Elastohydrodynamic film thickness model for heavily loaded contacts

NASA Technical Reports Server (NTRS)

Loewenthal, S. H.; Parker, R. J.; Zaretsky, E. V.

1973-01-01

An empirical elastohydrodynamic (EHD) film thickness formula for predicting the minimum film thickness occurring within heavily loaded contacts (maximum Hertz stresses above 150,000 psi) was developed. The formula was based upon X-ray film thickness measurements made with synthetic paraffinic, fluorocarbon, Type II ester and polyphenyl ether fluids covering a wide range of test conditions. Comparisons were made between predictions from an isothermal EHD theory and the test data. The deduced relationship was found to adequately reflect the high-load dependence exhibited by the measured data. The effects of contact geometry, material and lubricant properties on the form of the empirical model are also discussed.

Some special features of Wigner’s mass formula for nuclei

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nurmukhamedov, A. M., E-mail: fattah52@mail.ru

2014-12-15

Experimental data on anomalous values of the empirical function b(A) in Wigner’s mass formula are presented, the application of Student’s t criterion in experimentally proving the restoration of Wigner’s SU(4) symmetry in nuclei is validated, and a physical interpretation of the basic parameter of the empirical function a(A) in Wigner’s mass formula is given.

Empirical investigation of a field theory formula and Black's formula for the price of an interest-rate caplet

NASA Astrophysics Data System (ADS)

Baaquie, Belal E.; Liang, Cui

2007-01-01

The industry standard for pricing an interest-rate caplet is Black's formula. Another distinct price of the same caplet can be derived using a quantum field theory model of the forward interest rates. An empirical study is carried out to compare the two caplet pricing formulae. Historical volatility and correlation of forward interest rates are used to generate the field theory caplet price; another approach is to fit a parametric formula for the effective volatility using market caplet price. The study shows that the field theory model generates the price of a caplet and cap fairly accurately. Black's formula for a caplet is compared with field theory pricing formula. It is seen that the field theory formula for caplet price has many advantages over Black's formula.

Effect of homophily on network formation

NASA Astrophysics Data System (ADS)

Kim, Kibae; Altmann, Jörn

2017-03-01

Although there is much research on network formation based on the preferential attachment rule, the research did not come up with a formula that, on the one hand, can reproduce shapes of cumulative degree distributions of empirical complex networks and, on the other hand, can represent intuitively theories on individual behavior. In this paper, we propose a formula that closes this gap by integrating into the formula for the preferential attachment rule (i.e., a node with higher degree is more likely to gain a new link) a representation of the theory of individual behavior with respect to nodes preferring to connect to other nodes with similar attributes (i.e., homophily). Based on this formula, we simulate the shapes of cumulative degree distributions for different levels of homophily and five different seed networks. Our simulation results suggest that homophily and the preferential attachment rule interact for all five types of seed networks. Surprisingly, the resulting cumulative degree distribution in log-log scale always shifts from a concave shape to a convex shape, as the level of homophily gets larger. Therefore, our formula can explain intuitively why some of the empirical complex networks show a linear cumulative degree distribution in log-log scale while others show either a concave or convex shape. Furthermore, another major finding indicates that homophily makes people of a group richer than people outside this group, which is a surprising and significant finding.

An Empirical Formula From Ion Exchange Chromatography and Colorimetry.

ERIC Educational Resources Information Center

Johnson, Steven D.

1996-01-01

Presents a detailed procedure for finding an empirical formula from ion exchange chromatography and colorimetry. Introduces students to more varied techniques including volumetric manipulation, titration, ion-exchange, preparation of a calibration curve, and the use of colorimetry. (JRH)

GPS-Derived Precipitable Water Compared with the Air Force Weather Agency’s MM5 Model Output

DTIC Science & Technology

2002-03-26

and less then 100 sensors are available throughout Europe . While the receiver density is currently comparable to the upper-air sounding network...profiles from 38 upper air sites throughout Europe . Based on these empirical formulae and simplifications, Bevis (1992) has determined that the error...Alaska using Bevis’ (1992) empirical correlation based on 8718 radiosonde calculations over 2 years. Other studies have been conducted in Europe and

The analysis of predictability of recent alpha decay formulae and the alpha partial half-lives of some exotic nuclei

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dasgupta-Schubert, N.; Reyes, M. A.; Tamez, V. A.

2009-04-20

Alpha decay is one of the two main decay modes of the heaviest nuclei, (SHE), and constitutes one of the dominant decay modes of highly neutron deficient medium mass nuclei ('exotics'). Thus identifying and characterizing the alpha decay chains form a crucial part of the identification of SHE. We report the extension of the previously developed method for the detailed and systematic investigation of the reliability of the three main extant analytical formulae of alpha decay half-lives: the generalized liquid drop model based formula of Royer et al. (FR), the Sobiczewski modified semi-empirical Viola-Seaborg formula (VSS) and the recent phenomenologicalmore » formula of Sobiczewski and Parkhomenko (SP)« less

Investigation of 14-15 MeV ( n, t) Reaction Cross-sections by Using New Evaluated Empirical and Semi-empirical Systematic Formulas

NASA Astrophysics Data System (ADS)

Tel, E.; Aydın, A.; Kaplan, A.; Şarer, B.

2008-09-01

In the hybrid reactor, tritium self-sufficiency must be maintained for a commercial power plant. For self-sustaining (D-T) fusion driver tritium breeding ratio should be greater than 1.05. Working out the systematics of ( n, t) reaction cross-sections are of great importance for the definition of the excitation function character for the given reaction taking place on various nuclei at energies up to 20 MeV. In this study we have investigated asymmetry term effect for the ( n, t) reaction cross-sections at 14-15 neutron incident energy. It has been discussed the odd-even effect and the pairing effect considering binding energy systematic of the nuclear shell model for the new experimental data and new cross-sections formulas ( n, t) reactions developed by Tel et al. We have determined a different parameter groups by the classification of nuclei into even-even, even-odd and odd-even for ( n, t) reactions cross-sections. The obtained empirical and semi-empirical formulas by fitting two parameter for ( n, t) reactions were given. All calculated results have been compared with the experimental data and the other semi-empirical formulas.

Using Paperclips to Explain Empirical Formulas to Students

ERIC Educational Resources Information Center

Nassiff, Peter; Czerwinski, Wendy A.

2014-01-01

Early in their chemistry education, students learn to do empirical formula calculations by rote without an understanding of the historical context behind them or the reason why their calculations work. In these activities, students use paperclip "atoms", construct a series of simple compounds representing real molecules, and discover,…

An empirical formula to calculate the full energy peak efficiency of scintillation detectors.

PubMed

Badawi, Mohamed S; Abd-Elzaher, Mohamed; Thabet, Abouzeid A; El-khatib, Ahmed M

2013-04-01

This work provides an empirical formula to calculate the FEPE for different detectors using the effective solid angle ratio derived from experimental measurements. The full energy peak efficiency (FEPE) curves of the (2″(*)2″) NaI(Tl) detector at different seven axial distances from the detector were depicted in a wide energy range from 59.53 to 1408keV using standard point sources. The distinction was based on the effects of the source energy and the source-to-detector distance. A good agreement was noticed between the measured and calculated efficiency values for the source-to-detector distances at 20, 25, 30, 35, 40, 45 and 50cm. Copyright © 2012 Elsevier Ltd. All rights reserved.

Design flood hydrograph estimation procedure for small and fully-ungauged basins

NASA Astrophysics Data System (ADS)

Grimaldi, S.; Petroselli, A.

2013-12-01

The Rational Formula is the most applied equation in practical hydrology due to its simplicity and the effective compromise between theory and data availability. Although the Rational Formula is affected by several drawbacks, it is reliable and surprisingly accurate considering the paucity of input information. However, after more than a century, the recent computational, theoretical, and large-scale monitoring progresses compel us to try to suggest a more advanced yet still empirical procedure for estimating peak discharge in small and ungauged basins. In this contribution an alternative empirical procedure (named EBA4SUB - Event Based Approach for Small and Ungauged Basins) based on the common modelling steps: design hyetograph, rainfall excess, and rainfall-runoff transformation, is described. The proposed approach, accurately adapted for the fully-ungauged basin condition, provides a potentially better estimation of the peak discharge, a design hydrograph shape, and, most importantly, reduces the subjectivity of the hydrologist in its application.

An empirical relationship for homogenization in single-phase binary alloy systems

NASA Technical Reports Server (NTRS)

Unnam, J.; Tenney, D. R.; Stein, B. A.

1979-01-01

A semiempirical formula is developed for describing the extent of interaction between constituents in single-phase binary alloy systems with planar, cylindrical, or spherical interfaces. The formula contains two parameters that are functions of mean concentration and interface geometry of the couple. The empirical solution is simple, easy to use, and does not involve sequential calculations, thereby allowing quick estimation of the extent of interactions without lengthy calculations. Results obtained with this formula are in good agreement with those from a finite-difference analysis.

The Empirical Formula of Silver Sulfide: An Experiment for Introductory Chemistry

ERIC Educational Resources Information Center

Trujillo, Carlos Alexander

2007-01-01

An experiment is described that allows students to experimentally determine an empirical formula for silver sulfide. At elevated temperatures, silver sulfide reacts in air to form silver, silver sulfate, and sulfur dioxide. At higher temperatures (960 [degree]C) silver sulfate decomposes to produce metallic silver. (Contains 1 figure and 1 table.)

Towards a Trans-Disciplinary Methodology for a Game-Based Intervention Development Process

ERIC Educational Resources Information Center

Arnab, Sylvester; Clarke, Samantha

2017-01-01

The application of game-based learning adds play into educational and instructional contexts. Even though there is a lack of standard methodologies or formulaic frameworks to better inform game-based intervention development, there exist scientific and empirical studies that can serve as benchmarks for establishing scientific validity in terms of…

Estimation of the alpha decay of Platinum isotopes using different versions of theoretical formula

NASA Astrophysics Data System (ADS)

Hosseini, S. S.; Hassanabadi, H.; Sobhani, H.

The alpha decay half-lives of even-even and even-odd Platinum (Pt) nuclei have been studied within the Coulomb and proximity potential model (CPPM). The present study is restricted to even-even nuclei with A = 166-198. The results are compared with other calculations such as the Semi-empirical formula (SemFIS) from Poenaru et al. based on fission theory of alpha decay, the Viola-Seaborg (VS), Royer (R) and Brown formulae. Also, the alpha decay half-lives have been calculated using the Scaling law of Brown (SLB), the Universal Decay Law (UDL) of Qi et al., the Scaling Law of Horoi et al. (SLH), and Akrawy-Dorin formula (ADF) of Akrawy and Poenaru, which are the Royer modified formula for alpha decay half-live by adding asymmetry term.

Systematics of capture and fusion dynamics in heavy-ion collisions

NASA Astrophysics Data System (ADS)

Wang, Bing; Wen, Kai; Zhao, Wei-Juan; Zhao, En-Guang; Zhou, Shan-Gui

2017-03-01

We perform a systematic study of capture excitation functions by using an empirical coupled-channel (ECC) model. In this model, a barrier distribution is used to take effectively into account the effects of couplings between the relative motion and intrinsic degrees of freedom. The shape of the barrier distribution is of an asymmetric Gaussian form. The effect of neutron transfer channels is also included in the barrier distribution. Based on the interaction potential between the projectile and the target, empirical formulas are proposed to determine the parameters of the barrier distribution. Theoretical estimates for barrier distributions and calculated capture cross sections together with experimental cross sections of 220 reaction systems with 182 ⩽ZPZT ⩽ 1640 are tabulated. The results show that the ECC model together with the empirical formulas for parameters of the barrier distribution work quite well in the energy region around the Coulomb barrier. This ECC model can provide prediction of capture cross sections for the synthesis of superheavy nuclei as well as valuable information on capture and fusion dynamics.

Sub-diffusive scattering parameter maps recovered using wide-field high-frequency structured light imaging.

PubMed

Kanick, Stephen Chad; McClatchy, David M; Krishnaswamy, Venkataramanan; Elliott, Jonathan T; Paulsen, Keith D; Pogue, Brian W

2014-10-01

This study investigates the hypothesis that structured light reflectance imaging with high spatial frequency patterns [Formula: see text] can be used to quantitatively map the anisotropic scattering phase function distribution [Formula: see text] in turbid media. Monte Carlo simulations were used in part to establish a semi-empirical model of demodulated reflectance ([Formula: see text]) in terms of dimensionless scattering [Formula: see text] and [Formula: see text], a metric of the first two moments of the [Formula: see text] distribution. Experiments completed in tissue-simulating phantoms showed that simultaneous analysis of [Formula: see text] spectra sampled at multiple [Formula: see text] in the frequency range [0.05-0.5] [Formula: see text] allowed accurate estimation of both [Formula: see text] in the relevant tissue range [0.4-1.8] [Formula: see text], and [Formula: see text] in the range [1.4-1.75]. Pilot measurements of a healthy volunteer exhibited [Formula: see text]-based contrast between scar tissue and surrounding normal skin, which was not as apparent in wide field diffuse imaging. These results represent the first wide-field maps to quantify sub-diffuse scattering parameters, which are sensitive to sub-microscopic tissue structures and composition, and therefore, offer potential for fast diagnostic imaging of ultrastructure on a size scale that is relevant to surgical applications.

A theoretical model of the relationship between the h-index and other simple citation indicators.

PubMed

Bertoli-Barsotti, Lucio; Lando, Tommaso

2017-01-01

Of the existing theoretical formulas for the h -index, those recently suggested by Burrell (J Informetr 7:774-783, 2013b) and by Bertoli-Barsotti and Lando (J Informetr 9(4):762-776, 2015) have proved very effective in estimating the actual value of the h -index Hirsch (Proc Natl Acad Sci USA 102:16569-16572, 2005), at least at the level of the individual scientist. These approaches lead (or may lead) to two slightly different formulas, being based, respectively, on a "standard" and a "shifted" version of the geometric distribution. In this paper, we review the genesis of these two formulas-which we shall call the "basic" and "improved" Lambert- W formula for the h -index-and compare their effectiveness with that of a number of instances taken from the well-known Glänzel-Schubert class of models for the h -index (based, instead, on a Paretian model) by means of an empirical study. All the formulas considered in the comparison are "ready-to-use", i.e., functions of simple citation indicators such as: the total number of publications; the total number of citations; the total number of cited paper; the number of citations of the most cited paper. The empirical study is based on citation data obtained from two different sets of journals belonging to two different scientific fields: more specifically, 231 journals from the area of "Statistics and Mathematical Methods" and 100 journals from the area of "Economics, Econometrics and Finance", totaling almost 100,000 and 20,000 publications, respectively. The citation data refer to different publication/citation time windows, different types of "citable" documents, and alternative approaches to the analysis of the citation process ("prospective" and "retrospective"). We conclude that, especially in its improved version, the Lambert- W formula for the h -index provides a quite robust and effective ready-to-use rule that should be preferred to other known formulas if one's goal is (simply) to derive a reliable estimate of the h -index.

Experimental study on thrust and power of flapping-wing system based on rack-pinion mechanism.

PubMed

Nguyen, Tuan Anh; Vu Phan, Hoang; Au, Thi Kim Loan; Park, Hoon Cheol

2016-06-20

This experimental study investigates the effect of three parameters: wing aspect ratio (AR), wing offset, and flapping frequency, on thrust generation and power consumption of a flapping-wing system based on a rack-pinion mechanism. The new flapping-wing system is simple but robust, and is able to create a large flapping amplitude. The thrust measured by a load cell reveals that for a given power, the flapping-wing system using a higher wing AR produces larger thrust and higher flapping frequency at the wing offset of 0.15[Formula: see text] or 0.20[Formula: see text] ([Formula: see text] is the mean chord) than other wing offsets. Of the three parameters, the flapping frequency plays a more significant role on thrust generation than either the wing AR or the wing offset. Based on the measured thrusts, an empirical equation for thrust prediction is suggested, as a function of wing area, flapping frequency, flapping angle, and wing AR. The difference between the predicted and measured thrusts was less than 7%, which proved that the empirical equation for thrust prediction is reasonable. On average, the measured power consumption to flap the wings shows that 46.5% of the input power is spent to produce aerodynamic forces, 14.0% to overcome inertia force, 9.5% to drive the rack-pinion-based flapping mechanism, and 30.0% is wasted as the power loss of the installed motor. From the power analysis, it is found that the wing with an AR of 2.25 using a wing offset of 0.20[Formula: see text] showed the optimal power loading in the flapping-wing system. In addition, the flapping frequency of 25 Hz is recommended as the optimal frequency of the current flapping-wing system for high efficiency, which was 48.3%, using a wing with an AR of 2.25 and a wing offset of 0.20[Formula: see text] in the proposed design.

A simple calculation method for determination of equivalent square field.

PubMed

Shafiei, Seyed Ali; Hasanzadeh, Hadi; Shafiei, Seyed Ahmad

2012-04-01

Determination of the equivalent square fields for rectangular and shielded fields is of great importance in radiotherapy centers and treatment planning software. This is accomplished using standard tables and empirical formulas. The goal of this paper is to present a formula based on analysis of scatter reduction due to inverse square law to obtain equivalent field. Tables are published by different agencies such as ICRU (International Commission on Radiation Units and measurements), which are based on experimental data; but there exist mathematical formulas that yield the equivalent square field of an irregular rectangular field which are used extensively in computation techniques for dose determination. These processes lead to some complicated and time-consuming formulas for which the current study was designed. In this work, considering the portion of scattered radiation in absorbed dose at a point of measurement, a numerical formula was obtained based on which a simple formula was developed to calculate equivalent square field. Using polar coordinate and inverse square law will lead to a simple formula for calculation of equivalent field. The presented method is an analytical approach based on which one can estimate the equivalent square field of a rectangular field and may be used for a shielded field or an off-axis point. Besides, one can calculate equivalent field of rectangular field with the concept of decreased scatter radiation with inverse square law with a good approximation. This method may be useful in computing Percentage Depth Dose and Tissue-Phantom Ratio which are extensively used in treatment planning.

Study of a generalized birks formula for the scintillation response of a CaMoO4 crystal

NASA Astrophysics Data System (ADS)

Lee, J. Y.; Kim, H. J.; Kang, Sang Jun; Lee, M. H.

2017-12-01

We have investigated the scintillation characteristics of CaMoO4 (CMO) crystals by using a gamma source and various internal alpha sources. A 137Cs source with 662-keV gamma-rays was used for the gamma-quanta light yield calibration. Internal radioactive contaminations provided alpha particles with different energies from 5.41 to 7.88 MeV. We developed a C++ program based on the ROOT package for the fitting of parameters in a generalized Birks semi-empirical formula by combining the experimental and the simulation data. Results for the fitted Birks parameters are k b1 = 3.3 × 10 -3 (g/MeVcm2) for the 1st parameter and k b2 = 7.9 × 10 -5 (g/MeVcm2)2 for the 2nd parameter. The χ2/n.d.f. (Number of Degree of Freedom) is calculated as 0.1/4. We were able to estimate the 238U and 234U contaminations in a CMO crystal by using the generalized Birks semi-empirical formula.

Error Rates in Measuring Teacher and School Performance Based on Student Test Score Gains. NCEE 2010-4004

ERIC Educational Resources Information Center

Schochet, Peter Z.; Chiang, Hanley S.

2010-01-01

This paper addresses likely error rates for measuring teacher and school performance in the upper elementary grades using value-added models applied to student test score gain data. Using realistic performance measurement system schemes based on hypothesis testing, we develop error rate formulas based on OLS and Empirical Bayes estimators.…

Estimating wildfire behavior and effects

Treesearch

Frank A. Albini

1976-01-01

This paper presents a brief survey of the research literature on wildfire behavior and effects and assembles formulae and graphical computation aids based on selected theoretical and empirical models. The uses of mathematical fire behavior models are discussed, and the general capabilities and limitations of currently available models are outlined.

A simple calculation method for determination of equivalent square field

PubMed Central

Shafiei, Seyed Ali; Hasanzadeh, Hadi; Shafiei, Seyed Ahmad

2012-01-01

Determination of the equivalent square fields for rectangular and shielded fields is of great importance in radiotherapy centers and treatment planning software. This is accomplished using standard tables and empirical formulas. The goal of this paper is to present a formula based on analysis of scatter reduction due to inverse square law to obtain equivalent field. Tables are published by different agencies such as ICRU (International Commission on Radiation Units and measurements), which are based on experimental data; but there exist mathematical formulas that yield the equivalent square field of an irregular rectangular field which are used extensively in computation techniques for dose determination. These processes lead to some complicated and time-consuming formulas for which the current study was designed. In this work, considering the portion of scattered radiation in absorbed dose at a point of measurement, a numerical formula was obtained based on which a simple formula was developed to calculate equivalent square field. Using polar coordinate and inverse square law will lead to a simple formula for calculation of equivalent field. The presented method is an analytical approach based on which one can estimate the equivalent square field of a rectangular field and may be used for a shielded field or an off-axis point. Besides, one can calculate equivalent field of rectangular field with the concept of decreased scatter radiation with inverse square law with a good approximation. This method may be useful in computing Percentage Depth Dose and Tissue-Phantom Ratio which are extensively used in treatment planning. PMID:22557801

Assessment of Simple Models for Molecular Simulation of Ethylene Carbonate and Propylene Carbonate as Solvents for Electrolyte Solutions.

PubMed

Chaudhari, Mangesh I; Muralidharan, Ajay; Pratt, Lawrence R; Rempe, Susan B

2018-02-12

Progress in understanding liquid ethylene carbonate (EC) and propylene carbonate (PC) on the basis of molecular simulation, emphasizing simple models of interatomic forces, is reviewed. Results on the bulk liquids are examined from the perspective of anticipated applications to materials for electrical energy storage devices. Preliminary results on electrochemical double-layer capacitors based on carbon nanotube forests and on model solid-electrolyte interphase (SEI) layers of lithium ion batteries are considered as examples. The basic results discussed suggest that an empirically parameterized, non-polarizable force field can reproduce experimental structural, thermodynamic, and dielectric properties of EC and PC liquids with acceptable accuracy. More sophisticated force fields might include molecular polarizability and Buckingham-model description of inter-atomic overlap repulsions as extensions to Lennard-Jones models of van der Waals interactions. Simple approaches should be similarly successful also for applications to organic molecular ions in EC/PC solutions, but the important case of Li[Formula: see text] deserves special attention because of the particularly strong interactions of that small ion with neighboring solvent molecules. To treat the Li[Formula: see text] ions in liquid EC/PC solutions, we identify interaction models defined by empirically scaled partial charges for ion-solvent interactions. The empirical adjustments use more basic inputs, electronic structure calculations and ab initio molecular dynamics simulations, and also experimental results on Li[Formula: see text] thermodynamics and transport in EC/PC solutions. Application of such models to the mechanism of Li[Formula: see text] transport in glassy SEI models emphasizes the advantage of long time-scale molecular dynamics studies of these non-equilibrium materials.

A Method for Computing Leading-Edge Loads

NASA Technical Reports Server (NTRS)

Rhode, Richard V; Pearson, Henry A

1933-01-01

In this report a formula is developed that enables the determination of the proper design load for the portion of the wing forward of the front spar. The formula is inherently rational in concept, as it takes into account the most important variables that affect the leading-edge load, although theoretical rigor has been sacrificed for simplicity and ease of application. Some empirical corrections, based on pressure distribution measurements on the PW-9 and M-3 airplanes have been introduced to provide properly for biplanes. Results from the formula check experimental values in a variety of cases with good accuracy in the critical loading conditions. The use of the method for design purposes is therefore felt to be justified and is recommended.

Stress intensity factors for part-elliptical cracks emanating from dimpled rivet holes

NASA Astrophysics Data System (ADS)

Wang, Ailun; She, Chongmin; Lin, Gang; Zhou, You; Guo, Wanlin

2014-11-01

Detailed investigations on the stress intensity factors (SIFs) for corner cracks emanated from interference fitted dimpled rivet holes are conducted using three-dimensional finite element method. The influences of the crack length a, elliptical shape factor t, far-end stress S and interference magnitude δ on the stress intensity factors are systematically studied. The SIFs for corner cracks emanated from open holes are also investigated for comparisons. An empirical formula of the normalized SIF is proposed by use of the least square method for convenience of the engineering application, which is a function of the crack length a, elliptical shape factor t, far-end stress S, interference magnitude δ and the normalized elliptical centrifugal angle φn. Based on the empirical formula, a crack growth simulation for a rivet filled hole is conducted, which shows a good agreement with the test data.

Simplified analysis about horizontal displacement of deep soil under tunnel excavation

NASA Astrophysics Data System (ADS)

Tian, Xiaoyan; Gu, Shuancheng; Huang, Rongbin

2017-11-01

Most of the domestic scholars focus on the study about the law of the soil settlement caused by subway tunnel excavation, however, studies on the law of horizontal displacement are lacking. And it is difficult to obtain the horizontal displacement data of any depth in the project. At present, there are many formulas for calculating the settlement of soil layers. In terms of integral solutions of Mindlin classic elastic theory, stochastic medium theory, source-sink theory, the Peck empirical formula is relatively simple, and also has a strong applicability at home. Considering the incompressibility of rock and soil mass, based on the principle of plane strain, the calculation formula of the horizontal displacement of the soil along the cross section of the tunnel was derived by using the Peck settlement formula. The applicability of the formula is verified by comparing with the existing engineering cases, a simple and rapid analytical method for predicting the horizontal displacement is presented.

Study on the leakage flow through a clearance gap between two stationary walls

NASA Astrophysics Data System (ADS)

Zhao, W.; Billdal, J. T.; Nielsen, T. K.; Brekke, H.

2012-11-01

In the present paper, the leakage flow in the clearance gap between stationary walls was studied experimentally, theoretically and numerically by the computational fluid dynamics (CFD) in order to find the relationship between leakage flow, pressure difference and clearance gap. The experimental set-up of the clearance gap between two stationary walls is the simplification of the gap between the guide vane faces and facing plates in Francis turbines. This model was built in the Waterpower laboratory at Norwegian University of Science and Technology (NTNU). The empirical formula for calculating the leakage flow rate between the two stationary walls was derived from the empirical study. The experimental model is simulated by computational fluid dynamics employing the ANSYS CFX commercial software in order to study the flow structure. Both numerical simulation results and empirical formula results are in good agreement with the experimental results. The correction of the empirical formula is verified by experimental data and has been proven to be very useful in terms of quickly predicting the leakage flow rate in the guide vanes for hydraulic turbines.

Risk-adjusted capitation payments for catastrophic risks based on multi-year prior costs.

PubMed

van Barneveld, E M; van Vliet, R C; van de Ven, W P

1997-02-01

In many countries regulated competition among health insurance companies has recently been proposed or implemented. A crucial issue is whether or not the benefits package offered by competing insurers should also cover catastrophic risks (like several forms of expensive long-term care) in addition to non-catastrophic risks (like hospital care and physician services). In 1988 the Dutch government proposed compulsory national health insurance based on regulated competition among insurer as well as among providers of care. The competing insurers should offer a benefits package covering both non-catastrophic risks and catastrophic risks. The insurers would be largely financed via risk-adjusted capitation payments. The government intended to use a capitation formula that is, besides some demographic variables, based on multi-year prior costs. This paper presents the results of an explorative empirical analysis of the possible consequences of such a capitation formula for catastrophic risks. The main conclusion is that this formula would be inadequate because it would leave ample room for cream skimming.

Methods of forming single source precursors, methods of forming polymeric single source precursors, and single source precursors formed by such methods

DOEpatents

Fox, Robert V.; Rodriguez, Rene G.; Pak, Joshua J.; Sun, Chivin; Margulieux, Kelsey R.; Holland, Andrew W.

2016-04-19

Methods of forming single source precursors (SSPs) include forming intermediate products having the empirical formula 1/2{L.sub.2N(.mu.-X).sub.2M'X.sub.2}.sub.2, and reacting MER with the intermediate products to form SSPs of the formula L.sub.2N(.mu.-ER).sub.2M'(ER).sub.2, wherein L is a Lewis base, M is a Group IA atom, N is a Group IB atom, M' is a Group IIIB atom, each E is a Group VIB atom, each X is a Group VIIA atom or a nitrate group, and each R group is an alkyl, aryl, vinyl, (per)fluoro alkyl, (per)fluoro aryl, silane, or carbamato group. Methods of forming polymeric or copolymeric SSPs include reacting at least one of HE.sup.1R.sup.1E.sup.1H and MER with one or more substances having the empirical formula L.sub.2N(.mu.-ER).sub.2M'(ER).sub.2 or L.sub.2N(.mu.-X).sub.2M'(X).sub.2 to form a polymeric or copolymeric SSP. New SSPs and intermediate products are formed by such methods.

Methods of forming single source precursors, methods of forming polymeric single source precursors, and single source precursors formed by such methods

DOEpatents

Fox, Robert V.; Rodriguez, Rene G.; Pak, Joshua J.; Sun, Chivin; Margulieux, Kelsey R.; Holland, Andrew W.

2014-09-09

Methods of forming single source precursors (SSPs) include forming intermediate products having the empirical formula 1/2{L.sub.2N(.mu.-X).sub.2M'X.sub.2}.sub.2, and reacting MER with the intermediate products to form SSPs of the formula L.sub.2N(.mu.-ER).sub.2M'(ER).sub.2, wherein L is a Lewis base, M is a Group IA atom, N is a Group IB atom, M' is a Group IIIB atom, each E is a Group VIB atom, each X is a Group VIIA atom or a nitrate group, and each R group is an alkyl, aryl, vinyl, (per)fluoro alkyl, (per)fluoro aryl, silane, or carbamato group. Methods of forming polymeric or copolymeric SSPs include reacting at least one of HE.sup.1R.sup.1E.sup.1H and MER with one or more substances having the empirical formula L.sub.2N(.mu.-ER).sub.2M'(ER).sub.2 or L.sub.2N(.mu.-X).sub.2M'(X).sub.2 to form a polymeric or copolymeric SSP. New SSPs and intermediate products are formed by such methods.

Analysis of the Contribution of Wind Drift Factor to Oil Slick Movement under Strong Tidal Condition: Hebei Spirit Oil Spill Case

PubMed Central

Kim, Tae-Ho; Yang, Chan-Su; Oh, Jeong-Hwan; Ouchi, Kazuo

2014-01-01

The purpose of this study is to investigate the effects of the wind drift factor under strong tidal conditions in the western coastal area of Korea on the movement of oil slicks caused by the Hebei Spirit oil spill accident in 2007. The movement of oil slicks was computed using a simple simulation model based on the empirical formula as a function of surface current, wind speed, and the wind drift factor. For the simulation, the Environmental Fluid Dynamics Code (EFDC) model and Automatic Weather System (AWS) were used to generate tidal and wind fields respectively. Simulation results were then compared with 5 sets of spaceborne optical and synthetic aperture radar (SAR) data. From the present study, it was found that highest matching rate between the simulation results and satellite imagery was obtained with different values of the wind drift factor, and to first order, this factor was linearly proportional to the wind speed. Based on the results, a new modified empirical formula was proposed for forecasting the movement of oil slicks on the coastal area. PMID:24498094

An Empirical Comparison of Formulas Evaluating Early Intervention Program Impact on Development.

ERIC Educational Resources Information Center

Rosenberg, Steven A.; And Others

1987-01-01

The study evaluated developmental progress in three groups of infants (9-30 months) presenting Down syndrome (n=28), mild disability (n=16), or moderate/severe disabilities (n=16). To evaluate intervention impact, formulas that measure rate of development and change in rate of development were computed. Findings indicated rate change formulas were…

Students' Understanding of Chemical Formulae: A Review of Empirical Research

ERIC Educational Resources Information Center

Taskin, Vahide; Bernholt, Sascha

2014-01-01

The fluent use of the chemical language is a major tool for successfully passing chemistry courses at school or university as well as for working as a chemist, since chemical formulae are both a descriptive and a heuristic tool. However, numerous studies have revealed remarkable difficulties of students with chemical formulae both at school and at…

The Implications of Fiscal Incentives on Identification Rates and Placement in Special Education: Formulas for Influencing Best Practice

ERIC Educational Resources Information Center

Mahitivanichcha, Kanya; Parrish, Thomas

2005-01-01

This article explores possible fiscal incentives associated with various state formulas for allocating special education funds and the degree to which such incentives affect special education. First we review empirical and contextual evidence in the literature that addresses the relationship between funding formulas and special education…

An alternative method for centrifugal compressor loading factor modelling

NASA Astrophysics Data System (ADS)

Galerkin, Y.; Drozdov, A.; Rekstin, A.; Soldatova, K.

2017-08-01

The loading factor at design point is calculated by one or other empirical formula in classical design methods. Performance modelling as a whole is out of consideration. Test data of compressor stages demonstrates that loading factor versus flow coefficient at the impeller exit has a linear character independent of compressibility. Known Universal Modelling Method exploits this fact. Two points define the function - loading factor at design point and at zero flow rate. The proper formulae include empirical coefficients. A good modelling result is possible if the choice of coefficients is based on experience and close analogs. Earlier Y. Galerkin and K. Soldatova had proposed to define loading factor performance by the angle of its inclination to the ordinate axis and by the loading factor at zero flow rate. Simple and definite equations with four geometry parameters were proposed for loading factor performance calculated for inviscid flow. The authors of this publication have studied the test performance of thirteen stages of different types. The equations are proposed with universal empirical coefficients. The calculation error lies in the range of plus to minus 1,5%. The alternative model of a loading factor performance modelling is included in new versions of the Universal Modelling Method.

Readability Formulas as Applied to College Economics Textbooks.

ERIC Educational Resources Information Center

McConnell, Campbell R.

1982-01-01

Determines from empirical information on the application of four readability formulas to a group of widely used college economics textbooks that there is no consistency in the absolute reading levels or the rank orderings of these books. (AEA)

A review of physically based models for soil erosion by water

NASA Astrophysics Data System (ADS)

Le, Minh-Hoang; Cerdan, Olivier; Sochala, Pierre; Cheviron, Bruno; Brivois, Olivier; Cordier, Stéphane

2010-05-01

Physically-based models rely on fundamental physical equations describing stream flow and sediment and associated nutrient generation in a catchment. This paper reviews several existing erosion and sediment transport approaches. The process of erosion include soil detachment, transport and deposition, we present various forms of equations and empirical formulas used when modelling and quantifying each of these processes. In particular, we detail models describing rainfall and infiltration effects and the system of equations to describe the overland flow and the evolution of the topography. We also present the formulas for the flow transport capacity and the erodibility functions. Finally, we present some recent numerical schemes to approach the shallow water equations and it's coupling with infiltration and erosion source terms.

Analysis on ventilation pressure of fire area in longitudinal ventilation of underground tunnel

NASA Astrophysics Data System (ADS)

Li, Jiaxin; Li, Yanfeng; Feng, Xiao; Li, Junmei

2018-03-01

In order to solve the problem of ventilation pressure loss in the fire area under the fire condition, the wind pressure loss model of the fire area is established based on the thermodynamic equilibrium relation. The semi-empirical calculation formula is obtained by using the model experiment and CFD simulation. The validity of the formula is verified. The results show that the ventilation pressure loss in the fire zone is proportional to the convective heat release rate at the critical velocity, which is inversely proportional to the upstream ventilation velocity and the tunnel cross-sectional area. The proposed formula is consistent with the law of the tunnel fire test fitting formula that results are close, in contrast, the advantage lies in a clear theoretical basis and ventilation velocity values. The resistance of road tunnel ventilation system is calculated accurately and reliably, and then an effective emergency ventilation operation program is developed. It is necessary to consider the fire zone ventilation pressure loss. The proposed ventilation pressure loss formula can be used for design calculation after thorough verification.

Absorption coefficients of silicon: A theoretical treatment

NASA Astrophysics Data System (ADS)

Tsai, Chin-Yi

2018-05-01

A theoretical model with explicit formulas for calculating the optical absorption and gain coefficients of silicon is presented. It incorporates direct and indirect interband transitions and considers the effects of occupied/unoccupied carrier states. The indirect interband transition is calculated from the second-order time-independent perturbation theory of quantum mechanics by incorporating all eight possible routes of absorption or emission of photons and phonons. Absorption coefficients of silicon are calculated from these formulas. The agreements and discrepancies among the calculated results, the Rajkanan-Singh-Shewchun (RSS) formula, and Green's data are investigated and discussed. For example, the RSS formula tends to overestimate the contributions of indirect transitions for cases with high photon energy. The results show that the state occupied/unoccupied effect is almost negligible for silicon absorption coefficients up to the onset of the optical gain condition where the energy separation of Quasi-Femi levels between electrons and holes is larger than the band-gap energy. The usefulness of using the physics-based formulas, rather than semi-empirical fitting ones, for absorption coefficients in theoretical studies of photovoltaic devices is also discussed.

Effect of Time and Temperature on Thickened Infant Formula.

PubMed

Gosa, Memorie M; Dodrill, Pamela

2017-04-01

Unlike adult populations, who primarily depend on liquids for hydration alone, infants rely on liquids to provide them with hydration and nutrition. Speech-language pathologists working within pediatric medical settings often identify dysphagia in patients and subsequently recommend thickened liquids to reduce aspiration risk. Caregivers frequently report difficulty attempting to prepare infant formula to the prescribed thickness. This study was designed to determine (1) the relationship between consistencies in modified barium swallow studies and thickened infant formulas and (2) the effects of time and temperature on the resulting thickness of infant formula. Prepackaged barium consistencies and 1 standard infant formula that was thickened with rice cereal and with 2 commercially available thickening agents were studied. Thickness was determined via a line spread test after various time and temperature conditions were met. There were significant differences between the thickened formula and barium test consistencies. Formula thickened with rice cereal separated over time into thin liquid and solid residue. Formula thickened with a starch-based thickening agent was thicker than the desired consistency immediately after mixing, and it continued to thicken over time. The data from this project suggest that nectar-thick and honey-thick infant formulas undergo significant changes in flow rates within 30 minutes of preparation or if refrigerated and then reheated after 3 hours. Additional empirical evidence is warranted to determine the most reliable methods and safest products for thickening infant formula when necessary for effective dysphagia management.

Parametric study on single shot peening by dimensional analysis method incorporated with finite element method

NASA Astrophysics Data System (ADS)

Wu, Xian-Qian; Wang, Xi; Wei, Yan-Peng; Song, Hong-Wei; Huang, Chen-Guang

2012-06-01

Shot peening is a widely used surface treatment method by generating compressive residual stress near the surface of metallic materials to increase fatigue life and resistance to corrosion fatigue, cracking, etc. Compressive residual stress and dent profile are important factors to evaluate the effectiveness of shot peening process. In this paper, the influence of dimensionless parameters on maximum compressive residual stress and maximum depth of the dent were investigated. Firstly, dimensionless relations of processing parameters that affect the maximum compressive residual stress and the maximum depth of the dent were deduced by dimensional analysis method. Secondly, the influence of each dimensionless parameter on dimensionless variables was investigated by the finite element method. Furthermore, related empirical formulas were given for each dimensionless parameter based on the simulation results. Finally, comparison was made and good agreement was found between the simulation results and the empirical formula, which shows that a useful approach is provided in this paper for analyzing the influence of each individual parameter.

Variations in thermospheric composition: A model based on mass-spectrometer and satellite-drag data

NASA Technical Reports Server (NTRS)

Jacchia, L. G.

1973-01-01

The seasonal-latitudinal and the diurnal variations of composition observed by mass spectrometers on the OGO 6 satellite are represented by two simple empirical formulae, each of which uses only one numerical parameter. The formulae are of a very general nature and predict the behavior of these variations at all heights and for all levels of solar activity; they yield a satisfactory representation of the corresponding variations in total density as derived from satellite drag. It is suggested that a seasonal variation of hydrogen might explain the abnormally low hydrogen densities at high northern latitudes in July 1964.

Quantitative estimation of minimum offset for multichannel surface-wave survey with actively exciting source

USGS Publications Warehouse

Xu, Y.; Xia, J.; Miller, R.D.

2006-01-01

Multichannel analysis of surface waves is a developing method widely used in shallow subsurface investigations. The field procedures and related parameters are very important for successful applications. Among these parameters, the source-receiver offset range is seldom discussed in theory and normally determined by empirical or semi-quantitative methods in current practice. This paper discusses the problem from a theoretical perspective. A formula for quantitatively evaluating a layered homogenous elastic model was developed. The analytical results based on simple models and experimental data demonstrate that the formula is correct for surface wave surveys for near-surface applications. ?? 2005 Elsevier B.V. All rights reserved.

The Influence of the Form of a Wooden Beam on Its Stiffness and Strength II : Form Factors of Beams Subjected to Transverse Loading Only

NASA Technical Reports Server (NTRS)

Newlin, J A; Trayer, G W

1924-01-01

The general aim of the investigation described in this report is the achievement of efficient design in wing beams. The purpose of the tests was to determine factors to apply to the usual beam formula in order that the properties of wood based on tests of rectangular sections might be used as a basis of design for beams of any sections and if practical to develop formulas for determining such factors and to verify them by experiment. Such factors for various sections have been determined from test by comparing properties of the beam in question to similar properties of matched beams 2 by 2 inches in section. Furthermore, formulas were worked out, more or less empirical in character, which check all of these test values remarkably well.

Methods of forming single source precursors, methods of forming polymeric single source precursors, and single source precursors and intermediate products formed by such methods

DOEpatents

Fox, Robert V.; Rodriguez, Rene G.; Pak, Joshua J.; Sun, Chivin; Margulieux, Kelsey R.; Holland, Andrew W.

2012-12-04

Methods of forming single source precursors (SSPs) include forming intermediate products having the empirical formula 1/2{L.sub.2N(.mu.-X).sub.2M'X.sub.2}.sub.2, and reacting MER with the intermediate products to form SSPs of the formula L.sub.2N(.mu.-ER).sub.2M'(ER).sub.2, wherein L is a Lewis base, M is a Group IA atom, N is a Group IB atom, M' is a Group IIIB atom, each E is a Group VIB atom, each X is a Group VIIA atom or a nitrate group, and each R group is an alkyl, aryl, vinyl, (per)fluoro alkyl, (per)fluoro aryl, silane, or carbamato group. Methods of forming polymeric or copolymeric SSPs include reacting at least one of HE.sup.1R.sup.1E.sup.1H and MER with one or more substances having the empirical formula L.sub.2N(.mu.-ER).sub.2M'(ER).sub.2 or L.sub.2N(.mu.-X).sub.2M'(X).sub.2 to form a polymeric or copolymeric SSP. New SSPs and intermediate products are formed by such methods.

Magnetic fields for transporting charged beams

DOE Office of Scientific and Technical Information (OSTI.GOV)

Parzen, G.

1976-01-01

The transport of charged particle beams requires magnetic fields that must be shaped correctly and very accurately. During the last 20 years or so, many studies have been made, both analytically and through the use of computer programs, of various magnetic shapes that have proved to be useful. Many of the results for magnetic field shapes can be applied equally well to electric field shapes. A report is given which gathers together the results that have more general significance and would be useful in designing a configuration to produce a desired magnetic field shape. The field shapes studied include themore » fields in dipoles, quadrupoles, sextupoles, octupoles, septum magnets, combined-function magnets, and electrostatic septums. Where possible, empirical formulas are proposed, based on computer and analytical studies and on magnetic field measurements. These empirical formulas are often easier to use than analytical formulas and often include effects that are difficult to compute analytically. In addition, results given in the form of tables and graphs serve as illustrative examples. The field shapes studied include uniform fields produced by window-frame magnets, C-magnets, H-magnets, and cosine magnets; linear fields produced by various types of quadrupoles; quadratic and cubic fields produced by sextupoles and octupoles; combinations of uniform and linear fields; and septum fields with sharp boundaries.« less

Study of blasting seismic effects of underground powerhouse of pumped storage project in granite condition

NASA Astrophysics Data System (ADS)

Wan, Sheng; Li, Hui

2018-03-01

Though the test of blasting vibration, the blasting seismic wave propagation laws in southern granite pumped storage power project are studied. Attenuation coefficient of seismic wave and factors coefficient are acquired by the method of least squares regression analysis according to Sadaovsky empirical formula, and the empirical formula of seismic wave is obtained. This paper mainly discusses on the test of blasting vibration and the procedure of calculation. Our practice might as well serve as a reference for similar projects to come.

Improved Formula for the Stress Intensity Factor of Semi-Elliptical Surface Cracks in Welded Joints under Bending Stress

PubMed Central

Peng, Yang; Wu, Chao; Zheng, Yifu; Dong, Jun

2017-01-01

Welded joints are prone to fatigue cracking with the existence of welding defects and bending stress. Fracture mechanics is a useful approach in which the fatigue life of the welded joint can be predicted. The key challenge of such predictions using fracture mechanics is how to accurately calculate the stress intensity factor (SIF). An empirical formula for calculating the SIF of welded joints under bending stress was developed by Baik, Yamada and Ishikawa based on the hybrid method. However, when calculating the SIF of a semi-elliptical crack, this study found that the accuracy of the Baik-Yamada formula was poor when comparing the benchmark results, experimental data and numerical results. The reasons for the reduced accuracy of the Baik-Yamada formula were identified and discussed in this paper. Furthermore, a new correction factor was developed and added to the Baik-Yamada formula by using theoretical analysis and numerical regression. Finally, the predictions using the modified Baik-Yamada formula were compared with the benchmark results, experimental data and numerical results. It was found that the accuracy of the modified Baik-Yamada formula was greatly improved. Therefore, it is proposed that this modified formula is used to conveniently and accurately calculate the SIF of semi-elliptical cracks in welded joints under bending stress. PMID:28772527

Fiscal transfers based on inputs or outcomes? Lessons from the Twelfth and Thirteenth Finance Commission in India

PubMed Central

Iyer, Smriti; Kapur, Avani; Mahbub, Rifaiyat; Mukherjee, Anit

2017-01-01

Summary Background There is limited empirical evidence about the efficacy of fiscal transfers for a specific purpose, including for health which represents an important source of funds for the delivery of public services especially in large populous countries such as India. Objective To examine two distinct methodologies for allocating specific‐purpose centre‐to‐state transfers, one using an input‐based formula focused on equity and the other using an outcome‐based formula focused on performance. Materials and Methods We examine the Twelfth Finance Commission (12FC)'s use of Equalization Grants for Health (EGH) as an input‐based formula and the Thirteenth Finance Commission (13FC)'s use of Incentive Grants for Health (IGH) as an outcome‐based formula. We simulate and replicate the allocation of these two transfer methodologies and examine the consequences of these fiscal transfer mechanisms. Results The EGH placed conditions for releasing funds, but states varied in their ability to meet those conditions, and hence their allocations varied, eg, Madhya Pradesh received 100% and Odisha 67% of its expected allocation. Due to the design of the IGH formula, IGH allocations were unequally distributed and highly concentrated in 4 states (Manipur, Sikkim, Tamil Nadu, Nagaland), which received over half the national IGH allocation. Discussion The EGH had limited impact in achieving equalization, whereas the IGH rewards were concentrated in states which were already doing better. Greater transparency and accountability of centre‐to‐state allocations and specifically their methodologies are needed to ensure that allocation objectives are aligned to performance. PMID:28857284

Fiscal transfers based on inputs or outcomes? Lessons from the Twelfth and Thirteenth Finance Commission in India.

PubMed

Fan, Victoria Y; Iyer, Smriti; Kapur, Avani; Mahbub, Rifaiyat; Mukherjee, Anit

2018-01-01

There is limited empirical evidence about the efficacy of fiscal transfers for a specific purpose, including for health which represents an important source of funds for the delivery of public services especially in large populous countries such as India. To examine two distinct methodologies for allocating specific-purpose centre-to-state transfers, one using an input-based formula focused on equity and the other using an outcome-based formula focused on performance. We examine the Twelfth Finance Commission (12FC)'s use of Equalization Grants for Health (EGH) as an input-based formula and the Thirteenth Finance Commission (13FC)'s use of Incentive Grants for Health (IGH) as an outcome-based formula. We simulate and replicate the allocation of these two transfer methodologies and examine the consequences of these fiscal transfer mechanisms. The EGH placed conditions for releasing funds, but states varied in their ability to meet those conditions, and hence their allocations varied, eg, Madhya Pradesh received 100% and Odisha 67% of its expected allocation. Due to the design of the IGH formula, IGH allocations were unequally distributed and highly concentrated in 4 states (Manipur, Sikkim, Tamil Nadu, Nagaland), which received over half the national IGH allocation. The EGH had limited impact in achieving equalization, whereas the IGH rewards were concentrated in states which were already doing better. Greater transparency and accountability of centre-to-state allocations and specifically their methodologies are needed to ensure that allocation objectives are aligned to performance. © 2017 The Authors. The International Journal of Health Planning and Management published by John Wiley & Sons Ltd.

Modified retrieval algorithm for three types of precipitation distribution using x-band synthetic aperture radar

NASA Astrophysics Data System (ADS)

Xie, Yanan; Zhou, Mingliang; Pan, Dengke

2017-10-01

The forward-scattering model is introduced to describe the response of normalized radar cross section (NRCS) of precipitation with synthetic aperture radar (SAR). Since the distribution of near-surface rainfall is related to the rate of near-surface rainfall and horizontal distribution factor, a retrieval algorithm called modified regression empirical and model-oriented statistical (M-M) based on the volterra integration theory is proposed. Compared with the model-oriented statistical and volterra integration (MOSVI) algorithm, the biggest difference is that the M-M algorithm is based on the modified regression empirical algorithm rather than the linear regression formula to retrieve the value of near-surface rainfall rate. Half of the empirical parameters are reduced in the weighted integral work and a smaller average relative error is received while the rainfall rate is less than 100 mm/h. Therefore, the algorithm proposed in this paper can obtain high-precision rainfall information.

Parametrization of electron impact ionization cross sections for CO, CO2, NH3 and SO2

NASA Technical Reports Server (NTRS)

Srivastava, Santosh K.; Nguyen, Hung P.

1987-01-01

The electron impact ionization and dissociative ionization cross section data of CO, CO2, CH4, NH3, and SO2, measured in the laboratory, were parameterized utilizing an empirical formula based on the Born approximation. For this purpose an chi squared minimization technique was employed which provided an excellent fit to the experimental data.

Comparison of disease prevalence in two populations in the presence of misclassification.

PubMed

Tang, Man-Lai; Qiu, Shi-Fang; Poon, Wai-Yin

2012-11-01

Comparing disease prevalence in two groups is an important topic in medical research, and prevalence rates are obtained by classifying subjects according to whether they have the disease. Both high-cost infallible gold-standard classifiers or low-cost fallible classifiers can be used to classify subjects. However, statistical analysis that is based on data sets with misclassifications leads to biased results. As a compromise between the two classification approaches, partially validated sets are often used in which all individuals are classified by fallible classifiers, and some of the individuals are validated by the accurate gold-standard classifiers. In this article, we develop several reliable test procedures and approximate sample size formulas for disease prevalence studies based on the difference between two disease prevalence rates with two independent partially validated series. Empirical studies show that (i) the Score test produces close-to-nominal level and is preferred in practice; and (ii) the sample size formula based on the Score test is also fairly accurate in terms of the empirical power and type I error rate, and is hence recommended. A real example from an aplastic anemia study is used to illustrate the proposed methodologies. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Mathematical Storage-Battery Models

NASA Technical Reports Server (NTRS)

Chapman, C. P.; Aston, M.

1985-01-01

Empirical formula represents performance of electrical storage batteries. Formula covers many battery types and includes numerous coefficients adjusted to fit peculiarities of each type. Battery and load parameters taken into account include power density in battery, discharge time, and electrolyte temperature. Applications include electric-vehicle "fuel" gages and powerline load leveling.

Effect of corrosion on the buckling capacity of tubular members

NASA Astrophysics Data System (ADS)

Øyasæter, F. H.; Aeran, A.; Siriwardane, S. C.; Mikkelsen, O.

2017-12-01

Offshore installations are subjected to harsh marine environment and often have damages from corrosion. Several experimental and numerical studies were performed in the past to estimate buckling capacity of corroded tubular members. However, these studies were either based on limited experimental tests or numerical analyses of few cases resulting in semi-empirical relations. Also, there are no guidelines and recommendations in the currently available design standards. To fulfil this research gap, a new formula is proposed to estimate the residual strength of tubular members considering corrosion and initial geometrical imperfections. The proposed formula is verified with results from finite element analyses performed on several members and for varying corrosion patch parameters. The members are selected to represent the most relevant Eurocode buckling curve for tubular members. It is concluded that corrosion reduces the buckling capacity significantly and the proposed formula can be easily applied by practicing engineers without performing detailed numerical analyses.

Sparse Covariance Matrix Estimation by DCA-Based Algorithms.

PubMed

Phan, Duy Nhat; Le Thi, Hoai An; Dinh, Tao Pham

2017-11-01

This letter proposes a novel approach using the [Formula: see text]-norm regularization for the sparse covariance matrix estimation (SCME) problem. The objective function of SCME problem is composed of a nonconvex part and the [Formula: see text] term, which is discontinuous and difficult to tackle. Appropriate DC (difference of convex functions) approximations of [Formula: see text]-norm are used that result in approximation SCME problems that are still nonconvex. DC programming and DCA (DC algorithm), powerful tools in nonconvex programming framework, are investigated. Two DC formulations are proposed and corresponding DCA schemes developed. Two applications of the SCME problem that are considered are classification via sparse quadratic discriminant analysis and portfolio optimization. A careful empirical experiment is performed through simulated and real data sets to study the performance of the proposed algorithms. Numerical results showed their efficiency and their superiority compared with seven state-of-the-art methods.

Empirical mass formula with proton-neutron interaction

NASA Astrophysics Data System (ADS)

Tachibana, Takahiro; Uno, Masahiro; Yamada, So; Yamada, Masami

1987-12-01

An atomic mass formula consisting of a gross part, and averge even-odd part and an empirical shell part is studied. The gross part is, apart from a small atomic term, taken to be the sum of nucleon rest masses. Coulomb energies and a polynomial in A1/3 and ‖N-Z‖/A. The shell part includes, in addition to proton and neutron support of nuclear magicities and the cooperative deformation effect. After the first construction of such a formula, refinements have been made in two respects. One is a separate treatment of Z=N odd-odd nuclei suggested by a quartet model, and the other is an improvement of the proton neutron interaction term. By these refinements the root-mean-square deviation of calculated masses from the 1986 Audi-Wapstra masses has been reduced from 538 keV to 460 keV.

Study of the total reaction cross section via QMD

NASA Astrophysics Data System (ADS)

Yang, Lin-Meng; Guo, Wen-Jun; Zhang, Fan; Ni, Sheng

2013-10-01

This paper presents a new empirical formula to calculate the average nucleon-nucleon (N-N) collision number for the total reaction cross sections (σR). Based on the initial average N-N collision number calculated by quantum molecular dynamics (QMD), quantum correction and Coulomb correction are taken into account within it. The average N-N collision number is calculated by this empirical formula. The total reaction cross sections are obtained within the framework of the Glauber theory. σR of 23Al+12C, 24Al+12C, 25 Al+12C, 26Al+12C and 27Al+12C are calculated in the range of low energy. We also calculate the σR of 27Al+12C with different incident energies. The calculated σR are compared with the experimental data and the results of Glauber theory including the σR of both spherical nuclear and deformed nuclear. It is seen that the calculated σR are larger than σR of spherical nuclear and smaller than σR of deformed nuclear, whereas the results agree well with the experimental data in low-energy range.

Analytical determination of the heat transfer coefficient for gas, liquid and liquid metal flows in the tube based on stochastic equations and equivalence of measures for continuum

NASA Astrophysics Data System (ADS)

Dmitrenko, Artur V.

2017-11-01

The stochastic equations of continuum are used for determining the heat transfer coefficients. As a result, the formulas for Nusselt (Nu) number dependent on the turbulence intensity and scale instead of only on the Reynolds (Peclet) number are proposed for the classic flows of a nonisothermal fluid in a round smooth tube. It is shown that the new expressions for the classical heat transfer coefficient Nu, which depend only on the Reynolds number, should be obtained from these new general formulas if to use the well-known experimental data for the initial turbulence. It is found that the limitations of classical empirical and semiempirical formulas for heat transfer coefficients and their deviation from the experimental data depend on different parameters of initial fluctuations in the flow for different experiments in a wide range of Reynolds or Peclet numbers. Based on these new dependences, it is possible to explain that the differences between the experimental results for the fixed Reynolds or Peclet numbers are caused by the difference in values of flow fluctuations for each experiment instead of only due to the systematic error in the experiment processing. Accordingly, the obtained general dependences of Nu for a smooth round tube can serve as the basis for clarifying the experimental results and empirical formulas used for continuum flows in various power devices. Obtained results show that both for isothermal and for nonisothermal flows, the reason for the process of transition from a deterministic state into a turbulent one is determined by the physical law of equivalence of measures between them. Also the theory of stochastic equations and the law of equivalence of measures could determine mechanics which is basis in different phenomena of self-organization and chaos theory.

Reconstructing the primordial spectrum of fluctuations of the universe from the observed nonlinear clustering of galaxies

NASA Technical Reports Server (NTRS)

Hamilton, A. J. S.; Matthews, Alex; Kumar, P.; Lu, Edward

1991-01-01

It was discovered that the nonlinear evolution of the two point correlation function in N-body experiments of galaxy clustering with Omega = 1 appears to be described to good approximation by a simple general formula. The underlying form of the formula is physically motivated, but its detailed representation is obtained empirically by fitting to N-body experiments. In this paper, the formula is presented along with an inverse formula which converts a final, nonlinear correlation function into the initial linear correlation function. The inverse formula is applied to observational data from the CfA, IRAs, and APM galaxy surveys, and the initial spectrum of fluctuations of the universe, if Omega = 1.

Empirical mass formula with proton-neutron interaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tachibana, T.; Uno, M.; Yamada, S.

An atomic mass formula consisting of a gross part, and averge even-odd part and an empirical shell part is studied. The gross part is, apart from a small atomic term, taken to be the sum of nucleon rest masses. Coulomb energies and a polynomial in A/sup 1/3/ and chemically bondN-Zchemically bond/A. The shell part includes, in addition to proton and neutron support of nuclear magicities and the cooperative deformation effect. After the first construction of such a formula, refinements have been made in two respects. One is a separate treatment of Z = N odd-odd nuclei suggested by a quartetmore » model, and the other is an improvement of the proton neutron interaction term. By these refinements the root-mean-square deviation of calculated masses from the 1986 Audi-Wapstra masses has been reduced from 538 keV to 460 keV.« less

From medical tradition to traditional medicine: A Tibetan formula in the European framework.

PubMed

Schwabl, Herbert; Vennos, Cécile

2015-06-05

The increasing prevalence of complex multi-factorial chronic diseases and multimorbidity reveals the need for an enlargement of the therapeutic options. Potent multicompound herbal formulations from traditional medicine systems such as Tibetan Medicine might meet the requirements. With its practice over the centuries Tibetan Medicine is one of the important medical heritages of the world. In the 20th century Tibetan formulas came to Switzerland, where the formula Gabur-25 was then registered as medicine in 1977 (Padma 28, Swissmedic No 35872). The new European directive 2004/24/EC opened the avenue for traditional herbal medicinal products and registrations followed in Austria (HERB-00037) and the UK (39568/0001). The aim of this review was to analyse not only the critical points and hazards but also chances that occur in the endeavour of bringing a ethnopharmacological based preparation to the market within a modern Western medical and regulatory framework and to discuss the necessary transformation steps from a traditional herbal formula towards a modern pharmaceutical product with the example of the Tibetan formula Gabur-25. The historic transformation process from the 19th to the 21st century is analysed, using the registration documents and other material from the library of Padma AG, Hinwil, Switzerland. The transformation of a traditional formula into a modern traditional herbal medicinal product according to the present EU regulations is a multi faceted process. The modern indication represents only a small part of the possible traditional indications. Quality and product labelling has to be adopted to modern standards. The formula, once registered, is a fixed combination of herbal and mineral ingredients. Contrary to this the concept of Asian medical tradition allows a certain flexibility in the composition of an herbal formula. The ingredients are constantly adapted to local conditions, availability of raw material and therapeutic situation. The example shows that in principle complex herbal formulas from Asian medicine can meet the requirements of the European regime of traditional herbal medicinal products. A structured process of transformation from a traditional herbal formula to a modern medicinal product has to include selection of a suitable formula, development of an analytic concept and selection of a suitable indication with regard to the empirical set of possible indications. To extend the range of high quality medicinal products from other medical traditions within the European context the European legislators have to re-evaluate the imposed restrictions given in directive 2004/24/EC. Without amendment of the prerequisite of 15 years documented use in the EU and the limitation of indications for traditional herbal medicinal products, European citizens will be excluded from access to high quality medical traditions with their accumulated empirical knowledge. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

SU-E-T-439: An Improved Formula of Scatter-To-Primary Ratio for Photon Dose Calculation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhu, T

2014-06-01

Purpose: Scatter-to-primary ratio (SPR) is an important dosimetric quantity that describes the contribution from the scatter photons in an external photon beam. The purpose of this study is to develop an improved analytical formula to describe SPR as a function of circular field size (r) and depth (d) using Monte Carlo (MC) simulation. Methods: MC simulation was performed for Mohan photon spectra (Co-60, 4, 6, 10, 15, 23 MV) using EGSNRC code. Point-spread scatter dose kernels in water are generated. The scatter-to-primary ratio (SPR) is also calculated using MC simulation as a function of field size for circular field sizemore » with radius r and depth d. The doses from forward scatter and backscatter photons are calculated using a convolution of the point-spread scatter dose kernel and by accounting for scatter photons contributing to dose before (z'd) reaching the depth of interest, d, where z' is the location of scatter photons, respectively. The depth dependence of the ratio of the forward scatter and backscatter doses is determined as a function of depth and field size. Results: We are able to improve the existing 3-parameter (a, w, d0) empirical formula for SPR by introducing depth dependence for one of the parameter d0, which becomes 0 for deeper depths. The depth dependence of d0 can be directly calculated as a ratio of backscatter-to-forward scatter doses for otherwise the same field and depth. With the improved empirical formula, we can fit SPR for all megavoltage photon beams to within 2%. Existing 3-parameter formula cannot fit SPR data for Co-60 to better than 3.1%. Conclusion: An improved empirical formula is developed to fit SPR for all megavoltage photon energies to within 2%.« less

The role of hip and chest radiographs in osteoporotic evaluation among south Indian women population: a comparative scenario with DXA.

PubMed

Kumar, D Ashok; Anburajan, M

2014-05-01

Osteoporosis is recognized as a worldwide skeletal disorder problem. In India, the older as well as postmenopausal women population suffering from osteoporotic fractures has been a common issue. Bone mineral density measurements gauged by dual-energy X-ray absorptiometry (DXA) are used in the diagnosis of osteoporosis. (1) To evaluate osteoporosis in south Indian women by radiogrammetric method in a comparative perspective with DXA. (2) To assess the capability of KJH; Anburajan's Empirical formula in the prediction of total hip bone mineral density (T.BMD) with estimated Hologic T.BMD. In this cross-sectional design, 56 south Indian women were evaluated. These women were randomly selected from a health camp. The patients with secondary bone diseases were excluded. The standard protocol was followed in acquiring BMD of the right proximal femur by DPX Prodigy (DXA Scanner, GE-Lunar Corp., USA). The measured Lunar Total hip BMD was converted into estimated Hologic Total hip BMD. In addition, the studied population underwent chest and hip radiographic measurements. Combined cortical thickness of clavicle has been used in KJH; Anburajan's Empirical formula to predict T.BMD and compared with estimated Hologic T.BMD by DXA. The correlation coefficients exhibited high significance. The combined cortical thickness of clavicle and femur shaft of total studied population was strongly correlated with DXA femur T.BMD measurements (r = 0.87, P < 0.01 and r = 0.45, P < 0.01) and it is also having strong correlation with low bone mass group (r = 0.87, P < 0.01 and r = 0.67, P < 0.01) KJH; Anburajan's Empirical formula shows significant correlation with estimated Hologic T.BMD (r = 0.88, P < 0.01) in total studied population. The empirical formula was identified as better tool for predicting osteoporosis in total population and old-aged population with a sensitivity (88.8 and 95.6 %), specificity (89.6 and 90.9 %), positive predictive value (88.8 and 95.6 %) and negative predictive value (89.6 and 90.9 %), respectively. The results suggest that combined cortical thickness of clavicle and femur shaft using radiogrammetric method is significantly correlated with DXA. Moreover, KJH; Anburajan's Empirical formula is useful and better index than other simple radiogrammetry measurements in the evaluation of osteoporosis from the economical and widely available digital radiographs.

Reconsideration at Field Scale of the Relationship between Hydraulic Conductivity and Porosity: The Case of a Sandy Aquifer in South Italy

PubMed Central

2014-01-01

To describe flow or transport phenomena in porous media, relations between aquifer hydraulic conductivity and effective porosity can prove useful, avoiding the need to perform expensive and time consuming measurements. The practical applications generally require the determination of this parameter at field scale, while most of the empirical and semiempirical formulas, based on grain size analysis and allowing determination of the hydraulic conductivity from the porosity, are related to the laboratory scale and thus are not representative of the aquifer volumes to which one refers. Therefore, following the grain size distribution methodology, a new experimental relation between hydraulic conductivity and effective porosity, representative of aquifer volumes at field scale, is given for a confined aquifer. The experimental values used to determine this law were obtained for both parameters using only field measurements methods. The experimental results found, also if in the strict sense valid only for the investigated aquifer, can give useful suggestions for other alluvial aquifers with analogous characteristics of grain-size distribution. Limited to the investigated range, a useful comparison with the best known empirical formulas based on grain size analysis was carried out. The experimental data allowed also investigation of the existence of a scaling behaviour for both parameters considered. PMID:25180202

Determining Accuracy of Thermal Dissipation Methods-based Sap Flux in Japanese Cedar Trees

NASA Astrophysics Data System (ADS)

Su, Man-Ping; Shinohara, Yoshinori; Laplace, Sophie; Lin, Song-Jin; Kume, Tomonori

2017-04-01

Thermal dissipation method, one kind of sap flux measurement method that can estimate individual tree transpiration, have been widely used because of its low cost and uncomplicated operation. Although thermal dissipation method is widespread, the accuracy of this method is doubted recently because some tree species materials in previous studies were not suitable for its empirical formula from Granier due to difference of wood characteristics. In Taiwan, Cryptomeria japonica (Japanese cedar) is one of the dominant species in mountainous area, quantifying the transpiration of Japanese cedar trees is indispensable to understand water cycling there. However, no one have tested the accuracy of thermal dissipation methods-based sap flux for Japanese cedar trees in Taiwan. Thus, in this study we conducted calibration experiment using twelve Japanese cedar stem segments from six trees to investigate the accuracy of thermal dissipation methods-based sap flux in Japanese cedar trees in Taiwan. By pumping water from segment bottom to top and inserting probes into segments to collect data simultaneously, we compared sap flux densities calculated from real water uptakes (Fd_actual) and empirical formula (Fd_Granier). Exact sapwood area and sapwood depth of each sample were obtained from dying segment with safranin stain solution. Our results showed that Fd_Granier underestimated 39 % of Fd_actual across sap flux densities ranging from 10 to 150 (cm3m-2s-1); while applying sapwood depth corrected formula from Clearwater, Fd_Granier became accurately that only underestimated 0.01 % of Fd_actual. However, when sap flux densities ranging from 10 to 50 (cm3m-2s-1)which is similar with the field data of Japanese cedar trees in a mountainous area of Taiwan, Fd_Granier underestimated 51 % of Fd_actual, and underestimated 26 % with applying Clearwater sapwood depth corrected formula. These results suggested sapwood depth significantly impacted on the accuracy of thermal dissipation method; hence, careful determination of sapwood depth is the key for the accurate transpiration estimates. This study also apply the derived results to long-term field data in the mountainous area in Taiwan.

Evaluating the generalizability of GEP models for estimating reference evapotranspiration in distant humid and arid locations

NASA Astrophysics Data System (ADS)

Kiafar, Hamed; Babazadeh, Hosssien; Marti, Pau; Kisi, Ozgur; Landeras, Gorka; Karimi, Sepideh; Shiri, Jalal

2017-10-01

Evapotranspiration estimation is of crucial importance in arid and hyper-arid regions, which suffer from water shortage, increasing dryness and heat. A modeling study is reported here to cross-station assessment between hyper-arid and humid conditions. The derived equations estimate ET0 values based on temperature-, radiation-, and mass transfer-based configurations. Using data from two meteorological stations in a hyper-arid region of Iran and two meteorological stations in a humid region of Spain, different local and cross-station approaches are applied for developing and validating the derived equations. The comparison of the gene expression programming (GEP)-based-derived equations with corresponding empirical-semi empirical ET0 estimation equations reveals the superiority of new formulas in comparison with the corresponding empirical equations. Therefore, the derived models can be successfully applied in these hyper-arid and humid regions as well as similar climatic contexts especially in data-lack situations. The results also show that when relying on proper input configurations, cross-station might be a promising alternative for locally trained models for the stations with data scarcity.

Monte Carlo method for calculating the radiation skyshine produced by electron accelerators

NASA Astrophysics Data System (ADS)

Kong, Chaocheng; Li, Quanfeng; Chen, Huaibi; Du, Taibin; Cheng, Cheng; Tang, Chuanxiang; Zhu, Li; Zhang, Hui; Pei, Zhigang; Ming, Shenjin

2005-06-01

Using the MCNP4C Monte Carlo code, the X-ray skyshine produced by 9 MeV, 15 MeV and 21 MeV electron linear accelerators were calculated respectively with a new two-step method combined with the split and roulette variance reduction technique. Results of the Monte Carlo simulation, the empirical formulas used for skyshine calculation and the dose measurements were analyzed and compared. In conclusion, the skyshine dose measurements agreed reasonably with the results computed by the Monte Carlo method, but deviated from computational results given by empirical formulas. The effect on skyshine dose caused by different structures of accelerator head is also discussed in this paper.

Some approximations for the wet and dry removal of particles and gases from the atmosphere

Treesearch

W. G. N. Slinn

1976-01-01

Semi-empirical formulae are presented which can be used to estimate precipitation scavenging and dry deposition of particles and gases. The precipitation scavenging formulae are appropriate both for in- and below-cloud scavenging and comparisons with data indicate the importance of accounting for aerosol particle growth by water vapor condensation and attachment of the...

Theoretical Accuracy of Along-Track Displacement Measurements from Multiple-Aperture Interferometry (MAI)

PubMed Central

Jung, Hyung-Sup; Lee, Won-Jin; Zhang, Lei

2014-01-01

The measurement of precise along-track displacements has been made with the multiple-aperture interferometry (MAI). The empirical accuracies of the MAI measurements are about 6.3 and 3.57 cm for ERS and ALOS data, respectively. However, the estimated empirical accuracies cannot be generalized to any interferometric pair because they largely depend on the processing parameters and coherence of the used SAR data. A theoretical formula is given to calculate an expected MAI measurement accuracy according to the system and processing parameters and interferometric coherence. In this paper, we have investigated the expected MAI measurement accuracy on the basis of the theoretical formula for the existing X-, C- and L-band satellite SAR systems. The similarity between the expected and empirical MAI measurement accuracies has been tested as well. The expected accuracies of about 2–3 cm and 3–4 cm (γ = 0.8) are calculated for the X- and L-band SAR systems, respectively. For the C-band systems, the expected accuracy of Radarsat-2 ultra-fine is about 3–4 cm and that of Sentinel-1 IW is about 27 cm (γ = 0.8). The results indicate that the expected MAI measurement accuracy of a given interferometric pair can be easily calculated by using the theoretical formula. PMID:25251408

Relationship between the Geotail spacecraft potential and the magnetospheric electron number density including the distant tail regions

NASA Astrophysics Data System (ADS)

Ishisaka, K.; Okada, T.; Tsuruda, K.; Hayakawa, H.; Mukai, T.; Matsumoto, H.

2001-04-01

The spacecraft potential has been used to derive the electron number density surrounding the spacecraft in the magnetosphere and solar wind. We have investigated the correlation between the spacecraft potential of the Geotail spacecraft and the electron number density derived from the plasma waves in the solar wind and almost all the regions of the magnetosphere, except for the high-density plasmasphere, and obtained an empirical formula to show their relation. The new formula is effective in the range of spacecraft potential from a few volts up to 90 V, corresponding to the electron number density from 0.001 to 50 cm-3. We compared the electron number density obtained by the empirical formula with the density obtained by the plasma wave and plasma particle measurements. On occasions the density determined by plasma wave measurements in the lobe region is different from that calculated by the empirical formula. Using the difference in the densities measured by two methods, we discuss whether or not the lower cutoff frequency of the plasma waves, such as continuum radiation, indicates the local electron density near the spacecraft. Then we applied the new relation to the spacecraft potential measured by the Geotail spacecraft during the period from October 1993 to December 1995, and obtained the electron spatial distribution in the solar wind and magnetosphere, including the distant tail region. Higher electron number density is clearly observed on the dawnside than on the duskside of the magnetosphere in the distant tail beyond 100RE.

Sensitivity analysis of non-cohesive sediment transport formulae

NASA Astrophysics Data System (ADS)

Pinto, Lígia; Fortunato, André B.; Freire, Paula

2006-10-01

Sand transport models are often based on semi-empirical equilibrium transport formulae that relate sediment fluxes to physical properties such as velocity, depth and characteristic sediment grain sizes. In engineering applications, errors in these physical properties affect the accuracy of the sediment fluxes. The present analysis quantifies error propagation from the input physical properties to the sediment fluxes, determines which ones control the final errors, and provides insight into the relative strengths, weaknesses and limitations of four total load formulae (Ackers and White, Engelund and Hansen, van Rijn, and Karim and Kennedy) and one bed load formulation (van Rijn). The various sources of uncertainty are first investigated individually, in order to pinpoint the key physical properties that control the errors. Since the strong non-linearity of most sand transport formulae precludes analytical approaches, a Monte Carlo method is validated and used in the analysis. Results show that the accuracy in total sediment transport evaluations is mainly determined by errors in the current velocity and in the sediment median grain size. For the bed load transport using the van Rijn formula, errors in the current velocity alone control the final accuracy. In a final set of tests, all physical properties are allowed to vary simultaneously in order to analyze the combined effect of errors. The combined effect of errors in all the physical properties is then compared to an estimate of the errors due to the intrinsic limitations of the formulae. Results show that errors in the physical properties can be dominant for typical uncertainties associated with these properties, particularly for small depths. A comparison between the various formulae reveals that the van Rijn formula is more sensitive to basic physical properties. Hence, it should only be used when physical properties are known with precision.

Empirical modelling to predict the refractive index of human blood.

PubMed

Yahya, M; Saghir, M Z

2016-02-21

Optical techniques used for the measurement of the optical properties of blood are of great interest in clinical diagnostics. Blood analysis is a routine procedure used in medical diagnostics to confirm a patient's condition. Measuring the optical properties of blood is difficult due to the non-homogenous nature of the blood itself. In addition, there is a lot of variation in the refractive indices reported in the literature. These are the reasons that motivated the researchers to develop a mathematical model that can be used to predict the refractive index of human blood as a function of concentration, temperature and wavelength. The experimental measurements were conducted on mimicking phantom hemoglobin samples using the Abbemat Refractometer. The results analysis revealed a linear relationship between the refractive index and concentration as well as temperature, and a non-linear relationship between refractive index and wavelength. These results are in agreement with those found in the literature. In addition, a new formula was developed based on empirical modelling which suggests that temperature and wavelength coefficients be added to the Barer formula. The verification of this correlation confirmed its ability to determine refractive index and/or blood hematocrit values with appropriate clinical accuracy.

Shell Properties, Water Vapor Loss, and Hatching Success of Eggs from a Rain Forest Population of the Pearly-eyed Thrasher (Margarops fuscatus)

Treesearch

WAYNE J. ARENDT

2005-01-01

I calculated various shell properties, water vapor loss, and hatching success of eggs of the Pearly-eyed Thrasher (Margarops fuscatus) using measurements obtained during a long-term study in the Luquillo Mountains, Puerto Rico. Empirical results were comparable to standard reference formulae, demonstrating that published formulae can be used with confidence by field...

Piezoviscosity In Lubrication Of Nonconformal Contacts

NASA Technical Reports Server (NTRS)

Jeng, Yeau-Ren; Hamrock, Bernard J.; Brewe, David E.

1988-01-01

Developments in theory of lubrication. Analysis of piezoviscous-rigid regime of lubrication of two ellipsoidal contacts. Begins with Reynolds equation for point contact. Equation nondimensionalized using Roelands empirical formula and Dowson and Higginson formula. Equation solved numerically. Solutions obtained for full spectrum of conditions to find effects of dimensionless load, speed, parameters of lubricated and lubricating materials, and angle between direction of rolling and direction of entrainment of lubricant.

Phosphate-based glasses: Prediction of acoustical properties

NASA Astrophysics Data System (ADS)

El-Moneim, Amin Abd

2016-04-01

In this work, a comprehensive study has been carried out to predict the composition dependence of bulk modulus and ultrasonic attenuation coefficient in the phosphate-based glass systems PbO-P2O5, Li2O-TeO2-B2O3-P2O5, TiO2-Na2O-CaO-P2O5 and Cr2O3-doped Na2O-ZnO-P2O5 at room temperature. The prediction is based on (i) Makishima-Mackenzie theory, which correlates the bulk modulus with packing density and dissociation energy per unit volume, and (ii) Our recently presented semi-empirical formulas, which correlate the ultrasonic attenuation coefficient with the oxygen density, mean atomic ring size, first-order stretching force constant and experimental bulk modulus. Results revealed that our recently presented semi-empirical formulas can be applied successfully to predict changes of ultrasonic attenuation coefficient in binary PbO-P2O5 glasses at 10 MHz frequency and in quaternary Li2O-TeO2-B2O3-P2O5, TiO2-Na2O-CaO-P2O5 and Cr2O3-Na2O-ZnO-P2O5 glasses at 5 MHz frequency. Also, Makishima-Mackenzie theory appears to be valid for the studied glasses if the effect of the basic structural units that present in the glass network is taken into account.

Feynman perturbation expansion for the price of coupon bond options and swaptions in quantum finance. II. Empirical

NASA Astrophysics Data System (ADS)

Baaquie, Belal E.; Liang, Cui

2007-01-01

The quantum finance pricing formulas for coupon bond options and swaptions derived by Baaquie [Phys. Rev. E 75, 016703 (2006)] are reviewed. We empirically study the swaption market and propose an efficient computational procedure for analyzing the data. Empirical results of the swaption price, volatility, and swaption correlation are compared with the predictions of quantum finance. The quantum finance model generates the market swaption price to over 90% accuracy.

Feynman perturbation expansion for the price of coupon bond options and swaptions in quantum finance. II. Empirical.

PubMed

Baaquie, Belal E; Liang, Cui

2007-01-01

The quantum finance pricing formulas for coupon bond options and swaptions derived by Baaquie [Phys. Rev. E 75, 016703 (2006)] are reviewed. We empirically study the swaption market and propose an efficient computational procedure for analyzing the data. Empirical results of the swaption price, volatility, and swaption correlation are compared with the predictions of quantum finance. The quantum finance model generates the market swaption price to over 90% accuracy.

Model Checking with Multi-Threaded IC3 Portfolios

DTIC Science & Technology

2015-01-15

different runs varies randomly depending on the thread interleaving. The use of a portfolio of solvers to maximize the likelihood of a quick solution is...empirically show (cf. Sec. 5.2) that the predictions based on this formula have high accuracy. Note that each solver in the portfolio potentially searches...speedup of over 300. We also show that widening the proof search of ic3 by randomizing its SAT solver is not as effective as paral- lelization

A New Sample Size Formula for Regression.

ERIC Educational Resources Information Center

Brooks, Gordon P.; Barcikowski, Robert S.

The focus of this research was to determine the efficacy of a new method of selecting sample sizes for multiple linear regression. A Monte Carlo simulation was used to study both empirical predictive power rates and empirical statistical power rates of the new method and seven other methods: those of C. N. Park and A. L. Dudycha (1974); J. Cohen…

Light fluence dosimetry in lung-simulating cavities

NASA Astrophysics Data System (ADS)

Zhu, Timothy C.; Kim, Michele M.; Padawer, Jonah; Dimofte, Andreea; Potasek, Mary; Beeson, Karl; Parilov, Evgueni

2018-02-01

Accurate light dosimery is critical to ensure consistent outcome for pleural photodynamic therapy (pPDT). Ellipsoid shaped cavities with different sizes surrounded by turbid medium are used to simulate the intracavity lung geometry. An isotropic light source is introduced and surrounded by turbid media. Direct measurements of light fluence rate were compared to Monte Carlo simulated values on the surface of the cavities for various optical properties. The primary component of the light was determined by measurements performed in air in the same geometry. The scattered component was found by submerging the air-filled cavity in scattering media (Intralipid) and absorbent media (ink). The light source was located centrally with the azimuthal angle, but placed in two locations (vertically centered and 2 cm below the center) for measurements. Light fluence rate was measured using isotropic detectors placed at various angles on the ellipsoid surface. The measurements and simulations show that the scattered dose is uniform along the surface of the intracavity ellipsoid geometries in turbid media. One can express the light fluence rate empirically as φ =4S/As*Rd/(1- Rd), where Rd is the diffuse reflectance, As is the surface area, and S is the source power. The measurements agree with this empirical formula to within an uncertainty of 10% for the range of optical properties studied. GPU voxel-based Monte-Carlo simulation is performed to compare with measured results. This empirical formula can be applied to arbitrary geometries, such as the pleural or intraperitoneal cavity.

Gas Generator Feedline Orifice Sizing Methodology: Effects of Unsteadiness and Non-Axisymmetric Flow

NASA Technical Reports Server (NTRS)

Rothermel, Jeffry; West, Jeffrey S.

2011-01-01

Engine LH2 and LO2 gas generator feed assemblies were modeled with computational fluid dynamics (CFD) methods at 100% rated power level, using on-center square- and round-edge orifices. The purpose of the orifices is to regulate the flow of fuel and oxidizer to the gas generator, enabling optimal power supply to the turbine and pump assemblies. The unsteady Reynolds-Averaged Navier-Stokes equations were solved on unstructured grids at second-order spatial and temporal accuracy. The LO2 model was validated against published experimental data and semi-empirical relationships for thin-plate orifices over a range of Reynolds numbers. Predictions for the LO2 square- and round-edge orifices precisely match experiment and semi-empirical formulas, despite complex feedline geometry whereby a portion of the flow from the engine main feedlines travels at a right-angle through a smaller-diameter pipe containing the orifice. Predictions for LH2 square- and round-edge orifice designs match experiment and semi-empirical formulas to varying degrees depending on the semi-empirical formula being evaluated. LO2 mass flow rate through the square-edge orifice is predicted to be 25 percent less than the flow rate budgeted in the original engine balance, which was subsequently modified. LH2 mass flow rate through the square-edge orifice is predicted to be 5 percent greater than the flow rate budgeted in the engine balance. Since CFD predictions for LO2 and LH2 square-edge orifice pressure loss coefficients, K, both agree with published data, the equation for K has been used to define a procedure for orifice sizing.

A 2-D numerical simulation study on longitudinal solute transport and longitudinal dispersion coefficient

NASA Astrophysics Data System (ADS)

Zhang, Wei

2011-07-01

The longitudinal dispersion coefficient, DL, is a fundamental parameter of longitudinal solute transport models: the advection-dispersion (AD) model and various deadzone models. Since DL cannot be measured directly, and since its calibration using tracer test data is quite expensive and not always available, researchers have developed various methods, theoretical or empirical, for estimating DL by easier available cross-sectional hydraulic measurements (i.e., the transverse velocity profile, etc.). However, for known and unknown reasons, DL cannot be satisfactorily predicted using these theoretical/empirical formulae. Either there is very large prediction error for theoretical methods, or there is a lack of generality for the empirical formulae. Here, numerical experiments using Mike21, a software package that implements one of the most rigorous two-dimensional hydrodynamic and solute transport equations, for longitudinal solute transport in hypothetical streams, are presented. An analysis of the evolution of simulated solute clouds indicates that the two fundamental assumptions in Fischer's longitudinal transport analysis may be not reasonable. The transverse solute concentration distribution, and hence the longitudinal transport appears to be controlled by a dimensionless number ?, where Q is the average volumetric flowrate, Dt is a cross-sectional average transverse dispersion coefficient, and W is channel flow width. A simple empirical ? relationship may be established. Analysis and a revision of Fischer's theoretical formula suggest that ɛ influences the efficiency of transverse mixing and hence has restraining effect on longitudinal spreading. The findings presented here would improve and expand our understanding of longitudinal solute transport in open channel flow.

Sample size calculations for comparative clinical trials with over-dispersed Poisson process data.

PubMed

Matsui, Shigeyuki

2005-05-15

This paper develops a new formula for sample size calculations for comparative clinical trials with Poisson or over-dispersed Poisson process data. The criteria for sample size calculations is developed on the basis of asymptotic approximations for a two-sample non-parametric test to compare the empirical event rate function between treatment groups. This formula can accommodate time heterogeneity, inter-patient heterogeneity in event rate, and also, time-varying treatment effects. An application of the formula to a trial for chronic granulomatous disease is provided. Copyright 2004 John Wiley & Sons, Ltd.

Sparse RNA folding revisited: space-efficient minimum free energy structure prediction.

PubMed

Will, Sebastian; Jabbari, Hosna

2016-01-01

RNA secondary structure prediction by energy minimization is the central computational tool for the analysis of structural non-coding RNAs and their interactions. Sparsification has been successfully applied to improve the time efficiency of various structure prediction algorithms while guaranteeing the same result; however, for many such folding problems, space efficiency is of even greater concern, particularly for long RNA sequences. So far, space-efficient sparsified RNA folding with fold reconstruction was solved only for simple base-pair-based pseudo-energy models. Here, we revisit the problem of space-efficient free energy minimization. Whereas the space-efficient minimization of the free energy has been sketched before, the reconstruction of the optimum structure has not even been discussed. We show that this reconstruction is not possible in trivial extension of the method for simple energy models. Then, we present the time- and space-efficient sparsified free energy minimization algorithm SparseMFEFold that guarantees MFE structure prediction. In particular, this novel algorithm provides efficient fold reconstruction based on dynamically garbage-collected trace arrows. The complexity of our algorithm depends on two parameters, the number of candidates Z and the number of trace arrows T; both are bounded by [Formula: see text], but are typically much smaller. The time complexity of RNA folding is reduced from [Formula: see text] to [Formula: see text]; the space complexity, from [Formula: see text] to [Formula: see text]. Our empirical results show more than 80 % space savings over RNAfold [Vienna RNA package] on the long RNAs from the RNA STRAND database (≥2500 bases). The presented technique is intentionally generalizable to complex prediction algorithms; due to their high space demands, algorithms like pseudoknot prediction and RNA-RNA-interaction prediction are expected to profit even stronger than "standard" MFE folding. SparseMFEFold is free software, available at http://www.bioinf.uni-leipzig.de/~will/Software/SparseMFEFold.

Methods to achieve accurate projection of regional and global raster databases

USGS Publications Warehouse

Usery, E.L.; Seong, J.C.; Steinwand, D.R.; Finn, M.P.

2002-01-01

This research aims at building a decision support system (DSS) for selecting an optimum projection considering various factors, such as pixel size, areal extent, number of categories, spatial pattern of categories, resampling methods, and error correction methods. Specifically, this research will investigate three goals theoretically and empirically and, using the already developed empirical base of knowledge with these results, develop an expert system for map projection of raster data for regional and global database modeling. The three theoretical goals are as follows: (1) The development of a dynamic projection that adjusts projection formulas for latitude on the basis of raster cell size to maintain equal-sized cells. (2) The investigation of the relationships between the raster representation and the distortion of features, number of categories, and spatial pattern. (3) The development of an error correction and resampling procedure that is based on error analysis of raster projection.

Ignoring small predictable profits and losses: a new approach for measuring incentives for cream skimming.

PubMed

van Barneveld, E M; Lamers, L M; van Vliet, R C; van de Ven, W P

2000-02-01

Under inadequate capitation formulae competing health insurers have an incentive for cream skimming, i.e., the selection of enrollees whom the insurer expects to be profitable. When evaluating different capitation formulae, previous studies used various indicators of incentives for cream skimming. These conventional indicators are based on all actual profits and losses or on all predictable profits and losses. For the latter type of indicators, this paper proposes, as a new approach, to ignore the small predictable profits and losses. We assume that this new approach provides a better indication of the size of the cream skimming problem than the conventional one, because an insurer has to take into account its costs of cream skimming and the (statistical) uncertainties about the net benefits of cream skimming. Both approaches are applied in theoretical and empirical analyses. The results show that, if our assumption is right, the problem of cream skimming is overestimated by the conventional ways of measuring incentives for cream skimming, especially in the case of relatively good capitation formulae.

Computational Modeling of Aortic Valvular Stenosis to Asses the Range of Validity of Gorlin Equation

NASA Astrophysics Data System (ADS)

Okpara, Emanuel; Agarwal, Ramesh; Rifkin, Robert; Wendl, Mike

2003-11-01

It is well known from clinical observations that the underestimation errors occur with the use of Gorlin formula (1) for the calculation of valve area of the stenotic aortic valve in patients with low cardiac output, that is in low flow states. Since 1951, empirical modifications to Gorlin formula have been proposed in the literaure by many researchers. In this paper, we study the mild to severe aortic valve stenosis for low to high flow rates by employing a simplified model of aortic valve. The aortic valve stenosis is modeled by a circular orifice in a flat plate embedded in the cross-section of a rigid tube (aorta). Experimental results are available for this configuration for the validation of a CFD solver "FLUENT". The numerical data base generated for this model for various degrees of stenoses and flow rates is employed to asses the range of validity of Gorlin's equation. Modifications to Gorlin formula are suggested to make it valid for all flow rates to determine the valve area for clinical use. (1) R. Gorlin and S. Gorlin," Hydraulic Formula for Calculation of the Area of Stenotic Mitral Valve, Other Cardiac Valves and Central Circulatory Shunts," Am. Heart Journal, Vol. 41, 1951, pp. 1-29.

Calculation of water equivalent thickness of materials of arbitrary density, elemental composition and thickness in proton beam irradiation

NASA Astrophysics Data System (ADS)

Zhang, Rui; Newhauser, Wayne D.

2009-03-01

In proton therapy, the radiological thickness of a material is commonly expressed in terms of water equivalent thickness (WET) or water equivalent ratio (WER). However, the WET calculations required either iterative numerical methods or approximate methods of unknown accuracy. The objective of this study was to develop a simple deterministic formula to calculate WET values with an accuracy of 1 mm for materials commonly used in proton radiation therapy. Several alternative formulas were derived in which the energy loss was calculated based on the Bragg-Kleeman rule (BK), the Bethe-Bloch equation (BB) or an empirical version of the Bethe-Bloch equation (EBB). Alternative approaches were developed for targets that were 'radiologically thin' or 'thick'. The accuracy of these methods was assessed by comparison to values from an iterative numerical method that utilized evaluated stopping power tables. In addition, we also tested the approximate formula given in the International Atomic Energy Agency's dosimetry code of practice (Technical Report Series No 398, 2000, IAEA, Vienna) and stopping power ratio approximation. The results of these comparisons revealed that most methods were accurate for cases involving thin or low-Z targets. However, only the thick-target formulas provided accurate WET values for targets that were radiologically thick and contained high-Z material.

Rapid resolution of milk protein intolerance in infancy.

PubMed

Lazare, Farrah B; Brand, Donald A; Marciano, Tuvia A; Daum, Fredric

2014-08-01

Infants with milk protein intolerance are usually switched to a casein hydrolysate or amino acid-based formula, which they continue to receive until 1 year of age, when they are rechallenged with a cow's-milk or soy protein formula. To investigate whether some of these infants actually become tolerant sooner, this study gathered preliminary data for establishing an empirical timetable for the resolution of milk protein intolerance. This prospective, longitudinal cohort study enrolled infants <4 months of age receiving either breast milk or a cow's-milk or casein hydrolysate formula who presented to a pediatric subspecialty practice during an 18-month period and had a positive stool guaiac test. After having been successfully switched to a casein hydrolysate or amino acid formula, infants who had guaiac-negative stools for at least 2 consecutive months were rechallenged with the formula that had necessitated the most recent switch. Of the 25 patients enrolled in the study, 16 completed the food challenge and data collection protocol. Negative stool guaiac tests following rechallenge indicated resolution of milk protein intolerance by the time subjects reached an average age of 6.7 ± 1.0 months (mean ± standard deviation). By the age of 7 months, milk protein intolerance was resolved in 12 of the 16 infants, the remainder having resolved by 10 months. It may be reasonable to treat infants with milk protein intolerance for 2 to 3 months with a hypoallergenic formula, then rechallenge them at 6 months of age, usually without causing recurrence of the hematochezia. Rechallenging before 12 months old could result in cost savings to families and insurers.

Fundamental insights into ontogenetic growth from theory and fish.

PubMed

Sibly, Richard M; Baker, Joanna; Grady, John M; Luna, Susan M; Kodric-Brown, Astrid; Venditti, Chris; Brown, James H

2015-11-10

The fundamental features of growth may be universal, because growth trajectories of most animals are very similar, but a unified mechanistic theory of growth remains elusive. Still needed is a synthetic explanation for how and why growth rates vary as body size changes, both within individuals over their ontogeny and between populations and species over their evolution. Here, we use Bertalanffy growth equations to characterize growth of ray-finned fishes in terms of two parameters, the growth rate coefficient, K, and final body mass, m∞. We derive two alternative empirically testable hypotheses and test them by analyzing data from FishBase. Across 576 species, which vary in size at maturity by almost nine orders of magnitude, K scaled as [Formula: see text]. This supports our first hypothesis that growth rate scales as [Formula: see text] as predicted by metabolic scaling theory; it implies that species that grow to larger mature sizes grow faster as juveniles. Within fish species, however, K scaled as [Formula: see text]. This supports our second hypothesis, which predicts that growth rate scales as [Formula: see text] when all juveniles grow at the same rate. The unexpected disparity between across- and within-species scaling challenges existing theoretical interpretations. We suggest that the similar ontogenetic programs of closely related populations constrain growth to [Formula: see text] scaling, but as species diverge over evolutionary time they evolve the near-optimal [Formula: see text] scaling predicted by metabolic scaling theory. Our findings have important practical implications because fish supply essential protein in human diets, and sustainable yields from wild harvests and aquaculture depend on growth rates.

ON NORRIS' THEORY FOR THE SHAPE OF THE MAMMALIAN ERYTHROCYTE

PubMed Central

Ponder, Eric

1934-01-01

This paper is concerned with an attempt to put Norris' theory for the shape of the mammalian erythrocyte into a quantitative form. The theory supposes that the biconcave form of the cell is brought about by an expansive force enlarging the surface, and is also supposed to apply to the formation of the myelin forms of lecithn. The attempt is not successful, and is published merely because it is suggestive. Various points regarding the shape of the cell, the curvature of its surface, and the kind of system to which Norris' theory might be supposed to apply, are discussed, and an empirical formula is given for the curve which bounds the cross-section of the cell. This empirical formula describes the shape almost to perfection. PMID:19872803

The Study of ( n, d) Reaction Cross Sections for New Evaluated Semi-Empirical Formula Using Optical Model

NASA Astrophysics Data System (ADS)

Bölükdemir, M. H.; Tel, E.; Okuducu, Ş.; Aydın, A.

2009-12-01

Nuclear fusion can be one of the most attractive sources of energy from the viewpoint of safety and minimal environmental impact. The neutron scattering cross sections data have a critical importance on fusion reactor (and in the fusion-fission hybrid) reactors. So, the study of the systematic of ( n, d) etc., reaction cross sections is of great importance in the definition of the excitation function character for reaction taking place on various nuclei at energies up to 20 MeV. In this study, non-elastic cross-sections have been calculated by using optical model for ( n, d) reactions at 14-15 MeV energy. The excitation function character and reaction Q-values depending on the asymmetry term effect for the ( n, d) reaction have been investigated. New coefficients have been obtained and the semi-empirical formulas including optical model non-elastic effects by fitting two parameters for the ( n, d) reaction cross-sections have been suggested. The obtained cross-section formulas with new coefficients have been compared with the available experimental data and discussed.

An extended Zel'dovich model for the halo mass function

NASA Astrophysics Data System (ADS)

Lim, Seunghwan; Lee, Jounghun

2013-01-01

A new way to construct a fitting formula for the halo mass function is presented. Our formula is expressed as a solution to the modified Jedamzik matrix equation that automatically satisfies the normalization constraint. The characteristic parameters expressed in terms of the linear shear eigenvalues are empirically determined by fitting the analytic formula to the numerical results from the high-resolution N-body simulation and found to be independent of scale, redshift and background cosmology. Our fitting formula with the best-fit parameters is shown to work excellently in the wide mass-range at various redshifts: The ratio of the analytic formula to the N-body results departs from unity by up to 10% and 5% over 1011 <= M/(h-1Msolar) <= 5 × 1015 at z = 0,0.5 and 1 for the FoF-halo and SO-halo cases, respectively.

Harmonic analysis of electrified railway based on improved HHT

NASA Astrophysics Data System (ADS)

Wang, Feng

2018-04-01

In this paper, the causes and harms of the current electric locomotive electrical system harmonics are firstly studied and analyzed. Based on the characteristics of the harmonics in the electrical system, the Hilbert-Huang transform method is introduced. Based on the in-depth analysis of the empirical mode decomposition method and the Hilbert transform method, the reasons and solutions to the endpoint effect and modal aliasing problem in the HHT method are explored. For the endpoint effect of HHT, this paper uses point-symmetric extension method to extend the collected data; In allusion to the modal aliasing problem, this paper uses the high frequency harmonic assistant method to preprocess the signal and gives the empirical formula of high frequency auxiliary harmonic. Finally, combining the suppression of HHT endpoint effect and modal aliasing problem, an improved HHT method is proposed and simulated by matlab. The simulation results show that the improved HHT is effective for the electric locomotive power supply system.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pebay, Philippe; Terriberry, Timothy B.; Kolla, Hemanth

Formulas for incremental or parallel computation of second order central moments have long been known, and recent extensions of these formulas to univariate and multivariate moments of arbitrary order have been developed. Formulas such as these, are of key importance in scenarios where incremental results are required and in parallel and distributed systems where communication costs are high. We survey these recent results, and improve them with arbitrary-order, numerically stable one-pass formulas which we further extend with weighted and compound variants. We also develop a generalized correction factor for standard two-pass algorithms that enables the maintenance of accuracy over nearlymore » the full representable range of the input, avoiding the need for extended-precision arithmetic. We then empirically examine algorithm correctness for pairwise update formulas up to order four as well as condition number and relative error bounds for eight different central moment formulas, each up to degree six, to address the trade-offs between numerical accuracy and speed of the various algorithms. Finally, we demonstrate the use of the most elaborate among the above mentioned formulas, with the utilization of the compound moments for a practical large-scale scientific application.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pebay, Philippe; Terriberry, Timothy B.; Kolla, Hemanth

Formulas for incremental or parallel computation of second order central moments have long been known, and recent extensions of these formulas to univariate and multivariate moments of arbitrary order have been developed. Such formulas are of key importance in scenarios where incremental results are required and in parallel and distributed systems where communication costs are high. We survey these recent results, and improve them with arbitrary-order, numerically stable one-pass formulas which we further extend with weighted and compound variants. We also develop a generalized correction factor for standard two-pass algorithms that enables the maintenance of accuracy over nearly the fullmore » representable range of the input, avoiding the need for extended-precision arithmetic. We then empirically examine algorithm correctness for pairwise update formulas up to order four as well as condition number and relative error bounds for eight different central moment formulas, each up to degree six, to address the trade-offs between numerical accuracy and speed of the various algorithms. Finally, we demonstrate the use of the most elaborate among the above mentioned formulas, with the utilization of the compound moments for a practical large-scale scientific application.« less

Statistical correlations of shear wave velocity and penetration resistance for soils

NASA Astrophysics Data System (ADS)

Dikmen, Ünal

2009-03-01

In this paper, the correlation between shear wave velocity and standard penetration test blow counts (SPT-N) is investigated. The study focused primarily on the correlation of SPT-N and shear wave velocity (Vs) for several soil categories: all soils, sand, silt and clay-type soils. New empirical formulae are suggested to correlate SPT-N and Vs, based on a dataset collected in a part of Eskişehir settlement in the western central Anatolia region of Turkey. The formulae are based on geotechnical soundings and active and passive seismic experiments. The new and previously suggested formulae showing correlations between uncorrected SPT-N and Vs have been compared and evaluated by using the same dataset. The results suggest that better correlations in estimation of Vs are acquired when the uncorrected blow counts are used. The blow count is a major parameter and the soil type has no significant influence on the results. In cohesive soils, the plasticity contents and, in non-cohesive soils except for gravels, the graded contents have no significant effect on the estimation of Vs. The results support most of the conclusions of earlier studies. These practical relationships developed between SPT-N and Vs should be used with caution in geotechnical engineering and should be checked against measured Vs.

Semi-empirical correlation for binary interaction parameters of the Peng-Robinson equation of state with the van der Waals mixing rules for the prediction of high-pressure vapor-liquid equilibrium.

PubMed

Fateen, Seif-Eddeen K; Khalil, Menna M; Elnabawy, Ahmed O

2013-03-01

Peng-Robinson equation of state is widely used with the classical van der Waals mixing rules to predict vapor liquid equilibria for systems containing hydrocarbons and related compounds. This model requires good values of the binary interaction parameter kij . In this work, we developed a semi-empirical correlation for kij partly based on the Huron-Vidal mixing rules. We obtained values for the adjustable parameters of the developed formula for over 60 binary systems and over 10 categories of components. The predictions of the new equation system were slightly better than the constant-kij model in most cases, except for 10 systems whose predictions were considerably improved with the new correlation.

Numerical expression of color emotion and its application

NASA Astrophysics Data System (ADS)

Sato, Tetsuya; Kajiwara, Kanji; Xin, John H.; Hansuebsai, Aran; Nobbs, Jim

2002-06-01

Human emotions induced by colors are various but the emotions are expressed through words and languages. In order to analyze the emotions expressed through words and languages, visual assessment tests against color emotions expressed by twelve kinds of word pairs were carried out in Japan, Thailand, Hong Kong and UK. The numerical expression of each color emotion is being tried as a formula with an ellipsoid-shape resembling that of a color difference formula. In this paper, the numerical expression of 'Soft- Hard' color emotion was mainly discussed. The application of color emotions via the empirical color emotions formulae derived from kansei database (database of sensory assessments) was also briefly reported.

Specific characteristics of negative corona currents generated in short point-plane gap

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Zhen; Zhang, Bo; He, Jinliang

The Trichel pulse is a typical kind of negative corona current observed in electronegative gases with a highly regular form. The characteristics of the Trichel pulse, such as the repetition frequency, the amplitude of each pulse, and the mean current, are dependent on different discharge conditions. Quite many scholars have studied the mean current and the current-voltage characteristic of Trichel pulses, yet the specific characteristics of the pulses have barely been investigated. In this paper, a series of experiments were carried out in a short point-to-plane discharge gap to investigate the detailed characteristics of Trichel pulses. After numerical fitting ofmore » the experiment results was performed, a new set of empirical formulas were derived to predict the specific characteristics of the negative corona current under different conditions. Different from existing literature, this paper uses as variables the average electric field intensity and the corona inception field intensity which is independent of the gap spacing in the empirical formulas. In the experiments, an inverse correlation between amplitude and repetition frequency of the pulses was observed. Based on the investigation of the remaining space charge in the discharge gap, this correlation is theoretically proved to be caused by the influence of space charges.« less

Numerically stable, scalable formulas for parallel and online computation of higher-order multivariate central moments with arbitrary weights

DOE PAGES

Pebay, Philippe; Terriberry, Timothy B.; Kolla, Hemanth; ...

2016-03-29

Formulas for incremental or parallel computation of second order central moments have long been known, and recent extensions of these formulas to univariate and multivariate moments of arbitrary order have been developed. Such formulas are of key importance in scenarios where incremental results are required and in parallel and distributed systems where communication costs are high. We survey these recent results, and improve them with arbitrary-order, numerically stable one-pass formulas which we further extend with weighted and compound variants. We also develop a generalized correction factor for standard two-pass algorithms that enables the maintenance of accuracy over nearly the fullmore » representable range of the input, avoiding the need for extended-precision arithmetic. We then empirically examine algorithm correctness for pairwise update formulas up to order four as well as condition number and relative error bounds for eight different central moment formulas, each up to degree six, to address the trade-offs between numerical accuracy and speed of the various algorithms. Finally, we demonstrate the use of the most elaborate among the above mentioned formulas, with the utilization of the compound moments for a practical large-scale scientific application.« less

Determination of the quenching correction factors for plastic scintillation detectors in therapeutic high-energy proton beams

PubMed Central

Wang, L L W; Perles, L A; Archambault, L; Sahoo, N; Mirkovic, D; Beddar, S

2013-01-01

The plastic scintillation detectors (PSD) have many advantages over other detectors in small field dosimetry due to its high spatial resolution, excellent water equivalence and instantaneous readout. However, in proton beams, the PSDs will undergo a quenching effect which makes the signal level reduced significantly when the detector is close to Bragg peak where the linear energy transfer (LET) for protons is very high. This study measures the quenching correction factor (QCF) for a PSD in clinical passive-scattering proton beams and investigates the feasibility of using PSDs in depth-dose measurements in proton beams. A polystyrene based PSD (BCF-12, ϕ0.5mm×4mm) was used to measure the depth-dose curves in a water phantom for monoenergetic unmodulated proton beams of nominal energies 100, 180 and 250 MeV. A Markus plane-parallel ion chamber was also used to get the dose distributions for the same proton beams. From these results, the QCF as a function of depth was derived for these proton beams. Next, the LET depth distributions for these proton beams were calculated by using the MCNPX Monte Carlo code, based on the experimentally validated nozzle models for these passive-scattering proton beams. Then the relationship between the QCF and the proton LET could be derived as an empirical formula. Finally, the obtained empirical formula was applied to the PSD measurements to get the corrected depth-dose curves and they were compared to the ion chamber measurements. A linear relationship between QCF and LET, i.e. Birks' formula, was obtained for the proton beams studied. The result is in agreement with the literature. The PSD measurements after the quenching corrections agree with ion chamber measurements within 5%. PSDs are good dosimeters for proton beam measurement if the quenching effect is corrected appropriately. PMID:23128412

Determination of the quenching correction factors for plastic scintillation detectors in therapeutic high-energy proton beams

NASA Astrophysics Data System (ADS)

Wang, L. L. W.; Perles, L. A.; Archambault, L.; Sahoo, N.; Mirkovic, D.; Beddar, S.

2012-12-01

Plastic scintillation detectors (PSDs) have many advantages over other detectors in small field dosimetry due to their high spatial resolution, excellent water equivalence and instantaneous readout. However, in proton beams, the PSDs undergo a quenching effect which makes the signal level reduced significantly when the detector is close to the Bragg peak where the linear energy transfer (LET) for protons is very high. This study measures the quenching correction factor (QCF) for a PSD in clinical passive-scattering proton beams and investigates the feasibility of using PSDs in depth-dose measurements in proton beams. A polystyrene-based PSD (BCF-12, ϕ0.5 mm × 4 mm) was used to measure the depth-dose curves in a water phantom for monoenergetic unmodulated proton beams of nominal energies 100, 180 and 250 MeV. A Markus plane-parallel ion chamber was also used to get the dose distributions for the same proton beams. From these results, the QCF as a function of depth was derived for these proton beams. Next, the LET depth distributions for these proton beams were calculated by using the MCNPX Monte Carlo code, based on the experimentally validated nozzle models for these passive-scattering proton beams. Then the relationship between the QCF and the proton LET could be derived as an empirical formula. Finally, the obtained empirical formula was applied to the PSD measurements to get the corrected depth-dose curves and they were compared to the ion chamber measurements. A linear relationship between the QCF and LET, i.e. Birks' formula, was obtained for the proton beams studied. The result is in agreement with the literature. The PSD measurements after the quenching corrections agree with ion chamber measurements within 5%. PSDs are good dosimeters for proton beam measurement if the quenching effect is corrected appropriately.

Cloud vertical profiles derived from CALIPSO and CloudSat and a comparison with MODIS derived clouds

NASA Astrophysics Data System (ADS)

Kato, S.; Sun-Mack, S.; Miller, W. F.; Rose, F. G.; Minnis, P.; Wielicki, B. A.; Winker, D. M.; Stephens, G. L.; Charlock, T. P.; Collins, W. D.; Loeb, N. G.; Stackhouse, P. W.; Xu, K.

2008-05-01

CALIPSO and CloudSat from the a-train provide detailed information of vertical distribution of clouds and aerosols. The vertical distribution of cloud occurrence is derived from one month of CALIPSO and CloudSat data as a part of the effort of merging CALIPSO, CloudSat and MODIS with CERES data. This newly derived cloud profile is compared with the distribution of cloud top height derived from MODIS on Aqua from cloud algorithms used in the CERES project. The cloud base from MODIS is also estimated using an empirical formula based on the cloud top height and optical thickness, which is used in CERES processes. While MODIS detects mid and low level clouds over the Arctic in April fairly well when they are the topmost cloud layer, it underestimates high- level clouds. In addition, because the CERES-MODIS cloud algorithm is not able to detect multi-layer clouds and the empirical formula significantly underestimates the depth of high clouds, the occurrence of mid and low-level clouds is underestimated. This comparison does not consider sensitivity difference to thin clouds but we will impose an optical thickness threshold to CALIPSO derived clouds for a further comparison. The effect of such differences in the cloud profile to flux computations will also be discussed. In addition, the effect of cloud cover to the top-of-atmosphere flux over the Arctic using CERES SSF and FLASHFLUX products will be discussed.

α decay and cluster radioactivity of nuclei of interest to the synthesis of Z =119 , 120 isotopes

NASA Astrophysics Data System (ADS)

Poenaru, D. N.; Gherghescu, R. A.

2018-04-01

Super-heavy nuclei of interest for the forthcoming synthesis of the isotopes with Z =119 , 120 are investigated. One of the very interesting latest experiments was performed at the velocity filter SHIP (GSI Darmstadt) trying to produce 299120 in a fusion reaction 248Cm(54Cr,3 n )299120 . We report calculations of α -decay half-lives using four models: AKRA (Akrawy), ASAF (analytical superasymmetric fission), UNIV (universal formula), and semFIS (semi-empirical formula based on fission theory). The released energy, Q , is calculated using the theoretical model of atomic masses, WS4. For Sr,9492 cluster radioactivity of 120,302300 we predict a branching ratio relative to α decay of -0.10 and 0.49, respectively, meaning that it is worth trying to detect such kinds of decay modes in competition with α decay.

Development of an Empirical Local Magnitude Formula for Northern Oklahoma

NASA Astrophysics Data System (ADS)

Spriggs, N.; Karimi, S.; Moores, A. O.

2015-12-01

In this paper we focus on determining a local magnitude formula for northern Oklahoma that is unbiased with distance by empirically constraining the attenuation properties within the region of interest based on the amplitude of observed seismograms. For regional networks detecting events over several hundred kilometres, distance correction terms play an important role in determining the magnitude of an event. Standard distance correction terms such as Hutton and Boore (1987) may have a significant bias with distance if applied in a region with different attenuation properties, resulting in an incorrect magnitude. We have presented data from a regional network of broadband seismometers installed in bedrock in northern Oklahoma. The events with magnitude in the range of 2.0 and 4.5, distributed evenly across this network are considered. We find that existing models show a bias with respect to hypocentral distance. Observed amplitude measurements demonstrate that there is a significant Moho bounce effect that mandates the use of a trilinear attenuation model in order to avoid bias in the distance correction terms. We present two different approaches of local magnitude calibration. The first maintains the classic definition of local magnitude as proposed by Richter. The second method calibrates local magnitude so that it agrees with moment magnitude where a regional moment tensor can be computed. To this end, regional moment tensor solutions and moment magnitudes are computed for events with magnitude larger than 3.5 to allow calibration of local magnitude to moment magnitude. For both methods the new formula results in magnitudes systematically lower than previous values computed with Eaton's (1992) model. We compare the resulting magnitudes and discuss the benefits and drawbacks of each method. Our results highlight the importance of correct calibration of the distance correction terms for accurate local magnitude assessment in regional networks.

Compactness Aromaticity of Atoms in Molecules

PubMed Central

Putz, Mihai V.

2010-01-01

A new aromaticity definition is advanced as the compactness formulation through the ratio between atoms-in-molecule and orbital molecular facets of the same chemical reactivity property around the pre- and post-bonding stabilization limit, respectively. Geometrical reactivity index of polarizability was assumed as providing the benchmark aromaticity scale, since due to its observable character; with this occasion new Hydrogenic polarizability quantum formula that recovers the exact value of 4.5 a03 for Hydrogen is provided, where a0 is the Bohr radius; a polarizability based–aromaticity scale enables the introduction of five referential aromatic rules (Aroma 1 to 5 Rules). With the help of these aromatic rules, the aromaticity scales based on energetic reactivity indices of electronegativity and chemical hardness were computed and analyzed within the major semi-empirical and ab initio quantum chemical methods. Results show that chemical hardness based-aromaticity is in better agreement with polarizability based-aromaticity than the electronegativity-based aromaticity scale, while the most favorable computational environment appears to be the quantum semi-empirical for the first and quantum ab initio for the last of them, respectively. PMID:20480020

Fusion barrier characteristics of actinides

NASA Astrophysics Data System (ADS)

Manjunatha, H. C.; Sridhar, K. N.

2018-03-01

We have studied fusion barrier characteristics of actinide compound nuclei with atomic number range 89 ≤ Z ≤ 103 for all projectile target combinations. After the calculation of fusion barrier heights and positions, we have searched for their parameterization. We have achieved the empirical formula for fusion barrier heights (VB), positions (RB), curvature of the inverted parabola (ħω) of actinide compound nuclei with atomic number range 89 ≤ Z ≤ 103 for all projectile target combinations (6

Compensating the intensity fall-off effect in cone-beam tomography by an empirical weight formula.

PubMed

Chen, Zikuan; Calhoun, Vince D; Chang, Shengjiang

2008-11-10

The Feldkamp-David-Kress (FDK) algorithm is widely adopted for cone-beam reconstruction due to its one-dimensional filtered backprojection structure and parallel implementation. In a reconstruction volume, the conspicuous cone-beam artifact manifests as intensity fall-off along the longitudinal direction (the gantry rotation axis). This effect is inherent to circular cone-beam tomography due to the fact that a cone-beam dataset acquired from circular scanning fails to meet the data sufficiency condition for volume reconstruction. Upon observations of the intensity fall-off phenomenon associated with the FDK reconstruction of a ball phantom, we propose an empirical weight formula to compensate for the fall-off degradation. Specifically, a reciprocal cosine can be used to compensate the voxel values along longitudinal direction during three-dimensional backprojection reconstruction, in particular for boosting the values of voxels at positions with large cone angles. The intensity degradation within the z plane, albeit insignificant, can also be compensated by using the same weight formula through a parameter for radial distance dependence. Computer simulations and phantom experiments are presented to demonstrate the compensation effectiveness of the fall-off effect inherent in circular cone-beam tomography.

Alpha decay calculations with a new formula

NASA Astrophysics Data System (ADS)

Akrawy, D. T.; Poenaru, D. N.

2017-10-01

A new semi-empirical formula for calculations of α decay half-lives is presented. It was derived from the Royer relationship by introducing new parameters which are fixed by fit to a set of experimental data. We are using three sets: set A with 130 e-e (even-even), 119 e-o (even-odd), 109 o-e, and 96 o-o, set B with 188 e-e, 147 e-o, 131 o-e and 114 o-o, and set C with 136 e-e, 84 e-o, 76 o-e and 48 o-o alpha emitters. A comparison of results obtained with the new formula (newF) and the following well known relationships: semiempirical relationship based on fission theory (semFIS), analytical superasymmetric fission (ASAF) model and universal formula (UNIV) made in terms of rms standard deviation. We also introduced a weighted mean value of this quantity, allowing us to compare the global properties of a given model. For set B the order of the four models is the following: semFIS, UNIV, newF and ASAF. Nevertheless for even-even alpha emitters, UNIV gives the second best result after semFIS, and for odd-even parents the second is newF. Despite its simplicity in comparison with semFIS, newF, presented in this article, behaves quite well, competing with the other well known relationships.

An Empirical Study of Atmospheric Correction Procedures for Regional Infrasound Amplitudes with Ground Truth.

NASA Astrophysics Data System (ADS)

Howard, J. E.

2014-12-01

This study focusses on improving methods of accounting for atmospheric effects on infrasound amplitudes observed on arrays at regional distances in the southwestern United States. Recordings at ranges of 150 to nearly 300 km from a repeating ground truth source of small HE explosions are used. The explosions range in actual weight from approximately 2000-4000 lbs. and are detonated year-round which provides signals for a wide range of atmospheric conditions. Three methods of correcting the observed amplitudes for atmospheric effects are investigated with the data set. The first corrects amplitudes for upper stratospheric wind as developed by Mutschlecner and Whitaker (1999) and uses the average wind speed between 45-55 km altitudes in the direction of propagation to derive an empirical correction formula. This approach was developed using large chemical and nuclear explosions and is tested with the smaller explosions for which shorter wavelengths cause the energy to be scattered by the smaller scale structure of the atmosphere. The second approach isa semi-empirical method using ray tracing to determine wind speed at ray turning heights where the wind estimates replace the wind values in the existing formula. Finally, parabolic equation (PE) modeling is used to predict the amplitudes at the arrays at 1 Hz. The PE amplitudes are compared to the observed amplitudes with a narrow band filter centered at 1 Hz. An analysis is performed of the conditions under which the empirical and semi-empirical methods fail and full wave methods must be used.

Mass spectrometry-based protein identification with accurate statistical significance assignment.

PubMed

Alves, Gelio; Yu, Yi-Kuo

2015-03-01

Assigning statistical significance accurately has become increasingly important as metadata of many types, often assembled in hierarchies, are constructed and combined for further biological analyses. Statistical inaccuracy of metadata at any level may propagate to downstream analyses, undermining the validity of scientific conclusions thus drawn. From the perspective of mass spectrometry-based proteomics, even though accurate statistics for peptide identification can now be achieved, accurate protein level statistics remain challenging. We have constructed a protein ID method that combines peptide evidences of a candidate protein based on a rigorous formula derived earlier; in this formula the database P-value of every peptide is weighted, prior to the final combination, according to the number of proteins it maps to. We have also shown that this protein ID method provides accurate protein level E-value, eliminating the need of using empirical post-processing methods for type-I error control. Using a known protein mixture, we find that this protein ID method, when combined with the Sorić formula, yields accurate values for the proportion of false discoveries. In terms of retrieval efficacy, the results from our method are comparable with other methods tested. The source code, implemented in C++ on a linux system, is available for download at ftp://ftp.ncbi.nlm.nih.gov/pub/qmbp/qmbp_ms/RAId/RAId_Linux_64Bit. Published by Oxford University Press 2014. This work is written by US Government employees and is in the public domain in the US.

Empirical and semi-analytical models for predicting peak outflows caused by embankment dam failures

NASA Astrophysics Data System (ADS)

Wang, Bo; Chen, Yunliang; Wu, Chao; Peng, Yong; Song, Jiajun; Liu, Wenjun; Liu, Xin

2018-07-01

Prediction of peak discharge of floods has attracted great attention for researchers and engineers. In present study, nine typical nonlinear mathematical models are established based on database of 40 historical dam failures. The first eight models that were developed with a series of regression analyses are purely empirical, while the last one is a semi-analytical approach that was derived from an analytical solution of dam-break floods in a trapezoidal channel. Water depth above breach invert (Hw), volume of water stored above breach invert (Vw), embankment length (El), and average embankment width (Ew) are used as independent variables to develop empirical formulas of estimating the peak outflow from breached embankment dams. It is indicated from the multiple regression analysis that a function using the former two variables (i.e., Hw and Vw) produce considerably more accurate results than that using latter two variables (i.e., El and Ew). It is shown that the semi-analytical approach works best in terms of both prediction accuracy and uncertainty, and the established empirical models produce considerably reasonable results except the model only using El. Moreover, present models have been compared with other models available in literature for estimating peak discharge.

Resistance formulas in hydraulics-based models for routing debris flows

USGS Publications Warehouse

Chen, Cheng-lung; Ling, Chi-Hai

1997-01-01

The one-dimensional, cross-section-averaged flow equations formulated for routing debris flows down a narrow valley are identical to those for clear-water flow, except for the differences in the values of the flow parameters, such as the momentum (or energy) correction factor, resistance coefficient, and friction slope. Though these flow parameters for debris flow in channels with cross-sections of arbitrary geometric shape can only be determined empirically, the theoretical values of such parameters for debris flow in wide channels exist. This paper aims to derive the theoretical resistance coefficient and friction slope for debris flow in wide channels using a rheological model for highly-concentrated, rapidly-sheared granular flows, such as the generalized viscoplastic fluid (GVF) model. Formulating such resistance coefficient or friction slope is equivalent to developing a generally applicable resistance formula for routing debris flows. Inclusion of a nonuniform term in the expression of the resistance formula proves useful in removing the customary assumption that the spatially varied resistance at any section is equal to what would take place with the same rate of flow passing the same section under conditions of uniformity. This in effect implies an improvement in the accuracy of unsteady debris-flow computation.

The Molecular Structure of Penicillin

ERIC Educational Resources Information Center

Bentley, Ronald

2004-01-01

Overviews of the observations that constitute a structure proof for penicillin, specifically aimed at the general student population, are presented. Melting points and boiling points were criteria of purity and a crucial tool was microanalysis leading to empirical formulas.

[Near infrared analysis of blending homogeneity of Chinese medicine formula particles based on moving window F test method].

PubMed

Yang, Chan; Xu, Bing; Zhang, Zhi-Qiang; Wang, Xin; Shi, Xin-Yuan; Fu, Jing; Qiao, Yan-Jiang

2016-10-01

Blending uniformity is essential to ensure the homogeneity of Chinese medicine formula particles within each batch. This study was based on the blending process of ebony spray dried powder and dextrin(the proportion of dextrin was 10%),in which the analysis of near infrared (NIR) diffuse reflectance spectra was collected from six different sampling points in combination with moving window F test method in order to assess the blending uniformity of the blending process.The method was validated by the changes of citric acid content determined by the HPLC. The results of moving window F test method showed that the ebony spray dried powder and dextrin was homogeneous during 200-300 r and was segregated during 300-400 r. An advantage of this method is that the threshold value is defined statistically, not empirically and thus does not suffer from threshold ambiguities in common with the moving block standard deviatiun (MBSD). And this method could be employed to monitor other blending process of Chinese medicine powders on line. Copyright© by the Chinese Pharmaceutical Association.

Pull-out simulations of a capped carbon nanotube in carbon nanotube-reinforced nanocomposites

NASA Astrophysics Data System (ADS)

Li, Y.; Liu, S.; Hu, N.; Han, X.; Zhou, L.; Ning, H.; Wu, L.; Alamusi, Yamamoto, G.; Chang, C.; Hashida, T.; Atobe, S.; Fukunaga, H.

2013-04-01

Systematic atomic simulations based on molecular mechanics were conducted to investigate the pull-out behavior of a capped carbon nanotube (CNT) in CNT-reinforced nanocomposites. Two common cases were studied: the pull-out of a complete CNT from a polymer matrix in a CNT/polymer nanocomposite and the pull-out of the broken outer walls of a CNT from the intact inner walls (i.e., the sword-in-sheath mode) in a CNT/alumina nanocomposite. By analyzing the obtained relationship between the energy increment (i.e., the difference in the potential energy between two consecutive pull-out steps) and the pull-out displacement, a set of simple empirical formulas based on the nanotube diameter was developed to predict the corresponding pull-out force. The predictions from these formulas are quite consistent with the experimental results. Moreover, the much higher pull-out force for a capped CNT than that of the corresponding open-ended CNT implies a significant contribution from the CNT cap to the interfacial properties of the CNT-reinforced nanocomposites. This finding provides a valuable insight for designing nanocomposites with desirable mechanical properties.

Thermodynamic properties of sea air

NASA Astrophysics Data System (ADS)

Feistel, R.; Wright, D. G.; Kretzschmar, H.-J.; Hagen, E.; Herrmann, S.; Span, R.

2010-02-01

Very accurate thermodynamic potential functions are available for fluid water, ice, seawater and humid air covering wide ranges of temperature and pressure conditions. They permit the consistent computation of all equilibrium properties as, for example, required for coupled atmosphere-ocean models or the analysis of observational or experimental data. With the exception of humid air, these potential functions are already formulated as international standards released by the International Association for the Properties of Water and Steam (IAPWS), and have been adopted in 2009 for oceanography by IOC/UNESCO. In this paper, we derive a collection of formulas for important quantities expressed in terms of the thermodynamic potentials, valid for typical phase transitions and composite systems of humid air and water/ice/seawater. Particular attention is given to equilibria between seawater and humid air, referred to as "sea air" here. In a related initiative, these formulas will soon be implemented in a source-code library for easy practical use. The library is primarily aimed at oceanographic applications but will be relevant to air-sea interaction and meteorology as well. The formulas provided are valid for any consistent set of suitable thermodynamic potential functions. Here we adopt potential functions from previous publications in which they are constructed from theoretical laws and empirical data; they are briefly summarized in the appendix. The formulas make use of the full accuracy of these thermodynamic potentials, without additional approximations or empirical coefficients. They are expressed in the temperature scale ITS-90 and the 2008 Reference-Composition Salinity Scale.

Thermodynamic properties of sea air

NASA Astrophysics Data System (ADS)

Feistel, R.; Kretzschmar, H.-J.; Span, R.; Hagen, E.; Wright, D. G.; Herrmann, S.

2009-10-01

Very accurate thermodynamic potential functions are available for fluid water, ice, seawater and humid air covering wide ranges of temperature and pressure conditions. They permit the consistent computation of all equilibrium properties as, for example, required for coupled atmosphere-ocean models or the analysis of observational or experimental data. With the exception of humid air, these potential functions are already formulated as international standards released by the International Association for the Properties of Water and Steam (IAPWS), and have been adopted in 2009 for oceanography by IOC/UNESCO. In this paper, we derive a collection of formulas for important quantities expressed in terms of the thermodynamic potentials, valid for typical phase transitions and composite systems of humid air and water/ice/seawater. Particular attention is given to equilibria between seawater and humid air, referred to as ''sea air'' here. In a related initiative, these formulas will soon be implemented in a source-code library for easy practical use. The library is primarily aimed at oceanographic applications but will be relevant to air-sea interaction and meteorology as well. The formulas provided are valid for any consistent set of suitable thermodynamic potential functions. Here we adopt potential functions from previous publications in which they are constructed from theoretical laws and empirical data; they are briefly summarized in the appendix. The formulas make use of the full accuracy of these thermodynamic potentials, without additional approximations or empirical coefficients. They are expressed in the temperature scale ITS-90 and the 2008 Reference-Composition Salinity Scale.

Predictability in cellular automata.

PubMed

Agapie, Alexandru; Andreica, Anca; Chira, Camelia; Giuclea, Marius

2014-01-01

Modelled as finite homogeneous Markov chains, probabilistic cellular automata with local transition probabilities in (0, 1) always posses a stationary distribution. This result alone is not very helpful when it comes to predicting the final configuration; one needs also a formula connecting the probabilities in the stationary distribution to some intrinsic feature of the lattice configuration. Previous results on the asynchronous cellular automata have showed that such feature really exists. It is the number of zero-one borders within the automaton's binary configuration. An exponential formula in the number of zero-one borders has been proved for the 1-D, 2-D and 3-D asynchronous automata with neighborhood three, five and seven, respectively. We perform computer experiments on a synchronous cellular automaton to check whether the empirical distribution obeys also that theoretical formula. The numerical results indicate a perfect fit for neighbourhood three and five, which opens the way for a rigorous proof of the formula in this new, synchronous case.

Heat Transfer Coefficient at Cast-Mold Interface During Centrifugal Casting: Calculation of Air Gap

NASA Astrophysics Data System (ADS)

Bohacek, Jan; Kharicha, Abdellah; Ludwig, Andreas; Wu, Menghuai; Karimi-Sibaki, Ebrahim

2018-06-01

During centrifugal casting, the thermal resistance at the cast-mold interface represents a main blockage mechanism for heat transfer. In addition to the refractory coating, an air gap begins to form due to the shrinkage of the casting and the mold expansion, under the continuous influence of strong centrifugal forces. Here, the heat transfer coefficient at the cast-mold interface h has been determined from calculations of the air gap thickness d a based on a plane stress model taking into account thermoelastic stresses, centrifugal forces, plastic deformations, and a temperature-dependent Young's modulus. The numerical approach proposed here is rather novel and tries to offer an alternative to the empirical formulas usually used in numerical simulations for a description of a time-dependent heat transfer coefficient h. Several numerical tests were performed for different coating thicknesses d C, rotation rates Ω, and temperatures of solidus T sol. Results demonstrated that the scenario at the interface is unique for each set of parameters, hindering the possibility of employing empirical formulas without a preceding experiment being performed. Initial values of h are simply equivalent to the ratio of the coating thermal conductivity and its thickness ( 1000 Wm-2 K-1). Later, when the air gap is formed, h drops exponentially to values at least one order of magnitude smaller ( 100 Wm-2 K-1).

Temperature dependence of Er³⁺ ionoluminescence and photoluminescence in Gd₂O₃:Bi nanopowder.

PubMed

Boruc, Zuzanna; Gawlik, Grzegorz; Fetliński, Bartosz; Kaczkan, Marcin; Malinowski, Michał

2014-06-01

Ionoluminescence (IL) and photoluminescence (PL) of trivalent erbium ions (Er(3+)) in Gd2O3 nanopowder host activated with Bi(3+) ions has been studied in order to establish the link between changes in luminescent spectra and temperature of the sample material. IL measurements have been performed with H2 (+) 100 keV ion beam bombarding the target material for a few seconds, while PL spectra have been collected for temperatures ranging from 20 °C to 700 °C. The PL data was used as a reference in determining the temperature corresponding to IL spectra. The collected data enabled the definition of empirical formula based on the Boltzmann distribution, which allows the temperature to be determined with a maximum sensitivity of 9.7 × 10(-3) °C(-1). The analysis of the Er(3+) energy level structure in terms of tendency of the system to stay in thermal equilibrium, explained different behaviors of the line intensities. This work led to the conclusion that temperature changes during ion excitation can be easily defined with separately collected PL spectra. The final result, which is empirical formula describing dependence of fluorescence intensity ratio on temperature, raises the idea of an application of method in temperature control, during processes like ion implantation and some nuclear applications.

An empirical, graphical, and analytical study of the relationship between vegetation indices. [derived from LANDSAT data

NASA Technical Reports Server (NTRS)

Lautenschlager, L.; Perry, C. R., Jr. (Principal Investigator)

1981-01-01

The development of formulae for the reduction of multispectral scanner measurements to a single value (vegetation index) for predicting and assessing vegetative characteristics is addressed. The origin, motivation, and derivation of some four dozen vegetation indices are summarized. Empirical, graphical, and analytical techniques are used to investigate the relationships among the various indices. It is concluded that many vegetative indices are very similar, some being simple algebraic transforms of others.

Establishing the diffuse correlation spectroscopy signal relationship with blood flow.

PubMed

Boas, David A; Sakadžić, Sava; Selb, Juliette; Farzam, Parisa; Franceschini, Maria Angela; Carp, Stefan A

2016-07-01

Diffuse correlation spectroscopy (DCS) measurements of blood flow rely on the sensitivity of the temporal autocorrelation function of diffusively scattered light to red blood cell (RBC) mean square displacement (MSD). For RBCs flowing with convective velocity [Formula: see text], the autocorrelation is expected to decay exponentially with [Formula: see text], where [Formula: see text] is the delay time. RBCs also experience shear-induced diffusion with a diffusion coefficient [Formula: see text] and an MSD of [Formula: see text]. Surprisingly, experimental data primarily reflect diffusive behavior. To provide quantitative estimates of the relative contributions of convective and diffusive movements, we performed Monte Carlo simulations of light scattering through tissue of varying vessel densities. We assumed laminar vessel flow profiles and accounted for shear-induced diffusion effects. In agreement with experimental data, we found that diffusive motion dominates the correlation decay for typical DCS measurement parameters. Furthermore, our model offers a quantitative relationship between the RBC diffusion coefficient and absolute tissue blood flow. We thus offer, for the first time, theoretical support for the empirically accepted ability of the DCS blood flow index ([Formula: see text]) to quantify tissue perfusion. We find [Formula: see text] to be linearly proportional to blood flow, but with a proportionality modulated by the hemoglobin concentration and the average blood vessel diameter.

Lutetium oxyorthosilicate (LSO) intrinsic activity correction and minimal detectable target activity study for SPECT imaging with a LSO-based animal PET scanner

NASA Astrophysics Data System (ADS)

Yao, Rutao; Ma, Tianyu; Shao, Yiping

2008-08-01

This work is part of a feasibility study to develop SPECT imaging capability on a lutetium oxyorthosilicate (LSO) based animal PET system. The SPECT acquisition was enabled by inserting a collimator assembly inside the detector ring and acquiring data in singles mode. The same LSO detectors were used for both PET and SPECT imaging. The intrinsic radioactivity of 176Lu in the LSO crystals, however, contaminates the SPECT data, and can generate image artifacts and introduce quantification error. The objectives of this study were to evaluate the effectiveness of a LSO background subtraction method, and to estimate the minimal detectable target activity (MDTA) of image object for SPECT imaging. For LSO background correction, the LSO contribution in an image study was estimated based on a pre-measured long LSO background scan and subtracted prior to the image reconstruction. The MDTA was estimated in two ways. The empirical MDTA (eMDTA) was estimated from screening the tomographic images at different activity levels. The calculated MDTA (cMDTA) was estimated from using a formula based on applying a modified Currie equation on an average projection dataset. Two simulated and two experimental phantoms with different object activity distributions and levels were used in this study. The results showed that LSO background adds concentric ring artifacts to the reconstructed image, and the simple subtraction method can effectively remove these artifacts—the effect of the correction was more visible when the object activity level was near or above the eMDTA. For the four phantoms studied, the cMDTA was consistently about five times of the corresponding eMDTA. In summary, we implemented a simple LSO background subtraction method and demonstrated its effectiveness. The projection-based calculation formula yielded MDTA results that closely correlate with that obtained empirically and may have predicative value for imaging applications.

Fractal Analysis of Permeability of Unsaturated Fractured Rocks

PubMed Central

Jiang, Guoping; Shi, Wei; Huang, Lili

2013-01-01

A physical conceptual model for water retention in fractured rocks is derived while taking into account the effect of pore size distribution and tortuosity of capillaries. The formula of calculating relative hydraulic conductivity of fractured rock is given based on fractal theory. It is an issue to choose an appropriate capillary pressure-saturation curve in the research of unsaturated fractured mass. The geometric pattern of the fracture bulk is described based on the fractal distribution of tortuosity. The resulting water content expression is then used to estimate the unsaturated hydraulic conductivity of the fractured medium based on the well-known model of Burdine. It is found that for large enough ranges of fracture apertures the new constitutive model converges to the empirical Brooks-Corey model. PMID:23690746

Fractal analysis of permeability of unsaturated fractured rocks.

PubMed

Jiang, Guoping; Shi, Wei; Huang, Lili

2013-01-01

A physical conceptual model for water retention in fractured rocks is derived while taking into account the effect of pore size distribution and tortuosity of capillaries. The formula of calculating relative hydraulic conductivity of fractured rock is given based on fractal theory. It is an issue to choose an appropriate capillary pressure-saturation curve in the research of unsaturated fractured mass. The geometric pattern of the fracture bulk is described based on the fractal distribution of tortuosity. The resulting water content expression is then used to estimate the unsaturated hydraulic conductivity of the fractured medium based on the well-known model of Burdine. It is found that for large enough ranges of fracture apertures the new constitutive model converges to the empirical Brooks-Corey model.

Study on Inland River Vessel Fuel-oil Spillage and Emergency Response Strategies

NASA Astrophysics Data System (ADS)

Chen, R. C.; Shi, N.; Wang, K. S.

2017-12-01

by making statistics and conducting regression analysis on the carrying volume of vessels navigating on inland rivers and coastal waters, the linear relation between the oil volume carried by a vessel and its gross tonnage (GT) is found. Based on the linear relation, the possible spillage of a 10,000 GT vessel is estimated by using the empirical formula method which is commonly used to measure oil spillage from any vessel spill incident. In the waters downstream of Yangtze River, the trajectory and fates model is used to predict the drifting paths and fates of the spilled oil under three weather scenarios, and then, the emergency response strategies for vessel oil spills are put forth. The results of the research can be used to develop an empirical method to quickly estimate oil spillage and provide recommendations on oil spill emergency response strategies for decision-makers.

Improving an Empirical Formula for the Absorption of Sound in the Sea

DTIC Science & Technology

2008-05-01

Onderwater propagatie Advanced acoustic modelling Auteur (s) ir. C.A.M van Moll Programmanummer Projectnummer dr. M.A. Ainslie V512 032.11648 ing. J...versus calculated absorption .................................................................... 9 3 Inverse theory ...45 7.1 Statistical theory

Field dependence of the electron drift velocity along the hexagonal axis of 4H-SiC

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ivanov, P. A., E-mail: Pavel.Ivanov@mail.ioffe.ru; Potapov, A. S.; Samsonova, T. P.

The forward current–voltage characteristics of mesa-epitaxial 4H-SiC Schottky diodes are measured in high electric fields (up to 4 × 10{sup 5} V/cm) in the n-type base region. A semi-empirical formula for the field dependence of the electron drift velocity in 4H-SiC along the hexagonal axis of the crystal is derived. It is shown that the saturated drift velocity is (1.55 ± 0.05) × 10{sup 7} cm/s in electric fields higher than 2 × 10{sup 5} V/cm.

Chicken-based formula is better tolerated than extensively hydrolyzed casein formula for the management of cow milk protein allergy in infants.

PubMed

Jirapinyo, Pipop; Densupsoontorn, Narumon; Kangwanpornsiri, Channagan; Wongarn, Renu

2012-01-01

The effective treatment of cow milk allergy in infants consists of elimination of cow milk protein and the introduction of formulas based on an extensively hydrolyzed protein formula or an amino acid-based formula. However, about 10% of these infants are still allergic to an extensively hydrolyzed protein formula and an amino acid-based formula is very expensive. We conducted a study to verify whether the new chicken-based formula will be better tolerated than an extensively hydrolyzed protein formula for the treatment of cow milk allergy in infants. One hundred infants, diagnosed with cow milk allergy by double-blind, placebo-controlled food challenge tests, were enrolled in a double-blind, randomized, cross-over study to compare a response to an extensively hydrolyzed protein formula and the chicken-based formula. Subjects were randomly given one of the two formulas for 2 weeks. There was a 2-week washout period of taking an amino acid-based formula before being switched to the other formula for another 2 weeks. If the subjects showed allergic symptoms during the 2 weeks of test formula, they would be announced as intolerance or allergic to that formula. Sixty seven of 80 confirmed subjects agreed to enroll their infants. Fifty-eight subjects completed the study. Twenty and 33 infants were tolerant whereas and 38 and 25 infants were intolerant to an extensively hydrolyzed protein formula and the chicken-based formula, respectively. The chicken-based formula showed significantly better tolerance than an extensively hydrolyzed protein formula in the management of cow milk allergy in infants.

Ultra-heavy cosmic rays: Theoretical implications of recent observations

NASA Technical Reports Server (NTRS)

Blake, J. B.; Hainebach, K. L.; Schramm, D. N.; Anglin, J. D.

1977-01-01

Extreme ultraheavy cosmic ray observations (Z greater or equal 70) are compared with r-process models. A detailed cosmic ray propagation calculation is used to transform the calculated source distributions to those observed at the earth. The r-process production abundances are calculated using different mass formulae and beta-rate formulae; an empirical estimate based on the observed solar system abundances is used also. There is the continued strong indication of an r-process dominance in the extreme ultra-heavy cosmic rays. However it is shown that the observed high actinide/Pt ratio in the cosmic rays cannot be fit with the same r-process calculation which also fits the solar system material. This result suggests that the cosmic rays probably undergo some preferential acceleration in addition to the apparent general enrichment in heavy (r-process) material. As estimate also is made of the expected relative abundance of superheavy elements in the cosmic rays if the anomalous heavy xenon in carbonaceous chondrites is due to a fissioning superheavy element.

Analysis of the damage threshold of the GaAs pseudomorphic high electron mobility transistor induced by the electromagnetic pulse

NASA Astrophysics Data System (ADS)

Xi, Xiao-Wen; Chai, Chang-Chun; Liu, Yang; Yang, Yin-Tang; Fan, Qing-Yang; Shi, Chun-Lei

2016-08-01

An electromagnetic pulse (EMP)-induced damage model based on the internal damage mechanism of the GaAs pseudomorphic high electron mobility transistor (PHEMT) is established in this paper. With this model, the relationships among the damage power, damage energy, pulse width and signal amplitude are investigated. Simulation results show that the pulse width index from the damage power formula obtained here is higher than that from the empirical formula due to the hotspot transferring in the damage process of the device. It is observed that the damage energy is not a constant, which decreases with the signal amplitude increasing, and then changes little when the signal amplitude reaches up to a certain level. Project supported by the National Basic Research Program of China (Grant No. 2014CB339900) and the Open Fund of Key Laboratory of Complex Electromagnetic Environment Science and Technology, China Academy of Engineering Physics (CAEP) (Grant No. 2015-0214.XY.K).

Estimation of Downwind Concentration of Airborne Effluents Discharged in the Neighbourhood of Buildings.

ERIC Educational Resources Information Center

Barry, P. J.

Air flow in the neighborhood of buildings is briefly described and compared with that assumed for the usual atmospheric diffusion equations. The literature is reviewed and empirical formulae which have been proposed are listed and compared. (RH)

First-order approximation for the pressure-flow relationship of spontaneously contracting lymphangions.

PubMed

Quick, Christopher M; Venugopal, Arun M; Dongaonkar, Ranjeet M; Laine, Glen A; Stewart, Randolph H

2008-05-01

To return lymph to the great veins of the neck, it must be actively pumped against a pressure gradient. Mean lymph flow in a portion of a lymphatic network has been characterized by an empirical relationship (P(in) - P(out) = -P(p) + R(L)Q(L)), where P(in) - P(out) is the axial pressure gradient and Q(L) is mean lymph flow. R(L) and P(p) are empirical parameters characterizing the effective lymphatic resistance and pump pressure, respectively. The relation of these global empirical parameters to the properties of lymphangions, the segments of a lymphatic vessel bounded by valves, has been problematic. Lymphangions have a structure like blood vessels but cyclically contract like cardiac ventricles; they are characterized by a contraction frequency (f) and the slopes of the end-diastolic pressure-volume relationship [minimum value of resulting elastance (E(min))] and end-systolic pressure-volume relationship [maximum value of resulting elastance (E(max))]. Poiseuille's law provides a first-order approximation relating the pressure-flow relationship to the fundamental properties of a blood vessel. No analogous formula exists for a pumping lymphangion. We therefore derived an algebraic formula predicting lymphangion flow from fundamental physical principles and known lymphangion properties. Quantitative analysis revealed that lymph inertia and resistance to lymph flow are negligible and that lymphangions act like a series of interconnected ventricles. For a single lymphangion, P(p) = P(in) (E(max) - E(min))/E(min) and R(L) = E(max)/f. The formula was tested against a validated, realistic mathematical model of a lymphangion and found to be accurate. Predicted flows were within the range of flows measured in vitro. The present work therefore provides a general solution that makes it possible to relate fundamental lymphangion properties to lymphatic system function.

Towards the intrahour forecasting of direct normal irradiance using sky-imaging data.

PubMed

Nou, Julien; Chauvin, Rémi; Eynard, Julien; Thil, Stéphane; Grieu, Stéphane

2018-04-01

Increasing power plant efficiency through improved operation is key in the development of Concentrating Solar Power (CSP) technologies. To this end, one of the most challenging topics remains accurately forecasting the solar resource at a short-term horizon. Indeed, in CSP plants, production is directly impacted by both the availability and variability of the solar resource and, more specifically, by Direct Normal Irradiance (DNI). The present paper deals with a new approach to the intrahour forecasting (the forecast horizon [Formula: see text] is up to [Formula: see text] ahead) of DNI, taking advantage of the fact that this quantity can be split into two terms, i.e. clear-sky DNI and the clear sky index. Clear-sky DNI is forecasted from DNI measurements, using an empirical model (Ineichen and Perez, 2002) combined with a persistence of atmospheric turbidity. Moreover, in the framework of the CSPIMP (Concentrating Solar Power plant efficiency IMProvement) research project, PROMES-CNRS has developed a sky imager able to provide High Dynamic Range (HDR) images. So, regarding the clear-sky index, it is forecasted from sky-imaging data, using an Adaptive Network-based Fuzzy Inference System (ANFIS). A hybrid algorithm that takes inspiration from the classification algorithm proposed by Ghonima et al. (2012) when clear-sky anisotropy is known and from the hybrid thresholding algorithm proposed by Li et al. (2011) in the opposite case has been developed to the detection of clouds. Performance is evaluated via a comparative study in which persistence models - either a persistence of DNI or a persistence of the clear-sky index - are included. Preliminary results highlight that the proposed approach has the potential to outperform these models (both persistence models achieve similar performance) in terms of forecasting accuracy: over the test data used, RMSE (the Root Mean Square Error) is reduced of about [Formula: see text], with [Formula: see text], and [Formula: see text], with [Formula: see text].

A semi-empirical approach to analyze the activities of cylindrical radioactive samples using gamma energies from 185 to 1764 keV.

PubMed

Huy, Ngo Quang; Binh, Do Quang

2014-12-01

This work suggests a method for determining the activities of cylindrical radioactive samples. The self-attenuation factor was applied for providing the self-absorption correction of gamma rays in the sample material. The experimental measurement of a (238)U reference sample and the calculation using the MCNP5 code allow obtaining the semi-empirical formulae of detecting efficiencies for the gamma energies ranged from 185 to 1764keV. These formulae were used to determine the activities of the (238)U, (226)Ra, (232)Th, (137)Cs and (40)K nuclides in the IAEA RGU-1, IAEA-434, IAEA RGTh-1, IAEA-152 and IAEA RGK-1 radioactive standards. The coincidence summing corrections for gamma rays in the (238)U and (232)Th series were applied. The activities obtained in this work were in good agreement with the reference values. Copyright © 2014 Elsevier Ltd. All rights reserved.

Experimental scaling law for mass ablation rate from a Sn plasma generated by a 1064 nm laser

NASA Astrophysics Data System (ADS)

Burdt, Russell A.; Yuspeh, Sam; Sequoia, Kevin L.; Tao, Yezheng; Tillack, Mark S.; Najmabadi, Farrokh

2009-08-01

The ablation depth in planar Sn targets irradiated with a pulsed 1064 nm laser was investigated over laser intensities from 3×1011 to 2×1012 W/cm2. The ablation depth was measured by irradiating a thin layer of Sn evaporated onto a Si wafer, and looking for signatures of Si ions in the expanding plasma with spectroscopic and particle diagnostics. It was found that ablation depth scales with laser intensity to the (5/9)th power, which is consistent with analytical models of steady-state laser ablation, as well as empirical formulae from previous studies of mass ablation rate in overlapping parameter space. In addition, the scaling of mass ablation rate with atomic number of the target as given by empirical formulae in previous studies using targets such as C and Al, are shown to remain valid for the higher atomic number of the target (Z =50) used in these experiments.

Predictability in Cellular Automata

PubMed Central

Agapie, Alexandru; Andreica, Anca; Chira, Camelia; Giuclea, Marius

2014-01-01

Modelled as finite homogeneous Markov chains, probabilistic cellular automata with local transition probabilities in (0, 1) always posses a stationary distribution. This result alone is not very helpful when it comes to predicting the final configuration; one needs also a formula connecting the probabilities in the stationary distribution to some intrinsic feature of the lattice configuration. Previous results on the asynchronous cellular automata have showed that such feature really exists. It is the number of zero-one borders within the automaton's binary configuration. An exponential formula in the number of zero-one borders has been proved for the 1-D, 2-D and 3-D asynchronous automata with neighborhood three, five and seven, respectively. We perform computer experiments on a synchronous cellular automaton to check whether the empirical distribution obeys also that theoretical formula. The numerical results indicate a perfect fit for neighbourhood three and five, which opens the way for a rigorous proof of the formula in this new, synchronous case. PMID:25271778

Structure of S-shaped growth in innovation diffusion

NASA Astrophysics Data System (ADS)

Shimogawa, Shinsuke; Shinno, Miyuki; Saito, Hiroshi

2012-05-01

A basic question on innovation diffusion is why the growth curve of the adopter population in a large society is often S shaped. From macroscopic, microscopic, and mesoscopic viewpoints, the growth of the adopter population is observed as the growth curve, individual adoptions, and differences among individual adoptions, respectively. The S shape can be explained if an empirical model of the growth curve can be deduced from models of microscopic and mesoscopic structures. However, even the structure of growth curve has not been revealed yet because long-term extrapolations by proposed models of S-shaped curves are unstable and it has been very difficult to predict the long-term growth and final adopter population. This paper studies the S-shaped growth from the viewpoint of social regularities. Simple methods to analyze power laws enable us to extract the structure of the growth curve directly from the growth data of recent basic telecommunication services. This empirical model of growth curve is singular at the inflection point and a logarithmic function of time after this point, which explains the unstable extrapolations obtained using previously proposed models and the difficulty in predicting the final adopter population. Because the empirical S curve can be expressed in terms of two power laws of the regularity found in social performances of individuals, we propose the hypothesis that the S shape represents the heterogeneity of the adopter population, and the heterogeneity parameter is distributed under the regularity in social performances of individuals. This hypothesis is so powerful as to yield models of microscopic and mesoscopic structures. In the microscopic model, each potential adopter adopts the innovation when the information accumulated by the learning about the innovation exceeds a threshold. The accumulation rate of information is heterogeneous among the adopter population, whereas the threshold is a constant, which is the opposite of previously proposed models. In the mesoscopic model, flows of innovation information incoming to individuals are organized as dimorphic and partially clustered. These microscopic and mesoscopic models yield the empirical model of the S curve and explain the S shape as representing the regularities of information flows generated through a social self-organization. To demonstrate the validity and importance of the hypothesis, the models of three level structures are applied to reveal the mechanism determining and differentiating diffusion speeds. The empirical model of S curves implies that the coefficient of variation of the flow rates determines the diffusion speed for later adopters. Based on this property, a model describing the inside of information flow clusters can be given, which provides a formula interconnecting the diffusion speed, cluster populations, and a network topological parameter of the flow clusters. For two recent basic telecommunication services in Japan, the formula represents the variety of speeds in different areas and enables us to explain speed gaps between urban and rural areas and between the two services. Furthermore, the formula provides a method to estimate the final adopter population.

Testing the Quick Seismic Event Locator and Magnitude Calculator (SSL_Calc) by Marsite Project Data Base

NASA Astrophysics Data System (ADS)

Tunc, Suleyman; Tunc, Berna; Caka, Deniz; Baris, Serif

2016-04-01

Locating and calculating size of the seismic events is quickly one of the most important and challenging issue in especially real time seismology. In this study, we developed a Matlab application to locate seismic events and calculate their magnitudes (Local Magnitude and empirical Moment Magnitude) using single station called SSL_Calc. This newly developed sSoftware has been tested on the all stations of the Marsite project "New Directions in Seismic Hazard Assessment through Focused Earth Observation in the Marmara Supersite-MARsite". SSL_Calc algorithm is suitable both for velocity and acceleration sensors. Data has to be in GCF (Güralp Compressed Format). Online or offline data can be selected in SCREAM software (belongs to Guralp Systems Limited) and transferred to SSL_Calc. To locate event P and S wave picks have to be marked by using SSL_Calc window manually. During magnitude calculation, instrument correction has been removed and converted to real displacement in millimeter. Then the displacement data is converted to Wood Anderson Seismometer output by using; Z=[0;0]; P=[-6.28+4.71j; -6.28-4.71j]; A0=[2080] parameters. For Local Magnitude calculation,; maximum displacement amplitude (A) and distance (dist) are used in formula (1) for distances up to 200km and formula (2) for more than 200km. ML=log10(A)-(-1.118-0.0647*dist+0.00071*dist2-3.39E-6*dist3+5.71e-9*dist4) (1) ML=log10(A)+(2.1173+0.0082*dist-0.0000059628*dist2) (2) Following Local Magnitude calculation, the programcode calculates two empiric Moment Magnitudes using formulas (3) Akkar et al. (2010) and (4) Ulusay et al. (2004). Mw=0.953* ML+0.422 (3) Mw=0.7768* ML+1.5921 (4) SSL_Calc is a software that is easy to implement and user friendly and offers practical solution to individual users to location of event and ML, Mw calculation.

Experimental Study of Dry Granular Flow and Impact Behavior Against a Rigid Retaining Wall

NASA Astrophysics Data System (ADS)

Jiang, Yuan-Jun; Towhata, Ikuo

2013-07-01

Shallow slope failure in mountainous regions is a common and emergent hazard in terms of its damage to important traffic routes and local communities. The impact of dry granular flows consisting of rock fragments and other particles resulting from shallow slope failures on retaining structures has yet to be systematically researched and is not covered by current design codes. As a preliminary study of the impact caused by dry granular flows, a series of dry granular impact experiments were carried out for one model of a retaining wall. It was indirectly verified that the total normal force exerted on a retaining wall consists of a drag force ( F d), a gravitational and frictional force ( F gf), and a passive earth force ( F p), and that the calculation of F d can be based on the empirical formula defined in NF EN Eurocode 1990 ( Eurocode structuraux. Base de calcul des structures, AFNOR La plaine Saint Denis, 2003). It was also indirectly verified that, for flow with Froude number from 6 to 11, the drag coefficient ( C d) can be estimated using the previously proposed empirical parameters.

Modelling of deep gaps created by giant planets in protoplanetary disks

NASA Astrophysics Data System (ADS)

Kanagawa, Kazuhiro D.; Tanaka, Hidekazu; Muto, Takayuki; Tanigawa, Takayuki

2017-12-01

A giant planet embedded in a protoplanetary disk creates a gap. This process is important for both theory and observation. Using results of a survey for a wide parameter range with two-dimensional hydrodynamic simulations, we constructed an empirical formula for the gap structure (i.e., the radial surface density distribution), which can reproduce the gap width and depth obtained by two-dimensional simulations. This formula enables us to judge whether an observed gap is likely to be caused by an embedded planet or not. The propagation of waves launched by the planet is closely connected to the gap structure. It makes the gap wider and shallower as compared with the case where an instantaneous wave damping is assumed. The hydrodynamic simulations show that the waves do not decay immediately at the launching point of waves, even when the planet is as massive as Jupiter. Based on the results of hydrodynamic simulations, we also obtained an empirical model of wave propagation and damping in cases of deep gaps. The one-dimensional gap model with our wave propagation model is able to reproduce the gap structures in hydrodynamic simulations well. In the case of a Jupiter-mass planet, we also found that the waves with a smaller wavenumber (e.g., m = 2) are excited and transport the angular momentum to a location far away from the planet. The wave with m = 2 is closely related with a secondary wave launched by a site opposite from the planet.

Characterizing short-term stability for Boolean networks over any distribution of transfer functions

DOE PAGES

Seshadhri, C.; Smith, Andrew M.; Vorobeychik, Yevgeniy; ...

2016-07-05

Here we present a characterization of short-term stability of random Boolean networks under arbitrary distributions of transfer functions. Given any distribution of transfer functions for a random Boolean network, we present a formula that decides whether short-term chaos (damage spreading) will happen. We provide a formal proof for this formula, and empirically show that its predictions are accurate. Previous work only works for special cases of balanced families. Finally, it has been observed that these characterizations fail for unbalanced families, yet such families are widespread in real biological networks.

New Objective Refraction Metric Based on Sphere Fitting to the Wavefront

PubMed Central

Martínez-Finkelshtein, Andreí

2017-01-01

Purpose To develop an objective refraction formula based on the ocular wavefront error (WFE) expressed in terms of Zernike coefficients and pupil radius, which would be an accurate predictor of subjective spherical equivalent (SE) for different pupil sizes. Methods A sphere is fitted to the ocular wavefront at the center and at a variable distance, t. The optimal fitting distance, topt, is obtained empirically from a dataset of 308 eyes as a function of objective refraction pupil radius, r0, and used to define the formula of a new wavefront refraction metric (MTR). The metric is tested in another, independent dataset of 200 eyes. Results For pupil radii r0 ≤ 2 mm, the new metric predicts the equivalent sphere with similar accuracy (<0.1D), however, for r0 > 2 mm, the mean error of traditional metrics can increase beyond 0.25D, and the MTR remains accurate. The proposed metric allows clinicians to obtain an accurate clinical spherical equivalent value without rescaling/refitting of the wavefront coefficients. It has the potential to be developed into a metric which will be able to predict full spherocylindrical refraction for the desired illumination conditions and corresponding pupil size. PMID:29104804

New Objective Refraction Metric Based on Sphere Fitting to the Wavefront.

PubMed

Jaskulski, Mateusz; Martínez-Finkelshtein, Andreí; López-Gil, Norberto

2017-01-01

To develop an objective refraction formula based on the ocular wavefront error (WFE) expressed in terms of Zernike coefficients and pupil radius, which would be an accurate predictor of subjective spherical equivalent (SE) for different pupil sizes. A sphere is fitted to the ocular wavefront at the center and at a variable distance, t . The optimal fitting distance, t opt , is obtained empirically from a dataset of 308 eyes as a function of objective refraction pupil radius, r 0 , and used to define the formula of a new wavefront refraction metric (MTR). The metric is tested in another, independent dataset of 200 eyes. For pupil radii r 0 ≤ 2 mm, the new metric predicts the equivalent sphere with similar accuracy (<0.1D), however, for r 0 > 2 mm, the mean error of traditional metrics can increase beyond 0.25D, and the MTR remains accurate. The proposed metric allows clinicians to obtain an accurate clinical spherical equivalent value without rescaling/refitting of the wavefront coefficients. It has the potential to be developed into a metric which will be able to predict full spherocylindrical refraction for the desired illumination conditions and corresponding pupil size.

Pull-out simulations of a capped carbon nanotube in carbon nanotube-reinforced nanocomposites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Y.; Liu, S.; Hu, N.

2013-04-14

Systematic atomic simulations based on molecular mechanics were conducted to investigate the pull-out behavior of a capped carbon nanotube (CNT) in CNT-reinforced nanocomposites. Two common cases were studied: the pull-out of a complete CNT from a polymer matrix in a CNT/polymer nanocomposite and the pull-out of the broken outer walls of a CNT from the intact inner walls (i.e., the sword-in-sheath mode) in a CNT/alumina nanocomposite. By analyzing the obtained relationship between the energy increment (i.e., the difference in the potential energy between two consecutive pull-out steps) and the pull-out displacement, a set of simple empirical formulas based on themore » nanotube diameter was developed to predict the corresponding pull-out force. The predictions from these formulas are quite consistent with the experimental results. Moreover, the much higher pull-out force for a capped CNT than that of the corresponding open-ended CNT implies a significant contribution from the CNT cap to the interfacial properties of the CNT-reinforced nanocomposites. This finding provides a valuable insight for designing nanocomposites with desirable mechanical properties.« less

Electronically conductive perovskite-based oxide nanoparticles and films for optical sensing applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ohodnicki, Jr., Paul R; Schultz, Andrew M

2015-04-28

The disclosure relates to a method of detecting a change in a chemical composition by contacting a electronically conducting perovskite-based metal oxide material with a monitored stream, illuminating the electronically conducting perovskite-based metal oxide with incident light, collecting exiting light, monitoring an optical signal based on a comparison of the incident light and the exiting light, and detecting a shift in the optical signal. The electronically conducting perovskite-based metal oxide has a perovskite-based crystal structure and an electronic conductivity of at least 10.sup.-1 S/cm, where parameters are specified at the gas stream temperature. The electronically conducting perovskite-based metal oxide hasmore » an empirical formula A.sub.xB.sub.yO.sub.3-.delta., where A is at least a first element at the A-site, B is at least a second element at the B-site, and where 0.8« less

Understanding women's interpretations of infant formula advertising.

PubMed

Parry, Kathleen; Taylor, Emily; Hall-Dardess, Pam; Walker, Marsha; Labbok, Miriam

2013-06-01

Exclusive breastfeeding for 6 months and continued breastfeeding for at least 1 year is recommended by all major health organizations. Whereas 74.6 percent of mothers initiate breastfeeding at birth, exclusivity and duration remain significantly lower than national goals. Empirical evidence suggests that exposure to infant formula marketing contributes to supplementation and premature cessation. The objective of this study was to explore how women interpret infant formula advertising to aid in an understanding of this association. Four focus groups were structured to include women with similar childbearing experience divided according to reproductive status: preconceptional, pregnant, exclusive breastfeeders, and formula feeders. Facilitators used a prepared protocol to guide discussion of infant formula advertisements. Authors conducted a thematic content analysis with special attention to women's statements about what they believed the advertisements said about how the products related to human milk (superior, inferior, similar) and how they reported reacting to these interpretations. Participants reported that the advertisements conveyed an expectation of failure with breastfeeding, and that formula is a solution to fussiness, spitting up, and other normal infant behaviors. Participants reported that the advertisements were confusing in terms of how formula-feeding is superior, inferior or the same as breastfeeding. This confusion was exacerbated by an awareness of distribution by health care practitioners and institutions, suggesting provider endorsement of infant formula. Formula marketing appears to decrease mothers' confidence in their ability to breastfeed, especially when provided by health care practitioners and institutions. Therefore, to be supportive of breastfeeding, perinatal educators and practitioners could be more effective if they did not offer infant formula advertising to mothers. © 2013, Copyright the Authors, Journal compilation © 2013, Wiley Periodicals, Inc.

Characteristic fragment size distributions in dynamic fragmentation

NASA Astrophysics Data System (ADS)

Zhou, Fenghua; Molinari, Jean-François; Ramesh, K. T.

2006-06-01

The one-dimensional fragmentation of a dynamically expanding ring (Mott's problem) is studied numerically to obtain the fragment signatures under different strain rates. An empirical formula is proposed to calculate an average fragment size. Rayleigh distribution is found to describe the statistical properties of the fragment populations.

Estimation of Reliability Coefficients Using the Test Information Function and Its Modifications.

ERIC Educational Resources Information Center

Samejima, Fumiko

1994-01-01

The reliability coefficient is predicted from the test information function (TIF) or two modified TIF formulas and a specific trait distribution. Examples illustrate the variability of the reliability coefficient across different trait distributions, and results are compared with empirical reliability coefficients. (SLD)

Using antibiograms to improve antibiotic prescribing in skilled nursing facilities.

PubMed

Furuno, Jon P; Comer, Angela C; Johnson, J Kristie; Rosenberg, Joseph H; Moore, Susan L; MacKenzie, Thomas D; Hall, Kendall K; Hirshon, Jon Mark

2014-10-01

Antibiograms have effectively improved antibiotic prescribing in acute-care settings; however, their effectiveness in skilled nursing facilities (SNFs) is currently unknown. To develop SNF-specific antibiograms and identify opportunities to improve antibiotic prescribing. Cross-sectional and pretest-posttest study among residents of 3 Maryland SNFs. Antibiograms were created using clinical culture data from a 6-month period in each SNF. We also used admission clinical culture data from the acute care facility primarily associated with each SNF for transferred residents. We manually collected all data from medical charts, and antibiograms were created using WHONET software. We then used a pretest-posttest study to evaluate the effectiveness of an antibiogram on changing antibiotic prescribing practices in a single SNF. Appropriate empirical antibiotic therapy was defined as an empirical antibiotic choice that sufficiently covered the infecting organism, considering antibiotic susceptibilities. We reviewed 839 patient charts from SNF and acute care facilities. During the initial assessment period, 85% of initial antibiotic use in the SNFs was empirical, and thus only 15% of initial antibiotics were based on culture results. Fluoroquinolones were the most frequently used empirical antibiotics, accounting for 54.5% of initial prescribing instances. Among patients with available culture data, only 35% of empirical antibiotic prescribing was determined to be appropriate. In the single SNF in which we evaluated antibiogram effectiveness, prevalence of appropriate antibiotic prescribing increased from 32% to 45% after antibiogram implementation; however, this was not statistically significant ([Formula: see text]). Implementation of antibiograms may be effective in improving empirical antibiotic prescribing in SNFs.

Scalar hairy black holes and scalarons in the isolated horizons formalism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Corichi, Alejandro; Instituto de Matematicas, Universidad Nacional Autonoma de Mexico, A. Postal 61-3, Morelia, Michoacan, 58090; Nucamendi, Ulises

The Isolated Horizons (IH) formalism, together with a simple phenomenological model for colored black holes has been used to predict nontrivial formulas that relate the ADM mass of the solitons and hairy Black Holes of Gravity-Matter system on the one hand, and several horizon properties of the black holes in the other. In this article, the IH formalism is tested numerically for spherically symmetric solutions to an Einstein-Higgs system where hairy black holes were recently found to exist. It is shown that the mass formulas still hold and that, by appropriately extending the current model, one can account for themore » behavior of the horizon properties of these new solutions. An empirical formula that approximates the ADM mass of hairy solutions is put forward, and some of its properties are analyzed.« less

Universal formula for baryon spectra in heavy-ion collisions and its implications

NASA Astrophysics Data System (ADS)

Hwa, Rudolph C.; Zhu, Lilin

2018-05-01

In an unconventional presentation of the data on the transverse momentum spectra of baryons produced in heavy-ion collisions, regularities are found that make possible the discovery of a universal formula valid for p ,Λ ,Ξ , and Ω . The formula describes the baryon distributions over wide ranges of pT(0.5 ≲ pT≲5 GeV/c ) for 0.06 ≲√{sN N}≲3 TeV, except for very peripheral collisions. Some aspects of their empirical properties are derived in the recombination model, resulting in a revelation of some features of the light and strange quark distributions before hadronization. Interpretation of the inverse slopes of their exponential behavior leads to an implication that cannot accommodate the conventional description of fluid flow. This is mainly a study of phenomenology without detailed model input.

Effect of Afterbody Length and Keel Angle on Minimum Depth of Step for Landing Stability and on Take-Off Stability of a Flying Boat

NASA Technical Reports Server (NTRS)

Olson, Roland E; Land, Norman S

1949-01-01

Tests were made to fill partly the need for information on the effect of afterbody dimensions on the hydrodynamic stability of a flying boat in smooth water. The dimensions investigated were depth of step, angle of afterbody keel, and length of afterbody. An analysis of the data showed that as either the afterbody length or keel angle was increased an accompanying increase in depth of step was required in order to maintain adequate landing stability. The landing-tests results have been reduced to an empirical formula giving the minimum depth of step in terms of afterbody length and keel angle. This formula is compared with results from other tank tests, and the correlation is fairly good. The formula thus becomes of use in preliminary design.

Cosmic muon flux measurements at the Kimballton Underground Research Facility

NASA Astrophysics Data System (ADS)

Kalousis, L. N.; Guarnaccia, E.; Link, J. M.; Mariani, C.; Pelkey, R.

2014-08-01

In this article, the results from a series of muon flux measurements conducted at the Kimballton Underground Research Facility (KURF), Virginia, United States, are presented. The detector employed for these investigations, is made of plastic scintillator bars readout by wavelength shifting fibers and multianode photomultiplier tubes. Data was taken at several locations inside KURF, spanning rock overburden values from ~ 200 to 1450 m.w.e. From the extracted muon rates an empirical formula was devised, that estimates the muon flux inside the mine as a function of the overburden. The results are in good agreement with muon flux calculations based on analytical models and MUSIC.

Piezoelectric line moment actuator for active radiation control from light-weight structures

NASA Astrophysics Data System (ADS)

Jandak, Vojtech; Svec, Petr; Jiricek, Ondrej; Brothanek, Marek

2017-11-01

This article outlines the design of a piezoelectric line moment actuator used for active structural acoustic control. Actuators produce a dynamic bending moment that appears in the controlled structure resulting from the inertial forces when the attached piezoelectric stripe actuators start to oscillate. The article provides a detailed theoretical analysis necessary for the practical realization of these actuators, including considerations concerning their placement, a crucial factor in the overall system performance. Approximate formulas describing the dependency of the moment amplitude on the frequency and the required electric voltage are derived. Recommendations applicable for the system's design based on both theoretical and empirical results are provided.

Skyshine line-beam response functions for 20- to 100-MeV photons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brockhoff, R.C.; Shultis, J.K.; Faw, R.E.

1996-06-01

The line-beam response function, needed for skyshine analyses based on the integral line-beam method, was evaluated with the MCNP Monte Carlo code for photon energies from 20 to 100 MeV and for source-to-detector distances out to 1,000 m. These results are compared with point-kernel results, and the effects of bremsstrahlung and positron transport in the air are found to be important in this energy range. The three-parameter empirical formula used in the integral line-beam skyshine method was fit to the MCNP results, and values of these parameters are reported for various source energies and angles.

Validity of hearing impairment calculation methods for prediction of self-reported hearing handicap.

PubMed

John, Andrew B; Kreisman, Brian M; Pallett, Stephen

2012-01-01

Worker's compensation for hearing loss caused by occupational noise exposure is calculated by varying methods, from state to state within the United States (US), with many employing arithmetic formulas based on the pure-tone audiogram, to quantify hearing loss. Several assumptions unsupported or weakly supported by empirical data underlie these formulas. The present study evaluated the ability of various arithmetic hearing impairment calculations to predict a self-reported hearing handicap in a sample of presenting with sensorineural hearing loss. 204 adults (127 male, 77 female) ranging in age from 18 to 94 served as participants. The sample was selected to exclude patients who had been referred for hearing testing for a medicolegal examination or a hearing conservation appointment. A hearing handicap was measured by the Hearing Handicap Inventory for Adults/for the Elderly (HHIA/E). The covariance analysis of linear structural equations was used to assess the relative strength of correlation with the HHIA/E score among the six formulas and various forms of pure-tone average. The results revealed that all the hearing impairment calculations examined were significantly, but weakly, correlated with the self-reported hearing impairment scores. No significant differences among the predictive abilities of the impairment calculations were evident; however, the average binaural impairment assigned differed significantly among the six calculations examined. Individuals who demonstrated 0% impairment had significantly lower (i.e., better) HHIA/E scores compared to those with non-zero impairment for each formula. These results supported the idea that audiometric data provided an insufficient explanation for real-world hearing difficulties.

Fluid mechanical scaling of impact craters in unconsolidated granular materials

NASA Astrophysics Data System (ADS)

Miranda, Colin S.; Dowling, David R.

2015-11-01

A single scaling law is proposed for the diameter of simple low- and high-speed impact craters in unconsolidated granular materials where spall is not apparent. The scaling law is based on the assumption that gravity- and shock-wave effects set crater size, and is formulated in terms of a dimensionless crater diameter, and an empirical combination of Froude and Mach numbers. The scaling law involves the kinetic energy and speed of the impactor, the acceleration of gravity, and the density and speed of sound in the target material. The size of the impactor enters the formulation but divides out of the final empirical result. The scaling law achieves a 98% correlation with available measurements from drop tests, ballistic tests, missile impacts, and centrifugally-enhanced gravity impacts for a variety of target materials (sand, alluvium, granulated sugar, and expanded perlite). The available measurements cover more than 10 orders of magnitude in impact energy. For subsonic and supersonic impacts, the crater diameter is found to scale with the 1/4- and 1/6-power, respectively, of the impactor kinetic energy with the exponent crossover occurring near a Mach number of unity. The final empirical formula provides insight into how impact energy partitioning depends on Mach number.

21 CFR 184.1540 - Nitrogen.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Nitrogen. 184.1540 Section 184.1540 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DIRECT FOOD....1540 Nitrogen. (a) Nitrogen (empirical formula N2, CAS Reg. No. 7727-37-9) is a colorless, odorless...

Synthesis and Analysis of Copper Hydroxy Double Salts

ERIC Educational Resources Information Center

Brigandi, Laura M.; Leber, Phyllis A.; Yoder, Claude H.

2005-01-01

A project involving the synthesis of several naturally occurring copper double salts using simple aqueous conditions is reported. The ions present in the compound are analyzed using colorimetric, gravimetric, and gas-analysis techniques appropriate for the first-year laboratory and from the percent composition, the empirical formula of each…

Computer algorithm for coding gain

NASA Technical Reports Server (NTRS)

Dodd, E. E.

1974-01-01

Development of a computer algorithm for coding gain for use in an automated communications link design system. Using an empirical formula which defines coding gain as used in space communications engineering, an algorithm is constructed on the basis of available performance data for nonsystematic convolutional encoding with soft-decision (eight-level) Viterbi decoding.

An empirical model to estimate density of sodium hydroxide solution: An activator of geopolymer concretes

NASA Astrophysics Data System (ADS)

Rajamane, N. P.; Nataraja, M. C.; Jeyalakshmi, R.; Nithiyanantham, S.

2016-02-01

Geopolymer concrete is zero-Portland cement concrete containing alumino-silicate based inorganic polymer as binder. The polymer is obtained by chemical activation of alumina and silica bearing materials, blast furnace slag by highly alkaline solutions such as hydroxide and silicates of alkali metals. Sodium hydroxide solutions of different concentrations are commonly used in making GPC mixes. Often, it is seen that sodium hydroxide solution of very high concentration is diluted with water to obtain SHS of desired concentration. While doing so it was observed that the solute particles of NaOH in SHS tend to occupy lower volumes as the degree of dilution increases. This aspect is discussed in this paper. The observed phenomenon needs to be understood while formulating the GPC mixes since this influences considerably the relationship between concentration and density of SHS. This paper suggests an empirical formula to relate density of SHS directly to concentration expressed by w/w.

Dynamic equilibrium of reconstituting hematopoietic stem cell populations.

PubMed

O'Quigley, John

2010-12-01

Clonal dominance in hematopoietic stem cell populations is an important question of interest but not one we can directly answer. Any estimates are based on indirect measurement. For marked populations, we can equate empirical and theoretical moments for binomial sampling, in particular we can use the well-known formula for the sampling variation of a binomial proportion. The empirical variance itself cannot always be reliably estimated and some caution is needed. We describe the difficulties here and identify ready solutions which only require appropriate use of variance-stabilizing transformations. From these we obtain estimators for the steady state, or dynamic equilibrium, of the number of hematopoietic stem cells involved in repopulating the marrow. The calculations themselves are not too involved. We give the distribution theory for the estimator as well as simple approximations for practical application. As an illustration, we rework on data recently gathered to address the question as to whether or not reconstitution of marrow grafts in the clinical setting might be considered to be oligoclonal.

Effect of Infant Formula on Streptococcus Mutans Biofilm Formation.

PubMed

Hinds, Laura M; Moser, Elizabeth A S; Eckert, George; Gregory, Richard L

This study investigated the effect that infant formula had on biofilm growth of Streptococcus mutans. Specifically, it compared biofilm growth in media containing lactose-based and sucrose-based formulas. It also analyzed biofilm formation with formulas of varying iron content. Biofilm growth was tested with the specific infant formula components sucrose, lactose, and ferric chloride. The study was designed to determine if these types of infant formulas and components affected S. mutans biofilm formation differently. A 24-hour culture of S. mutans was treated with various concentrations of infant formula diluted in bacteriological media. To test for biofilm formation, S. mutans was cultured with and without the infant formula and formula components. The biofilms were washed, fixed, and stained with crystal violet. The absorbance was measured to evaluate biofilm growth and total absorbance. Sucrose-based formulas provided significant increases in biofilm growth when compared to lactose-based formulas at two dilutions (1:5, 1:20). Similac Sensitive RS (sucrose-based) at most dilutions provided the most significant increase in biofilm growth when compared to the control. Sucrose tested as an individual component provided more of a significant increase on biofilm growth than lactose or iron when compared to the control. A low iron formula provided a significant increase in biofilm growth at one dilution (1:5) when compared to formula containing a normal iron content. There was no significant difference in biofilm growth when comparing high iron formula to normal iron formula or low iron formula. There was no significant difference when comparing Similac PM 60/40 (low iron formula) to Similac PM 60/40 with additional ferric chloride. The results of this study demonstrated that sucrose-based formula provided more of a significant increase in biofilm growth compared to lactose-based formula. Sucrose alone provided a significant increase of biofilm growth at more dilutions when compared to the control than lactose and iron. The amount of iron in formula had a significant effect on biofilm formation only when comparing low iron formula to normal iron formula at the highest concentration (1:5). There was no significant difference in biofilm growth when iron was added to the low iron formula. The information obtained expands current knowledge regarding the influence of infant formula on the primary dentition and reinforces the importance of oral hygiene habits once the first tooth erupts.

A comparative analysis of alpha-decay half-lives for even-even 178Pb to 234U isotopes

NASA Astrophysics Data System (ADS)

Hosseini, S. S.; Hassanabadi, H.; Zarrinkamar, S.

2018-02-01

The feasibility for the alpha decay from the even-even transitions of 178Pb to 234U isotopes has been studied within the Coulomb and proximity potential model (CPPM). The alpha decay half-lives are considered from different theoretical approaches using Semi-empirical formula of Poenaru et al. (SemFIS), the Universal Decay law (UDL) of Qi et al., Akrawy-Dorin formula of Akrawy and Poenaru (ADF), the Scaling law of Brown (SLB) and the Scaling Law of Horoi et al. (SLH). The numerical results obtained by the CPPM and compared with other method as well the experimental data.

Restoration of longitudinal images.

PubMed

Hu, Y; Frieden, B R

1988-01-15

In this paper, a method of restoring longitudinal images is developed. By using the transfer function for longitudinal objects, and inverse filtering, a longitudinal image may be restored. The Fourier theory and sampling theorems for transverse images cannot be used directly in the longitudinal case. A modification and reasonable approximation are introduced. We have numerically established a necessary relationship between just-resolved longitudinal separation (after inverse filtering), noise level, and the taking conditions of object distance and lens diameter. An empirical formula is also found to well-fit the computed results. This formula may be of use for designing optical systems which are to image longitudinal details, such as in robotics or microscopy.

Challenges in defining an optimal approach to formula-based allocations of public health funds in the United States.

PubMed

Buehler, James W; Holtgrave, David R

2007-03-29

Controversy and debate can arise whenever public health agencies determine how program funds should be allocated among constituent jurisdictions. Two common strategies for making such allocations are expert review of competitive applications and the use of funding formulas. Despite widespread use of funding formulas by public health agencies in the United States, formula allocation strategies in public health have been subject to relatively little formal scrutiny, with the notable exception of the attention focused on formula funding of HIV care programs. To inform debates and deliberations in the selection of a formula-based approach, we summarize key challenges to formula-based funding, based on prior reviews of federal programs in the United States. The primary challenge lies in identifying data sources and formula calculation methods that both reflect and serve program objectives, with or without adjustments for variations in the cost of delivering services, the availability of local resources, capacity, or performance. Simplicity and transparency are major advantages of formula-based allocations, but these advantages can be offset if formula-based allocations are perceived to under- or over-fund some jurisdictions, which may result from how guaranteed minimum funding levels are set or from "hold-harmless" provisions intended to blunt the effects of changes in formula design or random variations in source data. While fairness is considered an advantage of formula-based allocations, the design of a formula may implicitly reflect unquestioned values concerning equity versus equivalence in setting funding policies. Whether or how past or projected trends are taken into account can also have substantial impacts on allocations. Insufficient attention has been focused on how the approach to designing funding formulas in public health should differ for treatment or service versus prevention programs. Further evaluations of formula-based versus competitive allocation methods are needed to promote the optimal use of public health funds. In the meantime, those who use formula-based strategies to allocate funds should be familiar with the nuances of this approach.

Modification of the nuclear landscape in the inverse problem framework using the generalized Bethe-Weizsäcker mass formula

NASA Astrophysics Data System (ADS)

Mavrodiev, S. Cht.; Deliyergiyev, M. A.

We formalized the nuclear mass problem in the inverse problem framework. This approach allows us to infer the underlying model parameters from experimental observation, rather than to predict the observations from the model parameters. The inverse problem was formulated for the numerically generalized semi-empirical mass formula of Bethe and von Weizsäcker. It was solved in a step-by-step way based on the AME2012 nuclear database. The established parametrization describes the measured nuclear masses of 2564 isotopes with a maximum deviation less than 2.6MeV, starting from the number of protons and number of neutrons equal to 1. The explicit form of unknown functions in the generalized mass formula was discovered in a step-by-step way using the modified least χ2 procedure, that realized in the algorithms which were developed by Lubomir Aleksandrov to solve the nonlinear systems of equations via the Gauss-Newton method, lets us to choose the better one between two functions with same χ2. In the obtained generalized model, the corrections to the binding energy depend on nine proton (2, 8, 14, 20, 28, 50, 82, 108, 124) and ten neutron (2, 8, 14, 20, 28, 50, 82, 124, 152, 202) magic numbers as well on the asymptotic boundaries of their influence. The obtained results were compared with the predictions of other models.

Sound field simulation and acoustic animation in urban squares

NASA Astrophysics Data System (ADS)

Kang, Jian; Meng, Yan

2005-04-01

Urban squares are important components of cities, and the acoustic environment is important for their usability. While models and formulae for predicting the sound field in urban squares are important for their soundscape design and improvement, acoustic animation tools would be of great importance for designers as well as for public participation process, given that below a certain sound level, the soundscape evaluation depends mainly on the type of sounds rather than the loudness. This paper first briefly introduces acoustic simulation models developed for urban squares, as well as empirical formulae derived from a series of simulation. It then presents an acoustic animation tool currently being developed. In urban squares there are multiple dynamic sound sources, so that the computation time becomes a main concern. Nevertheless, the requirements for acoustic animation in urban squares are relatively low compared to auditoria. As a result, it is important to simplify the simulation process and algorithms. Based on a series of subjective tests in a virtual reality environment with various simulation parameters, a fast simulation method with acceptable accuracy has been explored. [Work supported by the European Commission.

Multivariate Welch t-test on distances.

PubMed

Alekseyenko, Alexander V

2016-12-01

Permutational non-Euclidean analysis of variance, PERMANOVA, is routinely used in exploratory analysis of multivariate datasets to draw conclusions about the significance of patterns visualized through dimension reduction. This method recognizes that pairwise distance matrix between observations is sufficient to compute within and between group sums of squares necessary to form the (pseudo) F statistic. Moreover, not only Euclidean, but arbitrary distances can be used. This method, however, suffers from loss of power and type I error inflation in the presence of heteroscedasticity and sample size imbalances. We develop a solution in the form of a distance-based Welch t-test, [Formula: see text], for two sample potentially unbalanced and heteroscedastic data. We demonstrate empirically the desirable type I error and power characteristics of the new test. We compare the performance of PERMANOVA and [Formula: see text] in reanalysis of two existing microbiome datasets, where the methodology has originated. The source code for methods and analysis of this article is available at https://github.com/alekseyenko/Tw2 Further guidance on application of these methods can be obtained from the author. alekseye@musc.edu. © The Author 2016. Published by Oxford University Press.

Crack closure, a literature study

NASA Astrophysics Data System (ADS)

Holmgren, M.

1993-08-01

In this report crack closure is treated. The state of the art is reviewed. Different empirical formulas for determining the crack closure are compared with each other, and their benefits are discussed. Experimental techniques for determining the crack closure stress are discussed, and some results from fatigue tests are also reported. Experimental data from the literature are reported.

Challenges and Choices: A Multidistrict Analysis of Statewide Mandated Democratic Engagement

ERIC Educational Resources Information Center

Marsh, Julie A.; Hall, Michelle

2018-01-01

This article seeks to deepen our understanding of the nature and quality of democratic participation in educational reform by examining the first-year implementation of California's Local Control Funding Formula (LCFF) mandating civic engagement in district decision-making. Drawing on democratic theory, empirical literature, and data from 10…

21 CFR 184.1540 - Nitrogen.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Nitrogen. 184.1540 Section 184.1540 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN... Substances Affirmed as GRAS § 184.1540 Nitrogen. (a) Nitrogen (empirical formula N2, CAS Reg. No. 7727-37-9...

21 CFR 184.1540 - Nitrogen.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Nitrogen. 184.1540 Section 184.1540 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN... Substances Affirmed as GRAS § 184.1540 Nitrogen. (a) Nitrogen (empirical formula N2, CAS Reg. No. 7727-37-9...

21 CFR 184.1540 - Nitrogen.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Nitrogen. 184.1540 Section 184.1540 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN... Substances Affirmed as GRAS § 184.1540 Nitrogen. (a) Nitrogen (empirical formula N2, CAS Reg. No. 7727-37-9...

21 CFR 184.1540 - Nitrogen.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Nitrogen. 184.1540 Section 184.1540 Food and Drugs... Substances Affirmed as GRAS § 184.1540 Nitrogen. (a) Nitrogen (empirical formula N2, CAS Reg. No. 7727-37-9) is a colorless, odorless, flavorless gas that is produced commercially by the fractionation of liquid...

The use of permeation tube device and the development of empirical formula for accurate permeation rate

USDA-ARS?s Scientific Manuscript database

A series of laboratory experiments were conducted to assess the accuracy of permeation tube (PT) devices using a calibration gas generator system to measure permeation rate (PR) of volatile organic compounds (VOCs). Calibration gas standards of benzene, toluene, and m-xylene (BTX) were produced from...

Distanze dei pianeti e dei satelliti nel sistema solare dedotte da massa, raggio equatoriale e densità del corpo centrale.

NASA Astrophysics Data System (ADS)

Lupato, G.

1993-04-01

The author illustrates an empirical correlation linking planet distances from the Sun to some physical characteristics of the central body such as mass, equatorial radius, density. Such a formula is applicable, with good approximation, also to the major planet satellite systems.

Acoustic properties of reticulated plastic foams

NASA Astrophysics Data System (ADS)

Cummings, A.; Beadle, S. P.

1994-08-01

Some general aspects of sound propagation in rigid porous media are discussed, particularly with reference to the use of a single - dimensionless - frequency parameter and the role of this, in the light of the possibility of varying gas properties, is examined. Steady flow resistance coefficients of porous media are also considered, and simple scaling relationships between these coefficients and `system parameters' are derived. The results of a series of measurements of the bulk acoustic properties of 12 geometrically similar, fully reticulated, polyurethane foams are presented, and empirical curve-fitting coefficients are found; the curve-fitting formulae are valid within the experimental range of values of the frequency parameter. Comparison is made between the measured data and an alternative, fairly recently published, semi-empirical set of formulae. Measurements of the steady flow-resistive coefficients are also given and both the acoustical and flow-resistive data are shown to be consistent with theoretical ideas. The acoustical and flow-resistive data should be of use in predicting the acoustic bulk properties of open-celled foams of types similar to those used in the experimental tests.

The dynamic relationship between structural change and CO2 emissions in Malaysia: a cointegrating approach.

PubMed

Ali, Wajahat; Abdullah, Azrai; Azam, Muhammad

2017-05-01

The current study investigates the dynamic relationship between structural changes, real GDP per capita, energy consumption, trade openness, population density, and carbon dioxide (CO 2 ) emissions within the EKC framework over a period 1971-2013. The study used the autoregressive distributed lagged (ARDL) approach to investigate the long-run relationship between the selected variables. The study also employed the dynamic ordinary least squared (DOLS) technique to obtain the robust long-run estimates. Moreover, the causal relationship between the variables is explored using the VECM Granger causality test. Empirical results reveal a negative relationship between structural change and CO 2 emissions in the long run. The results indicate a positive relationship between energy consumption, trade openness, and CO 2 emissions. The study applied the turning point formula of Itkonen (2012) rather than the conventional formula of the turning point. The empirical estimates of the study do not support the presence of the EKC relationship between income and CO 2 emissions. The Granger causality test indicates the presence of long-run bidirectional causality between energy consumption, structural change, and CO 2 emissions in the long run. Economic growth, openness to trade, and population density unidirectionally cause CO 2 emissions. These results suggest that the government should focus more on information-based services rather than energy-intensive manufacturing activities. The feedback relationship between energy consumption and CO 2 emissions suggests that there is an ominous need to refurbish the energy-related policy reforms to ensure the installations of some energy-efficient modern technologies.

Nonlinear experimental dye-doped nematic liquid crystal optical transmission spectra estimated by neural network empirical physical formulas

NASA Astrophysics Data System (ADS)

Yildiz, Nihat; San, Sait Eren; Köysal, Oğuz

2010-09-01

In this paper, two complementary objectives related to optical transmission spectra of nematic liquid crystals (NLCs) were achieved. First, at room temperature, for both pure and dye (DR9) doped E7 NLCs, the 10-250 W halogen lamp transmission spectra (wavelength 400-1200 nm) were measured at various bias voltages. Second, because the measured spectra were inherently highly nonlinear, it was difficult to construct explicit empirical physical formulas (EPFs) to employ as transmittance functions. To avoid this difficulty, layered feedforward neural networks (LFNNs) were used to construct explicit EPFs for these theoretically unknown nonlinear NLC transmittance functions. As we theoretically showed in a previous work, a LFNN, as an excellent nonlinear function approximator, is highly relevant to EPF construction. The LFNN-EPFs efficiently and consistently estimated both the measured and yet-to-be-measured nonlinear transmittance response values. The experimentally obtained doping ratio dependencies and applied bias voltage responses of transmittance were also confirmed by LFFN-EPFs. This clearly indicates that physical laws embedded in the physical data can be faithfully extracted by the suitable LFNNs. The extraordinary success achieved with LFNN here suggests two potential applications. First, although not attempted here, these LFNN-EPFs, by such mathematical operations as derivation, integration, minimization etc., can be used to obtain further transmittance related functions of NLCs. Second, for a given NLC response function, whose theoretical nonlinear functional form is yet unknown, a suitable experimental data based LFNN-EPF can be constructed to predict the yet-to-be-measured values.

A weighted generalized score statistic for comparison of predictive values of diagnostic tests.

PubMed

Kosinski, Andrzej S

2013-03-15

Positive and negative predictive values are important measures of a medical diagnostic test performance. We consider testing equality of two positive or two negative predictive values within a paired design in which all patients receive two diagnostic tests. The existing statistical tests for testing equality of predictive values are either Wald tests based on the multinomial distribution or the empirical Wald and generalized score tests within the generalized estimating equations (GEE) framework. As presented in the literature, these test statistics have considerably complex formulas without clear intuitive insight. We propose their re-formulations that are mathematically equivalent but algebraically simple and intuitive. As is clearly seen with a new re-formulation we presented, the generalized score statistic does not always reduce to the commonly used score statistic in the independent samples case. To alleviate this, we introduce a weighted generalized score (WGS) test statistic that incorporates empirical covariance matrix with newly proposed weights. This statistic is simple to compute, always reduces to the score statistic in the independent samples situation, and preserves type I error better than the other statistics as demonstrated by simulations. Thus, we believe that the proposed WGS statistic is the preferred statistic for testing equality of two predictive values and for corresponding sample size computations. The new formulas of the Wald statistics may be useful for easy computation of confidence intervals for difference of predictive values. The introduced concepts have potential to lead to development of the WGS test statistic in a general GEE setting. Copyright © 2012 John Wiley & Sons, Ltd.

A weighted generalized score statistic for comparison of predictive values of diagnostic tests

PubMed Central

Kosinski, Andrzej S.

2013-01-01

Positive and negative predictive values are important measures of a medical diagnostic test performance. We consider testing equality of two positive or two negative predictive values within a paired design in which all patients receive two diagnostic tests. The existing statistical tests for testing equality of predictive values are either Wald tests based on the multinomial distribution or the empirical Wald and generalized score tests within the generalized estimating equations (GEE) framework. As presented in the literature, these test statistics have considerably complex formulas without clear intuitive insight. We propose their re-formulations which are mathematically equivalent but algebraically simple and intuitive. As is clearly seen with a new re-formulation we present, the generalized score statistic does not always reduce to the commonly used score statistic in the independent samples case. To alleviate this, we introduce a weighted generalized score (WGS) test statistic which incorporates empirical covariance matrix with newly proposed weights. This statistic is simple to compute, it always reduces to the score statistic in the independent samples situation, and it preserves type I error better than the other statistics as demonstrated by simulations. Thus, we believe the proposed WGS statistic is the preferred statistic for testing equality of two predictive values and for corresponding sample size computations. The new formulas of the Wald statistics may be useful for easy computation of confidence intervals for difference of predictive values. The introduced concepts have potential to lead to development of the weighted generalized score test statistic in a general GEE setting. PMID:22912343

Two modeling strategies for empirical Bayes estimation

PubMed Central

Efron, Bradley

2014-01-01

Empirical Bayes methods use the data from parallel experiments, for instance observations Xk ~ 𝒩 (Θk, 1) for k = 1, 2, …, N, to estimate the conditional distributions Θk|Xk. There are two main estimation strategies: modeling on the θ space, called “g-modeling” here, and modeling on the×space, called “f-modeling.” The two approaches are de- scribed and compared. A series of computational formulas are developed to assess their frequentist accuracy. Several examples, both contrived and genuine, show the strengths and limitations of the two strategies. PMID:25324592

Measurement of the refractive index of air in a low-pressure regime and the applicability of traditional empirical formulae

NASA Astrophysics Data System (ADS)

Schödel, René; Walkov, Alexander; Voigt, Michael; Bartl, Guido

2018-06-01

The refractive index of air is a major limiting factor in length measurements by interferometry, which are mostly performed under atmospheric conditions. Therefore, especially in the last century, measurement and description of the air refractive index was a key point in order to achieve accuracy in the realisation of the length by interferometry. Nevertheless, interferometric length measurements performed in vacuum are much more accurate since the wavelength of the light is not affected by the air refractive index. However, compared with thermal conditions in air, in high vacuum heat conduction is missing. In such a situation, dependent on the radiative thermal equilibrium, a temperature distribution can be very inhomogeneous. Using a so-called contact gas instead of high vacuum is a very effective way to enable heat conduction on nearly the same level as under atmospheric pressure conditions whereby keeping the effect of the air refractive index on a small level. As physics predicts, and as we have demonstrated previously, helium seems like the optimal contact gas because of its large heat conduction and its refractive index that can be calculated from precisely known parameters. On the other hand, helium gas situated in a vacuum chamber could easily be contaminated, e.g. by air leakage from outside. Above the boiling point of oxygen (‑183 °C) it is therefore beneficial to use dry air as a contact gas. In such an approach, the air refractive index could be calculated based on measured quantities for pressure and temperature. However, existing formulas for the air refractive index are not valid in the low-pressure regime. Although it seems reasonable that the refractivity (n  ‑  1) of dry air simply downscales with the pressure, to our knowledge there is no experimental evidence for the applicability of any empirical formula. This evidence is given in the present paper which reports on highly accurate measurements of the air refractive index for the wavelengths 532 nm, 633 nm and 780 nm in the low-pressure regime from 0 Pa to 1300 Pa. In our approach, using a vacuum cell, n  ‑  1 is obtained from the comparison of optical path lengths in vacuum and air along the same path by imaging interferometry. These measured values are compared with the ones obtained from Bönsch’s formula. An agreement of  ±10‑9 is found in the low-pressure regime. Accordingly, this formula could be applied for the accurate determination of the refractive index of dry air even at low pressures, provided that the pressure is measured with high accuracy.

[In vitro availability of minerals in infant foods with different protein source].

PubMed

Pérez-Llamas, F; Larqué, E; Marín, J F; Zamora, S

2001-01-01

As the result of the digestion process, it is produced at gastrointestinal level interactions between proteins-minerals and minerals-minerals that might modify the bioavailability of the nutrients initially designed for an adequate nutrition in infant formulas. The aim of the present study is to compare the in vitro availability of some minerals and trace elements (calcium, phosphorus, magnesium, iron and zinc) in infant formulas of initiation elaborated with different protein sources: formulas based on cow milk protein (whey-casein) versus vegetal protein (soy-based infant formulas). Also, for evaluating the effects of the different mineral supplementation in the availability of minerals, it was used infant formulas from two different manufacturers. Milk-protein based infant formulas showed for both manufacturers higher dialysis percentage (%) of phosphorus and zinc than the soy-protein based formulas. The availability of iron in the soy formula of the manufacturer A lowered significantly (P < 0.05) respect to the whey-casein based formula (9.6 +/- 2.3 versus 4.6 +/- 0.8), but not respect to the whey-casein formula of manufacturer B (9.6 +/- 1.1 versus 9.0 +/- 0.7), which might be due to the lowest proportion of phytic acid in this last commercial formula. Dialysability of all the minerals analysed from soy-protein based formulas showed significant differences depending on the manufacturer. The purification processes of the soy protein have a high repercussion in the mineral availability of soy-based infant formulas. It could be more interesting to use soy proteins more purified, with low level of phytic acid, in the elaboration of soy infants formulas, than the supplementation them with high amounts of minerals.

Shear wave velocities of unconsolidated shallow sediments in the Gulf of Mexico

USGS Publications Warehouse

Lee, Myung W.

2013-01-01

Accurate shear-wave velocities for shallow sediments are important for a variety of seismic applications such as inver-sion and amplitude versus offset analysis. During the U.S. Department of Energy-sponsored Gas Hydrate Joint Industry Project Leg II, shear-wave velocities were measured at six wells in the Gulf of Mexico using the logging-while-drilling SonicScope acoustic tool. Because the tool measurement point was only 35 feet from the drill bit, the adverse effect of the borehole condition, which is severe for the shallow unconsolidated sediments in the Gulf of Mexico, was mini-mized and accurate shear-wave velocities of unconsolidated sediments were measured. Measured shear-wave velocities were compared with the shear-wave velocities predicted from the compressional-wave velocities using empirical formulas and the rock physics models based on the Biot-Gassmann theory, and the effectiveness of the two prediction methods was evaluated. Although the empirical equation derived from measured shear-wave data is accurate for predicting shear-wave velocities for depths greater than 500 feet in these wells, the three-phase Biot-Gassmann-theory -based theory appears to be optimum for predicting shear-wave velocities for shallow unconsolidated sediments in the Gulf of Mexico.

Induction of cytochrome P450 1A by cow milk-based formula: a comparative study between human milk and formula

PubMed Central

Xu, Haibo; Rajesan, Ratheishan; Harper, Patricia; Kim, Richard B; Lonnerdal, Bo; Yang, Mingdong; Uematsu, Satoko; Hutson, Janine; Watson-MacDonell, Jo; Ito, Shinya

2005-01-01

During the treatment of neonatal apnea, formula-fed infants, compared to breastfed infants, show nearly three-fold increase in clearance of caffeine, a substrate of cytochrome P450 1A (CYP1A) and in part CYP3A4. However, human milk is known to contain higher concentrations of environmental pollutants than infant formula, which are potent CYP1A inducers. To gain insight into the mechanism underlying this apparent contradiction, we characterized CYP1A and CYP3A4 induction by human milk and cow milk-based infant formula. The mRNA and protein expression of CYP1A1/1A2 were significantly induced by cow milk-based formula, but not by human milk, in HepG2 cells. Luciferase reporter assay demonstrated that cow milk-based formula but not human milk activated aryl hydrocarbon receptor (AhR) significantly. The cotreatment of 3,4-dimethoxyflavone, an AhR antagonist, abolished the formula-induced CYP1A expression. In addition, AhR activation by dibenzo[a,h]anthracene, a potent AhR agonist, was significantly suppressed by infant formula and even more by human milk. In contrast, CYP3A4 mRNA expression was only mildly induced by formula and human milk. Consistently, neither formula nor human milk substantially activated pregnane X receptor (PXR). Effects of whey and soy protein-based formulas on the AhR–CYP1A and the PXR–CYP3A4 pathways were similar to those of cow milk-based formula. In conclusion, infant formula, but not human milk, enhances in vitro CYP1A expression via an AhR-mediated pathway, providing a potential mechanistic basis for the increased caffeine elimination in formula-fed infants. PMID:15997229

Induction of cytochrome P450 1A by cow milk-based formula: a comparative study between human milk and formula.

PubMed

Xu, Haibo; Rajesan, Ratheishan; Harper, Patricia; Kim, Richard B; Lonnerdal, Bo; Yang, Mingdong; Uematsu, Satoko; Hutson, Janine; Watson-MacDonell, Jo; Ito, Shinya

2005-09-01

During the treatment of neonatal apnea, formula-fed infants, compared to breastfed infants, show nearly three-fold increase in clearance of caffeine, a substrate of cytochrome P450 1A (CYP1A) and in part CYP3A4. However, human milk is known to contain higher concentrations of environmental pollutants than infant formula, which are potent CYP1A inducers. To gain insight into the mechanism underlying this apparent contradiction, we characterized CYP1A and CYP3A4 induction by human milk and cow milk-based infant formula. The mRNA and protein expression of CYP1A1/1A2 were significantly induced by cow milk-based formula, but not by human milk, in HepG2 cells. Luciferase reporter assay demonstrated that cow milk-based formula but not human milk activated aryl hydrocarbon receptor (AhR) significantly. The cotreatment of 3,4-dimethoxyflavone, an AhR antagonist, abolished the formula-induced CYP1A expression. In addition, AhR activation by dibenzo[a,h]anthracene, a potent AhR agonist, was significantly suppressed by infant formula and even more by human milk. In contrast, CYP3A4 mRNA expression was only mildly induced by formula and human milk. Consistently, neither formula nor human milk substantially activated pregnane X receptor (PXR). Effects of whey and soy protein-based formulas on the AhR-CYP1A and the PXR-CYP3A4 pathways were similar to those of cow milk-based formula. In conclusion, infant formula, but not human milk, enhances in vitro CYP1A expression via an AhR-mediated pathway, providing a potential mechanistic basis for the increased caffeine elimination in formula-fed infants.

Sample size determinations for group-based randomized clinical trials with different levels of data hierarchy between experimental and control arms.

PubMed

Heo, Moonseong; Litwin, Alain H; Blackstock, Oni; Kim, Namhee; Arnsten, Julia H

2017-02-01

We derived sample size formulae for detecting main effects in group-based randomized clinical trials with different levels of data hierarchy between experimental and control arms. Such designs are necessary when experimental interventions need to be administered to groups of subjects whereas control conditions need to be administered to individual subjects. This type of trial, often referred to as a partially nested or partially clustered design, has been implemented for management of chronic diseases such as diabetes and is beginning to emerge more commonly in wider clinical settings. Depending on the research setting, the level of hierarchy of data structure for the experimental arm can be three or two, whereas that for the control arm is two or one. Such different levels of data hierarchy assume correlation structures of outcomes that are different between arms, regardless of whether research settings require two or three level data structure for the experimental arm. Therefore, the different correlations should be taken into account for statistical modeling and for sample size determinations. To this end, we considered mixed-effects linear models with different correlation structures between experimental and control arms to theoretically derive and empirically validate the sample size formulae with simulation studies.

Energy-loss straggling of 2-10 MeV/u Kr ions in gases

NASA Astrophysics Data System (ADS)

Vockenhuber, Christof; Jensen, Jens; Julin, Jaakko; Kettunen, Heikki; Laitinen, Mikko; Rossi, Mikko; Sajavaara, Timo; Osmani, Orkhan; Schinner, Andreas; Sigmund, Peter; Whitlow, Harry J.

2013-07-01

Measurements have been performed on a time-of-flight setup at the Jyväskylä K130 cyclotron, aiming at energy-loss straggling of heavy ions in gases. Theoretical predictions based on recently developed theory as well as an empirical interpolation formula predict that straggling can be more than ten times higher than Bohr straggling in the MeV/u regime. Our measurements with up to 9.3 MeV/u Kr ions on He, N2, Ne and Kr targets confirm this feature. Our calculations show the relative contributions of linear straggling, bunching including packing, and charge exchange. Our results for stopping cross sections are compatible with values from the literature.

Calculation of the solvus temperature of metastable phases in the Al-Mg-Si alloys

NASA Astrophysics Data System (ADS)

Vasilyev, A. A.; Gruzdev, A. S.; Kuz'min, N. L.

2011-09-01

A procedure has been proposed for the self-consistent calculation of the solvus temperatures of metastable phase precipitates in Al-Mg-Si alloys and the specific energy of their interface with the aluminum matrix. The procedure is based on the results of experimental studies on the kinetics of formation of these precipitates during decomposition of supersaturated solid solutions of quenched Al-Mg-Si alloys, which were carried out by measuring the Young's modulus and electrical resistivity. On the basis of the obtained set of solvus temperatures of the β″-phase, an empirical formula has been proposed for calculating this temperature as a function of the chemical composition of the initial solid solution.

A modified Lorentz theory as a test theory of special relativity

NASA Technical Reports Server (NTRS)

Chang, T.; Torr, D. G.; Gagnon, D. R.

1988-01-01

Attention has been given recently to a modified Lorentz theory (MLT) that is based on the generalized Galilean transformation. Some explicit formulas within the framework of MLT, dealing with the one-way velocity of light, slow-clock transport, and the Doppler effect are derived. A number of typical experiments are analyzed on this basis. Results indicate that the empirical equivalence between MLT and special relativity is still maintained to second order terms. The results of previous works that predict that the MLT might be distinguished from special relativity at the third order by Doppler centrifuge tests capable of a fractional frequency detection threshold of 10 to the -15th are confirmed.

New Proofs of Some q-Summation and q-Transformation Formulas

PubMed Central

Liu, Xian-Fang; Bi, Ya-Qing; Luo, Qiu-Ming

2014-01-01

We obtain an expectation formula and give the probabilistic proofs of some summation and transformation formulas of q-series based on our expectation formula. Although these formulas in themselves are not the probability results, the proofs given are based on probabilistic concepts. PMID:24895675

Analysis of the propagation of neutrons and gamma-rays from the fast neutron source reactor YAYOI

NASA Astrophysics Data System (ADS)

Yoshida, Shigeo; Murata, Isao; Nakagawa, Tsutomu; Saito, Isao

2011-10-01

The skyshine effect is crucial for designing appropriate shielding. To investigate the skyshine effect, the propagation of neutrons was measured and analyzed at the fast neutron source reactor YAYOI. Pulse height spectra and dose distributions of neutron and secondary gamma-ray were measured outside YAYOI, and analyzed with MCNP-5 and JENDL-3.3. Comparison with the experimental results showed good agreement. Also, a semi-empirical formula was successfully derived to describe the dose distribution. The formulae can be used to predict the skyshine effect at YAYOI, and will be useful for estimating the skyshine effect and designing the shield structure for fusion facilities.

Influence of Convection and Aerosol Pollution on Ice Cloud Particle Effective Radius

NASA Technical Reports Server (NTRS)

Jiang, J. H.; Su, H.; Zhai, C.; Massie, S. T.; Schoeberl, M. R.; Colarco, P. R.; Platnick, S.; Gu, Y.; Liou, K.-N.

2011-01-01

Satellite observations show that ice cloud effective radius (r(sub e)) increases with ice water content (IWC) but decreases with aerosol optical thickness (AOT). Using least-squares fitting to the observed data, we obtain an analytical formula to describe the variations of r(sub e) with IWC and AOT for several regions with distinct characteristics of r(sub e) -IWC-AOT relationships. As IWC directly relates to convective strength and AOT represents aerosol loading, our empirical formula provides a means to quantify the relative roles of dynamics and aerosols in controlling r(sub e) in different geographical regions, and to establish a framework for parameterization of aerosol effects on r(sub e) in climate models.

A fast indirect method to compute functions of genomic relationships concerning genotyped and ungenotyped individuals, for diversity management.

PubMed

Colleau, Jean-Jacques; Palhière, Isabelle; Rodríguez-Ramilo, Silvia T; Legarra, Andres

2017-12-01

Pedigree-based management of genetic diversity in populations, e.g., using optimal contributions, involves computation of the [Formula: see text] type yielding elements (relationships) or functions (usually averages) of relationship matrices. For pedigree-based relationships [Formula: see text], a very efficient method exists. When all the individuals of interest are genotyped, genomic management can be addressed using the genomic relationship matrix [Formula: see text]; however, to date, the computational problem of efficiently computing [Formula: see text] has not been well studied. When some individuals of interest are not genotyped, genomic management should consider the relationship matrix [Formula: see text] that combines genotyped and ungenotyped individuals; however, direct computation of [Formula: see text] is computationally very demanding, because construction of a possibly huge matrix is required. Our work presents efficient ways of computing [Formula: see text] and [Formula: see text], with applications on real data from dairy sheep and dairy goat breeding schemes. For genomic relationships, an efficient indirect computation with quadratic instead of cubic cost is [Formula: see text], where Z is a matrix relating animals to genotypes. For the relationship matrix [Formula: see text], we propose an indirect method based on the difference between vectors [Formula: see text], which involves computation of [Formula: see text] and of products such as [Formula: see text] and [Formula: see text], where [Formula: see text] is a working vector derived from [Formula: see text]. The latter computation is the most demanding but can be done using sparse Cholesky decompositions of matrix [Formula: see text], which allows handling very large genomic and pedigree data files. Studies based on simulations reported in the literature show that the trends of average relationships in [Formula: see text] and [Formula: see text] differ as genomic selection proceeds. When selection is based on genomic relationships but management is based on pedigree data, the true genetic diversity is overestimated. However, our tests on real data from sheep and goat obtained before genomic selection started do not show this. We present efficient methods to compute elements and statistics of the genomic relationships [Formula: see text] and of matrix [Formula: see text] that combines ungenotyped and genotyped individuals. These methods should be useful to monitor and handle genomic diversity.

A Novel Code System for Revealing Sources of Students' Difficulties with Stoichiometry

ERIC Educational Resources Information Center

Gulacar, Ozcan; Overton, Tina L.; Bowman, Charles R.; Fynewever, Herb

2013-01-01

A coding scheme is presented and used to evaluate solutions of seventeen students working on twenty five stoichiometry problems in a think-aloud protocol. The stoichiometry problems are evaluated as a series of sub-problems (e.g., empirical formulas, mass percent, or balancing chemical equations), and the coding scheme was used to categorize each…

21 CFR 184.1240 - Carbon dioxide.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Carbon dioxide. 184.1240 Section 184.1240 Food and... Substances Affirmed as GRAS § 184.1240 Carbon dioxide. (a) Carbon dioxide (empirical formula CO2, CAS Reg. No.... The solid form, dry ice, sublimes under atmospheric pressure at a temperature of −78.5 °C. Carbon...

21 CFR 184.1240 - Carbon dioxide.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Carbon dioxide. 184.1240 Section 184.1240 Food and... Substances Affirmed as GRAS § 184.1240 Carbon dioxide. (a) Carbon dioxide (empirical formula CO2, CAS Reg. No.... The solid form, dry ice, sublimes under atmospheric pressure at a temperature of −78.5 °C. Carbon...

21 CFR 184.1240 - Carbon dioxide.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Carbon dioxide. 184.1240 Section 184.1240 Food and....1240 Carbon dioxide. (a) Carbon dioxide (empirical formula CO2, CAS Reg. No. 124-38-9) occurs as a..., sublimes under atmospheric pressure at a temperature of −78.5 °C. Carbon dioxide is prepared as a byproduct...

Fire spread characteristics determined in the laboratory

Treesearch

Richard C. Rothermel; Hal E. Anderson

1966-01-01

Fuel beds of ponderosa pine needles and white pine needles were burned under controlled environmental conditions to determine the effects of fuel moisture and windspeed upon the rate of fire spread. Empirical formulas are presented to show the effect of these parameters. A discussion of rate of spread and some simple experiments show how fuel may be preheated before...

Three Cheers for Language: A Closer Examination of a Widely Cited Study of Nonverbal Communication.

ERIC Educational Resources Information Center

Lapakko, David

1997-01-01

Focuses on applications of a widely cited empirical study in the communication field--A. Mehrabian and S. Ferris' 1967 study that inferred that communication is 7% verbal, 38% vocal, and 55% facial. Notes that these applications overlook important limitations which do not warrant formulation of a precise numerical formula. Discusses lessons…

21 CFR 184.1240 - Carbon dioxide.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Carbon dioxide. 184.1240 Section 184.1240 Food and... Substances Affirmed as GRAS § 184.1240 Carbon dioxide. (a) Carbon dioxide (empirical formula CO2, CAS Reg. No.... The solid form, dry ice, sublimes under atmospheric pressure at a temperature of −78.5 °C. Carbon...

Training, Sharing or Cheating? Gamer Strategies to Get a Digital Upper Hand

ERIC Educational Resources Information Center

Mortensen, Torill Elvira

2010-01-01

Digital game-players devote a large amount of their time to discovering rules hidden in the code and discoverable through empirical study, experiments, and developing or rediscovering the mathematical formulae governing the code. They do this through their own independent play as they test areas, gear and abilities, through data mining using…

21 CFR 184.1763 - Sodium hydroxide.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Sodium hydroxide. 184.1763 Section 184.1763 Food... GRAS § 184.1763 Sodium hydroxide. (a) Sodium hydroxide (NaOH, CAS Reg. No. 1310-73-2) is also known as sodium hydrate, soda lye, caustic soda, white caustic, and lye. The empirical formula is NaOH. Sodium...

Parameterization of fission barrier heights of medium, heavy and super heavy nuclei

NASA Astrophysics Data System (ADS)

Manjunatha, H. C.

2017-12-01

A new semi empirical formula is proposed for fission barrier heights of medium, heavy and super heavy nuclei in the atomic number region 50 ≤ Z ≤ 130. The fitting parameters for the proposed formula are obtained by making a polynomial fit to the available theoretical and experimental data. The calculated fission barrier heights are compared with that of experiments and other theoretical models such as SHF(SLy6) (Burvenich et al. in Phys Rev C 69:014307, 2004), SHFB(SkM) (Baran et al. in Nucl Phys A 944:442, 2015), FRLDM (Möller et al. in Phys Rev C 79:064304, 2009), ETFSI (SkSC4) with Skyrme SkSC4 force (Mamdouh et al. in Nucl Phys A 679:337, 2001), WS (Kowal et al. in Phys Rev C 82:014303, 2010) and CDFT(DD-ME2) (Abusara et al. in Phys Rev C 85:024314, 2012). The standard deviation for fission barrier heights produced by present formula is evaluated. The good agreement of present formula with the experiments and other models suggests that the present formula could be used to evaluate the fission barrier heights of medium, heavy and super heavy nuclei in the region 50 ≤ Z ≤ 130. This formula is a first of its kind that produces fission barrier heights of 2858 nuclei with the only simple inputs of only neutron number (N), proton number (Z) and mass number (A).

Parameterization of fission barrier heights of medium, heavy and super heavy nuclei

NASA Astrophysics Data System (ADS)

Manjunatha, H. C.

2018-04-01

A new semi empirical formula is proposed for fission barrier heights of medium, heavy and super heavy nuclei in the atomic number region 50 ≤ Z ≤ 130. The fitting parameters for the proposed formula are obtained by making a polynomial fit to the available theoretical and experimental data. The calculated fission barrier heights are compared with that of experiments and other theoretical models such as SHF(SLy6) (Burvenich et al. in Phys Rev C 69:014307, 2004), SHFB(SkM) (Baran et al. in Nucl Phys A 944:442, 2015), FRLDM (Möller et al. in Phys Rev C 79:064304, 2009), ETFSI (SkSC4) with Skyrme SkSC4 force (Mamdouh et al. in Nucl Phys A 679:337, 2001), WS (Kowal et al. in Phys Rev C 82:014303, 2010) and CDFT(DD-ME2) (Abusara et al. in Phys Rev C 85:024314, 2012). The standard deviation for fission barrier heights produced by present formula is evaluated. The good agreement of present formula with the experiments and other models suggests that the present formula could be used to evaluate the fission barrier heights of medium, heavy and super heavy nuclei in the region 50 ≤ Z ≤ 130. This formula is a first of its kind that produces fission barrier heights of 2858 nuclei with the only simple inputs of only neutron number (N), proton number (Z) and mass number (A).

Correlation between cystatin C-based formulas, Schwartz formula and urinary creatinine clearance for glomerular filtration rate estimation in children with kidney disease.

PubMed

Safaei-Asl, Afshin; Enshaei, Mercede; Heydarzadeh, Abtin; Maleknejad, Shohreh

2016-01-01

Assessment of glomerular filtration rate (GFR) is an important tool for monitoring renal function. Regarding to limitations in available methods, we intended to calculate GFR by cystatin C (Cys C) based formulas and determine correlation rate of them with current methods. We studied 72 children (38 boys and 34 girls) with renal disorders. The 24 hour urinary creatinine (Cr) clearance was the gold standard method. GFR was measured with Schwartz formula and Cys C-based formulas (Grubb, Hoek, Larsson and Simple). Then correlation rates of these formulas were determined. Using Pearson correlation coefficient, a significant positive correlation between all formulas and the standard method was seen (R(2) for Schwartz, Hoek, Larsson, Grubb and Simple formula was 0.639, 0.722, 0.705, 0.712, 0.722, respectively) (P<0.001). Cys C-based formulas could predict the variance of standard method results with high power. These formulas had correlation with Schwarz formula by R(2) 0.62-0.65 (intermediate correlation). Using linear regression and constant (y-intercept), it revealed that Larsson, Hoek and Grubb formulas can estimate GFR amounts with no statistical difference compared with standard method; but Schwartz and Simple formulas overestimate GFR. This study shows that Cys C-based formulas have strong relationship with 24 hour urinary Cr clearance. Hence, they can determine GFR in children with kidney injury, easier and with enough accuracy. It helps the physician to diagnosis of renal disease in early stages and improves the prognosis.

A function accounting for training set size and marker density to model the average accuracy of genomic prediction.

PubMed

Erbe, Malena; Gredler, Birgit; Seefried, Franz Reinhold; Bapst, Beat; Simianer, Henner

2013-01-01

Prediction of genomic breeding values is of major practical relevance in dairy cattle breeding. Deterministic equations have been suggested to predict the accuracy of genomic breeding values in a given design which are based on training set size, reliability of phenotypes, and the number of independent chromosome segments ([Formula: see text]). The aim of our study was to find a general deterministic equation for the average accuracy of genomic breeding values that also accounts for marker density and can be fitted empirically. Two data sets of 5'698 Holstein Friesian bulls genotyped with 50 K SNPs and 1'332 Brown Swiss bulls genotyped with 50 K SNPs and imputed to ∼600 K SNPs were available. Different k-fold (k = 2-10, 15, 20) cross-validation scenarios (50 replicates, random assignment) were performed using a genomic BLUP approach. A maximum likelihood approach was used to estimate the parameters of different prediction equations. The highest likelihood was obtained when using a modified form of the deterministic equation of Daetwyler et al. (2010), augmented by a weighting factor (w) based on the assumption that the maximum achievable accuracy is [Formula: see text]. The proportion of genetic variance captured by the complete SNP sets ([Formula: see text]) was 0.76 to 0.82 for Holstein Friesian and 0.72 to 0.75 for Brown Swiss. When modifying the number of SNPs, w was found to be proportional to the log of the marker density up to a limit which is population and trait specific and was found to be reached with ∼20'000 SNPs in the Brown Swiss population studied.

Empirical relations between large wood transport and catchment characteristics

NASA Astrophysics Data System (ADS)

Steeb, Nicolas; Rickenmann, Dieter; Rickli, Christian; Badoux, Alexandre

2017-04-01

The transport of vast amounts of large wood (LW) in water courses can considerably aggravate hazardous situations during flood events, and often strongly affects resulting flood damage. Large wood recruitment and transport are controlled by various factors which are difficult to assess and the prediction of transported LW volumes is difficult. Such information are, however, important for engineers and river managers to adequately dimension retention structures or to identify critical stream cross-sections. In this context, empirical formulas have been developed to estimate the volume of transported LW during a flood event (Rickenmann, 1997; Steeb et al., 2017). The data base of existing empirical wood load equations is, however, limited. The objective of the present study is to test and refine existing empirical equations, and to derive new relationships to reveal trends in wood loading. Data have been collected for flood events with LW occurrence in Swiss catchments of various sizes. This extended data set allows us to derive statistically more significant results. LW volumes were found to be related to catchment and transport characteristics, such as catchment size, forested area, forested stream length, water discharge, sediment load, or Melton ratio. Both the potential wood load and the fraction that is effectively mobilized during a flood event (effective wood load) are estimated. The difference of potential and effective wood load allows us to derive typical reduction coefficients that can be used to refine spatially explicit GIS models for potential LW recruitment.

COMPARISON OF CHILDREN'S FOLLOW-ON INSTANT POWDERED COW'S MILK FORMULA, BUFFALO MILK FORMULA AND CHICKEN-BASED FORMULA ON ENAMEL MICROHARDNESS OF BOVINE TEETH IN VITRO.

PubMed

Vongsavan, Kadkao; Rirattanapong, Praphasri; Surarit, Rudee

2016-03-01

Dental caries are a major public health problem worldwide. The aim of this study was to compare the effects of children's follow-on instant powdered cow's milk formula, buffalo milk formula and a chicken-based formula on microhardness of bovine enamel with artificial caries-like lesions. Forty bovine teeth were each placed in acrylic blocks and the enamel surfaces were polished to create flat 5 x 5 millimeter surfaces. The teeth surfaces were then demineralized using 0.1M lactic acid (pH 4.5) to achieve an enamel microhardness of 35-65 Vickers Hardness Numbers (VHN). All specimens were then randomly allocated into one of 4 groups (n=10/group). For remineralization, each group was soaked in a different kind of milk formula for 2 hours at 37°C except group 1 which was a negative control (artificial saliva) group. Group 2 was soaked in Murrah™ buffalo milk formula (a positive control ), group 3 in S-26-Promil-Gold™ (cow's milk formula) and group 4 in a chicken-based formula (Siriraj Hospital, Mahidol University). The microhardness of the specimens was then measured again. Data were analyzed using a one-way ANOVA and paired t-test with a 95% confidence interval. After exposure to the formula, the mean VHN for each study group was significantly higher (paired t-test, p < 0.05) except for group 1 (p = 0.345). The mean VHN for the the Murrah™ buffalo milk formula, the chicken-based formula and the S-26-Promil-Gold™ formula group were not significantly different from each other (one-way ANOVA, p > 0.05). In conclusion, S-26-Promil-Gold™ follow-on cow milk formula, Murrah™ buffalo milk formula and the chicken-based formula all increased bovine enamel microhardness after soaking for 2 hours.

29 CFR 547.1 - Essential requirements for qualifications.

Code of Federal Regulations, 2014 CFR

2014-07-01

... in accordance with a definite formula specified in the plan, which formula may be based on one or... formula or method of calculation specified in the plan, which formula or method of calculation is based on...

Bone mineralization and vitamin D/calcium daily intake of infants fed breast-milk, milk-based formula or soy-based formula

USDA-ARS?s Scientific Manuscript database

A cross-sectional analysis of bone mineralization during the first year of life of infants (N=107) exclusively fed breast-milk (BF), milk-based formula (MF), or soy-based formula (SF) for at least the first 4 months of life was conducted. Participants were part of the longitudinal Beginnings study. ...

Who gets how much: funding formulas in federal public health programs.

PubMed

Buehler, James W; Holtgrave, David R

2007-01-01

Federal public health programs use a mix of formula-based and competitive methods to allocate funds among states and other constituent jurisdictions. Characteristics of formula-based allocations used by a convenience sample of four programs, three from the Centers for Disease Control and Prevention and one from the Health Resources and Services Administration, are described to illustrate formula-based allocation methods in public health. Data sources in these public health formulas include population counts and funding proportions based on historical precedent. None include factors that adjust allocations based on variations in the availability of local resources or the cost of delivering services. Formula-funded activities are supplemented by programs that target specific prevention needs or encourage development of innovative methods to address emerging problems, using set-aside funds. A public health finance research agenda should address ways to improve the fit between funding allocation formulas and program objectives.

Two Prophecy Formulas for Assessing the Reliability of Item Response Theory-Based Ability Estimates

ERIC Educational Resources Information Center

Raju, Nambury S.; Oshima, T.C.

2005-01-01

Two new prophecy formulas for estimating item response theory (IRT)-based reliability of a shortened or lengthened test are proposed. Some of the relationships between the two formulas, one of which is identical to the well-known Spearman-Brown prophecy formula, are examined and illustrated. The major assumptions underlying these formulas are…

On the Link Between Kolmogorov Microscales and Friction in Wall-Bounded Flow of Viscoplastic Fluids

NASA Astrophysics Data System (ADS)

Ramos, Fabio; Anbarlooei, Hamid; Cruz, Daniel; Silva Freire, Atila; Santos, Cecilia M.

2017-11-01

Most discussions in literature on the friction coefficient of turbulent flows of fluids with complex rheology are empirical. As a rule, theoretical frameworks are not available even for some relatively simple constitutive models. In this work, we present a new family of formulas for the evaluation of the friction coefficient of turbulent flows of a large family of viscoplastic fluids. The developments combine an unified analysis for the description of the Kolmogorov's micro-scales and the phenomenological turbulence model of Gioia and Chakraborty. The resulting Blasius-type friction equation has only Blasius' constant as a parameter, and tests against experimental data show excellent agreement over a significant range of Hedstrom and Reynolds numbers. The limits of the proposed model are also discussed. We also comment on the role of the new formula as a possible benchmark test for the convergence of DNS simulations of viscoplastic flows. The friction formula also provides limits for the Maximum Drag Reduction (MDR) for viscoplastic flows, which resembles MDR asymptote for viscoelastic flows.

Présentation d'une formule pratique d'estimation de l'évaporation potentielle, conforme aux nouvelles recommandations internationales

NASA Astrophysics Data System (ADS)

Lhomme, J. P.; Monteny, B.

1982-03-01

This paper begins to recall new concepts concerning evapotranspiration as they have been specified by the round-table conference of Budapest in May 1977. The potential evaporation ( EP) is now defined as the evaporation of a crop whose all exchange surfaces (leaves, stalks,...) are saturated, i.e., covered with a thin film of water. It can be calculated by a theoretical formula of Penman type. We give the reasons why it is interesting to use grass potential evaporation ( EP g ) as reference. The empirical relationships to estimate in this case the net radiation and the aerodynamic component of the formula have been derived from measurements made in Ivory Coast (West Africa). The relationship (8) has been obtained. It gives the daily value of EP g in millimeters of water per day (mm/d). The values calculated by this formula are compared to measurements of grass maximal evapotranspiration ( ETM g ).

How accurate is the Pearson r-from-Z approximation? A Monte Carlo simulation study.

PubMed

Hittner, James B; May, Kim

2012-01-01

The Pearson r-from-Z approximation estimates the sample correlation (as an effect size measure) from the ratio of two quantities: the standard normal deviate equivalent (Z-score) corresponding to a one-tailed p-value divided by the square root of the total (pooled) sample size. The formula has utility in meta-analytic work when reports of research contain minimal statistical information. Although simple to implement, the accuracy of the Pearson r-from-Z approximation has not been empirically evaluated. To address this omission, we performed a series of Monte Carlo simulations. Results indicated that in some cases the formula did accurately estimate the sample correlation. However, when sample size was very small (N = 10) and effect sizes were small to small-moderate (ds of 0.1 and 0.3), the Pearson r-from-Z approximation was very inaccurate. Detailed figures that provide guidance as to when the Pearson r-from-Z formula will likely yield valid inferences are presented.

Long-term monitoring and prediction for settlement and composition of refuse in Shanghai Laogang Municipal Landfill.

PubMed

Jiangying, Liu; Dimin, Xu; Youcai, Zhao; Shaowei, Chen; Guojian, Li; Qi, Zhou

2004-09-01

Parameters about composition of refuse such as mass percentage of biodegradable matter, volatile solid, organic carbon, cellulose, total sugar, and settlement were monitored and analyzed in a large-scale experimental unit. The empirical formulas between composition and refuse age were established in terms of the data obtained from the experimental unit and verified by comparing with the corresponding parameters of refuse in the closed landfill units from 1991 until 1994 in the Shanghai Laogang Municipal Landfill. Furthermore, the long-term prediction for the composition of refuse was made, and it was predicted that the half-life is 7 to 11 years for biodegradable matter, 9 to 12 years for organic carbon or volatile solid, 7 to 16 years for cellulose, and 4 to 6 years for total sugar. In addition, a mathematical model, based on the mechanism of refuse biodegradation in the landfill, was developed to simulate the relationship between the settlement and the refuse age and manifests the secondary settlement potential. The mathematical model was proved not only to be reliable but also should be accurate for predicting the settlement of the landfill. The secondary settlement, which mainly results from the slow and gradual biodegradation of refuse, is linear with respect to the exponent of refuse age. Finally, according to the settlement model and empirical biodegradation formulas, it may be predicted that, 79.4% of biodegradable matter, 92.9% of total sugar, 72.7% of volatile solid and organic carbon, and 73.1% of cellulose will be biodegraded and that 79% of the maximum secondary settlement potential will occur before the Shanghai Laogang Municipal Landfill is in a high stabilization situation, i.e., approximately 21 years after final closure.

Crack closure and sequential effects in fatigue: A literature survey

NASA Astrophysics Data System (ADS)

Holmgren, M.

A literature survey of the phenomenon of crack closure is reported here. The state of the art is reviewed and several empirical formulas for determining the crack closure are compared with each other. Their properties, advantages and disadvantages are briefly discussed. Experimental techniques for determining the crack closure stress are presented and experimental data from the literature are reported.

Environmental Capability of Liquid Lubricants

NASA Technical Reports Server (NTRS)

Beerbower, A.

1973-01-01

The methods available for predicting the properties of liquid lubricants from their structural formulas are discussed. The methods make it possible to design lubricants by forecasting the results of changing the structure and to determine the limits to which liquid lubricants can cope with environmental extremes. The methods are arranged in order of their thermodynamic properties through empirical physical properties to chemical properties.

Different Things Make Different People Happy: Examining Social Capital and Subjective Well-Being by Gender and Parental Status

ERIC Educational Resources Information Center

Kroll, Christian

2011-01-01

This paper addresses a number of key challenges in current subjective well-being (SWB) research: A new wave of studies should take into account that different things may make different people happy, thus going beyond a unitary "happiness formula". Furthermore, empirical results need to be connected to broader theoretical narratives.…

Waters of Hydration of Cupric Hydrates: A Comparison between Heating and Absorbance Methods

ERIC Educational Resources Information Center

Barlag, Rebecca; Nyasulu, Frazier

2011-01-01

The empirical formulas of four cupric hydrates are determined by measuring the absorbance in aqueous solution. The Beer-Lambert Law is verified by constructing a calibration curve of absorbance versus known Cu[superscript 2+](aq) concentration. A solution of the unknown hydrate is prepared by using 0.2-0.3 g of hydrate, and water is added such…

Investigation the Arithmetical or Tabular Islamic calendar

NASA Astrophysics Data System (ADS)

Rashed, M. G.; Moklof, M. G.; Hamza, Alaa E.

2018-06-01

Arithmetical calendar (or tabular calendar) is sometimes referred to as the Fātimid calendar but this is in fact one of several almost identical tabular Islamic calendars. This calendar introduced by Muslim astronomers in the 9th century CE to predict the approximate begin of the months in the Islamic lunar calendar. Chronologists adopted 11 leap years in a 30 year cycle. In the case of leap Hijri year they add one day to the last month of the Hijri year. The cycle of this calendar agree with the Smaller cycles (2-5.333 years) discovered by Galal and Rashed (2011) and coincide with the lag criterion given by Galal (1988). We suggested the Islamic tabular calendar. The Leap years of this suggested Islamic tabular calendar may be 2, 5, 7, 10, 13, 15, 18, 21, 23, 26 and 29. Our suggested Arithmetical calendar satisfies the mathematical patterns, while the old Arithmetical calendar (or tabular calendar) does not satisfy a known fixed rule. We conclude empirical formula for our suggested Islamic tabular calendar. From this empirical formula, we can calculate if the Hijric year after immigration is a leap or a non-leap year.

A novel method to produce nonlinear empirical physical formulas for experimental nonlinear electro-optical responses of doped nematic liquid crystals: Feedforward neural network approach

NASA Astrophysics Data System (ADS)

Yildiz, Nihat; San, Sait Eren; Okutan, Mustafa; Kaya, Hüseyin

2010-04-01

Among other significant obstacles, inherent nonlinearity in experimental physical response data poses severe difficulty in empirical physical formula (EPF) construction. In this paper, we applied a novel method (namely layered feedforward neural network (LFNN) approach) to produce explicit nonlinear EPFs for experimental nonlinear electro-optical responses of doped nematic liquid crystals (NLCs). Our motivation was that, as we showed in a previous theoretical work, an appropriate LFNN, due to its exceptional nonlinear function approximation capabilities, is highly relevant to EPF construction. Therefore, in this paper, we obtained excellently produced LFNN approximation functions as our desired EPFs for above-mentioned highly nonlinear response data of NLCs. In other words, by using suitable LFNNs, we successfully fitted the experimentally measured response and predicted the new (yet-to-be measured) response data. The experimental data (response versus input) were diffraction and dielectric properties versus bias voltage; and they were all taken from our previous experimental work. We conclude that in general, LFNN can be applied to construct various types of EPFs for the corresponding various nonlinear physical perturbation (thermal, electronic, molecular, electric, optical, etc.) data of doped NLCs.

Quantifying uncertainty in climate change science through empirical information theory.

PubMed

Majda, Andrew J; Gershgorin, Boris

2010-08-24

Quantifying the uncertainty for the present climate and the predictions of climate change in the suite of imperfect Atmosphere Ocean Science (AOS) computer models is a central issue in climate change science. Here, a systematic approach to these issues with firm mathematical underpinning is developed through empirical information theory. An information metric to quantify AOS model errors in the climate is proposed here which incorporates both coarse-grained mean model errors as well as covariance ratios in a transformation invariant fashion. The subtle behavior of model errors with this information metric is quantified in an instructive statistically exactly solvable test model with direct relevance to climate change science including the prototype behavior of tracer gases such as CO(2). Formulas for identifying the most sensitive climate change directions using statistics of the present climate or an AOS model approximation are developed here; these formulas just involve finding the eigenvector associated with the largest eigenvalue of a quadratic form computed through suitable unperturbed climate statistics. These climate change concepts are illustrated on a statistically exactly solvable one-dimensional stochastic model with relevance for low frequency variability of the atmosphere. Viable algorithms for implementation of these concepts are discussed throughout the paper.

Elimination diets in the management of eosinophilic esophagitis.

PubMed

Wechsler, Joshua B; Schwartz, Sally; Amsden, Katie; Kagalwalla, Amir F

2014-01-01

Eosinophilic esophagitis, an increasingly recognized chronic inflammatory disorder isolated to the esophagus, is triggered by an abnormal allergic response to dietary antigens. Current treatment includes swallowed topical steroids and dietary modification, which aim to resolve symptoms and prevent long-term complications such as formation of strictures. The dietary approach has become more widely accepted because long-term steroid therapy is associated with potential risks. Dietary treatment includes elemental and elimination diets. An exclusive elemental diet, which requires replacement of all intact protein with amino acid-based formula, offers the best response of all available therapies, with remission in up to 96% of subjects proving it to be superior to all other available therapies including topical steroids. However, compliance with this approach is challenging because of poor taste and monotony. The high cost of formula and the associated psychosocial problems are additional drawbacks of this approach. Empiric and allergy test-directed elimination diets have gained popularity given that elimination of a limited number of foods is much easier and as such is more readily acceptable. There is a growing body of literature supporting this type of therapy in both children and adults. This paper reviews the evidence for all types of dietary therapy in eosinophilic esophagitis.

Global parameter optimization of a Mather-type plasma focus in the framework of the Gratton-Vargas two-dimensional snowplow model

NASA Astrophysics Data System (ADS)

Auluck, S. K. H.

2014-12-01

Dense plasma focus (DPF) is known to produce highly energetic ions, electrons and plasma environment which can be used for breeding short-lived isotopes, plasma nanotechnology and other material processing applications. Commercial utilization of DPF in such areas would need a design tool that can be deployed in an automatic search for the best possible device configuration for a given application. The recently revisited (Auluck 2013 Phys. Plasmas 20 112501) Gratton-Vargas (GV) two-dimensional analytical snowplow model of plasma focus provides a numerical formula for dynamic inductance of a Mather-type plasma focus fitted to thousands of automated computations, which enables the construction of such a design tool. This inductance formula is utilized in the present work to explore global optimization, based on first-principles optimality criteria, in a four-dimensional parameter-subspace of the zero-resistance GV model. The optimization process is shown to reproduce the empirically observed constancy of the drive parameter over eight decades in capacitor bank energy. The optimized geometry of plasma focus normalized to the anode radius is shown to be independent of voltage, while the optimized anode radius is shown to be related to capacitor bank inductance.

Synthesis and Elucidation Structure of Tetrakis-diphenylaminecopper(II) Chloride Hexahydrate

NASA Astrophysics Data System (ADS)

Syaima, H.; Rahardjo, S. B.; Suciningrum, E.

2017-11-01

CuCl2·2H2O with diphenylamine formed a complex compound in 1:4-mole ratio of metal to the ligand in methanol. Its structural properties were investigated by employing metal content analysis by Atomic Absorption Spectroscopy (AAS), magnetic susceptibility, UV-vis and FTIR spectroscopy. The forming of the complex was indicated by shifting of UV-Vis spectra. The result of analysis Cu(II) in the complex showed empirical formula of the complex were Cu(diphenylamine)4Cl2(H2O)6. The electrical conductivity of complex showed the charge ratio of cation and anion = 2:1. Finally, the proposed formula of the complex was [Cu(diphenylamine)4]Cl2·6H2O. Based on infrared spectra, it was revealed that diphenylamine existed as monodentate bind to copper(II) through the functional group of N-H. The electronic spectral study of the complex showed three transition peaks on 861, 592, and 419 nm corresponding to the 2B1g → 2A1g, 2B1g → 2B2g dan 2B1g → 2Eg transitions. The complex was paramagnetic and indicated that ligands form square planar geometry around the Cu(II).

24 CFR 905.10 - Capital Fund formula (CFF).

Code of Federal Regulations, 2010 CFR

2010-04-01

... Grant formula system or the Comprehensive Improvement Assistance Program (CIAP) formula system will be... formula share had the FFY 1999 formula system been applied to these CFF eligible units. The FFY 1999 formula system is based upon the FFY 1999 Comprehensive Grant formula system for PHAs with 250 or more...

Beam wandering of femtosecond laser filament in air.

PubMed

Yang, Jing; Zeng, Tao; Lin, Lie; Liu, Weiwei

2015-10-05

The spatial wandering of a femtosecond laser filament caused by the filament heating effect in air has been studied. An empirical formula has also been derived from the classical Karman turbulence model, which determines quantitatively the displacement of the beam center as a function of the propagation distance and the effective turbulence structure constant. After fitting the experimental data with this formula, the effective turbulence structure constant has been estimated for a single filament generated in laboratory environment. With this result, one may be able to estimate quantitatively the displacement of a filament over long distance propagation and interpret the practical performance of the experiments assisted by femtosecond laser filamentation, such as remote air lasing, pulse compression, high order harmonic generation (HHG), etc.

Tunable fractional-order capacitor using layered ferroelectric polymers

NASA Astrophysics Data System (ADS)

Agambayev, Agamyrat; Patole, Shashikant; Bagci, Hakan; Salama, Khaled N.

2017-09-01

Pairs of various Polyvinylidene fluoride P(VDF)-based polymers are used for fabricating bilayer fractional order capacitors (FOCs). The polymer layers are constructed using a simple drop casting approach. The resulting FOC has two advantages: It can be easily integrated with printed circuit boards, and its constant phase angle (CPA) can be tuned by changing the thickness ratio of the layers. Indeed, our experiments show that the CPA of the fabricated FOCs can be tuned within the range from -83° to -65° in the frequency band changing from 150 kHz to 10 MHz. Additionally, we provide an empirical formula describing the relationship between the thickness ratio and the CPA, which is highly useful for designing FOCs with the desired CPA.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pei, Zongrui; Stocks, George Malcolm

The sensitivity in predicting glide behaviour of dislocations has been a long-standing problem in the framework of the Peierls-Nabarro model. The predictions of both the model itself and the analytic formulas based on it are too sensitive to the input parameters. In order to reveal the origin of this important problem in materials science, a new empirical-parameter-free formulation is proposed in the same framework. Unlike previous formulations, it includes only a limited small set of parameters all of which can be determined by convergence tests. Under special conditions the new formulation is reduced to its classic counterpart. In the lightmore » of this formulation, new relationships between Peierls stresses and the input parameters are identified, where the sensitivity is greatly reduced or even removed.« less

Experimental study and numerical simulation of the salinity effect on water-freezing point and ice-melting rate

NASA Astrophysics Data System (ADS)

Qin, N.; Wu, Y.; Wang, H. W.; Wang, Y. Y.

2017-12-01

In this paper, based on the background of snowmelt de-icing tools, we studied the effect of salt on freezing point and melting rate of ice through laboratory test and FLUENT numerical simulation analysis. It was confirmed that the freezing point is inversely proportional to the salt solid content, and with the salt solid content increasing, the freezing process of salt water gradually accepts the curing rule of non-crystal solids. At the same temperature, an increase in the salt solid content, the ice melting rate increase by the empirical formula linking the melting time with temperature and salt content. The theoretical aspects of solid/fluid transformation are discussed in detail.

Reduction potentials of protein disulfides and catalysis of glutathionylation and deglutathionylation by glutaredoxin enzymes.

PubMed

Ukuwela, Ashwinie A; Bush, Ashley I; Wedd, Anthony G; Xiao, Zhiguang

2017-11-09

Glutaredoxins (Grxs) are a class of GSH (glutathione)-dependent thiol-disulfide oxidoreductase enzymes. They use the cellular redox buffer GSSG (glutathione disulfide)/GSH directly to catalyze these exchange reactions. Grxs feature dithiol active sites and can shuttle rapidly between three oxidation states, namely dithiol Grx(SH) 2 , mixed disulfide Grx(SH)(SSG) and oxidized disulfide Grx(SS). Each is characterized by a distinct standard reduction potential [Formula: see text] The [Formula: see text] values for the redox couple Grx(SS)/Grx(SH) 2 are available, but a recent estimate differs by over 100 mV from the literature values. No estimates are available for [Formula: see text] for the mixed disulfide couple Grx(SH)(SSG)/(Grx(SH) 2  + GSH). This work determined both [Formula: see text] and [Formula: see text] for two representative Grx enzymes, Homo sapiens HsGrx1 and Escherichia coli EcGrx1. The empirical approaches were verified rigorously to overcome the sensitivity of these redox-labile enzymes to experimental conditions. The classic method of acid 'quenching' was demonstrated to shift the thiol-disulfide redox equilibria. Both enzymes exhibit an [Formula: see text] (vs. SHE) at a pH of 7.0. Their [Formula: see text] values (-213 and -230 mV for EcGrx1 and HsGrx1, respectively) are slightly less negative than that ([Formula: see text]) of the redox buffer GSSG/2GSH. Both [Formula: see text] and [Formula: see text] vary with log [GSH], but the former more sensitively by a factor of 2. This confers dual catalytic functions to a Grx enzyme as either an oxidase at low [GSH] or as a reductase at high [GSH]. Consequently, these enzymes can participate efficiently in either glutathionylation or deglutathionylation. The catalysis is demonstrated to proceed via a monothiol ping-pong mechanism relying on a single Cys residue only in the dithiol active site. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

External validation of change formulae in neuropsychology with neuroimaging biomarkers: a methodological recommendation and preliminary clinical data.

PubMed

Duff, Kevin; Suhrie, Kayla R; Dalley, Bonnie C A; Anderson, Jeffrey S; Hoffman, John M

2018-06-08

Within neuropsychology, a number of mathematical formulae (e.g. reliable change index, standardized regression based) have been used to determine if change across time has reliably occurred. When these formulae have been compared, they often produce different results, but 'different' results do not necessarily indicate which formulae are 'best.' The current study sought to further our understanding of change formulae by comparing them to clinically relevant external criteria (amyloid deposition and hippocampal volume). In a sample of 25 older adults with varying levels of cognitive intactness, participants were tested twice across one week with a brief cognitive battery. Seven different change scores were calculated for each participant. An amyloid PET scan (to get a composite of amyloid deposition) and an MRI (to get hippocampal volume) were also obtained. Deviation-based change formulae (e.g. simple discrepancy score, reliable change index with or without correction for practice effects) were all identical in their relationship to the two neuroimaging biomarkers, and all were non-significant. Conversely, regression-based change formulae (e.g. simple and complex indices) showed stronger relationships to amyloid deposition and hippocampal volume. These results highlight the need for external validation of the various change formulae used by neuropsychologists in clinical settings and research projects. The findings also preliminarily suggest that regression-based change formulae may be more relevant than deviation-based change formulae in this context.

Dynamic characteristics of oxygen consumption.

PubMed

Ye, Lin; Argha, Ahmadreza; Yu, Hairong; Celler, Branko G; Nguyen, Hung T; Su, Steven

2018-04-23

Previous studies have indicated that oxygen uptake ([Formula: see text]) is one of the most accurate indices for assessing the cardiorespiratory response to exercise. In most existing studies, the response of [Formula: see text] is often roughly modelled as a first-order system due to the inadequate stimulation and low signal to noise ratio. To overcome this difficulty, this paper proposes a novel nonparametric kernel-based method for the dynamic modelling of [Formula: see text] response to provide a more robust estimation. Twenty healthy non-athlete participants conducted treadmill exercises with monotonous stimulation (e.g., single step function as input). During the exercise, [Formula: see text] was measured and recorded by a popular portable gas analyser ([Formula: see text], COSMED). Based on the recorded data, a kernel-based estimation method was proposed to perform the nonparametric modelling of [Formula: see text]. For the proposed method, a properly selected kernel can represent the prior modelling information to reduce the dependence of comprehensive stimulations. Furthermore, due to the special elastic net formed by [Formula: see text] norm and kernelised [Formula: see text] norm, the estimations are smooth and concise. Additionally, the finite impulse response based nonparametric model which estimated by the proposed method can optimally select the order and fit better in terms of goodness-of-fit comparing to classical methods. Several kernels were introduced for the kernel-based [Formula: see text] modelling method. The results clearly indicated that the stable spline (SS) kernel has the best performance for [Formula: see text] modelling. Particularly, based on the experimental data from 20 participants, the estimated response from the proposed method with SS kernel was significantly better than the results from the benchmark method [i.e., prediction error method (PEM)] ([Formula: see text] vs [Formula: see text]). The proposed nonparametric modelling method is an effective method for the estimation of the impulse response of VO 2 -Speed system. Furthermore, the identified average nonparametric model method can dynamically predict [Formula: see text] response with acceptable accuracy during treadmill exercise.

Daniel Goodman’s empirical approach to Bayesian statistics

USGS Publications Warehouse

Gerrodette, Tim; Ward, Eric; Taylor, Rebecca L.; Schwarz, Lisa K.; Eguchi, Tomoharu; Wade, Paul; Himes Boor, Gina

2016-01-01

Bayesian statistics, in contrast to classical statistics, uses probability to represent uncertainty about the state of knowledge. Bayesian statistics has often been associated with the idea that knowledge is subjective and that a probability distribution represents a personal degree of belief. Dr. Daniel Goodman considered this viewpoint problematic for issues of public policy. He sought to ground his Bayesian approach in data, and advocated the construction of a prior as an empirical histogram of “similar” cases. In this way, the posterior distribution that results from a Bayesian analysis combined comparable previous data with case-specific current data, using Bayes’ formula. Goodman championed such a data-based approach, but he acknowledged that it was difficult in practice. If based on a true representation of our knowledge and uncertainty, Goodman argued that risk assessment and decision-making could be an exact science, despite the uncertainties. In his view, Bayesian statistics is a critical component of this science because a Bayesian analysis produces the probabilities of future outcomes. Indeed, Goodman maintained that the Bayesian machinery, following the rules of conditional probability, offered the best legitimate inference from available data. We give an example of an informative prior in a recent study of Steller sea lion spatial use patterns in Alaska.

Improvement of Glucose Metabolism in Patients with Impaired Glucose Tolerance or Diabetes by Long-Term Administration of a Palatinose-Based Liquid Formula as a Part of Breakfast

PubMed Central

Sakuma, Masae; Arai, Hidekazu; Mizuno, Akira; Fukaya, Makiko; Matsuura, Motoi; Sasaki, Hajime; Yamanaka-Okumura, Hisami; Yamamoto, Hironori; Taketani, Yutaka; Doi, Toshio; Takeda, Eiji

2009-01-01

A palatinose-based liquid formula (palatinose-formula), suppresses postprandial plasma glucose and insulin levels in healthy men. The objective of this study was to investigate the effects of long-term palatinose-formula ingestion on glucose metabolism in patients with impaired glucose tolerance (IGT) or type 2 diabetes. Two patients with IGT and 7 patients with type 2 diabetes participated in the palatinose-formula and dextrin-based liquid formula (dextrin-formula) loading test and long-term palatinose-formula administration study. After a 3-month control period, palatinose-formula (1046 kJ) was ingested daily by patients as a part of breakfast for 5 months. In the loading test, palatinose-formula suppressed postprandial plasma glucose and insulin levels and areas under the curve compared with those after dextrin-formula ingestion. In the long-term study, glycated hemoglobin levels (after 3 months and 5 months of treatment) and serum 8-hydroxydeoxyguanosine levels (after 5 months of treatment) were markedly decreased comparing with those at baseline. Intake of 1046 kJ palatinose-formula as a part of breakfast over a long-term period may be effective for improvement of glucose metabolism in patients with IGT or type 2 diabetes. PMID:19794923

Soy-Based Therapeutic Baby Formulas: Testable Hypotheses Regarding the Pros and Cons.

PubMed

Westmark, Cara J

2016-01-01

Soy-based infant formulas have been consumed in the United States since 1909, and currently constitute a significant portion of the infant formula market. There are efforts underway to generate genetically modified soybeans that produce therapeutic agents of interest with the intent to deliver those agents in a soy-based infant formula platform. The threefold purpose of this review article is to first discuss the pros and cons of soy-based infant formulas, then present testable hypotheses to discern the suitability of a soy platform for drug delivery in babies, and finally start a discussion to inform public policy on this important area of infant nutrition.

26 CFR 1.411(a)(13)-1 - Statutory hybrid plans.

Code of Federal Regulations, 2014 CFR

2014-04-01

... another benefit amount) and at least one of those formulas is a statutory hybrid benefit formula, the... certain statutory hybrid plans that determine benefits under a lump sum-based benefit formula. Paragraph... current balance or current value under a lump sum-based benefit formula. Pursuant to section 411(a)(13)(A...

26 CFR 1.411(a)(13)-1 - Statutory hybrid plans.

Code of Federal Regulations, 2013 CFR

2013-04-01

... another benefit amount) and at least one of those formulas is a statutory hybrid benefit formula, the... certain statutory hybrid plans that determine benefits under a lump sum-based benefit formula. Paragraph... current balance or current value under a lump sum-based benefit formula. Pursuant to section 411(a)(13)(A...

26 CFR 1.411(a)(13)-1 - Statutory hybrid plans.

Code of Federal Regulations, 2012 CFR

2012-04-01

... another benefit amount) and at least one of those formulas is a statutory hybrid benefit formula, the... certain statutory hybrid plans that determine benefits under a lump sum-based benefit formula. Paragraph... current balance or current value under a lump sum-based benefit formula. Pursuant to section 411(a)(13)(A...

26 CFR 1.411(a)(13)-1 - Statutory hybrid plans.

Code of Federal Regulations, 2011 CFR

2011-04-01

... another benefit amount) and at least one of those formulas is a statutory hybrid benefit formula, the... certain statutory hybrid plans that determine benefits under a lump sum-based benefit formula. Paragraph... current balance or current value under a lump sum-based benefit formula. Pursuant to section 411(a)(13)(A...

Infant formula promotes bone growth in neonatal piglets by enhancing osteoblastogenesis through bone morphogenic protein signaling

USDA-ARS?s Scientific Manuscript database

Relatively few studies have examined the effects of formula feeding relative to breast-feeding on bone in the neonate. Using peripheral quantitative CT scan and histomorphometric analysis, we demonstrated that neonatal piglets fed with soy-based formula (SF) and cow milk-based formula (MF) for 21 or...

Breast development in the first 2 years of life: an association with soy-based infant formulas.

PubMed

Zung, Amnon; Glaser, Tamar; Kerem, Zohar; Zadik, Zvi

2008-02-01

To evaluate the estrogenic effect of soy-based formulas in female infants. These formulas contain significant amounts of phytoestrogens, compounds with structural similarity to estradiol. A cross-sectional study consisting of 694 female infants ages 3 to 24 months that consecutively attended 10 general pediatric clinics, none of them having been referred for breast development. The presence of breast buds served as a marker for the endocrine effect of soy-derived phytoestrogens. Of the participants, 92 had consumed soy formulas for more than 3 months. Breast tissue was more prevalent in the second year of life in infants fed soy-based formula vs those that were breast-fed and those fed dairy-based formula (22.0% vs 10.3%; P = 0.02) with an odds ratio of 2.45 (95% confidence interval 1.11-5.39). No differences in breast bud prevalence were observed during the first year of life. Unlike infants on dairy-based formulas and breast-feeding, infants fed a soy-based formula did not demonstrate a decline in the prevalence of breast during the second year of life. We suggest that phytoestrogens impose a preserving effect on breast tissue that is evolved in early infancy, leading eventually to a slower waning of infantile breast tissue.

Growth and Clinical Variables in Nitrogen-Restricted Piglets Fed an Adjusted Essential Amino Acid Mix: Effects of Partially Intact Protein-Based Diets.

PubMed

Worsøe, Päivi S; Sangild, Per T; van Goudoever, Johannes B; Koletzko, Berthold; van der Beek, Eline M; Abrahamse-Berkeveld, Marieke; Burrin, Douglas G; van de Heijning, Bert J M; Thymann, Thomas

2018-06-13

Current recommendations for protein levels in infant formula are intended to ensure that growth matches or exceeds growth of breastfed infants, but may provide a surplus of amino acids (AAs). Recent infant studies with AA-based formulas support specific adjustment of the essential amino acid (EAA) composition allowing for potential lowering of total protein levels. With the use of a combination of intact protein and free EAAs, we designed a formula that meets these adjusted EAA requirements for infants. Our objective was to test whether this adjusted formula is safe and supports growth in a protein-restricted piglet model, and whether it shows better growth than an isonitrogenous formula based on free AAs. Term piglets (Landrace × Yorkshire × Duroc, n = 72) were fed 1 of 4 isoenergetic formulas containing 70% intact protein and 30% of an EAA mixture or a complete AA-based control for 20 d: standard formula (ST-100), ST-100 with 25% reduction in proteinaceous nitrogen (ST-75), ST-75 with an adjusted EAA composition (O-75), or a diet as O-75, given as a complete AA-based diet (O-75AA). After an initial adaptation period, ST-75 and O-75 pigs showed similar growth rates, both lower than ST-100 pigs (∼25 compared with 31 g · kg-1 · d-1, respectively). The O-75AA pigs showed further reduced growth rate (15 g · kg-1 · d-1) and fat proportion (both P < 0.05, relative to O-75). Formula based partly on intact protein is superior to AA-based formula in this experimental setting. The 25% lower, but EAA-adjusted, partially intact protein-based formula resulted in similar weight gain with a concomitant increased AA catabolism, compared with the standard 25% lower standard formula in artificially reared, protein-restricted piglets. Further studies should investigate if and how the specific EAA adjustments that allow for lowering of total protein levels will affect growth and body composition development in formula-fed infants.

Update on dietary therapy for eosinophilic esophagitis in children and adults.

PubMed

Molina-Infante, Javier; Gonzalez-Cordero, Pedro Luis; Arias, Angel; Lucendo, Alfredo J

2017-02-01

Eosinophilic esophagitis (EoE) is a chronic inflammatory esophageal disease triggered predominantly, but not excusively, by food antigens. Elimination diet thus remains the only therapy targeting the cause of the disease. Importantly, EoE is a unique form of non-IgE mediated food allergy, largely dependant upon delayed, cell-mediated hypersensitivity. Areas covered: A comprehensive review of literature to summarize and update the most relevant advances on dietary therapy for pediatric and adult EoE patients is conducted. Expert commentary: None of the currently available food allergy tests adequately predict food triggers for EoE, especially in adults. Elemental diet (exclusive feeding with aminoacid-based formulas) and empiric six-food elimination diet, withdrawing cow´s milk, wheat, egg, soy, nuts and fish/seafood for 6 weeks, have consistently shown the best cure rates. However, their high level of restriction and need for multiple endoscopies (top-down approach) have been a deterrent for patients and physicians. Less restrictive empiric schemes, like a four-food (animal milk, gluten-containing cereals, egg, legumes) or a two-food (animal milk and gluten-containing cereals) elimination diet have lately shown encouraging results. Therefore, a novel step-up strategy (2-4-6) may enhance patient uptake and promptly identify most responders to empiric diets with few food triggers, besides saving unnecessary dietary restrictions and endoscopic procedures.

Revisiting the elemental composition and the calorific value of the organic fraction of municipal solid wastes.

PubMed

Komilis, Dimitrios; Evangelou, Alexandros; Giannakis, Georgios; Lymperis, Constantinos

2012-03-01

In this work, the elemental content (C, N, H, S, O), the organic matter content and the calorific value of various organic components that are commonly found in the municipal solid waste stream were measured. The objective of this work was to develop an empirical equation to describe the calorific value of the organic fraction of municipal solid waste as a function of its elemental composition. The MSW components were grouped into paper wastes, food wastes, yard wastes and plastics. Sample sizes ranged from 0.2 to 0.5 kg. In addition to the above individual components, commingled municipal solid wastes were sampled from a bio-drying facility located in Crete (sample sizes ranged from 8 to 15 kg) and were analyzed for the same parameters. Based on the results of this work, an improved empirical model was developed that revealed that carbon, hydrogen and oxygen were the only statistically significant predictors of calorific value. Total organic carbon was statistically similar to total carbon for most materials in this work. The carbon to organic matter ratio of 26 municipal solid waste substrates and of 18 organic composts varied from 0.40 to 0.99. An approximate chemical empirical formula calculated for the organic fraction of commingled municipal solid wastes was C(32)NH(55)O(16). Copyright © 2011 Elsevier Ltd. All rights reserved.

Deciphering the enigma of undetected species, phylogenetic, and functional diversity based on Good-Turing theory.

PubMed

Chao, Anne; Chiu, Chun-Huo; Colwell, Robert K; Magnago, Luiz Fernando S; Chazdon, Robin L; Gotelli, Nicholas J

2017-11-01

Estimating the species, phylogenetic, and functional diversity of a community is challenging because rare species are often undetected, even with intensive sampling. The Good-Turing frequency formula, originally developed for cryptography, estimates in an ecological context the true frequencies of rare species in a single assemblage based on an incomplete sample of individuals. Until now, this formula has never been used to estimate undetected species, phylogenetic, and functional diversity. Here, we first generalize the Good-Turing formula to incomplete sampling of two assemblages. The original formula and its two-assemblage generalization provide a novel and unified approach to notation, terminology, and estimation of undetected biological diversity. For species richness, the Good-Turing framework offers an intuitive way to derive the non-parametric estimators of the undetected species richness in a single assemblage, and of the undetected species shared between two assemblages. For phylogenetic diversity, the unified approach leads to an estimator of the undetected Faith's phylogenetic diversity (PD, the total length of undetected branches of a phylogenetic tree connecting all species), as well as a new estimator of undetected PD shared between two phylogenetic trees. For functional diversity based on species traits, the unified approach yields a new estimator of undetected Walker et al.'s functional attribute diversity (FAD, the total species-pairwise functional distance) in a single assemblage, as well as a new estimator of undetected FAD shared between two assemblages. Although some of the resulting estimators have been previously published (but derived with traditional mathematical inequalities), all taxonomic, phylogenetic, and functional diversity estimators are now derived under the same framework. All the derived estimators are theoretically lower bounds of the corresponding undetected diversities; our approach reveals the sufficient conditions under which the estimators are nearly unbiased, thus offering new insights. Simulation results are reported to numerically verify the performance of the derived estimators. We illustrate all estimators and assess their sampling uncertainty with an empirical dataset for Brazilian rain forest trees. These estimators should be widely applicable to many current problems in ecology, such as the effects of climate change on spatial and temporal beta diversity and the contribution of trait diversity to ecosystem multi-functionality. © 2017 by the Ecological Society of America.

A Powerful Test for Comparing Multiple Regression Functions.

PubMed

Maity, Arnab

2012-09-01

In this article, we address the important problem of comparison of two or more population regression functions. Recently, Pardo-Fernández, Van Keilegom and González-Manteiga (2007) developed test statistics for simple nonparametric regression models: Y(ij) = θ(j)(Z(ij)) + σ(j)(Z(ij))∊(ij), based on empirical distributions of the errors in each population j = 1, … , J. In this paper, we propose a test for equality of the θ(j)(·) based on the concept of generalized likelihood ratio type statistics. We also generalize our test for other nonparametric regression setups, e.g, nonparametric logistic regression, where the loglikelihood for population j is any general smooth function [Formula: see text]. We describe a resampling procedure to obtain the critical values of the test. In addition, we present a simulation study to evaluate the performance of the proposed test and compare our results to those in Pardo-Fernández et al. (2007).

Feature extraction of micro-motion frequency and the maximum wobble angle in a small range of missile warhead based on micro-Doppler effect

NASA Astrophysics Data System (ADS)

Li, M.; Jiang, Y. S.

2014-11-01

Micro-Doppler effect is induced by the micro-motion dynamics of the radar target itself or any structure on the target. In this paper, a simplified cone-shaped model for ballistic missile warhead with micro-nutation is established, followed by the theoretical formula of micro-nutation is derived. It is confirmed that the theoretical results are identical to simulation results by using short-time Fourier transform. Then we propose a new method for nutation period extraction via signature maximum energy fitting based on empirical mode decomposition and short-time Fourier transform. The maximum wobble angle is also extracted by distance approximate approach in a small range of wobble angle, which is combined with the maximum likelihood estimation. By the simulation studies, it is shown that these two feature extraction methods are both valid even with low signal-to-noise ratio.

Ultrathin nanoporous membranes for insulator-based dielectrophoresis.

PubMed

Mukaibo, Hitomi; Wang, Tonghui; Perez-Gonzalez, Victor H; Getpreecharsawas, Jirachai; Wurzer, Jack; Lapizco-Encinas, Blanca H; McGrath, James L

2018-06-08

Insulator-based dielectrophoresis (iDEP) is a simple, scalable mechanism that can be used for directly manipulating particle trajectories in pore-based filtration and separation processes. However, iDEP manipulation of nanoparticles presents unique challenges as the dielectrophoretic force [Formula: see text] exerted on the nanoparticles can easily be overshadowed by opposing kinetic forces. In this study, a molecularly thin, SiN-based nanoporous membrane (NPN) is explored as a breakthrough technology that enhances [Formula: see text] By numerically assessing the gradient of the electric field square [Formula: see text]-a common measure for [Formula: see text] magnitude-it was found that the unique geometrical features of NPN (pore tapering, sharp pore corner and ultrathin thickness) act in favor of intensifying the overall [Formula: see text] A comparative study indicated that [Formula: see text] generated in NPN are four orders of magnitude larger than track-etched polycarbonate membranes with comparable pore size. The stronger [Formula: see text] suggests that iDEP can be conducted under lower voltage bias with NPN: reducing joule heating concerns and enabling solutions to have higher ionic strength. Enabling higher ionic strength solutions may also extend the opportunities of iDEP applications under physiologically relevant conditions. This study also highlights the effects of [Formula: see text] induced by the ion accumulation along charged surfaces (electric-double layer (EDL)). EDL-based [Formula: see text] exists along the entire charged surface, including locations where geometry-based iDEP is negligible. The high surface-to-volume ratio of NPN offers a unique platform for exploiting such EDL-based DEP systems. The EDL-based [Formula: see text] was also found to offset the geometry-based [Formula: see text] but this effect was easily circumvented by reducing the EDL thickness (e.g. increasing the ionic strength from 0.1 to 100 mM). The results from this study imply the potential application of iDEP as a direct, in-operando antifouling mechanism for ultrafiltration technology, and also as an active tuning mechanism to control the cut-off size limit for continuous selectivity of nanomembrane-based separations.

Rice protein-based infant formula: current status and future development.

PubMed

Koo, W W K; Lasekan, J B

2007-02-01

Rice is the world's leading staple cereal food and is the major source of protein for many parts of the world. Rice is among the first solid foods fed to infants in many cultures, in part because of its hypoallergenicity from lack of gluten. Nutritional quality of rice protein compares favorably with other cereal proteins including wheat, oat and barley. It is rich in methionine and cystine, although as is the case for other cereals, it is an incomplete protein source for human infants with lysine and threonine being the primary limiting amino acids. Fortification of rice proteins with these two limiting amino acids improves its protein quality. Rice protein-based infant formulas (RPF) were initially based on high protein rice flours, but more recently are based on rice protein concentrates, isolates or hydrolysates, fortified with lysine and threonine. Hypoallergenicity efficacy, particularly for hydrolyzed rice protein-based formulas, has been reported, and limited data indicated that rice protein based infant formula may provide potentially adequate alternative if standard milk- or soy protein-based formulas are not tolerated. Unlike the rice-protein based infant formula, rice beverage formulas made from rice flour are nutritionally inadequate for infants. Reports have indicated stunted growth in infants/children fed rice beverage formulas. Future development for the RPF include those based on genetically improved rice with high lysine and threonine content, supplementation with appropriate mineral and fat blend, and long-term clinical studies in infants to confirm its efficacy and safety.

Comparison of postoperative vault height predictability using white-to-white or sulcus diameter-based sizing for the visian implantable collamer lens.

PubMed

Reinstein, Dan Z; Lovisolo, Carlo F; Archer, Timothy J; Gobbe, Marine

2013-01-01

To compare vault height predictability of Implantable Collamer Lens (ICL; Staar Surgical) sizing using a sulcus diameter-based formula or the manufacturer-recommended white-to-white-based method. In 50 myopic eyes, ICL size was calculated using both a formula including sulcus diameter and the traditional formula based on white-to-white diameter. Sulcus diameter was measured using Artemis 2 very high-frequency (VHF) digital ultrasound (ArcScan Inc). Implantation was based on the sulcus diameter derived size. Actual postoperative vault height achieved was measured by VHF digital ultrasound scanning. Circle segment trigonometry was used to calculate the vault height that would have resulted had lens sizing been based on the white-to-white formula. The same lens size would have been used in 60% of eyes, a smaller lens would have been used in 34% of eyes and a larger lens in 6% of eyes had lens sizing been based on the white-to-white formula. Mean vault for eyes with lenses sized using the sulcus diameter formula was 0.37±0.16 mm (range: 0.08 to 0.92 mm), with 2% <0.09 mm, the recognized low-vault height for risk of cataract. Circle segment trigonometry predicted that the vault height would have been 0.24±0.28 mm (range: -0.31 to 0.92 mm), with 26% <0.09 mm had lens sizing been based on the white-to-white formula. Significantly better predictability of postoperative vault height was achieved by including sulcus diameter into the ICL sizing formula compared with using the traditional white-to-white-based formula. Copyright 2013, SLACK Incorporated.

A penalized quantitative structure-property relationship study on melting point of energetic carbocyclic nitroaromatic compounds using adaptive bridge penalty.

PubMed

Al-Fakih, A M; Algamal, Z Y; Lee, M H; Aziz, M

2018-05-01

A penalized quantitative structure-property relationship (QSPR) model with adaptive bridge penalty for predicting the melting points of 92 energetic carbocyclic nitroaromatic compounds is proposed. To ensure the consistency of the descriptor selection of the proposed penalized adaptive bridge (PBridge), we proposed a ridge estimator ([Formula: see text]) as an initial weight in the adaptive bridge penalty. The Bayesian information criterion was applied to ensure the accurate selection of the tuning parameter ([Formula: see text]). The PBridge based model was internally and externally validated based on [Formula: see text], [Formula: see text], [Formula: see text], [Formula: see text], [Formula: see text], [Formula: see text], the Y-randomization test, [Formula: see text], [Formula: see text], [Formula: see text], [Formula: see text] and the applicability domain. The validation results indicate that the model is robust and not due to chance correlation. The descriptor selection and prediction performance of PBridge for the training dataset outperforms the other methods used. PBridge shows the highest [Formula: see text] of 0.959, [Formula: see text] of 0.953, [Formula: see text] of 0.949 and [Formula: see text] of 0.959, and the lowest [Formula: see text] and [Formula: see text]. For the test dataset, PBridge shows a higher [Formula: see text] of 0.945 and [Formula: see text] of 0.948, and a lower [Formula: see text] and [Formula: see text], indicating its better prediction performance. The results clearly reveal that the proposed PBridge is useful for constructing reliable and robust QSPRs for predicting melting points prior to synthesizing new organic compounds.

Performance Analysis of Evolutionary Algorithms for Steiner Tree Problems.

PubMed

Lai, Xinsheng; Zhou, Yuren; Xia, Xiaoyun; Zhang, Qingfu

2017-01-01

The Steiner tree problem (STP) aims to determine some Steiner nodes such that the minimum spanning tree over these Steiner nodes and a given set of special nodes has the minimum weight, which is NP-hard. STP includes several important cases. The Steiner tree problem in graphs (GSTP) is one of them. Many heuristics have been proposed for STP, and some of them have proved to be performance guarantee approximation algorithms for this problem. Since evolutionary algorithms (EAs) are general and popular randomized heuristics, it is significant to investigate the performance of EAs for STP. Several empirical investigations have shown that EAs are efficient for STP. However, up to now, there is no theoretical work on the performance of EAs for STP. In this article, we reveal that the (1+1) EA achieves 3/2-approximation ratio for STP in a special class of quasi-bipartite graphs in expected runtime [Formula: see text], where [Formula: see text], [Formula: see text], and [Formula: see text] are, respectively, the number of Steiner nodes, the number of special nodes, and the largest weight among all edges in the input graph. We also show that the (1+1) EA is better than two other heuristics on two GSTP instances, and the (1+1) EA may be inefficient on a constructed GSTP instance.

Path Loss Prediction Formula in Urban Area for the Fourth-Generation Mobile Communication Systems

NASA Astrophysics Data System (ADS)

Kitao, Koshiro; Ichitsubo, Shinichi

A site-general type prediction formula is created based on the measurement results in an urban area in Japan assuming that the prediction frequency range required for Fourth-Generation (4G) Mobile Communication Systems is from 3 to 6GHz, the distance range is 0.1 to 3km, and the base station (BS) height range is from 10 to 100m. Based on the measurement results, the path loss (dB) is found to be proportional to the logarithm of the distance (m), the logarithm of the BS height (m), and the logarithm of the frequency (GHz). Furthermore, we examine the extension of existing formulae such as the Okumura-Hata, Walfisch-Ikegami, and Sakagami formulae for 4G systems and propose a prediction formula based on the Extended Sakagami formula.

Flavor, relative palatability and components of cow's milk hydrolysed formulas and amino acid-based formula.

PubMed

Miraglia Del Giudice, Michele; D'Auria, Enza; Peroni, Diego; Palazzo, Samuele; Radaelli, Giovanni; Comberiati, Pasquale; Galdo, Francesca; Maiello, Nunzia; Riva, Enrica

2015-06-03

Both extensively hydrolysed formulas (eHF) and amino acid-based formula (AAFs) have been demonstrated effective for the treatment of CMA. However, in clinical practice, parents complain that hydrolysates are rejected by children due to their bad taste. Flavor of hydrolysed formulas has been poorly investigated although it affects the acceptance of milk over all the other attributes. The aim of the present study was to understand the factors underlying the unpleasant flavor of hydrolysed 25 formulas and amino acid-based formula. One hundred and fifty trained panelists performed a randomized-double-blind test with different milks. The smell, texture, taste and aftertaste of each formula were evaluated on a scale ranging from -2 (worst) to 2 (best). Formulas showed significant difference, as compared to cow's milk, in smell, texture, taste and aftertaste. Overall, whey eHFs were judged of better palatability than casein eHF and the AAFs (p < 0.05). Whey eHF showed significant differences among them for sensory attributes, especially for taste and aftertaste. These results suggest that a broad range of flavor exists among the hydrolysed formulas. Further studies, adequately designed to investigate the relationship between milks' flavor and nutrient profile of hydrolysed formulas are warranted.

Population Density and Moment-based Approaches to Modeling Domain Calcium-mediated Inactivation of L-type Calcium Channels.

PubMed

Wang, Xiao; Hardcastle, Kiah; Weinberg, Seth H; Smith, Gregory D

2016-03-01

We present a population density and moment-based description of the stochastic dynamics of domain [Formula: see text]-mediated inactivation of L-type [Formula: see text] channels. Our approach accounts for the effect of heterogeneity of local [Formula: see text] signals on whole cell [Formula: see text] currents; however, in contrast with prior work, e.g., Sherman et al. (Biophys J 58(4):985-995, 1990), we do not assume that [Formula: see text] domain formation and collapse are fast compared to channel gating. We demonstrate the population density and moment-based modeling approaches using a 12-state Markov chain model of an L-type [Formula: see text] channel introduced by Greenstein and Winslow (Biophys J 83(6):2918-2945, 2002). Simulated whole cell voltage clamp responses yield an inactivation function for the whole cell [Formula: see text] current that agrees with the traditional approach when domain dynamics are fast. We analyze the voltage-dependence of [Formula: see text] inactivation that may occur via slow heterogeneous domain [[Formula: see text

Formula feeding alters hepatic gene expression signature, iron and cholesterol homeostasis in the neonatal pig

USDA-ARS?s Scientific Manuscript database

Although the American Academy of Pediatrics recommends breast feeding for at least the first 6 months of life, formula feeding remains more popular in the US. In the current study, neonatal piglets were breast-fed or were fed commercially available milk-based formula (MF) or soy-based formula (SF) ...

Moments of inertia for neutron and strange stars: Limits derived for the Crab pulsar

NASA Astrophysics Data System (ADS)

Bejger, M.; Haensel, P.

2002-12-01

Recent estimates of the properties of the Crab nebula are used to derive constraints on the moment of inertia, mass and radius of the pulsar. To this purpose, we employ an approximate formula combining these three parameters. Our ``empirical formula'' I =~ a(x) M R2, where x=(M/Msun) (km/R), is based on numerical results obtained for thirty theoretical equations of state of dense matter. The functions a(x) for neutron stars and strange stars are qualitatively different. For neutron stars aNS(x)=x/(0.1+2x) for x<=0.1 (valid for M>0.2 Msun) and aNS(x)={2/ 9}(1+5x) for x>0.1. For strange stars aSS(x)={2/ 5}(1+x) (not valid for strange stars with crust and M<0.1 Msun). We obtain also an approximate expression for the maximum moment of inertia Imax,45 =~ (-0.37 + 7.12* xmax) (Mmax/Msun)(RM_max/ {10 km})2, where I45 = I/1045 g* cm2, valid for both neutron stars and strange stars. Applying our formulae to the evaluated values of ICrab, we derive constraints on the mass and radius of the pulsar. { A very conservative evaluation of the expanding nebula mass, Mneb=2 Msun, yields MCrab>1.2 Msun and RCrab= 10-14 km. Setting the most recent evaluation (``central value'') Mneb=4.6 Msun rules out most of the existing equations of state, leaving only the stiffest ones: MCrab>1.9 Msun, RCrab= 14-15 km.

Soy-Based Therapeutic Baby Formulas: Testable Hypotheses Regarding the Pros and Cons

PubMed Central

Westmark, Cara J.

2017-01-01

Soy-based infant formulas have been consumed in the United States since 1909, and currently constitute a significant portion of the infant formula market. There are efforts underway to generate genetically modified soybeans that produce therapeutic agents of interest with the intent to deliver those agents in a soy-based infant formula platform. The threefold purpose of this review article is to first discuss the pros and cons of soy-based infant formulas, then present testable hypotheses to discern the suitability of a soy platform for drug delivery in babies, and finally start a discussion to inform public policy on this important area of infant nutrition. PMID:28149839

[Determination of ventricular volumes by a non-geometric method using gamma-cineangiography].

PubMed

Faivre, R; Cardot, J C; Baud, M; Verdenet, J; Berthout, P; Bidet, A C; Bassand, J P; Maurat, J P

1985-08-01

The authors suggest a new way of determining ventricular volume by a non-geometric method using gamma-cineangiography. The results obtained by this method were compared with those obtained by a geometric methods and contrast ventriculography in 94 patients. The new non-geometric method supposes that the radioactive tracer is evenly distributed in the cardiovascular system so that blood radioactivity levels can be measured. The ventricular volume is then equal to the ratio of radioactivity in the LV zone to that of 1 ml of blood. Comparison of the radionuclide and angiographic data in the first 60 patients showed systematic values--despite a satisfactory statistical correlation (r = 0.87, y = 0.30 X + 6.3). This underestimation is due to the phenomenon of attenuation related to the depth of the heart in the thoracic cage and to autoabsorption at source, the degree of which depends on the ventricular volume. An empirical method of calculation allows correction for these factors by taking into account absorption in the tissues by relating to body surface area and autoabsorption at source by correcting for the surface of isotopic ventricular projection expressed in pixels. Using the data of this empirical method, the correction formula for radionuclide ventricular volume is obtained by a multiple linear regression: corrected radionuclide volume = K X measured radionuclide volume (Formula: see text). This formula was applied in the following 34 patients. The correlation between the uncorrected and corrected radionuclide volumes and the angiographic volumes was improved (r = 0.65 vs r = 0.94) and the values were more accurate (y = 0.18 X + 26 vs y = 0.96 X + 1.5).(ABSTRACT TRUNCATED AT 250 WORDS)

Determination of performance of non-ideal aluminized explosives.

PubMed

Keshavarz, Mohammad Hossein; Mofrad, Reza Teimuri; Poor, Karim Esmail; Shokrollahi, Arash; Zali, Abbas; Yousefi, Mohammad Hassan

2006-09-01

Non-ideal explosives can have Chapman-Jouguet (C-J) detonation pressure significantly different from those expected from existing thermodynamic computer codes, which usually allows finding the parameters of ideal detonation of individual high explosives with good accuracy. A simple method is introduced by which detonation pressure of non-ideal aluminized explosives with general formula C(a)H(b)N(c)O(d)Al(e) can be predicted only from a, b, c, d and e at any loading density without using any assumed detonation products and experimental data. Calculated detonation pressures show good agreement with experimental values with respect to computed results obtained by complicated computer code. It is shown here how loading density and atomic composition can be integrated into an empirical formula for predicting detonation pressure of proposed aluminized explosives.

Estimation of Right-Lobe Graft Weight From Computed Tomographic Volumetry for Living Donor Liver Transplantation.

PubMed

Yang, X; Chu, C W; Yang, J D; Yang, K H; Yu, H C; Cho, B H; You, H

2017-03-01

The objective of the study was to establish a right-lobe graft weight (GW) estimation formula for living donor liver transplantation (LDLT) from right-lobe graft volume without veins (GV w/o_veins ), including portal vein and hepatic vein measured by computed tomographic (CT) volumetry, and to compare its estimation accuracy with those of existing formulas. Right-lobe GW estimation formulas established with the use of graft volume with veins (GV w_veins ) sacrifice accuracy because GW measured intra-operatively excludes the weight of blood in the veins. Right-lobe GW estimation formulas have been established with the use of right-lobe GV w/o_veins , but a more accurate formula must be developed. The present study developed right-lobe GW estimation formulas based on GV w/o_veins as well as GV w_veins , using 40 cases of Korean donors: GW = 29.1 + 0.943 × GV w/o_veins (adjusted R 2  = 0.94) and GW = 74.7 + 0.773 × GV w_veins (adjusted R 2  = 0.87). The proposed GW estimation formulas were compared with existing GV w_veins - and GV w/o_veins -based models, using 43 cases additionally obtained from two medical centers for cross-validation. The GV w/o_veins -based formula developed in the present study was most preferred (absolute error = 21.5 ± 16.5 g and percentage of absolute error = 3.0 ± 2.3%). The GV w/o_veins -based formula is preferred to the GV w_veins -based formula in GW estimation. Accurate CT volumetry and alignment between planned and actual surgical cutting lines are crucial in the establishment of a better GW estimation formula. Copyright © 2016 Elsevier Inc. All rights reserved.

Kidney function estimating equations in patients with chronic kidney disease.

PubMed

Hojs, R; Bevc, S; Ekart, R; Gorenjak, M; Puklavec, L

2011-04-01

The current guidelines emphasise the need to assess kidney function using predictive equations rather than just serum creatinine. The present study compares serum cystatin C-based equations and serum creatinine-based equations in patients with chronic kidney disease (CKD). Seven hundred and sixty-four adult patients with CKD were enrolled. In each patient serum creatinine and serum cystatin C were determined. Their glomerular filtration rate (GFR) was estimated using three serum creatinine-based equations [Cockcroft-Gault (C&G), modification of diet in renal disease (MDRD) and the Chronic Kidney Disease Epidemiology Collaboration equation (CKD-EPI)] and two serum cystatin C-based equations [our own cystatin C formula (GFR=90.63 × cystatin C(-1.192) ) and simple cystatin C formula (GFR=100/cystatin C)]. The GFR was measured using (51) CrEDTA clearance. Statistically significant correlation between (51) CrEDTA clearance with serum creatinine, serum cystatin C and all observed formulas was found. The receiver operating characteristic curve analysis (cut-off for GFR 60 ml/min/1.73m(2)) showed that serum cystatin C and both cystatin C formulas had a higher diagnostic accuracy than C&G formula. Bland and Altman analysis for the same cut-off value showed that all formulas except simple cystatin C formula underestimated measured GFR. The accuracy within 30% of estimated (51) CrEDTA clearance values differs according to stages of CKD. Analysis of ability to correctly predict patient's GFR below or above 60 ml/min/1.73m(2) showed statistically significant higher ability for both cystatin C formulas compared to MDRD formula. Our results indicate that serum cystatin C-based equations are reliable markers of GFR comparable with creatinine-based formulas. © 2011 Blackwell Publishing Ltd.

Estimation of leaf traits from reflectance measurements: comparison between methods based on vegetation indices and several versions of the PROSPECT model.

PubMed

Jiang, Jingyi; Comar, Alexis; Burger, Philippe; Bancal, Pierre; Weiss, Marie; Baret, Frédéric

2018-01-01

Leaf biochemical composition corresponds to traits related to the plant state and its functioning. This study puts the emphasis on the main leaf absorbers: chlorophyll a and b ([Formula: see text]), carotenoids ([Formula: see text]), water ([Formula: see text]) and dry mater ([Formula: see text]) contents. Two main approaches were used to estimate [[Formula: see text] [Formula: see text], [Formula: see text], [Formula: see text

Internal twisting motion dependent conductance of an aperiodic DNA molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

The Combined Application of Impinger System and Permeation Tube for the Generation of Volatile Organic Compound Standard Gas Mixtures at Varying Diluent Flow Rates

PubMed Central

Kim, Ki-Hyun; Susaya, Janice; Cho, Jinwoo; Parker, David

2012-01-01

Commercial standard gas generators are often complex and expensive devices. The objective of this research was to assess the performance of a simplified glass impinger system for standard gas generation from a permeation tube (PT) device. The performance of the impinger standard gas generation system was assessed for four aromatic VOCs (benzene, toluene, ethylbenzene, and m-xylene; BTEX) at varying flow rates (FR) of 50 to 800 mL·min−1. Because actual permeation rate (APR) values deviated from those computed by the manufacturer's formula (MPR), new empirical relationships were developed to derive the predicted PR (PPR) of the target components. Experimental results corrected by such a formula indicate that the compatibility between the APR and MPR generally increased with low FR, while the reproducibility was generally reduced with decreasing flow rate. Although compatibility between different PRs is at a relatively small and narrow FR range, the use of correction formula is recommendable for the accurate use of PT. PMID:23112641

Electrical and thermoelectric transport properties of two-dimensional fermionic systems with k-cubic spin-orbit coupling.

PubMed

Mawrie, Alestin; Verma, Sonu; Ghosh, Tarun Kanti

2017-10-25

We investigate the effect of k-cubic spin-orbit interaction on the electrical and thermoelectric transport properties of two-dimensional fermionic systems. We obtain exact analytical expressions of the inverse relaxation time (IRT) and the Drude conductivity for long-range Coulomb and short-range delta scattering potentials. The IRT reveals that the scattering is completely suppressed along the three directions [Formula: see text] with [Formula: see text]. We also obtain analytical results of the thermopower and thermal conductivity at low temperature. The thermoelectric transport coefficients obey the Wiedemann-Franz law, even in the presence of k-cubic Rashba spin-orbit interaction (RSOI) at low temperature. In the presence of a quantizing magnetic field, the signature of the RSOI is revealed through the appearance of the beating pattern in the Shubnikov-de Haas (SdH) oscillations of thermopower and thermal conductivity in the low magnetic field regime. The empirical formulae for the SdH oscillation frequencies accurately describe the locations of the beating nodes. The beating pattern in magnetothermoelectric measurement can be used to extract the spin-orbit coupling constant.

Attenuation of thermal neutrons by an imperfect single crystal

NASA Astrophysics Data System (ADS)

Naguib, K.; Adib, M.

1996-06-01

A semi-empirical formula is given which allows one to calculate the total thermal cross section of an imperfect single crystal as a function of crystal constants, temperature and neutron energy E, in the energy range between 3 meV and 10 eV. The formula also includes the contribution of the parasitic Bragg scattering to the total cross section that takes into account the crystal mosaic spread value and its orientation with respect to the neutron beam direction. A computer program (ISCANF) was developed to calculate the total attenuation of neutrons using the proposed formula. The ISCANF program was applied to investigate the neutron attenuation through a copper single crystal. The calculated values of the neutron transmission through the imperfect copper single crystal were fitted to the measured ones in the energy range 3 - 40 meV at different crystal orientations. The result of fitting shows that use of the computer program ISCANF allows one to predict the behaviour of the total cross section of an imperfect copper single crystal for the whole energy range.

The Ca II infrared triplet's performance as an activity indicator compared to Ca II H and K. Empirical relations to convert Ca II infrared triplet measurements to common activity indices

NASA Astrophysics Data System (ADS)

Martin, J.; Fuhrmeister, B.; Mittag, M.; Schmidt, T. O. B.; Hempelmann, A.; González-Pérez, J. N.; Schmitt, J. H. M. M.

2017-09-01

Aims: A large number of Calcium infrared triplet (IRT) spectra are expected from the Gaia and CARMENES missions. Conversion of these spectra into known activity indicators will allow analysis of their temporal evolution to a better degree. We set out to find such a conversion formula and to determine its robustness. Methods: We have compared 2274 Ca II IRT spectra of active main-sequence F to K stars taken by the TIGRE telescope with those of inactive stars of the same spectral type. After normalizing and applying rotational broadening, we subtracted the comparison spectra to find the chromospheric excess flux caused by activity. We obtained the total excess flux, and compared it to established activity indices derived from the Ca II H and K lines, the spectra of which were obtained simultaneously to the infrared spectra. Results: The excess flux in the Ca II IRT is found to correlate well with R'HK and R+HK, as well as SMWO, if the B - V-dependency is taken into account. We find an empirical conversion formula to calculate the corresponding value of one activity indicator from the measurement of another, by comparing groups of datapoints of stars with similar B - V.

Relationship of attenuation in a vegetation canopy to physical parameters of the canopy

NASA Technical Reports Server (NTRS)

Karam, M. A.; Levine, D. M.

1993-01-01

A discrete scatter model is employed to compute the radiometric response (i.e. emissivity) of a layer of vegetation over a homogeneous ground. This was done to gain insight into empirical formulas for the emissivity which have recently appeared in the literature and which indicate that the attenuation through the canopy is proportional to the water content of the vegetation and inversely proportional to wavelength raised to a power around unity. The analytical result assumes that the vegetation can be modeled by a sparse layer of discrete, randomly oriented particles (leaves, stalks, etc.). The attenuation is given by the effective wave number of the layer obtained from the solution for the mean wave using the effective field approximation. By using the Ulaby-El Rayes formula to relate the dielectric constant of the vegetation to its water content, it can be shown that the attenuation is proportional to water content. The analytical form offers insight into the dependence of the empirical parameters on other variables of the canopy, including plant geometry (i.e. shape and orientation of the leaves and stalks of which the vegetation is comprised), frequency of the measurement and even the physical temperature of the vegetation. Solutions are presented for some special cases including layers consisting of cylinders (stalks) and disks (leaves).

Detailed characteristics of intermittent current pulses due to positive corona

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Yang, E-mail: liuyangwuh520@sina.com; Cui, Xiang; Lu, Tiebing

In order to get detailed characteristics of intermittent current pulses due to positive corona such as the repetition rate of burst-pulse trains, the peak value ratio of the primary pulse to the secondary pulse, the number of pulses per burst, and the interval of the secondary pulses, a systematic study was carried out in a coaxial conductor-cylinder electrode system with the conductor electrode being set with a discharge point. Empirical formulae for the number of pulses per burst and the interval of the secondary pulses are first presented. A theoretical model based on the motion of the space-charge clouds ismore » proposed. Analysis with the model gives explanations to the experimental results and reveals some new insights into the physical mechanism of positive intermittent corona.« less

Measurement of positive direct current corona pulse in coaxial wire-cylinder gap

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yin, Han, E-mail: hanyin1986@gmail.com; Zhang, Bo, E-mail: shizbcn@mail.tsinghua.edu.cn; He, Jinliang, E-mail: hejl@tsinghua.edu.cn

In this paper, a system is designed and developed to measure the positive corona current in coaxial wire-cylinder gaps. The characteristic parameters of corona current pulses, such as the amplitude, rise time, half-wave time, and repetition frequency, are statistically analyzed and a new set of empirical formulas are derived by numerical fitting. The influence of space charges on corona currents is tested by using three corona cages with different radii. A numerical method is used to solve a simplified ion-flow model to explain the influence of space charges. Based on the statistical results, a stochastic model is developed to simulatemore » the corona pulse trains. And this model is verified by comparing the simulated frequency-domain responses with the measured ones.« less

Origin of the sensitivity in modeling the glide behaviour of dislocations

DOE PAGES

Pei, Zongrui; Stocks, George Malcolm

2018-03-26

The sensitivity in predicting glide behaviour of dislocations has been a long-standing problem in the framework of the Peierls-Nabarro model. The predictions of both the model itself and the analytic formulas based on it are too sensitive to the input parameters. In order to reveal the origin of this important problem in materials science, a new empirical-parameter-free formulation is proposed in the same framework. Unlike previous formulations, it includes only a limited small set of parameters all of which can be determined by convergence tests. Under special conditions the new formulation is reduced to its classic counterpart. In the lightmore » of this formulation, new relationships between Peierls stresses and the input parameters are identified, where the sensitivity is greatly reduced or even removed.« less

Structural stability, elastic and thermodynamic properties of Au-Cu alloys from first-principles calculations

NASA Astrophysics Data System (ADS)

Kong, Ge-Xing; Ma, Xiao-Juan; Liu, Qi-Jun; Li, Yong; Liu, Zheng-Tang

2018-03-01

Using first-principles calculations method based on density functional theory (DFT) with the Perdew-Burke-Ernzerhof (PBE) implementation of the generalized gradient approximation (GGA), we investigate the structural, elastic and thermodynamic properties of gold-copper intermetallic compounds (Au-Cu ICs). The calculated lattice parameters are in excellent agreement with experimental data. The elastic constants show that all the investigated Au-Cu alloys are mechanically stable. Elastic properties, including the shear modulus, Young's modulus, Poisson's ratio and Pugh's indicator, of the intermetallic compounds are evaluated and discussed, with special attention to the remarkable anisotropy displayed by Au-Cu ICs. Thermodynamic and transport properties including the Debye temperature, thermal conductivity and melting point are predicted from the averaged sound velocity and elastic moduli, using semi-empirical formulas.

Formation mechanisms and characteristics of transition patterns in oblique detonations

NASA Astrophysics Data System (ADS)

Miao, Shikun; Zhou, Jin; Liu, Shijie; Cai, Xiaodong

2018-01-01

The transition structures of wedge-induced oblique detonation waves (ODWs) in high-enthalpy supersonic combustible mixtures are studied with two-dimensional reactive Euler simulations based on the open-source program AMROC (Adaptive Mesh Refinement in Object-oriented C++). The formation mechanisms of different transition patterns are investigated through theoretical analysis and numerical simulations. Results show that transition patterns of ODWs depend on the pressure ratio Pd/Ps, (Pd, Ps are the pressure behind the ODW and the pressure behind the induced shock, respectively). When Pd/Ps > 1.3, an abrupt transition occurs, while when Pd/Ps < 1.3, a smooth transition appears. A parameter ε is introduced to describe the transition patterns quantitatively. Besides, a criterion based on the velocity ratio Φ=U0/UCJ is proposed to predict the transition patterns based on the inflow conditions. It is concluded that an abrupt transition appears when Φ < 0.98Φ*, while a smooth transition occurs when Φ > 1.02Φ∗ (Φ∗ is the critical velocity ratio calculated with an empirical formula).

The effect of the H-1 scaling factors τ and ω on the structure of H in the single-step procedure.

PubMed

Martini, Johannes W R; Schrauf, Matias F; Garcia-Baccino, Carolina A; Pimentel, Eduardo C G; Munilla, Sebastian; Rogberg-Muñoz, Andres; Cantet, Rodolfo J C; Reimer, Christian; Gao, Ning; Wimmer, Valentin; Simianer, Henner

2018-04-13

The single-step covariance matrix H combines the pedigree-based relationship matrix [Formula: see text] with the more accurate information on realized relatedness of genotyped individuals represented by the genomic relationship matrix [Formula: see text]. In particular, to improve convergence behavior of iterative approaches and to reduce inflation, two weights [Formula: see text] and [Formula: see text] have been introduced in the definition of [Formula: see text], which blend the inverse of a part of [Formula: see text] with the inverse of [Formula: see text]. Since the definition of this blending is based on the equation describing [Formula: see text], its impact on the structure of [Formula: see text] is not obvious. In a joint discussion, we considered the question of the shape of [Formula: see text] for non-trivial [Formula: see text] and [Formula: see text]. Here, we present the general matrix [Formula: see text] as a function of these parameters and discuss its structure and properties. Moreover, we screen for optimal values of [Formula: see text] and [Formula: see text] with respect to predictive ability, inflation and iterations up to convergence on a well investigated, publicly available wheat data set. Our results may help the reader to develop a better understanding for the effects of changes of [Formula: see text] and [Formula: see text] on the covariance model. In particular, we give theoretical arguments that as a general tendency, inflation will be reduced by increasing [Formula: see text] or by decreasing [Formula: see text].

A Formula to Calculate Standard Liver Volume Using Thoracoabdominal Circumference.

PubMed

Shaw, Brian I; Burdine, Lyle J; Braun, Hillary J; Ascher, Nancy L; Roberts, John P

2017-12-01

With the use of split liver grafts as well as living donor liver transplantation (LDLT) it is imperative to know the minimum graft volume to avoid complications. Most current formulas to predict standard liver volume (SLV) rely on weight-based measures that are likely inaccurate in the setting of cirrhosis. Therefore, we sought to create a formula for estimating SLV without weight-based covariates. LDLT donors underwent computed tomography scan volumetric evaluation of their livers. An optimal formula for calculating SLV using the anthropomorphic measure thoracoabdominal circumference (TAC) was determined using leave-one-out cross-validation. The ability of this formula to correctly predict liver volume was checked against other existing formulas by analysis of variance. The ability of the formula to predict small grafts in LDLT was evaluated by exact logistic regression. The optimal formula using TAC was determined to be SLV = (TAC × 3.5816) - (Age × 3.9844) - (Sex × 109.7386) - 934.5949. When compared to historic formulas, the current formula was the only one which was not significantly different than computed tomography determined liver volumes when compared by analysis of variance with Dunnett posttest. When evaluating the ability of the formula to predict small for size syndrome, many (10/16) of the formulas tested had significant results by exact logistic regression, with our formula predicting small for size syndrome with an odds ratio of 7.94 (95% confidence interval, 1.23-91.36; P = 0.025). We report a formula for calculating SLV that does not rely on weight-based variables that has good ability to predict SLV and identify patients with potentially small grafts.

New Evaluated Semi-Empirical Formula Using Optical Model for 14-15 MeV ( n, t) Reaction Cross Sections

NASA Astrophysics Data System (ADS)

Tel, E.; Durgu, C.; Aydın, A.; Bölükdemir, M. H.; Kaplan, A.; Okuducu, Ş.

2009-12-01

In the next century the world will face the need for new energy sources. Nuclear fusion can be one of the most attractive sources of energy from the viewpoint of safety and minimal environmental impact. Fusion will not produce CO2 or SO2 and thus will not contribute to global warming or acid rain. Achieving acceptable performance for a fusion power system in the areas of economics, safety and environmental acceptability, is critically dependent on performance of the blanket and diverter systems which are the primary heat recovery, plasma purification, and tritium breeding systems. Tritium self-sufficiency must be maintained for a commercial power plant. The hybrid reactor is a combination of the fusion and fission processes. For self-sustaining (D-T) fusion driver tritium breeding ratio should be greater than 1.05. So working out the systematics of ( n, t) reaction cross-sections are of great importance for the definition of the excitation function character for the given reaction taking place on various nuclei at energies up to 20 MeV. In this study, we have calculated non-elastic cross-sections by using optical model for ( n, t) reactions at 14-15 MeV energy. We have investigated the excitation function character and reaction Q-values depending on the asymmetry term effect for the ( n, t) reaction cross-sections. We have obtained new coefficients for the ( n, t) reaction cross-sections. We have suggested semi-empirical formulas including optical model nonelastic effects by fitting two parameters for the ( n, t) reaction cross-sections at 14-15 MeV. We have discussed the odd-even effect and the pairing effect considering binding energy systematic of the nuclear shell model for the new experimental data and new cross-sections formulas ( n, t) reactions developed by Tel et al. We have determined a different parameter groups by the classification of nuclei into even-even, even-odd and odd-even for ( n, t) reactions cross-sections. The obtained cross-section formulas with new coefficients have been discussed and compared with the available experimental data.

Sustainable clinical research, health economic aspects and medical marketing: drivers of product innovation.

PubMed

Haschke, Ferdinand; Klassen-Wigger, Petra

2010-01-01

Marketing-driven innovation in the field of pediatric nutrition, in particular in the infant formula segment is not sustainable. New benefits of products must be scientifically proven and safety and efficacy of new formulae established in clinical trials. The scientific innovation process of three infant formulae is described. Improvement in protein quality allowed to reduce the protein concentration in whey-based infant formula. Weight gain and BMI of infants fed those formulae corresponds to breastfed infants and is lower than in infants fed traditional formulae with higher protein concentration. A meta-analysis indicates associations between rapid weight gain in infancy and obesity later in life. If infants cannot be exclusively breastfed until 4-6 months of age, feeding low-protein formulae may contribute to positive long-term health outcome with potentially important health economic effects. A partially hydrolyzed whey based formula for prevention of allergic symptoms in children with hereditary risk for allergic diseases was developed more than 25 years ago. The most recent meta-analysis which included 15 randomized clinical trials indicates that the risk of all allergic diseases and atopic dermatitis/eczema is significantly reduced in infants at risk when the partially hydrolyzed formula is fed. The partially hydrolyzed formula had the same protective effect as casein-based high-degree extensively hydrolyzed formula. Because of substantial price differences between the two formulae, feeding the partially hydrolyzed whey formula is cost saving. Hypoallergenic claims can be made in many countries, and international nutrition committees have positively commented the preventive effect of those formulae. Acidified formulae have been widely used during the last decade in replacement feeding programs for infants whose mothers are HIV positive. The formula was innovated by improving whey protein quality and lowering protein concentration. The bacteriostatic properties of the new formula were proven in in vitro tests. Meta-analysis indicated that feeding the formula to immunocompromised infants resulted in growth similar to breastfeeding. The bacteriostatic effects of the acidified formula need to be communicated to health care professionals, but also the risks if replacement feeding is not acceptable, feasible, affordable, sustainable, and safe for mother and infant. Copyright © 2010 S. Karger AG, Basel.

24 CFR 990.190 - Other formula expenses (add-ons).

Code of Federal Regulations, 2010 CFR

2010-04-01

... operating subsidy is determined to be zero based on the formula is still eligible to receive operating... formula expenses (add-ons). In addition to calculating operating subsidy based on the PEL and UEL, a PHA's... receive an amount for PILOT in accordance with section 6(d) of the 1937 Act, based on its cooperation...

24 CFR 990.190 - Other formula expenses (add-ons).

Code of Federal Regulations, 2011 CFR

2011-04-01

... operating subsidy is determined to be zero based on the formula is still eligible to receive operating... formula expenses (add-ons). In addition to calculating operating subsidy based on the PEL and UEL, a PHA's... receive an amount for PILOT in accordance with section 6(d) of the 1937 Act, based on its cooperation...

Impact of the bottom drag coefficient on saltwater intrusion in the extremely shallow estuary

NASA Astrophysics Data System (ADS)

Lyu, Hanghang; Zhu, Jianrong

2018-02-01

The interactions between the extremely shallow, funnel-shaped topography and dynamic processes in the North Branch (NB) of the Changjiang Estuary produce a particular type of saltwater intrusion, saltwater spillover (SSO), from the NB into the South Branch (SB). This dominant type of saltwater intrusion threatens the winter water supplies of reservoirs located in the estuary. Simulated SSO was weaker than actual SSO in previous studies, and this problem has not been solved until now. The improved ECOM-si model with the advection scheme HSIMT-TVD was applied in this study. Logarithmic and Chézy-Manning formulas of the bottom drag coefficient (BDC) were established in the model to investigate the associated effect on saltwater intrusion in the NB. Modeled data and data collected at eight measurement stations located in the NB from February 19 to March 1, 2017, were compared, and three skill assessment indicators, the correlation coefficient (CC), root-mean-square error (RMSE), and skill score (SS), of water velocity and salinity were used to quantitatively validate the model. The results indicated that the water velocities modeled using the Chézy-Manning formula of BDC were slightly more accurate than those based on the logarithmic BDC formula, but the salinities produced by the latter formula were more accurate than those of the former. The results showed that the BDC increases when water depth decreases during ebb tide, and the results based on the Chézy-Manning formula were smaller than those based on the logarithmic formula. Additionally, the landward net water flux in the upper reaches of the NB during spring tide increases based on the Chézy-Manning formula, and saltwater intrusion in the NB was enhanced, especially in the upper reaches of the NB. At a transect in the upper reaches of the NB, the net transect water flux (NTWF) is upstream in spring tide and downstream in neap tide, and the values produced by the Chézy-Manning formula are much larger than those based on the logarithmic formula. Notably, SSO during spring tide was 1.8 times larger based on the Chézy-Manning formula than that based on the logarithmic formula. The model underestimated SSO and salinity at the hydrological stations in the SB based on the logarithmic BDC formula but successfully simulated SSO and the temporal variations in salinity in the SB using the Chézy-Manning formula of BDC.

An empirical study of statistical properties of variance partition coefficients for multi-level logistic regression models

USGS Publications Warehouse

Li, Ji; Gray, B.R.; Bates, D.M.

2008-01-01

Partitioning the variance of a response by design levels is challenging for binomial and other discrete outcomes. Goldstein (2003) proposed four definitions for variance partitioning coefficients (VPC) under a two-level logistic regression model. In this study, we explicitly derived formulae for multi-level logistic regression model and subsequently studied the distributional properties of the calculated VPCs. Using simulations and a vegetation dataset, we demonstrated associations between different VPC definitions, the importance of methods for estimating VPCs (by comparing VPC obtained using Laplace and penalized quasilikehood methods), and bivariate dependence between VPCs calculated at different levels. Such an empirical study lends an immediate support to wider applications of VPC in scientific data analysis.

Reliability of sensor-based real-time workflow recognition in laparoscopic cholecystectomy.

PubMed

Kranzfelder, Michael; Schneider, Armin; Fiolka, Adam; Koller, Sebastian; Reiser, Silvano; Vogel, Thomas; Wilhelm, Dirk; Feussner, Hubertus

2014-11-01

Laparoscopic cholecystectomy is a very common minimally invasive surgical procedure that may be improved by autonomous or cooperative assistance support systems. Model-based surgery with a precise definition of distinct procedural tasks (PT) of the operation was implemented and tested to depict and analyze the process of this procedure. Reliability of real-time workflow recognition in laparoscopic cholecystectomy ([Formula: see text] cases) was evaluated by continuous sensor-based data acquisition. Ten PTs were defined including begin/end preparation calots' triangle, clipping/cutting cystic artery and duct, begin/end gallbladder dissection, begin/end hemostasis, gallbladder removal, and end of operation. Data acquisition was achieved with continuous instrument detection, room/table light status, intra-abdominal pressure, table tilt, irrigation/aspiration volume and coagulation/cutting current application. Two independent observers recorded start and endpoint of each step by analysis of the sensor data. The data were cross-checked with laparoscopic video recordings serving as gold standard for PT identification. Bland-Altman analysis revealed for 95% of cases a difference of annotation results within the limits of agreement ranging from [Formula: see text]309 s (PT 7) to +368 s (PT 5). Laparoscopic video and sensor data matched to a greater or lesser extent within the different procedural tasks. In the majority of cases, the observer results exceeded those obtained from the laparoscopic video. Empirical knowledge was required to detect phase transit. A set of sensors used to monitor laparoscopic cholecystectomy procedures was sufficient to enable expert observers to reliably identify each PT. In the future, computer systems may automate the task identification process provided a more robust data inflow is available.

Testing homogeneity of proportion ratios for stratified correlated bilateral data in two-arm randomized clinical trials.

PubMed

Pei, Yanbo; Tian, Guo-Liang; Tang, Man-Lai

2014-11-10

Stratified data analysis is an important research topic in many biomedical studies and clinical trials. In this article, we develop five test statistics for testing the homogeneity of proportion ratios for stratified correlated bilateral binary data based on an equal correlation model assumption. Bootstrap procedures based on these test statistics are also considered. To evaluate the performance of these statistics and procedures, we conduct Monte Carlo simulations to study their empirical sizes and powers under various scenarios. Our results suggest that the procedure based on score statistic performs well generally and is highly recommended. When the sample size is large, procedures based on the commonly used weighted least square estimate and logarithmic transformation with Mantel-Haenszel estimate are recommended as they do not involve any computation of maximum likelihood estimates requiring iterative algorithms. We also derive approximate sample size formulas based on the recommended test procedures. Finally, we apply the proposed methods to analyze a multi-center randomized clinical trial for scleroderma patients. Copyright © 2014 John Wiley & Sons, Ltd.

Estimation of spatially restricted LET using track structure models

NASA Technical Reports Server (NTRS)

Kiefer, J.

1994-01-01

The spatial distribution of energy deposition is an important determinant in the formation of biologically significant lesions. It has been widely realized that Linear Energy Transfer (LET) being an average quantity is not sufficient to describe the situation at a submicroscopic scale. To remedy this to some extent 'energy-cut-off' values are sometimes used but since they are related to secondary electron energy and only indirectly to their range they are also not adequate although they may be easily calculated. 'Range-restricted LET' appears to be better but its determination is usually quite involved. Xapsos (1992) suggested a semi-empirical approximation based on a modified Bethe-formula which contains a number of assumption which are difficult to verify. A simpler and easier way is to use existing beam-models which describe energy deposition around an ion's path. They all agree that the energy density (i. e., energy deposited per unit mass) decreases with the inverse square of the distance from the track center. This simple dependence can be used to determine the fraction of total LET which is deposited in a cylinder of a given radius. As an example our own beam model. Energy density depends on distance x (measured in m) from the track center according to the presented formula.

Synthesis and Characterization of A Coordination Complex of Tetrakis(diphenylamine)copper(II) Sulfate Hexahydrate

NASA Astrophysics Data System (ADS)

Syaima, H.; Rahardjo, S. B.; Suciningrum, E.

2018-03-01

CuSO4·5H2O with diphenylamine formed a complex compound in 1:4 mole ratio of metal to the ligand in methanol. The forming of the complex was indicated by shifting of UV-Vis spectra of CuSO4·5H2O and the complex from 819 nm to 593 nm. The result of analysis Cu(II) in the complex showed the copper content in the complex was 6.43 % therefore the empirical formula of the complex was Cu(diphenylamine)4SO4(H2O)6. The electrical conductivity of complex showed the charge ratio of cation and anion = 1:1. Therefore, the proposed formula of the complex was [Cu(diphenylamine)4]SO4·6H2O. Based on infrared spectra, it was determined that the functional group of N-H of diphenylamine was coordinated to the center ion Cu2+. The electronic spectral study of the complex showed a transition peak on λ = 593 nm (υ = 16863 cm-1) corresponding to the 2B1g → 2A1g transition. The complex was paramagnetic with effective magnetic moment 1.72 B.M. It was indicated square planar geometry around Cu(II).

Measurement of the production and lepton charge asymmetry of [Formula: see text] bosons in Pb+Pb collisions at [Formula: see text] with the ATLAS detector.

PubMed

Aad, G; Abbott, B; Abdallah, J; Abdel Khalek, S; Abdinov, O; Aben, R; Abi, B; Abolins, M; AbouZeid, O S; Abramowicz, H; Abreu, H; Abreu, R; Abulaiti, Y; Acharya, B S; Adamczyk, L; Adams, D L; Adelman, J; Adomeit, S; Adye, T; Agatonovic-Jovin, T; Aguilar-Saavedra, J A; Agustoni, M; Ahlen, S P; Ahmadov, F; Aielli, G; Akerstedt, H; Åkesson, T P A; Akimoto, G; Akimov, A V; Alberghi, G L; Albert, J; Albrand, S; Alconada Verzini, M J; Aleksa, M; Aleksandrov, I N; Alexa, C; Alexander, G; Alexandre, G; Alexopoulos, T; Alhroob, M; Alimonti, G; Alio, L; Alison, J; Allbrooke, B M M; Allison, L J; Allport, P P; Almond, J; Aloisio, A; Alonso, A; Alonso, F; Alpigiani, C; Altheimer, A; Alvarez Gonzalez, B; Alviggi, M G; Amako, K; Amaral Coutinho, Y; Amelung, C; Amidei, D; Amor Dos Santos, S P; Amorim, A; Amoroso, S; Amram, N; Amundsen, G; Anastopoulos, C; Ancu, L S; Andari, N; Andeen, T; Anders, C F; Anders, G; Anderson, K J; Andreazza, A; Andrei, V; Anduaga, X S; Angelidakis, S; Angelozzi, I; Anger, P; Angerami, A; Anghinolfi, F; Anisenkov, A V; Anjos, N; Annovi, A; Antonaki, A; Antonelli, M; Antonov, A; Antos, J; Anulli, F; Aoki, M; Aperio Bella, L; Apolle, R; Arabidze, G; Aracena, I; Arai, Y; Araque, J P; Arce, A T H; Arguin, J-F; Argyropoulos, S; Arik, M; Armbruster, A J; Arnaez, O; Arnal, V; Arnold, H; Arratia, M; Arslan, O; Artamonov, A; Artoni, G; Asai, S; Asbah, N; Ashkenazi, A; Åsman, B; Asquith, L; Assamagan, K; Astalos, R; Atkinson, M; Atlay, N B; Auerbach, B; Augsten, K; Aurousseau, M; Avolio, G; Azuelos, G; Azuma, Y; Baak, M A; Baas, A; Bacci, C; Bachacou, H; Bachas, K; Backes, M; Backhaus, M; Backus Mayes, J; Badescu, E; Bagiacchi, P; Bagnaia, P; Bai, Y; Bain, T; Baines, J T; Baker, O K; Balek, P; Balestri, T; Balli, F; Banas, E; Banerjee, Sw; Bannoura, A A E; Bansal, V; Bansil, H S; Barak, L; Baranov, S P; Barberio, E L; Barberis, D; Barbero, M; Barillari, T; Barisonzi, M; Barklow, T; Barlow, N; Barnett, B M; Barnett, R M; Barnovska, Z; Baroncelli, A; Barone, G; Barr, A J; Barreiro, F; Barreiro Guimarães da Costa, J; Bartoldus, R; Barton, A E; Bartos, P; Bartsch, V; Bassalat, A; Basye, A; Bates, R L; Batley, J R; Battaglia, M; Battistin, M; Bauer, F; Bawa, H S; Beattie, M D; Beau, T; Beauchemin, P H; Beccherle, R; Bechtle, P; Beck, H P; Becker, K; Becker, S; Beckingham, M; Becot, C; Beddall, A J; Beddall, A; Bedikian, S; Bednyakov, V A; Bee, C P; Beemster, L J; Beermann, T A; Begel, M; Behr, K; Belanger-Champagne, C; Bell, P J; Bell, W H; Bella, G; Bellagamba, L; Bellerive, A; Bellomo, M; Belotskiy, K; Beltramello, O; Benary, O; Benchekroun, D; Bendtz, K; Benekos, N; Benhammou, Y; Benhar Noccioli, E; Benitez Garcia, J A; Benjamin, D P; Bensinger, J R; Benslama, K; Bentvelsen, S; Berge, D; Bergeaas Kuutmann, E; Berger, N; Berghaus, F; Beringer, J; Bernard, C; Bernat, P; Bernius, C; Bernlochner, F U; Berry, T; Berta, P; Bertella, C; Bertoli, G; Bertolucci, F; Bertsche, C; Bertsche, D; Besana, M I; Besjes, G J; Bessidskaia, O; Bessner, M; Besson, N; Betancourt, C; Bethke, S; Bhimji, W; Bianchi, R M; Bianchini, L; Bianco, M; Biebel, O; Bieniek, S P; Bierwagen, K; Biesiada, J; Biglietti, M; Bilbao De Mendizabal, J; Bilokon, H; Bindi, M; Binet, S; Bingul, A; Bini, C; Black, C W; Black, J E; Black, K M; Blackburn, D; Blair, R E; Blanchard, J-B; Blazek, T; Bloch, I; Blocker, C; Blum, W; Blumenschein, U; Bobbink, G J; Bobrovnikov, V S; Bocchetta, S S; Bocci, A; Bock, C; Boddy, C R; Boehler, M; Boek, T T; Bogaerts, J A; Bogdanchikov, A G; Bogouch, A; Bohm, C; Bohm, J; Boisvert, V; Bold, T; Boldea, V; Boldyrev, A S; Bomben, M; Bona, M; Boonekamp, M; Borisov, A; Borissov, G; Borri, M; Borroni, S; Bortfeldt, J; Bortolotto, V; Bos, K; Boscherini, D; Bosman, M; Boterenbrood, H; Boudreau, J; Bouffard, J; Bouhova-Thacker, E V; Boumediene, D; Bourdarios, C; Bousson, N; Boutouil, S; Boveia, A; Boyd, J; Boyko, I R; Bracinik, J; Brandt, A; Brandt, G; Brandt, O; Bratzler, U; Brau, B; Brau, J E; Braun, H M; Brazzale, S F; Brelier, B; Brendlinger, K; Brennan, A J; Brenner, R; Bressler, S; Bristow, K; Bristow, T M; Britton, D; Brochu, F M; Brock, I; Brock, R; Bromberg, C; Bronner, J; Brooijmans, G; Brooks, T; Brooks, W K; Brosamer, J; Brost, E; Brown, J; Bruckman de Renstrom, P A; Bruncko, D; Bruneliere, R; Brunet, S; Bruni, A; Bruni, G; Bruschi, M; Bryngemark, L; Buanes, T; Buat, Q; Bucci, F; Buchholz, P; Buckingham, R M; Buckley, A G; Buda, S I; Budagov, I A; Buehrer, F; Bugge, L; Bugge, M K; Bulekov, O; Bundock, A C; Burckhart, H; Burdin, S; Burghgrave, B; Burke, S; Burmeister, I; Busato, E; Büscher, D; Büscher, V; Bussey, P; Buszello, C P; Butler, B; Butler, J M; Butt, A I; Buttar, C M; Butterworth, J M; Butti, P; Buttinger, W; Buzatu, A; Byszewski, M; Cabrera Urbán, S; Caforio, D; Cakir, O; Calafiura, P; Calandri, A; Calderini, G; Calfayan, P; Calkins, R; Caloba, L P; Calvet, D; Calvet, S; Camacho Toro, R; Camarda, S; Cameron, D; Caminada, L M; Caminal Armadans, R; Campana, S; Campanelli, M; Campoverde, A; Canale, V; Canepa, A; Cano Bret, M; Cantero, J; Cantrill, R; Cao, T; Capeans Garrido, M D M; Caprini, I; Caprini, M; Capua, M; Caputo, R; Cardarelli, R; Carli, T; Carlino, G; Carminati, L; Caron, S; Carquin, E; Carrillo-Montoya, G D; Carter, J R; Carvalho, J; Casadei, D; Casado, M P; Casolino, M; Castaneda-Miranda, E; Castelli, A; Castillo Gimenez, V; Castro, N F; Catastini, P; Catinaccio, A; Catmore, J R; Cattai, A; Cattani, G; Caughron, S; Cavaliere, V; Cavalli, D; Cavalli-Sforza, M; Cavasinni, V; Ceradini, F; Cerio, B; Cerny, K; Cerqueira, A S; Cerri, A; Cerrito, L; Cerutti, F; Cerv, M; Cervelli, A; Cetin, S A; Chafaq, A; Chakraborty, D; Chalupkova, I; Chang, P; Chapleau, B; Chapman, J D; Charfeddine, D; Charlton, D G; Chau, C C; Chavez Barajas, C A; Cheatham, S; Chegwidden, A; Chekanov, S; Chekulaev, S V; Chelkov, G A; Chelstowska, M A; Chen, C; Chen, H; Chen, K; Chen, L; Chen, S; Chen, X; Chen, Y; Chen, Y; Cheng, H C; Cheng, Y; Cheplakov, A; Cherkaoui El Moursli, R; Chernyatin, V; Cheu, E; Chevalier, L; Chiarella, V; Chiefari, G; Childers, J T; Chilingarov, A; Chiodini, G; Chisholm, A S; Chislett, R T; Chitan, A; Chizhov, M V; Chouridou, S; Chow, B K B; Chromek-Burckhart, D; Chu, M L; Chudoba, J; Chwastowski, J J; Chytka, L; Ciapetti, G; Ciftci, A K; Ciftci, R; Cinca, D; Cindro, V; Ciocio, A; Cirkovic, P; Citron, Z H; Citterio, M; Ciubancan, M; Clark, A; Clark, P J; Clarke, R N; Cleland, W; Clemens, J C; Clement, C; Coadou, Y; Cobal, M; Coccaro, A; Cochran, J; Coffey, L; Cogan, J G; Coggeshall, J; Cole, B; Cole, S; Colijn, A P; Collot, J; Colombo, T; Colon, G; Compostella, G; Conde Muiño, P; Coniavitis, E; Conidi, M C; Connell, S H; Connelly, I A; Consonni, S M; Consorti, V; Constantinescu, S; Conta, C; Conti, G; Conventi, F; Cooke, M; Cooper, B D; Cooper-Sarkar, A M; Cooper-Smith, N J; Copic, K; Cornelissen, T; Corradi, M; Corriveau, F; Corso-Radu, A; Cortes-Gonzalez, A; Cortiana, G; Costa, G; Costa, M J; Costanzo, D; Côté, D; Cottin, G; Cowan, G; Cox, B E; Cranmer, K; Cree, G; Crépé-Renaudin, S; Crescioli, F; Cribbs, W A; Crispin Ortuzar, M; Cristinziani, M; Croft, V; Crosetti, G; Cuciuc, C-M; Cuhadar Donszelmann, T; Cummings, J; Curatolo, M; Cuthbert, C; Czirr, H; Czodrowski, P; Czyczula, Z; D'Auria, S; D'Onofrio, M; Cunha Sargedas De Sousa, M J Da; Via, C Da; Dabrowski, W; Dafinca, A; Dai, T; Dale, O; Dallaire, F; Dallapiccola, C; Dam, M; Daniells, A C; Dano Hoffmann, M; Dao, V; Darbo, G; Darmora, S; Dassoulas, J A; Dattagupta, A; Davey, W; David, C; Davidek, T; Davies, E; Davies, M; Davignon, O; Davison, A R; Davison, P; Davygora, Y; Dawe, E; Dawson, I; Daya-Ishmukhametova, R K; De, K; de Asmundis, R; De Castro, S; De Cecco, S; De Groot, N; de Jong, P; De la Torre, H; De Lorenzi, F; De Nooij, L; De Pedis, D; De Salvo, A; De Sanctis, U; De Santo, A; De Vivie De Regie, J B; Dearnaley, W J; Debbe, R; Debenedetti, C; Dechenaux, B; Dedovich, D V; Deigaard, I; Del Peso, J; Del Prete, T; Deliot, F; Delitzsch, C M; Deliyergiyev, M; Dell'Acqua, A; Dell'Asta, L; Dell'Orso, M; Della Pietra, M; Della Volpe, D; Delmastro, M; Delsart, P A; Deluca, C; Demers, S; Demichev, M; Demilly, A; Denisov, S P; Derendarz, D; Derkaoui, J E; Derue, F; Dervan, P; Desch, K; Deterre, C; Deviveiros, P O; Dewhurst, A; Dhaliwal, S; Di Ciaccio, A; Di Ciaccio, L; Di Domenico, A; Di Donato, C; Di Girolamo, A; Di Girolamo, B; Di Mattia, A; Di Micco, B; Di Nardo, R; Di Simone, A; Di Sipio, R; Di Valentino, D; Dias, F A; Diaz, M A; Diehl, E B; Dietrich, J; Dietzsch, T A; Diglio, S; Dimitrievska, A; Dingfelder, J; Dionisi, C; Dita, P; Dita, S; Dittus, F; Djama, F; Djobava, T; do Vale, M A B; Do Valle Wemans, A; Doan, T K O; Dobos, D; Doglioni, C; Doherty, T; Dohmae, T; Dolejsi, J; Dolezal, Z; Dolgoshein, B A; Donadelli, M; Donati, S; Dondero, P; Donini, J; Dopke, J; Doria, A; Dova, M T; Doyle, A T; Dris, M; Dubbert, J; Dube, S; Dubreuil, E; Duchovni, E; Duckeck, G; Ducu, O A; Duda, D; Dudarev, A; Dudziak, F; Duflot, L; Duguid, L; Dührssen, M; Dunford, M; Duran Yildiz, H; Düren, M; Durglishvili, A; Dwuznik, M; Dyndal, M; Ebke, J; Edson, W; Edwards, N C; Ehrenfeld, W; Eifert, T; Eigen, G; Einsweiler, K; Ekelof, T; El Kacimi, M; Ellert, M; Elles, S; Ellinghaus, F; Ellis, N; Elmsheuser, J; Elsing, M; Emeliyanov, D; Enari, Y; Endner, O C; Endo, M; Engelmann, R; Erdmann, J; Ereditato, A; Eriksson, D; Ernis, G; Ernst, J; Ernst, M; Ernwein, J; Errede, D; Errede, S; Ertel, E; Escalier, M; Esch, H; Escobar, C; Esposito, B; Etienvre, A I; Etzion, E; Evans, H; Ezhilov, A; Fabbri, L; Facini, G; Fakhrutdinov, R M; Falciano, S; Falla, R J; Faltova, J; Fang, Y; Fanti, M; Farbin, A; Farilla, A; Farooque, T; Farrell, S; Farrington, S M; Farthouat, P; Fassi, F; Fassnacht, P; Fassouliotis, D; Favareto, A; Fayard, L; Federic, P; Fedin, O L; Fedorko, W; Fehling-Kaschek, M; Feigl, S; Feligioni, L; Feng, C; Feng, E J; Feng, H; Fenyuk, A B; Fernandez Perez, S; Ferrag, S; Ferrando, J; Ferrari, A; Ferrari, P; Ferrari, R; Ferreira de Lima, D E; Ferrer, A; Ferrere, D; Ferretti, C; Ferretto Parodi, A; Fiascaris, M; Fiedler, F; Filipčič, A; Filipuzzi, M; Filthaut, F; Fincke-Keeler, M; Finelli, K D; Fiolhais, M C N; Fiorini, L; Firan, A; Fischer, A; Fischer, J; Fisher, W C; Fitzgerald, E A; Flechl, M; Fleck, I; Fleischmann, P; Fleischmann, S; Fletcher, G T; Fletcher, G; Flick, T; Floderus, A; Flores Castillo, L R; Florez Bustos, A C; Flowerdew, M J; Formica, A; Forti, A; Fortin, D; Fournier, D; Fox, H; Fracchia, S; Francavilla, P; Franchini, M; Franchino, S; Francis, D; Franconi, L; Franklin, M; Franz, S; Fraternali, M; French, S T; Friedrich, C; Friedrich, F; Froidevaux, D; Frost, J A; Fukunaga, C; Fullana Torregrosa, E; Fulsom, B G; Fuster, J; Gabaldon, C; Gabizon, O; Gabrielli, A; Gabrielli, A; Gadatsch, S; Gadomski, S; Gagliardi, G; Gagnon, P; Galea, C; Galhardo, B; Gallas, E J; Gallo, V; Gallop, B J; Gallus, P; Galster, G; Gan, K K; Gandrajula, R P; Gao, J; Gao, Y S; Garay Walls, F M; Garberson, F; García, C; García Navarro, J E; Garcia-Sciveres, M; Gardner, R W; Garelli, N; Garonne, V; Gatti, C; Gaudio, G; Gaur, B; Gauthier, L; Gauzzi, P; Gavrilenko, I L; Gay, C; Gaycken, G; Gazis, E N; Ge, P; Gecse, Z; Gee, C N P; Geerts, D A A; Geich-Gimbel, Ch; Gellerstedt, K; Gemme, C; Gemmell, A; Genest, M H; Gentile, S; George, M; George, S; Gerbaudo, D; Gershon, A; Ghazlane, H; Ghodbane, N; Giacobbe, B; Giagu, S; Giangiobbe, V; Giannetti, P; Gianotti, F; Gibbard, B; Gibson, S M; Gilchriese, M; Gillam, T P S; Gillberg, D; Gilles, G; Gingrich, D M; Giokaris, N; Giordani, M P; Giordano, R; Giorgi, F M; Giorgi, F M; Giraud, P F; Giugni, D; Giuliani, C; Giulini, M; Gjelsten, B K; Gkaitatzis, S; Gkialas, I; Gladilin, L K; Glasman, C; Glatzer, J; Glaysher, P C F; Glazov, A; Glonti, G L; Goblirsch-Kolb, M; Goddard, J R; Godfrey, J; Godlewski, J; Goeringer, C; Goldfarb, S; Golling, T; Golubkov, D; Gomes, A; Gomez Fajardo, L S; Gonçalo, R; Goncalves Pinto Firmino Da Costa, J; Gonella, L; González de la Hoz, S; Gonzalez Parra, G; Gonzalez-Sevilla, S; Goossens, L; Gorbounov, P A; Gordon, H A; Gorelov, I; Gorini, B; Gorini, E; Gorišek, A; Gornicki, E; Goshaw, A T; Gössling, C; Gostkin, M I; Gouighri, M; Goujdami, D; Goulette, M P; Goussiou, A G; Goy, C; Gozpinar, S; Grabas, H M X; Graber, L; Grabowska-Bold, I; Grafström, P; Grahn, K-J; Gramling, J; Gramstad, E; Grancagnolo, S; Grassi, V; Gratchev, V; Gray, H M; Graziani, E; Grebenyuk, O G; Greenwood, Z D; Gregersen, K; Gregor, I M; Grenier, P; Griffiths, J; Grillo, A A; Grimm, K; Grinstein, S; Gris, Ph; Grishkevich, Y V; Grivaz, J-F; Grohs, J P; Grohsjean, A; Gross, E; Grosse-Knetter, J; Grossi, G C; Groth-Jensen, J; Grout, Z J; Guan, L; Guescini, F; Guest, D; Gueta, O; Guicheney, C; Guido, E; Guillemin, T; Guindon, S; Gul, U; Gumpert, C; Gunther, J; Guo, J; Gupta, S; Gutierrez, P; Gutierrez Ortiz, N G; Gutschow, C; Guttman, N; Guyot, C; Gwenlan, C; Gwilliam, C B; Haas, A; Haber, C; Hadavand, H K; Haddad, N; Haefner, P; Hageböeck, S; Hajduk, Z; Hakobyan, H; Haleem, M; Hall, D; Halladjian, G; Hamacher, K; Hamal, P; Hamano, K; Hamer, M; Hamilton, A; Hamilton, S; Hamity, G N; Hamnett, P G; Han, L; Hanagaki, K; Hanawa, K; Hance, M; Hanke, P; Hanna, R; Hansen, J B; Hansen, J D; Hansen, P H; Hara, K; Hard, A S; Harenberg, T; Hariri, F; Harkusha, S; Harper, D; Harrington, R D; Harris, O M; Harrison, P F; Hartjes, F; Hasegawa, M; Hasegawa, S; Hasegawa, Y; Hasib, A; Hassani, S; Haug, S; Hauschild, M; Hauser, R; Havranek, M; Hawkes, C M; Hawkings, R J; Hawkins, A D; Hayashi, T; Hayden, D; Hays, C P; Hayward, H S; Haywood, S J; Head, S J; Heck, T; Hedberg, V; Heelan, L; Heim, S; Heim, T; Heinemann, B; Heinrich, L; Hejbal, J; Helary, L; Heller, C; Heller, M; Hellman, S; Hellmich, D; Helsens, C; Henderson, J; Henderson, R C W; Heng, Y; Hengler, C; Henrichs, A; Henriques Correia, A M; Henrot-Versille, S; Hensel, C; Herbert, G H; Hernández Jiménez, Y; Herrberg-Schubert, R; Herten, G; Hertenberger, R; Hervas, L; Hesketh, G G; Hessey, N P; Hickling, R; Higón-Rodriguez, E; Hill, E; Hill, J C; Hiller, K H; Hillert, S; Hillier, S J; Hinchliffe, I; Hines, E; Hirose, M; Hirschbuehl, D; Hobbs, J; Hod, N; Hodgkinson, M C; Hodgson, P; Hoecker, A; Hoeferkamp, M R; Hoenig, F; Hoffman, J; Hoffmann, D; Hofmann, J I; Hohlfeld, M; Holmes, T R; Hong, T M; Hooft van Huysduynen, L; Hostachy, J-Y; Hou, S; Hoummada, A; Howard, J; Howarth, J; Hrabovsky, M; Hristova, I; Hrivnac, J; Hryn'ova, T; Hsu, C; Hsu, P J; Hsu, S-C; Hu, D; Hu, X; Huang, Y; Hubacek, Z; Hubaut, F; Huegging, F; Huffman, T B; Hughes, E W; Hughes, G; Huhtinen, M; Hülsing, T A; Hurwitz, M; Huseynov, N; Huston, J; Huth, J; Iacobucci, G; Iakovidis, G; Ibragimov, I; Iconomidou-Fayard, L; Ideal, E; Iengo, P; Igonkina, O; Iizawa, T; Ikegami, Y; Ikematsu, K; Ikeno, M; Ilchenko, Y; Iliadis, D; Ilic, N; Inamaru, Y; Ince, T; Ioannou, P; Iodice, M; Iordanidou, K; Ippolito, V; Irles Quiles, A; Isaksson, C; Ishino, M; Ishitsuka, M; Ishmukhametov, R; Issever, C; Istin, S; Iturbe Ponce, J M; Iuppa, R; Ivarsson, J; Iwanski, W; Iwasaki, H; Izen, J M; Izzo, V; Jackson, B; Jackson, M; Jackson, P; Jaekel, M R; Jain, V; Jakobs, K; Jakobsen, S; Jakoubek, T; Jakubek, J; Jamin, D O; Jana, D K; Jansen, E; Jansen, H; Janssen, J; Janus, M; Jarlskog, G; Javadov, N; Javůrek, T; Jeanty, L; Jejelava, J; Jeng, G-Y; Jennens, D; Jenni, P; Jentzsch, J; Jeske, C; Jézéquel, S; Ji, H; Jia, J; Jiang, Y; Jimenez Belenguer, M; Jin, S; Jinaru, A; Jinnouchi, O; Joergensen, M D; Johansson, K E; Johansson, P; Johns, K A; Jon-And, K; Jones, G; Jones, R W L; Jones, T J; Jongmanns, J; Jorge, P M; Joshi, K D; Jovicevic, J; Ju, X; Jung, C A; Jungst, R M; Jussel, P; Juste Rozas, A; Kaci, M; Kaczmarska, A; Kado, M; Kagan, H; Kagan, M; Kajomovitz, E; Kalderon, C W; Kama, S; Kamenshchikov, A; Kanaya, N; Kaneda, M; Kaneti, S; Kantserov, V A; Kanzaki, J; Kaplan, B; Kapliy, A; Kar, D; Karakostas, K; Karastathis, N; Karnevskiy, M; Karpov, S N; Karpova, Z M; Karthik, K; Kartvelishvili, V; Karyukhin, A N; Kashif, L; Kasieczka, G; Kass, R D; Kastanas, A; Kataoka, Y; Katre, A; Katzy, J; Kaushik, V; Kawagoe, K; Kawamoto, T; Kawamura, G; Kazama, S; Kazanin, V F; Kazarinov, M Y; Keeler, R; Kehoe, R; Keil, M; Keller, J S; Kempster, J J; Keoshkerian, H; Kepka, O; Kerševan, B P; Kersten, S; Kessoku, K; Keung, J; Khalil-Zada, F; Khandanyan, H; Khanov, A; Khodinov, A; Khomich, A; Khoo, T J; Khoriauli, G; Khoroshilov, A; Khovanskiy, V; Khramov, E; Khubua, J; Kim, H Y; Kim, H; Kim, S H; Kimura, N; Kind, O; King, B T; King, M; King, R S B; King, S B; Kirk, J; Kiryunin, A E; Kishimoto, T; Kisielewska, D; Kiss, F; Kittelmann, T; Kiuchi, K; Kladiva, E; Klein, M; Klein, U; Kleinknecht, K; Klimek, P; Klimentov, A; Klingenberg, R; Klinger, J A; Klioutchnikova, T; Klok, P F; Kluge, E-E; Kluit, P; Kluth, S; Kneringer, E; Knoops, E B F G; Knue, A; Kobayashi, D; Kobayashi, T; Kobel, M; Kocian, M; Kodys, P; Koevesarki, P; Koffas, T; Koffeman, E; Kogan, L A; Kohlmann, S; Kohout, Z; Kohriki, T; Koi, T; Kolanoski, H; Koletsou, I; Koll, J; Komar, A A; Komori, Y; Kondo, T; Kondrashova, N; Köneke, K; König, A C; König, S; Kono, T; Konoplich, R; Konstantinidis, N; Kopeliansky, R; Koperny, S; Köpke, L; Kopp, A K; Korcyl, K; Kordas, K; Korn, A; Korol, A A; Korolkov, I; Korolkova, E V; Korotkov, V A; Kortner, O; Kortner, S; Kostyukhin, V V; Kotov, V M; Kotwal, A; Kourkoumelis, C; Kouskoura, V; Koutsman, A; Kowalewski, R; Kowalski, T Z; Kozanecki, W; Kozhin, A S; Kral, V; Kramarenko, V A; Kramberger, G; Krasnopevtsev, D; Krasny, M W; Krasznahorkay, A; Kraus, J K; Kravchenko, A; Kreiss, S; Kretz, M; Kretzschmar, J; Kreutzfeldt, K; Krieger, P; Kroeninger, K; Kroha, H; Kroll, J; Kroseberg, J; Krstic, J; Kruchonak, U; Krüger, H; Kruker, T; Krumnack, N; Krumshteyn, Z V; Kruse, A; Kruse, M C; Kruskal, M; Kubota, T; Kuday, S; Kuehn, S; Kugel, A; Kuhl, A; Kuhl, T; Kukhtin, V; Kulchitsky, Y; Kuleshov, S; Kuna, M; Kunkle, J; Kupco, A; Kurashige, H; Kurochkin, Y A; Kurumida, R; Kus, V; Kuwertz, E S; Kuze, M; Kvita, J; La Rosa, A; La Rotonda, L; Lacasta, C; Lacava, F; Lacey, J; Lacker, H; Lacour, D; Lacuesta, V R; Ladygin, E; Lafaye, R; Laforge, B; Lagouri, T; Lai, S; Laier, H; Lambourne, L; Lammers, S; Lampen, C L; Lampl, W; Lançon, E; Landgraf, U; Landon, M P J; Lang, V S; Lankford, A J; Lanni, F; Lantzsch, K; Laplace, S; Lapoire, C; Laporte, J F; Lari, T; Lassnig, M; Laurelli, P; Lavrijsen, W; Law, A T; Laycock, P; Le Dortz, O; Le Guirriec, E; Le Menedeu, E; LeCompte, T; Ledroit-Guillon, F; Lee, C A; Lee, H; Lee, J S H; Lee, S C; Lee, L; Lefebvre, G; Lefebvre, M; Legger, F; Leggett, C; Lehan, A; Lehmacher, M; Lehmann Miotto, G; Lei, X; Leight, W A; Leisos, A; Leister, A G; Leite, M A L; Leitner, R; Lellouch, D; Lemmer, B; Leney, K J C; Lenz, T; Lenzen, G; Lenzi, B; Leone, R; Leone, S; Leonhardt, K; Leonidopoulos, C; Leontsinis, S; Leroy, C; Lester, C G; Lester, C M; Levchenko, M; Levêque, J; Levin, D; Levinson, L J; Levy, M; Lewis, A; Lewis, G H; Leyko, A M; Leyton, M; Li, B; Li, B; Li, H; Li, H L; Li, L; Li, L; Li, S; Li, Y; Liang, Z; Liao, H; Liberti, B; Lichard, P; Lie, K; Liebal, J; Liebig, W; Limbach, C; Limosani, A; Lin, S C; Lin, T H; Linde, F; Lindquist, B E; Linnemann, J T; Lipeles, E; Lipniacka, A; Lisovyi, M; Liss, T M; Lissauer, D; Lister, A; Litke, A M; Liu, B; Liu, D; Liu, J B; Liu, K; Liu, L; Liu, M; Liu, M; Liu, Y; Livan, M; Livermore, S S A; Lleres, A; Llorente Merino, J; Lloyd, S L; Lo Sterzo, F; Lobodzinska, E; Loch, P; Lockman, W S; Loddenkoetter, T; Loebinger, F K; Loevschall-Jensen, A E; Loginov, A; Lohse, T; Lohwasser, K; Lokajicek, M; Lombardo, V P; Long, B A; Long, J D; Long, R E; Lopes, L; Lopez Mateos, D; Lopez Paredes, B; Lopez Paz, I; Lorenz, J; Lorenzo Martinez, N; Losada, M; Loscutoff, P; Lou, X; Lounis, A; Love, J; Love, P A; Lowe, A J; Lu, F; Lu, N; Lubatti, H J; Luci, C; Lucotte, A; Luehring, F; Lukas, W; Luminari, L; Lundberg, O; Lund-Jensen, B; Lungwitz, M; Lynn, D; Lysak, R; Lytken, E; Ma, H; Ma, L L; Maccarrone, G; Macchiolo, A; Machado Miguens, J; Macina, D; Madaffari, D; Madar, R; Maddocks, H J; Mader, W F; Madsen, A; Maeno, M; Maeno, T; Magradze, E; Mahboubi, K; Mahlstedt, J; Mahmoud, S; Maiani, C; Maidantchik, C; Maier, A A; Maio, A; Majewski, S; Makida, Y; Makovec, N; Mal, P; Malaescu, B; Malecki, Pa; Maleev, V P; Malek, F; Mallik, U; Malon, D; Malone, C; Maltezos, S; Malyshev, V M; Malyukov, S; Mamuzic, J; Mandelli, B; Mandelli, L; Mandić, I; Mandrysch, R; Maneira, J; Manfredini, A; Manhaes de Andrade Filho, L; Manjarres Ramos, J A; Mann, A; Manning, P M; Manousakis-Katsikakis, A; Mansoulie, B; Mantifel, R; Mapelli, L; March, L; Marchand, J F; Marchiori, G; Marcisovsky, M; Marino, C P; Marjanovic, M; Marques, C N; Marroquim, F; Marsden, S P; Marshall, Z; Marti, L F; Marti-Garcia, S; Martin, B; Martin, B; Martin, T A; Martin, V J; Martin Dit Latour, B; Martinez, H; Martinez, M; Martin-Haugh, S; Martyniuk, A C; Marx, M; Marzano, F; Marzin, A; Masetti, L; Mashimo, T; Mashinistov, R; Masik, J; Maslennikov, A L; Massa, I; Massa, L; Massol, N; Mastrandrea, P; Mastroberardino, A; Masubuchi, T; Mättig, P; Mattmann, J; Maurer, J; Maxfield, S J; Maximov, D A; Mazini, R; Mazzaferro, L; Mc Goldrick, G; Mc Kee, S P; McCarn, A; McCarthy, R L; McCarthy, T G; McCubbin, N A; McFarlane, K W; Mcfayden, J A; Mchedlidze, G; McMahon, S J; McPherson, R A; Meade, A; Mechnich, J; Medinnis, M; Meehan, S; Mehlhase, S; Mehta, A; Meier, K; Meineck, C; Meirose, B; Melachrinos, C; Mellado Garcia, B R; Meloni, F; Mengarelli, A; Menke, S; Meoni, E; Mercurio, K M; Mergelmeyer, S; Meric, N; Mermod, P; Merola, L; Meroni, C; Merritt, F S; Merritt, H; Messina, A; Metcalfe, J; Mete, A S; Meyer, C; Meyer, C; Meyer, J-P; Meyer, J; Middleton, R P; Migas, S; Mijović, L; Mikenberg, G; Mikestikova, M; Mikuž, M; Milic, A; Miller, D W; Mills, C; Milov, A; Milstead, D A; Milstein, D; Minaenko, A A; Minashvili, I A; Mincer, A I; Mindur, B; Mineev, M; Ming, Y; Mir, L M; Mirabelli, G; Mitani, T; Mitrevski, J; Mitsou, V A; Mitsui, S; Miucci, A; Miyagawa, P S; Mjörnmark, J U; Moa, T; Mochizuki, K; Mohapatra, S; Mohr, W; Molander, S; Moles-Valls, R; Mönig, K; Monini, C; Monk, J; Monnier, E; Montejo Berlingen, J; Monticelli, F; Monzani, S; Moore, R W; Moraes, A; Morange, N; Moreno, D; Moreno Llácer, M; Morettini, P; Morgenstern, M; Morii, M; Moritz, S; Morley, A K; Mornacchi, G; Morris, J D; Morvaj, L; Moser, H G; Mosidze, M; Moss, J; Motohashi, K; Mount, R; Mountricha, E; Mouraviev, S V; Moyse, E J W; Muanza, S; Mudd, R D; Mueller, F; Mueller, J; Mueller, K; Mueller, T; Mueller, T; Muenstermann, D; Munwes, Y; Murillo Quijada, J A; Murray, W J; Musheghyan, H; Musto, E; Myagkov, A G; Myska, M; Nackenhorst, O; Nadal, J; Nagai, K; Nagai, R; Nagai, Y; Nagano, K; Nagarkar, A; Nagasaka, Y; Nagel, M; Nairz, A M; Nakahama, Y; Nakamura, K; Nakamura, T; Nakano, I; Namasivayam, H; Nanava, G; Narayan, R; Nattermann, T; Naumann, T; Navarro, G; Nayyar, R; Neal, H A; Nechaeva, P Yu; Neep, T J; Nef, P D; Negri, A; Negri, G; Negrini, M; Nektarijevic, S; Nelson, A; Nelson, T K; Nemecek, S; Nemethy, P; Nepomuceno, A A; Nessi, M; Neubauer, M S; Neumann, M; Neves, R M; Nevski, P; Newman, P R; Nguyen, D H; Nickerson, R B; Nicolaidou, R; Nicquevert, B; Nielsen, J; Nikiforou, N; Nikiforov, A; Nikolaenko, V; Nikolic-Audit, I; Nikolics, K; Nikolopoulos, K; Nilsson, P; Ninomiya, Y; Nisati, A; Nisius, R; Nobe, T; Nodulman, L; Nomachi, M; Nomidis, I; Norberg, S; Nordberg, M; Novgorodova, O; Nowak, S; Nozaki, M; Nozka, L; Ntekas, K; Nunes Hanninger, G; Nunnemann, T; Nurse, E; Nuti, F; O'Brien, B J; O'grady, F; O'Neil, D C; O'Shea, V; Oakham, F G; Oberlack, H; Obermann, T; Ocariz, J; Ochi, A; Ochoa, M I; Oda, S; Odaka, S; Ogren, H; Oh, A; Oh, S H; Ohm, C C; Ohman, H; Okamura, W; Okawa, H; Okumura, Y; Okuyama, T; Olariu, A; Olchevski, A G; Olivares Pino, S A; Oliveira Damazio, D; Oliver Garcia, E; Olszewski, A; Olszowska, J; Onofre, A; Onyisi, P U E; Oram, C J; Oreglia, M J; Oren, Y; Orestano, D; Orlando, N; Oropeza Barrera, C; Orr, R S; Osculati, B; Ospanov, R; Otero Y Garzon, G; Otono, H; Ouchrif, M; Ouellette, E A; Ould-Saada, F; Ouraou, A; Oussoren, K P; Ouyang, Q; Ovcharova, A; Owen, M; Ozcan, V E; Ozturk, N; Pachal, K; Pacheco Pages, A; Padilla Aranda, C; Pagáčová, M; Pagan Griso, S; Paganis, E; Pahl, C; Paige, F; Pais, P; Pajchel, K; Palacino, G; Palestini, S; Palka, M; Pallin, D; Palma, A; Palmer, J D; Pan, Y B; Panagiotopoulou, E; Panduro Vazquez, J G; Pani, P; Panikashvili, N; Panitkin, S; Pantea, D; Paolozzi, L; Papadopoulou, Th D; Papageorgiou, K; Paramonov, A; Paredes Hernandez, D; Parker, M A; Parodi, F; Parsons, J A; Parzefall, U; Pasqualucci, E; Passaggio, S; Passeri, A; Pastore, F; Pastore, Fr; Pásztor, G; Pataraia, S; Patel, N D; Pater, J R; Patricelli, S; Pauly, T; Pearce, J; Pedersen, M; Pedraza Lopez, S; Pedro, R; Peleganchuk, S V; Pelikan, D; Peng, H; Penning, B; Penwell, J; Perepelitsa, D V; Perez Codina, E; Pérez García-Estañ, M T; Perez Reale, V; Perini, L; Pernegger, H; Perrino, R; Peschke, R; Peshekhonov, V D; Peters, K; Peters, R F Y; Petersen, B A; Petersen, T C; Petit, E; Petridis, A; Petridou, C; Petrolo, E; Petrucci, F; Pettersson, N E; Pezoa, R; Phillips, P W; Piacquadio, G; Pianori, E; Picazio, A; Piccaro, E; Piccinini, M; Piegaia, R; Pignotti, D T; Pilcher, J E; Pilkington, A D; Pina, J; Pinamonti, M; Pinder, A; Pinfold, J L; Pingel, A; Pinto, B; Pires, S; Pitt, M; Pizio, C; Plazak, L; Pleier, M-A; Pleskot, V; Plotnikova, E; Plucinski, P; Poddar, S; Podlyski, F; Poettgen, R; Poggioli, L; Pohl, D; Pohl, M; Polesello, G; Policicchio, A; Polifka, R; Polini, A; Pollard, C S; Polychronakos, V; Pommès, K; Pontecorvo, L; Pope, B G; Popeneciu, G A; Popovic, D S; Poppleton, A; Portell Bueso, X; Pospisil, S; Potamianos, K; Potrap, I N; Potter, C J; Potter, C T; Poulard, G; Poveda, J; Pozdnyakov, V; Pralavorio, P; Pranko, A; Prasad, S; Pravahan, R; Prell, S; Price, D; Price, J; Price, L E; Prieur, D; Primavera, M; Proissl, M; Prokofiev, K; Prokoshin, F; Protopapadaki, E; Protopopescu, S; Proudfoot, J; Przybycien, M; Przysiezniak, H; Ptacek, E; Puddu, D; Pueschel, E; Puldon, D; Purohit, M; Puzo, P; Qian, J; Qin, G; Qin, Y; Quadt, A; Quarrie, D R; Quayle, W B; Queitsch-Maitland, M; Quilty, D; Qureshi, A; Radeka, V; Radescu, V; Radhakrishnan, S K; Radloff, P; Rados, P; Ragusa, F; Rahal, G; Rajagopalan, S; Rammensee, M; Randle-Conde, A S; Rangel-Smith, C; Rao, K; Rauscher, F; Rave, T C; Ravenscroft, T; Raymond, M; Read, A L; Readioff, N P; Rebuzzi, D M; Redelbach, A; Redlinger, G; Reece, R; Reeves, K; Rehnisch, L; Reisin, H; Relich, M; Rembser, C; Ren, H; Ren, Z L; Renaud, A; Rescigno, M; Resconi, S; Rezanova, O L; Reznicek, P; Rezvani, R; Richter, R; Ridel, M; Rieck, P; Rieger, J; Rijssenbeek, M; Rimoldi, A; Rinaldi, L; Ritsch, E; Riu, I; Rizatdinova, F; Rizvi, E; Robertson, S H; Robichaud-Veronneau, A; Robinson, D; Robinson, J E M; Robson, A; Roda, C; Rodrigues, L; Roe, S; Røhne, O; Rolli, S; Romaniouk, A; Romano, M; Romero Adam, E; Rompotis, N; Ronzani, M; Roos, L; Ros, E; Rosati, S; Rosbach, K; Rose, M; Rose, P; Rosendahl, P L; Rosenthal, O; Rossetti, V; Rossi, E; Rossi, L P; Rosten, R; Rotaru, M; Roth, I; Rothberg, J; Rousseau, D; Royon, C R; Rozanov, A; Rozen, Y; Ruan, X; Rubbo, F; Rubinskiy, I; Rud, V I; Rudolph, C; Rudolph, M S; Rühr, F; Ruiz-Martinez, A; Rurikova, Z; Rusakovich, N A; Ruschke, A; Rutherfoord, J P; Ruthmann, N; Ryabov, Y F; Rybar, M; Rybkin, G; Ryder, N C; Saavedra, A F; Sacerdoti, S; Saddique, A; Sadeh, I; Sadrozinski, H F-W; Sadykov, R; Safai Tehrani, F; Sakamoto, H; Sakurai, Y; Salamanna, G; Salamon, A; Saleem, M; Salek, D; Sales De Bruin, P H; Salihagic, D; Salnikov, A; Salt, J; Salvatore, D; Salvatore, F; Salvucci, A; Salzburger, A; Sampsonidis, D; Sanchez, A; Sánchez, J; Sanchez Martinez, V; Sandaker, H; Sandbach, R L; Sander, H G; Sanders, M P; Sandhoff, M; Sandoval, T; Sandoval, C; Sandstroem, R; Sankey, D P C; Sansoni, A; Santoni, C; Santonico, R; Santos, H; Santoyo Castillo, I; Sapp, K; Sapronov, A; Saraiva, J G; Sarrazin, B; Sartisohn, G; Sasaki, O; Sasaki, Y; Sauvage, G; Sauvan, E; Savard, P; Savu, D O; Sawyer, C; Sawyer, L; Saxon, D H; Saxon, J; Sbarra, C; Sbrizzi, A; Scanlon, T; Scannicchio, D A; Scarcella, M; Scarfone, V; Schaarschmidt, J; Schacht, P; Schaefer, D; Schaefer, R; Schaepe, S; Schaetzel, S; Schäfer, U; Schaffer, A C; Schaile, D; Schamberger, R D; Scharf, V; Schegelsky, V A; Scheirich, D; Schernau, M; Scherzer, M I; Schiavi, C; Schieck, J; Schillo, C; Schioppa, M; Schlenker, S; Schmidt, E; Schmieden, K; Schmitt, C; Schmitt, S; Schneider, B; Schnellbach, Y J; Schnoor, U; Schoeffel, L; Schoening, A; Schoenrock, B D; Schorlemmer, A L S; Schott, M; Schouten, D; Schovancova, J; Schramm, S; Schreyer, M; Schroeder, C; Schuh, N; Schultens, M J; Schultz-Coulon, H-C; Schulz, H; Schumacher, M; Schumm, B A; Schune, Ph; Schwanenberger, C; Schwartzman, A; Schwegler, Ph; Schwemling, Ph; Schwienhorst, R; Schwindling, J; Schwindt, T; Schwoerer, M; Sciacca, F G; Scifo, E; Sciolla, G; Scott, W G; Scuri, F; Scutti, F; Searcy, J; Sedov, G; Sedykh, E; Seidel, S C; Seiden, A; Seifert, F; Seixas, J M; Sekhniaidze, G; Sekula, S J; Selbach, K E; Seliverstov, D M; Sellers, G; Semprini-Cesari, N; Serfon, C; Serin, L; Serkin, L; Serre, T; Seuster, R; Severini, H; Sfiligoj, T; Sforza, F; Sfyrla, A; Shabalina, E; Shamim, M; Shan, L Y; Shang, R; Shank, J T; Shapiro, M; Shatalov, P B; Shaw, K; Shehu, C Y; Sherwood, P; Shi, L; Shimizu, S; Shimmin, C O; Shimojima, M; Shiyakova, M; Shmeleva, A; Shochet, M J; Short, D; Shrestha, S; Shulga, E; Shupe, M A; Shushkevich, S; Sicho, P; Sidiropoulou, O; Sidorov, D; Sidoti, A; Siegert, F; Sijacki, Dj; Silva, J; Silver, Y; Silverstein, D; Silverstein, S B; Simak, V; Simard, O; Simic, Lj; Simion, S; Simioni, E; Simmons, B; Simoniello, R; Simonyan, M; Sinervo, P; Sinev, N B; Sipica, V; Siragusa, G; Sircar, A; Sisakyan, A N; Sivoklokov, S Yu; Sjölin, J; Sjursen, T B; Skottowe, H P; Skovpen, K Yu; Skubic, P; Slater, M; Slavicek, T; Sliwa, K; Smakhtin, V; Smart, B H; Smestad, L; Smirnov, S Yu; Smirnov, Y; Smirnova, L N; Smirnova, O; Smith, K M; Smizanska, M; Smolek, K; Snesarev, A A; Snidero, G; Snyder, S; Sobie, R; Socher, F; Soffer, A; Soh, D A; Solans, C A; Solar, M; Solc, J; Soldatov, E Yu; Soldevila, U; Solodkov, A A; Soloshenko, A; Solovyanov, O V; Solovyev, V; Sommer, P; Song, H Y; Soni, N; Sood, A; Sopczak, A; Sopko, B; Sopko, V; Sorin, V; Sosebee, M; Soualah, R; Soueid, P; Soukharev, A M; South, D; Spagnolo, S; Spanò, F; Spearman, W R; Spettel, F; Spighi, R; Spigo, G; Spiller, L A; Spousta, M; Spreitzer, T; Spurlock, B; Denis, R D St; Staerz, S; Stahlman, J; Stamen, R; Stamm, S; Stanecka, E; Stanek, R W; Stanescu, C; Stanescu-Bellu, M; Stanitzki, M M; Stapnes, S; Starchenko, E A; Stark, J; Staroba, P; Starovoitov, P; Staszewski, R; Stavina, P; Steinberg, P; Stelzer, B; Stelzer, H J; Stelzer-Chilton, O; Stenzel, H; Stern, S; Stewart, G A; Stillings, J A; Stockton, M C; Stoebe, M; Stoicea, G; Stolte, P; Stonjek, S; Stradling, A R; Straessner, A; Stramaglia, M E; Strandberg, J; Strandberg, S; Strandlie, A; Strauss, E; Strauss, M; Strizenec, P; Ströhmer, R; Strom, D M; Stroynowski, R; Stucci, S A; Stugu, B; Styles, N A; Su, D; Su, J; Subramaniam, R; Succurro, A; Sugaya, Y; Suhr, C; Suk, M; Sulin, V V; Sultansoy, S; Sumida, T; Sun, S; Sun, X; Sundermann, J E; Suruliz, K; Susinno, G; Sutton, M R; Suzuki, Y; Svatos, M; Swedish, S; Swiatlowski, M; Sykora, I; Sykora, T; Ta, D; Taccini, C; Tackmann, K; Taenzer, J; Taffard, A; Tafirout, R; Taiblum, N; Takai, H; Takashima, R; Takeda, H; Takeshita, T; Takubo, Y; Talby, M; Talyshev, A A; Tam, J Y C; Tan, K G; Tanaka, J; Tanaka, R; Tanaka, S; Tanaka, S; Tanasijczuk, A J; Tannenwald, B B; Tannoury, N; Tapprogge, S; Tarem, S; Tarrade, F; Tartarelli, G F; Tas, P; Tasevsky, M; Tashiro, T; Tassi, E; Tavares Delgado, A; Tayalati, Y; Taylor, F E; Taylor, G N; Taylor, W; Teischinger, F A; Teixeira Dias Castanheira, M; Teixeira-Dias, P; Temming, K K; Ten Kate, H; Teng, P K; Teoh, J J; Terada, S; Terashi, K; Terron, J; Terzo, S; Testa, M; Teuscher, R J; Therhaag, J; Theveneaux-Pelzer, T; Thomas, J P; Thomas-Wilsker, J; Thompson, E N; Thompson, P D; Thompson, P D; Thompson, R J; Thompson, A S; Thomsen, L A; Thomson, E; Thomson, M; Thong, W M; Thun, R P; Tian, F; Tibbetts, M J; Tikhomirov, V O; Tikhonov, Yu A; Timoshenko, S; Tiouchichine, E; Tipton, P; Tisserant, S; Todorov, T; Todorova-Nova, S; Toggerson, B; Tojo, J; Tokár, S; Tokushuku, K; Tollefson, K; Tomlinson, L; Tomoto, M; Tompkins, L; Toms, K; Topilin, N D; Torrence, E; Torres, H; Torró Pastor, E; Toth, J; Touchard, F; Tovey, D R; Tran, H L; Trefzger, T; Tremblet, L; Tricoli, A; Trigger, I M; Trincaz-Duvoid, S; Tripiana, M F; Trischuk, W; Trocmé, B; Troncon, C; Trottier-McDonald, M; Trovatelli, M; True, P; Trzebinski, M; Trzupek, A; Tsarouchas, C; Tseng, J C-L; Tsiareshka, P V; Tsionou, D; Tsipolitis, G; Tsirintanis, N; Tsiskaridze, S; Tsiskaridze, V; Tskhadadze, E G; Tsukerman, I I; Tsulaia, V; Tsuno, S; Tsybychev, D; Tudorache, A; Tudorache, V; Tuna, A N; Tupputi, S A; Turchikhin, S; Turecek, D; Turk Cakir, I; Turra, R; Tuts, P M; Tykhonov, A; Tylmad, M; Tyndel, M; Uchida, K; Ueda, I; Ueno, R; Ughetto, M; Ugland, M; Uhlenbrock, M; Ukegawa, F; Unal, G; Undrus, A; Unel, G; Ungaro, F C; Unno, Y; Unverdorben, C; Urbaniec, D; Urquijo, P; Usai, G; Usanova, A; Vacavant, L; Vacek, V; Vachon, B; Valencic, N; Valentinetti, S; Valero, A; Valery, L; Valkar, S; Valladolid Gallego, E; Vallecorsa, S; Valls Ferrer, J A; Van Den Wollenberg, W; Van Der Deijl, P C; van der Geer, R; van der Graaf, H; Van Der Leeuw, R; van der Ster, D; van Eldik, N; van Gemmeren, P; Van Nieuwkoop, J; van Vulpen, I; van Woerden, M C; Vanadia, M; Vandelli, W; Vanguri, R; Vaniachine, A; Vankov, P; Vannucci, F; Vardanyan, G; Vari, R; Varnes, E W; Varol, T; Varouchas, D; Vartapetian, A; Varvell, K E; Vazeille, F; Vazquez Schroeder, T; Veatch, J; Veloso, F; Veneziano, S; Ventura, A; Ventura, D; Venturi, M; Venturi, N; Venturini, A; Vercesi, V; Verducci, M; Verkerke, W; Vermeulen, J C; Vest, A; Vetterli, M C; Viazlo, O; Vichou, I; Vickey, T; Vickey Boeriu, O E; Viehhauser, G H A; Viel, S; Vigne, R; Villa, M; Villaplana Perez, M; Vilucchi, E; Vincter, M G; Vinogradov, V B; Virzi, J; Vivarelli, I; Vives Vaque, F; Vlachos, S; Vladoiu, D; Vlasak, M; Vogel, A; Vogel, M; Vokac, P; Volpi, G; Volpi, M; von der Schmitt, H; von Radziewski, H; von Toerne, E; Vorobel, V; Vorobev, K; Vos, M; Voss, R; Vossebeld, J H; Vranjes, N; Vranjes Milosavljevic, M; Vrba, V; Vreeswijk, M; Vu Anh, T; Vuillermet, R; Vukotic, I; Vykydal, Z; Wagner, P; Wagner, W; Wahlberg, H; Wahrmund, S; Wakabayashi, J; Walder, J; Walker, R; Walkowiak, W; Wall, R; Waller, P; Walsh, B; Wang, C; Wang, C; Wang, F; Wang, H; Wang, H; Wang, J; Wang, J; Wang, K; Wang, R; Wang, S M; Wang, T; Wang, X; Wanotayaroj, C; Warburton, A; Ward, C P; Wardrope, D R; Warsinsky, M; Washbrook, A; Wasicki, C; Watkins, P M; Watson, A T; Watson, I J; Watson, M F; Watts, G; Watts, S; Waugh, B M; Webb, S; Weber, M S; Weber, S W; Webster, J S; Weidberg, A R; Weigell, P; Weinert, B; Weingarten, J; Weiser, C; Weits, H; Wells, P S; Wenaus, T; Wendland, D; Weng, Z; Wengler, T; Wenig, S; Wermes, N; Werner, M; Werner, P; Wessels, M; Wetter, J; Whalen, K; White, A; White, M J; White, R; White, S; Whiteson, D; Wicke, D; Wickens, F J; Wiedenmann, W; Wielers, M; Wienemann, P; Wiglesworth, C; Wiik-Fuchs, L A M; Wijeratne, P A; Wildauer, A; Wildt, M A; Wilkens, H G; Will, J Z; Williams, H H; Williams, S; Willis, C; Willocq, S; Wilson, A; Wilson, J A; Wingerter-Seez, I; Winklmeier, F; Winter, B T; Wittgen, M; Wittig, T; Wittkowski, J; Wollstadt, S J; Wolter, M W; Wolters, H; Wosiek, B K; Wotschack, J; Woudstra, M J; Wozniak, K W; Wright, M; Wu, M; Wu, S L; Wu, X; Wu, Y; Wulf, E; Wyatt, T R; Wynne, B M; Xella, S; Xiao, M; Xu, D; Xu, L; Yabsley, B; Yacoob, S; Yakabe, R; Yamada, M; Yamaguchi, H; Yamaguchi, Y; Yamamoto, A; Yamamoto, K; Yamamoto, S; Yamamura, T; Yamanaka, T; Yamauchi, K; Yamazaki, Y; Yan, Z; Yang, H; Yang, H; Yang, U K; Yang, Y; Yanush, S; Yao, L; Yao, W-M; Yasu, Y; Yatsenko, E; Yau Wong, K H; Ye, J; Ye, S; Yeletskikh, I; Yen, A L; Yildirim, E; Yilmaz, M; Yoosoofmiya, R; Yorita, K; Yoshida, R; Yoshihara, K; Young, C; Young, C J S; Youssef, S; Yu, D R; Yu, J; Yu, J M; Yu, J; Yuan, L; Yurkewicz, A; Yusuff, I; Zabinski, B; Zaidan, R; Zaitsev, A M; Zaman, A; Zambito, S; Zanello, L; Zanzi, D; Zeitnitz, C; Zeman, M; Zemla, A; Zengel, K; Zenin, O; Ženiš, T; Zerwas, D; Zevi Della Porta, G; Zhang, D; Zhang, F; Zhang, H; Zhang, J; Zhang, L; Zhang, X; Zhang, Z; Zhao, Z; Zhemchugov, A; Zhong, J; Zhou, B; Zhou, L; Zhou, N; Zhu, C G; Zhu, H; Zhu, J; Zhu, Y; Zhuang, X; Zhukov, K; Zibell, A; Zieminska, D; Zimine, N I; Zimmermann, C; Zimmermann, R; Zimmermann, S; Zimmermann, S; Zinonos, Z; Ziolkowski, M; Zobernig, G; Zoccoli, A; Zur Nedden, M; Zurzolo, G; Zutshi, V; Zwalinski, L

A measurement of [Formula: see text] boson production in lead-lead collisions at [Formula: see text] is presented. It is based on the analysis of data collected with the ATLAS detector at the LHC in 2011 corresponding to an integrated luminosity of 0.14 [Formula: see text] and 0.15 [Formula: see text] in the muon and electron decay channels, respectively. The differential production yields and lepton charge asymmetry are each measured as a function of the average number of participating nucleons [Formula: see text] and absolute pseudorapidity of the charged lepton. The results are compared to predictions based on next-to-leading-order QCD calculations. These measurements are, in principle, sensitive to possible nuclear modifications to the parton distribution functions and also provide information on scaling of [Formula: see text] boson production in multi-nucleon systems.

Growth of healthy term infants fed partially hydrolyzed whey-based infant formula: a randomized, blinded, controlled trial.

PubMed

Borschel, Marlene W; Choe, Yong S; Kajzer, Janice A

2014-12-01

Partially hydrolyzed formulas (pHF) represent a significant percentage of the infant formula market. A new whey-based, palm olein oil (PO)-free pHF was developed and a masked, randomized, parallel growth study was conducted in infants fed this formula or a commercially available whey-based pHF with PO. Infants between 0 and 8 days were to be enrolled and studied to 119 days of age. Growth and tolerance of infants were evaluated. Mean weight gain from 14 to 119 days of age was similar between groups. There were no significant differences between groups in weight, length, head circumference (HC), or length or HC gains. Infants fed the new PO-free pHF had significantly softer stools than those fed the PO-containing formula except at 119 days of age. This study demonstrates that whereas growth of infants fed different formulas during the first 4 months of life may be similar, infants may tolerate individual formulas differently. © The Author(s) 2014.

First Infant Formula Type and Risk of Islet Autoimmunity in The Environmental Determinants of Diabetes in the Young (TEDDY) Study

PubMed Central

Beyerlein, Andreas; Tamura, Roy; Uusitalo, Ulla; Andrén Aronsson, Carin; Yang, Jimin; Riikonen, Anne; Lernmark, Åke; Rewers, Marian J.; Hagopian, William A.; She, Jin-Xiong; Simell, Olli G.; Toppari, Jorma; Ziegler, Anette-G.; Akolkar, Beena; Krischer, Jeffrey P.; Virtanen, Suvi M.; Norris, Jill M.

2017-01-01

OBJECTIVE Studies on the introduction of infant formulas and its effect on the risk of islet autoimmunity and type 1 diabetes (T1D) have yielded inconsistent results. We investigated whether the introduction of formula based on hydrolyzed cow’s milk as the first formula is associated with reduced islet autoimmunity risk in a large prospective cohort. RESEARCH DESIGN AND METHODS The Environmental Determinants of Diabetes in the Young (TEDDY) study prospectively monitors 8,676 children at increased genetic risk for T1D. Autoantibodies to insulin, GAD65, and IA2 were measured regularly to define islet autoimmunity. Information on formula feeding was collected by questionnaires at 3 months of age. RESULTS In survival analyses, after adjustment for family history with T1D, HLA genotype, sex, country, delivery mode, breast-feeding ≥3 months, and seasonality of birth, we observed no significant association with islet autoimmunity in infants who received extensively hydrolyzed compared with nonhydrolyzed cow’s milk–based formula as the first formula during the first 3 months (adjusted hazard ratio 1.38 [95% CI 0.95; 2.01]), and a significantly increased risk for extensively hydrolyzed formula introduced during the first 7 days (adjusted hazard ratio 1.57 [1.04; 2.38]). Using a partially hydrolyzed or other formula as the first formula, or no formula, was not associated with islet autoimmunity risk. CONCLUSIONS These results add to the existing evidence that islet autoimmunity risk is not reduced, and may be increased, by using hydrolyzed compared with nonhydrolyzed cow’s milk–based infant formula as the first formula in infants at increased genetic risk for T1D. PMID:28096222

Assessment of Digoxin-Specific Fab Fragment Dosages in Digoxin Poisoning.

PubMed

Nordt, Sean Patrick; Clark, Richard F; Machado, Carol; Cantrell, F Lee

2016-01-01

Digoxin poisoning still remains a common cause of morbidity and mortality. Fortunately, digoxin-specific Fab fragments are commercially available as an antidote. However, these Fab fragments are several thousand dollars per vial. There is a standardized formula to calculate appropriate Fab fragment dosage based on the serum digoxin concentration. This can greatly reduce the amount of Fab fragment administered. There is also an empiric dosing guideline recommending 6-10 vials be given; however, this may result in higher amounts of Fab fragments being administered than required. We performed this study to assess the amounts of digoxin-specific Fab fragments administered in the treatment of digoxin poisonings recorded in a poison control system database from January 1, 2000, to December 31, 2009, in which digoxin serum concentrations were available. This was a retrospective study of 278 patients, 107 with acute poisonings (group A) and 171 following chronic poisoning (group B). In group A, the calculated Fab dose was higher than the calculated dose based on available concentrations in 39 (36%) of group A and 15 (9%) of group B patients. The average wholesale price cost of the excessive dosages ranged from $4818 to as high as $50,589 per patient. Our data suggests that clinician education on digoxin poisoning and the use of the standardized formula to calculate the Fab dose may decrease over utilization and decrease costs associated with the administration of digoxin-specific Fab fragments in the treatment of digoxin poisonings.

Climatic Forecasting of Net Infiltration at Yucca Mountain, Using Analogue Meteorological Data

NASA Astrophysics Data System (ADS)

Faybishenko, B.

2005-12-01

Net infiltration is a key hydrologic parameter that, throughout the unsaturated zone, controls the rate of deep percolation, the groundwater recharge, radionuclide transport, and seepage into underground tunnels. Because net infiltration is largely affected by climatic conditions, future changes in climatic conditions will potentially alter net infiltration. The objectives of this presentation are to: (1) Present a conceptual model and a semi-empirical approach for regional climatic forecasting of net infiltration, based on precipitation and temperature data from analogue meteorological stations; and (2) Demonstrate the results of forecasting net infiltration for future climates - interglacial, monsoon and glacial - over the Yucca Mountain region for a period of 500,000 years. Calculations of net infiltration were performed using a modified Budyko's water-balance model, and potential evapotranspiration was evaluated from the temperature-based Thornthwaite formula. (Both Budyko's and Thornthwaite's formulae have been used broadly in hydrological studies.) The results of these calculations were used for ranking net infiltration, along with aridity and precipitation-effectiveness (P-E) indices, for future climatic scenarios. Using this approach, we determined a general trend of increasing net infiltration from the present-day (interglacial) climate to the monsoon, intermediate (glacial transition) climate, a trend that continued into the glacial climate time frame. The ranking of aridity and P-E indices is practically the same as that for net infiltration. Validation of the computed net infiltration rates yielded a good match with other field and modeling study results related to groundwater recharge and net infiltration evaluation.

The differential production cross section of the [Formula: see text](1020) meson in [Formula: see text] = 7 TeV [Formula: see text] collisions measured with the ATLAS detector.

PubMed

Aad, G; Abajyan, T; Abbott, B; Abdallah, J; Abdel Khalek, S; Abdelalim, A A; Abdinov, O; Aben, R; Abi, B; Abolins, M; AbouZeid, O S; Abramowicz, H; Abreu, H; Acharya, B S; Adamczyk, L; Adams, D L; Addy, T N; Adelman, J; Adomeit, S; Adragna, P; Adye, T; Aefsky, S; Aguilar-Saavedra, J A; Agustoni, M; Aharrouche, M; Ahlen, S P; Ahles, F; Ahmad, A; Ahsan, M; Aielli, G; Åkesson, T P A; Akimoto, G; Akimov, A V; Alam, M S; Alam, M A; Albert, J; Albrand, S; Aleksa, M; Aleksandrov, I N; Alessandria, F; Alexa, C; Alexander, G; Alexandre, G; Alexopoulos, T; Alhroob, M; Aliev, M; Alimonti, G; Alison, J; Allbrooke, B M M; Allport, P P; Allwood-Spiers, S E; Almond, J; Aloisio, A; Alon, R; Alonso, A; Alonso, F; Altheimer, A; Alvarez Gonzalez, B; Alviggi, M G; Amako, K; Amelung, C; Ammosov, V V; Amor Dos Santos, S P; Amorim, A; Amram, N; Anastopoulos, C; Ancu, L S; Andari, N; Andeen, T; Anders, C F; Anders, G; Anderson, K J; Andreazza, A; Andrei, V; Andrieux, M-L; Anduaga, X S; Angelidakis, S; Anger, P; Angerami, A; Anghinolfi, F; Anisenkov, A; Anjos, N; Annovi, A; Antonaki, A; Antonelli, M; Antonov, A; Antos, J; Anulli, F; Aoki, M; Aoun, S; Aperio Bella, L; Apolle, R; Arabidze, G; Aracena, I; Arai, Y; Arce, A T H; Arfaoui, S; Arguin, J-F; Argyropoulos, S; Arik, E; Arik, M; Armbruster, A J; Arnaez, O; Arnal, V; Arnault, C; Artamonov, A; Artoni, G; Arutinov, D; Asai, S; Ask, S; Åsman, B; Asquith, L; Assamagan, K; Astbury, A; Atkinson, M; Aubert, B; Auge, E; Augsten, K; Aurousseau, M; Avolio, G; Avramidou, R; Axen, D; Azuelos, G; Azuma, Y; Baak, M A; Baccaglioni, G; Bacci, C; Bach, A M; Bachacou, H; Bachas, K; Backes, M; Backhaus, M; Backus Mayes, J; Badescu, E; Bagnaia, P; Bahinipati, S; Bai, Y; Bailey, D C; Bain, T; Baines, J T; Baker, O K; Baker, M D; Baker, S; Balek, P; Banas, E; Banerjee, P; Banerjee, Sw; Banfi, D; Bangert, A; Bansal, V; Bansil, H S; Barak, L; Baranov, S P; Barbaro Galtieri, A; Barber, T; Barberio, E L; Barberis, D; Barbero, M; Bardin, D Y; Barillari, T; Barisonzi, M; Barklow, T; Barlow, N; Barnett, B M; Barnett, R M; Baroncelli, A; Barone, G; Barr, A J; Barreiro, F; Barreiro Guimarães da Costa, J; Barrillon, P; Bartoldus, R; Barton, A E; Bartsch, V; Basye, A; Bates, R L; Batkova, L; Batley, J R; Battaglia, A; Battistin, M; Bauer, F; Bawa, H S; Beale, S; Beau, T; Beauchemin, P H; Beccherle, R; Bechtle, P; Beck, H P; Becker, A K; Becker, S; Beckingham, M; Becks, K H; Beddall, A J; Beddall, A; Bedikian, S; Bednyakov, V A; Bee, C P; Beemster, L J; Begel, M; Behar Harpaz, S; Behera, P K; Beimforde, M; Belanger-Champagne, C; Bell, P J; Bell, W H; Bella, G; Bellagamba, L; Bellomo, M; Belloni, A; Beloborodova, O; Belotskiy, K; Beltramello, O; Benary, O; Benchekroun, D; Bendtz, K; Benekos, N; Benhammou, Y; Benhar Noccioli, E; Benitez Garcia, J A; Benjamin, D P; Benoit, M; Bensinger, J R; Benslama, K; Bentvelsen, S; Berge, D; Bergeaas Kuutmann, E; Berger, N; Berghaus, F; Berglund, E; Beringer, J; Bernat, P; Bernhard, R; Bernius, C; Berry, T; Bertella, C; Bertin, A; Bertolucci, F; Besana, M I; Besjes, G J; Besson, N; Bethke, S; Bhimji, W; Bianchi, R M; Bianchini, L; Bianco, M; Biebel, O; Bieniek, S P; Bierwagen, K; Biesiada, J; Biglietti, M; Bilokon, H; Bindi, M; Binet, S; Bingul, A; Bini, C; Biscarat, C; Bittner, B; Black, C W; Black, K M; Blair, R E; Blanchard, J-B; Blanchot, G; Blazek, T; Bloch, I; Blocker, C; Blocki, J; Blondel, A; Blum, W; Blumenschein, U; Bobbink, G J; Bobrovnikov, V B; Bocchetta, S S; Bocci, A; Boddy, C R; Boehler, M; Boek, J; Boelaert, N; Bogaerts, J A; Bogdanchikov, A; Bogouch, A; Bohm, C; Bohm, J; Boisvert, V; Bold, T; Boldea, V; Bolnet, N M; Bomben, M; Bona, M; Boonekamp, M; Bordoni, S; Borer, C; Borisov, A; Borissov, G; Borjanovic, I; Borri, M; Borroni, S; Bortfeldt, J; Bortolotto, V; Bos, K; Boscherini, D; Bosman, M; Boterenbrood, H; Bouchami, J; Boudreau, J; Bouhova-Thacker, E V; Boumediene, D; Bourdarios, C; Bousson, N; Boveia, A; Boyd, J; Boyko, I R; Bozovic-Jelisavcic, I; Bracinik, J; Branchini, P; Brandt, A; Brandt, G; Brandt, O; Bratzler, U; Brau, B; Brau, J E; Braun, H M; Brazzale, S F; Brelier, B; Bremer, J; Brendlinger, K; Brenner, R; Bressler, S; Britton, D; Brochu, F M; Brock, I; Brock, R; Broggi, F; Bromberg, C; Bronner, J; Brooijmans, G; Brooks, T; Brooks, W K; Brown, G; Brown, H; Bruckman de Renstrom, P A; Bruncko, D; Bruneliere, R; Brunet, S; Bruni, A; Bruni, G; Bruschi, M; Buanes, T; Buat, Q; Bucci, F; Buchanan, J; Buchholz, P; Buckingham, R M; Buckley, A G; Buda, S I; Budagov, I A; Budick, B; Büscher, V; Bugge, L; Bulekov, O; Bundock, A C; Bunse, M; Buran, T; Burckhart, H; Burdin, S; Burgess, T; Burke, S; Busato, E; Bussey, P; Buszello, C P; Butler, B; Butler, J M; Buttar, C M; Butterworth, J M; Buttinger, W; Byszewski, M; Cabrera Urbán, S; Caforio, D; Cakir, O; Calafiura, P; Calderini, G; Calfayan, P; Calkins, R; Caloba, L P; Caloi, R; Calvet, D; Calvet, S; Camacho Toro, R; Camarri, P; Cameron, D; Caminada, L M; Caminal Armadans, R; Campana, S; Campanelli, M; Canale, V; Canelli, F; Canepa, A; Cantero, J; Cantrill, R; Capasso, L; Capeans Garrido, M D M; Caprini, I; Caprini, M; Capriotti, D; Capua, M; Caputo, R; Cardarelli, R; Carli, T; Carlino, G; Carminati, L; Caron, B; Caron, S; Carquin, E; Carrillo-Montoya, G D; Carter, A A; Carter, J R; Carvalho, J; Casadei, D; Casado, M P; Cascella, M; Caso, C; Castaneda Hernandez, A M; Castaneda-Miranda, E; Castillo Gimenez, V; Castro, N F; Cataldi, G; Catastini, P; Catinaccio, A; Catmore, J R; Cattai, A; Cattani, G; Caughron, S; Cavaliere, V; Cavalleri, P; Cavalli, D; Cavalli-Sforza, M; Cavasinni, V; Ceradini, F; Cerqueira, A S; Cerri, A; Cerrito, L; Cerutti, F; Cetin, S A; Chafaq, A; Chakraborty, D; Chalupkova, I; Chan, K; Chang, P; Chapleau, B; Chapman, J D; Chapman, J W; Chareyre, E; Charlton, D G; Chavda, V; Chavez Barajas, C A; Cheatham, S; Chekanov, S; Chekulaev, S V; Chelkov, G A; Chelstowska, M A; Chen, C; Chen, H; Chen, S; Chen, X; Chen, Y; Cheng, Y; Cheplakov, A; Cherkaoui El Moursli, R; Chernyatin, V; Cheu, E; Cheung, S L; Chevalier, L; Chiefari, G; Chikovani, L; Childers, J T; Chilingarov, A; Chiodini, G; Chisholm, A S; Chislett, R T; Chitan, A; Chizhov, M V; Choudalakis, G; Chouridou, S; Christidi, I A; Christov, A; Chromek-Burckhart, D; Chu, M L; Chudoba, J; Ciapetti, G; Ciftci, A K; Ciftci, R; Cinca, D; Cindro, V; Ciocca, C; Ciocio, A; Cirilli, M; Cirkovic, P; Citron, Z H; Citterio, M; Ciubancan, M; Clark, A; Clark, P J; Clarke, R N; Cleland, W; Clemens, J C; Clement, B; Clement, C; Coadou, Y; Cobal, M; Coccaro, A; Cochran, J; Coffey, L; Cogan, J G; Coggeshall, J; Cogneras, E; Colas, J; Cole, S; Colijn, A P; Collins, N J; Collins-Tooth, C; Collot, J; Colombo, T; Colon, G; Compostella, G; Conde Muiño, P; Coniavitis, E; Conidi, M C; Consonni, S M; Consorti, V; Constantinescu, S; Conta, C; Conti, G; Conventi, F; Cooke, M; Cooper, B D; Cooper-Sarkar, A M; Copic, K; Cornelissen, T; Corradi, M; Corriveau, F; Cortes-Gonzalez, A; Cortiana, G; Costa, G; Costa, M J; Costanzo, D; Côté, D; Courneyea, L; Cowan, G; Cowden, C; Cox, B E; Cranmer, K; Crescioli, F; Cristinziani, M; Crosetti, G; Crépé-Renaudin, S; Cuciuc, C-M; Cuenca Almenar, C; Cuhadar Donszelmann, T; Cummings, J; Curatolo, M; Curtis, C J; Cuthbert, C; Cwetanski, P; Czirr, H; Czodrowski, P; Czyczula, Z; D'Auria, S; D'Onofrio, M; D'Orazio, A; Da Cunha Sargedas De Sousa, M J; Da Via, C; Dabrowski, W; Dafinca, A; Dai, T; Dallapiccola, C; Dam, M; Dameri, M; Damiani, D S; Danielsson, H O; Dao, V; Darbo, G; Darlea, G L; Dassoulas, J A; Davey, W; Davidek, T; Davidson, N; Davidson, R; Davies, E; Davies, M; Davignon, O; Davison, A R; Davygora, Y; Dawe, E; Dawson, I; Daya-Ishmukhametova, R K; De, K; de Asmundis, R; De Castro, S; De Cecco, S; de Graat, J; De Groot, N; de Jong, P; De La Taille, C; De la Torre, H; De Lorenzi, F; de Mora, L; De Nooij, L; De Pedis, D; De Salvo, A; De Sanctis, U; De Santo, A; De Vivie De Regie, J B; De Zorzi, G; Dearnaley, W J; Debbe, R; Debenedetti, C; Dechenaux, B; Dedovich, D V; Degenhardt, J; Del Peso, J; Del Prete, T; Delemontex, T; Deliyergiyev, M; Dell'Acqua, A; Dell'Asta, L; Della Pietra, M; Della Volpe, D; Delmastro, M; Delsart, P A; Deluca, C; Demers, S; Demichev, M; Demirkoz, B; Denisov, S P; Derendarz, D; Derkaoui, J E; Derue, F; Dervan, P; Desch, K; Devetak, E; Deviveiros, P O; Dewhurst, A; DeWilde, B; Dhaliwal, S; Dhullipudi, R; Di Ciaccio, A; Di Ciaccio, L; Di Donato, C; Di Girolamo, A; Di Girolamo, B; Di Luise, S; Di Mattia, A; Di Micco, B; Di Nardo, R; Di Simone, A; Di Sipio, R; Diaz, M A; Diehl, E B; Dietrich, J; Dietzsch, T A; Diglio, S; Dindar Yagci, K; Dingfelder, J; Dinut, F; Dionisi, C; Dita, P; Dita, S; Dittus, F; Djama, F; Djobava, T; do Vale, M A B; Do Valle Wemans, A; Doan, T K O; Dobbs, M; Dobos, D; Dobson, E; Dodd, J; Doglioni, C; Doherty, T; Doi, Y; Dolejsi, J; Dolenc, I; Dolezal, Z; Dolgoshein, B A; Dohmae, T; Donadelli, M; Donini, J; Dopke, J; Doria, A; Dos Anjos, A; Dotti, A; Dova, M T; Doxiadis, A D; Doyle, A T; Dressnandt, N; Dris, M; Dubbert, J; Dube, S; Duchovni, E; Duckeck, G; Duda, D; Dudarev, A; Dudziak, F; Dührssen, M; Duerdoth, I P; Duflot, L; Dufour, M-A; Duguid, L; Dunford, M; Duran Yildiz, H; Duxfield, R; Dwuznik, M; Düren, M; Ebenstein, W L; Ebke, J; Eckweiler, S; Edmonds, K; Edson, W; Edwards, C A; Edwards, N C; Ehrenfeld, W; Eifert, T; Eigen, G; Einsweiler, K; Eisenhandler, E; Ekelof, T; El Kacimi, M; Ellert, M; Elles, S; Ellinghaus, F; Ellis, K; Ellis, N; Elmsheuser, J; Elsing, M; Emeliyanov, D; Engelmann, R; Engl, A; Epp, B; Erdmann, J; Ereditato, A; Eriksson, D; Ernst, J; Ernst, M; Ernwein, J; Errede, D; Errede, S; Ertel, E; Escalier, M; Esch, H; Escobar, C; Espinal Curull, X; Esposito, B; Etienne, F; Etienvre, A I; Etzion, E; Evangelakou, D; Evans, H; Fabbri, L; Fabre, C; Fakhrutdinov, R M; Falciano, S; Fang, Y; Fanti, M; Farbin, A; Farilla, A; Farley, J; Farooque, T; Farrell, S; Farrington, S M; Farthouat, P; Fassi, F; Fassnacht, P; Fassouliotis, D; Fatholahzadeh, B; Favareto, A; Fayard, L; Fazio, S; Febbraro, R; Federic, P; Fedin, O L; Fedorko, W; Fehling-Kaschek, M; Feligioni, L; Feng, C; Feng, E J; Fenyuk, A B; Ferencei, J; Fernando, W; Ferrag, S; Ferrando, J; Ferrara, V; Ferrari, A; Ferrari, P; Ferrari, R; Ferreira de Lima, D E; Ferrer, A; Ferrere, D; Ferretti, C; Ferretto Parodi, A; Fiascaris, M; Fiedler, F; Filipčič, A; Filthaut, F; Fincke-Keeler, M; Fiolhais, M C N; Fiorini, L; Firan, A; Fischer, G; Fisher, M J; Flechl, M; Fleck, I; Fleckner, J; Fleischmann, P; Fleischmann, S; Flick, T; Floderus, A; Flores Castillo, L R; Flowerdew, M J; Fonseca Martin, T; Formica, A; Forti, A; Fortin, D; Fournier, D; Fowler, A J; Fox, H; Francavilla, P; Franchini, M; Franchino, S; Francis, D; Frank, T; Franklin, M; Franz, S; Fraternali, M; Fratina, S; French, S T; Friedrich, C; Friedrich, F; Froeschl, R; Froidevaux, D; Frost, J A; Fukunaga, C; Fullana Torregrosa, E; Fulsom, B G; Fuster, J; Gabaldon, C; Gabizon, O; Gadfort, T; Gadomski, S; Gagliardi, G; Gagnon, P; Galea, C; Galhardo, B; Gallas, E J; Gallo, V; Gallop, B J; Gallus, P; Gan, K K; Gao, Y S; Gaponenko, A; Garberson, F; Garcia-Sciveres, M; García, C; García Navarro, J E; Gardner, R W; Garelli, N; Garitaonandia, H; Garonne, V; Gatti, C; Gaudio, G; Gaur, B; Gauthier, L; Gauzzi, P; Gavrilenko, I L; Gay, C; Gaycken, G; Gazis, E N; Ge, P; Gecse, Z; Gee, C N P; Geerts, D A A; Geich-Gimbel, Ch; Gellerstedt, K; Gemme, C; Gemmell, A; Genest, M H; Gentile, S; George, M; George, S; Gerlach, P; Gershon, A; Geweniger, C; Ghazlane, H; Ghodbane, N; Giacobbe, B; Giagu, S; Giakoumopoulou, V; Giangiobbe, V; Gianotti, F; Gibbard, B; Gibson, A; Gibson, S M; Gilchriese, M; Gillberg, D; Gillman, A R; Gingrich, D M; Ginzburg, J; Giokaris, N; Giordani, M P; Giordano, R; Giorgi, F M; Giovannini, P; Giraud, P F; Giugni, D; Giunta, M; Gjelsten, B K; Gladilin, L K; Glasman, C; Glatzer, J; Glazov, A; Glitza, K W; Glonti, G L; Goddard, J R; Godfrey, J; Godlewski, J; Goebel, M; Göpfert, T; Goeringer, C; Gössling, C; Goldfarb, S; Golling, T; Gomes, A; Gomez Fajardo, L S; Gonçalo, R; Goncalves Pinto Firmino Da Costa, J; Gonella, L; González de la Hoz, S; Gonzalez Parra, G; Gonzalez Silva, M L; Gonzalez-Sevilla, S; Goodson, J J; Goossens, L; Gorbounov, P A; Gordon, H A; Gorelov, I; Gorfine, G; Gorini, B; Gorini, E; Gorišek, A; Gornicki, E; Goshaw, A T; Gosselink, M; Gostkin, M I; Gough Eschrich, I; Gouighri, M; Goujdami, D; Goulette, M P; Goussiou, A G; Goy, C; Gozpinar, S; Grabowska-Bold, I; Grafström, P; Grahn, K-J; Gramstad, E; Grancagnolo, F; Grancagnolo, S; Grassi, V; Gratchev, V; Grau, N; Gray, H M; Gray, J A; Graziani, E; Grebenyuk, O G; Greenshaw, T; Greenwood, Z D; Gregersen, K; Gregor, I M; Grenier, P; Griffiths, J; Grigalashvili, N; Grillo, A A; Grinstein, S; Gris, Ph; Grishkevich, Y V; Grivaz, J-F; Gross, E; Grosse-Knetter, J; Groth-Jensen, J; Grybel, K; Guest, D; Guicheney, C; Guido, E; Guindon, S; Gul, U; Gunther, J; Guo, B; Guo, J; Gutierrez, P; Guttman, N; Gutzwiller, O; Guyot, C; Gwenlan, C; Gwilliam, C B; Haas, A; Haas, S; Haber, C; Hadavand, H K; Hadley, D R; Haefner, P; Hahn, F; Hajduk, Z; Hakobyan, H; Hall, D; Hamacher, K; Hamal, P; Hamano, K; Hamer, M; Hamilton, A; Hamilton, S; Han, L; Hanagaki, K; Hanawa, K; Hance, M; Handel, C; Hanke, P; Hansen, J R; Hansen, J B; Hansen, J D; Hansen, P H; Hansson, P; Hara, K; Harenberg, T; Harkusha, S; Harper, D; Harrington, R D; Harris, O M; Hartert, J; Hartjes, F; Haruyama, T; Harvey, A; Hasegawa, S; Hasegawa, Y; Hassani, S; Haug, S; Hauschild, M; Hauser, R; Havranek, M; Hawkes, C M; Hawkings, R J; Hawkins, A D; Hayakawa, T; Hayashi, T; Hayden, D; Hays, C P; Hayward, H S; Haywood, S J; Head, S J; Hedberg, V; Heelan, L; Heim, S; Heinemann, B; Heisterkamp, S; Helary, L; Heller, C; Heller, M; Hellman, S; Hellmich, D; Helsens, C; Henderson, R C W; Henke, M; Henrichs, A; Henriques Correia, A M; Henrot-Versille, S; Hensel, C; Henß, T; Hernandez, C M; Hernández Jiménez, Y; Herrberg, R; Herten, G; Hertenberger, R; Hervas, L; Hesketh, G G; Hessey, N P; Higón-Rodriguez, E; Hill, J C; Hiller, K H; Hillert, S; Hillier, S J; Hinchliffe, I; Hines, E; Hirose, M; Hirsch, F; Hirschbuehl, D; Hobbs, J; Hod, N; Hodgkinson, M C; Hodgson, P; Hoecker, A; Hoeferkamp, M R; Hoffman, J; Hoffmann, D; Hohlfeld, M; Holder, M; Holmgren, S O; Holy, T; Holzbauer, J L; Hong, T M; Hooft van Huysduynen, L; Horner, S; Hostachy, J-Y; Hou, S; Hoummada, A; Howard, J; Howarth, J; Hristova, I; Hrivnac, J; Hryn'ova, T; Hsu, P J; Hsu, S-C; Hu, D; Hubacek, Z; Hubaut, F; Huegging, F; Huettmann, A; Huffman, T B; Hughes, E W; Hughes, G; Huhtinen, M; Hurwitz, M; Huseynov, N; Huston, J; Huth, J; Iacobucci, G; Iakovidis, G; Ibbotson, M; Ibragimov, I; Iconomidou-Fayard, L; Idarraga, J; Iengo, P; Igonkina, O; Ikegami, Y; Ikeno, M; Iliadis, D; Ilic, N; Ince, T; Ioannou, P; Iodice, M; Iordanidou, K; Ippolito, V; Irles Quiles, A; Isaksson, C; Ishino, M; Ishitsuka, M; Ishmukhametov, R; Issever, C; Istin, S; Ivashin, A V; Iwanski, W; Iwasaki, H; Izen, J M; Izzo, V; Jackson, B; Jackson, J N; Jackson, P; Jaekel, M R; Jain, V; Jakobs, K; Jakobsen, S; Jakoubek, T; Jakubek, J; Jamin, D O; Jana, D K; Jansen, E; Jansen, H; Janssen, J; Jantsch, A; Janus, M; Jared, R C; Jarlskog, G; Jeanty, L; Jen-La Plante, I; Jennens, D; Jenni, P; Loevschall-Jensen, A E; Jež, P; Jézéquel, S; Jha, M K; Ji, H; Ji, W; Jia, J; Jiang, Y; Jimenez Belenguer, M; Jin, S; Jinnouchi, O; Joergensen, M D; Joffe, D; Johansen, M; Johansson, K E; Johansson, P; Johnert, S; Johns, K A; Jon-And, K; Jones, G; Jones, R W L; Jones, T J; Joram, C; Jorge, P M; Joshi, K D; Jovicevic, J; Jovin, T; Ju, X; Jung, C A; Jungst, R M; Juranek, V; Jussel, P; Juste Rozas, A; Kabana, S; Kaci, M; Kaczmarska, A; Kadlecik, P; Kado, M; Kagan, H; Kagan, M; Kajomovitz, E; Kalinin, S; Kalinovskaya, L V; Kama, S; Kanaya, N; Kaneda, M; Kaneti, S; Kanno, T; Kantserov, V A; Kanzaki, J; Kaplan, B; Kapliy, A; Kaplon, J; Kar, D; Karagounis, M; Karakostas, K; Karnevskiy, M; Kartvelishvili, V; Karyukhin, A N; Kashif, L; Kasieczka, G; Kass, R D; Kastanas, A; Kataoka, M; Kataoka, Y; Katsoufis, E; Katzy, J; Kaushik, V; Kawagoe, K; Kawamoto, T; Kawamura, G; Kayl, M S; Kazama, S; Kazanin, V A; Kazarinov, M Y; Keeler, R; Keener, P T; Kehoe, R; Keil, M; Kekelidze, G D; Keller, J S; Kenyon, M; Kepka, O; Kerschen, N; Kerševan, B P; Kersten, S; Kessoku, K; Keung, J; Khalil-Zada, F; Khandanyan, H; Khanov, A; Kharchenko, D; Khodinov, A; Khomich, A; Khoo, T J; Khoriauli, G; Khoroshilov, A; Khovanskiy, V; Khramov, E; Khubua, J; Kim, H; Kim, S H; Kimura, N; Kind, O; King, B T; King, M; King, R S B; Kirk, J; Kiryunin, A E; Kishimoto, T; Kisielewska, D; Kitamura, T; Kittelmann, T; Kiuchi, K; Kladiva, E; Klein, M; Klein, U; Kleinknecht, K; Klemetti, M; Klier, A; Klimek, P; Klimentov, A; Klingenberg, R; Klinger, J A; Klinkby, E B; Klioutchnikova, T; Klok, P F; Klous, S; Kluge, E-E; Kluge, T; Kluit, P; Kluth, S; Kneringer, E; Knoops, E B F G; Knue, A; Ko, B R; Kobayashi, T; Kobel, M; Kocian, M; Kodys, P; Köneke, K; König, A C; Koenig, S; Köpke, L; Koetsveld, F; Koevesarki, P; Koffas, T; Koffeman, E; Kogan, L A; Kohlmann, S; Kohn, F; Kohout, Z; Kohriki, T; Koi, T; Kolachev, G M; Kolanoski, H; Kolesnikov, V; Koletsou, I; Koll, J; Komar, A A; Komori, Y; Kondo, T; Kono, T; Kononov, A I; Konoplich, R; Konstantinidis, N; Kopeliansky, R; Koperny, S; Korcyl, K; Kordas, K; Korn, A; Korol, A; Korolkov, I; Korolkova, E V; Korotkov, V A; Kortner, O; Kortner, S; Kostyukhin, V V; Kotov, S; Kotov, V M; Kotwal, A; Kourkoumelis, C; Kouskoura, V; Koutsman, A; Kowalewski, R; Kowalski, T Z; Kozanecki, W; Kozhin, A S; Kral, V; Kramarenko, V A; Kramberger, G; Krasny, M W; Krasznahorkay, A; Kraus, J K; Kreiss, S; Krejci, F; Kretzschmar, J; Krieger, N; Krieger, P; Kroeninger, K; Kroha, H; Kroll, J; Kroseberg, J; Krstic, J; Kruchonak, U; Krüger, H; Kruker, T; Krumnack, N; Krumshteyn, Z V; Kruse, M K; Kubota, T; Kuday, S; Kuehn, S; Kugel, A; Kuhl, T; Kuhn, D; Kukhtin, V; Kulchitsky, Y; Kuleshov, S; Kummer, C; Kuna, M; Kunkle, J; Kupco, A; Kurashige, H; Kurata, M; Kurochkin, Y A; Kus, V; Kuwertz, E S; Kuze, M; Kvita, J; Kwee, R; La Rosa, A; La Rotonda, L; Labarga, L; Labbe, J; Lablak, S; Lacasta, C; Lacava, F; Lacey, J; Lacker, H; Lacour, D; Lacuesta, V R; Ladygin, E; Lafaye, R; Laforge, B; Lagouri, T; Lai, S; Laisne, E; Lambourne, L; Lampen, C L; Lampl, W; Lancon, E; Landgraf, U; Landon, M P J; Lang, V S; Lange, C; Lankford, A J; Lanni, F; Lantzsch, K; Laplace, S; Lapoire, C; Laporte, J F; Lari, T; Larner, A; Lassnig, M; Laurelli, P; Lavorini, V; Lavrijsen, W; Laycock, P; Le Dortz, O; Le Guirriec, E; Le Menedeu, E; LeCompte, T; Ledroit-Guillon, F; Lee, H; Lee, J S H; Lee, S C; Lee, L; Lefebvre, M; Legendre, M; Legger, F; Leggett, C; Lehmacher, M; Lehmann Miotto, G; Leister, A G; Leite, M A L; Leitner, R; Lellouch, D; Lemmer, B; Lendermann, V; Leney, K J C; Lenz, T; Lenzen, G; Lenzi, B; Leonhardt, K; Leontsinis, S; Lepold, F; Leroy, C; Lessard, J-R; Lester, C G; Lester, C M; Levêque, J; Levin, D; Levinson, L J; Lewis, A; Lewis, G H; Leyko, A M; Leyton, M; Li, B; Li, B; Li, H; Li, H L; Li, S; Li, X; Liang, Z; Liao, H; Liberti, B; Lichard, P; Lichtnecker, M; Lie, K; Liebig, W; Limbach, C; Limosani, A; Limper, M; Lin, S C; Linde, F; Linnemann, J T; Lipeles, E; Lipniacka, A; Liss, T M; Lissauer, D; Lister, A; Litke, A M; Liu, C; Liu, D; Liu, H; Liu, J B; Liu, L; Liu, M; Liu, Y; Livan, M; Livermore, S S A; Lleres, A; Llorente Merino, J; Lloyd, S L; Lobodzinska, E; Loch, P; Lockman, W S; Loddenkoetter, T; Loebinger, F K; Loginov, A; Loh, C W; Lohse, T; Lohwasser, K; Lokajicek, M; Lombardo, V P; Long, R E; Lopes, L; Lopez Mateos, D; Lorenz, J; Lorenzo Martinez, N; Losada, M; Loscutoff, P; Lo Sterzo, F; Losty, M J; Lou, X; Lounis, A; Loureiro, K F; Love, J; Love, P A; Lowe, A J; Lu, F; Lubatti, H J; Luci, C; Lucotte, A; Ludwig, A; Ludwig, D; Ludwig, I; Ludwig, J; Luehring, F; Luijckx, G; Lukas, W; Luminari, L; Lund, E; Lund-Jensen, B; Lundberg, B; Lundberg, J; Lundberg, O; Lundquist, J; Lungwitz, M; Lynn, D; Lytken, E; Ma, H; Ma, L L; Maccarrone, G; Macchiolo, A; Maček, B; Machado Miguens, J; Macina, D; Mackeprang, R; Madaras, R J; Maddocks, H J; Mader, W F; Maenner, R; Maeno, T; Mättig, P; Mättig, S; Magnoni, L; Magradze, E; Mahboubi, K; Mahlstedt, J; Mahmoud, S; Mahout, G; Maiani, C; Maidantchik, C; Maio, A; Majewski, S; Makida, Y; Makovec, N; Mal, P; Malaescu, B; Malecki, Pa; Malecki, P; Maleev, V P; Malek, F; Mallik, U; Malon, D; Malone, C; Maltezos, S; Malyshev, V; Malyukov, S; Mameghani, R; Mamuzic, J; Manabe, A; Mandelli, L; Mandić, I; Mandrysch, R; Maneira, J; Manfredini, A; Manhaes de Andrade Filho, L; Manjarres Ramos, J A; Mann, A; Manning, P M; Manousakis-Katsikakis, A; Mansoulie, B; Mapelli, A; Mapelli, L; March, L; Marchand, J F; Marchese, F; Marchiori, G; Marcisovsky, M; Marino, C P; Marroquim, F; Marshall, Z; Marti, L F; Marti-Garcia, S; Martin, B; Martin, B; Martin, J P; Martin, T A; Martin, V J; Martin Dit Latour, B; Martin-Haugh, S; Martinez, M; Martinez Outschoorn, V; Martyniuk, A C; Marx, M; Marzano, F; Marzin, A; Masetti, L; Mashimo, T; Mashinistov, R; Masik, J; Maslennikov, A L; Massa, I; Massaro, G; Massol, N; Mastrandrea, P; Mastroberardino, A; Masubuchi, T; Matricon, P; Matsunaga, H; Matsushita, T; Mattravers, C; Maurer, J; Maxfield, S J; Maximov, D A; Mayne, A; Mazini, R; Mazur, M; Mazzaferro, L; Mazzanti, M; Mc Donald, J; Mc Kee, S P; McCarn, A; McCarthy, R L; McCarthy, T G; McCubbin, N A; McFarlane, K W; Mcfayden, J A; Mchedlidze, G; Mclaughlan, T; McMahon, S J; McPherson, R A; Meade, A; Mechnich, J; Mechtel, M; Medinnis, M; Meehan, S; Meera-Lebbai, R; Meguro, T; Mehlhase, S; Mehta, A; Meier, K; Meirose, B; Melachrinos, C; Mellado Garcia, B R; Meloni, F; Mendoza Navas, L; Meng, Z; Mengarelli, A; Menke, S; Meoni, E; Mercurio, K M; Mermod, P; Merola, L; Meroni, C; Merritt, F S; Merritt, H; Messina, A; Metcalfe, J; Mete, A S; Meyer, C; Meyer, C; Meyer, J-P; Meyer, J; Meyer, J; Michal, S; Micu, L; Middleton, R P; Migas, S; Mijović, L; Mikenberg, G; Mikestikova, M; Mikuž, M; Miller, D W; Miller, R J; Mills, W J; Mills, C; Milov, A; Milstead, D A; Milstein, D; Minaenko, A A; Miñano Moya, M; Minashvili, I A; Mincer, A I; Mindur, B; Mineev, M; Ming, Y; Mir, L M; Mirabelli, G; Mitrevski, J; Mitsou, V A; Mitsui, S; Miyagawa, P S; Mjörnmark, J U; Moa, T; Moeller, V; Mönig, K; Möser, N; Mohapatra, S; Mohr, W; Moles-Valls, R; Molfetas, A; Monk, J; Monnier, E; Montejo Berlingen, J; Monticelli, F; Monzani, S; Moore, R W; Moorhead, G F; Mora Herrera, C; Moraes, A; Morange, N; Morel, J; Morello, G; Moreno, D; Moreno Llácer, M; Morettini, P; Morgenstern, M; Morii, M; Morley, A K; Mornacchi, G; Morris, J D; Morvaj, L; Moser, H G; Mosidze, M; Moss, J; Mount, R; Mountricha, E; Mouraviev, S V; Moyse, E J W; Mueller, F; Mueller, J; Mueller, K; Müller, T A; Mueller, T; Muenstermann, D; Munwes, Y; Murray, W J; Mussche, I; Musto, E; Myagkov, A G; Myska, M; Nackenhorst, O; Nadal, J; Nagai, K; Nagai, R; Nagano, K; Nagarkar, A; Nagasaka, Y; Nagel, M; Nairz, A M; Nakahama, Y; Nakamura, K; Nakamura, T; Nakano, I; Nanava, G; Napier, A; Narayan, R; Nash, M; Nattermann, T; Naumann, T; Navarro, G; Neal, H A; Nechaeva, P Yu; Neep, T J; Negri, A; Negri, G; Negrini, M; Nektarijevic, S; Nelson, A; Nelson, T K; Nemecek, S; Nemethy, P; Nepomuceno, A A; Nessi, M; Neubauer, M S; Neumann, M; Neusiedl, A; Neves, R M; Nevski, P; Newcomer, F M; Newman, P R; Nguyen Thi Hong, V; Nickerson, R B; Nicolaidou, R; Nicquevert, B; Niedercorn, F; Nielsen, J; Nikiforou, N; Nikiforov, A; Nikolaenko, V; Nikolic-Audit, I; Nikolics, K; Nikolopoulos, K; Nilsen, H; Nilsson, P; Ninomiya, Y; Nisati, A; Nisius, R; Nobe, T; Nodulman, L; Nomachi, M; Nomidis, I; Norberg, S; Nordberg, M; Norton, P R; Novakova, J; Nozaki, M; Nozka, L; Nugent, I M; Nuncio-Quiroz, A-E; Nunes Hanninger, G; Nunnemann, T; Nurse, E; O'Brien, B J; O'Neil, D C; O'Shea, V; Oakes, L B; Oakham, F G; Oberlack, H; Ocariz, J; Ochi, A; Oda, S; Odaka, S; Odier, J; Ogren, H; Oh, A; Oh, S H; Ohm, C C; Ohshima, T; Okamura, W; Okawa, H; Okumura, Y; Okuyama, T; Olariu, A; Olchevski, A G; Olivares Pino, S A; Oliveira, M; Oliveira Damazio, D; Oliver Garcia, E; Olivito, D; Olszewski, A; Olszowska, J; Onofre, A; Onyisi, P U E; Oram, C J; Oreglia, M J; Oren, Y; Orestano, D; Orlando, N; Orlov, I; Oropeza Barrera, C; Orr, R S; Osculati, B; Ospanov, R; Osuna, C; Otero Y Garzon, G; Ottersbach, J P; Ouchrif, M; Ouellette, E A; Ould-Saada, F; Ouraou, A; Ouyang, Q; Ovcharova, A; Owen, M; Owen, S; Ozcan, V E; Ozturk, N; Pacheco Pages, A; Padilla Aranda, C; Pagan Griso, S; Paganis, E; Pahl, C; Paige, F; Pais, P; Pajchel, K; Palacino, G; Paleari, C P; Palestini, S; Pallin, D; Palma, A; Palmer, J D; Pan, Y B; Panagiotopoulou, E; Panduro Vazquez, J G; Pani, P; Panikashvili, N; Panitkin, S; Pantea, D; Papadelis, A; Papadopoulou, Th D; Paramonov, A; Paredes Hernandez, D; Park, W; Parker, M A; Parodi, F; Parsons, J A; Parzefall, U; Pashapour, S; Pasqualucci, E; Passaggio, S; Passeri, A; Pastore, F; Pastore, Fr; Pásztor, G; Pataraia, S; Patel, N; Pater, J R; Patricelli, S; Pauly, T; Pecsy, M; Pedraza Lopez, S; Pedraza Morales, M I; Peleganchuk, S V; Pelikan, D; Peng, H; Penning, B; Penson, A; Penwell, J; Perantoni, M; Perez, K; Perez Cavalcanti, T; Perez Codina, E; Pérez García-Estañ, M T; Perez Reale, V; Perini, L; Pernegger, H; Perrino, R; Perrodo, P; Peshekhonov, V D; Peters, K; Petersen, B A; Petersen, J; Petersen, T C; Petit, E; Petridis, A; Petridou, C; Petrolo, E; Petrucci, F; Petschull, D; Petteni, M; Pezoa, R; Phan, A; Phillips, P W; Piacquadio, G; Picazio, A; Piccaro, E; Piccinini, M; Piec, S M; Piegaia, R; Pignotti, D T; Pilcher, J E; Pilkington, A D; Pina, J; Pinamonti, M; Pinder, A; Pinfold, J L; Pinto, B; Pizio, C; Plamondon, M; Pleier, M-A; Plotnikova, E; Poblaguev, A; Poddar, S; Podlyski, F; Poggioli, L; Pohl, D; Pohl, M; Polesello, G; Policicchio, A; Polini, A; Poll, J; Polychronakos, V; Pomeroy, D; Pommès, K; Pontecorvo, L; Pope, B G; Popeneciu, G A; Popovic, D S; Poppleton, A; Portell Bueso, X; Pospelov, G E; Pospisil, S; Potrap, I N; Potter, C J; Potter, C T; Poulard, G; Poveda, J; Pozdnyakov, V; Prabhu, R; Pralavorio, P; Pranko, A; Prasad, S; Pravahan, R; Prell, S; Pretzl, K; Price, D; Price, J; Price, L E; Prieur, D; Primavera, M; Prokofiev, K; Prokoshin, F; Protopopescu, S; Proudfoot, J; Prudent, X; Przybycien, M; Przysiezniak, H; Psoroulas, S; Ptacek, E; Pueschel, E; Purdham, J; Purohit, M; Puzo, P; Pylypchenko, Y; Qian, J; Quadt, A; Quarrie, D R; Quayle, W B; Quinonez, F; Raas, M; Radeka, V; Radescu, V; Radloff, P; Ragusa, F; Rahal, G; Rahimi, A M; Rahm, D; Rajagopalan, S; Rammensee, M; Rammes, M; Randle-Conde, A S; Randrianarivony, K; Rauscher, F; Rave, T C; Raymond, M; Read, A L; Rebuzzi, D M; Redelbach, A; Redlinger, G; Reece, R; Reeves, K; Reinsch, A; Reisinger, I; Rembser, C; Ren, Z L; Renaud, A; Rescigno, M; Resconi, S; Resende, B; Reznicek, P; Rezvani, R; Richter, R; Richter-Was, E; Ridel, M; Rijpstra, M; Rijssenbeek, M; Rimoldi, A; Rinaldi, L; Rios, R R; Riu, I; Rivoltella, G; Rizatdinova, F; Rizvi, E; Robertson, S H; Robichaud-Veronneau, A; Robinson, D; Robinson, J E M; Robson, A; Rocha de Lima, J G; Roda, C; Roda Dos Santos, D; Roe, A; Roe, S; Røhne, O; Rolli, S; Romaniouk, A; Romano, M; Romeo, G; Romero Adam, E; Rompotis, N; Roos, L; Ros, E; Rosati, S; Rosbach, K; Rose, A; Rose, M; Rosenbaum, G A; Rosenberg, E I; Rosendahl, P L; Rosenthal, O; Rosselet, L; Rossetti, V; Rossi, E; Rossi, L P; Rotaru, M; Roth, I; Rothberg, J; Rousseau, D; Royon, C R; Rozanov, A; Rozen, Y; Ruan, X; Rubbo, F; Rubinskiy, I; Ruckstuhl, N; Rud, V I; Rudolph, C; Rudolph, G; Rühr, F; Ruiz-Martinez, A; Rumyantsev, L; Rurikova, Z; Rusakovich, N A; Ruschke, A; Rutherfoord, J P; Ruzicka, P; Ryabov, Y F; Rybar, M; Rybkin, G; Ryder, N C; Saavedra, A F; Sadeh, I; Sadrozinski, H F-W; Sadykov, R; Safai Tehrani, F; Sakamoto, H; Salamanna, G; Salamon, A; Saleem, M; Salek, D; Salihagic, D; Salnikov, A; Salt, J; Salvachua Ferrando, B M; Salvatore, D; Salvatore, F; Salvucci, A; Salzburger, A; Sampsonidis, D; Samset, B H; Sanchez, A; Sanchez Martinez, V; Sandaker, H; Sander, H G; Sanders, M P; Sandhoff, M; Sandoval, T; Sandoval, C; Sandstroem, R; Sankey, D P C; Sansoni, A; Santamarina Rios, C; Santoni, C; Santonico, R; Santos, H; Santoyo Castillo, I; Saraiva, J G; Sarangi, T; Sarkisyan-Grinbaum, E; Sarri, F; Sartisohn, G; Sasaki, O; Sasaki, Y; Sasao, N; Satsounkevitch, I; Sauvage, G; Sauvan, E; Sauvan, J B; Savard, P; Savinov, V; Savu, D O; Sawyer, L; Saxon, D H; Saxon, J; Sbarra, C; Sbrizzi, A; Scannicchio, D A; Scarcella, M; Schaarschmidt, J; Schacht, P; Schaefer, D; Schäfer, U; Schaelicke, A; Schaepe, S; Schaetzel, S; Schaffer, A C; Schaile, D; Schamberger, R D; Schamov, A G; Scharf, V; Schegelsky, V A; Scheirich, D; Schernau, M; Scherzer, M I; Schiavi, C; Schieck, J; Schioppa, M; Schlenker, S; Schmidt, E; Schmieden, K; Schmitt, C; Schmitt, S; Schneider, B; Schnoor, U; Schoeffel, L; Schoening, A; Schorlemmer, A L S; Schott, M; Schouten, D; Schovancova, J; Schram, M; Schroeder, C; Schroer, N; Schultens, M J; Schultes, J; Schultz-Coulon, H-C; Schulz, H; Schumacher, M; Schumm, B A; Schune, Ph; Schwanenberger, C; Schwartzman, A; Schwegler, Ph; Schwemling, Ph; Schwienhorst, R; Schwierz, R; Schwindling, J; Schwindt, T; Schwoerer, M; Sciacca, F G; Sciolla, G; Scott, W G; Searcy, J; Sedov, G; Sedykh, E; Seidel, S C; Seiden, A; Seifert, F; Seixas, J M; Sekhniaidze, G; Sekula, S J; Selbach, K E; Seliverstov, D M; Sellden, B; Sellers, G; Seman, M; Semprini-Cesari, N; Serfon, C; Serin, L; Serkin, L; Seuster, R; Severini, H; Sfyrla, A; Shabalina, E; Shamim, M; Shan, L Y; Shank, J T; Shao, Q T; Shapiro, M; Shatalov, P B; Shaw, K; Sherman, D; Sherwood, P; Shimizu, S; Shimojima, M; Shin, T; Shiyakova, M; Shmeleva, A; Shochet, M J; Short, D; Shrestha, S; Shulga, E; Shupe, M A; Sicho, P; Sidoti, A; Siegert, F; Sijacki, Dj; Silbert, O; Silva, J; Silver, Y; Silverstein, D; Silverstein, S B; Simak, V; Simard, O; Simic, Lj; Simion, S; Simioni, E; Simmons, B; Simoniello, R; Simonyan, M; Sinervo, P; Sinev, N B; Sipica, V; Siragusa, G; Sircar, A; Sisakyan, A N; Sivoklokov, S Yu; Sjölin, J; Sjursen, T B; Skinnari, L A; Skottowe, H P; Skovpen, K; Skubic, P; Slater, M; Slavicek, T; Sliwa, K; Smakhtin, V; Smart, B H; Smestad, L; Smirnov, S Yu; Smirnov, Y; Smirnova, L N; Smirnova, O; Smith, B C; Smith, D; Smith, K M; Smizanska, M; Smolek, K; Snesarev, A A; Snow, S W; Snow, J; Snyder, S; Sobie, R; Sodomka, J; Soffer, A; Solans, C A; Solar, M; Solc, J; Soldatov, E Yu; Soldevila, U; Solfaroli Camillocci, E; Solodkov, A A; Solovyanov, O V; Solovyev, V; Soni, N; Sopko, V; Sopko, B; Sosebee, M; Soualah, R; Soukharev, A; Spagnolo, S; Spanò, F; Spighi, R; Spigo, G; Spiwoks, R; Spousta, M; Spreitzer, T; Spurlock, B; St Denis, R D; Stahlman, J; Stamen, R; Stanecka, E; Stanek, R W; Stanescu, C; Stanescu-Bellu, M; Stanitzki, M M; Stapnes, S; Starchenko, E A; Stark, J; Staroba, P; Starovoitov, P; Staszewski, R; Staude, A; Stavina, P; Steele, G; Steinbach, P; Steinberg, P; Stekl, I; Stelzer, B; Stelzer, H J; Stelzer-Chilton, O; Stenzel, H; Stern, S; Stewart, G A; Stillings, J A; Stockton, M C; Stoerig, K; Stoicea, G; Stonjek, S; Strachota, P; Stradling, A R; Straessner, A; Strandberg, J; Strandberg, S; Strandlie, A; Strang, M; Strauss, E; Strauss, M; Strizenec, P; Ströhmer, R; Strom, D M; Strong, J A; Stroynowski, R; Stugu, B; Stumer, I; Stupak, J; Sturm, P; Styles, N A; Soh, D A; Su, D; Subramania, H S; Subramaniam, R; Succurro, A; Sugaya, Y; Suhr, C; Suk, M; Sulin, V V; Sultansoy, S; Sumida, T; Sun, X; Sundermann, J E; Suruliz, K; Susinno, G; Sutton, M R; Suzuki, Y; Suzuki, Y; Svatos, M; Swedish, S; Sykora, I; Sykora, T; Sánchez, J; Ta, D; Tackmann, K; Taffard, A; Tafirout, R; Taiblum, N; Takahashi, Y; Takai, H; Takashima, R; Takeda, H; Takeshita, T; Takubo, Y; Talby, M; Talyshev, A; Tamsett, M C; Tan, K G; Tanaka, J; Tanaka, R; Tanaka, S; Tanaka, S; Tanasijczuk, A J; Tani, K; Tannoury, N; Tapprogge, S; Tardif, D; Tarem, S; Tarrade, F; Tartarelli, G F; Tas, P; Tasevsky, M; Tassi, E; Tayalati, Y; Taylor, C; Taylor, F E; Taylor, G N; Taylor, W; Teinturier, M; Teischinger, F A; Teixeira Dias Castanheira, M; Teixeira-Dias, P; Temming, K K; Ten Kate, H; Teng, P K; Terada, S; Terashi, K; Terron, J; Testa, M; Teuscher, R J; Therhaag, J; Theveneaux-Pelzer, T; Thoma, S; Thomas, J P; Thompson, E N; Thompson, P D; Thompson, P D; Thompson, A S; Thomsen, L A; Thomson, E; Thomson, M; Thong, W M; Thun, R P; Tian, F; Tibbetts, M J; Tic, T; Tikhomirov, V O; Tikhonov, Y A; Timoshenko, S; Tiouchichine, E; Tipton, P; Tisserant, S; Todorov, T; Todorova-Nova, S; Toggerson, B; Tojo, J; Tokár, S; Tokushuku, K; Tollefson, K; Tomoto, M; Tompkins, L; Toms, K; Tonoyan, A; Topfel, C; Topilin, N D; Torrence, E; Torres, H; Torró Pastor, E; Toth, J; Touchard, F; Tovey, D R; Trefzger, T; Tremblet, L; Tricoli, A; Trigger, I M; Trincaz-Duvoid, S; Tripiana, M F; Triplett, N; Trischuk, W; Trocmé, B; Troncon, C; Trottier-McDonald, M; True, P; Trzebinski, M; Trzupek, A; Tsarouchas, C; Tseng, J C-L; Tsiakiris, M; Tsiareshka, P V; Tsionou, D; Tsipolitis, G; Tsiskaridze, S; Tsiskaridze, V; Tskhadadze, E G; Tsukerman, I I; Tsulaia, V; Tsung, J-W; Tsuno, S; Tsybychev, D; Tua, A; Tudorache, A; Tudorache, V; Tuggle, J M; Turala, M; Turecek, D; Turk Cakir, I; Turlay, E; Turra, R; Tuts, P M; Tykhonov, A; Tylmad, M; Tyndel, M; Tzanakos, G; Uchida, K; Ueda, I; Ueno, R; Ugland, M; Uhlenbrock, M; Uhrmacher, M; Ukegawa, F; Unal, G; Undrus, A; Unel, G; Unno, Y; Urbaniec, D; Urquijo, P; Usai, G; Uslenghi, M; Vacavant, L; Vacek, V; Vachon, B; Vahsen, S; Valenta, J; Valentinetti, S; Valero, A; Valkar, S; Valladolid Gallego, E; Vallecorsa, S; Valls Ferrer, J A; Van Berg, R; Van Der Deijl, P C; van der Geer, R; van der Graaf, H; Van Der Leeuw, R; van der Poel, E; van der Ster, D; van Eldik, N; van Gemmeren, P; van Vulpen, I; Vanadia, M; Vandelli, W; Vaniachine, A; Vankov, P; Vannucci, F; Vari, R; Varnes, E W; Varol, T; Varouchas, D; Vartapetian, A; Varvell, K E; Vassilakopoulos, V I; Vazeille, F; Vazquez Schroeder, T; Vegni, G; Veillet, J J; Veloso, F; Veness, R; Veneziano, S; Ventura, A; Ventura, D; Venturi, M; Venturi, N; Vercesi, V; Verducci, M; Verkerke, W; Vermeulen, J C; Vest, A; Vetterli, M C; Vichou, I; Vickey, T; Vickey Boeriu, O E; Viehhauser, G H A; Viel, S; Villa, M; Villaplana Perez, M; Vilucchi, E; Vincter, M G; Vinek, E; Vinogradov, V B; Virchaux, M; Virzi, J; Vitells, O; Viti, M; Vivarelli, I; Vives Vaque, F; Vlachos, S; Vladoiu, D; Vlasak, M; Vogel, A; Vokac, P; Volpi, G; Volpi, M; Volpini, G; von der Schmitt, H; von Radziewski, H; von Toerne, E; Vorobel, V; Vorwerk, V; Vos, M; Voss, R; Voss, T T; Vossebeld, J H; Vranjes, N; Vranjes Milosavljevic, M; Vrba, V; Vreeswijk, M; Vu Anh, T; Vuillermet, R; Vukotic, I; Wagner, W; Wagner, P; Wahlen, H; Wahrmund, S; Wakabayashi, J; Walch, S; Walder, J; Walker, R; Walkowiak, W; Wall, R; Waller, P; Walsh, B; Wang, C; Wang, H; Wang, H; Wang, J; Wang, J; Wang, R; Wang, S M; Wang, T; Warburton, A; Ward, C P; Wardrope, D R; Warsinsky, M; Washbrook, A; Wasicki, C; Watanabe, I; Watkins, P M; Watson, A T; Watson, I J; Watson, M F; Watts, G; Watts, S; Waugh, A T; Waugh, B M; Weber, M S; Webster, J S; Weidberg, A R; Weigell, P; Weingarten, J; Weiser, C; Wells, P S; Wenaus, T; Wendland, D; Weng, Z; Wengler, T; Wenig, S; Wermes, N; Werner, M; Werner, P; Werth, M; Wessels, M; Wetter, J; Weydert, C; Whalen, K; White, A; White, M J; White, S; Whitehead, S R; Whiteson, D; Whittington, D; Wicek, F; Wicke, D; Wickens, F J; Wiedenmann, W; Wielers, M; Wienemann, P; Wiglesworth, C; Wiik-Fuchs, L A M; Wijeratne, P A; Wildauer, A; Wildt, M A; Wilhelm, I; Wilkens, H G; Will, J Z; Williams, E; Williams, H H; Willis, W; Willocq, S; Wilson, J A; Wilson, M G; Wilson, A; Wingerter-Seez, I; Winkelmann, S; Winklmeier, F; Wittgen, M; Wollstadt, S J; Wolter, M W; Wolters, H; Wong, W C; Wooden, G; Wosiek, B K; Wotschack, J; Woudstra, M J; Wozniak, K W; Wraight, K; Wright, M; Wrona, B; Wu, S L; Wu, X; Wu, Y; Wulf, E; Wynne, B M; Xella, S; Xiao, M; Xie, S; Xu, C; Xu, D; Xu, L; Yabsley, B; Yacoob, S; Yamada, M; Yamaguchi, H; Yamamoto, A; Yamamoto, K; Yamamoto, S; Yamamura, T; Yamanaka, T; Yamazaki, T; Yamazaki, Y; Yan, Z; Yang, H; Yang, U K; Yang, Y; Yang, Z; Yanush, S; Yao, L; Yao, Y; Yasu, Y; Ybeles Smit, G V; Ye, J; Ye, S; Yilmaz, M; Yoosoofmiya, R; Yorita, K; Yoshida, R; Yoshihara, K; Young, C; Young, C J; Youssef, S; Yu, D; Yu, J; Yu, J; Yuan, L; Yurkewicz, A; Zabinski, B; Zaidan, R; Zaitsev, A M; Zajacova, Z; Zanello, L; Zanzi, D; Zaytsev, A; Zeitnitz, C; Zeman, M; Zemla, A; Zendler, C; Zenin, O; Ženiš, T; Zinonos, Z; Zerwas, D; Zevi Della Porta, G; Zhang, D; Zhang, H; Zhang, J; Zhang, X; Zhang, Z; Zhao, L; Zhao, Z; Zhemchugov, A; Zhong, J; Zhou, B; Zhou, N; Zhou, Y; Zhu, C G; Zhu, H; Zhu, J; Zhu, Y; Zhuang, X; Zhuravlov, V; Zibell, A; Zieminska, D; Zimin, N I; Zimmermann, R; Zimmermann, S; Zimmermann, S; Ziolkowski, M; Zitoun, R; Živković, L; Zmouchko, V V; Zobernig, G; Zoccoli, A; Zur Nedden, M; Zutshi, V; Zwalinski, L

A measurement is presented of the [Formula: see text] production cross section at [Formula: see text] = 7 TeV using [Formula: see text] collision data corresponding to an integrated luminosity of 383 [Formula: see text], collected with the ATLAS experiment at the LHC. Selection of [Formula: see text](1020) mesons is based on the identification of charged kaons by their energy loss in the pixel detector. The differential cross section is measured as a function of the transverse momentum, [Formula: see text], and rapidity, [Formula: see text], of the [Formula: see text](1020) meson in the fiducial region 500 [Formula: see text] 1200 MeV, [Formula: see text] 0.8, kaon [Formula: see text] 230 MeV and kaon momentum [Formula: see text] 800 MeV. The integrated [Formula: see text]-meson production cross section in this fiducial range is measured to be [Formula: see text] = 570 [Formula: see text] 8 (stat) [Formula: see text] 66 (syst) [Formula: see text] 20 (lumi) [Formula: see text].

A Nonlinear Super-Exponential Rational Model of Speculative Financial Bubbles

NASA Astrophysics Data System (ADS)

Sornette, D.; Andersen, J. V.

Keeping a basic tenet of economic theory, rational expectations, we model the nonlinear positive feedback between agents in the stock market as an interplay between nonlinearity and multiplicative noise. The derived hyperbolic stochastic finite-time singularity formula transforms a Gaussian white noise into a rich time series possessing all the stylized facts of empirical prices, as well as accelerated speculative bubbles preceding crashes. We use the formula to invert the two years of price history prior to the recent crash on the Nasdaq (April 2000) and prior to the crash in the Hong Kong market associated with the Asian crisis in early 1994. These complex price dynamics are captured using only one exponent controlling the explosion, the variance and mean of the underlying random walk. This offers a new and powerful detection tool of speculative bubbles and herding behavior.

Objective approach for analysis of noise source characteristics and acoustic conditions in noisy computerized embroidery workrooms.

PubMed

Aliabadi, Mohsen; Golmohammadi, Rostam; Mansoorizadeh, Muharram

2014-03-01

It is highly important to analyze the acoustic properties of workrooms in order to identify best noise control measures from the standpoint of noise exposure limits. Due to the fact that sound pressure is dependent upon environments, it cannot be a suitable parameter for determining the share of workroom acoustic characteristics in producing noise pollution. This paper aims to empirically analyze noise source characteristics and acoustic properties of noisy embroidery workrooms based on special parameters. In this regard, reverberation time as the special room acoustic parameter in 30 workrooms was measured based on ISO 3382-2. Sound power quantity of embroidery machines was also determined based on ISO 9614-3. Multiple linear regression was employed for predicting reverberation time based on acoustic features of the workrooms using MATLAB software. The results showed that the measured reverberation times in most of the workrooms were approximately within the ranges recommended by ISO 11690-1. Similarity between reverberation time values calculated by the Sabine formula and measured values was relatively poor (R (2) = 0.39). This can be due to the inaccurate estimation of the acoustic influence of furniture and formula preconditions. Therefore, this value cannot be considered representative of an actual acoustic room. However, the prediction performance of the regression method with root mean square error (RMSE) = 0.23 s and R (2) = 0.69 is relatively acceptable. Because the sound power of the embroidery machines was relatively high, these sources get the highest priority when it comes to applying noise controls. Finally, an objective approach for the determination of the share of workroom acoustic characteristics in producing noise could facilitate the identification of cost-effective noise controls.

Time-of-Flight Measurements on TlBr Detectors

NASA Astrophysics Data System (ADS)

Suzuki, K.; Shorohov, M.; Sawada, T.; Seto, S.

2015-04-01

Carrier transport properties of TlBr crystals grown using the Bridgman method were investigated by the time-of-flight technique. The electron and hole mobilities were measured as 20 - 27 cm2 /Vs and 1.0 - 2.0 cm2/Vs respectively at room temperature. The temperature dependence of the electron mobility increases with decreasing temperature as approximated by a well-known empirical formula reflecting the reciprocal of the LO-phonon density.

Content, Social, and Metacognitive Statements: An Empirical Study Comparing Human-Human and Human-Computer Tutorial Dialogue

DTIC Science & Technology

2010-01-01

for each participant using the formula gain = ( posttest − pretest )/(1− pretest ). 6.2 Content-Learning Correlations The summary of language statistics...differences also affect which factors are correlated with learning gain and user satisfaction. We argue that ITS designers should pay particular...factors are correlated with learning gain and user satisfaction. We argue that ITS designers should pay particular attention to strategies for dealing

An Empirical Approach to Analysis of Similarities between Software Failure Regions

DTIC Science & Technology

1991-09-01

cycle costs after the soft- ware has been marketed (Alberts, 1976). 1 Unfortunately, extensive software testing is frequently necessary in spite of...incidence is primarily syntactic. This mixing of semantic and syntactic forms in the same analysis could lead to some distortion, especially since the...of formulae to improve readability or to indicate precedence of operations. * All defintions within ’Condition I’ of a failure region are assumed to

Coupling characteristics of the spun optical fiber with triple stress elements

NASA Astrophysics Data System (ADS)

Ji, Minning; Shang, Fengtao; Chen, Dandan

2018-06-01

An empirical formula related to the stress field distribution in the optical fiber with triple stress elements is proposed and proved. The possible intercoupling between the fundamental modes and the higher order modes is demonstrated. The transmission property of the spun optical fiber with triple stress elements is analyzed. The experimental data from a sample of the spun optical fiber with triple stress elements confirm the theoretical results very well.

Characterization of Transfluthrin Emissions Over Time in an Enclosed Space Over a Range of Discreet Temperatures

DTIC Science & Technology

2014-05-14

Transfluthrin I Permethrin DDT I Empirical C1sH12ClzF402C74J T, C21H20Clz03CBOJ ·1 C14H9ClsC72J DEET l Formula ! I 1 Molecular , 371.2(74) I 391.3(53...oil lamp to vaporize transfluthrin. Medical and veterinary entomology 16:277-84 65. Pesticide Target Interaction Database. 2012. Transfluthrin

Interval Predictor Models with a Formal Characterization of Uncertainty and Reliability

NASA Technical Reports Server (NTRS)

Crespo, Luis G.; Giesy, Daniel P.; Kenny, Sean P.

2014-01-01

This paper develops techniques for constructing empirical predictor models based on observations. By contrast to standard models, which yield a single predicted output at each value of the model's inputs, Interval Predictors Models (IPM) yield an interval into which the unobserved output is predicted to fall. The IPMs proposed prescribe the output as an interval valued function of the model's inputs, render a formal description of both the uncertainty in the model's parameters and of the spread in the predicted output. Uncertainty is prescribed as a hyper-rectangular set in the space of model's parameters. The propagation of this set through the empirical model yields a range of outputs of minimal spread containing all (or, depending on the formulation, most) of the observations. Optimization-based strategies for calculating IPMs and eliminating the effects of outliers are proposed. Outliers are identified by evaluating the extent by which they degrade the tightness of the prediction. This evaluation can be carried out while the IPM is calculated. When the data satisfies mild stochastic assumptions, and the optimization program used for calculating the IPM is convex (or, when its solution coincides with the solution to an auxiliary convex program), the model's reliability (that is, the probability that a future observation would be within the predicted range of outputs) can be bounded rigorously by a non-asymptotic formula.

[Effect of feeding methods in infants on serum lipid profile].

PubMed

Maślanka, R; Siemianowicz, K; Stajszczyk, M; Wojakowski, W

1995-07-01

Mothers very often do not start to breast feed their children, or stop very quickly and introduce various formulas based either on modified or unmodified cow's milk. These infant formulas differ from human milk in their chemical composition. Breast milk is the most suitable source of all nutrients required for the development of a newborn or infant. The serum levels of total cholesterol, HDL-cholesterol, LDL-cholesterol, triglycerides and phospholipids were determined. The influence of the type of feeding on the levels of the above-mentioned lipids was analyzed. Higher serum levels of triglycerides in babies fed formulas based on modified cow's milk than in those fed formulas based on unmodified milk were found. Higher serum levels of phospholipids were found in breast-fed babies than in those fed formulas based on unmodified cow's milk.

Optimal classification for the diagnosis of duchenne muscular dystrophy images using support vector machines.

PubMed

Zhang, Ming-Huan; Ma, Jun-Shan; Shen, Ying; Chen, Ying

2016-09-01

This study aimed to investigate the optimal support vector machines (SVM)-based classifier of duchenne muscular dystrophy (DMD) magnetic resonance imaging (MRI) images. T1-weighted (T1W) and T2-weighted (T2W) images of the 15 boys with DMD and 15 normal controls were obtained. Textural features of the images were extracted and wavelet decomposed, and then, principal features were selected. Scale transform was then performed for MRI images. Afterward, SVM-based classifiers of MRI images were analyzed based on the radical basis function and decomposition levels. The cost (C) parameter and kernel parameter [Formula: see text] were used for classification. Then, the optimal SVM-based classifier, expressed as [Formula: see text]), was identified by performance evaluation (sensitivity, specificity and accuracy). Eight of 12 textural features were selected as principal features (eigenvalues [Formula: see text]). The 16 SVM-based classifiers were obtained using combination of (C, [Formula: see text]), and those with lower C and [Formula: see text] values showed higher performances, especially classifier of [Formula: see text]). The SVM-based classifiers of T1W images showed higher performance than T1W images at the same decomposition level. The T1W images in classifier of [Formula: see text]) at level 2 decomposition showed the highest performance of all, and its overall correct sensitivity, specificity, and accuracy reached 96.9, 97.3, and 97.1 %, respectively. The T1W images in SVM-based classifier [Formula: see text] at level 2 decomposition showed the highest performance of all, demonstrating that it was the optimal classification for the diagnosis of DMD.

Learning Chinese Formulaic Expressions in a Scenario-Based Interactive Environment

ERIC Educational Resources Information Center

Taguchi, Naoko; Li, Qiong; Tang, Xiaofei

2017-01-01

This study examined the effectiveness and usability of a scenario-based interactive practice in teaching Chinese formulaic expressions. Thirty students enrolled in Chinese classes in a U.S. university interacted with characters in videos featuring scenes recorded in Shanghai. Students were prompted to use formulaic expressions during their…

Barycentric parameterizations for isotropic BRDFs.

PubMed

Stark, Michael M; Arvo, James; Smits, Brian

2005-01-01

A bidirectional reflectance distribution function (BRDF) is often expressed as a function of four real variables: two spherical coordinates in each of the the "incoming" and "outgoing" directions. However, many BRDFs reduce to functions of fewer variables. For example, isotropic reflection can be represented by a function of three variables. Some BRDF models can be reduced further. In this paper, we introduce new sets of coordinates which we use to reduce the dimensionality of several well-known analytic BRDFs as well as empirically measured BRDF data. The proposed coordinate systems are barycentric with respect to a triangular support with a direct physical interpretation. One coordinate set is based on the BRDF model proposed by Lafortune. Another set, based on a model of Ward, is associated with the "halfway" vector common in analytical BRDF formulas. Through these coordinate sets we establish lower bounds on the approximation error inherent in the models on which they are based. We present a third set of coordinates, not based on any analytical model, that performs well in approximating measured data. Finally, our proposed variables suggest novel ways of constructing and visualizing BRDFs.

Measurement of quarkonium production at forward rapidity in [Formula: see text] collisions at [Formula: see text]TeV.

PubMed

Abelev, B; Adam, J; Adamová, D; Aggarwal, M M; Agnello, M; Agostinelli, A; Agrawal, N; Ahammed, Z; Ahmad, N; Ahmad Masoodi, A; Ahmed, I; Ahn, S U; Ahn, S A; Aimo, I; Aiola, S; Ajaz, M; Akindinov, A; Aleksandrov, D; Alessandro, B; Alexandre, D; Alici, A; Alkin, A; Alme, J; Alt, T; Altini, V; Altinpinar, S; Altsybeev, I; Alves Garcia Prado, C; Andrei, C; Andronic, A; Anguelov, V; Anielski, J; Antičić, T; Antinori, F; Antonioli, P; Aphecetche, L; Appelshäuser, H; Arbor, N; Arcelli, S; Armesto, N; Arnaldi, R; Aronsson, T; Arsene, I C; Arslandok, M; Augustinus, A; Averbeck, R; Awes, T C; Azmi, M D; Bach, M; Badalà, A; Baek, Y W; Bagnasco, S; Bailhache, R; Bala, R; Baldisseri, A; Baltasar Dos Santos Pedrosa, F; Baral, R C; Barbera, R; Barile, F; Barnaföldi, G G; Barnby, L S; Barret, V; Bartke, J; Basile, M; Bastid, N; Basu, S; Bathen, B; Batigne, G; Batyunya, B; Batzing, P C; Baumann, C; Bearden, I G; Beck, H; Bedda, C; Behera, N K; Belikov, I; Bellini, F; Bellwied, R; Belmont-Moreno, E; Bencedi, G; Beole, S; Berceanu, I; Bercuci, A; Berdnikov, Y; Berenyi, D; Bertens, R A; Berzano, D; Betev, L; Bhasin, A; Bhat, I R; Bhati, A K; Bhattacharjee, B; Bhom, J; Bianchi, L; Bianchi, N; Bianchin, C; Bielčík, J; Bielčíková, J; Bilandzic, A; Bjelogrlic, S; Blanco, F; Blau, D; Blume, C; Bock, F; Bogdanov, A; Bøggild, H; Bogolyubsky, M; Boldizsár, L; Bombara, M; Book, J; Borel, H; Borissov, A; Bossú, F; Botje, M; Botta, E; Böttger, S; Braun-Munzinger, P; Bregant, M; Breitner, T; Broker, T A; Browning, T A; Broz, M; Bruna, E; Bruno, G E; Budnikov, D; Buesching, H; Bufalino, S; Buncic, P; Busch, O; Buthelezi, Z; Caffarri, D; Cai, X; Caines, H; Caliva, A; Calvo Villar, E; Camerini, P; Carena, F; Carena, W; Castillo Castellanos, J; Casula, E A R; Catanescu, V; Cavicchioli, C; Ceballos Sanchez, C; Cepila, J; Cerello, P; Chang, B; Chapeland, S; Charvet, J L; Chattopadhyay, S; Chattopadhyay, S; Chelnokov, V; Cherney, M; Cheshkov, C; Cheynis, B; Chibante Barroso, V; Chinellato, D D; Chochula, P; Chojnacki, M; Choudhury, S; Christakoglou, P; Christensen, C H; Christiansen, P; Chujo, T; Chung, S U; Cicalo, C; Cifarelli, L; Cindolo, F; Cleymans, J; Colamaria, F; Colella, D; Collu, A; Colocci, M; Conesa Balbastre, G; Conesa Del Valle, Z; Connors, M E; Contreras, J G; Cormier, T M; Corrales Morales, Y; Cortese, P; Cortés Maldonado, I; Cosentino, M R; Costa, F; Crochet, P; Cruz Albino, R; Cuautle, E; Cunqueiro, L; Dainese, A; Dang, R; Danu, A; Das, D; Das, I; Das, K; Das, S; Dash, A; Dash, S; De, S; Delagrange, H; Deloff, A; Dénes, E; D'Erasmo, G; De Caro, A; de Cataldo, G; de Cuveland, J; De Falco, A; De Gruttola, D; De Marco, N; De Pasquale, S; de Rooij, R; Diaz Corchero, M A; Dietel, T; Divià, R; Di Bari, D; Di Liberto, S; Di Mauro, A; Di Nezza, P; Djuvsland, Ø; Dobrin, A; Dobrowolski, T; Domenicis Gimenez, D; Dönigus, B; Dordic, O; Dubey, A K; Dubla, A; Ducroux, L; Dupieux, P; Dutta Majumdar, A K; Ehlers, R J; Elia, D; Engel, H; Erazmus, B; Erdal, H A; Eschweiler, D; Espagnon, B; Esposito, M; Estienne, M; Esumi, S; Evans, D; Evdokimov, S; Fabris, D; Faivre, J; Falchieri, D; Fantoni, A; Fasel, M; Fehlker, D; Feldkamp, L; Felea, D; Feliciello, A; Feofilov, G; Ferencei, J; Fernández Téllez, A; Ferreiro, E G; Ferretti, A; Festanti, A; Figiel, J; Figueredo, M A S; Filchagin, S; Finogeev, D; Fionda, F M; Fiore, E M; Floratos, E; Floris, M; Foertsch, S; Foka, P; Fokin, S; Fragiacomo, E; Francescon, A; Frankenfeld, U; Fuchs, U; Furget, C; Fusco Girard, M; Gaardhøje, J J; Gagliardi, M; Gago, A M; Gallio, M; Gangadharan, D R; Ganoti, P; Garabatos, C; Garcia-Solis, E; Gargiulo, C; Garishvili, I; Gerhard, J; Germain, M; Gheata, A; Gheata, M; Ghidini, B; Ghosh, P; Ghosh, S K; Gianotti, P; Giubellino, P; Gladysz-Dziadus, E; Glässel, P; Gomez Ramirez, A; González-Zamora, P; Gorbunov, S; Görlich, L; Gotovac, S; Graczykowski, L K; Grelli, A; Grigoras, A; Grigoras, C; Grigoriev, V; Grigoryan, A; Grigoryan, S; Grinyov, B; Grion, N; Grosse-Oetringhaus, J F; Grossiord, J-Y; Grosso, R; Guber, F; Guernane, R; Guerzoni, B; Guilbaud, M; Gulbrandsen, K; Gulkanyan, H; Gunji, T; Gupta, A; Gupta, R; Khan, K H; Haake, R; Haaland, Ø; Hadjidakis, C; Haiduc, M; Hamagaki, H; Hamar, G; Hanratty, L D; Hansen, A; Harris, J W; Hartmann, H; Harton, A; Hatzifotiadou, D; Hayashi, S; Heckel, S T; Heide, M; Helstrup, H; Herghelegiu, A; Herrera Corral, G; Hess, B A; Hetland, K F; Hicks, B; Hippolyte, B; Hladky, J; Hristov, P; Huang, M; Humanic, T J; Hutter, D; Hwang, D S; Ilkaev, R; Ilkiv, I; Inaba, M; Innocenti, G M; Ionita, C; Ippolitov, M; Irfan, M; Ivanov, M; Ivanov, V; Ivanytskyi, O; Jachołkowski, A; Jacobs, P M; Jahnke, C; Jang, H J; Janik, M A; Jayarathna, P H S Y; Jena, S; Jimenez Bustamante, R T; Jones, P G; Jung, H; Jusko, A; Kadyshevskiy, V; Kalcher, S; Kalinak, P; Kalweit, A; Kamin, J; Kang, J H; Kaplin, V; Kar, S; Karasu Uysal, A; Karavichev, O; Karavicheva, T; Karpechev, E; Kebschull, U; Keidel, R; Khan, M M; Khan, P; Khan, S A; Khanzadeev, A; Kharlov, Y; Kileng, B; Kim, B; Kim, D W; Kim, D J; Kim, J S; Kim, M; Kim, M; Kim, S; Kim, T; Kirsch, S; Kisel, I; Kiselev, S; Kisiel, A; Kiss, G; Klay, J L; Klein, J; Klein-Bösing, C; Kluge, A; Knichel, M L; Knospe, A G; Kobdaj, C; Köhler, M K; Kollegger, T; Kolojvari, A; Kondratiev, V; Kondratyeva, N; Konevskikh, A; Kovalenko, V; Kowalski, M; Kox, S; Koyithatta Meethaleveedu, G; Kral, J; Králik, I; Kramer, F; Kravčáková, A; Krelina, M; Kretz, M; Krivda, M; Krizek, F; Krus, M; Kryshen, E; Krzewicki, M; Kučera, V; Kucheriaev, Y; Kugathasan, T; Kuhn, C; Kuijer, P G; Kulakov, I; Kumar, J; Kurashvili, P; Kurepin, A; Kurepin, A B; Kuryakin, A; Kushpil, S; Kweon, M J; Kwon, Y; Ladron de Guevara, P; Lagana Fernandes, C; Lakomov, I; Langoy, R; Lara, C; Lardeux, A; Lattuca, A; La Pointe, S L; La Rocca, P; Lea, R; Lee, G R; Legrand, I; Lehnert, J; Lemmon, R C; Lenti, V; Leogrande, E; Leoncino, M; León Monzón, I; Lévai, P; Li, S; Lien, J; Lietava, R; Lindal, S; Lindenstruth, V; Lippmann, C; Lisa, M A; Ljunggren, H M; Lodato, D F; Loenne, P I; Loggins, V R; Loginov, V; Lohner, D; Loizides, C; Lopez, X; López Torres, E; Lu, X-G; Luettig, P; Lunardon, M; Luo, J; Luparello, G; Luzzi, C; Ma, R; Maevskaya, A; Mager, M; Mahapatra, D P; Maire, A; Majka, R D; Malaev, M; Maldonado Cervantes, I; Malinina, L; Mal'Kevich, D; Malzacher, P; Mamonov, A; Manceau, L; Manko, V; Manso, F; Manzari, V; Marchisone, M; Mareš, J; Margagliotti, G V; Margotti, A; Marín, A; Markert, C; Marquard, M; Martashvili, I; Martin, N A; Martinengo, P; Martínez, M I; Martínez García, G; Martin Blanco, J; Martynov, Y; Mas, A; Masciocchi, S; Masera, M; Masoni, A; Massacrier, L; Mastroserio, A; Matyja, A; Mayer, C; Mazer, J; Mazzoni, M A; Meddi, F; Menchaca-Rocha, A; Mercado Pérez, J; Meres, M; Miake, Y; Mikhaylov, K; Milano, L; Milosevic, J; Mischke, A; Mishra, A N; Miśkowiec, D; Mitu, C M; Mlynarz, J; Mohanty, B; Molnar, L; Montaño Zetina, L; Montes, E; Morando, M; Moreira De Godoy, D A; Moretto, S; Morreale, A; Morsch, A; Muccifora, V; Mudnic, E; Muhuri, S; Mukherjee, M; Müller, H; Munhoz, M G; Murray, S; Musa, L; Musinsky, J; Nandi, B K; Nania, R; Nappi, E; Nattrass, C; Nayak, T K; Nazarenko, S; Nedosekin, A; Nicassio, M; Niculescu, M; Nielsen, B S; Nikolaev, S; Nikulin, S; Nikulin, V; Nilsen, B S; Noferini, F; Nomokonov, P; Nooren, G; Nyanin, A; Nystrand, J; Oeschler, H; Oh, S; Oh, S K; Okatan, A; Olah, L; Oleniacz, J; Oliveira Da Silva, A C; Onderwaater, J; Oppedisano, C; Ortiz Velasquez, A; Oskarsson, A; Otwinowski, J; Oyama, K; Sahoo, P; Pachmayer, Y; Pachr, M; Pagano, P; Paić, G; Painke, F; Pajares, C; Pal, S K; Palmeri, A; Pant, D; Papikyan, V; Pappalardo, G S; Pareek, P; Park, W J; Parmar, S; Passfeld, A; Patalakha, D I; Paticchio, V; Paul, B; Pawlak, T; Peitzmann, T; Pereira Da Costa, H; Pereira De Oliveira Filho, E; Peresunko, D; Pérez Lara, C E; Pesci, A; Peskov, V; Pestov, Y; Petráček, V; Petran, M; Petris, M; Petrovici, M; Petta, C; Piano, S; Pikna, M; Pillot, P; Pinazza, O; Pinsky, L; Piyarathna, D B; Płoskoń, M; Planinic, M; Pluta, J; Pochybova, S; Podesta-Lerma, P L M; Poghosyan, M G; Pohjoisaho, E H O; Polichtchouk, B; Poljak, N; Pop, A; Porteboeuf-Houssais, S; Porter, J; Pospisil, V; Potukuchi, B; Prasad, S K; Preghenella, R; Prino, F; Pruneau, C A; Pshenichnov, I; Puddu, G; Pujahari, P; Punin, V; Putschke, J; Qvigstad, H; Rachevski, A; Raha, S; Rak, J; Rakotozafindrabe, A; Ramello, L; Raniwala, R; Raniwala, S; Räsänen, S S; Rascanu, B T; Rathee, D; Rauf, A W; Razazi, V; Read, K F; Real, J S; Redlich, K; Reed, R J; Rehman, A; Reichelt, P; Reicher, M; Reidt, F; Renfordt, R; Reolon, A R; Reshetin, A; Rettig, F; Revol, J-P; Reygers, K; Ricci, R A; Richert, T; Richter, M; Riedler, P; Riegler, W; Riggi, F; Rivetti, A; Rocco, E; Rodríguez Cahuantzi, M; Rodriguez Manso, A; Røed, K; Rogochaya, E; Rohni, S; Rohr, D; Röhrich, D; Romita, R; Ronchetti, F; Rosnet, P; Rossegger, S; Rossi, A; Roukoutakis, F; Roy, A; Roy, C; Roy, P; Rubio Montero, A J; Rui, R; Russo, R; Ryabinkin, E; Rybicki, A; Sadovsky, S; Šafařík, K; Sahlmuller, B; Sahoo, R; Sahu, P K; Saini, J; Salgado, C A; Salzwedel, J; Sambyal, S; Samsonov, V; Sanchez Castro, X; Sánchez Rodríguez, F J; Šándor, L; Sandoval, A; Sano, M; Santagati, G; Sarkar, D; Scapparone, E; Scarlassara, F; Scharenberg, R P; Schiaua, C; Schicker, R; Schmidt, C; Schmidt, H R; Schuchmann, S; Schukraft, J; Schulc, M; Schuster, T; Schutz, Y; Schwarz, K; Schweda, K; Scioli, G; Scomparin, E; Scott, R; Segato, G; Seger, J E; Sekiguchi, Y; Selyuzhenkov, I; Seo, J; Serradilla, E; Sevcenco, A; Shabetai, A; Shabratova, G; Shahoyan, R; Shangaraev, A; Sharma, N; Sharma, S; Shigaki, K; Shtejer, K; Sibiriak, Y; Siddhanta, S; Siemiarczuk, T; Silvermyr, D; Silvestre, C; Simatovic, G; Singaraju, R; Singh, R; Singha, S; Singhal, V; Sinha, B C; Sinha, T; Sitar, B; Sitta, M; Skaali, T B; Skjerdal, K; Smakal, R; Smirnov, N; Snellings, R J M; Søgaard, C; Soltz, R; Song, J; Song, M; Soramel, F; Sorensen, S; Spacek, M; Sputowska, I; Spyropoulou-Stassinaki, M; Srivastava, B K; Stachel, J; Stan, I; Stefanek, G; Steinpreis, M; Stenlund, E; Steyn, G; Stiller, J H; Stocco, D; Stolpovskiy, M; Strmen, P; Suaide, A A P; Sugitate, T; Suire, C; Suleymanov, M; Sultanov, R; Šumbera, M; Susa, T; Symons, T J M; Szanto de Toledo, A; Szarka, I; Szczepankiewicz, A; Szymanski, M; Takahashi, J; Tangaro, M A; Tapia Takaki, J D; Tarantola Peloni, A; Tarazona Martinez, A; Tauro, A; Tejeda Muñoz, G; Telesca, A; Terrevoli, C; Thäder, J; Thomas, D; Tieulent, R; Timmins, A R; Toia, A; Torii, H; Trubnikov, V; Trzaska, W H; Tsuji, T; Tumkin, A; Turrisi, R; Tveter, T S; Ulery, J; Ullaland, K; Uras, A; Usai, G L; Vajzer, M; Vala, M; Valencia Palomo, L; Vallero, S; Vande Vyvre, P; Vannucci, L; Van Hoorne, J W; van Leeuwen, M; Vargas, A; Varma, R; Vasileiou, M; Vasiliev, A; Vechernin, V; Veldhoen, M; Velure, A; Venaruzzo, M; Vercellin, E; Vergara Limón, S; Vernet, R; Verweij, M; Vickovic, L; Viesti, G; Viinikainen, J; Vilakazi, Z; Villalobos Baillie, O; Vinogradov, A; Vinogradov, L; Vinogradov, Y; Virgili, T; Viyogi, Y P; Vodopyanov, A; Völkl, M A; Voloshin, K; Voloshin, S A; Volpe, G; von Haller, B; Vorobyev, I; Vranic, D; Vrláková, J; Vulpescu, B; Vyushin, A; Wagner, B; Wagner, J; Wagner, V; Wang, M; Wang, Y; Watanabe, D; Weber, M; Wessels, J P; Westerhoff, U; Wiechula, J; Wikne, J; Wilde, M; Wilk, G; Wilkinson, J; Williams, M C S; Windelband, B; Winn, M; Xiang, C; Yaldo, C G; Yamaguchi, Y; Yang, H; Yang, P; Yang, S; Yano, S; Yasnopolskiy, S; Yi, J; Yin, Z; Yoo, I-K; Yushmanov, I; Zaccolo, V; Zach, C; Zaman, A; Zampolli, C; Zaporozhets, S; Zarochentsev, A; Závada, P; Zaviyalov, N; Zbroszczyk, H; Zgura, I S; Zhalov, M; Zhang, H; Zhang, X; Zhang, Y; Zhao, C; Zhigareva, N; Zhou, D; Zhou, F; Zhou, Y; Zhu, H; Zhu, J; Zhu, X; Zichichi, A; Zimmermann, A; Zimmermann, M B; Zinovjev, G; Zoccarato, Y; Zynovyev, M; Zyzak, M

The inclusive production cross sections at forward rapidity of [Formula: see text], [Formula: see text], [Formula: see text](1S) and [Formula: see text](2S) are measured in [Formula: see text] collisions at [Formula: see text] with the ALICE detector at the LHC. The analysis is based on a data sample corresponding to an integrated luminosity of 1.35 pb[Formula: see text]. Quarkonia are reconstructed in the dimuon-decay channel and the signal yields are evaluated by fitting the [Formula: see text] invariant mass distributions. The differential production cross sections are measured as a function of the transverse momentum [Formula: see text] and rapidity [Formula: see text], over the ranges [Formula: see text] GeV/c for [Formula: see text], [Formula: see text] GeV/c for all other resonances and for [Formula: see text]. The measured cross sections integrated over [Formula: see text] and [Formula: see text], and assuming unpolarized quarkonia, are: [Formula: see text] [Formula: see text]b, [Formula: see text] [Formula: see text]b, [Formula: see text] nb and [Formula: see text] nb, where the first uncertainty is statistical and the second one is systematic. The results are compared to measurements performed by other LHC experiments and to theoretical models.

Design conceptuel d'un avion blended wing body de 200 passagers

NASA Astrophysics Data System (ADS)

Ammar, Sami

The Blended Wing Body is built based on the flying wing concept and performance improvements compared to conventional aircraft. Contrariwise, most studies have focused on large aircraft and it is not sure whether the gains are the same for smaller aircraft. The main of objective is to perform the conceptual design of a BWB of 200 passengers and compare the performance obtained with a conventional aircraft equivalent in terms of payload and range. The design of the Blended Wing Body was carried out under the CEASIOM environment. This platform design suitable for conventional aircraft design has been modified and additional tools have been integrated in order to achieve the aerodynamic analysis, performance and stability of the aircraft fuselage built. A plane model is obtained in the geometric module AcBuilder CEASIOM from the design variables of a wing. Estimates of mass are made from semi- empirical formulas adapted to the geometry of the BWB and calculations centering and inertia are possible through BWB model developed in CATIA. Low fidelity methods, such as TORNADO and semi- empirical formulas are used to analyze the aerodynamic performance and stability of the aircraft. The aerodynamic results are validated using a high-fidelity analysis using FLUENT CFD software. An optimization process is implemented in order to obtain improved while maintaining a feasible design performance. It is an optimization of the plan form of the aircraft fuselage integrated with a number of passengers and equivalent to that of a A320.Les performance wing aircraft merged optimized maximum range are compared to A320 also optimized. Significant gains were observed. An analysis of the dynamics of longitudinal and lateral flight is carried out on the aircraft optimized BWB finesse and mass. This study identified the stable and unstable modes of the aircraft. Thus, this analysis has highlighted the stability problems associated with the oscillation of incidence and the Dutch roll for the absence of stabilizers.

Neural network consistent empirical physical formula construction for density functional theory based nonlinear vibrational absorbance and intensity of 6-choloronicotinic acid molecule

NASA Astrophysics Data System (ADS)

Yildiz, Nihat; Karabacak, Mehmet; Kurt, Mustafa; Akkoyun, Serkan

2012-05-01

Being directly related to the electric charge distributions in a molecule, the vibrational spectra intensities are both experimentally and theoretically important physical quantities. However, these intensities are inherently highly nonlinear and of complex pattern. Therefore, in particular for unknown detailed spatial molecular structures, it is difficult to make ab initio intensity calculations to compare with new experimental data. In this respect, we very recently initiated entirely novel layered feedforward neural network (LFNN) approach to construct empirical physical formulas (EPFs) for density functional theory (DFT) vibrational spectra of some molecules. In this paper, as a new and far improved contribution to our novel molecular vibrational spectra LFNN-EPF approach, we constructed LFFN-EPFs for absorbances and intensities of 6-choloronicotinic acid (6-CNA) molecule. The 6-CNA data, borrowed from our previous study, was entirely different and much larger than the vibrational intensity data of our formerly used LFNN-EPF molecules. In line with our another previous work which theoretically proved the LFNN relevance to EPFs, although the 6-CNA DFT absorbance and intensity were inherently highly nonlinear and sharply fluctuating in character, still the optimally constructed train set LFFN-EPFs very successfully fitted the absorbances and intensities. Moreover, test set (i.e. yet-to-be measured experimental data) LFNN-EPFs consistently and successfully predicted the absorbance and intensity data. This simply means that the physical law embedded in the 6-CNA vibrational data was successfully extracted by the LFNN-EPFs. In conclusion, these vibrational LFNN-EPFs are of explicit form. Therefore, by various suitable operations of mathematical analysis, they can be used to estimate the electronic charge distributions of the unknown molecule of the significant complexity. Additionally, these estimations can be combined with those of theoretical DFT atomic polar tensor calculations to contribute to the identification of the molecule.

Neural network consistent empirical physical formula construction for density functional theory based nonlinear vibrational absorbance and intensity of 6-choloronicotinic acid molecule.

PubMed

Yildiz, Nihat; Karabacak, Mehmet; Kurt, Mustafa; Akkoyun, Serkan

2012-05-01

Being directly related to the electric charge distributions in a molecule, the vibrational spectra intensities are both experimentally and theoretically important physical quantities. However, these intensities are inherently highly nonlinear and of complex pattern. Therefore, in particular for unknown detailed spatial molecular structures, it is difficult to make ab initio intensity calculations to compare with new experimental data. In this respect, we very recently initiated entirely novel layered feedforward neural network (LFNN) approach to construct empirical physical formulas (EPFs) for density functional theory (DFT) vibrational spectra of some molecules. In this paper, as a new and far improved contribution to our novel molecular vibrational spectra LFNN-EPF approach, we constructed LFFN-EPFs for absorbances and intensities of 6-choloronicotinic acid (6-CNA) molecule. The 6-CNA data, borrowed from our previous study, was entirely different and much larger than the vibrational intensity data of our formerly used LFNN-EPF molecules. In line with our another previous work which theoretically proved the LFNN relevance to EPFs, although the 6-CNA DFT absorbance and intensity were inherently highly nonlinear and sharply fluctuating in character, still the optimally constructed train set LFFN-EPFs very successfully fitted the absorbances and intensities. Moreover, test set (i.e. yet-to-be measured experimental data) LFNN-EPFs consistently and successfully predicted the absorbance and intensity data. This simply means that the physical law embedded in the 6-CNA vibrational data was successfully extracted by the LFNN-EPFs. In conclusion, these vibrational LFNN-EPFs are of explicit form. Therefore, by various suitable operations of mathematical analysis, they can be used to estimate the electronic charge distributions of the unknown molecule of the significant complexity. Additionally, these estimations can be combined with those of theoretical DFT atomic polar tensor calculations to contribute to the identification of the molecule. Copyright © 2012 Elsevier B.V. All rights reserved.

Measurement of WZ and ZZ production in pp collisions at [Formula: see text] in final states with b-tagged jets.

PubMed

Chatrchyan, S; Khachatryan, V; Sirunyan, A M; Tumasyan, A; Adam, W; Bergauer, T; Dragicevic, M; Erö, J; Fabjan, C; Friedl, M; Frühwirth, R; Ghete, V M; Hartl, C; Hörmann, N; Hrubec, J; Jeitler, M; Kiesenhofer, W; Knünz, V; Krammer, M; Krätschmer, I; Liko, D; Mikulec, I; Rabady, D; Rahbaran, B; Rohringer, H; Schöfbeck, R; Strauss, J; Taurok, A; Treberer-Treberspurg, W; Waltenberger, W; Wulz, C-E; Mossolov, V; Shumeiko, N; Suarez Gonzalez, J; Alderweireldt, S; Bansal, M; Bansal, S; Cornelis, T; De Wolf, E A; Janssen, X; Knutsson, A; Luyckx, S; Ochesanu, S; Roland, B; Rougny, R; Van Haevermaet, H; Van Mechelen, P; Van Remortel, N; Van Spilbeeck, A; Blekman, F; Blyweert, S; D'Hondt, J; Heracleous, N; Kalogeropoulos, A; Keaveney, J; Kim, T J; Lowette, S; Maes, M; Olbrechts, A; Strom, D; Tavernier, S; Van Doninck, W; Van Mulders, P; Van Onsem, G P; Villella, I; Caillol, C; Clerbaux, B; De Lentdecker, G; Favart, L; Gay, A P R; Léonard, A; Marage, P E; Mohammadi, A; Perniè, L; Reis, T; Seva, T; Thomas, L; Vander Velde, C; Vanlaer, P; Wang, J; Adler, V; Beernaert, K; Benucci, L; Cimmino, A; Costantini, S; Crucy, S; Dildick, S; Garcia, G; Klein, B; Lellouch, J; Mccartin, J; Ocampo Rios, A A; Ryckbosch, D; Salva Diblen, S; Sigamani, M; Strobbe, N; Thyssen, F; Tytgat, M; Walsh, S; Yazgan, E; Zaganidis, N; Basegmez, S; Beluffi, C; Bruno, G; Castello, R; Caudron, A; Ceard, L; Da Silveira, G G; Delaere, C; du Pree, T; Favart, D; Forthomme, L; Giammanco, A; Hollar, J; Jez, P; Komm, M; Lemaitre, V; Liao, J; Militaru, O; Nuttens, C; Pagano, D; Pin, A; Piotrzkowski, K; Popov, A; Quertenmont, L; Selvaggi, M; Vidal Marono, M; Vizan Garcia, J M; Beliy, N; Caebergs, T; Daubie, E; Hammad, G H; Alves, G A; Correa Martins Junior, M; Martins, T; Pol, M E; Souza, M H G; Aldá Júnior, W L; Carvalho, W; Chinellato, J; Custódio, A; Da Costa, E M; De Jesus Damiao, D; De Oliveira Martins, C; Fonseca De Souza, S; Malbouisson, H; Malek, M; Matos Figueiredo, D; Mundim, L; Nogima, H; Prado Da Silva, W L; Santaolalla, J; Santoro, A; Sznajder, A; Tonelli Manganote, E J; Vilela Pereira, A; Dias, F A; Fernandez Perez Tomei, T R; Novaes, S F; Padula, Sandra S; Bernardes, C A; Gregores, E M; Mercadante, P G; Genchev, V; Iaydjiev, P; Marinov, A; Piperov, S; Rodozov, M; Sultanov, G; Vutova, M; Dimitrov, A; Glushkov, I; Hadjiiska, R; Kozhuharov, V; Litov, L; Pavlov, B; Petkov, P; Bian, J G; Chen, G M; Chen, H S; Chen, M; Du, R; Jiang, C H; Liang, D; Liang, S; Meng, X; Plestina, R; Tao, J; Wang, X; Wang, Z; Asawatangtrakuldee, C; Ban, Y; Guo, Y; Li, Q; Li, W; Liu, S; Mao, Y; Qian, S J; Wang, D; Zhang, L; Zou, W; Avila, C; Chaparro Sierra, L F; Florez, C; Gomez, J P; Gomez Moreno, B; Sanabria, J C; Godinovic, N; Lelas, D; Polic, D; Puljak, I; Antunovic, Z; Kovac, M; Brigljevic, V; Kadija, K; Luetic, J; Mekterovic, D; Morovic, S; Tikvica, L; Attikis, A; Mavromanolakis, G; Mousa, J; Nicolaou, C; Ptochos, F; Razis, P A; Finger, M; Finger, M; Assran, Y; Elgammal, S; Ellithi Kamel, A; Mahmoud, M A; Mahrous, A; Radi, A; Kadastik, M; Müntel, M; Murumaa, M; Raidal, M; Tiko, A; Eerola, P; Fedi, G; Voutilainen, M; Härkönen, J; Karimäki, V; Kinnunen, R; Kortelainen, M J; Lampén, T; Lassila-Perini, K; Lehti, S; Lindén, T; Luukka, P; Mäenpää, T; Peltola, T; Tuominen, E; Tuominiemi, J; Tuovinen, E; Wendland, L; Tuuva, T; Besancon, M; Couderc, F; Dejardin, M; Denegri, D; Fabbro, B; Faure, J L; Ferri, F; Ganjour, S; Givernaud, A; Gras, P; Hamel de Monchenault, G; Jarry, P; Locci, E; Malcles, J; Nayak, A; Rander, J; Rosowsky, A; Titov, M; Baffioni, S; Beaudette, F; Busson, P; Charlot, C; Daci, N; Dahms, T; Dalchenko, M; Dobrzynski, L; Filipovic, N; Florent, A; Granier de Cassagnac, R; Mastrolorenzo, L; Miné, P; Mironov, C; Naranjo, I N; Nguyen, M; Ochando, C; Paganini, P; Sabes, D; Salerno, R; Sauvan, J B; Sirois, Y; Veelken, C; Yilmaz, Y; Zabi, A; Agram, J-L; Andrea, J; Bloch, D; Brom, J-M; Chabert, E C; Collard, C; Conte, E; Drouhin, F; Fontaine, J-C; Gelé, D; Goerlach, U; Goetzmann, C; Juillot, P; Le Bihan, A-C; Van Hove, P; Gadrat, S; Beauceron, S; Beaupere, N; Boudoul, G; Brochet, S; Carrillo Montoya, C A; Chasserat, J; Chierici, R; Contardo, D; Depasse, P; El Mamouni, H; Fan, J; Fay, J; Gascon, S; Gouzevitch, M; Ille, B; Kurca, T; Lethuillier, M; Mirabito, L; Perries, S; Ruiz Alvarez, J D; Sgandurra, L; Sordini, V; Vander Donckt, M; Verdier, P; Viret, S; Xiao, H; Tsamalaidze, Z; Autermann, C; Beranek, S; Bontenackels, M; Calpas, B; Edelhoff, M; Feld, L; Hindrichs, O; Klein, K; Ostapchuk, A; Perieanu, A; Raupach, F; Sammet, J; Schael, S; Sprenger, D; Weber, H; Wittmer, B; Zhukov, V; Ata, M; Caudron, J; Dietz-Laursonn, E; Duchardt, D; Erdmann, M; Fischer, R; Güth, A; Hebbeker, T; Heidemann, C; Hoepfner, K; Klingebiel, D; Knutzen, S; Kreuzer, P; Merschmeyer, M; Meyer, A; Olschewski, M; Padeken, K; Papacz, P; Reithler, H; Schmitz, S A; Sonnenschein, L; Teyssier, D; Thüer, S; Weber, M; Cherepanov, V; Erdogan, Y; Flügge, G; Geenen, H; Geisler, M; Haj Ahmad, W; Hoehle, F; Kargoll, B; Kress, T; Kuessel, Y; Lingemann, J; Nowack, A; Nugent, I M; Perchalla, L; Pooth, O; Stahl, A; Asin, I; Bartosik, N; Behr, J; Behrenhoff, W; Behrens, U; Bell, A J; Bergholz, M; Bethani, A; Borras, K; Burgmeier, A; Cakir, A; Calligaris, L; Campbell, A; Choudhury, S; Costanza, F; Diez Pardos, C; Dooling, S; Dorland, T; Eckerlin, G; Eckstein, D; Eichhorn, T; Flucke, G; Geiser, A; Grebenyuk, A; Gunnellini, P; Habib, S; Hauk, J; Hellwig, G; Hempel, M; Horton, D; Jung, H; Kasemann, M; Katsas, P; Kieseler, J; Kleinwort, C; Krämer, M; Krücker, D; Lange, W; Leonard, J; Lipka, K; Lohmann, W; Lutz, B; Mankel, R; Marfin, I; Melzer-Pellmann, I-A; Meyer, A B; Mnich, J; Mussgiller, A; Naumann-Emme, S; Novgorodova, O; Nowak, F; Ntomari, E; Perrey, H; Petrukhin, A; Pitzl, D; Placakyte, R; Raspereza, A; Ribeiro Cipriano, P M; Riedl, C; Ron, E; Sahin, M Ö; Salfeld-Nebgen, J; Saxena, P; Schmidt, R; Schoerner-Sadenius, T; Schröder, M; Stein, M; Vargas Trevino, A D R; Walsh, R; Wissing, C; Aldaya Martin, M; Blobel, V; Enderle, H; Erfle, J; Garutti, E; Goebel, K; Görner, M; Gosselink, M; Haller, J; Höing, R S; Kirschenmann, H; Klanner, R; Kogler, R; Lange, J; Lapsien, T; Lenz, T; Marchesini, I; Ott, J; Peiffer, T; Pietsch, N; Rathjens, D; Sander, C; Schettler, H; Schleper, P; Schlieckau, E; Schmidt, A; Seidel, M; Sibille, J; Sola, V; Stadie, H; Steinbrück, G; Troendle, D; Usai, E; Vanelderen, L; Barth, C; Baus, C; Berger, J; Böser, C; Butz, E; Chwalek, T; De Boer, W; Descroix, A; Dierlamm, A; Feindt, M; Guthoff, M; Hartmann, F; Hauth, T; Held, H; Hoffmann, K H; Husemann, U; Katkov, I; Kornmayer, A; Kuznetsova, E; Lobelle Pardo, P; Martschei, D; Mozer, M U; Müller, Th; Niegel, M; Nürnberg, A; Oberst, O; Quast, G; Rabbertz, K; Ratnikov, F; Röcker, S; Schilling, F-P; Schott, G; Simonis, H J; Stober, F M; Ulrich, R; Wagner-Kuhr, J; Wayand, S; Weiler, T; Wolf, R; Zeise, M; Anagnostou, G; Daskalakis, G; Geralis, T; Kesisoglou, S; Kyriakis, A; Loukas, D; Markou, A; Markou, C; Psallidas, A; Topsis-Giotis, I; Gouskos, L; Panagiotou, A; Saoulidou, N; Stiliaris, E; Aslanoglou, X; Evangelou, I; Flouris, G; Foudas, C; Jones, J; Kokkas, P; Manthos, N; Papadopoulos, I; Paradas, E; Bencze, G; Hajdu, C; Hidas, P; Horvath, D; Sikler, F; Veszpremi, V; Vesztergombi, G; Zsigmond, A J; Beni, N; Czellar, S; Molnar, J; Palinkas, J; Szillasi, Z; Karancsi, J; Raics, P; Trocsanyi, Z L; Ujvari, B; Swain, S K; Beri, S B; Bhatnagar, V; Dhingra, N; Gupta, R; Kaur, M; Mittal, M; Nishu, N; Sharma, A; Singh, J B; Kumar, Ashok; Kumar, Arun; Ahuja, S; Bhardwaj, A; Choudhary, B C; Kumar, A; Malhotra, S; Naimuddin, M; Ranjan, K; Sharma, V; Shivpuri, R K; Banerjee, S; Bhattacharya, S; Chatterjee, K; Dutta, S; Gomber, B; Jain, Sa; Jain, Sh; Khurana, R; Modak, A; Mukherjee, S; Roy, D; Sarkar, S; Sharan, M; Singh, A P; Abdulsalam, A; Dutta, D; Kailas, S; Kumar, V; Mohanty, A K; Pant, L M; Shukla, P; Topkar, A; Aziz, T; Chatterjee, R M; Ganguly, S; Ghosh, S; Guchait, M; Gurtu, A; Kole, G; Kumar, S; Maity, M; Majumder, G; Mazumdar, K; Mohanty, G B; Parida, B; Sudhakar, K; Wickramage, N; Dugad, S; Arfaei, H; Bakhshiansohi, H; Behnamian, H; Etesami, S M; Fahim, A; Jafari, A; Khakzad, M; Mohammadi Najafabadi, M; Naseri, M; Paktinat Mehdiabadi, S; Safarzadeh, B; Zeinali, M; Grunewald, M; Abbrescia, M; Barbone, L; Calabria, C; Chhibra, S S; Colaleo, A; Creanza, D; De Filippis, N; De Palma, M; Fiore, L; Iaselli, G; Maggi, G; Maggi, M; Marangelli, B; My, S; Nuzzo, S; Pacifico, N; Pompili, A; Pugliese, G; Radogna, R; Selvaggi, G; Silvestris, L; Singh, G; Venditti, R; Verwilligen, P; Zito, G; Abbiendi, G; Benvenuti, A C; Bonacorsi, D; Braibant-Giacomelli, S; Brigliadori, L; Campanini, R; Capiluppi, P; Castro, A; Cavallo, F R; Codispoti, G; Cuffiani, M; Dallavalle, G M; Fabbri, F; Fanfani, A; Fasanella, D; Giacomelli, P; Grandi, C; Guiducci, L; Marcellini, S; Masetti, G; Meneghelli, M; Montanari, A; Navarria, F L; Odorici, F; Perrotta, A; Primavera, F; Rossi, A M; Rovelli, T; Siroli, G P; Tosi, N; Travaglini, R; Albergo, S; Cappello, G; Chiorboli, M; Costa, S; Giordano, F; Potenza, R; Tricomi, A; Tuve, C; Barbagli, G; Ciulli, V; Civinini, C; D'Alessandro, R; Focardi, E; Gallo, E; Gonzi, S; Gori, V; Lenzi, P; Meschini, M; Paoletti, S; Sguazzoni, G; Tropiano, A; Benussi, L; Bianco, S; Piccolo, D; Fabbricatore, P; Ferretti, R; Ferro, F; Lo Vetere, M; Musenich, R; Robutti, E; Tosi, S; Dinardo, M E; Fiorendi, S; Gennai, S; Gerosa, R; Ghezzi, A; Govoni, P; Lucchini, M T; Malvezzi, S; Manzoni, R A; Martelli, A; Marzocchi, B; Menasce, D; Moroni, L; Paganoni, M; Pedrini, D; Ragazzi, S; Redaelli, N; Tabarelli de Fatis, T; Buontempo, S; Cavallo, N; Di Guida, S; Fabozzi, F; Iorio, A O M; Lista, L; Meola, S; Merola, M; Paolucci, P; Azzi, P; Bacchetta, N; Bisello, D; Branca, A; Carlin, R; Checchia, P; Dorigo, T; Dosselli, U; Galanti, M; Gasparini, F; Gasparini, U; Giubilato, P; Gozzelino, A; Kanishchev, K; Lacaprara, S; Lazzizzera, I; Margoni, M; Meneguzzo, A T; Pazzini, J; Pegoraro, M; Pozzobon, N; Ronchese, P; Simonetto, F; Torassa, E; Tosi, M; Triossi, A; Zotto, P; Zucchetta, A; Zumerle, G; Gabusi, M; Ratti, S P; Riccardi, C; Salvini, P; Vitulo, P; Biasini, M; Bilei, G M; Fanò, L; Lariccia, P; Mantovani, G; Menichelli, M; Romeo, F; Saha, A; Santocchia, A; Spiezia, A; Androsov, K; Azzurri, P; Bagliesi, G; Bernardini, J; Boccali, T; Broccolo, G; Castaldi, R; Ciocci, M A; Dell'Orso, R; Donato, S; Fiori, F; Foà, L; Giassi, A; Grippo, M T; Kraan, A; Ligabue, F; Lomtadze, T; Martini, L; Messineo, A; Moon, C S; Palla, F; Rizzi, A; Savoy-Navarro, A; Serban, A T; Spagnolo, P; Squillacioti, P; Tenchini, R; Tonelli, G; Venturi, A; Verdini, P G; Vernieri, C; Barone, L; Cavallari, F; Del Re, D; Diemoz, M; Grassi, M; Jorda, C; Longo, E; Margaroli, F; Meridiani, P; Micheli, F; Nourbakhsh, S; Organtini, G; Paramatti, R; Rahatlou, S; Rovelli, C; Soffi, L; Traczyk, P; Amapane, N; Arcidiacono, R; Argiro, S; Arneodo, M; Bellan, R; Biino, C; Cartiglia, N; Casasso, S; Costa, M; Degano, A; Demaria, N; Mariotti, C; Maselli, S; Migliore, E; Monaco, V; Musich, M; Obertino, M M; Ortona, G; Pacher, L; Pastrone, N; Pelliccioni, M; Potenza, A; Romero, A; Ruspa, M; Sacchi, R; Solano, A; Staiano, A; Tamponi, U; Belforte, S; Candelise, V; Casarsa, M; Cossutti, F; Della Ricca, G; Gobbo, B; La Licata, C; Marone, M; Montanino, D; Penzo, A; Schizzi, A; Umer, T; Zanetti, A; Chang, S; Kim, T Y; Nam, S K; Kim, D H; Kim, G N; Kim, J E; Kim, M S; Kong, D J; Lee, S; Oh, Y D; Park, H; Sakharov, A; Son, D C; Kim, J Y; Kim, Zero J; Song, S; Choi, S; Gyun, D; Hong, B; Jo, M; Kim, H; Kim, Y; Lee, B; Lee, K S; Park, S K; Roh, Y; Choi, M; Kim, J H; Park, C; Park, I C; Park, S; Ryu, G; Choi, Y; Choi, Y K; Goh, J; Kwon, E; Lee, J; Seo, H; Yu, I; Juodagalvis, A; Komaragiri, J R; Castilla-Valdez, H; De La Cruz-Burelo, E; Heredia-de La Cruz, I; Lopez-Fernandez, R; Martínez-Ortega, J; Sanchez-Hernandez, A; Villasenor-Cendejas, L M; Carrillo Moreno, S; Vazquez Valencia, F; Salazar Ibarguen, H A; Casimiro Linares, E; Morelos Pineda, A; Krofcheck, D; Butler, P H; Doesburg, R; Reucroft, S; Ahmad, A; Ahmad, M; Asghar, M I; Butt, J; Hassan, Q; Hoorani, H R; Khan, W A; Khurshid, T; Qazi, S; Shah, M A; Shoaib, M; Bialkowska, H; Bluj, M; Boimska, B; Frueboes, T; Górski, M; Kazana, M; Nawrocki, K; Romanowska-Rybinska, K; Szleper, M; Wrochna, G; Zalewski, P; Brona, G; Bunkowski, K; Cwiok, M; Dominik, W; Doroba, K; Kalinowski, A; Konecki, M; Krolikowski, J; Misiura, M; Wolszczak, W; Bargassa, P; Beirão Da Cruz E Silva, C; Faccioli, P; Ferreira Parracho, P G; Gallinaro, M; Nguyen, F; Rodrigues Antunes, J; Seixas, J; Varela, J; Vischia, P; Bunin, P; Golutvin, I; Gorbunov, I; Kamenev, A; Karjavin, V; Konoplyanikov, V; Korenkov, V; Lanev, A; Malakhov, A; Matveev, V; Moisenz, P; Palichik, V; Perelygin, V; Shmatov, S; Skatchkov, N; Smirnov, V; Tikhonenko, E; Zarubin, A; Golovtsov, V; Ivanov, Y; Kim, V; Levchenko, P; Murzin, V; Oreshkin, V; Smirnov, I; Sulimov, V; Uvarov, L; Vavilov, S; Vorobyev, A; Vorobyev, An; Andreev, Yu; Dermenev, A; Gninenko, S; Golubev, N; Kirsanov, M; Krasnikov, N; Pashenkov, A; Tlisov, D; Toropin, A; Epshteyn, V; Gavrilov, V; Lychkovskaya, N; Popov, V; Safronov, G; Semenov, S; Spiridonov, A; Stolin, V; Vlasov, E; Zhokin, A; Andreev, V; Azarkin, M; Dremin, I; Kirakosyan, M; Leonidov, A; Mesyats, G; Rusakov, S V; Vinogradov, A; Belyaev, A; Boos, E; Dubinin, M; Dudko, L; Ershov, A; Gribushin, A; Klyukhin, V; Kodolova, O; Lokhtin, I; Obraztsov, S; Petrushanko, S; Savrin, V; Snigirev, A; Azhgirey, I; Bayshev, I; Bitioukov, S; Kachanov, V; Kalinin, A; Konstantinov, D; Krychkine, V; Petrov, V; Ryutin, R; Sobol, A; Tourtchanovitch, L; Troshin, S; Tyurin, N; Uzunian, A; Volkov, A; Adzic, P; Djordjevic, M; Ekmedzic, M; Milosevic, J; Aguilar-Benitez, M; Alcaraz Maestre, J; Battilana, C; Calvo, E; Cerrada, M; Chamizo Llatas, M; Colino, N; De La Cruz, B; Delgado Peris, A; Domínguez Vázquez, D; Fernandez Bedoya, C; Fernández Ramos, J P; Ferrando, A; Flix, J; Fouz, M C; Garcia-Abia, P; Gonzalez Lopez, O; Goy Lopez, S; Hernandez, J M; Josa, M I; Merino, G; Navarro De Martino, E; Pérez-Calero Yzquierdo, A; Puerta Pelayo, J; Quintario Olmeda, A; Redondo, I; Romero, L; Soares, M S; Willmott, C; Albajar, C; de Trocóniz, J F; Missiroli, M; Brun, H; Cuevas, J; Fernandez Menendez, J; Folgueras, S; Gonzalez Caballero, I; Lloret Iglesias, L; Brochero Cifuentes, J A; Cabrillo, I J; Calderon, A; Duarte Campderros, J; Fernandez, M; Gomez, G; Gonzalez Sanchez, J; Graziano, A; Lopez Virto, A; Marco, J; Marco, R; Martinez Rivero, C; Matorras, F; Munoz Sanchez, F J; Piedra Gomez, J; Rodrigo, T; Rodríguez-Marrero, A Y; Ruiz-Jimeno, A; Scodellaro, L; Vila, I; Vilar Cortabitarte, R; Abbaneo, D; Auffray, E; Auzinger, G; Bachtis, M; Baillon, P; Ball, A H; Barney, D; Benaglia, A; Bendavid, J; Benhabib, L; Benitez, J F; Bernet, C; Bianchi, G; Bloch, P; Bocci, A; Bonato, A; Bondu, O; Botta, C; Breuker, H; Camporesi, T; Cerminara, G; Christiansen, T; Coarasa Perez, J A; Colafranceschi, S; D'Alfonso, M; d'Enterria, D; Dabrowski, A; David, A; De Guio, F; De Roeck, A; De Visscher, S; Dobson, M; Dupont-Sagorin, N; Elliott-Peisert, A; Eugster, J; Franzoni, G; Funk, W; Giffels, M; Gigi, D; Gill, K; Giordano, D; Girone, M; Giunta, M; Glege, F; Gomez-Reino Garrido, R; Gowdy, S; Guida, R; Hammer, J; Hansen, M; Harris, P; Hegeman, J; Innocente, V; Janot, P; Karavakis, E; Kousouris, K; Krajczar, K; Lecoq, P; Lourenço, C; Magini, N; Malgeri, L; Mannelli, M; Masetti, L; Meijers, F; Mersi, S; Meschi, E; Moortgat, F; Mulders, M; Musella, P; Orsini, L; Palencia Cortezon, E; Pape, L; Perez, E; Perrozzi, L; Petrilli, A; Petrucciani, G; Pfeiffer, A; Pierini, M; Pimiä, M; Piparo, D; Plagge, M; Racz, A; Reece, W; Rolandi, G; Rovere, M; Sakulin, H; Santanastasio, F; Schäfer, C; Schwick, C; Sekmen, S; Siegrist, P; Silva, P; Simon, M; Sphicas, P; Spiga, D; Steggemann, J; Stieger, B; Stoye, M; Treille, D; Tsirou, A; Veres, G I; Vlimant, J R; Wöhri, H K; Zeuner, W D; Bertl, W; Deiters, K; Erdmann, W; Horisberger, R; Ingram, Q; Kaestli, H C; König, S; Kotlinski, D; Langenegger, U; Renker, D; Rohe, T; Bachmair, F; Bäni, L; Bianchini, L; Bortignon, P; Buchmann, M A; Casal, B; Chanon, N; Deisher, A; Dissertori, G; Dittmar, M; Donegà, M; Dünser, M; Eller, P; Grab, C; Hits, D; Lustermann, W; Mangano, B; Marini, A C; Martinez Ruiz Del Arbol, P; Meister, D; Mohr, N; Nägeli, C; Nef, P; Nessi-Tedaldi, F; Pandolfi, F; Pauss, F; Peruzzi, M; Quittnat, M; Rebane, L; Ronga, F J; Rossini, M; Starodumov, A; Takahashi, M; Theofilatos, K; Wallny, R; Weber, H A; Amsler, C; Canelli, M F; Chiochia, V; De Cosa, A; Favaro, C; Hinzmann, A; Hreus, T; Ivova Rikova, M; Kilminster, B; Millan Mejias, B; Ngadiuba, J; Robmann, P; Snoek, H; Taroni, S; Verzetti, M; Yang, Y; Cardaci, M; Chen, K H; Ferro, C; Kuo, C M; Li, S W; Lin, W; Lu, Y J; Volpe, R; Yu, S S; Bartalini, P; Chang, P; Chang, Y H; Chang, Y W; Chao, Y; Chen, K F; Chen, P H; Dietz, C; Grundler, U; Hou, W-S; Hsiung, Y; Kao, K Y; Lei, Y J; Liu, Y F; Lu, R-S; Majumder, D; Petrakou, E; Shi, X; Shiu, J G; Tzeng, Y M; Wang, M; Wilken, R; Asavapibhop, B; Suwonjandee, N; Adiguzel, A; Bakirci, M N; Cerci, S; Dozen, C; Dumanoglu, I; Eskut, E; Girgis, S; Gokbulut, G; Gurpinar, E; Hos, I; Kangal, E E; Kayis Topaksu, A; Onengut, G; Ozdemir, K; Ozturk, S; Polatoz, A; Sogut, K; Sunar Cerci, D; Tali, B; Topakli, H; Vergili, M; Akin, I V; Aliev, T; Bilin, B; Bilmis, S; Deniz, M; Gamsizkan, H; Guler, A M; Karapinar, G; Ocalan, K; Ozpineci, A; Serin, M; Sever, R; Surat, U E; Yalvac, M; Zeyrek, M; Gülmez, E; Isildak, B; Kaya, M; Kaya, O; Ozkorucuklu, S; Bahtiyar, H; Barlas, E; Cankocak, K; Günaydin, Y O; Vardarlı, F I; Yücel, M; Levchuk, L; Sorokin, P; Brooke, J J; Clement, E; Cussans, D; Flacher, H; Frazier, R; Goldstein, J; Grimes, M; Heath, G P; Heath, H F; Jacob, J; Kreczko, L; Lucas, C; Meng, Z; Newbold, D M; Paramesvaran, S; Poll, A; Senkin, S; Smith, V J; Williams, T; Bell, K W; Brew, C; Brown, R M; Cockerill, D J A; Coughlan, J A; Harder, K; Harper, S; Ilic, J; Olaiya, E; Petyt, D; Shepherd-Themistocleous, C H; Thea, A; Tomalin, I R; Womersley, W J; Worm, S D; Baber, M; Bainbridge, R; Buchmuller, O; Burton, D; Colling, D; Cripps, N; Cutajar, M; Dauncey, P; Davies, G; Della Negra, M; Ferguson, W; Fulcher, J; Futyan, D; Gilbert, A; Guneratne Bryer, A; Hall, G; Hatherell, Z; Hays, J; Iles, G; Jarvis, M; Karapostoli, G; Kenzie, M; Lane, R; Lucas, R; Lyons, L; Magnan, A-M; Marrouche, J; Mathias, B; Nandi, R; Nash, J; Nikitenko, A; Pela, J; Pesaresi, M; Petridis, K; Pioppi, M; Raymond, D M; Rogerson, S; Rose, A; Seez, C; Sharp, P; Sparrow, A; Tapper, A; Vazquez Acosta, M; Virdee, T; Wakefield, S; Wardle, N; Cole, J E; Hobson, P R; Khan, A; Kyberd, P; Leggat, D; Leslie, D; Martin, W; Reid, I D; Symonds, P; Teodorescu, L; Turner, M; Dittmann, J; Hatakeyama, K; Kasmi, A; Liu, H; Scarborough, T; Charaf, O; Cooper, S I; Henderson, C; Rumerio, P; Avetisyan, A; Bose, T; Fantasia, C; Heister, A; Lawson, P; Lazic, D; Richardson, C; Rohlf, J; Sperka, D; St John, J; Sulak, L; Alimena, J; Christopher, G; Cutts, D; Demiragli, Z; Ferapontov, A; Garabedian, A; Heintz, U; Jabeen, S; Kukartsev, G; Laird, E; Landsberg, G; Luk, M; Narain, M; Segala, M; Sinthuprasith, T; Speer, T; Swanson, J; Breedon, R; Breto, G; Calderon De La Barca Sanchez, M; Chauhan, S; Chertok, M; Conway, J; Conway, R; Cox, P T; Erbacher, R; Gardner, M; Ko, W; Kopecky, A; Lander, R; Miceli, T; Mulhearn, M; Pellett, D; Pilot, J; Ricci-Tam, F; Rutherford, B; Searle, M; Shalhout, S; Smith, J; Squires, M; Tripathi, M; Wilbur, S; Yohay, R; Cline, D; Cousins, R; Erhan, S; Everaerts, P; Farrell, C; Felcini, M; Hauser, J; Ignatenko, M; Jarvis, C; Rakness, G; Schlein, P; Takasugi, E; Valuev, V; Weber, M; Babb, J; Clare, R; Ellison, J; Gary, J W; Hanson, G; Heilman, J; Jandir, P; Lacroix, F; Long, O R; Luthra, A; Malberti, M; Nguyen, H; Shrinivas, A; Sturdy, J; Sumowidagdo, S; Wimpenny, S; Andrews, W; Branson, J G; Cerati, G B; Cittolin, S; D'Agnolo, R T; Evans, D; Holzner, A; Kelley, R; Kovalskyi, D; Lebourgeois, M; Letts, J; Macneill, I; Padhi, S; Palmer, C; Pieri, M; Sani, M; Sharma, V; Simon, S; Sudano, E; Tadel, M; Tu, Y; Vartak, A; Wasserbaech, S; Würthwein, F; Yagil, A; Yoo, J; Barge, D; Bradmiller-Feld, J; Campagnari, C; Danielson, T; Dishaw, A; Flowers, K; Franco Sevilla, M; Geffert, P; George, C; Golf, F; Incandela, J; Justus, C; Magaña Villalba, R; Mccoll, N; Pavlunin, V; Richman, J; Rossin, R; Stuart, D; To, W; West, C; Apresyan, A; Bornheim, A; Bunn, J; Chen, Y; Di Marco, E; Duarte, J; Kcira, D; Mott, A; Newman, H B; Pena, C; Rogan, C; Spiropulu, M; Timciuc, V; Wilkinson, R; Xie, S; Zhu, R Y; Azzolini, V; Calamba, A; Carroll, R; Ferguson, T; Iiyama, Y; Jang, D W; Paulini, M; Russ, J; Vogel, H; Vorobiev, I; Cumalat, J P; Drell, B R; Ford, W T; Gaz, A; Luiggi Lopez, E; Nauenberg, U; Smith, J G; Stenson, K; Ulmer, K A; Wagner, S R; Alexander, J; Chatterjee, A; Chu, J; Eggert, N; Gibbons, L K; Hopkins, W; Khukhunaishvili, A; Kreis, B; Mirman, N; Nicolas Kaufman, G; Patterson, J R; Ryd, A; Salvati, E; Sun, W; Teo, W D; Thom, J; Thompson, J; Tucker, J; Weng, Y; Winstrom, L; Wittich, P; Winn, D; Abdullin, S; Albrow, M; Anderson, J; Apollinari, G; Bauerdick, L A T; Beretvas, A; Berryhill, J; Bhat, P C; Burkett, K; Butler, J N; Chetluru, V; Cheung, H W K; Chlebana, F; Cihangir, S; Elvira, V D; Fisk, I; Freeman, J; Gao, Y; Gottschalk, E; Gray, L; Green, D; Grünendahl, S; Gutsche, O; Hare, D; Harris, R M; Hirschauer, J; Hooberman, B; Jindariani, S; Johnson, M; Joshi, U; Kaadze, K; Klima, B; Kwan, S; Linacre, J; Lincoln, D; Lipton, R; Liu, T; Lykken, J; Maeshima, K; Marraffino, J M; Martinez Outschoorn, V I; Maruyama, S; Mason, D; McBride, P; Mishra, K; Mrenna, S; Musienko, Y; Nahn, S; Newman-Holmes, C; O'Dell, V; Prokofyev, O; Ratnikova, N; Sexton-Kennedy, E; Sharma, S; Soha, A; Spalding, W J; Spiegel, L; Taylor, L; Tkaczyk, S; Tran, N V; Uplegger, L; Vaandering, E W; Vidal, R; Whitbeck, A; Whitmore, J; Wu, W; Yang, F; Yun, J C; Acosta, D; Avery, P; Bourilkov, D; Cheng, T; Das, S; De Gruttola, M; Di Giovanni, G P; Dobur, D; Field, R D; Fisher, M; Fu, Y; Furic, I K; Hugon, J; Kim, B; Konigsberg, J; Korytov, A; Kropivnitskaya, A; Kypreos, T; Low, J F; Matchev, K; Milenovic, P; Mitselmakher, G; Muniz, L; Rinkevicius, A; Shchutska, L; Skhirtladze, N; Snowball, M; Yelton, J; Zakaria, M; Gaultney, V; Hewamanage, S; Linn, S; Markowitz, P; Martinez, G; Rodriguez, J L; Adams, T; Askew, A; Bochenek, J; Chen, J; Diamond, B; Haas, J; Hagopian, S; Hagopian, V; Johnson, K F; Prosper, H; Veeraraghavan, V; Weinberg, M; Baarmand, M M; Dorney, B; Hohlmann, M; Kalakhety, H; Yumiceva, F; Adams, M R; Apanasevich, L; Bazterra, V E; Betts, R R; Bucinskaite, I; Cavanaugh, R; Evdokimov, O; Gauthier, L; Gerber, C E; Hofman, D J; Khalatyan, S; Kurt, P; Moon, D H; O'Brien, C; Silkworth, C; Turner, P; Varelas, N; Akgun, U; Albayrak, E A; Bilki, B; Clarida, W; Dilsiz, K; Duru, F; Haytmyradov, M; Merlo, J-P; Mermerkaya, H; Mestvirishvili, A; Moeller, A; Nachtman, J; Ogul, H; Onel, Y; Ozok, F; Rahmat, R; Sen, S; Tan, P; Tiras, E; Wetzel, J; Yetkin, T; Yi, K; Barnett, B A; Blumenfeld, B; Bolognesi, S; Fehling, D; Gritsan, A V; Maksimovic, P; Martin, C; Swartz, M; Baringer, P; Bean, A; Benelli, G; Gray, J; Kenny, R P; Murray, M; Noonan, D; Sanders, S; Sekaric, J; Stringer, R; Wang, Q; Wood, J S; Barfuss, A F; Chakaberia, I; Ivanov, A; Khalil, S; Makouski, M; Maravin, Y; Saini, L K; Shrestha, S; Svintradze, I; Gronberg, J; Lange, D; Rebassoo, F; Wright, D; Baden, A; Calvert, B; Eno, S C; Gomez, J A; Hadley, N J; Kellogg, R G; Kolberg, T; Lu, Y; Marionneau, M; Mignerey, A C; Pedro, K; Skuja, A; Temple, J; Tonjes, M B; Tonwar, S C; Apyan, A; Barbieri, R; Bauer, G; Busza, W; Cali, I A; Chan, M; Di Matteo, L; Dutta, V; Gomez Ceballos, G; Goncharov, M; Gulhan, D; Klute, M; Lai, Y S; Lee, Y-J; Levin, A; Luckey, P D; Ma, T; Paus, C; Ralph, D; Roland, C; Roland, G; Stephans, G S F; Stöckli, F; Sumorok, K; Velicanu, D; Veverka, J; Wyslouch, B; Yang, M; Yoon, A S; Zanetti, M; Zhukova, V; Dahmes, B; De Benedetti, A; Gude, A; Kao, S C; Klapoetke, K; Kubota, Y; Mans, J; Pastika, N; Rusack, R; Singovsky, A; Tambe, N; Turkewitz, J; Acosta, J G; Cremaldi, L M; Kroeger, R; Oliveros, S; Perera, L; Sanders, D A; Summers, D; Avdeeva, E; Bloom, K; Bose, S; Claes, D R; Dominguez, A; Gonzalez Suarez, R; Keller, J; Knowlton, D; Kravchenko, I; Lazo-Flores, J; Malik, S; Meier, F; Snow, G R; Dolen, J; Godshalk, A; Iashvili, I; Jain, S; Kharchilava, A; Kumar, A; Rappoccio, S; Alverson, G; Barberis, E; Baumgartel, D; Chasco, M; Haley, J; Massironi, A; Nash, D; Orimoto, T; Trocino, D; Wood, D; Zhang, J; Anastassov, A; Hahn, K A; Kubik, A; Lusito, L; Mucia, N; Odell, N; Pollack, B; Pozdnyakov, A; Schmitt, M; Stoynev, S; Sung, K; Velasco, M; Won, S; Berry, D; Brinkerhoff, A; Chan, K M; Drozdetskiy, A; Hildreth, M; Jessop, C; Karmgard, D J; Kellams, N; Kolb, J; Lannon, K; Luo, W; Lynch, S; Marinelli, N; Morse, D M; Pearson, T; Planer, M; Ruchti, R; Slaunwhite, J; Valls, N; Wayne, M; Wolf, M; Woodard, A; Antonelli, L; Bylsma, B; Durkin, L S; Flowers, S; Hill, C; Hughes, R; Kotov, K; Ling, T Y; Puigh, D; Rodenburg, M; Smith, G; Vuosalo, C; Winer, B L; Wolfe, H; Wulsin, H W; Berry, E; Elmer, P; Halyo, V; Hebda, P; Hunt, A; Jindal, P; Koay, S A; Lujan, P; Marlow, D; Medvedeva, T; Mooney, M; Olsen, J; Piroué, P; Quan, X; Raval, A; Saka, H; Stickland, D; Tully, C; Werner, J S; Zenz, S C; Zuranski, A; Brownson, E; Lopez, A; Mendez, H; Ramirez Vargas, J E; Alagoz, E; Benedetti, D; Bolla, G; Bortoletto, D; De Mattia, M; Everett, A; Hu, Z; Jha, M K; Jones, M; Jung, K; Kress, M; Leonardo, N; Lopes Pegna, D; Maroussov, V; Merkel, P; Miller, D H; Neumeister, N; Radburn-Smith, B C; Shipsey, I; Silvers, D; Svyatkovskiy, A; Wang, F; Xie, W; Xu, L; Yoo, H D; Zablocki, J; Zheng, Y; Parashar, N; Adair, A; Akgun, B; Ecklund, K M; Geurts, F J M; Li, W; Michlin, B; Padley, B P; Redjimi, R; Roberts, J; Zabel, J; Betchart, B; Bodek, A; Covarelli, R; de Barbaro, P; Demina, R; Eshaq, Y; Ferbel, T; Garcia-Bellido, A; Goldenzweig, P; Han, J; Harel, A; Miner, D C; Petrillo, G; Vishnevskiy, D; Zielinski, M; Bhatti, A; Ciesielski, R; Demortier, L; Goulianos, K; Lungu, G; Mesropian, C; Arora, S; Barker, A; Chou, J P; Contreras-Campana, C; Contreras-Campana, E; Duggan, D; Ferencek, D; Gershtein, Y; Gray, R; Halkiadakis, E; Hidas, D; Lath, A; Panwalkar, S; Park, M; Patel, R; Rekovic, V; Robles, J; Salur, S; Schnetzer, S; Seitz, C; Somalwar, S; Stone, R; Thomas, S; Thomassen, P; Walker, M; Rose, K; Spanier, S; Yang, Z C; York, A; Bouhali, O; Eusebi, R; Flanagan, W; Gilmore, J; Kamon, T; Khotilovich, V; Krutelyov, V; Montalvo, R; Osipenkov, I; Pakhotin, Y; Perloff, A; Roe, J; Safonov, A; Sakuma, T; Suarez, I; Tatarinov, A; Toback, D; Akchurin, N; Cowden, C; Damgov, J; Dragoiu, C; Dudero, P R; Faulkner, J; Kovitanggoon, K; Kunori, S; Lee, S W; Libeiro, T; Volobouev, I; Appelt, E; Delannoy, A G; Greene, S; Gurrola, A; Johns, W; Maguire, C; Melo, A; Sharma, M; Sheldon, P; Snook, B; Tuo, S; Velkovska, J; Arenton, M W; Boutle, S; Cox, B; Francis, B; Goodell, J; Hirosky, R; Ledovskoy, A; Li, H; Lin, C; Neu, C; Wood, J; Gollapinni, S; Harr, R; Karchin, P E; Kottachchi Kankanamge Don, C; Lamichhane, P; Belknap, D A; Borrello, L; Carlsmith, D; Cepeda, M; Dasu, S; Duric, S; Friis, E; Grothe, M; Hall-Wilton, R; Herndon, M; Hervé, A; Klabbers, P; Klukas, J; Lanaro, A; Lazaridis, C; Levine, A; Loveless, R; Mohapatra, A; Ojalvo, I; Perry, T; Pierro, G A; Polese, G; Ross, I; Sarangi, T; Savin, A; Smith, W H; Woods, N

Measurements are reported of the WZ and ZZ production cross sections in proton-proton collisions at [Formula: see text][Formula: see text] in final states where one Z boson decays to b-tagged jets. The other gauge boson, either W or Z, is detected through its leptonic decay (either [Formula: see text], [Formula: see text] or [Formula: see text], [Formula: see text], or [Formula: see text]). The results are based on data corresponding to an integrated luminosity of 18.9 fb[Formula: see text] collected with the CMS detector at the Large Hadron Collider. The measured cross sections, [Formula: see text] and [Formula: see text], are consistent with next-to-leading order quantum chromodynamics calculations.

Electron efficiency measurements with the ATLAS detector using 2012 LHC proton-proton collision data.

PubMed

Aaboud, M; Aad, G; Abbott, B; Abdallah, J; Abdinov, O; Abeloos, B; AbouZeid, O S; Abraham, N L; Abramowicz, H; Abreu, H; Abreu, R; Abulaiti, Y; Acharya, B S; Adachi, S; Adamczyk, L; Adams, D L; Adelman, J; Adomeit, S; Adye, T; Affolder, A A; Agatonovic-Jovin, T; Aguilar-Saavedra, J A; Ahlen, S P; Ahmadov, F; Aielli, G; Akerstedt, H; Åkesson, T P A; Akimov, A V; Alberghi, G L; Albert, J; Albrand, S; Alconada Verzini, M J; Aleksa, M; Aleksandrov, I N; Alexa, C; Alexander, G; Alexopoulos, T; Alhroob, M; Ali, B; Aliev, M; Alimonti, G; Alison, J; Alkire, S P; Allbrooke, B M M; Allen, B W; Allport, P P; Aloisio, A; Alonso, A; Alonso, F; Alpigiani, C; Alshehri, A A; Alstaty, M; Alvarez Gonzalez, B; Álvarez Piqueras, D; Alviggi, M G; Amadio, B T; Amaral Coutinho, Y; Amelung, C; Amidei, D; Amor Dos Santos, S P; Amorim, A; Amoroso, S; Amundsen, G; Anastopoulos, C; Ancu, L S; Andari, N; Andeen, T; Anders, C F; Anders, J K; Anderson, K J; Andreazza, A; Andrei, V; Angelidakis, S; Angelozzi, I; Angerami, A; Anghinolfi, F; Anisenkov, A V; Anjos, N; Annovi, A; Antel, C; Antonelli, M; Antonov, A; Antrim, D J; Anulli, F; Aoki, M; Aperio Bella, L; Arabidze, G; Arai, Y; Araque, J P; Arce, A T H; Arduh, F A; Arguin, J-F; Argyropoulos, S; Arik, M; Armbruster, A J; Armitage, L J; Arnaez, O; Arnold, H; Arratia, M; Arslan, O; Artamonov, A; Artoni, G; Artz, S; Asai, S; Asbah, N; Ashkenazi, A; Åsman, B; Asquith, L; Assamagan, K; Astalos, R; Atkinson, M; Atlay, N B; Augsten, K; Avolio, G; Axen, B; Ayoub, M K; Azuelos, G; Baak, M A; Baas, A E; Baca, M J; Bachacou, H; Bachas, K; Backes, M; Backhaus, M; Bagiacchi, P; Bagnaia, P; Bai, Y; Baines, J T; Bajic, M; Baker, O K; Baldin, E M; Balek, P; Balestri, T; Balli, F; Balunas, W K; Banas, E; Banerjee, Sw; Bannoura, A A E; Barak, L; Barberio, E L; Barberis, D; Barbero, M; Barillari, T; Barisits, M-S; Barklow, T; Barlow, N; Barnes, S L; Barnett, B M; Barnett, R M; Barnovska-Blenessy, Z; Baroncelli, A; Barone, G; Barr, A J; Barranco Navarro, L; Barreiro, F; da Costa, J Barreiro Guimarães; Bartoldus, R; Barton, A E; Bartos, P; Basalaev, A; Bassalat, A; Bates, R L; Batista, S J; Batley, J R; Battaglia, M; Bauce, M; Bauer, F; Bawa, H S; Beacham, J B; Beattie, M D; Beau, T; Beauchemin, P H; Bechtle, P; Beck, H P; Becker, K; Becker, M; Beckingham, M; Becot, C; Beddall, A J; Beddall, A; Bednyakov, V A; Bedognetti, M; Bee, C P; Beemster, L J; Beermann, T A; Begel, M; Behr, J K; Bell, A S; Bella, G; Bellagamba, L; Bellerive, A; Bellomo, M; Belotskiy, K; Beltramello, O; Belyaev, N L; Benary, O; Benchekroun, D; Bender, M; Bendtz, K; Benekos, N; Benhammou, Y; Benhar Noccioli, E; Benitez, J; Benjamin, D P; Bensinger, J R; Bentvelsen, S; Beresford, L; Beretta, M; Berge, D; Bergeaas Kuutmann, E; Berger, N; Beringer, J; Berlendis, S; Bernard, N R; Bernius, C; Bernlochner, F U; Berry, T; Berta, P; Bertella, C; Bertoli, G; Bertolucci, F; Bertram, I A; Bertsche, C; Bertsche, D; Besjes, G J; Bessidskaia Bylund, O; Bessner, M; Besson, N; Betancourt, C; Bethani, A; Bethke, S; Bevan, A J; Bianchi, R M; Bianco, M; Biebel, O; Biedermann, D; Bielski, R; Biesuz, N V; Biglietti, M; De Mendizabal, J Bilbao; Billoud, T R V; Bilokon, H; Bindi, M; Bingul, A; Bini, C; Biondi, S; Bisanz, T; Bjergaard, D M; Black, C W; Black, J E; Black, K M; Blackburn, D; Blair, R E; Blazek, T; Bloch, I; Blocker, C; Blue, A; Blum, W; Blumenschein, U; Blunier, S; Bobbink, G J; Bobrovnikov, V S; Bocchetta, S S; Bocci, A; Bock, C; Boehler, M; Boerner, D; Bogaerts, J A; Bogavac, D; Bogdanchikov, A G; Bohm, C; Boisvert, V; Bokan, P; Bold, T; Boldyrev, A S; Bomben, M; Bona, M; Boonekamp, M; Borisov, A; Borissov, G; Bortfeldt, J; Bortoletto, D; Bortolotto, V; Bos, K; Boscherini, D; Bosman, M; Bossio Sola, J D; Boudreau, J; Bouffard, J; Bouhova-Thacker, E V; Boumediene, D; Bourdarios, C; Boutle, S K; Boveia, A; Boyd, J; Boyko, I R; Bracinik, J; Brandt, A; Brandt, G; Brandt, O; Bratzler, U; Brau, B; Brau, J E; Breaden Madden, W D; Brendlinger, K; Brennan, A J; Brenner, L; Brenner, R; Bressler, S; Bristow, T M; Britton, D; Britzger, D; Brochu, F M; Brock, I; Brock, R; Brooijmans, G; Brooks, T; Brooks, W K; Brosamer, J; Brost, E; Broughton, J H; de Renstrom, P A Bruckman; Bruncko, D; Bruneliere, R; Bruni, A; Bruni, G; Bruni, L S; Brunt, B H; Bruschi, M; Bruscino, N; Bryant, P; Bryngemark, L; Buanes, T; Buat, Q; Buchholz, P; Buckley, A G; Budagov, I A; Buehrer, F; Bugge, M K; Bulekov, O; Bullock, D; Burckhart, H; Burdin, S; Burgard, C D; Burger, A M; Burghgrave, B; Burka, K; Burke, S; Burmeister, I; Burr, J T P; Busato, E; Büscher, D; Büscher, V; Bussey, P; Butler, J M; Buttar, C M; Butterworth, J M; Butti, P; Buttinger, W; Buzatu, A; Buzykaev, A R; Cabrera Urbán, S; Caforio, D; Cairo, V M; Cakir, O; Calace, N; Calafiura, P; Calandri, A; Calderini, G; Calfayan, P; Callea, G; Caloba, L P; Calvente Lopez, S; Calvet, D; Calvet, S; Calvet, T P; Camacho Toro, R; Camarda, S; Camarri, P; Cameron, D; Caminal Armadans, R; Camincher, C; Campana, S; Campanelli, M; Camplani, A; Campoverde, A; Canale, V; Canepa, A; Cano Bret, M; Cantero, J; Cao, T; Capeans Garrido, M D M; Caprini, I; Caprini, M; Capua, M; Carbone, R M; Cardarelli, R; Cardillo, F; Carli, I; Carli, T; Carlino, G; Carlson, B T; Carminati, L; Carney, R M D; Caron, S; Carquin, E; Carrillo-Montoya, G D; Carter, J R; Carvalho, J; Casadei, D; Casado, M P; Casolino, M; Casper, D W; Castaneda-Miranda, E; Castelijn, R; Castelli, A; Castillo Gimenez, V; Castro, N F; Catinaccio, A; Catmore, J R; Cattai, A; Caudron, J; Cavaliere, V; Cavallaro, E; Cavalli, D; Cavalli-Sforza, M; Cavasinni, V; Ceradini, F; Cerda Alberich, L; Cerqueira, A S; Cerri, A; Cerrito, L; Cerutti, F; Cervelli, A; Cetin, S A; Chafaq, A; Chakraborty, D; Chan, S K; Chan, Y L; Chang, P; Chapman, J D; Charlton, D G; Chatterjee, A; Chau, C C; Chavez Barajas, C A; Che, S; Cheatham, S; Chegwidden, A; Chekanov, S; Chekulaev, S V; Chelkov, G A; Chelstowska, M A; Chen, C; Chen, H; Chen, S; Chen, S; Chen, X; Chen, Y; Cheng, H C; Cheng, H J; Cheng, Y; Cheplakov, A; Cheremushkina, E; El Moursli, R Cherkaoui; Chernyatin, V; Cheu, E; Chevalier, L; Chiarella, V; Chiarelli, G; Chiodini, G; Chisholm, A S; Chitan, A; Chizhov, M V; Choi, K; Chomont, A R; Chouridou, S; Chow, B K B; Christodoulou, V; Chromek-Burckhart, D; Chudoba, J; Chuinard, A J; Chwastowski, J J; Chytka, L; Ciapetti, G; Ciftci, A K; Cinca, D; Cindro, V; Cioara, I A; Ciocca, C; Ciocio, A; Cirotto, F; Citron, Z H; Citterio, M; Ciubancan, M; Clark, A; Clark, B L; Clark, M R; Clark, P J; Clarke, R N; Clement, C; Coadou, Y; Cobal, M; Coccaro, A; Cochran, J; Colasurdo, L; Cole, B; Colijn, A P; Collot, J; Colombo, T; Conde Muiño, P; Coniavitis, E; Connell, S H; Connelly, I A; Consorti, V; Constantinescu, S; Conti, G; Conventi, F; Cooke, M; Cooper, B D; Cooper-Sarkar, A M; Cormier, F; Cormier, K J R; Cornelissen, T; Corradi, M; Corriveau, F; Cortes-Gonzalez, A; Cortiana, G; Costa, G; Costa, M J; Costanzo, D; Cottin, G; Cowan, G; Cox, B E; Cranmer, K; Crawley, S J; Cree, G; Crépé-Renaudin, S; Crescioli, F; Cribbs, W A; Crispin Ortuzar, M; Cristinziani, M; Croft, V; Crosetti, G; Cueto, A; Cuhadar Donszelmann, T; Cummings, J; Curatolo, M; Cúth, J; Czirr, H; Czodrowski, P; D'amen, G; D'Auria, S; D'Onofrio, M; Da Cunha Sargedas De Sousa, M J; Da Via, C; Dabrowski, W; Dado, T; Dai, T; Dale, O; Dallaire, F; Dallapiccola, C; Dam, M; Dandoy, J R; Dang, N P; Daniells, A C; Dann, N S; Danninger, M; Dano Hoffmann, M; Dao, V; Darbo, G; Darmora, S; Dassoulas, J; Dattagupta, A; Davey, W; David, C; Davidek, T; Davies, M; Davison, P; Dawe, E; Dawson, I; De, K; de Asmundis, R; De Benedetti, A; De Castro, S; De Cecco, S; De Groot, N; de Jong, P; De la Torre, H; De Lorenzi, F; De Maria, A; De Pedis, D; De Salvo, A; De Sanctis, U; De Santo, A; De Vivie De Regie, J B; Dearnaley, W J; Debbe, R; Debenedetti, C; Dedovich, D V; Dehghanian, N; Deigaard, I; Del Gaudio, M; Del Peso, J; Del Prete, T; Delgove, D; Deliot, F; Delitzsch, C M; Dell'Acqua, A; Dell'Asta, L; Dell'Orso, M; Della Pietra, M; Della Volpe, D; Delmastro, M; Delsart, P A; DeMarco, D A; Demers, S; Demichev, M; Demilly, A; Denisov, S P; Denysiuk, D; Derendarz, D; Derkaoui, J E; Derue, F; Dervan, P; Desch, K; Deterre, C; Dette, K; Deviveiros, P O; Dewhurst, A; Dhaliwal, S; Di Ciaccio, A; Di Ciaccio, L; Di Clemente, W K; Di Donato, C; Di Girolamo, A; Di Girolamo, B; Di Micco, B; Di Nardo, R; Di Petrillo, K F; Di Simone, A; Di Sipio, R; Di Valentino, D; Diaconu, C; Diamond, M; Dias, F A; Diaz, M A; Diehl, E B; Dietrich, J; Díez Cornell, S; Dimitrievska, A; Dingfelder, J; Dita, P; Dita, S; Dittus, F; Djama, F; Djobava, T; Djuvsland, J I; do Vale, M A B; Dobos, D; Dobre, M; Doglioni, C; Dolejsi, J; Dolezal, Z; Donadelli, M; Donati, S; Dondero, P; Donini, J; Dopke, J; Doria, A; Dova, M T; Doyle, A T; Drechsler, E; Dris, M; Du, Y; Duarte-Campderros, J; Duchovni, E; Duckeck, G; Ducu, O A; Duda, D; Dudarev, A; Dudder, A Chr; Duffield, E M; Duflot, L; Dührssen, M; Dumancic, M; Duncan, A K; Dunford, M; Duran Yildiz, H; Düren, M; Durglishvili, A; Duschinger, D; Dutta, B; Dyndal, M; Eckardt, C; Ecker, K M; Edgar, R C; Edwards, N C; Eifert, T; Eigen, G; Einsweiler, K; Ekelof, T; Kacimi, M El; Ellajosyula, V; Ellert, M; Elles, S; Ellinghaus, F; Elliot, A A; Ellis, N; Elmsheuser, J; Elsing, M; Emeliyanov, D; Enari, Y; Endner, O C; Ennis, J S; Erdmann, J; Ereditato, A; Ernis, G; Ernst, J; Ernst, M; Errede, S; Ertel, E; Escalier, M; Esch, H; Escobar, C; Esposito, B; Etienvre, A I; Etzion, E; Evans, H; Ezhilov, A; Fabbri, F; Fabbri, L; Facini, G; Fakhrutdinov, R M; Falciano, S; Falla, R J; Faltova, J; Fang, Y; Fanti, M; Farbin, A; Farilla, A; Farina, C; Farina, E M; Farooque, T; Farrell, S; Farrington, S M; Farthouat, P; Fassi, F; Fassnacht, P; Fassouliotis, D; Faucci Giannelli, M; Favareto, A; Fawcett, W J; Fayard, L; Fedin, O L; Fedorko, W; Feigl, S; Feligioni, L; Feng, C; Feng, E J; Feng, H; Fenyuk, A B; Feremenga, L; Fernandez Martinez, P; Fernandez Perez, S; Ferrando, J; Ferrari, A; Ferrari, P; Ferrari, R; de Lima, D E Ferreira; Ferrer, A; Ferrere, D; Ferretti, C; Fiedler, F; Filipčič, A; Filipuzzi, M; Filthaut, F; Fincke-Keeler, M; Finelli, K D; Fiolhais, M C N; Fiorini, L; Fischer, A; Fischer, C; Fischer, J; Fisher, W C; Flaschel, N; Fleck, I; Fleischmann, P; Fletcher, G T; Fletcher, R R M; Flick, T; Flierl, B M; Flores Castillo, L R; Flowerdew, M J; Forcolin, G T; Formica, A; Forti, A; Foster, A G; Fournier, D; Fox, H; Fracchia, S; Francavilla, P; Franchini, M; Francis, D; Franconi, L; Franklin, M; Frate, M; Fraternali, M; Freeborn, D; Fressard-Batraneanu, S M; Friedrich, F; Froidevaux, D; Frost, J A; Fukunaga, C; Fullana Torregrosa, E; Fusayasu, T; Fuster, J; Gabaldon, C; Gabizon, O; Gabrielli, A; Gabrielli, A; Gach, G P; Gadatsch, S; Gagliardi, G; Gagnon, L G; Gagnon, P; Galea, C; Galhardo, B; Gallas, E J; Gallop, B J; Gallus, P; Galster, G; Gan, K K; Ganguly, S; Gao, J; Gao, Y; Gao, Y S; Garay Walls, F M; García, C; García Navarro, J E; Garcia-Sciveres, M; Gardner, R W; Garelli, N; Garonne, V; Gascon Bravo, A; Gasnikova, K; Gatti, C; Gaudiello, A; Gaudio, G; Gauthier, L; Gavrilenko, I L; Gay, C; Gaycken, G; Gazis, E N; Gecse, Z; Gee, C N P; Geich-Gimbel, Ch; Geisen, M; Geisler, M P; Gellerstedt, K; Gemme, C; Genest, M H; Geng, C; Gentile, S; Gentsos, C; George, S; Gerbaudo, D; Gershon, A; Ghasemi, S; Ghneimat, M; Giacobbe, B; Giagu, S; Giannetti, P; Gibson, S M; Gignac, M; Gilchriese, M; Gillam, T P S; Gillberg, D; Gilles, G; Gingrich, D M; Giokaris, N; Giordani, M P; Giorgi, F M; Giraud, P F; Giromini, P; Giugni, D; Giuli, F; Giuliani, C; Giulini, M; Gjelsten, B K; Gkaitatzis, S; Gkialas, I; Gkougkousis, E L; Gladilin, L K; Glasman, C; Glatzer, J; Glaysher, P C F; Glazov, A; Goblirsch-Kolb, M; Godlewski, J; Goldfarb, S; Golling, T; Golubkov, D; Gomes, A; Gonçalo, R; Da Costa, J Goncalves Pinto Firmino; Gonella, G; Gonella, L; Gongadze, A; de la Hoz, S González; Gonzalez-Sevilla, S; Goossens, L; Gorbounov, P A; Gordon, H A; Gorelov, I; Gorini, B; Gorini, E; Gorišek, A; Goshaw, A T; Gössling, C; Gostkin, M I; Goudet, C R; Goujdami, D; Goussiou, A G; Govender, N; Gozani, E; Graber, L; Grabowska-Bold, I; Gradin, P O J; Grafström, P; Gramling, J; Gramstad, E; Grancagnolo, S; Gratchev, V; Gravila, P M; Gray, H M; Graziani, E; Greenwood, Z D; Grefe, C; Gregersen, K; Gregor, I M; Grenier, P; Grevtsov, K; Griffiths, J; Grillo, A A; Grimm, K; Grinstein, S; Gris, Ph; Grivaz, J-F; Groh, S; Gross, E; Grosse-Knetter, J; Grossi, G C; Grout, Z J; Guan, L; Guan, W; Guenther, J; Guescini, F; Guest, D; Gueta, O; Gui, B; Guido, E; Guillemin, T; Guindon, S; Gul, U; Gumpert, C; Guo, J; Guo, W; Guo, Y; Gupta, R; Gupta, S; Gustavino, G; Gutierrez, P; Gutierrez Ortiz, N G; Gutschow, C; Guyot, C; Gwenlan, C; Gwilliam, C B; Haas, A; Haber, C; Hadavand, H K; Hadef, A; Hageböck, S; Hagihara, M; Hakobyan, H; Haleem, M; Haley, J; Halladjian, G; Hallewell, G D; Hamacher, K; Hamal, P; Hamano, K; Hamilton, A; Hamity, G N; Hamnett, P G; Han, L; Han, S; Hanagaki, K; Hanawa, K; Hance, M; Haney, B; Hanke, P; Hanna, R; Hansen, J B; Hansen, J D; Hansen, M C; Hansen, P H; Hara, K; Hard, A S; Harenberg, T; Hariri, F; Harkusha, S; Harrington, R D; Harrison, P F; Hartjes, F; Hartmann, N M; Hasegawa, M; Hasegawa, Y; Hasib, A; Hassani, S; Haug, S; Hauser, R; Hauswald, L; Havranek, M; Hawkes, C M; Hawkings, R J; Hayakawa, D; Hayden, D; Hays, C P; Hays, J M; Hayward, H S; Haywood, S J; Head, S J; Heck, T; Hedberg, V; Heelan, L; Heim, S; Heim, T; Heinemann, B; Heinrich, J J; Heinrich, L; Heinz, C; Hejbal, J; Helary, L; Hellman, S; Helsens, C; Henderson, J; Henderson, R C W; Heng, Y; Henkelmann, S; Henriques Correia, A M; Henrot-Versille, S; Herbert, G H; Herde, H; Herget, V; Hernández Jiménez, Y; Herten, G; Hertenberger, R; Hervas, L; Hesketh, G G; Hessey, N P; Hetherly, J W; Higón-Rodriguez, E; Hill, E; Hill, J C; Hiller, K H; Hillier, S J; Hinchliffe, I; Hines, E; Hirose, M; Hirschbuehl, D; Hladik, O; Hoad, X; Hobbs, J; Hod, N; Hodgkinson, M C; Hodgson, P; Hoecker, A; Hoeferkamp, M R; Hoenig, F; Hohn, D; Holmes, T R; Homann, M; Honda, S; Honda, T; Hong, T M; Hooberman, B H; Hopkins, W H; Horii, Y; Horton, A J; Hostachy, J-Y; Hou, S; Hoummada, A; Howarth, J; Hoya, J; Hrabovsky, M; Hristova, I; Hrivnac, J; Hryn'ova, T; Hrynevich, A; Hsu, P J; Hsu, S-C; Hu, Q; Hu, S; Huang, Y; Hubacek, Z; Hubaut, F; Huegging, F; Huffman, T B; Hughes, E W; Hughes, G; Huhtinen, M; Huo, P; Huseynov, N; Huston, J; Huth, J; Iacobucci, G; Iakovidis, G; Ibragimov, I; Iconomidou-Fayard, L; Ideal, E; Iengo, P; Igonkina, O; Iizawa, T; Ikegami, Y; Ikeno, M; Ilchenko, Y; Iliadis, D; Ilic, N; Introzzi, G; Ioannou, P; Iodice, M; Iordanidou, K; Ippolito, V; Ishijima, N; Ishino, M; Ishitsuka, M; Issever, C; Istin, S; Ito, F; Iturbe Ponce, J M; Iuppa, R; Iwasaki, H; Izen, J M; Izzo, V; Jabbar, S; Jackson, B; Jackson, P; Jain, V; Jakobi, K B; Jakobs, K; Jakobsen, S; Jakoubek, T; Jamin, D O; Jana, D K; Jansky, R; Janssen, J; Janus, M; Janus, P A; Jarlskog, G; Javadov, N; Javůrek, T; Javurkova, M; Jeanneau, F; Jeanty, L; Jejelava, J; Jeng, G-Y; Jenni, P; Jeske, C; Jézéquel, S; Ji, H; Jia, J; Jiang, H; Jiang, Y; Jiang, Z; Jiggins, S; Jimenez Pena, J; Jin, S; Jinaru, A; Jinnouchi, O; Jivan, H; Johansson, P; Johns, K A; Johnson, C A; Johnson, W J; Jon-And, K; Jones, G; Jones, R W L; Jones, S; Jones, T J; Jongmanns, J; Jorge, P M; Jovicevic, J; Ju, X; Juste Rozas, A; Köhler, M K; Kaczmarska, A; Kado, M; Kagan, H; Kagan, M; Kahn, S J; Kaji, T; Kajomovitz, E; Kalderon, C W; Kaluza, A; Kama, S; Kamenshchikov, A; Kanaya, N; Kaneti, S; Kanjir, L; Kantserov, V A; Kanzaki, J; Kaplan, B; Kaplan, L S; Kapliy, A; Kar, D; Karakostas, K; Karamaoun, A; Karastathis, N; Kareem, M J; Karentzos, E; Karnevskiy, M; Karpov, S N; Karpova, Z M; Karthik, K; Kartvelishvili, V; Karyukhin, A N; Kasahara, K; Kashif, L; Kass, R D; Kastanas, A; Kataoka, Y; Kato, C; Katre, A; Katzy, J; Kawade, K; Kawagoe, K; Kawamoto, T; Kawamura, G; Kazanin, V F; Keeler, R; Kehoe, R; Keller, J S; Kempster, J J; Keoshkerian, H; Kepka, O; Kerševan, B P; Kersten, S; Keyes, R A; Khader, M; Khalil-Zada, F; Khanov, A; Kharlamov, A G; Kharlamova, T; Khoo, T J; Khovanskiy, V; Khramov, E; Khubua, J; Kido, S; Kilby, C R; Kim, H Y; Kim, S H; Kim, Y K; Kimura, N; Kind, O M; King, B T; King, M; Kirk, J; Kiryunin, A E; Kishimoto, T; Kisielewska, D; Kiss, F; Kiuchi, K; Kivernyk, O; Kladiva, E; Klein, M H; Klein, M; Klein, U; Kleinknecht, K; Klimek, P; Klimentov, A; Klingenberg, R; Klioutchnikova, T; Kluge, E-E; Kluit, P; Kluth, S; Knapik, J; Kneringer, E; Knoops, E B F G; Knue, A; Kobayashi, A; Kobayashi, D; Kobayashi, T; Kobel, M; Kocian, M; Kodys, P; Koffas, T; Koffeman, E; Köhler, N M; Koi, T; Kolanoski, H; Kolb, M; Koletsou, I; Komar, A A; Komori, Y; Kondo, T; Kondrashova, N; Köneke, K; König, A C; Kono, T; Konoplich, R; Konstantinidis, N; Kopeliansky, R; Koperny, S; Kopp, A K; Korcyl, K; Kordas, K; Korn, A; Korol, A A; Korolkov, I; Korolkova, E V; Kortner, O; Kortner, S; Kosek, T; Kostyukhin, V V; Kotwal, A; Koulouris, A; Kourkoumeli-Charalampidi, A; Kourkoumelis, C; Kouskoura, V; Kowalewska, A B; Kowalewski, R; Kowalski, T Z; Kozakai, C; Kozanecki, W; Kozhin, A S; Kramarenko, V A; Kramberger, G; Krasnopevtsev, D; Krasny, M W; Krasznahorkay, A; Kravchenko, A; Kretz, M; Kretzschmar, J; Kreutzfeldt, K; Krieger, P; Krizka, K; Kroeninger, K; Kroha, H; Kroll, J; Kroseberg, J; Krstic, J; Kruchonak, U; Krüger, H; Krumnack, N; Kruse, M C; Kruskal, M; Kubota, T; Kucuk, H; Kuday, S; Kuechler, J T; Kuehn, S; Kugel, A; Kuger, F; Kuhl, T; Kukhtin, V; Kukla, R; Kulchitsky, Y; Kuleshov, S; Kuna, M; Kunigo, T; Kupco, A; Kuprash, O; Kurashige, H; Kurchaninov, L L; Kurochkin, Y A; Kurth, M G; Kus, V; Kuwertz, E S; Kuze, M; Kvita, J; Kwan, T; Kyriazopoulos, D; La Rosa, A; Rosa Navarro, J L La; La Rotonda, L; Lacasta, C; Lacava, F; Lacey, J; Lacker, H; Lacour, D; Ladygin, E; Lafaye, R; Laforge, B; Lagouri, T; Lai, S; Lammers, S; Lampl, W; Lançon, E; Landgraf, U; Landon, M P J; Lanfermann, M C; Lang, V S; Lange, J C; Lankford, A J; Lanni, F; Lantzsch, K; Lanza, A; Laplace, S; Lapoire, C; Laporte, J F; Lari, T; Lasagni Manghi, F; Lassnig, M; Laurelli, P; Lavrijsen, W; Law, A T; Laycock, P; Lazovich, T; Lazzaroni, M; Le, B; Le Dortz, O; Le Guirriec, E; Le Quilleuc, E P; LeBlanc, M; LeCompte, T; Ledroit-Guillon, F; Lee, C A; Lee, S C; Lee, L; Lefebvre, B; Lefebvre, G; Lefebvre, M; Legger, F; Leggett, C; Lehan, A; Lehmann Miotto, G; Lei, X; Leight, W A; Leister, A G; Leite, M A L; Leitner, R; Lellouch, D; Lemmer, B; Leney, K J C; Lenz, T; Lenzi, B; Leone, R; Leone, S; Leonidopoulos, C; Leontsinis, S; Lerner, G; Leroy, C; Lesage, A A J; Lester, C G; Lester, C M; Levchenko, M; Levêque, J; Levin, D; Levinson, L J; Levy, M; Lewis, D; Leyton, M; Li, B; Li, C; Li, H; Li, L; Li, L; Li, Q; Li, S; Li, X; Li, Y; Liang, Z; Liberti, B; Liblong, A; Lichard, P; Lie, K; Liebal, J; Liebig, W; Limosani, A; Lin, S C; Lin, T H; Lindquist, B E; Lionti, A E; Lipeles, E; Lipniacka, A; Lisovyi, M; Liss, T M; Lister, A; Litke, A M; Liu, B; Liu, D; Liu, H; Liu, H; Liu, J; Liu, J B; Liu, K; Liu, L; Liu, M; Liu, Y L; Liu, Y; Livan, M; Lleres, A; Llorente Merino, J; Lloyd, S L; Lo Sterzo, F; Lobodzinska, E M; Loch, P; Loebinger, F K; Loew, K M; Loginov, A; Lohse, T; Lohwasser, K; Lokajicek, M; Long, B A; Long, J D; Long, R E; Longo, L; Looper, K A; Lopez, J A; Lopez Mateos, D; Lopez Paredes, B; Lopez Paz, I; Lopez Solis, A; Lorenz, J; Lorenzo Martinez, N; Losada, M; Lösel, P J; Lou, X; Lounis, A; Love, J; Love, P A; Lu, H; Lu, N; Lubatti, H J; Luci, C; Lucotte, A; Luedtke, C; Luehring, F; Lukas, W; Luminari, L; Lundberg, O; Lund-Jensen, B; Luzi, P M; Lynn, D; Lysak, R; Lytken, E; Lyubushkin, V; Ma, H; Ma, L L; Ma, Y; Maccarrone, G; Macchiolo, A; Macdonald, C M; Maček, B; Machado Miguens, J; Madaffari, D; Madar, R; Maddocks, H J; Mader, W F; Madsen, A; Maeda, J; Maeland, S; Maeno, T; Maevskiy, A; Magradze, E; Mahlstedt, J; Maiani, C; Maidantchik, C; Maier, A A; Maier, T; Maio, A; Majewski, S; Makida, Y; Makovec, N; Malaescu, B; Malecki, Pa; Maleev, V P; Malek, F; Mallik, U; Malon, D; Malone, C; Maltezos, S; Malyukov, S; Mamuzic, J; Mancini, G; Mandelli, L; Mandić, I; Maneira, J; de Andrade Filho, L Manhaes; Manjarres Ramos, J; Mann, A; Manousos, A; Mansoulie, B; Mansour, J D; Mantifel, R; Mantoani, M; Manzoni, S; Mapelli, L; Marceca, G; March, L; Marchiori, G; Marcisovsky, M; Marjanovic, M; Marley, D E; Marroquim, F; Marsden, S P; Marshall, Z; Marti-Garcia, S; Martin, B; Martin, T A; Martin, V J; Martin Dit Latour, B; Martinez, M; Martinez Outschoorn, V I; Martin-Haugh, S; Martoiu, V S; Martyniuk, A C; Marzin, A; Masetti, L; Mashimo, T; Mashinistov, R; Masik, J; Maslennikov, A L; Massa, I; Massa, L; Mastrandrea, P; Mastroberardino, A; Masubuchi, T; Mättig, P; Mattmann, J; Maurer, J; Maxfield, S J; Maximov, D A; Mazini, R; Maznas, I; Mazza, S M; Mc Fadden, N C; Goldrick, G Mc; Mc Kee, S P; McCarn, A; McCarthy, R L; McCarthy, T G; McClymont, L I; McDonald, E F; Mcfayden, J A; Mchedlidze, G; McMahon, S J; McPherson, R A; Medinnis, M; Meehan, S; Mehlhase, S; Mehta, A; Meier, K; Meineck, C; Meirose, B; Melini, D; Mellado Garcia, B R; Melo, M; Meloni, F; Menary, S B; Meng, L; Meng, X T; Mengarelli, A; Menke, S; Meoni, E; Mergelmeyer, S; Mermod, P; Merola, L; Meroni, C; Merritt, F S; Messina, A; Metcalfe, J; Mete, A S; Meyer, C; Meyer, C; Meyer, J-P; Meyer, J; Meyer Zu Theenhausen, H; Miano, F; Middleton, R P; Miglioranzi, S; Mijović, L; Mikenberg, G; Mikestikova, M; Mikuž, M; Milesi, M; Milic, A; Miller, D W; Mills, C; Milov, A; Milstead, D A; Minaenko, A A; Minami, Y; Minashvili, I A; Mincer, A I; Mindur, B; Mineev, M; Minegishi, Y; Ming, Y; Mir, L M; Mistry, K P; Mitani, T; Mitrevski, J; Mitsou, V A; Miucci, A; Miyagawa, P S; Mizukami, A; Mjörnmark, J U; Mlynarikova, M; Moa, T; Mochizuki, K; Mogg, P; Mohapatra, S; Molander, S; Moles-Valls, R; Monden, R; Mondragon, M C; Mönig, K; Monk, J; Monnier, E; Montalbano, A; Montejo Berlingen, J; Monticelli, F; Monzani, S; Moore, R W; Morange, N; Moreno, D; Moreno Llácer, M; Morettini, P; Morgenstern, S; Mori, D; Mori, T; Morii, M; Morinaga, M; Morisbak, V; Moritz, S; Morley, A K; Mornacchi, G; Morris, J D; Morvaj, L; Moschovakos, P; Mosidze, M; Moss, H J; Moss, J; Motohashi, K; Mount, R; Mountricha, E; Moyse, E J W; Muanza, S; Mudd, R D; Mueller, F; Mueller, J; Mueller, R S P; Mueller, T; Muenstermann, D; Mullen, P; Mullier, G A; Munoz Sanchez, F J; Murillo Quijada, J A; Murray, W J; Musheghyan, H; Muškinja, M; Myagkov, A G; Myska, M; Nachman, B P; Nackenhorst, O; Nagai, K; Nagai, R; Nagano, K; Nagasaka, Y; Nagata, K; Nagel, M; Nagy, E; Nairz, A M; Nakahama, Y; Nakamura, K; Nakamura, T; Nakano, I; Naranjo Garcia, R F; Narayan, R; Narrias Villar, D I; Naryshkin, I; Naumann, T; Navarro, G; Nayyar, R; Neal, H A; Nechaeva, P Yu; Neep, T J; Negri, A; Negrini, M; Nektarijevic, S; Nellist, C; Nelson, A; Nemecek, S; Nemethy, P; Nepomuceno, A A; Nessi, M; Neubauer, M S; Neumann, M; Neves, R M; Nevski, P; Newman, P R; Nguyen, D H; Nguyen Manh, T; Nickerson, R B; Nicolaidou, R; Nielsen, J; Nikolaenko, V; Nikolic-Audit, I; Nikolopoulos, K; Nilsen, J K; Nilsson, P; Ninomiya, Y; Nisati, A; Nisius, R; Nobe, T; Nomachi, M; Nomidis, I; Nooney, T; Norberg, S; Nordberg, M; Norjoharuddeen, N; Novgorodova, O; Nowak, S; Nozaki, M; Nozka, L; Ntekas, K; Nurse, E; Nuti, F; O'grady, F; O'Neil, D C; O'Rourke, A A; O'Shea, V; Oakham, F G; Oberlack, H; Obermann, T; Ocariz, J; Ochi, A; Ochoa, I; Ochoa-Ricoux, J P; Oda, S; Odaka, S; Ogren, H; Oh, A; Oh, S H; Ohm, C C; Ohman, H; Oide, H; Okawa, H; Okumura, Y; Okuyama, T; Olariu, A; Oleiro Seabra, L F; Olivares Pino, S A; Oliveira Damazio, D; Olszewski, A; Olszowska, J; Onofre, A; Onogi, K; Onyisi, P U E; Oreglia, M J; Oren, Y; Orestano, D; Orlando, N; Orr, R S; Osculati, B; Ospanov, R; Otero Y Garzon, G; Otono, H; Ouchrif, M; Ould-Saada, F; Ouraou, A; Oussoren, K P; Ouyang, Q; Owen, M; Owen, R E; Ozcan, V E; Ozturk, N; Pachal, K; Pacheco Pages, A; Pacheco Rodriguez, L; Padilla Aranda, C; Pagan Griso, S; Paganini, M; Paige, F; Pais, P; Pajchel, K; Palacino, G; Palazzo, S; Palestini, S; Palka, M; Pallin, D; Panagiotopoulou, E St; Panagoulias, I; Pandini, C E; Panduro Vazquez, J G; Pani, P; Panitkin, S; Pantea, D; Paolozzi, L; Papadopoulou, Th D; Papageorgiou, K; Paramonov, A; Paredes Hernandez, D; Parker, A J; Parker, M A; Parker, K A; Parodi, F; Parsons, J A; Parzefall, U; Pascuzzi, V R; Pasqualucci, E; Passaggio, S; Pastore, Fr; Pásztor, G; Pataraia, S; Pater, J R; Pauly, T; Pearce, J; Pearson, B; Pedersen, L E; Pedraza Lopez, S; Pedro, R; Peleganchuk, S V; Penc, O; Peng, C; Peng, H; Penwell, J; Peralva, B S; Perego, M M; Perepelitsa, D V; Perez Codina, E; Perini, L; Pernegger, H; Perrella, S; Peschke, R; Peshekhonov, V D; Peters, K; Peters, R F Y; Petersen, B A; Petersen, T C; Petit, E; Petridis, A; Petridou, C; Petroff, P; Petrolo, E; Petrov, M; Petrucci, F; Pettersson, N E; Peyaud, A; Pezoa, R; Phillips, P W; Piacquadio, G; Pianori, E; Picazio, A; Piccaro, E; Piccinini, M; Pickering, M A; Piegaia, R; Pilcher, J E; Pilkington, A D; Pin, A W J; Pinamonti, M; Pinfold, J L; Pingel, A; Pires, S; Pirumov, H; Pitt, M; Plazak, L; Pleier, M-A; Pleskot, V; Plotnikova, E; Pluth, D; Poettgen, R; Poggioli, L; Pohl, D; Polesello, G; Poley, A; Policicchio, A; Polifka, R; Polini, A; Pollard, C S; Polychronakos, V; Pommès, K; Pontecorvo, L; Pope, B G; Popeneciu, G A; Poppleton, A; Pospisil, S; Potamianos, K; Potrap, I N; Potter, C J; Potter, C T; Poulard, G; Poveda, J; Pozdnyakov, V; Pozo Astigarraga, M E; Pralavorio, P; Pranko, A; Prell, S; Price, D; Price, L E; Primavera, M; Prince, S; Prokofiev, K; Prokoshin, F; Protopopescu, S; Proudfoot, J; Przybycien, M; Puddu, D; Purohit, M; Puzo, P; Qian, J; Qin, G; Qin, Y; Quadt, A; Quayle, W B; Queitsch-Maitland, M; Quilty, D; Raddum, S; Radeka, V; Radescu, V; Radhakrishnan, S K; Radloff, P; Rados, P; Ragusa, F; Rahal, G; Raine, J A; Rajagopalan, S; Rammensee, M; Rangel-Smith, C; Ratti, M G; Rauch, D M; Rauscher, F; Rave, S; Ravenscroft, T; Ravinovich, I; Raymond, M; Read, A L; Readioff, N P; Reale, M; Rebuzzi, D M; Redelbach, A; Redlinger, G; Reece, R; Reed, R G; Reeves, K; Rehnisch, L; Reichert, J; Reiss, A; Rembser, C; Ren, H; Rescigno, M; Resconi, S; Resseguie, E D; Rezanova, O L; Reznicek, P; Rezvani, R; Richter, R; Richter, S; Richter-Was, E; Ricken, O; Ridel, M; Rieck, P; Riegel, C J; Rieger, J; Rifki, O; Rijssenbeek, M; Rimoldi, A; Rimoldi, M; Rinaldi, L; Ristić, B; Ritsch, E; Riu, I; Rizatdinova, F; Rizvi, E; Rizzi, C; Roberts, R T; Robertson, S H; Robichaud-Veronneau, A; Robinson, D; Robinson, J E M; Robson, A; Roda, C; Rodina, Y; Rodriguez Perez, A; Rodriguez, D; Roe, S; Rogan, C S; Røhne, O; Roloff, J; Romaniouk, A; Romano, M; Saez, S M Romano; Romero Adam, E; Rompotis, N; Ronzani, M; Roos, L; Ros, E; Rosati, S; Rosbach, K; Rose, P; Rosien, N-A; Rossetti, V; Rossi, E; Rossi, L P; Rosten, J H N; Rosten, R; Rotaru, M; Roth, I; Rothberg, J; Rousseau, D; Rozanov, A; Rozen, Y; Ruan, X; Rubbo, F; Rudolph, M S; Rühr, F; Ruiz-Martinez, A; Rurikova, Z; Rusakovich, N A; Ruschke, A; Russell, H L; Rutherfoord, J P; Ruthmann, N; Ryabov, Y F; Rybar, M; Rybkin, G; Ryu, S; Ryzhov, A; Rzehorz, G F; Saavedra, A F; Sabato, G; Sacerdoti, S; Sadrozinski, H F-W; Sadykov, R; Safai Tehrani, F; Saha, P; Sahinsoy, M; Saimpert, M; Saito, T; Sakamoto, H; Sakurai, Y; Salamanna, G; Salamon, A; Salazar Loyola, J E; Salek, D; De Bruin, P H Sales; Salihagic, D; Salnikov, A; Salt, J; Salvatore, D; Salvatore, F; Salvucci, A; Salzburger, A; Sammel, D; Sampsonidis, D; Sánchez, J; Sanchez Martinez, V; Pineda, A Sanchez; Sandaker, H; Sandbach, R L; Sandhoff, M; Sandoval, C; Sankey, D P C; Sannino, M; Sansoni, A; Santoni, C; Santonico, R; Santos, H; Santoyo Castillo, I; Sapp, K; Sapronov, A; Saraiva, J G; Sarrazin, B; Sasaki, O; Sato, K; Sauvan, E; Savage, G; Savard, P; Savic, N; Sawyer, C; Sawyer, L; Saxon, J; Sbarra, C; Sbrizzi, A; Scanlon, T; Scannicchio, D A; Scarcella, M; Scarfone, V; Schaarschmidt, J; Schacht, P; Schachtner, B M; Schaefer, D; Schaefer, L; Schaefer, R; Schaeffer, J; Schaepe, S; Schaetzel, S; Schäfer, U; Schaffer, A C; Schaile, D; Schamberger, R D; Scharf, V; Schegelsky, V A; Scheirich, D; Schernau, M; Schiavi, C; Schier, S; Schillo, C; Schioppa, M; Schlenker, S; Schmidt-Sommerfeld, K R; Schmieden, K; Schmitt, C; Schmitt, S; Schmitz, S; Schneider, B; Schnoor, U; Schoeffel, L; Schoening, A; Schoenrock, B D; Schopf, E; Schott, M; Schouwenberg, J F P; Schovancova, J; Schramm, S; Schreyer, M; Schuh, N; Schulte, A; Schultens, M J; Schultz-Coulon, H-C; Schulz, H; Schumacher, M; Schumm, B A; Schune, Ph; Schwartzman, A; Schwarz, T A; Schweiger, H; Schwemling, Ph; Schwienhorst, R; Schwindling, J; Schwindt, T; Sciolla, G; Scuri, F; Scutti, F; Searcy, J; Seema, P; Seidel, S C; Seiden, A; Seifert, F; Seixas, J M; Sekhniaidze, G; Sekhon, K; Sekula, S J; Seliverstov, D M; Semprini-Cesari, N; Serfon, C; Serin, L; Serkin, L; Serre, T; Sessa, M; Seuster, R; Severini, H; Sfiligoj, T; Sforza, F; Sfyrla, A; Shabalina, E; Shaikh, N W; Shan, L Y; Shang, R; Shank, J T; Shapiro, M; Shatalov, P B; Shaw, K; Shaw, S M; Shcherbakova, A; Shehu, C Y; Sherwood, P; Shi, L; Shimizu, S; Shimmin, C O; Shimojima, M; Shirabe, S; Shiyakova, M; Shmeleva, A; Shoaleh Saadi, D; Shochet, M J; Shojaii, S; Shope, D R; Shrestha, S; Shulga, E; Shupe, M A; Sicho, P; Sickles, A M; Sidebo, P E; Sideras Haddad, E; Sidiropoulou, O; Sidorov, D; Sidoti, A; Siegert, F; Sijacki, Dj; Silva, J; Silverstein, S B; Simak, V; Simic, Lj; Simion, S; Simioni, E; Simmons, B; Simon, D; Simon, M; Sinervo, P; Sinev, N B; Sioli, M; Siragusa, G; Siral, I; Sivoklokov, S Yu; Sjölin, J; Skinner, M B; Skottowe, H P; Skubic, P; Slater, M; Slavicek, T; Slawinska, M; Sliwa, K; Slovak, R; Smakhtin, V; Smart, B H; Smestad, L; Smiesko, J; Smirnov, S Yu; Smirnov, Y; Smirnova, L N; Smirnova, O; Smith, J W; Smith, M N K; Smith, R W; Smizanska, M; Smolek, K; Snesarev, A A; Snyder, I M; Snyder, S; Sobie, R; Socher, F; Soffer, A; Soh, D A; Sokhrannyi, G; Solans Sanchez, C A; Solar, M; Soldatov, E Yu; Soldevila, U; Solodkov, A A; Soloshenko, A; Solovyanov, O V; Solovyev, V; Sommer, P; Son, H; Song, H Y; Sood, A; Sopczak, A; Sopko, V; Sorin, V; Sosa, D; Sotiropoulou, C L; Soualah, R; Soukharev, A M; South, D; Sowden, B C; Spagnolo, S; Spalla, M; Spangenberg, M; Spanò, F; Sperlich, D; Spettel, F; Spighi, R; Spigo, G; Spiller, L A; Spousta, M; Denis, R D St; Stabile, A; Stamen, R; Stamm, S; Stanecka, E; Stanek, R W; Stanescu, C; Stanescu-Bellu, M; Stanitzki, M M; Stapnes, S; Starchenko, E A; Stark, G H; Stark, J; Stark, S H; Staroba, P; Starovoitov, P; Stärz, S; Staszewski, R; Steinberg, P; Stelzer, B; Stelzer, H J; Stelzer-Chilton, O; Stenzel, H; Stewart, G A; Stillings, J A; Stockton, M C; Stoebe, M; Stoicea, G; Stolte, P; Stonjek, S; Stradling, A R; Straessner, A; Stramaglia, M E; Strandberg, J; Strandberg, S; Strandlie, A; Strauss, M; Strizenec, P; Ströhmer, R; Strom, D M; Stroynowski, R; Strubig, A; Stucci, S A; Stugu, B; Styles, N A; Su, D; Su, J; Suchek, S; Sugaya, Y; Suk, M; Sulin, V V; Sultansoy, S; Sumida, T; Sun, S; Sun, X; Sundermann, J E; Suruliz, K; Suster, C J E; Sutton, M R; Suzuki, S; Svatos, M; Swiatlowski, M; Swift, S P; Sykora, I; Sykora, T; Ta, D; Tackmann, K; Taenzer, J; Taffard, A; Tafirout, R; Taiblum, N; Takai, H; Takashima, R; Takeshita, T; Takubo, Y; Talby, M; Talyshev, A A; Tanaka, J; Tanaka, M; Tanaka, R; Tanaka, S; Tanioka, R; Tannenwald, B B; Tapia Araya, S; Tapprogge, S; Tarem, S; Tartarelli, G F; Tas, P; Tasevsky, M; Tashiro, T; Tassi, E; Tavares Delgado, A; Tayalati, Y; Taylor, A C; Taylor, G N; Taylor, P T E; Taylor, W; Teischinger, F A; Teixeira-Dias, P; Temming, K K; Temple, D; Ten Kate, H; Teng, P K; Teoh, J J; Tepel, F; Terada, S; Terashi, K; Terron, J; Terzo, S; Testa, M; Teuscher, R J; Theveneaux-Pelzer, T; Thomas, J P; Thomas-Wilsker, J; Thompson, P D; Thompson, A S; Thomsen, L A; Thomson, E; Tibbetts, M J; Ticse Torres, R E; Tikhomirov, V O; Tikhonov, Yu A; Timoshenko, S; Tiouchichine, E; Tipton, P; Tisserant, S; Todome, K; Todorov, T; Todorova-Nova, S; Tojo, J; Tokár, S; Tokushuku, K; Tolley, E; Tomlinson, L; Tomoto, M; Tompkins, L; Toms, K; Tong, B; Tornambe, P; Torrence, E; Torres, H; Torró Pastor, E; Toth, J; Touchard, F; Tovey, D R; Trefzger, T; Tricoli, A; Trigger, I M; Trincaz-Duvoid, S; Tripiana, M F; Trischuk, W; Trocmé, B; Trofymov, A; Troncon, C; Trottier-McDonald, M; Trovatelli, M; Truong, L; Trzebinski, M; Trzupek, A; Tseng, J C-L; Tsiareshka, P V; Tsipolitis, G; Tsirintanis, N; Tsiskaridze, S; Tsiskaridze, V; Tskhadadze, E G; Tsui, K M; Tsukerman, I I; Tsulaia, V; Tsuno, S; Tsybychev, D; Tu, Y; Tudorache, A; Tudorache, V; Tulbure, T T; Tuna, A N; Tupputi, S A; Turchikhin, S; Turgeman, D; Turk Cakir, I; Turra, R; Tuts, P M; Ucchielli, G; Ueda, I; Ughetto, M; Ukegawa, F; Unal, G; Undrus, A; Unel, G; Ungaro, F C; Unno, Y; Unverdorben, C; Urban, J; Urquijo, P; Urrejola, P; Usai, G; Usui, J; Vacavant, L; Vacek, V; Vachon, B; Valderanis, C; Valdes Santurio, E; Valencic, N; Valentinetti, S; Valero, A; Valery, L; Valkar, S; Valls Ferrer, J A; Van Den Wollenberg, W; Van Der Deijl, P C; van der Graaf, H; van Eldik, N; van Gemmeren, P; Van Nieuwkoop, J; van Vulpen, I; van Woerden, M C; Vanadia, M; Vandelli, W; Vanguri, R; Vaniachine, A; Vankov, P; Vardanyan, G; Vari, R; Varnes, E W; Varol, T; Varouchas, D; Vartapetian, A; Varvell, K E; Vasquez, J G; Vasquez, G A; Vazeille, F; Vazquez Schroeder, T; Veatch, J; Veeraraghavan, V; Veloce, L M; Veloso, F; Veneziano, S; Ventura, A; Venturi, M; Venturi, N; Venturini, A; Vercesi, V; Verducci, M; Verkerke, W; Vermeulen, J C; Vest, A; Vetterli, M C; Viazlo, O; Vichou, I; Vickey, T; Vickey Boeriu, O E; Viehhauser, G H A; Viel, S; Vigani, L; Villa, M; Villaplana Perez, M; Vilucchi, E; Vincter, M G; Vinogradov, V B; Vittori, C; Vivarelli, I; Vlachos, S; Vlasak, M; Vogel, M; Vokac, P; Volpi, G; Volpi, M; von der Schmitt, H; von Toerne, E; Vorobel, V; Vorobev, K; Vos, M; Voss, R; Vossebeld, J H; Vranjes, N; Vranjes Milosavljevic, M; Vrba, V; Vreeswijk, M; Vuillermet, R; Vukotic, I; Wagner, P; Wagner, W; Wahlberg, H; Wahrmund, S; Wakabayashi, J; Walder, J; Walker, R; Walkowiak, W; Wallangen, V; Wang, C; Wang, C; Wang, F; Wang, H; Wang, H; Wang, J; Wang, J; Wang, K; Wang, R; Wang, S M; Wang, T; Wang, W; Wanotayaroj, C; Warburton, A; Ward, C P; Wardrope, D R; Washbrook, A; Watkins, P M; Watson, A T; Watson, M F; Watts, G; Watts, S; Waugh, B M; Webb, S; Weber, M S; Weber, S W; Weber, S A; Webster, J S; Weidberg, A R; Weinert, B; Weingarten, J; Weiser, C; Weits, H; Wells, P S; Wenaus, T; Wengler, T; Wenig, S; Wermes, N; Werner, M D; Werner, P; Wessels, M; Wetter, J; Whalen, K; Whallon, N L; Wharton, A M; White, A; White, M J; White, R; Whiteson, D; Wickens, F J; Wiedenmann, W; Wielers, M; Wiglesworth, C; Wiik-Fuchs, L A M; Wildauer, A; Wilk, F; Wilkens, H G; Williams, H H; Williams, S; Willis, C; Willocq, S; Wilson, J A; Wingerter-Seez, I; Winklmeier, F; Winston, O J; Winter, B T; Wittgen, M; Wolf, T M H; Wolff, R; Wolter, M W; Wolters, H; Worm, S D; Wosiek, B K; Wotschack, J; Woudstra, M J; Wozniak, K W; Wu, M; Wu, M; Wu, S L; Wu, X; Wu, Y; Wyatt, T R; Wynne, B M; Xella, S; Xi, Z; Xu, D; Xu, L; Yabsley, B; Yacoob, S; Yamaguchi, D; Yamaguchi, Y; Yamamoto, A; Yamamoto, S; Yamanaka, T; Yamauchi, K; Yamazaki, Y; Yan, Z; Yang, H; Yang, H; Yang, Y; Yang, Z; Yao, W-M; Yap, Y C; Yasu, Y; Yatsenko, E; Yau Wong, K H; Ye, J; Ye, S; Yeletskikh, I; Yildirim, E; Yorita, K; Yoshida, R; Yoshihara, K; Young, C; Young, C J S; Youssef, S; Yu, D R; Yu, J; Yu, J M; Yu, J; Yuan, L; Yuen, S P Y; Yusuff, I; Zabinski, B; Zacharis, G; Zaidan, R; Zaitsev, A M; Zakharchuk, N; Zalieckas, J; Zaman, A; Zambito, S; Zanello, L; Zanzi, D; Zeitnitz, C; Zeman, M; Zemla, A; Zeng, J C; Zeng, Q; Zenin, O; Ženiš, T; Zerwas, D; Zhang, D; Zhang, F; Zhang, G; Zhang, H; Zhang, J; Zhang, L; Zhang, L; Zhang, M; Zhang, R; Zhang, R; Zhang, X; Zhang, Y; Zhang, Z; Zhao, X; Zhao, Y; Zhao, Z; Zhemchugov, A; Zhong, J; Zhou, B; Zhou, C; Zhou, L; Zhou, L; Zhou, M; Zhou, M; Zhou, N; Zhu, C G; Zhu, H; Zhu, J; Zhu, Y; Zhuang, X; Zhukov, K; Zibell, A; Zieminska, D; Zimine, N I; Zimmermann, C; Zimmermann, S; Zinonos, Z; Zinser, M; Ziolkowski, M; Živković, L; Zobernig, G; Zoccoli, A; Zur Nedden, M; Zwalinski, L

2017-01-01

This paper describes the algorithms for the reconstruction and identification of electrons in the central region of the ATLAS detector at the Large Hadron Collider (LHC). These algorithms were used for all ATLAS results with electrons in the final state that are based on the 2012 pp collision data produced by the LHC at [Formula: see text] = 8 [Formula: see text]. The efficiency of these algorithms, together with the charge misidentification rate, is measured in data and evaluated in simulated samples using electrons from [Formula: see text], [Formula: see text] and [Formula: see text] decays. For these efficiency measurements, the full recorded data set, corresponding to an integrated luminosity of 20.3 fb[Formula: see text], is used. Based on a new reconstruction algorithm used in 2012, the electron reconstruction efficiency is 97% for electrons with [Formula: see text] [Formula: see text] and 99% at [Formula: see text] [Formula: see text]. Combining this with the efficiency of additional selection criteria to reject electrons from background processes or misidentified hadrons, the efficiency to reconstruct and identify electrons at the ATLAS experiment varies from 65 to 95%, depending on the transverse momentum of the electron and background rejection.

Simulation-based investigation of the generality of Lyzenga's multispectral bathymetry formula in Case-1 coral reef water

NASA Astrophysics Data System (ADS)

Manessa, Masita Dwi Mandini; Kanno, Ariyo; Sagawa, Tatsuyuki; Sekine, Masahiko; Nurdin, Nurjannah

2018-01-01

Lyzenga's multispectral bathymetry formula has attracted considerable interest due to its simplicity. However, there has been little discussion of the effect that variation in optical conditions and bottom types-which commonly appears in coral reef environments-has on this formula's results. The present paper evaluates Lyzenga's multispectral bathymetry formula for a variety of optical conditions and bottom types. A noiseless dataset of above-water remote sensing reflectance from WorldView-2 images over Case-1 shallow coral reef water is simulated using a radiative transfer model. The simulation-based assessment shows that Lyzenga's formula performs robustly, with adequate generality and good accuracy, under a range of conditions. As expected, the influence of bottom type on depth estimation accuracy is far greater than the influence of other optical parameters, i.e., chlorophyll-a concentration and solar zenith angle. Further, based on the simulation dataset, Lyzenga's formula estimates depth when the bottom type is unknown almost as accurately as when the bottom type is known. This study provides a better understanding of Lyzenga's multispectral bathymetry formula under various optical conditions and bottom types.

Solar radiation over Egypt: Comparison of predicted and measured meteorological data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kamel, M.A.; Shalaby, S.A.; Mostafa, S.S.

1993-06-01

Measurements of global solar irradiance on a horizontal surface at five meteorological stations in Egypt for three years 1987, 1988, and 1989 are compared with their corresponding values computed by two independent methods. The first method is based on the Angstrom formula, which correlates relative solar irradiance H/H[sub o] to corresponding relative duration of bright sunshine n/N. Regional regression coefficients are obtained and used for prediction of global solar irradiance. Good agreement with measurements is obtained. In the second method an empirical relation, in which sunshine duration and the noon altitude of the sun as inputs together with appropriate choicemore » of zone parameters, is employed. This gives good agreement with the measurements. Comparison shows that the first method gives better fitting with the experimental data.« less

Heavy ion track-structure calculations for radial dose in arbitrary materials

NASA Technical Reports Server (NTRS)

Cucinotta, Francis A.; Katz, Robert; Wilson, John W.; Dubey, Rajendra R.

1995-01-01

The delta-ray theory of track structure is compared with experimental data for the radial dose from heavy ion irradiation. The effects of electron transmission and the angular dependence of secondary electron ejection are included in the calculations. Several empirical formulas for electron range and energy are compared in a wide variety of materials in order to extend the application of the track-structure theory. The model of Rudd for the secondary electron-spectrum in proton collisions, which is based on a modified classical kinematics binary encounter model at high energies and a molecular promotion model at low energies, is employed. For heavier projectiles, the secondary electron spectrum is found by scaling the effective charge. Radial dose calculations for carbon, water, silicon, and gold are discussed. The theoretical data agreed well with the experimental data.

The new model of the Big Bang and the Universe expansion. A comparison with modern observational data and cosmological theories

NASA Astrophysics Data System (ADS)

Kraiko, A. N.; Valiyev, Kh. F.

2016-10-01

The new model of the Big Bang and the Universe expansion is constructed. It is based on solutions in classical and in relativistic statements of problem on the dispersion into the void of the gas compressed into a point or in a finite, but for further negligible, volume. If to restrict in relativistic statement gas speed value v by the speed of light (υ =| v |

Mathematical modeling of synthetic unit hydrograph case study: Citarum watershed

NASA Astrophysics Data System (ADS)

Islahuddin, Muhammad; Sukrainingtyas, Adiska L. A.; Kusuma, M. Syahril B.; Soewono, Edy

2015-09-01

Deriving unit hydrograph is very important in analyzing watershed's hydrologic response of a rainfall event. In most cases, hourly measures of stream flow data needed in deriving unit hydrograph are not always available. Hence, one needs to develop methods for deriving unit hydrograph for ungagged watershed. Methods that have evolved are based on theoretical or empirical formulas relating hydrograph peak discharge and timing to watershed characteristics. These are usually referred to Synthetic Unit Hydrograph. In this paper, a gamma probability density function and its variant are used as mathematical approximations of a unit hydrograph for Citarum Watershed. The model is adjusted with real field condition by translation and scaling. Optimal parameters are determined by using Particle Swarm Optimization method with weighted objective function. With these models, a synthetic unit hydrograph can be developed and hydrologic parameters can be well predicted.

Light-quark and gluon jet discrimination in [Formula: see text] collisions at [Formula: see text] with the ATLAS detector.

PubMed

Aad, G; Abbott, B; Abdallah, J; Abdel Khalek, S; Abdinov, O; Aben, R; Abi, B; Abolins, M; AbouZeid, O S; Abramowicz, H; Abreu, H; Abreu, R; Abulaiti, Y; Acharya, B S; Adamczyk, L; Adams, D L; Adelman, J; Adomeit, S; Adye, T; Agatonovic-Jovin, T; Aguilar-Saavedra, J A; Agustoni, M; Ahlen, S P; Ahmad, A; Ahmadov, F; Aielli, G; Åkesson, T P A; Akimoto, G; Akimov, A V; Albert, J; Albrand, S; Alconada Verzini, M J; Aleksa, M; Aleksandrov, I N; Alexa, C; Alexander, G; Alexandre, G; Alexopoulos, T; Alhroob, M; Alimonti, G; Alio, L; Alison, J; Allbrooke, B M M; Allison, L J; Allport, P P; Allwood-Spiers, S E; Almond, J; Aloisio, A; Alonso, A; Alonso, F; Alpigiani, C; Altheimer, A; Alvarez Gonzalez, B; Alviggi, M G; Amako, K; Amaral Coutinho, Y; Amelung, C; Amidei, D; Amor Dos Santos, S P; Amorim, A; Amoroso, S; Amram, N; Amundsen, G; Anastopoulos, C; Ancu, L S; Andari, N; Andeen, T; Anders, C F; Anders, G; Anderson, K J; Andreazza, A; Andrei, V; Anduaga, X S; Angelidakis, S; Angelozzi, I; Anger, P; Angerami, A; Anghinolfi, F; Anisenkov, A V; Anjos, N; Annovi, A; Antonaki, A; Antonelli, M; Antonov, A; Antos, J; Anulli, F; Aoki, M; Aperio Bella, L; Apolle, R; Arabidze, G; Aracena, I; Arai, Y; Araque, J P; Arce, A T H; Arguin, J-F; Argyropoulos, S; Arik, M; Armbruster, A J; Arnaez, O; Arnal, V; Arnold, H; Arslan, O; Artamonov, A; Artoni, G; Asai, S; Asbah, N; Ashkenazi, A; Ask, S; Åsman, B; Asquith, L; Assamagan, K; Astalos, R; Atkinson, M; Atlay, N B; Auerbach, B; Augsten, K; Aurousseau, M; Avolio, G; Azuelos, G; Azuma, Y; Baak, M A; Bacci, C; Bachacou, H; Bachas, K; Backes, M; Backhaus, M; Backus Mayes, J; Badescu, E; Bagiacchi, P; Bagnaia, P; Bai, Y; Bain, T; Baines, J T; Baker, O K; Baker, S; Balek, P; Balli, F; Banas, E; Banerjee, Sw; Banfi, D; Bangert, A; Bannoura, A A E; Bansal, V; Bansil, H S; Barak, L; Baranov, S P; Barberio, E L; Barberis, D; Barbero, M; Barillari, T; Barisonzi, M; Barklow, T; Barlow, N; Barnett, B M; Barnett, R M; Barnovska, Z; Baroncelli, A; Barone, G; Barr, A J; Barreiro, F; Barreiro Guimarães da Costa, J; Bartoldus, R; Barton, A E; Bartos, P; Bartsch, V; Bassalat, A; Basye, A; Bates, R L; Batkova, L; Batley, J R; Battistin, M; Bauer, F; Bawa, H S; Beau, T; Beauchemin, P H; Beccherle, R; Bechtle, P; Beck, H P; Becker, K; Becker, S; Beckingham, M; Becot, C; Beddall, A J; Beddall, A; Bedikian, S; Bednyakov, V A; Bee, C P; Beemster, L J; Beermann, T A; Begel, M; Behr, K; Belanger-Champagne, C; Bell, P J; Bell, W H; Bella, G; Bellagamba, L; Bellerive, A; Bellomo, M; Belloni, A; Belotskiy, K; Beltramello, O; Benary, O; Benchekroun, D; Bendtz, K; Benekos, N; Benhammou, Y; Benhar Noccioli, E; Benitez Garcia, J A; Benjamin, D P; Bensinger, J R; Benslama, K; Bentvelsen, S; Berge, D; Bergeaas Kuutmann, E; Berger, N; Berghaus, F; Berglund, E; Beringer, J; Bernard, C; Bernat, P; Bernius, C; Bernlochner, F U; Berry, T; Berta, P; Bertella, C; Bertolucci, F; Besana, M I; Besjes, G J; Bessidskaia, O; Besson, N; Betancourt, C; Bethke, S; Bhimji, W; Bianchi, R M; Bianchini, L; Bianco, M; Biebel, O; Bieniek, S P; Bierwagen, K; Biesiada, J; Biglietti, M; Bilbao De Mendizabal, J; Bilokon, H; Bindi, M; Binet, S; Bingul, A; Bini, C; Black, C W; Black, J E; Black, K M; Blackburn, D; Blair, R E; Blanchard, J-B; Blazek, T; Bloch, I; Blocker, C; Blum, W; Blumenschein, U; Bobbink, G J; Bobrovnikov, V S; Bocchetta, S S; Bocci, A; Boddy, C R; Boehler, M; Boek, J; Boek, T T; Bogaerts, J A; Bogdanchikov, A G; Bogouch, A; Bohm, C; Bohm, J; Boisvert, V; Bold, T; Boldea, V; Boldyrev, A S; Bomben, M; Bona, M; Boonekamp, M; Borisov, A; Borissov, G; Borri, M; Borroni, S; Bortfeldt, J; Bortolotto, V; Bos, K; Boscherini, D; Bosman, M; Boterenbrood, H; Boudreau, J; Bouffard, J; Bouhova-Thacker, E V; Boumediene, D; Bourdarios, C; Bousson, N; Boutouil, S; Boveia, A; Boyd, J; Boyko, I R; Bozovic-Jelisavcic, I; Bracinik, J; Branchini, P; Brandt, A; Brandt, G; Brandt, O; Bratzler, U; Brau, B; Brau, J E; Braun, H M; Brazzale, S F; Brelier, B; Brendlinger, K; Brennan, A J; Brenner, R; Bressler, S; Bristow, K; Bristow, T M; Britton, D; Brochu, F M; Brock, I; Brock, R; Bromberg, C; Bronner, J; Brooijmans, G; Brooks, T; Brooks, W K; Brosamer, J; Brost, E; Brown, G; Brown, J; Bruckman de Renstrom, P A; Bruncko, D; Bruneliere, R; Brunet, S; Bruni, A; Bruni, G; Bruschi, M; Bryngemark, L; Buanes, T; Buat, Q; Bucci, F; Buchholz, P; Buckingham, R M; Buckley, A G; Buda, S I; Budagov, I A; Buehrer, F; Bugge, L; Bugge, M K; Bulekov, O; Bundock, A C; Burckhart, H; Burdin, S; Burghgrave, B; Burke, S; Burmeister, I; Busato, E; Büscher, D; Büscher, V; Bussey, P; Buszello, C P; Butler, B; Butler, J M; Butt, A I; Buttar, C M; Butterworth, J M; Butti, P; Buttinger, W; Buzatu, A; Byszewski, M; Cabrera Urbán, S; Caforio, D; Cakir, O; Calafiura, P; Calandri, A; Calderini, G; Calfayan, P; Calkins, R; Caloba, L P; Calvet, D; Calvet, S; Camacho Toro, R; Camarda, S; Cameron, D; Caminada, L M; Caminal Armadans, R; Campana, S; Campanelli, M; Campoverde, A; Canale, V; Canepa, A; Cantero, J; Cantrill, R; Cao, T; Capeans Garrido, M D M; Caprini, I; Caprini, M; Capua, M; Caputo, R; Cardarelli, R; Carli, T; Carlino, G; Carminati, L; Caron, S; Carquin, E; Carrillo-Montoya, G D; Carter, A A; Carter, J R; Carvalho, J; Casadei, D; Casado, M P; Castaneda-Miranda, E; Castelli, A; Castillo Gimenez, V; Castro, N F; Catastini, P; Catinaccio, A; Catmore, J R; Cattai, A; Cattani, G; Caughron, S; Cavaliere, V; Cavalli, D; Cavalli-Sforza, M; Cavasinni, V; Ceradini, F; Cerio, B; Cerny, K; Cerqueira, A S; Cerri, A; Cerrito, L; Cerutti, F; Cerv, M; Cervelli, A; Cetin, S A; Chafaq, A; Chakraborty, D; Chalupkova, I; Chan, K; Chang, P; Chapleau, B; Chapman, J D; Charfeddine, D; Charlton, D G; Chau, C C; Chavez Barajas, C A; Cheatham, S; Chegwidden, A; Chekanov, S; Chekulaev, S V; Chelkov, G A; Chelstowska, M A; Chen, C; Chen, H; Chen, K; Chen, L; Chen, S; Chen, X; Chen, Y; Cheng, H C; Cheng, Y; Cheplakov, A; Cherkaoui El Moursli, R; Chernyatin, V; Cheu, E; Chevalier, L; Chiarella, V; Chiefari, G; Childers, J T; Chilingarov, A; Chiodini, G; Chisholm, A S; Chislett, R T; Chitan, A; Chizhov, M V; Chouridou, S; Chow, B K B; Christidi, I A; Chromek-Burckhart, D; Chu, M L; Chudoba, J; Chwastowski, J J; Chytka, L; Ciapetti, G; Ciftci, A K; Ciftci, R; Cinca, D; Cindro, V; Ciocio, A; Cirkovic, P; Citron, Z H; Citterio, M; Ciubancan, M; Clark, A; Clark, P J; Clarke, R N; Cleland, W; Clemens, J C; Clement, C; Coadou, Y; Cobal, M; Coccaro, A; Cochran, J; Coffey, L; Cogan, J G; Coggeshall, J; Cole, B; Cole, S; Colijn, A P; Collins-Tooth, C; Collot, J; Colombo, T; Colon, G; Compostella, G; Conde Muiño, P; Coniavitis, E; Conidi, M C; Connell, S H; Connelly, I A; Consonni, S M; Consorti, V; Constantinescu, S; Conta, C; Conti, G; Conventi, F; Cooke, M; Cooper, B D; Cooper-Sarkar, A M; Cooper-Smith, N J; Copic, K; Cornelissen, T; Corradi, M; Corriveau, F; Corso-Radu, A; Cortes-Gonzalez, A; Cortiana, G; Costa, G; Costa, M J; Costanzo, D; Côté, D; Cottin, G; Cowan, G; Cox, B E; Cranmer, K; Cree, G; Crépé-Renaudin, S; Crescioli, F; Crispin Ortuzar, M; Cristinziani, M; Croft, V; Crosetti, G; Cuciuc, C-M; Almenar, C Cuenca; Cuhadar Donszelmann, T; Cummings, J; Curatolo, M; Cuthbert, C; Czirr, H; Czodrowski, P; Czyczula, Z; D'Auria, S; D'Onofrio, M; Cunha Sargedas De Sousa, M J Da; Via, C Da; Dabrowski, W; Dafinca, A; Dai, T; Dale, O; Dallaire, F; Dallapiccola, C; Dam, M; Daniells, A C; Dano Hoffmann, M; Dao, V; Darbo, G; Darlea, G L; Darmora, S; Dassoulas, J A; Dattagupta, A; Davey, W; David, C; Davidek, T; Davies, E; Davies, M; Davignon, O; Davison, A R; Davison, P; Davygora, Y; Dawe, E; Dawson, I; Daya-Ishmukhametova, R K; De, K; de Asmundis, R; De Castro, S; De Cecco, S; de Graat, J; De Groot, N; de Jong, P; De la Torre, H; De Lorenzi, F; De Nooij, L; De Pedis, D; De Salvo, A; De Sanctis, U; De Santo, A; De Vivie De Regie, J B; De Zorzi, G; Dearnaley, W J; Debbe, R; Debenedetti, C; Dechenaux, B; Dedovich, D V; Degenhardt, J; Deigaard, I; Del Peso, J; Del Prete, T; Deliot, F; Delitzsch, C M; Deliyergiyev, M; Dell'Acqua, A; Dell'Asta, L; Dell'Orso, M; Della Pietra, M; Della Volpe, D; Delmastro, M; Delsart, P A; Deluca, C; Demers, S; Demichev, M; Demilly, A; Denisov, S P; Derendarz, D; Derkaoui, J E; Derue, F; Dervan, P; Desch, K; Deterre, C; Deviveiros, P O; Dewhurst, A; Dhaliwal, S; Di Ciaccio, A; Di Ciaccio, L; Di Domenico, A; Di Donato, C; Di Girolamo, A; Di Girolamo, B; Di Mattia, A; Di Micco, B; Di Nardo, R; Di Simone, A; Di Sipio, R; Di Valentino, D; Diaz, M A; Diehl, E B; Dietrich, J; Dietzsch, T A; Diglio, S; Dimitrievska, A; Dingfelder, J; Dionisi, C; Dita, P; Dita, S; Dittus, F; Djama, F; Djobava, T; do Vale, M A B; Do Valle Wemans, A; Doan, T K O; Dobos, D; Dobson, E; Doglioni, C; Doherty, T; Dohmae, T; Dolejsi, J; Dolezal, Z; Dolgoshein, B A; Donadelli, M; Donati, S; Dondero, P; Donini, J; Dopke, J; Doria, A; Anjos, A Dos; Dova, M T; Doyle, A T; Dris, M; Dubbert, J; Dube, S; Dubreuil, E; Duchovni, E; Duckeck, G; Ducu, O A; Duda, D; Dudarev, A; Dudziak, F; Duflot, L; Duguid, L; Dührssen, M; Dunford, M; Duran Yildiz, H; Düren, M; Durglishvili, A; Dwuznik, M; Dyndal, M; Ebke, J; Edson, W; Edwards, N C; Ehrenfeld, W; Eifert, T; Eigen, G; Einsweiler, K; Ekelof, T; El Kacimi, M; Ellert, M; Elles, S; Ellinghaus, F; Ellis, N; Elmsheuser, J; Elsing, M; Emeliyanov, D; Enari, Y; Endner, O C; Endo, M; Engelmann, R; Erdmann, J; Ereditato, A; Eriksson, D; Ernis, G; Ernst, J; Ernst, M; Ernwein, J; Errede, D; Errede, S; Ertel, E; Escalier, M; Esch, H; Escobar, C; Esposito, B; Etienvre, A I; Etzion, E; Evans, H; Fabbri, L; Facini, G; Fakhrutdinov, R M; Falciano, S; Faltova, J; Fang, Y; Fanti, M; Farbin, A; Farilla, A; Farooque, T; Farrell, S; Farrington, S M; Farthouat, P; Fassi, F; Fassnacht, P; Fassouliotis, D; Favareto, A; Fayard, L; Federic, P; Fedin, O L; Fedorko, W; Fehling-Kaschek, M; Feigl, S; Feligioni, L; Feng, C; Feng, E J; Feng, H; Fenyuk, A B; Fernandez Perez, S; Ferrag, S; Ferrando, J; Ferrari, A; Ferrari, P; Ferrari, R; Ferreira de Lima, D E; Ferrer, A; Ferrere, D; Ferretti, C; Ferretto Parodi, A; Fiascaris, M; Fiedler, F; Filipčič, A; Filipuzzi, M; Filthaut, F; Fincke-Keeler, M; Finelli, K D; Fiolhais, M C N; Fiorini, L; Firan, A; Fischer, J; Fisher, W C; Fitzgerald, E A; Flechl, M; Fleck, I; Fleischmann, P; Fleischmann, S; Fletcher, G T; Fletcher, G; Flick, T; Floderus, A; Flores Castillo, L R; Florez Bustos, A C; Flowerdew, M J; Formica, A; Forti, A; Fortin, D; Fournier, D; Fox, H; Fracchia, S; Francavilla, P; Franchini, M; Franchino, S; Francis, D; Franklin, M; Franz, S; Fraternali, M; French, S T; Friedrich, C; Friedrich, F; Froidevaux, D; Frost, J A; Fukunaga, C; Fullana Torregrosa, E; Fulsom, B G; Fuster, J; Gabaldon, C; Gabizon, O; Gabrielli, A; Gabrielli, A; Gadatsch, S; Gadomski, S; Gagliardi, G; Gagnon, P; Galea, C; Galhardo, B; Gallas, E J; Gallo, V; Gallop, B J; Gallus, P; Galster, G; Gan, K K; Gandrajula, R P; Gao, J; Gao, Y S; Garay Walls, F M; Garberson, F; García, C; García Navarro, J E; Garcia-Sciveres, M; Gardner, R W; Garelli, N; Garonne, V; Gatti, C; Gaudio, G; Gaur, B; Gauthier, L; Gauzzi, P; Gavrilenko, I L; Gay, C; Gaycken, G; Gazis, E N; Ge, P; Gecse, Z; Gee, C N P; Geerts, D A A; Geich-Gimbel, Ch; Gellerstedt, K; Gemme, C; Gemmell, A; Genest, M H; Gentile, S; George, M; George, S; Gerbaudo, D; Gershon, A; Ghazlane, H; Ghodbane, N; Giacobbe, B; Giagu, S; Giangiobbe, V; Giannetti, P; Gianotti, F; Gibbard, B; Gibson, S M; Gilchriese, M; Gillam, T P S; Gillberg, D; Gilles, G; Gingrich, D M; Giokaris, N; Giordani, M P; Giordano, R; Giorgi, F M; Giraud, P F; Giugni, D; Giuliani, C; Giulini, M; Gjelsten, B K; Gkialas, I; Gladilin, L K; Glasman, C; Glatzer, J; Glaysher, P C F; Glazov, A; Glonti, G L; Goblirsch-Kolb, M; Goddard, J R; Godfrey, J; Godlewski, J; Goeringer, C; Goldfarb, S; Golling, T; Golubkov, D; Gomes, A; Gomez Fajardo, L S; Gonçalo, R; Goncalves Pinto Firmino Da Costa, J; Gonella, L; González de la Hoz, S; Gonzalez Parra, G; Gonzalez Silva, M L; Gonzalez-Sevilla, S; Goossens, L; Gorbounov, P A; Gordon, H A; Gorelov, I; Gorfine, G; Gorini, B; Gorini, E; Gorišek, A; Gornicki, E; Goshaw, A T; Gössling, C; Gostkin, M I; Gouighri, M; Goujdami, D; Goulette, M P; Goussiou, A G; Goy, C; Gozpinar, S; Grabas, H M X; Graber, L; Grabowska-Bold, I; Grafström, P; Grahn, K-J; Gramling, J; Gramstad, E; Grancagnolo, S; Grassi, V; Gratchev, V; Gray, H M; Graziani, E; Grebenyuk, O G; Greenwood, Z D; Gregersen, K; Gregor, I M; Grenier, P; Griffiths, J; Grigalashvili, N; Grillo, A A; Grimm, K; Grinstein, S; Gris, Ph; Grishkevich, Y V; Grivaz, J-F; Grohs, J P; Grohsjean, A; Gross, E; Grosse-Knetter, J; Grossi, G C; Groth-Jensen, J; Grout, Z J; Grybel, K; Guan, L; Guescini, F; Guest, D; Gueta, O; Guicheney, C; Guido, E; Guillemin, T; Guindon, S; Gul, U; Gumpert, C; Gunther, J; Guo, J; Gupta, S; Gutierrez, P; Gutierrez Ortiz, N G; Gutschow, C; Guttman, N; Guyot, C; Gwenlan, C; Gwilliam, C B; Haas, A; Haber, C; Hadavand, H K; Haddad, N; Haefner, P; Hageboeck, S; Hajduk, Z; Hakobyan, H; Haleem, M; Hall, D; Halladjian, G; Hamacher, K; Hamal, P; Hamano, K; Hamer, M; Hamilton, A; Hamilton, S; Hamnett, P G; Han, L; Hanagaki, K; Hanawa, K; Hance, M; Hanke, P; Hansen, J B; Hansen, J D; Hansen, P H; Hara, K; Hard, A S; Harenberg, T; Harkusha, S; Harper, D; Harrington, R D; Harris, O M; Harrison, P F; Hartjes, F; Hasegawa, S; Hasegawa, Y; Hasib, A; Hassani, S; Haug, S; Hauschild, M; Hauser, R; Havranek, M; Hawkes, C M; Hawkings, R J; Hawkins, A D; Hayashi, T; Hayden, D; Hays, C P; Hayward, H S; Haywood, S J; Head, S J; Heck, T; Hedberg, V; Heelan, L; Heim, S; Heim, T; Heinemann, B; Heinrich, L; Heisterkamp, S; Hejbal, J; Helary, L; Heller, C; Heller, M; Hellman, S; Hellmich, D; Helsens, C; Henderson, J; Henderson, R C W; Hengler, C; Henrichs, A; Henriques Correia, A M; Henrot-Versille, S; Hensel, C; Herbert, G H; Hernández Jiménez, Y; Herrberg-Schubert, R; Herten, G; Hertenberger, R; Hervas, L; Hesketh, G G; Hessey, N P; Hickling, R; Higón-Rodriguez, E; Hill, J C; Hiller, K H; Hillert, S; Hillier, S J; Hinchliffe, I; Hines, E; Hirose, M; Hirschbuehl, D; Hobbs, J; Hod, N; Hodgkinson, M C; Hodgson, P; Hoecker, A; Hoeferkamp, M R; Hoffman, J; Hoffmann, D; Hofmann, J I; Hohlfeld, M; Holmes, T R; Hong, T M; Hooft van Huysduynen, L; Hostachy, J-Y; Hou, S; Hoummada, A; Howard, J; Howarth, J; Hrabovsky, M; Hristova, I; Hrivnac, J; Hryn'ova, T; Hsu, P J; Hsu, S-C; Hu, D; Hu, X; Huang, Y; Hubacek, Z; Hubaut, F; Huegging, F; Huffman, T B; Hughes, E W; Hughes, G; Huhtinen, M; Hülsing, T A; Hurwitz, M; Huseynov, N; Huston, J; Huth, J; Iacobucci, G; Iakovidis, G; Ibragimov, I; Iconomidou-Fayard, L; Idarraga, J; Ideal, E; Iengo, P; Igonkina, O; Iizawa, T; Ikegami, Y; Ikematsu, K; Ikeno, M; Iliadis, D; Ilic, N; Inamaru, Y; Ince, T; Ioannou, P; Iodice, M; Iordanidou, K; Ippolito, V; Irles Quiles, A; Isaksson, C; Ishino, M; Ishitsuka, M; Ishmukhametov, R; Issever, C; Istin, S; Iturbe Ponce, J M; Ivarsson, J; Ivashin, A V; Iwanski, W; Iwasaki, H; Izen, J M; Izzo, V; Jackson, B; Jackson, J N; Jackson, M; Jackson, P; Jaekel, M R; Jain, V; Jakobs, K; Jakobsen, S; Jakoubek, T; Jakubek, J; Jamin, D O; Jana, D K; Jansen, E; Jansen, H; Janssen, J; Janus, M; Jarlskog, G; Javadov, N; Javůrek, T; Jeanty, L; Jeng, G-Y; Jennens, D; Jenni, P; Jentzsch, J; Jeske, C; Jézéquel, S; Ji, H; Ji, W; Jia, J; Jiang, Y; Jimenez Belenguer, M; Jin, S; Jinaru, A; Jinnouchi, O; Joergensen, M D; Johansson, K E; Johansson, P; Johns, K A; Jon-And, K; Jones, G; Jones, R W L; Jones, T J; Jongmanns, J; Jorge, P M; Joshi, K D; Jovicevic, J; Ju, X; Jung, C A; Jungst, R M; Jussel, P; Juste Rozas, A; Kaci, M; Kaczmarska, A; Kado, M; Kagan, H; Kagan, M; Kajomovitz, E; Kama, S; Kanaya, N; Kaneda, M; Kaneti, S; Kanno, T; Kantserov, V A; Kanzaki, J; Kaplan, B; Kapliy, A; Kar, D; Karakostas, K; Karastathis, N; Karnevskiy, M; Karpov, S N; Karthik, K; Kartvelishvili, V; Karyukhin, A N; Kashif, L; Kasieczka, G; Kass, R D; Kastanas, A; Kataoka, Y; Katre, A; Katzy, J; Kaushik, V; Kawagoe, K; Kawamoto, T; Kawamura, G; Kazama, S; Kazanin, V F; Kazarinov, M Y; Keeler, R; Keener, P T; Kehoe, R; Keil, M; Keller, J S; Keoshkerian, H; Kepka, O; Kerševan, B P; Kersten, S; Kessoku, K; Keung, J; Khalil-Zada, F; Khandanyan, H; Khanov, A; Khodinov, A; Khomich, A; Khoo, T J; Khoriauli, G; Khoroshilov, A; Khovanskiy, V; Khramov, E; Khubua, J; Kim, H Y; Kim, H; Kim, S H; Kimura, N; Kind, O; King, B T; King, M; King, R S B; King, S B; Kirk, J; Kiryunin, A E; Kishimoto, T; Kisielewska, D; Kiss, F; Kitamura, T; Kittelmann, T; Kiuchi, K; Kladiva, E; Klein, M; Klein, U; Kleinknecht, K; Klimek, P; Klimentov, A; Klingenberg, R; Klinger, J A; Klioutchnikova, T; Klok, P F; Kluge, E-E; Kluit, P; Kluth, S; Kneringer, E; Knoops, E B F G; Knue, A; Kobayashi, T; Kobel, M; Kocian, M; Kodys, P; Koevesarki, P; Koffas, T; Koffeman, E; Kogan, L A; Kohlmann, S; Kohout, Z; Kohriki, T; Koi, T; Kolanoski, H; Koletsou, I; Koll, J; Komar, A A; Komori, Y; Kondo, T; Kondrashova, N; Köneke, K; König, A C; König, S; Kono, T; Konoplich, R; Konstantinidis, N; Kopeliansky, R; Koperny, S; Köpke, L; Kopp, A K; Korcyl, K; Kordas, K; Korn, A; Korol, A A; Korolkov, I; Korolkova, E V; Korotkov, V A; Kortner, O; Kortner, S; Kostyukhin, V V; Kotov, S; Kotov, V M; Kotwal, A; Kourkoumelis, C; Kouskoura, V; Koutsman, A; Kowalewski, R; Kowalski, T Z; Kozanecki, W; Kozhin, A S; Kral, V; Kramarenko, V A; Kramberger, G; Krasnopevtsev, D; Krasny, M W; Krasznahorkay, A; Kraus, J K; Kravchenko, A; Kreiss, S; Kretz, M; Kretzschmar, J; Kreutzfeldt, K; Krieger, P; Kroeninger, K; Kroha, H; Kroll, J; Kroseberg, J; Krstic, J; Kruchonak, U; Krüger, H; Kruker, T; Krumnack, N; Krumshteyn, Z V; Kruse, A; Kruse, M C; Kruskal, M; Kubota, T; Kuday, S; Kuehn, S; Kugel, A; Kuhl, A; Kuhl, T; Kukhtin, V; Kulchitsky, Y; Kuleshov, S; Kuna, M; Kunkle, J; Kupco, A; Kurashige, H; Kurochkin, Y A; Kurumida, R; Kus, V; Kuwertz, E S; Kuze, M; Kvita, J; La Rosa, A; La Rotonda, L; Lacasta, C; Lacava, F; Lacey, J; Lacker, H; Lacour, D; Lacuesta, V R; Ladygin, E; Lafaye, R; Laforge, B; Lagouri, T; Lai, S; Laier, H; Lambourne, L; Lammers, S; Lampen, C L; Lampl, W; Lançon, E; Landgraf, U; Landon, M P J; Lang, V S; Lange, C; Lankford, A J; Lanni, F; Lantzsch, K; Laplace, S; Lapoire, C; Laporte, J F; Lari, T; Lassnig, M; Laurelli, P; Lavrijsen, W; Law, A T; Laycock, P; Le, B T; Le Dortz, O; Le Guirriec, E; Le Menedeu, E; LeCompte, T; Ledroit-Guillon, F; Lee, C A; Lee, H; Lee, J S H; Lee, S C; Lee, L; Lefebvre, G; Lefebvre, M; Legger, F; Leggett, C; Lehan, A; Lehmacher, M; Lehmann Miotto, G; Lei, X; Leister, A G; Leite, M A L; Leitner, R; Lellouch, D; Lemmer, B; Leney, K J C; Lenz, T; Lenzen, G; Lenzi, B; Leone, R; Leonhardt, K; Leontsinis, S; Leroy, C; Lester, C G; Lester, C M; Levchenko, M; Levêque, J; Levin, D; Levinson, L J; Levy, M; Lewis, A; Lewis, G H; Leyko, A M; Leyton, M; Li, B; Li, B; Li, H; Li, H L; Li, L; Li, S; Li, Y; Liang, Z; Liao, H; Liberti, B; Lichard, P; Lie, K; Liebal, J; Liebig, W; Limbach, C; Limosani, A; Limper, M; Lin, S C; Linde, F; Lindquist, B E; Linnemann, J T; Lipeles, E; Lipniacka, A; Lisovyi, M; Liss, T M; Lissauer, D; Lister, A; Litke, A M; Liu, B; Liu, D; Liu, J B; Liu, K; Liu, L; Liu, M; Liu, M; Liu, Y; Livan, M; Livermore, S S A; Lleres, A; Llorente Merino, J; Lloyd, S L; Lo Sterzo, F; Lobodzinska, E; Loch, P; Lockman, W S; Loddenkoetter, T; Loebinger, F K; Loevschall-Jensen, A E; Loginov, A; Loh, C W; Lohse, T; Lohwasser, K; Lokajicek, M; Lombardo, V P; Long, B A; Long, J D; Long, R E; Lopes, L; Lopez Mateos, D; Lopez Paredes, B; Lorenz, J; Lorenzo Martinez, N; Losada, M; Loscutoff, P; Lou, X; Lounis, A; Love, J; Love, P A; Lowe, A J; Lu, F; Lubatti, H J; Luci, C; Lucotte, A; Luehring, F; Lukas, W; Luminari, L; Lundberg, O; Lund-Jensen, B; Lungwitz, M; Lynn, D; Lysak, R; Lytken, E; Ma, H; Ma, L L; Maccarrone, G; Macchiolo, A; Machado Miguens, J; Macina, D; Madaffari, D; Madar, R; Maddocks, H J; Mader, W F; Madsen, A; Maeno, M; Maeno, T; Magradze, E; Mahboubi, K; Mahlstedt, J; Mahmoud, S; Maiani, C; Maidantchik, C; Maio, A; Majewski, S; Makida, Y; Makovec, N; Mal, P; Malaescu, B; Malecki, Pa; Maleev, V P; Malek, F; Mallik, U; Malon, D; Malone, C; Maltezos, S; Malyshev, V M; Malyukov, S; Mamuzic, J; Mandelli, B; Mandelli, L; Mandić, I; Mandrysch, R; Maneira, J; Manfredini, A; Manhaes de Andrade Filho, L; Manjarres Ramos, J A; Mann, A; Manning, P M; Manousakis-Katsikakis, A; Mansoulie, B; Mantifel, R; Mapelli, L; March, L; Marchand, J F; Marchiori, G; Marcisovsky, M; Marino, C P; Marques, C N; Marroquim, F; Marsden, S P; Marshall, Z; Marti, L F; Marti-Garcia, S; Martin, B; Martin, B; Martin, J P; Martin, T A; Martin, V J; Martin Dit Latour, B; Martinez, H; Martinez, M; Martin-Haugh, S; Martyniuk, A C; Marx, M; Marzano, F; Marzin, A; Masetti, L; Mashimo, T; Mashinistov, R; Masik, J; Maslennikov, A L; Massa, I; Massol, N; Mastrandrea, P; Mastroberardino, A; Masubuchi, T; Matricon, P; Matsunaga, H; Matsushita, T; Mättig, P; Mättig, S; Mattmann, J; Maurer, J; Maxfield, S J; Maximov, D A; Mazini, R; Mazzaferro, L; Mc Goldrick, G; Mc Kee, S P; McCarn, A; McCarthy, R L; McCarthy, T G; McCubbin, N A; McFarlane, K W; Mcfayden, J A; Mchedlidze, G; Mclaughlan, T; McMahon, S J; McPherson, R A; Meade, A; Mechnich, J; Medinnis, M; Meehan, S; Mehlhase, S; Mehta, A; Meier, K; Meineck, C; Meirose, B; Melachrinos, C; Mellado Garcia, B R; Meloni, F; Mengarelli, A; Menke, S; Meoni, E; Mercurio, K M; Mergelmeyer, S; Meric, N; Mermod, P; Merola, L; Meroni, C; Merritt, F S; Merritt, H; Messina, A; Metcalfe, J; Mete, A S; Meyer, C; Meyer, C; Meyer, J-P; Meyer, J; Middleton, R P; Migas, S; Mijović, L; Mikenberg, G; Mikestikova, M; Mikuž, M; Miller, D W; Mills, C; Milov, A; Milstead, D A; Milstein, D; Minaenko, A A; Moya, M Miñano; Minashvili, I A; Mincer, A I; Mindur, B; Mineev, M; Ming, Y; Mir, L M; Mirabelli, G; Mitani, T; Mitrevski, J; Mitsou, V A; Mitsui, S; Miucci, A; Miyagawa, P S; Mjörnmark, J U; Moa, T; Mochizuki, K; Moeller, V; Mohapatra, S; Mohr, W; Molander, S; Moles-Valls, R; Mönig, K; Monini, C; Monk, J; Monnier, E; Montejo Berlingen, J; Monticelli, F; Monzani, S; Moore, R W; Moraes, A; Morange, N; Morel, J; Moreno, D; Moreno Llácer, M; Morettini, P; Morgenstern, M; Morii, M; Moritz, S; Morley, A K; Mornacchi, G; Morris, J D; Morvaj, L; Moser, H G; Mosidze, M; Moss, J; Mount, R; Mountricha, E; Mouraviev, S V; Moyse, E J W; Muanza, S; Mudd, R D; Mueller, F; Mueller, J; Mueller, K; Mueller, T; Mueller, T; Muenstermann, D; Munwes, Y; Murillo Quijada, J A; Murray, W J; Musheghyan, H; Musto, E; Myagkov, A G; Myska, M; Nackenhorst, O; Nadal, J; Nagai, K; Nagai, R; Nagai, Y; Nagano, K; Nagarkar, A; Nagasaka, Y; Nagel, M; Nairz, A M; Nakahama, Y; Nakamura, K; Nakamura, T; Nakano, I; Namasivayam, H; Nanava, G; Narayan, R; Nattermann, T; Naumann, T; Navarro, G; Nayyar, R; Neal, H A; Nechaeva, P Yu; Neep, T J; Negri, A; Negri, G; Negrini, M; Nektarijevic, S; Nelson, A; Nelson, T K; Nemecek, S; Nemethy, P; Nepomuceno, A A; Nessi, M; Neubauer, M S; Neumann, M; Neves, R M; Nevski, P; Newcomer, F M; Newman, P R; Nguyen, D H; Nickerson, R B; Nicolaidou, R; Nicquevert, B; Nielsen, J; Nikiforou, N; Nikiforov, A; Nikolaenko, V; Nikolic-Audit, I; Nikolics, K; Nikolopoulos, K; Nilsson, P; Ninomiya, Y; Nisati, A; Nisius, R; Nobe, T; Nodulman, L; Nomachi, M; Nomidis, I; Norberg, S; Nordberg, M; Nowak, S; Nozaki, M; Nozka, L; Ntekas, K; Nunes Hanninger, G; Nunnemann, T; Nurse, E; Nuti, F; O'Brien, B J; O'grady, F; O'Neil, D C; O'Shea, V; Oakham, F G; Oberlack, H; Obermann, T; Ocariz, J; Ochi, A; Ochoa, M I; Oda, S; Odaka, S; Ogren, H; Oh, A; Oh, S H; Ohm, C C; Ohman, H; Ohshima, T; Okamura, W; Okawa, H; Okumura, Y; Okuyama, T; Olariu, A; Olchevski, A G; Olivares Pino, S A; Oliveira Damazio, D; Oliver Garcia, E; Olszewski, A; Olszowska, J; Onofre, A; Onyisi, P U E; Oram, C J; Oreglia, M J; Oren, Y; Orestano, D; Orlando, N; Oropeza Barrera, C; Orr, R S; Osculati, B; Ospanov, R; Otero Y Garzon, G; Otono, H; Ouchrif, M; Ouellette, E A; Ould-Saada, F; Ouraou, A; Oussoren, K P; Ouyang, Q; Ovcharova, A; Owen, M; Ozcan, V E; Ozturk, N; Pachal, K; Pacheco Pages, A; Padilla Aranda, C; Pagáčová, M; Pagan Griso, S; Paganis, E; Pahl, C; Paige, F; Pais, P; Pajchel, K; Palacino, G; Palestini, S; Pallin, D; Palma, A; Palmer, J D; Pan, Y B; Panagiotopoulou, E; Panduro Vazquez, J G; Pani, P; Panikashvili, N; Panitkin, S; Pantea, D; Paolozzi, L; Papadopoulou, Th D; Papageorgiou, K; Paramonov, A; Paredes Hernandez, D; Parker, M A; Parodi, F; Parsons, J A; Parzefall, U; Pasqualucci, E; Passaggio, S; Passeri, A; Pastore, F; Pastore, Fr; Pásztor, G; Pataraia, S; Patel, N D; Pater, J R; Patricelli, S; Pauly, T; Pearce, J; Pedersen, M; Pedraza Lopez, S; Pedro, R; Peleganchuk, S V; Pelikan, D; Peng, H; Penning, B; Penwell, J; Perepelitsa, D V; Perez Codina, E; Pérez García-Estañ, M T; Perez Reale, V; Perini, L; Pernegger, H; Perrino, R; Peschke, R; Peshekhonov, V D; Peters, K; Peters, R F Y; Petersen, B A; Petersen, J; Petersen, T C; Petit, E; Petridis, A; Petridou, C; Petrolo, E; Petrucci, F; Petteni, M; Pettersson, N E; Pezoa, R; Phillips, P W; Piacquadio, G; Pianori, E; Picazio, A; Piccaro, E; Piccinini, M; Piegaia, R; Pignotti, D T; Pilcher, J E; Pilkington, A D; Pina, J; Pinamonti, M; Pinder, A; Pinfold, J L; Pingel, A; Pinto, B; Pires, S; Pitt, M; Pizio, C; Pleier, M-A; Pleskot, V; Plotnikova, E; Plucinski, P; Poddar, S; Podlyski, F; Poettgen, R; Poggioli, L; Pohl, D; Pohl, M; Polesello, G; Policicchio, A; Polifka, R; Polini, A; Pollard, C S; Polychronakos, V; Pommès, K; Pontecorvo, L; Pope, B G; Popeneciu, G A; Popovic, D S; Poppleton, A; Portell Bueso, X; Pospelov, G E; Pospisil, S; Potamianos, K; Potrap, I N; Potter, C J; Potter, C T; Poulard, G; Poveda, J; Pozdnyakov, V; Pralavorio, P; Pranko, A; Prasad, S; Pravahan, R; Prell, S; Price, D; Price, J; Price, L E; Prieur, D; Primavera, M; Proissl, M; Prokofiev, K; Prokoshin, F; Protopapadaki, E; Protopopescu, S; Proudfoot, J; Przybycien, M; Przysiezniak, H; Ptacek, E; Pueschel, E; Puldon, D; Purohit, M; Puzo, P; Qian, J; Qin, G; Qin, Y; Quadt, A; Quarrie, D R; Quayle, W B; Quilty, D; Qureshi, A; Radeka, V; Radescu, V; Radhakrishnan, S K; Radloff, P; Rados, P; Ragusa, F; Rahal, G; Rajagopalan, S; Rammensee, M; Randle-Conde, A S; Rangel-Smith, C; Rao, K; Rauscher, F; Rave, T C; Ravenscroft, T; Raymond, M; Read, A L; Rebuzzi, D M; Redelbach, A; Redlinger, G; Reece, R; Reeves, K; Rehnisch, L; Reinsch, A; Reisin, H; Relich, M; Rembser, C; Ren, Z L; Renaud, A; Rescigno, M; Resconi, S; Resende, B; Rezanova, O L; Reznicek, P; Rezvani, R; Richter, R; Ridel, M; Rieck, P; Rijssenbeek, M; Rimoldi, A; Rinaldi, L; Ritsch, E; Riu, I; Rizatdinova, F; Rizvi, E; Robertson, S H; Robichaud-Veronneau, A; Robinson, D; Robinson, J E M; Robson, A; Roda, C; Rodrigues, L; Roe, S; Røhne, O; Rolli, S; Romaniouk, A; Romano, M; Romeo, G; Romero Adam, E; Rompotis, N; Roos, L; Ros, E; Rosati, S; Rosbach, K; Rose, M; Rosendahl, P L; Rosenthal, O; Rossetti, V; Rossi, E; Rossi, L P; Rosten, R; Rotaru, M; Roth, I; Rothberg, J; Rousseau, D; Royon, C R; Rozanov, A; Rozen, Y; Ruan, X; Rubbo, F; Rubinskiy, I; Rud, V I; Rudolph, C; Rudolph, M S; Rühr, F; Ruiz-Martinez, A; Rurikova, Z; Rusakovich, N A; Ruschke, A; Rutherfoord, J P; Ruthmann, N; Ryabov, Y F; Rybar, M; Rybkin, G; Ryder, N C; Saavedra, A F; Sacerdoti, S; Saddique, A; Sadeh, I; Sadrozinski, H F-W; Sadykov, R; Safai Tehrani, F; Sakamoto, H; Sakurai, Y; Salamanna, G; Salamon, A; Saleem, M; Salek, D; Sales De Bruin, P H; Salihagic, D; Salnikov, A; Salt, J; Salvachua Ferrando, B M; Salvatore, D; Salvatore, F; Salvucci, A; Salzburger, A; Sampsonidis, D; Sanchez, A; Sánchez, J; Sanchez Martinez, V; Sandaker, H; Sandbach, R L; Sander, H G; Sanders, M P; Sandhoff, M; Sandoval, T; Sandoval, C; Sandstroem, R; Sankey, D P C; Sansoni, A; Santoni, C; Santonico, R; Santos, H; Santoyo Castillo, I; Sapp, K; Sapronov, A; Saraiva, J G; Sarrazin, B; Sartisohn, G; Sasaki, O; Sasaki, Y; Satsounkevitch, I; Sauvage, G; Sauvan, E; Savard, P; Savu, D O; Sawyer, C; Sawyer, L; Saxon, J; Sbarra, C; Sbrizzi, A; Scanlon, T; Scannicchio, D A; Scarcella, M; Schaarschmidt, J; Schacht, P; Schaefer, D; Schaefer, R; Schaepe, S; Schaetzel, S; Schäfer, U; Schaffer, A C; Schaile, D; Schamberger, R D; Scharf, V; Schegelsky, V A; Scheirich, D; Schernau, M; Scherzer, M I; Schiavi, C; Schieck, J; Schillo, C; Schioppa, M; Schlenker, S; Schmidt, E; Schmieden, K; Schmitt, C; Schmitt, C; Schmitt, S; Schneider, B; Schnellbach, Y J; Schnoor, U; Schoeffel, L; Schoening, A; Schoenrock, B D; Schorlemmer, A L S; Schott, M; Schouten, D; Schovancova, J; Schram, M; Schramm, S; Schreyer, M; Schroeder, C; Schuh, N; Schultens, M J; Schultz-Coulon, H-C; Schulz, H; Schumacher, M; Schumm, B A; Schune, Ph; Schwartzman, A; Schwegler, Ph; Schwemling, Ph; Schwienhorst, R; Schwindling, J; Schwindt, T; Schwoerer, M; Sciacca, F G; Scifo, E; Sciolla, G; Scott, W G; Scuri, F; Scutti, F; Searcy, J; Sedov, G; Sedykh, E; Seidel, S C; Seiden, A; Seifert, F; Seixas, J M; Sekhniaidze, G; Sekula, S J; Selbach, K E; Seliverstov, D M; Sellers, G; Semprini-Cesari, N; Serfon, C; Serin, L; Serkin, L; Serre, T; Seuster, R; Severini, H; Sforza, F; Sfyrla, A; Shabalina, E; Shamim, M; Shan, L Y; Shank, J T; Shao, Q T; Shapiro, M; Shatalov, P B; Shaw, K; Sherwood, P; Shimizu, S; Shimmin, C O; Shimojima, M; Shiyakova, M; Shmeleva, A; Shochet, M J; Short, D; Shrestha, S; Shulga, E; Shupe, M A; Shushkevich, S; Sicho, P; Sidorov, D; Sidoti, A; Siegert, F; Sijacki, Dj; Silbert, O; Silva, J; Silver, Y; Silverstein, D; Silverstein, S B; Simak, V; Simard, O; Simic, Lj; Simion, S; Simioni, E; Simmons, B; Simoniello, R; Simonyan, M; Sinervo, P; Sinev, N B; Sipica, V; Siragusa, G; Sircar, A; Sisakyan, A N; Sivoklokov, S Yu; Sjölin, J; Sjursen, T B; Skottowe, H P; Skovpen, K Yu; Skubic, P; Slater, M; Slavicek, T; Sliwa, K; Smakhtin, V; Smart, B H; Smestad, L; Smirnov, S Yu; Smirnov, Y; Smirnova, L N; Smirnova, O; Smizanska, M; Smolek, K; Snesarev, A A; Snidero, G; Snow, J; Snyder, S; Sobie, R; Socher, F; Sodomka, J; Soffer, A; Soh, D A; Solans, C A; Solar, M; Solc, J; Soldatov, E Yu; Soldevila, U; Solfaroli Camillocci, E; Solodkov, A A; Solovyanov, O V; Solovyev, V; Sommer, P; Song, H Y; Soni, N; Sood, A; Sopczak, A; Sopko, V; Sopko, B; Sorin, V; Sosebee, M; Soualah, R; Soueid, P; Soukharev, A M; South, D; Spagnolo, S; Spanò, F; Spearman, W R; Spighi, R; Spigo, G; Spousta, M; Spreitzer, T; Spurlock, B; Denis, R D St; Staerz, S; Stahlman, J; Stamen, R; Stanecka, E; Stanek, R W; Stanescu, C; Stanescu-Bellu, M; Stanitzki, M M; Stapnes, S; Starchenko, E A; Stark, J; Staroba, P; Starovoitov, P; Staszewski, R; Stavina, P; Steele, G; Steinberg, P; Stekl, I; Stelzer, B; Stelzer, H J; Stelzer-Chilton, O; Stenzel, H; Stern, S; Stewart, G A; Stillings, J A; Stockton, M C; Stoebe, M; Stoicea, G; Stolte, P; Stonjek, S; Stradling, A R; Straessner, A; Stramaglia, M E; Strandberg, J; Strandberg, S; Strandlie, A; Strauss, E; Strauss, M; Strizenec, P; Ströhmer, R; Strom, D M; Stroynowski, R; Stucci, S A; Stugu, B; Styles, N A; Su, D; Su, J; Subramania, Hs; Subramaniam, R; Succurro, A; Sugaya, Y; Suhr, C; Suk, M; Sulin, V V; Sultansoy, S; Sumida, T; Sun, X; Sundermann, J E; Suruliz, K; Susinno, G; Sutton, M R; Suzuki, Y; Svatos, M; Swedish, S; Swiatlowski, M; Sykora, I; Sykora, T; Ta, D; Tackmann, K; Taenzer, J; Taffard, A; Tafirout, R; Taiblum, N; Takahashi, Y; Takai, H; Takashima, R; Takeda, H; Takeshita, T; Takubo, Y; Talby, M; Talyshev, A A; Tam, J Y C; Tamsett, M C; Tan, K G; Tanaka, J; Tanaka, R; Tanaka, S; Tanaka, S; Tanasijczuk, A J; Tani, K; Tannoury, N; Tapprogge, S; Tarem, S; Tarrade, F; Tartarelli, G F; Tas, P; Tasevsky, M; Tashiro, T; Tassi, E; Tavares Delgado, A; Tayalati, Y; Taylor, F E; Taylor, G N; Taylor, W; Teischinger, F A; Teixeira Dias Castanheira, M; Teixeira-Dias, P; Temming, K K; Ten Kate, H; Teng, P K; Terada, S; Terashi, K; Terron, J; Terzo, S; Testa, M; Teuscher, R J; Therhaag, J; Theveneaux-Pelzer, T; Thoma, S; Thomas, J P; Thomas-Wilsker, J; Thompson, E N; Thompson, P D; Thompson, P D; Thompson, A S; Thomsen, L A; Thomson, E; Thomson, M; Thong, W M; Thun, R P; Tian, F; Tibbetts, M J; Tikhomirov, V O; Tikhonov, Yu A; Timoshenko, S; Tiouchichine, E; Tipton, P; Tisserant, S; Todorov, T; Todorova-Nova, S; Toggerson, B; Tojo, J; Tokár, S; Tokushuku, K; Tollefson, K; Tomlinson, L; Tomoto, M; Tompkins, L; Toms, K; Topilin, N D; Torrence, E; Torres, H; Torró Pastor, E; Toth, J; Touchard, F; Tovey, D R; Tran, H L; Trefzger, T; Tremblet, L; Tricoli, A; Trigger, I M; Trincaz-Duvoid, S; Tripiana, M F; Triplett, N; Trischuk, W; Trocmé, B; Troncon, C; Trottier-McDonald, M; Trovatelli, M; True, P; Trzebinski, M; Trzupek, A; Tsarouchas, C; Tseng, J C-L; Tsiareshka, P V; Tsionou, D; Tsipolitis, G; Tsirintanis, N; Tsiskaridze, S; Tsiskaridze, V; Tskhadadze, E G; Tsukerman, I I; Tsulaia, V; Tsuno, S; Tsybychev, D; Tudorache, A; Tudorache, V; Tuna, A N; Tupputi, S A; Turchikhin, S; Turecek, D; Turk Cakir, I; Turra, R; Tuts, P M; Tykhonov, A; Tylmad, M; Tyndel, M; Uchida, K; Ueda, I; Ueno, R; Ughetto, M; Ugland, M; Uhlenbrock, M; Ukegawa, F; Unal, G; Undrus, A; Unel, G; Ungaro, F C; Unno, Y; Urbaniec, D; Urquijo, P; Usai, G; Usanova, A; Vacavant, L; Vacek, V; Vachon, B; Valencic, N; Valentinetti, S; Valero, A; Valery, L; Valkar, S; Valladolid Gallego, E; Vallecorsa, S; Valls Ferrer, J A; Van Berg, R; Van Der Deijl, P C; van der Geer, R; van der Graaf, H; Van Der Leeuw, R; van der Ster, D; van Eldik, N; van Gemmeren, P; Van Nieuwkoop, J; van Vulpen, I; van Woerden, M C; Vanadia, M; Vandelli, W; Vanguri, R; Vaniachine, A; Vankov, P; Vannucci, F; Vardanyan, G; Vari, R; Varnes, E W; Varol, T; Varouchas, D; Vartapetian, A; Varvell, K E; Vazeille, F; Vazquez Schroeder, T; Veatch, J; Veloso, F; Veneziano, S; Ventura, A; Ventura, D; Venturi, M; Venturi, N; Venturini, A; Vercesi, V; Verducci, M; Verkerke, W; Vermeulen, J C; Vest, A; Vetterli, M C; Viazlo, O; Vichou, I; Vickey, T; Vickey Boeriu, O E; Viehhauser, G H A; Viel, S; Vigne, R; Villa, M; Villaplana Perez, M; Vilucchi, E; Vincter, M G; Vinogradov, V B; Virzi, J; Vivarelli, I; Vives Vaque, F; Vlachos, S; Vladoiu, D; Vlasak, M; Vogel, A; Vokac, P; Volpi, G; Volpi, M; von der Schmitt, H; von Radziewski, H; von Toerne, E; Vorobel, V; Vorobev, K; Vos, M; Voss, R; Vossebeld, J H; Vranjes, N; Vranjes Milosavljevic, M; Vrba, V; Vreeswijk, M; Vu Anh, T; Vuillermet, R; Vukotic, I; Vykydal, Z; Wagner, W; Wagner, P; Wahrmund, S; Wakabayashi, J; Walder, J; Walker, R; Walkowiak, W; Wall, R; Waller, P; Walsh, B; Wang, C; Wang, C; Wang, F; Wang, H; Wang, H; Wang, J; Wang, J; Wang, K; Wang, R; Wang, S M; Wang, T; Wang, X; Wanotayaroj, C; Warburton, A; Ward, C P; Wardrope, D R; Warsinsky, M; Washbrook, A; Wasicki, C; Watanabe, I; Watkins, P M; Watson, A T; Watson, I J; Watson, M F; Watts, G; Watts, S; Waugh, B M; Webb, S; Weber, M S; Weber, S W; Webster, J S; Weidberg, A R; Weigell, P; Weinert, B; Weingarten, J; Weiser, C; Weits, H; Wells, P S; Wenaus, T; Wendland, D; Weng, Z; Wengler, T; Wenig, S; Wermes, N; Werner, M; Werner, P; Wessels, M; Wetter, J; Whalen, K; White, A; White, M J; White, R; White, S; Whiteson, D; Wicke, D; Wickens, F J; Wiedenmann, W; Wielers, M; Wienemann, P; Wiglesworth, C; Wiik-Fuchs, L A M; Wijeratne, P A; Wildauer, A; Wildt, M A; Wilkens, H G; Will, J Z; Williams, H H; Williams, S; Willis, C; Willocq, S; Wilson, J A; Wilson, A; Wingerter-Seez, I; Winklmeier, F; Wittgen, M; Wittig, T; Wittkowski, J; Wollstadt, S J; Wolter, M W; Wolters, H; Wosiek, B K; Wotschack, J; Woudstra, M J; Wozniak, K W; Wright, M; Wu, M; Wu, S L; Wu, X; Wu, Y; Wulf, E; Wyatt, T R; Wynne, B M; Xella, S; Xiao, M; Xu, D; Xu, L; Yabsley, B; Yacoob, S; Yamada, M; Yamaguchi, H; Yamaguchi, Y; Yamamoto, A; Yamamoto, K; Yamamoto, S; Yamamura, T; Yamanaka, T; Yamauchi, K; Yamazaki, Y; Yan, Z; Yang, H; Yang, H; Yang, U K; Yang, Y; Yanush, S; Yao, L; Yao, W-M; Yasu, Y; Yatsenko, E; Yau Wong, K H; Ye, J; Ye, S; Yen, A L; Yildirim, E; Yilmaz, M; Yoosoofmiya, R; Yorita, K; Yoshida, R; Yoshihara, K; Young, C; Young, C J S; Youssef, S; Yu, D R; Yu, J; Yu, J M; Yu, J; Yuan, L; Yurkewicz, A; Zabinski, B; Zaidan, R; Zaitsev, A M; Zaman, A; Zambito, S; Zanello, L; Zanzi, D; Zaytsev, A; Zeitnitz, C; Zeman, M; Zemla, A; Zengel, K; Zenin, O; Ženiš, T; Zerwas, D; Zevi Della Porta, G; Zhang, D; Zhang, F; Zhang, H; Zhang, J; Zhang, L; Zhang, X; Zhang, Z; Zhao, Z; Zhemchugov, A; Zhong, J; Zhou, B; Zhou, L; Zhou, N; Zhu, C G; Zhu, H; Zhu, J; Zhu, Y; Zhuang, X; Zibell, A; Zieminska, D; Zimine, N I; Zimmermann, C; Zimmermann, R; Zimmermann, S; Zimmermann, S; Zinonos, Z; Ziolkowski, M; Zobernig, G; Zoccoli, A; Zur Nedden, M; Zurzolo, G; Zutshi, V; Zwalinski, L

A likelihood-based discriminant for the identification of quark- and gluon-initiated jets is built and validated using 4.7 fb[Formula: see text] of proton-proton collision data at [Formula: see text] [Formula: see text] collected with the ATLAS detector at the LHC. Data samples with enriched quark or gluon content are used in the construction and validation of templates of jet properties that are the input to the likelihood-based discriminant. The discriminating power of the jet tagger is established in both data and Monte Carlo samples within a systematic uncertainty of [Formula: see text] 10-20 %. In data, light-quark jets can be tagged with an efficiency of [Formula: see text] while achieving a gluon-jet mis-tag rate of [Formula: see text] in a [Formula: see text] range between [Formula: see text] and [Formula: see text] for jets in the acceptance of the tracker. The rejection of gluon-jets found in the data is significantly below what is attainable using a Pythia 6 Monte Carlo simulation, where gluon-jet mis-tag rates of 10 % can be reached for a 50 % selection efficiency of light-quark jets using the same jet properties.

Estimation of heat loss from a cylindrical cavity receiver based on simultaneous energy and exergy analyses

NASA Astrophysics Data System (ADS)

Madadi, Vahid; Tavakoli, Touraj; Rahimi, Amir

2015-03-01

This study undertakes the experimental and theoretical investigation of heat losses from a cylindrical cavity receiver employed in a solar parabolic dish collector. Simultaneous energy and exergy equations are used for a thermal performance analysis of the system. The effects of wind speed and its direction on convection loss has also been investigated. The effects of operational parameters, such as heat transfer fluid mass flow rate and wind speed, and structural parameters, such as receiver geometry and inclination, are investigated. The portion of radiative heat loss is less than 10%. An empirical and simplified correlation for estimating the dimensionless convective heat transfer coefficient in terms of the Re mathrm {Re} number and the average receiver wall temperature is proposed. This correlation is applicable for a wind speed range of 0.10.1 to 10 m/s. Moreover, the proposed correlation for Nu mathrm {Nu} number is validated using experimental data obtained through the experiments carried out with a conical receiver with two aperture diameters. The coefficient of determination R2 and the normalized root mean square error (NRMSE) parameters were calculated, and the results show that there is a good agreement between predicted results and experimental data. R2 is greater than 0.950.95 and the NRMSE parameters is less than 0.060.06 in this analysis.

Randomized trial of exclusive human milk versus preterm formula diets in extremely premature infants

USDA-ARS?s Scientific Manuscript database

Our objective was to compare the duration of parenteral nutrition, growth, and morbidity in extremely premature infants fed exclusive diets of either bovine milk-based preterm formula (BOV) or donor human milk and human milk-based human milk fortifier (HUM), in a randomized trial of formula vs human...

75 FR 57912 - Boulder Canyon Project-Rate Order No. WAPA-150

Federal Register 2010, 2011, 2012, 2013, 2014

2010-09-23

...-setting Formula and Approval of FY 2011 Base Charge and Rates. SUMMARY: The Deputy Secretary of Energy... existing Boulder Canyon Project (BCP) rate-setting formula and approving the base charge and rates for FY... financial and load data. The existing rate-setting formula is being extended under Rate Order No. WAPA-150...

An Examination of Alternative Poverty Measures for the Wisconsin Equalization Aid Formula.

ERIC Educational Resources Information Center

Cibulka, James G.

1986-01-01

Wisconsin's guaranteed tax base equalization formula has no direct adjustment for the additional costs of educating poverty level pupils. This paper establishes the need for an adjustment and examines three measures (based on varying poverty definitions) to determine which provides the most equitable funding formula for educating poor children. (9…

24 CFR 968.103 - Allocation of funds under section 14.

Code of Federal Regulations, 2012 CFR

2012-04-01

... section is greater than one percent, the number of units on which formula funding is based will be the... there has been a one percent reduction in units on a cumulative basis; (ii) A reduction in formula... (c) of this section. (d) Formula allocation based on relative needs. After determining the amounts to...

An empirical model for the complex dielectric permittivity of soils as a function of water content

NASA Technical Reports Server (NTRS)

Wang, J. R.; Chmugge, T. J.

1978-01-01

The recent measurements on the dielectric properties of soils shows that the variation of dielectric constant with moisture content depends on soil types. The observed dielectric constant increases only slowly with moisture content up to a transition point. Beyond the transition it increases rapidly with moisture content. The moisture value of transition region was found to be higher for high clay content soils than for sandy soils. Many mixing formulas were compared with, and were found incompatible with, the measured dielectric variations of soil-water mixtures. A simple empirical model was proposed to describe the dielectric behavior of ths soil-water mixtures. The relationship between transition moisture and wilting point provides a means of estimating soil dielectric properties on the basis of texture information.

ShinyGPAS: interactive genomic prediction accuracy simulator based on deterministic formulas.

PubMed

Morota, Gota

2017-12-20

Deterministic formulas for the accuracy of genomic predictions highlight the relationships among prediction accuracy and potential factors influencing prediction accuracy prior to performing computationally intensive cross-validation. Visualizing such deterministic formulas in an interactive manner may lead to a better understanding of how genetic factors control prediction accuracy. The software to simulate deterministic formulas for genomic prediction accuracy was implemented in R and encapsulated as a web-based Shiny application. Shiny genomic prediction accuracy simulator (ShinyGPAS) simulates various deterministic formulas and delivers dynamic scatter plots of prediction accuracy versus genetic factors impacting prediction accuracy, while requiring only mouse navigation in a web browser. ShinyGPAS is available at: https://chikudaisei.shinyapps.io/shinygpas/ . ShinyGPAS is a shiny-based interactive genomic prediction accuracy simulator using deterministic formulas. It can be used for interactively exploring potential factors that influence prediction accuracy in genome-enabled prediction, simulating achievable prediction accuracy prior to genotyping individuals, or supporting in-class teaching. ShinyGPAS is open source software and it is hosted online as a freely available web-based resource with an intuitive graphical user interface.

Stochastic theory of fatigue corrosion

NASA Astrophysics Data System (ADS)

Hu, Haiyun

1999-10-01

A stochastic theory of corrosion has been constructed. The stochastic equations are described giving the transportation corrosion rate and fluctuation corrosion coefficient. In addition the pit diameter distribution function, the average pit diameter and the most probable pit diameter including other related empirical formula have been derived. In order to clarify the effect of stress range on the initiation and growth behaviour of pitting corrosion, round smooth specimen were tested under cyclic loading in 3.5% NaCl solution.

Dynamic properties of composite cemented clay.

PubMed

Cai, Yuan-Qiang; Liang, Xu

2004-03-01

In this work, the dynamic properties of composite cemented clay under a wide range of strains were studied considering the effect of different mixing ratio and the change of confining pressures through dynamic triaxial test. A simple and practical method to estimate the dynamic elastic modulus and damping ratio is proposed in this paper and a related empirical normalized formula is also presented. The results provide useful guidelines for preliminary estimation of cement requirements to improve the dynamic properties of clays.

On the inclusion of the hydrogen dimer in the analysis of Voyager IRIS spectra

NASA Technical Reports Server (NTRS)

Carlson, Barbara E.; Ma, Qiancheng; Lacis, Andrew

1992-01-01

Empirical formulas are fitted to existing theoretical absorption spectra of H2-H2 pairs in the far-infrared allowing the inclusion of dimer absorption, parameterized with the height dependence of the para-hydrogen profile, in the calculations. Comparison between synthetic and Voyager IRIS spectra shows that once the dimer absorption is included it is now possible to reproduce the hydrogen portion of the IRIS spectrum to within the precision of the measurements.

Impact of phenomenological theory of turbulence on pragmatic approach to fluvial hydraulics

NASA Astrophysics Data System (ADS)

Ali, Sk Zeeshan; Dey, Subhasish

2018-04-01

The phenomenological theory of turbulence (PTT) remains a long-standing and fascinating theory in turbulence research. In this review article, we highlight the state-of-the-science of the impact of the PTT on the pragmatic approach to fluvial hydraulics, explored over recent decades, discussing the salient and the subtle roles that the turbulence plays in governing many physical processes. To acquire a theoretical explanation of this pragmatic approach necessitates an intuitive thought that can bring together the background mechanisms of all the physical processes under one law—a thought that is capable of finding their inextricable links with the turbulent energy spectrum. We begin here with emphasizing the spectral and the co-spectral origin of the well-recognized laws of the wall, the resistance equation, and the turbulence intensities by portraying the typical momentum transfer mechanism of eddies in a turbulent flow. Next, we focus on the scaling laws of key fluvial processes derived from the perspective of the PTT, enlightening their physical insight and ability to judge how far the so-called empirical formulas can be used with confidence. The PTT has been able to disclose the origin of several primeval empirical formulas that have been used over many years without having any theoretical clarification and confirmation. Finally, we make an effort to describe some unsolved issues to be resolved as a future scope of research.

Flavor experiences during formula feeding are related to preferences during childhood

PubMed Central

Mennella, Julie A.; Beauchamp, Gary K.

2010-01-01

As part of a program of research designed to investigate the long-term effects of early feeding experiences, the present study exploited the substantial flavor variation inherent in three classes of commercially available infant formulas and determined whether flavor preferences during childhood differed as a function of the class of formula (i.e., milk, soy, hydrolysate) that 4- to 5-year-old children were fed during their infancy. Age appropriate, game-like tasks that were fun for children and minimized the impact of language development were used to examine their preferences for a wide range of food-related odor qualities including infant formulas, as well as the flavor of milk-based and hydrolysate formulas and plain, sour- and bitter-flavored apple juices. Formula type influenced children’s flavor preferences when tested several years after their last exposure to the formula. When compared to children who were fed milk-based formulas (n = 27), children fed protein hydrolysate formulas (n = 50) were more likely to prefer sour-flavored juices, as well as the odor and flavor of formulas, and less likely to make negative facial expressions during the taste tests. Those fed soy formulas (n = 27) preferred the bitter-flavored apple juice. That the effects of differential formula feeding also modified children’s food preferences is suggested by mothers’ reports that children fed hydrolysate or soy formulas were significantly more likely to prefer broccoli than were those fed milk formulas. These data are consistent with the hypothesis that flavor experiences influence subsequent flavor preferences even several years following the early experience. PMID:12113993

Soy infant formula and seizures in children with autism: a retrospective study.

PubMed

Westmark, Cara J

2014-01-01

Seizures are a common phenotype in many neurodevelopmental disorders including fragile X syndrome, Down syndrome and autism. We hypothesized that phytoestrogens in soy-based infant formula were contributing to lower seizure threshold in these disorders. Herein, we evaluated the dependence of seizure incidence on infant formula in a population of autistic children. Medical record data were obtained on 1,949 autistic children from the SFARI Simplex Collection. An autism diagnosis was determined by scores on the ADI-R and ADOS exams. The database included data on infant formula use, seizure incidence, the specific type of seizure exhibited and IQ. Soy-based formula was utilized in 17.5% of the study population. Females comprised 13.4% of the subjects. There was a 2.6-fold higher rate of febrile seizures [4.2% versus 1.6%, OR = 2.6, 95% CI = 1.3-5.3], a 2.1-fold higher rate of epilepsy comorbidity [3.6% versus 1.7%, OR = 2.2, 95% CI = 1.1-4.7] and a 4-fold higher rate of simple partial seizures [1.2% versus 0.3%, OR = 4.8, 95% CI = 1.0-23] in the autistic children fed soy-based formula. No statistically significant associations were found with other outcomes including: IQ, age of seizure onset, infantile spasms and atonic, generalized tonic clonic, absence and complex partial seizures. Limitations of the study included: infant formula and seizure data were based on parental recall, there were significantly less female subjects, and there was lack of data regarding critical confounders such as the reasons the subjects used soy formula, age at which soy formula was initiated and the length of time on soy formula. Despite these limitations, our results suggest that the use of soy-based infant formula may be associated with febrile seizures in both genders and with a diagnosis of epilepsy in males in autistic children. Given the lack of data on critical confounders and the retrospective nature of the study, a prospective study is required to confirm the association.

Inclusive quarkonium production at forward rapidity in pp collisions at [Formula: see text]TeV.

PubMed

Adam, J; Adamová, D; Aggarwal, M M; Aglieri Rinella, G; Agnello, M; Agrawal, N; Ahammed, Z; Ahn, S U; Aiola, S; Akindinov, A; Alam, S N; Aleksandrov, D; Alessandro, B; Alexandre, D; Alfaro Molina, R; Alici, A; Alkin, A; Almaraz, J R M; Alme, J; Alt, T; Altinpinar, S; Altsybeev, I; Alves Garcia Prado, C; Andrei, C; Andronic, A; Anguelov, V; Anielski, J; Antičić, T; Antinori, F; Antonioli, P; Aphecetche, L; Appelshäuser, H; Arcelli, S; Arnaldi, R; Arnold, O W; Arsene, I C; Arslandok, M; Audurier, B; Augustinus, A; Averbeck, R; Azmi, M D; Badalà, A; Baek, Y W; Bagnasco, S; Bailhache, R; Bala, R; Baldisseri, A; Baral, R C; Barbano, A M; Barbera, R; Barile, F; Barnaföldi, G G; Barnby, L S; Barret, V; Bartalini, P; Barth, K; Bartke, J; Bartsch, E; Basile, M; Bastid, N; Basu, S; Bathen, B; Batigne, G; Batista Camejo, A; Batyunya, B; Batzing, P C; Bearden, I G; Beck, H; Bedda, C; Behera, N K; Belikov, I; Bellini, F; Bello Martinez, H; Bellwied, R; Belmont, R; Belmont-Moreno, E; Belyaev, V; Bencedi, G; Beole, S; Berceanu, I; Bercuci, A; Berdnikov, Y; Berenyi, D; Bertens, R A; Berzano, D; Betev, L; Bhasin, A; Bhat, I R; Bhati, A K; Bhattacharjee, B; Bhom, J; Bianchi, L; Bianchi, N; Bianchin, C; Bielčík, J; Bielčíková, J; Bilandzic, A; Biswas, R; Biswas, S; Bjelogrlic, S; Blair, J T; Blau, D; Blume, C; Bock, F; Bogdanov, A; Bøggild, H; Boldizsár, L; Bombara, M; Book, J; Borel, H; Borissov, A; Borri, M; Bossú, F; Botta, E; Böttger, S; Bourjau, C; Braun-Munzinger, P; Bregant, M; Breitner, T; Broker, T A; Browning, T A; Broz, M; Brucken, E J; Bruna, E; Bruno, G E; Budnikov, D; Buesching, H; Bufalino, S; Buncic, P; Busch, O; Buthelezi, Z; Butt, J B; Buxton, J T; Caffarri, D; Cai, X; Caines, H; Calero Diaz, L; Caliva, A; Calvo Villar, E; Camerini, P; Carena, F; Carena, W; Carnesecchi, F; Castillo Castellanos, J; Castro, A J; Casula, E A R; Ceballos Sanchez, C; Cepila, J; Cerello, P; Cerkala, J; Chang, B; Chapeland, S; Chartier, M; Charvet, J L; Chattopadhyay, S; Chattopadhyay, S; Chelnokov, V; Cherney, M; Cheshkov, C; Cheynis, B; Chibante Barroso, V; Chinellato, D D; Cho, S; Chochula, P; Choi, K; Chojnacki, M; Choudhury, S; Christakoglou, P; Christensen, C H; Christiansen, P; Chujo, T; Chung, S U; Cicalo, C; Cifarelli, L; Cindolo, F; Cleymans, J; Colamaria, F; Colella, D; Collu, A; Colocci, M; Conesa Balbastre, G; Conesa Del Valle, Z; Connors, M E; Contreras, J G; Cormier, T M; Corrales Morales, Y; Cortés Maldonado, I; Cortese, P; Cosentino, M R; Costa, F; Crochet, P; Cruz Albino, R; Cuautle, E; Cunqueiro, L; Dahms, T; Dainese, A; Danu, A; Das, D; Das, I; Das, S; Dash, A; Dash, S; De, S; De Caro, A; de Cataldo, G; de Conti, C; de Cuveland, J; De Falco, A; De Gruttola, D; De Marco, N; De Pasquale, S; Deisting, A; Deloff, A; Dénes, E; Deplano, C; Dhankher, P; Di Bari, D; Di Mauro, A; Di Nezza, P; Diaz Corchero, M A; Dietel, T; Dillenseger, P; Divià, R; Djuvsland, Ø; Dobrin, A; Domenicis Gimenez, D; Dönigus, B; Dordic, O; Drozhzhova, T; Dubey, A K; Dubla, A; Ducroux, L; Dupieux, P; Ehlers, R J; Elia, D; Engel, H; Epple, E; Erazmus, B; Erdemir, I; Erhardt, F; Espagnon, B; Estienne, M; Esumi, S; Eum, J; Evans, D; Evdokimov, S; Eyyubova, G; Fabbietti, L; Fabris, D; Faivre, J; Fantoni, A; Fasel, M; Feldkamp, L; Feliciello, A; Feofilov, G; Ferencei, J; Fernández Téllez, A; Ferreiro, E G; Ferretti, A; Festanti, A; Feuillard, V J G; Figiel, J; Figueredo, M A S; Filchagin, S; Finogeev, D; Fionda, F M; Fiore, E M; Fleck, M G; Floris, M; Foertsch, S; Foka, P; Fokin, S; Fragiacomo, E; Francescon, A; Frankenfeld, U; Fuchs, U; Furget, C; Furs, A; Fusco Girard, M; Gaardhøje, J J; Gagliardi, M; Gago, A M; Gallio, M; Gangadharan, D R; Ganoti, P; Gao, C; Garabatos, C; Garcia-Solis, E; Gargiulo, C; Gasik, P; Gauger, E F; Germain, M; Gheata, A; Gheata, M; Ghosh, P; Ghosh, S K; Gianotti, P; Giubellino, P; Giubilato, P; Gladysz-Dziadus, E; Glässel, P; Goméz Coral, D M; Gomez Ramirez, A; Gonzalez, V; González-Zamora, P; Gorbunov, S; Görlich, L; Gotovac, S; Grabski, V; Grachov, O A; Graczykowski, L K; Graham, K L; Grelli, A; Grigoras, A; Grigoras, C; Grigoriev, V; Grigoryan, A; Grigoryan, S; Grinyov, B; Grion, N; Gronefeld, J M; Grosse-Oetringhaus, J F; Grossiord, J-Y; Grosso, R; Guber, F; Guernane, R; Guerzoni, B; Gulbrandsen, K; Gunji, T; Gupta, A; Gupta, R; Haake, R; Haaland, Ø; Hadjidakis, C; Haiduc, M; Hamagaki, H; Hamar, G; Harris, J W; Harton, A; Hatzifotiadou, D; Hayashi, S; Heckel, S T; Heide, M; Helstrup, H; Herghelegiu, A; Herrera Corral, G; Hess, B A; Hetland, K F; Hillemanns, H; Hippolyte, B; Hosokawa, R; Hristov, P; Huang, M; Humanic, T J; Hussain, N; Hussain, T; Hutter, D; Hwang, D S; Ilkaev, R; Inaba, M; Ippolitov, M; Irfan, M; Ivanov, M; Ivanov, V; Izucheev, V; Jacobs, P M; Jadhav, M B; Jadlovska, S; Jadlovsky, J; Jahnke, C; Jakubowska, M J; Jang, H J; Janik, M A; Jayarathna, P H S Y; Jena, C; Jena, S; Jimenez Bustamante, R T; Jones, P G; Jung, H; Jusko, A; Kalinak, P; Kalweit, A; Kamin, J; Kang, J H; Kaplin, V; Kar, S; Karasu Uysal, A; Karavichev, O; Karavicheva, T; Karayan, L; Karpechev, E; Kebschull, U; Keidel, R; Keijdener, D L D; Keil, M; Mohisin Khan, M; Khan, P; Khan, S A; Khanzadeev, A; Kharlov, Y; Kileng, B; Kim, D W; Kim, D J; Kim, D; Kim, H; Kim, J S; Kim, M; Kim, M; Kim, S; Kim, T; Kirsch, S; Kisel, I; Kiselev, S; Kisiel, A; Kiss, G; Klay, J L; Klein, C; Klein, J; Klein-Bösing, C; Klewin, S; Kluge, A; Knichel, M L; Knospe, A G; Kobayashi, T; Kobdaj, C; Kofarago, M; Kollegger, T; Kolojvari, A; Kondratiev, V; Kondratyeva, N; Kondratyuk, E; Konevskikh, A; Kopcik, M; Kour, M; Kouzinopoulos, C; Kovalenko, O; Kovalenko, V; Kowalski, M; Koyithatta Meethaleveedu, G; Králik, I; Kravčáková, A; Kretz, M; Krivda, M; Krizek, F; Kryshen, E; Krzewicki, M; Kubera, A M; Kučera, V; Kuhn, C; Kuijer, P G; Kumar, A; Kumar, J; Kumar, L; Kumar, S; Kurashvili, P; Kurepin, A; Kurepin, A B; Kuryakin, A; Kweon, M J; Kwon, Y; La Pointe, S L; La Rocca, P; Ladron de Guevara, P; Lagana Fernandes, C; Lakomov, I; Langoy, R; Lara, C; Lardeux, A; Lattuca, A; Laudi, E; Lea, R; Leardini, L; Lee, G R; Lee, S; Lehas, F; Lemmon, R C; Lenti, V; Leogrande, E; León Monzón, I; León Vargas, H; Leoncino, M; Lévai, P; Li, S; Li, X; Lien, J; Lietava, R; Lindal, S; Lindenstruth, V; Lippmann, C; Lisa, M A; Ljunggren, H M; Lodato, D F; Loenne, P I; Loginov, V; Loizides, C; Lopez, X; López Torres, E; Lowe, A; Luettig, P; Lunardon, M; Luparello, G; Maevskaya, A; Mager, M; Mahajan, S; Mahmood, S M; Maire, A; Majka, R D; Malaev, M; Maldonado Cervantes, I; Malinina, L; Mal'Kevich, D; Malzacher, P; Mamonov, A; Manko, V; Manso, F; Manzari, V; Marchisone, M; Mareš, J; Margagliotti, G V; Margotti, A; Margutti, J; Marín, A; Markert, C; Marquard, M; Martin, N A; Martin Blanco, J; Martinengo, P; Martínez, M I; Martínez García, G; Martinez Pedreira, M; Mas, A; Masciocchi, S; Masera, M; Masoni, A; Massacrier, L; Mastroserio, A; Matyja, A; Mayer, C; Mazer, J; Mazzoni, M A; Mcdonald, D; Meddi, F; Melikyan, Y; Menchaca-Rocha, A; Meninno, E; Mercado Pérez, J; Meres, M; Miake, Y; Mieskolainen, M M; Mikhaylov, K; Milano, L; Milosevic, J; Minervini, L M; Mischke, A; Mishra, A N; Miśkowiec, D; Mitra, J; Mitu, C M; Mohammadi, N; Mohanty, B; Molnar, L; Montaño Zetina, L; Montes, E; Moreira De Godoy, D A; Moreno, L A P; Moretto, S; Morreale, A; Morsch, A; Muccifora, V; Mudnic, E; Mühlheim, D; Muhuri, S; Mukherjee, M; Mulligan, J D; Munhoz, M G; Munzer, R H; Murray, S; Musa, L; Musinsky, J; Naik, B; Nair, R; Nandi, B K; Nania, R; Nappi, E; Naru, M U; Natal da Luz, H; Nattrass, C; Nayak, K; Nayak, T K; Nazarenko, S; Nedosekin, A; Nellen, L; Ng, F; Nicassio, M; Niculescu, M; Niedziela, J; Nielsen, B S; Nikolaev, S; Nikulin, S; Nikulin, V; Noferini, F; Nomokonov, P; Nooren, G; Noris, J C C; Norman, J; Nyanin, A; Nystrand, J; Oeschler, H; Oh, S; Oh, S K; Ohlson, A; Okatan, A; Okubo, T; Olah, L; Oleniacz, J; Oliveira Da Silva, A C; Oliver, M H; Onderwaater, J; Oppedisano, C; Orava, R; Ortiz Velasquez, A; Oskarsson, A; Otwinowski, J; Oyama, K; Ozdemir, M; Pachmayer, Y; Pagano, P; Paić, G; Pal, S K; Pan, J; Pandey, A K; Papcun, P; Papikyan, V; Pappalardo, G S; Pareek, P; Park, W J; Parmar, S; Passfeld, A; Paticchio, V; Patra, R N; Paul, B; Pei, H; Peitzmann, T; Pereira Da Costa, H; Pereira De Oliveira Filho, E; Peresunko, D; Pérez Lara, C E; Perez Lezama, E; Peskov, V; Pestov, Y; Petráček, V; Petrov, V; Petrovici, M; Petta, C; Piano, S; Pikna, M; Pillot, P; Pinazza, O; Pinsky, L; Piyarathna, D B; Płoskoń, M; Planinic, M; Pluta, J; Pochybova, S; Podesta-Lerma, P L M; Poghosyan, M G; Polichtchouk, B; Poljak, N; Poonsawat, W; Pop, A; Porteboeuf-Houssais, S; Porter, J; Pospisil, J; Prasad, S K; Preghenella, R; Prino, F; Pruneau, C A; Pshenichnov, I; Puccio, M; Puddu, G; Pujahari, P; Punin, V; Putschke, J; Qvigstad, H; Rachevski, A; Raha, S; Rajput, S; Rak, J; Rakotozafindrabe, A; Ramello, L; Rami, F; Raniwala, R; Raniwala, S; Räsänen, S S; Rascanu, B T; Rathee, D; Read, K F; Redlich, K; Reed, R J; Rehman, A; Reichelt, P; Reidt, F; Ren, X; Renfordt, R; Reolon, A R; Reshetin, A; Revol, J-P; Reygers, K; Riabov, V; Ricci, R A; Richert, T; Richter, M; Riedler, P; Riegler, W; Riggi, F; Ristea, C; Rocco, E; Rodríguez Cahuantzi, M; Rodriguez Manso, A; Røed, K; Rogochaya, E; Rohr, D; Röhrich, D; Romita, R; Ronchetti, F; Ronflette, L; Rosnet, P; Rossi, A; Roukoutakis, F; Roy, A; Roy, C; Roy, P; Rubio Montero, A J; Rui, R; Russo, R; Ryabinkin, E; Ryabov, Y; Rybicki, A; Sadovsky, S; Šafařík, K; Sahlmuller, B; Sahoo, P; Sahoo, R; Sahoo, S; Sahu, P K; Saini, J; Sakai, S; Saleh, M A; Salzwedel, J; Sambyal, S; Samsonov, V; Šándor, L; Sandoval, A; Sano, M; Sarkar, D; Scapparone, E; Scarlassara, F; Schiaua, C; Schicker, R; Schmidt, C; Schmidt, H R; Schuchmann, S; Schukraft, J; Schulc, M; Schuster, T; Schutz, Y; Schwarz, K; Schweda, K; Scioli, G; Scomparin, E; Scott, R; Šefčík, M; Seger, J E; Sekiguchi, Y; Sekihata, D; Selyuzhenkov, I; Senosi, K; Senyukov, S; Serradilla, E; Sevcenco, A; Shabanov, A; Shabetai, A; Shadura, O; Shahoyan, R; Shangaraev, A; Sharma, A; Sharma, M; Sharma, M; Sharma, N; Shigaki, K; Shtejer, K; Sibiriak, Y; Siddhanta, S; Sielewicz, K M; Siemiarczuk, T; Silvermyr, D; Silvestre, C; Simatovic, G; Simonetti, G; Singaraju, R; Singh, R; Singha, S; Singhal, V; Sinha, B C; Sinha, T; Sitar, B; Sitta, M; Skaali, T B; Slupecki, M; Smirnov, N; Snellings, R J M; Snellman, T W; Søgaard, C; Song, J; Song, M; Song, Z; Soramel, F; Sorensen, S; Sozzi, F; Spacek, M; Spiriti, E; Sputowska, I; Spyropoulou-Stassinaki, M; Stachel, J; Stan, I; Stefanek, G; Stenlund, E; Steyn, G; Stiller, J H; Stocco, D; Strmen, P; Suaide, A A P; Sugitate, T; Suire, C; Suleymanov, M; Suljic, M; Sultanov, R; Šumbera, M; Szabo, A; Szanto de Toledo, A; Szarka, I; Szczepankiewicz, A; Szymanski, M; Tabassam, U; Takahashi, J; Tambave, G J; Tanaka, N; Tangaro, M A; Tarhini, M; Tariq, M; Tarzila, M G; Tauro, A; Tejeda Muñoz, G; Telesca, A; Terasaki, K; Terrevoli, C; Teyssier, B; Thäder, J; Thomas, D; Tieulent, R; Timmins, A R; Toia, A; Trogolo, S; Trombetta, G; Trubnikov, V; Trzaska, W H; Tsuji, T; Tumkin, A; Turrisi, R; Tveter, T S; Ullaland, K; Uras, A; Usai, G L; Utrobicic, A; Vajzer, M; Vala, M; Valencia Palomo, L; Vallero, S; Van Der Maarel, J; Van Hoorne, J W; van Leeuwen, M; Vanat, T; Vande Vyvre, P; Varga, D; Vargas, A; Vargyas, M; Varma, R; Vasileiou, M; Vasiliev, A; Vauthier, A; Vechernin, V; Veen, A M; Veldhoen, M; Velure, A; Venaruzzo, M; Vercellin, E; Vergara Limón, S; Vernet, R; Verweij, M; Vickovic, L; Viesti, G; Viinikainen, J; Vilakazi, Z; Villalobos Baillie, O; Villatoro Tello, A; Vinogradov, A; Vinogradov, L; Vinogradov, Y; Virgili, T; Vislavicius, V; Viyogi, Y P; Vodopyanov, A; Völkl, M A; Voloshin, K; Voloshin, S A; Volpe, G; von Haller, B; Vorobyev, I; Vranic, D; Vrláková, J; Vulpescu, B; Vyushin, A; Wagner, B; Wagner, J; Wang, H; Wang, M; Watanabe, D; Watanabe, Y; Weber, M; Weber, S G; Weiser, D F; Wessels, J P; Westerhoff, U; Whitehead, A M; Wiechula, J; Wikne, J; Wilde, M; Wilk, G; Wilkinson, J; Williams, M C S; Windelband, B; Winn, M; Yaldo, C G; Yang, H; Yang, P; Yano, S; Yasar, C; Yin, Z; Yokoyama, H; Yoo, I-K; Yoon, J H; Yurchenko, V; Yushmanov, I; Zaborowska, A; Zaccolo, V; Zaman, A; Zampolli, C; Zanoli, H J C; Zaporozhets, S; Zardoshti, N; Zarochentsev, A; Závada, P; Zaviyalov, N; Zbroszczyk, H; Zgura, I S; Zhalov, M; Zhang, H; Zhang, X; Zhang, Y; Zhang, C; Zhang, Z; Zhao, C; Zhigareva, N; Zhou, D; Zhou, Y; Zhou, Z; Zhu, H; Zhu, J; Zichichi, A; Zimmermann, A; Zimmermann, M B; Zinovjev, G; Zyzak, M

2016-01-01

We report on the inclusive production cross sections of [Formula: see text], [Formula: see text], [Formula: see text](1S), [Formula: see text](2S) and [Formula: see text](3S), measured at forward rapidity with the ALICE detector in [Formula: see text] collisions at a center-of-mass energy [Formula: see text] TeV. The analysis is based on data collected at the LHC and corresponds to an integrated luminosity of 1.23 pb[Formula: see text]. Quarkonia are reconstructed in the dimuon-decay channel. The differential production cross sections are measured as a function of the transverse momentum [Formula: see text] and rapidity y , over the [Formula: see text] ranges [Formula: see text] GeV/ c for [Formula: see text], [Formula: see text] GeV/ c for all other resonances, and for [Formula: see text]. The cross sections, integrated over [Formula: see text] and y , and assuming unpolarized quarkonia, are [Formula: see text] [Formula: see text]b, [Formula: see text] [Formula: see text]b, [Formula: see text] nb, [Formula: see text] nb and [Formula: see text] nb, where the first uncertainty is statistical and the second one is systematic. These values agree, within at most [Formula: see text], with measurements performed by the LHCb collaboration in the same rapidity range.

Approximation of epidemic models by diffusion processes and their statistical inference.

PubMed

Guy, Romain; Larédo, Catherine; Vergu, Elisabeta

2015-02-01

Multidimensional continuous-time Markov jump processes [Formula: see text] on [Formula: see text] form a usual set-up for modeling [Formula: see text]-like epidemics. However, when facing incomplete epidemic data, inference based on [Formula: see text] is not easy to be achieved. Here, we start building a new framework for the estimation of key parameters of epidemic models based on statistics of diffusion processes approximating [Formula: see text]. First, previous results on the approximation of density-dependent [Formula: see text]-like models by diffusion processes with small diffusion coefficient [Formula: see text], where [Formula: see text] is the population size, are generalized to non-autonomous systems. Second, our previous inference results on discretely observed diffusion processes with small diffusion coefficient are extended to time-dependent diffusions. Consistent and asymptotically Gaussian estimates are obtained for a fixed number [Formula: see text] of observations, which corresponds to the epidemic context, and for [Formula: see text]. A correction term, which yields better estimates non asymptotically, is also included. Finally, performances and robustness of our estimators with respect to various parameters such as [Formula: see text] (the basic reproduction number), [Formula: see text], [Formula: see text] are investigated on simulations. Two models, [Formula: see text] and [Formula: see text], corresponding to single and recurrent outbreaks, respectively, are used to simulate data. The findings indicate that our estimators have good asymptotic properties and behave noticeably well for realistic numbers of observations and population sizes. This study lays the foundations of a generic inference method currently under extension to incompletely observed epidemic data. Indeed, contrary to the majority of current inference techniques for partially observed processes, which necessitates computer intensive simulations, our method being mostly an analytical approach requires only the classical optimization steps.

Partial transpose of random quantum states: Exact formulas and meanders

NASA Astrophysics Data System (ADS)

Fukuda, Motohisa; Śniady, Piotr

2013-04-01

We investigate the asymptotic behavior of the empirical eigenvalues distribution of the partial transpose of a random quantum state. The limiting distribution was previously investigated via Wishart random matrices indirectly (by approximating the matrix of trace 1 by the Wishart matrix of random trace) and shown to be the semicircular distribution or the free difference of two free Poisson distributions, depending on how dimensions of the concerned spaces grow. Our use of Wishart matrices gives exact combinatorial formulas for the moments of the partial transpose of the random state. We find three natural asymptotic regimes in terms of geodesics on the permutation groups. Two of them correspond to the above two cases; the third one turns out to be a new matrix model for the meander polynomials. Moreover, we prove the convergence to the semicircular distribution together with its extreme eigenvalues under weaker assumptions, and show large deviation bound for the latter.

Excise tax avoidance: the case of state cigarette taxes.

PubMed

DeCicca, Philip; Kenkel, Donald; Liu, Feng

2013-12-01

We conduct an applied welfare economics analysis of cigarette tax avoidance. We develop an extension of the standard formula for the optimal Pigouvian corrective tax to incorporate the possibility that consumers avoid the tax by making purchases in nearby lower tax jurisdictions. To provide a key parameter for our formula, we estimate a structural endogenous switching regression model of border-crossing and cigarette prices. In illustrative calculations, we find that for many states, after taking into account tax avoidance the optimal tax is at least 20% smaller than the standard Pigouvian tax that simply internalizes external costs. Our empirical estimate that tax avoidance strongly responds to the price differential is the main reason for this result. We also use our results to examine the benefits of replacing avoidable state excise taxes with a harder-to-avoid federal excise tax on cigarettes. Copyright © 2013 Elsevier B.V. All rights reserved.

Excise Tax Avoidance: The Case of State Cigarette Taxes

PubMed Central

DeCicca, Philip; Kenkel, Donald; Liu, Feng

2013-01-01

We conduct an applied welfare economics analysis of cigarette tax avoidance. We develop an extension of the standard formula for the optimal Pigouvian corrective tax to incorporate the possibility that consumers avoid the tax by making purchases in nearby lower-tax jurisdictions. To provide a key parameter for our formula, we estimate a structural endogenous switching regression model of border-crossing and cigarette prices. In illustrative calculations, we find that for many states, after taking into account tax avoidance the optimal tax is at least 20 percent smaller than the standard Pigouvian tax that simply internalizes external costs. Our empirical estimate that tax avoidance strongly responds to the price differential is the main reason for this result. We also use our results to examine the benefits of replacing avoidable state excise taxes with a harder-to-avoid federal excise tax on cigarettes. PMID:24140760

Search for lepton-flavour-violating decays of the Higgs and Z bosons with the ATLAS detector.

PubMed

Aad, G; Abbott, B; Abdallah, J; Abdinov, O; Abeloos, B; Aben, R; Abolins, M; AbouZeid, O S; Abraham, N L; Abramowicz, H; Abreu, H; Abreu, R; Abulaiti, Y; Acharya, B S; Adamczyk, L; Adams, D L; Adelman, J; Adomeit, S; Adye, T; Affolder, A A; Agatonovic-Jovin, T; Agricola, J; Aguilar-Saavedra, J A; Ahlen, S P; Ahmadov, F; Aielli, G; Akerstedt, H; Åkesson, T P A; Akimov, A V; Alberghi, G L; Albert, J; Albrand, S; Verzini, M J Alconada; Aleksa, M; Aleksandrov, I N; Alexa, C; Alexander, G; Alexopoulos, T; Alhroob, M; Aliev, M; Alimonti, G; Alison, J; Alkire, S P; Allbrooke, B M M; Allen, B W; Allport, P P; Aloisio, A; Alonso, A; Alonso, F; Alpigiani, C; Alstaty, M; Gonzalez, B Alvarez; Piqueras, D Álvarez; Alviggi, M G; Amadio, B T; Amako, K; Coutinho, Y Amaral; Amelung, C; Amidei, D; Santos, S P Amor Dos; Amorim, A; Amoroso, S; Amundsen, G; Anastopoulos, C; Ancu, L S; Andari, N; Andeen, T; Anders, C F; Anders, G; Anders, J K; Anderson, K J; Andreazza, A; Andrei, V; Angelidakis, S; Angelozzi, I; Anger, P; Angerami, A; Anghinolfi, F; Anisenkov, A V; Anjos, N; Annovi, A; Antonelli, M; Antonov, A; Antos, J; Anulli, F; Aoki, M; Bella, L Aperio; Arabidze, G; Arai, Y; Araque, J P; Arce, A T H; Arduh, F A; Arguin, J-F; Argyropoulos, S; Arik, M; Armbruster, A J; Armitage, L J; Arnaez, O; Arnold, H; Arratia, M; Arslan, O; Artamonov, A; Artoni, G; Artz, S; Asai, S; Asbah, N; Ashkenazi, A; Åsman, B; Asquith, L; Assamagan, K; Astalos, R; Atkinson, M; Atlay, N B; Augsten, K; Avolio, G; Axen, B; Ayoub, M K; Azuelos, G; Baak, M A; Baas, A E; Baca, M J; Bachacou, H; Bachas, K; Backes, M; Backhaus, M; Bagiacchi, P; Bagnaia, P; Bai, Y; Baines, J T; Baker, O K; Baldin, E M; Balek, P; Balestri, T; Balli, F; Balunas, W K; Banas, E; Banerjee, Sw; Bannoura, A A E; Barak, L; Barberio, E L; Barberis, D; Barbero, M; Barillari, T; Barklow, T; Barlow, N; Barnes, S L; Barnett, B M; Barnett, R M; Barnovska, Z; Baroncelli, A; Barone, G; Barr, A J; Navarro, L Barranco; Barreiro, F; da Costa, J Barreiro Guimarães; Bartoldus, R; Barton, A E; Bartos, P; Basalaev, A; Bassalat, A; Bates, R L; Batista, S J; Batley, J R; Battaglia, M; Bauce, M; Bauer, F; Bawa, H S; Beacham, J B; Beattie, M D; Beau, T; Beauchemin, P H; Bechtle, P; Beck, H P; Becker, K; Becker, M; Beckingham, M; Becot, C; Beddall, A J; Beddall, A; Bednyakov, V A; Bedognetti, M; Bee, C P; Beemster, L J; Beermann, T A; Begel, M; Behr, J K; Belanger-Champagne, C; Bell, A S; Bella, G; Bellagamba, L; Bellerive, A; Bellomo, M; Belotskiy, K; Beltramello, O; Belyaev, N L; Benary, O; Benchekroun, D; Bender, M; Bendtz, K; Benekos, N; Benhammou, Y; Noccioli, E Benhar; Benitez, J; Garcia, J A Benitez; Benjamin, D P; Bensinger, J R; Bentvelsen, S; Beresford, L; Beretta, M; Berge, D; Kuutmann, E Bergeaas; Berger, N; Beringer, J; Berlendis, S; Bernard, N R; Bernius, C; Bernlochner, F U; Berry, T; Berta, P; Bertella, C; Bertoli, G; Bertolucci, F; Bertram, I A; Bertsche, C; Bertsche, D; Besjes, G J; Bylund, O Bessidskaia; Bessner, M; Besson, N; Betancourt, C; Bethke, S; Bevan, A J; Bhimji, W; Bianchi, R M; Bianchini, L; Bianco, M; Biebel, O; Biedermann, D; Bielski, R; Biesuz, N V; Biglietti, M; De Mendizabal, J Bilbao; Bilokon, H; Bindi, M; Binet, S; Bingul, A; Bini, C; Biondi, S; Bjergaard, D M; Black, C W; Black, J E; Black, K M; Blackburn, D; Blair, R E; Blanchard, J-B; Blanco, J E; Blazek, T; Bloch, I; Blocker, C; Blum, W; Blumenschein, U; Blunier, S; Bobbink, G J; Bobrovnikov, V S; Bocchetta, S S; Bocci, A; Bock, C; Boehler, M; Boerner, D; Bogaerts, J A; Bogavac, D; Bogdanchikov, A G; Bohm, C; Boisvert, V; Bokan, P; Bold, T; Boldyrev, A S; Bomben, M; Bona, M; Boonekamp, M; Borisov, A; Borissov, G; Bortfeldt, J; Bortoletto, D; Bortolotto, V; Bos, K; Boscherini, D; Bosman, M; Sola, J D Bossio; Boudreau, J; Bouffard, J; Bouhova-Thacker, E V; Boumediene, D; Bourdarios, C; Boutle, S K; Boveia, A; Boyd, J; Boyko, I R; Bracinik, J; Brandt, A; Brandt, G; Brandt, O; Bratzler, U; Brau, B; Brau, J E; Braun, H M; Madden, W D Breaden; Brendlinger, K; Brennan, A J; Brenner, L; Brenner, R; Bressler, S; Bristow, T M; Britton, D; Britzger, D; Brochu, F M; Brock, I; Brock, R; Brooijmans, G; Brooks, T; Brooks, W K; Brosamer, J; Brost, E; Broughton, J H; de Renstrom, P A Bruckman; Bruncko, D; Bruneliere, R; Bruni, A; Bruni, G; Brunt, B H; Bruschi, M; Bruscino, N; Bryant, P; Bryngemark, L; Buanes, T; Buat, Q; Buchholz, P; Buckley, A G; Budagov, I A; Buehrer, F; Bugge, M K; Bulekov, O; Bullock, D; Burckhart, H; Burdin, S; Burgard, C D; Burghgrave, B; Burka, K; Burke, S; Burmeister, I; Busato, E; Büscher, D; Büscher, V; Bussey, P; Butler, J M; Buttar, C M; Butterworth, J M; Butti, P; Buttinger, W; Buzatu, A; Buzykaev, A R; Urbán, S Cabrera; Caforio, D; Cairo, V M; Cakir, O; Calace, N; Calafiura, P; Calandri, A; Calderini, G; Calfayan, P; Caloba, L P; Calvet, D; Calvet, S; Calvet, T P; Toro, R Camacho; Camarda, S; Camarri, P; Cameron, D; Armadans, R Caminal; Camincher, C; Campana, S; Campanelli, M; Camplani, A; Campoverde, A; Canale, V; Canepa, A; Bret, M Cano; Cantero, J; Cantrill, R; Cao, T; Garrido, M D M Capeans; Caprini, I; Caprini, M; Capua, M; Caputo, R; Carbone, R M; Cardarelli, R; Cardillo, F; Carli, I; Carli, T; Carlino, G; Carminati, L; Caron, S; Carquin, E; Carrillo-Montoya, G D; Carter, J R; Carvalho, J; Casadei, D; Casado, M P; Casolino, M; Casper, D W; Castaneda-Miranda, E; Castelli, A; Gimenez, V Castillo; Castro, N F; Catinaccio, A; Catmore, J R; Cattai, A; Caudron, J; Cavaliere, V; Cavallaro, E; Cavalli, D; Cavalli-Sforza, M; Cavasinni, V; Ceradini, F; Alberich, L Cerda; Cerio, B C; Cerqueira, A S; Cerri, A; Cerrito, L; Cerutti, F; Cerv, M; Cervelli, A; Cetin, S A; Chafaq, A; Chakraborty, D; Chan, S K; Chan, Y L; Chang, P; Chapman, J D; Charlton, D G; Chatterjee, A; Chau, C C; Barajas, C A Chavez; Che, S; Cheatham, S; Chegwidden, A; Chekanov, S; Chekulaev, S V; Chelkov, G A; Chelstowska, M A; Chen, C; Chen, H; Chen, K; Chen, S; Chen, S; Chen, X; Chen, Y; Cheng, H C; Cheng, H J; Cheng, Y; Cheplakov, A; Cheremushkina, E; Moursli, R Cherkaoui El; Chernyatin, V; Cheu, E; Chevalier, L; Chiarella, V; Chiarelli, G; Chiodini, G; Chisholm, A S; Chitan, A; Chizhov, M V; Choi, K; Chomont, A R; Chouridou, S; Chow, B K B; Christodoulou, V; Chromek-Burckhart, D; Chudoba, J; Chuinard, A J; Chwastowski, J J; Chytka, L; Ciapetti, G; Ciftci, A K; Cinca, D; Cindro, V; Cioara, I A; Ciocio, A; Cirotto, F; Citron, Z H; Citterio, M; Ciubancan, M; Clark, A; Clark, B L; Clark, M R; Clark, P J; Clarke, R N; Clement, C; Coadou, Y; Cobal, M; Coccaro, A; Cochran, J; Coffey, L; Colasurdo, L; Cole, B; Cole, S; Colijn, A P; Collot, J; Colombo, T; Compostella, G; Muiño, P Conde; Coniavitis, E; Connell, S H; Connelly, I A; Consorti, V; Constantinescu, S; Conta, C; Conti, G; Conventi, F; Cooke, M; Cooper, B D; Cooper-Sarkar, A M; Cormier, K J R; Cornelissen, T; Corradi, M; Corriveau, F; Corso-Radu, A; Cortes-Gonzalez, A; Cortiana, G; Costa, G; Costa, M J; Costanzo, D; Cottin, G; Cowan, G; Cox, B E; Cranmer, K; Crawley, S J; Cree, G; Crépé-Renaudin, S; Crescioli, F; Cribbs, W A; Ortuzar, M Crispin; Cristinziani, M; Croft, V; Crosetti, G; Donszelmann, T Cuhadar; Cummings, J; Curatolo, M; Cúth, J; Cuthbert, C; Czirr, H; Czodrowski, P; D'Auria, S; D'Onofrio, M; De Sousa, M J Da Cunha Sargedas; Via, C Da; Dabrowski, W; Dado, T; Dai, T; Dale, O; Dallaire, F; Dallapiccola, C; Dam, M; Dandoy, J R; Dang, N P; Daniells, A C; Dann, N S; Danninger, M; Hoffmann, M Dano; Dao, V; Darbo, G; Darmora, S; Dassoulas, J; Dattagupta, A; Davey, W; David, C; Davidek, T; Davies, M; Davison, P; Dawe, E; Dawson, I; Daya-Ishmukhametova, R K; De, K; de Asmundis, R; De Benedetti, A; De Castro, S; De Cecco, S; De Groot, N; de Jong, P; De la Torre, H; De Lorenzi, F; De Pedis, D; De Salvo, A; De Sanctis, U; De Santo, A; De Regie, J B De Vivie; Dearnaley, W J; Debbe, R; Debenedetti, C; Dedovich, D V; Deigaard, I; Del Gaudio, M; Del Peso, J; Del Prete, T; Delgove, D; Deliot, F; Delitzsch, C M; Deliyergiyev, M; Dell'Acqua, A; Dell'Asta, L; Dell'Orso, M; Della Pietra, M; Della Volpe, D; Delmastro, M; Delsart, P A; Deluca, C; DeMarco, D A; Demers, S; Demichev, M; Demilly, A; Denisov, S P; Denysiuk, D; Derendarz, D; Derkaoui, J E; Derue, F; Dervan, P; Desch, K; Deterre, C; Dette, K; Deviveiros, P O; Dewhurst, A; Dhaliwal, S; Di Ciaccio, A; Di Ciaccio, L; Di Clemente, W K; Di Donato, C; Di Girolamo, A; Di Girolamo, B; Di Micco, B; Di Nardo, R; Di Simone, A; Di Sipio, R; Di Valentino, D; Diaconu, C; Diamond, M; Dias, F A; Diaz, M A; Diehl, E B; Dietrich, J; Diglio, S; Dimitrievska, A; Dingfelder, J; Dita, P; Dita, S; Dittus, F; Djama, F; Djobava, T; Djuvsland, J I; do Vale, M A B; Dobos, D; Dobre, M; Doglioni, C; Dohmae, T; Dolejsi, J; Dolezal, Z; Dolgoshein, B A; Donadelli, M; Donati, S; Dondero, P; Donini, J; Dopke, J; Doria, A; Dova, M T; Doyle, A T; Drechsler, E; Dris, M; Du, Y; Duarte-Campderros, J; Duchovni, E; Duckeck, G; Ducu, O A; Duda, D; Dudarev, A; Duflot, L; Duguid, L; Dührssen, M; Dumancic, M; Dunford, M; Yildiz, H Duran; Düren, M; Durglishvili, A; Duschinger, D; Dutta, B; Dyndal, M; Eckardt, C; Ecker, K M; Edgar, R C; Edwards, N C; Eifert, T; Eigen, G; Einsweiler, K; Ekelof, T; Kacimi, M El; Ellajosyula, V; Ellert, M; Elles, S; Ellinghaus, F; Elliot, A A; Ellis, N; Elmsheuser, J; Elsing, M; Emeliyanov, D; Enari, Y; Endner, O C; Endo, M; Ennis, J S; Erdmann, J; Ereditato, A; Ernis, G; Ernst, J; Ernst, M; Errede, S; Ertel, E; Escalier, M; Esch, H; Escobar, C; Esposito, B; Etienvre, A I; Etzion, E; Evans, H; Ezhilov, A; Fabbri, F; Fabbri, L; Facini, G; Fakhrutdinov, R M; Falciano, S; Falla, R J; Faltova, J; Fang, Y; Fanti, M; Farbin, A; Farilla, A; Farina, C; Farooque, T; Farrell, S; Farrington, S M; Farthouat, P; Fassi, F; Fassnacht, P; Fassouliotis, D; Giannelli, M Faucci; Favareto, A; Fawcett, W J; Fayard, L; Fedin, O L; Fedorko, W; Feigl, S; Feligioni, L; Feng, C; Feng, E J; Feng, H; Fenyuk, A B; Feremenga, L; Martinez, P Fernandez; Perez, S Fernandez; Ferrando, J; Ferrari, A; Ferrari, P; Ferrari, R; de Lima, D E Ferreira; Ferrer, A; Ferrere, D; Ferretti, C; Parodi, A Ferretto; Fiedler, F; Filipčič, A; Filipuzzi, M; Filthaut, F; Fincke-Keeler, M; Finelli, K D; Fiolhais, M C N; Fiorini, L; Firan, A; Fischer, A; Fischer, C; Fischer, J; Fisher, W C; Flaschel, N; Fleck, I; Fleischmann, P; Fletcher, G T; Fletcher, R R M; Flick, T; Floderus, A; Castillo, L R Flores; Flowerdew, M J; Forcolin, G T; Formica, A; Forti, A; Foster, A G; Fournier, D; Fox, H; Fracchia, S; Francavilla, P; Franchini, M; Francis, D; Franconi, L; Franklin, M; Frate, M; Fraternali, M; Freeborn, D; Fressard-Batraneanu, S M; Friedrich, F; Froidevaux, D; Frost, J A; Fukunaga, C; Torregrosa, E Fullana; Fusayasu, T; Fuster, J; Gabaldon, C; Gabizon, O; Gabrielli, A; Gabrielli, A; Gach, G P; Gadatsch, S; Gadomski, S; Gagliardi, G; Gagnon, L G; Gagnon, P; Galea, C; Galhardo, B; Gallas, E J; Gallop, B J; Gallus, P; Galster, G; Gan, K K; Gao, J; Gao, Y; Gao, Y S; Walls, F M Garay; García, C; Navarro, J E García; Garcia-Sciveres, M; Gardner, R W; Garelli, N; Garonne, V; Bravo, A Gascon; Gatti, C; Gaudiello, A; Gaudio, G; Gaur, B; Gauthier, L; Gavrilenko, I L; Gay, C; Gaycken, G; Gazis, E N; Gecse, Z; Gee, C N P; Geich-Gimbel, Ch; Geisler, M P; Gemme, C; Genest, M H; Geng, C; Gentile, S; George, S; Gerbaudo, D; Gershon, A; Ghasemi, S; Ghazlane, H; Ghneimat, M; Giacobbe, B; Giagu, S; Giannetti, P; Gibbard, B; Gibson, S M; Gignac, M; Gilchriese, M; Gillam, T P S; Gillberg, D; Gilles, G; Gingrich, D M; Giokaris, N; Giordani, M P; Giorgi, F M; Giorgi, F M; Giraud, P F; Giromini, P; Giugni, D; Giuli, F; Giuliani, C; Giulini, M; Gjelsten, B K; Gkaitatzis, S; Gkialas, I; Gkougkousis, E L; Gladilin, L K; Glasman, C; Glatzer, J; Glaysher, P C F; Glazov, A; Goblirsch-Kolb, M; Godlewski, J; Goldfarb, S; Golling, T; Golubkov, D; Gomes, A; Gonçalo, R; Costa, J Goncalves Pinto Firmino Da; Gonella, L; Gongadze, A; de la Hoz, S González; Parra, G Gonzalez; Gonzalez-Sevilla, S; Goossens, L; Gorbounov, P A; Gordon, H A; Gorelov, I; Gorini, B; Gorini, E; Gorišek, A; Gornicki, E; Goshaw, A T; Gössling, C; Gostkin, M I; Goudet, C R; Goujdami, D; Goussiou, A G; Govender, N; Gozani, E; Graber, L; Grabowska-Bold, I; Gradin, P O J; Grafström, P; Gramling, J; Gramstad, E; Grancagnolo, S; Gratchev, V; Gray, H M; Graziani, E; Greenwood, Z D; Grefe, C; Gregersen, K; Gregor, I M; Grenier, P; Grevtsov, K; Griffiths, J; Grillo, A A; Grimm, K; Grinstein, S; Gris, Ph; Grivaz, J-F; Groh, S; Grohs, J P; Gross, E; Grosse-Knetter, J; Grossi, G C; Grout, Z J; Guan, L; Guan, W; Guenther, J; Guescini, F; Guest, D; Gueta, O; Guido, E; Guillemin, T; Guindon, S; Gul, U; Gumpert, C; Guo, J; Guo, Y; Gupta, S; Gustavino, G; Gutierrez, P; Ortiz, N G Gutierrez; Gutschow, C; Guyot, C; Gwenlan, C; Gwilliam, C B; Haas, A; Haber, C; Hadavand, H K; Haddad, N; Hadef, A; Haefner, P; Hageböck, S; Hajduk, Z; Hakobyan, H; Haleem, M; Haley, J; Halladjian, G; Hallewell, G D; Hamacher, K; Hamal, P; Hamano, K; Hamilton, A; Hamity, G N; Hamnett, P G; Han, L; Hanagaki, K; Hanawa, K; Hance, M; Haney, B; Hanke, P; Hanna, R; Hansen, J B; Hansen, J D; Hansen, M C; Hansen, P H; Hara, K; Hard, A S; Harenberg, T; Hariri, F; Harkusha, S; Harrington, R D; Harrison, P F; Hartjes, F; Hasegawa, M; Hasegawa, Y; Hasib, A; Hassani, S; Haug, S; Hauser, R; Hauswald, L; Havranek, M; Hawkes, C M; Hawkings, R J; Hawkins, A D; Hayden, D; Hays, C P; Hays, J M; Hayward, H S; Haywood, S J; Head, S J; Heck, T; Hedberg, V; Heelan, L; Heim, S; Heim, T; Heinemann, B; Heinrich, J J; Heinrich, L; Heinz, C; Hejbal, J; Helary, L; Hellman, S; Helsens, C; Henderson, J; Henderson, R C W; Heng, Y; Henkelmann, S; Correia, A M Henriques; Henrot-Versille, S; Herbert, G H; Jiménez, Y Hernández; Herten, G; Hertenberger, R; Hervas, L; Hesketh, G G; Hessey, N P; Hetherly, J W; Hickling, R; Higón-Rodriguez, E; Hill, E; Hill, J C; Hiller, K H; Hillier, S J; Hinchliffe, I; Hines, E; Hinman, R R; Hirose, M; Hirschbuehl, D; Hobbs, J; Hod, N; Hodgkinson, M C; Hodgson, P; Hoecker, A; Hoeferkamp, M R; Hoenig, F; Hohlfeld, M; Hohn, D; Holmes, T R; Homann, M; Hong, T M; Hooberman, B H; Hopkins, W H; Horii, Y; Horton, A J; Hostachy, J-Y; Hou, S; Hoummada, A; Howarth, J; Hrabovsky, M; Hristova, I; Hrivnac, J; Hryn'ova, T; Hrynevich, A; Hsu, C; Hsu, P J; Hsu, S-C; Hu, D; Hu, Q; Huang, Y; Hubacek, Z; Hubaut, F; Huegging, F; Huffman, T B; Hughes, E W; Hughes, G; Huhtinen, M; Hülsing, T A; Huo, P; Huseynov, N; Huston, J; Huth, J; Iacobucci, G; Iakovidis, G; Ibragimov, I; Iconomidou-Fayard, L; Ideal, E; Idrissi, Z; Iengo, P; Igonkina, O; Iizawa, T; Ikegami, Y; Ikeno, M; Ilchenko, Y; Iliadis, D; Ilic, N; Ince, T; Introzzi, G; Ioannou, P; Iodice, M; Iordanidou, K; Ippolito, V; Ishino, M; Ishitsuka, M; Ishmukhametov, R; Issever, C; Istin, S; Ito, F; Ponce, J M Iturbe; Iuppa, R; Iwanski, W; Iwasaki, H; Izen, J M; Izzo, V; Jabbar, S; Jackson, B; Jackson, M; Jackson, P; Jain, V; Jakobi, K B; Jakobs, K; Jakobsen, S; Jakoubek, T; Jamin, D O; Jana, D K; Jansen, E; Jansky, R; Janssen, J; Janus, M; Jarlskog, G; Javadov, N; Javůrek, T; Jeanneau, F; Jeanty, L; Jejelava, J; Jeng, G-Y; Jennens, D; Jenni, P; Jentzsch, J; Jeske, C; Jézéquel, S; Ji, H; Jia, J; Jiang, H; Jiang, Y; Jiggins, S; Pena, J Jimenez; Jin, S; Jinaru, A; Jinnouchi, O; Johansson, P; Johns, K A; Johnson, W J; Jon-And, K; Jones, G; Jones, R W L; Jones, S; Jones, T J; Jongmanns, J; Jorge, P M; Jovicevic, J; Ju, X; Rozas, A Juste; Köhler, M K; Kaczmarska, A; Kado, M; Kagan, H; Kagan, M; Kahn, S J; Kajomovitz, E; Kalderon, C W; Kaluza, A; Kama, S; Kamenshchikov, A; Kanaya, N; Kaneti, S; Kanjir, L; Kantserov, V A; Kanzaki, J; Kaplan, B; Kaplan, L S; Kapliy, A; Kar, D; Karakostas, K; Karamaoun, A; Karastathis, N; Kareem, M J; Karentzos, E; Karnevskiy, M; Karpov, S N; Karpova, Z M; Karthik, K; Kartvelishvili, V; Karyukhin, A N; Kasahara, K; Kashif, L; Kass, R D; Kastanas, A; Kataoka, Y; Kato, C; Katre, A; Katzy, J; Kawagoe, K; Kawamoto, T; Kawamura, G; Kazama, S; Kazanin, V F; Keeler, R; Kehoe, R; Keller, J S; Kempster, J J; Kentaro, K; Keoshkerian, H; Kepka, O; Kerševan, B P; Kersten, S; Keyes, R A; Khalil-Zada, F; Khanov, A; Kharlamov, A G; Khoo, T J; Khovanskiy, V; Khramov, E; Khubua, J; Kido, S; Kim, H Y; Kim, S H; Kim, Y K; Kimura, N; Kind, O M; King, B T; King, M; King, S B; Kirk, J; Kiryunin, A E; Kishimoto, T; Kisielewska, D; Kiss, F; Kiuchi, K; Kivernyk, O; Kladiva, E; Klein, M H; Klein, M; Klein, U; Kleinknecht, K; Klimek, P; Klimentov, A; Klingenberg, R; Klinger, J A; Klioutchnikova, T; Kluge, E-E; Kluit, P; Kluth, S; Knapik, J; Kneringer, E; Knoops, E B F G; Knue, A; Kobayashi, A; Kobayashi, D; Kobayashi, T; Kobel, M; Kocian, M; Kodys, P; Koffas, T; Koffeman, E; Koi, T; Kolanoski, H; Kolb, M; Koletsou, I; Komar, A A; Komori, Y; Kondo, T; Kondrashova, N; Köneke, K; König, A C; Kono, T; Konoplich, R; Konstantinidis, N; Kopeliansky, R; Koperny, S; Köpke, L; Kopp, A K; Korcyl, K; Kordas, K; Korn, A; Korol, A A; Korolkov, I; Korolkova, E V; Kortner, O; Kortner, S; Kosek, T; Kostyukhin, V V; Kotwal, A; Kourkoumeli-Charalampidi, A; Kourkoumelis, C; Kouskoura, V; Kowalewska, A B; Kowalewski, R; Kowalski, T Z; Kozakai, C; Kozanecki, W; Kozhin, A S; Kramarenko, V A; Kramberger, G; Krasnopevtsev, D; Krasny, M W; Krasznahorkay, A; Kraus, J K; Kravchenko, A; Kretz, M; Kretzschmar, J; Kreutzfeldt, K; Krieger, P; Krizka, K; Kroeninger, K; Kroha, H; Kroll, J; Kroseberg, J; Krstic, J; Kruchonak, U; Krüger, H; Krumnack, N; Kruse, A; Kruse, M C; Kruskal, M; Kubota, T; Kucuk, H; Kuday, S; Kuechler, J T; Kuehn, S; Kugel, A; Kuger, F; Kuhl, A; Kuhl, T; Kukhtin, V; Kukla, R; Kulchitsky, Y; Kuleshov, S; Kuna, M; Kunigo, T; Kupco, A; Kurashige, H; Kurochkin, Y A; Kus, V; Kuwertz, E S; Kuze, M; Kvita, J; Kwan, T; Kyriazopoulos, D; Rosa, A La; Navarro, J L La Rosa; Rotonda, L La; Lacasta, C; Lacava, F; Lacey, J; Lacker, H; Lacour, D; Lacuesta, V R; Ladygin, E; Lafaye, R; Laforge, B; Lagouri, T; Lai, S; Lammers, S; Lampl, W; Lançon, E; Landgraf, U; Landon, M P J; Lang, V S; Lange, J C; Lankford, A J; Lanni, F; Lantzsch, K; Lanza, A; Laplace, S; Lapoire, C; Laporte, J F; Lari, T; Manghi, F Lasagni; Lassnig, M; Laurelli, P; Lavrijsen, W; Law, A T; Laycock, P; Lazovich, T; Lazzaroni, M; Le, B; Dortz, O Le; Guirriec, E Le; Quilleuc, E P Le; LeBlanc, M; LeCompte, T; Ledroit-Guillon, F; Lee, C A; Lee, S C; Lee, L; Lefebvre, G; Lefebvre, M; Legger, F; Leggett, C; Lehan, A; Miotto, G Lehmann; Lei, X; Leight, W A; Leisos, A; Leister, A G; Leite, M A L; Leitner, R; Lellouch, D; Lemmer, B; Leney, K J C; Lenz, T; Lenzi, B; Leone, R; Leone, S; Leonidopoulos, C; Leontsinis, S; Lerner, G; Leroy, C; Lesage, A A J; Lester, C G; Levchenko, M; Levêque, J; Levin, D; Levinson, L J; Levy, M; Leyko, A M; Leyton, M; Li, B; Li, H; Li, H L; Li, L; Li, L; Li, Q; Li, S; Li, X; Li, Y; Liang, Z; Liberti, B; Liblong, A; Lichard, P; Lie, K; Liebal, J; Liebig, W; Limosani, A; Lin, S C; Lin, T H; Lindquist, B E; Lipeles, E; Lipniacka, A; Lisovyi, M; Liss, T M; Lissauer, D; Lister, A; Litke, A M; Liu, B; Liu, D; Liu, H; Liu, H; Liu, J; Liu, J B; Liu, K; Liu, L; Liu, M; Liu, M; Liu, Y L; Liu, Y; Livan, M; Lleres, A; Merino, J Llorente; Lloyd, S L; Sterzo, F Lo; Lobodzinska, E; Loch, P; Lockman, W S; Loebinger, F K; Loevschall-Jensen, A E; Loew, K M; Loginov, A; Lohse, T; Lohwasser, K; Lokajicek, M; Long, B A; Long, J D; Long, R E; Longo, L; Looper, K A; Lopes, L; Mateos, D Lopez; Paredes, B Lopez; Paz, I Lopez; Solis, A Lopez; Lorenz, J; Martinez, N Lorenzo; Losada, M; Lösel, P J; Lou, X; Lounis, A; Love, J; Love, P A; Lu, H; Lu, N; Lubatti, H J; Luci, C; Lucotte, A; Luedtke, C; Luehring, F; Lukas, W; Luminari, L; Lundberg, O; Lund-Jensen, B; Lynn, D; Lysak, R; Lytken, E; Lyubushkin, V; Ma, H; Ma, L L; Ma, Y; Maccarrone, G; Macchiolo, A; Macdonald, C M; Maček, B; Miguens, J Machado; Madaffari, D; Madar, R; Maddocks, H J; Mader, W F; Madsen, A; Maeda, J; Maeland, S; Maeno, T; Maevskiy, A; Magradze, E; Mahlstedt, J; Maiani, C; Maidantchik, C; Maier, A A; Maier, T; Maio, A; Majewski, S; Makida, Y; Makovec, N; Malaescu, B; Malecki, Pa; Maleev, V P; Malek, F; Mallik, U; Malon, D; Malone, C; Maltezos, S; Malyukov, S; Mamuzic, J; Mancini, G; Mandelli, B; Mandelli, L; Mandić, I; Maneira, J; Filho, L Manhaes de Andrade; Ramos, J Manjarres; Mann, A; Mansoulie, B; Mansour, J D; Mantifel, R; Mantoani, M; Manzoni, S; Mapelli, L; Marceca, G; March, L; Marchiori, G; Marcisovsky, M; Marjanovic, M; Marley, D E; Marroquim, F; Marsden, S P; Marshall, Z; Marti-Garcia, S; Martin, B; Martin, T A; Martin, V J; Latour, B Martin Dit; Martinez, M; Martin-Haugh, S; Martoiu, V S; Martyniuk, A C; Marx, M; Marzin, A; Masetti, L; Mashimo, T; Mashinistov, R; Masik, J; Maslennikov, A L; Massa, I; Massa, L; Mastrandrea, P; Mastroberardino, A; Masubuchi, T; Mättig, P; Mattmann, J; Maurer, J; Maxfield, S J; Maximov, D A; Mazini, R; Mazza, S M; Fadden, N C Mc; Goldrick, G Mc; Kee, S P Mc; McCarn, A; McCarthy, R L; McCarthy, T G; McClymont, L I; McDonald, E F; McFarlane, K W; Mcfayden, J A; Mchedlidze, G; McMahon, S J; McPherson, R A; Medinnis, M; Meehan, S; Mehlhase, S; Mehta, A; Meier, K; Meineck, C; Meirose, B; Melini, D; Garcia, B R Mellado; Melo, M; Meloni, F; Mengarelli, A; Menke, S; Meoni, E; Mergelmeyer, S; Mermod, P; Merola, L; Meroni, C; Merritt, F S; Messina, A; Metcalfe, J; Mete, A S; Meyer, C; Meyer, C; Meyer, J-P; Meyer, J; Theenhausen, H Meyer Zu; Miano, F; Middleton, R P; Miglioranzi, S; Mijović, L; Mikenberg, G; Mikestikova, M; Mikuž, M; Milesi, M; Milic, A; Miller, D W; Mills, C; Milov, A; Milstead, D A; Minaenko, A A; Minami, Y; Minashvili, I A; Mincer, A I; Mindur, B; Mineev, M; Ming, Y; Mir, L M; Mistry, K P; Mitani, T; Mitrevski, J; Mitsou, V A; Miucci, A; Miyagawa, P S; Mjörnmark, J U; Moa, T; Mochizuki, K; Mohapatra, S; Mohr, W; Molander, S; Moles-Valls, R; Monden, R; Mondragon, M C; Mönig, K; Monk, J; Monnier, E; Montalbano, A; Berlingen, J Montejo; Monticelli, F; Monzani, S; Moore, R W; Morange, N; Moreno, D; Llácer, M Moreno; Morettini, P; Mori, D; Mori, T; Morii, M; Morinaga, M; Morisbak, V; Moritz, S; Morley, A K; Mornacchi, G; Morris, J D; Mortensen, S S; Morvaj, L; Mosidze, M; Moss, J; Motohashi, K; Mount, R; Mountricha, E; Mouraviev, S V; Moyse, E J W; Muanza, S; Mudd, R D; Mueller, F; Mueller, J; Mueller, R S P; Mueller, T; Muenstermann, D; Mullen, P; Mullier, G A; Sanchez, F J Munoz; Quijada, J A Murillo; Murray, W J; Musheghyan, H; Muškinja, M; Myagkov, A G; Myska, M; Nachman, B P; Nackenhorst, O; Nadal, J; Nagai, K; Nagai, R; Nagano, K; Nagasaka, Y; Nagata, K; Nagel, M; Nagy, E; Nairz, A M; Nakahama, Y; Nakamura, K; Nakamura, T; Nakano, I; Namasivayam, H; Garcia, R F Naranjo; Narayan, R; Villar, D I Narrias; Naryshkin, I; Naumann, T; Navarro, G; Nayyar, R; Neal, H A; Nechaeva, P Yu; Neep, T J; Nef, P D; Negri, A; Negrini, M; Nektarijevic, S; Nellist, C; Nelson, A; Nemecek, S; Nemethy, P; Nepomuceno, A A; Nessi, M; Neubauer, M S; Neumann, M; Neves, R M; Nevski, P; Newman, P R; Nguyen, D H; Manh, T Nguyen; Nickerson, R B; Nicolaidou, R; Nielsen, J; Nikiforov, A; Nikolaenko, V; Nikolic-Audit, I; Nikolopoulos, K; Nilsen, J K; Nilsson, P; Ninomiya, Y; Nisati, A; Nisius, R; Nobe, T; Nodulman, L; Nomachi, M; Nomidis, I; Nooney, T; Norberg, S; Nordberg, M; Norjoharuddeen, N; Novgorodova, O; Nowak, S; Nozaki, M; Nozka, L; Ntekas, K; Nurse, E; Nuti, F; O'grady, F; O'Neil, D C; O'Rourke, A A; O'Shea, V; Oakham, F G; Oberlack, H; Obermann, T; Ocariz, J; Ochi, A; Ochoa, I; Ochoa-Ricoux, J P; Oda, S; Odaka, S; Ogren, H; Oh, A; Oh, S H; Ohm, C C; Ohman, H; Oide, H; Okawa, H; Okumura, Y; Okuyama, T; Olariu, A; Seabra, L F Oleiro; Pino, S A Olivares; Damazio, D Oliveira; Olszewski, A; Olszowska, J; Onofre, A; Onogi, K; Onyisi, P U E; Oreglia, M J; Oren, Y; Orestano, D; Orlando, N; Orr, R S; Osculati, B; Ospanov, R; Garzon, G Otero Y; Otono, H; Ouchrif, M; Ould-Saada, F; Ouraou, A; Oussoren, K P; Ouyang, Q; Owen, M; Owen, R E; Ozcan, V E; Ozturk, N; Pachal, K; Pages, A Pacheco; Aranda, C Padilla; Pagáčová, M; Griso, S Pagan; Paige, F; Pais, P; Pajchel, K; Palacino, G; Palestini, S; Palka, M; Pallin, D; Palma, A; Panagiotopoulou, E St; Pandini, C E; Vazquez, J G Panduro; Pani, P; Panitkin, S; Pantea, D; Paolozzi, L; Papadopoulou, Th D; Papageorgiou, K; Paramonov, A; Hernandez, D Paredes; Parker, A J; Parker, M A; Parker, K A; Parodi, F; Parsons, J A; Parzefall, U; Pascuzzi, V R; Pasqualucci, E; Passaggio, S; Pastore, F; Pastore, Fr; Pásztor, G; Pataraia, S; Pater, J R; Pauly, T; Pearce, J; Pearson, B; Pedersen, L E; Pedersen, M; Lopez, S Pedraza; Pedro, R; Peleganchuk, S V; Pelikan, D; Penc, O; Peng, C; Peng, H; Penwell, J; Peralva, B S; Perego, M M; Perepelitsa, D V; Codina, E Perez; Perini, L; Pernegger, H; Perrella, S; Peschke, R; Peshekhonov, V D; Peters, K; Peters, R F Y; Petersen, B A; Petersen, T C; Petit, E; Petridis, A; Petridou, C; Petroff, P; Petrolo, E; Petrov, M; Petrucci, F; Pettersson, N E; Peyaud, A; Pezoa, R; Phillips, P W; Piacquadio, G; Pianori, E; Picazio, A; Piccaro, E; Piccinini, M; Pickering, M A; Piegaia, R; Pilcher, J E; Pilkington, A D; Pin, A W J; Pinamonti, M; Pinfold, J L; Pingel, A; Pires, S; Pirumov, H; Pitt, M; Plazak, L; Pleier, M-A; Pleskot, V; Plotnikova, E; Plucinski, P; Pluth, D; Poettgen, R; Poggioli, L; Pohl, D; Polesello, G; Poley, A; Policicchio, A; Polifka, R; Polini, A; Pollard, C S; Polychronakos, V; Pommès, K; Pontecorvo, L; Pope, B G; Popeneciu, G A; Popovic, D S; Poppleton, A; Pospisil, S; Potamianos, K; Potrap, I N; Potter, C J; Potter, C T; Poulard, G; Poveda, J; Pozdnyakov, V; Astigarraga, M E Pozo; Pralavorio, P; Pranko, A; Prell, S; Price, D; Price, L E; Primavera, M; Prince, S; Proissl, M; Prokofiev, K; Prokoshin, F; Protopopescu, S; Proudfoot, J; Przybycien, M; Puddu, D; Puldon, D; Purohit, M; Puzo, P; Qian, J; Qin, G; Qin, Y; Quadt, A; Quayle, W B; Queitsch-Maitland, M; Quilty, D; Raddum, S; Radeka, V; Radescu, V; Radhakrishnan, S K; Radloff, P; Rados, P; Ragusa, F; Rahal, G; Raine, J A; Rajagopalan, S; Rammensee, M; Rangel-Smith, C; Ratti, M G; Rauscher, F; Rave, S; Ravenscroft, T; Raymond, M; Read, A L; Readioff, N P; Rebuzzi, D M; Redelbach, A; Redlinger, G; Reece, R; Reeves, K; Rehnisch, L; Reichert, J; Reisin, H; Rembser, C; Ren, H; Rescigno, M; Resconi, S; Rezanova, O L; Reznicek, P; Rezvani, R; Richter, R; Richter, S; Richter-Was, E; Ricken, O; Ridel, M; Rieck, P; Riegel, C J; Rieger, J; Rifki, O; Rijssenbeek, M; Rimoldi, A; Rinaldi, L; Ristić, B; Ritsch, E; Riu, I; Rizatdinova, F; Rizvi, E; Rizzi, C; Robertson, S H; Robichaud-Veronneau, A; Robinson, D; Robinson, J E M; Robson, A; Roda, C; Rodina, Y; Perez, A Rodriguez; Rodriguez, D Rodriguez; Roe, S; Rogan, C S; Røhne, O; Romaniouk, A; Romano, M; Saez, S M Romano; Adam, E Romero; Rompotis, N; Ronzani, M; Roos, L; Ros, E; Rosati, S; Rosbach, K; Rose, P; Rosenthal, O; Rosien, N-A; Rossetti, V; Rossi, E; Rossi, L P; Rosten, J H N; Rosten, R; Rotaru, M; Roth, I; Rothberg, J; Rousseau, D; Royon, C R; Rozanov, A; Rozen, Y; Ruan, X; Rubbo, F; Rud, V I; Rudolph, M S; Rühr, F; Ruiz-Martinez, A; Rurikova, Z; Rusakovich, N A; Ruschke, A; Russell, H L; Rutherfoord, J P; Ruthmann, N; Ryabov, Y F; Rybar, M; Rybkin, G; Ryu, S; Ryzhov, A; Rzehorz, G F; Saavedra, A F; Sabato, G; Sacerdoti, S; Sadrozinski, H F-W; Sadykov, R; Tehrani, F Safai; Saha, P; Sahinsoy, M; Saimpert, M; Saito, T; Sakamoto, H; Sakurai, Y; Salamanna, G; Salamon, A; Loyola, J E Salazar; Salek, D; De Bruin, P H Sales; Salihagic, D; Salnikov, A; Salt, J; Salvatore, D; Salvatore, F; Salvucci, A; Salzburger, A; Sammel, D; Sampsonidis, D; Sanchez, A; Sánchez, J; Martinez, V Sanchez; Sandaker, H; Sandbach, R L; Sander, H G; Sandhoff, M; Sandoval, C; Sandstroem, R; Sankey, D P C; Sannino, M; Sansoni, A; Santoni, C; Santonico, R; Santos, H; Castillo, I Santoyo; Sapp, K; Sapronov, A; Saraiva, J G; Sarrazin, B; Sasaki, O; Sasaki, Y; Sato, K; Sauvage, G; Sauvan, E; Savage, G; Savard, P; Sawyer, C; Sawyer, L; Saxon, J; Sbarra, C; Sbrizzi, A; Scanlon, T; Scannicchio, D A; Scarcella, M; Scarfone, V; Schaarschmidt, J; Schacht, P; Schaefer, D; Schaefer, R; Schaeffer, J; Schaepe, S; Schaetzel, S; Schäfer, U; Schaffer, A C; Schaile, D; Schamberger, R D; Scharf, V; Schegelsky, V A; Scheirich, D; Schernau, M; Schiavi, C; Schillo, C; Schioppa, M; Schlenker, S; Schmieden, K; Schmitt, C; Schmitt, S; Schmitz, S; Schneider, B; Schnoor, U; Schoeffel, L; Schoening, A; Schoenrock, B D; Schopf, E; Schorlemmer, A L S; Schott, M; Schovancova, J; Schramm, S; Schreyer, M; Schuh, N; Schultens, M J; Schultz-Coulon, H-C; Schulz, H; Schumacher, M; Schumm, B A; Schune, Ph; Schwanenberger, C; Schwartzman, A; Schwarz, T A; Schwegler, Ph; Schweiger, H; Schwemling, Ph; Schwienhorst, R; Schwindling, J; Schwindt, T; Sciolla, G; Scuri, F; Scutti, F; Searcy, J; Seema, P; Seidel, S C; Seiden, A; Seifert, F; Seixas, J M; Sekhniaidze, G; Sekhon, K; Sekula, S J; Seliverstov, D M; Semprini-Cesari, N; Serfon, C; Serin, L; Serkin, L; Sessa, M; Seuster, R; Severini, H; Sfiligoj, T; Sforza, F; Sfyrla, A; Shabalina, E; Shaikh, N W; Shan, L Y; Shang, R; Shank, J T; Shapiro, M; Shatalov, P B; Shaw, K; Shaw, S M; Shcherbakova, A; Shehu, C Y; Sherwood, P; Shi, L; Shimizu, S; Shimmin, C O; Shimojima, M; Shiyakova, M; Shmeleva, A; Saadi, D Shoaleh; Shochet, M J; Shojaii, S; Shrestha, S; Shulga, E; Shupe, M A; Sicho, P; Sidebo, P E; Sidiropoulou, O; Sidorov, D; Sidoti, A; Siegert, F; Sijacki, Dj; Silva, J; Silverstein, S B; Simak, V; Simard, O; Simic, Lj; Simion, S; Simioni, E; Simmons, B; Simon, D; Simon, M; Sinervo, P; Sinev, N B; Sioli, M; Siragusa, G; Sivoklokov, S Yu; Sjölin, J; Sjursen, T B; Skinner, M B; Skottowe, H P; Skubic, P; Slater, M; Slavicek, T; Slawinska, M; Sliwa, K; Slovak, R; Smakhtin, V; Smart, B H; Smestad, L; Smirnov, S Yu; Smirnov, Y; Smirnova, L N; Smirnova, O; Smith, M N K; Smith, R W; Smizanska, M; Smolek, K; Snesarev, A A; Snyder, S; Sobie, R; Socher, F; Soffer, A; Soh, D A; Sokhrannyi, G; Sanchez, C A Solans; Solar, M; Soldatov, E Yu; Soldevila, U; Solodkov, A A; Soloshenko, A; Solovyanov, O V; Solovyev, V; Sommer, P; Son, H; Song, H Y; Sood, A; Sopczak, A; Sopko, V; Sorin, V; Sosa, D; Sotiropoulou, C L; Soualah, R; Soukharev, A M; South, D; Sowden, B C; Spagnolo, S; Spalla, M; Spangenberg, M; Spanò, F; Sperlich, D; Spettel, F; Spighi, R; Spigo, G; Spiller, L A; Spousta, M; Denis, R D St; Stabile, A; Stamen, R; Stamm, S; Stanecka, E; Stanek, R W; Stanescu, C; Stanescu-Bellu, M; Stanitzki, M M; Stapnes, S; Starchenko, E A; Stark, G H; Stark, J; Staroba, P; Starovoitov, P; Stärz, S; Staszewski, R; Steinberg, P; Stelzer, B; Stelzer, H J; Stelzer-Chilton, O; Stenzel, H; Stewart, G A; Stillings, J A; Stockton, M C; Stoebe, M; Stoicea, G; Stolte, P; Stonjek, S; Stradling, A R; Straessner, A; Stramaglia, M E; Strandberg, J; Strandberg, S; Strandlie, A; Strauss, M; Strizenec, P; Ströhmer, R; Strom, D M; Stroynowski, R; Strubig, A; Stucci, S A; Stugu, B; Styles, N A; Su, D; Su, J; Subramaniam, R; Suchek, S; Sugaya, Y; Suk, M; Sulin, V V; Sultansoy, S; Sumida, T; Sun, S; Sun, X; Sundermann, J E; Suruliz, K; Susinno, G; Sutton, M R; Suzuki, S; Svatos, M; Swiatlowski, M; Sykora, I; Sykora, T; Ta, D; Taccini, C; Tackmann, K; Taenzer, J; Taffard, A; Tafirout, R; Taiblum, N; Takai, H; Takashima, R; Takeshita, T; Takubo, Y; Talby, M; Talyshev, A A; Tam, J Y C; Tan, K G; Tanaka, J; Tanaka, R; Tanaka, S; Tannenwald, B B; Araya, S Tapia; Tapprogge, S; Tarem, S; Tartarelli, G F; Tas, P; Tasevsky, M; Tashiro, T; Tassi, E; Delgado, A Tavares; Tayalati, Y; Taylor, A C; Taylor, G N; Taylor, P T E; Taylor, W; Teischinger, F A; Teixeira-Dias, P; Temming, K K; Temple, D; Kate, H Ten; Teng, P K; Teoh, J J; Tepel, F; Terada, S; Terashi, K; Terron, J; Terzo, S; Testa, M; Teuscher, R J; Theveneaux-Pelzer, T; Thomas, J P; Thomas-Wilsker, J; Thompson, E N; Thompson, P D; Thompson, A S; Thomsen, L A; Thomson, E; Thomson, M; Tibbetts, M J; Torres, R E Ticse; Tikhomirov, V O; Tikhonov, Yu A; Timoshenko, S; Tipton, P; Tisserant, S; Todome, K; Todorov, T; Todorova-Nova, S; Tojo, J; Tokár, S; Tokushuku, K; Tolley, E; Tomlinson, L; Tomoto, M; Tompkins, L; Toms, K; Tong, B; Torrence, E; Torres, H; Pastor, E Torró; Toth, J; Touchard, F; Tovey, D R; Trefzger, T; Tricoli, A; Trigger, I M; Trincaz-Duvoid, S; Tripiana, M F; Trischuk, W; Trocmé, B; Trofymov, A; Troncon, C; Trottier-McDonald, M; Trovatelli, M; Truong, L; Trzebinski, M; Trzupek, A; Tseng, J C-L; Tsiareshka, P V; Tsipolitis, G; Tsirintanis, N; Tsiskaridze, S; Tsiskaridze, V; Tskhadadze, E G; Tsui, K M; Tsukerman, I I; Tsulaia, V; Tsuno, S; Tsybychev, D; Tudorache, A; Tudorache, V; Tuna, A N; Tupputi, S A; Turchikhin, S; Turecek, D; Turgeman, D; Turra, R; Turvey, A J; Tuts, P M; Tyndel, M; Ucchielli, G; Ueda, I; Ueno, R; Ughetto, M; Ukegawa, F; Unal, G; Undrus, A; Unel, G; Ungaro, F C; Unno, Y; Unverdorben, C; Urban, J; Urquijo, P; Urrejola, P; Usai, G; Usanova, A; Vacavant, L; Vacek, V; Vachon, B; Valderanis, C; Santurio, E Valdes; Valencic, N; Valentinetti, S; Valero, A; Valery, L; Valkar, S; Vallecorsa, S; Ferrer, J A Valls; Van Den Wollenberg, W; Van Der Deijl, P C; van der Geer, R; van der Graaf, H; van Eldik, N; van Gemmeren, P; Van Nieuwkoop, J; van Vulpen, I; van Woerden, M C; Vanadia, M; Vandelli, W; Vanguri, R; Vaniachine, A; Vankov, P; Vardanyan, G; Vari, R; Varnes, E W; Varol, T; Varouchas, D; Vartapetian, A; Varvell, K E; Vasquez, J G; Vazeille, F; Schroeder, T Vazquez; Veatch, J; Veloce, L M; Veloso, F; Veneziano, S; Ventura, A; Venturi, M; Venturi, N; Venturini, A; Vercesi, V; Verducci, M; Verkerke, W; Vermeulen, J C; Vest, A; Vetterli, M C; Viazlo, O; Vichou, I; Vickey, T; Boeriu, O E Vickey; Viehhauser, G H A; Viel, S; Vigani, L; Vigne, R; Villa, M; Perez, M Villaplana; Vilucchi, E; Vincter, M G; Vinogradov, V B; Vittori, C; Vivarelli, I; Vlachos, S; Vlasak, M; Vogel, M; Vokac, P; Volpi, G; Volpi, M; von der Schmitt, H; von Toerne, E; Vorobel, V; Vorobev, K; Vos, M; Voss, R; Vossebeld, J H; Vranjes, N; Milosavljevic, M Vranjes; Vrba, V; Vreeswijk, M; Vuillermet, R; Vukotic, I; Vykydal, Z; Wagner, P; Wagner, W; Wahlberg, H; Wahrmund, S; Wakabayashi, J; Walder, J; Walker, R; Walkowiak, W; Wallangen, V; Wang, C; Wang, C; Wang, F; Wang, H; Wang, H; Wang, J; Wang, J; Wang, K; Wang, R; Wang, S M; Wang, T; Wang, T; Wang, X; Wanotayaroj, C; Warburton, A; Ward, C P; Wardrope, D R; Washbrook, A; Watkins, P M; Watson, A T; Watson, M F; Watts, G; Watts, S; Waugh, B M; Webb, S; Weber, M S; Weber, S W; Webster, J S; Weidberg, A R; Weinert, B; Weingarten, J; Weiser, C; Weits, H; Wells, P S; Wenaus, T; Wengler, T; Wenig, S; Wermes, N; Werner, M; Werner, P; Wessels, M; Wetter, J; Whalen, K; Whallon, N L; Wharton, A M; White, A; White, M J; White, R; White, S; Whiteson, D; Wickens, F J; Wiedenmann, W; Wielers, M; Wienemann, P; Wiglesworth, C; Wiik-Fuchs, L A M; Wildauer, A; Wilk, F; Wilkens, H G; Williams, H H; Williams, S; Willis, C; Willocq, S; Wilson, J A; Wingerter-Seez, I; Winklmeier, F; Winston, O J; Winter, B T; Wittgen, M; Wittkowski, J; Wollstadt, S J; Wolter, M W; Wolters, H; Wosiek, B K; Wotschack, J; Woudstra, M J; Wozniak, K W; Wu, M; Wu, M; Wu, S L; Wu, X; Wu, Y; Wyatt, T R; Wynne, B M; Xella, S; Xu, D; Xu, L; Yabsley, B; Yacoob, S; Yakabe, R; Yamaguchi, D; Yamaguchi, Y; Yamamoto, A; Yamamoto, S; Yamanaka, T; Yamauchi, K; Yamazaki, Y; Yan, Z; Yang, H; Yang, H; Yang, Y; Yang, Z; Yao, W-M; Yap, Y C; Yasu, Y; Yatsenko, E; Wong, K H Yau; Ye, J; Ye, S; Yeletskikh, I; Yen, A L; Yildirim, E; Yorita, K; Yoshida, R; Yoshihara, K; Young, C; Young, C J S; Youssef, S; Yu, D R; Yu, J; Yu, J M; Yu, J; Yuan, L; Yuen, S P Y; Yusuff, I; Zabinski, B; Zaidan, R; Zaitsev, A M; Zakharchuk, N; Zalieckas, J; Zaman, A; Zambito, S; Zanello, L; Zanzi, D; Zeitnitz, C; Zeman, M; Zemla, A; Zeng, J C; Zeng, Q; Zengel, K; Zenin, O; Ženiš, T; Zerwas, D; Zhang, D; Zhang, F; Zhang, G; Zhang, H; Zhang, J; Zhang, L; Zhang, R; Zhang, R; Zhang, X; Zhang, Z; Zhao, X; Zhao, Y; Zhao, Z; Zhemchugov, A; Zhong, J; Zhou, B; Zhou, C; Zhou, L; Zhou, L; Zhou, M; Zhou, N; Zhu, C G; Zhu, H; Zhu, J; Zhu, Y; Zhuang, X; Zhukov, K; Zibell, A; Zieminska, D; Zimine, N I; Zimmermann, C; Zimmermann, S; Zinonos, Z; Zinser, M; Ziolkowski, M; Živković, L; Zobernig, G; Zoccoli, A; Nedden, M Zur; Zurzolo, G; Zwalinski, L

2017-01-01

Direct searches for lepton flavour violation in decays of the Higgs and Z bosons with the ATLAS detector at the LHC are presented. The following three decays are considered: [Formula: see text], [Formula: see text], and [Formula: see text]. The searches are based on the data sample of proton-proton collisions collected by the ATLAS detector corresponding to an integrated luminosity of 20.3 [Formula: see text] at a centre-of-mass energy of [Formula: see text] TeV. No significant excess is observed, and upper limits on the lepton-flavour-violating branching ratios are set at the 95[Formula: see text] confidence level: Br[Formula: see text], Br[Formula: see text], and Br[Formula: see text].

Moving CLABSI prevention beyond the intensive care unit: risk factors in pediatric oncology patients.

PubMed

Kelly, Matthew; Conway, Margaret; Wirth, Kathleen; Potter-Bynoe, Gail; Billett, Amy L; Sandora, Thomas J

2011-11-01

Central line-associated bloodstream infections (CLABSIs) frequently complicate the use of central venous catheters (CVCs) among pediatric patients with cancer. Our objectives were to describe the microbiology and identify risk factors for hospital-onset CLABSI in this patient population. Retrospective case-control study. Oncology and stem cell transplant units of a freestanding, 396-bed quaternary care pediatric hospital. Case subjects ([Formula: see text]) were patients with a diagnosis of malignancy and/or stem cell transplant recipients with CLABSI occurring during admission. Controls ([Formula: see text]) were identified using risk set sampling of hospitalizations among patients with a CVC, matched on date of admission. Multivariate conditional logistic regression was used to identify independent predictors of CLABSI. The majority of CLABSI isolates were gram-positive bacteria (58%). The most frequently isolated organism was Enterococcus faecium, and 6 of 9 isolates were resistant to vancomycin. In multivariate analyses, independent risk factors for CLABSI included platelet transfusion within the prior week (odds ratio [OR], 10.90 [95% confidence interval (CI), 3.02-39.38]; [Formula: see text]) and CVC placement within the previous month (<1 week vs ≥1 month: OR, 11.71 [95% CI, 1.98-69.20]; [Formula: see text]; ≥1 week and <1 month vs ≥1 month: OR, 7.37 [95% CI, 1.85-29.36]; [Formula: see text]). Adjunctive measures to prevent CLABSI among pediatric oncology patients may be most beneficial in the month following CVC insertion and in patients requiring frequent platelet transfusions. Vancomycin-resistant enterococci may be an emerging cause of CLABSI in hospitalized pediatric oncology patients and are unlikely to be treated by typical empiric antimicrobial regimens.

Cortical Responses to Speech Sounds in 3- and 6-Month-Old Infants Fed Breast Milk, Milk Formula, or Soy Formula

USDA-ARS?s Scientific Manuscript database

The influence of the three most common infant diets (breast milk, milk-based and soy-based formulas) on growth, behavioral development, and cortical responses (ERPs) to the consonant-vowel syllable /pa/, was examined in 130 healthy infants from an ongoing longitudinal study of 600 from birth through...

Measurement of azimuthal correlations of D mesons with charged particles in pp collisions at [Formula: see text] TeV and p-Pb collisions at [Formula: see text] TeV.

PubMed

Adam, J; Adamová, D; Aggarwal, M M; Aglieri Rinella, G; Agnello, M; Agrawal, N; Ahammed, Z; Ahmad, S; Ahn, S U; Aiola, S; Akindinov, A; Alam, S N; Albuquerque, D S D; Aleksandrov, D; Alessandro, B; Alexandre, D; Alfaro Molina, R; Alici, A; Alkin, A; Almaraz, J R M; Alme, J; Alt, T; Altinpinar, S; Altsybeev, I; Alves Garcia Prado, C; Andrei, C; Andronic, A; Anguelov, V; Antičić, T; Antinori, F; Antonioli, P; Aphecetche, L; Appelshäuser, H; Arcelli, S; Arnaldi, R; Arnold, O W; Arsene, I C; Arslandok, M; Audurier, B; Augustinus, A; Averbeck, R; Azmi, M D; Badalà, A; Baek, Y W; Bagnasco, S; Bailhache, R; Bala, R; Balasubramanian, S; Baldisseri, A; Baral, R C; Barbano, A M; Barbera, R; Barile, F; Barnaföldi, G G; Barnby, L S; Barret, V; Bartalini, P; Barth, K; Bartke, J; Bartsch, E; Basile, M; Bastid, N; Basu, S; Bathen, B; Batigne, G; Batista Camejo, A; Batyunya, B; Batzing, P C; Bearden, I G; Beck, H; Bedda, C; Behera, N K; Belikov, I; Bellini, F; Bello Martinez, H; Bellwied, R; Belmont, R; Belmont-Moreno, E; Beltran, L G E; Belyaev, V; Bencedi, G; Beole, S; Berceanu, I; Bercuci, A; Berdnikov, Y; Berenyi, D; Bertens, R A; Berzano, D; Betev, L; Bhasin, A; Bhat, I R; Bhati, A K; Bhattacharjee, B; Bhom, J; Bianchi, L; Bianchi, N; Bianchin, C; Bielčík, J; Bielčíková, J; Bilandzic, A; Biro, G; Biswas, R; Biswas, S; Bjelogrlic, S; Blair, J T; Blau, D; Blume, C; Bock, F; Bogdanov, A; Bøggild, H; Boldizsár, L; Bombara, M; Bonora, M; Book, J; Borel, H; Borissov, A; Borri, M; Bossú, F; Botta, E; Bourjau, C; Braun-Munzinger, P; Bregant, M; Breitner, T; Broker, T A; Browning, T A; Broz, M; Brucken, E J; Bruna, E; Bruno, G E; Budnikov, D; Buesching, H; Bufalino, S; Buitron, S A I; Buncic, P; Busch, O; Buthelezi, Z; Butt, J B; Buxton, J T; Cabala, J; Caffarri, D; Cai, X; Caines, H; Diaz, L Calero; Caliva, A; Calvo Villar, E; Camerini, P; Carena, F; Carena, W; Carnesecchi, F; Castillo Castellanos, J; Castro, A J; Casula, E A R; Ceballos Sanchez, C; Cepila, J; Cerello, P; Cerkala, J; Chang, B; Chapeland, S; Chartier, M; Charvet, J L; Chattopadhyay, S; Chattopadhyay, S; Chauvin, A; Chelnokov, V; Cherney, M; Cheshkov, C; Cheynis, B; Chibante Barroso, V; Chinellato, D D; Cho, S; Chochula, P; Choi, K; Chojnacki, M; Choudhury, S; Christakoglou, P; Christensen, C H; Christiansen, P; Chujo, T; Chung, S U; Cicalo, C; Cifarelli, L; Cindolo, F; Cleymans, J; Colamaria, F; Colella, D; Collu, A; Colocci, M; Conesa Balbastre, G; Conesa Del Valle, Z; Connors, M E; Contreras, J G; Cormier, T M; Corrales Morales, Y; Cortés Maldonado, I; Cortese, P; Cosentino, M R; Costa, F; Crkovská, J; Crochet, P; Cruz Albino, R; Cuautle, E; Cunqueiro, L; Dahms, T; Dainese, A; Danisch, M C; Danu, A; Das, D; Das, I; Das, S; Dash, A; Dash, S; De, S; De Caro, A; de Cataldo, G; de Conti, C; de Cuveland, J; De Falco, A; De Gruttola, D; De Marco, N; De Pasquale, S; De Souza, R D; Deisting, A; Deloff, A; Dénes, E; Deplano, C; Dhankher, P; Di Bari, D; Di Mauro, A; Di Nezza, P; Di Ruzza, B; Diaz Corchero, M A; Dietel, T; Dillenseger, P; Divià, R; Djuvsland, Ø; Dobrin, A; Domenicis Gimenez, D; Dönigus, B; Dordic, O; Drozhzhova, T; Dubey, A K; Dubla, A; Ducroux, L; Dupieux, P; Ehlers, R J; Elia, D; Endress, E; Engel, H; Epple, E; Erazmus, B; Erdemir, I; Erhardt, F; Espagnon, B; Estienne, M; Esumi, S; Eum, J; Evans, D; Evdokimov, S; Eyyubova, G; Fabbietti, L; Fabris, D; Faivre, J; Fantoni, A; Fasel, M; Feldkamp, L; Feliciello, A; Feofilov, G; Ferencei, J; Fernández Téllez, A; Ferreiro, E G; Ferretti, A; Festanti, A; Feuillard, V J G; Figiel, J; Figueredo, M A S; Filchagin, S; Finogeev, D; Fionda, F M; Fiore, E M; Fleck, M G; Floris, M; Foertsch, S; Foka, P; Fokin, S; Fragiacomo, E; Francescon, A; Francisco, A; Frankenfeld, U; Fronze, G G; Fuchs, U; Furget, C; Furs, A; Fusco Girard, M; Gaardhøje, J J; Gagliardi, M; Gago, A M; Gajdosova, K; Gallio, M; Galvan, C D; Gangadharan, D R; Ganoti, P; Gao, C; Garabatos, C; Garcia-Solis, E; Gargiulo, C; Gasik, P; Gauger, E F; Germain, M; Gheata, M; Ghosh, P; Ghosh, S K; Gianotti, P; Giubellino, P; Giubilato, P; Gladysz-Dziadus, E; Glässel, P; Goméz Coral, D M; Gomez Ramirez, A; Gonzalez, A S; Gonzalez, V; González-Zamora, P; Gorbunov, S; Görlich, L; Gotovac, S; Grabski, V; Grachov, O A; Graczykowski, L K; Graham, K L; Grelli, A; Grigoras, A; Grigoras, C; Grigoriev, V; Grigoryan, A; Grigoryan, S; Grinyov, B; Grion, N; Gronefeld, J M; Grosse-Oetringhaus, J F; Grosso, R; Gruber, L; Guber, F; Guernane, R; Guerzoni, B; Gulbrandsen, K; Gunji, T; Gupta, A; Gupta, R; Haake, R; Hadjidakis, C; Haiduc, M; Hamagaki, H; Hamar, G; Hamon, J C; Harris, J W; Harton, A; Hatzifotiadou, D; Hayashi, S; Heckel, S T; Hellbär, E; Helstrup, H; Herghelegiu, A; Herrera Corral, G; Hess, B A; Hetland, K F; Hillemanns, H; Hippolyte, B; Horak, D; Hosokawa, R; Hristov, P; Hughes, C; Humanic, T J; Hussain, N; Hussain, T; Hutter, D; Hwang, D S; Ilkaev, R; Inaba, M; Incani, E; Ippolitov, M; Irfan, M; Isakov, V; Ivanov, M; Ivanov, V; Izucheev, V; Jacak, B; Jacazio, N; Jacobs, P M; Jadhav, M B; Jadlovska, S; Jadlovsky, J; Jahnke, C; Jakubowska, M J; Janik, M A; Jayarathna, P H S Y; Jena, C; Jena, S; Jimenez Bustamante, R T; Jones, P G; Jusko, A; Kalinak, P; Kalweit, A; Kang, J H; Kaplin, V; Kar, S; Karasu Uysal, A; Karavichev, O; Karavicheva, T; Karayan, L; Karpechev, E; Kebschull, U; Keidel, R; Keijdener, D L D; Keil, M; Khan, M Mohisin; Khan, P; Khan, S A; Khanzadeev, A; Kharlov, Y; Kileng, B; Kim, D W; Kim, D J; Kim, D; Kim, H; Kim, J S; Kim, J; Kim, M; Kim, M; Kim, S; Kim, T; Kirsch, S; Kisel, I; Kiselev, S; Kisiel, A; Kiss, G; Klay, J L; Klein, C; Klein, J; Klein-Bösing, C; Klewin, S; Kluge, A; Knichel, M L; Knospe, A G; Kobdaj, C; Kofarago, M; Kollegger, T; Kolojvari, A; Kondratiev, V; Kondratyeva, N; Kondratyuk, E; Konevskikh, A; Kopcik, M; Kour, M; Kouzinopoulos, C; Kovalenko, O; Kovalenko, V; Kowalski, M; Koyithatta Meethaleveedu, G; Králik, I; Kravčáková, A; Krivda, M; Krizek, F; Kryshen, E; Krzewicki, M; Kubera, A M; Kučera, V; Kuhn, C; Kuijer, P G; Kumar, A; Kumar, J; Kumar, L; Kumar, S; Kurashvili, P; Kurepin, A; Kurepin, A B; Kuryakin, A; Kweon, M J; Kwon, Y; La Pointe, S L; La Rocca, P; Ladron de Guevara, P; Lagana Fernandes, C; Lakomov, I; Langoy, R; Lapidus, K; Lara, C; Lardeux, A; Lattuca, A; Laudi, E; Lea, R; Leardini, L; Lee, S; Lehas, F; Lehner, S; Lemmon, R C; Lenti, V; Leogrande, E; León Monzón, I; León Vargas, H; Leoncino, M; Lévai, P; Li, S; Li, X; Lien, J; Lietava, R; Lindal, S; Lindenstruth, V; Lippmann, C; Lisa, M A; Ljunggren, H M; Lodato, D F; Loenne, P I; Loginov, V; Loizides, C; Lopez, X; López Torres, E; Lowe, A; Luettig, P; Lunardon, M; Luparello, G; Lupi, M; Lutz, T H; Maevskaya, A; Mager, M; Mahajan, S; Mahmood, S M; Maire, A; Majka, R D; Malaev, M; Maldonado Cervantes, I; Malinina, L; Mal'Kevich, D; Malzacher, P; Mamonov, A; Manko, V; Manso, F; Manzari, V; Mao, Y; Marchisone, M; Mareš, J; Margagliotti, G V; Margotti, A; Margutti, J; Marín, A; Markert, C; Marquard, M; Martin, N A; Martinengo, P; Martínez, M I; Martínez García, G; Martinez Pedreira, M; Mas, A; Masciocchi, S; Masera, M; Masoni, A; Mastroserio, A; Matyja, A; Mayer, C; Mazer, J; Mazzoni, M A; Mcdonald, D; Meddi, F; Melikyan, Y; Menchaca-Rocha, A; Meninno, E; Mercado Pérez, J; Meres, M; Mhlanga, S; Miake, Y; Mieskolainen, M M; Mikhaylov, K; Milano, L; Milosevic, J; Mischke, A; Mishra, A N; Miśkowiec, D; Mitra, J; Mitu, C M; Mohammadi, N; Mohanty, B; Molnar, L; Montaño Zetina, L; Montes, E; Moreira De Godoy, D A; Moreno, L A P; Moretto, S; Morreale, A; Morsch, A; Muccifora, V; Mudnic, E; Mühlheim, D; Muhuri, S; Mukherjee, M; Mulligan, J D; Munhoz, M G; Münning, K; Munzer, R H; Murakami, H; Murray, S; Musa, L; Musinsky, J; Naik, B; Nair, R; Nandi, B K; Nania, R; Nappi, E; Naru, M U; Natal da Luz, H; Nattrass, C; Navarro, S R; Nayak, K; Nayak, R; Nayak, T K; Nazarenko, S; Nedosekin, A; Negrao De Oliveira, R A; Nellen, L; Ng, F; Nicassio, M; Niculescu, M; Niedziela, J; Nielsen, B S; Nikolaev, S; Nikulin, S; Nikulin, V; Noferini, F; Nomokonov, P; Nooren, G; Noris, J C C; Norman, J; Nyanin, A; Nystrand, J; Oeschler, H; Oh, S; Oh, S K; Ohlson, A; Okatan, A; Okubo, T; Olah, L; Oleniacz, J; Oliveira Da Silva, A C; Oliver, M H; Onderwaater, J; Oppedisano, C; Orava, R; Oravec, M; Ortiz Velasquez, A; Oskarsson, A; Otwinowski, J; Oyama, K; Ozdemir, M; Pachmayer, Y; Pagano, D; Pagano, P; Paić, G; Pal, S K; Palni, P; Pan, J; Pandey, A K; Papikyan, V; Pappalardo, G S; Pareek, P; Park, J; Park, W J; Parmar, S; Passfeld, A; Paticchio, V; Patra, R N; Paul, B; Pei, H; Peitzmann, T; Peng, X; Pereira Da Costa, H; Peresunko, D; Perez Lezama, E; Peskov, V; Pestov, Y; Petráček, V; Petrov, V; Petrovici, M; Petta, C; Piano, S; Pikna, M; Pillot, P; Pimentel, L O D L; Pinazza, O; Pinsky, L; Piyarathna, D B; Płoskoń, M; Planinic, M; Pluta, J; Pochybova, S; Podesta-Lerma, P L M; Poghosyan, M G; Polichtchouk, B; Poljak, N; Poonsawat, W; Pop, A; Poppenborg, H; Porteboeuf-Houssais, S; Porter, J; Pospisil, J; Prasad, S K; Preghenella, R; Prino, F; Pruneau, C A; Pshenichnov, I; Puccio, M; Puddu, G; Pujahari, P; Punin, V; Putschke, J; Qvigstad, H; Rachevski, A; Raha, S; Rajput, S; Rak, J; Rakotozafindrabe, A; Ramello, L; Rami, F; Raniwala, R; Raniwala, S; Räsänen, S S; Rascanu, B T; Rathee, D; Read, K F; Redlich, K; Reed, R J; Rehman, A; Reichelt, P; Reidt, F; Ren, X; Renfordt, R; Reolon, A R; Reshetin, A; Reygers, K; Riabov, V; Ricci, R A; Richert, T; Richter, M; Riedler, P; Riegler, W; Riggi, F; Ristea, C; Rocco, E; Rodríguez Cahuantzi, M; Rodriguez Manso, A; Røed, K; Rogochaya, E; Rohr, D; Röhrich, D; Ronchetti, F; Ronflette, L; Rosnet, P; Rossi, A; Roukoutakis, F; Roy, A; Roy, C; Roy, P; Rubio Montero, A J; Rui, R; Russo, R; Ryabinkin, E; Ryabov, Y; Rybicki, A; Saarinen, S; Sadhu, S; Sadovsky, S; Šafařík, K; Sahlmuller, B; Sahoo, P; Sahoo, R; Sahoo, S; Sahu, P K; Saini, J; Sakai, S; Saleh, M A; Salzwedel, J; Sambyal, S; Samsonov, V; Šándor, L; Sandoval, A; Sano, M; Sarkar, D; Sarkar, N; Sarma, P; Scapparone, E; Scarlassara, F; Schiaua, C; Schicker, R; Schmidt, C; Schmidt, H R; Schmidt, M; Schuchmann, S; Schukraft, J; Schutz, Y; Schwarz, K; Schweda, K; Scioli, G; Scomparin, E; Scott, R; Šefčík, M; Seger, J E; Sekiguchi, Y; Sekihata, D; Selyuzhenkov, I; Senosi, K; Senyukov, S; Serradilla, E; Sevcenco, A; Shabanov, A; Shabetai, A; Shadura, O; Shahoyan, R; Shangaraev, A; Sharma, A; Sharma, M; Sharma, M; Sharma, N; Sheikh, A I; Shigaki, K; Shou, Q; Shtejer, K; Sibiriak, Y; Siddhanta, S; Sielewicz, K M; Siemiarczuk, T; Silvermyr, D; Silvestre, C; Simatovic, G; Simonetti, G; Singaraju, R; Singh, R; Singhal, V; Sinha, T; Sitar, B; Sitta, M; Skaali, T B; Slupecki, M; Smirnov, N; Snellings, R J M; Snellman, T W; Song, J; Song, M; Song, Z; Soramel, F; Sorensen, S; Sozzi, F; Spiriti, E; Sputowska, I; Spyropoulou-Stassinaki, M; Stachel, J; Stan, I; Stankus, P; Stenlund, E; Steyn, G; Stiller, J H; Stocco, D; Strmen, P; Suaide, A A P; Sugitate, T; Suire, C; Suleymanov, M; Suljic, M; Sultanov, R; Šumbera, M; Sumowidagdo, S; Szabo, A; Szarka, I; Szczepankiewicz, A; Szymanski, M; Tabassam, U; Takahashi, J; Tambave, G J; Tanaka, N; Tarhini, M; Tariq, M; Tarzila, M G; Tauro, A; Muñoz, G Tejeda; Telesca, A; Terasaki, K; Terrevoli, C; Teyssier, B; Thäder, J; Thakur, D; Thomas, D; Tieulent, R; Tikhonov, A; Timmins, A R; Toia, A; Trogolo, S; Trombetta, G; Trubnikov, V; Trzaska, W H; Tsuji, T; Tumkin, A; Turrisi, R; Tveter, T S; Ullaland, K; Uras, A; Usai, G L; Utrobicic, A; Vala, M; Valencia Palomo, L; Vallero, S; Van Der Maarel, J; Van Hoorne, J W; van Leeuwen, M; Vanat, T; Vande Vyvre, P; Varga, D; Vargas, A; Vargyas, M; Varma, R; Vasileiou, M; Vasiliev, A; Vauthier, A; Vázquez Doce, O; Vechernin, V; Veen, A M; Velure, A; Vercellin, E; Vergara Limón, S; Vernet, R; Verweij, M; Vickovic, L; Viinikainen, J; Vilakazi, Z; Villalobos Baillie, O; Villatoro Tello, A; Vinogradov, A; Vinogradov, L; Virgili, T; Vislavicius, V; Viyogi, Y P; Vodopyanov, A; Völkl, M A; Voloshin, K; Voloshin, S A; Volpe, G; von Haller, B; Vorobyev, I; Vranic, D; Vrláková, J; Vulpescu, B; Wagner, B; Wagner, J; Wang, H; Wang, M; Watanabe, D; Watanabe, Y; Weber, M; Weber, S G; Weiser, D F; Wessels, J P; Westerhoff, U; Whitehead, A M; Wiechula, J; Wikne, J; Wilk, G; Wilkinson, J; Willems, G A; Williams, M C S; Windelband, B; Winn, M; Yalcin, S; Yang, P; Yano, S; Yin, Z; Yokoyama, H; Yoo, I-K; Yoon, J H; Yurchenko, V; Zaborowska, A; Zaccolo, V; Zaman, A; Zampolli, C; Zanoli, H J C; Zaporozhets, S; Zardoshti, N; Zarochentsev, A; Závada, P; Zaviyalov, N; Zbroszczyk, H; Zgura, I S; Zhalov, M; Zhang, H; Zhang, X; Zhang, Y; Zhang, C; Zhang, Z; Zhao, C; Zhigareva, N; Zhou, D; Zhou, Y; Zhou, Z; Zhu, H; Zhu, J; Zichichi, A; Zimmermann, A; Zimmermann, M B; Zinovjev, G; Zyzak, M

2017-01-01

The azimuthal correlations of D mesons with charged particles were measured with the ALICE apparatus in pp collisions at [Formula: see text] and p-Pb collisions at [Formula: see text] at the Large Hadron Collider. [Formula: see text], [Formula: see text], and [Formula: see text] mesons and their charge conjugates with transverse momentum [Formula: see text] and rapidity in the nucleon-nucleon centre-of-mass system [Formula: see text] (pp collisions) and [Formula: see text] (p-Pb collisions) were correlated to charged particles with [Formula: see text]. The yield of charged particles in the correlation peak induced by the jet containing the D meson and the peak width are compatible within uncertainties in the two collision systems. The data are described within uncertainties by Monte-Carlo simulations based on PYTHIA, POWHEG, and EPOS 3 event generators.

[Food matching based on herbal properties of formulas in "Treatise on Febrile Diseases"].

PubMed

Yan, Su-rong; Zheng, Hu-zhan; Miao, Su-fen; Wang, Yun

2015-09-01

Based on databases for herbal properties of formulas and foods recorded in "Treatise on Febrile Diseases", a case study was conducted for the food matching method according to herbal properties of formulas in "Treatise on Febrile Diseases". The result show that the method was technically feasible once the herbal properties of foods were determined. Moreover, according to herbal properties of target formulas, the compositions of foods were effectively defined. In this study, researchers determined the similarity between the food matching scheme and the target formulas in function and efficacy, provided a quantitative method for food formulation and promote the development of application technology of the herbal property theory and the compatibility theory.

The U.S. infant formula industry: is direct-to-consumer advertising unethical or inevitable?

PubMed

Cutler, Bob D; Wright, Robert F

2002-01-01

Throughout their history, U.S. based infant formula companies have promoted their products as though they required a prescription. This form of marketing is called "ethical" promotion, which focuses on gaining a physician to parent recommendation for a brand of infant formula. Until Nestle's entry into the U.S. infant formula market in 1988, there was little direct-to-consumer promotion of infant formula. This article provides a background on the history of infant formula practices in the United States and then focuses on a descriptive model to explain how mothers' make their infant formula selection. Finally, we offer suggestions for the "ethical" marketers of infant formula.

Plausibility and parameter sensitivity of micro-finite element-based joint load prediction at the proximal femur.

PubMed

Synek, Alexander; Pahr, Dieter H

2018-06-01

A micro-finite element-based method to estimate the bone loading history based on bone architecture was recently presented in the literature. However, a thorough investigation of the parameter sensitivity and plausibility of this method to predict joint loads is still missing. The goals of this study were (1) to analyse the parameter sensitivity of the joint load predictions at one proximal femur and (2) to assess the plausibility of the results by comparing load predictions of ten proximal femora to in vivo hip joint forces measured with instrumented prostheses (available from www.orthoload.com ). Joint loads were predicted by optimally scaling the magnitude of four unit loads (inclined [Formula: see text] to [Formula: see text] with respect to the vertical axis) applied to micro-finite element models created from high-resolution computed tomography scans ([Formula: see text]m voxel size). Parameter sensitivity analysis was performed by varying a total of nine parameters and showed that predictions of the peak load directions (range 10[Formula: see text]-[Formula: see text]) are more robust than the predicted peak load magnitudes (range 2344.8-4689.5 N). Comparing the results of all ten femora with the in vivo loading data of ten subjects showed that peak loads are plausible both in terms of the load direction (in vivo: [Formula: see text], predicted: [Formula: see text]) and magnitude (in vivo: [Formula: see text], predicted: [Formula: see text]). Overall, this study suggests that micro-finite element-based joint load predictions are both plausible and robust in terms of the predicted peak load direction, but predicted load magnitudes should be interpreted with caution.

Classical eighth- and lower-order Runge-Kutta-Nystroem formulas with a new stepsize control procedure for special second-order differential equations

NASA Technical Reports Server (NTRS)

Fehlberg, E.

1973-01-01

New Runge-Kutta-Nystrom formulas of the eighth, seventh, sixth, and fifth order are derived for the special second-order (vector) differential equation x = f (t,x). In contrast to Runge-Kutta-Nystrom formulas of an earlier NASA report, these formulas provide a stepsize control procedure based on the leading term of the local truncation error in x. This new procedure is more accurate than the earlier Runge-Kutta-Nystrom procedure (with stepsize control based on the leading term of the local truncation error in x) when integrating close to singularities. Two central orbits are presented as examples. For these orbits, the accuracy and speed of the formulas of this report are compared with those of Runge-Kutta-Nystrom and Runge-Kutta formulas of earlier NASA reports.

Predictions on the modes of decay of even Z superheavy isotopes within the range 104 ≤ Z ≤ 136

NASA Astrophysics Data System (ADS)

Santhosh, K. P.; Nithya, C.

2018-01-01

The decay modes and half lives of all the even Z isotopes of superheavy elements within the range 104 ≤ Z ≤ 136 have been predicted by comparing the alpha decay half-lives with the spontaneous fission half-lives. The Coulomb and proximity potential model for deformed nuclei (CPPMDN) and the shell-effect-dependent formula of Santhosh et al. are used to calculate the alpha half-lives and spontaneous fission half-lives respectively. For theoretical comparison the alpha decay half-lives are also calculated using Coulomb and proximity potential model (CPPM), the Viola-Seaborg-Sobiczewski semi-empirical (VSS) relation, the universal (UNIV) curve of Poenaru et al., the analytical formula of Royer and the universal decay law (UDL) of Qi et al. Another tool used for the evaluation of spontaneous fission half-lives is the semi-empirical formula of Xu et al. The nuclei with alpha decay half-lives less than spontaneous fission half-lives will survive fission and hence decay through alpha emission. The predicted half lives and decay modes are compared with the available experimental results. The one-proton and two-proton separation energies of all the isotopes are calculated to find nuclei which lie beyond the proton drip line. Among 1119 even Z nuclei within the range 104 ≤ Z ≤ 136, 164 nuclei show sequential alpha emission followed by subsequent spontaneous fission. Since the isotopes decay through alpha decay chain and the half-lives are in measurable range, these isotopes are predicted to be synthesized and detected in laboratory via alpha decay. 2 nuclei will decay by alpha decay followed by proton emission, 54 nuclei show full alpha chains, 642 nuclei will decay through spontaneous fission, 166 nuclei exhibit proton decay and 91 isotopes are found to be stable against alpha decay. All the isotopes are tabulated according to their decay modes. The study is intended to enhance further experimental investigations in superheavy region.

CORKSCREW 2013 CORK study of children's realistic estimation of weight.

PubMed

Skrobo, Darko; Kelleher, Gemma

2015-01-01

In a resuscitation situation involving a child (age 1-15 years) it is crucial to obtain a weight as most interventions and management depend on it. The APLS formula, '2×(age+4)', is taught via the APLS course and is widely used in Irish hospitals. As the prevalence of obesity is increasing the accuracy of the formula has been questioned and a newer formula has been suggested, the Luscombe and Owens (LO) formula, '(3×age)+7'. To gather data on the weights and ages of the Cork paediatric population (ages 1-15 years) attending services at the Cork University Hospital (CUH), and to identify which of the two age-based weight estimation formulae has best diagnostic accuracy. CUH, Ireland's only level one trauma centre. Retrospective data collection from charts in the Emergency Department, Paediatric Assessment Unit and the Paediatric wards of CUH. 3155 children aged 1-15 years were included in the study. There were 1344 girls and 1811 boys. The formula weight='2×(age+4)' underestimated children's weights by a mean of 20.3% (95% CI 19.7% to 20.9%) for the ages of 1-15 years. The LO formula weight='(3×age)+7' showed a mean underestimation of 4.0% (95% CI 3.3% to 4.6%) for the same age range. The LO formula has been validated in several studies and proven to be a superior age-based weight estimation formula in many western emergency departments. This study shows that the LO formula leads to less underestimation of weights in Irish children than the APLS formula. It is a simple, safe and more accurate age-based estimation formula that can be used over a large age range (1-15 years). Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Understanding Fomalhaut as a Cooper pair

NASA Astrophysics Data System (ADS)

Feng, F.; Jones, H. R. A.

2018-03-01

Fomalhaut is a nearby stellar system and has been found to be a triple based on astrometric observations. With new radial velocity and astrometric data, we study the association between Fomalhaut A, B, and C in a Bayesian framework, finding that the system is gravitationally bound or at least associated. Based on simulations of the system, we find that Fomalhaut C can be easily destabilized through combined perturbations from the Galactic tide and stellar encounters. Considering that observing the disruption of a triple is probably rare in the solar neighbourhood, we conclude that Fomalhaut C is a so-called `gravitational pair' of Fomalhaut A and B. Like the Cooper pair mechanism in superconductors, this phenomenon only appears once the orbital energy of a component becomes comparable with the energy fluctuations caused by the environment. Based on our simulations, we find (1) an upper limit of 8 km s-1 velocity difference is appropriate when selecting binary candidates, and (2) an empirical formula for the escape radius, which is more appropriate than tidal radius when measuring the stability of wide binaries.

Evaluating the formulae for integrated lethality in ethylene oxide sterilization using six different endospore forming strains of bacteria, and comparisons of integrated lethality for ethylene oxide and steam systems.

PubMed

Mosley, Gregg A; Gillis, John R; Krushefski, Garrett

2005-01-01

Bacterial endospores from six different species of bacteria were exposed to a spectrum of ethylene oxide (EtO) sterilizing conditions. Temperature was varied from 40 to 60 degrees C and the ethylene oxide concentration was varied from 300 to 750 mg/L. Relative humidity was maintained at 60+/-10% RH. The fraction negative procedure was used to determine the D value for each of the test conditions. Bacterial species tested included Bacillus atrophaeus ATCC # 9372, Bacillus smithii ATCC # 51232, Bacillus subtilis "5230" ATCC # 35021, Bacillus subtilis, DSM # 4181, Bacillus pumilus ATCC # 27142, and Geobacillus stearothermophilus ATCC # 7953. All spore preparations were inoculated on filter paper strips packaged in blue, sterilizable glassine pouches. G. stearothermophilus was the least resistant organism tested. The most resistant organisms tested were B. atrophaeus and B. subtilis "5230". The B. subtilis "5230" strain was slightly more resistant than B. atrophaeus at conditions of 54C and EtO concentrations of 400, 600, and 750 mg/L, as well as at 60C/750mg/L EtO. The other species were between these extremes. This empirical data allowed the application of the recently published formula for converting D values from one set of conditions to another and evaluations of accuracy. The measured D values also allowed the determination of Z values based on temperature variations. These formulae, when applied to process temperatures independent of gas concentration, result in a Z value of approximately 32 degrees C that appears to be similar for all species tested. These data support the application of the previously published formulae 1-6 and allow the same approach to integrated lethality for ethylene oxide processes as is commonly applied to steam sterilization. A review of steam sterilization and related principles was conducted for comparison of integrated lethality for these two methods of sterilization. Errors associated with D values, Z values, extrapolation, and integrated lethality for both methods of sterilization are discussed.

Settling velocity of marine microplastic particles: laboratory tests

NASA Astrophysics Data System (ADS)

Isachenko, Igor; Khatmullina, Lilia; Chubarenko, Irina; Stepanova, Natalia

2016-04-01

An assessment of the settling velocity of different classes of microplastic particles (< 5 mm) is crucial for the prediction of their transport and fate. The Reynolds numbers for the settling microplastic particles is usually outside the Stokes range (Re << 1), but still far from fully developed turbulent flow (Re >105). Even for such transitional regime, the settling velocity of the particles that could be treated as more or less smooth spheres can be predicted with high accuracy by relationships available in publications. This is not the case for the non-spherical particles like fibres or flakes. There are quite a large number of quasi-theoretical or semi-empirical approaches that take into account the shape and roughness of the particles, usually in the applications to transport of natural sediments. Some engineering formulas for the settling velocity are also developed which have simpler structure along with high degree of accuracy on the set of experimental data. For marine microplastic particles, the absence of relationship between the settling velocity and the properties of the particle requires testing on the samples of marine microplastics. Besides small fragments of rigid plastic (granules, microbeads), there are also fibres and thin plastic sheets (flakes) with some degree of flexibility. The applicability of available formulae to thin and/or flexible plastic particles again requires verification by experiments. The set of laboratory experiments on settling of microplastic particles of various shapes and excess densities in homogeneous water is reported. The particles were collected in water column, bottom sediments and on the beaches of the South-Eastern Baltic. The experiments demonstrate not just different regimes of motion but different manner of the sinking of spheres, flakes and fibres. The very definition of the "settling velocity" has a specific meaning for every kind of a particle shape. The results of test measurements are compared with predictions by several published semi-empirical formulae. We conclude that there are several new questions to discuss in this regard: (i) proper definition of the meaning of "settling velocity" for complicated motion of particles of different shape classes, (ii) usage of formulae calibrated for particles in the density range characteristic for plastics (not natural sands, etc.). The research is supported by the Russian Science Foundation, project number 15-17-10020.

Multi-component hydrogen storage material

DOEpatents

Faheem, Syed A.; Lewis, Gregory J.; Sachtler, J.W. Adriaan; Low, John J.; Lesch, David A.; Dosek, Paul M.; Wolverton, Christopher M.; Siegel, Donald J.; Sudik, Andrea C.; Yang, Jun

2010-09-07

A reversible hydrogen storage composition having an empirical formula of: Li.sub.(x+z)N.sub.xMg.sub.yB.sub.zH.sub.w where 0.4.ltoreq.x.ltoreq.0.8; 0.2.ltoreq.y.ltoreq.0.6; 0

Isotope Separation in Concurrent Gas Centrifuges

NASA Astrophysics Data System (ADS)

Bogovalov, S. V.; Borman, V. D.

An analytical equation defining separative power of an optimized concurrent gas centrifuge is obtained for an arbitrary binary mixture of isotopes. In the case of the uranium isotopes the equation gives δU= 12.7(V/700 m/s)2(300 K/T)L, kg SWU/yr, where L and V are the length and linear velocity of the rotor of the gas centrifuge, T is the temperature. This formula well agrees with an empirical separative power of counter current gas centrifuges.

Silicon Nitride Ceramic Fibers from Preceramic Polymers.

DTIC Science & Technology

1987-06-01

the preceramic fibers into high strength Si3 N and silicon carbide nitride (SiCN) fibers. In the past year, we have learned to prepare polysilazanes...INTHELOY, Given the Empirical Formula for a Material, It Should be Possible to Prepare a Chemical Analog CERAMC CHMIAL MONOMERIC UNIT MONOMERIC UNIT SI3 N4...e a d e nf u ible B y. POLYSILAZANE PRECURSORS TO Si3 Nj IN PRACTICE: It Is Difficult to Synthesize Even Simple, High Molecular Weight Preceramic

Catalyst for elemental sulfur recovery process

DOEpatents

Flytzani-Stephanopoulos, M.; Liu, W.

1995-01-24

A catalytic reduction process is described for the direct recovery of elemental sulfur from various SO[sub 2]-containing industrial gas streams. The catalytic process provides high activity and selectivity, as well as stability in the reaction atmosphere, for the reduction of SO[sub 2] to elemental sulfur product with carbon monoxide or other reducing gases. The reaction of sulfur dioxide and reducing gas takes place over a metal oxide composite catalyst having one of the following empirical formulas: [(FO[sub 2])[sub 1[minus]n](RO)[sub n

Regional lung ventilation and perfusion by electrical impedance tomography compared to single-photon emission computed tomography.

PubMed

Hentze, Benjamin; Muders, Thomas; Luepschen, Henning; Maripuu, Enn; Hedenstierna, Göran; Putensen, Christian; Walter, Marian; Leonhardt, Steffen

2018-06-20

Electrical impedance tomography (EIT) is a noninvasive imaging modality that allows real-time monitoring of regional lung ventilation ([Formula: see text]) in intensive care patients at bedside. However, for improved guidance of ventilation therapy it would be beneficial to obtain regional ventilation-to-perfusion ratio ([Formula: see text]) by EIT. In order to further explore the feasibility, we first evaluate a model-based approach, based on semi-negative matrix factorization and a gamma-variate model, to extract regional lung perfusion ([Formula: see text]) from EIT measurements. Subsequently, a combined validation of both [Formula: see text] and [Formula: see text] measured by EIT against single-photon emission computed tomography (SPECT) is performed on data acquired as part of a porcine animal trial. Four pigs were ventilated at two different levels of positive end-expiratory pressure (PEEP 0 and 15 cm H 2 O, respectively) in randomized order. Repeated injections of an EIT contrast agent (NaCl 10%) and simultaneous SPECT measurements of [Formula: see text] (81 m Kr gas) and [Formula: see text] (99 m Tc-labeled albumin) were performed. Both [Formula: see text] and [Formula: see text] from EIT and SPECT were compared by correlation analysis. Very strong (r 2   =  0.94 to 0.95) correlations were found for [Formula: see text] and [Formula: see text] in the dorsal-ventral direction at both PEEP levels. Moderate (r 2   =  0.36 to 0.46) and moderate to strong (r 2   =  0.61 to 0.82) correlations resulted for [Formula: see text] and [Formula: see text] in the right-left direction, respectively. The results of combined validation indicate that monitoring of [Formula: see text] and [Formula: see text] by EIT is possible. However, care should be taken when trying to quantify [Formula: see text] by EIT, as imaging artefacts and model bias may void necessary spatial matching.

A hydrolysed rice-based formula is tolerated by children with cow's milk allergy: a multi-centre study.

PubMed

Fiocchi, A; Restani, P; Bernardini, R; Lucarelli, S; Lombardi, G; Magazzù, G; Marseglia, G L; Pittschieler, K; Tripodi, S; Troncone, R; Ranzini, C

2006-03-01

Children allergic to cow's milk are fed a soy- or a hydrolysed cow's milk-based substitute. Neither can rule out a sensitization risk. Previous studies have shown that hydrolysed rice is tolerated by animals and children with multiple food hypersensitivities. A prospective clinical assessment of tolerance to a rice-based hydrolysed formula was carried out in children allergic to cow's milk. Patients and methods One hundred children (42 girls and 58 boys, mean age 3.17+/-2.93 years, median 2.20, range 0.18-14.6 years) with a history of immediate reactions to cow's milk and confirmed at double-blind, placebo-controlled food challenge (DBPCFC) when not contraindicated were assessed for clinical tolerance to cow's milk proteins. Their allergy work-up included skin prick tests with whole milk, alpha-lactalbumin (ALA), beta-lactoglobulin (BLG) and total caseins, and specific IgE determinations using CAP technology were performed against whole milk, ALA, BLG and casein. Sensitization to rice and rice-based hydrolysed formula was similarly investigated. Patients' sera were evaluated at immunoblotting for specific IgE to cow's milk proteins, rice and rice-based hydrolysed formula. DBPCFC was carried out with increasing doses of a rice-based hydrolysed formula. All patients were sensitized to cow's milk and/or at least one cow's milk protein fraction. Eighty-seven out of 99 were positive to cow's milk and/or a cow's milk protein fraction at skin prick test. Positive (>0.35 kUA/L) specific IgE determinations were found for cow's milk and/or milk fractions (92/95), rice (21/91) and hydrolysed rice infant formula (4/91). At immunoblotting, sera from 96 children were positive to alpha-casein (n=54), beta-casein (n=38), ALA (n=57), BLG (n=37) and bovine serum albumin (n=61). Similarly, although patients' sera often contained specific IgE against rice proteins at CAP (21/91) and immunoblotting (70/96), only six very weakly positive responses were observed against rice-based hydrolysed formula. All DBPCFC with rice-based hydrolysed formula were negative. Rice-based hydrolysed formula is a possible alternative not only for children with multiple allergies, but also for children with cow's milk allergy.

A Novel Wake Oscillator Model for Vortex-Induced Vibrations Prediction of A Cylinder Considering the Influence of Reynolds Number

NASA Astrophysics Data System (ADS)

Gao, Xi-feng; Xie, Wu-de; Xu, Wan-hai; Bai, Yu-chuan; Zhu, Hai-tao

2018-04-01

It is well known that the Reynolds number has a significant effect on the vortex-induced vibrations (VIV) of cylinders. In this paper, a novel in-line (IL) and cross-flow (CF) coupling VIV prediction model for circular cylinders has been proposed, in which the influence of the Reynolds number was comprehensively considered. The Strouhal number linked with the vortex shedding frequency was calculated through a function of the Reynolds number. The coefficient of the mean drag force was fitted as a new piecewise function of the Reynolds number, and its amplification resulted from the CF VIV was also taken into account. The oscillating drag and lift forces were modelled with classical van der Pol wake oscillators and their empirical parameters were determined based on the lock-in boundaries and the peak-amplitude formulas. A new peak-amplitude formula for the IL VIV was developed under the resonance condition with respect to the mass-damping ratio and the Reynolds number. When compared with the results from the experiments and some other prediction models, the present model could give good estimations on the vibration amplitudes and frequencies of the VIV both for elastically-mounted rigid and long flexible cylinders. The present model considering the influence of the Reynolds number could generally provide better results than that neglecting the effect of the Reynolds number.

Calculation of midplane dose for total body irradiation from entrance and exit dose MOSFET measurements.

PubMed

Satory, P R

2012-03-01

This work is the development of a MOSFET based surface in vivo dosimetry system for total body irradiation patients treated with bilateral extended SSD beams using PMMA missing tissue compensators adjacent to the patient. An empirical formula to calculate midplane dose from MOSFET measured entrance and exit doses has been derived. The dependency of surface dose on the air-gap between the spoiler and the surface was investigated by suspending a spoiler above a water phantom, and taking percentage depth dose measurements (PDD). Exit and entrances doses were measured with MOSFETs in conjunction with midplane doses measured with an ion chamber. The entrance and exit doses were combined using an exponential attenuation formula to give an estimate of midplane dose and were compared to the midplane ion chamber measurement for a range of phantom thicknesses. Having a maximum PDD at the surface simplifies the prediction of midplane dose, which is achieved by ensuring that the air gap between the compensator and the surface is less than 10 cm. The comparison of estimated midplane dose and measured midplane dose showed no dependence on phantom thickness and an average correction factor of 0.88 was found. If the missing tissue compensators are kept within 10 cm of the patient then MOSFET measurements of entrance and exit dose can predict the midplane dose for the patient.

Breastfeeding duration and early parenting behaviour: the importance of an infant-led, responsive style.

PubMed

Brown, Amy; Arnott, Bronia

2014-01-01

Popular parenting literature promotes different approaches to caring for infants, based around variations in the use of parent-led routines and promoting infant independence. However, there is little empirical evidence of how these early behaviours affect wider parenting choices such as infant feeding. Breastfeeding often requires an infant-led approach, feeding on demand and allowing the infant to regulate intake whilst conversely formula feeding is open to greater caregiver manipulation. The infant-led style associated with breastfeeding may therefore be at odds with philosophies that encourage strict use of routine and independence. The aim of this study was to explore the association between early parenting behaviours and breastfeeding duration. Five hundred and eight mothers with an infant aged 0-12 months completed a questionnaire examining breastfeeding duration, attitudes and behaviours surrounding early parenting (e.g. anxiety, use of routine, involvement, nurturance and discipline). Participants were attendees at baby groups or participants of online parenting forums based in the UK. Formula use at birth or short breastfeeding duration were significantly associated with low levels of nurturance, high levels of reported anxiety and increased maternal use of Parent-led routines. Conversely an infant-led approach characterised by responding to and following infant cues was associated with longer breastfeeding duration. Maternal desire to follow a structured parenting approach which purports use of Parent-led routines and early demands for infant independence may have a negative impact upon breastfeeding duration. Increased maternal anxiety may further influence this relationship. The findings have important implications for Health Professionals supporting new mothers during pregnancy and the postpartum period.

A simple and fast physics-based analytical method to calculate therapeutic and stray doses from external beam, megavoltage x-ray therapy

PubMed Central

Wilson, Lydia J; Newhauser, Wayne D

2015-01-01

State-of-the-art radiotherapy treatment planning systems provide reliable estimates of the therapeutic radiation but are known to underestimate or neglect the stray radiation exposures. Most commonly, stray radiation exposures are reconstructed using empirical formulas or lookup tables. The purpose of this study was to develop the basic physics of a model capable of calculating the total absorbed dose both inside and outside of the therapeutic radiation beam for external beam photon therapy. The model was developed using measurements of total absorbed dose in a water-box phantom from a 6 MV medical linear accelerator to calculate dose profiles in both the in-plane and cross-plane direction for a variety of square field sizes and depths in water. The water-box phantom facilitated development of the basic physical aspects of the model. RMS discrepancies between measured and calculated total absorbed dose values in water were less than 9.3% for all fields studied. Computation times for 10 million dose points within a homogeneous phantom were approximately 4 minutes. These results suggest that the basic physics of the model are sufficiently simple, fast, and accurate to serve as a foundation for a variety of clinical and research applications, some of which may require that the model be extended or simplified based on the needs of the user. A potentially important advantage of a physics-based approach is that the model is more readily adaptable to a wide variety of treatment units and treatment techniques than with empirical models. PMID:26040833

A simple and fast physics-based analytical method to calculate therapeutic and stray doses from external beam, megavoltage x-ray therapy.

PubMed

Jagetic, Lydia J; Newhauser, Wayne D

2015-06-21

State-of-the-art radiotherapy treatment planning systems provide reliable estimates of the therapeutic radiation but are known to underestimate or neglect the stray radiation exposures. Most commonly, stray radiation exposures are reconstructed using empirical formulas or lookup tables. The purpose of this study was to develop the basic physics of a model capable of calculating the total absorbed dose both inside and outside of the therapeutic radiation beam for external beam photon therapy. The model was developed using measurements of total absorbed dose in a water-box phantom from a 6 MV medical linear accelerator to calculate dose profiles in both the in-plane and cross-plane direction for a variety of square field sizes and depths in water. The water-box phantom facilitated development of the basic physical aspects of the model. RMS discrepancies between measured and calculated total absorbed dose values in water were less than 9.3% for all fields studied. Computation times for 10 million dose points within a homogeneous phantom were approximately 4 min. These results suggest that the basic physics of the model are sufficiently simple, fast, and accurate to serve as a foundation for a variety of clinical and research applications, some of which may require that the model be extended or simplified based on the needs of the user. A potentially important advantage of a physics-based approach is that the model is more readily adaptable to a wide variety of treatment units and treatment techniques than with empirical models.

A Comprehensive Physical Impedance Model of Polymer Electrolyte Fuel Cell Cathodes in Oxygen-free Atmosphere.

PubMed

Obermaier, Michael; Bandarenka, Aliaksandr S; Lohri-Tymozhynsky, Cyrill

2018-03-21

Electrochemical impedance spectroscopy (EIS) is an indispensable tool for non-destructive operando characterization of Polymer Electrolyte Fuel Cells (PEFCs). However, in order to interpret the PEFC's impedance response and understand the phenomena revealed by EIS, numerous semi-empirical or purely empirical models are used. In this work, a relatively simple model for PEFC cathode catalyst layers in absence of oxygen has been developed, where all the equivalent circuit parameters have an entire physical meaning. It is based on: (i) experimental quantification of the catalyst layer pore radii, (ii) application of De Levie's analytical formula to calculate the response of a single pore, (iii) approximating the ionomer distribution within every pore, (iv) accounting for the specific adsorption of sulfonate groups and (v) accounting for a small H 2 crossover through ~15 μm ionomer membranes. The derived model has effectively only 6 independent fitting parameters and each of them has clear physical meaning. It was used to investigate the cathode catalyst layer and the double layer capacitance at the interface between the ionomer/membrane and Pt-electrocatalyst. The model has demonstrated excellent results in fitting and interpretation of the impedance data under different relative humidities. A simple script enabling fitting of impedance data is provided as supporting information.

Strong Generative Capacity and the Empirical Base of Linguistic Theory

PubMed Central

Ott, Dennis

2017-01-01

This Perspective traces the evolution of certain central notions in the theory of Generative Grammar (GG). The founding documents of the field suggested a relation between the grammar, construed as recursively enumerating an infinite set of sentences, and the idealized native speaker that was essentially equivalent to the relation between a formal language (a set of well-formed formulas) and an automaton that recognizes strings as belonging to the language or not. But this early view was later abandoned, when the focus of the field shifted to the grammar's strong generative capacity as recursive generation of hierarchically structured objects as opposed to strings. The grammar is now no longer seen as specifying a set of well-formed expressions and in fact necessarily constructs expressions of any degree of intuitive “acceptability.” The field of GG, however, has not sufficiently acknowledged the significance of this shift in perspective, as evidenced by the fact that (informal and experimentally-controlled) observations about string acceptability continue to be treated as bona fide data and generalizations for the theory of GG. The focus on strong generative capacity, it is argued, requires a new discussion of what constitutes valid empirical evidence for GG beyond observations pertaining to weak generation. PMID:28983268

Binomial distribution for quantification of protein subunits in biological Nanoassemblies and functional nanomachines

PubMed Central

Fang, Huaming; Zhang, Peng; Huang, Lisa P.; Zhao, Zhengyi; Pi, Fengmei; Montemagno, Carlo; Guo, Peixuan

2014-01-01

Living systems produce ordered structures and nanomachines that inspire the development of biomimetic nanodevices such as chips, MEMS, actuators, sensors, sorters, and apparatuses for single-pore DNA sequencing, disease diagnosis, drug or therapeutic RNA delivery. Determination of the copy numbers of subunits that build these machines is challenging due to small size. Here we report a simple mathematical method to determine the stoichiometry, using phi29 DNA-packaging nanomotor as a model to elucidate the application of a formula ∑M=0Z(ZM)pZ−MqM, where p and q are the percentage of wild-type and inactive mutant in the empirical assay; M is the copy numbers of mutant and Z is the stoichiometry in question. Variable ratios of mutants and wild-type were mixed to inhibit motor function. Empirical data were plotted over the theoretical curves to determine the stoichiometry and the value of K, which is the number of mutant needed in each machine to block the function, all based on the condition that wild-type and mutant are equal in binding affinity. Both Z and K from 1–12 were investigated. The data precisely confirmed that phi29 motor contains six copies (Z) of the motor ATPase gp16, and K = 1. PMID:24650885

Option pricing: Stock price, stock velocity and the acceleration Lagrangian

NASA Astrophysics Data System (ADS)

Baaquie, Belal E.; Du, Xin; Bhanap, Jitendra

2014-12-01

The industry standard Black-Scholes option pricing formula is based on the current value of the underlying security and other fixed parameters of the model. The Black-Scholes formula, with a fixed volatility, cannot match the market's option price; instead, it has come to be used as a formula for generating the option price, once the so called implied volatility of the option is provided as additional input. The implied volatility not only is an entire surface, depending on the strike price and maturity of the option, but also depends on calendar time, changing from day to day. The point of view adopted in this paper is that the instantaneous rate of return of the security carries part of the information that is provided by implied volatility, and with a few (time-independent) parameters required for a complete pricing formula. An option pricing formula is developed that is based on knowing the value of both the current price and rate of return of the underlying security which in physics is called velocity. Using an acceleration Lagrangian model based on the formalism of quantum mathematics, we derive the pricing formula for European call options. The implied volatility of the market can be generated by our pricing formula. Our option price is applied to foreign exchange rates and equities and the accuracy is compared with Black-Scholes pricing formula and with the market price.

Improvements in the Approximate Formulae for the Period of the Simple Pendulum

ERIC Educational Resources Information Center

Turkyilmazoglu, M.

2010-01-01

This paper is concerned with improvements in some exact formulae for the period of the simple pendulum problem. Two recently presented formulae are re-examined and refined rationally, yielding more accurate approximate periods. Based on the improved expressions here, a particular new formula is proposed for the period. It is shown that the derived…

Formulaic Language and Collocations in German Essays: From Corpus-Driven Data to Corpus-Based Materials

ERIC Educational Resources Information Center

Krummes, Cedric; Ensslin, Astrid

2015-01-01

Whereas there exists a plethora of research on collocations and formulaic language in English, this article contributes towards a somewhat less developed area: the understanding and teaching of formulaic language in German as a foreign language. It analyses formulaic sequences and collocations in German writing (corpus-driven) and provides modern…

30 CFR 560.110 - What bidding systems may BOEM use?

Code of Federal Regulations, 2014 CFR

2014-07-01

... bonus with royalty rate(s) based on formula(s) or schedule(s) during one or more periods of production...-scale formula, which relates the royalty rate to the adjusted value or volume of production, or (ii) A... include the sliding-scale formula or schedule and will specify the lowest and highest royalty rates that...

30 CFR 560.110 - What bidding systems may BOEM use?

Code of Federal Regulations, 2012 CFR

2012-07-01

... bonus with royalty rate(s) based on formula(s) or schedule(s) during one or more periods of production...-scale formula, which relates the royalty rate to the adjusted value or volume of production, or (ii) A... include the sliding-scale formula or schedule and will specify the lowest and highest royalty rates that...

78 FR 19736 - Notice on Reallotment of Workforce Investment Act (WIA) Title I Formula Allotted Funds for...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-04-02

... Dislocated Worker program for one State and distributed by formula to PY 2012 dislocated worker funds for... Investment Act (WIA) Title I Formula Allotted Funds for Dislocated Worker Activities for Program Year (PY... of dislocated worker formula allotted funds based on State financial reports submitted as of the end...

30 CFR 560.110 - What bidding systems may BOEM use?

Code of Federal Regulations, 2013 CFR

2013-07-01

... bonus with royalty rate(s) based on formula(s) or schedule(s) during one or more periods of production...-scale formula, which relates the royalty rate to the adjusted value or volume of production, or (ii) A... include the sliding-scale formula or schedule and will specify the lowest and highest royalty rates that...

Refining the Use of Linkage Disequilibrium as a Robust Signature of Selective Sweeps.

PubMed

Jacobs, Guy S; Sluckin, Tim J; Kivisild, Toomas

2016-08-01

During a selective sweep, characteristic patterns of linkage disequilibrium can arise in the genomic region surrounding a selected locus. These have been used to infer past selective sweeps. However, the recombination rate is known to vary substantially along the genome for many species. We here investigate the effectiveness of current (Kelly's [Formula: see text] and [Formula: see text]) and novel statistics at inferring hard selective sweeps based on linkage disequilibrium distortions under different conditions, including a human-realistic demographic model and recombination rate variation. When the recombination rate is constant, Kelly's [Formula: see text] offers high power, but is outperformed by a novel statistic that we test, which we call [Formula: see text] We also find this statistic to be effective at detecting sweeps from standing variation. When recombination rate fluctuations are included, there is a considerable reduction in power for all linkage disequilibrium-based statistics. However, this can largely be reversed by appropriately controlling for expected linkage disequilibrium using a genetic map. To further test these different methods, we perform selection scans on well-characterized HapMap data, finding that all three statistics-[Formula: see text] Kelly's [Formula: see text] and [Formula: see text]-are able to replicate signals at regions previously identified as selection candidates based on population differentiation or the site frequency spectrum. While [Formula: see text] replicates most candidates when recombination map data are not available, the [Formula: see text] and [Formula: see text] statistics are more successful when recombination rate variation is controlled for. Given both this and their higher power in simulations of selective sweeps, these statistics are preferred when information on local recombination rate variation is available. Copyright © 2016 by the Genetics Society of America.

Effects of neurological damage on production of formulaic language

PubMed Central

Sidtis, D.; Canterucci, G.; Katsnelson, D.

2014-01-01

Early studies reported preserved formulaic language in left hemisphere damaged subjects and reduced incidence of formulaic expressions in the conversational speech of stroke patients with right hemispheric damage. Clinical observations suggest a possible role also of subcortical nuclei. This study examined formulaic language in the spontaneous speech of stroke patients with left, right, or subcortical damage. Four subjects were interviewed and their speech samples compared to normal speakers. Raters classified formulaic expressions as speech formulae, fillers, sentence stems, and proper nouns. Results demonstrated that brain damage affected novel and formulaic language competence differently, with a significantly smaller proportion of formulaic expressions in subjects with right or subcortical damage compared to left hemisphere damaged or healthy speakers. These findings converge with previous studies that support the proposal of a right hemisphere/subcortical circuit in the management of formulaic expressions, based on a dual-process model of language incorporating novel and formulaic language use. PMID:19382014

Accuracy-preserving source term quadrature for third-order edge-based discretization

NASA Astrophysics Data System (ADS)

Nishikawa, Hiroaki; Liu, Yi

2017-09-01

In this paper, we derive a family of source term quadrature formulas for preserving third-order accuracy of the node-centered edge-based discretization for conservation laws with source terms on arbitrary simplex grids. A three-parameter family of source term quadrature formulas is derived, and as a subset, a one-parameter family of economical formulas is identified that does not require second derivatives of the source term. Among the economical formulas, a unique formula is then derived that does not require gradients of the source term at neighbor nodes, thus leading to a significantly smaller discretization stencil for source terms. All the formulas derived in this paper do not require a boundary closure, and therefore can be directly applied at boundary nodes. Numerical results are presented to demonstrate third-order accuracy at interior and boundary nodes for one-dimensional grids and linear triangular/tetrahedral grids over straight and curved geometries.

Review of Infant Feeding: Key Features of Breast Milk and Infant Formula

PubMed Central

Martin, Camilia R.; Ling, Pei-Ra; Blackburn, George L.

2016-01-01

Mothers’ own milk is the best source of nutrition for nearly all infants. Beyond somatic growth, breast milk as a biologic fluid has a variety of other benefits, including modulation of postnatal intestinal function, immune ontogeny, and brain development. Although breastfeeding is highly recommended, breastfeeding may not always be possible, suitable or solely adequate. Infant formula is an industrially produced substitute for infant consumption. Infant formula attempts to mimic the nutritional composition of breast milk as closely as possible, and is based on cow’s milk or soymilk. A number of alternatives to cow’s milk-based formula also exist. In this article, we review the nutritional information of breast milk and infant formulas for better understanding of the importance of breastfeeding and the uses of infant formula from birth to 12 months of age when a substitute form of nutrition is required. PMID:27187450

Randomized Trial of a Yogurt-type Amino Acid-based Formula in Infants and Children With Severe Cow's Milk Allergy.

PubMed

Payot, François; Lachaux, Alain; Lalanne, Florent; Kalach, Nicolas

2018-01-01

Evaluation of a spoon-fed amino acid-based formula (AAF) with a yogurt-type texture compared to the reference oral liquid formula (Neocate). Phase III/IV, prospective, randomized (1:1), open-label, multicenter study in infants/young children (6-36 months) with severe cow's milk protein allergy (CMA) who had consumed AAF for ≥1 month before the study. Patients received reference+test formula (Neocate with a yogurt-type texture for spoon-feeding: group 1) or reference formula (group 2) for 28 days. The study formulae were integrated into the patients' usual daily diet. Efficacy on Day 0, 14, and 28 was assessed primarily in terms of symptoms associated with CMA. The evolution of symptoms, amount of formula consumed, nutritional and energy intake, anthropometric data, and tolerability were also assessed. The incidence of CMA symptoms was similar in each group (P > 0.05) on day 0, 14, and 28. For specific symptoms, there was little change from day 0 and no significant difference between groups for incidence on day 0 or evolution at day 14 or 28. There was no difference in formula consumption (day 0-day 28) between groups (P = 0.90), but nutritional value was generally higher for group 1 and calcium intake was statistically higher for group 1 (P < 0.05). Weight-for-height, weight-for age, and body mass index-for-age z scores were higher for group 1 than group 2 (P < 0.05). Both formulae were well tolerated. There was no difference in efficacy, formula consumption, and tolerability between the new spoon-fed yogurt-type AAF formula and the reference formula, whereas significantly higher calcium intake was achieved with the new formula.

[Formula: see text]-convergence, complete convergence, and weak laws of large numbers for asymptotically negatively associated random vectors with values in [Formula: see text].

PubMed

Ko, Mi-Hwa

2018-01-01

In this paper, based on the Rosenthal-type inequality for asymptotically negatively associated random vectors with values in [Formula: see text], we establish results on [Formula: see text]-convergence and complete convergence of the maximums of partial sums are established. We also obtain weak laws of large numbers for coordinatewise asymptotically negatively associated random vectors with values in [Formula: see text].

Fluid mechanics of Windkessel effect.

PubMed

Mei, C C; Zhang, J; Jing, H X

2018-01-08

We describe a mechanistic model of Windkessel phenomenon based on the linear dynamics of fluid-structure interactions. The phenomenon has its origin in an old-fashioned fire-fighting equipment where an air chamber serves to transform the intermittent influx from a pump to a more steady stream out of the hose. A similar mechanism exists in the cardiovascular system where blood injected intermittantly from the heart becomes rather smooth after passing through an elastic aorta. In existing haeodynamics literature, this mechanism is explained on the basis of electric circuit analogy with empirical impedances. We present a mechanistic theory based on the principles of fluid/structure interactions. Using a simple one-dimensional model, wave motion in the elastic aorta is coupled to the viscous flow in the rigid peripheral artery. Explicit formulas are derived that exhibit the role of material properties such as the blood density, viscosity, wall elasticity, and radii and lengths of the vessels. The current two-element model in haemodynamics is shown to be the limit of short aorta and low injection frequency and the impedance coefficients are derived theoretically. Numerical results for different aorta lengths and radii are discussed to demonstrate their effects on the time variations of blood pressure, wall shear stress, and discharge. Graphical Abstract A mechanistic analysis of Windkessel Effect is described which confirms theoretically the well-known feature that intermittent influx becomes continuous outflow. The theory depends only on the density and viscosity of the blood, the elasticity and dimensions of the vessel. Empirical impedence parameters are avoided.

Sensing sheet: the response of full-bridge strain sensors to thermal variations for detecting and characterizing cracks

NASA Astrophysics Data System (ADS)

Tung, S.-T.; Glisic, B.

2016-12-01

Sensing sheets based on large-area electronics consist of a dense array of unit strain sensors. This new technology has potential for becoming an effective and affordable monitoring tool that can identify, localize and quantify surface damage in structures. This research contributes to their development by investigating the response of full-bridge unit strain sensors to thermal variations. Overall, this investigation quantifies the effects of temperature on thin-film full-bridge strain sensors monitoring uncracked and cracked concrete. Additionally, an empirical formula is developed to estimate crack width given an observed strain change and a measured temperature change. This research led to the understanding of the behavior of full-bridge strain sensors installed on cracked concrete and exposed to temperature variations. It proves the concept of the sensing sheet and its suitability for application in environments with variable temperature.

An oilspill trajectory analysis model with a variable wind deflection angle

USGS Publications Warehouse

Samuels, W.B.; Huang, N.E.; Amstutz, D.E.

1982-01-01

The oilspill trajectory movement algorithm consists of a vector sum of the surface drift component due to wind and the surface current component. In the U.S. Geological Survey oilspill trajectory analysis model, the surface drift component is assumed to be 3.5% of the wind speed and is rotated 20 degrees clockwise to account for Coriolis effects in the Northern Hemisphere. Field and laboratory data suggest, however, that the deflection angle of the surface drift current can be highly variable. An empirical formula, based on field observations and theoretical arguments relating wind speed to deflection angle, was used to calculate a new deflection angle at each time step in the model. Comparisons of oilspill contact probabilities to coastal areas calculated for constant and variable deflection angles showed that the model is insensitive to this changing angle at low wind speeds. At high wind speeds, some statistically significant differences in contact probabilities did appear. ?? 1982.

A Simple and Reliable Method of Design for Standalone Photovoltaic Systems

NASA Astrophysics Data System (ADS)

Srinivasarao, Mantri; Sudha, K. Rama; Bhanu, C. V. K.

2017-06-01

Standalone photovoltaic (SAPV) systems are seen as a promoting method of electrifying areas of developing world that lack power grid infrastructure. Proliferations of these systems require a design procedure that is simple, reliable and exhibit good performance over its life time. The proposed methodology uses simple empirical formulae and easily available parameters to design SAPV systems, that is, array size with energy storage. After arriving at the different array size (area), performance curves are obtained for optimal design of SAPV system with high amount of reliability in terms of autonomy at a specified value of loss of load probability (LOLP). Based on the array to load ratio (ALR) and levelized energy cost (LEC) through life cycle cost (LCC) analysis, it is shown that the proposed methodology gives better performance, requires simple data and is more reliable when compared with conventional design using monthly average daily load and insolation.

Contribution of explosion and future collision fragments to the orbital debris environment

NASA Technical Reports Server (NTRS)

Su, S.-Y.; Kessler, D. J.

1985-01-01

The time evolution of the near-earth man-made orbital debris environment modeled by numerical simulation is presented in this paper. The model starts with a data base of orbital debris objects which are tracked by the NORAD ground radar system. The current untrackable small objects are assumed to result from explosions and are predicted from data collected from a ground explosion experiment. Future collisions between earth orbiting objects are handled by the Monte Carlo method to simulate the range of collision possibilities that may occur in the real world. The collision fragmentation process between debris objects is calculated using an empirical formula derived from a laboratory spacecraft impact experiment to obtain the number versus size distribution of the newly generated debris population. The evolution of the future space debris environment is compared with the natural meteoroid background for the relative spacecraft penetration hazard.

Influence of humidity on the characteristics of negative corona discharge in air

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Pengfei, E-mail: xpftsh@126.com; Zhang, Bo, E-mail: shizbcn@mail.tsinghua.edu.cn; He, Jinliang, E-mail: hejl@tsinghua.edu.cn

Detailed negative corona discharge characteristics, such as the pulse amplitude, repetition frequency, average corona current, rise time, and half-wave time, are systematically studied under various air humidities with a single artificial defect electrode. The experimental result reveals that the pulse amplitude increases with the increase of air humidity; meanwhile, the repetition frequency deceases as the air humidity increases. Empirical formulae are first established for the pulse amplitude and repetition frequency with the humidity factor taken into consideration. The effective ionization integral is calculated and a positive correlation is found between the integral and the pulse amplitude. Furthermore, a simplified negative-ionmore » cloud model is built up to investigate the mechanism of the humidity's influence on negative corona discharge. Based on the theoretical analyses, the correlation between pulse amplitude, repetition frequency, and air humidity is well explained.« less

Optimizing Decision Preparedness by Adapting Scenario Complexity and Automating Scenario Generation

NASA Technical Reports Server (NTRS)

Dunne, Rob; Schatz, Sae; Flore, Stephen M.; Nicholson, Denise

2011-01-01

Klein's recognition-primed decision (RPD) framework proposes that experts make decisions by recognizing similarities between current decision situations and previous decision experiences. Unfortunately, military personnel arQ often presented with situations that they have not experienced before. Scenario-based training (S8T) can help mitigate this gap. However, SBT remains a challenging and inefficient training approach. To address these limitations, the authors present an innovative formulation of scenario complexity that contributes to the larger research goal of developing an automated scenario generation system. This system will enable trainees to effectively advance through a variety of increasingly complex decision situations and experiences. By adapting scenario complexities and automating generation, trainees will be provided with a greater variety of appropriately calibrated training events, thus broadening their repositories of experience. Preliminary results from empirical testing (N=24) of the proof-of-concept formula are presented, and future avenues of scenario complexity research are also discussed.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Capone, D.G.; Penhale, P.A.; Oremland, R.S.

N/sub 2/ (C/sub 2/H/sub 2/) fixation and primary production were measured in communities of Thalassia testudinum at two sites in Bimini Harbor (Bahamas). Production was determined by uptake of (/sup 14/C)NaHCO/sub 3/, by leaf growth measurements, and by applying an empirical formula based on leaf dimensions. The last two methods gave similar results but the /sup 14/C method gave higher values. Anaerobic sediment N/sub 2/ fixation supplied about 1/4 to 1/2 of the nitrogen demand for leaf production (by leaf growth method) and there was a significant correlation between N/sub 2/ fixation and CO/sub 2/ fixation rates when all componentsmore » of the communities were considered (macrophyte, phyllosphere epiphytes, and detrital leaves). N/sub 2/ fixation is important to production in Thalassia communities and the plant and its leaf epiphytes may be distinct entities in terms of nitrogen and carbon metabolism.« less

Two accounts of the colonised "other" in South Asia re-exploring alterity.

PubMed

Mukherjee, Soumen

2010-01-01

Taking examples from South Asia, this article shows how British colonial knowledge about the non-European "other" hinged substantially on the participation of sections of that other, especially in the context of liminal groups, for whom no ready standardised formula of identification was available. Development of a colonial episteme often involved active intervention from the colonised body, thereby dispelling any strict notion of coloniser-colonised alterity and mere top-down governance. This process of identity construction took place in several arenas and also involved negotiations in courts of law, where rival sections of the amorphous colonised body fought for competing ideals of selfhood. Complementing this legal construction were ethnographic formulations, internally diverse, and often relating to broader politico-intellectual concerns and debates of the Empire, at different planes in different ways. The article explicates their theoretical bases and practical modalities.

How are population-based funding formulae for healthcare composed? A comparative analysis of seven models.

PubMed

Penno, Erin; Gauld, Robin; Audas, Rick

2013-11-08

Population-based funding formulae act as an important means of promoting equitable health funding structures. To evaluate how policy makers in different jurisdictions construct health funding formulae and build an understanding of contextual influences underpinning formula construction we carried out a comparative analysis of key components of funding formulae across seven high-income and predominantly publically financed health systems: New Zealand, England, Scotland, the Netherlands, the state of New South Wales in Australia, the Canadian province of Ontario, and the city of Stockholm, Sweden. Core components from each formula were summarised and key similarities and differences evaluated from a compositional perspective. We categorised approaches to constructing funding formulae under three main themes: identifying factors which predict differential need amongst populations; adjusting for cost factors outside of needs factors; and engaging in normative correction of allocations for 'unmet' need. We found significant congruence in the factors used to guide need and cost adjustments. However, there is considerable variation in interpretation and implementation of these factors. Despite broadly similar frameworks, there are distinct differences in the composition of the formulae across the seven health systems. Ultimately, the development of funding formulae is a dynamic process, subject to availability of data reflecting health needs, the influence of wider socio-political objectives and health system determinants.

Estimating Glenoid Width for Instability-Related Bone Loss: A CT Evaluation of an MRI Formula.

PubMed

Giles, Joshua W; Owens, Brett D; Athwal, George S

2015-07-01

Determining the magnitude of glenoid bone loss in cases of shoulder instability is an important step in selecting the optimal reconstructive procedure. Recently, a formula has been proposed that estimates native glenoid width based on magnetic resonance imaging (MRI) measurements of height (1/3 × glenoid height + 15 mm). This technique, however, has not been validated for use with computed tomography (CT), which is often the preferred imaging modality to assess bone deficiencies. The purpose of this project was 2-fold: (1) to determine if the MRI-based formula that predicts glenoid width from height is valid with CT and (2) to determine if a more accurate regression can be resolved for use specifically with CT data. Descriptive laboratory study. Ninety normal shoulder CT scans with preserved osseous anatomy were drawn from an existing database and analyzed. Measurements of glenoid height and width were performed by 2 observers on reconstructed 3-dimensional models. After assessment of reliability, the data were correlated, and regression models were created for male and female shoulders. The accuracy of the MRI-based model's predictions was then compared with that of the CT-based models. Intra- and interrater reliabilities were good to excellent for height and width, with intraclass correlation coefficients of 0.765 to 0.992. The height and width values had a strong correlation of 0.900 (P < .001). Regression analyses for male and female shoulders produced CT-specific formulas: for men, glenoid width = 2/3 × glenoid height + 5 mm; for women, glenoid width = 2/3 × glenoid height + 3 mm. Comparison of predictions from the MRI- and CT-specific formulas demonstrated good agreement (intraclass correlation coefficient = 0.818). The CT-specific formulas produced a root mean squared error of 1.2 mm, whereas application of the MRI-specific formula to CT images resulted in a root mean squared error of 1.5 mm. Use of the MRI-based formula on CT scans to predict glenoid width produced estimates that were nearly as accurate as the CT-specific formulas. The CT-specific formulas, however, are more accurate at predicting native glenoid width when applied to CT data. Imaging-specific (CT and MRI) formulas have been developed to estimate glenoid bone loss in patients with instability. The CT-specific formula can accurately predict native glenoid width, having an error of only 2.2% of average glenoid width. © 2015 The Author(s).

Gravitational birefringence and an exotic formula for redshifts

NASA Astrophysics Data System (ADS)

Duval, Christian; Pasquet, Johanna; Schücker, Thomas; Tilquin, André

2018-06-01

We compute the birefringence of light in curved Robertson-Walker spacetimes and propose an exotic formula for redshift based on the internal structure of the spinning photon. We then use the Hubble diagram of supernovae to test this formula.

Replication Research in Pedagogical Approaches to Formulaic Sequences: Jones & Haywood (2004) and Alali & Schmitt (2012)

ERIC Educational Resources Information Center

Coxhead, Averil

2018-01-01

Research into the formulaic nature of language has grown in size and scale in the last 20 years or more, much of it based in corpus studies and involving the identification and categorisation of formulas. Research suggests that there are benefits for second and foreign language learners recognising formulaic sequences when listening and reading,…

Measurement of the muon reconstruction performance of the ATLAS detector using 2011 and 2012 LHC proton-proton collision data.

PubMed

Aad, G; Abbott, B; Abdallah, J; Abdel Khalek, S; Abdinov, O; Aben, R; Abi, B; Abolins, M; AbouZeid, O S; Abramowicz, H; Abreu, H; Abreu, R; Abulaiti, Y; Acharya, B S; Adamczyk, L; Adams, D L; Adelman, J; Adomeit, S; Adye, T; Agatonovic-Jovin, T; Aguilar-Saavedra, J A; Agustoni, M; Ahlen, S P; Ahmadov, F; Aielli, G; Akerstedt, H; Åkesson, T P A; Akimoto, G; Akimov, A V; Alberghi, G L; Albert, J; Albrand, S; Alconada Verzini, M J; Aleksa, M; Aleksandrov, I N; Alexa, C; Alexander, G; Alexandre, G; Alexopoulos, T; Alhroob, M; Alimonti, G; Alio, L; Alison, J; Allbrooke, B M M; Allison, L J; Allport, P P; Almond, J; Aloisio, A; Alonso, A; Alonso, F; Alpigiani, C; Altheimer, A; Alvarez Gonzalez, B; Alviggi, M G; Amako, K; Amaral Coutinho, Y; Amelung, C; Amidei, D; Amor Dos Santos, S P; Amorim, A; Amoroso, S; Amram, N; Amundsen, G; Anastopoulos, C; Ancu, L S; Andari, N; Andeen, T; Anders, C F; Anders, G; Anderson, K J; Andreazza, A; Andrei, V; Anduaga, X S; Angelidakis, S; Angelozzi, I; Anger, P; Angerami, A; Anghinolfi, F; Anisenkov, A V; Anjos, N; Annovi, A; Antonaki, A; Antonelli, M; Antonov, A; Antos, J; Anulli, F; Aoki, M; Aperio Bella, L; Apolle, R; Arabidze, G; Aracena, I; Arai, Y; Araque, J P; Arce, A T H; Arguin, J-F; Argyropoulos, S; Arik, M; Armbruster, A J; Arnaez, O; Arnal, V; Arnold, H; Arratia, M; Arslan, O; Artamonov, A; Artoni, G; Asai, S; Asbah, N; Ashkenazi, A; Åsman, B; Asquith, L; Assamagan, K; Astalos, R; Atkinson, M; Atlay, N B; Auerbach, B; Augsten, K; Aurousseau, M; Avolio, G; Azuelos, G; Azuma, Y; Baak, M A; Baas, A; Bacci, C; Bachacou, H; Bachas, K; Backes, M; Backhaus, M; Backus Mayes, J; Badescu, E; Bagiacchi, P; Bagnaia, P; Bai, Y; Bain, T; Baines, J T; Baker, O K; Balek, P; Balli, F; Banas, E; Banerjee, Sw; Bannoura, A A E; Bansal, V; Bansil, H S; Barak, L; Baranov, S P; Barberio, E L; Barberis, D; Barbero, M; Barillari, T; Barisonzi, M; Barklow, T; Barlow, N; Barnett, B M; Barnett, R M; Barnovska, Z; Baroncelli, A; Barone, G; Barr, A J; Barreiro, F; Barreiro Guimarães da Costa, J; Bartoldus, R; Barton, A E; Bartos, P; Bartsch, V; Bassalat, A; Basye, A; Bates, R L; Batley, J R; Battaglia, M; Battistin, M; Bauer, F; Bawa, H S; Beattie, M D; Beau, T; Beauchemin, P H; Beccherle, R; Bechtle, P; Beck, H P; Becker, K; Becker, S; Beckingham, M; Becot, C; Beddall, A J; Beddall, A; Bedikian, S; Bednyakov, V A; Bee, C P; Beemster, L J; Beermann, T A; Begel, M; Behr, K; Belanger-Champagne, C; Bell, P J; Bell, W H; Bella, G; Bellagamba, L; Bellerive, A; Bellomo, M; Belotskiy, K; Beltramello, O; Benary, O; Benchekroun, D; Bendtz, K; Benekos, N; Benhammou, Y; Benhar Noccioli, E; Benitez Garcia, J A; Benjamin, D P; Bensinger, J R; Benslama, K; Bentvelsen, S; Berge, D; Bergeaas Kuutmann, E; Berger, N; Berghaus, F; Beringer, J; Bernard, C; Bernat, P; Bernius, C; Bernlochner, F U; Berry, T; Berta, P; Bertella, C; Bertoli, G; Bertolucci, F; Bertsche, C; Bertsche, D; Bessner, M; Besana, M I; Besjes, G J; Bessidskaia, O; Besson, N; Betancourt, C; Bethke, S; Bhimji, W; Bianchi, R M; Bianchini, L; Bianco, M; Biebel, O; Bieniek, S P; Bierwagen, K; Biesiada, J; Biglietti, M; Bilbao De Mendizabal, J; Bilokon, H; Bindi, M; Binet, S; Bingul, A; Bini, C; Black, C W; Black, J E; Black, K M; Blackburn, D; Blair, R E; Blanchard, J-B; Blazek, T; Bloch, I; Blocker, C; Blum, W; Blumenschein, U; Bobbink, G J; Bobrovnikov, V S; Bocchetta, S S; Bocci, A; Bock, C; Boddy, C R; Boehler, M; Boek, T T; Bogaerts, J A; Bogdanchikov, A G; Bogouch, A; Bohm, C; Bohm, J; Boisvert, V; Bold, T; Boldea, V; Boldyrev, A S; Bomben, M; Bona, M; Boonekamp, M; Borisov, A; Borissov, G; Borri, M; Borroni, S; Bortfeldt, J; Bortolotto, V; Bos, K; Boscherini, D; Bosman, M; Boterenbrood, H; Boudreau, J; Bouffard, J; Bouhova-Thacker, E V; Boumediene, D; Bourdarios, C; Bousson, N; Boutouil, S; Boveia, A; Boyd, J; Boyko, I R; Bracinik, J; Brandt, A; Brandt, G; Brandt, O; Bratzler, U; Brau, B; Brau, J E; Braun, H M; Brazzale, S F; Brelier, B; Brendlinger, K; Brennan, A J; Brenner, R; Bressler, S; Bristow, K; Bristow, T M; Britton, D; Brochu, F M; Brock, I; Brock, R; Bromberg, C; Bronner, J; Brooijmans, G; Brooks, T; Brooks, W K; Brosamer, J; Brost, E; Brown, J; Bruckman de Renstrom, P A; Bruncko, D; Bruneliere, R; Brunet, S; Bruni, A; Bruni, G; Bruschi, M; Bryngemark, L; Buanes, T; Buat, Q; Bucci, F; Buchholz, P; Buckingham, R M; Buckley, A G; Buda, S I; Budagov, I A; Buehrer, F; Bugge, L; Bugge, M K; Bulekov, O; Bundock, A C; Burckhart, H; Burdin, S; Burghgrave, B; Burke, S; Burmeister, I; Busato, E; Büscher, D; Büscher, V; Bussey, P; Buszello, C P; Butler, B; Butler, J M; Butt, A I; Buttar, C M; Butterworth, J M; Butti, P; Buttinger, W; Buzatu, A; Byszewski, M; Cabrera Urbán, S; Caforio, D; Cakir, O; Calafiura, P; Calandri, A; Calderini, G; Calfayan, P; Calkins, R; Caloba, L P; Calvet, D; Calvet, S; Camacho Toro, R; Camarda, S; Cameron, D; Caminada, L M; Caminal Armadans, R; Campana, S; Campanelli, M; Campoverde, A; Canale, V; Canepa, A; Cano Bret, M; Cantero, J; Cantrill, R; Cao, T; Capeans Garrido, M D M; Caprini, I; Caprini, M; Capua, M; Caputo, R; Cardarelli, R; Carli, T; Carlino, G; Carminati, L; Caron, S; Carquin, E; Carrillo-Montoya, G D; Carter, J R; Carvalho, J; Casadei, D; Casado, M P; Casolino, M; Castaneda-Miranda, E; Castelli, A; Castillo Gimenez, V; Castro, N F; Catastini, P; Catinaccio, A; Catmore, J R; Cattai, A; Cattani, G; Caughron, S; Cavaliere, V; Cavalli, D; Cavalli-Sforza, M; Cavasinni, V; Ceradini, F; Cerio, B; Cerny, K; Cerqueira, A S; Cerri, A; Cerrito, L; Cerutti, F; Cerv, M; Cervelli, A; Cetin, S A; Chafaq, A; Chakraborty, D; Chalupkova, I; Chang, P; Chapleau, B; Chapman, J D; Charfeddine, D; Charlton, D G; Chau, C C; Chavez Barajas, C A; Cheatham, S; Chegwidden, A; Chekanov, S; Chekulaev, S V; Chelkov, G A; Chelstowska, M A; Chen, C; Chen, H; Chen, K; Chen, L; Chen, S; Chen, X; Chen, Y; Chen, Y; Cheng, H C; Cheng, Y; Cheplakov, A; Cherkaoui El Moursli, R; Chernyatin, V; Cheu, E; Chevalier, L; Chiarella, V; Chiefari, G; Childers, J T; Chilingarov, A; Chiodini, G; Chisholm, A S; Chislett, R T; Chitan, A; Chizhov, M V; Chouridou, S; Chow, B K B; Chromek-Burckhart, D; Chu, M L; Chudoba, J; Chwastowski, J J; Chytka, L; Ciapetti, G; Ciftci, A K; Ciftci, R; Cinca, D; Cindro, V; Ciocio, A; Cirkovic, P; Citron, Z H; Citterio, M; Ciubancan, M; Clark, A; Clark, P J; Clarke, R N; Cleland, W; Clemens, J C; Clement, C; Coadou, Y; Cobal, M; Coccaro, A; Cochran, J; Coffey, L; Cogan, J G; Coggeshall, J; Cole, B; Cole, S; Colijn, A P; Collot, J; Colombo, T; Colon, G; Compostella, G; Conde Muiño, P; Coniavitis, E; Conidi, M C; Connell, S H; Connelly, I A; Consonni, S M; Consorti, V; Constantinescu, S; Conta, C; Conti, G; Conventi, F; Cooke, M; Cooper, B D; Cooper-Sarkar, A M; Cooper-Smith, N J; Copic, K; Cornelissen, T; Corradi, M; Corriveau, F; Corso-Radu, A; Cortes-Gonzalez, A; Cortiana, G; Costa, G; Costa, M J; Costanzo, D; Côté, D; Cottin, G; Cowan, G; Cox, B E; Cranmer, K; Cree, G; Crépé-Renaudin, S; Crescioli, F; Cribbs, W A; Crispin Ortuzar, M; Cristinziani, M; Croft, V; Crosetti, G; Cuciuc, C-M; Cuhadar Donszelmann, T; Cummings, J; Curatolo, M; Cuthbert, C; Czirr, H; Czodrowski, P; Czyczula, Z; D'Auria, S; D'Onofrio, M; Cunha Sargedas De Sousa, M J Da; Via, C Da; Dabrowski, W; Dafinca, A; Dai, T; Dale, O; Dallaire, F; Dallapiccola, C; Dam, M; Daniells, A C; Dano Hoffmann, M; Dao, V; Darbo, G; Darmora, S; Dassoulas, J A; Dattagupta, A; Davey, W; David, C; Davidek, T; Davies, E; Davies, M; Davignon, O; Davison, A R; Davison, P; Davygora, Y; Dawe, E; Dawson, I; Daya-Ishmukhametova, R K; De, K; de Asmundis, R; De Castro, S; De Cecco, S; De Groot, N; de Jong, P; De la Torre, H; De Lorenzi, F; De Nooij, L; De Pedis, D; De Salvo, A; De Sanctis, U; De Santo, A; De Vivie De Regie, J B; Dearnaley, W J; Debbe, R; Debenedetti, C; Dechenaux, B; Dedovich, D V; Deigaard, I; Del Peso, J; Del Prete, T; Deliot, F; Delitzsch, C M; Deliyergiyev, M; Dell'Acqua, A; Dell'Asta, L; Dell'Orso, M; Della Pietra, M; Della Volpe, D; Delmastro, M; Delsart, P A; Deluca, C; Demers, S; Demichev, M; Demilly, A; Denisov, S P; Derendarz, D; Derkaoui, J E; Derue, F; Dervan, P; Desch, K; Deterre, C; Deviveiros, P O; Dewhurst, A; Dhaliwal, S; Di Ciaccio, A; Di Ciaccio, L; Di Domenico, A; Di Donato, C; Di Girolamo, A; Di Girolamo, B; Di Mattia, A; Di Micco, B; Di Nardo, R; Di Simone, A; Di Sipio, R; Di Valentino, D; Dias, F A; Diaz, M A; Diehl, E B; Dietrich, J; Dietzsch, T A; Diglio, S; Dimitrievska, A; Dingfelder, J; Dionisi, C; Dita, P; Dita, S; Dittus, F; Djama, F; Djobava, T; do Vale, M A B; Do Valle Wemans, A; Doan, T K O; Dobos, D; Doglioni, C; Doherty, T; Dohmae, T; Dolejsi, J; Dolezal, Z; Dolgoshein, B A; Donadelli, M; Donati, S; Dondero, P; Donini, J; Dopke, J; Doria, A; Dova, M T; Doyle, A T; Dris, M; Dubbert, J; Dube, S; Dubreuil, E; Duchovni, E; Duckeck, G; Ducu, O A; Duda, D; Dudarev, A; Dudziak, F; Duflot, L; Duguid, L; Dührssen, M; Dunford, M; Duran Yildiz, H; Düren, M; Durglishvili, A; Dwuznik, M; Dyndal, M; Ebke, J; Edson, W; Edwards, N C; Ehrenfeld, W; Eifert, T; Eigen, G; Einsweiler, K; Ekelof, T; El Kacimi, M; Ellert, M; Elles, S; Ellinghaus, F; Ellis, N; Elmsheuser, J; Elsing, M; Emeliyanov, D; Enari, Y; Endner, O C; Endo, M; Engelmann, R; Erdmann, J; Ereditato, A; Eriksson, D; Ernis, G; Ernst, J; Ernst, M; Ernwein, J; Errede, D; Errede, S; Ertel, E; Escalier, M; Esch, H; Escobar, C; Esposito, B; Etienvre, A I; Etzion, E; Evans, H; Ezhilov, A; Fabbri, L; Facini, G; Fakhrutdinov, R M; Falciano, S; Falla, R J; Faltova, J; Fang, Y; Fanti, M; Farbin, A; Farilla, A; Farooque, T; Farrell, S; Farrington, S M; Farthouat, P; Fassi, F; Fassnacht, P; Fassouliotis, D; Favareto, A; Fayard, L; Federic, P; Fedin, O L; Fedorko, W; Fehling-Kaschek, M; Feigl, S; Feligioni, L; Feng, C; Feng, E J; Feng, H; Fenyuk, A B; Fernandez Perez, S; Ferrag, S; Ferrando, J; Ferrari, A; Ferrari, P; Ferrari, R; Ferreira de Lima, D E; Ferrer, A; Ferrere, D; Ferretti, C; Ferretto Parodi, A; Fiascaris, M; Fiedler, F; Filipčič, A; Filipuzzi, M; Filthaut, F; Fincke-Keeler, M; Finelli, K D; Fiolhais, M C N; Fiorini, L; Firan, A; Fischer, A; Fischer, J; Fisher, W C; Fitzgerald, E A; Flechl, M; Fleck, I; Fleischmann, P; Fleischmann, S; Fletcher, G T; Fletcher, G; Flick, T; Floderus, A; Flores Castillo, L R; Florez Bustos, A C; Flowerdew, M J; Formica, A; Forti, A; Fortin, D; Fournier, D; Fox, H; Fracchia, S; Francavilla, P; Franchini, M; Franchino, S; Francis, D; Franconi, L; Franklin, M; Franz, S; Fraternali, M; French, S T; Friedrich, C; Friedrich, F; Froidevaux, D; Frost, J A; Fukunaga, C; Fullana Torregrosa, E; Fulsom, B G; Fuster, J; Gabaldon, C; Gabizon, O; Gabrielli, A; Gabrielli, A; Gadatsch, S; Gadomski, S; Gagliardi, G; Gagnon, P; Galea, C; Galhardo, B; Gallas, E J; Gallo, V; Gallop, B J; Gallus, P; Galster, G; Gan, K K; Gao, J; Gao, Y S; Garay Walls, F M; Garberson, F; García, C; García Navarro, J E; Garcia-Sciveres, M; Gardner, R W; Garelli, N; Garonne, V; Gatti, C; Gaudio, G; Gaur, B; Gauthier, L; Gauzzi, P; Gavrilenko, I L; Gay, C; Gaycken, G; Gazis, E N; Ge, P; Gecse, Z; Gee, C N P; Geerts, D A A; Geich-Gimbel, Ch; Gellerstedt, K; Gemme, C; Gemmell, A; Genest, M H; Gentile, S; George, M; George, S; Gerbaudo, D; Gershon, A; Ghazlane, H; Ghodbane, N; Giacobbe, B; Giagu, S; Giangiobbe, V; Giannetti, P; Gianotti, F; Gibbard, B; Gibson, S M; Gilchriese, M; Gillam, T P S; Gillberg, D; Gilles, G; Gingrich, D M; Giokaris, N; Giordani, M P; Giordano, R; Giorgi, F M; Giorgi, F M; Giraud, P F; Giugni, D; Giuliani, C; Giulini, M; Gjelsten, B K; Gkaitatzis, S; Gkialas, I; Gladilin, L K; Glasman, C; Glatzer, J; Glaysher, P C F; Glazov, A; Glonti, G L; Goblirsch-Kolb, M; Goddard, J R; Godfrey, J; Godlewski, J; Goeringer, C; Goldfarb, S; Golling, T; Golubkov, D; Gomes, A; Gomez Fajardo, L S; Gonçalo, R; Goncalves Pinto Firmino Da Costa, J; Gonella, L; González de la Hoz, S; Gonzalez Parra, G; Gonzalez-Sevilla, S; Goossens, L; Gorbounov, P A; Gordon, H A; Gorelov, I; Gorini, B; Gorini, E; Gorišek, A; Gornicki, E; Goshaw, A T; Gössling, C; Gostkin, M I; Gouighri, M; Goujdami, D; Goulette, M P; Goussiou, A G; Goy, C; Gozpinar, S; Grabas, H M X; Graber, L; Grabowska-Bold, I; Grafström, P; Grahn, K-J; Gramling, J; Gramstad, E; Grancagnolo, S; Grassi, V; Gratchev, V; Gray, H M; Graziani, E; Grebenyuk, O G; Greenwood, Z D; Gregersen, K; Gregor, I M; Grenier, P; Griffiths, J; Grillo, A A; Grimm, K; Grinstein, S; Gris, Ph; Grishkevich, Y V; Grivaz, J-F; Grohs, J P; Grohsjean, A; Gross, E; Grosse-Knetter, J; Grossi, G C; Groth-Jensen, J; Grout, Z J; Guan, L; Guescini, F; Guest, D; Gueta, O; Guicheney, C; Guido, E; Guillemin, T; Guindon, S; Gul, U; Gumpert, C; Gunther, J; Guo, J; Gupta, S; Gutierrez, P; Gutierrez Ortiz, N G; Gutschow, C; Guttman, N; Guyot, C; Gwenlan, C; Gwilliam, C B; Haas, A; Haber, C; Hadavand, H K; Haddad, N; Haefner, P; Hageböeck, S; Hajduk, Z; Hakobyan, H; Haleem, M; Hall, D; Halladjian, G; Hamacher, K; Hamal, P; Hamano, K; Hamer, M; Hamilton, A; Hamilton, S; Hamity, G N; Hamnett, P G; Han, L; Hanagaki, K; Hanawa, K; Hance, M; Hanke, P; Hann, R; Hansen, J B; Hansen, J D; Hansen, P H; Hara, K; Hard, A S; Harenberg, T; Hariri, F; Harkusha, S; Harper, D; Harrington, R D; Harris, O M; Harrison, P F; Hartjes, F; Hasegawa, M; Hasegawa, S; Hasegawa, Y; Hasib, A; Hassani, S; Haug, S; Hauschild, M; Hauser, R; Havranek, M; Hawkes, C M; Hawkings, R J; Hawkins, A D; Hayashi, T; Hayden, D; Hays, C P; Hayward, H S; Haywood, S J; Head, S J; Heck, T; Hedberg, V; Heelan, L; Heim, S; Heim, T; Heinemann, B; Heinrich, L; Hejbal, J; Helary, L; Heller, C; Heller, M; Hellman, S; Hellmich, D; Helsens, C; Henderson, J; Heng, Y; Henderson, R C W; Hengler, C; Henrichs, A; Henriques Correia, A M; Henrot-Versille, S; Hensel, C; Herbert, G H; Hernández Jiménez, Y; Herrberg-Schubert, R; Herten, G; Hertenberger, R; Hervas, L; Hesketh, G G; Hessey, N P; Hickling, R; Higón-Rodriguez, E; Hill, E; Hill, J C; Hiller, K H; Hillert, S; Hillier, S J; Hinchliffe, I; Hines, E; Hirose, M; Hirschbuehl, D; Hobbs, J; Hod, N; Hodgkinson, M C; Hodgson, P; Hoecker, A; Hoeferkamp, M R; Hoenig, F; Hoffman, J; Hoffmann, D; Hofmann, J I; Hohlfeld, M; Holmes, T R; Hong, T M; Hooft van Huysduynen, L; Horii, Y; Hostachy, J-Y; Hou, S; Hoummada, A; Howard, J; Howarth, J; Hrabovsky, M; Hristova, I; Hrivnac, J; Hryn'ova, T; Hsu, C; Hsu, P J; Hsu, S-C; Hu, D; Hu, X; Huang, Y; Hubacek, Z; Hubaut, F; Huegging, F; Huffman, T B; Hughes, E W; Hughes, G; Huhtinen, M; Hülsing, T A; Hurwitz, M; Huseynov, N; Huston, J; Huth, J; Iacobucci, G; Iakovidis, G; Ibragimov, I; Iconomidou-Fayard, L; Ideal, E; Iengo, P; Igonkina, O; Iizawa, T; Ikegami, Y; Ikematsu, K; Ikeno, M; Ilchenko, Y; Iliadis, D; Ilic, N; Inamaru, Y; Ince, T; Ioannou, P; Iodice, M; Iordanidou, K; Ippolito, V; Irles Quiles, A; Isaksson, C; Ishino, M; Ishitsuka, M; Ishmukhametov, R; Issever, C; Istin, S; Iturbe Ponce, J M; Iuppa, R; Ivarsson, J; Iwanski, W; Iwasaki, H; Izen, J M; Izzo, V; Jackson, B; Jackson, M; Jackson, P; Jaekel, M R; Jain, V; Jakobs, K; Jakobsen, S; Jakoubek, T; Jakubek, J; Jamin, D O; Jana, D K; Jansen, E; Jansen, H; Janssen, J; Janus, M; Jarlskog, G; Javadov, N; Javůrek, T; Jeanty, L; Jejelava, J; Jeng, G-Y; Jennens, D; Jenni, P; Jentzsch, J; Jeske, C; Jézéquel, S; Ji, H; Jia, J; Jiang, Y; Jimenez Belenguer, M; Jin, S; Jinaru, A; Jinnouchi, O; Joergensen, M D; Johansson, K E; Johansson, P; Johns, K A; Jon-And, K; Jones, G; Jones, R W L; Jones, T J; Jongmanns, J; Jorge, P M; Joshi, K D; Jovicevic, J; Ju, X; Jung, C A; Jungst, R M; Jussel, P; Juste Rozas, A; Kaci, M; Kaczmarska, A; Kado, M; Kagan, H; Kagan, M; Kajomovitz, E; Kalderon, C W; Kama, S; Kamenshchikov, A; Kanaya, N; Kaneda, M; Kaneti, S; Kantserov, V A; Kanzaki, J; Kaplan, B; Kapliy, A; Kar, D; Karakostas, K; Karastathis, N; Karnevskiy, M; Karpov, S N; Karpova, Z M; Karthik, K; Kartvelishvili, V; Karyukhin, A N; Kashif, L; Kasieczka, G; Kass, R D; Kastanas, A; Kataoka, Y; Katre, A; Katzy, J; Kaushik, V; Kawagoe, K; Kawamoto, T; Kawamura, G; Kazama, S; Kazanin, V F; Kazarinov, M Y; Keeler, R; Kehoe, R; Keil, M; Keller, J S; Kempster, J J; Keoshkerian, H; Kepka, O; Kerševan, B P; Kersten, S; Kessoku, K; Keung, J; Khalil-Zada, F; Khandanyan, H; Khanov, A; Khodinov, A; Khomich, A; Khoo, T J; Khoriauli, G; Khoroshilov, A; Khovanskiy, V; Khramov, E; Khubua, J; Kim, H Y; Kim, H; Kim, S H; Kimura, N; Kind, O; King, B T; King, M; King, R S B; King, S B; Kirk, J; Kiryunin, A E; Kishimoto, T; Kisielewska, D; Kiss, F; Kittelmann, T; Kiuchi, K; Kladiva, E; Klein, M; Klein, U; Kleinknecht, K; Klimek, P; Klimentov, A; Klingenberg, R; Klinger, J A; Klioutchnikova, T; Klok, P F; Kluge, E-E; Kluit, P; Kluth, S; Kneringer, E; Knoops, E B F G; Knue, A; Kobayashi, D; Kobayashi, T; Kobel, M; Kocian, M; Kodys, P; Koevesarki, P; Koffas, T; Koffeman, E; Kogan, L A; Kohlmann, S; Kohout, Z; Kohriki, T; Koi, T; Kolanoski, H; Koletsou, I; Koll, J; Komar, A A; Komori, Y; Kondo, T; Kondrashova, N; Köneke, K; König, A C; König, S; Kono, T; Konoplich, R; Konstantinidis, N; Kopeliansky, R; Koperny, S; Köpke, L; Kopp, A K; Korcyl, K; Kordas, K; Korn, A; Korol, A A; Korolkov, I; Korolkova, E V; Korotkov, V A; Kortner, O; Kortner, S; Kostyukhin, V V; Kotov, V M; Kotwal, A; Kourkoumelis, C; Kouskoura, V; Koutsman, A; Kowalewski, R; Kowalski, T Z; Kozanecki, W; Kozhin, A S; Kral, V; Kramarenko, V A; Kramberger, G; Krasnopevtsev, D; Krasny, M W; Krasznahorkay, A; Kraus, J K; Kravchenko, A; Kreiss, S; Kretz, M; Kretzschmar, J; Kreutzfeldt, K; Krieger, P; Kroeninger, K; Kroha, H; Kroll, J; Kroseberg, J; Krstic, J; Kruchonak, U; Krüger, H; Kruker, T; Krumnack, N; Krumshteyn, Z V; Kruse, A; Kruse, M C; Kruskal, M; Kubota, T; Kuday, S; Kuehn, S; Kugel, A; Kuhl, A; Kuhl, T; Kukhtin, V; Kulchitsky, Y; Kuleshov, S; Kuna, M; Kunkle, J; Kupco, A; Kurashige, H; Kurochkin, Y A; Kurumida, R; Kus, V; Kuwertz, E S; Kuze, M; Kvita, J; La Rosa, A; La Rotonda, L; Lacasta, C; Lacava, F; Lacey, J; Lacker, H; Lacour, D; Lacuesta, V R; Ladygin, E; Lafaye, R; Laforge, B; Lagouri, T; Lai, S; Laier, H; Lambourne, L; Lammers, S; Lampen, C L; Lampl, W; Lançon, E; Landgraf, U; Landon, M P J; Lang, V S; Lankford, A J; Lanni, F; Lantzsch, K; Laplace, S; Lapoire, C; Laporte, J F; Lari, T; Lassnig, M; Laurelli, P; Lavrijsen, W; Law, A T; Laycock, P; Le Dortz, O; Le Guirriec, E; Le Menedeu, E; LeCompte, T; Ledroit-Guillon, F; Lee, C A; Lee, H; Lee, J S H; Lee, S C; Lee, L; Lefebvre, G; Lefebvre, M; Legger, F; Leggett, C; Lehan, A; Lehmacher, M; Lehmann Miotto, G; Lei, X; Leight, W A; Leisos, A; Leister, A G; Leite, M A L; Leitner, R; Lellouch, D; Lemmer, B; Leney, K J C; Lenz, T; Lenzen, G; Lenzi, B; Leone, R; Leone, S; Leonhardt, K; Leonidopoulos, C; Leontsinis, S; Leroy, C; Lester, C G; Lester, C M; Levchenko, M; Levêque, J; Levin, D; Levinson, L J; Levy, M; Lewis, A; Lewis, G H; Leyko, A M; Leyton, M; Li, B; Li, B; Li, H; Li, H L; Li, L; Li, L; Li, S; Li, Y; Liang, Z; Liao, H; Liberti, B; Lichard, P; Lie, K; Liebal, J; Liebig, W; Limbach, C; Limosani, A; Lin, S C; Lin, T H; Linde, F; Lindquist, B E; Linnemann, J T; Lipeles, E; Lipniacka, A; Lisovyi, M; Liss, T M; Lissauer, D; Lister, A; Litke, A M; Liu, B; Liu, D; Liu, J B; Liu, K; Liu, L; Liu, M; Liu, M; Liu, Y; Livan, M; Livermore, S S A; Lleres, A; Llorente Merino, J; Lloyd, S L; Lo Sterzo, F; Lobodzinska, E; Loch, P; Lockman, W S; Loddenkoetter, T; Loebinger, F K; Loevschall-Jensen, A E; Loginov, A; Lohse, T; Lohwasser, K; Lokajicek, M; Lombardo, V P; Long, B A; Long, J D; Long, R E; Lopes, L; Lopez Mateos, D; Lopez Paredes, B; Lopez Paz, I; Lorenz, J; Lorenzo Martinez, N; Losada, M; Loscutoff, P; Lou, X; Lounis, A; Love, J; Love, P A; Lowe, A J; Lu, F; Lu, N; Lubatti, H J; Luci, C; Lucotte, A; Luehring, F; Lukas, W; Luminari, L; Lundberg, O; Lund-Jensen, B; Lungwitz, M; Lynn, D; Lysak, R; Lytken, E; Ma, H; Ma, L L; Maccarrone, G; Macchiolo, A; Machado Miguens, J; Macina, D; Madaffari, D; Madar, R; Maddocks, H J; Mader, W F; Madsen, A; Maeno, M; Maeno, T; Magradze, E; Mahboubi, K; Mahlstedt, J; Mahmoud, S; Maiani, C; Maidantchik, C; Maier, A A; Maio, A; Majewski, S; Makida, Y; Makovec, N; Mal, P; Malaescu, B; Malecki, Pa; Maleev, V P; Malek, F; Mallik, U; Malon, D; Malone, C; Maltezos, S; Malyshev, V M; Malyukov, S; Mamuzic, J; Mandelli, B; Mandelli, L; Mandić, I; Mandrysch, R; Maneira, J; Manfredini, A; Manhaes de Andrade Filho, L; Manjarres Ramos, J A; Mann, A; Manning, P M; Manousakis-Katsikakis, A; Mansoulie, B; Mantifel, R; Mapelli, L; March, L; Marchand, J F; Marchiori, G; Marcisovsky, M; Marino, C P; Marjanovic, M; Marques, C N; Marroquim, F; Marsden, S P; Marshall, Z; Marti, L F; Marti-Garcia, S; Martin, B; Martin, B; Martin, T A; Martin, V J; Martin Dit Latour, B; Martinez, H; Martinez, M; Martin-Haugh, S; Martyniuk, A C; Marx, M; Marzano, F; Marzin, A; Masetti, L; Mashimo, T; Mashinistov, R; Masik, J; Maslennikov, A L; Massa, I; Massa, L; Massol, N; Mastrandrea, P; Mastroberardino, A; Masubuchi, T; Mättig, P; Mattmann, J; Maurer, J; Maxfield, S J; Maximov, D A; Mazini, R; Mazzaferro, L; Mc Goldrick, G; Mc Kee, S P; McCarn, A; McCarthy, R L; McCarthy, T G; McCubbin, N A; McFarlane, K W; Mcfayden, J A; Mchedlidze, G; McMahon, S J; McPherson, R A; Meade, A; Mechnich, J; Medinnis, M; Meehan, S; Mehlhase, S; Mehta, A; Meier, K; Meineck, C; Meirose, B; Melachrinos, C; Mellado Garcia, B R; Meloni, F; Mengarelli, A; Menke, S; Meoni, E; Mercurio, K M; Mergelmeyer, S; Meric, N; Mermod, P; Merola, L; Meroni, C; Merritt, F S; Merritt, H; Messina, A; Metcalfe, J; Mete, A S; Meyer, C; Meyer, C; Meyer, J-P; Meyer, J; Middleton, R P; Migas, S; Mijović, L; Mikenberg, G; Mikestikova, M; Mikuž, M; Milic, A; Miller, D W; Mills, C; Milov, A; Milstead, D A; Milstein, D; Minaenko, A A; Minashvili, I A; Mincer, A I; Mindur, B; Mineev, M; Ming, Y; Mir, L M; Mirabelli, G; Mitani, T; Mitrevski, J; Mitsou, V A; Mitsui, S; Miucci, A; Miyagawa, P S; Mjörnmark, J U; Moa, T; Mochizuki, K; Mohapatra, S; Mohr, W; Molander, S; Moles-Valls, R; Mönig, K; Monini, C; Monk, J; Monnier, E; Montejo Berlingen, J; Monticelli, F; Monzani, S; Moore, R W; Morange, N; Moreno, D; Moreno Llácer, M; Morettini, P; Morgenstern, M; Morii, M; Moritz, S; Morley, A K; Mornacchi, G; Morris, J D; Morvaj, L; Moser, H G; Mosidze, M; Moss, J; Motohashi, K; Mount, R; Mountricha, E; Mouraviev, S V; Moyse, E J W; Muanza, S; Mudd, R D; Mueller, F; Mueller, J; Mueller, K; Mueller, T; Mueller, T; Muenstermann, D; Munwes, Y; Murillo Quijada, J A; Murray, W J; Musheghyan, H; Musto, E; Myagkov, A G; Myska, M; Nackenhorst, O; Nadal, J; Nagai, K; Nagai, R; Nagai, Y; Nagano, K; Nagarkar, A; Nagasaka, Y; Nagel, M; Nairz, A M; Nakahama, Y; Nakamura, K; Nakamura, T; Nakano, I; Namasivayam, H; Nanava, G; Narayan, R; Nattermann, T; Naumann, T; Navarro, G; Nayyar, R; Neal, H A; Nechaeva, P Yu; Neep, T J; Nef, P D; Negri, A; Negri, G; Negrini, M; Nektarijevic, S; Nelson, A; Nelson, T K; Nemecek, S; Nemethy, P; Nepomuceno, A A; Nessi, M; Neubauer, M S; Neumann, M; Neves, R M; Nevski, P; Newman, P R; Nguyen, D H; Nickerson, R B; Nicolaidou, R; Nicquevert, B; Nielsen, J; Nikiforou, N; Nikiforov, A; Nikolaenko, V; Nikolic-Audit, I; Nikolics, K; Nikolopoulos, K; Nilsson, P; Ninomiya, Y; Nisati, A; Nisius, R; Nobe, T; Nodulman, L; Nomachi, M; Nomidis, I; Norberg, S; Nordberg, M; Novgorodova, O; Nowak, S; Nozaki, M; Nozka, L; Ntekas, K; Nunes Hanninger, G; Nunnemann, T; Nurse, E; Nuti, F; O'Brien, B J; O'grady, F; O'Neil, D C; O'Shea, V; Oakham, F G; Oberlack, H; Obermann, T; Ocariz, J; Ochi, A; Ochoa, M I; Oda, S; Odaka, S; Ogren, H; Oh, A; Oh, S H; Ohm, C C; Ohman, H; Okamura, W; Okawa, H; Okumura, Y; Okuyama, T; Olariu, A; Olchevski, A G; Olivares Pino, S A; Oliveira Damazio, D; Oliver Garcia, E; Olszewski, A; Olszowska, J; Onofre, A; Onyisi, P U E; Oram, C J; Oreglia, M J; Oren, Y; Orestano, D; Orlando, N; Oropeza Barrera, C; Orr, R S; Osculati, B; Ospanov, R; Otero Y Garzon, G; Otono, H; Ouchrif, M; Ouellette, E A; Ould-Saada, F; Ouraou, A; Oussoren, K P; Ouyang, Q; Ovcharova, A; Owen, M; Ozcan, V E; Ozturk, N; Pachal, K; Pacheco Pages, A; Padilla Aranda, C; Pagáčová, M; Pagan Griso, S; Paganis, E; Pahl, C; Paige, F; Pais, P; Pajchel, K; Palacino, G; Palestini, S; Palka, M; Pallin, D; Palma, A; Palmer, J D; Pan, Y B; Panagiotopoulou, E; Panduro Vazquez, J G; Pani, P; Panikashvili, N; Panitkin, S; Pantea, D; Paolozzi, L; Papadopoulou, Th D; Papageorgiou, K; Paramonov, A; Paredes Hernandez, D; Parker, M A; Parodi, F; Parsons, J A; Parzefall, U; Pasqualucci, E; Passaggio, S; Passeri, A; Pastore, F; Pastore, Fr; Pásztor, G; Pataraia, S; Patel, N D; Pater, J R; Patricelli, S; Pauly, T; Pearce, J; Pedersen, L E; Pedersen, M; Pedraza Lopez, S; Pedro, R; Peleganchuk, S V; Pelikan, D; Peng, H; Penning, B; Penwell, J; Perepelitsa, D V; Perez Codina, E; Pérez García-Estañ, M T; Perez Reale, V; Perini, L; Pernegger, H; Perrino, R; Peschke, R; Peshekhonov, V D; Peters, K; Peters, R F Y; Petersen, B A; Petersen, T C; Petit, E; Petridis, A; Petridou, C; Petrolo, E; Petrucci, F; Pettersson, N E; Pezoa, R; Phillips, P W; Piacquadio, G; Pianori, E; Picazio, A; Piccaro, E; Piccinini, M; Piegaia, R; Pignotti, D T; Pilcher, J E; Pilkington, A D; Pina, J; Pinamonti, M; Pinder, A; Pinfold, J L; Pingel, A; Pinto, B; Pires, S; Pitt, M; Pizio, C; Plazak, L; Pleier, M-A; Pleskot, V; Plotnikova, E; Plucinski, P; Poddar, S; Podlyski, F; Poettgen, R; Poggioli, L; Pohl, D; Pohl, M; Polesello, G; Policicchio, A; Polifka, R; Polini, A; Pollard, C S; Polychronakos, V; Pommès, K; Pontecorvo, L; Pope, B G; Popeneciu, G A; Popovic, D S; Poppleton, A; Portell Bueso, X; Pospisil, S; Potamianos, K; Potrap, I N; Potter, C J; Potter, C T; Poulard, G; Poveda, J; Pozdnyakov, V; Pralavorio, P; Pranko, A; Prasad, S; Pravahan, R; Prell, S; Price, D; Price, J; Price, L E; Prieur, D; Primavera, M; Proissl, M; Prokofiev, K; Prokoshin, F; Protopapadaki, E; Protopopescu, S; Proudfoot, J; Przybycien, M; Przysiezniak, H; Ptacek, E; Puddu, D; Pueschel, E; Puldon, D; Purohit, M; Puzo, P; Qian, J; Qin, G; Qin, Y; Quadt, A; Quarrie, D R; Quayle, W B; Queitsch-Maitland, M; Quilty, D; Qureshi, A; Radeka, V; Radescu, V; Radhakrishnan, S K; Radloff, P; Rados, P; Ragusa, F; Rahal, G; Rajagopalan, S; Rammensee, M; Randle-Conde, A S; Rangel-Smith, C; Rao, K; Rauscher, F; Rave, T C; Ravenscroft, T; Raymond, M; Read, A L; Readioff, N P; Rebuzzi, D M; Redelbach, A; Redlinger, G; Reece, R; Reeves, K; Rehnisch, L; Reisin, H; Relich, M; Rembser, C; Ren, H; Ren, Z L; Renaud, A; Rescigno, M; Resconi, S; Rezanova, O L; Reznicek, P; Rezvani, R; Richter, R; Ridel, M; Rieck, P; Rieger, J; Rijssenbeek, M; Rimoldi, A; Rinaldi, L; Ritsch, E; Riu, I; Rizatdinova, F; Rizvi, E; Robertson, S H; Robichaud-Veronneau, A; Robinson, D; Robinson, J E M; Robson, A; Roda, C; Rodrigues, L; Roe, S; Røhne, O; Rolli, S; Romaniouk, A; Romano, M; Romero Adam, E; Rompotis, N; Ronzani, M; Roos, L; Ros, E; Rosati, S; Rosbach, K; Rose, M; Rose, P; Rosendahl, P L; Rosenthal, O; Rossetti, V; Rossi, E; Rossi, L P; Rosten, R; Rotaru, M; Roth, I; Rothberg, J; Rousseau, D; Royon, C R; Rozanov, A; Rozen, Y; Ruan, X; Rubbo, F; Rubinskiy, I; Rud, V I; Rudolph, C; Rudolph, M S; Rühr, F; Ruiz-Martinez, A; Rurikova, Z; Rusakovich, N A; Ruschke, A; Rutherfoord, J P; Ruthmann, N; Ryabov, Y F; Rybar, M; Rybkin, G; Ryder, N C; Saavedra, A F; Sacerdoti, S; Saddique, A; Sadeh, I; Sadrozinski, H F-W; Sadykov, R; Safai Tehrani, F; Sakamoto, H; Sakurai, Y; Salamanna, G; Salamon, A; Saleem, M; Salek, D; Sales De Bruin, P H; Salihagic, D; Salnikov, A; Salt, J; Salvatore, D; Salvatore, F; Salvucci, A; Salzburger, A; Sampsonidis, D; Sanchez, A; Sánchez, J; Sanchez Martinez, V; Sandaker, H; Sandbach, R L; Sander, H G; Sanders, M P; Sandhoff, M; Sandoval, T; Sandoval, C; Sandstroem, R; Sankey, D P C; Sansoni, A; Santoni, C; Santonico, R; Santos, H; Santoyo Castillo, I; Sapp, K; Sapronov, A; Saraiva, J G; Sarrazin, B; Sartisohn, G; Sasaki, O; Sasaki, Y; Sauvage, G; Sauvan, E; Savard, P; Savu, D O; Sawyer, C; Sawyer, L; Saxon, D H; Saxon, J; Sbarra, C; Sbrizzi, A; Scanlon, T; Scannicchio, D A; Scarcella, M; Scarfone, V; Schaarschmidt, J; Schacht, P; Schaefer, D; Schaefer, R; Schaepe, S; Schaetzel, S; Schäfer, U; Schaffer, A C; Schaile, D; Schamberger, R D; Scharf, V; Schegelsky, V A; Scheirich, D; Schernau, M; Scherzer, M I; Schiavi, C; Schieck, J; Schillo, C; Schioppa, M; Schlenker, S; Schmidt, E; Schmieden, K; Schmitt, C; Schmitt, S; Schneider, B; Schnellbach, Y J; Schnoor, U; Schoeffel, L; Schoening, A; Schoenrock, B D; Schorlemmer, A L S; Schott, M; Schouten, D; Schovancova, J; Schramm, S; Schreyer, M; Schroeder, C; Schuh, N; Schultens, M J; Schultz-Coulon, H-C; Schulz, H; Schumacher, M; Schumm, B A; Schune, Ph; Schwanenberger, C; Schwartzman, A; Schwegler, Ph; Schwemling, Ph; Schwienhorst, R; Schwindling, J; Schwindt, T; Schwoerer, M; Sciacca, F G; Scifo, E; Sciolla, G; Scott, W G; Scuri, F; Scutti, F; Searcy, J; Sedov, G; Sedykh, E; Seidel, S C; Seiden, A; Seifert, F; Seixas, J M; Sekhniaidze, G; Sekula, S J; Selbach, K E; Seliverstov, D M; Sellers, G; Semprini-Cesari, N; Serfon, C; Serin, L; Serkin, L; Serre, T; Seuster, R; Severini, H; Sfiligoj, T; Sforza, F; Sfyrla, A; Shabalina, E; Shamim, M; Shan, L Y; Shang, R; Shank, J T; Shapiro, M; Shatalov, P B; Shaw, K; Shehu, C Y; Sherwood, P; Shi, L; Shimizu, S; Shimmin, C O; Shimojima, M; Shiyakova, M; Shmeleva, A; Shochet, M J; Short, D; Shrestha, S; Shulga, E; Shupe, M A; Shushkevich, S; Sicho, P; Sidiropoulou, O; Sidorov, D; Sidoti, A; Siegert, F; Sijacki, Dj; Silva, J; Silver, Y; Silverstein, D; Silverstein, S B; Simak, V; Simard, O; Simic, Lj; Simion, S; Simioni, E; Simmons, B; Simoniello, R; Simonyan, M; Sinervo, P; Sinev, N B; Sipica, V; Siragusa, G; Sircar, A; Sisakyan, A N; Sivoklokov, S Yu; Sjölin, J; Sjursen, T B; Skottowe, H P; Skovpen, K Yu; Skubic, P; Slater, M; Slavicek, T; Sliwa, K; Smakhtin, V; Smart, B H; Smestad, L; Smirnov, S Yu; Smirnov, Y; Smirnova, L N; Smirnova, O; Smith, K M; Smizanska, M; Smolek, K; Snesarev, A A; Snidero, G; Snyder, S; Sobie, R; Socher, F; Soffer, A; Soh, D A; Solans, C A; Solar, M; Solc, J; Soldatov, E Yu; Soldevila, U; Solodkov, A A; Soloshenko, A; Solovyanov, O V; Solovyev, V; Sommer, P; Song, H Y; Soni, N; Sood, A; Sopczak, A; Sopko, B; Sopko, V; Sorin, V; Sosebee, M; Soualah, R; Soueid, P; Soukharev, A M; South, D; Spagnolo, S; Spanò, F; Spearman, W R; Spettel, F; Spighi, R; Spigo, G; Spiller, L A; Spousta, M; Spreitzer, T; Spurlock, B; Denis, R D St; Staerz, S; Stahlman, J; Stamen, R; Stamm, S; Stanecka, E; Stanek, R W; Stanescu, C; Stanescu-Bellu, M; Stanitzki, M M; Stapnes, S; Starchenko, E A; Stark, J; Staroba, P; Starovoitov, P; Staszewski, R; Stavina, P; Steinberg, P; Stelzer, B; Stelzer, H J; Stelzer-Chilton, O; Stenzel, H; Stern, S; Stewart, G A; Stillings, J A; Stockton, M C; Stoebe, M; Stoicea, G; Stolte, P; Stonjek, S; Stradling, A R; Straessner, A; Stramaglia, M E; Strandberg, J; Strandberg, S; Strandlie, A; Strauss, E; Strauss, M; Strizenec, P; Ströhmer, R; Strom, D M; Stroynowski, R; Struebig, A; Stucci, S A; Stugu, B; Styles, N A; Su, D; Su, J; Subramaniam, R; Succurro, A; Sugaya, Y; Suhr, C; Suk, M; Sulin, V V; Sultansoy, S; Sumida, T; Sun, S; Sun, X; Sundermann, J E; Suruliz, K; Susinno, G; Sutton, M R; Suzuki, Y; Svatos, M; Swedish, S; Swiatlowski, M; Sykora, I; Sykora, T; Ta, D; Taccini, C; Tackmann, K; Taenzer, J; Taffard, A; Tafirout, R; Taiblum, N; Takai, H; Takashima, R; Takeda, H; Takeshita, T; Takubo, Y; Talby, M; Talyshev, A A; Tam, J Y C; Tan, K G; Tanaka, J; Tanaka, R; Tanaka, S; Tanaka, S; Tanasijczuk, A J; Tannenwald, B B; Tannoury, N; Tapprogge, S; Tarem, S; Tarrade, F; Tartarelli, G F; Tas, P; Tasevsky, M; Tashiro, T; Tassi, E; Tavares Delgado, A; Tayalati, Y; Taylor, F E; Taylor, G N; Taylor, W; Teischinger, F A; Teixeira Dias Castanheira, M; Teixeira-Dias, P; Temming, K K; Ten Kate, H; Teng, P K; Teoh, J J; Terada, S; Terashi, K; Terron, J; Terzo, S; Testa, M; Teuscher, R J; Therhaag, J; Theveneaux-Pelzer, T; Thomas, J P; Thomas-Wilsker, J; Thompson, E N; Thompson, P D; Thompson, P D; Thompson, R J; Thompson, A S; Thomsen, L A; Thomson, E; Thomson, M; Thong, W M; Thun, R P; Tian, F; Tibbetts, M J; Tikhomirov, V O; Tikhonov, Yu A; Timoshenko, S; Tiouchichine, E; Tipton, P; Tisserant, S; Todorov, T; Todorova-Nova, S; Toggerson, B; Tojo, J; Tokár, S; Tokushuku, K; Tollefson, K; Tomlinson, L; Tomoto, M; Tompkins, L; Toms, K; Topilin, N D; Torrence, E; Torres, H; Torró Pastor, E; Toth, J; Touchard, F; Tovey, D R; Tran, H L; Trefzger, T; Tremblet, L; Tricoli, A; Trigger, I M; Trincaz-Duvoid, S; Tripiana, M F; Trischuk, W; Trocmé, B; Troncon, C; Trottier-McDonald, M; Trovatelli, M; True, P; Trzebinski, M; Trzupek, A; Tsarouchas, C; Tseng, J C-L; Tsiareshka, P V; Tsionou, D; Tsipolitis, G; Tsirintanis, N; Tsiskaridze, S; Tsiskaridze, V; Tskhadadze, E G; Tsukerman, I I; Tsulaia, V; Tsuno, S; Tsybychev, D; Tudorache, A; Tudorache, V; Tuna, A N; Tupputi, S A; Turchikhin, S; Turecek, D; Turk Cakir, I; Turra, R; Tuts, P M; Tykhonov, A; Tylmad, M; Tyndel, M; Uchida, K; Ueda, I; Ueno, R; Ughetto, M; Ugland, M; Uhlenbrock, M; Ukegawa, F; Unal, G; Undrus, A; Unel, G; Ungaro, F C; Unno, Y; Unverdorben, C; Urbaniec, D; Urquijo, P; Usai, G; Usanova, A; Vacavant, L; Vacek, V; Vachon, B; Valencic, N; Valentinetti, S; Valero, A; Valery, L; Valkar, S; Valladolid Gallego, E; Vallecorsa, S; Valls Ferrer, J A; Van Den Wollenberg, W; Van Der Deijl, P C; van der Geer, R; van der Graaf, H; Van Der Leeuw, R; van der Ster, D; van Eldik, N; van Gemmeren, P; Van Nieuwkoop, J; van Vulpen, I; van Woerden, M C; Vanadia, M; Vandelli, W; Vanguri, R; Vaniachine, A; Vankov, P; Vannucci, F; Vardanyan, G; Vari, R; Varnes, E W; Varol, T; Varouchas, D; Vartapetian, A; Varvell, K E; Vazeille, F; Vazquez Schroeder, T; Veatch, J; Veloso, F; Veneziano, S; Ventura, A; Ventura, D; Venturi, M; Venturi, N; Venturini, A; Vercesi, V; Verducci, M; Verkerke, W; Vermeulen, J C; Vest, A; Vetterli, M C; Viazlo, O; Vichou, I; Vickey, T; Vickey Boeriu, O E; Viehhauser, G H A; Viel, S; Vigne, R; Villa, M; Villaplana Perez, M; Vilucchi, E; Vincter, M G; Vinogradov, V B; Virzi, J; Vivarelli, I; Vives Vaque, F; Vlachos, S; Vladoiu, D; Vlasak, M; Vogel, A; Vogel, M; Vokac, P; Volpi, G; Volpi, M; von der Schmitt, H; von Radziewski, H; von Toerne, E; Vorobel, V; Vorobev, K; Vos, M; Voss, R; Vossebeld, J H; Vranjes, N; Vranjes Milosavljevic, M; Vrba, V; Vreeswijk, M; Vu Anh, T; Vuillermet, R; Vukotic, I; Vykydal, Z; Wagner, P; Wagner, W; Wahlberg, H; Wahrmund, S; Wakabayashi, J; Walder, J; Walker, R; Walkowiak, W; Wall, R; Waller, P; Walsh, B; Wang, C; Wang, C; Wang, F; Wang, H; Wang, H; Wang, J; Wang, J; Wang, K; Wang, R; Wang, S M; Wang, T; Wang, X; Wanotayaroj, C; Warburton, A; Ward, C P; Wardrope, D R; Warsinsky, M; Washbrook, A; Wasicki, C; Watkins, P M; Watson, A T; Watson, I J; Watson, M F; Watts, G; Watts, S; Waugh, B M; Webb, S; Weber, M S; Weber, S W; Webster, J S; Weidberg, A R; Weigell, P; Weinert, B; Weingarten, J; Weiser, C; Weits, H; Wells, P S; Wenaus, T; Wendland, D; Weng, Z; Wengler, T; Wenig, S; Wermes, N; Werner, M; Werner, P; Wessels, M; Wetter, J; Whalen, K; White, A; White, M J; White, R; White, S; Whiteson, D; Wicke, D; Wickens, F J; Wiedenmann, W; Wielers, M; Wienemann, P; Wiglesworth, C; Wiik-Fuchs, L A M; Wijeratne, P A; Wildauer, A; Wildt, M A; Wilkens, H G; Will, J Z; Williams, H H; Williams, S; Willis, C; Willocq, S; Wilson, A; Wilson, J A; Wingerter-Seez, I; Winklmeier, F; Winter, B T; Wittgen, M; Wittig, T; Wittkowski, J; Wollstadt, S J; Wolter, M W; Wolters, H; Wosiek, B K; Wotschack, J; Woudstra, M J; Wozniak, K W; Wright, M; Wu, M; Wu, S L; Wu, X; Wu, Y; Wulf, E; Wyatt, T R; Wynne, B M; Xella, S; Xiao, M; Xu, D; Xu, L; Yabsley, B; Yacoob, S; Yakabe, R; Yamada, M; Yamaguchi, H; Yamaguchi, Y; Yamamoto, A; Yamamoto, K; Yamamoto, S; Yamamura, T; Yamanaka, T; Yamauchi, K; Yamazaki, Y; Yan, Z; Yang, H; Yang, H; Yang, U K; Yang, Y; Yanush, S; Yao, L; Yao, W-M; Yasu, Y; Yatsenko, E; Yau Wong, K H; Ye, J; Ye, S; Yeletskikh, I; Yen, A L; Yildirim, E; Yilmaz, M; Yoosoofmiya, R; Yorita, K; Yoshida, R; Yoshihara, K; Young, C; Young, C J S; Youssef, S; Yu, D R; Yu, J; Yu, J M; Yu, J; Yuan, L; Yurkewicz, A; Yusuff, I; Zabinski, B; Zaidan, R; Zaitsev, A M; Zaman, A; Zambito, S; Zanello, L; Zanzi, D; Zeitnitz, C; Zeman, M; Zemla, A; Zengel, K; Zenin, O; Ženiš, T; Zerwas, D; Zevi Della Porta, G; Zhang, D; Zhang, F; Zhang, H; Zhang, J; Zhang, L; Zhang, X; Zhang, Z; Zhao, Z; Zhemchugov, A; Zhong, J; Zhou, B; Zhou, L; Zhou, N; Zhu, C G; Zhu, H; Zhu, J; Zhu, Y; Zhuang, X; Zhukov, K; Zibell, A; Zieminska, D; Zimine, N I; Zimmermann, C; Zimmermann, R; Zimmermann, S; Zimmermann, S; Zinonos, Z; Ziolkowski, M; Zobernig, G; Zoccoli, A; Zur Nedden, M; Zurzolo, G; Zutshi, V; Zwalinski, L

This paper presents the performance of the ATLAS muon reconstruction during the LHC run with [Formula: see text] collisions at [Formula: see text]-8 TeV in 2011-2012, focusing mainly on data collected in 2012. Measurements of the reconstruction efficiency and of the momentum scale and resolution, based on large reference samples of [Formula: see text], [Formula: see text] and [Formula: see text] decays, are presented and compared to Monte Carlo simulations. Corrections to the simulation, to be used in physics analysis, are provided. Over most of the covered phase space (muon [Formula: see text] and [Formula: see text] GeV) the efficiency is above [Formula: see text] and is measured with per-mille precision. The momentum resolution ranges from [Formula: see text] at central rapidity and for transverse momentum [Formula: see text] GeV, to [Formula: see text] at large rapidity and [Formula: see text] GeV. The momentum scale is known with an uncertainty of [Formula: see text] to [Formula: see text] depending on rapidity. A method for the recovery of final state radiation from the muons is also presented.

Association of health profession and direct-to-consumer marketing with infant formula choice and switching.

PubMed

Huang, Yi; Labiner-Wolfe, Judith; Huang, Hui; Choiniere, Conrad J; Fein, Sara B

2013-03-01

Infant formula is marketed by health professionals and directly to consumers. Formula marketing has been shown to reduce breastfeeding, but the relation with switching formulas has not been studied. Willingness to switch formula can enable families to spend less on formula. Data are from the Infant Feeding Practices Study II, a United States national longitudinal study. Mothers were asked about media exposure to formula information during pregnancy, receiving formula samples or coupons at hospital discharge, reasons for their formula choice at infant age 1 month, and formula switching at infant ages 2, 5, 7, and 9 months. Analysis included 1,700 mothers who fed formula at infant age 1 month; it used logistic regression and longitudinal data analysis methods to evaluate the association between marketing and formula choice and switching. Most mothers were exposed to both types of formula marketing. Mothers who received a sample of formula from the hospital at birth were more likely to use the hospital formula 1 month later. Mothers who chose formula at 1 month because their doctor recommended it were less likely to switch formula than those who chose in response to direct-to-consumer marketing. Mothers who chose a formula because it was used in the hospital were less likely to switch if they had not been exposed to Internet web-based formula information when pregnant or if they received a formula sample in the mail. Marketing formula through health professionals may decrease mothers' willingness to switch formula. © 2013, Copyright the Authors Journal compilation © 2013, Wiley Periodicals, Inc.

Mental health community based funding: Ohio's experience in revising its funding allocation methodology.

PubMed

Seiber, Eric E; Sweeney, Helen Anne; Partridge, Jamie; Dembe, Allard E; Jones, Holly

2012-10-01

Over the past 20 years, states have increasingly moved away from centrally financed, state-operated facilities to financing models built around community-based service delivery mechanisms. This paper identifies four important broad factors to consider when developing a funding formula to allocate state funding for community mental health services to local boards in an equitable manner, based on local community need: (1) funding factors used by other states; (2) state specific legislative requirements; (3) data availability; and (4) local variation of factors in the funding formula. These considerations are illustrated with the recent experience of Ohio using available evidence and data sources to develop a new community-based allocation formula. We discuss opportunities for implementing changes in formula based mental health funding related to Medicaid expansions for low income adults scheduled to go into effect under the new Patient Protection and Affordable Care Act.

Emittance formula for slits and pepper-pot measurement

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, M.

1996-10-01

In this note, a rigid formula for slits and pepper-pot emittance measurement is derived. The derivation is based on the one- dimensional slit measurement setup. A mathematical generalization of the slit emittance formula to the pepper-pot measurement is discussed.

A Circuit Model of Real Time Human Body Hydration.

PubMed

Asogwa, Clement Ogugua; Teshome, Assefa K; Collins, Stephen F; Lai, Daniel T H

2016-06-01

Changes in human body hydration leading to excess fluid losses or overload affects the body fluid's ability to provide the necessary support for healthy living. We propose a time-dependent circuit model of real-time human body hydration, which models the human body tissue as a signal transmission medium. The circuit model predicts the attenuation of a propagating electrical signal. Hydration rates are modeled by a time constant τ, which characterizes the individual specific metabolic function of the body part measured. We define a surrogate human body anthropometric parameter θ by the muscle-fat ratio and comparing it with the body mass index (BMI), we find theoretically, the rate of hydration varying from 1.73 dB/min, for high θ and low τ to 0.05 dB/min for low θ and high τ. We compare these theoretical values with empirical measurements and show that real-time changes in human body hydration can be observed by measuring signal attenuation. We took empirical measurements using a vector network analyzer and obtained different hydration rates for various BMI, ranging from 0.6 dB/min for 22.7 [Formula: see text] down to 0.04 dB/min for 41.2 [Formula: see text]. We conclude that the galvanic coupling circuit model can predict changes in the volume of the body fluid, which are essential in diagnosing and monitoring treatment of body fluid disorder. Individuals with high BMI would have higher time-dependent biological characteristic, lower metabolic rate, and lower rate of hydration.

Performance comparison of protonic and sodium phosphomolybdovanadate polyoxoanion catholytes within a chemically regenerative redox cathode polymer electrolyte fuel cell

NASA Astrophysics Data System (ADS)

Ward, David B.; Gunn, Natasha L. O.; Uwigena, Nadine; Davies, Trevor J.

2018-01-01

The direct reduction of oxygen in conventional polymer electrolyte fuel cells (PEFCs) is seen by many researchers as a key challenge in PEFC development. Chemically regenerative redox cathode (CRRC) polymer electrolyte fuel cells offer an alternative approach via the indirect reduction of oxygen, improving durability and reducing cost. These systems substitute gaseous oxygen for a liquid catalyst that is reduced at the cathode then oxidised in a regeneration vessel via air bubbling. A key component of a CRRC system is the liquid catalyst or catholyte. To date, phosphomolybdovanadium polyoxometalates with empirical formula H3+nPVnMo12-nO40 have shown the most promise for CRRC PEFC systems. In this work, four catholyte formulations are studied and compared against each other. The catholytes vary in vanadium content, pH and counter ion, with empirical formulas H6PV3Mo9O40, H7PV4Mo8O40, Na3H3PV3Mo9O40 and Na4H3PV4Mo8O40. Thermodynamic properties, cell performance and regeneration rates are measured, generating new insights into how formulation chemistry affects the components of a CRRC system. The results include the best CRRC PEFC performance reported to date, with noticeable advantages over conventional PEFCs. The optimum catholyte formulation is then determined via steady state tests, the results of which will guide further optimization of the catholyte formulation.

Conventional and microwave-assisted synthesis of new indole-tethered benzimidazole-based 1,2,3-triazoles and evaluation of their antimycobacterial, antioxidant and antimicrobial activities.

PubMed

Ashok, Dongamanti; Gundu, Srinivas; Aamate, Vikas Kumar; Devulapally, Mohan Gandhi

2018-04-18

A new series of triheterocycles containing indole-benzimidazole-based 1,2,3-triazole hybrids have been synthesized in good yields via a microwave-assisted click reaction. All the compounds were characterized by IR, [Formula: see text] NMR, [Formula: see text] NMR and mass spectroscopy and were evaluated for their in vitro antitubercular activity against the Mycobacterium tuberculosis H37Rv strain. Compounds 4b, 4h and 4i displayed highly potent antitubercular activity with MIC 3.125-6.25 [Formula: see text]. The antioxidant potential was evaluated using 2,2-diphenyl-1-picryl hydrazine and [Formula: see text] radical scavenging activity, and compounds 4e,4f and 4g showed excellent radical scavenging activity with [Formula: see text] values in the range of 08.50-10.05 [Formula: see text]. Furthermore, the compounds were evaluated for antimicrobial activity against numerous bacterial and fungal strains, and compounds 4b, 4c and 4h were found to be the most promising potential antimicrobial molecules with MIC 3.125-6.25 [Formula: see text].

United Formula for the Friction Factor in the Turbulent Region of Pipe Flow.

PubMed

Li, Shuolin; Huai, Wenxin

2016-01-01

Friction factor is an important element in both flow simulations and river engineering. In hydraulics, studies on the friction factor in turbulent regions have been based on the concept of three flow regimes, namely, the fully smooth regime, the fully rough regime, and the transitional regime, since the establishment of the Nikuradze's chart. However, this study further demonstrates that combining the friction factor with Reynolds number yields a united formula that can scale the entire turbulent region. This formula is derived by investigating the correlation between friction in turbulent pipe flow and its influencing factors, i.e., Reynolds number and relative roughness. In the present study, the formulae of Blasius and Stricklerare modified to rearrange the implicit model of Tao. In addition, we derive a united explicit formula that can compute the friction factor in the entire turbulent regimes based on the asymptotic behavior of the improved Tao's model. Compared with the reported formulae of Nikuradze, the present formula exhibits higher computational accuracy for the original pipe experiment data of Nikuradze.

[Formula: see text]-regularized recursive total least squares based sparse system identification for the error-in-variables.

PubMed

Lim, Jun-Seok; Pang, Hee-Suk

2016-01-01

In this paper an [Formula: see text]-regularized recursive total least squares (RTLS) algorithm is considered for the sparse system identification. Although recursive least squares (RLS) has been successfully applied in sparse system identification, the estimation performance in RLS based algorithms becomes worse, when both input and output are contaminated by noise (the error-in-variables problem). We proposed an algorithm to handle the error-in-variables problem. The proposed [Formula: see text]-RTLS algorithm is an RLS like iteration using the [Formula: see text] regularization. The proposed algorithm not only gives excellent performance but also reduces the required complexity through the effective inversion matrix handling. Simulations demonstrate the superiority of the proposed [Formula: see text]-regularized RTLS for the sparse system identification setting.

The effect of choosing three different C factor formulae derived from NDVI on a fully raster-based erosion modelling

NASA Astrophysics Data System (ADS)

Sulistyo, Bambang

2016-11-01

The research was aimed at studying the efect of choosing three different C factor formulae derived from NDVI on a fully raster-based erosion modelling of The USLE using remote sensing data and GIS technique. Methods applied was by analysing all factors affecting erosion such that all data were in the form of raster. Those data were R, K, LS, C and P factors. Monthly R factor was evaluated based on formula developed by Abdurachman. K factor was determined using modified formula used by Ministry of Forestry based on soil samples taken in the field. LS factor was derived from Digital Elevation Model. Three C factors used were all derived from NDVI and developed by Suriyaprasit (non-linear) and by Sulistyo (linear and non-linear). P factor was derived from the combination between slope data and landcover classification interpreted from Landsat 7 ETM+. Another analysis was the creation of map of Bulk Density used to convert erosion unit. To know the model accuracy, model validation was done by applying statistical analysis and by comparing Emodel with Eactual. A threshold value of ≥ 0.80 or ≥ 80% was chosen to justify. The research result showed that all Emodel using three formulae of C factors have coeeficient of correlation value of > 0.8. The results of analysis of variance showed that there was significantly difference between Emodel and Eactual when using C factor formula developed by Suriyaprasit and Sulistyo (non-linear). Among the three formulae, only Emodel using C factor formula developed by Sulistyo (linear) reached the accuracy of 81.13% while the other only 56.02% as developed by Sulistyo (nonlinear) and 4.70% as developed by Suriyaprasit, respectively.

Composition formulas of Fe-based transition metals-metalloid bulk metallic glasses derived from dual-cluster model of binary eutectics.

PubMed

Naz, Gul Jabeen; Dong, Dandan; Geng, Yaoxiang; Wang, Yingmin; Dong, Chuang

2017-08-22

It is known that bulk metallic glasses follow simple composition formulas [cluster](glue atom) 1 or 3 with 24 valence electrons within the framework of the cluster-plus-glue-atom model. Though the relevant nearest-neighbor cluster can be readily identified from a devitrification phase, the glue atoms remains poorly defined. The present work is devoted to understanding the composition rule of Fe-(B,P,C) based multi-component bulk metallic glasses, by introducing a cluster-based eutectic liquid model. This model regards a eutectic liquid to be composed of two stable liquids formulated respectively by cluster formulas for ideal metallic glasses from the two eutectic phases. The dual cluster formulas are first established for binary Fe-(B,C,P) eutectics: [Fe-Fe 14 ]B 2 Fe + [B-B 2 Fe 8 ]Fe ≈ Fe 83.3 B 16.7 for eutectic Fe 83 B 17 , [P-Fe 14 ]P + [P-Fe 9 ]P 2 Fe≈Fe 82.8 P 17.2 for Fe 83 P 17 , and [C-Fe 6 ]Fe 3  + [C-Fe 9 ]C 2 Fe ≈ Fe 82.6 C 17.4 for Fe 82.7 C 17.3 . The second formulas in these dual-cluster formulas, being respectively relevant to devitrification phases Fe 2 B, Fe 3 P, and Fe 3 C, well explain the compositions of existing Fe-based transition metals-metalloid bulk metallic glasses. These formulas also satisfy the 24-electron rule. The proposition of the composition formulas for good glass formers, directly from known eutectic points, constitutes a new route towards understanding and eventual designing metallic glasses of high glass forming abilities.

Health economic potential of early nutrition programming: a model calculation of long-term reduction in blood pressure and related morbidity costs by use of long-chain polyunsaturated fatty acid-supplemented formula.

PubMed

Straub, Niels; Grunert, Philipp; von Kries, Rüdiger; Koletzko, Berthold

2011-12-01

The reported effect sizes of early nutrition programming on long-term health outcomes are often small, and it has been questioned whether early interventions would be worthwhile in enhancing public health. We explored the possible health economic consequences of early nutrition programming by performing a model calculation, based on the only published study currently available for analysis, to evaluate the effects of supplementing infant formula with long-chain polyunsaturated fatty acids (LC-PUFAs) on lowering blood pressure and lowering the risk of hypertension-related diseases in later life. The costs and health effects of LC-PUFA-enriched and standard infant formulas were compared by using a Markov model, including all relevant direct and indirect costs based on German statistics. We assessed the effect size of blood pressure reduction from LC-PUFA-supplemented formula, the long-term persistence of the effect, and the effect of lowered blood pressure on hypertension-related morbidity. The cost-effectiveness analysis showed an increased life expectancy of 1.2 quality-adjusted life-years and an incremental cost-effectiveness ratio of -630 Euros (discounted to present value) for the LC-PUFA formula in comparison with standard formula. LC-PUFA nutrition was the superior strategy even when the blood pressure-lowering effect was reduced to the lower 95% CI. Breastfeeding is the recommended feeding practice, but infants who are not breastfed should receive an appropriate infant formula. Following this model calculation, LC-PUFA supplementation of infant formula represents an economically worthwhile prevention strategy, based on the costs derived from hypertension-linked diseases in later life. However, because our analysis was based on a single randomized controlled trial, further studies are required to verify the validity of this thesis.

A comprehensive energy approach to predict fatigue life in CuAlBe shape memory alloy

NASA Astrophysics Data System (ADS)

Sameallah, S.; Legrand, V.; Saint-Sulpice, L.; Kadkhodaei, M.; Arbab Chirani, S.

2015-02-01

Stabilized dissipated energy is an effective parameter on the fatigue life of shape memory alloys (SMAs). In this study, a formula is proposed to directly evaluate the stabilized dissipated energy for different values of the maximum and minimum applied stresses, as well as the loading frequency, under cyclic tensile loadings. To this aim, a one-dimensional fully coupled thermomechanical constitutive model and a cycle-dependent phase diagram are employed to predict the uniaxial stress-strain response of an SMA in a specified cycle, including the stabilized one, with no need of obtaining the responses of the previous cycles. An enhanced phase diagram in which different slopes are defined for the start and finish of a backward transformation strip is also proposed to enable the capture of gradual transformations in a CuAlBe shape memory alloy. It is shown that the present approach is capable of reproducing the experimental responses of CuAlBe specimens under cyclic tensile loadings. An explicit formula is further presented to predict the fatigue life of CuAlBe as a function of the maximum and minimum applied stresses as well as the loading frequency. Fatigue tests are also carried out, and this formula is verified against the empirically predicted number of cycles for failure.

L'effet Doppler et le décalage vers le rouge en mécanique rationnelle: applications et verifications experimentales.

PubMed

Loiseaus, J

1968-07-01

Shifts z and z' toward the red of the galaxy NGC 5668 for a beam of 21 cm, z measured in radioastronomy with a frequency meter and z' measured in optics with a spectrograph, not being equal, it follows that the speed of light from a galaxy c ' is not equal to that of a galaxy c which is measured on earth from stationary source. The Doppler empirical formula cannot be explained in classical mechanics since it is in contradiction with it. As for the theory of relativity c ' = c from a postulate and z' = z. If we consider the universe represented on a three-dimensional space (H), non-Euclidian, with Euclidian connection plunged in a Riemannine four-dimension space (E), a certain universal time, like that of an astronomer, can be defined and its course calculated in relation to this time: it will necessarily be confounded with the atomic clock time, but c ' not equal c and z' not equal z: the Doppler formula is not accurate. However, c ' and c as well as z' and z are so close in all the experiments carried out on earth, even when an artificial satellite is used, that the errors made in using the Doppler formula are clearly inferior to experimental errors.

A Meta-Analysis of Factors Influencing the Development of Trust in Automation: Implications for Understanding Autonomy in Future Systems.

PubMed

Schaefer, Kristin E; Chen, Jessie Y C; Szalma, James L; Hancock, P A

2016-05-01

We used meta-analysis to assess research concerning human trust in automation to understand the foundation upon which future autonomous systems can be built. Trust is increasingly important in the growing need for synergistic human-machine teaming. Thus, we expand on our previous meta-analytic foundation in the field of human-robot interaction to include all of automation interaction. We used meta-analysis to assess trust in automation. Thirty studies provided 164 pairwise effect sizes, and 16 studies provided 63 correlational effect sizes. The overall effect size of all factors on trust development was ḡ = +0.48, and the correlational effect was [Formula: see text]  = +0.34, each of which represented medium effects. Moderator effects were observed for the human-related (ḡ  = +0.49; [Formula: see text] = +0.16) and automation-related (ḡ = +0.53; [Formula: see text] = +0.41) factors. Moderator effects specific to environmental factors proved insufficient in number to calculate at this time. Findings provide a quantitative representation of factors influencing the development of trust in automation as well as identify additional areas of needed empirical research. This work has important implications to the enhancement of current and future human-automation interaction, especially in high-risk or extreme performance environments. © 2016, Human Factors and Ergonomics Society.

Assessment of Palm Press Fibre and Sawdust-Based Substrate Formulas for Efficient Carpophore Production of Lentinus squarrosulus (Mont.) Singer

PubMed Central

Chiejina, Nneka Virginia

2015-01-01

Development of efficient substrate formulas to improve yield and shorten production time is one of the prerequisites for commercial cultivation of edible mushrooms. In this study, fifteen substrate formulas consisting of varying ratios of palm press fibre (PPF), mahogany sawdust (MS), Gmelina sawdust, wheat bran (WB), and fixed proportions of 1% calcium carbonate (CaCO3) and 1% sucrose were assessed for efficient Lentinus squarrosulus production. Proximate compositions of mushrooms produced on the different substrate formulas were also analysed and compared. Substrate formulations containing 85% PPF, 13% WB, 1% CaCO3, and 1% sucrose were found to produce the highest carpophore yield, biological efficiency and size (206.5 g/kg, 61.96%, and 7.26 g, respectively). Days to production (first harvest) tended to increase with an increase in the amount of WB in the substrate formulas, except for PPF based formulas. The addition of WB in amounts equivalent to 8~18% in substrate formulas containing 80~90% PPF resulted in a decrease in the time to first harvest by an average of 17.7 days compared to 80~90% MS with similar treatment. Nutritional content of mushrooms was affected by the different substrate formulas. Protein content was high for mushrooms produced on formulas containing PPF as the basal substrate. Thus, formulas comprising PPF, WB, CaCO3, and sucrose at 85% : 13% : 1% : 1%) respectively could be explored as starter basal ingredients for efficient large scale production of L. squarrosulus. PMID:26839507

Minimalistic optic flow sensors applied to indoor and outdoor visual guidance and odometry on a car-like robot.

PubMed

Mafrica, Stefano; Servel, Alain; Ruffier, Franck

2016-11-10

Here we present a novel bio-inspired optic flow (OF) sensor and its application to visual  guidance and odometry on a low-cost car-like robot called BioCarBot. The minimalistic OF sensor was robust to high-dynamic-range lighting conditions and to various visual patterns encountered thanks to its M 2 APIX auto-adaptive pixels and the new cross-correlation OF algorithm implemented. The low-cost car-like robot estimated its velocity and steering angle, and therefore its position and orientation, via an extended Kalman filter (EKF) using only two downward-facing OF sensors and the Ackerman steering model. Indoor and outdoor experiments were carried out in which the robot was driven in the closed-loop mode based on the velocity and steering angle estimates. The experimental results obtained show that our novel OF sensor can deliver high-frequency measurements ([Formula: see text]) in a wide OF range (1.5-[Formula: see text]) and in a 7-decade high-dynamic light level range. The OF resolution was constant and could be adjusted as required (up to [Formula: see text]), and the OF precision obtained was relatively high (standard deviation of [Formula: see text] with an average OF of [Formula: see text], under the most demanding lighting conditions). An EKF-based algorithm gave the robot's position and orientation with a relatively high accuracy (maximum errors outdoors at a very low light level: [Formula: see text] and [Formula: see text] over about [Formula: see text] and [Formula: see text]) despite the low-resolution control systems of the steering servo and the DC motor, as well as a simplified model identification and calibration. Finally, the minimalistic OF-based odometry results were compared to those obtained using measurements based on an inertial measurement unit (IMU) and a motor's speed sensor.

Why does the sign problem occur in evaluating the overlap of HFB wave functions?

NASA Astrophysics Data System (ADS)

Mizusaki, Takahiro; Oi, Makito; Shimizu, Noritaka

2018-04-01

For the overlap matrix element between Hartree-Fock-Bogoliubov states, there are two analytically different formulae: one with the square root of the determinant (the Onishi formula) and the other with the Pfaffian (Robledo's Pfaffian formula). The former formula is two-valued as a complex function, hence it leaves the sign of the norm overlap undetermined (i.e., the so-called sign problem of the Onishi formula). On the other hand, the latter formula does not suffer from the sign problem. The derivations for these two formulae are so different that the reasons are obscured why the resultant formulae possess different analytical properties. In this paper, we discuss the reason why the difference occurs by means of the consistent framework, which is based on the linked cluster theorem and the product-sum identity for the Pfaffian. Through this discussion, we elucidate the source of the sign problem in the Onishi formula. We also point out that different summation methods of series expansions may result in analytically different formulae.

Production of [Formula: see text] and [Formula: see text] mesons up to high transverse momentum in pp collisions at 2.76 TeV.

PubMed

Acharya, S; Adamová, D; Aggarwal, M M; Rinella, G Aglieri; Agnello, M; Agrawal, N; Ahammed, Z; Ahmad, N; Ahn, S U; Aiola, S; Akindinov, A; Alam, S N; Albuquerque, D S D; Aleksandrov, D; Alessandro, B; Alexandre, D; Molina, R Alfaro; Alici, A; Alkin, A; Alme, J; Alt, T; Altsybeev, I; Prado, C Alves Garcia; An, M; Andrei, C; Andrews, H A; Andronic, A; Anguelov, V; Anson, C; Antičić, T; Antinori, F; Antonioli, P; Anwar, R; Aphecetche, L; Appelshäuser, H; Arcelli, S; Arnaldi, R; Arnold, O W; Arsene, I C; Arslandok, M; Audurier, B; Augustinus, A; Averbeck, R; Awes, T; Azmi, M D; Badalà, A; Baek, Y W; Bagnasco, S; Bailhache, R; Bala, R; Baldisseri, A; Ball, M; Baral, R C; Barbano, A M; Barbera, R; Barile, F; Barioglio, L; Barnaföldi, G G; Barnby, L S; Barret, V; Bartalini, P; Barth, K; Bartke, J; Bartsch, E; Basile, M; Bastid, N; Basu, S; Bathen, B; Batigne, G; Camejo, A Batista; Batyunya, B; Batzing, P C; Bearden, I G; Beck, H; Bedda, C; Behera, N K; Belikov, I; Bellini, F; Martinez, H Bello; Bellwied, R; Beltran, L G E; Belyaev, V; Bencedi, G; Beole, S; Bercuci, A; Berdnikov, Y; Berenyi, D; Bertens, R A; Berzano, D; Betev, L; Bhasin, A; Bhat, I R; Bhati, A K; Bhattacharjee, B; Bhom, J; Bianchi, L; Bianchi, N; Bianchin, C; Bielčík, J; Bielčíková, J; Bilandzic, A; Biro, G; Biswas, R; Biswas, S; Blair, J T; Blau, D; Blume, C; Boca, G; Bock, F; Bogdanov, A; Boldizsár, L; Bombara, M; Bonomi, G; Bonora, M; Book, J; Borel, H; Borissov, A; Borri, M; Botta, E; Bourjau, C; Braun-Munzinger, P; Bregant, M; Broker, T A; Browning, T A; Broz, M; Brucken, E J; Bruna, E; Bruno, G E; Budnikov, D; Buesching, H; Bufalino, S; Buhler, P; Buitron, S A I; Buncic, P; Busch, O; Buthelezi, Z; Butt, J B; Buxton, J T; Cabala, J; Caffarri, D; Caines, H; Caliva, A; Villar, E Calvo; Camerini, P; Capon, A A; Carena, F; Carena, W; Carnesecchi, F; Castellanos, J Castillo; Castro, A J; Casula, E A R; Sanchez, C Ceballos; Cerello, P; Chang, B; Chapeland, S; Chartier, M; Charvet, J L; Chattopadhyay, S; Chattopadhyay, S; Chauvin, A; Cherney, M; Cheshkov, C; Cheynis, B; Barroso, V Chibante; Chinellato, D D; Cho, S; Chochula, P; Choi, K; Chojnacki, M; Choudhury, S; Christakoglou, P; Christensen, C H; Christiansen, P; Chujo, T; Chung, S U; Cicalo, C; Cifarelli, L; Cindolo, F; Cleymans, J; Colamaria, F; Colella, D; Collu, A; Colocci, M; Concas, M; Balbastre, G Conesa; Valle, Z Conesa Del; Connors, M E; Contreras, J G; Cormier, T M; Morales, Y Corrales; Maldonado, I Cortés; Cortese, P; Cosentino, M R; Costa, F; Costanza, S; Crkovská, J; Crochet, P; Cuautle, E; Cunqueiro, L; Dahms, T; Dainese, A; Danisch, M C; Danu, A; Das, D; Das, I; Das, S; Dash, A; Dash, S; De, S; De Caro, A; de Cataldo, G; de Conti, C; de Cuveland, J; De Falco, A; De Gruttola, D; De Marco, N; De Pasquale, S; De Souza, R D; Degenhardt, H F; Deisting, A; Deloff, A; Deplano, C; Dhankher, P; Di Bari, D; Di Mauro, A; Di Nezza, P; Di Ruzza, B; Corchero, M A Diaz; Dietel, T; Dillenseger, P; Divià, R; Djuvsland, Ø; Dobrin, A; Gimenez, D Domenicis; Dönigus, B; Dordic, O; Drozhzhova, T; Dubey, A K; Dubla, A; Ducroux, L; Duggal, A K; Dupieux, P; Ehlers, R J; Elia, D; Endress, E; Engel, H; Epple, E; Erazmus, B; Erhardt, F; Espagnon, B; Esumi, S; Eulisse, G; Eum, J; Evans, D; Evdokimov, S; Fabbietti, L; Faivre, J; Fantoni, A; Fasel, M; Feldkamp, L; Feliciello, A; Feofilov, G; Ferencei, J; Téllez, A Fernández; Ferreiro, E G; Ferretti, A; Festanti, A; Feuillard, V J G; Figiel, J; Figueredo, M A S; Filchagin, S; Finogeev, D; Fionda, F M; Fiore, E M; Floris, M; Foertsch, S; Foka, P; Fokin, S; Fragiacomo, E; Francescon, A; Francisco, A; Frankenfeld, U; Fronze, G G; Fuchs, U; Furget, C; Furs, A; Girard, M Fusco; Gaardhøje, J J; Gagliardi, M; Gago, A M; Gajdosova, K; Gallio, M; Galvan, C D; Ganoti, P; Gao, C; Garabatos, C; Garcia-Solis, E; Garg, K; Garg, P; Gargiulo, C; Gasik, P; Gauger, E F; Ducati, M B Gay; Germain, M; Ghosh, P; Ghosh, S K; Gianotti, P; Giubellino, P; Giubilato, P; Gladysz-Dziadus, E; Glässel, P; Coral, D M Goméz; Ramirez, A Gomez; Gonzalez, A S; Gonzalez, V; González-Zamora, P; Gorbunov, S; Görlich, L; Gotovac, S; Grabski, V; Graczykowski, L K; Graham, K L; Greiner, L; Grelli, A; Grigoras, C; Grigoriev, V; Grigoryan, A; Grigoryan, S; Grion, N; Gronefeld, J M; Grosa, F; Grosse-Oetringhaus, J F; Grosso, R; Gruber, L; Grull, F R; Guber, F; Guernane, R; Guerzoni, B; Gulbrandsen, K; Gunji, T; Gupta, A; Gupta, R; Guzman, I B; Haake, R; Hadjidakis, C; Hamagaki, H; Hamar, G; Hamon, J C; Harris, J W; Harton, A; Hatzifotiadou, D; Hayashi, S; Heckel, S T; Hellbär, E; Helstrup, H; Herghelegiu, A; Corral, G Herrera; Herrmann, F; Hess, B A; Hetland, K F; Hillemanns, H; Hippolyte, B; Hladky, J; Hohlweger, B; Horak, D; Hornung, S; Hosokawa, R; Hristov, P; Hughes, C; Humanic, T J; Hussain, N; Hussain, T; Hutter, D; Hwang, D S; Ilkaev, R; Inaba, M; Ippolitov, M; Irfan, M; Isakov, V; Ivanov, M; Ivanov, V; Izucheev, V; Jacak, B; Jacazio, N; Jacobs, P M; Jadhav, M B; Jadlovska, S; Jadlovsky, J; Jaelani, S; Jahnke, C; Jakubowska, M J; Janik, M A; Jayarathna, P H S Y; Jena, C; Jena, S; Jercic, M; Bustamante, R T Jimenez; Jones, P G; Jusko, A; Kalinak, P; Kalweit, A; Kamin, J; Kang, J H; Kaplin, V; Kar, S; Uysal, A Karasu; Karavichev, O; Karavicheva, T; Karayan, L; Karpechev, E; Kebschull, U; Keidel, R; Keijdener, D L D; Keil, M; Ketzer, B; Khan, P; Khan, S A; Khanzadeev, A; Kharlov, Y; Khatun, A; Khuntia, A; Kielbowicz, M M; Kileng, B; Kim, D; Kim, D W; Kim, D J; Kim, H; Kim, J S; Kim, J; Kim, M; Kim, M; Kim, S; Kim, T; Kirsch, S; Kisel, I; Kiselev, S; Kisiel, A; Kiss, G; Klay, J L; Klein, C; Klein, J; Klein-Bösing, C; Klewin, S; Kluge, A; Knichel, M L; Knospe, A G; Kobdaj, C; Kofarago, M; Kollegger, T; Kolojvari, A; Kondratiev, V; Kondratyeva, N; Kondratyuk, E; Konevskikh, A; Kopcik, M; Kour, M; Kouzinopoulos, C; Kovalenko, O; Kovalenko, V; Kowalski, M; Meethaleveedu, G Koyithatta; Králik, I; Kravčáková, A; Krivda, M; Krizek, F; Kryshen, E; Krzewicki, M; Kubera, A M; Kučera, V; Kuhn, C; Kuijer, P G; Kumar, A; Kumar, J; Kumar, L; Kumar, S; Kundu, S; Kurashvili, P; Kurepin, A; Kurepin, A B; Kuryakin, A; Kushpil, S; Kweon, M J; Kwon, Y; La Pointe, S L; La Rocca, P; Fernandes, C Lagana; Lakomov, I; Langoy, R; Lapidus, K; Lara, C; Lardeux, A; Lattuca, A; Laudi, E; Lavicka, R; Lazaridis, L; Lea, R; Leardini, L; Lee, S; Lehas, F; Lehner, S; Lehrbach, J; Lemmon, R C; Lenti, V; Leogrande, E; Monzón, I León; Lévai, P; Li, S; Li, X; Lien, J; Lietava, R; Lindal, S; Lindenstruth, V; Lippmann, C; Lisa, M A; Litichevskyi, V; Ljunggren, H M; Llope, W J; Lodato, D F; Loenne, P I; Loginov, V; Loizides, C; Loncar, P; Lopez, X; Torres, E López; Lowe, A; Luettig, P; Lunardon, M; Luparello, G; Lupi, M; Lutz, T H; Maevskaya, A; Mager, M; Mahajan, S; Mahmood, S M; Maire, A; Majka, R D; Malaev, M; Cervantes, I Maldonado; Malinina, L; Mal'Kevich, D; Malzacher, P; Mamonov, A; Manko, V; Manso, F; Manzari, V; Mao, Y; Marchisone, M; Mareš, J; Margagliotti, G V; Margotti, A; Margutti, J; Marín, A; Markert, C; Marquard, M; Martin, N A; Martinengo, P; Martinez, J A L; Martínez, M I; García, G Martínez; Pedreira, M Martinez; Mas, A; Masciocchi, S; Masera, M; Masoni, A; Mastroserio, A; Mathis, A M; Matyja, A; Mayer, C; Mazer, J; Mazzilli, M; Mazzoni, M A; Meddi, F; Melikyan, Y; Menchaca-Rocha, A; Meninno, E; Pérez, J Mercado; Meres, M; Mhlanga, S; Miake, Y; Mieskolainen, M M; Mihaylov, D L; Mikhaylov, K; Milano, L; Milosevic, J; Mischke, A; Mishra, A N; Miśkowiec, D; Mitra, J; Mitu, C M; Mohammadi, N; Mohanty, B; Khan, M Mohisin; Montes, E; De Godoy, D A Moreira; Moreno, L A P; Moretto, S; Morreale, A; Morsch, A; Muccifora, V; Mudnic, E; Mühlheim, D; Muhuri, S; Mukherjee, M; Mulligan, J D; Munhoz, M G; Münning, K; Munzer, R H; Murakami, H; Murray, S; Musa, L; Musinsky, J; Myers, C J; Naik, B; Nair, R; Nandi, B K; Nania, R; Nappi, E; Narayan, A; Naru, M U; da Luz, H Natal; Nattrass, C; Navarro, S R; Nayak, K; Nayak, R; Nayak, T K; Nazarenko, S; Nedosekin, A; De Oliveira, R A Negrao; Nellen, L; Nesbo, S V; Ng, F; Nicassio, M; Niculescu, M; Niedziela, J; Nielsen, B S; Nikolaev, S; Nikulin, S; Nikulin, V; Noferini, F; Nomokonov, P; Nooren, G; Noris, J C C; Norman, J; Nyanin, A; Nystrand, J; Oeschler, H; Oh, S; Ohlson, A; Okubo, T; Olah, L; Oleniacz, J; Da Silva, A C Oliveira; Oliver, M H; Onderwaater, J; Oppedisano, C; Orava, R; Oravec, M; Velasquez, A Ortiz; Oskarsson, A; Otwinowski, J; Oyama, K; Pachmayer, Y; Pacik, V; Pagano, D; Pagano, P; Paić, G; Palni, P; Pan, J; Pandey, A K; Panebianco, S; Papikyan, V; Pappalardo, G S; Pareek, P; Park, J; Park, W J; Parmar, S; Passfeld, A; Pathak, S P; Paticchio, V; Patra, R N; Paul, B; Pei, H; Peitzmann, T; Peng, X; Pereira, L G; Da Costa, H Pereira; Peresunko, D; Lezama, E Perez; Peskov, V; Pestov, Y; Petráček, V; Petrov, V; Petrovici, M; Petta, C; Pezzi, R P; Piano, S; Pikna, M; Pillot, P; Pimentel, L O D L; Pinazza, O; Pinsky, L; Piyarathna, D B; Oskoń, M Pł; Planinic, M; Pluta, J; Pochybova, S; Podesta-Lerma, P L M; Poghosyan, M G; Polichtchouk, B; Poljak, N; Poonsawat, W; Pop, A; Poppenborg, H; Porteboeuf-Houssais, S; Porter, J; Pospisil, J; Pozdniakov, V; Prasad, S K; Preghenella, R; Prino, F; Pruneau, C A; Pshenichnov, I; Puccio, M; Puddu, G; Pujahari, P; Punin, V; Putschke, J; Qvigstad, H; Rachevski, A; Raha, S; Rajput, S; Rak, J; Rakotozafindrabe, A; Ramello, L; Rami, F; Rana, D B; Raniwala, R; Raniwala, S; Räsänen, S S; Rascanu, B T; Rathee, D; Ratza, V; Ravasenga, I; Read, K F; Redlich, K; Rehman, A; Reichelt, P; Reidt, F; Ren, X; Renfordt, R; Reolon, A R; Reshetin, A; Reygers, K; Riabov, V; Ricci, R A; Richert, T; Richter, M; Riedler, P; Riegler, W; Riggi, F; Ristea, C; Cahuantzi, M Rodríguez; Røed, K; Rogochaya, E; Rohr, D; Röhrich, D; Rokita, P S; Ronchetti, F; Ronflette, L; Rosnet, P; Rossi, A; Rotondi, A; Roukoutakis, F; Roy, A; Roy, C; Roy, P; Montero, A J Rubio; Rueda, O V; Rui, R; Russo, R; Rustamov, A; Ryabinkin, E; Ryabov, Y; Rybicki, A; Saarinen, S; Sadhu, S; Sadovsky, S; Šafařík, K; Saha, S K; Sahlmuller, B; Sahoo, B; Sahoo, P; Sahoo, R; Sahoo, S; Sahu, P K; Saini, J; Sakai, S; Saleh, M A; Salzwedel, J; Sambyal, S; Samsonov, V; Sandoval, A; Sarkar, D; Sarkar, N; Sarma, P; Sas, M H P; Scapparone, E; Scarlassara, F; Scharenberg, R P; Scheid, H S; Schiaua, C; Schicker, R; Schmidt, C; Schmidt, H R; Schmidt, M O; Schmidt, M; Schuchmann, S; Schukraft, J; Schutz, Y; Schwarz, K; Schweda, K; Scioli, G; Scomparin, E; Scott, R; Šefčík, M; Seger, J E; Sekiguchi, Y; Sekihata, D; Selyuzhenkov, I; Senosi, K; Senyukov, S; Serradilla, E; Sett, P; Sevcenco, A; Shabanov, A; Shabetai, A; Shadura, O; Shahoyan, R; Shangaraev, A; Sharma, A; Sharma, A; Sharma, M; Sharma, M; Sharma, N; Sheikh, A I; Shigaki, K; Shou, Q; Shtejer, K; Sibiriak, Y; Siddhanta, S; Sielewicz, K M; Siemiarczuk, T; Silvermyr, D; Silvestre, C; Simatovic, G; Simonetti, G; Singaraju, R; Singh, R; Singhal, V; Sinha, T; Sitar, B; Sitta, M; Skaali, T B; Slupecki, M; Smirnov, N; Snellings, R J M; Snellman, T W; Song, J; Song, M; Soramel, F; Sorensen, S; Sozzi, F; Spiriti, E; Sputowska, I; Srivastava, B K; Stachel, J; Stan, I; Stankus, P; Stenlund, E; Stiller, J H; Stocco, D; Strmen, P; Suaide, A A P; Sugitate, T; Suire, C; Suleymanov, M; Suljic, M; Sultanov, R; Šumbera, M; Sumowidagdo, S; Suzuki, K; Swain, S; Szabo, A; Szarka, I; Szczepankiewicz, A; Szymanski, M; Tabassam, U; Takahashi, J; Tambave, G J; Tanaka, N; Tarhini, M; Tariq, M; Tarzila, M G; Tauro, A; Muñoz, G Tejeda; Telesca, A; Terasaki, K; Terrevoli, C; Teyssier, B; Thakur, D; Thakur, S; Thomas, D; Tieulent, R; Tikhonov, A; Timmins, A R; Toia, A; Tripathy, S; Trogolo, S; Trombetta, G; Trubnikov, V; Trzaska, W H; Trzeciak, B A; Tsuji, T; Tumkin, A; Turrisi, R; Tveter, T S; Ullaland, K; Umaka, E N; Uras, A; Usai, G L; Utrobicic, A; Vala, M; Van Der Maarel, J; Van Hoorne, J W; van Leeuwen, M; Vanat, T; Vyvre, P Vande; Varga, D; Vargas, A; Vargyas, M; Varma, R; Vasileiou, M; Vasiliev, A; Vauthier, A; Doce, O Vázquez; Vechernin, V; Veen, A M; Velure, A; Vercellin, E; Limón, S Vergara; Vernet, R; Vértesi, R; Vickovic, L; Vigolo, S; Viinikainen, J; Vilakazi, Z; Baillie, O Villalobos; Tello, A Villatoro; Vinogradov, A; Vinogradov, L; Virgili, T; Vislavicius, V; Vodopyanov, A; Völkl, M A; Voloshin, K; Voloshin, S A; Volpe, G; von Haller, B; Vorobyev, I; Voscek, D; Vranic, D; Vrláková, J; Wagner, B; Wagner, J; Wang, H; Wang, M; Watanabe, D; Watanabe, Y; Weber, M; Weber, S G; Weiser, D F; Wessels, J P; Westerhoff, U; Whitehead, A M; Wiechula, J; Wikne, J; Wilk, G; Wilkinson, J; Willems, G A; Williams, M C S; Windelband, B; Witt, W E; Yalcin, S; Yang, P; Yano, S; Yin, Z; Yokoyama, H; Yoo, I-K; Yoon, J H; Yurchenko, V; Zaccolo, V; Zaman, A; Zampolli, C; Zanoli, H J C; Zardoshti, N; Zarochentsev, A; Závada, P; Zaviyalov, N; Zbroszczyk, H; Zhalov, M; Zhang, H; Zhang, X; Zhang, Y; Zhang, C; Zhang, Z; Zhao, C; Zhigareva, N; Zhou, D; Zhou, Y; Zhou, Z; Zhu, H; Zhu, J; Zhu, X; Zichichi, A; Zimmermann, A; Zimmermann, M B; Zimmermann, S; Zinovjev, G; Zmeskal, J

2017-01-01

The invariant differential cross sections for inclusive [Formula: see text] and [Formula: see text] mesons at midrapidity were measured in pp collisions at [Formula: see text] TeV for transverse momenta [Formula: see text] GeV/ c and [Formula: see text] GeV/ c , respectively, using the ALICE detector. This large range in [Formula: see text] was achieved by combining various analysis techniques and different triggers involving the electromagnetic calorimeter (EMCal). In particular, a new single-cluster, shower-shape based method was developed for the identification of high-[Formula: see text] neutral pions, which exploits that the showers originating from their decay photons overlap in the EMCal. Above 4 GeV/[Formula: see text], the measured cross sections are found to exhibit a similar power-law behavior with an exponent of about 6.3. Next-to-leading-order perturbative QCD calculations differ from the measured cross sections by about 30% for the [Formula: see text], and between 30-50% for the [Formula: see text] meson, while generator-level simulations with PYTHIA 8.2 describe the data to better than 10-30%, except at [Formula: see text] GeV/[Formula: see text]. The new data can therefore be used to further improve the theoretical description of [Formula: see text] and [Formula: see text] meson production.

Supplementation of Infant Formula with Bovine Milk Fat Globule Membranes.

PubMed

Timby, Niklas; Domellöf, Magnus; Lönnerdal, Bo; Hernell, Olle

2017-03-01

Studies have shown that supplementation of infant formula with bovine milk fat globule membranes (MFGMs) may substantially narrow the gap in health outcomes between formula-fed and breastfed infants. In one study, consumption of a formula supplemented with a lipid-rich MFGM concentrate between 2 and 6 mo of age improved cognitive performance at 24 wk of age. In another study, a formula supplemented with a protein-rich MFGM concentrate given between 2 and 6 mo of age improved cognitive performance at 12 mo of age, decreased infectious morbidity until 6 mo of age, and yielded serum cholesterol concentrations closer to those of breastfed infants. A third study that assessed the safety of supplementing infant formula with a lipid-rich or a protein-rich MFGM concentrate found a noninferior weight gain for both groups compared with a nonsupplemented formula. In this study, there was an increased risk of eczema in the protein-rich group, but no serious adverse events. Infant formulas with supplemental MFGMs have been launched on the market in several countries. However, the evidence base must still be considered quite limited. Based on 3 randomized controlled trials that are not comparable, the intervention seems safe, but there is not enough evidence for a general recommendation on which MFGM fraction to use and at what concentration as formula supplement for a given outcome. © 2017 American Society for Nutrition.

On homogeneous second order linear general quantum difference equations.

PubMed

Faried, Nashat; Shehata, Enas M; El Zafarani, Rasha M

2017-01-01

In this paper, we prove the existence and uniqueness of solutions of the β -Cauchy problem of second order β -difference equations [Formula: see text] [Formula: see text], in a neighborhood of the unique fixed point [Formula: see text] of the strictly increasing continuous function β , defined on an interval [Formula: see text]. These equations are based on the general quantum difference operator [Formula: see text], which is defined by [Formula: see text], [Formula: see text]. We also construct a fundamental set of solutions for the second order linear homogeneous β -difference equations when the coefficients are constants and study the different cases of the roots of their characteristic equations. Finally, we drive the Euler-Cauchy β -difference equation.

Randomized controlled trial of an e-learning designed behavioral intervention for increasing physical activity behavior in multiple sclerosis.

PubMed

Motl, Robert W; Hubbard, Elizabeth A; Bollaert, Rachel E; Adamson, Brynn C; Kinnett-Hopkins, Dominique; Balto, Julia M; Sommer, Sarah K; Pilutti, Lara A; McAuley, Edward

2017-01-01

Internet-delivered, behavioral interventions represent a cost-effective, broadly disseminable approach for teaching persons with multiple sclerosis (MS) the theory-based skills, techniques, and strategies for changing physical activity. This pilot, randomized controlled trial examined the efficacy of a newly developed Internet website based on e-learning approaches that delivered a theory-based behavior intervention for increasing physical activity and improving symptoms, walking impairment, and neurological disability. Participants with MS ( N  = 47) were randomly assigned into behavioral intervention ( n  = 23) or waitlist control ( n  = 24) conditions delivered over a six-month period. Outcomes were administered before and after the six-month period using blinded assessors, and data were analyzed using analysis of covariance in SPSS. There was a significant, positive intervention effect on self-reported physical activity ( P  = 0.05, [Formula: see text]   = 0.10), and non-significant improvement in objectively measured physical activity ( P  = 0.24, [Formula: see text]   = 0.04). There were significant, positive effects of the intervention on overall ( P  = 0.018, [Formula: see text]   = 0.13) and physical impact of fatigue ( P  = 0.003, [Formula: see text]   = 0.20), self-reported walking impairment ( P  = 0.047, [Formula: see text]   = 0.10), and disability status ( P  = 0.033, [Formula: see text]   = 0.11). There were non-significant improvements in fatigue severity ( P  = 0.10, [Formula: see text]   = 0.06), depression ( P  = 0.10, [Formula: see text]   = 0.07) and anxiety ( P  = 0.06, [Formula: see text]   = 0.09) symptoms, and self-reported disability ( P  = 0.10, [Formula: see text]   = 0.07). We provide evidence for the efficacy of an Internet-based behavioral intervention with content delivered through interactive video courses grounded in e-learning principles for increasing physical activity and possibly improving secondary outcomes of fatigue, depression, anxiety, and walking impairment/disability in persons with MS.

Study on Incompatibility of Traditional Chinese Medicine: Evidence from Formula Network, Chemical Space, and Metabolism Room

PubMed Central

Zhang, Xiao-Dong; Wu, Hong-Ying; Jin, Jin; Yu, Guang-Yun; He, Xin; Wang, Hao; Shen, Xiu; Zhou, Ze-Wei; Liu, Pei-Xun; Fan, Sai-Jun

2013-01-01

A traditional Chinese medicine (TCM) formula network including 362 TCM formulas was built by using complex network methodologies. The properties of this network were analyzed including network diameter, average distance, clustering coefficient, and average degree. Meanwhile, we built a TCM chemical space and a TCM metabolism room under the theory of chemical space. The properties of chemical space and metabolism room were calculated and analyzed. The properties of the medicine pairs in “eighteen antagonisms and nineteen mutual inhibitors,” an ancient rule for TCM incompatibility, were studied based on the TCM formula network, chemical space, and metabolism room. The results showed that the properties of these incompatible medicine pairs are different from those of the other TCM based on the analysis of the TCM formula network, chemical space, and metabolism room. The lines of evidence derived from our work demonstrated that the ancient rule of TCM incompatibility, “eighteen antagonisms and nineteen mutual inhibitors,” is probably scientifically based. PMID:24369478

Research on energy efficiency design index for sea-going LNG carriers

NASA Astrophysics Data System (ADS)

Lin, Yan; Yu, Yanyun; Guan, Guan

2014-12-01

This paper describes the characteristics of liquefied natural gas (LNG) carriers briefly. The LNG carrier includes power plant selection, vapor treatment, liquid cargo tank type, etc. Two parameters—fuel substitution rate and recovery of boil of gas (BOG) volume to energy efficiency design index (EEDI) formula are added, and EEDI formula of LNG carriers is established based on ship EEDI formula. Then, based on steam turbine propulsion device of LNG carriers, mathematical models of LNG carriers' reference line value are established in this paper. By verification, the EEDI formula of LNG carriers described in this paper can provide a reference for LNG carrier EEDI calculation and green shipbuilding.

Optimal prediction of the number of unseen species.

PubMed

Orlitsky, Alon; Suresh, Ananda Theertha; Wu, Yihong

2016-11-22

Estimating the number of unseen species is an important problem in many scientific endeavors. Its most popular formulation, introduced by Fisher et al. [Fisher RA, Corbet AS, Williams CB (1943) J Animal Ecol 12(1):42-58], uses n samples to predict the number U of hitherto unseen species that would be observed if [Formula: see text] new samples were collected. Of considerable interest is the largest ratio t between the number of new and existing samples for which U can be accurately predicted. In seminal works, Good and Toulmin [Good I, Toulmin G (1956) Biometrika 43(102):45-63] constructed an intriguing estimator that predicts U for all [Formula: see text] Subsequently, Efron and Thisted [Efron B, Thisted R (1976) Biometrika 63(3):435-447] proposed a modification that empirically predicts U even for some [Formula: see text], but without provable guarantees. We derive a class of estimators that provably predict U all of the way up to [Formula: see text] We also show that this range is the best possible and that the estimator's mean-square error is near optimal for any t Our approach yields a provable guarantee for the Efron-Thisted estimator and, in addition, a variant with stronger theoretical and experimental performance than existing methodologies on a variety of synthetic and real datasets. The estimators are simple, linear, computationally efficient, and scalable to massive datasets. Their performance guarantees hold uniformly for all distributions, and apply to all four standard sampling models commonly used across various scientific disciplines: multinomial, Poisson, hypergeometric, and Bernoulli product.

Parametric mediational g-formula approach to mediation analysis with time-varying exposures, mediators, and confounders

PubMed Central

Lin, Sheng-Hsuan; Young, Jessica; Logan, Roger; Tchetgen Tchetgen, Eric J.; VanderWeele, Tyler J.

2016-01-01

The assessment of direct and indirect effects with time-varying mediators and confounders is a common but challenging problem, and standard mediation analysis approaches are generally not applicable in this context. The mediational g-formula was recently proposed to address this problem, paired with a semi-parametric estimation approach to evaluate longitudinal mediation effects empirically. In this paper, we develop a parametric estimation approach to the mediational g-formula, including a feasible algorithm implemented in a freely available SAS macro. In the Framingham Heart Study data, we apply this method to estimate the interventional analogues of natural direct and indirect effects of smoking behaviors sustained over a 10-year period on blood pressure when considering weight change as a time-varying mediator. Compared with not smoking, smoking 20 cigarettes per day for 10 years was estimated to increase blood pressure by 1.2 (95 % CI: −0.7, 2.7) mm-Hg. The direct effect was estimated to increase blood pressure by 1.5 (95 % CI: −0.3, 2.9) mm-Hg, and the indirect effect was −0.3 (95% CI: −0.5, −0.1) mm-Hg, which is negative because smoking which is associated with lower weight is associated in turn with lower blood pressure. These results provide evidence that weight change in fact partially conceals the detrimental effects of cigarette smoking on blood pressure. Our work represents, to our knowledge, the first application of the parametric mediational g-formula in an epidemiologic cohort study. PMID:27984420

Boosting Higgs pair production in the [Formula: see text] final state with multivariate techniques.

PubMed

Behr, J Katharina; Bortoletto, Daniela; Frost, James A; Hartland, Nathan P; Issever, Cigdem; Rojo, Juan

2016-01-01

The measurement of Higgs pair production will be a cornerstone of the LHC program in the coming years. Double Higgs production provides a crucial window upon the mechanism of electroweak symmetry breaking and has a unique sensitivity to the Higgs trilinear coupling. We study the feasibility of a measurement of Higgs pair production in the [Formula: see text] final state at the LHC. Our analysis is based on a combination of traditional cut-based methods with state-of-the-art multivariate techniques. We account for all relevant backgrounds, including the contributions from light and charm jet mis-identification, which are ultimately comparable in size to the irreducible 4 b QCD background. We demonstrate the robustness of our analysis strategy in a high pileup environment. For an integrated luminosity of [Formula: see text] ab[Formula: see text], a signal significance of [Formula: see text] is obtained, indicating that the [Formula: see text] final state alone could allow for the observation of double Higgs production at the High Luminosity LHC.

Optical Coherence Tomography–Based Corneal Power Measurement and Intraocular Lens Power Calculation Following Laser Vision Correction (An American Ophthalmological Society Thesis)

PubMed Central

Huang, David; Tang, Maolong; Wang, Li; Zhang, Xinbo; Armour, Rebecca L.; Gattey, Devin M.; Lombardi, Lorinna H.; Koch, Douglas D.

2013-01-01

Purpose: To use optical coherence tomography (OCT) to measure corneal power and improve the selection of intraocular lens (IOL) power in cataract surgeries after laser vision correction. Methods: Patients with previous myopic laser vision corrections were enrolled in this prospective study from two eye centers. Corneal thickness and power were measured by Fourier-domain OCT. Axial length, anterior chamber depth, and automated keratometry were measured by a partial coherence interferometer. An OCT-based IOL formula was developed. The mean absolute error of the OCT-based formula in predicting postoperative refraction was compared to two regression-based IOL formulae for eyes with previous laser vision correction. Results: Forty-six eyes of 46 patients all had uncomplicated cataract surgery with monofocal IOL implantation. The mean arithmetic prediction error of postoperative refraction was 0.05 ± 0.65 diopter (D) for the OCT formula, 0.14 ± 0.83 D for the Haigis-L formula, and 0.24 ± 0.82 D for the no-history Shammas-PL formula. The mean absolute error was 0.50 D for OCT compared to a mean absolute error of 0.67 D for Haigis-L and 0.67 D for Shammas-PL. The adjusted mean absolute error (average prediction error removed) was 0.49 D for OCT, 0.65 D for Haigis-L (P=.031), and 0.62 D for Shammas-PL (P=.044). For OCT, 61% of the eyes were within 0.5 D of prediction error, whereas 46% were within 0.5 D for both Haigis-L and Shammas-PL (P=.034). Conclusions: The predictive accuracy of OCT-based IOL power calculation was better than Haigis-L and Shammas-PL formulas in eyes after laser vision correction. PMID:24167323

Optimal Therapy Scheduling Based on a Pair of Collaterally Sensitive Drugs.

PubMed

Yoon, Nara; Vander Velde, Robert; Marusyk, Andriy; Scott, Jacob G

2018-05-07

Despite major strides in the treatment of cancer, the development of drug resistance remains a major hurdle. One strategy which has been proposed to address this is the sequential application of drug therapies where resistance to one drug induces sensitivity to another drug, a concept called collateral sensitivity. The optimal timing of drug switching in these situations, however, remains unknown. To study this, we developed a dynamical model of sequential therapy on heterogeneous tumors comprised of resistant and sensitive cells. A pair of drugs (DrugA, DrugB) are utilized and are periodically switched during therapy. Assuming resistant cells to one drug are collaterally sensitive to the opposing drug, we classified cancer cells into two groups, [Formula: see text] and [Formula: see text], each of which is a subpopulation of cells resistant to the indicated drug and concurrently sensitive to the other, and we subsequently explored the resulting population dynamics. Specifically, based on a system of ordinary differential equations for [Formula: see text] and [Formula: see text], we determined that the optimal treatment strategy consists of two stages: an initial stage in which a chosen effective drug is utilized until a specific time point, T, and a second stage in which drugs are switched repeatedly, during which each drug is used for a relative duration (i.e., [Formula: see text]-long for DrugA and [Formula: see text]-long for DrugB with [Formula: see text] and [Formula: see text]). We prove that the optimal duration of the initial stage, in which the first drug is administered, T, is shorter than the period in which it remains effective in decreasing the total population, contrary to current clinical intuition. We further analyzed the relationship between population makeup, [Formula: see text], and the effect of each drug. We determine a critical ratio, which we term [Formula: see text], at which the two drugs are equally effective. As the first stage of the optimal strategy is applied, [Formula: see text] changes monotonically to [Formula: see text] and then, during the second stage, remains at [Formula: see text] thereafter. Beyond our analytic results, we explored an individual-based stochastic model and presented the distribution of extinction times for the classes of solutions found. Taken together, our results suggest opportunities to improve therapy scheduling in clinical oncology.

Cooperative Coevolution with Formula-Based Variable Grouping for Large-Scale Global Optimization.

PubMed

Wang, Yuping; Liu, Haiyan; Wei, Fei; Zong, Tingting; Li, Xiaodong

2017-08-09

For a large-scale global optimization (LSGO) problem, divide-and-conquer is usually considered an effective strategy to decompose the problem into smaller subproblems, each of which can then be solved individually. Among these decomposition methods, variable grouping is shown to be promising in recent years. Existing variable grouping methods usually assume the problem to be black-box (i.e., assuming that an analytical model of the objective function is unknown), and they attempt to learn appropriate variable grouping that would allow for a better decomposition of the problem. In such cases, these variable grouping methods do not make a direct use of the formula of the objective function. However, it can be argued that many real-world problems are white-box problems, that is, the formulas of objective functions are often known a priori. These formulas of the objective functions provide rich information which can then be used to design an effective variable group method. In this article, a formula-based grouping strategy (FBG) for white-box problems is first proposed. It groups variables directly via the formula of an objective function which usually consists of a finite number of operations (i.e., four arithmetic operations "[Formula: see text]", "[Formula: see text]", "[Formula: see text]", "[Formula: see text]" and composite operations of basic elementary functions). In FBG, the operations are classified into two classes: one resulting in nonseparable variables, and the other resulting in separable variables. In FBG, variables can be automatically grouped into a suitable number of non-interacting subcomponents, with variables in each subcomponent being interdependent. FBG can easily be applied to any white-box problem and can be integrated into a cooperative coevolution framework. Based on FBG, a novel cooperative coevolution algorithm with formula-based variable grouping (so-called CCF) is proposed in this article for decomposing a large-scale white-box problem into several smaller subproblems and optimizing them respectively. To further enhance the efficiency of CCF, a new local search scheme is designed to improve the solution quality. To verify the efficiency of CCF, experiments are conducted on the standard LSGO benchmark suites of CEC'2008, CEC'2010, CEC'2013, and a real-world problem. Our results suggest that the performance of CCF is very competitive when compared with those of the state-of-the-art LSGO algorithms.

A Glucose Biosensor Using CMOS Potentiostat and Vertically Aligned Carbon Nanofibers.

PubMed

Al Mamun, Khandaker A; Islam, Syed K; Hensley, Dale K; McFarlane, Nicole

2016-08-01

This paper reports a linear, low power, and compact CMOS based potentiostat for vertically aligned carbon nanofibers (VACNF) based amperometric glucose sensors. The CMOS based potentiostat consists of a single-ended potential control unit, a low noise common gate difference-differential pair transimpedance amplifier and a low power VCO. The potentiostat current measuring unit can detect electrochemical current ranging from 500 nA to 7 [Formula: see text] from the VACNF working electrodes with high degree of linearity. This current corresponds to a range of glucose, which depends on the fiber forest density. The potentiostat consumes 71.7 [Formula: see text] of power from a 1.8 V supply and occupies 0.017 [Formula: see text] of chip area realized in a 0.18 [Formula: see text] standard CMOS process.

The role of beach morphodynamic state on infragravity swash on beaches: field observations.

NASA Astrophysics Data System (ADS)

Gomes da Silva, Paula; González, Mauricio; Medina, Raul

2017-04-01

The runup generated by waves can be defined as the maximum height above sea water level on the coastline and is an important criterion for costal structures/nourishment design and erosion/flooding risk analysis. Given the complexity of nonlinear processes involved in the runup generation, its prediction is commonly made by means of empirical formulations that relate wave and beach parameters. The most accepted parametrization presented till the moment was proposed by Stockdon et al. (2006), in which the runup exceeded by 2 percent of the waves (R2) is described in terms of setup (η - the steady superelevation of the mean water level caused by breaking waves) and incident and infragravity swash (Sinc and Sig- time-varying fluctuations around the setup caused by non-breaking waves). Such formulation has been widely accepted and its efficiency was appraised in many works. Nevertheless, although empirical parametrization of infragravity swash using incident wave's parameters shows reasonable skill, the correlation can still present considerable scatter. The amount of infragravity energy on swash is directly related to the morphodynamic beach state, in a way that beach profiles classified as reflective (low wave energy, coarse sediment and higher beach slope) tend to show lower Sig values than dissipative ones (high wave energy, fine sediment and lower beach slope). However, since Stockdon's formula for predicting infragravity swash consider only wave parameters, its use implies that beaches receiving the same wave energy but with different grain size and beach slope would present the same Sig values. This work assumed the hypothesis that the scatter verified on the predictions of the infragravity swash is mainly related to the lack of information about the beach state in Stockdon formula. Based on that, a field campaign was designed and carried out in Somo-El Puntal beach, north Spain, with the aim of generating data to be analyzed in terms of infragravity swash. An important aspect about this field site is that, given the gradient of wave energy that reaches each part of the beach, it can present many morphodynamic states simultaneously, allowing a high range of measurements in a single beach. Thus, wave, currents, sediment and runup data were measured in three different profiles, as well as the whole beach topography, bathymetry and video camera images. These data, summed to those available from Stockdon study, were used to verify the validity of the hypothesis and to propose a new approach for empirically determining infragravity swash on beaches.

Determination of vitamin K1 in powdered infant formulas, using supercritical fluid extraction and liquid chromatography with electrochemical detection.

PubMed

Schneiderman, M A; Sharma, A K; Mahanama, K R; Locke, D C

1988-01-01

Vitamin K1 (phylloquinone) is extracted from commercial soy protein-based and milk-based powdered infant formulas by using supercritical fluid extraction with CO2 at 8000 psi and 60 degrees C. Quantitative extraction requires only 15 min, and does not suffer from the problems associated with conventional solvent extraction of lipophilic materials from media such as formulas. Vitamin K1 is determined in the extracts by using reverse-phase liquid chromatography (LC) with reductive mode electrochemical detection at a silver electrode polarized at -1.1 V vs SCE. LC run time is 9 min. The minimum detectable quantity is 80 pg, and response is linear over at least 5 orders of magnitude. Recovery of vitamin K1 from a milk-based powdered formula was 95.6% with RSD of 7.4%, and from a soy protein-based product, 94.4% recovery with RSD of 6.5%.

Single crystal to polycrystal neutron transmission simulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dessieux, Luc Lucius; Stoica, Alexandru Dan; Bingham, Philip R.

A collection of routines for calculation of the total cross section that determines the attenuation of neutrons by crystalline solids is presented. The total cross section is calculated semi-empirically as a function of crystal structure, neutron energy, temperature, and crystal orientation. The semi-empirical formula includes the contribution of parasitic Bragg scattering to the total cross section using both the crystal’s mosaic spread value and its orientation with respect to the neutron beam direction as parameters. These routines allow users to enter a distribution of crystal orientations for calculation of total cross sections of user defined powder or pseudo powder distributions,more » which enables simulation of non-uniformities such as texture and strain. In conclusion, the spectra for neutron transmission simulations in the neutron thermal energy range (2 meV–100 meV) are presented for single crystal and polycrystal samples and compared to measurements.« less

IB-LBM study on cell sorting by pinched flow fractionation.

PubMed

Ma, Jingtao; Xu, Yuanqing; Tian, Fangbao; Tang, Xiaoying

2014-01-01

Separation of two categories of cells in pinched flow fractionation(PFF) device is simulated by employing IB-LBM. The separation performances at low Reynolds number (about 1) under different pinched segment widths, flow ratios, cell features, and distances between neighboring cells are studied and the results are compared with those predicted by the empirical formula. The simulation indicates that the diluent flow rate should approximate to or more than the flow rate of particle solution in order to get a relatively ideal separation performance. The discrepancy of outflow position between numerical simulation and the empirical prediction enlarges, when the cells become more flexible. Too short distance between two neighboring cells could lead to cell banding which would result in incomplete separation, and the relative position of two neighboring cells influences the banding of cells. The present study will probably provide some new applications of PFF, and make some suggestions on the design of PFF devices.

Semi-empirical formulation of multiple scattering for the Gaussian beam model of heavy charged particles stopping in tissue-like matter.

PubMed

Kanematsu, Nobuyuki

2009-03-07

Dose calculation for radiotherapy with protons and heavier ions deals with a large volume of path integrals involving a scattering power of body tissue. This work provides a simple model for such demanding applications. There is an approximate linearity between RMS end-point displacement and range of incident particles in water, empirically found in measurements and detailed calculations. This fact was translated into a simple linear formula, from which the scattering power that is only inversely proportional to the residual range was derived. The simplicity enabled the analytical formulation for ions stopping in water, which was designed to be equivalent with the extended Highland model and agreed with measurements within 2% or 0.02 cm in RMS displacement. The simplicity will also improve the efficiency of numerical path integrals in the presence of heterogeneity.

Unfolding large-scale online collaborative human dynamics

PubMed Central

Zha, Yilong; Zhou, Tao; Zhou, Changsong

2016-01-01

Large-scale interacting human activities underlie all social and economic phenomena, but quantitative understanding of regular patterns and mechanism is very challenging and still rare. Self-organized online collaborative activities with a precise record of event timing provide unprecedented opportunity. Our empirical analysis of the history of millions of updates in Wikipedia shows a universal double–power-law distribution of time intervals between consecutive updates of an article. We then propose a generic model to unfold collaborative human activities into three modules: (i) individual behavior characterized by Poissonian initiation of an action, (ii) human interaction captured by a cascading response to previous actions with a power-law waiting time, and (iii) population growth due to the increasing number of interacting individuals. This unfolding allows us to obtain an analytical formula that is fully supported by the universal patterns in empirical data. Our modeling approaches reveal “simplicity” beyond complex interacting human activities. PMID:27911766

The interactions between vegetation and climate seasonality, topography on different time scales under the Budyko framework: case study in China's Loess Plateau

NASA Astrophysics Data System (ADS)

Liu, W.; Ning, T.; Shen, H.; Li, Z.

2017-12-01

Vegetation, climate seasonality and topography are the main impact factors controlling the water and heat balance over a catchment, and they are usually empirically formulated into the controlling parameter in Budyko model. However, their interactions on different time scales have not been fully addressed. Taking 30 catchments in China's Loess Plateau as an example, on annual scale, vegetation coverage was found poorly correlated with climate seasonality index; therefore, they could be both parameterized into the Budyko model. On the long-term scale, vegetation coverage tended to have close relationships with topographic conditions and climate seasonality, which was confirmed by the multi-collinearity problems; in that sense, vegetation information could fit the controlling parameter exclusively. Identifying the dominant controlling factors over different time scales, this study simplified the empirical parameterization of the Budyko formula. Though the above relationships further investigation over the other regions/catchments.

Two Empirical Models for Land-falling Hurricane Gust Factors

NASA Technical Reports Server (NTRS)

Merceret, Franics J.

2008-01-01

Gaussian and lognormal models for gust factors as a function of height and mean windspeed in land-falling hurricanes are presented. The models were empirically derived using data from 2004 hurricanes Frances and Jeanne and independently verified using data from 2005 hurricane Wilma. The data were collected from three wind towers at Kennedy Space Center and Cape Canaveral Air Force Station with instrumentation at multiple levels from 12 to 500 feet above ground level. An additional 200-foot tower was available for the verification. Mean wind speeds from 15 to 60 knots were included in the data. The models provide formulas for the mean and standard deviation of the gust factor given the mean windspeed and height above ground. These statistics may then be used to assess the probability of exceeding a specified peak wind threshold of operational significance given a specified mean wind speed.

Single crystal to polycrystal neutron transmission simulation

DOE PAGES

Dessieux, Luc Lucius; Stoica, Alexandru Dan; Bingham, Philip R.

2018-02-02

A collection of routines for calculation of the total cross section that determines the attenuation of neutrons by crystalline solids is presented. The total cross section is calculated semi-empirically as a function of crystal structure, neutron energy, temperature, and crystal orientation. The semi-empirical formula includes the contribution of parasitic Bragg scattering to the total cross section using both the crystal’s mosaic spread value and its orientation with respect to the neutron beam direction as parameters. These routines allow users to enter a distribution of crystal orientations for calculation of total cross sections of user defined powder or pseudo powder distributions,more » which enables simulation of non-uniformities such as texture and strain. In conclusion, the spectra for neutron transmission simulations in the neutron thermal energy range (2 meV–100 meV) are presented for single crystal and polycrystal samples and compared to measurements.« less

Measurements of fiducial cross-sections for [Formula: see text] production with one or two additional b-jets in pp collisions at [Formula: see text]=8 TeV using the ATLAS detector.

PubMed

Aad, G; Abbott, B; Abdallah, J; Abdinov, O; Aben, R; Abolins, M; AbouZeid, O S; Abramowicz, H; Abreu, H; Abreu, R; Abulaiti, Y; Acharya, B S; Adamczyk, L; Adams, D L; Adelman, J; Adomeit, S; Adye, T; Affolder, A A; Agatonovic-Jovin, T; Agricola, J; Aguilar-Saavedra, J A; Ahlen, S P; Ahmadov, F; Aielli, G; Akerstedt, H; Åkesson, T P A; Akimov, A V; Alberghi, G L; Albert, J; Albrand, S; Alconada Verzini, M J; Aleksa, M; Aleksandrov, I N; Alexa, C; Alexander, G; Alexopoulos, T; Alhroob, M; Alimonti, G; Alio, L; Alison, J; Alkire, S P; Allbrooke, B M M; Allport, P P; Aloisio, A; Alonso, A; Alonso, F; Alpigiani, C; Altheimer, A; Alvarez Gonzalez, B; Álvarez Piqueras, D; Alviggi, M G; Amadio, B T; Amako, K; Amaral Coutinho, Y; Amelung, C; Amidei, D; Amor Dos Santos, S P; Amorim, A; Amoroso, S; Amram, N; Amundsen, G; Anastopoulos, C; Ancu, L S; Andari, N; Andeen, T; Anders, C F; Anders, G; Anders, J K; Anderson, K J; Andreazza, A; Andrei, V; Angelidakis, S; Angelozzi, I; Anger, P; Angerami, A; Anghinolfi, F; Anisenkov, A V; Anjos, N; Annovi, A; Antonelli, M; Antonov, A; Antos, J; Anulli, F; Aoki, M; Aperio Bella, L; Arabidze, G; Arai, Y; Araque, J P; Arce, A T H; Arduh, F A; Arguin, J-F; Argyropoulos, S; Arik, M; Armbruster, A J; Arnaez, O; Arnold, H; Arratia, M; Arslan, O; Artamonov, A; Artoni, G; Asai, S; Asbah, N; Ashkenazi, A; Åsman, B; Asquith, L; Assamagan, K; Astalos, R; Atkinson, M; Atlay, N B; Augsten, K; Aurousseau, M; Avolio, G; Axen, B; Ayoub, M K; Azuelos, G; Baak, M A; Baas, A E; Baca, M J; Bacci, C; Bachacou, H; Bachas, K; Backes, M; Backhaus, M; Bagiacchi, P; Bagnaia, P; Bai, Y; Bain, T; Baines, J T; Baker, O K; Baldin, E M; Balek, P; Balestri, T; Balli, F; Balunas, W K; Banas, E; Banerjee, Sw; Bannoura, A A E; Barak, L; Barberio, E L; Barberis, D; Barbero, M; Barillari, T; Barisonzi, M; Barklow, T; Barlow, N; Barnes, S L; Barnett, B M; Barnett, R M; Barnovska, Z; Baroncelli, A; Barone, G; Barr, A J; Barreiro, F; Barreiro Guimarães da Costa, J; Bartoldus, R; Barton, A E; Bartos, P; Basalaev, A; Bassalat, A; Basye, A; Bates, R L; Batista, S J; Batley, J R; Battaglia, M; Bauce, M; Bauer, F; Bawa, H S; Beacham, J B; Beattie, M D; Beau, T; Beauchemin, P H; Beccherle, R; Bechtle, P; Beck, H P; Becker, K; Becker, M; Beckingham, M; Becot, C; Beddall, A J; Beddall, A; Bednyakov, V A; Bee, C P; Beemster, L J; Beermann, T A; Begel, M; Behr, J K; Belanger-Champagne, C; Bell, W H; Bella, G; Bellagamba, L; Bellerive, A; Bellomo, M; Belotskiy, K; Beltramello, O; Benary, O; Benchekroun, D; Bender, M; Bendtz, K; Benekos, N; Benhammou, Y; Benhar Noccioli, E; Benitez Garcia, J A; Benjamin, D P; Bensinger, J R; Bentvelsen, S; Beresford, L; Beretta, M; Berge, D; Bergeaas Kuutmann, E; Berger, N; Berghaus, F; Beringer, J; Bernard, C; Bernard, N R; Bernius, C; Bernlochner, F U; Berry, T; Berta, P; Bertella, C; Bertoli, G; Bertolucci, F; Bertsche, C; Bertsche, D; Besana, M I; Besjes, G J; Bessidskaia Bylund, O; Bessner, M; Besson, N; Betancourt, C; Bethke, S; Bevan, A J; Bhimji, W; Bianchi, R M; Bianchini, L; Bianco, M; Biebel, O; Biedermann, D; Bieniek, S P; Biglietti, M; Bilbao De Mendizabal, J; Bilokon, H; Bindi, M; Binet, S; Bingul, A; Bini, C; Biondi, S; Bjergaard, D M; Black, C W; Black, J E; Black, K M; Blackburn, D; Blair, R E; Blanchard, J-B; Blanco, J E; Blazek, T; Bloch, I; Blocker, C; Blum, W; Blumenschein, U; Blunier, S; Bobbink, G J; Bobrovnikov, V S; Bocchetta, S S; Bocci, A; Bock, C; Boehler, M; Bogaerts, J A; Bogavac, D; Bogdanchikov, A G; Bohm, C; Boisvert, V; Bold, T; Boldea, V; Boldyrev, A S; Bomben, M; Bona, M; Boonekamp, M; Borisov, A; Borissov, G; Borroni, S; Bortfeldt, J; Bortolotto, V; Bos, K; Boscherini, D; Bosman, M; Boudreau, J; Bouffard, J; Bouhova-Thacker, E V; Boumediene, D; Bourdarios, C; Bousson, N; Boutle, S K; Boveia, A; Boyd, J; Boyko, I R; Bozic, I; Bracinik, J; Brandt, A; Brandt, G; Brandt, O; Bratzler, U; Brau, B; Brau, J E; Braun, H M; Breaden Madden, W D; Brendlinger, K; Brennan, A J; Brenner, L; Brenner, R; Bressler, S; Bristow, K; Bristow, T M; Britton, D; Britzger, D; Brochu, F M; Brock, I; Brock, R; Bronner, J; Brooijmans, G; Brooks, T; Brooks, W K; Brosamer, J; Brost, E; Bruckman de Renstrom, P A; Bruncko, D; Bruneliere, R; Bruni, A; Bruni, G; Bruschi, M; Bruscino, N; Bryngemark, L; Buanes, T; Buat, Q; Buchholz, P; Buckley, A G; Buda, S I; Budagov, I A; Buehrer, F; Bugge, L; Bugge, M K; Bulekov, O; Bullock, D; Burckhart, H; Burdin, S; Burgard, C D; Burghgrave, B; Burke, S; Burmeister, I; Busato, E; Büscher, D; Büscher, V; Bussey, P; Butler, J M; Butt, A I; Buttar, C M; Butterworth, J M; Butti, P; Buttinger, W; Buzatu, A; Buzykaev, A R; Cabrera Urbán, S; Caforio, D; Cairo, V M; Cakir, O; Calace, N; Calafiura, P; Calandri, A; Calderini, G; Calfayan, P; Caloba, L P; Calvet, D; Calvet, S; Camacho Toro, R; Camarda, S; Camarri, P; Cameron, D; Caminal Armadans, R; Campana, S; Campanelli, M; Campoverde, A; Canale, V; Canepa, A; Cano Bret, M; Cantero, J; Cantrill, R; Cao, T; Capeans Garrido, M D M; Caprini, I; Caprini, M; Capua, M; Caputo, R; Cardarelli, R; Cardillo, F; Carli, T; Carlino, G; Carminati, L; Caron, S; Carquin, E; Carrillo-Montoya, G D; Carter, J R; Carvalho, J; Casadei, D; Casado, M P; Casolino, M; Castaneda-Miranda, E; Castelli, A; Castillo Gimenez, V; Castro, N F; Catastini, P; Catinaccio, A; Catmore, J R; Cattai, A; Caudron, J; Cavaliere, V; Cavalli, D; Cavalli-Sforza, M; Cavasinni, V; Ceradini, F; Cerio, B C; Cerny, K; Cerqueira, A S; Cerri, A; Cerrito, L; Cerutti, F; Cerv, M; Cervelli, A; Cetin, S A; Chafaq, A; Chakraborty, D; Chalupkova, I; Chang, P; Chapman, J D; Charlton, D G; Chau, C C; Chavez Barajas, C A; Cheatham, S; Chegwidden, A; Chekanov, S; Chekulaev, S V; Chelkov, G A; Chelstowska, M A; Chen, C; Chen, H; Chen, K; Chen, L; Chen, S; Chen, S; Chen, X; Chen, Y; Cheng, H C; Cheng, Y; Cheplakov, A; Cheremushkina, E; Cherkaoui El Moursli, R; Chernyatin, V; Cheu, E; Chevalier, L; Chiarella, V; Chiarelli, G; Chiodini, G; Chisholm, A S; Chislett, R T; Chitan, A; Chizhov, M V; Choi, K; Chouridou, S; Chow, B K B; Christodoulou, V; Chromek-Burckhart, D; Chudoba, J; Chuinard, A J; Chwastowski, J J; Chytka, L; Ciapetti, G; Ciftci, A K; Cinca, D; Cindro, V; Cioara, I A; Ciocio, A; Cirotto, F; Citron, Z H; Ciubancan, M; Clark, A; Clark, B L; Clark, P J; Clarke, R N; Clement, C; Coadou, Y; Cobal, M; Coccaro, A; Cochran, J; Coffey, L; Cogan, J G; Colasurdo, L; Cole, B; Cole, S; Colijn, A P; Collot, J; Colombo, T; Compostella, G; Conde Muiño, P; Coniavitis, E; Connell, S H; Connelly, I A; Consorti, V; Constantinescu, S; Conta, C; Conti, G; Conventi, F; Cooke, M; Cooper, B D; Cooper-Sarkar, A M; Cornelissen, T; Corradi, M; Corriveau, F; Corso-Radu, A; Cortes-Gonzalez, A; Cortiana, G; Costa, G; Costa, M J; Costanzo, D; Côté, D; Cottin, G; Cowan, G; Cox, B E; Cranmer, K; Cree, G; Crépé-Renaudin, S; Crescioli, F; Cribbs, W A; Crispin Ortuzar, M; Cristinziani, M; Croft, V; Crosetti, G; Cuhadar Donszelmann, T; Cummings, J; Curatolo, M; Cúth, J; Cuthbert, C; Czirr, H; Czodrowski, P; D'Auria, S; D'Onofrio, M; Da Cunha Sargedas De Sousa, M J; Da Via, C; Dabrowski, W; Dafinca, A; Dai, T; Dale, O; Dallaire, F; Dallapiccola, C; Dam, M; Dandoy, J R; Dang, N P; Daniells, A C; Danninger, M; Dano Hoffmann, M; Dao, V; Darbo, G; Darmora, S; Dassoulas, J; Dattagupta, A; Davey, W; David, C; Davidek, T; Davies, E; Davies, M; Davison, P; Davygora, Y; Dawe, E; Dawson, I; Daya-Ishmukhametova, R K; De, K; de Asmundis, R; De Benedetti, A; De Castro, S; De Cecco, S; De Groot, N; de Jong, P; De la Torre, H; De Lorenzi, F; De Pedis, D; De Salvo, A; De Sanctis, U; De Santo, A; De Vivie De Regie, J B; Dearnaley, W J; Debbe, R; Debenedetti, C; Dedovich, D V; Deigaard, I; Del Peso, J; Del Prete, T; Delgove, D; Deliot, F; Delitzsch, C M; Deliyergiyev, M; Dell'Acqua, A; Dell'Asta, L; Dell'Orso, M; Della Pietra, M; Della Volpe, D; Delmastro, M; Delsart, P A; Deluca, C; DeMarco, D A; Demers, S; Demichev, M; Demilly, A; Denisov, S P; Derendarz, D; Derkaoui, J E; Derue, F; Dervan, P; Desch, K; Deterre, C; Deviveiros, P O; Dewhurst, A; Dhaliwal, S; Di Ciaccio, A; Di Ciaccio, L; Di Domenico, A; Di Donato, C; Di Girolamo, A; Di Girolamo, B; Di Mattia, A; Di Micco, B; Di Nardo, R; Di Simone, A; Di Sipio, R; Di Valentino, D; Diaconu, C; Diamond, M; Dias, F A; Diaz, M A; Diehl, E B; Dietrich, J; Diglio, S; Dimitrievska, A; Dingfelder, J; Dita, P; Dita, S; Dittus, F; Djama, F; Djobava, T; Djuvsland, J I; do Vale, M A B; Dobos, D; Dobre, M; Doglioni, C; Dohmae, T; Dolejsi, J; Dolezal, Z; Dolgoshein, B A; Donadelli, M; Donati, S; Dondero, P; Donini, J; Dopke, J; Doria, A; Dova, M T; Doyle, A T; Drechsler, E; Dris, M; Dubreuil, E; Duchovni, E; Duckeck, G; Ducu, O A; Duda, D; Dudarev, A; Duflot, L; Duguid, L; Dührssen, M; Dunford, M; Duran Yildiz, H; Düren, M; Durglishvili, A; Duschinger, D; Dyndal, M; Eckardt, C; Ecker, K M; Edgar, R C; Edson, W; Edwards, N C; Ehrenfeld, W; Eifert, T; Eigen, G; Einsweiler, K; Ekelof, T; El Kacimi, M; Ellert, M; Elles, S; Ellinghaus, F; Elliot, A A; Ellis, N; Elmsheuser, J; Elsing, M; Emeliyanov, D; Enari, Y; Endner, O C; Endo, M; Erdmann, J; Ereditato, A; Ernis, G; Ernst, J; Ernst, M; Errede, S; Ertel, E; Escalier, M; Esch, H; Escobar, C; Esposito, B; Etienvre, A I; Etzion, E; Evans, H; Ezhilov, A; Fabbri, L; Facini, G; Fakhrutdinov, R M; Falciano, S; Falla, R J; Faltova, J; Fang, Y; Fanti, M; Farbin, A; Farilla, A; Farooque, T; Farrell, S; Farrington, S M; Farthouat, P; Fassi, F; Fassnacht, P; Fassouliotis, D; Faucci Giannelli, M; Favareto, A; Fayard, L; Fedin, O L; Fedorko, W; Feigl, S; Feligioni, L; Feng, C; Feng, E J; Feng, H; Fenyuk, A B; Feremenga, L; Fernandez Martinez, P; Fernandez Perez, S; Ferrando, J; Ferrari, A; Ferrari, P; Ferrari, R; Ferreira de Lima, D E; Ferrer, A; Ferrere, D; Ferretti, C; Ferretto Parodi, A; Fiascaris, M; Fiedler, F; Filipčič, A; Filipuzzi, M; Filthaut, F; Fincke-Keeler, M; Finelli, K D; Fiolhais, M C N; Fiorini, L; Firan, A; Fischer, A; Fischer, C; Fischer, J; Fisher, W C; Flaschel, N; Fleck, I; Fleischmann, P; Fletcher, G T; Fletcher, G; Fletcher, R R M; Flick, T; Floderus, A; Flores Castillo, L R; Flowerdew, M J; Formica, A; Forti, A; Fournier, D; Fox, H; Fracchia, S; Francavilla, P; Franchini, M; Francis, D; Franconi, L; Franklin, M; Frate, M; Fraternali, M; Freeborn, D; French, S T; Friedrich, F; Froidevaux, D; Frost, J A; Fukunaga, C; Fullana Torregrosa, E; Fulsom, B G; Fusayasu, T; Fuster, J; Gabaldon, C; Gabizon, O; Gabrielli, A; Gabrielli, A; Gach, G P; Gadatsch, S; Gadomski, S; Gagliardi, G; Gagnon, P; Galea, C; Galhardo, B; Gallas, E J; Gallop, B J; Gallus, P; Galster, G; Gan, K K; Gao, J; Gao, Y; Gao, Y S; Garay Walls, F M; Garberson, F; García, C; García Navarro, J E; Garcia-Sciveres, M; Gardner, R W; Garelli, N; Garonne, V; Gatti, C; Gaudiello, A; Gaudio, G; Gaur, B; Gauthier, L; Gauzzi, P; Gavrilenko, I L; Gay, C; Gaycken, G; Gazis, E N; Ge, P; Gecse, Z; Gee, C N P; Geich-Gimbel, Ch; Geisler, M P; Gemme, C; Genest, M H; Gentile, S; George, M; George, S; Gerbaudo, D; Gershon, A; Ghasemi, S; Ghazlane, H; Giacobbe, B; Giagu, S; Giangiobbe, V; Giannetti, P; Gibbard, B; Gibson, S M; Gignac, M; Gilchriese, M; Gillam, T P S; Gillberg, D; Gilles, G; Gingrich, D M; Giokaris, N; Giordani, M P; Giorgi, F M; Giorgi, F M; Giraud, P F; Giromini, P; Giugni, D; Giuliani, C; Giulini, M; Gjelsten, B K; Gkaitatzis, S; Gkialas, I; Gkougkousis, E L; Gladilin, L K; Glasman, C; Glatzer, J; Glaysher, P C F; Glazov, A; Goblirsch-Kolb, M; Goddard, J R; Godlewski, J; Goldfarb, S; Golling, T; Golubkov, D; Gomes, A; Gonçalo, R; Goncalves Pinto Firmino Da Costa, J; Gonella, L; González de la Hoz, S; Gonzalez Parra, G; Gonzalez-Sevilla, S; Goossens, L; Gorbounov, P A; Gordon, H A; Gorelov, I; Gorini, B; Gorini, E; Gorišek, A; Gornicki, E; Goshaw, A T; Gössling, C; Gostkin, M I; Goujdami, D; Goussiou, A G; Govender, N; Gozani, E; Grabas, H M X; Graber, L; Grabowska-Bold, I; Gradin, P O J; Grafström, P; Grahn, K-J; Gramling, J; Gramstad, E; Grancagnolo, S; Gratchev, V; Gray, H M; Graziani, E; Greenwood, Z D; Grefe, C; Gregersen, K; Gregor, I M; Grenier, P; Griffiths, J; Grillo, A A; Grimm, K; Grinstein, S; Gris, Ph; Grivaz, J-F; Grohs, J P; Grohsjean, A; Gross, E; Grosse-Knetter, J; Grossi, G C; Grout, Z J; Guan, L; Guenther, J; Guescini, F; Guest, D; Gueta, O; Guido, E; Guillemin, T; Guindon, S; Gul, U; Gumpert, C; Guo, J; Guo, Y; Gupta, S; Gustavino, G; Gutierrez, P; Gutierrez Ortiz, N G; Gutschow, C; Guyot, C; Gwenlan, C; Gwilliam, C B; Haas, A; Haber, C; Hadavand, H K; Haddad, N; Haefner, P; Hageböck, S; Hajduk, Z; Hakobyan, H; Haleem, M; Haley, J; Hall, D; Halladjian, G; Hallewell, G D; Hamacher, K; Hamal, P; Hamano, K; Hamilton, A; Hamity, G N; Hamnett, P G; Han, L; Hanagaki, K; Hanawa, K; Hance, M; Haney, B; Hanke, P; Hanna, R; Hansen, J B; Hansen, J D; Hansen, M C; Hansen, P H; Hara, K; Hard, A S; Harenberg, T; Hariri, F; Harkusha, S; Harrington, R D; Harrison, P F; Hartjes, F; Hasegawa, M; Hasegawa, Y; Hasib, A; Hassani, S; Haug, S; Hauser, R; Hauswald, L; Havranek, M; Hawkes, C M; Hawkings, R J; Hawkins, A D; Hayashi, T; Hayden, D; Hays, C P; Hays, J M; Hayward, H S; Haywood, S J; Head, S J; Heck, T; Hedberg, V; Heelan, L; Heim, S; Heim, T; Heinemann, B; Heinrich, L; Hejbal, J; Helary, L; Hellman, S; Hellmich, D; Helsens, C; Henderson, J; Henderson, R C W; Heng, Y; Hengler, C; Henkelmann, S; Henrichs, A; Henriques Correia, A M; Henrot-Versille, S; Herbert, G H; Hernández Jiménez, Y; Herten, G; Hertenberger, R; Hervas, L; Hesketh, G G; Hessey, N P; Hetherly, J W; Hickling, R; Higón-Rodriguez, E; Hill, E; Hill, J C; Hiller, K H; Hillier, S J; Hinchliffe, I; Hines, E; Hinman, R R; Hirose, M; Hirschbuehl, D; Hobbs, J; Hod, N; Hodgkinson, M C; Hodgson, P; Hoecker, A; Hoeferkamp, M R; Hoenig, F; Hohlfeld, M; Hohn, D; Holmes, T R; Homann, M; Hong, T M; Hopkins, W H; Horii, Y; Horton, A J; Hostachy, J-Y; Hou, S; Hoummada, A; Howard, J; Howarth, J; Hrabovsky, M; Hristova, I; Hrivnac, J; Hryn'ova, T; Hrynevich, A; Hsu, C; Hsu, P J; Hsu, S-C; Hu, D; Hu, Q; Hu, X; Huang, Y; Hubacek, Z; Hubaut, F; Huegging, F; Huffman, T B; Hughes, E W; Hughes, G; Huhtinen, M; Hülsing, T A; Huseynov, N; Huston, J; Huth, J; Iacobucci, G; Iakovidis, G; Ibragimov, I; Iconomidou-Fayard, L; Ideal, E; Idrissi, Z; Iengo, P; Igonkina, O; Iizawa, T; Ikegami, Y; Ikematsu, K; Ikeno, M; Ilchenko, Y; Iliadis, D; Ilic, N; Ince, T; Introzzi, G; Ioannou, P; Iodice, M; Iordanidou, K; Ippolito, V; Irles Quiles, A; Isaksson, C; Ishino, M; Ishitsuka, M; Ishmukhametov, R; Issever, C; Istin, S; Iturbe Ponce, J M; Iuppa, R; Ivarsson, J; Iwanski, W; Iwasaki, H; Izen, J M; Izzo, V; Jabbar, S; Jackson, B; Jackson, M; Jackson, P; Jaekel, M R; Jain, V; Jakobs, K; Jakobsen, S; Jakoubek, T; Jakubek, J; Jamin, D O; Jana, D K; Jansen, E; Jansky, R; Janssen, J; Janus, M; Jarlskog, G; Javadov, N; Javůrek, T; Jeanty, L; Jejelava, J; Jeng, G-Y; Jennens, D; Jenni, P; Jentzsch, J; Jeske, C; Jézéquel, S; Ji, H; Jia, J; Jiang, Y; Jiggins, S; Jimenez Pena, J; Jin, S; Jinaru, A; Jinnouchi, O; Joergensen, M D; Johansson, P; Johns, K A; Johnson, W J; Jon-And, K; Jones, G; Jones, R W L; Jones, T J; Jongmanns, J; Jorge, P M; Joshi, K D; Jovicevic, J; Ju, X; Jussel, P; Juste Rozas, A; Kaci, M; Kaczmarska, A; Kado, M; Kagan, H; Kagan, M; Kahn, S J; Kajomovitz, E; Kalderon, C W; Kama, S; Kamenshchikov, A; Kanaya, N; Kaneti, S; Kantserov, V A; Kanzaki, J; Kaplan, B; Kaplan, L S; Kapliy, A; Kar, D; Karakostas, K; Karamaoun, A; Karastathis, N; Kareem, M J; Karentzos, E; Karnevskiy, M; Karpov, S N; Karpova, Z M; Karthik, K; Kartvelishvili, V; Karyukhin, A N; Kasahara, K; Kashif, L; Kass, R D; Kastanas, A; Kataoka, Y; Kato, C; Katre, A; Katzy, J; Kawagoe, K; Kawamoto, T; Kawamura, G; Kazama, S; Kazanin, V F; Keeler, R; Kehoe, R; Keller, J S; Kempster, J J; Keoshkerian, H; Kepka, O; Kerševan, B P; Kersten, S; Keyes, R A; Khalil-Zada, F; Khandanyan, H; Khanov, A; Kharlamov, A G; Khoo, T J; Khovanskiy, V; Khramov, E; Khubua, J; Kido, S; Kim, H Y; Kim, S H; Kim, Y K; Kimura, N; Kind, O M; King, B T; King, M; King, S B; Kirk, J; Kiryunin, A E; Kishimoto, T; Kisielewska, D; Kiss, F; Kiuchi, K; Kivernyk, O; Kladiva, E; Klein, M H; Klein, M; Klein, U; Kleinknecht, K; Klimek, P; Klimentov, A; Klingenberg, R; Klinger, J A; Klioutchnikova, T; Kluge, E-E; Kluit, P; Kluth, S; Knapik, J; Kneringer, E; Knoops, E B F G; Knue, A; Kobayashi, A; Kobayashi, D; Kobayashi, T; Kobel, M; Kocian, M; Kodys, P; Koffas, T; Koffeman, E; Kogan, L A; Kohlmann, S; Kohout, Z; Kohriki, T; Koi, T; Kolanoski, H; Kolb, M; Koletsou, I; Komar, A A; Komori, Y; Kondo, T; Kondrashova, N; Köneke, K; König, A C; Kono, T; Konoplich, R; Konstantinidis, N; Kopeliansky, R; Koperny, S; Köpke, L; Kopp, A K; Korcyl, K; Kordas, K; Korn, A; Korol, A A; Korolkov, I; Korolkova, E V; Kortner, O; Kortner, S; Kosek, T; Kostyukhin, V V; Kotov, V M; Kotwal, A; Kourkoumeli-Charalampidi, A; Kourkoumelis, C; Kouskoura, V; Koutsman, A; Kowalewski, R; Kowalski, T Z; Kozanecki, W; Kozhin, A S; Kramarenko, V A; Kramberger, G; Krasnopevtsev, D; Krasny, M W; Krasznahorkay, A; Kraus, J K; Kravchenko, A; Kreiss, S; Kretz, M; Kretzschmar, J; Kreutzfeldt, K; Krieger, P; Krizka, K; Kroeninger, K; Kroha, H; Kroll, J; Kroseberg, J; Krstic, J; Kruchonak, U; Krüger, H; Krumnack, N; Kruse, A; Kruse, M C; Kruskal, M; Kubota, T; Kucuk, H; Kuday, S; Kuehn, S; Kugel, A; Kuger, F; Kuhl, A; Kuhl, T; Kukhtin, V; Kukla, R; Kulchitsky, Y; Kuleshov, S; Kuna, M; Kunigo, T; Kupco, A; Kurashige, H; Kurochkin, Y A; Kus, V; Kuwertz, E S; Kuze, M; Kvita, J; Kwan, T; Kyriazopoulos, D; La Rosa, A; La Rosa Navarro, J L; La Rotonda, L; Lacasta, C; Lacava, F; Lacey, J; Lacker, H; Lacour, D; Lacuesta, V R; Ladygin, E; Lafaye, R; Laforge, B; Lagouri, T; Lai, S; Lambourne, L; Lammers, S; Lampen, C L; Lampl, W; Lançon, E; Landgraf, U; Landon, M P J; Lang, V S; Lange, J C; Lankford, A J; Lanni, F; Lantzsch, K; Lanza, A; Laplace, S; Lapoire, C; Laporte, J F; Lari, T; Lasagni Manghi, F; Lassnig, M; Laurelli, P; Lavrijsen, W; Law, A T; Laycock, P; Lazovich, T; Le Dortz, O; Le Guirriec, E; Le Menedeu, E; LeBlanc, M; LeCompte, T; Ledroit-Guillon, F; Lee, C A; Lee, S C; Lee, L; Lefebvre, G; Lefebvre, M; Legger, F; Leggett, C; Lehan, A; Lehmann Miotto, G; Lei, X; Leight, W A; Leisos, A; Leister, A G; Leite, M A L; Leitner, R; Lellouch, D; Lemmer, B; Leney, K J C; Lenz, T; Lenzi, B; Leone, R; Leone, S; Leonidopoulos, C; Leontsinis, S; Leroy, C; Lester, C G; Levchenko, M; Levêque, J; Levin, D; Levinson, L J; Levy, M; Lewis, A; Leyko, A M; Leyton, M; Li, B; Li, H; Li, H L; Li, L; Li, L; Li, S; Li, X; Li, Y; Liang, Z; Liao, H; Liberti, B; Liblong, A; Lichard, P; Lie, K; Liebal, J; Liebig, W; Limbach, C; Limosani, A; Lin, S C; Lin, T H; Linde, F; Lindquist, B E; Linnemann, J T; Lipeles, E; Lipniacka, A; Lisovyi, M; Liss, T M; Lissauer, D; Lister, A; Litke, A M; Liu, B; Liu, D; Liu, H; Liu, J; Liu, J B; Liu, K; Liu, L; Liu, M; Liu, M; Liu, Y; Livan, M; Lleres, A; Llorente Merino, J; Lloyd, S L; Lo Sterzo, F; Lobodzinska, E; Loch, P; Lockman, W S; Loebinger, F K; Loevschall-Jensen, A E; Loew, K M; Loginov, A; Lohse, T; Lohwasser, K; Lokajicek, M; Long, B A; Long, J D; Long, R E; Looper, K A; Lopes, L; Lopez Mateos, D; Lopez Paredes, B; Lopez Paz, I; Lorenz, J; Lorenzo Martinez, N; Losada, M; Lösel, P J; Lou, X; Lounis, A; Love, J; Love, P A; Lu, N; Lubatti, H J; Luci, C; Lucotte, A; Luedtke, C; Luehring, F; Lukas, W; Luminari, L; Lundberg, O; Lund-Jensen, B; Lynn, D; Lysak, R; Lytken, E; Ma, H; Ma, L L; Maccarrone, G; Macchiolo, A; Macdonald, C M; Maček, B; Machado Miguens, J; Macina, D; Madaffari, D; Madar, R; Maddocks, H J; Mader, W F; Madsen, A; Maeda, J; Maeland, S; Maeno, T; Maevskiy, A; Magradze, E; Mahboubi, K; Mahlstedt, J; Maiani, C; Maidantchik, C; Maier, A A; Maier, T; Maio, A; Majewski, S; Makida, Y; Makovec, N; Malaescu, B; Malecki, Pa; Maleev, V P; Malek, F; Mallik, U; Malon, D; Malone, C; Maltezos, S; Malyshev, V M; Malyukov, S; Mamuzic, J; Mancini, G; Mandelli, B; Mandelli, L; Mandić, I; Mandrysch, R; Maneira, J; Manfredini, A; Manhaes de Andrade Filho, L; Manjarres Ramos, J; Mann, A; Manousakis-Katsikakis, A; Mansoulie, B; Mantifel, R; Mantoani, M; Mapelli, L; March, L; Marchiori, G; Marcisovsky, M; Marino, C P; Marjanovic, M; Marley, D E; Marroquim, F; Marsden, S P; Marshall, Z; Marti, L F; Marti-Garcia, S; Martin, B; Martin, T A; Martin, V J; Martin Dit Latour, B; Martinez, M; Martin-Haugh, S; Martoiu, V S; Martyniuk, A C; Marx, M; Marzano, F; Marzin, A; Masetti, L; Mashimo, T; Mashinistov, R; Masik, J; Maslennikov, A L; Massa, I; Massa, L; Mastrandrea, P; Mastroberardino, A; Masubuchi, T; Mättig, P; Mattmann, J; Maurer, J; Maxfield, S J; Maximov, D A; Mazini, R; Mazza, S M; Mc Goldrick, G; Mc Kee, S P; McCarn, A; McCarthy, R L; McCarthy, T G; McCubbin, N A; McFarlane, K W; Mcfayden, J A; Mchedlidze, G; McMahon, S J; McPherson, R A; Medinnis, M; Meehan, S; Mehlhase, S; Mehta, A; Meier, K; Meineck, C; Meirose, B; Mellado Garcia, B R; Meloni, F; Mengarelli, A; Menke, S; Meoni, E; Mercurio, K M; Mergelmeyer, S; Mermod, P; Merola, L; Meroni, C; Merritt, F S; Messina, A; Metcalfe, J; Mete, A S; Meyer, C; Meyer, C; Meyer, J-P; Meyer, J; Meyer Zu Theenhausen, H; Middleton, R P; Miglioranzi, S; Mijović, L; Mikenberg, G; Mikestikova, M; Mikuž, M; Milesi, M; Milic, A; Miller, D W; Mills, C; Milov, A; Milstead, D A; Minaenko, A A; Minami, Y; Minashvili, I A; Mincer, A I; Mindur, B; Mineev, M; Ming, Y; Mir, L M; Mistry, K P; Mitani, T; Mitrevski, J; Mitsou, V A; Miucci, A; Miyagawa, P S; Mjörnmark, J U; Moa, T; Mochizuki, K; Mohapatra, S; Mohr, W; Molander, S; Moles-Valls, R; Monden, R; Mönig, K; Monini, C; Monk, J; Monnier, E; Montalbano, A; Montejo Berlingen, J; Monticelli, F; Monzani, S; Moore, R W; Morange, N; Moreno, D; Moreno Llácer, M; Morettini, P; Mori, D; Mori, T; Morii, M; Morinaga, M; Morisbak, V; Moritz, S; Morley, A K; Mornacchi, G; Morris, J D; Mortensen, S S; Morton, A; Morvaj, L; Mosidze, M; Moss, J; Motohashi, K; Mount, R; Mountricha, E; Mouraviev, S V; Moyse, E J W; Muanza, S; Mudd, R D; Mueller, F; Mueller, J; Mueller, R S P; Mueller, T; Muenstermann, D; Mullen, P; Mullier, G A; Murillo Quijada, J A; Murray, W J; Musheghyan, H; Musto, E; Myagkov, A G; Myska, M; Nachman, B P; Nackenhorst, O; Nadal, J; Nagai, K; Nagai, R; Nagai, Y; Nagano, K; Nagarkar, A; Nagasaka, Y; Nagata, K; Nagel, M; Nagy, E; Nairz, A M; Nakahama, Y; Nakamura, K; Nakamura, T; Nakano, I; Namasivayam, H; Naranjo Garcia, R F; Narayan, R; Narrias Villar, D I; Naumann, T; Navarro, G; Nayyar, R; Neal, H A; Nechaeva, P Yu; Neep, T J; Nef, P D; Negri, A; Negrini, M; Nektarijevic, S; Nellist, C; Nelson, A; Nemecek, S; Nemethy, P; Nepomuceno, A A; Nessi, M; Neubauer, M S; Neumann, M; Neves, R M; Nevski, P; Newman, P R; Nguyen, D H; Nickerson, R B; Nicolaidou, R; Nicquevert, B; Nielsen, J; Nikiforou, N; Nikiforov, A; Nikolaenko, V; Nikolic-Audit, I; Nikolopoulos, K; Nilsen, J K; Nilsson, P; Ninomiya, Y; Nisati, A; Nisius, R; Nobe, T; Nomachi, M; Nomidis, I; Nooney, T; Norberg, S; Nordberg, M; Novgorodova, O; Nowak, S; Nozaki, M; Nozka, L; Ntekas, K; Nunes Hanninger, G; Nunnemann, T; Nurse, E; Nuti, F; O'Brien, B J; O'grady, F; O'Neil, D C; O'Shea, V; Oakham, F G; Oberlack, H; Obermann, T; Ocariz, J; Ochi, A; Ochoa, I; Ochoa-Ricoux, J P; Oda, S; Odaka, S; Ogren, H; Oh, A; Oh, S H; Ohm, C C; Ohman, H; Oide, H; Okamura, W; Okawa, H; Okumura, Y; Okuyama, T; Olariu, A; Olivares Pino, S A; Oliveira Damazio, D; Olszewski, A; Olszowska, J; Onofre, A; Onogi, K; Onyisi, P U E; Oram, C J; Oreglia, M J; Oren, Y; Orestano, D; Orlando, N; Oropeza Barrera, C; Orr, R S; Osculati, B; Ospanov, R; Otero Y Garzon, G; Otono, H; Ouchrif, M; Ould-Saada, F; Ouraou, A; Oussoren, K P; Ouyang, Q; Ovcharova, A; Owen, M; Owen, R E; Ozcan, V E; Ozturk, N; Pachal, K; Pacheco Pages, A; Padilla Aranda, C; Pagáčová, M; Pagan Griso, S; Paganis, E; Paige, F; Pais, P; Pajchel, K; Palacino, G; Palestini, S; Palka, M; Pallin, D; Palma, A; Pan, Y B; Panagiotopoulou, E; Pandini, C E; Panduro Vazquez, J G; Pani, P; Panitkin, S; Pantea, D; Paolozzi, L; Papadopoulou, Th D; Papageorgiou, K; Paramonov, A; Paredes Hernandez, D; Parker, M A; Parker, K A; Parodi, F; Parsons, J A; Parzefall, U; Pasqualucci, E; Passaggio, S; Pastore, F; Pastore, Fr; Pásztor, G; Pataraia, S; Patel, N D; Pater, J R; Pauly, T; Pearce, J; Pearson, B; Pedersen, L E; Pedersen, M; Pedraza Lopez, S; Pedro, R; Peleganchuk, S V; Pelikan, D; Penc, O; Peng, C; Peng, H; Penning, B; Penwell, J; Perepelitsa, D V; Perez Codina, E; Pérez García-Estañ, M T; Perini, L; Pernegger, H; Perrella, S; Peschke, R; Peshekhonov, V D; Peters, K; Peters, R F Y; Petersen, B A; Petersen, T C; Petit, E; Petridis, A; Petridou, C; Petroff, P; Petrolo, E; Petrucci, F; Pettersson, N E; Pezoa, R; Phillips, P W; Piacquadio, G; Pianori, E; Picazio, A; Piccaro, E; Piccinini, M; Pickering, M A; Piegaia, R; Pignotti, D T; Pilcher, J E; Pilkington, A D; Pina, J; Pinamonti, M; Pinfold, J L; Pingel, A; Pires, S; Pirumov, H; Pitt, M; Pizio, C; Plazak, L; Pleier, M-A; Pleskot, V; Plotnikova, E; Plucinski, P; Pluth, D; Poettgen, R; Poggioli, L; Pohl, D; Polesello, G; Poley, A; Policicchio, A; Polifka, R; Polini, A; Pollard, C S; Polychronakos, V; Pommès, K; Pontecorvo, L; Pope, B G; Popeneciu, G A; Popovic, D S; Poppleton, A; Pospisil, S; Potamianos, K; Potrap, I N; Potter, C J; Potter, C T; Poulard, G; Poveda, J; Pozdnyakov, V; Pralavorio, P; Pranko, A; Prasad, S; Prell, S; Price, D; Price, L E; Primavera, M; Prince, S; Proissl, M; Prokofiev, K; Prokoshin, F; Protopapadaki, E; Protopopescu, S; Proudfoot, J; Przybycien, M; Ptacek, E; Puddu, D; Pueschel, E; Puldon, D; Purohit, M; Puzo, P; Qian, J; Qin, G; Qin, Y; Quadt, A; Quarrie, D R; Quayle, W B; Queitsch-Maitland, M; Quilty, D; Raddum, S; Radeka, V; Radescu, V; Radhakrishnan, S K; Radloff, P; Rados, P; Ragusa, F; Rahal, G; Rajagopalan, S; Rammensee, M; Rangel-Smith, C; Rauscher, F; Rave, S; Ravenscroft, T; Raymond, M; Read, A L; Readioff, N P; Rebuzzi, D M; Redelbach, A; Redlinger, G; Reece, R; Reeves, K; Rehnisch, L; Reichert, J; Reisin, H; Rembser, C; Ren, H; Renaud, A; Rescigno, M; Resconi, S; Rezanova, O L; Reznicek, P; Rezvani, R; Richter, R; Richter, S; Richter-Was, E; Ricken, O; Ridel, M; Rieck, P; Riegel, C J; Rieger, J; Rifki, O; Rijssenbeek, M; Rimoldi, A; Rinaldi, L; Ristić, B; Ritsch, E; Riu, I; Rizatdinova, F; Rizvi, E; Robertson, S H; Robichaud-Veronneau, A; Robinson, D; Robinson, J E M; Robson, A; Roda, C; Roe, S; Røhne, O; Rolli, S; Romaniouk, A; Romano, M; Romano Saez, S M; Romero Adam, E; Rompotis, N; Ronzani, M; Roos, L; Ros, E; Rosati, S; Rosbach, K; Rose, P; Rosendahl, P L; Rosenthal, O; Rossetti, V; Rossi, E; Rossi, L P; Rosten, J H N; Rosten, R; Rotaru, M; Roth, I; Rothberg, J; Rousseau, D; Royon, C R; Rozanov, A; Rozen, Y; Ruan, X; Rubbo, F; Rubinskiy, I; Rud, V I; Rudolph, C; Rudolph, M S; Rühr, F; Ruiz-Martinez, A; Rurikova, Z; Rusakovich, N A; Ruschke, A; Russell, H L; Rutherfoord, J P; Ruthmann, N; Ryabov, Y F; Rybar, M; Rybkin, G; Ryder, N C; Saavedra, A F; Sabato, G; Sacerdoti, S; Saddique, A; Sadrozinski, H F-W; Sadykov, R; Safai Tehrani, F; Saha, P; Sahinsoy, M; Saimpert, M; Saito, T; Sakamoto, H; Sakurai, Y; Salamanna, G; Salamon, A; Salazar Loyola, J E; Saleem, M; Salek, D; Sales De Bruin, P H; Salihagic, D; Salnikov, A; Salt, J; Salvatore, D; Salvatore, F; Salvucci, A; Salzburger, A; Sammel, D; Sampsonidis, D; Sanchez, A; Sánchez, J; Sanchez Martinez, V; Sandaker, H; Sandbach, R L; Sander, H G; Sanders, M P; Sandhoff, M; Sandoval, C; Sandstroem, R; Sankey, D P C; Sannino, M; Sansoni, A; Santoni, C; Santonico, R; Santos, H; Santoyo Castillo, I; Sapp, K; Sapronov, A; Saraiva, J G; Sarrazin, B; Sasaki, O; Sasaki, Y; Sato, K; Sauvage, G; Sauvan, E; Savage, G; Savard, P; Sawyer, C; Sawyer, L; Saxon, J; Sbarra, C; Sbrizzi, A; Scanlon, T; Scannicchio, D A; Scarcella, M; Scarfone, V; Schaarschmidt, J; Schacht, P; Schaefer, D; Schaefer, R; Schaeffer, J; Schaepe, S; Schaetzel, S; Schäfer, U; Schaffer, A C; Schaile, D; Schamberger, R D; Scharf, V; Schegelsky, V A; Scheirich, D; Schernau, M; Schiavi, C; Schillo, C; Schioppa, M; Schlenker, S; Schmieden, K; Schmitt, C; Schmitt, S; Schmitt, S; Schneider, B; Schnellbach, Y J; Schnoor, U; Schoeffel, L; Schoening, A; Schoenrock, B D; Schopf, E; Schorlemmer, A L S; Schott, M; Schouten, D; Schovancova, J; Schramm, S; Schreyer, M; Schuh, N; Schultens, M J; Schultz-Coulon, H-C; Schulz, H; Schumacher, M; Schumm, B A; Schune, Ph; Schwanenberger, C; Schwartzman, A; Schwarz, T A; Schwegler, Ph; Schweiger, H; Schwemling, Ph; Schwienhorst, R; Schwindling, J; Schwindt, T; Sciacca, F G; Scifo, E; Sciolla, G; Scuri, F; Scutti, F; Searcy, J; Sedov, G; Sedykh, E; Seema, P; Seidel, S C; Seiden, A; Seifert, F; Seixas, J M; Sekhniaidze, G; Sekhon, K; Sekula, S J; Seliverstov, D M; Semprini-Cesari, N; Serfon, C; Serin, L; Serkin, L; Serre, T; Sessa, M; Seuster, R; Severini, H; Sfiligoj, T; Sforza, F; Sfyrla, A; Shabalina, E; Shamim, M; Shan, L Y; Shang, R; Shank, J T; Shapiro, M; Shatalov, P B; Shaw, K; Shaw, S M; Shcherbakova, A; Shehu, C Y; Sherwood, P; Shi, L; Shimizu, S; Shimmin, C O; Shimojima, M; Shiyakova, M; Shmeleva, A; Shoaleh Saadi, D; Shochet, M J; Shojaii, S; Shrestha, S; Shulga, E; Shupe, M A; Shushkevich, S; Sicho, P; Sidebo, P E; Sidiropoulou, O; Sidorov, D; Sidoti, A; Siegert, F; Sijacki, Dj; Silva, J; Silver, Y; Silverstein, S B; Simak, V; Simard, O; Simic, Lj; Simion, S; Simioni, E; Simmons, B; Simon, D; Sinervo, P; Sinev, N B; Sioli, M; Siragusa, G; Sisakyan, A N; Sivoklokov, S Yu; Sjölin, J; Sjursen, T B; Skinner, M B; Skottowe, H P; Skubic, P; Slater, M; Slavicek, T; Slawinska, M; Sliwa, K; Smakhtin, V; Smart, B H; Smestad, L; Smirnov, S Yu; Smirnov, Y; Smirnova, L N; Smirnova, O; Smith, M N K; Smith, R W; Smizanska, M; Smolek, K; Snesarev, A A; Snidero, G; Snyder, S; Sobie, R; Socher, F; Soffer, A; Soh, D A; Sokhrannyi, G; Solans, C A; Solar, M; Solc, J; Soldatov, E Yu; Soldevila, U; Solodkov, A A; Soloshenko, A; Solovyanov, O V; Solovyev, V; Sommer, P; Song, H Y; Soni, N; Sood, A; Sopczak, A; Sopko, B; Sopko, V; Sorin, V; Sosa, D; Sosebee, M; Sotiropoulou, C L; Soualah, R; Soukharev, A M; South, D; Sowden, B C; Spagnolo, S; Spalla, M; Spangenberg, M; Spanò, F; Spearman, W R; Sperlich, D; Spettel, F; Spighi, R; Spigo, G; Spiller, L A; Spousta, M; Denis, R D St; Stabile, A; Staerz, S; Stahlman, J; Stamen, R; Stamm, S; Stanecka, E; Stanescu, C; Stanescu-Bellu, M; Stanitzki, M M; Stapnes, S; Starchenko, E A; Stark, J; Staroba, P; Starovoitov, P; Staszewski, R; Steinberg, P; Stelzer, B; Stelzer, H J; Stelzer-Chilton, O; Stenzel, H; Stewart, G A; Stillings, J A; Stockton, M C; Stoebe, M; Stoicea, G; Stolte, P; Stonjek, S; Stradling, A R; Straessner, A; Stramaglia, M E; Strandberg, J; Strandberg, S; Strandlie, A; Strauss, E; Strauss, M; Strizenec, P; Ströhmer, R; Strom, D M; Stroynowski, R; Strubig, A; Stucci, S A; Stugu, B; Styles, N A; Su, D; Su, J; Subramaniam, R; Succurro, A; Sugaya, Y; Suk, M; Sulin, V V; Sultansoy, S; Sumida, T; Sun, S; Sun, X; Sundermann, J E; Suruliz, K; Susinno, G; Sutton, M R; Suzuki, S; Svatos, M; Swiatlowski, M; Sykora, I; Sykora, T; Ta, D; Taccini, C; Tackmann, K; Taenzer, J; Taffard, A; Tafirout, R; Taiblum, N; Takai, H; Takashima, R; Takeda, H; Takeshita, T; Takubo, Y; Talby, M; Talyshev, A A; Tam, J Y C; Tan, K G; Tanaka, J; Tanaka, R; Tanaka, S; Tannenwald, B B; Tannoury, N; Tapprogge, S; Tarem, S; Tarrade, F; Tartarelli, G F; Tas, P; Tasevsky, M; Tashiro, T; Tassi, E; Tavares Delgado, A; Tayalati, Y; Taylor, F E; Taylor, G N; Taylor, P T E; Taylor, W; Teischinger, F A; Teixeira Dias Castanheira, M; Teixeira-Dias, P; Temming, K K; Temple, D; Ten Kate, H; Teng, P K; Teoh, J J; Tepel, F; Terada, S; Terashi, K; Terron, J; Terzo, S; Testa, M; Teuscher, R J; Theveneaux-Pelzer, T; Thomas, J P; Thomas-Wilsker, J; Thompson, E N; Thompson, P D; Thompson, R J; Thompson, A S; Thomsen, L A; Thomson, E; Thomson, M; Thun, R P; Tibbetts, M J; Ticse Torres, R E; Tikhomirov, V O; Tikhonov, Yu A; Timoshenko, S; Tiouchichine, E; Tipton, P; Tisserant, S; Todome, K; Todorov, T; Todorova-Nova, S; Tojo, J; Tokár, S; Tokushuku, K; Tollefson, K; Tolley, E; Tomlinson, L; Tomoto, M; Tompkins, L; Toms, K; Torrence, E; Torres, H; Torró Pastor, E; Toth, J; Touchard, F; Tovey, D R; Trefzger, T; Tremblet, L; Tricoli, A; Trigger, I M; Trincaz-Duvoid, S; Tripiana, M F; Trischuk, W; Trocmé, B; Troncon, C; Trottier-McDonald, M; Trovatelli, M; Truong, L; Trzebinski, M; Trzupek, A; Tsarouchas, C; Tseng, J C-L; Tsiareshka, P V; Tsionou, D; Tsipolitis, G; Tsirintanis, N; Tsiskaridze, S; Tsiskaridze, V; Tskhadadze, E G; Tsukerman, I I; Tsulaia, V; Tsuno, S; Tsybychev, D; Tudorache, A; Tudorache, V; Tuna, A N; Tupputi, S A; Turchikhin, S; Turecek, D; Turra, R; Turvey, A J; Tuts, P M; Tykhonov, A; Tylmad, M; Tyndel, M; Ueda, I; Ueno, R; Ughetto, M; Ugland, M; Ukegawa, F; Unal, G; Undrus, A; Unel, G; Ungaro, F C; Unno, Y; Unverdorben, C; Urban, J; Urquijo, P; Urrejola, P; Usai, G; Usanova, A; Vacavant, L; Vacek, V; Vachon, B; Valderanis, C; Valencic, N; Valentinetti, S; Valero, A; Valery, L; Valkar, S; Vallecorsa, S; Valls Ferrer, J A; Van Den Wollenberg, W; Van Der Deijl, P C; van der Geer, R; van der Graaf, H; van Eldik, N; van Gemmeren, P; Van Nieuwkoop, J; van Vulpen, I; van Woerden, M C; Vanadia, M; Vandelli, W; Vanguri, R; Vaniachine, A; Vannucci, F; Vardanyan, G; Vari, R; Varnes, E W; Varol, T; Varouchas, D; Vartapetian, A; Varvell, K E; Vazeille, F; Vazquez Schroeder, T; Veatch, J; Veloce, L M; Veloso, F; Velz, T; Veneziano, S; Ventura, A; Ventura, D; Venturi, M; Venturi, N; Venturini, A; Vercesi, V; Verducci, M; Verkerke, W; Vermeulen, J C; Vest, A; Vetterli, M C; Viazlo, O; Vichou, I; Vickey, T; Vickey Boeriu, O E; Viehhauser, G H A; Viel, S; Vigne, R; Villa, M; Villaplana Perez, M; Vilucchi, E; Vincter, M G; Vinogradov, V B; Vivarelli, I; Vives Vaque, F; Vlachos, S; Vladoiu, D; Vlasak, M; Vogel, M; Vokac, P; Volpi, G; Volpi, M; von der Schmitt, H; von Radziewski, H; von Toerne, E; Vorobel, V; Vorobev, K; Vos, M; Voss, R; Vossebeld, J H; Vranjes, N; Vranjes Milosavljevic, M; Vrba, V; Vreeswijk, M; Vuillermet, R; Vukotic, I; Vykydal, Z; Wagner, P; Wagner, W; Wahlberg, H; Wahrmund, S; Wakabayashi, J; Walder, J; Walker, R; Walkowiak, W; Wang, C; Wang, F; Wang, H; Wang, H; Wang, J; Wang, J; Wang, K; Wang, R; Wang, S M; Wang, T; Wang, T; Wang, X; Wanotayaroj, C; Warburton, A; Ward, C P; Wardrope, D R; Washbrook, A; Wasicki, C; Watkins, P M; Watson, A T; Watson, I J; Watson, M F; Watts, G; Watts, S; Waugh, B M; Webb, S; Weber, M S; Weber, S W; Webster, J S; Weidberg, A R; Weinert, B; Weingarten, J; Weiser, C; Weits, H; Wells, P S; Wenaus, T; Wengler, T; Wenig, S; Wermes, N; Werner, M; Werner, P; Wessels, M; Wetter, J; Whalen, K; Wharton, A M; White, A; White, M J; White, R; White, S; Whiteson, D; Wickens, F J; Wiedenmann, W; Wielers, M; Wienemann, P; Wiglesworth, C; Wiik-Fuchs, L A M; Wildauer, A; Wilkens, H G; Williams, H H; Williams, S; Willis, C; Willocq, S; Wilson, A; Wilson, J A; Wingerter-Seez, I; Winklmeier, F; Winter, B T; Wittgen, M; Wittkowski, J; Wollstadt, S J; Wolter, M W; Wolters, H; Wosiek, B K; Wotschack, J; Woudstra, M J; Wozniak, K W; Wu, M; Wu, M; Wu, S L; Wu, X; Wu, Y; Wyatt, T R; Wynne, B M; Xella, S; Xu, D; Xu, L; Yabsley, B; Yacoob, S; Yakabe, R; Yamada, M; Yamaguchi, D; Yamaguchi, Y; Yamamoto, A; Yamamoto, S; Yamanaka, T; Yamauchi, K; Yamazaki, Y; Yan, Z; Yang, H; Yang, H; Yang, Y; Yao, W-M; Yasu, Y; Yatsenko, E; Yau Wong, K H; Ye, J; Ye, S; Yeletskikh, I; Yen, A L; Yildirim, E; Yorita, K; Yoshida, R; Yoshihara, K; Young, C; Young, C J S; Youssef, S; Yu, D R; Yu, J; Yu, J M; Yu, J; Yuan, L; Yuen, S P Y; Yurkewicz, A; Yusuff, I; Zabinski, B; Zaidan, R; Zaitsev, A M; Zalieckas, J; Zaman, A; Zambito, S; Zanello, L; Zanzi, D; Zeitnitz, C; Zeman, M; Zemla, A; Zeng, Q; Zengel, K; Zenin, O; Ženiš, T; Zerwas, D; Zhang, D; Zhang, F; Zhang, G; Zhang, H; Zhang, J; Zhang, L; Zhang, R; Zhang, X; Zhang, Z; Zhao, X; Zhao, Y; Zhao, Z; Zhemchugov, A; Zhong, J; Zhou, B; Zhou, C; Zhou, L; Zhou, L; Zhou, M; Zhou, N; Zhu, C G; Zhu, H; Zhu, J; Zhu, Y; Zhuang, X; Zhukov, K; Zibell, A; Zieminska, D; Zimine, N I; Zimmermann, C; Zimmermann, S; Zinonos, Z; Zinser, M; Ziolkowski, M; Živković, L; Zobernig, G; Zoccoli, A; Zur Nedden, M; Zurzolo, G; Zwalinski, L

Fiducial cross-sections for [Formula: see text] production with one or two additional b -jets are reported, using an integrated luminosity of 20.3 fb[Formula: see text] of proton-proton collisions at a centre-of-mass energy of 8 TeV at the Large Hadron Collider, collected with the ATLAS detector. The cross-section times branching ratio for [Formula: see text] events with at least one additional b -jet is measured to be 950 [Formula: see text] 70 (stat.) [Formula: see text] (syst.) fb in the lepton-plus-jets channel and 50 [Formula: see text] 10 (stat.) [Formula: see text] (syst.) fb in the [Formula: see text] channel. The cross-section times branching ratio for events with at least two additional b -jets is measured to be 19.3 [Formula: see text] 3.5 (stat.) [Formula: see text] 5.7 (syst.) fb in the dilepton channel ([Formula: see text], [Formula: see text], and   ee ) using a method based on tight selection criteria, and 13.5 [Formula: see text] 3.3 (stat.) [Formula: see text] 3.6 (syst.) fb using a looser selection that allows the background normalisation to be extracted from data. The latter method also measures a value of 1.30 [Formula: see text] 0.33 (stat.) [Formula: see text] 0.28 (syst.)% for the ratio of [Formula: see text] production with two additional b -jets to [Formula: see text] production with any two additional jets. All measurements are in good agreement with recent theory predictions.

Statistics Using Just One Formula

ERIC Educational Resources Information Center

Rosenthal, Jeffrey S.

2018-01-01

This article advocates that introductory statistics be taught by basing all calculations on a single simple margin-of-error formula and deriving all of the standard introductory statistical concepts (confidence intervals, significance tests, comparisons of means and proportions, etc) from that one formula. It is argued that this approach will…

Vestibular schwannomas: Accuracy of tumor volume estimated by ice cream cone formula using thin-sliced MR images.

PubMed

Ho, Hsing-Hao; Li, Ya-Hui; Lee, Jih-Chin; Wang, Chih-Wei; Yu, Yi-Lin; Hueng, Dueng-Yuan; Ma, Hsin-I; Hsu, Hsian-He; Juan, Chun-Jung

2018-01-01

We estimated the volume of vestibular schwannomas by an ice cream cone formula using thin-sliced magnetic resonance images (MRI) and compared the estimation accuracy among different estimating formulas and between different models. The study was approved by a local institutional review board. A total of 100 patients with vestibular schwannomas examined by MRI between January 2011 and November 2015 were enrolled retrospectively. Informed consent was waived. Volumes of vestibular schwannomas were estimated by cuboidal, ellipsoidal, and spherical formulas based on a one-component model, and cuboidal, ellipsoidal, Linskey's, and ice cream cone formulas based on a two-component model. The estimated volumes were compared to the volumes measured by planimetry. Intraobserver reproducibility and interobserver agreement was tested. Estimation error, including absolute percentage error (APE) and percentage error (PE), was calculated. Statistical analysis included intraclass correlation coefficient (ICC), linear regression analysis, one-way analysis of variance, and paired t-tests with P < 0.05 considered statistically significant. Overall tumor size was 4.80 ± 6.8 mL (mean ±standard deviation). All ICCs were no less than 0.992, suggestive of high intraobserver reproducibility and high interobserver agreement. Cuboidal formulas significantly overestimated the tumor volume by a factor of 1.9 to 2.4 (P ≤ 0.001). The one-component ellipsoidal and spherical formulas overestimated the tumor volume with an APE of 20.3% and 29.2%, respectively. The two-component ice cream cone method, and ellipsoidal and Linskey's formulas significantly reduced the APE to 11.0%, 10.1%, and 12.5%, respectively (all P < 0.001). The ice cream cone method and other two-component formulas including the ellipsoidal and Linskey's formulas allow for estimation of vestibular schwannoma volume more accurately than all one-component formulas.

Nutritional adequacy of goat milk infant formulas for term infants: a double-blind randomised controlled trial.

PubMed

Zhou, Shao J; Sullivan, Thomas; Gibson, Robert A; Lönnerdal, Bo; Prosser, Colin G; Lowry, Dianne J; Makrides, Maria

2014-05-01

The safety and nutritional adequacy of goat milk infant formulas have been questioned. The primary aim of the present study was to compare the growth and nutritional status of infants fed a goat milk infant formula with those of infants fed a typical whey-based cow milk infant formula. The secondary aim was to examine a range of health- and allergy-related outcomes. A double-blind, randomised controlled trial with 200 formula-fed term infants randomly assigned to receive either goat or cow milk formula from 2 weeks to at least 4 months of age was conducted. A cohort of 101 breast-fed infants was included for comparison. Weight, length and head circumference were measured at 2 weeks and 1, 2, 3, 4, 6 and 12 months of age. Nutritional status was assessed from serum albumin, urea, creatinine, Hb, ferritin, and folate and plasma amino acid concentrations at 4 months. Z-scores for weight, length, head circumference and weight for length were not different between the two formula-fed groups. There were differences in the values of some amino acids and blood biomarkers between the formula-fed groups, but the mean values for biomarkers were within the normal reference range. There were no differences in the occurrence of serious adverse events, general health, and incidence of dermatitis or medically diagnosed food allergy. The incidence of parentally reported blood-stained stools was higher in the goat milk formula-fed group, although this was a secondary outcome and its importance is unclear. Goat milk formula provided growth and nutritional outcomes in infants that did not differ from those provided by a standard whey-based cow milk formula.

Why we need to look beyond the glass transition temperature to characterize the dynamics of thin supported polymer films.

PubMed

Zhang, Wengang; Douglas, Jack F; Starr, Francis W

2018-05-29

There is significant variation in the reported magnitude and even the sign of [Formula: see text] shifts in thin polymer films with nominally the same chemistry, film thickness, and supporting substrate. The implicit assumption is that methods used to estimate [Formula: see text] in bulk materials are relevant for inferring dynamic changes in thin films. To test the validity of this assumption, we perform molecular simulations of a coarse-grained polymer melt supported on an attractive substrate. As observed in many experiments, we find that [Formula: see text] based on thermodynamic criteria (temperature dependence of film height or enthalpy) decreases with decreasing film thickness, regardless of the polymer-substrate interaction strength ε. In contrast, we find that [Formula: see text] based on a dynamic criterion (relaxation of the dynamic structure factor) also decreases with decreasing thickness when ε is relatively weak, but [Formula: see text] increases when ε exceeds the polymer-polymer interaction strength. We show that these qualitatively different trends in [Formula: see text] reflect differing sensitivities to the mobility gradient across the film. Apparently, the slowly relaxing polymer segments in the substrate region make the largest contribution to the shift of [Formula: see text] in the dynamic measurement, but this part of the film contributes less to the thermodynamic estimate of [Formula: see text] Our results emphasize the limitations of using [Formula: see text] to infer changes in the dynamics of polymer thin films. However, we show that the thermodynamic and dynamic estimates of [Formula: see text] can be combined to predict local changes in [Formula: see text] near the substrate, providing a simple method to infer information about the mobility gradient.

Concealed d-wave pairs in the s± condensate of iron-based superconductors.

PubMed

Ong, Tzen; Coleman, Piers; Schmalian, Jörg

2016-05-17

A central question in iron-based superconductivity is the mechanism by which the paired electrons minimize their strong mutual Coulomb repulsion. In most unconventional superconductors, Coulomb repulsion is minimized through the formation of higher angular momentum Cooper pairs, with Fermi surface nodes in the pair wavefunction. The apparent absence of such nodes in the iron-based superconductors has led to a belief they form an s-wave ([Formula: see text]) singlet state, which changes sign between the electron and hole pockets. However, the multiorbital nature of these systems opens an alternative possibility. Here, we propose a new class of [Formula: see text] state containing a condensate of d-wave Cooper pairs, concealed by their entanglement with the iron orbitals. By combining the d-wave ([Formula: see text]) motion of the pairs with the internal angular momenta [Formula: see text] of the iron orbitals to make a singlet ([Formula: see text]), an [Formula: see text] superconductor with a nontrivial topology is formed. This scenario allows us to understand the development of octet nodes in potassium-doped Ba1-x KXFe2As2 as a reconfiguration of the orbital and internal angular momentum into a high spin ([Formula: see text]) state; the reverse transition under pressure into a fully gapped state can then be interpreted as a return to the low-spin singlet. The formation of orbitally entangled pairs is predicted to give rise to a shift in the orbital content at the Fermi surface, which can be tested via laser-based angle-resolved photoemission spectroscopy.

On thermal conductivity of gas mixtures containing hydrogen

NASA Astrophysics Data System (ADS)

Zhukov, Victor P.; Pätz, Markus

2017-06-01

A brief review of formulas used for the thermal conductivity of gas mixtures in CFD simulations of rocket combustion chambers is carried out in the present work. In most cases, the transport properties of mixtures are calculated from the properties of individual components using special mixing rules. The analysis of different mixing rules starts from basic equations and ends by very complex semi-empirical expressions. The formulas for the thermal conductivity are taken for the analysis from the works on modelling of rocket combustion chambers. \\hbox {H}_2{-}\\hbox {O}_2 mixtures are chosen for the evaluation of the accuracy of the considered mixing rules. The analysis shows that two of them, of Mathur et al. (Mol Phys 12(6):569-579, 1967), and of Mason and Saxena (Phys Fluids 1(5):361-369, 1958), have better agreement with the experimental data than other equations for the thermal conductivity of multicomponent gas mixtures.

A covariance correction that accounts for correlation estimation to improve finite-sample inference with generalized estimating equations: A study on its applicability with structured correlation matrices

PubMed Central

Westgate, Philip M.

2016-01-01

When generalized estimating equations (GEE) incorporate an unstructured working correlation matrix, the variances of regression parameter estimates can inflate due to the estimation of the correlation parameters. In previous work, an approximation for this inflation that results in a corrected version of the sandwich formula for the covariance matrix of regression parameter estimates was derived. Use of this correction for correlation structure selection also reduces the over-selection of the unstructured working correlation matrix. In this manuscript, we conduct a simulation study to demonstrate that an increase in variances of regression parameter estimates can occur when GEE incorporates structured working correlation matrices as well. Correspondingly, we show the ability of the corrected version of the sandwich formula to improve the validity of inference and correlation structure selection. We also study the relative influences of two popular corrections to a different source of bias in the empirical sandwich covariance estimator. PMID:27818539

Principal Effects of Axial Load on Moment-Distribution Analysis of Rigid Structures

NASA Technical Reports Server (NTRS)

James, Benjamin Wylie

1935-01-01

This thesis presents the method of moment distribution modified to include the effect of axial load upon the bending moments. This modification makes it possible to analyze accurately complex structures, such as rigid fuselage trusses, that heretofore had to be analyzed by approximate formulas and empirical rules. The method is simple enough to be practicable even for complex structures, and it gives a means of analysis for continuous beams that is simpler than the extended three-moment equation now in common use. When the effect of axial load is included, it is found that the basic principles of moment distribution remain unchanged, the only difference being that the factors used, instead of being constants for a given member, become functions of the axial load. Formulas have been developed for these factors, and curves plotted so that their applications requires no more work than moment distribution without axial load. Simple problems have been included to illustrate the use of the curves.

A covariance correction that accounts for correlation estimation to improve finite-sample inference with generalized estimating equations: A study on its applicability with structured correlation matrices.

PubMed

Westgate, Philip M

2016-01-01

When generalized estimating equations (GEE) incorporate an unstructured working correlation matrix, the variances of regression parameter estimates can inflate due to the estimation of the correlation parameters. In previous work, an approximation for this inflation that results in a corrected version of the sandwich formula for the covariance matrix of regression parameter estimates was derived. Use of this correction for correlation structure selection also reduces the over-selection of the unstructured working correlation matrix. In this manuscript, we conduct a simulation study to demonstrate that an increase in variances of regression parameter estimates can occur when GEE incorporates structured working correlation matrices as well. Correspondingly, we show the ability of the corrected version of the sandwich formula to improve the validity of inference and correlation structure selection. We also study the relative influences of two popular corrections to a different source of bias in the empirical sandwich covariance estimator.

Ever since Gompertz.

PubMed

Olshansky, S J; Carnes, B A

1997-02-01

In 1825 British actuary Benjamin Gompertz made a simple but important observation that a law of geometrical progression pervades large portions of different tables of mortality for humans. The simple formula he derived describing the exponential rise in death rates between sexual maturity and old age is commonly, referred to as the Gompertz equation-a formula that remains a valuable tool in demography and in other scientific disciplines. Gompertz's observation of a mathematical regularity in the life table led him to believe in the presence of a low of mortality that explained why common age patterns of death exist. This law of mortality has captured the attention of scientists for the past 170 years because it was the first among what are now several reliable empirical tools for describing the dying-out process of many living organisms during a significant portion of their life spans. In this paper we review the literature on Gompertz's law of mortality and discuss the importance of his observations and insights in light of research on aging that has taken place since then.

Observation and Simulations of the Backsplash Effects in High-Energy Gamma-Ray Telescopes Containing a Massive Calorimeter

NASA Technical Reports Server (NTRS)

Moiseev, Alexander A.; Ormes, Jonathan F.; Hartman, Robert C.; Johnson, Thomas E.; Mitchell, John W.; Thompson, David J.

1999-01-01

Beam test and simulation results are presented for a study of the backsplash effects produced in a high-energy gamma-ray detector containing a massive calorimeter. An empirical formula is developed to estimate the probability (per unit area) of backsplash for different calorimeter materials and thicknesses, different incident particle energies, and at different distances from the calorimeter. The results obtained are applied to the design of Anti-Coincidence Detector (ACD) for the Large Area Telescope (LAT) on the Gamma-ray Large Area Space Telescope (GLAST).

METHOD FOR THE RECOVERY AND PURIFICATION OF GASEOUS UF$sub 6$ FROM GASEOUS MIXTURES AND UF$sub 7$NO AND UF$sub 7$NO$sub 2$ PRODUCTS PRODUCED THEREBY

DOEpatents

Ogle, P.R. Jr.

1962-06-16

A method is given for recovering uranium hexafluoride from a gaseous mixture containing said uranium hexafluoride and extraneous gaseous impurities. The method comprises reacting said mixture with a nitrogen oxyfluoride at a temperature in the range - 100 to 50 deg C to thereby form a solid compound having the empirical formula UF/sub 7/N(O)/sub x/ where x is a number from 1 to 2. (AEC)

On laminar and turbulent friction

NASA Technical Reports Server (NTRS)

Von Karman, TH

1946-01-01

Report deals, first with the theory of the laminar friction flow, where the basic concepts of Prandtl's boundary layer theory are represented from mathematical and physical points of view, and a method is indicated by means of which even more complicated cases can be treated with simple mathematical means, at least approximately. An attempt is also made to secure a basis for the computation of the turbulent friction by means of formulas through which the empirical laws of the turbulent pipe resistance can be applied to other problems on friction drag. (author)

Proton bombarded reactions of Calcium target nuclei

NASA Astrophysics Data System (ADS)

Tel, Eyyup; Sahan, Muhittin; Sarpün, Ismail Hakki; Kavun, Yusuf; Gök, Ali Armagan; Depedelen, Mesut

2017-09-01

In this study, proton bombarded nuclear reactions calculations of Calcium target nuclei have been investigated in the incident proton energy range of 1-50 MeV. The excitation functions for 40Ca target nuclei reactions have been calculated by using PCROSS nuclear reaction calculation code. Weisskopf-Ewing and the full exciton models were used for equilibrium and for pre-equilibrium calculations, respectively. The excitation functions for 40Ca target nuclei reactions (p,α), (p,n), (p,p) have been calculated using the semi-empirical formula Tel et al. [5].

Thermal boundary layer due to sudden heating of fluid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kurkal, K.R.; Munukutla, S.

This paper proposes to solve computationally the heat-transfer problems (introduced by Munukutla and Venkataraman, 1988) related to a closed-cycle pulsed high-power laser flow loop. The continuity and the momentum equations as well as the unsteady energy equation are solved using the Keller-Box method. The solutions were compared with the steady-state solutions at large times, and the comparison was found to be excellent. Empirical formulas are proposed for calculating the time-dependent boundary-layer thickness and mass-heat transfer, that can be used by laser flow loop designers. 6 refs.

Thermal boundary layer due to sudden heating of fluid

NASA Astrophysics Data System (ADS)

Kurkal, K. R.; Munukutla, S.

1989-10-01

This paper proposes to solve computationally the heat-transfer problems (introduced by Munukutla and Venkataraman, 1988) related to a closed-cycle pulsed high-power laser flow loop. The continuity and the momentum equations as well as the unsteady energy equation are solved using the Keller-Box method. The solutions were compared with the steady-state solutions at large times, and the comparison was found to be excellent. Empirical formulas are proposed for calculating the time-dependent boundary-layer thickness and mass-heat transfer, that can be used by laser flow loop designers.

Electrical characteristics of a free-burning direct-current argon arc operating between 90 and 563 kilowatts with two types of cathodes

NASA Technical Reports Server (NTRS)

Curtis, H. B.; Decker, A. J.

1975-01-01

The electrical characteristics of a high-power, long-lived, free-burning dc argon arc are presented. Empirical formulas relating voltage to current, electrode separation, and operating pressure are given for two types of cathodes: a typical point tip cathode and a cathode with a 1.27-cm-(0.5-in.-) diameter crater in the tip. Power was varied from 90 to 563 kW. A discussion of the cathode with the crater tip is given.

Nonparametric estimation of the multivariate survivor function: the multivariate Kaplan-Meier estimator.

PubMed

Prentice, Ross L; Zhao, Shanshan

2018-01-01

The Dabrowska (Ann Stat 16:1475-1489, 1988) product integral representation of the multivariate survivor function is extended, leading to a nonparametric survivor function estimator for an arbitrary number of failure time variates that has a simple recursive formula for its calculation. Empirical process methods are used to sketch proofs for this estimator's strong consistency and weak convergence properties. Summary measures of pairwise and higher-order dependencies are also defined and nonparametrically estimated. Simulation evaluation is given for the special case of three failure time variates.

Evaluation of Metal-Organic Frameworks for the Removal of Toxic Industrial Chemicals

DTIC Science & Technology

2008-06-01

ECBC ID# 085-07), more commonly known as Cu-BTC or HKUST - 1 , has the empirical formula CuO 4C 6H 2. The sample is a dark blue/purple powder. 2.2...0704-0188 Public reporting burden for this collection of information is estimated to average 1 hour per response, including the time for reviewing...FORM TO THE ABOVE ADDRESS. 1 . REPORT DATE (DD-MM-YYYY) 2. REPORT TYPE 3. DATES COVERED (From - To) XX-06-2008 Final Nov 2007 - Jan 2008 4. TITLE AND

Propagation and Directional Scattering of Ocean Waves in the Marginal Ice Zone and Neighboring Seas

DTIC Science & Technology

2015-09-30

expected to be the average of the kernel for 10 s and 12 s. This means that we should be able to calculate empirical formulas for 2 the scattering kernel...floe packing. Thus, establish a way to incorporate what has been done by Squire and co-workers into the wave model paradigm (in which the phase of the...cases observed by Kohout et al. (2014) in Antarctica . vii. Validation: We are planning validation tests for wave-ice scattering / attenuation model by

Low inorganic arsenic in hydrolysed-rice formula used for cow's milk protein allergy.

PubMed

Meyer, Rosan; Carey, Manus P; Turner, Paul; Meharg, Andrew A

2018-04-27

Hypoallergenic formulas are recommended for use in young children with cow's milk protein allergy (CMPA), where breastmilk is not available, 1 with the choice between both extensively hydrolysed casein/whey or amino acid-based products. More recently, hydrolysed rice protein-based formulas (HRF) have become available and are now commonly used in Europe for CMPA This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Tolerance of a standard intact protein formula versus a partially hydrolyzed formula in healthy, term infants

PubMed Central

Berseth, Carol Lynn; Mitmesser, Susan Hazels; Ziegler, Ekhard E; Marunycz, John D; Vanderhoof, Jon

2009-01-01

Background Parents who perceive common infant behaviors as formula intolerance-related often switch formulas without consulting a health professional. Up to one-half of formula-fed infants experience a formula change during the first six months of life. Methods The objective of this study was to assess discontinuance due to study physician-assessed formula intolerance in healthy, term infants. Infants (335) were randomized to receive either a standard intact cow milk protein formula (INTACT) or a partially hydrolyzed cow milk protein formula (PH) in a 60 day non-inferiority trial. Discontinuance due to study physician-assessed formula intolerance was the primary outcome. Secondary outcomes included number of infants who discontinued for any reason, including parent-assessed. Results Formula intolerance between groups (INTACT, 12.3% vs. PH, 13.7%) was similar for infants who completed the study or discontinued due to study physician-assessed formula intolerance. Overall study discontinuance based on parent- vs. study physician-assessed intolerance for all infants (14.4 vs.11.1%) was significantly different (P = 0.001). Conclusion This study demonstrated no difference in infant tolerance of intact vs. partially hydrolyzed cow milk protein formulas for healthy, term infants over a 60-day feeding trial, suggesting nonstandard partially hydrolyzed formulas are not necessary as a first-choice for healthy infants. Parents frequently perceived infant behavior as formula intolerance, paralleling previous reports of unnecessary formula changes. Trial Registration clinicaltrials.gov: NCT00666120 PMID:19545360

Prevalence of infant formula advertisements in parenting magazines over a 5-year span.

PubMed

Basch, Corey H; Shaffer, Ellen J; Hammond, Rodney; Rajan, Sonali

2013-01-01

Marketing of infant formula contributes to a decreased likelihood to breastfeed. This study established the prevalence of infant formula advertisements in two popular US parenting magazines and explored trends in infant formula advertisement prevalence from 2007 to 2012. Advertisements were analyzed using a comprehensive coding schematic. We established a high proportion of 0.43 advertisements per page of content in both magazines and observed a significant increase in infant formula advertisement prevalence beginning in 2009. Infant formula companies use aggressive marketing in parenting magazines. Nurses who are well-trained in breastfeeding best practices can offer new mothers evidence-based information on the benefits of breastfeeding. © 2013.

Research on capability of detecting ballistic missile by near space infrared system

NASA Astrophysics Data System (ADS)

Lu, Li; Sheng, Wen; Jiang, Wei; Jiang, Feng

2018-01-01

The infrared detection technology of ballistic missile based on near space platform can effectively make up the shortcomings of high-cost of traditional early warning satellites and the limited earth curvature of ground-based early warning radar. In terms of target detection capability, aiming at the problem that the formula of the action distance based on contrast performance ignores the background emissivity in the calculation process and the formula is only valid for the monochromatic light, an improved formula of the detecting range based on contrast performance is proposed. The near space infrared imaging system parameters are introduced, the expression of the contrastive action distance formula based on the target detection of the near space platform is deduced. The detection range of the near space infrared system for the booster stage ballistic missile skin, the tail nozzle and the tail flame is calculated. The simulation results show that the near-space infrared system has the best effect on the detection of tail-flame radiation.

27 CFR 21.39 - Formula No. 6-B.

Code of Federal Regulations, 2010 CFR

2010-04-01

... chemicals. (2) Miscellaneous uses: 812.Product development and pilot plant uses (own use only). ... and Authorized Uses § 21.39 Formula No. 6-B. (a) Formula. To every 100 gallons of alcohol add: One-half gallon of pyridine bases. (b) Authorized uses. (1) As a raw material: 523.Miscellaneous ethyl...

27 CFR 21.39 - Formula No. 6-B.

Code of Federal Regulations, 2011 CFR

2011-04-01

... chemicals. (2) Miscellaneous uses: 812.Product development and pilot plant uses (own use only). ... and Authorized Uses § 21.39 Formula No. 6-B. (a) Formula. To every 100 gallons of alcohol add: One-half gallon of pyridine bases. (b) Authorized uses. (1) As a raw material: 523.Miscellaneous ethyl...

Infant formula feeding alters the proliferative status of neonatal mammary glands independent of estrogen signaling

USDA-ARS?s Scientific Manuscript database

Soy infant formula contains many phytochemicals, including phytoestrogens, which are structurally similar to estradiol (E2). The mammary gland is particularly sensitive to estrogens, and there are concerns that use of soy-based infant formulas may potentially have adverse effects on mammary tissue ...

Evaluation of Large-scale Data to Detect Irregularity in Payment for Medical Services. An Extended Use of Benford's Law.

PubMed

Park, Junghyun A; Kim, Minki; Yoon, Seokjoon

2016-05-17

Sophisticated anti-fraud systems for the healthcare sector have been built based on several statistical methods. Although existing methods have been developed to detect fraud in the healthcare sector, these algorithms consume considerable time and cost, and lack a theoretical basis to handle large-scale data. Based on mathematical theory, this study proposes a new approach to using Benford's Law in that we closely examined the individual-level data to identify specific fees for in-depth analysis. We extended the mathematical theory to demonstrate the manner in which large-scale data conform to Benford's Law. Then, we empirically tested its applicability using actual large-scale healthcare data from Korea's Health Insurance Review and Assessment (HIRA) National Patient Sample (NPS). For Benford's Law, we considered the mean absolute deviation (MAD) formula to test the large-scale data. We conducted our study on 32 diseases, comprising 25 representative diseases and 7 DRG-regulated diseases. We performed an empirical test on 25 diseases, showing the applicability of Benford's Law to large-scale data in the healthcare industry. For the seven DRG-regulated diseases, we examined the individual-level data to identify specific fees to carry out an in-depth analysis. Among the eight categories of medical costs, we considered the strength of certain irregularities based on the details of each DRG-regulated disease. Using the degree of abnormality, we propose priority action to be taken by government health departments and private insurance institutions to bring unnecessary medical expenses under control. However, when we detect deviations from Benford's Law, relatively high contamination ratios are required at conventional significance levels.

Breastfeeding Duration and Early Parenting Behaviour: The Importance of an Infant-Led, Responsive Style

PubMed Central

Brown, Amy; Arnott, Bronia

2014-01-01

Background Popular parenting literature promotes different approaches to caring for infants, based around variations in the use of parent-led routines and promoting infant independence. However, there is little empirical evidence of how these early behaviours affect wider parenting choices such as infant feeding. Breastfeeding often requires an infant-led approach, feeding on demand and allowing the infant to regulate intake whilst conversely formula feeding is open to greater caregiver manipulation. The infant-led style associated with breastfeeding may therefore be at odds with philosophies that encourage strict use of routine and independence. The aim of this study was to explore the association between early parenting behaviours and breastfeeding duration. Methods Five hundred and eight mothers with an infant aged 0–12 months completed a questionnaire examining breastfeeding duration, attitudes and behaviours surrounding early parenting (e.g. anxiety, use of routine, involvement, nurturance and discipline). Participants were attendees at baby groups or participants of online parenting forums based in the UK. Results Formula use at birth or short breastfeeding duration were significantly associated with low levels of nurturance, high levels of reported anxiety and increased maternal use of Parent-led routines. Conversely an infant-led approach characterised by responding to and following infant cues was associated with longer breastfeeding duration. Discussion Maternal desire to follow a structured parenting approach which purports use of Parent-led routines and early demands for infant independence may have a negative impact upon breastfeeding duration. Increased maternal anxiety may further influence this relationship. The findings have important implications for Health Professionals supporting new mothers during pregnancy and the postpartum period. PMID:24533046

Blocking, descent and gravity waves: Observations and modelling of a MAP northerly föhn event

NASA Astrophysics Data System (ADS)

Jiang, Qingfang; Doyle, James D.; Smith, Ronald B.

2005-01-01

A northerly föhn event observed during the special observational period of the Mesoscale Alpine Programme is investigated based on observational analysis and numerical modelling. The focus of this study includes three dynamical processes associated with mountain perturbations and their interactions, namely, windward flow blocking, descent and warming on the lee side, and mountain waves. Observations indicate the presence of a deep weak-flow layer underneath a stable layer, associated with Alpine-scale blocking. Satellite imagery reveals a föhninduced cloud-free area to the south of the Alps, which is consistent with flow descent diagnosed from radiosondes and constant-volume balloons. Moderate-amplitude stationary waves were observed by research aircraft over the major Alpine peaks. Satellite images and balloon data indicate the presence of stationary trapped-wave patterns located to the north of the Alpine massif.Satisfactory agreement is found between observations and a real-data COAMPS simulation nested to 1 km resolution. COAMPS indicates the presence of trapped waves associated with a sharp decrease of Scorer parameter above a stable layer in the mid-troposphere. Underneath the stable layer, moist low-level flow is blocked to the north of the Alps. The warm air in the stable layer descends in the lee and recovers its altitude over a relatively short horizontal distance through a hydraulic jump.Blocking reduces the effective mountain and hence significantly reduces mountain drag. A simple empirical formula for estimation of the effective mountain height, he, is derived based on numerical simulations. The formula states he/hc = (h/hc), where h is the real mountain height and hc is the critical mountain height to have flow stagnation.

A study of sound absorption by street canyon boundaries and asphalt rubber concrete pavement

NASA Astrophysics Data System (ADS)

Drysdale, Graeme Robert

A sound field model, based on a classical diffusion equation, is extended to account for sound absorption in a diffusion parameter used to model sound energy in a narrow street canyon. The model accounts for a single sound absorption coefficient, separate accommodation coefficients and a combination of separate absorption and accommodation coefficients from parallel canyon walls. The new expressions are compared to the original formula through numerical simulations to reveal the effect of absorption on sound diffusion. The newly established analytical formulae demonstrate satisfactory agreement with their predecessor under perfect reflection. As well, the influence of the extended diffusion parameter on normalized sound pressure levels in a narrow street canyon is in agreement with experimental data. The diffusion parameters are used to model sound energy density in a street canyon as a function of the sound absorption coefficient of the street canyon walls. The acoustic and material properties of conventional and asphalt rubber concrete (ARC) pavement are also studied to assess how the crumb rubber content influences sound absorption in street canyons. The porosity and absolute permeability of compacted specimens of asphalt rubber concrete are measured and compared to their normal and random incidence sound absorption coefficients as a function of crumb rubber content in the modified binder. Nonlinear trends are found between the sound absorption coefficients, porosity and absolute permeability of the compacted specimens and the percentage of crumb rubber in the modified binders. The cross-sectional areas of the air voids on the surfaces of the compacted specimens are measured using digital image processing techniques and a linear relationship is obtained between the average void area and crumb rubber content. The measured material properties are used to construct an empirical formula relating the average porosity, normal incidence noise reduction coefficients and percentage of crumb rubber in the modified binder of the compacted specimens.

Adaptive fuzzy controller for thermal comfort inside the air-conditioned automobile chamber

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tong, L.; Yu, B.; Chen, Z.

1999-07-01

In order to meet the passengers' demand for thermal comfort, the adaptive fuzzy logic control design methodology is applied for the automobile airconditioner system. In accordance with the theory of air flow and heat transfer, the air temperature field inside the airconditioned automobile chamber is simulated by a set of simplified half-empirical formula. Then, instead of PMV (Predicted Mean Vote) criterion, RIV (Real Individual Vote) criterion is adopted as the base of the control for passengers' thermal comfort. The proposed controller is applied to the air temperature regulation at the individual passenger position. The control procedure is based on partitioningmore » the state space of the system into cell-groups and fuzzily quantificating the state space into these cells. When the system model has some parameter perturbation, the controller can also adjust its control parameters to compensate for the perturbation and maintain the good performance. The learning procedure shows its ideal effect in both computer simulation and experiments. The final results demonstrate the ideal performance of this adaptive fuzzy controller.« less

Ocean Lidar Measurements of Beam Attenuation and a Roadmap to Accurate Phytoplankton Biomass Estimates

NASA Astrophysics Data System (ADS)

Hu, Yongxiang; Behrenfeld, Mike; Hostetler, Chris; Pelon, Jacques; Trepte, Charles; Hair, John; Slade, Wayne; Cetinic, Ivona; Vaughan, Mark; Lu, Xiaomei; Zhai, Pengwang; Weimer, Carl; Winker, David; Verhappen, Carolus C.; Butler, Carolyn; Liu, Zhaoyan; Hunt, Bill; Omar, Ali; Rodier, Sharon; Lifermann, Anne; Josset, Damien; Hou, Weilin; MacDonnell, David; Rhew, Ray

2016-06-01

Beam attenuation coefficient, c, provides an important optical index of plankton standing stocks, such as phytoplankton biomass and total particulate carbon concentration. Unfortunately, c has proven difficult to quantify through remote sensing. Here, we introduce an innovative approach for estimating c using lidar depolarization measurements and diffuse attenuation coefficients from ocean color products or lidar measurements of Brillouin scattering. The new approach is based on a theoretical formula established from Monte Carlo simulations that links the depolarization ratio of sea water to the ratio of diffuse attenuation Kd and beam attenuation C (i.e., a multiple scattering factor). On July 17, 2014, the CALIPSO satellite was tilted 30° off-nadir for one nighttime orbit in order to minimize ocean surface backscatter and demonstrate the lidar ocean subsurface measurement concept from space. Depolarization ratios of ocean subsurface backscatter are measured accurately. Beam attenuation coefficients computed from the depolarization ratio measurements compare well with empirical estimates from ocean color measurements. We further verify the beam attenuation coefficient retrievals using aircraft-based high spectral resolution lidar (HSRL) data that are collocated with in-water optical measurements.

An Innovative Concept for Spacebased Lidar Measurement of Ocean Carbon Biomass

NASA Technical Reports Server (NTRS)

Hu, Yongxiang; Behrenfeld, Michael; Hostetler, Chris; Pelon, Jacques; Trepte, Charles; Hair, John; Slade, Wayne; Cetinic, Ivona; Vaughan, Mark; Lu, Xiaomei;

Effects of Raindrop Shape Parameter on the Simulation of Plum Rains

NASA Astrophysics Data System (ADS)

Mei, H.; Zhou, L.; Li, X.; Huang, X.; Guo, W.

2017-12-01

The raindrop shape parameter of particle distribution is generally set as constant in a Double-moment Bulk Microphysics Scheme (DBMS) using Gama distribution function though which suggest huge differences in time and space according to observations. Based on Milbrandt 2-mon(MY) DBMS, four cases during Plum Rains season are simulated coupled with four empirical relationships between shape parameter (μr) and slope parameter of raindrop which have been concluded from observations of raindrop distributions. The analysis of model results suggest that μr have some influences on rainfall. Introducing the diagnostic formulas of μr may have some improvement on systematic biases of 24h accumulated rainfall and show some correction ability on local characteristics of rainfall distribution. Besides,the tendency to improve strong rainfall could be sensitive to μr. With the improvement of the diagnosis of μr using the empirically diagnostic formulas, μr increases generally in the middle- and lower-troposphere and decreases with the stronger rainfall. Its conclued that, the decline in raindrop water content and the increased raindrop mass-weighted average terminal velocity directly related to μr are the direct reasons of variations in the precipitation.On the other side, the environmental conditions including relative humidity and dynamical parameters are the key indirectly causes which has close relationships with the changes in cloud particles and rainfall distributions.Furthermore,the differences in the scale of improvement between the weak and heavy rainfall mainly come from the distinctions of response features about their variable fields respectively. The extent of variation in the features of cloud particles in warm clouds of heavy rainfall differs greatly from that of weak rainfall, though they share the same trend of variation. On the conditions of weak rainfall, the response of physical characteristics to μr performed consistent trends and some linear features. However, environmental conditions of relative humidity and dynamical parameters perform strong and vertically deep adjustments in the heavy precipitation with vigorous cloud systems. In this case, the microphysical processes and environmental conditions experience complex interactions with each other and no significant laws could be concluded.

A new age-based formula for estimating weight of Korean children.

PubMed

Park, Jungho; Kwak, Young Ho; Kim, Do Kyun; Jung, Jae Yun; Lee, Jin Hee; Jang, Hye Young; Kim, Hahn Bom; Hong, Ki Jeong

2012-09-01

The objective of this study was to develop and validate a new age-based formula for estimating body weights of Korean children. We obtained body weight and age data from a survey conducted in 2005 by the Korean Pediatric Society that was performed to establish normative values for Korean children. Children aged 0-14 were enrolled, and they were divided into three groups according to age: infants (<12 months), preschool-aged (1-4 years) and school-aged children (5-14 years). Seventy-five percent of all subjects were randomly selected to make a derivation set. Regression analysis was performed in order to produce equations that predict the weight from the age for each group. The linear equations derived from this analysis were simplified to create a weight estimating formula for Korean children. This formula was then validated using the remaining 25% of the study subjects with mean percentage error and absolute error. To determine whether a new formula accurately predicts actual weights of Korean children, we also compared this new formula to other weight estimation methods (APLS, Shann formula, Leffler formula, Nelson formula and Broselow tape). A total of 124,095 children's data were enrolled, and 19,854 (16.0%), 40,612 (32.7%) and 63,629 (51.3%) were classified as infants, preschool-aged and school-aged groups, respectively. Three equations, (age in months+9)/2, 2×(age in years)+9 and 4×(age in years)-1 were derived for infants, pre-school and school-aged groups, respectively. When these equations were applied to the validation set, the actual average weight of those children was 0.4kg heavier than our estimated weight (95% CI=0.37-0.43, p<0.001). The mean percentage error of our model (+0.9%) was lower than APLS (-11.5%), Shann formula (-8.6%), Leffler formula (-1.7%), Nelson formula (-10.0%), Best Guess formula (+5.0%) and Broselow tape (-4.8%) for all age groups. We developed and validated a simple formula to estimate body weight from the age of Korean children and found that this new formula was more accurate than other weight estimating methods. However, care should be taken when applying this formula to older children because of a large standard deviation of estimated weight. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Hydrolysed formula and risk of allergic or autoimmune disease: systematic review and meta-analysis

PubMed Central

Ierodiakonou, Despo; Khan, Tasnia; Chivinge, Jennifer; Robinson, Zoe; Geoghegan, Natalie; Jarrold, Katharine; Afxentiou, Thalia; Reeves, Tim; Cunha, Sergio; Trivella, Marialena; Garcia-Larsen, Vanessa; Leonardi-Bee, Jo

2016-01-01

Objective To determine whether feeding infants with hydrolysed formula reduces their risk of allergic or autoimmune disease. Design Systematic review and meta-analysis, as part of a series of systematic reviews commissioned by the UK Food Standards Agency to inform guidelines on infant feeding. Two authors selected studies by consensus, independently extracted data, and assessed the quality of included studies using the Cochrane risk of bias tool. Data sources Medline, Embase, Web of Science, CENTRAL, and LILACS searched between January 1946 and April 2015. Eligibility criteria for selecting studies Prospective intervention trials of hydrolysed cows’ milk formula compared with another hydrolysed formula, human breast milk, or a standard cows’ milk formula, which reported on allergic or autoimmune disease or allergic sensitisation. Results 37 eligible intervention trials of hydrolysed formula were identified, including over 19 000 participants. There was evidence of conflict of interest and high or unclear risk of bias in most studies of allergic outcomes and evidence of publication bias for studies of eczema and wheeze. Overall there was no consistent evidence that partially or extensively hydrolysed formulas reduce risk of allergic or autoimmune outcomes in infants at high pre-existing risk of these outcomes. Odds ratios for eczema at age 0-4, compared with standard cows’ milk formula, were 0.84 (95% confidence interval 0.67 to 1.07; I2=30%) for partially hydrolysed formula; 0.55 (0.28 to 1.09; I2=74%) for extensively hydrolysed casein based formula; and 1.12 (0.88 to 1.42; I2=0%) for extensively hydrolysed whey based formula. There was no evidence to support the health claim approved by the US Food and Drug Administration that a partially hydrolysed formula could reduce the risk of eczema nor the conclusion of the Cochrane review that hydrolysed formula could prevent allergy to cows’ milk. Conclusion These findings do not support current guidelines that recommend the use of hydrolysed formula to prevent allergic disease in high risk infants. Review registration PROSPERO CRD42013004252. PMID:26956579

Experimental validation of a 2D overland flow model using high resolution water depth and velocity data

NASA Astrophysics Data System (ADS)

Cea, L.; Legout, C.; Darboux, F.; Esteves, M.; Nord, G.

2014-05-01

This paper presents a validation of a two-dimensional overland flow model using empirical laboratory data. Unlike previous publications in which model performance is evaluated as the ability to predict an outlet hydrograph, we use high resolution 2D water depth and velocity data to analyze to what degree the model is able to reproduce the spatial distribution of these variables. Several overland flow conditions over two impervious surfaces of the order of one square meter with different micro and macro-roughness characteristics are studied. The first surface is a simplified representation of a sinusoidal terrain with three crests and furrows, while the second one is a mould of a real agricultural seedbed terrain. We analyze four different bed friction parameterizations and we show that the performance of formulations which consider the transition between laminar, smooth turbulent and rough turbulent flow do not improve the results obtained with Manning or Keulegan formulas for rough turbulent flow. The simulations performed show that using Keulegan formula with a physically-based definition of the bed roughness coefficient, a two-dimensional shallow water model is able to reproduce satisfactorily the flow hydrodynamics. It is shown that, even if the resolution of the topography data and numerical mesh are high enough to include all the small scale features of the bed surface, the roughness coefficient must account for the macro-roughness characteristics of the terrain in order to correctly reproduce the flow hydrodynamics.

Hydroacoustics for the discovery and quantification of Nassau grouper ( Epinephelus striatus) spawning aggregations

NASA Astrophysics Data System (ADS)

Egerton, J. P.; Johnson, A. F.; Le Vay, L.; McCoy, C. M.; Semmens, B. X.; Heppell, S. A.; Turner, J. R.

2017-06-01

Fish spawning aggregations (FSAs) are vital life-history events that need to be monitored to determine the health of aggregating populations; this is especially true of the endangered Nassau grouper ( Epinephelus striatus). Hydroacoustics were used to locate Nassau grouper FSAs at sites on the west end of Little Cayman (LCW), and east ends of Grand Cayman (GCE) and Cayman Brac (CBE). Fish abundance and biomass at each FSA were estimated via echo integration and FSA extent. Acoustic mean fish abundance estimates (±SE) on the FSA at LCW (893 ± 459) did not differ significantly from concurrent SCUBA estimates (1150 ± 75). Mean fish densities (number 1000 m-3) were significantly higher at LCW (33.13 ± 5.62) than at the other sites (GCE: 7.01 ± 2.1, CBE: 4.61 ± 1.16). We investigate different acoustic post-processing options to obtain target strength (TS), and we examine the different TS to total length (TL) formulas available. The SCUBA surveys also provided measures of TL through the use of laser callipers allowing development of an in situ TS to TL formula for Nassau grouper at the LCW FSA. Application of this formula revealed mean fish TL was significantly higher at LCW (65.4 ± 0.7 cm) than GCE (60.7 ± 0.4 cm), but not CBE (61.1 ± 2.5 cm). Use of the empirical TS to TL formula resulted in underestimation of fish length in comparison with diver measurements, highlighting the benefits of secondary length data and deriving specific TS to TL formulas for each population. FSA location examined with reference to seasonal marine protected areas (Designated Grouper Spawning Areas) showed FSAs were partially outside these areas at GCE and very close to the boundary at CBE. As FSAs often occur at the limits of safe diving operations, hydroacoustic technology provides an alternative method to monitor and inform future management of aggregating fish species.

Established dietary estimates of net acid production do not predict measured net acid excretion in patients with Type 2 diabetes on Paleolithic-Hunter-Gatherer-type diets.

PubMed

Frassetto, L A; Shi, L; Schloetter, M; Sebastian, A; Remer, T

2013-09-01

Formulas developed to estimate diet-dependent net acid excretion (NAE) generally agree with measured values for typical Western diets. Whether they can also appropriately predict NAE for 'Paleolithic-type' (Paleo) diets-which contain very high amounts of fruits and vegetables (F&V) and concurrent high amounts of protein is unknown. Here, we compare measured NAEs with established NAE estimates in subjects with Type 2 diabetes (T2D). Thirteen subjects with well-controlled T2D were randomized to either a Paleo or American Diabetes Association (ADA) diet for 14 days. Twenty-four hour urine collections were performed at baseline and end of the diet period, and analyzed for titratable acid, bicarbonate and ammonium to calculate measured NAE. Three formulas for estimating NAE from dietary intake were used; two (NAE_diet R or L) that include dietary mineral intake and sulfate- and organic acid (OA) production, and one that is empirically derived (NAE_diet F) only considering potassium and protein intake. Measured NAE on the Paleo diet was significantly lower than on the ADA-diet (+31±22 vs 112±52 mEq/day, P=0.002). Although all formula estimates showed similar and reasonable correlations (r=0.52-0.76) with measured NAE, each one underestimated measured values. The formula with the best correlation did not contain an estimate of dietary OA production. Paleo-diets are lower in NAE than typical Western diets. However, commonly used formulas clearly underestimate NAE, especially for diets with very high F&V (as the Paleo diet), and in subjects with T2D. This may be due to an inappropriate estimation of proton loads stemming from OAs, underlining the necessity for improved measures of OA-related proton sources.

Established dietary estimates of net acid production do not predict measured net acid excretion in patients with Type 2 diabetes on Paleolithic-Hunter-Gatherer-type diets

PubMed Central

Frassetto, Lynda A; Shi, Lijie; Schloetter, Monique; Sebastian, Anthony; Remer, Thomas

2014-01-01

Background Formulas developed to estimate diet-dependent net acid excretion (NAE) generally agree with measured values for typical Western diets. Whether they can also appropriately predict NAE for "Paleolithic-type" (Paleo) diets – which contain very high amounts of fruits and vegetables (F&V) and concurrent high amounts of protein is unknown. Here we compare measured NAEs with established NAE-estimates in subjects with Type 2 diabetes (T2D). Methods Thirteen subjects with well controlled T2D were randomized to either a Paleo or American Diabetes Association (ADA) diet for 14 days. 24-hour urine collections were performed at baseline and end of the diet period, and analyzed for titratable acid, bicarbonate, and ammonium to calculate measured NAE. Three formulas for estimating NAE from dietary intake were used; two (NAE_diet R or L) that include dietary mineral intake and sulfate- and organic acid (OA) production, and one that is empirically-derived (NAE_diet F) only considering potassium and protein intake. Results Measured NAE on the Paleo diet was significantly lower than on the ADA diet (+31±22 vs. 112±52 mEq/day, p=0.002). Although all formula estimates showed similar and reasonable correlations (r=0.52–0.76) with measured NAE, each one underestimated measured values. The formula with the best correlation did not contain an estimate of dietary organic acid production. Conclusions Paleo diets are lower in NAE than typical Western diets. However, commonly used formulas clearly underestimate NAE, especially for diets with very high F&V (as the Paleo diet), and in subjects with T2D. This may be due to an inappropriate estimation of proton loads stemming from OAs, underlining the necessity for improved measures of OA-related proton sources. PMID:23859996