The EMBL nucleotide sequence database
Stoesser, Guenter; Baker, Wendy; van den Broek, Alexandra; Camon, Evelyn; Garcia-Pastor, Maria; Kanz, Carola; Kulikova, Tamara; Lombard, Vincent; Lopez, Rodrigo; Parkinson, Helen; Redaschi, Nicole; Sterk, Peter; Stoehr, Peter; Tuli, Mary Ann
2001-01-01
The EMBL Nucleotide Sequence Database (http://www.ebi.ac.uk/embl/) is maintained at the European Bioinformatics Institute (EBI) in an international collaboration with the DNA Data Bank of Japan (DDBJ) and GenBank at the NCBI (USA). Data is exchanged amongst the collaborating databases on a daily basis. The major contributors to the EMBL database are individual authors and genome project groups. Webin is the preferred web-based submission system for individual submitters, whilst automatic procedures allow incorporation of sequence data from large-scale genome sequencing centres and from the European Patent Office (EPO). Database releases are produced quarterly. Network services allow free access to the most up-to-date data collection via ftp, email and World Wide Web interfaces. EBI’s Sequence Retrieval System (SRS), a network browser for databanks in molecular biology, integrates and links the main nucleotide and protein databases plus many specialized databases. For sequence similarity searching a variety of tools (e.g. Blitz, Fasta, BLAST) are available which allow external users to compare their own sequences against the latest data in the EMBL Nucleotide Sequence Database and SWISS-PROT. PMID:11125039
Linder, P; Dölz, R; Mossé, M O; Lazowska, J; Slonimski, P P
1993-01-01
The amount of nucleotide sequence data is increasing exponentially. We therefore made an effort to make a comprehensive database (LISTA) for the yeast Saccharomyces cerevisiae. Each sequence has been attributed a single genetic name and in the case of allelic duplicated sequences, synonyms are given, if necessary. For the nomenclature we have introduced a standard principle for naming gene sequences based on priority rules. We have also applied a simple method to distinguish duplicated sequences of one and the same gene from non-allelic sequences of duplicated genes. By using these principles we have sorted out a lot of confusion in the literature and databanks. Along with the genetic name, the mnemonic from the EMBL databank, the codon bias, reference of the publication of the sequence and the EMBL accession numbers are included in each entry. PMID:8332521
Accessing and distributing EMBL data using CORBA (common object request broker architecture).
Wang, L; Rodriguez-Tomé, P; Redaschi, N; McNeil, P; Robinson, A; Lijnzaad, P
2000-01-01
The EMBL Nucleotide Sequence Database is a comprehensive database of DNA and RNA sequences and related information traditionally made available in flat-file format. Queries through tools such as SRS (Sequence Retrieval System) also return data in flat-file format. Flat files have a number of shortcomings, however, and the resources therefore currently lack a flexible environment to meet individual researchers' needs. The Object Management Group's common object request broker architecture (CORBA) is an industry standard that provides platform-independent programming interfaces and models for portable distributed object-oriented computing applications. Its independence from programming languages, computing platforms and network protocols makes it attractive for developing new applications for querying and distributing biological data. A CORBA infrastructure developed by EMBL-EBI provides an efficient means of accessing and distributing EMBL data. The EMBL object model is defined such that it provides a basis for specifying interfaces in interface definition language (IDL) and thus for developing the CORBA servers. The mapping from the object model to the relational schema in the underlying Oracle database uses the facilities provided by PersistenceTM, an object/relational tool. The techniques of developing loaders and 'live object caching' with persistent objects achieve a smart live object cache where objects are created on demand. The objects are managed by an evictor pattern mechanism. The CORBA interfaces to the EMBL database address some of the problems of traditional flat-file formats and provide an efficient means for accessing and distributing EMBL data. CORBA also provides a flexible environment for users to develop their applications by building clients to our CORBA servers, which can be integrated into existing systems.
Accessing and distributing EMBL data using CORBA (common object request broker architecture)
Wang, Lichun; Rodriguez-Tomé, Patricia; Redaschi, Nicole; McNeil, Phil; Robinson, Alan; Lijnzaad, Philip
2000-01-01
Background: The EMBL Nucleotide Sequence Database is a comprehensive database of DNA and RNA sequences and related information traditionally made available in flat-file format. Queries through tools such as SRS (Sequence Retrieval System) also return data in flat-file format. Flat files have a number of shortcomings, however, and the resources therefore currently lack a flexible environment to meet individual researchers' needs. The Object Management Group's common object request broker architecture (CORBA) is an industry standard that provides platform-independent programming interfaces and models for portable distributed object-oriented computing applications. Its independence from programming languages, computing platforms and network protocols makes it attractive for developing new applications for querying and distributing biological data. Results: A CORBA infrastructure developed by EMBL-EBI provides an efficient means of accessing and distributing EMBL data. The EMBL object model is defined such that it provides a basis for specifying interfaces in interface definition language (IDL) and thus for developing the CORBA servers. The mapping from the object model to the relational schema in the underlying Oracle database uses the facilities provided by PersistenceTM, an object/relational tool. The techniques of developing loaders and 'live object caching' with persistent objects achieve a smart live object cache where objects are created on demand. The objects are managed by an evictor pattern mechanism. Conclusions: The CORBA interfaces to the EMBL database address some of the problems of traditional flat-file formats and provide an efficient means for accessing and distributing EMBL data. CORBA also provides a flexible environment for users to develop their applications by building clients to our CORBA servers, which can be integrated into existing systems. PMID:11178259
Nucleotide sequences encoding a thermostable alkaline protease
Wilson, David B.; Lao, Guifang
1998-01-01
Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.
Nucleotide sequences encoding a thermostable alkaline protease
Wilson, D.B.; Lao, G.
1998-01-06
Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.
Protein sequence annotation in the genome era: the annotation concept of SWISS-PROT+TREMBL.
Apweiler, R; Gateau, A; Contrino, S; Martin, M J; Junker, V; O'Donovan, C; Lang, F; Mitaritonna, N; Kappus, S; Bairoch, A
1997-01-01
SWISS-PROT is a curated protein sequence database which strives to provide a high level of annotation, a minimal level of redundancy and high level of integration with other databases. Ongoing genome sequencing projects have dramatically increased the number of protein sequences to be incorporated into SWISS-PROT. Since we do not want to dilute the quality standards of SWISS-PROT by incorporating sequences without proper sequence analysis and annotation, we cannot speed up the incorporation of new incoming data indefinitely. However, as we also want to make the sequences available as fast as possible, we introduced TREMBL (TRanslation of EMBL nucleotide sequence database), a supplement to SWISS-PROT. TREMBL consists of computer-annotated entries in SWISS-PROT format derived from the translation of all coding sequences (CDS) in the EMBL nucleotide sequence database, except for CDS already included in SWISS-PROT. While TREMBL is already of immense value, its computer-generated annotation does not match the quality of SWISS-PROTs. The main difference is in the protein functional information attached to sequences. With this in mind, we are dedicating substantial effort to develop and apply computer methods to enhance the functional information attached to TREMBL entries.
Analysis Tool Web Services from the EMBL-EBI.
McWilliam, Hamish; Li, Weizhong; Uludag, Mahmut; Squizzato, Silvano; Park, Young Mi; Buso, Nicola; Cowley, Andrew Peter; Lopez, Rodrigo
2013-07-01
Since 2004 the European Bioinformatics Institute (EMBL-EBI) has provided access to a wide range of databases and analysis tools via Web Services interfaces. This comprises services to search across the databases available from the EMBL-EBI and to explore the network of cross-references present in the data (e.g. EB-eye), services to retrieve entry data in various data formats and to access the data in specific fields (e.g. dbfetch), and analysis tool services, for example, sequence similarity search (e.g. FASTA and NCBI BLAST), multiple sequence alignment (e.g. Clustal Omega and MUSCLE), pairwise sequence alignment and protein functional analysis (e.g. InterProScan and Phobius). The REST/SOAP Web Services (http://www.ebi.ac.uk/Tools/webservices/) interfaces to these databases and tools allow their integration into other tools, applications, web sites, pipeline processes and analytical workflows. To get users started using the Web Services, sample clients are provided covering a range of programming languages and popular Web Service tool kits, and a brief guide to Web Services technologies, including a set of tutorials, is available for those wishing to learn more and develop their own clients. Users of the Web Services are informed of improvements and updates via a range of methods.
Analysis Tool Web Services from the EMBL-EBI
McWilliam, Hamish; Li, Weizhong; Uludag, Mahmut; Squizzato, Silvano; Park, Young Mi; Buso, Nicola; Cowley, Andrew Peter; Lopez, Rodrigo
2013-01-01
Since 2004 the European Bioinformatics Institute (EMBL-EBI) has provided access to a wide range of databases and analysis tools via Web Services interfaces. This comprises services to search across the databases available from the EMBL-EBI and to explore the network of cross-references present in the data (e.g. EB-eye), services to retrieve entry data in various data formats and to access the data in specific fields (e.g. dbfetch), and analysis tool services, for example, sequence similarity search (e.g. FASTA and NCBI BLAST), multiple sequence alignment (e.g. Clustal Omega and MUSCLE), pairwise sequence alignment and protein functional analysis (e.g. InterProScan and Phobius). The REST/SOAP Web Services (http://www.ebi.ac.uk/Tools/webservices/) interfaces to these databases and tools allow their integration into other tools, applications, web sites, pipeline processes and analytical workflows. To get users started using the Web Services, sample clients are provided covering a range of programming languages and popular Web Service tool kits, and a brief guide to Web Services technologies, including a set of tutorials, is available for those wishing to learn more and develop their own clients. Users of the Web Services are informed of improvements and updates via a range of methods. PMID:23671338
Vaughan, Bob; Kaye, Jon
2018-01-24
The Genomic Standards Consortium was formed in September 2005. It is an international, open-membership working body which promotes standardization in the description of genomes and the exchange and integration of genomic data. The 2009 meeting was an activity of a five-year funding "Research Coordination Network" from the National Science Foundation and was organized held at the DOE Joint Genome Institute with organizational support provided by the JGI and by the University of California - San Diego. Bob Vaughan of EMBL on submitting MIGS/MIMS/MIENS information to EMBL-EBI's system, followed by a brief talk from Jon Kaye of the Gordon and Betty Moore Foundation on standards and the foundation's sequencing pipelines at the Genomic Standards Consortium's 8th meeting at the DOE JGI in Walnut Creek, CA on Sept. 9, 2009.
Dölz, R; Mossé, M O; Slonimski, P P; Bairoch, A; Linder, P
1994-01-01
We continued our effort to make a comprehensive database (LISTA) for the yeast Saccharomyces cerevisiae. In this database each sequence has been attributed a single genetic name. In the case of duplicated sequences a simple method has been applied to distinguish between sequences of one and the same gene from non-allelic sequences of duplicated genes. If necessary, synonyms are given in the case of allelic duplicated sequences. Thus sequences can be found either by the name or by synonyms given in LISTA. Each entry contains the genetic name, the mnemonic from the EMBL data bank, the codon bias, reference of the publication of the sequence, Chromosomal location as far as known, Swissprot and EMBL accession numbers. To obtain more information on the included sequences, each entry has been screened against non-redundant nucleotide and protein data bank collections resulting in LISTA-HON and LISTA-HOP. The LISTA data base can be linked to the associated data sets or to nucleotide and protein banks by the Sequence Retrieval System (SRS). PMID:7937046
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vaughan, Bob; Kaye, Jon
2009-09-09
The Genomic Standards Consortium was formed in September 2005. It is an international, open-membership working body which promotes standardization in the description of genomes and the exchange and integration of genomic data. The 2009 meeting was an activity of a five-year funding "Research Coordination Network" from the National Science Foundation and was organized held at the DOE Joint Genome Institute with organizational support provided by the JGI and by the University of California - San Diego. Bob Vaughan of EMBL on submitting MIGS/MIMS/MIENS information to EMBL-EBI's system, followed by a brief talk from Jon Kaye of the Gordon and Bettymore » Moore Foundation on standards and the foundation's sequencing pipelines at the Genomic Standards Consortium's 8th meeting at the DOE JGI in Walnut Creek, CA on Sept. 9, 2009.« less
DNA Nucleotide Sequence Restricted by the RI Endonuclease
Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.
1972-01-01
The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974
Lee, Yookyung; Lim, Sooyeon; Rhee, Moon-Soo; Chang, Dong-Ho; Kim, Byoung-Chan
2016-03-01
Clostridium lituseburense L74 was isolated from the larval gut of the rhinoceros beetle, Trypoxylus dichotomus collected in Yeong-dong, Chuncheongbuk-do, South Korea and subjected to whole genome sequencing on HiSeq platform and annotated on RAST. The nucleotide sequence of this genome was deposited into DDBJ/EMBL/GenBank under the accession NZ_LITJ00000000.
Federal Register 2010, 2011, 2012, 2013, 2014
2012-10-29
... DEPARTMENT OF COMMERCE Patent and Trademark Office Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request... Patent applications that contain nucleotide and/or amino acid sequence disclosures must include a copy of...
The annotation-enriched non-redundant patent sequence databases.
Li, Weizhong; Kondratowicz, Bartosz; McWilliam, Hamish; Nauche, Stephane; Lopez, Rodrigo
2013-01-01
The EMBL-European Bioinformatics Institute (EMBL-EBI) offers public access to patent sequence data, providing a valuable service to the intellectual property and scientific communities. The non-redundant (NR) patent sequence databases comprise two-level nucleotide and protein sequence clusters (NRNL1, NRNL2, NRPL1 and NRPL2) based on sequence identity (level-1) and patent family (level-2). Annotation from the source entries in these databases is merged and enhanced with additional information from the patent literature and biological context. Corrections in patent publication numbers, kind-codes and patent equivalents significantly improve the data quality. Data are available through various user interfaces including web browser, downloads via FTP, SRS, Dbfetch and EBI-Search. Sequence similarity/homology searches against the databases are available using BLAST, FASTA and PSI-Search. In this article, we describe the data collection and annotation and also outline major changes and improvements introduced since 2009. Apart from data growth, these changes include additional annotation for singleton clusters, the identifier versioning for tracking entry change and the entry mappings between the two-level databases. Database URL: http://www.ebi.ac.uk/patentdata/nr/
The Annotation-enriched non-redundant patent sequence databases
Li, Weizhong; Kondratowicz, Bartosz; McWilliam, Hamish; Nauche, Stephane; Lopez, Rodrigo
2013-01-01
The EMBL-European Bioinformatics Institute (EMBL-EBI) offers public access to patent sequence data, providing a valuable service to the intellectual property and scientific communities. The non-redundant (NR) patent sequence databases comprise two-level nucleotide and protein sequence clusters (NRNL1, NRNL2, NRPL1 and NRPL2) based on sequence identity (level-1) and patent family (level-2). Annotation from the source entries in these databases is merged and enhanced with additional information from the patent literature and biological context. Corrections in patent publication numbers, kind-codes and patent equivalents significantly improve the data quality. Data are available through various user interfaces including web browser, downloads via FTP, SRS, Dbfetch and EBI-Search. Sequence similarity/homology searches against the databases are available using BLAST, FASTA and PSI-Search. In this article, we describe the data collection and annotation and also outline major changes and improvements introduced since 2009. Apart from data growth, these changes include additional annotation for singleton clusters, the identifier versioning for tracking entry change and the entry mappings between the two-level databases. Database URL: http://www.ebi.ac.uk/patentdata/nr/ PMID:23396323
Nucleotide sequencing and identification of some wild mushrooms.
Das, Sudip Kumar; Mandal, Aninda; Datta, Animesh K; Gupta, Sudha; Paul, Rita; Saha, Aditi; Sengupta, Sonali; Dubey, Priyanka Kumari
2013-01-01
The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India) was amplified using ITS1 (Internal Transcribed Spacers 1) and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base) of Amanita hemibapha [CN (Chota Nagpur) 1, % identity 99 (JX844716.1)], Amanita sp. [CN 2, % identity 98 (JX844763.1)], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1)], Termitomyces sp. [CN 4, % identity 90 (JF746992.1)], Termitomyces sp. [CN 5, % identity 99 (GU001667.1)], T. microcarpus [CN 6, % identity 82 (EF421077.1)], Termitomyces sp. [CN 7, % identity 76 (JF746993.1)], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1)]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.
Nucleotide sequences specific to Brucella and methods for the detection of Brucella
DOE Office of Scientific and Technical Information (OSTI.GOV)
McCready, Paula M; Radnedge, Lyndsay; Andersen, Gary L
Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.
The ChEMBL database as linked open data
2013-01-01
Background Making data available as Linked Data using Resource Description Framework (RDF) promotes integration with other web resources. RDF documents can natively link to related data, and others can link back using Uniform Resource Identifiers (URIs). RDF makes the data machine-readable and uses extensible vocabularies for additional information, making it easier to scale up inference and data analysis. Results This paper describes recent developments in an ongoing project converting data from the ChEMBL database into RDF triples. Relative to earlier versions, this updated version of ChEMBL-RDF uses recently introduced ontologies, including CHEMINF and CiTO; exposes more information from the database; and is now available as dereferencable, linked data. To demonstrate these new features, we present novel use cases showing further integration with other web resources, including Bio2RDF, Chem2Bio2RDF, and ChemSpider, and showing the use of standard ontologies for querying. Conclusions We have illustrated the advantages of using open standards and ontologies to link the ChEMBL database to other databases. Using those links and the knowledge encoded in standards and ontologies, the ChEMBL-RDF resource creates a foundation for integrated semantic web cheminformatics applications, such as the presented decision support. PMID:23657106
Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.
Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O
1987-06-01
The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.
myChEMBL: a virtual machine implementation of open data and cheminformatics tools.
Ochoa, Rodrigo; Davies, Mark; Papadatos, George; Atkinson, Francis; Overington, John P
2014-01-15
myChEMBL is a completely open platform, which combines public domain bioactivity data with open source database and cheminformatics technologies. myChEMBL consists of a Linux (Ubuntu) Virtual Machine featuring a PostgreSQL schema with the latest version of the ChEMBL database, as well as the latest RDKit cheminformatics libraries. In addition, a self-contained web interface is available, which can be modified and improved according to user specifications. The VM is available at: ftp://ftp.ebi.ac.uk/pub/databases/chembl/VM/myChEMBL/current. The web interface and web services code is available at: https://github.com/rochoa85/myChEMBL.
VarDetect: a nucleotide sequence variation exploratory tool
Ngamphiw, Chumpol; Kulawonganunchai, Supasak; Assawamakin, Anunchai; Jenwitheesuk, Ekachai; Tongsima, Sissades
2008-01-01
Background Single nucleotide polymorphisms (SNPs) are the most commonly studied units of genetic variation. The discovery of such variation may help to identify causative gene mutations in monogenic diseases and SNPs associated with predisposing genes in complex diseases. Accurate detection of SNPs requires software that can correctly interpret chromatogram signals to nucleotides. Results We present VarDetect, a stand-alone nucleotide variation exploratory tool that automatically detects nucleotide variation from fluorescence based chromatogram traces. Accurate SNP base-calling is achieved using pre-calculated peak content ratios, and is enhanced by rules which account for common sequence reading artifacts. The proposed software tool is benchmarked against four other well-known SNP discovery software tools (PolyPhred, novoSNP, Genalys and Mutation Surveyor) using fluorescence based chromatograms from 15 human genes. These chromatograms were obtained from sequencing 16 two-pooled DNA samples; a total of 32 individual DNA samples. In this comparison of automatic SNP detection tools, VarDetect achieved the highest detection efficiency. Availability VarDetect is compatible with most major operating systems such as Microsoft Windows, Linux, and Mac OSX. The current version of VarDetect is freely available at . PMID:19091032
Non-redundant patent sequence databases with value-added annotations at two levels
Li, Weizhong; McWilliam, Hamish; de la Torre, Ana Richart; Grodowski, Adam; Benediktovich, Irina; Goujon, Mickael; Nauche, Stephane; Lopez, Rodrigo
2010-01-01
The European Bioinformatics Institute (EMBL-EBI) provides public access to patent data, including abstracts, chemical compounds and sequences. Sequences can appear multiple times due to the filing of the same invention with multiple patent offices, or the use of the same sequence by different inventors in different contexts. Information relating to the source invention may be incomplete, and biological information available in patent documents elsewhere may not be reflected in the annotation of the sequence. Search and analysis of these data have become increasingly challenging for both the scientific and intellectual-property communities. Here, we report a collection of non-redundant patent sequence databases, which cover the EMBL-Bank nucleotides patent class and the patent protein databases and contain value-added annotations from patent documents. The databases were created at two levels by the use of sequence MD5 checksums. Sequences within a level-1 cluster are 100% identical over their whole length. Level-2 clusters were defined by sub-grouping level-1 clusters based on patent family information. Value-added annotations, such as publication number corrections, earliest publication dates and feature collations, significantly enhance the quality of the data, allowing for better tracking and cross-referencing. The databases are available format: http://www.ebi.ac.uk/patentdata/nr/. PMID:19884134
Non-redundant patent sequence databases with value-added annotations at two levels.
Li, Weizhong; McWilliam, Hamish; de la Torre, Ana Richart; Grodowski, Adam; Benediktovich, Irina; Goujon, Mickael; Nauche, Stephane; Lopez, Rodrigo
2010-01-01
The European Bioinformatics Institute (EMBL-EBI) provides public access to patent data, including abstracts, chemical compounds and sequences. Sequences can appear multiple times due to the filing of the same invention with multiple patent offices, or the use of the same sequence by different inventors in different contexts. Information relating to the source invention may be incomplete, and biological information available in patent documents elsewhere may not be reflected in the annotation of the sequence. Search and analysis of these data have become increasingly challenging for both the scientific and intellectual-property communities. Here, we report a collection of non-redundant patent sequence databases, which cover the EMBL-Bank nucleotides patent class and the patent protein databases and contain value-added annotations from patent documents. The databases were created at two levels by the use of sequence MD5 checksums. Sequences within a level-1 cluster are 100% identical over their whole length. Level-2 clusters were defined by sub-grouping level-1 clusters based on patent family information. Value-added annotations, such as publication number corrections, earliest publication dates and feature collations, significantly enhance the quality of the data, allowing for better tracking and cross-referencing. The databases are available format: http://www.ebi.ac.uk/patentdata/nr/.
The nucleotide sequence and genome organization of Plasmopara halstedii virus.
Heller-Dohmen, Marion; Göpfert, Jens C; Pfannstiel, Jens; Spring, Otmar
2011-03-17
Only very few viruses of Oomycetes have been studied in detail. Isometric virions were found in different isolates of the oomycete Plasmopara halstedii, the downy mildew pathogen of sunflower. However, complete nucleotide sequences and data on the genome organization were lacking. Viral RNA of different P. halstedii isolates was subjected to nucleotide sequencing and analysis of the viral genome. The N-terminal sequence of the viral coat protein was determined using Top-Down MALDI-TOF analysis. The complete nucleotide sequences of both single-stranded RNA segments (RNA1 and RNA2) were established. RNA1 consisted of 2793 nucleotides (nt) exclusive its 3' poly(A) tract and a single open-reading frame (ORF1) of 2745 nt. ORF1 was framed by a 5' untranslated region (5' UTR) of 18 nt and a 3' untranslated region (3' UTR) of 30 nt. ORF1 contained motifs of RNA-dependent RNA polymerases (RdRp) and showed similarities to RdRp of Scleropthora macrospora virus A (SmV A) and viruses within the Nodaviridae family. RNA2 consisted of 1526 nt exclusive its 3' poly(A) tract and a second ORF (ORF2) of 1128 nt. ORF2 coded for the single viral coat protein (CP) and was framed by a 5' UTR of 164 nt and a 3' UTR of 234 nt. The deduced amino acid sequence of ORF2 was verified by nano-LC-ESI-MS/MS experiments. Top-Down MALDI-TOF analysis revealed the N-terminal sequence of the CP. The N-terminal sequence represented a region within ORF2 suggesting a proteolytic processing of the CP in vivo. The CP showed similarities to CP of SmV A and viruses within the Tombusviridae family. Fragments of RNA1 (ca. 1.9 kb) and RNA2 (ca. 1.4 kb) were used to analyze the nucleotide sequence variation of virions in different P. halstedii isolates. Viral sequence variation was 0.3% or less regardless of their host's pathotypes, the geographical origin and the sensitivity towards the fungicide metalaxyl. The results showed the presence of a single and new virus type in different P. halstedii isolates
37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...
37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 37 Patents, Trademarks, and Copyrights 1 2011-07-01 2011-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...
Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.
Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant
2017-11-28
Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.
ChEMBL web services: streamlining access to drug discovery data and utilities
Davies, Mark; Nowotka, Michał; Papadatos, George; Dedman, Nathan; Gaulton, Anna; Atkinson, Francis; Bellis, Louisa; Overington, John P.
2015-01-01
ChEMBL is now a well-established resource in the fields of drug discovery and medicinal chemistry research. The ChEMBL database curates and stores standardized bioactivity, molecule, target and drug data extracted from multiple sources, including the primary medicinal chemistry literature. Programmatic access to ChEMBL data has been improved by a recent update to the ChEMBL web services (version 2.0.x, https://www.ebi.ac.uk/chembl/api/data/docs), which exposes significantly more data from the underlying database and introduces new functionality. To complement the data-focused services, a utility service (version 1.0.x, https://www.ebi.ac.uk/chembl/api/utils/docs), which provides RESTful access to commonly used cheminformatics methods, has also been concurrently developed. The ChEMBL web services can be used together or independently to build applications and data processing workflows relevant to drug discovery and chemical biology. PMID:25883136
ChEMBL web services: streamlining access to drug discovery data and utilities.
Davies, Mark; Nowotka, Michał; Papadatos, George; Dedman, Nathan; Gaulton, Anna; Atkinson, Francis; Bellis, Louisa; Overington, John P
2015-07-01
ChEMBL is now a well-established resource in the fields of drug discovery and medicinal chemistry research. The ChEMBL database curates and stores standardized bioactivity, molecule, target and drug data extracted from multiple sources, including the primary medicinal chemistry literature. Programmatic access to ChEMBL data has been improved by a recent update to the ChEMBL web services (version 2.0.x, https://www.ebi.ac.uk/chembl/api/data/docs), which exposes significantly more data from the underlying database and introduces new functionality. To complement the data-focused services, a utility service (version 1.0.x, https://www.ebi.ac.uk/chembl/api/utils/docs), which provides RESTful access to commonly used cheminformatics methods, has also been concurrently developed. The ChEMBL web services can be used together or independently to build applications and data processing workflows relevant to drug discovery and chemical biology. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Interactive computer programs for the graphic analysis of nucleotide sequence data.
Luckow, V A; Littlewood, R K; Rownd, R H
1984-01-01
A group of interactive computer programs have been developed which aid in the collection and graphical analysis of nucleotide and protein sequence data. The programs perform the following basic functions: a) enter, edit, list, and rearrange sequence data; b) permit automatic entry of nucleotide sequence data directly from an autoradiograph into the computer; c) search for restriction sites or other specified patterns and plot a linear or circular restriction map, or print their locations; d) plot base composition; e) analyze homology between sequences by plotting a two-dimensional graphic matrix; and f) aid in plotting predicted secondary structures of RNA molecules. PMID:6546437
WEB-server for search of a periodicity in amino acid and nucleotide sequences
NASA Astrophysics Data System (ADS)
E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.
2017-12-01
A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.
Nucleotide sequences specific to Yersinia pestis and methods for the detection of Yersinia pestis
McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Motin, Vladinir L [League City, TX
2009-02-24
Nucleotide sequences specific to Yersinia pestis that serve as markers or signatures for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.
Information capacity of nucleotide sequences and its applications.
Sadovsky, M G
2006-05-01
The information capacity of nucleotide sequences is defined through the specific entropy of frequency dictionary of a sequence determined with respect to another one containing the most probable continuations of shorter strings. This measure distinguishes a sequence both from a random one, and from ordered entity. A comparison of sequences based on their information capacity is studied. An order within the genetic entities is found at the length scale ranged from 3 to 8. Some other applications of the developed methodology to genetics, bioinformatics, and molecular biology are discussed.
Nucleotide sequences of Japanese isolates of citrus vein enation virus.
Nakazono-Nagaoka, Eiko; Fujikawa, Takashi; Iwanami, Toru
2017-03-01
The genomic sequences of five Japanese isolates of citrus vein enation virus (CVEV) isolates that induce vein enation were determined and compared with that of the Spanish isolate VE-1. The nucleotide sequences of all Japanese isolates were 5,983 nt in length. The genomic RNA of Japanese isolates had five potential open reading frames (ORF 0, ORF 1, ORF 2, ORF 3, and ORF 5) in the positive-sense strand. The nucleotide sequence identity among the Japanese isolates and Spanish isolate VE-1 ranged from 98.0% to 99.8%. Comparison of the partial amino acid sequences of ten Japanese isolates and three Spanish isolates suggested that four amino acid residues, at positions of 83, 104, and 113 in ORF 2 and position 41 in ORF 5, might be unique to some Japanese isolates.
Dölz, R; Mossé, M O; Slonimski, P P; Bairoch, A; Linder, P
1996-01-01
We continued our effort to make a comprehensive database (LISTA) for the yeast Saccharomyces cerevisiae. As in previous editions the genetic names are consistently associated to each sequence with a known and confirmed ORF. If necessary, synonyms are given in the case of allelic duplicated sequences. Although the first publication of a sequence gives-according to our rules-the genetic name of a gene, in some instances more commonly used names are given to avoid nomenclature problems and the use of ancient designations which are no longer used. In these cases the old designation is given as synonym. Thus sequences can be found either by the name or by synonyms given in LISTA. Each entry contains the genetic name, the mnemonic from the EMBL data bank, the codon bias, reference of the publication of the sequence, Chromosomal location as far as known, SWISSPROT and EMBL accession numbers. New entries will also contain the name from the systematic sequencing efforts. Since the release of LISTA4.1 we update the database continuously. To obtain more information on the included sequences, each entry has been screened against non-redundant nucleotide and protein data bank collections resulting in LISTA-HON and LISTA-HOP. This release includes reports from full Smith and Watermann peptide-level searches against a non-redundant protein sequence database. The LISTA data base can be linked to the associated data sets or to nucleotide and protein banks by the Sequence Retrieval System (SRS). The database is available by FTP and on World Wide Web. PMID:8594599
Shahid, M S; Yoshida, S; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T
2013-06-01
Carica papaya (papaya) is a fruit crop that is cultivated mostly in kitchen gardens throughout Nepal. Leaf samples of C. papaya plants with leaf curling, vein darkening, vein thickening, and a reduction in leaf size were collected from a garden in Darai village, Rampur, Nepal in 2010. Full-length clones of a monopartite Begomovirus, a betasatellite and an alphasatellite were isolated. The complete nucleotide sequence of the Begomovirus showed the arrangement of genes typical of Old World begomoviruses with the highest nucleotide sequence identity (>99 %) to an isolate of Ageratum yellow vein virus (AYVV), confirming it as an isolate of AYVV. The complete nucleotide sequence of betasatellite showed greater than 89 % nucleotide sequence identity to an isolate of Tomato leaf curl Java betasatellite originating from Indonesian. The sequence of the alphasatellite displayed 92 % nucleotide sequence identity to Sida yellow vein China alphasatellite. This is the first identification of these components in Nepal and the first time they have been identified in papaya.
McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA
2007-02-06
Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.
McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA
2009-02-24
Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.
Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R. Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M.; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas
2011-01-01
Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi. PMID:21949797
PPDMs-a resource for mapping small molecule bioactivities from ChEMBL to Pfam-A protein domains.
Kruger, Felix A; Gaulton, Anna; Nowotka, Michal; Overington, John P
2015-03-01
PPDMs is a resource that maps small molecule bioactivities to protein domains from the Pfam-A collection of protein families. Small molecule bioactivities mapped to protein domains add important precision to approaches that use protein sequence searches alignments to assist applications in computational drug discovery and systems and chemical biology. We have previously proposed a mapping heuristic for a subset of bioactivities stored in ChEMBL with the Pfam-A domain most likely to mediate small molecule binding. We have since refined this mapping using a manual procedure. Here, we present a resource that provides up-to-date mappings and the possibility to review assigned mappings as well as to participate in their assignment and curation. We also describe how mappings provided through the PPDMs resource are made accessible through the main schema of the ChEMBL database. The PPDMs resource and curation interface is available at https://www.ebi.ac.uk/chembl/research/ppdms/pfam_maps. The source-code for PPDMs is available under the Apache license at https://github.com/chembl/pfam_maps. Source code is available at https://github.com/chembl/pfam_map_loader to demonstrate the integration process with the main schema of ChEMBL. © The Author 2014. Published by Oxford University Press.
Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A
2012-05-01
The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.
Squizzato, Silvano; Park, Young Mi; Buso, Nicola; Gur, Tamer; Cowley, Andrew; Li, Weizhong; Uludag, Mahmut; Pundir, Sangya; Cham, Jennifer A; McWilliam, Hamish; Lopez, Rodrigo
2015-07-01
The European Bioinformatics Institute (EMBL-EBI-https://www.ebi.ac.uk) provides free and unrestricted access to data across all major areas of biology and biomedicine. Searching and extracting knowledge across these domains requires a fast and scalable solution that addresses the requirements of domain experts as well as casual users. We present the EBI Search engine, referred to here as 'EBI Search', an easy-to-use fast text search and indexing system with powerful data navigation and retrieval capabilities. API integration provides access to analytical tools, allowing users to further investigate the results of their search. The interconnectivity that exists between data resources at EMBL-EBI provides easy, quick and precise navigation and a better understanding of the relationship between different data types including sequences, genes, gene products, proteins, protein domains, protein families, enzymes and macromolecular structures, together with relevant life science literature. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
The EMBL-EBI bioinformatics web and programmatic tools framework.
Li, Weizhong; Cowley, Andrew; Uludag, Mahmut; Gur, Tamer; McWilliam, Hamish; Squizzato, Silvano; Park, Young Mi; Buso, Nicola; Lopez, Rodrigo
2015-07-01
Since 2009 the EMBL-EBI Job Dispatcher framework has provided free access to a range of mainstream sequence analysis applications. These include sequence similarity search services (https://www.ebi.ac.uk/Tools/sss/) such as BLAST, FASTA and PSI-Search, multiple sequence alignment tools (https://www.ebi.ac.uk/Tools/msa/) such as Clustal Omega, MAFFT and T-Coffee, and other sequence analysis tools (https://www.ebi.ac.uk/Tools/pfa/) such as InterProScan. Through these services users can search mainstream sequence databases such as ENA, UniProt and Ensembl Genomes, utilising a uniform web interface or systematically through Web Services interfaces (https://www.ebi.ac.uk/Tools/webservices/) using common programming languages, and obtain enriched results with novel visualisations. Integration with EBI Search (https://www.ebi.ac.uk/ebisearch/) and the dbfetch retrieval service (https://www.ebi.ac.uk/Tools/dbfetch/) further expands the usefulness of the framework. New tools and updates such as NCBI BLAST+, InterProScan 5 and PfamScan, new categories such as RNA analysis tools (https://www.ebi.ac.uk/Tools/rna/), new databases such as ENA non-coding, WormBase ParaSite, Pfam and Rfam, and new workflow methods, together with the retirement of depreciated services, ensure that the framework remains relevant to today's biological community. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Extension of the COG and arCOG databases by amino acid and nucleotide sequences
Meereis, Florian; Kaufmann, Michael
2008-01-01
Background The current versions of the COG and arCOG databases, both excellent frameworks for studies in comparative and functional genomics, do not contain the nucleotide sequences corresponding to their protein or protein domain entries. Results Using sequence information obtained from GenBank flat files covering the completely sequenced genomes of the COG and arCOG databases, we constructed NUCOCOG (nucleotide sequences containing COG databases) as an extended version including all nucleotide sequences and in addition the amino acid sequences originally utilized to construct the current COG and arCOG databases. We make available three comprehensive single XML files containing the complete databases including all sequence information. In addition, we provide a web interface as a utility suitable to browse the NUCOCOG database for sequence retrieval. The database is accessible at . Conclusion NUCOCOG offers the possibility to analyze any sequence related property in the context of the COG and arCOG framework simply by using script languages such as PERL applied to a large but single XML document. PMID:19014535
37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.
Code of Federal Regulations, 2011 CFR
2011-07-01
... for nucleotide and/or amino acid sequence data. 1.822 Section 1.822 Patents, Trademarks, and... Amino Acid Sequences § 1.822 Symbols and format to be used for nucleotide and/or amino acid sequence data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...
Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián
2014-06-01
The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.
Nucleotide sequence composition and method for detection of neisseria gonorrhoeae
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lo, A.; Yang, H.L.
1990-02-13
This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.
Hunt, C; Morimoto, R I
1985-01-01
We have determined the nucleotide sequence of the human hsp70 gene and 5' flanking region. The hsp70 gene is transcribed as an uninterrupted primary transcript of 2440 nucleotides composed of a 5' noncoding leader sequence of 212 nucleotides, a 3' noncoding region of 242 nucleotides, and a continuous open reading frame of 1986 nucleotides that encodes a protein with predicted molecular mass of 69,800 daltons. Upstream of the 5' terminus are the canonical TATAAA box, the sequence ATTGG that corresponds in the inverted orientation to the CCAAT motif, and the dyad sequence CTGGAAT/ATTCCCG that shares homology in 12 of 14 positions with the consensus transcription regulatory sequence common to Drosophila heat shock genes. Comparison of the predicted amino acid sequences of human hsp70 with the published sequences of Drosophila hsp70 and Escherichia coli dnaK reveals that human hsp70 is 73% identical to Drosophila hsp70 and 47% identical to E. coli dnaK. Surprisingly, the nucleotide sequences of the human and Drosophila genes are 72% identical and human and E. coli genes are 50% identical, which is more highly conserved than necessary given the degeneracy of the genetic code. The lack of accumulated silent nucleotide substitutions leads us to propose that there may be additional information in the nucleotide sequence of the hsp70 gene or the corresponding mRNA that precludes the maximum divergence allowed in the silent codon positions. PMID:3931075
SureChEMBL: a large-scale, chemically annotated patent document database
Papadatos, George; Davies, Mark; Dedman, Nathan; Chambers, Jon; Gaulton, Anna; Siddle, James; Koks, Richard; Irvine, Sean A.; Pettersson, Joe; Goncharoff, Nicko; Hersey, Anne; Overington, John P.
2016-01-01
SureChEMBL is a publicly available large-scale resource containing compounds extracted from the full text, images and attachments of patent documents. The data are extracted from the patent literature according to an automated text and image-mining pipeline on a daily basis. SureChEMBL provides access to a previously unavailable, open and timely set of annotated compound-patent associations, complemented with sophisticated combined structure and keyword-based search capabilities against the compound repository and patent document corpus; given the wealth of knowledge hidden in patent documents, analysis of SureChEMBL data has immediate applications in drug discovery, medicinal chemistry and other commercial areas of chemical science. Currently, the database contains 17 million compounds extracted from 14 million patent documents. Access is available through a dedicated web-based interface and data downloads at: https://www.surechembl.org/. PMID:26582922
Statistical analysis of nucleotide sequences of the hemagglutinin gene of human influenza A viruses.
Ina, Y; Gojobori, T
1994-01-01
To examine whether positive selection operates on the hemagglutinin 1 (HA1) gene of human influenza A viruses (H1 subtype), 21 nucleotide sequences of the HA1 gene were statistically analyzed. The nucleotide sequences were divided into antigenic and nonantigenic sites. The nucleotide diversities for antigenic and nonantigenic sites of the HA1 gene were computed at synonymous and nonsynonymous sites separately. For nonantigenic sites, the nucleotide diversities were larger at synonymous sites than at nonsynonymous sites. This is consistent with the neutral theory of molecular evolution. For antigenic sites, however, the nucleotide diversities at nonsynonymous sites were larger than those at synonymous sites. These results suggest that positive selection operates on antigenic sites of the HA1 gene of human influenza A viruses (H1 subtype). PMID:8078892
Nucleotide sequence of a resistance breaking mutant of southern bean mosaic virus.
Lee, L; Anderson, E J
1998-01-01
SBMV-S is a resistance-breaking mutant of an Arkansas isolate of the bean strain of southern bean mosaic virus (SBMV-BARK) that is able to move systemically in Phaseolus vulgaris cvs. Pinto and Great Northern, whereas the wild-type SBMV-BARK causes local necrotic lesions and is restricted to the inoculated leaves of these hosts. Sequence analysis of the 4136 nucleotide genomes of SBMV-BARK and SBMV-S revealed seven nucleotide differences, but only four deduced amino acid changes. A single amino acid change occurred in the C-terminal region of the putative RNA-dependent RNA polymerase and three differences were identified in the N-terminal portion of the virus coat protein. SBMV-BARK and SBMV-S were compared with other sobemoviruses and were found to contain a high level of nucleotide sequence identity (91.3%) to SBMV-B. Unlike SBMV-B however, SBMV-BARK and SBMV-S contained four putative overlapping open reading frames, making them more similar in genome organization to the cowpea strain, SBMV-C. The possibility exists that mutations or even errors, that resulted in mis-identification of open reading frames, occurred in previously published information on nucleotide sequence and genomic organization for SBMV-B.
Nucleotide-Specific Contrast for DNA Sequencing by Electron Spectroscopy.
Mankos, Marian; Persson, Henrik H J; N'Diaye, Alpha T; Shadman, Khashayar; Schmid, Andreas K; Davis, Ronald W
2016-01-01
DNA sequencing by imaging in an electron microscope is an approach that holds promise to deliver long reads with low error rates and without the need for amplification. Earlier work using transmission electron microscopes, which use high electron energies on the order of 100 keV, has shown that low contrast and radiation damage necessitates the use of heavy atom labeling of individual nucleotides, which increases the read error rates. Other prior work using scattering electrons with much lower energy has shown to suppress beam damage on DNA. Here we explore possibilities to increase contrast by employing two methods, X-ray photoelectron and Auger electron spectroscopy. Using bulk DNA samples with monomers of each base, both methods are shown to provide contrast mechanisms that can distinguish individual nucleotides without labels. Both spectroscopic techniques can be readily implemented in a low energy electron microscope, which may enable label-free DNA sequencing by direct imaging.
Nucleotide-Specific Contrast for DNA Sequencing by Electron Spectroscopy
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mankos, Marian; Persson, Henrik H. J.; N’Diaye, Alpha T.
DNA sequencing by imaging in an electron microscope is an approach that holds promise to deliver long reads with low error rates and without the need for amplification. Earlier work using transmission electron microscopes, which use high electron energies on the order of 100 keV, has shown that low contrast and radiation damage necessitates the use of heavy atom labeling of individual nucleotides, which increases the read error rates. Other prior work using scattering electrons with much lower energy has shown to suppress beam damage on DNA. Here we explore possibilities to increase contrast by employing two methods, X-ray photoelectronmore » and Auger electron spectroscopy. Using bulk DNA samples with monomers of each base, both methods are shown to provide contrast mechanisms that can distinguish individual nucleotides without labels. In conclusion, both spectroscopic techniques can be readily implemented in a low energy electron microscope, which may enable label-free DNA sequencing by direct imaging.« less
Nucleotide-Specific Contrast for DNA Sequencing by Electron Spectroscopy
Mankos, Marian; Persson, Henrik H. J.; N’Diaye, Alpha T.; ...
2016-05-05
DNA sequencing by imaging in an electron microscope is an approach that holds promise to deliver long reads with low error rates and without the need for amplification. Earlier work using transmission electron microscopes, which use high electron energies on the order of 100 keV, has shown that low contrast and radiation damage necessitates the use of heavy atom labeling of individual nucleotides, which increases the read error rates. Other prior work using scattering electrons with much lower energy has shown to suppress beam damage on DNA. Here we explore possibilities to increase contrast by employing two methods, X-ray photoelectronmore » and Auger electron spectroscopy. Using bulk DNA samples with monomers of each base, both methods are shown to provide contrast mechanisms that can distinguish individual nucleotides without labels. In conclusion, both spectroscopic techniques can be readily implemented in a low energy electron microscope, which may enable label-free DNA sequencing by direct imaging.« less
37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.
Code of Federal Regulations, 2014 CFR
2014-07-01
...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2014-07-01 2014-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...
37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.
Code of Federal Regulations, 2013 CFR
2013-07-01
...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2013-07-01 2013-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...
37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.
Code of Federal Regulations, 2012 CFR
2012-07-01
...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2012-07-01 2012-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...
SureChEMBL: a large-scale, chemically annotated patent document database.
Papadatos, George; Davies, Mark; Dedman, Nathan; Chambers, Jon; Gaulton, Anna; Siddle, James; Koks, Richard; Irvine, Sean A; Pettersson, Joe; Goncharoff, Nicko; Hersey, Anne; Overington, John P
2016-01-04
SureChEMBL is a publicly available large-scale resource containing compounds extracted from the full text, images and attachments of patent documents. The data are extracted from the patent literature according to an automated text and image-mining pipeline on a daily basis. SureChEMBL provides access to a previously unavailable, open and timely set of annotated compound-patent associations, complemented with sophisticated combined structure and keyword-based search capabilities against the compound repository and patent document corpus; given the wealth of knowledge hidden in patent documents, analysis of SureChEMBL data has immediate applications in drug discovery, medicinal chemistry and other commercial areas of chemical science. Currently, the database contains 17 million compounds extracted from 14 million patent documents. Access is available through a dedicated web-based interface and data downloads at: https://www.surechembl.org/. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
The complete nucleotide sequence of the glnALG operon of Escherichia coli K12.
Miranda-Ríos, J; Sánchez-Pescador, R; Urdea, M; Covarrubias, A A
1987-01-01
The nucleotide sequence of the E. coli glnALG operon has been determined. The glnL (ntrB) and glnG (ntrC) genes present a high homology, at the nucleotide and aminoacid levels, with the corresponding genes of Klebsiella pneumoniae. The predicted aminoacid sequence for glutamine synthetase allowed us to locate some of the enzyme domains. The structure of this operon is discussed. PMID:2882477
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
Hori, H; Osawa, S; Murao, K; Ishikura, H
1980-01-01
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979
Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.
Le Gall, O; Candresse, T; Brault, V; Dunez, J
1989-01-01
The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein. PMID:2798128
Nowotka, Michał M; Gaulton, Anna; Mendez, David; Bento, A Patricia; Hersey, Anne; Leach, Andrew
2017-08-01
ChEMBL is a manually curated database of bioactivity data on small drug-like molecules, used by drug discovery scientists. Among many access methods, a REST API provides programmatic access, allowing the remote retrieval of ChEMBL data and its integration into other applications. This approach allows scientists to move from a world where they go to the ChEMBL web site to search for relevant data, to one where ChEMBL data can be simply integrated into their everyday tools and work environment. Areas covered: This review highlights some of the audiences who may benefit from using the ChEMBL API, and the goals they can address, through the description of several use cases. The examples cover a team communication tool (Slack), a data analytics platform (KNIME), batch job management software (Luigi) and Rich Internet Applications. Expert opinion: The advent of web technologies, cloud computing and micro services oriented architectures have made REST APIs an essential ingredient of modern software development models. The widespread availability of tools consuming RESTful resources have made them useful for many groups of users. The ChEMBL API is a valuable resource of drug discovery bioactivity data for professional chemists, chemistry students, data scientists, scientific and web developers.
Chen, Qingyu; Zobel, Justin; Verspoor, Karin
2017-01-01
GenBank, the EMBL European Nucleotide Archive and the DNA DataBank of Japan, known collectively as the International Nucleotide Sequence Database Collaboration or INSDC, are the three most significant nucleotide sequence databases. Their records are derived from laboratory work undertaken by different individuals, by different teams, with a range of technologies and assumptions and over a period of decades. As a consequence, they contain a great many duplicates, redundancies and inconsistencies, but neither the prevalence nor the characteristics of various types of duplicates have been rigorously assessed. Existing duplicate detection methods in bioinformatics only address specific duplicate types, with inconsistent assumptions; and the impact of duplicates in bioinformatics databases has not been carefully assessed, making it difficult to judge the value of such methods. Our goal is to assess the scale, kinds and impact of duplicates in bioinformatics databases, through a retrospective analysis of merged groups in INSDC databases. Our outcomes are threefold: (1) We analyse a benchmark dataset consisting of duplicates manually identified in INSDC—a dataset of 67 888 merged groups with 111 823 duplicate pairs across 21 organisms from INSDC databases – in terms of the prevalence, types and impacts of duplicates. (2) We categorize duplicates at both sequence and annotation level, with supporting quantitative statistics, showing that different organisms have different prevalence of distinct kinds of duplicate. (3) We show that the presence of duplicates has practical impact via a simple case study on duplicates, in terms of GC content and melting temperature. We demonstrate that duplicates not only introduce redundancy, but can lead to inconsistent results for certain tasks. Our findings lead to a better understanding of the problem of duplication in biological databases. Database URL: the merged records are available at https
Control of total GFP expression by alterations to the 3′ region nucleotide sequence
2013-01-01
Background Previously, we distinguished the Escherichia coli type II cytoplasmic membrane translocation pathways of Tat, Yid, and Sec for unfolded and folded soluble target proteins. The translocation of folded protein to the periplasm for soluble expression via the Tat pathway was controlled by an N-terminal hydrophilic leader sequence. In this study, we investigated the effect of the hydrophilic C-terminal end and its nucleotide sequence on total and soluble protein expression. Results The native hydrophilic C-terminal end of GFP was obtained by deleting the C-terminal peptide LeuGlu-6×His, derived from pET22b(+). The corresponding clones induced total and soluble GFP expression that was either slightly increased or dramatically reduced, apparently through reconstruction of the nucleotide sequence around the stop codon in the 3′ region. In the expression-induced clones, the hydrophilic C-terminus showed increased Tat pathway specificity for soluble expression. However, in the expression-reduced clone, after analyzing the role of the 5′ poly(A) coding sequence with a substituted synonymous codon, we proved that the longer 5′ poly(A) coding sequence interacted with the reconstructed 3′ region nucleotide sequence to create a new mRNA tertiary structure between the 5′ and 3′ regions, which resulted in reduced total GFP expression. Further, to recover the reduced expression by changing the 3′ nucleotide sequence, after replacing selected C-terminal 5′ codons and the stop codon in the ORF with synonymous codons, total GFP expression in most of the clones was recovered to the undeleted control level. The insertion of trinucleotides after the stop codon in the 3′-UTR recovered or reduced total GFP expression. RT-PCR revealed that the level of total protein expression was controlled by changes in translational or transcriptional regulation, which were induced or reduced by the substitution or insertion of 3′ region nucleotides. Conclusions We found
Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M
1982-01-01
The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460
Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue
2016-01-01
DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962
USDA-ARS?s Scientific Manuscript database
A new species of the family Alphaflexiviridae provisionally named Alfalfa virus S (AVS) was diagnosed in alfalfa samples originating from Sudan. A complete nucleotide sequence of the viral genome consisting of 8,349 nucleotides excluding the 3’ poly(A) tail was determined by Illumina NGS technology ...
Hop stunt viroid: molecular cloning and nucleotide sequence of the complete cDNA copy.
Ohno, T; Takamatsu, N; Meshi, T; Okada, Y
1983-01-01
The complete cDNA of hop stunt viroid (HSV) has been cloned by the method of Okayama and Berg (Mol.Cell.Biol.2,161-170. (1982] and the complete nucleotide sequence has been established. The covalently closed circular single-stranded HSV RNA consists of 297 nucleotides. The secondary structure predicted for HSV contains 67% of its residues base-paired. The native HSV can possess an extended rod-like structure characteristic of viroids previously established. The central region of the native HSV has a similar structure to the conserved region found in all viroids sequenced so far except for avocado sunblotch viroid. The sequence homologous to the 5'-end of U1a RNA is also found in the sequence of HSV but not in the central conserved region. Images PMID:6312412
Hammond, R; Smith, D R; Diener, T O
1989-01-01
The Columnea latent viroid (CLV) occurs latently in certain Columnea erythrophae plants grown commercially. In potato and tomato, CLV causes potato spindle tuber viroid (PSTV)-like symptoms. Its nucleotide sequence and proposed secondary structure reveal that CLV consists of a single-stranded circular RNA of 370 nucleotides which can assume a rod-like structure with extensive base-pairing characteristic of all known viroids. The electrophoretic mobility of circular CLV under nondenaturing conditions suggests a potential tertiary structure. CLV contains extensive sequence homologies to the PSTV group of viroids but contains a central conserved region identical to that of hop stunt viroid (HSV). CLV also shares some biological properties with each of the two types of viroids. Most probably, CLV is the result of intracellular RNA recombination between an HSV-type and one or more PSTV-type viroids replicating in the same plant. Images PMID:2602114
Hughes, M. S.; Hoey, E. M.; Coyle, P. V.
1993-01-01
Ten coxsackievirus B4 (CVB4) strains isolated from clinical and environmental sources in Northern Ireland in 1985-7, were compared at the nucleotide sequence level. Dideoxynucleotide sequencing of a polymerase chain reaction (PCR) amplified fragment, spanning the VP1/P2A genomic region, classified the isolates into two distinct groups or genotypes as defined by Rico-Hesse and colleagues for poliovirus type 1. Isolates within each group shared approximately 99% sequence identity at the nucleotide level whereas < or = 86% sequence identity was shared between groups. One isolate derived from a clinical specimen in 1987 was grouped with six CVB4 isolates recovered from the aquatic environment in 1986-7. The second group comprised CVB4 isolates from clinical specimens in 1985-6. Both groups were different at the nucleotide level from the prototype strain isolated in 1950. It was concluded that the method could be used to sub-type CVB4 isolates and would be of value in epidemiological studies of CVB4. Predicted amino acid sequences revealed non-conservation of the tyrosine residue at the VP1/P2A cleavage site but were of little value in distinguishing CVB4 variants. PMID:8386098
DOE Office of Scientific and Technical Information (OSTI.GOV)
Paule Roth, M.; Malfroy, L.; Offer, C.
1995-07-20
Human myelin oligodendrocyte glycoprotein (MOG), a myelin component of the central nervous system, is a candidate target antigen for autoimmune-mediated demyelination. We have isolated and sequenced part of a cosmid clone that contains the entire human MOG gene. The primary nuclear transcript, extending from the putative start of transcription to the site of poly(A) addition, is 15,561 nucleotides in length. The human MOG gene contains 8 exons, separated by 7 introns; canonical intron/exon boundary sites are observed at each junction. The introns vary in size from 242 to 6484 bp and contain numerous repetitive DNA elements, including 14 Alu sequencesmore » within 3 introns. Another Alu element is located in the 3{prime}-untranslated region of the gene. Alu sequences were classified with respect to subfamily assignment. Seven hundred sixty-three nucleotides 5{prime} of the transcription start and 1214 nucleotides 3{prime} of the poly(A) addition sites were also sequenced. The 5{prime}-flanking region revealed the presence of several consensus sequences that could be relevant in the transcription of the MOG gene, in particular binding sites in common with other myelin gene promoters. Two polymorphic intragenic dinucleotide (CA){sub n} and tetranucleotide (TAAA){sub n} repeats were identified and may provide genetic marker tools for association and linkage studies. 50 refs., 3 figs., 3 tabs.« less
He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang
2015-01-01
Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.
Yusoff, K; Millar, N S; Chambers, P; Emmerson, P T
1987-01-01
The nucleotide sequence of the L gene of the Beaudette C strain of Newcastle disease virus (NDV) has been determined. The L gene is 6704 nucleotides long and encodes a protein of 2204 amino acids with a calculated molecular weight of 248822. Mung bean nuclease mapping of the 5' terminus of the L gene mRNA indicates that the transcription of the L gene is initiated 11 nucleotides upstream of the translational start site. Comparison with the amino acid sequences of the L genes of Sendai virus and vesicular stomatitis virus (VSV) suggests that there are several regions of homology between the sequences. These data provide further evidence for an evolutionary relationship between the Paramyxoviridae and the Rhabdoviridae. A non-coding sequence of 46 nucleotides downstream of the presumed polyadenylation site of the L gene may be part of a negative strand leader RNA. Images PMID:3035486
[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].
Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I
1985-11-01
The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.
Integrated databanks access and sequence/structure analysis services at the PBIL.
Perrière, Guy; Combet, Christophe; Penel, Simon; Blanchet, Christophe; Thioulouse, Jean; Geourjon, Christophe; Grassot, Julien; Charavay, Céline; Gouy, Manolo; Duret, Laurent; Deléage, Gilbert
2003-07-01
The World Wide Web server of the PBIL (Pôle Bioinformatique Lyonnais) provides on-line access to sequence databanks and to many tools of nucleic acid and protein sequence analyses. This server allows to query nucleotide sequence banks in the EMBL and GenBank formats and protein sequence banks in the SWISS-PROT and PIR formats. The query engine on which our data bank access is based is the ACNUC system. It allows the possibility to build complex queries to access functional zones of biological interest and to retrieve large sequence sets. Of special interest are the unique features provided by this system to query the data banks of gene families developed at the PBIL. The server also provides access to a wide range of sequence analysis methods: similarity search programs, multiple alignments, protein structure prediction and multivariate statistics. An originality of this server is the integration of these two aspects: sequence retrieval and sequence analysis. Indeed, thanks to the introduction of re-usable lists, it is possible to perform treatments on large sets of data. The PBIL server can be reached at: http://pbil.univ-lyon1.fr.
Xin, Min; Zhang, Peipei; Liu, Wenwen; Ren, Yingdang; Cao, Mengji; Wang, Xifeng
2017-10-01
The complete nucleotide sequence of a novel positive single-stranded (+ss) RNA virus, tentatively named watermelon virus A (WVA), was determined using a combination of three methods: RNA sequencing, small RNA sequencing, and Sanger sequencing. The full genome of WVA is comprised of 8,372 nucleotides (nt), excluding the poly (A) tail, and contains four open reading frames (ORFs). The largest ORF, ORF1 encodes a putative replication-associated polyprotein (RP) with three conserved domains. ORF2 and ORF4 encode a movement protein (MP) and coat protein (CP), respectively. The putative product encoded by ORF3, of an estimated molecular mass of 25 kDa, has no significant similarity with other proteins. Identity and phylogenetic analysis indicate that WVA is a new virus, closely related to members of the family Betaflexiviridae. However, the final taxonomic allocation of WVA within the family is yet to be determined.
McCutchen-Maloney, Sandra L.
2002-01-01
DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.
Chen, Qingyu; Zobel, Justin; Verspoor, Karin
2017-01-01
GenBank, the EMBL European Nucleotide Archive and the DNA DataBank of Japan, known collectively as the International Nucleotide Sequence Database Collaboration or INSDC, are the three most significant nucleotide sequence databases. Their records are derived from laboratory work undertaken by different individuals, by different teams, with a range of technologies and assumptions and over a period of decades. As a consequence, they contain a great many duplicates, redundancies and inconsistencies, but neither the prevalence nor the characteristics of various types of duplicates have been rigorously assessed. Existing duplicate detection methods in bioinformatics only address specific duplicate types, with inconsistent assumptions; and the impact of duplicates in bioinformatics databases has not been carefully assessed, making it difficult to judge the value of such methods. Our goal is to assess the scale, kinds and impact of duplicates in bioinformatics databases, through a retrospective analysis of merged groups in INSDC databases. Our outcomes are threefold: (1) We analyse a benchmark dataset consisting of duplicates manually identified in INSDC-a dataset of 67 888 merged groups with 111 823 duplicate pairs across 21 organisms from INSDC databases - in terms of the prevalence, types and impacts of duplicates. (2) We categorize duplicates at both sequence and annotation level, with supporting quantitative statistics, showing that different organisms have different prevalence of distinct kinds of duplicate. (3) We show that the presence of duplicates has practical impact via a simple case study on duplicates, in terms of GC content and melting temperature. We demonstrate that duplicates not only introduce redundancy, but can lead to inconsistent results for certain tasks. Our findings lead to a better understanding of the problem of duplication in biological databases.Database URL: the merged records are available at https
Nucleotide sequence of the gene determining plasmid-mediated citrate utilization.
Ishiguro, N; Sato, G
1985-01-01
The citrate utilization determinant from transposon Tn3411 has been cloned and sequenced, and its polypeptide products have been characterized in minicell experiments. The nucleotide sequence was determined for a 2,047-base-pair BglII restriction endonuclease fragment that includes the citrate determinant. This region contains an open reading frame that would encode a 431-amino-acid very hydrophobic polypeptide and which is preceded by a reasonable ribosomal binding site. However, the single polypeptide found in minicell experiments had an apparent molecular weight of 35,000 on sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Images PMID:2999087
The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus.
Gustafson, G; Armour, S L
1986-01-01
The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus (BSMV) has been determined. The sequence is 3289 nucleotides in length and contains four open reading frames (ORFs) which code for proteins of Mr 22,147 (ORF1), Mr 58,098 (ORF2), Mr 17,378 (ORF3), and Mr 14,119 (ORF4). The predicted N-terminal amino acid sequence of the polypeptide encoded by the ORF nearest the 5'-end of the RNA (ORF1) is identical (after the initiator methionine) to the published N-terminal amino acid sequence of BSMV coat protein for 29 of the first 30 amino acids. ORF2 occupies the central portion of the coding region of RNA beta and ORF3 is located at the 3'-end. The ORF4 sequence overlaps the 3'-region of ORF2 and the 5'-region of ORF3 and differs in codon usage from the other three RNA beta ORFs. The coding region of RNA beta is followed by a poly(A) tract and a 238 nucleotide tRNA-like structure which are common to all three BSMV genomic RNAs. Images PMID:3754962
Seal, B S; Neill, J D; Ridpath, J F
1994-07-01
Caliciviruses are nonenveloped with a polyadenylated genome of approximately 7.6 kb and a single capsid protein. The "RNA Fold" computer program was used to analyze 3'-terminal noncoding sequences of five feline calicivirus (FCV), rabbit hemorrhagic disease virus (RHDV), and two San Miguel sea lion virus (SMSV) isolates. The FCV 3'-terminal sequences are 40-46 nucleotides in length and 72-91% similar. The FCV sequences were predicted to contain two possible duplex structures and one stem-loop structure with free energies of -2.1 to -18.2 kcal/mole. The RHDV genomic 3'-terminal RNA sequences are 54 nucleotides in length and share 49% sequence similarity to homologous regions of the FCV genome. The RHDV sequence was predicted to form two duplex structures in the 3'-terminal noncoding region with a single stem-loop structure, resembling that of FCV. In contrast, the SMSV 1 and 4 genomic 3'-terminal noncoding sequences were 185 and 182 nucleotides in length, respectively. Ten possible duplex structures were predicted with an average structural free energy of -35 kcal/mole. Sequence similarity between the two SMSV isolates was 75%. Furthermore, extensive cloverleaflike structures are predicted in the 3' noncoding region of the SMSV genome, in contrast to the predicted single stem-loop structures of FCV or RHDV.
Nucleotide sequence of an exceptionally long 5.8S ribosomal RNA from Crithidia fasciculata.
Schnare, M N; Gray, M W
1982-01-01
In Crithidia fasciculata, a trypanosomatid protozoan, the large ribosomal subunit contains five small RNA species (e, f, g, i, j) in addition to 5S rRNA [Gray, M.W. (1981) Mol. Cell. Biol. 1, 347-357]. The complete primary sequence of species i is shown here to be pAACGUGUmCGCGAUGGAUGACUUGGCUUCCUAUCUCGUUGA ... AGAmACGCAGUAAAGUGCGAUAAGUGGUApsiCAAUUGmCAGAAUCAUUCAAUUACCGAAUCUUUGAACGAAACGG ... CGCAUGGGAGAAGCUCUUUUGAGUCAUCCCCGUGCAUGCCAUAUUCUCCAmGUGUCGAA(C)OH. This sequence establishes that species i is a 5.8S rRNA, despite its exceptional length (171-172 nucleotides). The extra nucleotides in C. fasciculata 5.8S rRNA are located in a region whose primary sequence and length are highly variable among 5.8S rRNAs, but which is capable of forming a stable hairpin loop structure (the "G+C-rich hairpin"). The sequence of C. fasciculata 5.8S rRNA is no more closely related to that of another protozoan, Acanthamoeba castellanii, than it is to representative 5.8S rRNA sequences from the other eukaryotic kingdoms, emphasizing the deep phylogenetic divisions that seem to exist within the Kingdom Protista. Images PMID:7079176
Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA
Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco
1974-01-01
Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714
Nucleotide sequence of the gag gene and gag-pol junction of feline leukemia virus.
Laprevotte, I; Hampe, A; Sherr, C J; Galibert, F
1984-01-01
The nucleotide sequence of the gag gene of feline leukemia virus and its flanking sequences were determined and compared with the corresponding sequences of two strains of feline sarcoma virus and with that of the Moloney strain of murine leukemia virus. A high degree of nucleotide sequence homology between the feline leukemia virus and murine leukemia virus gag genes was observed, suggesting that retroviruses of domestic cats and laboratory mice have a common, proximal evolutionary progenitor. The predicted structure of the complete feline leukemia virus gag gene precursor suggests that the translation of nonglycosylated and glycosylated gag gene polypeptides is initiated at two different AUG codons. These initiator codons fall in the same reading frame and are separated by a 222-base-pair segment which encodes an amino terminal signal peptide. The nucleotide sequence predicts the order of amino acids in each of the individual gag-coded proteins (p15, p12, p30, p10), all of which derive from the gag gene precursor. Stable stem-and-loop secondary structures are proposed for two regions of viral RNA. The first falls within sequences at the 5' end of the viral genome, together with adjacent palindromic sequences which may play a role in dimer linkage of RNA subunits. The second includes coding sequences at the gag-pol junction and is proposed to be involved in translation of the pol gene product. Sequence analysis of the latter region shows that the gag and pol genes are translated in different reading frames. Classical consensus splice donor and acceptor sequences could not be localized to regions which would permit synthesis of the expected gag-pol precursor protein. Alternatively, we suggest that the pol gene product (RNA-dependent DNA polymerase) could be translated by a frameshift suppressing mechanism which could involve cleavage modification of stems and loops in a manner similar to that observed in tRNA processing. PMID:6328019
Iterative Correction of Reference Nucleotides (iCORN) using second generation sequencing technology.
Otto, Thomas D; Sanders, Mandy; Berriman, Matthew; Newbold, Chris
2010-07-15
The accuracy of reference genomes is important for downstream analysis but a low error rate requires expensive manual interrogation of the sequence. Here, we describe a novel algorithm (Iterative Correction of Reference Nucleotides) that iteratively aligns deep coverage of short sequencing reads to correct errors in reference genome sequences and evaluate their accuracy. Using Plasmodium falciparum (81% A + T content) as an extreme example, we show that the algorithm is highly accurate and corrects over 2000 errors in the reference sequence. We give examples of its application to numerous other eukaryotic and prokaryotic genomes and suggest additional applications. The software is available at http://icorn.sourceforge.net
Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito
2017-12-01
The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Zhang, Bin; Nardi, Francesco; Hull-Sanders, Helen; Wan, Xuanwu; Liu, Yinghong
2014-01-01
The complete 16,043 bp mitochondrial genome (mitogenome) of Bactrocera minax (Diptera: Tephritidae) has been sequenced. The genome encodes 37 genes usually found in insect mitogenomes. The mitogenome information for B. minax was compared to the homologous sequences of Bactrocera oleae, Bactrocera tryoni, Bactrocera philippinensis, Bactrocera carambolae, Bactrocera papayae, Bactrocera dorsalis, Bactrocera correcta, Bactrocera cucurbitae and Ceratitis capitata. The analysis indicated the structure and organization are typical of, and similar to, the nine closely related species mentioned above, although it contains the lowest genome-wide A+T content (67.3%). Four short intergenic spacers with a high degree of conservation among the nine tephritid species mentioned above and B. minax were observed, which also have clear counterparts in the control regions (CRs). Correlation analysis among these ten tephritid species revealed close positive correlation between the A+T content of zero-fold degenerate sites (P0FD), the ratio of nucleotide substitution frequency at P0FD sites to all degenerate sites (zero-fold degenerate sites, two-fold degenerate sites and four-fold degenerate sites) and amino acid sequence distance (ASD) were found. Further, significant positive correlation was observed between the A+T content of four-fold degenerate sites (P4FD) and the ratio of nucleotide substitution frequency at P4FD sites to all degenerate sites; however, we found significant negative correlation between ASD and the A+T content of P4FD, and the ratio of nucleotide substitution frequency at P4FD sites to all degenerate sites. A higher nucleotide substitution frequency at non-synonymous sites compared to synonymous sites was observed in nad4, the first time that has been observed in an insect mitogenome. A poly(T) stretch at the 5′ end of the CR followed by a [TA(A)]n-like stretch was also found. In addition, a highly conserved G+A-rich sequence block was observed in front of the
USDA-ARS?s Scientific Manuscript database
Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...
Tan, Lianjiang; Liu, Yazhi; Li, Xiaowei; Wu, Xin-Yan; Gong, Bing; Shen, Yu-Mei; Shao, Zhifeng
2016-02-11
An acid-cleavable linker based on a dimethylketal moiety was synthesized and used to connect a nucleotide with a fluorophore to produce a 3'-OH unblocked nucleotide analogue as an excellent reversible terminator for DNA sequencing by synthesis.
Dasgupta, R; Kaesberg, P
1982-01-01
The nucleotide sequences of the subgenomic coat protein messengers (RNA4's) of two related bromoviruses, brome mosaic virus (BMV) and cowpea chlorotic mottle virus (CCMV), have been determined by direct RNA and CDNA sequencing without cloning. BMV RNA4 is 876 b long including a 5' noncoding region of nine nucleotides and a 3' noncoding region of 300 nucleotides. CCMV RNA 4 is 824 b long, including a 5' noncoding region of 10 nucleotides and a 3' noncoding region of 244 nucleotides. The encoded coat proteins are similar in length (188 amino acids for BMV and 189 amino acids for CCMV) and display about 70% homology in their amino acid sequences. Length difference between the two RNAs is due mostly to a single deletion, in CCMV with respect to BMV, of about 57 b immediately following the coding region. Allowing for this deletion the RNAs are indicate that mutations leading to divergence were constrained in the coding region primarily by the requirement of maintaining a favorable coat protein structure and in the 3' noncoding region primarily by the requirement of maintaining a favorable RNA spatial configuration. PMID:6895941
Kumar, Rajnish; Mishra, Bharat Kumar; Lahiri, Tapobrata; Kumar, Gautam; Kumar, Nilesh; Gupta, Rahul; Pal, Manoj Kumar
2017-06-01
Online retrieval of the homologous nucleotide sequences through existing alignment techniques is a common practice against the given database of sequences. The salient point of these techniques is their dependence on local alignment techniques and scoring matrices the reliability of which is limited by computational complexity and accuracy. Toward this direction, this work offers a novel way for numerical representation of genes which can further help in dividing the data space into smaller partitions helping formation of a search tree. In this context, this paper introduces a 36-dimensional Periodicity Count Value (PCV) which is representative of a particular nucleotide sequence and created through adaptation from the concept of stochastic model of Kolekar et al. (American Institute of Physics 1298:307-312, 2010. doi: 10.1063/1.3516320 ). The PCV construct uses information on physicochemical properties of nucleotides and their positional distribution pattern within a gene. It is observed that PCV representation of gene reduces computational cost in the calculation of distances between a pair of genes while being consistent with the existing methods. The validity of PCV-based method was further tested through their use in molecular phylogeny constructs in comparison with that using existing sequence alignment methods.
Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou
2011-01-01
DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738
Loreni, F; Ruberti, I; Bozzoni, I; Pierandrei-Amaldi, P; Amaldi, F
1985-01-01
Ribosomal protein L1 is encoded by two genes in Xenopus laevis. The comparison of two cDNA sequences shows that the two L1 gene copies (L1a and L1b) have diverged in many silent sites and very few substitution sites; moreover a small duplication occurred at the very end of the coding region of the L1b gene which thus codes for a product five amino acids longer than that coded by L1a. Quantitatively the divergence between the two L1 genes confirms that a whole genome duplication took place in Xenopus laevis approximately 30 million years ago. A genomic fragment containing one of the two L1 gene copies (L1a), with its nine introns and flanking regions, has been completely sequenced. The 5' end of this gene has been mapped within a 20-pyridimine stretch as already found for other vertebrate ribosomal protein genes. Four of the nine introns have a 60-nucleotide sequence with 80% homology; within this region some boxes, one of which is 16 nucleotides long, are 100% homologous among the four introns. This feature of L1a gene introns is interesting since we have previously shown that the activity of this gene is regulated at a post-transcriptional level and it involves the block of the normal splicing of some intron sequences. Images Fig. 3. Fig. 5. PMID:3841512
JICST Factual Database JICST DNA Database
NASA Astrophysics Data System (ADS)
Shirokizawa, Yoshiko; Abe, Atsushi
Japan Information Center of Science and Technology (JICST) has started the on-line service of DNA database in October 1988. This database is composed of EMBL Nucleotide Sequence Library and Genetic Sequence Data Bank. The authors outline the database system, data items and search commands. Examples of retrieval session are presented.
Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.
Dunn, Joshua G; Weissman, Jonathan S
2016-11-22
Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily
37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.
Code of Federal Regulations, 2011 CFR
2011-07-01
... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...
37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.
Code of Federal Regulations, 2013 CFR
2013-07-01
... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...
37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.
Code of Federal Regulations, 2012 CFR
2012-07-01
... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...
37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.
Code of Federal Regulations, 2010 CFR
2010-07-01
... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...
37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.
Code of Federal Regulations, 2014 CFR
2014-07-01
... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...
Lin, C S; Sun, Y L; Liu, C Y; Yang, P C; Chang, L C; Cheng, I C; Mao, S J; Huang, M C
1999-08-05
The complete nucleotide sequence of the pig (Sus scrofa) mitochondrial genome, containing 16613bp, is presented in this report. The genome is not a specific length because of the presence of the variable numbers of tandem repeats, 5'-CGTGCGTACA in the displacement loop (D-loop). Genes responsible for 12S and 16S rRNAs, 22 tRNAs, and 13 protein-coding regions are found. The genome carries very few intergenic nucleotides with several instances of overlap between protein-coding or tRNA genes, except in the D-loop region. For evaluating the possible evolutionary relationships between Artiodactyla and Cetacea, the nucleotide substitutions and amino acid sequences of 13 protein-coding genes were aligned by pairwise comparisons of the pig, cow, and fin whale. By comparing these sequences, we suggest that there is a closer relationship between the pig and cow than that between either of these species and fin whale. In addition, the accumulation of transversions and gaps in pig 12S and 16S rRNA genes was compared with that in other eutherian species, including cow, fin whale, human, horse, and harbor seal. The results also reveal a close phylogenetic relationship between pig and cow, as compared to fin whale and others. Thus, according to the sequence differences of mitochondrial rRNA genes in eutherian species, the evolutionary separation of pig and cow occurred about 53-60 million years ago.
Labeled nucleotide phosphate (NP) probes
Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY
2009-02-03
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Normand, A C; Packeu, A; Cassagne, C; Hendrickx, M; Ranque, S; Piarroux, R
2018-05-01
Conventional dermatophyte identification is based on morphological features. However, recent studies have proposed to use the nucleotide sequences of the rRNA internal transcribed spacer (ITS) region as an identification barcode of all fungi, including dermatophytes. Several nucleotide databases are available to compare sequences and thus identify isolates; however, these databases often contain mislabeled sequences that impair sequence-based identification. We evaluated five of these databases on a clinical isolate panel. We selected 292 clinical dermatophyte strains that were prospectively subjected to an ITS2 nucleotide sequence analysis. Sequences were analyzed against the databases, and the results were compared to clusters obtained via DNA alignment of sequence segments. The DNA tree served as the identification standard throughout the study. According to the ITS2 sequence identification, the majority of strains (255/292) belonged to the genus Trichophyton , mainly T. rubrum complex ( n = 184), T. interdigitale ( n = 40), T. tonsurans ( n = 26), and T. benhamiae ( n = 5). Other genera included Microsporum (e.g., M. canis [ n = 21], M. audouinii [ n = 10], Nannizzia gypsea [ n = 3], and Epidermophyton [ n = 3]). Species-level identification of T. rubrum complex isolates was an issue. Overall, ITS DNA sequencing is a reliable tool to identify dermatophyte species given that a comprehensive and correctly labeled database is consulted. Since many inaccurate identification results exist in the DNA databases used for this study, reference databases must be verified frequently and amended in line with the current revisions of fungal taxonomy. Before describing a new species or adding a new DNA reference to the available databases, its position in the phylogenetic tree must be verified. Copyright © 2018 American Society for Microbiology.
USDA-ARS?s Scientific Manuscript database
The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...
A clustering package for nucleotide sequences using Laplacian Eigenmaps and Gaussian Mixture Model.
Bruneau, Marine; Mottet, Thierry; Moulin, Serge; Kerbiriou, Maël; Chouly, Franz; Chretien, Stéphane; Guyeux, Christophe
2018-02-01
In this article, a new Python package for nucleotide sequences clustering is proposed. This package, freely available on-line, implements a Laplacian eigenmap embedding and a Gaussian Mixture Model for DNA clustering. It takes nucleotide sequences as input, and produces the optimal number of clusters along with a relevant visualization. Despite the fact that we did not optimise the computational speed, our method still performs reasonably well in practice. Our focus was mainly on data analytics and accuracy and as a result, our approach outperforms the state of the art, even in the case of divergent sequences. Furthermore, an a priori knowledge on the number of clusters is not required here. For the sake of illustration, this method is applied on a set of 100 DNA sequences taken from the mitochondrially encoded NADH dehydrogenase 3 (ND3) gene, extracted from a collection of Platyhelminthes and Nematoda species. The resulting clusters are tightly consistent with the phylogenetic tree computed using a maximum likelihood approach on gene alignment. They are coherent too with the NCBI taxonomy. Further test results based on synthesized data are then provided, showing that the proposed approach is better able to recover the clusters than the most widely used software, namely Cd-hit-est and BLASTClust. Copyright © 2017 Elsevier Ltd. All rights reserved.
The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.
Hori, H; Osawa, S; Iwabuchi, M
1980-01-01
The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421
The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.
Hammond, R W; Crosslin, J M
1995-04-01
The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.
Mining of haplotype-based expressed sequence tag single nucleotide polymorphisms in citrus
2013-01-01
Background Single nucleotide polymorphisms (SNPs), the most abundant variations in a genome, have been widely used in various studies. Detection and characterization of citrus haplotype-based expressed sequence tag (EST) SNPs will greatly facilitate further utilization of these gene-based resources. Results In this paper, haplotype-based SNPs were mined out of publicly available citrus expressed sequence tags (ESTs) from different citrus cultivars (genotypes) individually and collectively for comparison. There were a total of 567,297 ESTs belonging to 27 cultivars in varying numbers and consequentially yielding different numbers of haplotype-based quality SNPs. Sweet orange (SO) had the most (213,830) ESTs, generating 11,182 quality SNPs in 3,327 out of 4,228 usable contigs. Summed from all the individually mining results, a total of 25,417 quality SNPs were discovered – 15,010 (59.1%) were transitions (AG and CT), 9,114 (35.9%) were transversions (AC, GT, CG, and AT), and 1,293 (5.0%) were insertion/deletions (indels). A vast majority of SNP-containing contigs consisted of only 2 haplotypes, as expected, but the percentages of 2 haplotype contigs varied widely in these citrus cultivars. BLAST of the 25,417 25-mer SNP oligos to the Clementine reference genome scaffolds revealed 2,947 SNPs had “no hits found”, 19,943 had 1 unique hit / alignment, 1,571 had one hit and 2+ alignments per hit, and 956 had 2+ hits and 1+ alignment per hit. Of the total 24,293 scaffold hits, 23,955 (98.6%) were on the main scaffolds 1 to 9, and only 338 were on 87 minor scaffolds. Most alignments had 100% (25/25) or 96% (24/25) nucleotide identities, accounting for 93% of all the alignments. Considering almost all the nucleotide discrepancies in the 24/25 alignments were at the SNP sites, it served well as in silico validation of these SNPs, in addition to and consistent with the rate (81%) validated by sequencing and SNaPshot assay. Conclusions High-quality EST-SNPs from different
Nucleotide cleaving agents and method
Que, Jr., Lawrence; Hanson, Richard S.; Schnaith, Leah M. T.
2000-01-01
The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.
Meiler, Arno; Klinger, Claudia; Kaufmann, Michael
2012-09-08
The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.
Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K
1982-01-01
The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%). PMID:6891053
Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K
1982-11-11
The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sakoyama, Y.; Hong, K.J.; Byun, S.M.
To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: themore » mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.« less
Nucleotide sequences of bovine alpha S1- and kappa-casein cDNAs.
Stewart, A F; Willis, I M; Mackinlay, A G
1984-01-01
The nucleotide sequences corresponding to bovine alpha S1- and kappa-casein mRNAs are presented. An unusual alpha S1-casein cDNA has been characterised whose 5' end commences upstream from its putative TATA box. The alpha S1-casein mRNA is compared to rat alpha-casein mRNA and two components of divergence are identified. Firstly, the two sequences have diverged at a high point mutation rate and the rate of amino acid replacement by this mechanism is at least as great as the rate of divergence of any other part of the mRNAs. Secondly, the protein coding sequence has been subjected to several insertion/deletion events, one of which may be an example of exon shuffling . The kappa-casein mRNA sequence verifies the proposition that it has arisen from a different ancestral gene to the other caseins. Images PMID:6328443
NASA Astrophysics Data System (ADS)
Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian
Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.
Beasley, D W; Suderman, M T; Holbrook, M R; Barrett, A D
2001-11-05
Deer tick virus (DTV) is a recently recognized North American virus isolated from Ixodes dammini ticks. Nucleotide sequencing of fragments of structural and non-structural protein genes suggested that this virus was most closely related to the tick-borne flavivirus Powassan (POW), which causes potentially fatal encephalitis in humans. To determine whether DTV represents a new and distinct member of the Flavivirus genus of the family Flaviviridae, we sequenced the structural protein genes and 5' and 3' non-coding regions of this virus. In addition, we compared the reactivity of DTV and POW in hemagglutination inhibition tests with a panel of polyclonal and monoclonal antisera, and performed cross-neutralization experiments using anti-DTV antisera. Nucleotide sequencing revealed a high degree of homology between DTV and POW at both nucleotide (>80% homology) and amino acid (>90% homology) levels, and the two viruses were indistinguishable in serological assays and mouse neuroinvasiveness. On the basis of these results, we suggest that DTV should be classified as a genotype of POW virus.
Shimamoto, I; Sonoda, S; Vazquez, P; Minaka, N; Nishiguchi, M
1998-01-01
The 3' terminal 2378 nucleotides of a wasabi strain of crucifer tobamovirus (CTMV-W) infectious to crucifer plants was determined. This includes the 3' non-coding region of 235 nucleotides, coat protein (CP) gene (468 nucleotides), movement protein (MP) gene (798 nucleotides) and C-terminal partial readthrough portion of 180 K protein gene (940 nucleotides). Comparison of the sequence with homologous regions of thirteen other tobamovirus genomes showed that it had much higher identity to those of four other crucifer tobamoviruses, 85.2% to cr-TMV and turnip vein-clearing virus (TVCV), 87.4% to oilseed rape mosaic virus (ORMV) and 87.1% to TMV-Cg, than to those of other tobamoviruses. Thus CTMV-W was most similar to ORMV and TMV-Cg in sequence, but only marginally so, whereas the location and size of its MP gene was the same as cr-TMV amd TVCV. These results, together with other analyses, show that CTMV-W is a new crucifer tobamovirus, that the five crucifer tobamoviruses can be classified into two subgroups based on MP gene organization, and that the rate of sequence change is not the same in all lineages.
Complete Nucleotide Sequence of Watermelon Chlorotic Stunt Virus Originating from Oman
Khan, Akhtar J.; Akhtar, Sohail; Briddon, Rob W.; Ammara, Um; Al-Matrooshi, Abdulrahman M.; Mansoor, Shahid
2012-01-01
Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6–99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93–98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed. PMID:22852046
Complete nucleotide sequence of watermelon chlorotic stunt virus originating from Oman.
Khan, Akhtar J; Akhtar, Sohail; Briddon, Rob W; Ammara, Um; Al-Matrooshi, Abdulrahman M; Mansoor, Shahid
2012-07-01
Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6-99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93-98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed.
Khan, A S
1984-01-01
The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact, total nucleotide sequence identity existed between the endogenous MuLV DNA and the MCF247 MuLV provirus in the 3' portion of the pol gene. In the 5' env region, only 4 of 564 nucleotides were different, resulting in three amino acid changes between AKR MCF247 MuLV DNA and the endogenous MuLV DNA present in clone A-12. In addition, nucleotide sequence comparison indicated that Moloney-and Friend-MCF MuLVs were also highly related in the 3' pol and 5' env regions to the cloned endogenous MuLV DNA. These results establish the role of endogenous MuLV DNA segments in generation of recombinant MCF viruses. PMID:6328017
Fauzi, Hamid; Agyeman, Akwasi; Hines, Jennifer V.
2008-01-01
Many bacteria utilize riboswitch transcription regulation to monitor and appropriately respond to cellular levels of important metabolites or effector molecules. The T box transcription antitermination riboswitch responds to cognate uncharged tRNA by specifically stabilizing an antiterminator element in the 5′-untranslated mRNA leader region and precluding formation of a thermodynamically more stable terminator element. Stabilization occurs when the tRNA acceptor end base pairs with the first four nucleotides in the seven nucleotide bulge of the highly conserved antiterminator element. The significance of the conservation of the antiterminator bulge nucleotides that do not base pair with the tRNA is unknown, but they are required for optimal function. In vitro selection was used to determine if the isolated antiterminator bulge context alone dictates the mode in which the tRNA acceptor end binds the bulge nucleotides. No sequence conservation beyond complementarity was observed and the location was not constrained to the first four bases of the bulge. The results indicate that formation of a structure that recognizes the tRNA acceptor end in isolation is not the determinant driving force for the high phylogenetic sequence conservation observed within the antiterminator bulge. Additional factors or T box leader features more likely influenced the phylogenetic sequence conservation. PMID:19152843
Van Kreijl, C F; Bos, J L
1977-01-01
The repeating nucleotide sequence of 68 base pairs in the mtDNA from an ethidium-induced cytoplasmic petite mutant of yeast has been determined. For sequence analysis specifically primed and terminated RNA copies, obtained by in vitro transcription of the separated strands, were use. The sequence consists of 66 consecutive AT base pairs flanked by two GC pairs and comprises nearly all of the mutant mitochondrial genome. The sequence, moreover, also represents the first part of wild-type mtDNA sequence so far. Images PMID:198740
Fujisaki, K; Hagihara, F; Kaido, M; Mise, K; Okuno, T
2003-01-01
Spring beauty latent virus (SBLV), a bromovirus, systemically and efficiently infected Arabidopsis thaliana, whereas the well-studied bromoviruses brome mosaic virus (BMV) and cowpea chlorotic mottle virus (CCMV) did not infect and poorly infected A. thaliana, respectively. We constructed biologically active cDNA clones of SBLV genomic RNAs and determined their complete nucleotide sequences. Interestingly, SBLV RNA3 contains both the box B motif in the intercistronic region, as does BMV, and the subgenomic promoter-like sequence in the 5' noncoding region, as does CCMV. Sequence comparisons of SBLV, BMV, CCMV, and broad bean mottle virus demonstrated that SBLV is closely related to BMV and CCMV.
Nakamura, Ryohei; Uno, Ayako; Kumagai, Masahiko; Fukushima, Hiroto S.; Morishita, Shinichi; Takeda, Hiroyuki
2017-01-01
The heavily methylated vertebrate genomes are punctuated by stretches of poorly methylated DNA sequences that usually mark gene regulatory regions. It is known that the methylation state of these regions confers transcriptional control over their associated genes. Given its governance on the transcriptome, cellular functions and identity, genome-wide DNA methylation pattern is tightly regulated and evidently predefined. However, how is the methylation pattern determined in vivo remains enigmatic. Based on in silico and in vitro evidence, recent studies proposed that the regional hypomethylated state is primarily determined by local DNA sequence, e.g., high CpG density and presence of specific transcription factor binding sites. Nonetheless, the dependency of DNA methylation on nucleotide sequence has not been carefully validated in vertebrates in vivo. Herein, with the use of medaka (Oryzias latipes) as a model, the sequence dependency of DNA methylation was intensively tested in vivo. Our statistical modeling confirmed the strong statistical association between nucleotide sequence pattern and methylation state in the medaka genome. However, by manipulating the methylation state of a number of genomic sequences and reintegrating them into medaka embryos, we demonstrated that artificially conferred DNA methylation states were predominantly and robustly maintained in vivo, regardless of their sequences and endogenous states. This feature was also observed in the medaka transgene that had passed across generations. Thus, despite the observed statistical association, nucleotide sequence was unable to autonomously determine its own methylation state in medaka in vivo. Our results apparently argue against the notion of the governance on the DNA methylation by nucleotide sequence, but instead suggest the involvement of other epigenetic factors in defining and maintaining the DNA methylation landscape. Further investigation in other vertebrate models in vivo will be needed
Schnitzler, P; Delius, H; Scholz, J; Touray, M; Orth, E; Darai, G
1987-12-01
The genome of the fish lymphocystis disease virus (FLDV) was screened for the existence of repetitive DNA sequences using a defined and complete gene library of the viral genome (98 kbp) by DNA-DNA hybridization, heteroduplex analysis, and restriction fine mapping. A repetitive DNA sequence was detected at the coordinates 0.034 to 0.057 and 0.718 to 0.736 map units (m.u.) of the FLDV genome. The first region (0.034 to 0.057 m.u.) corresponds to the 5' terminus of the EcoRI FLDV DNA fragment B (0.034 to 0.165 m.u.) and the second region (0.718 to 0.736 m.u.) is identical to the EcoRI DNA fragment M of the viral genome. The DNA nucleotide sequence of the EcoRI FLDV DNA fragment M was determined. This analysis revealed the presence of many short direct and inverted repetitions, e.g., a 18-mer direct repetition (TTTAAAATTTAATTAA) that started at nucleotide positions 812 and 942 and a 14-mer inverted repeat (TTAAATTTAAATTT) at nucleotide positions 820 and 959. Only short open reading frames were detected within this region. The DNA repetitions are discussed as sequences that play a possible regulatory role for virus replication. Furthermore, hybridization experiments revealed that the repetitive DNA sequences are conserved in the genome of different strains of fish lymphocystis disease virus isolated from two species of Pleuronectidae (flounder and dab).
Okimoto, R; Chamberlin, H M; Macfarlane, J L; Wolstenholme, D R
1991-01-01
Within a 7 kb segment of the mtDNA molecule of the root knot nematode, Meloidogyne javanica, that lacks standard mitochondrial genes, are three sets of strictly tandemly arranged, direct repeat sequences: approximately 36 copies of a 102 ntp sequence that contains a TaqI site; 11 copies of a 63 ntp sequence, and 5 copies of an 8 ntp sequence. The 7 kb repeat-containing segment is bounded by putative tRNAasp and tRNAf-met genes and the arrangement of sequences within this segment is: the tRNAasp gene; a unique 1,528 ntp segment that contains two highly stable hairpin-forming sequences; the 102 ntp repeat set; the 8 ntp repeat set; a unique 1,068 ntp segment; the 63 ntp repeat set; and the tRNAf-met gene. The nucleotide sequences of the 102 ntp copies and the 63 ntp copies have been conserved among the species examined. Data from Southern hybridization experiments indicate that 102 ntp and 63 ntp repeats occur in the mtDNAs of three, two and two races of M.incognita, M.hapla and M.arenaria, respectively. Nucleotide sequences of the M.incognita Race-3 102 ntp repeat were found to be either identical or highly similar to those of the M.javanica 102 ntp repeat. Differences in migration distance and number of 102 ntp repeat-containing bands seen in Southern hybridization autoradiographs of restriction-digested mtDNAs of M.javanica and the different host races of M.incognita, M.hapla and M.arenaria are sufficient to distinguish the different host races of each species. Images PMID:2027769
Hashimoto, Masayuki; Fukui, Mitsuru; Hayano, Kouichi; Hayatsu, Masahito
2002-01-01
Rhizobium sp. strain AC100, which is capable of degrading carbaryl (1-naphthyl-N-methylcarbamate), was isolated from soil treated with carbaryl. This bacterium hydrolyzed carbaryl to 1-naphthol and methylamine. Carbaryl hydrolase from the strain was purified to homogeneity, and its N-terminal sequence, molecular mass (82 kDa), and enzymatic properties were determined. The purified enzyme hydrolyzed 1-naphthyl acetate and 4-nitrophenyl acetate indicating that the enzyme is an esterase. We then cloned the carbaryl hydrolase gene (cehA) from the plasmid DNA of the strain and determined the nucleotide sequence of the 10-kb region containing cehA. No homologous sequences were found by a database homology search using the nucleotide and deduced amino acid sequences of the cehA gene. Six open reading frames including the cehA gene were found in the 10-kb region, and sequencing analysis shows that the cehA gene is flanked by two copies of insertion sequence-like sequence, suggesting that it makes part of a composite transposon. PMID:11872471
2012-01-01
Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836
Mudalkar, Shalini; Golla, Ramesh; Ghatty, Sreenivas; Reddy, Attipalli Ramachandra
2014-01-01
Camelina sativa L. is an emerging biofuel crop with potential applications in industry, medicine, cosmetics and human nutrition. The crop is unexploited owing to very limited availability of transcriptome and genomic data. In order to analyse the various metabolic pathways, we performed de novo assembly of the transcriptome on Illumina GAIIX platform with paired end sequencing for obtaining short reads. The sequencing output generated a FastQ file size of 2.97 GB with 10.83 million reads having a maximum read length of 101 nucleotides. The number of contigs generated was 53,854 with maximum and minimum lengths of 10,086 and 200 nucleotides respectively. These trancripts were annotated using BLAST search against the Aracyc, Swiss-Prot, TrEMBL, gene ontology and clusters of orthologous groups (KOG) databases. The genes involved in lipid metabolism were studied and the transcription factors were identified. Sequence similarity studies of Camelina with the other related organisms indicated the close relatedness of Camelina with Arabidopsis. In addition, bioinformatics analysis revealed the presence of a total of 19,379 simple sequence repeats. This is the first report on Camelina sativa L., where the transcriptome of the entire plant, including seedlings, seed, root, leaves and stem was done. Our data established an excellent resource for gene discovery and provide useful information for functional and comparative genomic studies in this promising biofuel crop.
Compilation of DNA sequences of Escherichia coli (update 1991)
Kröger, Manfred; Wahl, Ralf; Rice, Peter
1991-01-01
We have compiled the DNA sequence data for E.coli available from the GENBANK and EMBL data libraries and over a period of several years independently from the literature. This is the third listing replacing and increasing the former listing roughly by one fifth. However, in order to save space this printed version contains DNA sequence information only. The complete compilation is now available in machine readable form from the EMBL data library (ECD release 6). After deletion of all detected overlaps a total of 1 492 282 individual bp is found to be determined till the beginning of 1991. This corresponds to a total of 31.62% of the entire E.coli chromosome consisting of about 4,720 kbp. This number may actually be higher by some extra 2,5% derived from lysogenic bacteriophage lambda and various DNA sequences already received for statistical purposes only. PMID:2041799
Hori, H; Osawa, S; Takaiwa, F; Sugiura, M
1984-01-01
The nucleotide sequences from two Pteridophyta species, a fern Dryopteris acuminata and a horsetail Equisetum arvense have been determined. These two sequences are more related to those of the Bryophyta species (88% identity on average) than to those of seed plants (84% identity on average). PMID:6538332
Irie, S; Doi, S; Yorifuji, T; Takagi, M; Yano, K
1987-01-01
The nucleotide sequence of the genes from Pseudomonas putida encoding oxidation of benzene to catechol was determined. Five open reading frames were found in the sequence. Four corresponding protein molecules were detected by a DNA-directed in vitro translation system. Escherichia coli cells containing the fragment with the four open reading frames transformed benzene to cis-benzene glycol, which is an intermediate of the oxidation of benzene to catechol. The relation between the product of each cistron and the components of the benzene oxidation enzyme system is discussed. Images PMID:3667527
Rule, G S; Pratt, E A; Chin, C C; Wold, F; Ho, C
1985-01-01
Recombinant DNA plasmids containing the gene for the membrane-bound D-lactate dehydrogenase (D-LDH) of Escherichia coli linked to the promoter PL from lambda were constructed. After induction, the levels of D-LDH were elevated 300-fold over that of the wild type and amounted to 35% of the total cellular protein. The nucleotide sequence of the D-LDH gene was determined and shown to agree with the amino acid composition and the amino-terminal sequence of the purified enzyme. Removal of the amino-terminal formyl-Met from D-LDH was not inhibited in cells which contained these high levels of D-LDH. Images PMID:3882663
Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca
2015-01-01
Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450
Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca
2015-01-01
Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.
Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.
1998-01-01
Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304
Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme
2013-07-01
The design of RNA sequences folding into predefined secondary structures is a milestone for many synthetic biology and gene therapy studies. Most of the current software uses similar local search strategies (i.e. a random seed is progressively adapted to acquire the desired folding properties) and more importantly do not allow the user to control explicitly the nucleotide distribution such as the GC-content in their sequences. However, the latter is an important criterion for large-scale applications as it could presumably be used to design sequences with better transcription rates and/or structural plasticity. In this article, we introduce IncaRNAtion, a novel algorithm to design RNA sequences folding into target secondary structures with a predefined nucleotide distribution. IncaRNAtion uses a global sampling approach and weighted sampling techniques. We show that our approach is fast (i.e. running time comparable or better than local search methods), seedless (we remove the bias of the seed in local search heuristics) and successfully generates high-quality sequences (i.e. thermodynamically stable) for any GC-content. To complete this study, we develop a hybrid method combining our global sampling approach with local search strategies. Remarkably, our glocal methodology overcomes both local and global approaches for sampling sequences with a specific GC-content and target structure. IncaRNAtion is available at csb.cs.mcgill.ca/incarnation/. Supplementary data are available at Bioinformatics online.
Long, C M; Virolle, M J; Chang, S Y; Chang, S; Bibb, M J
1987-01-01
The nucleotide sequence of the coding and regulatory regions of the alpha-amylase gene (aml) of Streptomyces limosus was determined. High-resolution S1 mapping was used to locate the 5' end of the transcript and demonstrated that the gene is transcribed from a unique promoter. The predicted amino acid sequence has considerable identity to mammalian and invertebrate alpha-amylases, but not to those of plant, fungal, or eubacterial origin. Consistent with this is the susceptibility of the enzyme to an inhibitor of mammalian alpha-amylases. The amino-terminal sequence of the extracellular enzyme was determined, revealing the presence of a typical signal peptide preceding the mature form of the alpha-amylase. Images PMID:3500166
Nucleic acid analysis using terminal-phosphate-labeled nucleotides
Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY
2008-04-22
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.
Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M
1991-02-15
The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.
Sheikh, Faruk G; Mukhopadhyay, Sudit S; Gupta, Prabhakar
2002-02-01
The PstI family of elements are short, highly repetitive DNA sequences interspersed throughout the genome of the Bovidae. We have cloned and sequenced some members of the PstI family from cattle, goat, and buffalo. These elements are approximately 500 bp, have a copy number of 2 x 10(5) - 4 x 10(5), and comprise about 4% of the haploid genome. Studies of nucleotide sequence homology indicate that the buffalo and goat PstI repeats (type II) are similar types of short interspersed nucleotide element (SINE) sequences, but the cattle PstI repeat (type I) is considerably more divergent. Additionally, the goat PstI sequence showed significant sequence homology with bovine serine tRNA, and is therefore likely derived from serine tRNA. Interestingly, Southern hybridization suggests that both types of SINEs (I and II) are present in all the species of Bovidae. Dendrogram analysis indicates that cattle PstI SINE is similar to bovine Alu-like SINEs. Goat and buffalo SINEs formed a separate cluster, suggesting that these two types of SINEs evolved separately in the genome of the Bovidae.
Nishizawa, M; Nishizawa, K
2000-10-01
The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.
Nishizawa, Manami; Nishizawa, Kazuhisa
2000-01-01
The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the ‘between gene’ GC content heterogeneity, which is linked to ‘isochores’, is a principal factor associated with the bias in substitution patterns in human, ‘within gene’ heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed. PMID:11000273
Code of Federal Regulations, 2010 CFR
2010-07-01
... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Form and format for... And/or Amino Acid Sequences § 1.824 Form and format for nucleotide and/or amino acid sequence... Code for Information Interchange (ASCII) text. No other formats shall be allowed. (3) The computer...
USDA-ARS?s Scientific Manuscript database
Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Torella, JP; Lienert, F; Boehm, CR
2014-08-07
Recombination-based DNA construction methods, such as Gibson assembly, have made it possible to easily and simultaneously assemble multiple DNA parts, and they hold promise for the development and optimization of metabolic pathways and functional genetic circuits. Over time, however, these pathways and circuits have become more complex, and the increasing need for standardization and insulation of genetic parts has resulted in sequence redundancies-for example, repeated terminator and insulator sequences-that complicate recombination-based assembly. We and others have recently developed DNA assembly methods, which we refer to collectively as unique nucleotide sequence (UNS)-guided assembly, in which individual DNA parts are flanked withmore » UNSs to facilitate the ordered, recombination-based assembly of repetitive sequences. Here we present a detailed protocol for UNS-guided assembly that enables researchers to convert multiple DNA parts into sequenced, correctly assembled constructs, or into high-quality combinatorial libraries in only 2-3 d. If the DNA parts must be generated from scratch, an additional 2-5 d are necessary. This protocol requires no specialized equipment and can easily be implemented by a student with experience in basic cloning techniques.« less
Nucleotide sequence and phylogenetic analysis of Cucurbit yellow stunting disorder virus RNA 2.
Livieratos, Ioannis C; Coutts, Robert H A
2002-06-01
The complete nucleotide sequence of Cucurbit yellow stunting disorder virus (CYSDV) RNA 2, a whitefly (Bemisia tabaci)-transmitted closterovirus with a bi-partite genome, is reported. CYSDV RNA 2 is 7,281 nucleotides long and contains the closterovirus hallmark gene array with a similar arrangement to the prototype member of the genus Crinivirus, Lettuce infectious yellows virus (LIYV). CYSDV RNA 2 contains open reading frames (ORFs) potentially encoding in a 5' to 3' direction for proteins of 5 kDa (ORF 1; hydrophobic protein), 62 kDa (ORF 2; heat shock protein 70 homolog, HSP70h), 59 kDa (ORF 3; protein of unknown function), 9 kDa (ORF 4; protein of unknown function), 28.5 kDa (ORF 5; coat protein, CP), 53 kDa (ORF 6; coat protein minor, CPm), and 26.5 kDa (ORF 7; protein of unknown function). Pairwise comparisons of CYSDV RNA 2-encoded proteins (HSP70h, p59 and CPm) among the closteroviruses showed that CYSDV is closely related to LIYV. Phylogenetic analysis based on the amino acid sequence of the HSP70h, indicated that CYSDV clusters with other members of the genus Crinivirus, and it is related to Little cherry virus-1 (LChV-1), but is distinct from the aphid- or mealybug-transmitted closteroviruses.
miBLAST: scalable evaluation of a batch of nucleotide sequence queries with BLAST
Kim, You Jung; Boyd, Andrew; Athey, Brian D.; Patel, Jignesh M.
2005-01-01
A common task in many modern bioinformatics applications is to match a set of nucleotide query sequences against a large sequence dataset. Exis-ting tools, such as BLAST, are designed to evaluate a single query at a time and can be unacceptably slow when the number of sequences in the query set is large. In this paper, we present a new algorithm, called miBLAST, that evaluates such batch workloads efficiently. At the core, miBLAST employs a q-gram filtering and an index join for efficiently detecting similarity between the query sequences and database sequences. This set-oriented technique, which indexes both the query and the database sets, results in substantial performance improvements over existing methods. Our results show that miBLAST is significantly faster than BLAST in many cases. For example, miBLAST aligned 247 965 oligonucleotide sequences in the Affymetrix probe set against the Human UniGene in 1.26 days, compared with 27.27 days with BLAST (an improvement by a factor of 22). The relative performance of miBLAST increases for larger word sizes; however, it decreases for longer queries. miBLAST employs the familiar BLAST statistical model and output format, guaranteeing the same accuracy as BLAST and facilitating a seamless transition for existing BLAST users. PMID:16061938
Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O
2004-01-01
Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Compilation of small ribosomal subunit RNA structures.
Neefs, J M; Van de Peer, Y; De Rijk, P; Chapelle, S; De Wachter, R
1993-01-01
The database on small ribosomal subunit RNA structure contained 1804 nucleotide sequences on April 23, 1993. This number comprises 365 eukaryotic, 65 archaeal, 1260 bacterial, 30 plastidial, and 84 mitochondrial sequences. These are stored in the form of an alignment in order to facilitate the use of the database as input for comparative studies on higher-order structure and for reconstruction of phylogenetic trees. The elements of the postulated secondary structure for each molecule are indicated by special symbols. The database is available on-line directly from the authors by ftp and can also be obtained from the EMBL nucleotide sequence library by electronic mail, ftp, and on CD ROM disk. PMID:8332525
Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8)
Russo, James J.; Bohenzky, Roy A.; Chien, Ming-Cheng; Chen, Jing; Yan, Ming; Maddalena, Dawn; Parry, J. Preston; Peruzzi, Daniela; Edelman, Isidore S.; Chang, Yuan; Moore, Patrick S.
1996-01-01
The genome of the Kaposi sarcoma-associated herpesvirus (KSHV or HHV8) was mapped with cosmid and phage genomic libraries from the BC-1 cell line. Its nucleotide sequence was determined except for a 3-kb region at the right end of the genome that was refractory to cloning. The BC-1 KSHV genome consists of a 140.5-kb-long unique coding region flanked by multiple G+C-rich 801-bp terminal repeat sequences. A genomic duplication that apparently arose in the parental tumor is present in this cell culture-derived strain. At least 81 ORFs, including 66 with homology to herpesvirus saimiri ORFs, and 5 internal repeat regions are present in the long unique region. The virus encodes homologs to complement-binding proteins, three cytokines (two macrophage inflammatory proteins and interleukin 6), dihydrofolate reductase, bcl-2, interferon regulatory factors, interleukin 8 receptor, neural cell adhesion molecule-like adhesin, and a D-type cyclin, as well as viral structural and metabolic proteins. Terminal repeat analysis of virus DNA from a KS lesion suggests a monoclonal expansion of KSHV in the KS tumor. PMID:8962146
DOE Office of Scientific and Technical Information (OSTI.GOV)
White, D.A.; Zilinskas, B.A.
1991-08-01
The authors now report the nucleotide sequence of the cytosolic Cu/Zn SOD cloned from a {lambda}gt11 cDNA library constructed from mRNA extracted from leaves of 7- to 10-d pea seedlings (Pisum sativum L.). The clone was isolated using a 22-base synthetic oligonucleotide complementary to the amino acid sequence CGIIGLQG. This sequence, found at the protein's carboxy terminus, is highly conserved among plant cytosolic Cu/Zn SODs but not chloroplastic Cu/Zn SODs. The 738-base pair sequence contains an open reading frame specifying 152 codons and a predicted M{sub r} of 18,024 D. The deduced amino acid sequence is highly homologous (79-82% identity)more » with the sequences of other known plant cytosolic Cu/Zn SODs but less highly conserved (63-65%) when compared with several chloroplastic Cu/Zn SODs including pea (10).« less
Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui
2012-07-01
We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were <90%. This suggests that it is a new member of the genus Polerovirus, and the name pea mild chlorosis virus is proposed.
Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G
2008-04-01
The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.
Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.
2008-01-01
The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283
Lima, L S; Gramacho, K P; Carels, N; Novais, R; Gaiotto, F A; Lopes, U V; Gesteira, A S; Zaidan, H A; Cascardo, J C M; Pires, J L; Micheli, F
2009-07-14
In order to increase the efficiency of cacao tree resistance to witches' broom disease, which is caused by Moniliophthora perniciosa (Tricholomataceae), we looked for molecular markers that could help in the selection of resistant cacao genotypes. Among the different markers useful for developing marker-assisted selection, single nucleotide polymorphisms (SNPs) constitute the most common type of sequence difference between alleles and can be easily detected by in silico analysis from expressed sequence tag libraries. We report the first detection and analysis of SNPs from cacao-M. perniciosa interaction expressed sequence tags, using bioinformatics. Selection based on analysis of these SNPs should be useful for developing cacao varieties resistant to this devastating disease.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Krishnakumar, Raga; Sinha, Anupama; Bird, Sara W.
Emerging sequencing technologies are allowing us to characterize environmental, clinical and laboratory samples with increasing speed and detail, including real-time analysis and interpretation of data. One example of this is being able to rapidly and accurately detect a wide range of pathogenic organisms, both in the clinic and the field. Genomes can have radically different GC content however, such that accurate sequence analysis can be challenging depending upon the technology used. Here, we have characterized the performance of the Oxford MinION nanopore sequencer for detection and evaluation of organisms with a range of genomic nucleotide bias. We have diagnosed themore » quality of base-calling across individual reads and discovered that the position within the read affects base-calling and quality scores. Finally, we have evaluated the performance of the current state-of-the-art neural network-based MinION basecaller, characterizing its behavior with respect to systemic errors as well as context- and sequence-specific errors. Overall, we present a detailed characterization the capabilities of the MinION in terms of generating high-accuracy sequence data from genomes with a wide range of nucleotide content. This study provides a framework for designing the appropriate experiments that are the likely to lead to accurate and rapid field-forward diagnostics.« less
Krishnakumar, Raga; Sinha, Anupama; Bird, Sara W.; ...
2018-02-16
Emerging sequencing technologies are allowing us to characterize environmental, clinical and laboratory samples with increasing speed and detail, including real-time analysis and interpretation of data. One example of this is being able to rapidly and accurately detect a wide range of pathogenic organisms, both in the clinic and the field. Genomes can have radically different GC content however, such that accurate sequence analysis can be challenging depending upon the technology used. Here, we have characterized the performance of the Oxford MinION nanopore sequencer for detection and evaluation of organisms with a range of genomic nucleotide bias. We have diagnosed themore » quality of base-calling across individual reads and discovered that the position within the read affects base-calling and quality scores. Finally, we have evaluated the performance of the current state-of-the-art neural network-based MinION basecaller, characterizing its behavior with respect to systemic errors as well as context- and sequence-specific errors. Overall, we present a detailed characterization the capabilities of the MinION in terms of generating high-accuracy sequence data from genomes with a wide range of nucleotide content. This study provides a framework for designing the appropriate experiments that are the likely to lead to accurate and rapid field-forward diagnostics.« less
Bryant, D A; de Lorimier, R; Lambert, D H; Dubbs, J M; Stirewalt, V L; Stevens, S E; Porter, R D; Tam, J; Jay, E
1985-01-01
The genes for the alpha- and beta-subunit apoproteins of allophycocyanin (AP) were isolated from the cyanelle genome of Cyanophora paradoxa and subjected to nucleotide sequence analysis. The AP beta-subunit apoprotein gene was localized to a 7.8-kilobase-pair Pst I restriction fragment from cyanelle DNA by hybridization with a tetradecameric oligonucleotide probe. Sequence analysis using that oligonucleotide and its complement as primers for the dideoxy chain-termination sequencing method confirmed the presence of both AP alpha- and beta-subunit genes on this restriction fragment. Additional oligonucleotide primers were synthesized as sequencing progressed and were used to determine rapidly the nucleotide sequence of a 1336-base-pair region of this cloned fragment. This strategy allowed the sequencing to be completed without a detailed restriction map and without extensive and time-consuming subcloning. The sequenced region contains two open reading frames whose deduced amino acid sequences are 81-85% homologous to cyanobacterial and red algal AP subunits whose amino acid sequences have been determined. The two open reading frames are in the same orientation and are separated by 39 base pairs. AP alpha is 5' to AP beta and both coding sequences are preceded by a polypurine, Shine-Dalgarno-type sequence. Sequences upstream from AP alpha closely resemble the Escherichia coli consensus promoter sequences and also show considerable homology to promoter sequences for several chloroplast-encoded psbA genes. A 56-base-pair palindromic sequence downstream from the AP beta gene could play a role in the termination of transcription or translation. The allophycocyanin apoprotein subunit genes are located on the large single-copy region of the cyanelle genome. PMID:2987916
Torella, Joseph P.; Lienert, Florian; Boehm, Christian R.; Chen, Jan-Hung; Way, Jeffrey C.; Silver, Pamela A.
2016-01-01
Recombination-based DNA construction methods, such as Gibson assembly, have made it possible to easily and simultaneously assemble multiple DNA parts and hold promise for the development and optimization of metabolic pathways and functional genetic circuits. Over time, however, these pathways and circuits have become more complex, and the increasing need for standardization and insulation of genetic parts has resulted in sequence redundancies — for example repeated terminator and insulator sequences — that complicate recombination-based assembly. We and others have recently developed DNA assembly methods that we refer to collectively as unique nucleotide sequence (UNS)-guided assembly, in which individual DNA parts are flanked with UNSs to facilitate the ordered, recombination-based assembly of repetitive sequences. Here we present a detailed protocol for UNS-guided assembly that enables researchers to convert multiple DNA parts into sequenced, correctly-assembled constructs, or into high-quality combinatorial libraries in only 2–3 days. If the DNA parts must be generated from scratch, an additional 2–5 days are necessary. This protocol requires no specialized equipment and can easily be implemented by a student with experience in basic cloning techniques. PMID:25101822
Lee, Mei-Ling Ting; Bulyk, Martha L; Whitmore, G A; Church, George M
2002-12-01
There is considerable scientific interest in knowing the probability that a site-specific transcription factor will bind to a given DNA sequence. Microarray methods provide an effective means for assessing the binding affinities of a large number of DNA sequences as demonstrated by Bulyk et al. (2001, Proceedings of the National Academy of Sciences, USA 98, 7158-7163) in their study of the DNA-binding specificities of Zif268 zinc fingers using microarray technology. In a follow-up investigation, Bulyk, Johnson, and Church (2002, Nucleic Acid Research 30, 1255-1261) studied the interdependence of nucleotides on the binding affinities of transcription proteins. Our article is motivated by this pair of studies. We present a general statistical methodology for analyzing microarray intensity measurements reflecting DNA-protein interactions. The log probability of a protein binding to a DNA sequence on an array is modeled using a linear ANOVA model. This model is convenient because it employs familiar statistical concepts and procedures and also because it is effective for investigating the probability structure of the binding mechanism.
Parrish, R Ryley; Day, Jeremy J; Lubin, Farah D
2012-07-01
DNA methylation is an epigenetic modification that is essential for the development and mature function of the central nervous system. Due to the relevance of this modification to the transcriptional control of gene expression, it is often necessary to examine changes in DNA methylation patterns with both gene and single-nucleotide resolution. Here, we describe an in-depth basic protocol for direct bisulfite sequencing of DNA isolated from brain tissue, which will permit direct assessment of methylation status at individual genes as well as individual cytosine molecules/nucleotides within a genomic region. This method yields analysis of DNA methylation patterns that is robust, accurate, and reproducible, thereby allowing insights into the role of alterations in DNA methylation in brain tissue.
Feltus, F A; Singh, H P; Lohithaswa, H C; Schulze, S R; Silva, T D; Paterson, A H
2006-04-01
Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species.
Nandi, Sukdeb; Anbazhagan, Rajendra; Kumar, Manoj
2010-01-01
Canine parvovirus 2 (CPV-2) is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV-2a, CPV-2b and CPV-2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal) were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV-2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India.
Deng, Ke-Jun; Yang, Zu-Jun; Liu, Cheng; Zhao, Wei; Liu, Chang; Feng, Juan; Ren, Zheng-Long
2007-03-01
Genetic characterization of 9 populations of Rhodiola crenulata, R. fastigiata and R. sachalinensis (Crassulaceae) species from Sichuan and Jilin Provinces of China, was investigated using the conserved primer of nad7 intron 2. All PCR products about 800 bp long were shorter than other Crassulaceae plants, which were used as molecular markers to identify the Rhodiola species. The sequence of the products indicated that total exon of 53 bp and intron of 738 bp exhibit only 9 nucleotide variations. Blasting the nad7 sequences to GenBank and the phylogenetic analysis showed that the sequence of Rhodiola species was clusted independently, and the length was smaller than all the registered sequences of higher plants. The result suggests that the Rhiodola species had a unique sequence in this gene region, which might be related to the special growth condition.
The multiBac protein complex production platform at the EMBL.
Berger, Imre; Garzoni, Frederic; Chaillet, Maxime; Haffke, Matthias; Gupta, Kapil; Aubert, Alice
2013-07-11
Proteomics research revealed the impressive complexity of eukaryotic proteomes in unprecedented detail. It is now a commonly accepted notion that proteins in cells mostly exist not as isolated entities but exert their biological activity in association with many other proteins, in humans ten or more, forming assembly lines in the cell for most if not all vital functions.(1,2) Knowledge of the function and architecture of these multiprotein assemblies requires their provision in superior quality and sufficient quantity for detailed analysis. The paucity of many protein complexes in cells, in particular in eukaryotes, prohibits their extraction from native sources, and necessitates recombinant production. The baculovirus expression vector system (BEVS) has proven to be particularly useful for producing eukaryotic proteins, the activity of which often relies on post-translational processing that other commonly used expression systems often cannot support.(3) BEVS use a recombinant baculovirus into which the gene of interest was inserted to infect insect cell cultures which in turn produce the protein of choice. MultiBac is a BEVS that has been particularly tailored for the production of eukaryotic protein complexes that contain many subunits.(4) A vital prerequisite for efficient production of proteins and their complexes are robust protocols for all steps involved in an expression experiment that ideally can be implemented as standard operating procedures (SOPs) and followed also by non-specialist users with comparative ease. The MultiBac platform at the European Molecular Biology Laboratory (EMBL) uses SOPs for all steps involved in a multiprotein complex expression experiment, starting from insertion of the genes into an engineered baculoviral genome optimized for heterologous protein production properties to small-scale analysis of the protein specimens produced.(5-8) The platform is installed in an open-access mode at EMBL Grenoble and has supported many
Hall, L; Laird, J E; Craig, R K
1984-01-01
Nucleotide sequence analysis of cloned guinea-pig casein B cDNA sequences has identified two casein B variants related to the bovine and rat alpha s1 caseins. Amino acid homology was largely confined to the known bovine or predicted rat phosphorylation sites and within the 'signal' precursor sequence. Comparison of the deduced nucleotide sequence of the guinea-pig and rat alpha s1 casein mRNA species showed greater sequence conservation in the non-coding than in the coding regions, suggesting a functional and possibly regulatory role for the non-coding regions of casein mRNA. The results provide insight into the evolution of the casein genes, and raise questions as to the role of conserved nucleotide sequences within the non-coding regions of mRNA species. Images Fig. 1. PMID:6548375
Genome sequencing and annotation of Serratia sp. strain TEL.
Lephoto, Tiisetso E; Gray, Vincent M
2015-12-01
We present the annotation of the draft genome sequence of Serratia sp. strain TEL (GenBank accession number KP711410). This organism was isolated from entomopathogenic nematode Oscheius sp. strain TEL (GenBank accession number KM492926) collected from grassland soil and has a genome size of 5,000,541 bp and 542 subsystems. The genome sequence can be accessed at DDBJ/EMBL/GenBank under the accession number LDEG00000000.
Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.
Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C
2018-01-10
Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing
NASA Astrophysics Data System (ADS)
Goubin, Gerard; Goldman, Debra S.; Luce, Judith; Neiman, Paul E.; Cooper, Geoffrey M.
1983-03-01
A transforming gene detected by transfection of chicken B-cell lymphoma DNA has been isolated by molecular cloning. It is homologous to a conserved family of sequences present in normal chicken and human DNAs but is not related to transforming genes of acutely transforming retroviruses. The nucleotide sequence of the cloned transforming gene suggests that it encodes a protein that is partially homologous to the amino terminus of transferrin and related proteins although only about one tenth the size of transferrin.
Nucleotide Sequence of the blaRTG-2 (CARB-5) Gene and Phylogeny of a New Group of Carbenicillinases
Choury, Daniele; Szajnert, Marie-France; Joly-Guillou, Marie-Laure; Azibi, Kemal; Delpech, Marc; Paul, Gérard
2000-01-01
We determined the nucleotide sequence of the bla gene for the Acinetobacter calcoaceticus β-lactamase previously described as CARB-5. Alignment of the deduced amino acid sequence with those of known β-lactamases revealed that CARB-5 possesses an RTG triad in box VII, as described for the Proteus mirabilis GN79 enzyme, instead of the RSG consensus characteristic of the other carbenicillinases. Phylogenetic studies showed that these RTG enzymes constitute a new, separate group, possibly ancestors of the carbenicillinase family. PMID:10722515
DOE Office of Scientific and Technical Information (OSTI.GOV)
Peters, J.; Peters, M.; Lottspeich, F.
1987-11-01
The complete nucleotide sequence of the gene encoding the surface (hexagonally packed intermediate (HPI))-layer polypeptide of Deinococcus radiodurans Sark was determined and found to encode a polypeptide of 1036 amino acids. Amino acid sequence analysis of about 30% of the residues revealed that the mature polypeptide consists of at least 978 amino acids. The N terminus was blocked to Edman degradation. The results of proteolytic modification of the HPI layer in situ and M/sub r/ estimations of the HPI polypeptide expressed in Escherichia coli indicated that there is a leader sequence. The N-terminal region contained a very high percentage (29%)more » of threonine and serine, including a cluster of nine consecutive serine or threonine residues, whereas a stretch near the C terminus was extremely rich in aromatic amino acids (29%). The protein contained at least two disulfide bridges, as well as tightly bound reducing sugars and fatty acids.« less
USDA-ARS?s Scientific Manuscript database
Salmonid genomes are considered to be in a pseudo-tetraploid state as a result of an evolutionarily recent genome duplication event. This situation complicates single nucleotide polymorphism (SNP) discovery in rainbow trout as many putative SNPs are actually paralogous sequence variants (PSVs) and ...
Identification of single nucleotide polymorphism in ginger using expressed sequence tags
Chandrasekar, Arumugam; Riju, Aikkal; Sithara, Kandiyl; Anoop, Sahadevan; Eapen, Santhosh J
2009-01-01
Ginger (Zingiber officinale Rosc) (Family: Zingiberaceae) is a herbaceous perennial, the rhizomes of which are used as a spice. Ginger is a plant which is well known for its medicinal applications. Recently EST-derived SNPs are a free by-product of the currently expanding EST (Expressed Sequence Tag) databases. The development of high-throughput methods for the detection of SNPs (Single Nucleotide Polymorphism) and small indels (insertion/deletion) has led to a revolution in their use as molecular markers. Available (38139) Ginger EST sequences were mined from dbEST of NCBI. CAP3 program was used to assemble EST sequences into contigs. Candidate SNPs and Indel polymorphisms were detected using the perl script AutoSNP version 1.0 which has used 31905 ESTs for detecting SNPs and Indel sites. We found 64026 SNP sites and 7034 indel polymorphisms with frequency of 0.84 SNPs / 100 bp. Among the three tissues from which the EST libraries had been generated, Rhizomes had high frequency of 1.08 SNPs/indels per 100 bp whereas the leaves had lowest frequency of 0.63 per 100 bp and root is showing relative frequency 0.82/100bp. Transitions and transversion ratio is 0.90. In overall detected SNP, transversion is high when compare to transition. These detected SNPs can be used as markers for genetic studies. Availability The results of the present study hosted in our webserver www.spices.res.in/spicesnip PMID:20198184
Viral to metazoan marine plankton nucleotide sequences from the Tara Oceans expedition
Alberti, Adriana; Poulain, Julie; Engelen, Stefan; Labadie, Karine; Romac, Sarah; Ferrera, Isabel; Albini, Guillaume; Aury, Jean-Marc; Belser, Caroline; Bertrand, Alexis; Cruaud, Corinne; Da Silva, Corinne; Dossat, Carole; Gavory, Frédérick; Gas, Shahinaz; Guy, Julie; Haquelle, Maud; Jacoby, E'krame; Jaillon, Olivier; Lemainque, Arnaud; Pelletier, Eric; Samson, Gaëlle; Wessner, Mark; Bazire, Pascal; Beluche, Odette; Bertrand, Laurie; Besnard-Gonnet, Marielle; Bordelais, Isabelle; Boutard, Magali; Dubois, Maria; Dumont, Corinne; Ettedgui, Evelyne; Fernandez, Patricia; Garcia, Espérance; Aiach, Nathalie Giordanenco; Guerin, Thomas; Hamon, Chadia; Brun, Elodie; Lebled, Sandrine; Lenoble, Patricia; Louesse, Claudine; Mahieu, Eric; Mairey, Barbara; Martins, Nathalie; Megret, Catherine; Milani, Claire; Muanga, Jacqueline; Orvain, Céline; Payen, Emilie; Perroud, Peggy; Petit, Emmanuelle; Robert, Dominique; Ronsin, Murielle; Vacherie, Benoit; Acinas, Silvia G.; Royo-Llonch, Marta; Cornejo-Castillo, Francisco M.; Logares, Ramiro; Fernández-Gómez, Beatriz; Bowler, Chris; Cochrane, Guy; Amid, Clara; Hoopen, Petra Ten; De Vargas, Colomban; Grimsley, Nigel; Desgranges, Elodie; Kandels-Lewis, Stefanie; Ogata, Hiroyuki; Poulton, Nicole; Sieracki, Michael E.; Stepanauskas, Ramunas; Sullivan, Matthew B.; Brum, Jennifer R.; Duhaime, Melissa B.; Poulos, Bonnie T.; Hurwitz, Bonnie L.; Acinas, Silvia G.; Bork, Peer; Boss, Emmanuel; Bowler, Chris; De Vargas, Colomban; Follows, Michael; Gorsky, Gabriel; Grimsley, Nigel; Hingamp, Pascal; Iudicone, Daniele; Jaillon, Olivier; Kandels-Lewis, Stefanie; Karp-Boss, Lee; Karsenti, Eric; Not, Fabrice; Ogata, Hiroyuki; Pesant, Stéphane; Raes, Jeroen; Sardet, Christian; Sieracki, Michael E.; Speich, Sabrina; Stemmann, Lars; Sullivan, Matthew B.; Sunagawa, Shinichi; Wincker, Patrick; Pesant, Stéphane; Karsenti, Eric; Wincker, Patrick
2017-01-01
A unique collection of oceanic samples was gathered by the Tara Oceans expeditions (2009–2013), targeting plankton organisms ranging from viruses to metazoans, and providing rich environmental context measurements. Thanks to recent advances in the field of genomics, extensive sequencing has been performed for a deep genomic analysis of this huge collection of samples. A strategy based on different approaches, such as metabarcoding, metagenomics, single-cell genomics and metatranscriptomics, has been chosen for analysis of size-fractionated plankton communities. Here, we provide detailed procedures applied for genomic data generation, from nucleic acids extraction to sequence production, and we describe registries of genomics datasets available at the European Nucleotide Archive (ENA, www.ebi.ac.uk/ena). The association of these metadata to the experimental procedures applied for their generation will help the scientific community to access these data and facilitate their analysis. This paper complements other efforts to provide a full description of experiments and open science resources generated from the Tara Oceans project, further extending their value for the study of the world’s planktonic ecosystems. PMID:28763055
Viral to metazoan marine plankton nucleotide sequences from the Tara Oceans expedition.
Alberti, Adriana; Poulain, Julie; Engelen, Stefan; Labadie, Karine; Romac, Sarah; Ferrera, Isabel; Albini, Guillaume; Aury, Jean-Marc; Belser, Caroline; Bertrand, Alexis; Cruaud, Corinne; Da Silva, Corinne; Dossat, Carole; Gavory, Frédérick; Gas, Shahinaz; Guy, Julie; Haquelle, Maud; Jacoby, E'krame; Jaillon, Olivier; Lemainque, Arnaud; Pelletier, Eric; Samson, Gaëlle; Wessner, Mark; Acinas, Silvia G; Royo-Llonch, Marta; Cornejo-Castillo, Francisco M; Logares, Ramiro; Fernández-Gómez, Beatriz; Bowler, Chris; Cochrane, Guy; Amid, Clara; Hoopen, Petra Ten; De Vargas, Colomban; Grimsley, Nigel; Desgranges, Elodie; Kandels-Lewis, Stefanie; Ogata, Hiroyuki; Poulton, Nicole; Sieracki, Michael E; Stepanauskas, Ramunas; Sullivan, Matthew B; Brum, Jennifer R; Duhaime, Melissa B; Poulos, Bonnie T; Hurwitz, Bonnie L; Pesant, Stéphane; Karsenti, Eric; Wincker, Patrick
2017-08-01
A unique collection of oceanic samples was gathered by the Tara Oceans expeditions (2009-2013), targeting plankton organisms ranging from viruses to metazoans, and providing rich environmental context measurements. Thanks to recent advances in the field of genomics, extensive sequencing has been performed for a deep genomic analysis of this huge collection of samples. A strategy based on different approaches, such as metabarcoding, metagenomics, single-cell genomics and metatranscriptomics, has been chosen for analysis of size-fractionated plankton communities. Here, we provide detailed procedures applied for genomic data generation, from nucleic acids extraction to sequence production, and we describe registries of genomics datasets available at the European Nucleotide Archive (ENA, www.ebi.ac.uk/ena). The association of these metadata to the experimental procedures applied for their generation will help the scientific community to access these data and facilitate their analysis. This paper complements other efforts to provide a full description of experiments and open science resources generated from the Tara Oceans project, further extending their value for the study of the world's planktonic ecosystems.
Using EMBL-EBI services via Web interface and programmatically via Web Services
Lopez, Rodrigo; Cowley, Andrew; Li, Weizhong; McWilliam, Hamish
2015-01-01
The European Bioinformatics Institute (EMBL-EBI) provides access to a wide range of databases and analysis tools that are of key importance in bioinformatics. As well as providing Web interfaces to these resources, Web Services are available using SOAP and REST protocols that enable programmatic access to our resources and allow their integration into other applications and analytical workflows. This unit describes the various options available to a typical researcher or bioinformatician who wishes to use our resources via Web interface or programmatically via a range of programming languages. PMID:25501941
Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon
2015-02-01
There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.
Empirical Bayes Estimation of Coalescence Times from Nucleotide Sequence Data.
King, Leandra; Wakeley, John
2016-09-01
We demonstrate the advantages of using information at many unlinked loci to better calibrate estimates of the time to the most recent common ancestor (TMRCA) at a given locus. To this end, we apply a simple empirical Bayes method to estimate the TMRCA. This method is both asymptotically optimal, in the sense that the estimator converges to the true value when the number of unlinked loci for which we have information is large, and has the advantage of not making any assumptions about demographic history. The algorithm works as follows: we first split the sample at each locus into inferred left and right clades to obtain many estimates of the TMRCA, which we can average to obtain an initial estimate of the TMRCA. We then use nucleotide sequence data from other unlinked loci to form an empirical distribution that we can use to improve this initial estimate. Copyright © 2016 by the Genetics Society of America.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Machlin, S.M.; Hanson, R.S.
The nucleotide sequence of a cloned 2.5-kilobase-pair SmaI fragment containing the methanol dehydrogenase (MDH) structural gene from Methylobacterium organophilum XX was determined. A single open reading frame with a coding capacity of 626 amino acids (molecular weight, 66,000) was identified on one stand, and N-terminal sequencing of purified MDH revealed that 27 of these residues constituted a putative signal peptide. Primer extension mapping of in vivo transcripts indicated that the start of mRNA synthesis was 160 to 170 base pairs upstream of the ATG codon. Northern (RNA) blot analysis further demonstrated that the transcript was 2.1 kilobase pairs in lengthmore » and therefore appeared to encode only MDH.« less
Feng, Hao; Conneely, Karen N.; Wu, Hao
2014-01-01
DNA methylation is an important epigenetic modification that has essential roles in cellular processes including gene regulation, development and disease and is widely dysregulated in most types of cancer. Recent advances in sequencing technology have enabled the measurement of DNA methylation at single nucleotide resolution through methods such as whole-genome bisulfite sequencing and reduced representation bisulfite sequencing. In DNA methylation studies, a key task is to identify differences under distinct biological contexts, for example, between tumor and normal tissue. A challenge in sequencing studies is that the number of biological replicates is often limited by the costs of sequencing. The small number of replicates leads to unstable variance estimation, which can reduce accuracy to detect differentially methylated loci (DML). Here we propose a novel statistical method to detect DML when comparing two treatment groups. The sequencing counts are described by a lognormal-beta-binomial hierarchical model, which provides a basis for information sharing across different CpG sites. A Wald test is developed for hypothesis testing at each CpG site. Simulation results show that the proposed method yields improved DML detection compared to existing methods, particularly when the number of replicates is low. The proposed method is implemented in the Bioconductor package DSS. PMID:24561809
Liu, J; Turnbough, C L
1994-01-01
In Escherichia coli, expression of the pyrC gene is regulated primarily by a translational control mechanism based on nucleotide-sensitive selection of transcriptional start sites at the pyrC promoter. When intracellular levels of CTP are high, pyrC transcripts are initiated predominantly with CTP at a site 7 bases downstream of the Pribnow box. These transcripts form a stable hairpin at their 5' ends that blocks ribosome binding. When the CTP level is low and the GTP level is high, conditions found in pyrimidine-limited cells, transcripts are initiated primarily with GTP at a site 9 bases downstream of the Pribnow box. These shorter transcripts are unable to form a hairpin at their 5' ends and are readily translated. In this study, we examined the effects of nucleotide sequence and position on the selection of transcriptional start sites at the pyrC promoter. We characterized promoter mutations that systematically alter the sequence at position 7 or 9 downstream of the Pribnow box or vary the spacing between the Pribnow box and wild-type transcriptional initiation region. The results reveal preferences for particular initiating nucleotides (ATP > or = GTP > UTP >> CTP) and for starting positions downstream of the Pribnow box (7 >> 6 and 8 > 9 > 10). The results indicate that optimal nucleotide-sensitive start site switching at the wild-type pyrC promoter is the result of competition between the preferred start site (position 7) that uses the poorest initiating nucleotide (CTP) and a weak start site (position 9) that uses a good initiating nucleotide (GTP). The sequence of the pyrC promoter also minimizes the synthesis of untranslatable transcripts and provides for maximum stability of the regulatory transcript hairpin. In addition, the results show that the effects of the mutations on pyrC expression and regulation are consistent with the current model for translational control. Possible effects of preferences for initiating nucleotides and start sites on the
Plucienniczak, A; Schroeder, E; Zettlmeissl, G; Streeck, R E
1985-01-01
The nucleotide sequence of a 7.6 kb vaccinia DNA segment from a genomic region conserved among different orthopox virus has been determined. This segment contains a tight cluster of 12 partly overlapping open reading frames most of which can be correlated with previously identified early and late proteins and mRNAs. Regulatory signals used by vaccinia virus have been studied. Presumptive promoter regions are rich in A, T and carry the consensus sequences TATA and AATAA spaced at 20-24 base pairs. Tandem repeats of a CTATTC consensus sequence are proposed to be involved in the termination of early transcription. PMID:2987815
Stephenson, F H; Ballard, B T; Boyer, H W; Rosenberg, J M; Greene, P J
1989-12-21
The RsrI endonuclease, a type-II restriction endonuclease (ENase) found in Rhodobacter sphaeroides, is an isoschizomer of the EcoRI ENase. A clone containing an 11-kb BamHI fragment was isolated from an R. sphaeroides genomic DNA library by hybridization with synthetic oligodeoxyribonucleotide probes based on the N-terminal amino acid (aa) sequence of RsrI. Extracts of E. coli containing a subclone of the 11-kb fragment display RsrI activity. Nucleotide sequence analysis reveals an 831-bp open reading frame encoding a polypeptide of 277 aa. A 50% identity exists within a 266-aa overlap between the deduced aa sequences of RsrI and EcoRI. Regions of 75-100% aa sequence identity correspond to key structural and functional regions of EcoRI. The type-II ENases have many common properties, and a common origin might have been expected. Nevertheless, this is the first demonstration of aa sequence similarity between ENases produced by different organisms.
The complete nucleotide sequence of the domestic dog (Canis familiaris) mitochondrial genome.
Kim, K S; Lee, S E; Jeong, H W; Ha, J H
1998-10-01
The complete nucleotide sequence of the mitochondrial genome of the domestic dog, Canis familiaris, was determined. The length of the sequence was 16,728 bp; however, the length was not absolute due to the variation (heteroplasmy) caused by differing numbers of the repetitive motif, 5'-GTACACGT(A/G)C-3', in the control region. The genome organization, gene contents, and codon usage conformed to those of other mammalian mitochondrial genomes. Although its features were unknown, the "CTAGA" duplication event which followed the translational stop codon of the COII gene was not observed in other mammalian mitochondrial genomes. In order to determine the possible differences between mtDNAs in carnivores, two rRNA and 13 protein-coding genes from the cat, dog, and seal were compared. The combined molecular differences, in two rRNA genes as well as in the inferred amino acid sequences of the mitochondrial 13 protein-coding genes, suggested that there is a closer relationship between the dog and the seal than there is between either of these species and the cat. Based on the molecular differences of the mtDNA, the evolutionary divergence between the cat, the dog, and the seal was dated to approximately 50 +/- 4 million years ago. The degree of difference between carnivore mtDNAs varied according to the individual protein-coding gene applied, showing that the evolutionary relationships of distantly related species should be presented in an extended study based on ample sequence data like complete mtDNA molecules. Copyright 1998 Academic Press.
Molecular cloning and nucleotide sequence of CYP6BF1 from the diamondback moth, Plutella xylostella
Li, Hongshan; Dai, Huaguo; Wei, Hui
2005-01-01
A novel cDNA clong encoding a cytochrome P450 was screened from the insecticide-susceptible strain of Plutella xylostella (L.) (Lepidoptera:Yponomeutidae). The nucleotide sequence of the clone, designated CYP6BF1, was determined. This is the first full-length sequence of the CYP6 family from Plutella xylostella (L.). The cDNA is 1661bp in length and contains an open reading frame from base pairs 26 to 1570, encoding a protein of 514 amino acid residues. It is similar to the other insect P450s in gene family 6, including CYP6AE1 from Depressaria pastinacella, (46%). The GenBank accession number is AY971374. PMID:17119627
Chiusano, M L; D'Onofrio, G; Alvarez-Valin, F; Jabbari, K; Colonna, G; Bernardi, G
1999-09-30
We investigated the relationships between the nucleotide substitution rates and the predicted secondary structures in the three states representation (alpha-helix, beta-sheet, and coil). The analysis was carried out on 34 alignments, each of which comprised sequences belonging to at least four different mammalian orders. The rates of synonymous substitution were found to be significantly different in regions predicted to be alpha-helix, beta-sheet, or coil. Likewise, the nonsynonymous rates also differ, although expectedly at a lower extent, in the three types of secondary structure, suggesting that different selective constraints associated with the different structures are affecting in a similar way the synonymous and nonsynonymous rates. Moreover, the base composition of the third codon positions is different in coding sequence regions corresponding to different secondary structures of proteins.
Using EMBL-EBI Services via Web Interface and Programmatically via Web Services.
Lopez, Rodrigo; Cowley, Andrew; Li, Weizhong; McWilliam, Hamish
2014-12-12
The European Bioinformatics Institute (EMBL-EBI) provides access to a wide range of databases and analysis tools that are of key importance in bioinformatics. As well as providing Web interfaces to these resources, Web Services are available using SOAP and REST protocols that enable programmatic access to our resources and allow their integration into other applications and analytical workflows. This unit describes the various options available to a typical researcher or bioinformatician who wishes to use our resources via Web interface or programmatically via a range of programming languages. Copyright © 2014 John Wiley & Sons, Inc.
Piddington, C S; Kovacevich, B R; Rambosek, J
1995-01-01
Dibenzothiophene (DBT), a model compound for sulfur-containing organic molecules found in fossil fuels, can be desulfurized to 2-hydroxybiphenyl (2-HBP) by Rhodococcus sp. strain IGTS8. Complementation of a desulfurization (dsz) mutant provided the genes from Rhodococcus sp. strain IGTS8 responsible for desulfurization. A 6.7-kb TaqI fragment cloned in Escherichia coli-Rhodococcus shuttle vector pRR-6 was found to both complement this mutation and confer desulfurization to Rhodococcus fascians, which normally is not able to desulfurize DBT. Expression of this fragment in E. coli also conferred the ability to desulfurize DBT. A molecular analysis of the cloned fragment revealed a single operon containing three open reading frames involved in the conversion of DBT to 2-HBP. The three genes were designated dszA, dszB, and dszC. Neither the nucleotide sequences nor the deduced amino acid sequences of the enzymes exhibited significant similarity to sequences obtained from the GenBank, EMBL, and Swiss-Prot databases, indicating that these enzymes are novel enzymes. Subclone analyses revealed that the gene product of dszC converts DBT directly to DBT-sulfone and that the gene products of dszA and dszB act in concert to convert DBT-sulfone to 2-HBP. PMID:7574582
Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang
2009-01-01
The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.
Feltus, F.A.; Singh, H.P.; Lohithaswa, H.C.; Schulze, S.R.; Silva, T.D.; Paterson, A.H.
2006-01-01
Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species. PMID:16607031
Kyöstiö, S R; Cramer, C L; Lacy, G H
1991-01-01
The prt1 gene encoding extracellular protease from Erwinia carotovora subsp. carotovora EC14 in cosmid pCA7 was subcloned to create plasmid pSK1. The partial nucleotide sequence of the insert in pSK1 (1,878 bp) revealed a 1,041-bp open reading frame (ORF1) that correlated with protease activity in deletion mutants. ORF1 encodes a polypeptide of 347 amino acids with a calculated molecular mass of 38,826 Da. Escherichia coli transformed with pSK1 or pSK23, a subclone of pSK1, produces a protease (Prt1) intracellularly with a molecular mass of 38 kDa and a pI of 4.8. Prt1 activity was inhibited by phenanthroline, suggesting that it is a metalloprotease. The prt1 promoter was localized between 173 and 1,173 bp upstream of ORF1 by constructing transcriptional lacZ fusions. Primer extension identified the prt1 transcription start site 205 bp upstream of ORF1. The deduced amino acid sequence of ORF1 showed significant sequence identity to metalloproteases from Bacillus thermoproteolyticus (thermolysin), B. subtilis (neutral protease), Legionella pneumophila (metalloprotease), and Pseudomonas aeruginosa (elastase). It has less sequence similarity to metalloproteases from Serratia marcescens and Erwinia chrysanthemi. Locations for three zinc ligands and the active site for E. carotovora subsp. carotovora protease were predicted from thermolysin. Images FIG. 2 FIG. 5 FIG. 6 FIG. 8 FIG. 9 PMID:1917878
The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition
NASA Astrophysics Data System (ADS)
Štambuk, Nikola
The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.
Panwar, Bharat; Raghava, Gajendra P S
2015-04-01
The RNA-protein interactions play a diverse role in the cells, thus identification of RNA-protein interface is essential for the biologist to understand their function. In the past, several methods have been developed for predicting RNA interacting residues in proteins, but limited efforts have been made for the identification of protein-interacting nucleotides in RNAs. In order to discriminate protein-interacting and non-interacting nucleotides, we used various classifiers (NaiveBayes, NaiveBayesMultinomial, BayesNet, ComplementNaiveBayes, MultilayerPerceptron, J48, SMO, RandomForest, SMO and SVM(light)) for prediction model development using various features and achieved highest 83.92% sensitivity, 84.82 specificity, 84.62% accuracy and 0.62 Matthew's correlation coefficient by SVM(light) based models. We observed that certain tri-nucleotides like ACA, ACC, AGA, CAC, CCA, GAG, UGA, and UUU preferred in protein-interaction. All the models have been developed using a non-redundant dataset and are evaluated using five-fold cross validation technique. A web-server called RNApin has been developed for the scientific community (http://crdd.osdd.net/raghava/rnapin/). Copyright © 2015 Elsevier Inc. All rights reserved.
García-Sancho, Miguel
2011-01-01
This paper explores the introduction of professional systems engineers and information management practices into the first centralized DNA sequence database, developed at the European Molecular Biology Laboratory (EMBL) during the 1980s. In so doing, it complements the literature on the emergence of an information discourse after World War II and its subsequent influence in biological research. By the careers of the database creators and the computer algorithms they designed, analyzing, from the mid-1960s onwards information in biology gradually shifted from a pervasive metaphor to be embodied in practices and professionals such as those incorporated at the EMBL. I then investigate the reception of these database professionals by the EMBL biological staff, which evolved from initial disregard to necessary collaboration as the relationship between DNA, genes, and proteins turned out to be more complex than expected. The trajectories of the database professionals at the EMBL suggest that the initial subject matter of the historiography of genomics should be the long-standing practices that emerged after World War II and to a large extent originated outside biomedicine and academia. Only after addressing these practices, historians may turn to their further disciplinary assemblage in fields such as bioinformatics or biotechnology.
Liu, Siyang; Huang, Shujia; Rao, Junhua; Ye, Weijian; Krogh, Anders; Wang, Jun
2015-01-01
Comprehensive recognition of genomic variation in one individual is important for understanding disease and developing personalized medication and treatment. Many tools based on DNA re-sequencing exist for identification of single nucleotide polymorphisms, small insertions and deletions (indels) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction of population-scale pan-genomes. Our study also highlights the usefulness of the de novo assembly strategy for definition of genome structure.
Evaluation of atpB nucleotide sequences for phylogenetic studies of ferns and other pteridophytes.
Wolf, P
1997-10-01
Inferring basal relationships among vascular plants poses a major challenge to plant systematists. The divergence events that describe these relationships occurred long ago and considerable homoplasy has since accrued for both molecular and morphological characters. A potential solution is to examine phylogenetic analyses from multiple data sets. Here I present a new source of phylogenetic data for ferns and other pteridophytes. I sequenced the chloroplast gene atpB from 23 pteridophyte taxa and used maximum parsimony to infer relationships. A 588-bp region of the gene appeared to contain a statistically significant amount of phylogenetic signal and the resulting trees were largely congruent with similar analyses of nucleotide sequences from rbcL. However, a combined analysis of atpB plus rbcL produced a better resolved tree than did either data set alone. In the shortest trees, leptosporangiate ferns formed a monophyletic group. Also, I detected a well-supported clade of Psilotaceae (Psilotum and Tmesipteris) plus Ophioglossaceae (Ophioglossum and Botrychium). The demonstrated utility of atpB suggests that sequences from this gene should play a role in phylogenetic analyses that incorporate data from chloroplast genes, nuclear genes, morphology, and fossil data.
Energy efficiency trade-offs drive nucleotide usage in transcribed regions
Chen, Wei-Hua; Lu, Guanting; Bork, Peer; Hu, Songnian; Lercher, Martin J.
2016-01-01
Efficient nutrient usage is a trait under universal selection. A substantial part of cellular resources is spent on making nucleotides. We thus expect preferential use of cheaper nucleotides especially in transcribed sequences, which are often amplified thousand-fold compared with genomic sequences. To test this hypothesis, we derive a mutation-selection-drift equilibrium model for nucleotide skews (strand-specific usage of ‘A' versus ‘T' and ‘G' versus ‘C'), which explains nucleotide skews across 1,550 prokaryotic genomes as a consequence of selection on efficient resource usage. Transcription-related selection generally favours the cheaper nucleotides ‘U' and ‘C' at synonymous sites. However, the information encoded in mRNA is further amplified through translation. Due to unexpected trade-offs in the codon table, cheaper nucleotides encode on average energetically more expensive amino acids. These trade-offs apply to both strand-specific nucleotide usage and GC content, causing a universal bias towards the more expensive nucleotides ‘A' and ‘G' at non-synonymous coding sites. PMID:27098217
Reading biological processes from nucleotide sequences
NASA Astrophysics Data System (ADS)
Murugan, Anand
Cellular processes have traditionally been investigated by techniques of imaging and biochemical analysis of the molecules involved. The recent rapid progress in our ability to manipulate and read nucleic acid sequences gives us direct access to the genetic information that directs and constrains biological processes. While sequence data is being used widely to investigate genotype-phenotype relationships and population structure, here we use sequencing to understand biophysical mechanisms. We present work on two different systems. First, in chapter 2, we characterize the stochastic genetic editing mechanism that produces diverse T-cell receptors in the human immune system. We do this by inferring statistical distributions of the underlying biochemical events that generate T-cell receptor coding sequences from the statistics of the observed sequences. This inferred model quantitatively describes the potential repertoire of T-cell receptors that can be produced by an individual, providing insight into its potential diversity and the probability of generation of any specific T-cell receptor. Then in chapter 3, we present work on understanding the functioning of regulatory DNA sequences in both prokaryotes and eukaryotes. Here we use experiments that measure the transcriptional activity of large libraries of mutagenized promoters and enhancers and infer models of the sequence-function relationship from this data. For the bacterial promoter, we infer a physically motivated 'thermodynamic' model of the interaction of DNA-binding proteins and RNA polymerase determining the transcription rate of the downstream gene. For the eukaryotic enhancers, we infer heuristic models of the sequence-function relationship and use these models to find synthetic enhancer sequences that optimize inducibility of expression. Both projects demonstrate the utility of sequence information in conjunction with sophisticated statistical inference techniques for dissecting underlying biophysical
DOE Office of Scientific and Technical Information (OSTI.GOV)
Herzog, R.; Lutz, S.; Blin, N.
1991-02-05
Heparin cofactor II (HCII) is a 66-kDa plasma glycoprotein that inhibits thrombin rapidly in the presence of dermatan sulfate or heparin. Clones comprising the entire HCII gene were isolated from a human leukocyte genomic library in EMBL-3 {lambda} phage. The sequence of the gene was determined on both strands of DNA (15,849 bp) and included 1,749 bp of 5{prime}-flanking sequence, five exons, four introns, and 476 bp of DNA 3{prime} to the polyadenylation site. Ten complete and one partial Alu repeats were identified in the introns and 5{prime}-flanking region. The HCII gene was regionally mapped on chromosome 22 using rodent-humanmore » somatic cell hybrids, carrying only parts of human chromosome 22, and the chronic myelogenous leukemia cell line K562. With the cDNA probe HCII7.2, containing the entire coding region of the gene, the HCII gene was shown to be amplified 10-20-fold in K562 cells by Southern analysis and in situ hybridization. From these data, the authors concluded that the HCII gene is localized on the chromosomal band 22q11 proximal to the breakpoint cluster region (BCR). Analysis by pulsed-field gel electrophoresis indicated that the amplified HCII gene in K562 cells maps at least 2 Mbp proximal to BCR-1. Furthermore, the HCII7.2 cDNA probe detected two frequent restriction fragment length polymorphisms with the restriction enzymes BamHI and Hind III.« less
Bowen, D; Littlechild, J A; Fothergill, J E; Watson, H C; Hall, L
1988-01-01
Using oligonucleotide probes derived from amino acid sequencing information, the structural gene for phosphoglycerate kinase from the extreme thermophile, Thermus thermophilus, was cloned in Escherichia coli and its complete nucleotide sequence determined. The gene consists of an open reading frame corresponding to a protein of 390 amino acid residues (calculated Mr 41,791) with an extreme bias for G or C (93.1%) in the codon third base position. Comparison of the deduced amino acid sequence with that of the corresponding mesophilic yeast enzyme indicated a number of significant differences. These are discussed in terms of the unusual codon bias and their possible role in enhanced protein thermal stability. Images Fig. 1. PMID:3052437
Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred
2014-01-01
Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield. PMID:25333064
Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred
2014-09-01
Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.
de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E
2015-01-01
The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Guédon, Yann; d'Aubenton-Carafa, Yves; Thermes, Claude
2006-03-01
The most commonly used models for analysing local dependencies in DNA sequences are (high-order) Markov chains. Incorporating knowledge relative to the possible grouping of the nucleotides enables to define dedicated sub-classes of Markov chains. The problem of formulating lumpability hypotheses for a Markov chain is therefore addressed. In the classical approach to lumpability, this problem can be formulated as the determination of an appropriate state space (smaller than the original state space) such that the lumped chain defined on this state space retains the Markov property. We propose a different perspective on lumpability where the state space is fixed and the partitioning of this state space is represented by a one-to-many probabilistic function within a two-level stochastic process. Three nested classes of lumped processes can be defined in this way as sub-classes of first-order Markov chains. These lumped processes enable parsimonious reparameterizations of Markov chains that help to reveal relevant partitions of the state space. Characterizations of the lumped processes on the original transition probability matrix are derived. Different model selection methods relying either on hypothesis testing or on penalized log-likelihood criteria are presented as well as extensions to lumped processes constructed from high-order Markov chains. The relevance of the proposed approach to lumpability is illustrated by the analysis of DNA sequences. In particular, the use of lumped processes enables to highlight differences between intronic sequences and gene untranslated region sequences.
USDA-ARS?s Scientific Manuscript database
Watermelon (Citrullus lanatus var. lanatus) is an important vegetable fruit throughout the world. A high number of single nucleotide polymorphism (SNP) and simple sequence repeat (SSR) markers should provide large coverage of the watermelon genome and high phylogenetic resolution of germplasm acces...
Jiang, Rui ; Yang, Hua ; Zhou, Linqi ; Kuo, C.-C. Jay ; Sun, Fengzhu ; Chen, Ting
2007-01-01
The increasing demand for the identification of genetic variation responsible for common diseases has translated into a need for sophisticated methods for effectively prioritizing mutations occurring in disease-associated genetic regions. In this article, we prioritize candidate nonsynonymous single-nucleotide polymorphisms (nsSNPs) through a bioinformatics approach that takes advantages of a set of improved numeric features derived from protein-sequence information and a new statistical learning model called “multiple selection rule voting” (MSRV). The sequence-based features can maximize the scope of applications of our approach, and the MSRV model can capture subtle characteristics of individual mutations. Systematic validation of the approach demonstrates that this approach is capable of prioritizing causal mutations for both simple monogenic diseases and complex polygenic diseases. Further studies of familial Alzheimer diseases and diabetes show that the approach can enrich mutations underlying these polygenic diseases among the top of candidate mutations. Application of this approach to unclassified mutations suggests that there are 10 suspicious mutations likely to cause diseases, and there is strong support for this in the literature. PMID:17668383
Kletsov, Aleksey A; Glukhovskoy, Evgeny G; Chumakov, Aleksey S; Ortiz, Joseph V
2016-01-01
The conduction properties of DNA molecule, particularly its transverse conductance (electron transfer through nucleotide bridges), represent a point of interest for DNA chemistry community, especially for DNA sequencing. However, there is no fully developed first-principles theory for molecular conductance and current that allows one to analyze the transverse flow of electrical charge through a nucleotide base. We theoretically investigate the transverse electron transport through all four DNA nucleotide bases by implementing an unbiased ab initio theoretical approach, namely, the electron propagator theory. The electrical conductance and current through DNA nucleobases (guanine [G], cytosine [C], adenine [A] and thymine [T]) inserted into a model 1-nm Ag-Ag nanogap are calculated. The magnitudes of the calculated conductance and current are ordered in the following hierarchies: gA>gG>gC>gT and IG>IA>IT>IC correspondingly. The new distinguishing parameter for the nucleobase identification is proposed, namely, the onset bias magnitude. Nucleobases exhibit the following hierarchy with respect to this parameter: Vonset(A)
Foster, Gayle C; McGhee, Gayle C; Jones, Alan L; Sundin, George W
2004-12-01
The nucleotide sequences, genetic organization, and distribution of plasmids pEU30 (30,314 bp) and pEL60 (60,145 bp) from the plant pathogen Erwinia amylovora are described. The newly characterized pEU30 and pEL60 plasmids inhabited strains isolated in the western United States and Lebanon, respectively. The gene content of pEU30 resembled plasmids found in plant-associated bacteria, while that of pEL60 was most similar to IncL/M plasmids inhabiting enteric bacteria.
Composition for nucleic acid sequencing
Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY
2008-08-26
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M
2016-01-01
Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.
Ramu, Chenna
2003-07-01
SIRW (http://sirw.embl.de/) is a World Wide Web interface to the Simple Indexing and Retrieval System (SIR) that is capable of parsing and indexing various flat file databases. In addition it provides a framework for doing sequence analysis (e.g. motif pattern searches) for selected biological sequences through keyword search. SIRW is an ideal tool for the bioinformatics community for searching as well as analyzing biological sequences of interest.
Zscheck, K K; Murray, B E
1991-01-01
The nucleotide sequence of the constitutively produced beta-lactamase (Bla) gene from Enterococcus faecalis HH22 was shown to be identical to the published sequences of three of four staphylococcal type A beta-lactamase genes; more differences were seen with the genes for staphylococcal type C and D enzymes. One hundred forty nucleotides upstream of the beta-lactamase start codon were determined for an inducible staphylococcal beta-lactamase and were identical to those of the constitutively expressed enterococcal gene, indicating that the changes resulting in constitutive expression are not due to changes in the promoter or operator region. Moreover, complementation studies indicated that production of the enterococcal enzyme could be repressed. The genes for the enterococcal Bla and an inducible staphylococcal Bla were each cloned into a shuttle vector and transformed into enterococcal and staphylococcal recipients. The major difference between the backgrounds of the two hosts was that more enzyme was produced by the staphylococcal host, regardless of the source of the gene. The location of the enzyme was found to be host dependent, since each cloned gene generated extracellular (free) enzyme in the staphylococcus and cell-bound enzyme in the enterococcus. On the basis of the identities of the enterococcal Bla and several staphylococcal Bla sequences, these data suggest the recent spread of beta-lactamase to enterococci and also suggest the loss of a functional repressor. PMID:1952840
Koike-Takeshita, A; Koyama, T; Obata, S; Ogura, K
1995-08-04
The genes encoding two dissociable components essential for Bacillus stearothermophilus heptaprenyl diphosphate synthase (all-trans-hexparenyl-diphosphate:isopentenyl-diphosphate hexaprenyl-trans-transferase, EC 2.5.1.30) were cloned, and their nucleotide sequences were determined. Sequence analyses revealed the presence of three open reading frames within 2,350 base pairs, designated as ORF-1, ORF-2, and ORF-3 in order of nucleotide sequence, which encode proteins of 220, 234, and 323 amino acids, respectively. Deletion experiments have shown that expression of the enzymatic activity requires the presence of ORF-1 and ORF-3, but ORF-2 is not essential. As a result, this enzyme was proved genetically to consist of two different protein compounds with molecular masses of 25 kDa (Component I) and 36 kDa (Component II), encoded by two of the three tandem genes. The protein encoded by ORF-1 has no similarity to any protein so far registered. However, the protein encoded by ORF-3 shows a 32% similarity to the farnesyl diphosphate synthase of the same bacterium and has seven highly conserved regions that have been shown typical in prenyltransferases (Koyama, T., Obata, S., Osabe, M., Takeshita, A., Yokoyama, K., Uchida, M., Nishino, T., and Ogura, K. (1993) J. Biochem. (Tokyo) 113, 355-363).
Zúñiga, M C; Steitz, J A
1977-01-01
The nucleotide sequence of tRNA1Gly isolated from the posterior silk gland of Bombyx mori has been determined. This transfer RNA is present in high amounts in the posterior silk gland during the fifth larval instar. It has a GCC anticodon, capable of decoding a major glycine codon in the fibroin messenger RNA, GGU. Structural features of Bombyx tRNA1Gly and its homology to other eukaryotic glycine tRNAs are discussed. Images PMID:414206
Whole genome sequences and annotation of Micrococcus luteus SUBG006, a novel phytopathogen of mango.
Rakhashiya, Purvi M; Patel, Pooja P; Thaker, Vrinda S
2015-12-01
Actinobaceria, Micrococcus luteus SUBG006 was isolated from infected leaves of Mangifera indica L. vr. Nylon in Rajkot, (22.30°N, 70.78°E), Gujarat, India. The genome size is 3.86 Mb with G + C content of 69.80% and contains 112 rRNA sequences (5S, 16S and 23S). The whole genome sequencing has been deposited in DDBJ/EMBL/GenBank under the accession number JOKP00000000.
JNSViewer—A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures
Dong, Min; Graham, Mitchell; Yadav, Nehul
2017-01-01
Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html. PMID:28582416
The Complete Nucleotide Sequence of the Human Immunoglobulin Heavy Chain Variable Region Locus
Matsuda, Fumihiko; Ishii, Kazuo; Bourvagnet, Patrice; Kuma, Kei-ichi; Hayashida, Hidenori; Miyata, Takashi; Honjo, Tasuku
1998-01-01
The complete nucleotide sequence of the 957-kb DNA of the human immunoglobulin heavy chain variable (VH) region locus was determined and 43 novel VH segments were identified. The region contains 123 VH segments classifiable into seven different families, of which 79 are pseudogenes. Of the 44 VH segments with an open reading frame, 39 are expressed as heavy chain proteins and 1 as mRNA, while the remaining 4 are not found in immunoglobulin cDNAs. Combinatorial diversity of VH region was calculated to be ∼6,000. Conservation of the promoter and recombination signal sequences was observed to be higher in functional VH segments than in pseudogenes. Phylogenetic analysis of 114 VH segments clearly showed clustering of the VH segments of each family. However, an independent branch in the tree contained a single VH, V4-44.1P, sharing similar levels of homology to human VH families and to those of other vertebrates. Comparison between different copies of homologous units that appear repeatedly across the locus clearly demonstrates that dynamic DNA reorganization of the locus took place at least eight times between 133 and 10 million years ago. One nonimmunoglobulin gene of unknown function was identified in the intergenic region. PMID:9841928
Becker, Y; Asher, Y; Tabor, E; Davidson, I; Malkinson, M
1994-01-01
A DNA segment of the MDV-1 BamHI-D fragment was sequenced, and the open reading frames (ORFs) present in the 4556 nucleotide fragment were analyzed by computer programs. Computer analysis identified 19 putative ORFs in the sequence ranging from a coding capacity of 37 amino acids (aa) (ORF-1a) to 684aa (ORF-1). The special properties of four ORFs (1a, 1, 2, and 3) were investigated. Two adjacent ORFs, ORF-1a and ORF-1, were found by computer analysis to have the properties of two introns encoding a glycoprotein: ORF-1a encodes an aa sequence with the properties of a signal peptide, and ORF-1 encodes a polypeptide with a membrane anchor domain and putative N-glycosylation sites in the aa sequence. ORF-1a and ORF-1 were found to be transcribed in MDV-1-infected cells. Two RNA transcripts were detected: a precursor RNA and its spliced form. Both are transcribed from a promoter located 5' to ORF-1a, and splice donor and acceptor sites are used to splice the mRNA after cleavage of a 71-nucleotide sequence. This finding suggest that ORF-1a and ORF-1 are two introns of a new MDV-1 glycoprotein gene. The DNA sequence containing ORF-1 was transiently expressed in COS-1 cells, and the viral protein produced in these cells was found to react with anti-MDV serotype-1 Antigen B-specific monoclonal antibodies. These studies indicate that the protein encoded by ORF-1 has antigenic properties resembling Antigen B of MDV-1. A gene homologous to ORF-1 was detected in the genome of both MDV-2(SB1) and MDV-3(HVT), which serve as commercial vaccine strains. Two additional ORFs were noted in the 4556 nucleotide sequence: ORF-2, which encodes a 333 aa polypeptide initiating in the UL and terminating in the TRL prior to the putative origin of replication, and ORF-3, which encodes a 155 aa polypeptide that is partly homologous to the phosphoprotein pp38 encoded by the BamHI-H sequence. The 65 N-terminal aa of the two gene products are identical, both being derived from the nucleotide
Gupta, A; Morby, A P; Turner, J S; Whitton, B A; Robinson, N J
1993-01-01
Genomic rearrangements involving amplification of metallothionein (MT) genes have been reported in metal-tolerant eukaryotes. Similarly, we have recently observed amplification and rearrangement of a prokaryotic MT locus, smt, in cells of Synechococcus PCC 6301 selected for Cd tolerance. Following the characterization of this locus, the altered smt region has now been isolated from a Cd-tolerant cell line, C3.2, and its nucleotide sequence determined. This has identified a deletion within smtB, which encodes a trans-acting repressor of smt transcription. Two identical palindromic octanucleotides (5'-GCGATC-GC-3') traverse both borders of the excised element. This palindromic sequence is highly represented in the smt locus (7 occurrences in 1326 nucleotides) and analysis of the GenBank/EMBL/DDBJ DNA Nucleotide Sequence Data Libraries reveals that this is a highly iterated palindrome (HIP1) in other known sequences from Synechococcus strains (estimated to occur at an average frequency of once every c. 664 bp). HIP1 is also abundant in the genomes of other cyanobacteria. The functional significance of smtB deletion and the possible role of HIP1 in genome plasticity and adaptation in cyanobacteria are discussed.
Characterization of a dam Mutant of Serratia marcescens and Nucleotide Sequence of the dam Region
Ostendorf, Tammo; Cherepanov, Peter; de Vries, Johann; Wackernagel, Wilfried
1999-01-01
The DNA of Serratia marcescens has N6-adenine methylation in GATC sequences. Among 2-aminopurine-sensitive mutants isolated from S. marcescens Sr41, one was identified which lacked GATC methylation. The mutant showed up to 30-fold increased spontaneous mutability and enhanced mutability after treatment with 2-aminopurine, ethyl methanesulfonate, or UV light. The gene (dam) coding for the adenine methyltransferase (Dam enzyme) of S. marcescens was identified on a gene bank plasmid which alleviated the 2-aminopurine sensitivity and the higher mutability of a dam-13::Tn9 mutant of Escherichia coli. Nucleotide sequencing revealed that the deduced amino acid sequence of Dam (270 amino acids; molecular mass, 31.3 kDa) has 72% identity to the Dam enzyme of E. coli. The dam gene is located between flanking genes which are similar to those found to the sides of the E. coli dam gene. The results of complementation studies indicated that like Dam of E. coli and unlike Dam of Vibrio cholerae, the Dam enzyme of S. marcescens plays an important role in mutation avoidance by allowing the mismatch repair enzymes to discriminate between the parental and newly synthesized strands during correction of replication errors. PMID:10383952
Yang, Seung Hak; Lim, Joung Soo; Khan, Modabber Ahmed; Kim, Bong Soo; Choi, Dong Yoon; Lee, Eun Young; Ahn, Hee Kwon
2015-01-01
The leachate generated by the decomposition of animal carcass has been implicated as an environmental contaminant surrounding the burial site. High-throughput nucleotide sequencing was conducted to investigate the bacterial communities in leachates from the decomposition of pig carcasses. We acquired 51,230 reads from six different samples (1, 2, 3, 4, 6 and 14 week-old carcasses) and found that sequences representing the phylum Firmicutes predominated. The diversity of bacterial 16S rRNA gene sequences in the leachate was the highest at 6 weeks, in contrast to those at 2 and 14 weeks. The relative abundance of Firmicutes was reduced, while the proportion of Bacteroidetes and Proteobacteria increased from 3–6 weeks. The representation of phyla was restored after 14 weeks. However, the community structures between the samples taken at 1–2 and 14 weeks differed at the bacterial classification level. The trend in pH was similar to the changes seen in bacterial communities, indicating that the pH of the leachate could be related to the shift in the microbial community. The results indicate that the composition of bacterial communities in leachates of decomposing pig carcasses shifted continuously during the study period and might be influenced by the burial site. PMID:26500442
Wang, Jianye; Huang, Yu; Zhou, Mingxu; Zhu, Guoqiang
2016-09-01
Genomic information about Muscovy duck parvovirus is still limited. In this study, the genome of the pathogenic MDPV strain YY was sequenced. The full-length genome of YY is 5075 nucleotides (nt) long, 57 nt shorter than that of strain FM. Sequence alignment indicates that the 5' and 3' inverted terminal repeats (ITR) of strain YY contain a 14-nucleotide-pair deletion in the stem of the palindromic hairpin structure in comparison to strain FM and FZ91-30. The deleted region contains one "E-box" site and one repeated motif with the sequence "TTCCGGT" or "ACCGGAA". Phylogenetic trees constructed based the protein coding genes concordantly showed that YY, together with nine other MDPV isolates from various places, clustered in a separate branch, distinct from the branch formed by goose parvovirus (GPV) strains. These results demonstrate that, despite the distinctive deletion, the YY strain still belongs to the classical MDPV group. Moreover, the deletion of ITR may contribute to the genome evolution of MDPV under immunization pressure.
Sánchez-Navarro, J A; Pallás, V
1997-01-01
The complete nucleotide sequence of an isolate of prunus necrotic ringspot virus (PNRSV) RNA 3 has been determined. Elucidation of the amino acid sequence of the proteins encoded by the two large open reading frames (ORFs) allowed us to carry out comparative and phylogenetic studies on the movement (MP) and coat (CP) proteins in the ilarvirus group. Amino acid sequence comparison of the MP revealed a highly conserved basic sequence motif with an amphipathic alpha-helical structure preceding the conserved motif of the '30K superfamily' proposed by Mushegian and Koonin [26] for MP's. Within this '30K' motif a strictly conserved transmembrane domain is present in all ilarviruses sequenced so far. At the amino-terminal end, prune dwarf virus (PDV) has an extension not present in other ilarviruses but which is observed in all bromo- and cucumoviruses, suggesting a common ancestor or a recombinational event in the Bromoviridae family. Examination of the N-terminus of the CP's of all ilarviruses revealed a highly basic region, part of which resembles the Arg-rich motif that has been characterized in the RNA-binding protein family. This motif has also been found in the other members of the Bromoviridae family, suggesting its involvement in a structural function. Furthermore this region is required for infectivity in ilarviruses. The similarities found in this Arg-rich motif are discussed in terms of this process known as genome activation. Finally, phylogenetic analysis of both the MP and CP proteins revealed a higher relationship of A1MV to PNRSV, apple mosaic virus (ApMV) and PDV than any other member of the ilarvirus group. In that sense, A1MV should be considered as a true ilarvirus instead of forming a distinct group of viruses.
Method for sequencing nucleic acid molecules
Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu
2006-06-06
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Method for sequencing nucleic acid molecules
Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu
2006-05-30
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Wu, Jiaxin; Li, Yanda; Jiang, Rui
2014-03-01
Exome sequencing has been widely used in detecting pathogenic nonsynonymous single nucleotide variants (SNVs) for human inherited diseases. However, traditional statistical genetics methods are ineffective in analyzing exome sequencing data, due to such facts as the large number of sequenced variants, the presence of non-negligible fraction of pathogenic rare variants or de novo mutations, and the limited size of affected and normal populations. Indeed, prevalent applications of exome sequencing have been appealing for an effective computational method for identifying causative nonsynonymous SNVs from a large number of sequenced variants. Here, we propose a bioinformatics approach called SPRING (Snv PRioritization via the INtegration of Genomic data) for identifying pathogenic nonsynonymous SNVs for a given query disease. Based on six functional effect scores calculated by existing methods (SIFT, PolyPhen2, LRT, MutationTaster, GERP and PhyloP) and five association scores derived from a variety of genomic data sources (gene ontology, protein-protein interactions, protein sequences, protein domain annotations and gene pathway annotations), SPRING calculates the statistical significance that an SNV is causative for a query disease and hence provides a means of prioritizing candidate SNVs. With a series of comprehensive validation experiments, we demonstrate that SPRING is valid for diseases whose genetic bases are either partly known or completely unknown and effective for diseases with a variety of inheritance styles. In applications of our method to real exome sequencing data sets, we show the capability of SPRING in detecting causative de novo mutations for autism, epileptic encephalopathies and intellectual disability. We further provide an online service, the standalone software and genome-wide predictions of causative SNVs for 5,080 diseases at http://bioinfo.au.tsinghua.edu.cn/spring.
Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou
2014-11-01
In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.
Quantum-Sequencing: Fast electronic single DNA molecule sequencing
NASA Astrophysics Data System (ADS)
Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant
2014-03-01
A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.
Liu, Bin; Ertesvåg, Helga; Aasen, Inga Marie; Vadstein, Olav; Brautaset, Trygve; Heggeset, Tonje Marita Bjerkan
2016-06-01
Thraustochytrids are unicellular, marine protists, and there is a growing industrial interest in these organisms, particularly because some species, including strains belonging to the genus Aurantiochytrium, accumulate high levels of docosahexaenoic acid (DHA). Here, we report the draft genome sequence of Aurantiochytrium sp. T66 (ATCC PRA-276), with a size of 43 Mbp, and 11,683 predicted protein-coding sequences. The data has been deposited at DDBJ/EMBL/Genbank under the accession LNGJ00000000. The genome sequence will contribute new insight into DHA biosynthesis and regulation, providing a basis for metabolic engineering of thraustochytrids.
Mosaic organization of DNA nucleotides
NASA Technical Reports Server (NTRS)
Peng, C. K.; Buldyrev, S. V.; Havlin, S.; Simons, M.; Stanley, H. E.; Goldberger, A. L.
1994-01-01
Long-range power-law correlations have been reported recently for DNA sequences containing noncoding regions. We address the question of whether such correlations may be a trivial consequence of the known mosaic structure ("patchiness") of DNA. We analyze two classes of controls consisting of patchy nucleotide sequences generated by different algorithms--one without and one with long-range power-law correlations. Although both types of sequences are highly heterogenous, they are quantitatively distinguishable by an alternative fluctuation analysis method that differentiates local patchiness from long-range correlations. Application of this analysis to selected DNA sequences demonstrates that patchiness is not sufficient to account for long-range correlation properties.
Aguadé, M
2001-01-01
The FAH1 and F3H genes encode ferulate-5-hydroxylase and flavanone-3-hydroxylase, which are enzymes in the pathways leading to the synthesis of sinapic acid esters and flavonoids, respectively. Nucleotide variation at these genes was surveyed by sequencing a sample of 20 worldwide Arabidopsis thaliana ecotypes and one Arabidopsis lyrata spp. petraea stock. In contrast with most previously studied genes, the percentage of singletons was rather low in both the FAH1 and the F3H gene regions. There was, therefore, no footprint of a recent species expansion in the pattern of nucleotide variation in these regions. In both FAH1 and F3H, nucleotide variation was structured into two major highly differentiated haplotypes. In both genes, there was a peak of silent polymorphism in the 5' part of the coding region without a parallel increase in silent divergence. In FAH1, the peak was centered at the beginning of the second exon. In F3H, nucleotide diversity was highest at the beginning of the gene. The observed pattern of variation in both FAH1 and F3H, although suggestive of balancing selection, was compatible with a neutral model with no recombination.
Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa
2013-06-01
Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and
Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki
2002-06-05
The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.
Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome
Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274
Suyama, Yoshihisa; Matsuki, Yu
2015-01-01
Restriction-enzyme (RE)-based next-generation sequencing methods have revolutionized marker-assisted genetic studies; however, the use of REs has limited their widespread adoption, especially in field samples with low-quality DNA and/or small quantities of DNA. Here, we developed a PCR-based procedure to construct reduced representation libraries without RE digestion steps, representing de novo single-nucleotide polymorphism discovery, and its genotyping using next-generation sequencing. Using multiplexed inter-simple sequence repeat (ISSR) primers, thousands of genome-wide regions were amplified effectively from a wide variety of genomes, without prior genetic information. We demonstrated: 1) Mendelian gametic segregation of the discovered variants; 2) reproducibility of genotyping by checking its applicability for individual identification; and 3) applicability in a wide variety of species by checking standard population genetic analysis. This approach, called multiplexed ISSR genotyping by sequencing, should be applicable to many marker-assisted genetic studies with a wide range of DNA qualities and quantities. PMID:26593239
Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y
1981-01-01
The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776
Choury, Danièle; Aubert, Gérald; Szajnert, Marie-France; Azibi, Kemal; Delpech, Marc; Paul, Gérard
1999-01-01
A clinical strain of Vibrio cholerae non-O1 non-O139 isolated in France produced a new β-lactamase with a pI of 5.35. The purified enzyme, with a molecular mass of 33,000 Da, was characterized. Its kinetic constants show it to be a carbenicillin-hydrolyzing enzyme comparable to the five previously reported CARB β-lactamases and to SAR-1, another carbenicillin-hydrolyzing β-lactamase that has a pI of 4.9 and that is produced by a V. cholerae strain from Tanzania. This β-lactamase is designated CARB-6, and the gene for CARB-6 could not be transferred to Escherichia coli K-12 by conjugation. The nucleotide sequence of the structural gene was determined by direct sequencing of PCR-generated fragments from plasmid DNA with four pairs of primers covering the whole sequence of the reference CARB-3 gene. The gene encodes a 288-amino-acid protein that shares 94% homology with the CARB-1, CARB-2, and CARB-3 enzymes, 93% homology with the Proteus mirabilis N29 enzyme, and 86.5% homology with the CARB-4 enzyme. The sequence of CARB-6 differs from those of CARB-3, CARB-2, CARB-1, N29, and CARB-4 at 15, 16, 17, 19, and 37 amino acid positions, respectively. All these mutations are located in the C-terminal region of the sequence and at the surface of the molecule, according to the crystal structure of the Staphylococcus aureus PC-1 β-lactamase. PMID:9925522
Arai, Y T; Takahashi, H; Kameoka, Y; Shiino, T; Wimalaratne, O; Lodmell, D L
2001-01-01
Thirty-four suspected rabid brain samples from 2 humans, 24 dogs, 4 cats, 2 mongooses, I jackal and I water buffalo were collected in 1995-1996 in Sri Lanka. Total RNA was extracted directly from brain suspensions and examined using a one-step reverse transcription-polymerase chain reaction (RT-PCR) for the rabies virus nucleoprotein (N) gene. Twenty-eight samples were found positive for the virus N gene by RT-PCR and also for the virus antigens by fluorescent antibody (FA) test. Rabies virus isolates obtained from different animal species in different regions of Sri Lanka were genetically homogenous. Sequences of 203 nucleotides (nt)-long RT-PCR products obtained from 16 of 27 samples were found identical. Sequences of 1350 nt of N genes of 14 RT-PCR products were determined. The Sri Lanka isolates under study formed a specific cluster that included also an earlier isolate from India but did not include the known isolates from China, Thailand, Malaysia, Israel, Iran, Oman, Saudi Arabia, Russia, Nepal, Philippines, Japan and from several other countries. These results suggest that one type of rabies virus is circulating among human, dog, cat, mongoose, jackal and water buffalo living near Colombo City and in other five remote regions in Sri Lanka.
Yang, G; Liu, X G; Qiu, B S
2000-07-01
The complete nucleotides of two Chinese tobacco mosaic virus (TMV) isolates, TMV-Cv (vulgare strain) and TMV-N14 (an attenuated virus originated from a tomato strain), were determined from their respective full-length infectious cDNA clones and compared with published TMV sequences. The genome structure of TMV-Cv contained 6395 nucleotides, in which four functional open reading frames (ORF), coding for replicase (126 kD/183 kD), movement protein (MP, 30 kD) and coat protein (CP, 17.6 kD) respectively, could be recognized. TMV-N14 contained 6384 nucleotides in its genome. In contrast to TMV-Cv, five functional ORFs encoding the replicase 98.5 kD/126 kD/183 kD, MP(27 kD) and CP(17.6 kD), respectively, were detected in the TMV-N14 genome. TMV-Cv is 99% homologous to a Korean TMV isolate belonging to the vulgare strain at the nucleotide level. TMV-N14 is 99% homologous to a highly virulent Japanese isolate TMV-L (tomato strain) at the nucleotide level. In TMV-N14, one opal nulation (UGA) occurred in the replicase gene and one ochre nutation (UAA) in the MP gene. The former mutation created a potential, additional ORF within the replicase gene, the latter reduced the size of the MP to 27 kD. In addition, there were also 13 amino acid substitutions in the replicase gene of TMV-N14 when compared to that of TMV-L. Collectively, these changes may have significant implications in the attenuation of the virulence of TMV-N14.
The Nucleotide Sequence and Spliced pol mRNA Levels of the Nonprimate Spumavirus Bovine Foamy Virus
Holzschu, Donald L.; Delaney, Mari A.; Renshaw, Randall W.; Casey, James W.
1998-01-01
We have determined the complete nucleotide sequence of a replication-competent clone of bovine foamy virus (BFV) and have quantitated the amount of splice pol mRNA processed early in infection. The 544-amino-acid Gag protein precursor has little sequence similarity with its primate foamy virus homologs, but the putative nucleocapsid (NC) protein, like the primate NCs, contains the three glycine-arginine-rich regions that are postulated to bind genomic RNA during virion assembly. The BFV gag and pol open reading frames overlap, with pro and pol in the same translational frame. As with the human foamy virus (HFV) and feline foamy virus, we have detected a spliced pol mRNA by PCR. Quantitatively, this mRNA approximates the level of full-length genomic RNA early in infection. The integrase (IN) domain of reverse transcriptase does not contain the canonical HH-CC zinc finger motif present in all characterized retroviral INs, but it does contain a nearby histidine residue that could conceivably participate as a member of the zinc finger. The env gene encodes a protein that is over 40% identical in sequence to the HFV Env. By comparison, the Gag precursor of BFV is predicted to be only 28% identical to the HFV protein. PMID:9499074
Uncommon nucleotide excision repair phenotypes revealed by targeted high-throughput sequencing.
Calmels, Nadège; Greff, Géraldine; Obringer, Cathy; Kempf, Nadine; Gasnier, Claire; Tarabeux, Julien; Miguet, Marguerite; Baujat, Geneviève; Bessis, Didier; Bretones, Patricia; Cavau, Anne; Digeon, Béatrice; Doco-Fenzy, Martine; Doray, Bérénice; Feillet, François; Gardeazabal, Jesus; Gener, Blanca; Julia, Sophie; Llano-Rivas, Isabel; Mazur, Artur; Michot, Caroline; Renaldo-Robin, Florence; Rossi, Massimiliano; Sabouraud, Pascal; Keren, Boris; Depienne, Christel; Muller, Jean; Mandel, Jean-Louis; Laugel, Vincent
2016-03-22
Deficient nucleotide excision repair (NER) activity causes a variety of autosomal recessive diseases including xeroderma pigmentosum (XP) a disorder which pre-disposes to skin cancer, and the severe multisystem condition known as Cockayne syndrome (CS). In view of the clinical overlap between NER-related disorders, as well as the existence of multiple phenotypes and the numerous genes involved, we developed a new diagnostic approach based on the enrichment of 16 NER-related genes by multiplex amplification coupled with next-generation sequencing (NGS). Our test cohort consisted of 11 DNA samples, all with known mutations and/or non pathogenic SNPs in two of the tested genes. We then used the same technique to analyse samples from a prospective cohort of 40 patients. Multiplex amplification and sequencing were performed using AmpliSeq protocol on the Ion Torrent PGM (Life Technologies). We identified causative mutations in 17 out of the 40 patients (43%). Four patients showed biallelic mutations in the ERCC6(CSB) gene, five in the ERCC8(CSA) gene: most of them had classical CS features but some had very mild and incomplete phenotypes. A small cohort of 4 unrelated classic XP patients from the Basque country (Northern Spain) revealed a common splicing mutation in POLH (XP-variant), demonstrating a new founder effect in this population. Interestingly, our results also found ERCC2(XPD), ERCC3(XPB) or ERCC5(XPG) mutations in two cases of UV-sensitive syndrome and in two cases with mixed XP/CS phenotypes. Our study confirms that NGS is an efficient technique for the analysis of NER-related disorders on a molecular level. It is particularly useful for phenotypes with combined features or unusually mild symptoms. Targeted NGS used in conjunction with DNA repair functional tests and precise clinical evaluation permits rapid and cost-effective diagnosis in patients with NER-defects.
Li, Yunfeng; Zhou, Zunchun; Tian, Meilin; Tian, Yi; Dong, Ying; Li, Shilei; Liu, Weidong; He, Chongbo
2017-08-01
In this study, single nucleotide polymorphism (SNP), microsatellite (SSR) and differentially expressed genes (DEGs) in the oral parts, gonads, and umbrella parts of the jellyfish Rhopilema esculentum were analyzed by RNA-Seq technology. A total of 76.4 million raw reads and 72.1 million clean reads were generated from deep sequencing. Approximately 119,874 tentative unigenes and 149,239 transcripts were obtained. A total of 1,034,708 SNP markers were detected in the three tissues. For microsatellite mining, 5088 SSRs were identified from the unigene sequences. The most frequent repeat motifs were mononucleotide repeats, which accounted for 61.93%. Transcriptome comparison of the three tissues yielded a total of 8841 DEGs, of which 3560 were up-regulated and 5281 were down-regulated. This study represents the greatest sequencing effort carried out for a jellyfish and provides the first high-throughput transcriptomic resource for jellyfish. Copyright © 2017 Elsevier B.V. All rights reserved.
Sugita, Chieko; Ogata, Koretsugu; Shikata, Masamitsu; Jikuya, Hiroyuki; Takano, Jun; Furumichi, Miho; Kanehisa, Minoru; Omata, Tatsuo; Sugiura, Masahiro; Sugita, Mamoru
2007-01-01
The entire genome of the unicellular cyanobacterium Synechococcus elongatus PCC 6301 (formerly Anacystis nidulans Berkeley strain 6301) was sequenced. The genome consisted of a circular chromosome 2,696,255 bp long. A total of 2,525 potential protein-coding genes, two sets of rRNA genes, 45 tRNA genes representing 42 tRNA species, and several genes for small stable RNAs were assigned to the chromosome by similarity searches and computer predictions. The translated products of 56% of the potential protein-coding genes showed sequence similarities to experimentally identified and predicted proteins of known function, and the products of 35% of the genes showed sequence similarities to the translated products of hypothetical genes. The remaining 9% of genes lacked significant similarities to genes for predicted proteins in the public DNA databases. Some 139 genes coding for photosynthesis-related components were identified. Thirty-seven genes for two-component signal transduction systems were also identified. This is the smallest number of such genes identified in cyanobacteria, except for marine cyanobacteria, suggesting that only simple signal transduction systems are found in this strain. The gene arrangement and nucleotide sequence of Synechococcus elongatus PCC 6301 were nearly identical to those of a closely related strain Synechococcus elongatus PCC 7942, except for the presence of a 188.6 kb inversion. The sequences as well as the gene information shown in this paper are available in the Web database, CYORF (http://www.cyano.genome.jp/).
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.
Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions
NASA Astrophysics Data System (ADS)
Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
Lin, Chung-Jian; Huang, Chi-Chung; Huang, Chao-Ching; Chiang, Yu-Chung; Chiang, Tzen-Yuh
2012-01-01
Background Pinus massoniana, an ecologically and economically important conifer, is widespread across central and southern mainland China and Taiwan. In this study, we tested the central–marginal paradigm that predicts that the marginal populations tend to be less polymorphic than the central ones in their genetic composition, and examined a founders' effect in the island population. Methodology/Principal Findings We examined the phylogeography and population structuring of the P. massoniana based on nucleotide sequences of cpDNA atpB-rbcL intergenic spacer, intron regions of the AdhC2 locus, and microsatellite fingerprints. SAMOVA analysis of nucleotide sequences indicated that most genetic variants resided among geographical regions. High levels of genetic diversity in the marginal populations in the south region, a pattern seemingly contradicting the central–marginal paradigm, and the fixation of private haplotypes in most populations indicate that multiple refugia may have existed over the glacial maxima. STRUCTURE analyses on microsatellites revealed that genetic structure of mainland populations was mediated with recent genetic exchanges mostly via pollen flow, and that the genetic composition in east region was intermixed between south and west regions, a pattern likely shaped by gene introgression and maintenance of ancestral polymorphisms. As expected, the small island population in Taiwan was genetically differentiated from mainland populations. Conclusions/Significance The marginal populations in south region possessed divergent gene pools, suggesting that the past glaciations might have low impacts on these populations at low latitudes. Estimates of ancestral population sizes interestingly reflect a recent expansion in mainland from a rather smaller population, a pattern that seemingly agrees with the pollen record. PMID:22952747
Srinivasan, A R; Yathindra, N
1977-01-01
A novel description of the conformational characteristics of all the individual nucleotides and the phosphodiesters in tRNAs is presented in the form of a circular plot. This representation furnishes information of the base sequence with the folding patterns of the polynucleotide chain as one traverses along the circumference and with the individual nucleotide and phosphodiester linkage torsions along the radii. The circular plot obtained for yeast tRNAPhe strikingly distinguishes the helical and the loop regions. The variation of the different nucleotide torsions along the entire chain length and their effect on the secondary helical and tertiary loop regions become readily apparent. PMID:339206
Salmon, Jérôme; Nonnenmacher, Mathieu; Cazé, Sandrine; Flamant, Patricia; Croissant, Odile; Orth, Gérard; Breitburd, Françoise
2000-01-01
We previously reported the partial characterization of two cottontail rabbit papillomavirus (CRPV) subtypes with strikingly divergent E6 and E7 oncoproteins. We report now the complete nucleotide sequences of these subtypes, referred to as CRPVa4 (7,868 nucleotides) and CRPVb (7,867 nucleotides). The CRPVa4 and CRPVb genomes differed at 238 (3%) nucleotide positions, whereas CRPVa4 and the prototype CRPV differed by only 5 nucleotides. The most variable region (7% nucleotide divergence) included the long regulatory region (LRR) and the E6 and E7 genes. A mutation in the stop codon resulted in an 8-amino-acid-longer CRPVb E4 protein, and a nucleotide deletion reduced the coding capacity of the E5 gene from 101 to 25 amino acids. In domestic rabbits homozygous for a specific haplotype of the DRA and DQA genes of the major histocompatibility complex, warts induced by CRPVb DNA or a chimeric genome containing the CRPVb LRR/E6/E7 region showed an early regression, whereas warts induced by CRPVa4 or a chimeric genome containing the CRPVa4 LRR/E6/E7 region persisted and evolved into carcinomas. In contrast, most CRPVa, CRPVb, and chimeric CRPV DNA-induced warts showed no early regression in rabbits homozygous for another DRA-DQA haplotype. Little, if any, viral replication is usually observed in domestic rabbit warts. When warts induced by CRPVa and CRPVb virions and DNA were compared, the number of cells positive for viral DNA or capsid antigens was found to be greater by 1 order of magnitude for specimens induced by CRPVb. Thus, both sequence variation in the LRR/E6/E7 region and the genetic constitution of the host influence the expression of the oncogenic potential of CRPV. Furthermore, intratype variation may overcome to some extent the host restriction of CRPV replication in domestic rabbits. PMID:11044121
Rozanov, Aleksey S; Korzhuk, Anton V; Bryanskaya, Alla V; Peltek, Sergey E
2018-02-01
The Anoxybacillus flavithermus KU2-6-11 was isolated from sediments of a nameless hot spring. The hot spring is located in Uzon caldera (Kamchatka, Russia). The sequenced and annotated genome is 2,646,305 bp and encodes 2787genes. The draft genome sequence of the Anoxybacillus flavithermus KU2-6-11 has been deposited at DDBJ/EMBL/GenBank under the accession PEDM01000000 and the sequences could be found at the site https://www.ncbi.nlm.nih.gov/nuccore/PEDM01000000.
Vandenbol, M; Jauniaux, J C; Grenson, M
1989-11-15
The complete nucleotide (nt) sequence of the PUT4 gene, whose product is required for high-affinity proline active transport in the yeast Saccharomyces cerevisiae, is presented. The sequence contains a single long open reading frame of 1881 nt, encoding a polypeptide with a calculated Mr of 68,795. The predicted protein is strongly hydrophobic and exhibits six potential glycosylation sites. Its hydropathy profile suggests the presence of twelve membrane-spanning regions flanked by hydrophilic N- and C-terminal domains. The N terminus does not resemble signal sequences found in secreted proteins. These features are characteristic of integral membrane proteins catalyzing translocation of ligands across cellular membranes. Protein sequence comparisons indicate strong resemblance to the arginine and histidine permeases of S. cerevisiae, but no marked sequence similarity to the proline permease of Escherichia coli or to other known prokaryotic or eukaryotic transport proteins. The strong similarity between the three yeast amino acid permeases suggests a common ancestor for the three proteins.
FASH: A web application for nucleotides sequence search.
Veksler-Lublinksy, Isana; Barash, Danny; Avisar, Chai; Troim, Einav; Chew, Paul; Kedem, Klara
2008-05-27
: FASH (Fourier Alignment Sequence Heuristics) is a web application, based on the Fast Fourier Transform, for finding remote homologs within a long nucleic acid sequence. Given a query sequence and a long text-sequence (e.g, the human genome), FASH detects subsequences within the text that are remotely-similar to the query. FASH offers an alternative approach to Blast/Fasta for querying long RNA/DNA sequences. FASH differs from these other approaches in that it does not depend on the existence of contiguous seed-sequences in its initial detection phase. The FASH web server is user friendly and very easy to operate. FASH can be accessed athttps://fash.bgu.ac.il:8443/fash/default.jsp (secured website).
Jairin, Jirapong; Kobayashi, Tetsuya; Yamagata, Yoshiyuki; Sanada-Morimura, Sachiyo; Mori, Kazuki; Tashiro, Kosuke; Kuhara, Satoru; Kuwazaki, Seigo; Urio, Masahiro; Suetsugu, Yoshitaka; Yamamoto, Kimiko; Matsumura, Masaya; Yasui, Hideshi
2013-01-01
In this study, we developed the first genetic linkage map for the major rice insect pest, the brown planthopper (BPH, Nilaparvata lugens). The linkage map was constructed by integrating linkage data from two backcross populations derived from three inbred BPH strains. The consensus map consists of 474 simple sequence repeats, 43 single-nucleotide polymorphisms, and 1 sequence-tagged site, for a total of 518 markers at 472 unique positions in 17 linkage groups. The linkage groups cover 1093.9 cM, with an average distance of 2.3 cM between loci. The average number of marker loci per linkage group was 27.8. The sex-linkage group was identified by exploiting X-linked and Y-specific markers. Our linkage map and the newly developed markers used to create it constitute an essential resource and a useful framework for future genetic analyses in BPH. PMID:23204257
Urano, Y; Kominami, R; Mishima, Y; Muramatsu, M
1980-01-01
Approximately one kilobase pairs surrounding and upstream the transcription initiation site of a cloned ribosomal DNA (rDNA) of the mouse were sequenced. The putative transcription initiation site was determined by two independent methods: one nuclease S1 protection and the other reverse transcriptase elongation mapping using isolated 45S ribosomal RNA precursor (45S RNA) and appropriate restriction fragments of rDNA. Both methods gave an identical result; 45S RNA had a structure starting from ACTCTTAG---. Characteristically, mouse rDNA had many T clusters (greater than or equal to 5) upstream the initiation site, the longest being 21 consecutive T's. A pentadecanucleotide, TGCCTCCCGAGTGCA, appeared twice within 260 nucleotides upstream the putative initiation site. No such characteristic sequences were found downstream this site. Little similarity was found in the upstream of the transcription initiation site between the mouse, Xenopus laevis and Saccharomyces cerevisiae rDNA. Images PMID:6162156
The sequence specificity of UV-induced DNA damage in a systematically altered DNA sequence.
Khoe, Clairine V; Chung, Long H; Murray, Vincent
2018-06-01
The sequence specificity of UV-induced DNA damage was investigated in a specifically designed DNA plasmid using two procedures: end-labelling and linear amplification. Absorption of UV photons by DNA leads to dimerisation of pyrimidine bases and produces two major photoproducts, cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). A previous study had determined that two hexanucleotide sequences, 5'-GCTC*AC and 5'-TATT*AA, were high intensity UV-induced DNA damage sites. The UV clone plasmid was constructed by systematically altering each nucleotide of these two hexanucleotide sequences. One of the main goals of this study was to determine the influence of single nucleotide alterations on the intensity of UV-induced DNA damage. The sequence 5'-GCTC*AC was designed to examine the sequence specificity of 6-4PPs and the highest intensity 6-4PP damage sites were found at 5'-GTTC*CC nucleotides. The sequence 5'-TATT*AA was devised to investigate the sequence specificity of CPDs and the highest intensity CPD damage sites were found at 5'-TTTT*CG nucleotides. It was proposed that the tetranucleotide DNA sequence, 5'-YTC*Y (where Y is T or C), was the consensus sequence for the highest intensity UV-induced 6-4PP adduct sites; while it was 5'-YTT*C for the highest intensity UV-induced CPD damage sites. These consensus tetranucleotides are composed entirely of consecutive pyrimidines and must have a DNA conformation that is highly productive for the absorption of UV photons. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.
Xu, Qin; Xiong, Guanjun; Li, Pengbo; He, Fei; Huang, Yi; Wang, Kunbo; Li, Zhaohu; Hua, Jinping
2012-01-01
Gossypium is the maternal source of extant allotetraploid species and allotetraploids have a monophyletic origin. G. hirsutum AD1 lineages have experienced more sequence variations than other allotetraploids in intergenic regions. The available complete nucleotide sequences of 12 Gossypium chloroplast genomes should facilitate studies to uncover the molecular mechanisms of compartmental co-evolution and speciation of Gossypium allotetraploids. PMID:22876273
Al-Qahtani, Ahmed Ali; Mubin, Muhammad; Dela Cruz, Damian M; Althawadi, Sahar Isa; Ul Rehman, Muhammad Shah Nawaz; Bohol, Marie Fe F; Al-Ahdal, Mohammed N
2017-01-30
In early 2009, a novel influenza A (H1N1) virus appeared in Mexico and rapidly disseminated worldwide. Little is known about the phylogeny and evolutionary dynamics of the H1N1 strain found in Saudi Arabia. Nucleotide sequencing and bioinformatics analyses were used to study molecular variation between the virus isolates. In this report, 72 hemagglutinin (HA) and 45 neuraminidase (NA) H1N1 virus gene sequences, isolated in 2009 from various regions of Saudi Arabia, were analyzed. Genetic characterization indicated that viruses from two different clades, 6 and 7, were circulating in the region, with clade 7, the most widely circulating H1N1 clade globally in 2009, being predominant. Sequence analysis of the HA and NA genes revealed a high degree of sequence identity with the corresponding genes from viruses circulating in the South East Asia region and with the A/California/7/2009 strain. New mutations in the HA gene of pandemic H1N1 (pH1N1) viruses, that could alter viral fitness, were identified. Relaxed-clock and Bayesian Skyline Plot analyses, based on the isolates used in this study and closely related globally representative strains, indicated marginally higher substitution rates than the type strain (5.14×10-3 and 4.18×10-3 substitutions/nucleotide/year in the HA and NA genes, respectively). The Saudi isolates were antigenically homogeneous and closely related to the prototype vaccine strain A/California/7/2009. The antigenic site of the HA gene had acquired novel mutations in some isolates, making continued monitoring of these viruses vital for the identification of potentially highly virulent and drug resistant variants.
NASA Astrophysics Data System (ADS)
Tremberger, G.; Dehipawala, Sunil; Cheung, E.; Holden, T.; Sullivan, R.; Nguyen, A.; Lieberman, D.; Cheung, T.
2015-09-01
All metallo-proteins need post-translation metal incorporation. In fact, the isotope ratio of Fe, Cu, and Zn in physiology and oncology have emerged as an important tool. The nickel containing F430 is the prosthetic group of the enzyme methyl coenzyme M reductase which catalyzes the release of methane in the final step of methano-genesis, a prime energy metabolism candidate for life exploration space mission in the solar system. The 3.5 Gyr early life sulfite reductase as a life switch energy metabolism had Fe-Mo clusters. The nitrogenase for nitrogen fixation 3 billion years ago had Mo. The early life arsenite oxidase needed for anoxygenic photosynthesis energy metabolism 2.8 billion years ago had Mo and Fe. The selection pressure in metal incorporation inside a protein would be quantifiable in terms of the related nucleotide sequence complexity with fractal dimension and entropy values. Simulation model showed that the studied metal-required energy metabolism sequences had at least ten times more selection pressure relatively in comparison to the horizontal transferred sequences in Mealybug, guided by the outcome histogram of the correlation R-sq values. The metal energy metabolism sequence group was compared to the circadian clock KaiC sequence group using magnesium atomic level bond shifting mechanism in the protein, and the simulation model would suggest a much higher selection pressure for the energy life switch sequence group. The possibility of using Kepler 444 as an example of ancient life in Galaxy with the associated exoplanets has been proposed and is further discussed in this report. Examples of arsenic metal bonding shift probed by Synchrotron-based X-ray spectroscopy data and Zn controlled FOXP2 regulated pathways in human and chimp brain studied tissue samples are studied in relationship to the sequence bioinformatics. The analysis results suggest that relatively large metal bonding shift amount is associated with low probability correlation R
Counting Patterns in Degenerated Sequences
NASA Astrophysics Data System (ADS)
Nuel, Grégory
Biological sequences like DNA or proteins, are always obtained through a sequencing process which might produce some uncertainty. As a result, such sequences are usually written in a degenerated alphabet where some symbols may correspond to several possible letters (ex: IUPAC DNA alphabet). When counting patterns in such degenerated sequences, the question that naturally arises is: how to deal with degenerated positions ? Since most (usually 99%) of the positions are not degenerated, it is considered harmless to discard the degenerated positions in order to get an observation, but the exact consequences of such a practice are unclear. In this paper, we introduce a rigorous method to take into account the uncertainty of sequencing for biological sequences (DNA, Proteins). We first introduce a Forward-Backward approach to compute the marginal distribution of the constrained sequence and use it both to perform a Expectation-Maximization estimation of parameters, as well as deriving a heterogeneous Markov distribution for the constrained sequence. This distribution is hence used along with known DFA-based pattern approaches to obtain the exact distribution of the pattern count under the constraints. As an illustration, we consider a EST dataset from the EMBL database. Despite the fact that only 1% of the positions in this dataset are degenerated, we show that not taking into account these positions might lead to erroneous observations, further proving the interest of our approach.
Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V
2018-04-01
Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.
Li, Y; Hui, H; Burgess, C J; Price, R W; Sharp, P M; Hahn, B H; Shaw, G M
1992-01-01
Previous studies of the genetic and biologic characteristics of human immunodeficiency virus type 1 (HIV-1) have by necessity used tissue culture-derived virus. We recently reported the molecular cloning of four full-length HIV-1 genomes directly from uncultured human brain tissue (Y. Li, J. C. Kappes, J. A. Conway, R. W. Price, G. M. Shaw, and B. H. Hahn, J. Virol. 65:3973-3985, 1991). In this report, we describe the biologic properties of these four clones and the complete nucleotide sequences and genome organization of two of them. Clones HIV-1YU-2 and HIV-1YU-10 were 9,174 and 9,176 nucleotides in length, differed by 0.26% in nucleotide sequence, and except for a frameshift mutation in the pol gene in HIV-1YU-10, contained open reading frames corresponding to 5'-gag-pol-vif-vpr-tat-rev-vpu-env-nef-3' flanked by long terminal repeats. HIV-1YU-2 was fully replication competent, while HIV-1YU-10 and two other clones, HIV-1YU-21 and HIV-1YU-32, were defective. All three defective clones, however, when transfected into Cos-1 cells in any pairwise combination, yielded virions that were replication competent and transmissible by cell-free passage. The cellular host range of HIV-1YU-2 was strictly limited to primary T lymphocytes and monocyte-macrophages, a property conferred by its external envelope glycoprotein. Phylogenetic analyses of HIV-1YU-2 gene sequences revealed this virus to be a member of the North American/European HIV-1 subgroup, with specific similarity to other monocyte-tropic viruses in its V3 envelope amino acid sequence. These results indicate that HIV-1 infection of brain is characterized by the persistence of mixtures of fully competent, minimally defective, and more substantially altered viral forms and that complementation among them is readily attainable. In addition, the limited degree of genotypic heterogeneity observed among HIV-1YU and other brain-derived viruses and their preferential tropism for monocyte-macrophages suggest that viral
Cai, Yuqin; Kropachev, Konstantin; Xu, Rong; Tang, Yijin; Kolbanovskii, Marina; Kolbanovskii, Alexander; Amin, Shantu; Patel, Dinshaw J.; Broyde, Suse; Geacintov, Nicholas E.
2010-01-01
Summary The effects of non-nearest base sequences, beyond the nucleotides flanking a DNA lesion on either side, on nucleotide excision repair (NER) in extracts from human cells were investigated. We constructed two duplexes containing the same minor groove-aligned 10S (+)-trans-anti-B[a]P-N2-dG (G*) DNA adduct, derived from the environmental carcinogen benzo[a]pyrene (B[a]P): 5′-C-C-A-T-C-G*-C-T-A-C-C-3′ (CG*C-I), and 5′-C-A-C3-A4-C5-G*-C-A-C-A-C-3′ (CG*C-II). We utilized gel electrophoresis to compare the extent of DNA bending, and molecular dynamics (MD) simulations to analyze the structural characteristics of these two DNA duplexes. The NER efficiencies are 1.6 ± 0.2 times greater in the case of the CG*C-II than the CG*C-I sequence context in 135-mer duplexes. Gel electrophoresis and self-ligation circularization experiments revealed that the CG*C-II duplex is more bent than the CG*C-I duplex, while MD simulations showed that the unique -C3-A4-C5- segment in the CG*C-II duplex plays a key role. The presence of a minor groove-positioned guanine amino group, namely, the Watson-Crick partner to C3, acts as a wedge; facilitated by a highly deformable local -C3-A4- base step, this amino group allows the B[a]P ring system to produce a more enlarged minor groove in CG*C-II than in CG*C-I, as well as a local untwisting and enlarged and flexible Roll only in the CG*C-II sequence. These structural properties fit well with our prior findings that in the case of the family of minor groove 10S (+)-trans-anti-B[a]P-N2-dG lesions, flexible bends and enlarged minor groove widths (Cai et al. (2009) J. Mol. Biol., 385: 30–44) constitute NER recognition signals, and extend our understanding of sequence context effects on NER to the neighbors that are distant to the lesion. PMID:20399214
Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi
2016-01-01
Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870
Horai, Makiko; Mishima, Hiroyuki; Hayashida, Chisa; Kinoshita, Akira; Nakane, Yoshibumi; Matsuo, Tatsuki; Tsuruda, Kazuto; Yanagihara, Katsunori; Sato, Shinya; Imanishi, Daisuke; Imaizumi, Yoshitaka; Hata, Tomoko; Miyazaki, Yasushi; Yoshiura, Koh-Ichiro
2018-03-01
Ionizing radiation released by the atomic bombs at Hiroshima and Nagasaki, Japan, in 1945 caused many long-term illnesses, including increased risks of malignancies such as leukemia and solid tumours. Radiation has demonstrated genetic effects in animal models, leading to concerns over the potential hereditary effects of atomic bomb-related radiation. However, no direct analyses of whole DNA have yet been reported. We therefore investigated de novo variants in offspring of atomic-bomb survivors by whole-genome sequencing (WGS). We collected peripheral blood from three trios, each comprising a father (atomic-bomb survivor with acute radiation symptoms), a non-exposed mother, and their child, none of whom had any past history of haematological disorders. One trio of non-exposed individuals was included as a control. DNA was extracted and the numbers of de novo single nucleotide variants in the children were counted by WGS with sequencing confirmation. Gross structural variants were also analysed. Written informed consent was obtained from all participants prior to the study. There were 62, 81, and 42 de novo single nucleotide variants in the children of atomic-bomb survivors, compared with 48 in the control trio. There were no gross structural variants in any trio. These findings are in accord with previously published results that also showed no significant genetic effects of atomic-bomb radiation on second-generation survivors.
Ishikawa, Sohta A; Inagaki, Yuji; Hashimoto, Tetsuo
2012-01-01
In phylogenetic analyses of nucleotide sequences, 'homogeneous' substitution models, which assume the stationarity of base composition across a tree, are widely used, albeit individual sequences may bear distinctive base frequencies. In the worst-case scenario, a homogeneous model-based analysis can yield an artifactual union of two distantly related sequences that achieved similar base frequencies in parallel. Such potential difficulty can be countered by two approaches, 'RY-coding' and 'non-homogeneous' models. The former approach converts four bases into purine and pyrimidine to normalize base frequencies across a tree, while the heterogeneity in base frequency is explicitly incorporated in the latter approach. The two approaches have been applied to real-world sequence data; however, their basic properties have not been fully examined by pioneering simulation studies. Here, we assessed the performances of the maximum-likelihood analyses incorporating RY-coding and a non-homogeneous model (RY-coding and non-homogeneous analyses) on simulated data with parallel convergence to similar base composition. Both RY-coding and non-homogeneous analyses showed superior performances compared with homogeneous model-based analyses. Curiously, the performance of RY-coding analysis appeared to be significantly affected by a setting of the substitution process for sequence simulation relative to that of non-homogeneous analysis. The performance of a non-homogeneous analysis was also validated by analyzing a real-world sequence data set with significant base heterogeneity.
Murphy, R C; Gasparich, G E; Bryant, D A; Porter, R D
1990-01-01
The nucleotide sequence and transcript initiation site of the Synechococcus sp. strain PCC 7002 recA gene have been determined. The deduced amino acid sequence of the RecA protein of this cyanobacterium is 56% identical and 73% similar to the Escherichia coli RecA protein. Northern (RNA) blot analysis indicates that the Synechococcus strain PCC 7002 recA gene is transcribed as a monocistronic transcript 1,200 bases in length. The 5' endpoint of the recA mRNA was mapped by primer extension by using synthetic oligonucleotides of 17 and 27 nucleotides as primers. The nucleotide sequence 5' to the mapped endpoint contained sequence motifs bearing a striking resemblance to the heat shock (sigma 32-specific) promoters of E. coli but did not contain sequences similar to the E. coli SOS operator recognized by the LexA repressor. An insertion mutation introduced into the recA locus of Synechococcus strain PCC 7002 via homologous recombination resulted in the formation of diploids carrying both mutant and wild-type recA alleles. A variety of growth regimens and transformation procedures failed to produce a recA Synechococcus strain PCC 7002 mutant. However, introduction into these diploid cells of the E. coli recA gene in trans on a biphasic shuttle vector resulted in segregation of the cyanobacterial recA alleles, indicating that the E. coli recA gene was able to provide a function required for growth of recA Synechococcus strain PCC 7002 cells. This interpretation is supported by the observation that the E. coli recA gene is maintained in these cells when antibiotic selection for the shuttle vector is removed. Images FIG. 3 FIG. 4 FIG. 6 PMID:2105307
NASA Technical Reports Server (NTRS)
Lacey, J. C., Jr.; Mullins, D. W., Jr.; Watkins, C. L.; Hall, L. M.
1986-01-01
Cellular organisms store information as sequences of nucleotides in double stranded DNA. This information is useless unless it can be converted into the active molecular species, protein. This is done in contemporary creatures first by transcription of one strand to give a complementary strand of mRNA. The sequence of nucleotides is then translated into a specific sequence of amino acids in a protein. Translation is made possible by a genetic coding system in which a sequence of three nucleotides codes for a specific amino acid. The origin and evolution of any chemical system can be understood through elucidation of the properties of the chemical entities which make up the system. There is an underlying logic to the coding system revealed by a correlation of the hydrophobicities of amino acids and their anticodonic nucleotides (i.e., the complement of the codon). Its importance lies in the fact that every amino acid going into protein synthesis must first be activated. This is universally accomplished with ATP. Past studies have concentrated on the chemistry of the adenylates, but more recently we have found, through the use of NMR, that we can observe intramolecular interactions even at low concentrations, between amino acid side chains and nucleotide base rings in these adenylates. The use of this type of compound thus affords a novel way of elucidating the manner in which amino acids and nucleotides interact with each other. In aqueous solution, when a hydrophobic amino acid is attached to the most hydrophobic nucleotide, AMP, a hydrophobic interaction takes place between the amino acid side chain and the adenine ring. The studies to be reported concern these hydrophobic interactions.
Implications of the dependence of the elastic properties of DNA on nucleotide sequence.
Olson, Wilma K; Swigon, David; Coleman, Bernard D
2004-07-15
Recent advances in structural biochemistry have provided evidence that not only the geometric properties but also the elastic moduli of duplex DNA are strongly dependent on nucleotide sequence in a way that is not accounted for by classical rod models of the Kirchhoff type. A theory of sequence-dependent DNA elasticity is employed here to calculate the dependence of the equilibrium configurations of circular DNA on the binding of ligands that can induce changes in intrinsic twist at a single base-pair step. Calculations are presented of the influence on configurations of the assumed values and distribution along the DNA of intrinsic roll and twist and a modulus coupling roll to twist. Among the results obtained are the following. For minicircles formed from intrinsically straight DNA, the distribution of roll-twist coupling strongly affects the dependence of the total elastic energy Psi on the amount alpha of imposed untwisting, and that dependence can be far from quadratic. (In fact, for a periodic distribution of roll-twist coupling with a period equal to the intrinsic helical repeat length, Psi can be essentially independent of alpha for -90 degrees < alpha <90 degrees.) When the minicircle is homogeneous and without roll-twist coupling, but with uniform positive intrinsic roll, the point at which Psi attains its minimum value shifts towards negative values of alpha. It is remarked that there are cases in which one can relate graphs of Psi versus alpha to the 'effective values' of bending and twisting moduli and helical repeat length obtained from measurements of equilibrium distributions of topoisomers and probabilities of ring closure. For a minicircle formed from DNA that has an 'S' shape when stress-free, the graphs of Psi versus alpha have maxima at alpha = 0. As the binding of a twisting agent to such a minicircle results in a net decrease in Psi, the affinity of the twisting agent for binding to the minicircle is greater than its affinity for binding to
Watson, Christopher M; Crinnion, Laura A; Harrison, Sally M; Lascelles, Carolina; Antanaviciute, Agne; Carr, Ian M; Bonthron, David T; Sheridan, Eamonn
2016-01-01
Next generation sequencing methodologies are facilitating the rapid characterisation of novel structural variants at nucleotide resolution. These approaches are particularly applicable to variants initially identified using alternative molecular methods. We report a child born with bilateral postaxial syndactyly of the feet and bilateral fifth finger clinodactyly. This was presumed to be an autosomal recessive syndrome, due to the family history of consanguinity. Karyotype analysis revealed a homozygous pericentric inversion of chromosome 7 (46,XX,inv(7)(p15q21)x2) which was confirmed to be heterozygous in both unaffected parents. Since the resolution of the karyotype was insufficient to identify any putatively causative gene, we undertook medium-coverage whole genome sequencing using paired-end reads, in order to elucidate the molecular breakpoints. In a two-step analysis, we first narrowed down the region by identifying discordant read-pairs, and then determined the precise molecular breakpoint by analysing the mapping locations of "soft-clipped" breakpoint-spanning reads. PCR and Sanger sequencing confirmed the identified breakpoints, both of which were located in intergenic regions. Significantly, the 7p15 breakpoint was located 523 kb upstream of HOXA13, the locus for hand-foot-genital syndrome. By inference from studies of HOXA locus control in the mouse, we suggest that the inversion has delocalised a HOXA13 enhancer to produce the phenotype observed in our patient. This study demonstrates how modern genetic diagnostic approach can characterise structural variants at nucleotide resolution and provide potential insights into functional regulation.
Biological nanopore MspA for DNA sequencing
NASA Astrophysics Data System (ADS)
Manrao, Elizabeth A.
Unlocking the information hidden in the human genome provides insight into the inner workings of complex biological systems and can be used to greatly improve health-care. In order to allow for widespread sequencing, new technologies are required that provide fast and inexpensive readings of DNA. Nanopore sequencing is a third generation DNA sequencing technology that is currently being developed to fulfill this need. In nanopore sequencing, a voltage is applied across a small pore in an electrolyte solution and the resulting ionic current is recorded. When DNA passes through the channel, the ionic current is partially blocked. If the DNA bases uniquely modulate the ionic current flowing through the channel, the time trace of the current can be related to the sequence of DNA passing through the pore. There are two main challenges to realizing nanopore sequencing: identifying a pore with sensitivity to single nucleotides and controlling the translocation of DNA through the pore so that the small single nucleotide current signatures are distinguishable from background noise. In this dissertation, I explore the use of Mycobacterium smegmatis porin A (MspA) for nanopore sequencing. In order to determine MspA's sensitivity to single nucleotides, DNA strands of various compositions are held in the pore as the resulting ionic current is measured. DNA is immobilized in MspA by attaching it to a large molecule which acts as an anchor. This technique confirms the single nucleotide resolution of the pore and additionally shows that MspA is sensitive to epigenetic modifications and single nucleotide polymorphisms. The forces from the electric field within MspA, the effective charge of nucleotides, and elasticity of DNA are estimated using a Freely Jointed Chain model of single stranded DNA. These results offer insight into the interactions of DNA within the pore. With the nucleotide sensitivity of MspA confirmed, a method is introduced to controllably pass DNA through the pore
Predicting protein-binding regions in RNA using nucleotide profiles and compositions.
Choi, Daesik; Park, Byungkyu; Chae, Hanju; Lee, Wook; Han, Kyungsook
2017-03-14
Motivated by the increased amount of data on protein-RNA interactions and the availability of complete genome sequences of several organisms, many computational methods have been proposed to predict binding sites in protein-RNA interactions. However, most computational methods are limited to finding RNA-binding sites in proteins instead of protein-binding sites in RNAs. Predicting protein-binding sites in RNA is more challenging than predicting RNA-binding sites in proteins. Recent computational methods for finding protein-binding sites in RNAs have several drawbacks for practical use. We developed a new support vector machine (SVM) model for predicting protein-binding regions in mRNA sequences. The model uses sequence profiles constructed from log-odds scores of mono- and di-nucleotides and nucleotide compositions. The model was evaluated by standard 10-fold cross validation, leave-one-protein-out (LOPO) cross validation and independent testing. Since actual mRNA sequences have more non-binding regions than protein-binding regions, we tested the model on several datasets with different ratios of protein-binding regions to non-binding regions. The best performance of the model was obtained in a balanced dataset of positive and negative instances. 10-fold cross validation with a balanced dataset achieved a sensitivity of 91.6%, a specificity of 92.4%, an accuracy of 92.0%, a positive predictive value (PPV) of 91.7%, a negative predictive value (NPV) of 92.3% and a Matthews correlation coefficient (MCC) of 0.840. LOPO cross validation showed a lower performance than the 10-fold cross validation, but the performance remains high (87.6% accuracy and 0.752 MCC). In testing the model on independent datasets, it achieved an accuracy of 82.2% and an MCC of 0.656. Testing of our model and other state-of-the-art methods on a same dataset showed that our model is better than the others. Sequence profiles of log-odds scores of mono- and di-nucleotides were much more powerful
René, P; Lenne, F; Ventura, M A; Bertagna, X; de Keyzer, Y
2000-01-04
In the pituitary, vasopressin triggers ACTH release through a specific receptor subtype, termed V3 or V1b. We cloned the V3 cDNA and showed that its expression was almost exclusive to pituitary corticotrophs and some corticotroph tumors. To study the determinants of this tissue specificity, we have now cloned the gene for the human (h) V3 receptor and characterized its structure. It is composed of two exons, spanning 10kb, with the coding region interrupted between transmembrane domains 6 and 7. We established that the transcription initiation site is located 498 nucleotides upstream of the initiator codon and showed that two polyadenylation sites may be used, while the most frequent is the most downstream. Sequence analysis of the promoter region showed no TATA box but identified consensus binding motifs for Sp1, CREB, and half sites of the estrogen receptor binding site. However comparison with another corticotroph-specific gene, proopiomelanocortin, did not identify common regulatory elements in the two promoters except for a short GC-rich region. Unexpectedly, hV3 gene analysis revealed that a formerly cloned 'artifactual' hV3 cDNA indeed corresponded to a spliced antisense transcript, overlapping the 5' part of the coding sequence in exon 1 and the promoter region. This transcript, hV3rev, was detected in normal pituitary and in many corticotroph tumors expressing hV3 sense mRNA and may therefore play a role in hV3 gene expression.
Sequencing of cDNA Clones from the Genetic Map of Tomato (Lycopersicon esculentum)
Ganal, Martin W.; Czihal, Rosemarie; Hannappel, Ulrich; Kloos, Dorothee-U.; Polley, Andreas; Ling, Hong-Qing
1998-01-01
The dense RFLP linkage map of tomato (Lycopersicon esculentum) contains >300 anonymous cDNA clones. Of those clones, 272 were partially or completely sequenced. The sequences were compared at the DNA and protein level to known genes in databases. For 57% of the clones, a significant match to previously described genes was found. The information will permit the conversion of those markers to STS markers and allow their use in PCR-based mapping experiments. Furthermore, it will facilitate the comparative mapping of genes across distantly related plant species by direct comparison of DNA sequences and map positions. [cDNA sequence data reported in this paper have been submitted to the EMBL database under accession nos. AA824695–AA825005 and the dbEST_Id database under accession nos. 1546519–1546862.] PMID:9724330
Bellerophon: A program to detect chimeric sequences in multiple sequence alignments
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip
2003-12-23
Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments.
Sequence of a cDNA encoding pancreatic preprosomatostatin-22.
Magazin, M; Minth, C D; Funckes, C L; Deschenes, R; Tavianini, M A; Dixon, J E
1982-01-01
We report the nucleotide sequence of a precursor to somatostatin that upon proteolytic processing may give rise to a hormone of 22 amino acids. The nucleotide sequence of a cDNA from the channel catfish (Ictalurus punctatus) encodes a precursor to somatostatin that is 105 amino acids (Mr, 11,500). The cDNA coding for somatostatin-22 consists of 36 nucleotides in the 5' untranslated region, 315 nucleotides that code for the precursor to somatostatin-22, 269 nucleotides at the 3' untranslated region, and a variable length of poly(A). The putative preprohormone contains a sequence of hydrophobic amino acids at the amino terminus that has the properties of a "signal" peptide. A connecting sequence of approximately 57 amino acids is followed by a single Arg-Arg sequence, which immediately precedes the hormone. Somatostatin-22 is homologous to somatostatin-14 in 7 of the 14 amino acids, including the Phe-Trp-Lys sequence. Hybridization selection of mRNA, followed by its translation in a wheat germ cell-free system, resulted in the synthesis of a single polypeptide having a molecular weight of approximately 10,000 as estimated on Na-DodSO4/polyacrylamide gels. Images PMID:6127673
OrthoANI: An improved algorithm and software for calculating average nucleotide identity.
Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik
2016-02-01
Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.
Alabi, Olufemi J; Villegas, Cecilia; Gregg, Lori; Murray, K Daniel
2016-06-01
Two isolates of a novel bipartite begomovirus, tentatively named malvastrum bright yellow mosaic virus (MaBYMV), were molecularly characterized from naturally infected plants of the genus Malvastrum showing bright yellow mosaic disease symptoms in South Texas. Six complete DNA-A and five DNA-B genome sequences of MaBYMV obtained from the isolates ranged in length from 2,608 to 2,609 nucleotides (nt) and 2,578 to 2,605 nt, respectively. Both genome segments shared a 178- to 180-nt common region. In pairwise comparisons, the complete DNA-A and DNA-B sequences of MaBYMV were most similar (87-88 % and 79-81 % identity, respectively) and phylogenetically related to the corresponding sequences of sida mosaic Sinaloa virus-[MX-Gua-06]. Further analysis revealed that MaBYMV is a putative recombinant virus, thus supporting the notion that malvaceous hosts may be influencing the evolution of several begomoviruses. The design of new diagnostic primers enabled the detection of MaBYMV in cohorts of Bemisia tabaci collected from symptomatic Malvastrum sp. plants, thus implicating whiteflies as potential vectors of the virus.
Guo, Juan; Wang, Yunsheng; Song, Chi; Zhou, Jianfeng; Qiu, Lijuan; Huang, Hongwen; Wang, Ying
2010-01-01
Background and Aims It is essential to illuminate the evolutionary history of crop domestication in order to understand further the origin and development of modern cultivation and agronomy; however, despite being one of the most important crops, the domestication origin and bottleneck of soybean (Glycine max) are poorly understood. In the present study, microsatellites and nucleotide sequences were employed to elucidate the domestication genetics of soybean. Methods The genomes of 79 landrace soybeans (endemic cultivated soybeans) and 231 wild soybeans (G. soja) that represented the species-wide distribution of wild soybean in East Asia were scanned with 56 microsatellites to identify the genetic structure and domestication origin of soybean. To understand better the domestication bottleneck, four nucleotide sequences were selected to simulate the domestication bottleneck. Key Results Model-based analysis revealed that most of the landrace genotypes were assigned to the inferred wild soybean cluster of south China, South Korea and Japan. Phylogeny for wild and landrace soybeans showed that all landrace soybeans formed a single cluster supporting a monophyletic origin of all the cultivars. The populations of the nearest branches which were basal to the cultivar lineage were wild soybeans from south China. The coalescent simulation detected a bottleneck severity of K′ = 2 during soybean domestication, which could be explained by a foundation population of 6000 individuals if domestication duration lasted 3000 years. Conclusions As a result of integrating geographic distribution with microsatellite genotype assignment and phylogeny between landrace and wild soybeans, a single origin of soybean in south China is proposed. The coalescent simulation revealed a moderate genetic bottleneck with an effective wild soybean population used for domestication estimated to be ≈2 % of the total number of ancestral wild soybeans. Wild soybeans in Asia, especially in south
Hayashi, Kei; Mohanta, Uday K; Ohari, Yuma; Neeraja, Tambireddy; Singh, T Shantikumar; Sugiyama, Hiromu; Itagaki, Tadashi
2016-12-01
The aim of this study was to analyze the phylogenetic relationship between Explanatum explanatum populations in India and other countries of the Indian subcontinent. Seventy liver amphistomes collected from four localities in India were identified as E. explanatum based on the nucleotide sequences of ribosomal ITS2. The flukes were then analyzed phylogenetically based on the nucleotide sequence of the mitochondrial gene nad1 in comparison with flukes from Bangladesh and Nepal. In the resulting phylogenetic tree, the nad1 haplotypes from India were divided into four clades, and the flukes showing the haplotypes of clades A and C were predominant in India. The haplotypes of the clades A and C have also been detected in Bangladesh and Nepal, and therefore, it seems they occur commonly throughout the Indian subcontinent. The results of AMOVA suggested that gene flow was likely to occur between E. explanatum populations in these countries. These countries are geographically close and have been historically and culturally connected to each other, and therefore, the movements of host ruminants among these countries might have been involved in the migration of the flukes and their gene flow.
Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi
2012-01-01
We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.
High speed nucleic acid sequencing
Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY
2011-05-17
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid. Each type of labeled nucleotide comprises an acceptor fluorophore attached to a phosphate portion of the nucleotide such that the fluorophore is removed upon incorporation into a growing strand. Fluorescent signal is emitted via fluorescent resonance energy transfer between the donor fluorophore and the acceptor fluorophore as each nucleotide is incorporated into the growing strand. The sequence is deduced by identifying which base is being incorporated into the growing strand.
Functional analysis of regulatory single-nucleotide polymorphisms.
Pampín, Sandra; Rodríguez-Rey, José C
2007-04-01
The identification of regulatory polymorphisms has become a key problem in human genetics. In the past few years there has been a conceptual change in the way in which regulatory single-nucleotide polymorphisms are studied. We revise the new approaches and discuss how gene expression studies can contribute to a better knowledge of the genetics of common diseases. New techniques for the association of single-nucleotide polymorphisms with changes in gene expression have been recently developed. This, together with a more comprehensive use of the old in-vitro methods, has produced a great amount of genetic information. When added to current databases, it will help to design better tools for the detection of regulatory single-nucleotide polymorphisms. The identification of functional regulatory single-nucleotide polymorphisms cannot be done by the simple inspection of DNA sequence. In-vivo techniques, based on primer-extension, and the more recently developed 'haploChIP' allow the association of gene variants to changes in gene expression. Gene expression analysis by conventional in-vitro techniques is the only way to identify the functional consequences of regulatory single-nucleotide polymorphisms. The amount of information produced in the last few years will help to refine the tools for the future analysis of regulatory gene variants.
Akins, R A; Grant, D M; Stohl, L L; Bottorff, D A; Nargang, F E; Lambowitz, A M
1988-11-05
The Mauriceville and Varkud mitochondrial plasmids of Neurospora are closely related, closed circular DNAs (3.6 and 3.7 kb, respectively; 1 kb = 10(3) bases or base-pairs), whose characteristics suggest relationships to mitochondrial DNA introns and retrotransposons. Here, we characterized the structure of the Varkud plasmid, determined its complete nucleotide sequence and mapped its major transcripts. The Mauriceville and Varkud plasmids have more than 97% positional identity. Both plasmids contain a 710 amino acid open reading frame that encodes a reverse transcriptase-like protein. The amino acid sequence of this open reading frame is strongly conserved between the two plasmids (701/710 amino acids) as expected for a functionally important protein. Both plasmids have a 0.4 kb region that contains five PstI palindromes and a direct repeat of approximately 160 base-pairs. Comparison of sequences in this region suggests that the Varkud plasmid has diverged less from a common ancestor than has the Mauriceville plasmid. Two major transcripts of the Varkud plasmid were detected by Northern hybridization experiments: a full-length linear RNA of 3.7 kb and an additional prominent transcript of 4.9 kb, 1.2 kb longer than monomer plasmid. Remarkably, we find that the 4.9 kb transcript is a hybrid RNA consisting of the full-length 3.7 kb Varkud plasmid transcript plus a 5' leader of 1.2 kb that is derived from the 5' end of the mitochondrial small rRNA. This and other findings suggest that the Varkud plasmid, like certain RNA viruses, has a mechanism for joining heterologous RNAs to the 5' end of its major transcript, and that, under some circumstances, nucleotide sequences in mitochondria may be recombined at the RNA level.
Phosphate-Modified Nucleotides for Monitoring Enzyme Activity.
Ermert, Susanne; Marx, Andreas; Hacker, Stephan M
2017-04-01
Nucleotides modified at the terminal phosphate position have been proven to be interesting entities to study the activity of a variety of different protein classes. In this chapter, we present various types of modifications that were attached as reporter molecules to the phosphate chain of nucleotides and briefly describe the chemical reactions that are frequently used to synthesize them. Furthermore, we discuss a variety of applications of these molecules. Kinase activity, for instance, was studied by transfer of a phosphate modified with a reporter group to the target proteins. This allows not only studying the activity of kinases, but also identifying their target proteins. Moreover, kinases can also be directly labeled with a reporter at a conserved lysine using acyl-phosphate probes. Another important application for phosphate-modified nucleotides is the study of RNA and DNA polymerases. In this context, single-molecule sequencing is made possible using detection in zero-mode waveguides, nanopores or by a Förster resonance energy transfer (FRET)-based mechanism between the polymerase and a fluorophore-labeled nucleotide. Additionally, fluorogenic nucleotides that utilize an intramolecular interaction between a fluorophore and the nucleobase or an intramolecular FRET effect have been successfully developed to study a variety of different enzymes. Finally, also some novel techniques applying electron paramagnetic resonance (EPR)-based detection of nucleotide cleavage or the detection of the cleavage of fluorophosphates are discussed. Taken together, nucleotides modified at the terminal phosphate position have been applied to study the activity of a large diversity of proteins and are valuable tools to enhance the knowledge of biological systems.
Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E
2009-11-25
To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the
Allegre, Mathilde; Argout, Xavier; Boccara, Michel; Fouet, Olivier; Roguet, Yolande; Bérard, Aurélie; Thévenin, Jean Marc; Chauveau, Aurélie; Rivallan, Ronan; Clement, Didier; Courtois, Brigitte; Gramacho, Karina; Boland-Augé, Anne; Tahi, Mathias; Umaharan, Pathmanathan; Brunel, Dominique; Lanaud, Claire
2012-01-01
Theobroma cacao is an economically important tree of several tropical countries. Its genetic improvement is essential to provide protection against major diseases and improve chocolate quality. We discovered and mapped new expressed sequence tag-single nucleotide polymorphism (EST-SNP) and simple sequence repeat (SSR) markers and constructed a high-density genetic map. By screening 149 650 ESTs, 5246 SNPs were detected in silico, of which 1536 corresponded to genes with a putative function, while 851 had a clear polymorphic pattern across a collection of genetic resources. In addition, 409 new SSR markers were detected on the Criollo genome. Lastly, 681 new EST-SNPs and 163 new SSRs were added to the pre-existing 418 co-dominant markers to construct a large consensus genetic map. This high-density map and the set of new genetic markers identified in this study are a milestone in cocoa genomics and for marker-assisted breeding. The data are available at http://tropgenedb.cirad.fr. PMID:22210604
Updating Our View of Organelle Genome Nucleotide Landscape
Smith, David Roy
2012-01-01
Organelle genomes show remarkable variation in architecture and coding content, yet their nucleotide composition is relatively unvarying across the eukaryotic domain, with most having a high adenine and thymine (AT) content. Recent studies, however, have uncovered guanine and cytosine (GC)-rich mitochondrial and plastid genomes. These sequences come from a small but eclectic list of species, including certain green plants and animals. Here, I review GC-rich organelle DNAs and the insights they have provided into the evolution of nucleotide landscape. I emphasize that GC-biased mitochondrial and plastid DNAs are more widespread than once thought, sometimes occurring together in the same species, and suggest that the forces biasing their nucleotide content can differ both among and within lineages, and may be associated with specific genome architectural features and life history traits. PMID:22973299
Zurawski, Gerard; Bohnert, Hans J.; Whitfeld, Paul R.; Bottomley, Warwick
1982-01-01
The gene for the so-called Mr 32,000 rapidly labeled photosystem II thylakoid membrane protein (here designated psbA) of spinach (Spinacia oleracea) chloroplasts is located on the chloroplast DNA in the large single-copy region immediately adjacent to one of the inverted repeat sequences. In this paper we show that the size of the mRNA for this protein is ≈ 1.25 kilobases and that the direction of transcription is towards the inverted repeat unit. The nucleotide sequence of the gene and its flanking regions is presented. The only large open reading frame in the sequence codes for a protein of Mr 38,950. The nucleotide sequence of psbA from Nicotiana debneyi also has been determined, and comparison of the sequences from the two species shows them to be highly conserved (>95% homology) throughout the entire reading frame. Conservation of the amino acid sequence is absolute, there being no changes in a total of 353 residues. This leads us to conclude that the primary translation product of psbA must be a protein of Mr 38,950. The protein is characterized by the complete absence of lysine residues and is relatively rich in hydrophobic amino acids, which tend to be clustered. Transcription of spinach psbA starts about 86 base pairs before the first ATG codon. Immediately upstream from this point there is a sequence typical of that found in E. coli promoters. An almost identical sequence occurs in the equivalent region of N. debneyi DNA. Images PMID:16593262
Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A
2009-01-01
The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.
RSAT: regulatory sequence analysis tools.
Thomas-Chollier, Morgane; Sand, Olivier; Turatsinze, Jean-Valéry; Janky, Rekin's; Defrance, Matthieu; Vervisch, Eric; Brohée, Sylvain; van Helden, Jacques
2008-07-01
The regulatory sequence analysis tools (RSAT, http://rsat.ulb.ac.be/rsat/) is a software suite that integrates a wide collection of modular tools for the detection of cis-regulatory elements in genome sequences. The suite includes programs for sequence retrieval, pattern discovery, phylogenetic footprint detection, pattern matching, genome scanning and feature map drawing. Random controls can be performed with random gene selections or by generating random sequences according to a variety of background models (Bernoulli, Markov). Beyond the original word-based pattern-discovery tools (oligo-analysis and dyad-analysis), we recently added a battery of tools for matrix-based detection of cis-acting elements, with some original features (adaptive background models, Markov-chain estimation of P-values) that do not exist in other matrix-based scanning tools. The web server offers an intuitive interface, where each program can be accessed either separately or connected to the other tools. In addition, the tools are now available as web services, enabling their integration in programmatic workflows. Genomes are regularly updated from various genome repositories (NCBI and EnsEMBL) and 682 organisms are currently supported. Since 1998, the tools have been used by several hundreds of researchers from all over the world. Several predictions made with RSAT were validated experimentally and published.
Finding similar nucleotide sequences using network BLAST searches.
Ladunga, Istvan
2009-06-01
The Basic Local Alignment Search Tool (BLAST) is a keystone of bioinformatics due to its performance and user-friendliness. Beginner and intermediate users will learn how to design and submit blastn and Megablast searches on the Web pages at the National Center for Biotechnology Information. We map nucleic acid sequences to genomes, find identical or similar mRNA, expressed sequence tag, and noncoding RNA sequences, and run Megablast searches, which are much faster than blastn. Understanding results is assisted by taxonomy reports, genomic views, and multiple alignments. We interpret expected frequency thresholds, biological significance, and statistical significance. Weak hits provide no evidence, but hints for further analyses. We find genes that may code for homologous proteins by translated BLAST. We reduce false positives by filtering out low-complexity regions. Parsed BLAST results can be integrated into analysis pipelines. Links in the output connect to Entrez, PUBMED, structural, sequence, interaction, and expression databases. This facilitates integration with a wide spectrum of biological knowledge.
Chromosome specific repetitive DNA sequences
Moyzis, Robert K.; Meyne, Julianne
1991-01-01
A method is provided for determining specific nucleotide sequences useful in forming a probe which can identify specific chromosomes, preferably through in situ hybridization within the cell itself. In one embodiment, chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family me This invention is the result of a contract with the Department of Energy (Contract No. W-7405-ENG-36).
A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms
ERIC Educational Resources Information Center
Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.
2016-01-01
The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…
Novel methodologies for spectral classification of exon and intron sequences
NASA Astrophysics Data System (ADS)
Kwan, Hon Keung; Kwan, Benjamin Y. M.; Kwan, Jennifer Y. Y.
2012-12-01
Digital processing of a nucleotide sequence requires it to be mapped to a numerical sequence in which the choice of nucleotide to numeric mapping affects how well its biological properties can be preserved and reflected from nucleotide domain to numerical domain. Digital spectral analysis of nucleotide sequences unfolds a period-3 power spectral value which is more prominent in an exon sequence as compared to that of an intron sequence. The success of a period-3 based exon and intron classification depends on the choice of a threshold value. The main purposes of this article are to introduce novel codes for 1-sequence numerical representations for spectral analysis and compare them to existing codes to determine appropriate representation, and to introduce novel thresholding methods for more accurate period-3 based exon and intron classification of an unknown sequence. The main findings of this study are summarized as follows: Among sixteen 1-sequence numerical representations, the K-Quaternary Code I offers an attractive performance. A windowed 1-sequence numerical representation (with window length of 9, 15, and 24 bases) offers a possible speed gain over non-windowed 4-sequence Voss representation which increases as sequence length increases. A winner threshold value (chosen from the best among two defined threshold values and one other threshold value) offers a top precision for classifying an unknown sequence of specified fixed lengths. An interpolated winner threshold value applicable to an unknown and arbitrary length sequence can be estimated from the winner threshold values of fixed length sequences with a comparable performance. In general, precision increases as sequence length increases. The study contributes an effective spectral analysis of nucleotide sequences to better reveal embedded properties, and has potential applications in improved genome annotation.
Prediction of Nucleotide Binding Peptides Using Star Graph Topological Indices.
Liu, Yong; Munteanu, Cristian R; Fernández Blanco, Enrique; Tan, Zhiliang; Santos Del Riego, Antonino; Pazos, Alejandro
2015-11-01
The nucleotide binding proteins are involved in many important cellular processes, such as transmission of genetic information or energy transfer and storage. Therefore, the screening of new peptides for this biological function is an important research topic. The current study proposes a mixed methodology to obtain the first classification model that is able to predict new nucleotide binding peptides, using only the amino acid sequence. Thus, the methodology uses a Star graph molecular descriptor of the peptide sequences and the Machine Learning technique for the best classifier. The best model represents a Random Forest classifier based on two features of the embedded and non-embedded graphs. The performance of the model is excellent, considering similar models in the field, with an Area Under the Receiver Operating Characteristic Curve (AUROC) value of 0.938 and true positive rate (TPR) of 0.886 (test subset). The prediction of new nucleotide binding peptides with this model could be useful for drug target studies in drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Suhaili, Zarizal; Lean, Soo-Sum; Mohamad, Noor Muzamil; Rachman, Abdul R Abdul; Desa, Mohd Nasir Mohd; Yeo, Chew Chieng
2016-09-01
Most of the efforts in elucidating the molecular relatedness and epidemiology of Staphylococcus aureus in Malaysia have been largely focused on methicillin-resistant S. aureus (MRSA). Therefore, here we report the draft genome sequence of the methicillin-susceptible Staphylococcus aureus (MSSA) with sequence type 1 (ST1), spa type t127 with Panton-Valentine Leukocidin (pvl) pathogenic determinant isolated from pus sample designated as KT/314250 strain. The size of the draft genome is 2.86 Mbp with 32.7% of G + C content consisting 2673 coding sequences. The draft genome sequence has been deposited in DDBJ/EMBL/GenBank under the accession number AOCP00000000.
Ito, Hiroya; Ogawa, Torata; Fukamizu, Dai; Morinaga, Yuiko; Kusumoto, Masahiro
2016-11-01
The aim of our study was to reveal the molecular basis of the serologic nontypeability of 2 Actinobacillus pleuropneumoniae field isolates. Nine field strains of A. pleuropneumoniae, the causative agent of porcine pleuropneumonia, were isolated from pigs raised on the same farm and sent to our diagnostic laboratory for serotyping. Seven of the 9 strains were identified as serovar 15 strains by immunodiffusion tests. However, 2 strains, designated FH24-2 and FH24-5, could not be serotyped with antiserum prepared against serovars 1-15. Strain FH24-5 showed positive results in 2 serovar 15-specific PCR tests, whereas strain FH24-2 was only positive in 1 of the 2 PCR tests. The nucleotide sequence analysis of gene clusters involved in capsular polysaccharide biosynthesis of the 2 nontypeable strains revealed that both had been rendered nontypeable by the action of ISApl1, a transposable element of A. pleuropneumoniae belonging to the IS30 family. The results showed that ISApl1 of A. pleuropneumoniae can interfere with both the serologic and molecular typing methods, and that nucleotide sequence analysis across the capsular gene clusters is the best means of determining the cause of serologic nontypeability in A. pleuropneumoniae. © 2016 The Author(s).
Roisin, S; Gaudin, C; De Mendonça, R; Bellon, J; Van Vaerenbergh, K; De Bruyne, K; Byl, B; Pouseele, H; Denis, O; Supply, P
2016-06-01
We used a two-step whole genome sequencing analysis for resolving two concurrent outbreaks in two neonatal services in Belgium, caused by exfoliative toxin A-encoding-gene-positive (eta+) methicillin-susceptible Staphylococcus aureus with an otherwise sporadic spa-type t209 (ST-109). Outbreak A involved 19 neonates and one healthcare worker in a Brussels hospital from May 2011 to October 2013. After a first episode interrupted by decolonization procedures applied over 7 months, the outbreak resumed concomitantly with the onset of outbreak B in a hospital in Asse, comprising 11 neonates and one healthcare worker from mid-2012 to January 2013. Pan-genome multilocus sequence typing, defined on the basis of 42 core and accessory reference genomes, and single-nucleotide polymorphisms mapped on an outbreak-specific de novo assembly were used to compare 28 available outbreak isolates and 19 eta+/spa-type t209 isolates identified by routine or nationwide surveillance. Pan-genome multilocus sequence typing showed that the outbreaks were caused by independent clones not closely related to any of the surveillance isolates. Isolates from only ten cases with overlapping stays in outbreak A, including four pairs of twins, showed no or only a single nucleotide polymorphism variation, indicating limited sequential transmission. Detection of larger genomic variation, even from the start of the outbreak, pointed to sporadic seeding from a pre-existing exogenous source, which persisted throughout the whole course of outbreak A. Whole genome sequencing analysis can provide unique fine-tuned insights into transmission pathways of complex outbreaks even at their inception, which, with timely use, could valuably guide efforts for early source identification. Copyright © 2016 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Lee, Sheila; McMullen, D.; Brown, G. L.; Stokes, A. R.
1965-01-01
1. A theoretical analysis of the errors in multicomponent spectrophotometric analysis of nucleoside mixtures, by a least-squares procedure, has been made to obtain an expression for the error coefficient, relating the error in calculated concentration to the error in extinction measurements. 2. The error coefficients, which depend only on the `library' of spectra used to fit the experimental curves, have been computed for a number of `libraries' containing the following nucleosides found in s-RNA: adenosine, guanosine, cytidine, uridine, 5-ribosyluracil, 7-methylguanosine, 6-dimethylaminopurine riboside, 6-methylaminopurine riboside and thymine riboside. 3. The error coefficients have been used to determine the best conditions for maximum accuracy in the determination of the compositions of nucleoside mixtures. 4. Experimental determinations of the compositions of nucleoside mixtures have been made and the errors found to be consistent with those predicted by the theoretical analysis. 5. It has been demonstrated that, with certain precautions, the multicomponent spectrophotometric method described is suitable as a basis for automatic nucleotide-composition analysis of oligonucleotides containing nine nucleotides. Used in conjunction with continuous chromatography and flow chemical techniques, this method can be applied to the study of the sequence of s-RNA. PMID:14346087
Ogembo, Javier Gordon; Caoili, Barbara L; Shikata, Masamitsu; Chaeychomsri, Sudawan; Kobayashi, Michihiro; Ikeda, Motoko
2009-10-01
A newly cloned Helicoverpa armigera nucleopolyhedrovirus (HearNPV) from Kenya, HearNPV-NNg1, has a higher insecticidal activity than HearNPV-G4, which also exhibits lower insecticidal activity than HearNPV-C1. In the search for genes and/or nucleotide sequences that might be involved in the observed virulence differences among Helicoverpa spp. NPVs, the entire genome of NNg1 was sequenced and compared with previously sequenced genomes of G4, C1 and Helicoverpa zea single-nucleocapsid NPV (Hz). The NNg1 genome was 132,425 bp in length, with a total of 143 putative open reading frames (ORFs), and shared high levels of overall amino acid and nucleotide sequence identities with G4, C1 and Hz. Three NNg1 ORFs, ORF5, ORF100 and ORF124, which were shared with C1, were absent in G4 and Hz, while NNg1 and C1 were missing a homologue of G4/Hz ORF5. Another three ORFs, ORF60 (bro-b), ORF119 and ORF120, and one direct repeat sequence (dr) were unique to NNg1. Relative to the overall nucleotide sequence identity, lower sequence identities were observed between NNg1 hrs and the homologous hrs in the other three Helicoverpa spp. NPVs, despite containing the same number of hrs located at essentially the same positions on the genomes. Differences were also observed between NNg1 and each of the other three Helicoverpa spp. NPVs in the diversity of bro genes encoded on the genomes. These results indicate several putative genes and nucleotide sequences that may be responsible for the virulence differences observed among Helicoverpa spp., yet the specific genes and/or nucleotide sequences responsible have not been identified.
Shih, S L; Kumar, S; Tsai, W S; Lee, L M; Green, S K
2009-01-01
Okra (Abelmoschus esculentus) is a major crop in Niger. In the fall of 2007, okra leaf curl disease was observed in Niger and the begomovirus and DNA-beta satellite were found associated with the disease. The complete nucleotide sequences of DNA-A (FJ469626 and FJ469627) and associated DNA-beta satellites (FJ469628 and FJ469629) were determined from two samples. This is the first report of molecular characterization of okra-infecting begomovirus and their associated DNA-beta from Niger. The begomovirus and DNA-beta have been identified as Cotton leaf curl Gezira virus and Cotton leaf curl Gezira betasatellite, respectively, which are reported to also infect okra in Egypt, Mali and Sudan.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rudwaleit, M.; Bowness, P.; Wordsworth, P.
1996-12-31
The HLA-B27 subtype HLA-B{sup *}2704 is virtually absent in Caucasians but common in Orientals, where it is associated with ankylosing spondylitis. The amino acid sequence of HLA-B{sup *}2704 has been established by peptide mapping and was shown to differ by two amino acids from HLA-B{sup *}2705, HLA-B{sup *}2704 is characterized by a serine for aspartic acid substitution at position 77 and glutamic acid for valine at position 152. To date, however, no nucleotide sequence confirming these changes at the DNA level has been published. 13 refs., 2 figs.
Takagi, M; Kobayashi, N; Sugimoto, M; Fujii, T; Watari, J; Yano, K
1987-01-01
The expression of a LEU gene from Candida maltosa (designated as C-LEU2) isolated previously (Kawamura et al. 1983) was shown to be regulated, when transferred into Saccharomyces cerevisiae, by leucine and threonine in the medium, as in the case of LEU2 gene of S. cerevisiae. The coding region together with the regulatory region was subcloned and the nucleotide sequence was determined. When the sequence of the coding region was compared with that of LEU2, the homology was 72% for base pairs and 76% for deduced amino acids. Comparison of the regulatory region of C-LEU2 with those of LEU1 and LEU2 suggested a few short consensus sequences which are involved in regulation of gene expression by leucine and threonine in the medium.
PUTATIVE GENE PROMOTER SEQUENCES IN THE CHLORELLA VIRUSES
Fitzgerald, Lisa A.; Boucher, Philip T.; Yanai-Balser, Giane; Suhre, Karsten; Graves, Michael V.; Van Etten, James L.
2008-01-01
Three short (7 to 9 nucleotides) highly conserved nucleotide sequences were identified in the putative promoter regions (150 bp upstream and 50 bp downstream of the ATG translation start site) of three members of the genus Chlorovirus, family Phycodnaviridae. Most of these sequences occurred in similar locations within the defined promoter regions. The sequence and location of the motifs were often conserved among homologous ORFs within the Chlorovirus family. One of these conserved sequences (AATGACA) is predominately associated with genes expressed early in virus replication. PMID:18768195
Huiet, L; Feldstein, P A; Tsai, J H; Falk, B W
1993-12-01
Primer extension analyses and a PCR-based cloning strategy were used to identify and characterize 5' nucleotide sequences on the maize stripe virus (MStV) RNA4 mRNA transcripts encoding the major noncapsid protein (NCP). Direct RNA sequence analysis by primer extension showed that the NCP mRNA transcripts had 10-15 nucleotides beyond the 5' terminus of the MStV RNA4 nucleotide sequence. MStV genomic RNAs isolated from ribonucleoprotein particles (RNPs) lacked the additional 5' nucleotides. cDNA clones representing the 5' region of the mRNA transcripts were constructed, and the nucleotide sequences of the 5' regions were determined for 16 clones. Each was found to have a distinct 10-15 nucleotide sequence immediately 5' of the MStV RNA4 sequence. Eleven of 16 clones had the correct MStV RNA4 5' nucleotide sequence, while five showed minor variations at or near the 5' most MStV RNA4 nucleotide. These characteristics show strong similarities to other viral mRNA transcripts which are synthesized by cap snatching.
Wang, Boyi; Tan, Hua-Wei; Fang, Wanping; Meinhardt, Lyndel W; Mischke, Sue; Matsumoto, Tracie; Zhang, Dapeng
2015-01-01
Longan (Dimocarpus longan Lour.) is an important tropical fruit tree crop. Accurate varietal identification is essential for germplasm management and breeding. Using longan transcriptome sequences from public databases, we developed single nucleotide polymorphism (SNP) markers; validated 60 SNPs in 50 longan germplasm accessions, including cultivated varieties and wild germplasm; and designated 25 SNP markers that unambiguously identified all tested longan varieties with high statistical rigor (P<0.0001). Multiple trees from the same clone were verified and off-type trees were identified. Diversity analysis revealed genetic relationships among analyzed accessions. Cultivated varieties differed significantly from wild populations (Fst=0.300; P<0.001), demonstrating untapped genetic diversity for germplasm conservation and utilization. Within cultivated varieties, apparent differences between varieties from China and those from Thailand and Hawaii indicated geographic patterns of genetic differentiation. These SNP markers provide a powerful tool to manage longan genetic resources and breeding, with accurate and efficient genotype identification. PMID:26504559
Earl, P L; Jones, E V; Moss, B
1986-01-01
A 5400-base-pair segment of the vaccinia virus genome was sequenced and an open reading frame of 938 codons was found precisely where the DNA polymerase had been mapped by transfer of a phosphonoacetate-resistance marker. A single nucleotide substitution changing glycine at position 347 to aspartic acid accounts for the drug resistance of the mutant vaccinia virus. The 5' end of the DNA polymerase mRNA was located 80 base pairs before the methionine codon initiating the open reading frame. Correspondence between the predicted Mr 108,577 polypeptide and the 110,000 purified enzyme indicates that little or no proteolytic processing occurs. Extensive homology, extending over 435 amino acids, was found upon comparing the DNA polymerase of vaccinia virus and DNA polymerase of Epstein-Barr virus. A highly conserved sequence of 14 amino acids in the carboxyl-terminal regions of the above DNA polymerases is also present at a similar location in adenovirus DNA polymerase. This structure, which is predicted to form a turn flanked by beta-pleated sheets, may form part of an essential binding or catalytic site that accounts for its presence in DNA polymerases of poxviruses, herpesviruses, and adenoviruses. Images PMID:3012524
Mo, Xiao-han; Chen, Zheng-bin; Chen, Jian-ping
2010-12-01
Tobacco bushy top disease is caused by tobacco bushy top virus (TBTV, a member of the genus Umbravirus) which is dependent on tobacco vein-distorting virus (TVDV) to act as a helper virus encapsidating TBTV and enabling its transmission by aphids. Isometric virions from diseased tobacco plants were purified and disease symptoms were reproduced after experimental aphid transmission. The complete genome of TVDV was determined from cloned RT-PCR products derived from viral RNA. It was 5,920 nucleotides (nts) long and had the six major open reading frames (ORFs) typical of a member of the genus Polerovirus. Sequence comparisons showed that it differed significantly from any of the other species in the genus and this was confirmed by phylogenetic analyses of the RdRp and coat protein. SDS-PAGE analysis of purified virions gave two protein bands of about 26 and 59 kDa both of which reacted strongly in Western blots with antiserum produced to prokaryotically expressed TVDV CP showing that the two forms of the TVDV CP were the only protein components of the capsid.
Genome sequence and description of Corynebacterium ihumii sp. nov.
Padmanabhan, Roshan; Dubourg, Grégory; Lagier, Jean-Christophe; Couderc, Carine; Michelle, Caroline; Raoult, Didier; Fournier, Pierre-Edouard
2014-01-01
Corynebacterium ihumii strain GD7T sp. nov. is proposed as the type strain of a new species, which belongs to the family Corynebacteriaceae of the class Actinobacteria. This strain was isolated from the fecal flora of a 62 year-old male patient, as a part of the culturomics study. Corynebacterium ihumii is a Gram positive, facultativly anaerobic, nonsporulating bacillus. Here, we describe the features of this organism, together with the high quality draft genome sequence, annotation and the comparison with other member of the genus Corynebacteria. C. ihumii genome is 2,232,265 bp long (one chromosome but no plasmid) containing 2,125 protein-coding and 53 RNA genes, including 4 rRNA genes. The whole-genome shotgun sequence of Corynebacterium ihumii strain GD7T sp. nov has been deposited in EMBL under accession number GCA_000403725. PMID:25197488
Graff, J; Normann, A; Feinstone, S M; Flehmig, B
1994-01-01
In order to study cell tropism and attenuation of hepatitis A virus (HAV), the genome of HAV wild-type GBM and two cell culture-adapted variants, GBM/FRhK and GBM/HFS, were cloned and sequenced after amplification by reverse transcriptase-PCR. During virus cultivation, the HAV variant GBM/FRhK had a strict host range for FRhK-4 cells, in contrast to GBM/HFS, which can be grown in HFS and FRhK-4 cells. The HAV variant GBM/HFS was shown to be attenuated when inoculated into chimpanzees (B. Flehmig, R. F. Mauler, G. Noll, E. Weinmann, and J. P. Gregerson, p. 87-90, in A. Zuckerman, ed., Viral Hepatitis and Liver Disease, 1988). On the basis of this biological background, the comparison of the nucleotide sequences of these three HAV GBM variants should elucidate differences which may be of importance for cell tropism and attenuation. The comparison of the genome between the GBM wild type and HAV wild types HM175 (J. I. Cohen, J. R. Ticehurst, R. H. Purcell, A. Buckler-White, and B. M. Baroudy, J. Virol. 61:50-59, 1987) and HAV-LA (R. Najarian, O. Caput, W. Gee, S. J. Potter, A. Renard, J. Merryweather, G. Van Nest, and D. Dina, Proc. Natl. Acad. Sci. USA 82:2627-2631, 1985) showed a 92 to 96.3% identity, whereas the identity was 99.3 to 99.6% between the GBM variants. Nucleotide differences between the wild-type and the cell culture-adapted variants, which were identical in both cell culture-adapted GBM variants, were localized in the 5' noncoding region; in 2B, 3B, and 3D; and in the 3' noncoding region. Our result concerning the 2B/2C region confirms a mutation at position 3889 (C-->T, alanine to valine), which had been shown to be of importance for cell culture adaptation (S. U. Emerson, C. McRill, B. Rosenblum, S. M. Feinstone, and R. H. Purcell, J. Virol. 65:4882-4886, 1991; S. U. Emerson, Y. K. Huang, C. McRill, M. Lewis, and R. H. Purcell, J. Virol. 66:650-654, 1992), whereas other mutations differ from published HAV sequence data and may be cell specific
Benson, Dennis A; Karsch-Mizrachi, Ilene; Lipman, David J; Ostell, James; Wheeler, David L
2007-01-01
GenBank (R) is a comprehensive database that contains publicly available nucleotide sequences for more than 240 000 named organisms, obtained primarily through submissions from individual laboratories and batch submissions from large-scale sequencing projects. Most submissions are made using the web-based BankIt or standalone Sequin programs and accession numbers are assigned by GenBank staff upon receipt. Daily data exchange with the EMBL Data Library in Europe and the DNA Data Bank of Japan ensures worldwide coverage. GenBank is accessible through NCBI's retrieval system, Entrez, which integrates data from the major DNA and protein sequence databases along with taxonomy, genome, mapping, protein structure and domain information, and the biomedical journal literature via PubMed. BLAST provides sequence similarity searches of GenBank and other sequence databases. Complete bimonthly releases and daily updates of the GenBank database are available by FTP. To access GenBank and its related retrieval and analysis services, begin at the NCBI Homepage (www.ncbi.nlm.nih.gov).
Benson, Dennis A.; Karsch-Mizrachi, Ilene; Lipman, David J.; Ostell, James; Wheeler, David L.
2007-01-01
GenBank (R) is a comprehensive database that contains publicly available nucleotide sequences for more than 240 000 named organisms, obtained primarily through submissions from individual laboratories and batch submissions from large-scale sequencing projects. Most submissions are made using the web-based BankIt or standalone Sequin programs and accession numbers are assigned by GenBank staff upon receipt. Daily data exchange with the EMBL Data Library in Europe and the DNA Data Bank of Japan ensures worldwide coverage. GenBank is accessible through NCBI's retrieval system, Entrez, which integrates data from the major DNA and protein sequence databases along with taxonomy, genome, mapping, protein structure and domain information, and the biomedical journal literature via PubMed. BLAST provides sequence similarity searches of GenBank and other sequence databases. Complete bimonthly releases and daily updates of the GenBank database are available by FTP. To access GenBank and its related retrieval and analysis services, begin at the NCBI Homepage (). PMID:17202161
Bellerophon: a program to detect chimeric sequences in multiple sequence alignments.
Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip
2004-09-22
Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments. Bellerophon is available as an interactive web server at http://foo.maths.uq.edu.au/~huber/bellerophon.pl
Regulation of Ion Channels by Pyridine Nucleotides
Kilfoil, Peter J.; Tipparaju, Srinivas M.; Barski, Oleg A.; Bhatnagar, Aruni
2014-01-01
Recent research suggests that in addition to their role as soluble electron carriers, pyridine nucleotides [NAD(P)(H)] also regulate ion transport mechanisms. This mode of regulation seems to have been conserved through evolution. Several bacterial ion–transporting proteins or their auxiliary subunits possess nucleotide-binding domains. In eukaryotes, the Kv1 and Kv4 channels interact with pyridine nucleotide–binding β-subunits that belong to the aldo-keto reductase superfamily. Binding of NADP+ to Kvβ removes N-type inactivation of Kv currents, whereas NADPH stabilizes channel inactivation. Pyridine nucleotides also regulate Slo channels by interacting with their cytosolic regulator of potassium conductance domains that show high sequence homology to the bacterial TrkA family of K+ transporters. These nucleotides also have been shown to modify the activity of the plasma membrane KATP channels, the cystic fibrosis transmembrane conductance regulator, the transient receptor potential M2 channel, and the intracellular ryanodine receptor calcium release channels. In addition, pyridine nucleotides also modulate the voltage-gated sodium channel by supporting the activity of its ancillary subunit—the glycerol-3-phosphate dehydrogenase-like protein. Moreover, the NADP+ metabolite, NAADP+, regulates intracellular calcium homeostasis via the 2-pore channel, ryanodine receptor, or transient receptor potential M2 channels. Regulation of ion channels by pyridine nucleotides may be required for integrating cell ion transport to energetics and for sensing oxygen levels or metabolite availability. This mechanism also may be an important component of hypoxic pulmonary vasoconstriction, memory, and circadian rhythms, and disruption of this regulatory axis may be linked to dysregulation of calcium homeostasis and cardiac arrhythmias. PMID:23410881
Telling apart Felidae and Ursidae from the distribution of nucleotides in mitochondrial DNA
NASA Astrophysics Data System (ADS)
Rovenchak, Andrij
2018-02-01
Rank-frequency distributions of nucleotide sequences in mitochondrial DNA are defined in a way analogous to the linguistic approach, with the highest-frequent nucleobase serving as a whitespace. For such sequences, entropy and mean length are calculated. These parameters are shown to discriminate the species of the Felidae (cats) and Ursidae (bears) families. From purely numerical values we are able to see in particular that giant pandas are bears while koalas are not. The observed linear relation between the parameters is explained using a simple probabilistic model. The approach based on the non-additive generalization of the Bose distribution is used to analyze the frequency spectra of the nucleotide sequences. In this case, the separation of families is not very sharp. Nevertheless, the distributions for Felidae have on average longer tails comparing to Ursidae.
Sasaya, Takahide; Kusaba, Shinnosuke; Ishikawa, Koichi; Koganezawa, Hiroki
2004-09-01
Lettuce big-vein virus (LBVV) is the type species of the genus Varicosavirus and is a two-segmented negative-sense single-stranded RNA virus. The larger LBVV genome segment (RNA1) consists of 6797 nt and encodes an L polymerase that resembles that of rhabdoviruses. Here, the nucleotide sequence of the second LBVV genome segment (RNA2) is reported. LBVV RNA2 consisted of 6081 nt and contained antisense information for five major ORFs: ORF1 (nt 210-1403 on the viral RNA), ORF2 (nt 1493-2494), ORF3 (nt 2617-3489), ORF4 (nt 3843-4337) and ORF5 (nt 4530-5636), which had coding capacities of 44, 36, 32, 19 and 41 kDa, respectively. The gene at the 3' end of the viral RNA encoded a coat protein, while the other four genes encoded proteins of unknown functions. The 3'-terminal 11 nt of LBVV RNA2 were identical to those of LBVV RNA1, and the 5'-terminal regions of LBVV RNA1 and RNA2 contained a long common nucleotide stretch of about 100 nt. Northern blot analysis using probes specific to the individual ORFs revealed that LBVV transcribes monocistronic RNAs. Analysis of the terminal sequences, and primer extension and RNase H digestion analysis of LBVV mRNAs, suggested that LBVV utilizes a transcription termination/initiation strategy comparable with that of rhabdoviruses.
Structure of the coding region and mRNA variants of the apyrase gene from pea (Pisum sativum)
NASA Technical Reports Server (NTRS)
Shibata, K.; Abe, S.; Davies, E.
2001-01-01
Partial amino acid sequences of a 49 kDa apyrase (ATP diphosphohydrolase, EC 3.6.1.5) from the cytoskeletal fraction of etiolated pea stems were used to derive oligonucleotide DNA primers to generate a cDNA fragment of pea apyrase mRNA by RT-PCR and these primers were used to screen a pea stem cDNA library. Two almost identical cDNAs differing in just 6 nucleotides within the coding regions were found, and these cDNA sequences were used to clone genomic fragments by PCR. Two nearly identical gene fragments containing 8 exons and 7 introns were obtained. One of them (H-type) encoded the mRNA sequence described by Hsieh et al. (1996) (DDBJ/EMBL/GenBank Z32743), while the other (S-type) differed by the same 6 nucleotides as the mRNAs, suggesting that these genes may be alleles. The six nucleotide differences between these two alleles were found solely in the first exon, and these mutation sites had two types of consensus sequences. These mRNAs were found with varying lengths of 3' untranslated regions (3'-UTR). There are some similarities between the 3'-UTR of these mRNAs and those of actin and actin binding proteins in plants. The putative roles of the 3'-UTR and alternative polyadenylation sites are discussed in relation to their possible role in targeting the mRNAs to different subcellular compartments.
El-Sabrout, Karim; Aggag, Sarah A.
2017-01-01
Aim: In this study, we examined parts of six growth genes (growth hormone [GH], melanocortin 4 receptor [MC4R], growth hormone receptor [GHR], phosphorglycerate mutase [PGAM], myostatin [MSTN], and fibroblast growth factor [FGF]) as specific primers for two rabbit lines (V-line, Alexandria) using nucleotide sequence analysis, to investigate association between detecting single nucleotide polymorphism (SNP) of these genes and body weight (BW) at market. Materials and Methods: Each line kits were grouped into high and low weight rabbits to identify DNA markers useful for association studies with high BW. DNA from blood samples of each group was extracted to amplify the six growth genes. SNP technique was used to study the associate polymorphism in the six growth genes and marketing BW (at 63 days) in the two rabbit lines. The purified polymerase chain reaction products were sequenced in those had the highest and lowest BW in each line. Results: Alignment of sequence data from each group revealed the following SNPs: At nucleotide 23 (A-C) and nucleotide 35 (T-G) in MC4R gene (sense mutation) of Alexandria and V-line high BW. Furthermore, we detected the following SNPs variation between the two lines: A SNP (T-C) at nucleotide 27 was identified by MC4R gene (sense mutation) and another one (A-C) at nucleotide 14 was identified by GHR gene (nonsense mutation) of Alexandria line. The results of individual BW at market (63 days) indicated that Alexandria rabbits had significantly higher BW compared with V-line rabbits. MC4R polymorphism showed significant association with high BW in rabbits. Conclusion: The results of polymorphism demonstrate the possibility to detect an association between BW in rabbits and the efficiency of the used primers to predict through the genetic specificity using the SNP of MC4R. PMID:28246458
Tong, Steven Y C; Xie, Shirley; Richardson, Leisha J; Ballard, Susan A; Dakh, Farshid; Grabsch, Elizabeth A; Grayson, M Lindsay; Howden, Benjamin P; Johnson, Paul D R; Giffard, Philip M
2011-01-01
We have developed a single nucleotide polymorphism (SNP) nucleated high-resolution melting (HRM) technique to genotype Enterococcus faecium. Eight SNPs were derived from the E. faecium multilocus sequence typing (MLST) database and amplified fragments containing these SNPs were interrogated by HRM. We tested the HRM genotyping scheme on 85 E. faecium bloodstream isolates and compared the results with MLST, pulsed-field gel electrophoresis (PFGE) and an allele specific real-time PCR (AS kinetic PCR) SNP typing method. In silico analysis based on predicted HRM curves according to the G+C content of each fragment for all 567 sequence types (STs) in the MLST database together with empiric data from the 85 isolates demonstrated that HRM analysis resolves E. faecium into 231 "melting types" (MelTs) and provides a Simpson's Index of Diversity (D) of 0.991 with respect to MLST. This is a significant improvement on the AS kinetic PCR SNP typing scheme that resolves 61 SNP types with D of 0.95. The MelTs were concordant with the known ST of the isolates. For the 85 isolates, there were 13 PFGE patterns, 17 STs, 14 MelTs and eight SNP types. There was excellent concordance between PFGE, MLST and MelTs with Adjusted Rand Indices of PFGE to MelT 0.936 and ST to MelT 0.973. In conclusion, this HRM based method appears rapid and reproducible. The results are concordant with MLST and the MLST based population structure.
Nucleotide excision repair by dual incisions in plants.
Canturk, Fazile; Karaman, Muhammet; Selby, Christopher P; Kemp, Michael G; Kulaksiz-Erkmen, Gulnihal; Hu, Jinchuan; Li, Wentao; Lindsey-Boltz, Laura A; Sancar, Aziz
2016-04-26
Plants use light for photosynthesis and for various signaling purposes. The UV wavelengths in sunlight also introduce DNA damage in the form of cyclobutane pyrimidine dimers (CPDs) and pyrimidine (6-4) pyrimidone photoproducts [(6-4)PPs] that must be repaired for the survival of the plant. Genome sequencing has revealed the presence of genes for both CPD and (6-4)PP photolyases, as well as genes for nucleotide excision repair in plants, such as Arabidopsis and rice. Plant photolyases have been purified, characterized, and have been shown to play an important role in plant survival. In contrast, even though nucleotide excision repair gene homologs have been found in plants, the mechanism of nucleotide excision repair has not been investigated. Here we used the in vivo excision repair assay developed in our laboratory to demonstrate that Arabidopsis removes CPDs and (6-4)PPs by a dual-incision mechanism that is essentially identical to the mechanism of dual incisions in humans and other eukaryotes, in which oligonucleotides with a mean length of 26-27 nucleotides are removed by incising ∼20 phosphodiester bonds 5' and 5 phosphodiester bonds 3' to the photoproduct.
Li, Guang-Qing; Liu, Zi; Shen, Hong-Bin; Yu, Dong-Jun
2016-10-01
As one of the most ubiquitous post-transcriptional modifications of RNA, N 6 -methyladenosine ( [Formula: see text]) plays an essential role in many vital biological processes. The identification of [Formula: see text] sites in RNAs is significantly important for both basic biomedical research and practical drug development. In this study, we designed a computational-based method, called TargetM6A, to rapidly and accurately target [Formula: see text] sites solely from the primary RNA sequences. Two new features, i.e., position-specific nucleotide/dinucleotide propensities (PSNP/PSDP), are introduced and combined with the traditional nucleotide composition (NC) feature to formulate RNA sequences. The extracted features are further optimized to obtain a much more compact and discriminative feature subset by applying an incremental feature selection (IFS) procedure. Based on the optimized feature subset, we trained TargetM6A on the training dataset with a support vector machine (SVM) as the prediction engine. We compared the proposed TargetM6A method with existing methods for predicting [Formula: see text] sites by performing stringent jackknife tests and independent validation tests on benchmark datasets. The experimental results show that the proposed TargetM6A method outperformed the existing methods for predicting [Formula: see text] sites and remarkably improved the prediction performances, with MCC = 0.526 and AUC = 0.818. We also provided a user-friendly web server for TargetM6A, which is publicly accessible for academic use at http://csbio.njust.edu.cn/bioinf/TargetM6A.
SNP discovery through de novo deep sequencing using the next generation of DNA sequencers
USDA-ARS?s Scientific Manuscript database
The production of high volumes of DNA sequence data using new technologies has permitted more efficient identification of single nucleotide polymorphisms in vertebrate genomes. This chapter presented practical methodology for production and analysis of DNA sequence data for SNP discovery....
Correlation approach to identify coding regions in DNA sequences
NASA Technical Reports Server (NTRS)
Ossadnik, S. M.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.
1994-01-01
Recently, it was observed that noncoding regions of DNA sequences possess long-range power-law correlations, whereas coding regions typically display only short-range correlations. We develop an algorithm based on this finding that enables investigators to perform a statistical analysis on long DNA sequences to locate possible coding regions. The algorithm is particularly successful in predicting the location of lengthy coding regions. For example, for the complete genome of yeast chromosome III (315,344 nucleotides), at least 82% of the predictions correspond to putative coding regions; the algorithm correctly identified all coding regions larger than 3000 nucleotides, 92% of coding regions between 2000 and 3000 nucleotides long, and 79% of coding regions between 1000 and 2000 nucleotides. The predictive ability of this new algorithm supports the claim that there is a fundamental difference in the correlation property between coding and noncoding sequences. This algorithm, which is not species-dependent, can be implemented with other techniques for rapidly and accurately locating relatively long coding regions in genomic sequences.
DNA sequencing using polymerase substrate-binding kinetics
Previte, Michael John Robert; Zhou, Chunhong; Kellinger, Matthew; Pantoja, Rigo; Chen, Cheng-Yao; Shi, Jin; Wang, BeiBei; Kia, Amirali; Etchin, Sergey; Vieceli, John; Nikoomanzar, Ali; Bomati, Erin; Gloeckner, Christian; Ronaghi, Mostafa; He, Molly Min
2015-01-01
Next-generation sequencing (NGS) has transformed genomic research by decreasing the cost of sequencing. However, whole-genome sequencing is still costly and complex for diagnostics purposes. In the clinical space, targeted sequencing has the advantage of allowing researchers to focus on specific genes of interest. Routine clinical use of targeted NGS mandates inexpensive instruments, fast turnaround time and an integrated and robust workflow. Here we demonstrate a version of the Sequencing by Synthesis (SBS) chemistry that potentially can become a preferred targeted sequencing method in the clinical space. This sequencing chemistry uses natural nucleotides and is based on real-time recording of the differential polymerase/DNA-binding kinetics in the presence of correct or mismatch nucleotides. This ensemble SBS chemistry has been implemented on an existing Illumina sequencing platform with integrated cluster amplification. We discuss the advantages of this sequencing chemistry for targeted sequencing as well as its limitations for other applications. PMID:25612848
De Laurentiis, Evelina Ines; Mercier, Evan; Wieden, Hans-Joachim
2016-10-28
Little is known about the conservation of critical kinetic parameters and the mechanistic strategies of elongation factor (EF) Ts-catalyzed nucleotide exchange in EF-Tu in bacteria and particularly in clinically relevant pathogens. EF-Tu from the clinically relevant pathogen Pseudomonas aeruginosa shares over 84% sequence identity with the corresponding elongation factor from Escherichia coli Interestingly, the functionally closely linked EF-Ts only shares 55% sequence identity. To identify any differences in the nucleotide binding properties, as well as in the EF-Ts-mediated nucleotide exchange reaction, we performed a comparative rapid kinetics and mutagenesis analysis of the nucleotide exchange mechanism for both the E. coli and P. aeruginosa systems, identifying helix 13 of EF-Ts as a previously unnoticed regulatory element in the nucleotide exchange mechanism with species-specific elements. Our findings support the base side-first entry of the nucleotide into the binding pocket of the EF-Tu·EF-Ts binary complex, followed by displacement of helix 13 and rapid binding of the phosphate side of the nucleotide, ultimately leading to the release of EF-Ts. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Denoising DNA deep sequencing data—high-throughput sequencing errors and their correction
Laehnemann, David; Borkhardt, Arndt
2016-01-01
Characterizing the errors generated by common high-throughput sequencing platforms and telling true genetic variation from technical artefacts are two interdependent steps, essential to many analyses such as single nucleotide variant calling, haplotype inference, sequence assembly and evolutionary studies. Both random and systematic errors can show a specific occurrence profile for each of the six prominent sequencing platforms surveyed here: 454 pyrosequencing, Complete Genomics DNA nanoball sequencing, Illumina sequencing by synthesis, Ion Torrent semiconductor sequencing, Pacific Biosciences single-molecule real-time sequencing and Oxford Nanopore sequencing. There is a large variety of programs available for error removal in sequencing read data, which differ in the error models and statistical techniques they use, the features of the data they analyse, the parameters they determine from them and the data structures and algorithms they use. We highlight the assumptions they make and for which data types these hold, providing guidance which tools to consider for benchmarking with regard to the data properties. While no benchmarking results are included here, such specific benchmarks would greatly inform tool choices and future software development. The development of stand-alone error correctors, as well as single nucleotide variant and haplotype callers, could also benefit from using more of the knowledge about error profiles and from (re)combining ideas from the existing approaches presented here. PMID:26026159
Komiyama, Tomoyoshi; Ikeo, Kazuho; Gojobori, Takashi
2004-05-26
Chickens with exceptionally long crow are often favored all over the world, and connoisseur breeders have bred certain types of chicken exclusively for this trait. In Japan, three chicken varieties have been specifically bred to develop an exceptionally long crow of over 15 s. Although these three long-crowing chickens, Naganakidori, are honored as heritage varieties of Japan, the domestication process and genealogical origin of long-crowing chickens remain unclear. The purpose of this study is to clarify these issues using nucleotide sequences of the mitochondrial DNA D-loop region. Blood samples from a total of nine long-crowing chickens and 74 chickens from 11 Japanese native varieties were collected. DNA sequence data of two Junglefowl species were also collected from the International DNA database (DDBJ /EMBL/GenBank) for use as the outgroup. A phylogenetic tree was then constructed revealing that all three Naganakidori varieties were monophyletic and originated from a fighting cock, a Shamo, for cockfighting. These results suggest that these three long-crowing chickens share a common origin in spite of their conspicuously different characters, and that human cultures favoring long-crowing chickens might have been preceded by a tradition of cockfighting. Moreover, these long-crowing varieties first separated from the fighting cocks of Okinawa, which is geographically closer to Southern China and Indochina than Mainland Japan (Honshu/Kyushu). This implies that Japanese long-crowing chickens were first brought to Mainland Japan as fighting cocks from the surrounding regions of Southern China or Indochina and through Okinawa.
HTSeq--a Python framework to work with high-throughput sequencing data.
Anders, Simon; Pyl, Paul Theodor; Huber, Wolfgang
2015-01-15
A large choice of tools exists for many standard tasks in the analysis of high-throughput sequencing (HTS) data. However, once a project deviates from standard workflows, custom scripts are needed. We present HTSeq, a Python library to facilitate the rapid development of such scripts. HTSeq offers parsers for many common data formats in HTS projects, as well as classes to represent data, such as genomic coordinates, sequences, sequencing reads, alignments, gene model information and variant calls, and provides data structures that allow for querying via genomic coordinates. We also present htseq-count, a tool developed with HTSeq that preprocesses RNA-Seq data for differential expression analysis by counting the overlap of reads with genes. HTSeq is released as an open-source software under the GNU General Public Licence and available from http://www-huber.embl.de/HTSeq or from the Python Package Index at https://pypi.python.org/pypi/HTSeq. © The Author 2014. Published by Oxford University Press.
Lammers, P J; McLaughlin, S; Papin, S; Trujillo-Provencio, C; Ryncarz, A J
1990-01-01
An 11-kbp DNA element of unknown function interrupts the nifD gene in vegetative cells of Anabaena sp. strain PCC 7120. In developing heterocysts the nifD element excises from the chromosome via site-specific recombination between short repeat sequences that flank the element. The nucleotide sequence of the nifH-proximal half of the element was determined to elucidate the genetic potential of the element. Four open reading frames with the same relative orientation as the nifD element-encoded xisA gene were identified in the sequenced region. Each of the open reading frames was preceded by a reasonable ribosome-binding site and had biased codon utilization preferences consistent with low levels of expression. Open reading frame 3 was highly homologous with three cytochrome P-450 omega-hydroxylase proteins and showed regional homology to functionally significant domains common to the cytochrome P-450 superfamily. The sequence encoding open reading frame 2 was the most highly conserved portion of the sequenced region based on heterologous hybridization experiments with three genera of heterocystous cyanobacteria. Images PMID:2123860
A Bioluminometric Method of DNA Sequencing
NASA Technical Reports Server (NTRS)
Ronaghi, Mostafa; Pourmand, Nader; Stolc, Viktor; Arnold, Jim (Technical Monitor)
2001-01-01
Pyrosequencing is a bioluminometric single-tube DNA sequencing method that takes advantage of co-operativity between four enzymes to monitor DNA synthesis. In this sequencing-by-synthesis method, a cascade of enzymatic reactions yields detectable light, which is proportional to incorporated nucleotides. Pyrosequencing has the advantages of accuracy, flexibility and parallel processing. It can be easily automated. Furthermore, the technique dispenses with the need for labeled primers, labeled nucleotides and gel-electrophoresis. In this chapter, the use of this technique for different applications is discussed.
PASTA: Ultra-Large Multiple Sequence Alignment for Nucleotide and Amino-Acid Sequences
Mirarab, Siavash; Nguyen, Nam; Guo, Sheng; Wang, Li-San; Kim, Junhyong
2015-01-01
Abstract We introduce PASTA, a new multiple sequence alignment algorithm. PASTA uses a new technique to produce an alignment given a guide tree that enables it to be both highly scalable and very accurate. We present a study on biological and simulated data with up to 200,000 sequences, showing that PASTA produces highly accurate alignments, improving on the accuracy and scalability of the leading alignment methods (including SATé). We also show that trees estimated on PASTA alignments are highly accurate—slightly better than SATé trees, but with substantial improvements relative to other methods. Finally, PASTA is faster than SATé, highly parallelizable, and requires relatively little memory. PMID:25549288
PASTA: Ultra-Large Multiple Sequence Alignment for Nucleotide and Amino-Acid Sequences.
Mirarab, Siavash; Nguyen, Nam; Guo, Sheng; Wang, Li-San; Kim, Junhyong; Warnow, Tandy
2015-05-01
We introduce PASTA, a new multiple sequence alignment algorithm. PASTA uses a new technique to produce an alignment given a guide tree that enables it to be both highly scalable and very accurate. We present a study on biological and simulated data with up to 200,000 sequences, showing that PASTA produces highly accurate alignments, improving on the accuracy and scalability of the leading alignment methods (including SATé). We also show that trees estimated on PASTA alignments are highly accurate--slightly better than SATé trees, but with substantial improvements relative to other methods. Finally, PASTA is faster than SATé, highly parallelizable, and requires relatively little memory.
Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC
2006-01-01
Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935
Gibbs, Mark J; Armstrong, John S; Gibbs, Adrian J
2005-01-01
Background Most current DNA diagnostic tests for identifying organisms use specific oligonucleotide probes that are complementary in sequence to, and hence only hybridise with the DNA of one target species. By contrast, in traditional taxonomy, specimens are usually identified by 'dichotomous keys' that use combinations of characters shared by different members of the target set. Using one specific character for each target is the least efficient strategy for identification. Using combinations of shared bisectionally-distributed characters is much more efficient, and this strategy is most efficient when they separate the targets in a progressively binary way. Results We have developed a practical method for finding minimal sets of sub-sequences that identify individual sequences, and could be targeted by combinations of probes, so that the efficient strategy of traditional taxonomic identification could be used in DNA diagnosis. The sizes of minimal sub-sequence sets depended mostly on sequence diversity and sub-sequence length and interactions between these parameters. We found that 201 distinct cytochrome oxidase subunit-1 (CO1) genes from moths (Lepidoptera) were distinguished using only 15 sub-sequences 20 nucleotides long, whereas only 8–10 sub-sequences 6–10 nucleotides long were required to distinguish the CO1 genes of 92 species from the 9 largest orders of insects. Conclusion The presence/absence of sub-sequences in a set of gene sequences can be used like the questions in a traditional dichotomous taxonomic key; hybridisation probes complementary to such sub-sequences should provide a very efficient means for identifying individual species, subtypes or genotypes. Sequence diversity and sub-sequence length are the major factors that determine the numbers of distinguishing sub-sequences in any set of sequences. PMID:15817134
Nature and distribution of feline sarcoma virus nucleotide sequences.
Frankel, A E; Gilbert, J H; Porzig, K J; Scolnick, E M; Aaronson, S A
1979-01-01
The genomes of three independent isolates of feline sarcoma virus (FeSV) were compared by molecular hybridization techniques. Using complementary DNAs prepared from two strains, SM- and ST-FeSV, common complementary DNA'S were selected by sequential hybridization to FeSV and feline leukemia virus RNAs. These DNAs were shown to be highly related among the three independent sarcoma virus isolates. FeSV-specific complementary DNAs were prepared by selection for hybridization by the homologous FeSV RNA and against hybridization by fline leukemia virus RNA. Sarcoma virus-specific sequences of SM-FeSV were shown to differ from those of either ST- or GA-FeSV strains, whereas ST-FeSV-specific DNA shared extensive sequence homology with GA-FeSV. By molecular hybridization, each set of FeSV-specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae. In contrast, FeSV-common sequences were present in multiple DNA copies and were found only in Mediterranean cats. The present results are consistent with the concept that each FeSV strain has arisen by a mechanism involving recombination between feline leukemia virus and cat cellular DNA sequences, the latter represented within the cat genome in a manner analogous to that of a cellular gene. PMID:225544
USDA-ARS?s Scientific Manuscript database
: Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...
Glessner, Joseph T; Bick, Alexander G; Ito, Kaoru; Homsy, Jason; Rodriguez-Murillo, Laura; Fromer, Menachem; Mazaika, Erica; Vardarajan, Badri; Italia, Michael; Leipzig, Jeremy; DePalma, Steven R; Golhar, Ryan; Sanders, Stephan J; Yamrom, Boris; Ronemus, Michael; Iossifov, Ivan; Willsey, A Jeremy; State, Matthew W; Kaltman, Jonathan R; White, Peter S; Shen, Yufeng; Warburton, Dorothy; Brueckner, Martina; Seidman, Christine; Goldmuntz, Elizabeth; Gelb, Bruce D; Lifton, Richard; Seidman, Jonathan; Hakonarson, Hakon; Chung, Wendy K
2014-10-24
Congenital heart disease (CHD) is among the most common birth defects. Most cases are of unknown pathogenesis. To determine the contribution of de novo copy number variants (CNVs) in the pathogenesis of sporadic CHD. We studied 538 CHD trios using genome-wide dense single nucleotide polymorphism arrays and whole exome sequencing. Results were experimentally validated using digital droplet polymerase chain reaction. We compared validated CNVs in CHD cases with CNVs in 1301 healthy control trios. The 2 complementary high-resolution technologies identified 63 validated de novo CNVs in 51 CHD cases. A significant increase in CNV burden was observed when comparing CHD trios with healthy trios, using either single nucleotide polymorphism array (P=7×10(-5); odds ratio, 4.6) or whole exome sequencing data (P=6×10(-4); odds ratio, 3.5) and remained after removing 16% of de novo CNV loci previously reported as pathogenic (P=0.02; odds ratio, 2.7). We observed recurrent de novo CNVs on 15q11.2 encompassing CYFIP1, NIPA1, and NIPA2 and single de novo CNVs encompassing DUSP1, JUN, JUP, MED15, MED9, PTPRE SREBF1, TOP2A, and ZEB2, genes that interact with established CHD proteins NKX2-5 and GATA4. Integrating de novo variants in whole exome sequencing and CNV data suggests that ETS1 is the pathogenic gene altered by 11q24.2-q25 deletions in Jacobsen syndrome and that CTBP2 is the pathogenic gene in 10q subtelomeric deletions. We demonstrate a significantly increased frequency of rare de novo CNVs in CHD patients compared with healthy controls and suggest several novel genetic loci for CHD. © 2014 American Heart Association, Inc.
Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.
Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook
2014-11-01
As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of
Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J
2011-12-01
Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.
Hannou, Najat; Mondy, Samuel; Planamente, Sara; Moumni, Mohieddine; Llop, Pablo; López, María; Manceau, Charles; Barny, Marie-Anne; Faure, Denis
2013-10-01
Erwinia amylovora causes economic losses that affect pear and apple production in Morocco. Here, we report comparative genomics of four Moroccan E. amylovora strains with the European strain CFBP1430 and North-American strain ATCC49946. Analysis of single nucleotide polymorphisms (SNPs) revealed genetic homogeneity of Moroccan's strains and their proximity to the European strain CFBP1430. Moreover, the collected sequences allowed the assembly of a 65 kpb plasmid, which is highly similar to the plasmid pEI70 harbored by several European E. amylovora isolates. This plasmid was found in 33% of the 40 E. amylovora strains collected from several host plants in 2009 and 2010 in Morocco. Copyright © 2013 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Guo, D; Maiss, E; Adam, G; Casper, R
1995-05-01
The RNA3 of prunus necrotic ringspot ilarvirus (PNRSV) has been cloned and its entire sequence determined. The RNA3 consists of 1943 nucleotides (nt) and possesses two large open reading frames (ORFs) separated by an intergenic region of 74 nt. The 5' proximal ORF is 855 nt in length and codes for a protein of molecular mass 31.4 kDa which has homologies with the putative movement protein of other members of the Bromoviridae. The 3' proximal ORF of 675 nt is the cistron for the coat protein (CP) and has a predicted molecular mass of 24.9 kDa. The sequence of the 3' non-coding region (NCR) of PNRSV RNA3 showed a high degree of similarity with those of tobacco streak virus (TSV), prune dwarf virus (PDV), apple mosaic virus (ApMV) and also alfalfa mosaic virus (AIMV). In addition it contained potential stem-loop structures with interspersed AUGC motifs characteristic for ilar- and alfamoviruses. This conserved primary and secondary structure in all 3' NCRs may be responsible for the interaction with homologous and heterologous CPs and subsequent activation of genome replication. The CP gene of an ApMV isolate (ApMV-G) of 657 nt has also been cloned and sequenced. Although ApMV and PNRSV have a distant serological relationship, the deduced amino acid sequences of their CPs have an identity of only 51.8%. The N termini of PNRSV and ApMV CPs have in common a zinc-finger motif and the potential to form an amphipathic helix.
Jo, Yeong Deuk; Choi, Yoomi; Kim, Dong-Hwan; Kim, Byung-Dong; Kang, Byoung-Cheorl
2014-07-04
Cytoplasmic male sterility (CMS) is an inability to produce functional pollen that is caused by mutation of the mitochondrial genome. Comparative analyses of mitochondrial genomes of lines with and without CMS in several species have revealed structural differences between genomes, including extensive rearrangements caused by recombination. However, the mitochondrial genome structure and the DNA rearrangements that may be related to CMS have not been characterized in Capsicum spp. We obtained the complete mitochondrial genome sequences of the pepper CMS line FS4401 (507,452 bp) and the fertile line Jeju (511,530 bp). Comparative analysis between mitochondrial genomes of peppers and tobacco that are included in Solanaceae revealed extensive DNA rearrangements and poor conservation in non-coding DNA. In comparison between pepper lines, FS4401 and Jeju mitochondrial DNAs contained the same complement of protein coding genes except for one additional copy of an atp6 gene (ψatp6-2) in FS4401. In terms of genome structure, we found eighteen syntenic blocks in the two mitochondrial genomes, which have been rearranged in each genome. By contrast, sequences between syntenic blocks, which were specific to each line, accounted for 30,380 and 17,847 bp in FS4401 and Jeju, respectively. The previously-reported CMS candidate genes, orf507 and ψatp6-2, were located on the edges of the largest sequence segments that were specific to FS4401. In this region, large number of small sequence segments which were absent or found on different locations in Jeju mitochondrial genome were combined together. The incorporation of repeats and overlapping of connected sequence segments by a few nucleotides implied that extensive rearrangements by homologous recombination might be involved in evolution of this region. Further analysis using mtDNA pairs from other plant species revealed common features of DNA regions around CMS-associated genes. Although large portion of sequence context was
O'Toole, Amanda S.; Miller, Stacy; Haines, Nathan; Zink, M. Coleen; Serra, Martin J.
2006-01-01
Thermodynamic parameters are reported for duplex formation of 48 self-complementary RNA duplexes containing Watson–Crick terminal base pairs (GC, AU and UA) with all 16 possible 3′ double-nucleotide overhangs; mimicking the structures of short interfering RNAs (siRNA) and microRNAs (miRNA). Based on nearest-neighbor analysis, the addition of a second dangling nucleotide to a single 3′ dangling nucleotide increases stability of duplex formation up to 0.8 kcal/mol in a sequence dependent manner. Results from this study in conjunction with data from a previous study [A. S. O'Toole, S. Miller and M. J. Serra (2005) RNA, 11, 512.] allows for the development of a refined nearest-neighbor model to predict the influence of 3′ double-nucleotide overhangs on the stability of duplex formation. The model improves the prediction of free energy and melting temperature when tested against five oligomers with various core duplex sequences. Phylogenetic analysis of naturally occurring miRNAs was performed to support our results. Selection of the effector miR strand of the mature miRNA duplex appears to be dependent upon the identity of the 3′ double-nucleotide overhang. Thermodynamic parameters for 3′ single terminal overhangs adjacent to a UA pair are also presented. PMID:16820533
NASA Astrophysics Data System (ADS)
Nallaseth, Ferez Soli
The Y-chromosome presents a unique cytogenetic framework for the evolution of nucleotide sequences. Alignment of nine Y-chromosomal fragments in their increasing Y-specific/non Y-specific (male/female) sequence divergence ratios was directly and inversely related to their interspersion on these two respective genomic fractions. Sequence analysis confirmed a direct relationship between divergence ratios and the Alu, LINE-1, Satellite and their derivative oligonucleotide contents. Thus their relocation on the Y-chromosome is followed by sequence divergence rather than the well documented concerted evolution of these non-coding progenitor repeated sequences. Five of the nine Y-chromosomal fragments are non-pseudoautosomal and transcribed into heterogeneous PolyA^+ RNA and thus can be retrotransposed. Evolutionary and computer analysis identified homologous oligonucleotide tracts in several human loci suggesting common and random mechanistic origins. Dysgenic genomes represent the accelerated evolution driving sequence divergence (McClintock, 1984). Sex reversal and sterility characterizing dysgenesis occurs in C57BL/6JY ^{rm Pos} but not in 129/SvY^{rm Pos} derivative strains. High frequency, random, multi-locus deletion products of the feral Y^{ rm Pos}-chromosome are generated in the germlines of F1(C57BL/6J X 129/SvY^{ rm Pos})(male) and C57BL/6JY ^{rm Pos}(male) but not in 129/SvY^{rm Pos}(male). Equal, 10^{-1}, 10^ {-2}, and 0 copies (relative to males) of Y^{rm Pos}-specific deletion products respectively characterize C57BL/6JY ^{rm Pos} (HC), (LC), (T) and (F) females. The testes determining loci of inactive Y^{rm Pos}-chromosomes in C57BL/6JY^{rm Pos} HC females are the preferentially deleted/rearranged Y ^{rm Pos}-sequences. Disruption of regulation of plasma testosterone and hepatic MUP-A mRNA levels, TRD of a 4.7 Kbp EcoR1 fragment suggest disruption of autosomal/X-chromosomal sequences. These data and the highly repeated progenitor (Alu, GATA, LINE-1
Detection of a divergent variant of grapevine virus F by next-generation sequencing.
Molenaar, Nicholas; Burger, Johan T; Maree, Hans J
2015-08-01
The complete genome sequence of a South African isolate of grapevine virus F (GVF) is presented. It was first detected by metagenomic next-generation sequencing of field samples and validated through direct Sanger sequencing. The genome sequence of GVF isolate V5 consists of 7539 nucleotides and contains a poly(A) tail. It has a typical vitivirus genome arrangement that comprises five open reading frames (ORFs), which share only 88.96 % nucleotide sequence identity with the existing complete GVF genome sequence (JX105428).
Predicting protein-binding RNA nucleotides with consideration of binding partners.
Tuvshinjargal, Narankhuu; Lee, Wook; Park, Byungkyu; Han, Kyungsook
2015-06-01
In recent years several computational methods have been developed to predict RNA-binding sites in protein. Most of these methods do not consider interacting partners of a protein, so they predict the same RNA-binding sites for a given protein sequence even if the protein binds to different RNAs. Unlike the problem of predicting RNA-binding sites in protein, the problem of predicting protein-binding sites in RNA has received little attention mainly because it is much more difficult and shows a lower accuracy on average. In our previous study, we developed a method that predicts protein-binding nucleotides from an RNA sequence. In an effort to improve the prediction accuracy and usefulness of the previous method, we developed a new method that uses both RNA and protein sequence data. In this study, we identified effective features of RNA and protein molecules and developed a new support vector machine (SVM) model to predict protein-binding nucleotides from RNA and protein sequence data. The new model that used both protein and RNA sequence data achieved a sensitivity of 86.5%, a specificity of 86.2%, a positive predictive value (PPV) of 72.6%, a negative predictive value (NPV) of 93.8% and Matthews correlation coefficient (MCC) of 0.69 in a 10-fold cross validation; it achieved a sensitivity of 58.8%, a specificity of 87.4%, a PPV of 65.1%, a NPV of 84.2% and MCC of 0.48 in independent testing. For comparative purpose, we built another prediction model that used RNA sequence data alone and ran it on the same dataset. In a 10 fold-cross validation it achieved a sensitivity of 85.7%, a specificity of 80.5%, a PPV of 67.7%, a NPV of 92.2% and MCC of 0.63; in independent testing it achieved a sensitivity of 67.7%, a specificity of 78.8%, a PPV of 57.6%, a NPV of 85.2% and MCC of 0.45. In both cross-validations and independent testing, the new model that used both RNA and protein sequences showed a better performance than the model that used RNA sequence data alone in
FALDO: a semantic standard for describing the location of nucleotide and protein feature annotation.
Bolleman, Jerven T; Mungall, Christopher J; Strozzi, Francesco; Baran, Joachim; Dumontier, Michel; Bonnal, Raoul J P; Buels, Robert; Hoehndorf, Robert; Fujisawa, Takatomo; Katayama, Toshiaki; Cock, Peter J A
2016-06-13
Nucleotide and protein sequence feature annotations are essential to understand biology on the genomic, transcriptomic, and proteomic level. Using Semantic Web technologies to query biological annotations, there was no standard that described this potentially complex location information as subject-predicate-object triples. We have developed an ontology, the Feature Annotation Location Description Ontology (FALDO), to describe the positions of annotated features on linear and circular sequences. FALDO can be used to describe nucleotide features in sequence records, protein annotations, and glycan binding sites, among other features in coordinate systems of the aforementioned "omics" areas. Using the same data format to represent sequence positions that are independent of file formats allows us to integrate sequence data from multiple sources and data types. The genome browser JBrowse is used to demonstrate accessing multiple SPARQL endpoints to display genomic feature annotations, as well as protein annotations from UniProt mapped to genomic locations. Our ontology allows users to uniformly describe - and potentially merge - sequence annotations from multiple sources. Data sources using FALDO can prospectively be retrieved using federalised SPARQL queries against public SPARQL endpoints and/or local private triple stores.
FALDO: a semantic standard for describing the location of nucleotide and protein feature annotation
Bolleman, Jerven T.; Mungall, Christopher J.; Strozzi, Francesco; ...
2016-06-13
Nucleotide and protein sequence feature annotations are essential to understand biology on the genomic, transcriptomic, and proteomic level. Using Semantic Web technologies to query biological annotations, there was no standard that described this potentially complex location information as subject-predicate-object triples. In this paper, we have developed an ontology, the Feature Annotation Location Description Ontology (FALDO), to describe the positions of annotated features on linear and circular sequences. FALDO can be used to describe nucleotide features in sequence records, protein annotations, and glycan binding sites, among other features in coordinate systems of the aforementioned “omics” areas. Using the same data formatmore » to represent sequence positions that are independent of file formats allows us to integrate sequence data from multiple sources and data types. The genome browser JBrowse is used to demonstrate accessing multiple SPARQL endpoints to display genomic feature annotations, as well as protein annotations from UniProt mapped to genomic locations. Our ontology allows users to uniformly describe – and potentially merge – sequence annotations from multiple sources. Finally, data sources using FALDO can prospectively be retrieved using federalised SPARQL queries against public SPARQL endpoints and/or local private triple stores.« less
FALDO: a semantic standard for describing the location of nucleotide and protein feature annotation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bolleman, Jerven T.; Mungall, Christopher J.; Strozzi, Francesco
Nucleotide and protein sequence feature annotations are essential to understand biology on the genomic, transcriptomic, and proteomic level. Using Semantic Web technologies to query biological annotations, there was no standard that described this potentially complex location information as subject-predicate-object triples. In this paper, we have developed an ontology, the Feature Annotation Location Description Ontology (FALDO), to describe the positions of annotated features on linear and circular sequences. FALDO can be used to describe nucleotide features in sequence records, protein annotations, and glycan binding sites, among other features in coordinate systems of the aforementioned “omics” areas. Using the same data formatmore » to represent sequence positions that are independent of file formats allows us to integrate sequence data from multiple sources and data types. The genome browser JBrowse is used to demonstrate accessing multiple SPARQL endpoints to display genomic feature annotations, as well as protein annotations from UniProt mapped to genomic locations. Our ontology allows users to uniformly describe – and potentially merge – sequence annotations from multiple sources. Finally, data sources using FALDO can prospectively be retrieved using federalised SPARQL queries against public SPARQL endpoints and/or local private triple stores.« less
Quantitative trait nucleotide analysis using Bayesian model selection.
Blangero, John; Goring, Harald H H; Kent, Jack W; Williams, Jeff T; Peterson, Charles P; Almasy, Laura; Dyer, Thomas D
2005-10-01
Although much attention has been given to statistical genetic methods for the initial localization and fine mapping of quantitative trait loci (QTLs), little methodological work has been done to date on the problem of statistically identifying the most likely functional polymorphisms using sequence data. In this paper we provide a general statistical genetic framework, called Bayesian quantitative trait nucleotide (BQTN) analysis, for assessing the likely functional status of genetic variants. The approach requires the initial enumeration of all genetic variants in a set of resequenced individuals. These polymorphisms are then typed in a large number of individuals (potentially in families), and marker variation is related to quantitative phenotypic variation using Bayesian model selection and averaging. For each sequence variant a posterior probability of effect is obtained and can be used to prioritize additional molecular functional experiments. An example of this quantitative nucleotide analysis is provided using the GAW12 simulated data. The results show that the BQTN method may be useful for choosing the most likely functional variants within a gene (or set of genes). We also include instructions on how to use our computer program, SOLAR, for association analysis and BQTN analysis.
Discovery, Validation and Characterization of 1039 Cattle Single Nucleotide Polymorphisms
USDA-ARS?s Scientific Manuscript database
We identified approximately 13000 putative single nucleotide polymorphisms (SNPs) by comparison of repeat-masked BAC-end sequences from the cattle RPCI-42 BAC library with whole-genome shotgun contigs of cattle genome assembly Btau 1.0. Genotyping of a subset of these SNPs was performed on a panel ...
Evolution of Nucleotide Punctuation Marks: From Structural to Linear Signals.
El Houmami, Nawal; Seligmann, Hervé
2017-01-01
We present an evolutionary hypothesis assuming that signals marking nucleotide synthesis (DNA replication and RNA transcription) evolved from multi- to unidimensional structures, and were carried over from transcription to translation. This evolutionary scenario presumes that signals combining secondary and primary nucleotide structures are evolutionary transitions. Mitochondrial replication initiation fits this scenario. Some observations reported in the literature corroborate that several signals for nucleotide synthesis function in translation, and vice versa. (a) Polymerase-induced frameshift mutations occur preferentially at translational termination signals (nucleotide deletion is interpreted as termination of nucleotide polymerization, paralleling the role of stop codons in translation). (b) Stem-loop hairpin presence/absence modulates codon-amino acid assignments, showing that translational signals sometimes combine primary and secondary nucleotide structures (here codon and stem-loop). (c) Homopolymer nucleotide triplets (AAA, CCC, GGG, TTT) cause transcriptional and ribosomal frameshifts. Here we find in recently described human mitochondrial RNAs that systematically lack mono-, dinucleotides after each trinucleotide (delRNAs) that delRNA triplets include 2x more homopolymers than mitogenome regions not covered by delRNA. Further analyses of delRNAs show that the natural circular code X (a little-known group of 20 translational signals enabling ribosomal frame retrieval consisting of 20 codons {AAC, AAT, ACC, ATC, ATT, CAG, CTC, CTG, GAA, GAC, GAG, GAT, GCC, GGC, GGT, GTA, GTC, GTT, TAC, TTC} universally overrepresented in coding versus other frames of gene sequences), regulates frameshift in transcription and translation. This dual transcription and translation role confirms for X the hypothesis that translational signals were carried over from transcriptional signals.
Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki
2011-03-01
The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.
Minimap2: pairwise alignment for nucleotide sequences.
Li, Heng
2018-05-10
Recent advances in sequencing technologies promise ultra-long reads of ∼100 kilo bases (kb) in average, full-length mRNA or cDNA reads in high throughput and genomic contigs over 100 mega bases (Mb) in length. Existing alignment programs are unable or inefficient to process such data at scale, which presses for the development of new alignment algorithms. Minimap2 is a general-purpose alignment program to map DNA or long mRNA sequences against a large reference database. It works with accurate short reads of ≥ 100bp in length, ≥1kb genomic reads at error rate ∼15%, full-length noisy Direct RNA or cDNA reads, and assembly contigs or closely related full chromosomes of hundreds of megabases in length. Minimap2 does split-read alignment, employs concave gap cost for long insertions and deletions (INDELs) and introduces new heuristics to reduce spurious alignments. It is 3-4 times as fast as mainstream short-read mappers at comparable accuracy, and is ≥30 times faster than long-read genomic or cDNA mappers at higher accuracy, surpassing most aligners specialized in one type of alignment. https://github.com/lh3/minimap2. hengli@broadinstitute.org.
Diverse nucleotide compositions and sequence fluctuation in Rubisco protein genes
NASA Astrophysics Data System (ADS)
Holden, Todd; Dehipawala, S.; Cheung, E.; Bienaime, R.; Ye, J.; Tremberger, G., Jr.; Schneider, P.; Lieberman, D.; Cheung, T.
2011-10-01
The Rubisco protein-enzyme is arguably the most abundance protein on Earth. The biology dogma of transcription and translation necessitates the study of the Rubisco genes and Rubisco-like genes in various species. Stronger correlation of fractal dimension of the atomic number fluctuation along a DNA sequence with Shannon entropy has been observed in the studied Rubisco-like gene sequences, suggesting a more diverse evolutionary pressure and constraints in the Rubisco sequences. The strategy of using metal for structural stabilization appears to be an ancient mechanism, with data from the porphobilinogen deaminase gene in Capsaspora owczarzaki and Monosiga brevicollis. Using the chi-square distance probability, our analysis supports the conjecture that the more ancient Rubisco-like sequence in Microcystis aeruginosa would have experienced very different evolutionary pressure and bio-chemical constraint as compared to Bordetella bronchiseptica, the two microbes occupying either end of the correlation graph. Our exploratory study would indicate that high fractal dimension Rubisco sequence would support high carbon dioxide rate via the Michaelis- Menten coefficient; with implication for the control of the whooping cough pathogen Bordetella bronchiseptica, a microbe containing a high fractal dimension Rubisco-like sequence (2.07). Using the internal comparison of chi-square distance probability for 16S rRNA (~ E-22) versus radiation repair Rec-A gene (~ E-05) in high GC content Deinococcus radiodurans, our analysis supports the conjecture that high GC content microbes containing Rubisco-like sequence are likely to include an extra-terrestrial origin, relative to Deinococcus radiodurans. Similar photosynthesis process that could utilize host star radiation would not compete with radiation resistant process from the biology dogma perspective in environments such as Mars and exoplanets.
Sirena, Dominique; Ruzsics, Zsolt; Schaffner, Walter; Greber, Urs F; Hemmi, Silvio
2005-12-20
Human adenovirus (Ad) serotype 3 causes respiratory infections. It is considered highly virulent, accounting for about 13% of all Ad isolates. We report here the complete Ad3 DNA sequence of 35,343 base pairs (GenBank accession DQ086466). Ad3 shares 96.43% nucleotide identity with Ad7, another virulent subspecies B1 serotype, and 82.56 and 62.75% identity with the less virulent species B2 Ad11 and species C Ad5, respectively. The genomic organization of Ad3 is similar to the other human Ads comprising five early transcription units, E1A, E1B, E2, E3, and E4, two delayed early units IX and IVa2, and the major late unit, in total 39 putative and 7 hypothetical open reading frames. A recombinant E1-deleted Ad3 was generated on a bacterial artificial chromosome. This prototypic virus efficiently transduced CD46-positive rodent and human cells. Our results will help in clarifying the biology and pathology of adenoviruses and enhance therapeutic applications of viral vectors in clinical settings.
Ha, Wai Y; Reid, David G; Kam, Wan L; Lau, Yuk Y; Sham, Wing C; Tam, Silvia Y K; Sin, Della W M; Mok, Chuen S
2011-05-25
Abalones ( Haliotis species) are a popular delicacy and commonly preserved in dried form either whole or in slices or small pieces for consumption in Asian countries. Driven by the huge profit from trading abalones, dishonest traders may substitute other molluscan species for processed abalone, of which the morphological characteristics are frequently lost in the processed form. For protection of consumer rights and law enforcement against fraud, there is a need for an effective methodology to differentiate between fake and genuine abalone. This paper describes a method (validated according to the international forensic guidelines provided by SWGDAM) for the identification of fake abalone species using forensically informative nucleotide sequence (FINS) analysis. A study of the local market revealed that many claimed "abalone slice" samples on sale are not genuine. The fake abalone samples were found to be either volutids of the genus Cymbium (93%) or the muricid Concholepas concholepas (7%). This is the first report of Cymbium species being used for the preparation and sale as "abalone" in dried sliced form in Hong Kong.
Zn-metalloprotease sequences in extremophiles
NASA Astrophysics Data System (ADS)
Holden, T.; Dehipawala, S.; Golebiewska, U.; Cheung, E.; Tremberger, G., Jr.; Williams, E.; Schneider, P.; Gadura, N.; Lieberman, D.; Cheung, T.
2010-09-01
The Zn-metalloprotease family contains conserved amino acid structures such that the nucleotide fluctuation at the DNA level would exhibit correlated randomness as described by fractal dimension. A nucleotide sequence fractal dimension can be calculated from a numerical series consisting of the atomic numbers of each nucleotide. The structure's vibration modes can also be studied using a Gaussian Network Model. The vibration measure and fractal dimension values form a two-dimensional plot with a standard vector metric that can be used for comparison of structures. The preference for amino acid usage in extremophiles may suppress nucleotide fluctuations that could be analyzed in terms of fractal dimension and Shannon entropy. A protein level cold adaptation study of the thermolysin Zn-metalloprotease family using molecular dynamics simulation was reported recently and our results show that the associated nucleotide fluctuation suppression is consistent with a regression pattern generated from the sequences's fractal dimension and entropy values (R-square { 0.98, N =5). It was observed that cold adaptation selected for high entropy and low fractal dimension values. Extension to the Archaemetzincin M54 family in extremophiles reveals a similar regression pattern (R-square = 0.98, N = 6). It was observed that the metalloprotease sequences of extremely halophilic organisms possess high fractal dimension and low entropy values as compared with non-halophiles. The zinc atom is usually bonded to the histidine residue, which shows limited levels of vibration in the Gaussian Network Model. The variability of the fractal dimension and entropy for a given protein structure suggests that extremophiles would have evolved after mesophiles, consistent with the bias usage of non-prebiotic amino acids by extremophiles. It may be argued that extremophiles have the capacity to offer extinction protection during drastic changes in astrobiological environments.
Gallium plasmonic nanoparticles for label-free DNA and single nucleotide polymorphism sensing
NASA Astrophysics Data System (ADS)
Marín, Antonio García; García-Mendiola, Tania; Bernabeu, Cristina Navio; Hernández, María Jesús; Piqueras, Juan; Pau, Jose Luis; Pariente, Félix; Lorenzo, Encarnación
2016-05-01
A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells.A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori
Sequencing and phylogenetic analysis of tobacco virus 2, a polerovirus from Nicotiana tabacum.
Zhou, Benguo; Wang, Fang; Zhang, Xuesong; Zhang, Lina; Lin, Huafeng
2017-07-01
The complete genome sequence of a new virus, provisionally named tobacco virus 2 (TV2), was determined and identified from leaves of tobacco (Nicotiana tabacum) exhibiting leaf mosaic, yellowing, and deformity, in Anhui Province, China. The genome sequence of TV2 comprises 5,979 nucleotides, with 87% nucleotide sequence identity to potato leafroll virus (PLRV). Its genome organization is similar to that of PLRV, containing six open reading frames (ORFs) that potentially encode proteins with putative functions in cell-to-cell movement and suppression of RNA silencing. Phylogenetic analysis of the nucleotide sequence placed TV2 alongside members of the genus Polerovirus in the family Luteoviridae. To the best our knowledge, this study is the first report of a complete genome sequence of a new polerovirus identified in tobacco.
Gritsun, T S; Frolova, T V; Pogodina, V V; Lashkevich, V A; Venugopal, K; Gould, E A
1993-02-01
A strain of tick-borne encephalitis virus known as Vasilchenko (Vs) exhibits relatively low virulence characteristics in monkeys, Syrian hamsters and humans. The gene encoding the envelope glycoprotein of this virus was cloned and sequenced. Alignment of the sequence with those of other known tick-borne flaviviruses and identification of the recognised amino acid genetic marker EHLPTA confirmed its identity as a member of the TBE complex. However, Vs virus was distinguishable from eastern and western tick-borne serotypes by the presence of the sequence AQQ at amino acid positions 232-234 and also by the presence of other specific amino acid substitutions which may be genetic markers for these viruses and could determine their pathogenetic characteristics. When compared with other tick-borne flaviviruses, Vs virus had 12 unique amino acid substitutions including an additional potential glycosylation site at position (315-317). The Vs virus strain shared closest nucleotide and amino acid homology (84.5% and 95.5% respectively) with western and far eastern strains of tick-borne encephalitis virus. Comparison with the far eastern serotype of tick-borne encephalitis virus, by cross-immunoelectrophoresis of Vs virions and PAGE analysis of the extracted virion proteins, revealed differences in surface charge and virus stability that may account for the different virulence characteristics of Vs virus. These results support and enlarge upon previous data obtained from molecular and serological analysis.
Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P; Panitz, Frank; Bendixen, Christian; Nielsen, Rasmus; Willerslev, Eske
2007-02-14
The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources. We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences). Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis. We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%). Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial analyses
Dinant, S; Lot, H; Albouy, J; Kuziak, C; Meyer, M; Astier-Manifacier, S
1991-01-01
DNA complementary to the 3' terminal 1651 nucleotides of the genome of the common strain of lettuce mosaic virus (LMV-O) has been cloned and sequenced. Microsequencing of the N-terminus enabled localization of the coat protein gene in this sequence. It showed also that the LMV coat protein coding region is at the 3' end of the genome, and that the coat protein is processed from a larger protein by cleavage at an unusual Q/V dipeptide between the polymerase and the coat protein. This is the first report of such a site for cleavage of a potyvirus polyprotein, where only Q/A, Q/S, and Q/G cleavage sites have been reported. The LMV coat protein gene encodes a 278 amino acid polypeptide with a calculated Mr of 31,171 and is flanked by a region which has a high degree of homology with the putative polymerase and a 3' untranslated region of 211 nucleotides in length. Percentage of homology with the coat protein of other potyviruses confirms that LMV is a distinct member of this group. Moreover, amino acid homologies noticed with the coat protein of potexvirus, bymovirus, and carlavirus elongated plant viruses suggest a functional significance for the conserved domains.
Brandon Schlautman; Vera Pfeiffer; Juan Zalapa; Johanne Brunet
2014-01-01
Numerous microsatellite markers were developed for Aquilegia formosafrom sequences deposited within the Expressed Sequence Tag (EST), Genomic Survey Sequence (GSS), and Nucleotide databases in NCBI. Microsatellites (SSRs) were identified and primers were designed for 9 SSR containing sequences in the Nucleotide database, 3803 sequences in the EST...
USDA-ARS?s Scientific Manuscript database
Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...
Villahermosa, Desirée; Christensen, Olaf; Knapp, Karen; Fleck, Oliver
2017-01-01
Defective mismatch repair (MMR) in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6), which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1), which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3) recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes. PMID:28341698
Villahermosa, Desirée; Christensen, Olaf; Knapp, Karen; Fleck, Oliver
2017-05-05
Defective mismatch repair (MMR) in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6), which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1), which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3) recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade + reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2 FEN1 Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe , but contributes to DNA repeat stability in MMR-independent processes. Copyright © 2017 Villahermosa et al.
Tabler, M; Homann, M; Tzortzakaki, S; Sczakiel, G
1994-01-01
Trans-cleaving hammerhead ribozymes with long target-specific antisense sequences flanking the catalytic domain share some features with conventional antisense RNA and are therefore termed 'catalytic antisense RNAs'. Sequences 5' to the catalytic domain form helix I and sequences 3' to it form helix III when complexed with the target RNA. A catalytic antisense RNA of more than 400 nucleotides, and specific for the human immunodeficiency virus type 1 (HIV-1), was systematically truncated within the arm that constituted originally a helix I of 128 base pairs. The resulting ribozymes formed helices I of 13, 8, 5, 3, 2, 1 and 0 nucleotides, respectively, and a helix III of about 280 nucleotides. When their in vitro cleavage activity was compared with the original catalytic antisense RNA, it was found that a helix I of as little as three nucleotides was sufficient for full endonucleolytic activity. The catalytically active constructs inhibited HIV-1 replication about four-fold more effectively than the inactive ones when tested in human cells. A conventional hammerhead ribozyme having helices of just 8 nucleotides on either side failed to cleave the target RNA in vitro when tested under the conditions for catalytic antisense RNA. Cleavage activity could only be detected after heat-treatment of the ribozyme substrate mixture which indicates that hammerhead ribozymes with short arms do not associate as efficiently to the target RNA as catalytic antisense RNA. The requirement of just a three-nucleotide helix I allows simple PCR-based generation strategies for asymmetric hammerhead ribozymes. Advantages of an asymmetric design will be discussed. Images PMID:7937118
USDA-ARS?s Scientific Manuscript database
Polymorphic genetic markers were identified and characterized using a partial genomic library of Heliothis virescens enriched for simple sequence repeats (SSR) and nucleotide sequences of expressed sequence tags (EST). Nucleotide sequences of 192 clones from the partial genomic library yielded 147 u...
Image Encryption Algorithm Based on Hyperchaotic Maps and Nucleotide Sequences Database
2017-01-01
Image encryption technology is one of the main means to ensure the safety of image information. Using the characteristics of chaos, such as randomness, regularity, ergodicity, and initial value sensitiveness, combined with the unique space conformation of DNA molecules and their unique information storage and processing ability, an efficient method for image encryption based on the chaos theory and a DNA sequence database is proposed. In this paper, digital image encryption employs a process of transforming the image pixel gray value by using chaotic sequence scrambling image pixel location and establishing superchaotic mapping, which maps quaternary sequences and DNA sequences, and by combining with the logic of the transformation between DNA sequences. The bases are replaced under the displaced rules by using DNA coding in a certain number of iterations that are based on the enhanced quaternary hyperchaotic sequence; the sequence is generated by Chen chaos. The cipher feedback mode and chaos iteration are employed in the encryption process to enhance the confusion and diffusion properties of the algorithm. Theoretical analysis and experimental results show that the proposed scheme not only demonstrates excellent encryption but also effectively resists chosen-plaintext attack, statistical attack, and differential attack. PMID:28392799
Human somatostatin I: sequence of the cDNA.
Shen, L P; Pictet, R L; Rutter, W J
1982-01-01
RNA has been isolated from a human pancreatic somatostatinoma and used to prepare a cDNA library. After prescreening, clones containing somatostatin I sequences were identified by hybridization with an anglerfish somatostatin I-cloned cDNA probe. From the nucleotide sequence of two of these clones, we have deduced an essentially full-length mRNA sequence, including the preprosomatostatin coding region, 105 nucleotides from the 5' untranslated region and the complete 150-nucleotide 3' untranslated region. The coding region predicts a 116-amino acid precursor protein (Mr, 12.727) that contains somatostatin-14 and -28 at its COOH terminus. The predicted amino acid sequence of human somatostatin-28 is identical to that of somatostatin-28 isolated from the porcine and ovine species. A comparison of the amino acid sequences of human and anglerfish preprosomatostatin I indicated that the COOH-terminal region encoding somatostatin-14 and the adjacent 6 amino acids are highly conserved, whereas the remainder of the molecule, including the signal peptide region, is more divergent. However, many of the amino acid differences found in the pro region of the human and anglerfish proteins are conservative changes. This suggests that the propeptides have a similar secondary structure, which in turn may imply a biological function for this region of the molecule. Images PMID:6126875
USDA-ARS?s Scientific Manuscript database
Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...
Detection of possible restriction sites for type II restriction enzymes in DNA sequences.
Gagniuc, P; Cimponeriu, D; Ionescu-Tîrgovişte, C; Mihai, Andrada; Stavarachi, Monica; Mihai, T; Gavrilă, L
2011-01-01
In order to make a step forward in the knowledge of the mechanism operating in complex polygenic disorders such as diabetes and obesity, this paper proposes a new algorithm (PRSD -possible restriction site detection) and its implementation in Applied Genetics software. This software can be used for in silico detection of potential (hidden) recognition sites for endonucleases and for nucleotide repeats identification. The recognition sites for endonucleases may result from hidden sequences through deletion or insertion of a specific number of nucleotides. Tests were conducted on DNA sequences downloaded from NCBI servers using specific recognition sites for common type II restriction enzymes introduced in the software database (n = 126). Each possible recognition site indicated by the PRSD algorithm implemented in Applied Genetics was checked and confirmed by NEBcutter V2.0 and Webcutter 2.0 software. In the sequence NG_008724.1 (which includes 63632 nucleotides) we found a high number of potential restriction sites for ECO R1 that may be produced by deletion (n = 43 sites) or insertion (n = 591 sites) of one nucleotide. The second module of Applied Genetics has been designed to find simple repeats sizes with a real future in understanding the role of SNPs (Single Nucleotide Polymorphisms) in the pathogenesis of the complex metabolic disorders. We have tested the presence of simple repetitive sequences in five DNA sequence. The software indicated exact position of each repeats detected in the tested sequences. Future development of Applied Genetics can provide an alternative for powerful tools used to search for restriction sites or repetitive sequences or to improve genotyping methods.
Optimization of sequence alignment for simple sequence repeat regions.
Jighly, Abdulqader; Hamwieh, Aladdin; Ogbonnaya, Francis C
2011-07-20
Microsatellites, or simple sequence repeats (SSRs), are tandemly repeated DNA sequences, including tandem copies of specific sequences no longer than six bases, that are distributed in the genome. SSR has been used as a molecular marker because it is easy to detect and is used in a range of applications, including genetic diversity, genome mapping, and marker assisted selection. It is also very mutable because of slipping in the DNA polymerase during DNA replication. This unique mutation increases the insertion/deletion (INDELs) mutation frequency to a high ratio - more than other types of molecular markers such as single nucleotide polymorphism (SNPs).SNPs are more frequent than INDELs. Therefore, all designed algorithms for sequence alignment fit the vast majority of the genomic sequence without considering microsatellite regions, as unique sequences that require special consideration. The old algorithm is limited in its application because there are many overlaps between different repeat units which result in false evolutionary relationships. To overcome the limitation of the aligning algorithm when dealing with SSR loci, a new algorithm was developed using PERL script with a Tk graphical interface. This program is based on aligning sequences after determining the repeated units first, and the last SSR nucleotides positions. This results in a shifting process according to the inserted repeated unit type.When studying the phylogenic relations before and after applying the new algorithm, many differences in the trees were obtained by increasing the SSR length and complexity. However, less distance between different linage had been observed after applying the new algorithm. The new algorithm produces better estimates for aligning SSR loci because it reflects more reliable evolutionary relations between different linages. It reduces overlapping during SSR alignment, which results in a more realistic phylogenic relationship.
The complete sequence of Cymbidium mosaic virus from Vanilla fragrans in Hainan, China.
He, Zhen; Jiang, Dongmei; Liu, Aiqin; Sang, Liwei; Li, Wenfeng; Li, Shifang
2011-06-01
The complete nucleotide sequence of Cymbidium mosaic virus (CymMV) isolated from vanilla in Hainan province, China was determined for the first time. It comprised 6,224 nucleotides; sequence analysis suggested that the isolate we obtained was a member of the genus Potexvirus, and its sequence shared 86.67-96.61% identities with previously reported sequences. Phylogenetic analysis suggested that CymMV from vanilla fragrans was clustered into subgroup A and the isolates in this subgroup displayed little regional difference.
Sequence-specific bias correction for RNA-seq data using recurrent neural networks.
Zhang, Yao-Zhong; Yamaguchi, Rui; Imoto, Seiya; Miyano, Satoru
2017-01-25
The recent success of deep learning techniques in machine learning and artificial intelligence has stimulated a great deal of interest among bioinformaticians, who now wish to bring the power of deep learning to bare on a host of bioinformatical problems. Deep learning is ideally suited for biological problems that require automatic or hierarchical feature representation for biological data when prior knowledge is limited. In this work, we address the sequence-specific bias correction problem for RNA-seq data redusing Recurrent Neural Networks (RNNs) to model nucleotide sequences without pre-determining sequence structures. The sequence-specific bias of a read is then calculated based on the sequence probabilities estimated by RNNs, and used in the estimation of gene abundance. We explore the application of two popular RNN recurrent units for this task and demonstrate that RNN-based approaches provide a flexible way to model nucleotide sequences without knowledge of predetermined sequence structures. Our experiments show that training a RNN-based nucleotide sequence model is efficient and RNN-based bias correction methods compare well with the-state-of-the-art sequence-specific bias correction method on the commonly used MAQC-III data set. RNNs provides an alternative and flexible way to calculate sequence-specific bias without explicitly pre-determining sequence structures.
Brütting, Christine; Emmer, Alexander; Kornhuber, Malte; Staege, Martin S
2016-08-01
Although multiple sclerosis (MS) is one of the most common central nervous system diseases in young adults, little is known about its etiology. Several human endogenous retroviruses (ERVs) are considered to play a role in MS. We are interested in which ERVs can be identified in the vicinity of MS associated genetic marker to find potential initiators of MS. We analysed the chromosomal regions surrounding 58 single nucleotide polymorphisms (SNPs) that are associated with MS identified in one of the last major genome wide association studies. We scanned these regions for putative endogenous retrovirus sequences with large open reading frames (ORFs). We observed that more retrovirus-related putative ORFs exist in the relatively close vicinity of SNP marker indices in multiple sclerosis compared to control SNPs. We found very high homologies to HERV-K, HCML-ARV, XMRV, Galidia ERV, HERV-H/env62 and XMRV-like mouse endogenous retrovirus mERV-XL. The associated genes (CYP27B1, CD6, CD58, MPV17L2, IL12RB1, CXCR5, PTGER4, TAGAP, TYK2, ICAM3, CD86, GALC, GPR65 as well as the HLA DRB1*1501) are mainly involved in the immune system, but also in vitamin D regulation. The most frequently detected ERV sequences are related to the multiple sclerosis-associated retrovirus, the human immunodeficiency virus 1, HERV-K, and the Simian foamy virus. Our data shows that there is a relation between MS associated SNPs and the number of retroviral elements compared to control. Our data identifies new ERV sequences that have not been associated with MS, so far.
Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes
USDA-ARS?s Scientific Manuscript database
Technical Abstract: 20-75 CHARACTER LINES A strategy for a genome-wide assessment of nucleotide diversity in a polyploid species must minimize the inclusion of homoeologous sequences into diversity estimates and reliably allocate individual haplotypes into respective genomes. In this study, nucle...
Sigalotti, Luca; Fratta, Elisabetta; Bidoli, Ettore; Covre, Alessia; Parisi, Giulia; Colizzi, Francesca; Coral, Sandra; Massarut, Samuele; Kirkwood, John M; Maio, Michele
2011-05-26
The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients.
2011-01-01
Background The prognosis of cutaneous melanoma (CM) differs for patients with identical clinico-pathological stage, and no molecular markers discriminating the prognosis of stage III individuals have been established. Genome-wide alterations in DNA methylation are a common event in cancer. This study aimed to define the prognostic value of genomic DNA methylation levels in stage III CM patients. Methods Overall level of genomic DNA methylation was measured using bisulfite pyrosequencing at three CpG sites (CpG1, CpG2, CpG3) of the Long Interspersed Nucleotide Element-1 (LINE-1) sequences in short-term CM cultures from 42 stage IIIC patients. The impact of LINE-1 methylation on overall survival (OS) was assessed using Cox regression and Kaplan-Meier analysis. Results Hypomethylation (i.e., methylation below median) at CpG2 and CpG3 sites significantly associated with improved prognosis of CM, CpG3 showing the strongest association. Patients with hypomethylated CpG3 had increased OS (P = 0.01, log-rank = 6.39) by Kaplan-Meyer analysis. Median OS of patients with hypomethylated or hypermethylated CpG3 were 31.9 and 11.5 months, respectively. The 5 year OS for patients with hypomethylated CpG3 was 48% compared to 7% for patients with hypermethylated sequences. Among the variables examined by Cox regression analysis, LINE-1 methylation at CpG2 and CpG3 was the only predictor of OS (Hazard Ratio = 2.63, for hypermethylated CpG3; 95% Confidence Interval: 1.21-5.69; P = 0.01). Conclusion LINE-1 methylation is identified as a molecular marker of prognosis for CM patients in stage IIIC. Evaluation of LINE-1 promises to represent a key tool for driving the most appropriate clinical management of stage III CM patients. PMID:21615918
Base Preferences in Non-Templated Nucleotide Incorporation by MMLV-Derived Reverse Transcriptases
Zajac, Pawel; Islam, Saiful; Hochgerner, Hannah; Lönnerberg, Peter; Linnarsson, Sten
2013-01-01
Reverse transcriptases derived from Moloney Murine Leukemia Virus (MMLV) have an intrinsic terminal transferase activity, which causes the addition of a few non-templated nucleotides at the 3´ end of cDNA, with a preference for cytosine. This mechanism can be exploited to make the reverse transcriptase switch template from the RNA molecule to a secondary oligonucleotide during first-strand cDNA synthesis, and thereby to introduce arbitrary barcode or adaptor sequences in the cDNA. Because the mechanism is relatively efficient and occurs in a single reaction, it has recently found use in several protocols for single-cell RNA sequencing. However, the base preference of the terminal transferase activity is not known in detail, which may lead to inefficiencies in template switching when starting from tiny amounts of mRNA. Here, we used fully degenerate oligos to determine the exact base preference at the template switching site up to a distance of ten nucleotides. We found a strong preference for guanosine at the first non-templated nucleotide, with a greatly reduced bias at progressively more distant positions. Based on this result, and a number of careful optimizations, we report conditions for efficient template switching for cDNA amplification from single cells. PMID:24392002
Stafuzza, Nedenia Bonvino; Zerlotini, Adhemar; Lobo, Francisco Pereira; Yamagishi, Michel Eduardo Beleza; Chud, Tatiane Cristina Seleguim; Caetano, Alexandre Rodrigues; Munari, Danísio Prado; Garrick, Dorian J; Machado, Marco Antonio; Martins, Marta Fonseca; Carvalho, Maria Raquel; Cole, John Bruce; Barbosa da Silva, Marcos Vinicius Gualberto
2017-01-01
Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose), Gyr, Girolando and Holstein (dairy production). A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs) and 3,828,041 insertions/deletions (InDels) were detected in the samples, of which 2,557,670 SNVs and 883,219 InDels were novel. The submission of these genetic variants to the dbSNP database significantly increased the number of known variants, particularly for the indicine genome. The concordance rate between genotypes obtained using the Bovine HD BeadChip array and the same variants identified by sequencing was about 99.05%. The annotation of variants identified numerous non-synonymous SNVs and frameshift InDels which could affect phenotypic variation. Functional enrichment analysis was performed and revealed that variants in the olfactory transduction pathway was over represented in all four cattle breeds, while the ECM-receptor interaction pathway was over represented in Girolando and Guzerat breeds, the ABC transporters pathway was over represented only in Holstein breed, and the metabolic pathways was over represented only in Gyr breed. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Gyr, Girolando, Guzerat and Holstein breeding programs.
Lobo, Francisco Pereira; Yamagishi, Michel Eduardo Beleza; Chud, Tatiane Cristina Seleguim; Caetano, Alexandre Rodrigues; Munari, Danísio Prado; Garrick, Dorian J.; Machado, Marco Antonio; Martins, Marta Fonseca; Carvalho, Maria Raquel; Cole, John Bruce; Barbosa da Silva, Marcos Vinicius Gualberto
2017-01-01
Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose), Gyr, Girolando and Holstein (dairy production). A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs) and 3,828,041 insertions/deletions (InDels) were detected in the samples, of which 2,557,670 SNVs and 883,219 InDels were novel. The submission of these genetic variants to the dbSNP database significantly increased the number of known variants, particularly for the indicine genome. The concordance rate between genotypes obtained using the Bovine HD BeadChip array and the same variants identified by sequencing was about 99.05%. The annotation of variants identified numerous non-synonymous SNVs and frameshift InDels which could affect phenotypic variation. Functional enrichment analysis was performed and revealed that variants in the olfactory transduction pathway was over represented in all four cattle breeds, while the ECM-receptor interaction pathway was over represented in Girolando and Guzerat breeds, the ABC transporters pathway was over represented only in Holstein breed, and the metabolic pathways was over represented only in Gyr breed. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Gyr, Girolando, Guzerat and Holstein breeding programs. PMID:28323836
Genome sequences of a mouse-avirulent and a mouse-virulent strain of Ross River virus.
Faragher, S G; Meek, A D; Rice, C M; Dalgarno, L
1988-04-01
The nucleotide sequence of the genomic RNA of a mouse-avirulent strain of Ross River virus, RRV NB5092 (isolated in 1969), has been determined and the corresponding sequence for the prototype mouse-virulent strain, RRV T48 (isolated in 1959), has been completed. The RRV NB5092 genome is approximately 11,674 nucleotides in length, compared with 11,853 nucleotides for RRV T48. RRV NB5092 and RRV T48 have the same genome organization. For both viruses an untranslated region of 80 nucleotides at the 5' end of the genome is followed by a 7440-nucleotide open reading frame which is interrupted after 5586 nucleotides by a single opal termination codon. By homology with other alphaviruses, the 5586-nucleotide open reading frame encodes the nonstructural proteins nsP1, nsP2, and nsP3; a fourth nonstructural protein, nsP4, is produced by read-through of the opal codon. The RRV nonstructural proteins show strong homology with the corresponding proteins of Sindbis virus and Semliki Forest virus in terms of size, net charge, and hydropathy characteristics. However, homology is not uniform between or within the proteins; nsP1, nsP2, and nsP4 contain extended domains which are highly conserved between alphaviruses, while the C-terminal region of nsP3 shows little conservation in sequence or length between alphaviruses. An untranslated "junction" region of 44 nucleotides (for RRV NB5092) or 47 nucleotides (for RRV T48) separates the nonstructural and structural protein coding regions. The structural proteins (capsid-E3-E2-6K-E1) are translated from an open reading frame of 3762 nucleotides which is followed by a 3'-untranslated region of approximately 348 nucleotides (for RRV NB5092) or 524 nucleotides (for RRV T48). Excluding deletions and insertions, the genomes of RRV NB5092 and RRV T48 differ at 284 nucleotides, representing a sequence divergence of 2.38%. Sequence deletions or insertions were found only in the noncoding regions and include a 173-nucleotide deletion in the 3
Sequence variation and phylogenetic analysis of envelope glycoprotein of hepatitis G virus.
Lim, M Y; Fry, K; Yun, A; Chong, S; Linnen, J; Fung, K; Kim, J P
1997-11-01
A transfusion-transmissible agent provisionally designated hepatitis G virus (HGV) was recently identified. In this study, we examined the variability of the HGV genome by analysing sequences in the putative envelope region from 72 isolates obtained from diverse geographical sources. The 1561 nucleotide sequence of the E1/E2/NS2a region of HGV was determined from 12 isolates, and compared with three published sequences. The most variability was observed in 400 nucleotides at the N terminus of E2. We next analysed this 400 nucleotide envelope variable region (EV) from an additional 60 HGV isolates. This sequence varied considerably among the 75 isolates, with overall identity ranging from 79.3% to 99.5% at the nucleotide level, and from 83.5% to 100% at the amino acid level. However, hypervariable regions were not identified. Phylogenetic analyses indicated that the 75 HGV isolates belong to a single genotype. A single-tier distribution of evolutionary distances was observed among the 15 E1/E2/NS2a sequences and the 75 EV sequences. In contrast, 11 isolates of HCV were analysed and showed a three-tiered distribution, representing genotypes, subtypes, and isolates. The 75 isolates of HGV fell into four clusters on the phylogenetic tree. Tight geographical clustering was observed among the HGV isolates from Japan and Korea.
Using expected sequence features to improve basecalling accuracy of amplicon pyrosequencing data.
Rask, Thomas S; Petersen, Bent; Chen, Donald S; Day, Karen P; Pedersen, Anders Gorm
2016-04-22
Amplicon pyrosequencing targets a known genetic region and thus inherently produces reads highly anticipated to have certain features, such as conserved nucleotide sequence, and in the case of protein coding DNA, an open reading frame. Pyrosequencing errors, consisting mainly of nucleotide insertions and deletions, are on the other hand likely to disrupt open reading frames. Such an inverse relationship between errors and expectation based on prior knowledge can be used advantageously to guide the process known as basecalling, i.e. the inference of nucleotide sequence from raw sequencing data. The new basecalling method described here, named Multipass, implements a probabilistic framework for working with the raw flowgrams obtained by pyrosequencing. For each sequence variant Multipass calculates the likelihood and nucleotide sequence of several most likely sequences given the flowgram data. This probabilistic approach enables integration of basecalling into a larger model where other parameters can be incorporated, such as the likelihood for observing a full-length open reading frame at the targeted region. We apply the method to 454 amplicon pyrosequencing data obtained from a malaria virulence gene family, where Multipass generates 20 % more error-free sequences than current state of the art methods, and provides sequence characteristics that allow generation of a set of high confidence error-free sequences. This novel method can be used to increase accuracy of existing and future amplicon sequencing data, particularly where extensive prior knowledge is available about the obtained sequences, for example in analysis of the immunoglobulin VDJ region where Multipass can be combined with a model for the known recombining germline genes. Multipass is available for Roche 454 data at http://www.cbs.dtu.dk/services/MultiPass-1.0 , and the concept can potentially be implemented for other sequencing technologies as well.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ghosh, S.S.; Fahy, E.; Bodis-Wollner, I.
1996-02-01
Nucleotide-sequencing and multiplexed primer-extension assays have been used to quantitate the mutant-allele frequency in 14 maternal relatives, spanning three generations, from a family that is heteroplasmic for the primary Leber hereditary optic neuropathy (LHON) mutation at nucleotide 3460 of the mitochondrial genome. There was excellent agreement between the values that were obtained with the two different methods. The longitudinal study shows that the mutant-allele frequency was constant within individual family members over a sampling period of 3.5 years. Second, although there was an overall increase in the mutant-allele frequency in successive generations, segregation in the direction of the mutant allelemore » was not invariant, and there was one instance in which there was a significant decrease in the frequency from parent to offspring. From these two sets of results, and from previous studies of heteroplasmic LHON families, we conclude that there is no evidence for a marked selective pressure that determines the replication, segregation, or transmission of primary LHON mutations to white blood cells and platelets. Instead, the mtDNA molecules are most likely to replicate and segregate under conditions of random drift at the cellular level. Finally, the pattern of transmission in this maternal lineage is compatible with a developmental bottleneck model in which the number of mitochondrial units of segregation in the female germ line is relatively small in relation to the number of mtDNA molecules within a cell. However, this is not an invariant pattern for humans, and simple models of mitochondrial gene transmission are inappropriate at the present time. 37 refs., 4 figs., 1 tab.« less
Shi, Ainong; Qin, Jun; Mou, Beiquan; Correll, James; Weng, Yuejin; Brenner, David; Feng, Chunda; Motes, Dennis; Yang, Wei; Dong, Lingdi; Bhattarai, Gehendra; Ravelombola, Waltram
2017-01-01
Spinach (Spinacia oleracea L., 2n = 2x = 12) is an economically important vegetable crop worldwide and one of the healthiest vegetables due to its high concentrations of nutrients and minerals. The objective of this research was to conduct genetic diversity and population structure analysis of a collection of world-wide spinach genotypes using single nucleotide polymorphisms (SNPs) markers. Genotyping by sequencing (GBS) was used to discover SNPs in spinach genotypes. Three sets of spinach genotypes were used: 1) 268 USDA GRIN spinach germplasm accessions originally collected from 30 countries; 2) 45 commercial spinach F1 hybrids from three countries; and 3) 30 US Arkansas spinach cultivars/breeding lines. The results from this study indicated that there was genetic diversity among the 343 spinach genotypes tested. Furthermore, the genetic background in improved commercial F1 hybrids and in Arkansas cultivars/lines had a different structured populations from the USDA germplasm. In addition, the genetic diversity and population structures were associated with geographic origin and germplasm from the US Arkansas breeding program had a unique genetic background. These data could provide genetic diversity information and the molecular markers for selecting parents in spinach breeding programs.
Qin, Jun; Mou, Beiquan; Correll, James; Weng, Yuejin; Brenner, David; Feng, Chunda; Motes, Dennis; Yang, Wei; Dong, Lingdi; Bhattarai, Gehendra; Ravelombola, Waltram
2017-01-01
Spinach (Spinacia oleracea L., 2n = 2x = 12) is an economically important vegetable crop worldwide and one of the healthiest vegetables due to its high concentrations of nutrients and minerals. The objective of this research was to conduct genetic diversity and population structure analysis of a collection of world-wide spinach genotypes using single nucleotide polymorphisms (SNPs) markers. Genotyping by sequencing (GBS) was used to discover SNPs in spinach genotypes. Three sets of spinach genotypes were used: 1) 268 USDA GRIN spinach germplasm accessions originally collected from 30 countries; 2) 45 commercial spinach F1 hybrids from three countries; and 3) 30 US Arkansas spinach cultivars/breeding lines. The results from this study indicated that there was genetic diversity among the 343 spinach genotypes tested. Furthermore, the genetic background in improved commercial F1 hybrids and in Arkansas cultivars/lines had a different structured populations from the USDA germplasm. In addition, the genetic diversity and population structures were associated with geographic origin and germplasm from the US Arkansas breeding program had a unique genetic background. These data could provide genetic diversity information and the molecular markers for selecting parents in spinach breeding programs. PMID:29190770
DNA Sequence-Dependent Ionic Currents in Ultra-Small Solid-State Nanopores†
Comer, Jeffrey
2016-01-01
Measurements of ionic currents through nanopores partially blocked by DNA have emerged as a powerful method for characterization of the DNA nucleotide sequence. Although the effect of the nucleotide sequence on the nanopore blockade current has been experimentally demonstrated, prediction and interpretation of such measurements remain a formidable challenge. Using atomic resolution computational approaches, here we show how the sequence, molecular conformation, and pore geometry affect the blockade ionic current in model solid-state nanopores. We demonstrate that the blockade current from a DNA molecule is determined by the chemical identities and conformations of at least three consecutive nucleotides. We find the blockade currents produced by the nucleotide triplets to vary considerably with their nucleotide sequence despite having nearly identical molecular conformations. Encouragingly, we find blockade current differences as large as 25% for single-base substitutions in ultra small (1.6 nm × 1.1 nm cross section; 2 nm length) solid-state nanopores. Despite the complex dependence of the blockade current on the sequence and conformation of the DNA triplets, we find that, under many conditions, the number of thymine bases is positively correlated with the current, whereas the number of purine bases and the presence of both purine and pyrimidines in the triplet are negatively correlated with the current. Based on these observations, we construct a simple theoretical model that relates the ion current to the base content of a solid-state nanopore. Furthermore, we show that compact conformations of DNA in narrow pores provide the greatest signal-to-noise ratio for single base detection, whereas reduction of the nanopore length increases the ionic current noise. Thus, the sequence dependence of nanopore blockade current can be theoretically rationalized, although the predictions will likely need to be customized for each nanopore type. PMID:27103233
Solution to a gene divergence problem under arbitrary stable nucleotide transition probabilities
NASA Technical Reports Server (NTRS)
Holmquist, R.
1976-01-01
A nucleic acid chain, L nucleotides in length, with the specific base sequence B(1)B(2) ... B(L) is defined by the L-dimensional vector B = (B(1), B(2), ..., B(L)). For twelve given constant non-negative transition probabilities that, in a specified position, the base B is replaced by the base B' in a single step, an exact analytical expression is derived for the probability that the position goes from base B to B' in X steps. Assuming that each base mutates independently of the others, an exact expression is derived for the probability that the initial gene sequence B goes to a sequence B' = (B'(1), B'(2), ..., B'(L)) after X = (X(1), X(2), ..., X(L)) base replacements. The resulting equations allow a more precise accounting for the effects of Darwinian natural selection in molecular evolution than does the idealized (biologically less accurate) assumption that each of the four nucleotides is equally likely to mutate to and be fixed as one of the other three. Illustrative applications of the theory to some problems of biological evolution are given.
NASA Astrophysics Data System (ADS)
Xie, Xian-Hua; Yu, Zu-Guo; Ma, Yuan-Lin; Han, Guo-Sheng; Anh, Vo
2017-09-01
There has been a growing interest in visualization of metagenomic data. The present study focuses on the visualization of metagenomic data using inter-nucleotide distances profile. We first convert the fragment sequences into inter-nucleotide distances profiles. Then we analyze these profiles by principal component analysis. Finally the principal components are used to obtain the 2-D scattered plot according to their source of species. We name our method as inter-nucleotide distances profiles (INP) method. Our method is evaluated on three benchmark data sets used in previous published papers. Our results demonstrate that the INP method is good, alternative and efficient for visualization of metagenomic data.
An extended sequence specificity for UV-induced DNA damage.
Chung, Long H; Murray, Vincent
2018-01-01
The sequence specificity of UV-induced DNA damage was determined with a higher precision and accuracy than previously reported. UV light induces two major damage adducts: cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). Employing capillary electrophoresis with laser-induced fluorescence and taking advantages of the distinct properties of the CPDs and 6-4PPs, we studied the sequence specificity of UV-induced DNA damage in a purified DNA sequence using two approaches: end-labelling and a polymerase stop/linear amplification assay. A mitochondrial DNA sequence that contained a random nucleotide composition was employed as the target DNA sequence. With previous methodology, the UV sequence specificity was determined at a dinucleotide or trinucleotide level; however, in this paper, we have extended the UV sequence specificity to a hexanucleotide level. With the end-labelling technique (for 6-4PPs), the consensus sequence was found to be 5'-GCTC*AC (where C* is the breakage site); while with the linear amplification procedure, it was 5'-TCTT*AC. With end-labelling, the dinucleotide frequency of occurrence was highest for 5'-TC*, 5'-TT* and 5'-CC*; whereas it was 5'-TT* for linear amplification. The influence of neighbouring nucleotides on the degree of UV-induced DNA damage was also examined. The core sequences consisted of pyrimidine nucleotides 5'-CTC* and 5'-CTT* while an A at position "1" and C at position "2" enhanced UV-induced DNA damage. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.
Dimeric PROP1 binding to diverse palindromic TAAT sequences promotes its transcriptional activity.
Nakayama, Michie; Kato, Takako; Susa, Takao; Sano, Akiko; Kitahara, Kousuke; Kato, Yukio
2009-08-13
Mutations in the Prop1 gene are responsible for murine Ames dwarfism and human combined pituitary hormone deficiency with hypogonadism. Recently, we reported that PROP1 is a possible transcription factor for gonadotropin subunit genes through plural cis-acting sites composed of AT-rich sequences containing a TAAT motif which differs from its consensus binding sequence known as PRDQ9 (TAATTGAATTA). This study aimed to verify the binding specificity and sequence of PROP1 by applying the method of SELEX (Systematic Evolution of Ligands by EXponential enrichment), EMSA (electrophoretic mobility shift assay) and transient transfection assay. SELEX, after 5, 7 and 9 generations of selection using a random sequence library, showed that nucleotides containing one or two TAAT motifs were accumulated and accounted for 98.5% at the 9th generation. Aligned sequences and EMSA demonstrated that PROP1 binds preferentially to 11 nucleotides composed of an inverted TAAT motif separated by 3 nucleotides with variation in the half site of palindromic TAAT motifs and with preferential requirement of T at the nucleotide number 5 immediately 3' to a TAAT motif. Transient transfection assay demonstrated first that dimeric binding of PROP1 to an inverted TAAT motif and its cognates resulted in transcriptional activation, whereas monomeric binding of PROP1 to a single TAAT motif and an inverted ATTA motif did not mediate activation. Thus, this study demonstrated that dimeric binding of PROP1 is able to recognize diverse palindromic TAAT sequences separated by 3 nucleotides and to exhibit its transcriptional activity.
Major, Peter; Embley, T. Martin
2017-01-01
Plasma membrane-located nucleotide transport proteins (NTTs) underpin the lifestyle of important obligate intracellular bacterial and eukaryotic pathogens by importing energy and nucleotides from infected host cells that the pathogens can no longer make for themselves. As such their presence is often seen as a hallmark of an intracellular lifestyle associated with reductive genome evolution and loss of primary biosynthetic pathways. Here, we investigate the phylogenetic distribution of NTT sequences across the domains of cellular life. Our analysis reveals an unexpectedly broad distribution of NTT genes in both host-associated and free-living prokaryotes and eukaryotes. We also identify cases of within-bacteria and bacteria-to-eukaryote horizontal NTT transfer, including into the base of the oomycetes, a major clade of parasitic eukaryotes. In addition to identifying sequences that retain the canonical NTT structure, we detected NTT gene fusions with HEAT-repeat and cyclic nucleotide binding domains in Cyanobacteria, pathogenic Chlamydiae and Oomycetes. Our results suggest that NTTs are versatile functional modules with a much wider distribution and a broader range of potential roles than has previously been appreciated. PMID:28164241
Fukumori, F; Saint, C P
1997-01-01
A 9,233-bp HindIII fragment of the aromatic amine catabolic plasmid pTDN1, isolated from a derivative of Pseudomonas putida mt-2 (UCC22), confers the ability to degrade aniline on P. putida KT2442. The fragment encodes six open reading frames which are arranged in the same direction. Their 5' upstream region is part of the direct-repeat sequence of pTDN1. Nucleotide sequence of 1.8 kb of the repeat sequence revealed only a single base pair change compared to the known sequence of IS1071 which is involved in the transposition of the chlorobenzoate genes (C. Nakatsu, J. Ng, R. Singh, N. Straus, and C. Wyndham, Proc. Natl. Acad. Sci. USA 88:8312-8316, 1991). Four open reading frames encode proteins with considerable homology to proteins found in other aromatic-compound degradation pathways. On the basis of sequence similarity, these genes are proposed to encode the large and small subunits of aniline oxygenase (tdnA1 and tdnA2, respectively), a reductase (tdnB), and a LysR-type regulatory gene (tdnR). The putative large subunit has a conserved [2Fe-2S]R Rieske-type ligand center. Two genes, tdnQ and tdnT, which may be involved in amino group transfer, are localized upstream of the putative oxygenase genes. The tdnQ gene product shares about 30% similarity with glutamine synthetases; however, a pUC-based plasmid carrying tdnQ did not support the growth of an Escherichia coli glnA strain in the absence of glutamine. TdnT possesses domains that are conserved among amidotransferases. The tdnQ, tdnA1, tdnA2, tdnB, and tdnR genes are essential for the conversion of aniline to catechol. PMID:8990291
Ma, X X; Feng, Y P; Gu, Y X; Zhou, J H; Ma, Z R
2016-06-01
As for the alternative AUGs in foot-and-mouth disease virus (FMDV), nucleotide bias of the context flanking the AUG(2nd) could be used as a strong signal to initiate translation. To determine the role of the specific nucleotide context, dicistronic reporter constructs were engineered to contain different versions of nucleotide context linking between internal ribosome entry site (IRES) and downstream gene. The results indicate that under FMDV IRES-dependent mechanism, the nucleotide contexts flanking start codon can influence the translation initiation efficiencies. The most optimal sequences for both start codons have proved to be UUU AUG(1st) AAC and AAG AUG(2nd) GAA.
Trento, Alfonsina; Viegas, Mariana; Galiano, Mónica; Videla, Cristina; Carballal, Guadalupe; Mistchenko, Alicia S.; Melero, José A.
2006-01-01
A total of 47 clinical samples were identified during an active surveillance program of respiratory infections in Buenos Aires (BA) (1999 to 2004) that contained sequences of human respiratory syncytial virus (HRSV) with a 60-nucleotide duplication in the attachment (G) protein gene. This duplication was analogous to that previously described for other three viruses also isolated in Buenos Aires in 1999 (A. Trento et al., J. Gen. Virol. 84:3115-3120, 2003). Phylogenetic analysis indicated that BA sequences with that duplication shared a common ancestor (dated about 1998) with other HRSV G sequences reported worldwide after 1999. The duplicated nucleotide sequence was an exact copy of the preceding 60 nucleotides in early viruses, but both copies of the duplicated segment accumulated nucleotide substitutions in more recent viruses at a rate apparently higher than in other regions of the G protein gene. The evolution of the viruses with the duplicated G segment apparently followed the overall evolutionary pattern previously described for HRSV, and this genotype has replaced other prevailing antigenic group B genotypes in Buenos Aires and other places. Thus, the duplicated segment represents a natural tag that can be used to track the dissemination and evolution of HRSV in an unprecedented setting. We have taken advantage of this situation to reexamine the molecular epidemiology of HRSV and to explore the natural history of this important human pathogen. PMID:16378999
The EBI search engine: EBI search as a service-making biological data accessible for all.
Park, Young M; Squizzato, Silvano; Buso, Nicola; Gur, Tamer; Lopez, Rodrigo
2017-07-03
We present an update of the EBI Search engine, an easy-to-use fast text search and indexing system with powerful data navigation and retrieval capabilities. The interconnectivity that exists between data resources at EMBL-EBI provides easy, quick and precise navigation and a better understanding of the relationship between different data types that include nucleotide and protein sequences, genes, gene products, proteins, protein domains, protein families, enzymes and macromolecular structures, as well as the life science literature. EBI Search provides a powerful RESTful API that enables its integration into third-party portals, thus providing 'Search as a Service' capabilities, which are the main topic of this article. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Chemical Space Mapping and Structure-Activity Analysis of the ChEMBL Antiviral Compound Set.
Klimenko, Kyrylo; Marcou, Gilles; Horvath, Dragos; Varnek, Alexandre
2016-08-22
Curation, standardization and data fusion of the antiviral information present in the ChEMBL public database led to the definition of a robust data set, providing an association of antiviral compounds to seven broadly defined antiviral activity classes. Generative topographic mapping (GTM) subjected to evolutionary tuning was then used to produce maps of the antiviral chemical space, providing an optimal separation of compound families associated with the different antiviral classes. The ability to pinpoint the specific spots occupied (responsibility patterns) on a map by various classes of antiviral compounds opened the way for a GTM-supported search for privileged structural motifs, typical for each antiviral class. The privileged locations of antiviral classes were analyzed in order to highlight underlying privileged common structural motifs. Unlike in classical medicinal chemistry, where privileged structures are, almost always, predefined scaffolds, privileged structural motif detection based on GTM responsibility patterns has the decisive advantage of being able to automatically capture the nature ("resolution detail"-scaffold, detailed substructure, pharmacophore pattern, etc.) of the relevant structural motifs. Responsibility patterns were found to represent underlying structural motifs of various natures-from very fuzzy (groups of various "interchangeable" similar scaffolds), to the classical scenario in medicinal chemistry (underlying motif actually being the scaffold), to very precisely defined motifs (specifically substituted scaffolds).
Adenovirus sequences required for replication in vivo.
Wang, K; Pearson, G D
1985-01-01
We have studied the in vivo replication properties of plasmids carrying deletion mutations within cloned adenovirus terminal sequences. Deletion mapping located the adenovirus DNA replication origin entirely within the first 67 bp of the adenovirus inverted terminal repeat. This region could be further subdivided into two functional domains: a minimal replication origin and an adjacent auxillary region which boosted the efficiency of replication by more than 100-fold. The minimal origin occupies the first 18 to 21 bp and includes sequences conserved between all adenovirus serotypes. The adjacent auxillary region extends past nucleotide 36 but not past nucleotide 67 and contains the binding site for nuclear factor I. Images PMID:2991857
Benne, R; De Vries, B F; Van den Burg, J; Klaver, B
1983-01-01
The nucleotide sequence of a 2.5-kb segment of the maxi-circle of Trypanosoma brucei mtDNA has been determined. The segment contains the gene for apocytochrome b, which displays about 25% homology at the amino acid level to the apocytochrome b gene from fungal and mammalian mtDNAs. Northern blot and S1 nuclease analyses have yielded accurate map positions of an RNA species in an area that coincides with the reading frame. The segment also contains two pairs of overlapping unassigned reading frames, which lack homology with any known mitochondrial gene or URF. The DNA sequence in these areas is AG-rich (70%), resulting in URFs with an unusually high level of glycine and charged amino acids (60%). They may not encode proteins, in spite of their size and the fact that abundant transcripts are mapped in these areas. Images PMID:6314266
Sampson, Juliana K.; Sheth, Nihar U.; Koparde, Vishal N.; Scalora, Allison F.; Serrano, Myrna G.; Lee, Vladimir; Roberts, Catherine H.; Jameson-Lee, Max; Ferreira-Gonzalez, Andrea; Manjili, Masoud H.; Buck, Gregory A.; Neale, Michael C.; Toor, Amir A.
2016-01-01
Summary Whole exome sequencing (WES) was performed on stem cell transplant donor-recipient (D-R) pairs to determine the extent of potential antigenic variation at a molecular level. In a small cohort of D-R pairs, a high frequency of sequence variation was observed between the donor and recipient exomes independent of human leucocyte antigen (HLA) matching. Nonsynonymous, nonconservative single nucleotide polymorphisms were approximately twice as frequent in HLA-matched unrelated, compared with related D-R pairs. When mapped to individual chromosomes, these polymorphic nucleotides were uniformly distributed across the entire exome. In conclusion, WES reveals extensive nucleotide sequence variation in the exomes of HLA-matched donors and recipients. PMID:24749631
Sounds of silence: synonymous nucleotides as a key to biological regulation and complexity
Shabalina, Svetlana A.; Spiridonov, Nikolay A.; Kashina, Anna
2013-01-01
Messenger RNA is a key component of an intricate regulatory network of its own. It accommodates numerous nucleotide signals that overlap protein coding sequences and are responsible for multiple levels of regulation and generation of biological complexity. A wealth of structural and regulatory information, which mRNA carries in addition to the encoded amino acid sequence, raises the question of how these signals and overlapping codes are delineated along non-synonymous and synonymous positions in protein coding regions, especially in eukaryotes. Silent or synonymous codon positions, which do not determine amino acid sequences of the encoded proteins, define mRNA secondary structure and stability and affect the rate of translation, folding and post-translational modifications of nascent polypeptides. The RNA level selection is acting on synonymous sites in both prokaryotes and eukaryotes and is more common than previously thought. Selection pressure on the coding gene regions follows three-nucleotide periodic pattern of nucleotide base-pairing in mRNA, which is imposed by the genetic code. Synonymous positions of the coding regions have a higher level of hybridization potential relative to non-synonymous positions, and are multifunctional in their regulatory and structural roles. Recent experimental evidence and analysis of mRNA structure and interspecies conservation suggest that there is an evolutionary tradeoff between selective pressure acting at the RNA and protein levels. Here we provide a comprehensive overview of the studies that define the role of silent positions in regulating RNA structure and processing that exert downstream effects on proteins and their functions. PMID:23293005
Morrison, Carl D.; Liu, Pengyuan; Woloszynska-Read, Anna; Zhang, Jianmin; Luo, Wei; Qin, Maochun; Bshara, Wiam; Conroy, Jeffrey M.; Sabatini, Linda; Vedell, Peter; Xiong, Donghai; Liu, Song; Wang, Jianmin; Shen, He; Li, Yinwei; Omilian, Angela R.; Hill, Annette; Head, Karen; Guru, Khurshid; Kunnev, Dimiter; Leach, Robert; Eng, Kevin H.; Darlak, Christopher; Hoeflich, Christopher; Veeranki, Srividya; Glenn, Sean; You, Ming; Pruitt, Steven C.; Johnson, Candace S.; Trump, Donald L.
2014-01-01
Using complete genome analysis, we sequenced five bladder tumors accrued from patients with muscle-invasive transitional cell carcinoma of the urinary bladder (TCC-UB) and identified a spectrum of genomic aberrations. In three tumors, complex genotype changes were noted. All three had tumor protein p53 mutations and a relatively large number of single-nucleotide variants (SNVs; average of 11.2 per megabase), structural variants (SVs; average of 46), or both. This group was best characterized by chromothripsis and the presence of subclonal populations of neoplastic cells or intratumoral mutational heterogeneity. Here, we provide evidence that the process of chromothripsis in TCC-UB is mediated by nonhomologous end-joining using kilobase, rather than megabase, fragments of DNA, which we refer to as “stitchers,” to repair this process. We postulate that a potential unifying theme among tumors with the more complex genotype group is a defective replication–licensing complex. A second group (two bladder tumors) had no chromothripsis, and a simpler genotype, WT tumor protein p53, had relatively few SNVs (average of 5.9 per megabase) and only a single SV. There was no evidence of a subclonal population of neoplastic cells. In this group, we used a preclinical model of bladder carcinoma cell lines to study a unique SV (translocation and amplification) of the gene glutamate receptor ionotropic N-methyl D-aspertate as a potential new therapeutic target in bladder cancer. PMID:24469795
Sequence diversity of wheat mosaic virus isolates.
Stewart, Lucy R
2016-02-02
Wheat mosaic virus (WMoV), transmitted by eriophyid wheat curl mites (Aceria tosichella) is the causal agent of High Plains disease in wheat and maize. WMoV and other members of the genus Emaravirus evaded thorough molecular characterization for many years due to the experimental challenges of mite transmission and manipulating multisegmented negative sense RNA genomes. Recently, the complete genome sequence of a Nebraska isolate of WMoV revealed eight segments, plus a variant sequence of the nucleocapsid protein-encoding segment. Here, near-complete and partial consensus sequences of five more WMoV isolates are reported and compared to the Nebraska isolate: an Ohio maize isolate (GG1), a Kansas barley isolate (KS7), and three Ohio wheat isolates (H1, K1, W1). Results show two distinct groups of WMoV isolates: Ohio wheat isolate RNA segments had 84% or lower nucleotide sequence identity to the NE isolate, whereas GG1 and KS7 had 98% or higher nucleotide sequence identity to the NE isolate. Knowledge of the sequence variability of WMoV isolates is a step toward understanding virus biology, and potentially explaining observed biological variation. Published by Elsevier B.V.
Neill, John D; Newcomer, Benjamin W; Marley, Shonda D; Ridpath, Julia F; Givens, M Daniel
2012-08-06
Bovine viral diarrhea virus (BVDV) strains circulating in livestock herds show significant sequence variation. Conventional wisdom states that most sequence variation arises during acute infections in response to immune or other environmental pressures. A recent study showed that more nucleotide changes were introduced into the BVDV genomic RNA during the establishment of a single fetal persistent infection than following a series of acute infections of naïve cattle. However, it was not known if nucleotide changes were introduce when the virus crossed the placenta and infected the fetus or during the acute infection of the dam. The sequence of the open reading frame (ORF) from viruses isolated from four acutely infected pregnant heifers following exposure to persistently infected (PI) calves was compared to the sequences of the virus from the progenitor PI calf and the virus from the resulting progeny PI calf to determine when genetic change was introduced. This was compared to genetic change found in viruses isolated from a pregnant PI cow and its PI calf, and in three viruses isolated from acutely infected, non-pregnant cattle exposed to PI calves. Most genetic changes previously identified between the progenitor and progeny PI viruses were in place in the acute phase viruses isolated from the dams six days post-exposure to the progenitor PI calf. Additionally, each progeny PI virus had two to three unique nucleotide substitutions that were introduced in crossing the placenta and infection of the fetus. The nucleotide sequence of two acute phase viruses isolated from steers exposed to PI calves revealed that six and seven nucleotide changes were introduced during the acute infection. The sequence of the BVDV-2 virus isolated from an acute infection of a PI calf (BVDV-1a) co-housed with a BVDV-2 PI calf had ten nucleotides that were different from the progenitor PI virus. Finally, twenty nucleotide changes were identified in the PI virus of a calf born to a PI
Umdale, Suraj D; Kshirsagar, Parthraj R; Lekhak, Manoj M; Gaikwad, Nikhil B
2017-07-01
Smithia conferta Sm. is an annual herb widely used in Indian traditional medical practice and commonly known as "Lakshman booti" in Sanskrit. Morphological resemblance among the species of genus Smithia Aiton . leads to inaccurate identification and adulteration. This causes inconsistent therapeutic effects and also affects the quality of herbal medicine. This study aimed to generate potential barcode for authentication of S. conferta and its adulterants through DNA barcoding technique. Genomic DNA extracted from S. conferta and its adulterants was used as templates for polymerase chain reaction amplification of the barcoding regions. The amplicons were directed for sequencing, and species identification was conducted using BLASTn and unweighted pair-group method with arithmetic mean trees. In addition, the secondary structures of internal transcribed spacer (ITS) 2 region were predicted. The nucleotide sequence of ITS provides species-specific single nucleotide polymorphisms and sequence divergence (22%) than psb A- trn H (10.9%) and rbc L (3.1%) sequences. The ITS barcode indicates that S. conferta and Smithia sensitiva are closely related compared to other species. ITS is the most applicable barcode for molecular authentication of S. conferta , and further chloroplast barcodes should be tested for phylogenetic analysis of genus Smithia. The present investigation is the first effort of utilization of DNA barcode for molecular authentication of S. conferta and its adulterants. Also, this study expanded the application of the ITS2 sequence data in the authentication. The ITS has been proved as a potential and reliable candidate barcode for the authentication of S. conferta . Abbreviations used: BLASTn: Basic Local Alignment Search Tool for Nucleotide; MEGA: Molecular Evolutionary Genetic Analysis; EMBL: European Molecular Biology Laboratory; psb A- trn H: Photosystem II protein D1- stuctural RNA: His tRNA gene; rbcL: Ribulose 1,5 bi-phosphate carboxylase
Taylor, Angela J; Lappi, Victoria; Wolfgang, William J; Lapierre, Pascal; Palumbo, Michael J; Medus, Carlota; Boxrud, David
2015-10-01
Salmonella enterica serovar Enteritidis is a significant cause of gastrointestinal illness in the United States; however, current molecular subtyping methods lack resolution for this highly clonal serovar. Advances in next-generation sequencing technologies have made it possible to examine whole-genome sequencing (WGS) as a potential molecular subtyping tool for outbreak detection and source trace back. Here, we conducted a retrospective analysis of S. Enteritidis isolates from seven epidemiologically confirmed foodborne outbreaks and sporadic isolates (not epidemiologically linked) to determine the utility of WGS to identify outbreaks. A collection of 55 epidemiologically characterized clinical and environmental S. Enteritidis isolates were sequenced. Single nucleotide polymorphism (SNP)-based cluster analysis of the S. Enteritidis genomes revealed well supported clades, with less than four-SNP pairwise diversity, that were concordant with epidemiologically defined outbreaks. Sporadic isolates were an average of 42.5 SNPs distant from the outbreak clusters. Isolates collected from the same patient over several weeks differed by only two SNPs. Our findings show that WGS provided greater resolution between outbreak, sporadic, and suspect isolates than the current gold standard subtyping method, pulsed-field gel electrophoresis (PFGE). Furthermore, results could be obtained in a time frame suitable for surveillance activities, supporting the use of WGS as an outbreak detection and characterization method for S. Enteritidis. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Wu, L-P; Yang, T; Liu, H-W; Postman, J; Li, R
2018-05-01
A large contig with sequence similarities to several nucleorhabdoviruses was identified by high-throughput sequencing analysis from a black currant (Ribes nigrum L.) cultivar. The complete genome sequence of this new nucleorhabdovirus is 14,432 nucleotides long. Its genomic organization is very similar to those of unsegmented plant rhabdoviruses, containing six open reading frames in the order 3'-N-P-P3-M-G-L-5. The virus, which is provisionally named "black currant-associated rhabdovirus", is 41-52% identical in its genome nucleotide sequence to other nucleorhabdoviruses and may represent a new species in the genus Nucleorhabdovirus.
Setoh, Yin Xiang; Amarilla, Alberto A; Peng, Nias Y; Slonchak, Andrii; Periasamy, Parthiban; Figueiredo, Luiz T M; Aquino, Victor H; Khromykh, Alexander A
2018-01-01
Rocio virus (ROCV) is an arbovirus belonging to the genus Flavivirus, family Flaviviridae. We present an updated sequence of ROCV strain SPH 34675 (GenBank: AY632542.4), the only available full genome sequence prior to this study. Using next-generation sequencing of the entire genome, we reveal substantial sequence variation from the prototype sequence, with 30 nucleotide differences amounting to 14 amino acid changes, as well as significant changes to predicted 3'UTR RNA structures. Our results present an updated and corrected sequence of a potential emerging human-virulent flavivirus uniquely indigenous to Brazil (GenBank: MF461639).
Rajpoot, Ankita; Kumar, Ved Prakash; Bahuguna, Archana; Kumar, Dhyanendra
2017-11-01
Monitor lizards are Varanus species widely distributed, endangered reptile in the IUCN red data list. In India, based on the morphological and ecological characteristic, it is divided into four species viz. Bengal monitor lizard, Yellow monitor lizard, Desert monitor lizard and Water monitor lizard. These four species listed as Schedule I species in Indian Wildlife (Protection) Act 1972. This paper first attempt to present Forensically Informative Nucleotide Sequencing (FINS) for the Indian Varanus based on three mitochondrial genes. The molecular framework will be useful for the identification of Indian Varanus species and trade products derived from monitors and as such, have important applications for wildlife management and conservation. Here, we used known 14 individual skin pieces of four species of monitor lizards; the partial fragment of three mitochondrial genes (Cyt b, 12S rRNA, and 16S rRNA) were amplified for genetic study. In Cyt b, 12S rRNA and 16s rRNA, we observed, 5, 5 and 4 Haplotypes; 71, 69, and 43 Variables sites; 90, 89, and 50 Parsimony Informative sites within four species of Indian monitor lizards, respectively. Despite it, the nucleotide composition was T 26.4, C 32.8, A 29.2 and G11.6; T 18.8, C 29.7, A 34.0 and G 17.5; T 21.7, C 27.3, A 32.5 and G 18.5 in Cyt b, 12S rRNA and 16S rRNA, respectively. The neighbor joining phylogenetic tree and maximum parsimony tree of three mitochondrial genes, showed similar results and reveal that, there are two major clades are present in Indian monitor lizards.
Detection of nucleotide-specific CRISPR/Cas9 modified alleles using multiplex ligation detection
KC, R.; Srivastava, A.; Wilkowski, J. M.; Richter, C. E.; Shavit, J. A.; Burke, D. T.; Bielas, S. L.
2016-01-01
CRISPR/Cas9 genome-editing has emerged as a powerful tool to create mutant alleles in model organisms. However, the precision with which these mutations are created has introduced a new set of complications for genotyping and colony management. Traditional gene-targeting approaches in many experimental organisms incorporated exogenous DNA and/or allele specific sequence that allow for genotyping strategies based on binary readout of PCR product amplification and size selection. In contrast, alleles created by non-homologous end-joining (NHEJ) repair of double-stranded DNA breaks generated by Cas9 are much less amenable to such strategies. Here we describe a novel genotyping strategy that is cost effective, sequence specific and allows for accurate and efficient multiplexing of small insertion-deletions and single-nucleotide variants characteristic of CRISPR/Cas9 edited alleles. We show that ligation detection reaction (LDR) can be used to generate products that are sequence specific and uniquely detected by product size and/or fluorescent tags. The method works independently of the model organism and will be useful for colony management as mutant alleles differing by a few nucleotides become more prevalent in experimental animal colonies. PMID:27557703
Fernandes, Licia Natal; de Paula, Marcia Bicudo; Araújo, Alessandra Bergamo; Gonçalves, Elisabeth Fernandes Bertoletti; Romano, Camila Malta; Natal, Delsio; Malafronte, Rosely dos Santos; Marrelli, Mauro Toledo; Levi, José Eduardo
2016-05-01
The dengue viruses are widespread in Brazil and are a major public health concern. Other flaviviruses also cause diseases in humans, although on a smaller scale. The city of São Paulo is in a highly urbanized area with few green spaces apart from its parks, which are used for recreation and where potential vertebrate hosts and mosquito vectors of pathogenic Flavivirus species can be found. Although this scenario can contribute to the transmission of Flavivirus to humans, little is known about the circulation of members of this genus in these areas. In light of this, the present study sought to identify Flavivirus infection in mosquitoes (Diptera: Culicidae) collected in parks in the city of São Paulo. Seven parks in different sectors of the city were selected. Monthly mosquito collections were carried out in each park from March 2011 to February 2012 using aspiration and traps (Shannon and CD C-CO2). Nucleic acids were extracted from the mosquitoes collected and used for reverse-transcriptase and real-time polymerase chain reactions with genus-specific primers targeting a 200-nucleotide region in the Flavivirus NS5 gene. Positive samples were sequenced, and phylogenetic analyses were performed. Culex and Aedes were the most frequent genera of Culicidae collected. Culex flavivirus (CxFV)-related and Aedes flavivirus (AEFV)- related nucleotide sequences were detected in 17 pools of Culex and two pools of Aedes mosquitoes, respectively, among the 818 pools of non-engorged females analyzed. To the best of our knowledge, this is the first report of CxFV and AEFV in the city of São Paulo and Latin America, respectively. Both viruses are insect- specific flaviviruses, a group known to replicate only in mosquito cells and induce a cytopathic effect in some situations. Hence, our data suggests that CxFV and AEFV are present in Culex and Aedes mosquitoes, respectively, in parks in the city of São Paulo. Even though Flavivirus species of medical importance were not
Profiling of Sugar Nucleotides.
Rejzek, Martin; Hill, Lionel; Hems, Edward S; Kuhaudomlarp, Sakonwan; Wagstaff, Ben A; Field, Robert A
2017-01-01
Sugar nucleotides are essential building blocks for the glycobiology of all living organisms. Detailed information on the types of sugar nucleotides present in a particular cell and how they change as a function of metabolic, developmental, or disease status is vital. The extraction, identification, and quantification of sugar nucleotides in a given sample present formidable challenges. In this chapter, currently used techniques for sugar nucleotide extraction from cells, separation from complex biological matrices, and detection by optical and mass spectrometry methods are discussed. © 2017 Elsevier Inc. All rights reserved.
Sequence search on a supercomputer.
Gotoh, O; Tagashira, Y
1986-01-10
A set of programs was developed for searching nucleic acid and protein sequence data bases for sequences similar to a given sequence. The programs, written in FORTRAN 77, were optimized for vector processing on a Hitachi S810-20 supercomputer. A search of a 500-residue protein sequence against the entire PIR data base Ver. 1.0 (1) (0.5 M residues) is carried out in a CPU time of 45 sec. About 4 min is required for an exhaustive search of a 1500-base nucleotide sequence against all mammalian sequences (1.2M bases) in Genbank Ver. 29.0. The CPU time is reduced to about a quarter with a faster version.
Hong, Yanbin; Pandey, Manish K; Liu, Ying; Chen, Xiaoping; Liu, Hong; Varshney, Rajeev K; Liang, Xuanqiang; Huang, Shangzhi
2015-01-01
The cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB) species derived from the A-genome (Arachis duranensis) and B-genome (Arachis ipaensis) progenitors. Presence of two versions of a DNA sequence based on the two progenitor genomes poses a serious technical and analytical problem during single nucleotide polymorphism (SNP) marker identification and analysis. In this context, we have analyzed 200 amplicons derived from expressed sequence tags (ESTs) and genome survey sequences (GSS) to identify SNPs in a panel of genotypes consisting of 12 cultivated peanut varieties and two diploid progenitors representing the ancestral genomes. A total of 18 EST-SNPs and 44 genomic-SNPs were identified in 12 peanut varieties by aligning the sequence of A. hypogaea with diploid progenitors. The average frequency of sequence polymorphism was higher for genomic-SNPs than the EST-SNPs with one genomic-SNP every 1011 bp as compared to one EST-SNP every 2557 bp. In order to estimate the potential and further applicability of these identified SNPs, 96 peanut varieties were genotyped using high resolution melting (HRM) method. Polymorphism information content (PIC) values for EST-SNPs ranged between 0.021 and 0.413 with a mean of 0.172 in the set of peanut varieties, while genomic-SNPs ranged between 0.080 and 0.478 with a mean of 0.249. Total 33 SNPs were used for polymorphism detection among the parents and 10 selected lines from mapping population Y13Zh (Zhenzhuhei × Yueyou13). Of the total 33 SNPs, nine SNPs showed polymorphism in the mapping population Y13Zh, and seven SNPs were successfully mapped into five linkage groups. Our results showed that SNPs can be identified in allotetraploid peanut with high accuracy through amplicon sequencing and HRM assay. The identified SNPs were very informative and can be used for different genetic and breeding applications in peanut.
Sequence Complexity of Chromosome 3 in Caenorhabditis elegans
Pierro, Gaetano
2012-01-01
The nucleotide sequences complexity in chromosome 3 of Caenorhabditis elegans (C. elegans) is studied. The complexity of these sequences is compared with some random sequences. Moreover, by using some parameters related to complexity such as fractal dimension and frequency, indicator matrix is given a first classification of sequences of C. elegans. In particular, the sequences with highest and lowest fractal value are singled out. It is shown that the intrinsic nature of the low fractal dimension sequences has many common features with the random sequences. PMID:22919380
Lineage and genogroup-defining single nucleotide polymorphisms of Escherichia coli 0157:H7
USDA-ARS?s Scientific Manuscript database
Escherichia coli O157:H7 is a zoonotic human pathogen for which cattle are an important reservoir host. Using both previously published and new sequencing data, a 48-locus single nucleotide polymorphism (SNP) based typing panel was developed that redundantly identified eleven genogroups that span ...
Single nucleotide polymorphism analysis using different colored dye dimer probes
NASA Astrophysics Data System (ADS)
Marmé, Nicole; Friedrich, Achim; Denapaite, Dalia; Hakenbeck, Regine; Knemeyer, Jens-Peter
2006-09-01
Fluorescence quenching by dye dimer formation has been utilized to develop hairpin-structured DNA probes for the detection of a single nucleotide polymorphism (SNP) in the penicillin target gene pbp2x, which is implicated in the penicillin resistance of Streptococcus pneumoniae. We designed two specific DNA probes for the identification of the pbp2x genes from a penicillin susceptible strain R6 and a resistant strain Streptococcus mitis 661 using green-fluorescent tetramethylrhodamine (TMR) and red-fluorescent DY-636, respectively. Hybridization of each of the probes to its respective target DNA sequence opened the DNA hairpin probes, consequently breaking the nonfluorescent dye dimers into fluorescent species. This hybridization of the target with the hairpin probe achieved single nucleotide specific detection at nanomolar concentrations via increased fluorescence.
Nucleic and Amino Acid Sequences Support Structure-Based Viral Classification.
Sinclair, Robert M; Ravantti, Janne J; Bamford, Dennis H
2017-04-15
Viral capsids ensure viral genome integrity by protecting the enclosed nucleic acids. Interactions between the genome and capsid and between individual capsid proteins (i.e., capsid architecture) are intimate and are expected to be characterized by strong evolutionary conservation. For this reason, a capsid structure-based viral classification has been proposed as a way to bring order to the viral universe. The seeming lack of sufficient sequence similarity to reproduce this classification has made it difficult to reject structural convergence as the basis for the classification. We reinvestigate whether the structure-based classification for viral coat proteins making icosahedral virus capsids is in fact supported by previously undetected sequence similarity. Since codon choices can influence nascent protein folding cotranslationally, we searched for both amino acid and nucleotide sequence similarity. To demonstrate the sensitivity of the approach, we identify a candidate gene for the pandoravirus capsid protein. We show that the structure-based classification is strongly supported by amino acid and also nucleotide sequence similarities, suggesting that the similarities are due to common descent. The correspondence between structure-based and sequence-based analyses of the same proteins shown here allow them to be used in future analyses of the relationship between linear sequence information and macromolecular function, as well as between linear sequence and protein folds. IMPORTANCE Viral capsids protect nucleic acid genomes, which in turn encode capsid proteins. This tight coupling of protein shell and nucleic acids, together with strong functional constraints on capsid protein folding and architecture, leads to the hypothesis that capsid protein-coding nucleotide sequences may retain signatures of ancient viral evolution. We have been able to show that this is indeed the case, using the major capsid proteins of viruses forming icosahedral capsids. Importantly
Nucleic and Amino Acid Sequences Support Structure-Based Viral Classification
Sinclair, Robert M.; Ravantti, Janne J.
2017-01-01
ABSTRACT Viral capsids ensure viral genome integrity by protecting the enclosed nucleic acids. Interactions between the genome and capsid and between individual capsid proteins (i.e., capsid architecture) are intimate and are expected to be characterized by strong evolutionary conservation. For this reason, a capsid structure-based viral classification has been proposed as a way to bring order to the viral universe. The seeming lack of sufficient sequence similarity to reproduce this classification has made it difficult to reject structural convergence as the basis for the classification. We reinvestigate whether the structure-based classification for viral coat proteins making icosahedral virus capsids is in fact supported by previously undetected sequence similarity. Since codon choices can influence nascent protein folding cotranslationally, we searched for both amino acid and nucleotide sequence similarity. To demonstrate the sensitivity of the approach, we identify a candidate gene for the pandoravirus capsid protein. We show that the structure-based classification is strongly supported by amino acid and also nucleotide sequence similarities, suggesting that the similarities are due to common descent. The correspondence between structure-based and sequence-based analyses of the same proteins shown here allow them to be used in future analyses of the relationship between linear sequence information and macromolecular function, as well as between linear sequence and protein folds. IMPORTANCE Viral capsids protect nucleic acid genomes, which in turn encode capsid proteins. This tight coupling of protein shell and nucleic acids, together with strong functional constraints on capsid protein folding and architecture, leads to the hypothesis that capsid protein-coding nucleotide sequences may retain signatures of ancient viral evolution. We have been able to show that this is indeed the case, using the major capsid proteins of viruses forming icosahedral capsids
Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya
2011-01-01
To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533
Methods for making nucleotide probes for sequencing and synthesis
Church, George M; Zhang, Kun; Chou, Joseph
2014-07-08
Compositions and methods for making a plurality of probes for analyzing a plurality of nucleic acid samples are provided. Compositions and methods for analyzing a plurality of nucleic acid samples to obtain sequence information in each nucleic acid sample are also provided.
Quantum-Sequencing: Biophysics of quantum tunneling through nucleic acids
NASA Astrophysics Data System (ADS)
Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant
2014-03-01
Tunneling microscopy and spectroscopy has extensively been used in physical surface sciences to study quantum tunneling to measure electronic local density of states of nanomaterials and to characterize adsorbed species. Quantum-Sequencing (Q-Seq) is a new method based on tunneling microscopy for electronic sequencing of single molecule of nucleic acids. A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free single-molecule sequencing method. Here, we present the unique ``electronic fingerprints'' for all nucleotides on DNA and RNA using Q-Seq along their intrinsic biophysical parameters. We have analyzed tunneling spectra for the nucleotides at different pH conditions and analyzed the HOMO, LUMO and energy gap for all of them. In addition we show a number of biophysical parameters to further characterize all nucleobases (electron and hole transition voltage and energy barriers). These results highlight the robustness of Q-Seq as a technique for next-generation sequencing.
Sampson, Juliana K; Sheth, Nihar U; Koparde, Vishal N; Scalora, Allison F; Serrano, Myrna G; Lee, Vladimir; Roberts, Catherine H; Jameson-Lee, Max; Ferreira-Gonzalez, Andrea; Manjili, Masoud H; Buck, Gregory A; Neale, Michael C; Toor, Amir A
2014-08-01
Whole exome sequencing (WES) was performed on stem cell transplant donor-recipient (D-R) pairs to determine the extent of potential antigenic variation at a molecular level. In a small cohort of D-R pairs, a high frequency of sequence variation was observed between the donor and recipient exomes independent of human leucocyte antigen (HLA) matching. Nonsynonymous, nonconservative single nucleotide polymorphisms were approximately twice as frequent in HLA-matched unrelated, compared with related D-R pairs. When mapped to individual chromosomes, these polymorphic nucleotides were uniformly distributed across the entire exome. In conclusion, WES reveals extensive nucleotide sequence variation in the exomes of HLA-matched donors and recipients. © 2014 John Wiley & Sons Ltd.
CryoEM structure of a prokaryotic cyclic nucleotide-gated ion channel
James, Zachary M.; Borst, Andrew J.; Haitin, Yoni; Frenz, Brandon; DiMaio, Frank; Zagotta, William N.; Veesler, David
2017-01-01
Cyclic nucleotide-gated (CNG) and hyperpolarization-activated cyclic nucleotide-regulated (HCN) ion channels play crucial physiological roles in phototransduction, olfaction, and cardiac pace making. These channels are characterized by the presence of a carboxyl-terminal cyclic nucleotide-binding domain (CNBD) that connects to the channel pore via a C-linker domain. Although cyclic nucleotide binding has been shown to promote CNG and HCN channel opening, the precise mechanism underlying gating remains poorly understood. Here we used cryoEM to determine the structure of the intact LliK CNG channel isolated from Leptospira licerasiae—which shares sequence similarity to eukaryotic CNG and HCN channels—in the presence of a saturating concentration of cAMP. A short S4–S5 linker connects nearby voltage-sensing and pore domains to produce a non–domain-swapped transmembrane architecture, which appears to be a hallmark of this channel family. We also observe major conformational changes of the LliK C-linkers and CNBDs relative to the crystal structures of isolated C-linker/CNBD fragments and the cryoEM structures of related CNG, HCN, and KCNH channels. The conformation of our LliK structure may represent a functional state of this channel family not captured in previous studies. PMID:28396445
MSuPDA: A Memory Efficient Algorithm for Sequence Alignment.
Khan, Mohammad Ibrahim; Kamal, Md Sarwar; Chowdhury, Linkon
2016-03-01
Space complexity is a million dollar question in DNA sequence alignments. In this regard, memory saving under pushdown automata can help to reduce the occupied spaces in computer memory. Our proposed process is that anchor seed (AS) will be selected from given data set of nucleotide base pairs for local sequence alignment. Quick splitting techniques will separate the AS from all the DNA genome segments. Selected AS will be placed to pushdown automata's (PDA) input unit. Whole DNA genome segments will be placed into PDA's stack. AS from input unit will be matched with the DNA genome segments from stack of PDA. Match, mismatch and indel of nucleotides will be popped from the stack under the control unit of pushdown automata. During the POP operation on stack, it will free the memory cell occupied by the nucleotide base pair.
Krishnan, Neeraja M; Seligmann, Hervé; Stewart, Caro-Beth; De Koning, A P Jason; Pollock, David D
2004-10-01
Reconstruction of ancestral DNA and amino acid sequences is an important means of inferring information about past evolutionary events. Such reconstructions suggest changes in molecular function and evolutionary processes over the course of evolution and are used to infer adaptation and convergence. Maximum likelihood (ML) is generally thought to provide relatively accurate reconstructed sequences compared to parsimony, but both methods lead to the inference of multiple directional changes in nucleotide frequencies in primate mitochondrial DNA (mtDNA). To better understand this surprising result, as well as to better understand how parsimony and ML differ, we constructed a series of computationally simple "conditional pathway" methods that differed in the number of substitutions allowed per site along each branch, and we also evaluated the entire Bayesian posterior frequency distribution of reconstructed ancestral states. We analyzed primate mitochondrial cytochrome b (Cyt-b) and cytochrome oxidase subunit I (COI) genes and found that ML reconstructs ancestral frequencies that are often more different from tip sequences than are parsimony reconstructions. In contrast, frequency reconstructions based on the posterior ensemble more closely resemble extant nucleotide frequencies. Simulations indicate that these differences in ancestral sequence inference are probably due to deterministic bias caused by high uncertainty in the optimization-based ancestral reconstruction methods (parsimony, ML, Bayesian maximum a posteriori). In contrast, ancestral nucleotide frequencies based on an average of the Bayesian set of credible ancestral sequences are much less biased. The methods involving simpler conditional pathway calculations have slightly reduced likelihood values compared to full likelihood calculations, but they can provide fairly unbiased nucleotide reconstructions and may be useful in more complex phylogenetic analyses than considered here due to their speed and
Masking as an effective quality control method for next-generation sequencing data analysis.
Yun, Sajung; Yun, Sijung
2014-12-13
Next generation sequencing produces base calls with low quality scores that can affect the accuracy of identifying simple nucleotide variation calls, including single nucleotide polymorphisms and small insertions and deletions. Here we compare the effectiveness of two data preprocessing methods, masking and trimming, and the accuracy of simple nucleotide variation calls on whole-genome sequence data from Caenorhabditis elegans. Masking substitutes low quality base calls with 'N's (undetermined bases), whereas trimming removes low quality bases that results in a shorter read lengths. We demonstrate that masking is more effective than trimming in reducing the false-positive rate in single nucleotide polymorphism (SNP) calling. However, both of the preprocessing methods did not affect the false-negative rate in SNP calling with statistical significance compared to the data analysis without preprocessing. False-positive rate and false-negative rate for small insertions and deletions did not show differences between masking and trimming. We recommend masking over trimming as a more effective preprocessing method for next generation sequencing data analysis since masking reduces the false-positive rate in SNP calling without sacrificing the false-negative rate although trimming is more commonly used currently in the field. The perl script for masking is available at http://code.google.com/p/subn/. The sequencing data used in the study were deposited in the Sequence Read Archive (SRX450968 and SRX451773).
Mandl, C W; Holzmann, H; Kunz, C; Heinz, F X
1993-05-01
The complete nucleotide sequence of the positive-stranded RNA genome of the tick-borne flavivirus Powassan (10,839 nucleotides) was elucidated and the amino acid sequence of all viral proteins was derived. Based on this sequence as well as serological data, Powassan virus represents the most divergent member of the tick-borne serocomplex within the genus flaviviruses, family Flaviviridae. The primary nucleotide sequence and potential RNA secondary structures of the Powassan virus genome as well as the protein sequences and the reactivities of the virion with a panel of monoclonal antibodies were compared to other tick-borne and mosquito-borne flaviviruses. These analyses corroborated significant differences between tick-borne and mosquito-borne flaviviruses, but also emphasized structural elements that are conserved among both vector groups. The comparisons among tick-borne flaviviruses revealed conserved sequence elements that might represent important determinants of the tick-borne flavivirus phenotype.
Complete sequence analysis reveals two distinct poleroviruses infecting cucurbits in China.
Xiang, Hai-ying; Shang, Qiao-xia; Han, Cheng-gui; Li, Da-wei; Yu, Jia-lin
2008-01-01
The complete RNA genomes of a Chinese isolate of cucurbit aphid-borne yellows virus (CABYV-CHN) and a new polerovirus tentatively referred to as melon aphid-borne yellows virus (MABYV) were determined. The entire genome of CABYV-CHN shared 89.0% nucleotide sequence identity with the French CABYV isolate. In contrast, nucleotide sequence identities between MABYV and CABYV and other poleroviruses were in the range of 50.7-74.2%, with amino acid sequence identities ranging from 24.8 to 82.9% for individual gene products. We propose that CABYV-CHN is a strain of CABYV and that MABYV is a member of a tentative distinct species within the genus Polerovirus.
Greiner, Stephan; Wang, Xi; Herrmann, Reinhold G; Rauwolf, Uwe; Mayer, Klaus; Haberer, Georg; Meurer, Jörg
2008-09-01
A unique combination of genetic features and a rich stock of information make the flowering plant genus Oenothera an appealing model to explore the molecular basis of speciation processes including nucleus-organelle coevolution. From representative species, we have recently reported complete nucleotide sequences of the 5 basic and genetically distinguishable plastid chromosomes of subsection Oenothera (I-V). In nature, Oenothera plastid genomes are associated with 6 distinct, either homozygous or heterozygous, diploid nuclear genotypes of the 3 basic genomes A, B, or C. Artificially produced plastome-genome combinations that do not occur naturally often display interspecific plastome-genome incompatibility (PGI). In this study, we compare formal genetic data available from all 30 plastome-genome combinations with sequence differences between the plastomes to uncover potential determinants for interspecific PGI. Consistent with an active role in speciation, a remarkable number of genes have high Ka/Ks ratios. Different from the Solanacean cybrid model Atropa/tobacco, RNA editing seems not to be relevant for PGIs in Oenothera. However, predominantly sequence polymorphisms in intergenic segments are proposed as possible sources for PGI. A single locus, the bidirectional promoter region between psbB and clpP, is suggested to contribute to compartmental PGI in the interspecific AB hybrid containing plastome I (AB-I), consistent with its perturbed photosystem II activity.
McAllister, Christine A; Miller, Allison J
2016-07-01
Autopolyploidy, genome duplication within a single lineage, can result in multiple cytotypes within a species. Geographic distributions of cytotypes may reflect the evolutionary history of autopolyploid formation and subsequent population dynamics including stochastic (drift) and deterministic (differential selection among cytotypes) processes. Here, we used a population genomic approach to investigate whether autopolyploidy occurred once or multiple times in Andropogon gerardii, a widespread, North American grass with two predominant cytotypes. Genotyping by sequencing was used to identify single nucleotide polymorphisms (SNPs) in individuals collected from across the geographic range of A. gerardii. Two independent approaches to SNP calling were used: the reference-free UNEAK pipeline and a reference-guided approach based on the sequenced Sorghum bicolor genome. SNPs generated using these pipelines were analyzed independently with genetic distance and clustering. Analyses of the two SNP data sets showed very similar patterns of population-level clustering of A. gerardii individuals: a cluster of A. gerardii individuals from the southern Plains, a northern Plains cluster, and a western cluster. Groupings of individuals corresponded to geographic localities regardless of cytotype: 6x and 9x individuals from the same geographic area clustered together. SNPs generated using reference-guided and reference-free pipelines in A. gerardii yielded unique subsets of genomic data. Both data sets suggest that the 9x cytotype in A. gerardii likely evolved multiple times from 6x progenitors across the range of the species. Genomic approaches like GBS and diverse bioinformatics pipelines used here facilitate evolutionary analyses of complex systems with multiple ploidy levels. © 2016 Botanical Society of America.
Chen, Sherry Xi; Seelig, Georg
2016-04-20
Even a single-nucleotide difference between the sequences of two otherwise identical biological nucleic acids can have dramatic functional consequences. Here, we use model-guided reaction pathway engineering to quantitatively improve the performance of selective hybridization probes in recognizing single nucleotide variants (SNVs). Specifically, we build a detection system that combines discrimination by competition with DNA strand displacement-based catalytic amplification. We show, both mathematically and experimentally, that the single nucleotide selectivity of such a system in binding to single-stranded DNA and RNA is quadratically better than discrimination due to competitive hybridization alone. As an additional benefit the integrated circuit inherits the property of amplification and provides at least 10-fold better sensitivity than standard hybridization probes. Moreover, we demonstrate how the detection mechanism can be tuned such that the detection reaction is agnostic to the position of the SNV within the target sequence. in contrast, prior strand displacement-based probes designed for kinetic discrimination are highly sensitive to position effects. We apply our system to reliably discriminate between different members of the let-7 microRNA family that differ in only a single base position. Our results demonstrate the power of systematic reaction network design to quantitatively improve biotechnology.
Wickersheim, Michelle L; Blumenstiel, Justin P
2013-11-01
A large number of methods are available to deplete ribosomal RNA reads from high-throughput RNA sequencing experiments. Such methods are critical for sequencing Drosophila small RNAs between 20 and 30 nucleotides because size selection is not typically sufficient to exclude the highly abundant class of 30 nucleotide 2S rRNA. Here we demonstrate that pre-annealing terminator oligos complimentary to Drosophila 2S rRNA prior to 5' adapter ligation and reverse transcription efficiently depletes 2S rRNA sequences from the sequencing reaction in a simple and inexpensive way. This depletion is highly specific and is achieved with minimal perturbation of miRNA and piRNA profiles.
Seabury, Christopher M.; Dowd, Scot E.; Seabury, Paul M.; Raudsepp, Terje; Brightsmith, Donald J.; Liboriussen, Poul; Halley, Yvette; Fisher, Colleen A.; Owens, Elaine; Viswanathan, Ganesh; Tizard, Ian R.
2013-01-01
Data deposition to NCBI Genomes This Whole Genome Shotgun project has been deposited at DDBJ/EMBL/GenBank under the accession AMXX00000000 (SMACv1.0, unscaffolded genome assembly). The version described in this paper is the first version (AMXX01000000). The scaffolded assembly (SMACv1.1) has been deposited at DDBJ/EMBL/GenBank under the accession AOUJ00000000, and is also the first version (AOUJ01000000). Strong biological interest in traits such as the acquisition and utilization of speech, cognitive abilities, and longevity catalyzed the utilization of two next-generation sequencing platforms to provide the first-draft de novo genome assembly for the large, new world parrot Ara macao (Scarlet Macaw). Despite the challenges associated with genome assembly for an outbred avian species, including 951,507 high-quality putative single nucleotide polymorphisms, the final genome assembly (>1.035 Gb) includes more than 997 Mb of unambiguous sequence data (excluding N’s). Cytogenetic analyses including ZooFISH revealed complex rearrangements associated with two scarlet macaw macrochromosomes (AMA6, AMA7), which supports the hypothesis that translocations, fusions, and intragenomic rearrangements are key factors associated with karyotype evolution among parrots. In silico annotation of the scarlet macaw genome provided robust evidence for 14,405 nuclear gene annotation models, their predicted transcripts and proteins, and a complete mitochondrial genome. Comparative analyses involving the scarlet macaw, chicken, and zebra finch genomes revealed high levels of nucleotide-based conservation as well as evidence for overall genome stability among the three highly divergent species. Application of a new whole-genome analysis of divergence involving all three species yielded prioritized candidate genes and noncoding regions for parrot traits of interest (i.e., speech, intelligence, longevity) which were independently supported by the results of previous human GWAS studies. We
Rosinski-Chupin, Isabelle; Sauvage, Elisabeth; Sismeiro, Odile; Villain, Adrien; Da Cunha, Violette; Caliot, Marie-Elise; Dillies, Marie-Agnès; Trieu-Cuot, Patrick; Bouloc, Philippe; Lartigue, Marie-Frédérique; Glaser, Philippe
2015-05-30
Streptococcus agalactiae, or Group B Streptococcus, is a leading cause of neonatal infections and an increasing cause of infections in adults with underlying diseases. In an effort to reconstruct the transcriptional networks involved in S. agalactiae physiology and pathogenesis, we performed an extensive and robust characterization of its transcriptome through a combination of differential RNA-sequencing in eight different growth conditions or genetic backgrounds and strand-specific RNA-sequencing. Our study identified 1,210 transcription start sites (TSSs) and 655 transcript ends as well as 39 riboswitches and cis-regulatory regions, 39 cis-antisense non-coding RNAs and 47 small RNAs potentially acting in trans. Among these putative regulatory RNAs, ten were differentially expressed in response to an acid stress and two riboswitches sensed directly or indirectly the pH modification. Strikingly, 15% of the TSSs identified were associated with the incorporation of pseudo-templated nucleotides, showing that reiterative transcription is a pervasive process in S. agalactiae. In particular, 40% of the TSSs upstream genes involved in nucleotide metabolism show reiterative transcription potentially regulating gene expression, as exemplified for pyrG and thyA encoding the CTP synthase and the thymidylate synthase respectively. This comprehensive map of the transcriptome at the single nucleotide resolution led to the discovery of new regulatory mechanisms in S. agalactiae. It also provides the basis for in depth analyses of transcriptional networks in S. agalactiae and of the regulatory role of reiterative transcription following variations of intra-cellular nucleotide pools.
Complete genome sequence of a new maize-associated cytorhabdovirus
USDA-ARS?s Scientific Manuscript database
A new 11,877 nt cytorhabdovirus sequence with 6 open reading frames has been identified in a maize sample. It shares 50 and 51% genome-wide nucleotide sequence identity with northern cereal mosaic cytorhabdovirus (NCMV) and barley yellow striate mosaic cytorhabdovirus (BYSMV), respectively....
Seligmann, Hervé
2013-05-07
GenBank's EST database includes RNAs matching exactly human mitochondrial sequences assuming systematic asymmetric nucleotide exchange-transcription along exchange rules: A→G→C→U/T→A (12 ESTs), A→U/T→C→G→A (4 ESTs), C→G→U/T→C (3 ESTs), and A→C→G→U/T→A (1 EST), no RNAs correspond to other potential asymmetric exchange rules. Hypothetical polypeptides translated from nucleotide-exchanged human mitochondrial protein coding genes align with numerous GenBank proteins, predicted secondary structures resemble their putative GenBank homologue's. Two independent methods designed to detect overlapping genes (one based on nucleotide contents analyses in relation to replicative deamination gradients at third codon positions, and circular code analyses of codon contents based on frame redundancy), confirm nucleotide-exchange-encrypted overlapping genes. Methods converge on which genes are most probably active, and which not, and this for the various exchange rules. Mean EST lengths produced by different nucleotide exchanges are proportional to (a) extents that various bioinformatics analyses confirm the protein coding status of putative overlapping genes; (b) known kinetic chemistry parameters of the corresponding nucleotide substitutions by the human mitochondrial DNA polymerase gamma (nucleotide DNA misinsertion rates); (c) stop codon densities in predicted overlapping genes (stop codon readthrough and exchanging polymerization regulate gene expression by counterbalancing each other). Numerous rarely expressed proteins seem encoded within regular mitochondrial genes through asymmetric nucleotide exchange, avoiding lengthening genomes. Intersecting evidence between several independent approaches confirms the working hypothesis status of gene encryption by systematic nucleotide exchanges. Copyright © 2013 Elsevier Ltd. All rights reserved.
Zhao, Zhenqing; Gu, Honghui; Sheng, Xiaoguang; Yu, Huifang; Wang, Jiansheng; Huang, Long; Wang, Dan
2016-01-01
Molecular markers and genetic maps play an important role in plant genomics and breeding studies. Cauliflower is an important and distinctive vegetable; however, very few molecular resources have been reported for this species. In this study, a novel, specific-locus amplified fragment (SLAF) sequencing strategy was employed for large-scale single nucleotide polymorphism (SNP) discovery and high-density genetic map construction in a double-haploid, segregating population of cauliflower. A total of 12.47 Gb raw data containing 77.92 M pair-end reads were obtained after processing and 6815 polymorphic SLAFs between the two parents were detected. The average sequencing depths reached 52.66-fold for the female parent and 49.35-fold for the male parent. Subsequently, these polymorphic SLAFs were used to genotype the population and further filtered based on several criteria to construct a genetic linkage map of cauliflower. Finally, 1776 high-quality SLAF markers, including 2741 SNPs, constituted the linkage map with average data integrity of 95.68%. The final map spanned a total genetic length of 890.01 cM with an average marker interval of 0.50 cM, and covered 364.9 Mb of the reference genome. The markers and genetic map developed in this study could provide an important foundation not only for comparative genomics studies within Brassica oleracea species but also for quantitative trait loci identification and molecular breeding of cauliflower. PMID:27047515
Co-operation between Polymerases and Nucleotide Synthetases in the RNA World.
Kim, Ye Eun; Higgs, Paul G
2016-11-01
It is believed that life passed through an RNA World stage in which replication was sustained by catalytic RNAs (ribozymes). The two most obvious types of ribozymes are a polymerase, which uses a neighbouring strand as a template to make a complementary sequence to the template, and a nucleotide synthetase, which synthesizes monomers for use by the polymerase. When a chemical source of monomers is available, the polymerase can survive on its own. When the chemical supply of monomers is too low, nucleotide production by the synthetase is essential and the two ribozymes can only survive when they are together. Here we consider a computational model to investigate conditions under which coexistence and cooperation of these two types of ribozymes is possible. The model considers six types of strands: the two functional sequences, the complementary strands to these sequences (which are required as templates), and non-functional mutants of the two sequences (which act as parasites). Strands are distributed on a two-dimensional lattice. Polymerases replicate strands on neighbouring sites and synthetases produce monomers that diffuse in the local neighbourhood. We show that coexistence of unlinked polymerases and synthetases is possible in this spatial model under conditions in which neither sequence could survive alone; hence, there is a selective force for increasing complexity. Coexistence is dependent on the relative lengths of the two functional strands, the strand diffusion rate, the monomer diffusion rate, and the rate of deleterious mutations. The sensitivity of this two-ribozyme system suggests that evolution of a system of many types of ribozymes would be difficult in a purely spatial model with unlinked genes. We therefore speculate that linkage of genes onto mini-chromosomes and encapsulation of strands in protocells would have been important fairly early in the history of life as a means of enabling more complex systems to evolve.
Modular and configurable optimal sequence alignment software: Cola.
Zamani, Neda; Sundström, Görel; Höppner, Marc P; Grabherr, Manfred G
2014-01-01
The fundamental challenge in optimally aligning homologous sequences is to define a scoring scheme that best reflects the underlying biological processes. Maximising the overall number of matches in the alignment does not always reflect the patterns by which nucleotides mutate. Efficiently implemented algorithms that can be parameterised to accommodate more complex non-linear scoring schemes are thus desirable. We present Cola, alignment software that implements different optimal alignment algorithms, also allowing for scoring contiguous matches of nucleotides in a nonlinear manner. The latter places more emphasis on short, highly conserved motifs, and less on the surrounding nucleotides, which can be more diverged. To illustrate the differences, we report results from aligning 14,100 sequences from 3' untranslated regions of human genes to 25 of their mammalian counterparts, where we found that a nonlinear scoring scheme is more consistent than a linear scheme in detecting short, conserved motifs. Cola is freely available under LPGL from https://github.com/nedaz/cola.
Guilfoyle, Amy P; Deshpande, Chandrika N; Schenk, Gerhard; Maher, Megan J; Jormakka, Mika
2014-12-12
GDP release from GTPases is usually extremely slow and is in general assisted by external factors, such as association with guanine exchange factors or membrane-embedded GPCRs (G protein-coupled receptors), which accelerate the release of GDP by several orders of magnitude. Intrinsic factors can also play a significant role; a single amino acid substitution in one of the guanine nucleotide recognition motifs, G5, results in a drastically altered GDP release rate, indicating that the sequence composition of this motif plays an important role in spontaneous GDP release. In the present study, we used the GTPase domain from EcNFeoB (Escherichia coli FeoB) as a model and applied biochemical and structural approaches to evaluate the role of all the individual residues in the G5 loop. Our study confirms that several of the residues in the G5 motif have an important role in the intrinsic affinity and release of GDP. In particular, a T151A mutant (third residue of the G5 loop) leads to a reduced nucleotide affinity and provokes a drastically accelerated dissociation of GDP.
Sequence Diversity Diagram for comparative analysis of multiple sequence alignments.
Sakai, Ryo; Aerts, Jan
2014-01-01
The sequence logo is a graphical representation of a set of aligned sequences, commonly used to depict conservation of amino acid or nucleotide sequences. Although it effectively communicates the amount of information present at every position, this visual representation falls short when the domain task is to compare between two or more sets of aligned sequences. We present a new visual presentation called a Sequence Diversity Diagram and validate our design choices with a case study. Our software was developed using the open-source program called Processing. It loads multiple sequence alignment FASTA files and a configuration file, which can be modified as needed to change the visualization. The redesigned figure improves on the visual comparison of two or more sets, and it additionally encodes information on sequential position conservation. In our case study of the adenylate kinase lid domain, the Sequence Diversity Diagram reveals unexpected patterns and new insights, for example the identification of subgroups within the protein subfamily. Our future work will integrate this visual encoding into interactive visualization tools to support higher level data exploration tasks.
SEAN: SNP prediction and display program utilizing EST sequence clusters.
Huntley, Derek; Baldo, Angela; Johri, Saurabh; Sergot, Marek
2006-02-15
SEAN is an application that predicts single nucleotide polymorphisms (SNPs) using multiple sequence alignments produced from expressed sequence tag (EST) clusters. The algorithm uses rules of sequence identity and SNP abundance to determine the quality of the prediction. A Java viewer is provided to display the EST alignments and predicted SNPs.
A graphical method is presented for displaying how binding proteins and other macromolecules interact with individual bases of nucleotide sequences. Characters representing the sequence are either oriented normally and placed above a line indicating favorable contact, or upside-down and placed below the line indicating unfavorable contact. The positive or negative height of
Chiron: translating nanopore raw signal directly into nucleotide sequence using deep learning.
Teng, Haotian; Cao, Minh Duc; Hall, Michael B; Duarte, Tania; Wang, Sheng; Coin, Lachlan J M
2018-05-01
Sequencing by translocating DNA fragments through an array of nanopores is a rapidly maturing technology that offers faster and cheaper sequencing than other approaches. However, accurately deciphering the DNA sequence from the noisy and complex electrical signal is challenging. Here, we report Chiron, the first deep learning model to achieve end-to-end basecalling and directly translate the raw signal to DNA sequence without the error-prone segmentation step. Trained with only a small set of 4,000 reads, we show that our model provides state-of-the-art basecalling accuracy, even on previously unseen species. Chiron achieves basecalling speeds of more than 2,000 bases per second using desktop computer graphics processing units.
Focareta, T; Manning, P A
1987-01-01
The gene encoding the extracellular DNase of Vibrio cholerae was cloned into Escherichia coli K-12. A maximal coding region of 1.2 kb and a minimal region of 0.6 kb were determined by transposon mutagenesis and deletion analysis. The nucleotide sequence of this region contained a single open reading frame of 690 bp corresponding to a protein of Mr 26,389 with a typical N-terminal signal sequence of 18 aa which, when removed, would give a mature protein of Mr 24,163. This is in good agreement with the size of 24 kDa, calculated directly by Coomassie blue staining following sodium dodecyl sulphate-polyacrylamide gel electrophoresis and indirectly via a DNA-hydrolysis assay. The protein is located in the periplasmic space of E. coli K-12 unlike in V. cholerae where it is excreted into the extracellular medium. The introduction of the DNase gene into a periplasmic (tolA) leaky mutant of E. coli K-12 facilitates the release of the protein, further confirming the periplasmic location.
Wen, Chiu-Ming
2017-08-01
An aquabirnavirus was isolated from diseased marbled eels (Anguilla marmorata; MEIPNV1310) with gill haemorrhages and associated mortality. Its genome segment sequences were obtained through next-generation sequencing and compared with published aquabirnavirus sequences. The results indicated that the genome sequence of MEIPNV1310 contains segment A (3099 nucleotides) and segment B (2789 nucleotides). Phylogenetic analysis showed that MEIPNV1310 is closely related to the infectious pancreatic necrosis Ab strain within genogroup II. This genome sequence is beneficial for studying the geographic distribution and evolution of aquabirnaviruses.
Object-oriented parsing of biological databases with Python.
Ramu, C; Gemünd, C; Gibson, T J
2000-07-01
While database activities in the biological area are increasing rapidly, rather little is done in the area of parsing them in a simple and object-oriented way. We present here an elegant, simple yet powerful way of parsing biological flat-file databases. We have taken EMBL, SWISSPROT and GENBANK as examples. EMBL and SWISS-PROT do not differ much in the format structure. GENBANK has a very different format structure than EMBL and SWISS-PROT. Extracting the desired fields in an entry (for example a sub-sequence with an associated feature) for later analysis is a constant need in the biological sequence-analysis community: this is illustrated with tools to make new splice-site databases. The interface to the parser is abstract in the sense that the access to all the databases is independent from their different formats, since parsing instructions are hidden.
NASA Astrophysics Data System (ADS)
Holden, Todd; Marchese, P.; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Sullivan, R.; Schneider, P.; Flamholz, A.; Lieberman, D.; Cheung, T.
2008-08-01
We have characterized function related DNA sequences of various organisms using informatics techniques, including fractal dimension calculation, nucleotide and multi-nucleotide statistics, and sequence fluctuation analysis. Our analysis shows trends which differentiate extremophile from non-extremophile organisms, which could be reproduced in extraterrestrial life. Among the systems studied are radiation repair genes, genes involved in thermal shocks, and genes involved in drug resistance. We also evaluate sequence level changes that have occurred during short term evolution (several thousand generations) under extreme conditions.
Liu, Bin; Liu, Fule; Fang, Longyun; Wang, Xiaolong; Chou, Kuo-Chen
2015-04-15
In order to develop powerful computational predictors for identifying the biological features or attributes of DNAs, one of the most challenging problems is to find a suitable approach to effectively represent the DNA sequences. To facilitate the studies of DNAs and nucleotides, we developed a Python package called representations of DNAs (repDNA) for generating the widely used features reflecting the physicochemical properties and sequence-order effects of DNAs and nucleotides. There are three feature groups composed of 15 features. The first group calculates three nucleic acid composition features describing the local sequence information by means of kmers; the second group calculates six autocorrelation features describing the level of correlation between two oligonucleotides along a DNA sequence in terms of their specific physicochemical properties; the third group calculates six pseudo nucleotide composition features, which can be used to represent a DNA sequence with a discrete model or vector yet still keep considerable sequence-order information via the physicochemical properties of its constituent oligonucleotides. In addition, these features can be easily calculated based on both the built-in and user-defined properties via using repDNA. The repDNA Python package is freely accessible to the public at http://bioinformatics.hitsz.edu.cn/repDNA/. bliu@insun.hit.edu.cn or kcchou@gordonlifescience.org Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
MSuPDA: A memory efficient algorithm for sequence alignment.
Khan, Mohammad Ibrahim; Kamal, Md Sarwar; Chowdhury, Linkon
2015-01-16
Space complexity is a million dollar question in DNA sequence alignments. In this regards, MSuPDA (Memory Saving under Pushdown Automata) can help to reduce the occupied spaces in computer memory. Our proposed process is that Anchor Seed (AS) will be selected from given data set of Nucleotides base pairs for local sequence alignment. Quick Splitting (QS) techniques will separate the Anchor Seed from all the DNA genome segments. Selected Anchor Seed will be placed to pushdown Automata's (PDA) input unit. Whole DNA genome segments will be placed into PDA's stack. Anchor Seed from input unit will be matched with the DNA genome segments from stack of PDA. Whatever matches, mismatches or Indel, of Nucleotides will be POP from the stack under the control of control unit of Pushdown Automata. During the POP operation on stack it will free the memory cell occupied by the Nucleotide base pair.
Torshin, Ivan Y.
2004-01-01
Ribozymes are functionally diverse RNA molecules with intrinsic catalytic activity. Multiple structural and biochemical studies are required to establish which nucleotide bases are involved in the catalysis. The relative energetic properties of the nucleotide bases have been analyzed in a set of the known ribozyme structures. It was found that many of the known catalytic nucleotides can be identified using only the structure without any additional biochemical data. The results of the calculations compare well with the available biochemical data on RNA stability. Extensive in silico mutagenesis suggests that most of the nucleotides in ribozymes stabilize the RNA. The calculations show that relative contribution of the catalytic bases to RNA stability observably differs from contributions of the noncatalytic bases. Distinction between the concepts of “relative stability” and “mutational stability” is suggested. As results of prediction for several models of ribozymes appear to be in agreement with the published data on the potential active site regions, the method can potentially be used for prediction of functional nucleotides from nucleic sequence. PMID:15105962
DNA binding site characterization by means of Rényi entropy measures on nucleotide transitions.
Perera, A; Vallverdu, M; Claria, F; Soria, J M; Caminal, P
2008-06-01
In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measures such as Rényi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency-based Rényi measures. Results are reported in this work comparing transition frequencies (i.e., dinucleotides) and base frequencies for Shannon and parametric Rényi entropies for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that the information provided by both approaches is not redundant. Furthermore, under the presence of noise in the binding site matrix we observe overall improved robustness of nucleotide transition-based algorithms when compared with nucleotide frequency-based method.
Singular over-representation of an octameric palindrome, HIP1, in DNA from many cyanobacteria.
Robinson, N J; Robinson, P J; Gupta, A; Bleasby, A J; Whitton, B A; Morby, A P
1995-03-11
An octameric palindrome (5'-GCGATCGC-3') is abundant in cyanobacterial sequences within databases (GenBank/EMBL) and was designated HIP1 (highly iterated palindrome). The frequency of occurrence of all 256 octameric palindromes has now been determined in sub-databases revealing large and unique over-representation of HIP1 in cyanobacterial entries. DNA sequences from other bacteria were searched for any over-represented octameric palindromes analogous to HIP1. Only two sequences were identified, in the genomes of a thermophile and halophilic archaebacteria, although these were less abundant than HIP1 in cyanobacteria and relate to codon usage. To test the proposed widespread distribution of HIP1 in DNA from the cyanobacterium Synechococcus PCC 6301, randomly selected genomic clones were partly sequenced. HIP1 constituted 2.5% of the novel sequences, equivalent to a site on average once every 320 nucleotides. An oligonucleotide including HIP1 was also tested in PCR. Multiple products were obtained using template DNA from cyanobacterial strains in which HIP1 is abundant in known sequences, and some strains generated characteristic HIP-PCR banding patterns. However, analysis of DNA from one strain (not previously represented in databases) by random sequencing, HIP-PCR and Pvul digestion, confirms that not all cyanobacterial genomes are rich in HIP1.
Hirao, Tomonori; Watanabe, Atsushi; Kurita, Manabu; Kondo, Teiji; Takata, Katsuhiko
2008-06-23
The recent determination of complete chloroplast (cp) genomic sequences of various plant species has enabled numerous comparative analyses as well as advances in plant and genome evolutionary studies. In angiosperms, the complete cp genome sequences of about 70 species have been determined, whereas those of only three gymnosperm species, Cycas taitungensis, Pinus thunbergii, and Pinus koraiensis have been established. The lack of information regarding the gene content and genomic structure of gymnosperm cp genomes may severely hamper further progress of plant and cp genome evolutionary studies. To address this need, we report here the complete nucleotide sequence of the cp genome of Cryptomeria japonica, the first in the Cupressaceae sensu lato of gymnosperms, and provide a comparative analysis of their gene content and genomic structure that illustrates the unique genomic features of gymnosperms. The C. japonica cp genome is 131,810 bp in length, with 112 single copy genes and two duplicated (trnI-CAU, trnQ-UUG) genes that give a total of 116 genes. Compared to other land plant cp genomes, the C. japonica cp has lost one of the relevant large inverted repeats (IRs) found in angiosperms, fern, liverwort, and gymnosperms, such as Cycas and Gingko, and additionally has completely lost its trnR-CCG, partially lost its trnT-GGU, and shows diversification of accD. The genomic structure of the C. japonica cp genome also differs significantly from those of other plant species. For example, we estimate that a minimum of 15 inversions would be required to transform the gene organization of the Pinus thunbergii cp genome into that of C. japonica. In the C. japonica cp genome, direct repeat and inverted repeat sequences are observed at the inversion and translocation endpoints, and these sequences may be associated with the genomic rearrangements. The observed differences in genomic structure between C. japonica and other land plants, including pines, strongly support the
Winterhagen, Patrick; Wünsche, Jens-Norbert
2016-05-01
Within a polyembryonic mango seedling tree population, the genetic background of individuals should be identical because vigorous plants for cultivation are expected to develop from nucellar embryos representing maternal clones. Due to the fact that the mango cultivar 'Hôi' is assigned to the polyembryonic ecotype, an intra-cultivar variability of ethylene receptor genes was unexpected. Ethylene receptors in plants are conserved, but the number of receptors or receptor isoforms is variable regarding different plant species. However, it is shown here that the ethylene receptor MiETR1 is present in various isoforms within the mango cultivar 'Hôi'. The investigation of single nucleotide polymorphisms revealed that different MiETR1 isoforms can not be discriminated simply by individual single nucleotide exchanges but by the specific arrangement of single nucleotide polymorphisms at certain positions in the exons of MiETR1. Furthermore, an MiETR1 isoform devoid of introns in the genomic sequence was identified. The investigation demonstrates some limitations of high resolution melting and ScreenClust analysis and points out the necessity of sequencing to identify individual isoforms and to determine the variability within the tree population.
Single nucleotide variations: Biological impact and theoretical interpretation
Katsonis, Panagiotis; Koire, Amanda; Wilson, Stephen Joseph; Hsu, Teng-Kuei; Lua, Rhonald C; Wilkins, Angela Dawn; Lichtarge, Olivier
2014-01-01
Genome-wide association studies (GWAS) and whole-exome sequencing (WES) generate massive amounts of genomic variant information, and a major challenge is to identify which variations drive disease or contribute to phenotypic traits. Because the majority of known disease-causing mutations are exonic non-synonymous single nucleotide variations (nsSNVs), most studies focus on whether these nsSNVs affect protein function. Computational studies show that the impact of nsSNVs on protein function reflects sequence homology and structural information and predict the impact through statistical methods, machine learning techniques, or models of protein evolution. Here, we review impact prediction methods and discuss their underlying principles, their advantages and limitations, and how they compare to and complement one another. Finally, we present current applications and future directions for these methods in biological research and medical genetics. PMID:25234433
Identification and correction of abnormal, incomplete and mispredicted proteins in public databases.
Nagy, Alinda; Hegyi, Hédi; Farkas, Krisztina; Tordai, Hedvig; Kozma, Evelin; Bányai, László; Patthy, László
2008-08-27
Despite significant improvements in computational annotation of genomes, sequences of abnormal, incomplete or incorrectly predicted genes and proteins remain abundant in public databases. Since the majority of incomplete, abnormal or mispredicted entries are not annotated as such, these errors seriously affect the reliability of these databases. Here we describe the MisPred approach that may provide an efficient means for the quality control of databases. The current version of the MisPred approach uses five distinct routines for identifying abnormal, incomplete or mispredicted entries based on the principle that a sequence is likely to be incorrect if some of its features conflict with our current knowledge about protein-coding genes and proteins: (i) conflict between the predicted subcellular localization of proteins and the absence of the corresponding sequence signals; (ii) presence of extracellular and cytoplasmic domains and the absence of transmembrane segments; (iii) co-occurrence of extracellular and nuclear domains; (iv) violation of domain integrity; (v) chimeras encoded by two or more genes located on different chromosomes. Analyses of predicted EnsEMBL protein sequences of nine deuterostome (Homo sapiens, Mus musculus, Rattus norvegicus, Monodelphis domestica, Gallus gallus, Xenopus tropicalis, Fugu rubripes, Danio rerio and Ciona intestinalis) and two protostome species (Caenorhabditis elegans and Drosophila melanogaster) have revealed that the absence of expected signal peptides and violation of domain integrity account for the majority of mispredictions. Analyses of sequences predicted by NCBI's GNOMON annotation pipeline show that the rates of mispredictions are comparable to those of EnsEMBL. Interestingly, even the manually curated UniProtKB/Swiss-Prot dataset is contaminated with mispredicted or abnormal proteins, although to a much lesser extent than UniProtKB/TrEMBL or the EnsEMBL or GNOMON-predicted entries. MisPred works efficiently in
Cánovas, A; Rincón, G; Islas-Trejo, A; Jimenez-Flores, R; Laubscher, A; Medrano, J F
2013-04-01
The technological properties of milk have significant importance for the dairy industry. Citrate, a normal constituent of milk, forms one of the main buffer systems that regulate the equilibrium between Ca(2+) and H(+) ions. Higher-than-normal citrate content is associated with poor coagulation properties of milk. To identify the genes responsible for the variation of citrate content in milk in dairy cattle, the metabolic steps involved in citrate and fatty acid synthesis pathways in ruminant mammary tissue using RNA sequencing were studied. Genetic markers that could influence milk citrate content in Holstein cows were used in a marker-trait association study to establish the relationship between 74 single nucleotide polymorphisms (SNP) in 20 candidate genes and citrate content in 250 Holstein cows. This analysis revealed 6 SNP in key metabolic pathway genes [isocitrate dehydrogenase 1 (NADP+), soluble (IDH1); pyruvate dehydrogenase (lipoamide) β (PDHB); pyruvate kinase (PKM2); and solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 (SLC25A1)] significantly associated with increased milk citrate content. The amount of the phenotypic variation explained by the 6 SNP ranged from 10.1 to 13.7%. Also, genotype-combination analysis revealed the highest phenotypic variation was explained combining IDH1_23211, PDHB_5562, and SLC25A1_4446 genotypes. This specific genotype combination explained 21.3% of the phenotypic variation. The largest citrate associated effect was in the 3' untranslated region of the SLC25A1 gene, which is responsible for the transport of citrate across the mitochondrial inner membrane. This study provides an approach using RNA sequencing, metabolic pathway analysis, and association studies to identify genetic variation in functional target genes determining complex trait phenotypes. Copyright © 2013 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
INFO-RNA--a server for fast inverse RNA folding satisfying sequence constraints.
Busch, Anke; Backofen, Rolf
2007-07-01
INFO-RNA is a new web server for designing RNA sequences that fold into a user given secondary structure. Furthermore, constraints on the sequence can be specified, e.g. one can restrict sequence positions to a fixed nucleotide or to a set of nucleotides. Moreover, the user can allow violations of the constraints at some positions, which can be advantageous in complicated cases. The INFO-RNA web server allows biologists to design RNA sequences in an automatic manner. It is clearly and intuitively arranged and easy to use. The procedure is fast, as most applications are completed within seconds and it proceeds better and faster than other existing tools. The INFO-RNA web server is freely available at http://www.bioinf.uni-freiburg.de/Software/INFO-RNA/
Faragher, S G; Dalgarno, L
1986-07-20
The 3' untranslated (UT) sequences of the genomic RNAs of five geographic variants of the alphavirus Ross River virus (RRV) were determined and compared with the 3' UT sequence of RRV T48, the prototype strain. Part of the 3' UT region of Getah virus, a close serological relative of RRV, was also sequenced. The RRV 3' UT region varies markedly in length between variants. Large deletions or insertions, sequence rearrangements and single nucleotide substitutions are observed. A sequence tract of 49 to 58 nucleotides, which is repeated as four blocks in the RRV T48 3' UT region, occurs only once in the 3' UT region of one RRV strain (NB5092), indicating that the existence of repeat sequence blocks is not essential for RRV replication. However, the precise sequence of the 3' proximal copy of the repeat block and its position relative to the poly(A) tail were identical in all RRV isolates examined, suggesting that it has an important role in RRV replication. Nucleotide substitutions between RRV variants are distributed non-randomly along the length of the 3' UT region. The sequence of 120 to 130 nucleotides adjacent to the poly(A) tail is strongly conserved. Getah virus RNA contains three repeat sequence blocks in the 3' UT region. These are similar in sequence to those in RRV RNA but differ in their arrangement. Homology between the RRV and Getah 3' UT sequences is greatest in the 3' proximal repeat sequence block that shows three differences in 49 nucleotides. The 3' proximal repeat in Getah RNA occurs at the same position, relative to the poly(A) tail, as in all RRV variants. The RRV and Getah virus 3' UT sequences show extensive homology in the region between the 3' proximal repeat and the poly(A) tail but, apart from the repeat blocks themselves, they show no significant homology elsewhere.
Behera, Pratiksha; Vaishampayan, Parag; Singh, Nitin K; Mishra, Samir R; Raina, Vishakha; Suar, Mrutyunjay; Pattnaik, Ajit K; Rastogi, Gurdeep
2016-09-01
Till date, only one draft genome has been reported within the genus Mangrovibacter. Here, we report the second draft genome shotgun sequence of a Mangrovibacter sp. strain MP23 that was isolated from the roots of Phargmites karka (P. karka), an invasive weed growing in the Chilika Lagoon, Odisha, India. Strain MP23 is a facultative anaerobic, nitrogen-fixing endophytic bacteria that grows optimally at 37 °C, 7.0 pH, and 1% NaCl concentration. The draft genome sequence of strain MP23 contains 4,947,475 bp with an estimated G + C content of 49.9% and total 4392 protein coding genes. The genome sequence has provided information on putative genes that code for proteins involved in oxidative stress, uptake of nutrients, and nitrogen fixation that might offer niche specific ecological fitness and explain the invasive success of P. karka in Chilika Lagoon. The draft genome sequence and annotation have been deposited at DDBJ/EMBL/GenBank under the accession number LYRP00000000.
Zador, Anthony M.; Dubnau, Joshua; Oyibo, Hassana K.; Zhan, Huiqing; Cao, Gang; Peikon, Ian D.
2012-01-01
Connectivity determines the function of neural circuits. Historically, circuit mapping has usually been viewed as a problem of microscopy, but no current method can achieve high-throughput mapping of entire circuits with single neuron precision. Here we describe a novel approach to determining connectivity. We propose BOINC (“barcoding of individual neuronal connections”), a method for converting the problem of connectivity into a form that can be read out by high-throughput DNA sequencing. The appeal of using sequencing is that its scale—sequencing billions of nucleotides per day is now routine—is a natural match to the complexity of neural circuits. An inexpensive high-throughput technique for establishing circuit connectivity at single neuron resolution could transform neuroscience research. PMID:23109909
Li, Yunlang; Schlick, Tamar
2013-01-01
Incorporating the cognate instead of non-cognate substrates is crucial for DNA polymerase function. Here we analyze molecular dynamics simulations of DNA polymerase μ (pol μ) bound to different non-cognate incoming nucleotides including A:dCTP, A:dGTP, A(syn):dGTP, A:dATP, A(syn):dATP, T:dCTP, and T:dGTP to study the structure-function relationships involved with aberrant base pairs in the conformational pathway; while a pol μ complex with the A:dTTP base pair is available, no solved non-cognate structures are available. We observe distinct differences of the non-cognate systems compared to the cognate system. Specifically, the motions of active-site residue His329 and Asp330 distort the active site, and Trp436, Gln440, Glu443 and Arg444 tend to tighten the nucleotide-binding pocket when non-cognate nucleotides are bound; the latter effect may further lead to an altered electrostatic potential within the active site. That most of these “gate-keeper” residues are located farther apart from the upstream primer in pol μ, compared to other X family members, also suggests an interesting relation to pol μ's ability to incorporate nucleotides when the upstream primer is not paired. By examining the correlated motions within pol μ complexes, we also observe different patterns of correlations between non-cognate systems and the cognate system, especially decreased interactions between the incoming nucleotides and the nucleotide-binding pocket. Altered correlated motions in non-cognate systems agree with our recently proposed hybrid conformational selection/induced-fit models. Taken together, our studies propose the following order for difficulty of non-cognate system insertions by pol μ: T:dGTPsequence agrees with available kinetic data for non-cognate nucleotide insertions, with the exception of A:dGTP, which may be more sensitive to the template sequence. The structures and conformational aspects
Nucleotide sequence of the gene encoding the nitrogenase iron protein of Thiobacillus ferrooxidans
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pretorius, I.M.; Rawlings, D.E.; O'Neill, E.G.
1987-01-01
The DNA sequence was determined for the cloned Thiobacillus ferrooxidans nifH and part of the nifD genes. The DNA chains were radiolabeled with (..cap alpha..-/sup 32/P)dCTP (3000 Ci/mmol) or (..cap alpha..-/sup 35/S)dCTP (400 Ci/mmol). A putative T. ferrooxidans nifH promoter was identified whose sequences showed perfect consensus with those of the Klebsiella pneumoniae nif promoter. Two putative consensus upstream activator sequences were also identified. The amino acid sequence was deduced from the DNA sequence. In a comparison of nifH DNA sequences from T. ferrooxidans and eight other nitrogen-fixing microbes, a Rhizobium sp. isolated from Parasponia andersonii showed the greatest homologymore » (74%) and Clostridium pasteurianum (nifH1) showed the least homology (54%). In the comparison of the amino acid sequences of the Fe proteins, the Rhizobium sp. and Rhizobium japonicum showed the greatest homology (both 86%) and C. pasteurianum (nifH1 gene product) demonstrated the least homology (56%) to the T. ferrooxidans Fe protein.« less
Antinociceptive effect of purine nucleotides.
Mello, C F; Begnini, J; De-La-Vega, D D; Lopes, F P; Schwartz, C C; Jimenez-Bernal, R E; Bellot, R G; Frussa-Filho, R
1996-10-01
The antinociceptive effect of purine nucleotides administered systematically (sc) was determined using the formalin and writhing tests in adult male albino mice. The mechanisms underlying nucleotide-induced antinociception were investigated by preinjecting the animals (sc) with specific antagonists for opioid (naloxone, 1 mg/kg), purinergic P1 (caffeine, 5, 10, of 30 mg/kg); theophylline, 10 mg/kg) or purinergic P2 receptors (suramin, 100 mg/kg; Coomassie blue, 30-300 mg/kg; quinidine, 10 mg/kg). Adenosine, adenosine monophosphate (AMP), diphosphate (ADP) and triphosphate (ATP) caused a reduction in the number of writhes and in the time of licking the formalin-injected paw. Naloxone had no effect on adenosine- or adenine nucleotide-induced antinociception. Caffeine (30 mg/kg) and theophylline (10 mg/kg) reversed the antinociceptive action of adenosine and adenine nucleotide derivatives in both tests. P2 antagonists did not reverse adenine nucleotide-induced antinociception. These results suggest that antinociceptive effect of adenine nucleotides is mediated by adenosine.
Kishine, Masahiro; Tsutsumi, Katsuji; Kitta, Kazumi
2017-12-01
Simple sequence repeat (SSR) is a popular tool for individual fingerprinting. The long-core motif (e.g. tetra-, penta-, and hexa-nucleotide) simple sequence repeats (SSRs) are preferred because they make it easier to separate and distinguish neighbor alleles. In the present study, a new set of 8 tetra-nucleotide SSRs in potato ( Solanum tuberosum ) is reported. By using these 8 markers, 72 out of 76 cultivars obtained from Japan and the United States were clearly discriminated, while two pairs, both of which arose from natural variation, showed identical profiles. The combined probability of identity between two random cultivars for the set of 8 SSR markers was estimated to be 1.10 × 10 -8 , confirming the usefulness of the proposed SSR markers for fingerprinting analyses of potato.
Fluorescent signatures for variable DNA sequences
Rice, John E.; Reis, Arthur H.; Rice, Lisa M.; Carver-Brown, Rachel K.; Wangh, Lawrence J.
2012-01-01
Life abounds with genetic variations writ in sequences that are often only a few hundred nucleotides long. Rapid detection of these variations for identification of genetic diseases, pathogens and organisms has become the mainstay of molecular science and medicine. This report describes a new, highly informative closed-tube polymerase chain reaction (PCR) strategy for analysis of both known and unknown sequence variations. It combines efficient quantitative amplification of single-stranded DNA targets through LATE-PCR with sets of Lights-On/Lights-Off probes that hybridize to their target sequences over a broad temperature range. Contiguous pairs of Lights-On/Lights-Off probes of the same fluorescent color are used to scan hundreds of nucleotides for the presence of mutations. Sets of probes in different colors can be combined in the same tube to analyze even longer single-stranded targets. Each set of hybridized Lights-On/Lights-Off probes generates a composite fluorescent contour, which is mathematically converted to a sequence-specific fluorescent signature. The versatility and broad utility of this new technology is illustrated in this report by characterization of variant sequences in three different DNA targets: the rpoB gene of Mycobacterium tuberculosis, a sequence in the mitochondrial cytochrome C oxidase subunit 1 gene of nematodes and the V3 hypervariable region of the bacterial 16 s ribosomal RNA gene. We anticipate widespread use of these technologies for diagnostics, species identification and basic research. PMID:22879378
NASA Astrophysics Data System (ADS)
Mackiewicz, P.; Gierlik, A.; Kowalczuk, M.; Szczepanik, D.; Dudek, M. R.; Cebrat, S.
1999-12-01
We have analysed protein coding and intergenic sequences in the Borrelia burgdorferi (the Lyme disease bacterium) genome using different kinds of DNA walks. Genes occupying the leading strand of DNA have significantly different nucleotide composition from genes occupying the lagging strand. Nucleotide compositional bias of the two DNA strands reflects the aminoacid composition of proteins. 96% of genes coding for ribosomal proteins lie on the leading DNA strand, which suggests that the positions of these as well as other genes are non-random. In the B. burgdorferi genome, the asymmetry in intergenic DNA sequences is lower than the asymmetry in the third positions in codons. All these characters of the B. burgdorferi genome suggest that both replication-associated mutational pressure and recombination mechanisms have established the specific structure of the genome and now any recombination leading to inversion of a gene in respect to the direction of replication is forbidden. This property of the genome allows us to assume that it is in a steady state, which enables us to fix some parameters for simulations of DNA evolution.
Complete genome sequence of ‘Candidatus Liberibacter africanus’
USDA-ARS?s Scientific Manuscript database
The complete genome sequence of ‘Candidatus Liberibacter africanus’ (Laf), strain ptsapsy, was obtained by an Illumina HiSeq 2000. The Laf genome comprises 1,192,232 nucleotides, 34.5% GC content, 1,141 predicted coding sequences, 44 tRNAs, 3 complete copies of ribosomal RNA genes (16S, 23S and 5S) ...
Chen, Jeffrey
2017-01-01
The AID / APOBEC genes are a family of cytidine deaminases that have evolved in vertebrates, and particularly mammals, to mutate RNA and DNA at distinct preferred nucleotide contexts (or “hotspots”) on foreign genomes such as viruses and retrotransposons. These enzymes play a pivotal role in intrinsic immunity defense mechanisms, often deleteriously mutating invading retroviruses or retrotransposons and, in the case of AID, changing antibody sequences to drive affinity maturation. We investigate the strength of various hotspots on their known biological targets by evaluating the potential impact of mutations on the DNA coding sequences of these targets, and compare these results to hypothetical hotspots that did not evolve. We find that the existing AID / APOBEC hotspots have a large impact on retrotransposons and non-mammalian viruses while having a much smaller effect on vital mammalian genes, suggesting co-evolution with AID / APOBECs may have had an impact on the genomes of the viruses we analyzed. We determine that GC content appears to be a significant, but not sole, factor in resistance to deaminase activity. We discuss possible mechanisms AID and APOBEC viral targets have adopted to escape the impacts of deamination activity, including changing the GC content of the genome. PMID:28362825
Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays
Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie; Liévin, Jacques; Körzdörfer, Thomas; Rotaru, Alexandru; Gothelf, Kurt V.; Besenbacher, Flemming; Bald, Ilko
2014-01-01
The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sections for electron induced single strand breaks in specific 13 mer oligonucleotides we used atomic force microscopy analysis of DNA origami based DNA nanoarrays. We investigated the DNA sequences 5′-TT(XYX)3TT with X = A, G, C and Y = T, BrU 5-bromouracil and found absolute strand break cross sections between 2.66 · 10−14 cm2 and 7.06 · 10−14 cm2. The highest cross section was found for 5′-TT(ATA)3TT and 5′-TT(ABrUA)3TT, respectively. BrU is a radiosensitizer, which was discussed to be used in cancer radiation therapy. The replacement of T by BrU into the investigated DNA sequences leads to a slight increase of the absolute strand break cross sections resulting in sequence-dependent enhancement factors between 1.14 and 1.66. Nevertheless, the variation of strand break cross sections due to the specific nucleotide sequence is considerably higher. Thus, the present results suggest the development of targeted radiosensitizers for cancer radiation therapy. PMID:25487346
Genotyping-by-sequencing in three octoploid cultivated strawberry families
USDA-ARS?s Scientific Manuscript database
With the goal of evaluating genotyping-by-sequencing (GBS) in a species with a complex octoploid genome, GBS was used to survey genome-wide single-nucleotide polymorphisms (SNPs) in three biparental strawberry (Fragaria ×ananassa) populations. GBS sequence data were aligned to the F. vesca ‘Fvb’ ref...
Templated sequence insertion polymorphisms in the human genome
NASA Astrophysics Data System (ADS)
Onozawa, Masahiro; Aplan, Peter
2016-11-01
Templated Sequence Insertion Polymorphism (TSIP) is a recently described form of polymorphism recognized in the human genome, in which a sequence that is templated from a distant genomic region is inserted into the genome, seemingly at random. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; Class 1 TSIPs show features of insertions that are mediated via the LINE-1 ORF2 protein, including 1) target-site duplication (TSD), 2) polyadenylation 10-30 nucleotides downstream of a “cryptic” polyadenylation signal, and 3) preference for insertion at a 5’-TTTT/A-3’ sequence. In contrast, class 2 TSIPs show features consistent with repair of a DNA double-strand break via insertion of a DNA “patch” that is derived from a distant genomic region. Survey of a large number of normal human volunteers demonstrates that most individuals have 25-30 TSIPs, and that these TSIPs track with specific geographic regions. Similar to other forms of human polymorphism, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases.
Keith R. Merrill; Craig E. Coleman; Susan E. Meyer; Elizabeth A. Leger; Katherine A. Collins
2016-01-01
Premise of the study: Bromus tectorum (Poaceae) is an annual grass species that is invasive in many areas of the world but most especially in the U.S. Intermountain West. Single-nucleotide polymorphism (SNP) markers were developed for use in investigating the geospatial and ecological diversity of B. tectorum in the Intermountain West to better understand the...
Biswas, Sovan; Sen, Suman; Im, JongOne; Biswas, Sudipta; Krstic, Predrag; Ashcroft, Brian; Borges, Chad; Zhao, Yanan; Lindsay, Stuart; Zhang, Peiming
2016-12-27
A reader molecule, which recognizes all the naturally occurring nucleobases in an electron tunnel junction, is required for sequencing DNA by a recognition tunneling (RT) technique, referred to as a universal reader. In the present study, we have designed a series of heterocyclic carboxamides based on hydrogen bonding and a large-sized pyrene ring based on a π-π stacking interaction as universal reader candidates. Each of these compounds was synthesized to bear a thiolated linker for attachment to metal electrodes and examined for their interactions with naturally occurring DNA nucleosides and nucleotides by 1 H NMR, ESI-MS, computational calculations, and surface plasmon resonance. RT measurements were carried out in a scanning tunnel microscope. All of these molecules generated electrical signals with DNA nucleotides in tunneling junctions under physiological conditions (phosphate buffered aqueous solution, pH 7.4). Using a support vector machine as a tool for data analysis, we found that these candidates distinguished among naturally occurring DNA nucleotides with the accuracy of pyrene (by π-π stacking interactions) > azole carboxamides (by hydrogen-bonding interactions). In addition, the pyrene reader operated efficiently in a larger tunnel junction. However, the azole carboxamide could read abasic (AP) monophosphate, a product from spontaneous base hydrolysis or an intermediate of base excision repair. Thus, we envision that sequencing DNA using both π-π stacking and hydrogen-bonding-based universal readers in parallel should generate more comprehensive genome sequences than sequencing based on either reader molecule alone.
Genome-scale engineering of Saccharomyces cerevisiae with single-nucleotide precision.
Bao, Zehua; HamediRad, Mohammad; Xue, Pu; Xiao, Han; Tasan, Ipek; Chao, Ran; Liang, Jing; Zhao, Huimin
2018-07-01
We developed a CRISPR-Cas9- and homology-directed-repair-assisted genome-scale engineering method named CHAnGE that can rapidly output tens of thousands of specific genetic variants in yeast. More than 98% of target sequences were efficiently edited with an average frequency of 82%. We validate the single-nucleotide resolution genome-editing capability of this technology by creating a genome-wide gene disruption collection and apply our method to improve tolerance to growth inhibitors.
Demirci, Berna; Lee, Yoosook; Lanzaro, Gregory C; Alten, Bulent
2012-05-01
Culex theileri Theobald (Diptera: Culicidae) is one of the most common mosquito species in northeastern Turkey and serves as a vector for various zoonotic diseases including West Nile virus. Although there have been some studies on the ecology of Cx. theileri, very little genetic data has been made available. We successfully sequenced 11 gene fragments from Cx. theileri specimens collected from the northeastern part of Turkey. On average, we found a Single nucleotide polymorphism every 45 bp. Transitions outnumbered transversions, at a ratio of 2:1. This is the first report of genetic polymorphisms in Cx. theileri and Single nucleotide polymorphism discovered from this study can be used to investigate population structure and gene-environmental interactions.
Spreadsheet macros for coloring sequence alignments.
Haygood, M G
1993-12-01
This article describes a set of Microsoft Excel macros designed to color amino acid and nucleotide sequence alignments for review and preparation of visual aids. The colored alignments can then be modified to emphasize features of interest. Procedures for importing and coloring sequences are described. The macro file adds a new menu to the menu bar containing sequence-related commands to enable users unfamiliar with Excel to use the macros more readily. The macros were designed for use with Macintosh computers but will also run with the DOS version of Excel.
Ruhlman, Tracey A; Zhang, Jin; Blazier, John C; Sabir, Jamal S M; Jansen, Robert K
2017-04-01
There is a misinterpretation in the literature regarding the variable orientation of the small single copy region of plastid genomes (plastomes). The common phenomenon of small and large single copy inversion, hypothesized to occur through intramolecular recombination between inverted repeats (IR) in a circular, single unit-genome, in fact, more likely occurs through recombination-dependent replication (RDR) of linear plastome templates. If RDR can be primed through both intra- and intermolecular recombination, then this mechanism could not only create inversion isomers of so-called single copy regions, but also an array of alternative sequence arrangements. We used Illumina paired-end and PacBio single-molecule real-time (SMRT) sequences to characterize repeat structure in the plastome of Monsonia emarginata (Geraniaceae). We used OrgConv and inspected nucleotide alignments to infer ancestral nucleotides and identify gene conversion among repeats and mapped long (>1 kb) SMRT reads against the unit-genome assembly to identify alternative sequence arrangements. Although M. emarginata lacks the canonical IR, we found that large repeats (>1 kilobase; kb) represent ∼22% of the plastome nucleotide content. Among the largest repeats (>2 kb), we identified GC-biased gene conversion and mapping filtered, long SMRT reads to the M. emarginata unit-genome assembly revealed alternative, substoichiometric sequence arrangements. We offer a model based on RDR and gene conversion between long repeated sequences in the M. emarginata plastome and provide support that both intra-and intermolecular recombination between large repeats, particularly in repeat-rich plastomes, varies unit-genome structure while homogenizing the nucleotide sequence of repeats. © 2017 Botanical Society of America.
Raibaud, A; Zalacain, M; Holt, T G; Tizard, R; Thompson, C J
1991-01-01
Nucleotide sequence analysis of a 5,000-bp region of the bialaphos antibiotic production (bap) gene cluster defined five open reading frames (ORFs) which predicted structural genes in the order bah, ORF1, ORF2, and ORF3 followed by the regulatory gene, brpA (H. Anzai, T. Murakami, S. Imai, A. Satoh, K. Nagaoka, and C.J. Thompson, J. Bacteriol. 169:3482-3488, 1987). The four structural genes were translationally coupled and apparently cotranscribed from an undefined promoter(s) under the positive control of the brpA gene product. S1 mapping experiments indicated that brpA was transcribed by two promoters (brpAp1 and brpAp2) which initiate transcription 150 and 157 bp upstream of brp A within an intergenic region and at least one promoter further upstream within the bap gene cluster (brpAp3). All three transcripts were present at low levels during exponential growth and increased just before the stationary phase. The levels of the brpAp3 band continued to increase at the onset of stationary phase, whereas brpAp1-and brpAp2-protected fragments showed no further change. BrpA contained a possible helix-turn-helix motif at its C terminus which was similar to the C-terminal regulatory motif found in the receiver component of a family of two-component transcriptional activator proteins. This motif was not associated with the N-terminal domain conserved in other members of the family. The structural gene cluster sequenced began with bah, encoding a bialaphos acetylhydrolase which removes the N-acetyl group from bialaphos as one of the final steps in the biosynthetic pathway. The observation that Bah was similar to a rat and to a bacterial (Acinetobacter calcoaceticus) lipase probably reflects the fact that the ester bonds of triglycerides and the amide bond linking acetate to phosphinothricin are similar and hydrolysis is catalyzed by structurally related enzymes. This was followed by two regions encoding ORF1 and ORF2 which were similar to each other (48% nucleotide
Olsson, Linda; Zettermark, Sofia; Biloglav, Andrea; Castor, Anders; Behrendtz, Mikael; Forestier, Erik; Paulsson, Kajsa; Johansson, Bertil
2016-07-01
Cytogenetic analyses of a consecutive series of 67 paediatric (median age 8 years; range 0-17) de novo acute myeloid leukaemia (AML) patients revealed aberrations in 55 (82%) cases. The most common subgroups were KMT2A rearrangement (29%), normal karyotype (15%), RUNX1-RUNX1T1 (10%), deletions of 5q, 7q and/or 17p (9%), myeloid leukaemia associated with Down syndrome (7%), PML-RARA (7%) and CBFB-MYH11 (5%). Single nucleotide polymorphism array (SNP-A) analysis and exon sequencing of 100 genes, performed in 52 and 40 cases, respectively (39 overlapping), revealed ≥1 aberration in 89%; when adding cytogenetic data, this frequency increased to 98%. Uniparental isodisomies (UPIDs) were detected in 13% and copy number aberrations (CNAs) in 63% (median 2/case); three UPIDs and 22 CNAs were recurrent. Twenty-two genes were targeted by focal CNAs, including AEBP2 and PHF6 deletions and genes involved in AML-associated gene fusions. Deep sequencing identified mutations in 65% of cases (median 1/case). In total, 60 mutations were found in 30 genes, primarily those encoding signalling proteins (47%), transcription factors (25%), or epigenetic modifiers (13%). Twelve genes (BCOR, CEBPA, FLT3, GATA1, KIT, KRAS, NOTCH1, NPM1, NRAS, PTPN11, SMC3 and TP53) were recurrently mutated. We conclude that SNP-A and deep sequencing analyses complement the cytogenetic diagnosis of paediatric AML. © 2016 John Wiley & Sons Ltd.
Blaiotta, Giuseppe; Pepe, Olimpia; Mauriello, Gianluigi; Villani, Francesco; Andolfi, Rosamaria; Moschetti, Giancarlo
2002-12-01
The intergenic spacer region (ISR) between the 16S and 23S rRNA genes was tested as a tool for differentiating lactococci commonly isolated in a dairy environment. 17 reference strains, representing 11 different species belonging to the genera Lactococcus, Streptococcus, Lactobacillus, Enterococcus and Leuconostoc, and 127 wild streptococcal strains isolated during the whole fermentation process of "Fior di Latte" cheese were analyzed. After 16S-23S rDNA ISR amplification by PCR, species or genus-specific patterns were obtained for most of the reference strains tested. Moreover, results obtained after nucleotide analysis show that the 16S-23S rDNA ISR sequences vary greatly, in size and sequence, among Lactococcus garvieae, Lactococcus raffinolactis, Lactococcus lactis as well as other streptococci from dairy environments. Because of the high degree of inter-specific polymorphism observed, 16S-23S rDNA ISR can be considered a good potential target for selecting species-specific molecular assays, such as PCR primer or probes, for a rapid and extremely reliable differentiation of dairy lactococcal isolates.
Bijective transformation circular codes and nucleotide exchanging RNA transcription.
Michel, Christian J; Seligmann, Hervé
2014-04-01
The C(3) self-complementary circular code X identified in genes of prokaryotes and eukaryotes is a set of 20 trinucleotides enabling reading frame retrieval and maintenance, i.e. a framing code (Arquès and Michel, 1996; Michel, 2012, 2013). Some mitochondrial RNAs correspond to DNA sequences when RNA transcription systematically exchanges between nucleotides (Seligmann, 2013a,b). We study here the 23 bijective transformation codes ΠX of X which may code nucleotide exchanging RNA transcription as suggested by this mitochondrial observation. The 23 bijective transformation codes ΠX are C(3) trinucleotide circular codes, seven of them are also self-complementary. Furthermore, several correlations are observed between the Reading Frame Retrieval (RFR) probability of bijective transformation codes ΠX and the different biological properties of ΠX related to their numbers of RNAs in GenBank's EST database, their polymerization rate, their number of amino acids and the chirality of amino acids they code. Results suggest that the circular code X with the functions of reading frame retrieval and maintenance in regular RNA transcription, may also have, through its bijective transformation codes ΠX, the same functions in nucleotide exchanging RNA transcription. Associations with properties such as amino acid chirality suggest that the RFR of X and its bijective transformations molded the origins of the genetic code's machinery. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
2012-01-01
Background Salmonids are popular sport fishes, and as such have been subjected to widespread stocking throughout western North America. Historically, stocking was done with little regard for genetic variation among populations and has resulted in genetic mixing among species and subspecies in many areas, thus putting the genetic integrity of native salmonid populations at risk and creating a need to assess the genetic constitution of native salmonid populations. Cutthroat trout is a salmonid species with pronounced geographic structure (there are 10 extant subspecies) and a recent history of hybridization with introduced rainbow trout in many populations. Genetic admixture has also occurred among cutthroat trout subspecies in areas where introductions have brought two or more subspecies into contact. Consequently, management agencies have increased their efforts to evaluate the genetic composition of cutthroat trout populations to identify populations that remain uncompromised and manage them accordingly, but additional genetic markers are needed to do so effectively. Here we used genome reduction, MID-barcoding, and 454-pyrosequencing to discover single nucleotide polymorphisms that differentiate cutthroat trout subspecies and can be used as a rapid, cost-effective method to characterize the genetic composition of cutthroat trout populations. Results Thirty cutthroat and six rainbow trout individuals were subjected to genome reduction and next-generation sequencing. A total of 1,499,670 reads averaging 379 base pairs in length were generated by 454-pyrosequencing, resulting in 569,060,077 total base pairs sequenced. A total of 43,558 putative SNPs were identified, and of those, 125 SNP primers were developed that successfully amplified 96 cutthroat trout and rainbow trout individuals. These SNP loci were able to differentiate most cutthroat trout subspecies using distance methods and Structure analyses. Conclusions Genomic and bioinformatic protocols were
INFO-RNA—a server for fast inverse RNA folding satisfying sequence constraints
Busch, Anke; Backofen, Rolf
2007-01-01
INFO-RNA is a new web server for designing RNA sequences that fold into a user given secondary structure. Furthermore, constraints on the sequence can be specified, e.g. one can restrict sequence positions to a fixed nucleotide or to a set of nucleotides. Moreover, the user can allow violations of the constraints at some positions, which can be advantageous in complicated cases. The INFO-RNA web server allows biologists to design RNA sequences in an automatic manner. It is clearly and intuitively arranged and easy to use. The procedure is fast, as most applications are completed within seconds and it proceeds better and faster than other existing tools. The INFO-RNA web server is freely available at http://www.bioinf.uni-freiburg.de/Software/INFO-RNA/ PMID:17452349
Astell, C R; Gardiner, E M; Tattersall, P
1986-02-01
The sequence of molecular clones of the genome of MVM(i), a lymphotropic variant of minute virus of mice, was determined and compared with that of MVM(p), the fibrotropic prototype strain. At the nucleotide level there are 163 base changes: 129 transitions and 34 transversions. Most nucleotide changes are silent, with only 27 amino acids changes predicted, of which 22 are conservative. Notable differences between the MVM(i) and MVM(p) genomes which may account for the cell specificities of these viruses occur within the 3' nontranslated regions. The differences discussed include the absence of a 65-base-pair direct in MVM(i), the presence of only two polyadenylation sites in MVM(i) compared with four in MVM(p), and sequences that bear a resemblance to enhancer sequences. Also included in this paper is an important correction to the MVM(p) sequence (C.R. Astell, M. Thomson, M. Merchlinsky, and D. C. Ward, Nucleic Acids Res. 11:999-1018, 1983).
Rasmussen, C.; Purcell, M.K.; Gregg, J.L.; LaPatra, S.E.; Winton, J.R.; Hershberger, P.K.
2010-01-01
The mesomycetozoean parasite Ichthyophonus hoferi is most commonly associated with marine fish hosts but also occurs in some components of the freshwater rainbow trout Oncorhynchus mykiss aquaculture industry in Idaho, USA. It is not certain how the parasite was introduced into rainbow trout culture, but it might have been associated with the historical practice of feeding raw, ground common carp Cyprinus carpio that were caught by commercial fisherman. Here, we report a major genetic division between west coast freshwater and marine isolates of Ichthyophonus hoferi. Sequence differences were not detected in 2 regions of the highly conserved small subunit (18S) rDNA gene; however, nucleotide variation was seen in internal transcribed spacer loci (ITS1 and ITS2), both within and among the isolates. Intra-isolate variation ranged from 2.4 to 7.6 nucleotides over a region consisting of ~740 bp. Majority consensus sequences from marine/anadromous hosts differed in only 0 to 3 nucleotides (99.6 to 100% nucleotide identity), while those derived from freshwater rainbow trout had no nucleotide substitutions relative to each other. However, the consensus sequences between isolates from freshwater rainbow trout and those from marine/anadromous hosts differed in 13 to 16 nucleotides (97.8 to 98.2% nucleotide identity).
Nucleotide diversity and linkage disequilibrium in wild avocado (Persea americana Mill.).
Chen, Haofeng; Morrell, Peter L; de la Cruz, Marlene; Clegg, Michael T
2008-01-01
Resequencing studies provide the ultimate resolution of genetic diversity because they identify all mutations in a gene that are present within the sampled individuals. We report a resequencing study of Persea americana, a subtropical tree species native to Meso- and Central America and the progenitor of cultivated avocado. The sample includes 21 wild accessions from Mexico, Costa Rica, Ecuador, and the Dominican Republic. Estimated levels of nucleotide polymorphism and linkage disequilibrium (LD) are obtained from fully resolved haplotype data from 4 nuclear loci that span 5960 nucleotide sites. Results show that, although avocado is a subtropical tree crop and a predominantly outcrossing plant, the overall level of genetic variation is not exceptionally high (nucleotide diversity at silent sites, pi(sil) = 0.0102) compared with available estimates from temperate plant species. Intralocus LD decays rapidly to half the initial value within about 1 kb. Estimates of recombination rate (based on the sequence data) show that the rate is not exceptionally high when compared with annual plants such as wild barley or maize. Interlocus LD is significant owing to substantial population structure induced by mixing of the 3 botanical races of avocado.
IBS: an illustrator for the presentation and visualization of biological sequences.
Liu, Wenzhong; Xie, Yubin; Ma, Jiyong; Luo, Xiaotong; Nie, Peng; Zuo, Zhixiang; Lahrmann, Urs; Zhao, Qi; Zheng, Yueyuan; Zhao, Yong; Xue, Yu; Ren, Jian
2015-10-15
Biological sequence diagrams are fundamental for visualizing various functional elements in protein or nucleotide sequences that enable a summarization and presentation of existing information as well as means of intuitive new discoveries. Here, we present a software package called illustrator of biological sequences (IBS) that can be used for representing the organization of either protein or nucleotide sequences in a convenient, efficient and precise manner. Multiple options are provided in IBS, and biological sequences can be manipulated, recolored or rescaled in a user-defined mode. Also, the final representational artwork can be directly exported into a publication-quality figure. The standalone package of IBS was implemented in JAVA, while the online service was implemented in HTML5 and JavaScript. Both the standalone package and online service are freely available at http://ibs.biocuckoo.org. renjian.sysu@gmail.com or xueyu@hust.edu.cn Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.
IBS: an illustrator for the presentation and visualization of biological sequences
Liu, Wenzhong; Xie, Yubin; Ma, Jiyong; Luo, Xiaotong; Nie, Peng; Zuo, Zhixiang; Lahrmann, Urs; Zhao, Qi; Zheng, Yueyuan; Zhao, Yong; Xue, Yu; Ren, Jian
2015-01-01
Summary: Biological sequence diagrams are fundamental for visualizing various functional elements in protein or nucleotide sequences that enable a summarization and presentation of existing information as well as means of intuitive new discoveries. Here, we present a software package called illustrator of biological sequences (IBS) that can be used for representing the organization of either protein or nucleotide sequences in a convenient, efficient and precise manner. Multiple options are provided in IBS, and biological sequences can be manipulated, recolored or rescaled in a user-defined mode. Also, the final representational artwork can be directly exported into a publication-quality figure. Availability and implementation: The standalone package of IBS was implemented in JAVA, while the online service was implemented in HTML5 and JavaScript. Both the standalone package and online service are freely available at http://ibs.biocuckoo.org. Contact: renjian.sysu@gmail.com or xueyu@hust.edu.cn Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26069263
Pervasive sequence patents cover the entire human genome.
Rosenfeld, Jeffrey A; Mason, Christopher E
2013-01-01
The scope and eligibility of patents for genetic sequences have been debated for decades, but a critical case regarding gene patents (Association of Molecular Pathologists v. Myriad Genetics) is now reaching the US Supreme Court. Recent court rulings have supported the assertion that such patents can provide intellectual property rights on sequences as small as 15 nucleotides (15mers), but an analysis of all current US patent claims and the human genome presented here shows that 15mer sequences from all human genes match at least one other gene. The average gene matches 364 other genes as 15mers; the breast-cancer-associated gene BRCA1 has 15mers matching at least 689 other genes. Longer sequences (1,000 bp) still showed extensive cross-gene matches. Furthermore, 15mer-length claims from bovine and other animal patents could also claim as much as 84% of the genes in the human genome. In addition, when we expanded our analysis to full-length patent claims on DNA from all US patents to date, we found that 41% of the genes in the human genome have been claimed. Thus, current patents for both short and long nucleotide sequences are extraordinarily non-specific and create an uncertain, problematic liability for genomic medicine, especially in regard to targeted re-sequencing and other sequence diagnostic assays.
González-Martínez, Santiago C; Ersoz, Elhan; Brown, Garth R; Wheeler, Nicholas C; Neale, David B
2006-03-01
Genetic association studies are rapidly becoming the experimental approach of choice to dissect complex traits, including tolerance to drought stress, which is the most common cause of mortality and yield losses in forest trees. Optimization of association mapping requires knowledge of the patterns of nucleotide diversity and linkage disequilibrium and the selection of suitable polymorphisms for genotyping. Moreover, standard neutrality tests applied to DNA sequence variation data can be used to select candidate genes or amino acid sites that are putatively under selection for association mapping. In this article, we study the pattern of polymorphism of 18 candidate genes for drought-stress response in Pinus taeda L., an important tree crop. Data analyses based on a set of 21 putatively neutral nuclear microsatellites did not show population genetic structure or genomewide departures from neutrality. Candidate genes had moderate average nucleotide diversity at silent sites (pi(sil) = 0.00853), varying 100-fold among single genes. The level of within-gene LD was low, with an average pairwise r2 of 0.30, decaying rapidly from approximately 0.50 to approximately 0.20 at 800 bp. No apparent LD among genes was found. A selective sweep may have occurred at the early-response-to-drought-3 (erd3) gene, although population expansion can also explain our results and evidence for selection was not conclusive. One other gene, ccoaomt-1, a methylating enzyme involved in lignification, showed dimorphism (i.e., two highly divergent haplotype lineages at equal frequency), which is commonly associated with the long-term action of balancing selection. Finally, a set of haplotype-tagging SNPs (htSNPs) was selected. Using htSNPs, a reduction of genotyping effort of approximately 30-40%, while sampling most common allelic variants, can be gained in our ongoing association studies for drought tolerance in pine.
Brunak, S; Engelbrecht, J
1996-06-01
A direct comparison of experimentally determined protein structures and their corresponding protein coding mRNA sequences has been performed. We examine whether real world data support the hypothesis that clusters of rare codons correlate with the location of structural units in the resulting protein. The degeneracy of the genetic code allows for a biased selection of codons which may control the translational rate of the ribosome, and may thus in vivo have a catalyzing effect on the folding of the polypeptide chain. A complete search for GenBank nucleotide sequences coding for structural entries in the Brookhaven Protein Data Bank produced 719 protein chains with matching mRNA sequence, amino acid sequence, and secondary structure assignment. By neural network analysis, we found strong signals in mRNA sequence regions surrounding helices and sheets. These signals do not originate from the clustering of rare codons, but from the similarity of codons coding for very abundant amino acid residues at the N- and C-termini of helices and sheets. No correlation between the positioning of rare codons and the location of structural units was found. The mRNA signals were also compared with conserved nucleotide features of 16S-like ribosomal RNA sequences and related to mechanisms for maintaining the correct reading frame by the ribosome.