational Resources Information Center

    Keller, Rodney D.

    Showing ten-minute movie clips can be an effective way to motivate students to read literature and to teach elements of fiction, namely plot, character, setting, symbol, irony, and theme. A clip from "And Then There Were None" may be used to teach various elements of plot, including conflict and the four types of conflict (man vs. man, man vs.…

  4. Automatic finite element generators

    NASA Technical Reports Server (NTRS)

    Wang, P. S.


    The design and implementation of a software system for generating finite elements and related computations are described. Exact symbolic computational techniques are employed to derive strain-displacement matrices and element stiffness matrices. Methods for dealing with the excessive growth of symbolic expressions are discussed. Automatic FORTRAN code generation is described with emphasis on improving the efficiency of the resultant code.



    Kesselring, K.A.; Seybolt, A.U.


    A reactor fuel element of the capillary tube type is described. The element consists of a thin walled tube, sealed at both ends, and having an interior coatlng of a fissionable material, such as uranium enriched in U-235. The tube wall is gas tight and is constructed of titanium, zirconium, or molybdenum.

  6. The ends of elements

    NASA Astrophysics Data System (ADS)

    Thornton, Brett F.; Burdette, Shawn C.


    When elements 117 and 118 are finally named, should these new members of the halogen and noble gas families receive names ending in -ium as IUPAC has suggested? Brett F. Thornton and Shawn C. Burdette look at the history of element suffixes and make the case for not following this recommendation.

  7. The Elements Drawing.

    ERIC Educational Resources Information Center

    Dkeidek, Iyad M.


    Presents an educational game designed for first- or second-year high school students who have already studied themes related to the periodic table elements, such as their symbols, electronic configurations, properties, and uses. The game is designed to help students learn the symbols of the elements and their properties or uses in a fun, engaging…

  8. Trace element emissions

    SciTech Connect

    Benson, S.A.; Erickson, T.A.; Steadman, E.N.; Zygarlicke, C.J.; Hauserman, W.B.; Hassett, D.J.


    The Energy & Environmental Research Center (EERC) is carrying out an investigation that will provide methods to predict the fate of selected trace elements in integrated gasification combined cycle (IGCC) and integrated gasification fuel cell (IGFC) systems to aid in the development of methods to control the emission of trace elements determined to be air toxics. The goal of this project is to identify the effects of critical chemical and physical transformations associated with trace element behavior in IGCC and IGFC systems. The trace elements included in this project are arsenic, chromium, cadmium, mercury, nickel, selenium, and lead. The research seeks to identify and fill, experimentally and/or theoretically, data gaps that currently exist on the fate and composition of trace elements. The specific objectives are to (1) review the existing literature to identify the type and quantity of trace elements from coal gasification systems, (2) perform laboratory-scale experimentation and computer modeling to enable prediction of trace element emissions, and (3) identify methods to control trace element emissions.

  9. Repression by ARP-1 sensitizes apolipoprotein AI gene responsiveness to RXR alpha and retinoic acid.

    PubMed Central

    Widom, R L; Rhee, M; Karathanasis, S K


    The gene coding for apolipoprotein AI (apoAI), a lipid binding protein involved in the transport of cholesterol and other lipids in the plasma, is expressed in mammals predominantly in the liver and the intestine. Liver-specific expression is controlled by synergistic interactions between transcription factors bound to three separate sites, sites A (-214 to -192), B (-169 to -146), and C (-134 to -119), within a powerful liver-specific enhancer located between nucleotides -222 and -110 upstream of the apoAI gene transcription start site (+1). Previous studies in our laboratory have shown that ARP-1, a member of the nuclear receptor superfamily whose ligand is unknown (orphan receptor), binds to site A and represses transcription of the apoAI gene in liver cells. In a more recent series of experiments, we found that site A is a retinoic acid (RA) response element that responds preferentially to the recently identified RA-responsive receptor RXR alpha over the previously characterized RA receptors RAR alpha and RAR beta. In this study we investigated the combined effects of ARP-1 and RXR alpha on apoAI gene expression in liver cells. Transient transfection assays showed that site A is necessary and sufficient for RXR alpha-mediated transactivation of the apoAI gene basal promoter in human hepatoma HepG2 cells in the presence of RA and that this transactivation is abolished by increasing amounts of cotransfected ARP-1. Electrophoretic mobility shift assays and subsequent Scatchard analysis of the data revealed that ARP-1 and RXR alpha bind to site A with similar affinities. These assays also revealed that ARP-1 and RXR alpha bind to site A as heterodimers with an affinity approximately 10 times greater than that of either ARP-1 or RXR alpha alone. Further transfection assays in HepG2 cells, using as a reporter a construct containing the apoAI gene basal promoter and its upstream regulatory elements (including site A) in their natural context, revealed that RXR alpha

  10. Fan-less long range alpha detector


    MacArthur, Duncan W.; Bounds, John A.


    A fan-less long range alpha detector which operates by using an electrical field between a signal plane and the surface or substance to be monitored for air ions created by collisions with alpha radiation. Without a fan, the detector can operate without the possibility of spreading dust and potential contamination into the atmosphere. A guard plane between the signal plane and the electrically conductive enclosure and maintained at the same voltage as the signal plane, reduces leakage currents. The detector can easily monitor soil, or other solid or liquid surfaces.

  11. Fan-less long range alpha detector


    MacArthur, D.W.; Bounds, J.A.


    A fan-less long range alpha detector is disclosed which operates by using an electrical field between a signal plane and the surface or substance to be monitored for air ions created by collisions with alpha radiation. Without a fan, the detector can operate without the possibility of spreading dust and potential contamination into the atmosphere. A guard plane between the signal plane and the electrically conductive enclosure and maintained at the same voltage as the signal plane, reduces leakage currents. The detector can easily monitor soil, or other solid or liquid surfaces. 2 figures.

  12. Alpha particles in effective field theory

    SciTech Connect

    Caniu, C.


    Using an effective field theory for alpha (α) particles at non-relativistic energies, we calculate the strong scattering amplitude modified by Coulomb corrections for a system of two αs. For the strong interaction, we consider a momentum-dependent interaction which, in contrast to an energy dependent interaction alone [1], could be more useful in extending the theory to systems with more than two α particles. We will present preliminary results of our EFT calculations for systems with two alpha particles.

  13. Lyman Alpha Searches at Redshift Z>7

    NASA Astrophysics Data System (ADS)

    Willis, Jon


    The ZEN survey is a narrow J-band survey for Ly-alpha emitting galaxies at z > 7. I will briefly review the pros and cons of narrow band observations before summarising the ZEN1 and ZEN2 searches based upon deep ISAAC pointings. I will then present ZEN3, consisting of wide field, narrow band observations of two fields using the CFHT WIRCam facility. I will conclude by reviewing the current sample of candidates and what we have learned about the z > 7 Ly-alpha emitting population.

  14. Task motivation influences alpha suppression following errors.


    Compton, Rebecca J; Bissey, Bryn; Worby-Selim, Sharoda


    The goal of the present research is to examine the influence of motivation on a novel error-related neural marker, error-related alpha suppression (ERAS). Participants completed an attentionally demanding flanker task under conditions that emphasized either speed or accuracy or under conditions that manipulated the monetary value of errors. Conditions in which errors had greater motivational value produced greater ERAS, that is, greater alpha suppression following errors compared to correct trials. A second study found that a manipulation of task difficulty did not affect ERAS. Together, the results confirm that ERAS is both a robust phenomenon and one that is sensitive to motivational factors. PMID:24673621

  15. Signatures for Multi-{alpha}-Condensed States

    SciTech Connect

    Kokalova, Tz.; Wheldon, C.; Itagaki, N.; Oertzen, W. von


    An experimental way of testing Bose-Einstein condensation of {alpha} clusters in the atomic nucleus is reported. The enhancement of cluster emission and the multiplicity partition of possible emitted clusters could be direct signatures for the condensed states. The barrier for the emission of clusters, such as {sup 8}Be and {sup 12}C{sup *}(0{sub 2}{sup +}), is calculated and compared with the barrier for the sequential emission of 2 or 3{alpha} particles from the compound nucleus. For the calculations, a simple approach using a folded Woods-Saxon potential is used.

  16. {alpha} Decay of Deformed Actinide Nuclei

    SciTech Connect

    Stewart, T.L.; Kermode, M.W.; Beachey, D.J.; Rowley, N.; Grant, I.S.; Kruppa, A.T.


    {alpha} decay through a deformed potential barrier produces significant mixing of angular momenta when mapped from the nuclear interior to the outside. Using experimental branching ratios and either semiclassical or coupled-channels transmission matrices, we have found that there is a set of internal amplitudes which is essentially constant for all even-even actinide nuclei. These same amplitudes also give good results for the known anisotropic {alpha}-particle emission of the favored decays of odd nuclei in the same mass region. {copyright} {ital 1996 The American Physical Society.}

  17. Lunar surface outgassing and alpha particle measurements

    SciTech Connect

    Lawson, S. L.; Feldman, W. C.; Lawrence, David J. ,; Moore, K. R.; Elphic, R. C.; Maurice, S.; Belian, Richard D.; Binder, Alan B.


    The Lunar Prospector Alpha Particle Spectrometer (LP APS) searched for lunar surface gas release events and mapped their distribution by detecting alpha particle?; produced by the decay of gaseous radon-222 (5.5 MeV, 3.8 day half-life), solid polonium-2 18 (6.0 MeV, 3 minute half-life), and solid polonium-210 (5.3 MeV, 138 day half-life, but held up in production by the 21 year half-life of lead-210). These three nuclides are radioactive daughters from the decay of uranium-238.

  18. Enteric alpha defensins in norm and pathology

    PubMed Central


    Microbes living in the mammalian gut exist in constant contact with immunity system that prevents infection and maintains homeostasis. Enteric alpha defensins play an important role in regulation of bacterial colonization of the gut, as well as in activation of pro- and anti-inflammatory responses of the adaptive immune system cells in lamina propria. This review summarizes currently available data on functions of mammalian enteric alpha defensins in the immune defense and changes in their secretion in intestinal inflammatory diseases and cancer. PMID:22236533

  19. Evaluation of plasma alpha-2-macroglobulin and interactions with tumour necrosis factor-alpha in horses with endotoxemic signs.

    PubMed Central

    Coté, N; Trout, D R; Hayes, A M


    The electrophoretic position and behavior of the native and activated forms of equine plasma alpha-2-macroglobulin (alpha 2M) were characterized and compared to human alpha 2M by nondenaturing polyacrylamide-gel electrophoresis (PAGE). Plasma alpha 2M was also compared between 6 normal horses and 6 horses with clinical signs of colic and endotoxemia due to volvulus or enteritis. Native and activated forms of alpha 2M were quantified by PAGE and densitometry. Binding of radio-labeled recombinant human tumour necrosis factor-alpha (125I-rhTNF-alpha) to native and activated forms of equine alpha 2M was also evaluated by autoradiography and densitometry of PAGE. Equine plasma alpha 2M migrated as a single band at a position equivalent to native human alpha 2M. Methylamine-reacted equine plasma samples resulted in faster migration of alpha 2M in a similar position to activated human alpha 2M. However, in methylamine-reacted equine plasma, an intermediate alpha 2M band was consistently present between the bands corresponding to native and activated alpha 2M. Amounts of plasma alpha 2M were similar in normal and endotoxemic horses, and remained in the electrophoretically slow or unreacted native form. The vast majority of 125I-rHuTNF-alpha did not bind to alpha 2M or other equine plasma proteins. 125I-rHuTNF-alpha bound weakly to both native and fast methylamine-reacted equine forms of alpha 2M, although binding was better to the activated form. This study indicates that: (1) equine plasma alpha 2M behaves similarly to human alpha 2M on PAGE, (2) plasma alpha 2M of horses can be activated to electrophoretically fast forms, but it is neither activated nor depleted during endotoxemia, and (3) the binding interactions between equine alpha 2M and TNF-alpha are too low to implicate equine alpha 2M as a regulator of TNF-alpha during endotoxemia in horses. Images Figure 1. Figure 2. Figure 3. PMID:8785722

  20. Molecular basis of alpha-thalassemia in Algeria.


    Mesbah-Amroun, Hamida; Rouabhi, Fatiha; Ducrocq, Rolande; Elion, Jacques


    An epidemiological molecular study was carried out to evaluate the spectrum and allelic frequency of alpha-thalassemia (alpha-thal) defects in Algeria. A series of 153 randomly selected blood donors was screened for 10 alpha-thal alleles described in the Mediterranean area. In addition, six unrelated cases with hematological and biochemical data suggestive of Hb H disease were investigated. Our data revealed an allele frequency of 4.6%. The presence of alpha(0)-thal determinants (-alpha(20.5) and --MED I) was observed both in Hb H patients and in the randomly collected samples. Overall, the -alpha(3.7) deletion was the most prevalent allele (2.9%), followed by the alpha(Nco I)alpha (HBA2:c.1A>G) allele (0.6%) and by the alpha(Hph I)alpha (HBA2:c.95 + 2_95 + 6delTGAGG), -alpha(20.5), --(MED I) alleles (0.3% each). The -alpha(4.2) deletion was observed in only one Hb H patient. These results outline the heterogeneity of the alpha-thal alleles in Algeria which reflects the anthropological history of the country. Because of their frequency, alpha-thal alleles are probably frequent modulators of prevalent beta-globin gene-related hemoglobinopathies in Algeria. PMID:18473243