The product of the Saccharomyces cerevisiae cell cycle gene DBF2 has homology with protein kinases and is periodically expressed in the cell cycle.

PubMed Central

Johnston, L H; Eberly, S L; Chapman, J W; Araki, H; Sugino, A

1990-01-01

Several Saccharomyces cerevisiae dbf mutants defective in DNA synthesis have been described previously. In this paper, one of them, dbf2, is characterized in detail. The DBF2 gene has been cloned and mapped, and its nucleotide sequence has been determined. This process has identified an open reading frame capable of encoding a protein of molecular weight 64,883 (561 amino acids). The deduced amino acid sequence contains all 11 conserved domains found in various protein kinases. DBF2 was periodically expressed in the cell cycle at a time that clearly differed from the time of expression of either the histone H2A or DNA polymerase I gene. Its first function was completed very near to initiation of DNA synthesis. However, DNA synthesis in the mutant was only delayed at 37 degrees C, and the cells blocked in nuclear division. Consistent with this finding, the execution point occurred about 1 h after DNA synthesis, and the nuclear morphology of the mutant at the restrictive temperature was that of cells blocked in late nuclear division. DBF2 is therefore likely to encode a protein kinase that may function in initiation of DNA synthesis and also in late nuclear division. Images PMID:2181271

Sequences within the 5' untranslated region regulate the levels of a kinetoplast DNA topoisomerase mRNA during the cell cycle.

PubMed Central

Pasion, S G; Hines, J C; Ou, X; Mahmood, R; Ray, D S

1996-01-01

Gene expression in trypanosomatids appears to be regulated largely at the posttranscriptional level and involves maturation of mRNA precursors by trans splicing of a 39-nucleotide miniexon sequence to the 5' end of the mRNA and cleavage and polyadenylation at the 3' end of the mRNA. To initiate the identification of sequences involved in the periodic expression of DNA replication genes in trypanosomatids, we have mapped splice acceptor sites in the 5' flanking region of the TOP2 gene, which encodes the kinetoplast DNA topoisomerase, and have carried out deletion analysis of this region on a plasmid-encoded TOP2 gene. Block deletions within the 5' untranslated region (UTR) identified two regions (-608 to -388 and -387 to -186) responsible for periodic accumulation of the mRNA. Deletion of one or the other of these sequences had no effect on periodic expression of the mRNA, while deletion of both regions resulted in constitutive expression of the mRNA throughout the cell cycle. Subcloning of these sequences into the 5' UTR of a construct lacking both regions of the TOP2 5' UTR has shown that an octamer consensus sequence present in the 5' UTR of the TOP2, RPA1, and DHFR-TS mRNAs is required for normal cycling of the TOP2 mRNA. Mutation of the consensus octamer sequence in the TOP2 5' UTR in a plasmid construct containing only a single consensus octamer and that shows normal cycling of the plasmid-encoded TOP2 mRNA resulted in substantial reduction of the cycling of the mRNA level. These results imply a negative regulation of TOP2 mRNA during the cell cycle by a mechanism involving redundant elements containing one or more copies of a conserved octamer sequence within the 5' UTR of TOP2 mRNA. PMID:8943327

Sequences within the 5' untranslated region regulate the levels of a kinetoplast DNA topoisomerase mRNA during the cell cycle.

PubMed

Pasion, S G; Hines, J C; Ou, X; Mahmood, R; Ray, D S

1996-12-01

Gene expression in trypanosomatids appears to be regulated largely at the posttranscriptional level and involves maturation of mRNA precursors by trans splicing of a 39-nucleotide miniexon sequence to the 5' end of the mRNA and cleavage and polyadenylation at the 3' end of the mRNA. To initiate the identification of sequences involved in the periodic expression of DNA replication genes in trypanosomatids, we have mapped splice acceptor sites in the 5' flanking region of the TOP2 gene, which encodes the kinetoplast DNA topoisomerase, and have carried out deletion analysis of this region on a plasmid-encoded TOP2 gene. Block deletions within the 5' untranslated region (UTR) identified two regions (-608 to -388 and -387 to -186) responsible for periodic accumulation of the mRNA. Deletion of one or the other of these sequences had no effect on periodic expression of the mRNA, while deletion of both regions resulted in constitutive expression of the mRNA throughout the cell cycle. Subcloning of these sequences into the 5' UTR of a construct lacking both regions of the TOP2 5' UTR has shown that an octamer consensus sequence present in the 5' UTR of the TOP2, RPA1, and DHFR-TS mRNAs is required for normal cycling of the TOP2 mRNA. Mutation of the consensus octamer sequence in the TOP2 5' UTR in a plasmid construct containing only a single consensus octamer and that shows normal cycling of the plasmid-encoded TOP2 mRNA resulted in substantial reduction of the cycling of the mRNA level. These results imply a negative regulation of TOP2 mRNA during the cell cycle by a mechanism involving redundant elements containing one or more copies of a conserved octamer sequence within the 5' UTR of TOP2 mRNA.

Digital encoding of cellular mRNAs enabling precise and absolute gene expression measurement by single-molecule counting.

PubMed

Fu, Glenn K; Wilhelmy, Julie; Stern, David; Fan, H Christina; Fodor, Stephen P A

2014-03-18

We present a new approach for the sensitive detection and accurate quantitation of messenger ribonucleic acid (mRNA) gene transcripts in single cells. First, the entire population of mRNAs is encoded with molecular barcodes during reverse transcription. After amplification of the gene targets of interest, molecular barcodes are counted by sequencing or scored on a simple hybridization detector to reveal the number of molecules in the starting sample. Since absolute quantities are measured, calibration to standards is unnecessary, and many of the relative quantitation challenges such as polymerase chain reaction (PCR) bias are avoided. We apply the method to gene expression analysis of minute sample quantities and demonstrate precise measurements with sensitivity down to sub single-cell levels. The method is an easy, single-tube, end point assay utilizing standard thermal cyclers and PCR reagents. Accurate and precise measurements are obtained without any need for cycle-to-cycle intensity-based real-time monitoring or physical partitioning into multiple reactions (e.g., digital PCR). Further, since all mRNA molecules are encoded with molecular barcodes, amplification can be used to generate more material for multiple measurements and technical replicates can be carried out on limited samples. The method is particularly useful for small sample quantities, such as single-cell experiments. Digital encoding of cellular content preserves true abundance levels and overcomes distortions introduced by amplification.

Characterization of cyclin-dependent kinases and Cdc2/Cdc28 kinase subunits in Trichomonas vaginalis.

PubMed

Amador, Erick; López-Pacheco, Karla; Morales, Nataly; Coria, Roberto; López-Villaseñor, Imelda

2017-04-01

Cyclin-dependent kinases (CDKs) have important roles in regulating key checkpoints between stages of the cell cycle. Their activity is tightly regulated through a variety of mechanisms, including through binding with cyclin proteins and the Cdc2/Cdc28 kinase subunit (CKS), and their phosphorylation at specific amino acids. Studies of the components involved in cell cycle control in parasitic protozoa are limited. Trichomonas vaginalis is the causative agent of trichomoniasis in humans and is therefore important in public health; however, some of the basic biological processes used by this organism have not been defined. Here, we characterized proteins potentially involved in cell cycle regulation in T. vaginalis. Three genes encoding protein kinases were identified in the T. vaginalis genome, and the corresponding recombinant proteins (TvCRK1, TvCRK2, TvCRK5) were studied. These proteins displayed similar sequence features to CDKs. Two genes encoding CKSs were also identified, and the corresponding recombinant proteins were found to interact with TvCRK1 and TvCRK2 by a yeast two-hybrid system. One putative cyclin B protein from T. vaginalis was found to bind to and activate the kinase activities of TvCRK1 and TvCRK5, but not TvCRK2. This work is the first characterization of proteins involved in cell cycle control in T. vaginalis.

Wounding coordinately induces cell wall protein, cell cycle and pectin methyl esterase genes involved in tuber closing layer and wound periderm development.

PubMed

Neubauer, Jonathan D; Lulai, Edward C; Thompson, Asunta L; Suttle, Jeffrey C; Bolton, Melvin D

2012-04-15

Little is known about the coordinate induction of genes that may be involved in agriculturally important wound-healing events. In this study, wound-healing events were determined together with wound-induced expression profiles of selected cell cycle, cell wall protein, and pectin methyl esterase genes using two diverse potato genotypes and two harvests (NDTX4271-5R and Russet Burbank tubers; 2008 and 2009 harvests). By 5 d after wounding, the closing layer and a nascent phellogen had formed. Phellogen cell divisions generated phellem layers until cessation of cell division at 28 d after wounding for both genotypes and harvests. Cell cycle genes encoding epidermal growth factor binding protein (StEBP), cyclin-dependent kinase B (StCDKB) and cyclin-dependent kinase regulatory subunit (StCKS1At) were induced by 1 d after wounding; these expressions coordinated with related phellogen formation and the induction and cessation of phellem cell formation. Genes encoding the structural cell wall proteins extensin (StExt1) and extensin-like (StExtlk) were dramatically up-regulated by 1-5 d after wounding, suggesting involvement with closing layer and later phellem cell layer formation. Wounding up-regulated pectin methyl esterase genes (StPME and StPrePME); StPME expression increased during closing layer and phellem cell formation, whereas maximum expression of StPrePME occurred at 5-14 d after wounding, implicating involvement in later modifications for closing layer and phellem cell formation. The coordinate induction and expression profile of StTLRP, a gene encoding a cell wall strengthening "tyrosine-and lysine-rich protein," suggested a role in the formation of the closing layer followed by phellem cell generation and maturation. Collectively, the genes monitored were wound-inducible and their expression profiles markedly coordinated with closing layer formation and the index for phellogen layer meristematic activity during wound periderm development; results were more influenced by harvest than genotype. Importantly, StTLRP was the only gene examined that may be involved in phellogen cell wall thickening after cessation of phellogen cell division. Published by Elsevier GmbH.

Genome-wide screen identifies novel machineries required for both ciliogenesis and cell cycle arrest upon serum starvation

PubMed Central

Kim, Ji Hyun; Ki, Soo Mi; Joung, Je-Gun; Scott, Eric; Heynen-Genel, Susanne; Aza-Blanc, Pedro; Kwon, Chang Hyuk; Kim, Joon; Gleeson, Joseph G.; Lee, Ji Eun

2016-01-01

Biogenesis of the primary cilium, a cellular organelle mediating various signaling pathways, is generally coordinated with cell cycle exit/re-entry. Although the dynamic cell cycle-associated profile of the primary cilium has been largely accepted, the mechanism governing the link between ciliogenesis and cell cycle progression has been poorly understood. Using a human genome-wide RNAi screen, we identify genes encoding subunits of the spliceosome and proteasome as novel regulators of ciliogenesis. We demonstrate that 1) the mRNA processing-related hits are essential for RNA expression of molecules acting in cilia disassembly, such as AURKA and PLK1, and 2) the ubiquitin-proteasome systems (UPS)-involved hits are necessary for proteolysis of molecules acting in cilia assembly, such as IFT88 and CPAP. In particular, we show that these screen hit-associated mechanisms are crucial for both cilia assembly and cell cycle arrest in response to serum withdrawal. Finally, our data suggest that the mRNA processing mechanism may modulate the UPS-dependent decay of cilia assembly regulators to control ciliary resorption-coupled cell cycle re-entry. PMID:27033521

In vivo expression of human cytomegalovirus (HCMV) microRNAs during latency.

PubMed

Meshesha, Mesfin K; Bentwich, Zvi; Solomon, Semaria A; Avni, Yonat Shemer

2016-01-01

Viral encoded microRNAs play key roles in regulating gene expression and the life cycle of human herpes viruses. Latency is one of the hallmarks of the human cytomegalovirus (HCMV or HHV5) life cycle, and its control may have immense practical applications. The present study aims to identify HCMV encoded microRNAs during the latency phase of the virus. We used a highly sensitive real time PCR (RTPCR) assay that involves a pre-amplification step before RTPCR. It can detect HCMV encoded microRNAs (miRNAs) during latency in purified monocytes and PBMCs from HCMV IgG positive donors and in latently infected monocytic THP-1 cell lines. During the latency phase, only eight HCMV encoded microRNAs were detected in PBMCs, monocytes and in the THP-1 cells. Five originated from the UL region of the virus genome and three from the US region. Reactivation of the virus from latency, in monocytes obtained from the same donor, using dexamethasone restored the expression of all known HCMV encoded miRNAs including those that were absent during latency. We observed a shift in the abundance of the two arms of mir-US29 between the productive and latency stages of the viral life cycle, suggesting that the star "passenger" form of this microRNA is preferentially expressed during latency. As a whole, our study demonstrates that HCMV expresses during the latency phase, both in vivo and in vitro, only a subset of its microRNAs, which may indicate that they play an important role in maintenance and reactivation of latency. Copyright © 2015 Elsevier B.V. All rights reserved.

The cell-cycle interactome: a source of growth regulators?

PubMed

Blomme, Jonas; Inzé, Dirk; Gonzalez, Nathalie

2014-06-01

When plants develop, cell proliferation and cell expansion are tightly controlled in order to generate organs with a determinate final size such as leaves. Several studies have demonstrated the importance of the cell proliferation phase for leaf growth, illustrating that cell-cycle regulation is crucial for correct leaf development. A large and complex set of interacting proteins that constitute the cell-cycle interactome controls the transition from one cell-cycle phase to another. Here, we review the current knowledge on cell-cycle regulators from this interactome affecting final leaf size when their expression is altered, mainly in Arabidopsis. In addition to the description of mutants of CYCLIN-DEPENDENT KINASES (CDKs), CYCLINS (CYCs), and their transcriptional and post-translational regulators, a phenotypic analysis of gain- and loss-of-function mutants for 27 genes encoding proteins that interact with cell-cycle proteins is presented. This compilation of information shows that when cell-cycle-related genes are mis-expressed, leaf growth is often altered and that, seemingly, three main trends appear to be crucial in the regulation of final organ size by cell-cycle-related genes: (i) cellular compensation; (ii) gene dosage; and (iii) correct transition through the G2/M phase by ANAPHASE PROMOTING COMPLEX/CYCLOSOME (APC/C) activation. In conclusion, this meta-analysis shows that the cell-cycle interactome is enriched in leaf growth regulators, and illustrates the potential to identify new leaf growth regulators among putative new cell-cycle regulators. © The Author 2013. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

The theta/gamma discrete phase code occuring during the hippocampal phase precession may be a more general brain coding scheme.

PubMed

Lisman, John

2005-01-01

In the hippocampus, oscillations in the theta and gamma frequency range occur together and interact in several ways, indicating that they are part of a common functional system. It is argued that these oscillations form a coding scheme that is used in the hippocampus to organize the readout from long-term memory of the discrete sequence of upcoming places, as cued by current position. This readout of place cells has been analyzed in several ways. First, plots of the theta phase of spikes vs. position on a track show a systematic progression of phase as rats run through a place field. This is termed the phase precession. Second, two cells with nearby place fields have a systematic difference in phase, as indicated by a cross-correlation having a peak with a temporal offset that is a significant fraction of a theta cycle. Third, several different decoding algorithms demonstrate the information content of theta phase in predicting the animal's position. It appears that small phase differences corresponding to jitter within a gamma cycle do not carry information. This evidence, together with the finding that principle cells fire preferentially at a given gamma phase, supports the concept of theta/gamma coding: a given place is encoded by the spatial pattern of neurons that fire in a given gamma cycle (the exact timing within a gamma cycle being unimportant); sequential places are encoded in sequential gamma subcycles of the theta cycle (i.e., with different discrete theta phase). It appears that this general form of coding is not restricted to readout of information from long-term memory in the hippocampus because similar patterns of theta/gamma oscillations have been observed in multiple brain regions, including regions involved in working memory and sensory integration. It is suggested that dual oscillations serve a general function: the encoding of multiple units of information (items) in a way that preserves their serial order. The relationship of such coding to that proposed by Singer and von der Malsburg is discussed; in their scheme, theta is not considered. It is argued that what theta provides is the absolute phase reference needed for encoding order. Theta/gamma coding therefore bears some relationship to the concept of "word" in digital computers, with word length corresponding to the number of gamma cycles within a theta cycle, and discrete phase corresponding to the ordered "place" within a word. Copyright 2005 Wiley-Liss, Inc.

Epstein–Barr virus nuclear antigen 3C interact with p73: Interplay between a viral oncoprotein and cellular tumor suppressor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sahu, Sushil Kumar; Mohanty, Suchitra; Kumar, Amit

The p73 protein has structural and functional homology with the tumor suppressor p53, which plays an important role in cell cycle regulation, apoptosis, and DNA repair. The p73 locus encodes both a tumor suppressor (TAp73) and a putative oncogene (ΔNp73). p73 May play a significant role in p53-deficient lymphomas infected with Epstein–Barr virus (EBV). EBV produces an asymptomatic infection in the majority of the global population, but it is associated with several human B-cell malignancies. The EBV-encoded Epstein–Barr virus nuclear antigen 3C (EBNA3C) is thought to disrupt the cell cycle checkpoint by interacting directly with p53 family proteins. Doxorubicin, amore » commonly used chemotherapeutic agent, induces apoptosis through p53 and p73 signaling such that the lowΔNp73 level promotes the p73-mediated intrinsic pathway of apoptosis. In this report, we investigated the mechanism by which EBV infection counters p73α-induced apoptosis through EBNA3C. - Highlights: • EBV-encoded EBNA3C suppresses doxorubicin-induced apoptosis in B-cell lymphomas. • EBNA3C binds to p73 to suppress its apoptotic effect. • EBNA3C maintains latency by regulating downstream mitochondrial pathways.« less

Protein farnesyltransferase in plants: molecular characterization and involvement in cell cycle control.

PubMed Central

Qian, D; Zhou, D; Ju, R; Cramer, C L; Yang, Z

1996-01-01

Farnesylation is required for membrane targeting, protein-protein interactions, and the biological activity of key regulatory proteins, such as Ras small GTPases and protein kinases in a wide range of eukaryotes. In this report, we describe the molecular identification of a plant protein farnesyltransferase (FTase) and evidence for its role in the control of the cell cycle in plants. A pea gene encoding a homolog of the FTase beta subunit was previously cloned using a polymerase chain reaction-based strategy. A similar approach was used to clone a pea gene encoding a homolog of the FTase alpha subunit. The biochemical function of the pea FTase homologs was demonstrated by the reconstitution of FTase enzyme activity using FTase fusion proteins coexpressed in Escherichia coll. RNA gel blot analyses showed that levels of FTase mRNAs are generally higher in tissues, such as those of nodules, that are active in cell division. The relationship of FTase to cell division was further analyzed during the growth of suspension-cultured tobacco BY-2 cells. A biphasic fluctuation of FTase enzyme activity preceded corresponding changes in mitotic activity at the early log phase of cell growth. Moreover, manumycin, a specific inhibitor of FTase, was effective in inhibiting mitosis and growth in these cells. Using synchronized BY-2 cells, manumycin completely blocked mitosis when added at the early S phase but not when added at the G2 phase. These data suggest that FTase is required for the plant cell cycle, perhaps by modulating the progression through the S phase and the transition from G1 to the S phase. PMID:8989889

dNTP pool levels modulate mutator phenotypes of error-prone DNA polymerase ε variants.

PubMed

Williams, Lindsey N; Marjavaara, Lisette; Knowels, Gary M; Schultz, Eric M; Fox, Edward J; Chabes, Andrei; Herr, Alan J

2015-05-12

Mutator phenotypes create genetic diversity that fuels tumor evolution. DNA polymerase (Pol) ε mediates leading strand DNA replication. Proofreading defects in this enzyme drive a number of human malignancies. Here, using budding yeast, we show that mutator variants of Pol ε depend on damage uninducible (Dun)1, an S-phase checkpoint kinase that maintains dNTP levels during a normal cell cycle and up-regulates dNTP synthesis upon checkpoint activation. Deletion of DUN1 (dun1Δ) suppresses the mutator phenotype of pol2-4 (encoding Pol ε proofreading deficiency) and is synthetically lethal with pol2-M644G (encoding altered Pol ε base selectivity). Although pol2-4 cells cycle normally, pol2-M644G cells progress slowly through S-phase. The pol2-M644G cells tolerate deletions of mediator of the replication checkpoint (MRC) 1 (mrc1Δ) and radiation sensitive (Rad) 9 (rad9Δ), which encode mediators of checkpoint responses to replication stress and DNA damage, respectively. The pol2-M644G mutator phenotype is partially suppressed by mrc1Δ but not rad9Δ; neither deletion suppresses the pol2-4 mutator phenotype. Thus, checkpoint activation augments the Dun1 effect on replication fidelity but is not required for it. Deletions of genes encoding key Dun1 targets that negatively regulate dNTP synthesis, suppress the dun1Δ pol2-M644G synthetic lethality and restore the mutator phenotype of pol2-4 in dun1Δ cells. DUN1 pol2-M644G cells have constitutively high dNTP levels, consistent with checkpoint activation. In contrast, pol2-4 and POL2 cells have similar dNTP levels, which decline in the absence of Dun1 and rise in the absence of the negative regulators of dNTP synthesis. Thus, dNTP pool levels correlate with Pol ε mutator severity, suggesting that treatments targeting dNTP pools could modulate mutator phenotypes for therapy.

Elongator complex is critical for cell cycle progression and leaf patterning in Arabidopsis.

PubMed

Xu, Deyang; Huang, Weihua; Li, Yang; Wang, Hua; Huang, Hai; Cui, Xiaofeng

2012-03-01

The mitotic cell cycle in higher eukaryotes is of pivotal importance for organ growth and development. Here, we report that Elongator, an evolutionarily conserved histone acetyltransferase complex, acts as an important regulator of mitotic cell cycle to promote leaf patterning in Arabidopsis. Mutations in genes encoding Elongator subunits resulted in aberrant cell cycle progression, and the altered cell division affects leaf polarity formation. The defective cell cycle progression is caused by aberrant DNA replication and increased DNA damage, which activate the DNA replication checkpoint to arrest the cell cycle. Elongator interacts with proliferating cell nuclear antigen (PCNA) and is required for efficient histone 3 (H3) and H4 acetylation coupled with DNA replication. Levels of chromatin-bound H3K56Ac and H4K5Ac known to associate with replicons during DNA replication were reduced in the mutants of both Elongator and chromatin assembly factor 1 (CAF-1), another protein complex that physically interacts with PCNA for DNA replication-coupled chromatin assembly. Disruptions of CAF-1 also led to severe leaf polarity defects, which indicated that Elongator and CAF-1 act, at least partially, in the same pathway to promote cell cycle progression. Collectively, our results demonstrate that Elongator is an important regulator of mitotic cell cycle, and the Elongator pathway plays critical roles in promoting leaf polarity formation. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

Complementation for an essential ancillary nonstructural protein function across parvovirus genera

PubMed Central

Mihaylov, Ivailo S.; Cotmore, Susan F.; Tattersall, Peter

2014-01-01

Parvoviruses encode a small number of ancillary proteins that differ substantially between genera. Within the genus Protoparvovirus, minute virus of mice (MVM) encodes three isoforms of its ancillary protein NS2, while human bocavirus 1 (HBoV1), in the genus Bocaparvovirus, encodes an NP1 protein that is unrelated in primary sequence to MVM NS2. To search for functional overlap between NS2 and NP1, we generated murine A9 cell populations that inducibly express HBoV1 NP1. These were used to test whether NP1 expression could complement specific defects resulting from depletion of MVM NS2 isoforms. NP1 induction had little impact on cell viability or cell cycle progression in uninfected cells, and was unable to complement late defects in MVM virion production associated with low NS2 levels. However, NP1 did relocate to MVM replication centers, and supports both the normal expansion of these foci and overcomes the early paralysis of DNA replication in NS2-null infections. PMID:25194919

BmCyclin B and BmCyclin B3 are required for cell cycle progression in the silkworm, Bombyx mori.

PubMed

Pan, Minhui; Hong, Kaili; Chen, Xiangyun; Pan, Chun; Chen, Xuemei; Kuang, Xiuxiu; Lu, Cheng

2013-04-01

Cyclin B is an important regulator of the cell cycle G2 to M phase transition. The silkworm genomic database shows that there are two Cyclin B genes in the silkworm (Bombyx mori), BmCyclin B and BmCyclin B3. Using silkworm EST data, the cyclin B3 (EU074796) gene was cloned. Its complete cDNA was 1665 bp with an ORF of 1536 bp derived from seven exons and six introns. The BmCyclin B3 gene encodes 511 amino acids, and the predicted molecular weight is 57.8 kD with an isoelectric point of 9.18. The protein contains one protein damage box and two cyclin boxes. RNA interference-mediated reduction of BmCyclin B and BmCyclin B3 expression induced cell cycle arrest in G2 or M phase in BmN-SWU1 cells, thus inhibiting cell proliferation. These results suggest that BmCyclin B and BmCyclin B3 are necessary for completing the cell cycle in silkworm cells.

Live-cell imaging of cell signaling using genetically encoded fluorescent reporters.

PubMed

Ni, Qiang; Mehta, Sohum; Zhang, Jin

2018-01-01

Synergistic advances in fluorescent protein engineering and live-cell imaging techniques in recent years have fueled the concurrent development and application of genetically encoded fluorescent reporters that are tailored for tracking signaling dynamics in living systems over multiple length and time scales. These biosensors are uniquely suited for this challenging task, owing to their specificity, sensitivity, and versatility, as well as to the noninvasive and nondestructive nature of fluorescence and the power of genetic encoding. Over the past 10 years, a growing number of fluorescent reporters have been developed for tracking a wide range of biological signals in living cells and animals, including second messenger and metabolite dynamics, enzyme activation and activity, and cell cycle progression and neuronal activity. Many of these biosensors are gaining wide use and are proving to be indispensable for unraveling the complex biological functions of individual signaling molecules in their native environment, the living cell, shedding new light on the structural and molecular underpinnings of cell signaling. In this review, we highlight recent advances in protein engineering that are likely to help expand and improve the design and application of these valuable tools. We then turn our focus to specific examples of live-cell imaging using genetically encoded fluorescent reporters as an important platform for advancing our understanding of G protein-coupled receptor signaling and neuronal activity. © 2017 Federation of European Biochemical Societies.

Gametophyte differentiation and imprinting control in plants: Crosstalk between RBR and chromatin.

PubMed

Johnston, Amal J; Gruissem, Wilhelm

2009-01-01

The Retinoblastoma (pRb) pathway has been implicated as a convergent regulatory unit in the control of cell cycle and disease. We have shown that a crosstalk between RETINOBLASTOMA RELATED (RBR), the Arabidopsis homologue of pRb, and the genes encoding proteins of the chromatin complexes involved in DNA or histone methylation, controls gametophytic and post-fertilization differentiation events and a subset of imprinting effects. We describe here a plausible model that incorporates several components of the plant Retinoblastoma pathway, thus offering a novel paradigm that merges the traditional cell cycle and the chromatin components in the control of cell differentiation and imprinting.

Defects in a New Class of Sulfate/Anion Transporter Link Sulfur Acclimation Responses to Intracellular Glutathione Levels and Cell Cycle Control1[W][OPEN

PubMed Central

Fang, Su-Chiung; Chung, Chin-Lin; Chen, Chun-Han; Lopez-Paz, Cristina; Umen, James G.

2014-01-01

We previously identified a mutation, suppressor of mating type locus3 15-1 (smt15-1), that partially suppresses the cell cycle defects caused by loss of the retinoblastoma tumor suppressor-related protein encoded by the MAT3 gene in Chlamydomonas reinhardtii. smt15-1 single mutants were also found to have a cell cycle defect leading to a small-cell phenotype. SMT15 belongs to a previously uncharacterized subfamily of putative membrane-localized sulfate/anion transporters that contain a sulfate transporter domain and are found in a widely distributed subset of eukaryotes and bacteria. Although we observed that smt15-1 has a defect in acclimation to sulfur-limited growth conditions, sulfur acclimation (sac) mutants, which are more severely defective for acclimation to sulfur limitation, do not have cell cycle defects and cannot suppress mat3. Moreover, we found that smt15-1, but not sac mutants, overaccumulates glutathione. In wild-type cells, glutathione fluctuated during the cell cycle, with highest levels in mid G1 phase and lower levels during S and M phases, while in smt15-1, glutathione levels remained elevated during S and M. In addition to increased total glutathione levels, smt15-1 cells had an increased reduced-to-oxidized glutathione redox ratio throughout the cell cycle. These data suggest a role for SMT15 in maintaining glutathione homeostasis that impacts the cell cycle and sulfur acclimation responses. PMID:25361960

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gabrielson, Marike; Reizer, Edwin; Stål, Olle

An increasing body of evidence is pointing towards mitochondrial regulation of the cell cycle. In a previous study of HER2-positive tumours we could demonstrate a common loss in the gene encoding for the mitochondrial transporter SLC25A43 and also a significant relation between SLC25A43 protein expression and S-phase fraction. Here, we investigated the consequence of suppressed SLC25A43 expression on cell cycle progression and proliferation in breast epithelial cells. In the present study, we suppressed SLC25A43 using siRNA in immortalised non-cancerous breast epithelial MCF10A cells and HER2-positive breast cancer cells BT-474. Viability, apoptosis, cell proliferation rate, cell cycle phase distribution, and nuclearmore » Ki-67 and p21, were assessed by flow cytometry. Cell cycle related gene expressions were analysed using real-time PCR. We found that SLC25A43 knockdown in MCF10A cells significantly inhibited cell cycle progression during G{sub 1}-to-S transition, thus significantly reducing the proliferation rate and fraction of Ki-67 positive MCF10A cells. In contrast, suppressed SLC25A43 expression in BT-474 cells resulted in a significantly increased proliferation rate together with an enhanced G{sub 1}-to-S transition. This was reflected by an increased fraction of Ki-67 positive cells and reduced level of nuclear p21. In line with our previous results, we show a role for SLC25A43 as a regulator of cell cycle progression and proliferation through a putative mitochondrial checkpoint. These novel data further strengthen the connection between mitochondrial function and the cell cycle, both in non-malignant and in cancer cells. - Highlights: • Proposed cell cycle regulation through the mitochondrial transporter SLC25A43. • SLC25A43 alters cell proliferation rate and cell cycle progression. • Suppressed SLC25A43 influences transcription of cell cycle regulatory genes.« less

Optogenetic manipulation of cGMP in cells and animals by the tightly light-regulated guanylyl-cyclase opsin CyclOp

PubMed Central

Gao, Shiqiang; Nagpal, Jatin; Schneider, Martin W.; Kozjak-Pavlovic, Vera; Nagel, Georg; Gottschalk, Alexander

2015-01-01

Cyclic GMP (cGMP) signalling regulates multiple biological functions through activation of protein kinase G and cyclic nucleotide-gated (CNG) channels. In sensory neurons, cGMP permits signal modulation, amplification and encoding, before depolarization. Here we implement a guanylyl cyclase rhodopsin from Blastocladiella emersonii as a new optogenetic tool (BeCyclOp), enabling rapid light-triggered cGMP increase in heterologous cells (Xenopus oocytes, HEK293T cells) and in Caenorhabditis elegans. Among five different fungal CyclOps, exhibiting unusual eight transmembrane topologies and cytosolic N-termini, BeCyclOp is the superior optogenetic tool (light/dark activity ratio: 5,000; no cAMP production; turnover (20 °C) ∼17 cGMP s−1). Via co-expressed CNG channels (OLF in oocytes, TAX-2/4 in C. elegans muscle), BeCyclOp photoactivation induces a rapid conductance increase and depolarization at very low light intensities. In O2/CO2 sensory neurons of C. elegans, BeCyclOp activation evokes behavioural responses consistent with their normal sensory function. BeCyclOp therefore enables precise and rapid optogenetic manipulation of cGMP levels in cells and animals. PMID:26345128

Optogenetic manipulation of cGMP in cells and animals by the tightly light-regulated guanylyl-cyclase opsin CyclOp.

PubMed

Gao, Shiqiang; Nagpal, Jatin; Schneider, Martin W; Kozjak-Pavlovic, Vera; Nagel, Georg; Gottschalk, Alexander

2015-09-08

Cyclic GMP (cGMP) signalling regulates multiple biological functions through activation of protein kinase G and cyclic nucleotide-gated (CNG) channels. In sensory neurons, cGMP permits signal modulation, amplification and encoding, before depolarization. Here we implement a guanylyl cyclase rhodopsin from Blastocladiella emersonii as a new optogenetic tool (BeCyclOp), enabling rapid light-triggered cGMP increase in heterologous cells (Xenopus oocytes, HEK293T cells) and in Caenorhabditis elegans. Among five different fungal CyclOps, exhibiting unusual eight transmembrane topologies and cytosolic N-termini, BeCyclOp is the superior optogenetic tool (light/dark activity ratio: 5,000; no cAMP production; turnover (20 °C) ∼17 cGMP s(-1)). Via co-expressed CNG channels (OLF in oocytes, TAX-2/4 in C. elegans muscle), BeCyclOp photoactivation induces a rapid conductance increase and depolarization at very low light intensities. In O2/CO2 sensory neurons of C. elegans, BeCyclOp activation evokes behavioural responses consistent with their normal sensory function. BeCyclOp therefore enables precise and rapid optogenetic manipulation of cGMP levels in cells and animals.

Drosophila stem loop binding protein coordinates accumulation of mature histone mRNA with cell cycle progression

PubMed Central

Sullivan, Eileen; Santiago, Carlos; Parker, Emily D.; Dominski, Zbigniew; Yang, Xiaocui; Lanzotti, David J.; Ingledue, Tom C.; Marzluff, William F.; Duronio, Robert J.

2001-01-01

Replication-associated histone genes encode the only metazoan mRNAs that lack polyA tails, ending instead in a conserved 26-nt sequence that forms a stem–loop. Most of the regulation of mammalian histone mRNA is posttranscriptional and mediated by this unique 3′ end. Stem–loop–binding protein (SLBP) binds to the histone mRNA 3′ end and is thought to participate in all aspects of histone mRNA metabolism, including cell cycle regulation. To examine SLBP function genetically, we have cloned the gene encoding Drosophila SLBP (dSLBP) by a yeast three-hybrid method and have isolated mutations in dSLBP. dSLBP function is required both zygotically and maternally. Strong dSLBP alleles cause zygotic lethality late in development and result in production of stable histone mRNA that accumulates in nonreplicating cells. These histone mRNAs are cytoplasmic and have polyadenylated 3′ ends like other polymerase II transcripts. Hypomorphic dSLBP alleles support zygotic development but cause female sterility. Eggs from these females contain dramatically reduced levels of histone mRNA, and mutant embryos are not able to complete the syncytial embryonic cycles. This is in part because of a failure of chromosome condensation at mitosis that blocks normal anaphase. These data demonstrate that dSLBP is required in vivo for 3′ end processing of histone pre-mRNA, and that this is an essential function for development. Moreover, dSLBP-dependent processing plays an important role in coupling histone mRNA production with the cell cycle. PMID:11157774

Propionibacterium acnes inhibits FOXM1 and induces cell cycle alterations in human primary prostate cells.

PubMed

Sayanjali, Behnam; Christensen, Gitte J M; Al-Zeer, Munir A; Mollenkopf, Hans-Joachim; Meyer, Thomas F; Brüggemann, Holger

2016-11-01

Propionibacterium acnes has been detected in diseased human prostate tissue, and cell culture experiments suggest that the bacterium can establish a low-grade inflammation. Here, we investigated its impact on human primary prostate epithelial cells. Microarray analysis confirmed the inflammation-inducing capability of P. acnes but also showed deregulation of genes involved in the cell cycle. qPCR experiments showed that viable P. acnes downregulates a master regulator of cell cycle progression, FOXM1. Flow cytometry experiments revealed that P. acnes increases the number of cells in S-phase. We tested the hypothesis that a P. acnes-produced berninamycin-like thiopeptide is responsible for this effect, since it is related to the FOXM1 inhibitor siomycin. The thiopeptide biosynthesis gene cluster was strongly expressed; it is present in subtype IB of P. acnes, but absent from type IA, which is most abundant on human skin. A knock-out mutant lacking the gene encoding the berninamycin-like peptide precursor was unable to downregulate FOXM1 and to halt the cell cycle. Our study reveals a novel host cell-interacting activity of P. acnes. Copyright © 2016 The Authors. Published by Elsevier GmbH.. All rights reserved.

The spatio-temporal dynamics of PKA activity profile during mitosis and its correlation to chromosome segregation.

PubMed

Vandame, Pauline; Spriet, Corentin; Trinel, Dave; Gelaude, Armance; Caillau, Katia; Bompard, Coralie; Biondi, Emanuele; Bodart, Jean-François

2014-01-01

The cyclic adenosine monophosphate dependent kinase protein (PKA) controls a variety of cellular processes including cell cycle regulation. Here, we took advantages of genetically encoded FRET-based biosensors, using an AKAR-derived biosensor to characterize PKA activity during mitosis in living HeLa cells using a single-cell approach. We measured PKA activity changes during mitosis. HeLa cells exhibit a substantial increase during mitosis, which ends with telophase. An AKAREV T>A inactive form of the biosensor and H89 inhibitor were used to ascertain for the specificity of the PKA activity measured. On a spatial point of view, high levels of activity near to chromosomal plate during metaphase and anaphase were detected. By using the PKA inhibitor H89, we assessed the role of PKA in the maintenance of a proper division phenotype. While this treatment in our hands did not impaired cell cycle progression in a drastic manner, inhibition of PKA leads to a dramatic increase in chromososme misalignement on the spindle during metaphase that could result in aneuploidies. Our study emphasizes the insights that can be gained with genetically encoded FRET-based biosensors, which enable to overcome the shortcomings of classical methologies and unveil in vivo PKA spatiotemporal profiles in HeLa cells.

Actin cytoskeletal remodeling with protrusion formation is essential for heart regeneration in Hippo-deficient mice

PubMed Central

Morikawa, Yuka; Zhang, Min; Heallen, Todd; Leach, John; Tao, Ge; Xiao, Yang; Bai, Yan; Li, Wei; Willerson, James T.; Martin, James F.

2015-01-01

The mammalian heart regenerates poorly, and damage commonly leads to heart failure. Hippo signaling is an evolutionarily conserved kinase cascade that regulates organ size during development and prevents adult mammalian cardiomyocyte regeneration by inhibiting the transcriptional coactivator Yap, which also responds to mechanical signaling in cultured cells to promote cell proliferation. To identify Yap target genes that are activated during cardiomyocyte renewal and regeneration, we performed Yap chromatin immunoprecipitation sequencing (ChIP-Seq) and mRNA expression profiling in Hippo signaling-deficient mouse hearts. We found that Yap directly regulated genes encoding cell cycle progression proteins, as well as genes encoding proteins that promote F-actin polymerization and that link the actin cytoskeleton to the extracellular matrix. Included in the latter group were components of the dystrophin glycoprotein complex (DGC), a large molecular complex that, when defective, results in muscular dystrophy in humans. Cardiomyocytes near scar tissue of injured Hippo signaling-deficient mouse hearts showed cellular protrusions suggestive of cytoskeletal remodeling. The hearts of mdx mutant mice, which lack functional dystrophin and are a model for muscular dystrophy, showed impaired regeneration and cytoskeleton remodeling, but normal cardiomyocyte proliferation after injury. Our data showed that, in addition to genes encoding cell cycle progression proteins, Yap regulated genes that enhance cytoskeletal remodeling Thus, blocking the Hippo pathway input to Yap may tip the balance so that Yap responds to the mechanical changes associated with heart injury to promote repair. PMID:25943351

Fission yeast cdc24(+) encodes a novel replication factor required for chromosome integrity.

PubMed

Gould, K L; Burns, C G; Feoktistova, A; Hu, C P; Pasion, S G; Forsburg, S L

1998-07-01

A mutation within the Schizosaccharomyces pombe cdc24(+) gene was identified previously in a screen for cell division cycle mutants and the cdc24(+) gene was determined to be essential for S phase in this yeast. We have isolated the cdc24(+) gene by complementation of a new temperature-sensitive allele of the gene, cdc24-G1. The DNA sequence predicts the presence of an open reading frame punctuated by six introns which encodes a pioneer protein of 58 kD. A cdc24 null mutant was generated by homologous recombination. Haploid cells lacking cdc24(+) are inviable, indicating that cdc24(+) is an essential gene. The transcript of cdc24(+) is present at constant levels throughout the cell cycle. Cells lacking cdc24(+) function show a checkpoint-dependent arrest with a 2N DNA content, indicating a block late in S phase. Arrest is accompanied by a rapid loss of viability and chromosome breakage. An S. pombe homolog of the replicative DNA helicase DNA2 of S. cerevisiae suppresses cdc24. These results suggest that Cdc24p plays a role in the progression of normal DNA replication and is required to maintain genomic integrity.

Fission yeast cdc24(+) encodes a novel replication factor required for chromosome integrity.

PubMed Central

Gould, K L; Burns, C G; Feoktistova, A; Hu, C P; Pasion, S G; Forsburg, S L

1998-01-01

A mutation within the Schizosaccharomyces pombe cdc24(+) gene was identified previously in a screen for cell division cycle mutants and the cdc24(+) gene was determined to be essential for S phase in this yeast. We have isolated the cdc24(+) gene by complementation of a new temperature-sensitive allele of the gene, cdc24-G1. The DNA sequence predicts the presence of an open reading frame punctuated by six introns which encodes a pioneer protein of 58 kD. A cdc24 null mutant was generated by homologous recombination. Haploid cells lacking cdc24(+) are inviable, indicating that cdc24(+) is an essential gene. The transcript of cdc24(+) is present at constant levels throughout the cell cycle. Cells lacking cdc24(+) function show a checkpoint-dependent arrest with a 2N DNA content, indicating a block late in S phase. Arrest is accompanied by a rapid loss of viability and chromosome breakage. An S. pombe homolog of the replicative DNA helicase DNA2 of S. cerevisiae suppresses cdc24. These results suggest that Cdc24p plays a role in the progression of normal DNA replication and is required to maintain genomic integrity. PMID:9649516

Inhibition of E2F1 activity and cell cycle progression by arsenic via retinoblastoma protein.

PubMed

Sheldon, Lynn A

2017-01-01

The regulation of cell cycle progression by steroid hormones and growth factors is important for maintaining normal cellular processes including development and cell proliferation. Deregulated progression through the G1/S and G2/M cell cycle transitions can lead to uncontrolled cell proliferation and cancer. The transcription factor E2F1, a key cell cycle regulator, targets genes encoding proteins that regulate cell cycle progression through the G1/S transition as well as proteins important in DNA repair and apoptosis. E2F1 expression and activity is inhibited by inorganic arsenic (iAs) that has a dual role as a cancer therapeutic and as a toxin that leads to diseases including cancer. An understanding of what underlies this dichotomy will contribute to understanding how to use iAs as a more effective therapeutic and also how to treat cancers that iAs promotes. Here, we show that quiescent breast adenocarcinoma MCF-7 cells treated with 17-β estradiol (E2) progress through the cell cycle, but few cells treated with E2 + iAs progress from G1 into S-phase due to a block in cell cycle progression. Our data support a model in which iAs inhibits the dissociation of E2F1 from the tumor suppressor, retinoblastoma protein (pRB) due to changes in pRB phosphorylation which leads to decreased E2F1 transcriptional activity. These findings present an explanation for how iAs can disrupt cell cycle progression through E2F1-pRB and has implications for how iAs acts as a cancer therapeutic as well as how it may promote tumorigenesis through decreased DNA repair.

Fucci2a: a bicistronic cell cycle reporter that allows Cre mediated tissue specific expression in mice.

PubMed

Mort, Richard Lester; Ford, Matthew Jonathan; Sakaue-Sawano, Asako; Lindstrom, Nils Olof; Casadio, Angela; Douglas, Adam Thomas; Keighren, Margaret Anne; Hohenstein, Peter; Miyawaki, Atsushi; Jackson, Ian James

2014-01-01

Markers of cell cycle stage allow estimation of cell cycle dynamics in cell culture and during embryonic development. The Fucci system incorporates genetically encoded probes that highlight G1 and S/G2/M phases of the cell cycle allowing live imaging. However the available mouse models that incorporate Fucci are beset by problems with transgene inactivation, varying expression level, lack of conditional potential and/or the need to maintain separate transgenes-there is no transgenic mouse model that solves all these problems. To address these shortfalls we re-engineered the Fucci system to create 2 bicistronic Fucci variants incorporating both probes fused using the Thosea asigna virus 2A (T2A) self cleaving peptide. We characterize these variants in stable 3T3 cell lines. One of the variants (termed Fucci2a) faithfully recapitulated the nuclear localization and cell cycle stage specific florescence of the original Fucci system. We go on to develop a conditional mouse allele (R26Fucci2aR) carefully designed for high, inducible, ubiquitous expression allowing investigation of cell cycle status in single cell lineages within the developing embryo. We demonstrate the utility of R26Fucci2aR for live imaging by using high resolution confocal microscopy of ex vivo lung, kidney and neural crest development. Using our 3T3 system we describe and validate a method to estimate cell cycle times from relatively short time-lapse sequences that we then apply to our neural crest data. The Fucci2a system and the R26Fucci2aR mouse model are compelling new tools for the investigation of cell cycle dynamics in cell culture and during mouse embryonic development.

p53 functions as a cell cycle control protein in osteosarcomas.

PubMed

Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

1990-11-01

Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae.

Canonical and Non-Canonical Autophagy in HIV-1 Replication Cycle

PubMed Central

Leymarie, Olivier; Lepont, Leslie; Berlioz-Torrent, Clarisse

2017-01-01

Autophagy is a lysosomal-dependent degradative process essential for maintaining cellular homeostasis, and is a key player in innate and adaptive immune responses to intracellular pathogens such as human immunodeficiency virus type 1 (HIV-1). In HIV-1 target cells, autophagy mechanisms can (i) selectively direct viral proteins and viruses for degradation; (ii) participate in the processing and presentation of viral-derived antigens through major histocompatibility complexes; and (iii) contribute to interferon production in response to HIV-1 infection. As a consequence, HIV-1 has evolved different strategies to finely regulate the autophagy pathway to favor its replication and dissemination. HIV-1 notably encodes accessory genes encoding Tat, Nef and Vpu proteins, which are able to perturb and hijack canonical and non-canonical autophagy mechanisms. This review outlines the current knowledge on the complex interplay between autophagy and HIV-1 replication cycle, providing an overview of the autophagy-mediated molecular processes deployed both by infected cells to combat the virus and by HIV-1 to evade antiviral response. PMID:28946621

A super-assembly of Whi3 encodes memory of deceptive encounters by single cells during yeast courtship.

PubMed

Caudron, Fabrice; Barral, Yves

2013-12-05

Cellular behavior is frequently influenced by the cell's history, indicating that single cells may memorize past events. We report that budding yeast permanently escape pheromone-induced cell-cycle arrest when experiencing a deceptive mating attempt, i.e., not reaching their putative partner within reasonable time. This acquired behavior depends on super-assembly and inactivation of the G1/S inhibitor Whi3, which liberates the G1 cyclin Cln3 from translational inhibition. Super-assembly of Whi3 is a slow response to pheromone, driven by polyQ and polyN domains, counteracted by Hsp70, and stable over generations. Unlike prion aggregates, Whi3 super-assemblies are not inherited mitotically but segregate to the mother cell. We propose that such polyQ- and polyN-based elements, termed here mnemons, act as cellular memory devices to encode previous environmental conditions. Copyright © 2013 Elsevier Inc. All rights reserved.

Mutations in a gene encoding the. cap alpha. subunit of a Saccharomyces cerevisiae G protein indicate a role in mating pheromone signaling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jahng, K.Y.; Ferguson, J.; Reed, S.I.

1988-06-01

Mutations which allowed conjugation by Saccharomyces cerevisiae cells lacking a mating pheromone receptor gene were selected. One of the genes defined by such mutations was isolated from a yeast genomic library by complementation of a temperature-sensitive mutation and is identically to the gene GPA1 (also known as SCG1), recently shown to be highly homologous to gene encoding the ..cap alpha.. subunits of mammalian G proteins. Physiological analysis of temperature-sensitive gpal mutations suggests that the encoded G protein is involved in signaling in response to mating pheromones. Mutational disruption of G-protein activity causes cell-cycle arrest in G/sub 1/, deposition of mating-specificmore » cell surface aggultinins, and induction of pheromone-specific mRNa, all of which are responses to pheromone in wild-type cells. In addition, mutants can conjugate without the benefit of mating pheromone or pheromone receptor. A model is presented where the activated G protein has a negative impact on a constitutive signal which normally keeps the pheromone response repressed.« less

Complementation for an essential ancillary non-structural protein function across parvovirus genera.

PubMed

Mihaylov, Ivailo S; Cotmore, Susan F; Tattersall, Peter

2014-11-01

Parvoviruses encode a small number of ancillary proteins that differ substantially between genera. Within the genus Protoparvovirus, minute virus of mice (MVM) encodes three isoforms of its ancillary protein NS2, while human bocavirus 1 (HBoV1), in the genus Bocaparvovirus, encodes an NP1 protein that is unrelated in primary sequence to MVM NS2. To search for functional overlap between NS2 and NP1, we generated murine A9 cell populations that inducibly express HBoV1 NP1. These were used to test whether NP1 expression could complement specific defects resulting from depletion of MVM NS2 isoforms. NP1 induction had little impact on cell viability or cell cycle progression in uninfected cells, and was unable to complement late defects in MVM virion production associated with low NS2 levels. However, NP1 did relocate to MVM replication centers, and supports both the normal expansion of these foci and overcomes the early paralysis of DNA replication in NS2-null infections. Copyright © 2014 Elsevier Inc. All rights reserved.

Active touch and self-motion encoding by Merkel cell-associated afferents

PubMed Central

Severson, Kyle S.; Xu, Duo; Van de Loo, Margaret; Bai, Ling; Ginty, David D.; O’Connor, Daniel H.

2017-01-01

Summary Touch perception depends on integrating signals from multiple types of peripheral mechanoreceptors. Merkel-cell associated afferents are thought to play a major role in form perception by encoding surface features of touched objects. However, activity of Merkel afferents during active touch has not been directly measured. Here, we show that Merkel and unidentified slowly adapting afferents in the whisker system of behaving mice respond to both self-motion and active touch. Touch responses were dominated by sensitivity to bending moment (torque) at the base of the whisker and its rate of change, and largely explained by a simple mechanical model. Self-motion responses encoded whisker position within a whisk cycle (phase), not absolute whisker angle, and arose from stresses reflecting whisker inertia and activity of specific muscles. Thus, Merkel afferents send to the brain multiplexed information about whisker position and surface features, suggesting that proprioception and touch converge at the earliest neural level. PMID:28434802

Regulation of plasmid-encoded isoprene metabolism in Rhodococcus, a representative of an important link in the global isoprene cycle

PubMed Central

Crombie, Andrew T; Khawand, Myriam El; Rhodius, Virgil A; Fengler, Kevin A; Miller, Michael C; Whited, Gregg M; McGenity, Terry J; Murrell, J Colin

2015-01-01

Emissions of biogenic volatile organic compounds (VOCs) form an important part of the global carbon cycle, comprising a significant proportion of net ecosystem productivity. They impact atmospheric chemistry and contribute directly and indirectly to greenhouse gases. Isoprene, emitted largely from plants, comprises one third of total VOCs, yet in contrast to methane, which is released in similar quantities, we know little of its biodegradation. Here, we report the genome of an isoprene degrading isolate, Rhodococcus sp. AD45, and, using mutagenesis shows that a plasmid-encoded soluble di-iron centre isoprene monooxygenase (IsoMO) is essential for isoprene metabolism. Using RNA sequencing (RNAseq) to analyse cells exposed to isoprene or epoxyisoprene in a substrate-switch time-course experiment, we show that transcripts from 22 contiguous genes, including those encoding IsoMO, were highly upregulated, becoming among the most abundant in the cell and comprising over 25% of the entire transcriptome. Analysis of gene transcription in the wild type and an IsoMO-disrupted mutant strain showed that epoxyisoprene, or a subsequent product of isoprene metabolism, rather than isoprene itself, was the inducing molecule. We provide a foundation of molecular data for future research on the environmental biological consumption of this important, climate-active compound. PMID:25727256

Does mechanism matter? Unrelated neurotoxicants converge on cell cycle and apoptosis during neurodifferentiation.

PubMed

Slotkin, Theodore A; Seidler, Frederic J

2012-07-01

Mechanistically unrelated developmental neurotoxicants often produce neural cell loss culminating in similar functional and behavioral outcomes. We compared an organophosphate pesticide (diazinon), an organochlorine pesticide (dieldrin) and a metal (Ni(2+)) for effects on the genes regulating cell cycle and apoptosis in differentiating PC12 cells, an in vitro model of neuronal development. Each agent was introduced at 30μM for 24 or 72h, treatments devoid of cytotoxicity. Using microarrays, we examined the mRNAs encoding nearly 400 genes involved in each of the biological processes. All three agents targeted both the cell cycle and apoptosis pathways, evidenced by significant transcriptional changes in 40-45% of the cell cycle-related genes and 30-40% of the apoptosis-related genes. There was also a high degree of overlap as to which specific genes were affected by the diverse agents, with 80 cell cycle genes and 56 apoptosis genes common to all three. Concordance analysis, which assesses stringent matching of the direction, magnitude and timing of the transcriptional changes, showed highly significant correlations for pairwise comparisons of all the agents, for both cell cycle and apoptosis. Our results show that otherwise disparate developmental neurotoxicants converge on common cellular pathways governing the acquisition and programmed death of neural cells, providing a specific link to cell deficits. Our studies suggest that identifying the initial mechanism of action of a developmental neurotoxicant may be strategically less important than focusing on the pathways that converge on common final outcomes such as cell loss. Copyright © 2012 Elsevier Inc. All rights reserved.

DOES MECHANISM MATTER? UNRELATED NEUROTOXICANTS CONVERGE ON CELL CYCLE AND APOPTOSIS DURING NEURODIFFERENTIATION

PubMed Central

Slotkin, Theodore A.; Seidler, Frederic J.

2012-01-01

Mechanistically unrelated developmental neurotoxicants often produce neural cell loss culminating in similar functional and behavioral outcomes. We compared an organophosphate pesticide (diazinon), an organochlorine pesticide (dieldrin) and a metal (Ni2+) for effects on the genes regulating cell cycle and apoptosis in differentiating PC12 cells, an in vitro model of neuronal development. Each agent was introduced at 30 μM for 24 or 72 hr, treatments devoid of cytotoxicity. Using microarrays, we examined the mRNAs encoding nearly 400 genes involved in each of the biological processes. All three agents targeted both the cell cycle and apoptosis pathways, evidenced by significant transcriptional changes in 40–45% of the cell cycle-related genes and 30–40% of the apoptosis-related genes. There was also a high degree of overlap as to which specific genes were affected by the diverse agents, with 80 cell cycle genes and 56 apoptosis genes common to all three. Concordance analysis, which assesses stringent matching of the direction, magnitude and timing of the transcriptional changes, showed highly significant correlations for pairwise comparisons of all the agents, for both cell cycle and apoptosis. Our results show that otherwise disparate developmental neurotoxicants converge on common cellular pathways governing the acquisition and programmed death of neural cells, providing a specific link to cell deficits. Our studies suggest that identifying the initial mechanism of action of a developmental neurotoxicant may be strategically less important than focusing on the pathways that converge on common final outcomes such as cell loss. PMID:22546817

Regulation of male germ cell cycle arrest and differentiation by DND1 is modulated by genetic background

PubMed Central

Cook, Matthew S.; Munger, Steven C.; Nadeau, Joseph H.; Capel, Blanche

2011-01-01

Human germ cell tumors show a strong sensitivity to genetic background similar to Dnd1Ter/Ter mutant mice, where testicular teratomas arise only on the 129/SvJ genetic background. The introduction of the Bax mutation onto mixed background Dnd1Ter/Ter mutants, where teratomas do not typically develop, resulted in a high incidence of teratomas. However, when Dnd1Ter/Ter; Bax–/– double mutants were backcrossed to C57BL/6J, no tumors arose. Dnd1Ter/Ter germ cells show a strong downregulation of male differentiation genes including Nanos2. In susceptible strains, where teratomas initiate around E15.5-E17.5, many mutant germ cells fail to enter mitotic arrest in G0 and do not downregulate the pluripotency markers NANOG, SOX2 and OCT4. We show that DND1 directly binds a group of transcripts that encode negative regulators of the cell cycle, including p27Kip1 and p21Cip1. P27Kip1 and P21Cip1 protein are both significantly decreased in Dnd1Ter/Ter germ cells on all strain backgrounds tested, strongly suggesting that DND1 regulates mitotic arrest in male germ cells through translational regulation of cell cycle genes. Nonetheless, in C57BL/6J mutants, germ cells arrest prior to M-phase of the cell cycle and downregulate NANOG, SOX2 and OCT4. Consistent with their ability to rescue cell cycle arrest, C57BL/6J germ cells overexpress negative regulators of the cell cycle relative to 129/SvJ. This work suggests that reprogramming of pluripotency in germ cells and prevention of tumor formation requires cell cycle arrest, and that differences in the balance of cell cycle regulators between 129/SvJ and C57BL/6 might underlie differences in tumor susceptibility. PMID:21115610

Development of cell-cycle checkpoint therapy for solid tumors.

PubMed

Tamura, Kenji

2015-12-01

Cellular proliferation is tightly controlled by several cell-cycle checkpoint proteins. In cancer, the genes encoding these proteins are often disrupted and cause unrestrained cancer growth. The proteins are over-expressed in many malignancies; thus, they are potential targets for anti-cancer therapies. These proteins include cyclin-dependent kinase, checkpoint kinase, WEE1 kinase, aurora kinase and polo-like kinase. Cyclin-dependent kinase inhibitors are the most advanced cell-cycle checkpoint therapeutics available. For instance, palbociclib (PD0332991) is a first-in-class, oral, highly selective inhibitor of CDK4/6 and, in combination with letrozole (Phase II; PALOMA-1) or with fulvestrant (Phase III; PALOMA-3), it has significantly prolonged progression-free survival, in patients with metastatic estrogen receptor-positive, HER2-negative breast cancer, in comparison with that observed in patients using letrozole, or fulvestrant alone, respectively. In this review, we provide an overview of the current compounds available for cell-cycle checkpoint protein-directed therapy for solid tumors. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

HTLV-I Tax and cell cycle progression.

PubMed

Neuveut, C; Jeang, K T

2000-01-01

Human T-cell leukemia virus type I (HTLV-I) is the etiological agent for adult T-cell leukemia (ATL) and various human myopathies/neuropathies. HTLV-I encodes a 40 kDa phosphoprotein, Tax, which has been implicated in cellular transformation. In similarity with several other oncoproteins such as Myc, Jun, and Fos, Tax is a transcriptional activator. How Tax mechanistically dysregulates the cell cycle remains unclear. Recent findings from us and others have shown that Tax targets key regulators of G1/S and M progression such as p16INK4a, cyclin D1, cyclin D3-cdk, and the mitotic spindle checkpoint apparatus. Thus, Tax influences the progression of cells in various phases of the cell cycle. In this regard, we will discuss three distinct mechanisms through which Tax affects cell-cycling: a) through direct association Tax can abrogate the inhibitory function of p16INK4a on the G1-cdks, b) Tax can also directly influence cyclin D-cdk activities by a protein-protein interaction, and c) Tax targets the HsMAD1 mitotic spindle-assembly checkpoint protein. Through these varied routes, the HTLV-I oncoprotein dysregulates cellular growth controls and engenders a proclivity of cells toward a loss of DNA-damage surveillance.

A DISCRETE-EVENT SIMULATION APPROACH TO IDENTIFY RULES THAT GOVERN ARBOR REMODELING FOR BRANCHING CUTANEOUS AFFERENTS IN HAIRY SKIN.

PubMed

Kang, Hyojung; Orlowsky, Rachel L; Gerling, Gregory J

2017-12-01

In mammals, touch is encoded by sensory receptors embedded in the skin. For one class of receptors in the mouse, the architecture of its Merkel cells, unmyelinated neurites, and heminodes follow particular renewal and remodeling trends over hair cycle stages from ages 4 to 10 weeks. As it is currently impossible to observe such trends across a single animal's hair cycle, this work employs discrete event simulation to identify and evaluate policies of Merkel cell and heminode dynamics. Well matching the observed data, the results show that the baseline model replicates dynamic remodeling behaviors between stages of the hair cycle - based on particular addition and removal polices and estimated probabilities tied to constituent parts of Merkel cells, terminal branch neurites and heminodes. The analysis shows further that certain policies hold greater influence than others. This use of computation is a novel approach to understanding neuronal development.

p53 functions as a cell cycle control protein in osteosarcomas.

PubMed Central

Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

1990-01-01

Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae. Images PMID:2233717

Gene co-expression analysis identifies gene clusters associated with isotropic and polarized growth in Aspergillus fumigatus conidia.

PubMed

Baltussen, Tim J H; Coolen, Jordy P M; Zoll, Jan; Verweij, Paul E; Melchers, Willem J G

2018-04-26

Aspergillus fumigatus is a saprophytic fungus that extensively produces conidia. These microscopic asexually reproductive structures are small enough to reach the lungs. Germination of conidia followed by hyphal growth inside human lungs is a key step in the establishment of infection in immunocompromised patients. RNA-Seq was used to analyze the transcriptome of dormant and germinating A. fumigatus conidia. Construction of a gene co-expression network revealed four gene clusters (modules) correlated with a growth phase (dormant, isotropic growth, polarized growth). Transcripts levels of genes encoding for secondary metabolites were high in dormant conidia. During isotropic growth, transcript levels of genes involved in cell wall modifications increased. Two modules encoding for growth and cell cycle/DNA processing were associated with polarized growth. In addition, the co-expression network was used to identify highly connected intermodular hub genes. These genes may have a pivotal role in the respective module and could therefore be compelling therapeutic targets. Generally, cell wall remodeling is an important process during isotropic and polarized growth, characterized by an increase of transcripts coding for hyphal growth and cell cycle/DNA processing when polarized growth is initiated. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Selective Effects of PD-1 on Akt and Ras Pathways Regulate Molecular Components of the Cell Cycle and Inhibit T Cell Proliferation

PubMed Central

Patsoukis, Nikolaos; Brown, Julia; Petkova, Victoria; Liu, Fang; Li, Lequn; Boussiotis, Vassiliki A.

2017-01-01

The receptor programmed death 1 (PD-1) inhibits T cell proliferation and plays a critical role in suppressing self-reactive T cells, and it also compromises antiviral and antitumor responses. To determine how PD-1 signaling inhibits T cell proliferation, we used human CD4+ T cells to examine the effects of PD-1 signaling on the molecular control of the cell cycle. The ubiquitin ligase SCFSkp2 degrades p27kip1, an inhibitor of cyclin-dependent kinases (Cdks), and PD-1 blocked cell cycle progression through the G1 phase by suppressing transcription of SKP2, which encodes a component of this ubiquitin ligase. Thus, in T cells stimulated through PD-1, Cdks were not activated, and two critical Cdk substrates were not phosphorylated. Activation of PD-1 inhibited phosphorylation of the retinoblastoma gene product, which suppressed expression of E2F target genes. PD-1 also inhibited phosphorylation of the transcription factor Smad3, which increased its activity. These events induced additional inhibitory checkpoints in the cell cycle by increasing the abundance of the G1 phase inhibitor p15INK4 and repressing the Cdk-activating phosphatase Cdc25A. PD-1 suppressed SKP2 transcription by inhibiting phosphoinositide 3-kinase–Akt and Ras–mitogen-activated and extracellular signal–regulated kinase kinase (MEK)–extracellular signal–regulated kinase (ERK) signaling. Exposure of cells to the proliferation-promoting cytokine interleukin-2 restored activation of MEK-ERK signaling, but not Akt signaling, and only partially restored SKP2 expression. Thus, PD-1 blocks cell cycle progression and proliferation of T lymphocytes by affecting multiple regulators of the cell cycle. PMID:22740686

Herpes simplex virus 1 regulatory protein ICP22 interacts with a new cell cycle-regulated factor and accumulates in a cell cycle-dependent fashion in infected cells.

PubMed

Bruni, R; Roizman, B

1998-11-01

The herpes simplex virus 1 infected cell protein 22 (ICP22), the product of the alpha22 gene, is a nucleotidylylated and phosphorylated nuclear protein with properties of a transcriptional factor required for the expression of a subset of viral genes. Here, we report the following. (i) ICP22 interacts with a previously unknown cellular factor designated p78 in the yeast two-hybrid system. The p78 cDNA encodes a polypeptide with a distribution of leucines reminiscent of a leucine zipper. (ii) In uninfected and infected cells, antibody to p78 reacts with two major bands with an apparent Mr of 78,000 and two minor bands with apparent Mrs of 62, 000 and 55,000. (ii) p78 also interacts with ICP22 in vitro. (iii) In uninfected cells, p78 was dispersed largely in the nucleoplasm in HeLa cells and in the nucleoplasm and cytoplasm in HEp-2 cells. After infection, p78 formed large dense bodies which did not colocalize with the viral regulatory protein ICP0. (iv) Accumulation of p78 was cell cycle dependent, being highest very early in S phase. (v) The accumulation of ICP22 in synchronized cells was highest in early S phase, in contrast to the accumulation of another protein, ICP27, which was relatively independent of the cell cycle. (vi) In the course of the cell cycle, ICP22 was transiently modified in an aberrant fashion, and this modification coincided with expression of p78. The results suggest that ICP22 interacts with and may be stabilized by cell cycle-dependent proteins.

Hedgehog regulates Norrie disease protein to drive neural progenitor self-renewal.

PubMed

McNeill, Brian; Mazerolle, Chantal; Bassett, Erin A; Mears, Alan J; Ringuette, Randy; Lagali, Pamela; Picketts, David J; Paes, Kim; Rice, Dennis; Wallace, Valerie A

2013-03-01

Norrie disease (ND) is a congenital disorder characterized by retinal hypovascularization and cognitive delay. ND has been linked to mutations in 'Norrie Disease Protein' (Ndp), which encodes the secreted protein Norrin. Norrin functions as a secreted angiogenic factor, although its role in neural development has not been assessed. Here, we show that Ndp expression is initiated in retinal progenitors in response to Hedgehog (Hh) signaling, which induces Gli2 binding to the Ndp promoter. Using a combination of genetic epistasis and acute RNAi-knockdown approaches, we show that Ndp is required downstream of Hh activation to induce retinal progenitor proliferation in the retina. Strikingly, Ndp regulates the rate of cell-cycle re-entry and not cell-cycle kinetics, thereby uncoupling the self-renewal and cell-cycle progression functions of Hh. Taken together, we have uncovered a cell autonomous function for Ndp in retinal progenitor proliferation that is independent of its function in the retinal vasculature, which could explain the neural defects associated with ND.

CAPNS1 Regulates USP1 Stability and Maintenance of Genome Integrity

PubMed Central

Cataldo, Francesca; Peche, Leticia Y.; Klaric, Enio; Brancolini, Claudio; Myers, Michael P.

2013-01-01

Calpains regulate a wide spectrum of biological functions, including migration, adhesion, apoptosis, secretion, and autophagy, through the modulating cleavage of specific substrates. Ubiquitous microcalpain (μ-calpain) and millicalpain (m-calpain) are heterodimers composed of catalytic subunits encoded, respectively, by CAPN1 and CAPN2 and a regulatory subunit encoded by CAPNS1. Here we show that calpain is required for the stability of the deubiquitinating enzyme USP1 in several cell lines. USP1 modulates DNA replication polymerase choice and repair by deubiquitinating PCNA. The ubiquitinated form of the USP1 substrate PCNA is stabilized in CAPNS1-depleted U2OS cells and mouse embryonic fibroblasts (MEFs), favoring polymerase-η loading on chromatin and increased mutagenesis. USP1 degradation directed by the cell cycle regulator APC/Ccdh1, which marks USP1 for destruction in the G1 phase, is upregulated in CAPNS1-depleted cells. USP1 stability can be rescued upon forced expression of calpain-activated Cdk5/p25, previously reported as a cdh1 repressor. These data suggest that calpain stabilizes USP1 by activating Cdk5, which in turn inhibits cdh1 and, consequently, USP1 degradation. Altogether these findings point to a connection between the calpain system and the ubiquitin pathway in the regulation of DNA damage response and place calpain at the interface between cell cycle modulation and DNA repair. PMID:23589330

Lhx6 and Lhx8 promote palate development through negative regulation of a cell cycle inhibitor gene, p57Kip2

PubMed Central

Cesario, Jeffry M.; Landin Malt, Andre; Deacon, Lindsay J.; Sandberg, Magnus; Vogt, Daniel; Tang, Zuojian; Zhao, Yangu; Brown, Stuart; Rubenstein, John L.; Jeong, Juhee

2015-01-01

Cleft palate is a common birth defect in humans. Therefore, understanding the molecular genetics of palate development is important from both scientific and medical perspectives. Lhx6 and Lhx8 encode LIM homeodomain transcription factors, and inactivation of both genes in mice resulted in profound craniofacial defects including cleft secondary palate. The initial outgrowth of the palate was severely impaired in the mutant embryos, due to decreased cell proliferation. Through genome-wide transcriptional profiling, we discovered that p57Kip2 (Cdkn1c), encoding a cell cycle inhibitor, was up-regulated in the prospective palate of Lhx6−/−;Lhx8−/− mutants. p57Kip2 has been linked to Beckwith–Wiedemann syndrome and IMAGe syndrome in humans, which are developmental disorders with increased incidents of palate defects among the patients. To determine the molecular mechanism underlying the regulation of p57Kip2 by the Lhx genes, we combined chromatin immunoprecipitation, in silico search for transcription factor-binding motifs, and in vitro reporter assays with putative cis-regulatory elements. The results of these experiments indicated that LHX6 and LHX8 regulated p57Kip2 via both direct and indirect mechanisms, with the latter mediated by Forkhead box (FOX) family transcription factors. Together, our findings uncovered a novel connection between the initiation of palate development and a cell cycle inhibitor via LHX. We propose a model in which Lhx6 and Lhx8 negatively regulate p57Kip2 expression in the prospective palate area to allow adequate levels of cell proliferation and thereby promote normal palate development. This is the first report elucidating a molecular genetic pathway downstream of Lhx in palate development. PMID:26071365

A high-resolution transcriptome map of cell cycle reveals novel connections between periodic genes and cancer

PubMed Central

Dominguez, Daniel; Tsai, Yi-Hsuan; Gomez, Nicholas; Jha, Deepak Kumar; Davis, Ian; Wang, Zefeng

2016-01-01

Progression through the cell cycle is largely dependent on waves of periodic gene expression, and the regulatory networks for these transcriptome dynamics have emerged as critical points of vulnerability in various aspects of tumor biology. Through RNA-sequencing of human cells during two continuous cell cycles (>2.3 billion paired reads), we identified over 1 000 mRNAs, non-coding RNAs and pseudogenes with periodic expression. Periodic transcripts are enriched in functions related to DNA metabolism, mitosis, and DNA damage response, indicating these genes likely represent putative cell cycle regulators. Using our set of periodic genes, we developed a new approach termed “mitotic trait” that can classify primary tumors and normal tissues by their transcriptome similarity to different cell cycle stages. By analyzing >4 000 tumor samples in The Cancer Genome Atlas (TCGA) and other expression data sets, we found that mitotic trait significantly correlates with genetic alterations, tumor subtype and, notably, patient survival. We further defined a core set of 67 genes with robust periodic expression in multiple cell types. Proteins encoded by these genes function as major hubs of protein-protein interaction and are mostly required for cell cycle progression. The core genes also have unique chromatin features including increased levels of CTCF/RAD21 binding and H3K36me3. Loss of these features in uterine and kidney cancers is associated with altered expression of the core 67 genes. Our study suggests new chromatin-associated mechanisms for periodic gene regulation and offers a predictor of cancer patient outcomes. PMID:27364684

Understanding Strategy of Nitrate and Urea Assimilation in a Chinese Strain of Aureococcus anophagefferens through RNA-Seq Analysis

PubMed Central

Dong, Hong-Po; Huang, Kai-Xuan; Wang, Hua-Long; Lu, Song-Hui; Cen, Jing-Yi; Dong, Yue-Lei

2014-01-01

Aureococcus anophagefferens is a harmful alga that dominates plankton communities during brown tides in North America, Africa, and Asia. Here, RNA-seq technology was used to profile the transcriptome of a Chinese strain of A. anophagefferens that was grown on urea, nitrate, and a mixture of urea and nitrate, and that was under N-replete, limited and recovery conditions to understand the molecular mechanisms that underlie nitrate and urea utilization. The number of differentially expressed genes between urea-grown and mixture N-grown cells were much less than those between urea-grown and nitrate-grown cells. Compared with nitrate-grown cells, mixture N-grown cells contained much lower levels of transcripts encoding proteins that are involved in nitrate transport and assimilation. Together with profiles of nutrient changes in media, these results suggest that A. anophagefferens primarily feeds on urea instead of nitrate when urea and nitrate co-exist. Furthermore, we noted that transcripts upregulated by nitrate and N-limitation included those encoding proteins involved in amino acid and nucleotide transport, degradation of amides and cyanates, and nitrate assimilation pathway. The data suggest that A. anophagefferens possesses an ability to utilize a variety of dissolved organic nitrogen. Moreover, transcripts for synthesis of proteins, glutamate-derived amino acids, spermines and sterols were upregulated by urea. Transcripts encoding key enzymes that are involved in the ornithine-urea and TCA cycles were differentially regulated by urea and nitrogen concentration, which suggests that the OUC may be linked to the TCA cycle and involved in reallocation of intracellular carbon and nitrogen. These genes regulated by urea may be crucial for the rapid proliferation of A. anophagefferens when urea is provided as the N source. PMID:25338000

Impaired tissue growth is mediated by checkpoint kinase 1 (CHK1) in the integrated stress response

PubMed Central

Malzer, Elke; Daly, Marie-Louise; Moloney, Aileen; Sendall, Timothy J.; Thomas, Sally E.; Ryder, Edward; Ryoo, Hyung Don; Crowther, Damian C.; Lomas, David A.; Marciniak, Stefan J.

2010-01-01

The integrated stress response (ISR) protects cells from numerous forms of stress and is involved in the growth of solid tumours; however, it is unclear how the ISR acts on cellular proliferation. We have developed a model of ISR signalling with which to study its effects on tissue growth. Overexpression of the ISR kinase PERK resulted in a striking atrophic eye phenotype in Drosophila melanogaster that could be rescued by co-expressing the eIF2α phosphatase GADD34. A genetic screen of 3000 transposon insertions identified grapes, the gene that encodes the Drosophila orthologue of checkpoint kinase 1 (CHK1). Knockdown of grapes by RNAi rescued eye development despite ongoing PERK activation. In mammalian cells, CHK1 was activated by agents that induce ER stress, which resulted in a G2 cell cycle delay. PERK was both necessary and sufficient for CHK1 activation. These findings indicate that non-genotoxic misfolded protein stress accesses DNA-damage-induced cell cycle checkpoints to couple the ISR to cell cycle arrest. PMID:20682638

Calcium Signaling throughout the Toxoplasma gondii Lytic Cycle

PubMed Central

Borges-Pereira, Lucas; Budu, Alexandre; McKnight, Ciara A.; Moore, Christina A.; Vella, Stephen A.; Hortua Triana, Miryam A.; Liu, Jing; Garcia, Celia R. S.; Pace, Douglas A.; Moreno, Silvia N. J.

2015-01-01

Toxoplasma gondii is an obligate intracellular parasite that invades host cells, creating a parasitophorous vacuole where it communicates with the host cell cytosol through the parasitophorous vacuole membrane. The lytic cycle of the parasite starts with its exit from the host cell followed by gliding motility, conoid extrusion, attachment, and invasion of another host cell. Here, we report that Ca2+ oscillations occur in the cytosol of the parasite during egress, gliding, and invasion, which are critical steps of the lytic cycle. Extracellular Ca2+ enhances each one of these processes. We used tachyzoite clonal lines expressing genetically encoded calcium indicators combined with host cells expressing transiently expressed calcium indicators of different colors, and we measured Ca2+ changes in both parasites and host simultaneously during egress. We demonstrated a link between cytosolic Ca2+ oscillations in the host and in the parasite. Our approach also allowed us to measure two new features of motile parasites, which were enhanced by Ca2+ influx. This is the first study showing, in real time, Ca2+ signals preceding egress and their direct link with motility, an essential virulence trait. PMID:26374900

Regulation of plasmid-encoded isoprene metabolism in Rhodococcus, a representative of an important link in the global isoprene cycle.

PubMed

Crombie, Andrew T; Khawand, Myriam El; Rhodius, Virgil A; Fengler, Kevin A; Miller, Michael C; Whited, Gregg M; McGenity, Terry J; Murrell, J Colin

2015-09-01

Emissions of biogenic volatile organic compounds (VOCs) form an important part of the global carbon cycle, comprising a significant proportion of net ecosystem productivity. They impact atmospheric chemistry and contribute directly and indirectly to greenhouse gases. Isoprene, emitted largely from plants, comprises one third of total VOCs, yet in contrast to methane, which is released in similar quantities, we know little of its biodegradation. Here, we report the genome of an isoprene degrading isolate, Rhodococcus sp. AD45, and, using mutagenesis shows that a plasmid-encoded soluble di-iron centre isoprene monooxygenase (IsoMO) is essential for isoprene metabolism. Using RNA sequencing (RNAseq) to analyse cells exposed to isoprene or epoxyisoprene in a substrate-switch time-course experiment, we show that transcripts from 22 contiguous genes, including those encoding IsoMO, were highly upregulated, becoming among the most abundant in the cell and comprising over 25% of the entire transcriptome. Analysis of gene transcription in the wild type and an IsoMO-disrupted mutant strain showed that epoxyisoprene, or a subsequent product of isoprene metabolism, rather than isoprene itself, was the inducing molecule. We provide a foundation of molecular data for future research on the environmental biological consumption of this important, climate-active compound. © 2015 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.

Modulated Expression of Genes Encoding Estrogen Metabolizing Enzymes by G1-Phase Cyclin-Dependent Kinases 6 and 4 in Human Breast Cancer Cells

PubMed Central

Jia, Yi; Domenico, Joanne; Swasey, Christina; Wang, Meiqin; Gelfand, Erwin W.; Lucas, Joseph J.

2014-01-01

G1-phase cell cycle defects, such as alterations in cyclin D1 or cyclin-dependent kinase (cdk) levels, are seen in most tumors. For example, increased cyclin D1 and decreased cdk6 levels are seen in many human breast tumors. Overexpression of cdk6 in breast tumor cells in culture has been shown to suppress proliferation, unlike the growth stimulating effects of its close homolog, cdk4. In addition to directly affecting proliferation, alterations in cdk6 or cdk4 levels in breast tumor cells also differentially influence levels of numerous steroid metabolic enzymes (SMEs), including those involved in estrogen metabolism. Overexpression of cdk6 in tumor cell lines having low cdk6 resulted in decreased levels of mRNAs encoding aldo-keto reductase (AKR)1C1, AKR1C2 and AKR1C3, which are hydroxysteroid dehydrogenases (HSDs) involved in steroid hormone metabolism. In contrast, increasing cdk4 dramatically increased these transcript levels, especially those encoding AKR1C3, an enzyme that converts estrone to 17β-estradiol, a change that could result in a pro-estrogenic state favoring tumor growth. Effects on other estrogen metabolizing enzymes, including cytochrome P450 (CYP) 19 aromatase, 17β-HSD2, and CYP1B1 transcripts, were also observed. Interactions of cdk6 and cdk4, but not cyclin D1, with the promoter region of a cdk-regulated gene, 17β-HSD2, were detected. The results uncover a previously unsuspected link between the cell cycle and hormone metabolism and differential roles for cdk6 and cdk4 in a novel mechanism for pre-receptor control of steroid hormone action, with important implications for the origin and treatment of steroid hormone-dependent cancers. PMID:24848372

Characterization of Bombyx mori nucleopolyhedrovirus orf68 gene that encodes a novel structural protein of budded virus.

PubMed

Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung

2002-05-25

All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).

Human Cytomegalovirus-Encoded miR-US25-1 Aggravates the Oxidised Low Density Lipoprotein-Induced Apoptosis of Endothelial Cells

PubMed Central

Fan, Jianmin; Zhang, Wen; Liu, Qiming

2014-01-01

Human cytomegalovirus (HCMV) infection is linked to the development and severity of the cardiovascular disease atherosclerosis; however, there is little known about the promotion of atherosclerosis. miR-US25-1 is one of HCMV-encoded miRNAs and targets cellular genes that are essential for virus growth to control the life cycle of the virus and host cells. The prominent regulation on cell cycle genes of the miR-US25-1 attracts us to explore its role in the atherosclerosis promotion. It was indicated that miR-US25-1 level was upregulated in subjects or in endothelial cells with HCMV infection; and the miR-US25-1 downregulated the expression of BRCC 3 by targeting the 5′ UTR of BRCC 3. And a miR-US25-1 mimics transfection could reduce the EAhy926 cell viability but did not induce apoptosis in EAhy926 cells. And what is more, miR-US25-1 mimicis transfection deteriorated the ox-LDL-induced apoptosis and aggravated the upregulation of apoptosis-associated molecules by oxidised low density lipoprotein (ox-LDL) in EAhy926 cells. And we have also confirmed the deregulation of BRCC 3 expression by miR-US25-1 by targeting the 5′ UTR of it. Given the vital role of BRCC 3 in DNA damage repairing, we speculated that the targeting inhibition of BRCC 3 by miR-US25-1 may contribute to the aggravation of ox-LDL-promoted apoptosis of endothelial EAhy926 cells. PMID:24895586

A complex regulatory network coordinating cell cycles during C. elegans development is revealed by a genome-wide RNAi screen.

PubMed

Roy, Sarah H; Tobin, David V; Memar, Nadin; Beltz, Eleanor; Holmen, Jenna; Clayton, Joseph E; Chiu, Daniel J; Young, Laura D; Green, Travis H; Lubin, Isabella; Liu, Yuying; Conradt, Barbara; Saito, R Mako

2014-02-28

The development and homeostasis of multicellular animals requires precise coordination of cell division and differentiation. We performed a genome-wide RNA interference screen in Caenorhabditis elegans to reveal the components of a regulatory network that promotes developmentally programmed cell-cycle quiescence. The 107 identified genes are predicted to constitute regulatory networks that are conserved among higher animals because almost half of the genes are represented by clear human orthologs. Using a series of mutant backgrounds to assess their genetic activities, the RNA interference clones displaying similar properties were clustered to establish potential regulatory relationships within the network. This approach uncovered four distinct genetic pathways controlling cell-cycle entry during intestinal organogenesis. The enhanced phenotypes observed for animals carrying compound mutations attest to the collaboration between distinct mechanisms to ensure strict developmental regulation of cell cycles. Moreover, we characterized ubc-25, a gene encoding an E2 ubiquitin-conjugating enzyme whose human ortholog, UBE2Q2, is deregulated in several cancers. Our genetic analyses suggested that ubc-25 acts in a linear pathway with cul-1/Cul1, in parallel to pathways employing cki-1/p27 and lin-35/pRb to promote cell-cycle quiescence. Further investigation of the potential regulatory mechanism demonstrated that ubc-25 activity negatively regulates CYE-1/cyclin E protein abundance in vivo. Together, our results show that the ubc-25-mediated pathway acts within a complex network that integrates the actions of multiple molecular mechanisms to control cell cycles during development. Copyright © 2014 Roy et al.

Anaerobic Respiration Using a Complete Oxidative TCA Cycle Drives Multicellular Swarming in Proteus mirabilis

PubMed Central

Alteri, Christopher J.; Himpsl, Stephanie D.; Engstrom, Michael D.; Mobley, Harry L. T.

2012-01-01

ABSTRACT Proteus mirabilis rapidly migrates across surfaces using a periodic developmental process of differentiation alternating between short swimmer cells and elongated hyperflagellated swarmer cells. To undergo this vigorous flagellum-mediated motility, bacteria must generate a substantial proton gradient across their cytoplasmic membranes by using available energy pathways. We sought to identify the link between energy pathways and swarming differentiation by examining the behavior of defined central metabolism mutants. Mutations in the tricarboxylic acid (TCA) cycle (fumC and sdhB mutants) caused altered patterns of swarming periodicity, suggesting an aerobic pathway. Surprisingly, the wild-type strain swarmed on agar containing sodium azide, which poisons aerobic respiration; the fumC TCA cycle mutant, however, was unable to swarm on azide. To identify other contributing energy pathways, we screened transposon mutants for loss of swarming on sodium azide and found insertions in the following genes that involved fumarate metabolism or respiration: hybB, encoding hydrogenase; fumC, encoding fumarase; argH, encoding argininosuccinate lyase (generates fumarate); and a quinone hydroxylase gene. These findings validated the screen and suggested involvement of anaerobic electron transport chain components. Abnormal swarming periodicity of fumC and sdhB mutants was associated with the excretion of reduced acidic fermentation end products. Bacteria lacking SdhB were rescued to wild-type pH and periodicity by providing fumarate, independent of carbon source but dependent on oxygen, while fumC mutants were rescued by glycerol, independent of fumarate only under anaerobic conditions. These findings link multicellular swarming patterns with fumarate metabolism and membrane electron transport using a previously unappreciated configuration of both aerobic and anaerobic respiratory chain components. PMID:23111869

Single-cell genomics reveals co-metabolic interactions within uncultivated Marine Group A bacteria

NASA Astrophysics Data System (ADS)

Hawley, A. K.; Hallam, S. J.

2016-02-01

Marine Group A (MGA) bacteria represent a ubiquitous and abundant candidate phylum enriched in oxygen minimum zones (OMZs) and the deep ocean. Despite MGA prevalence little is known about their ecology and biogeochemistry. Here we chart the metabolic potential of 26 MGA single-cell amplified genomes sourced from different environments spanning ecothermodynamic gradients including open ocean waters, OMZs and methanogenic environments including a terephthalate-degrading bioreactor. Metagenomic contig recruitment to SAGs combined with tetra-nucleotide frequency distribution patterns resolved nine MGA population genome bins. All population genomes exhibited genomic streamlining with open ocean MGA being the most reduced. Different strategies for carbohydrate utilization, carbon fixation energy metabolism and respiratory pathways were identified between population genome bins, including various roles in the nitrogen and sulfur cycles. MGA inhabiting OMZ oxyclines encoded genes for partial denitrification with potential to feed into anammox and nitrification as well as a polysulfide reductase with a potential role in the cryptic sulfur cycle. MGA inhabiting anoxic waters, encoded NiFe hydrogenase and nitrous oxide reductase with the potential to complete partial denitrification pathways previously linked to sulfur oxidation in SUP05 bacteria. MGA from methanogenic environments encoded genes mediating cascading syntrophic interactions with fatty acid degraders and methanogens including reverse electron transport potential. The MGA phylum appears to have evolved alternative metabolic innovations adapting specific subgroups to occupy specific niches along ecothermodynamic gradients. Additionally, expression of MGA genes from different OMZ environments supports that these subgroups manifest an increasing propensity for co-metabolic interactions under energy limiting conditions that mandates a cooperative mode of existence with important implications for C, N and S cycling in marine ecosystems.

The potential role of ribosomal protein S5 on cell cycle arrest and initiation of murine erythroleukemia cell differentiation.

PubMed

Matragkou, Christina N; Papachristou, Eleni T; Tezias, Sotirios S; Tsiftsoglou, Asterios S; Choli-Papadopoulou, Theodora; Vizirianakis, Ioannis S

2008-07-01

Evidence now exists to indicate that some ribosomal proteins besides being structural components of the ribosomal subunits are involved in the regulation of cell differentiation and apoptosis. As we have shown earlier, initiation of erythroid differentiation of murine erythroleukemia (MEL) cells is associated with transcriptional inactivation of genes encoding ribosomal RNAs and ribosomal proteins S5 (RPS5) and L35a. In this study, we extended these observations and investigated whether transfection of MEL cells with RPS5 cDNA affects the onset of initiation of erythroid maturation and their entrance in cell cycle arrest. Stably transfected MEL cloned cells (MEL-C14 and MEL-C56) were established and assessed for their capacity to produce RPS5 RNA transcript and its translated product. The impact of RPS5 cDNA transfection on the RPS5 gene expression patterns and the accumulation of RPS5 protein in inducible transfected MEL cells were correlated with their ability to: (a) initiate differentiation, (b) enter cell cycle arrest at G(1)/G(0) phase, and (c) modulate the level of cyclin-dependent kinases CDK2, CDK4, and CDK6. The data presented indicate that deregulation of RPS5 gene expression (constitutive expression) affects RPS5 protein level and delays both the onset of initiation of erythroid maturation and entrance in cell cycle arrest in inducer-treated MEL cells. 2008 Wiley-Liss, Inc.

Characterization and Identification of Cryptic Biopeptides in Carya illinoinensis (Wangenh K. Koch) Storage Proteins.

PubMed

Mares-Mares, Everardo; Gutiérrez-Vargas, Santiago; Pérez-Moreno, Luis; Ordoñez-Acevedo, Leandro G; Barboza-Corona, José E; León-Galván, Ma Fabiola

2017-01-01

The objective of this research was to identify and characterize the encoded peptides present in nut storage proteins of Carya illinoinensis . It was found, through in silico prediction, proteomic analysis, and MS spectrometry, that bioactive peptides were mainly found in albumin and glutelin fractions. Glutelin was the major fraction with ~53% of the nut storage proteins containing at least 21 peptides with different putative biological activities, including antihypertensives, antioxidants, immunomodulators, protease inhibitors, and inhibitors of cell cycle progression in cancer cells. Data showed that using 50  μ g/mL tryptic digests of enriched peptides obtained from nut glutelins is able to induce up to 19% of apoptosis in both HeLa and CasKi cervical cancer cells. To our knowledge, this is the first report that shows the potential value of the nut-encoded peptides to be considered as adjuvants in cancer therapies.

Characterization and Identification of Cryptic Biopeptides in Carya illinoinensis (Wangenh K. Koch) Storage Proteins

PubMed Central

Gutiérrez-Vargas, Santiago; Pérez-Moreno, Luis; Ordoñez-Acevedo, Leandro G.

2017-01-01

The objective of this research was to identify and characterize the encoded peptides present in nut storage proteins of Carya illinoinensis. It was found, through in silico prediction, proteomic analysis, and MS spectrometry, that bioactive peptides were mainly found in albumin and glutelin fractions. Glutelin was the major fraction with ~53% of the nut storage proteins containing at least 21 peptides with different putative biological activities, including antihypertensives, antioxidants, immunomodulators, protease inhibitors, and inhibitors of cell cycle progression in cancer cells. Data showed that using 50 μg/mL tryptic digests of enriched peptides obtained from nut glutelins is able to induce up to 19% of apoptosis in both HeLa and CasKi cervical cancer cells. To our knowledge, this is the first report that shows the potential value of the nut-encoded peptides to be considered as adjuvants in cancer therapies. PMID:29279842

PKCeta enhances cell cycle progression, the expression of G1 cyclins and p21 in MCF-7 cells.

PubMed

Fima, E; Shtutman, M; Libros, P; Missel, A; Shahaf, G; Kahana, G; Livneh, E

2001-10-11

Protein kinase C encodes a family of enzymes implicated in cellular differentiation, growth control and tumor promotion. However, not much is known with respect to the molecular mechanisms that link protein kinase C to cell cycle control. Here we report that the expression of PKCeta in MCF-7 cells, under the control of a tetracycline-responsive inducible promoter, enhanced cell growth and affected the cell cycle at several points. The induced expression of another PKC isoform, PKCdelta, in MCF-7 cells had opposite effects and inhibited their growth. PKCeta expression activated cellular pathways in these cells that resulted in the increased expression of the G1 phase cyclins, cyclin D and cyclin E. Expression of the cyclin-dependent kinase inhibitor p21(WAF1) was also specifically elevated in PKCeta expressing cells, but its overall effects were not inhibitory. Although, the protein levels of the cyclin-dependent kinase inhibitor p27(KIP1) were not altered by the induced expression of PKCeta, the cyclin E associated Cdk2 kinase activity was in correlation with the p27(KIP1) bound to the cyclin E complex and not by p21(WAF1) binding. PKCeta expression enhanced the removal of p27(KIP1) from this complex, and its re-association with the cyclin D/Cdk4 complex. Reduced binding of p27(KIP1) to the cyclin D/Cdk4 complex at early time points of the cell cycle also enhanced the activity of this complex, while at later time points the decrease in bound p21(WAF1) correlated with its increased activity in PKCeta-expressing cells. Thus, PKCeta induces altered expression of several cell cycle functions, which may contribute to its ability to affect cell growth.

Integrative functional transcriptomic analyses implicate specific molecular pathways in pulmonary toxicity from exposure to aluminum oxide nanoparticles.

PubMed

Li, Xiaobo; Zhang, Chengcheng; Bian, Qian; Gao, Na; Zhang, Xin; Meng, Qingtao; Wu, Shenshen; Wang, Shizhi; Xia, Yankai; Chen, Rui

2016-09-01

Gene expression profiling has developed rapidly in recent years and it can predict and define mechanisms underlying chemical toxicity. Here, RNA microarray and computational technology were used to show that aluminum oxide nanoparticles (Al2O3 NPs) were capable of triggering up-regulation of genes related to the cell cycle and cell death in a human A549 lung adenocarcinoma cell line. Gene expression levels were validated in Al2O3 NPs exposed A549 cells and mice lung tissues, most of which showed consistent trends in regulation. Gene-transcription factor network analysis coupled with cell- and animal-based assays demonstrated that the genes encoding PTPN6, RTN4, BAX and IER play a role in the biological responses induced by the nanoparticle exposure, which caused cell death and cell cycle arrest in the G2/S phase. Further, down-regulated PTPN6 expression demonstrated a core role in the network, thus expression level of PTPN6 was rescued by plasmid transfection, which showed ameliorative effects of A549 cells against cell death and cell cycle arrest. These results demonstrate the feasibility of using gene expression profiling to predict cellular responses induced by nanomaterials, which could be used to develop a comprehensive knowledge of nanotoxicity.

A cell cycle-independent, conditional gene inactivation strategy for differentially tagging wild-type and mutant cells.

PubMed

Nagarkar-Jaiswal, Sonal; Manivannan, Sathiya N; Zuo, Zhongyuan; Bellen, Hugo J

2017-05-31

Here, we describe a novel method based on intronic MiMIC insertions described in Nagarkar-Jaiswal et al. (2015) to perform conditional gene inactivation in Drosophila . Mosaic analysis in Drosophila cannot be easily performed in post-mitotic cells. We therefore, therefore, developed Flip-Flop, a flippase -dependent in vivo cassette-inversion method that marks wild-type cells with the endogenous EGFP-tagged protein, whereas mutant cells are marked with mCherry upon inversion. We document the ease and usefulness of this strategy in differential tagging of wild-type and mutant cells in mosaics. We use this approach to phenotypically characterize the loss of SNF4Aγ , encoding the γ subunit of the AMP Kinase complex. The Flip-Flop method is efficient and reliable, and permits conditional gene inactivation based on both spatial and temporal cues, in a cell cycle-, and developmental stage-independent fashion, creating a platform for systematic screens of gene function in developing and adult flies with unprecedented detail.

Genetic alterations in Krebs cycle and its impact on cancer pathogenesis.

PubMed

Sajnani, Karishma; Islam, Farhadul; Smith, Robert Anthony; Gopalan, Vinod; Lam, Alfred King-Yin

2017-04-01

Cancer cells exhibit alterations in many cellular processes, including oxygen sensing and energy metabolism. Glycolysis in non-oxygen condition is the main energy production process in cancer rather than mitochondrial respiration as in benign cells. Genetic and epigenetic alterations of Krebs cycle enzymes favour the shift of cancer cells from oxidative phosphorylation to anaerobic glycolysis. Mutations in genes encoding aconitase, isocitrate dehydrogenase, succinate dehydrogenase, fumarate hydratase, and citrate synthase are noted in many cancers. Abnormalities of Krebs cycle enzymes cause ectopic production of Krebs cycle intermediates (oncometabolites) such as 2-hydroxyglutarate, and citrate. These oncometabolites stabilize hypoxia inducible factor 1 (HIF1), nuclear factor like 2 (Nrf2), inhibit p53 and prolyl hydroxylase 3 (PDH3) activities as well as regulate DNA/histone methylation, which in turn activate cell growth signalling. They also stimulate increased glutaminolysis, glycolysis and production of reactive oxygen species (ROS). Additionally, genetic alterations in Krebs cycle enzymes are involved with increased fatty acid β-oxidations and epithelial mesenchymal transition (EMT) induction. These altered phenomena in cancer could in turn promote carcinogenesis by stimulating cell proliferation and survival. Overall, epigenetic and genetic changes of Krebs cycle enzymes lead to the production of oncometabolite intermediates, which are important driving forces of cancer pathogenesis and progression. Understanding and applying the knowledge of these mechanisms opens new therapeutic options for patients with cancer. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

Evidence that the tri-cellular metabolism of N-acetylaspartate functions as the brain's "operating system": how NAA metabolism supports meaningful intercellular frequency-encoded communications.

PubMed

Baslow, Morris H

2010-11-01

N-acetylaspartate (NAA), an acetylated derivative of L-aspartate (Asp), and N-acetylaspartylglutamate (NAAG), a derivative of NAA and L-glutamate (Glu), are synthesized by neurons in brain. However, neurons cannot catabolize either of these substances, and so their metabolism requires the participation of two other cell types. Neurons release both NAA and NAAG to extra-cellular fluid (ECF) upon stimulation, where astrocytes, the target cells for NAAG, hydrolyze it releasing NAA back into ECF, and oligodendrocytes, the target cells for NAA, hydrolyze it releasing Asp to ECF for recycling to neurons. This sequence is unique as it is the only known amino acid metabolic cycle in brain that requires three cell types for its completion. The results of this cycling are two-fold. First, neuronal metabolic water is transported to ECF for its removal from brain. Second, the rate of neuronal activity is coupled with focal hyperemia, providing stimulated neurons with the energy required for transmission of meaningful frequency-encoded messages. In this paper, it is proposed that the tri-cellular metabolism of NAA functions as the "operating system" of the brain, and is essential for normal cognitive and motor activities. Evidence in support of this hypothesis is provided by the outcomes of two human inborn errors in NAA metabolism.

Bombyx mori nucleopolyhedrovirus orf25 encodes a 30kDa late protein in the infection cycle.

PubMed

Wang, Haiyan; Chen, Keping; Guo, Zhongjian; Yao, Qin

2008-02-01

Bombyx mori nucleopolyhedrovirus (BmNPV) orf25 gene was characterized for the first time. The coding sequence of Bm25 was amplified and subcloned into the prokaryotic expression vector pGEX-4T-2 to produce glutathione S-transferase-tagged fusion protein in the BL21 (DE3) cells. The GST-Bm25 fusion protein was expressed efficiently after induction with IPTG. The purified fusion protein was used to immunize New Zealand white rabbits to prepare polyclonal antibody. Temporal expression analysis revealed a 30-kDa protein, which was detected beginning 24 hours post-infection using a polyclonal antibody against GST-Bm25 fusion protein. The transcript of Bm25 was detected by RT-PCR at 18-72 h p.i. In conclusion, the available data suggest that Bm25 encodes a 30kDa protein expressed in the late stage of infection cycle.

Lentiviral Delivery of HIV-1 Vpr Protein Induces Apoptosis in Transformed Cells

NASA Astrophysics Data System (ADS)

Stewart, Sheila A.; Poon, Betty; Jowett, Jeremy B. M.; Xie, Yiming; Chen, Irvin S. Y.

1999-10-01

Most current anticancer therapies act by inducing tumor cell stasis followed by apoptosis. HIV-1 Vpr effectively induces apoptosis of T cells after arrest of cells at a G2/M checkpoint. Here, we investigated whether this property of Vpr could be exploited for use as a potential anticancer agent. As a potentially safer alternative to transfer of genes encoding Vpr, we developed a method to efficiently introduce Vpr protein directly into cells. Vpr packaged into HIV-1 virions lacking a genome induced efficient cell cycle arrest and apoptosis. Introduction of Vpr into tumor cell lines of various tissue origin, including those bearing predisposing mutations in p53, XPA, and hMLH1, induced cell cycle arrest and apoptosis with high efficiency. Significantly, apoptosis mediated by virion-associated Vpr was more effective on rapidly dividing cells compared with slow-growing cells, thus, in concept, providing a potential differential effect between some types of tumor cells and surrounding normal cells. This model system provides a rationale and proof of concept for the development of potential cancer therapeutic agents based on the growth-arresting and apoptotic properties of Vpr.

A DISCRETE-EVENT SIMULATION APPROACH TO IDENTIFY RULES THAT GOVERN ARBOR REMODELING FOR BRANCHING CUTANEOUS AFFERENTS IN HAIRY SKIN

PubMed Central

Kang, Hyojung; Orlowsky, Rachel L.; Gerling, Gregory J.

2018-01-01

In mammals, touch is encoded by sensory receptors embedded in the skin. For one class of receptors in the mouse, the architecture of its Merkel cells, unmyelinated neurites, and heminodes follow particular renewal and remodeling trends over hair cycle stages from ages 4 to 10 weeks. As it is currently impossible to observe such trends across a single animal’s hair cycle, this work employs discrete event simulation to identify and evaluate policies of Merkel cell and heminode dynamics. Well matching the observed data, the results show that the baseline model replicates dynamic remodeling behaviors between stages of the hair cycle – based on particular addition and removal polices and estimated probabilities tied to constituent parts of Merkel cells, terminal branch neurites and heminodes. The analysis shows further that certain policies hold greater influence than others. This use of computation is a novel approach to understanding neuronal development. PMID:29527094

Turning the Table: Plants Consume Microbes as a Source of Nutrients

PubMed Central

Paungfoo-Lonhienne, Chanyarat; Rentsch, Doris; Robatzek, Silke; Webb, Richard I.; Sagulenko, Evgeny; Näsholm, Torgny

2010-01-01

Interactions between plants and microbes in soil, the final frontier of ecology, determine the availability of nutrients to plants and thereby primary production of terrestrial ecosystems. Nutrient cycling in soils is considered a battle between autotrophs and heterotrophs in which the latter usually outcompete the former, although recent studies have questioned the unconditional reign of microbes on nutrient cycles and the plants' dependence on microbes for breakdown of organic matter. Here we present evidence indicative of a more active role of plants in nutrient cycling than currently considered. Using fluorescent-labeled non-pathogenic and non-symbiotic strains of a bacterium and a fungus (Escherichia coli and Saccharomyces cerevisiae, respectively), we demonstrate that microbes enter root cells and are subsequently digested to release nitrogen that is used in shoots. Extensive modifications of root cell walls, as substantiated by cell wall outgrowth and induction of genes encoding cell wall synthesizing, loosening and degrading enzymes, may facilitate the uptake of microbes into root cells. Our study provides further evidence that the autotrophy of plants has a heterotrophic constituent which could explain the presence of root-inhabiting microbes of unknown ecological function. Our discovery has implications for soil ecology and applications including future sustainable agriculture with efficient nutrient cycles. PMID:20689833

The A- and B-type cyclin associated cdc2 kinases in Xenopus turn on and off at different times in the cell cycle.

PubMed Central

Minshull, J; Golsteyn, R; Hill, C S; Hunt, T

1990-01-01

Cyclins play a key role in the induction of mitosis. In this paper we report the isolation of a cyclin A cDNA clone from Xenopus eggs. Its cognate mRNA encodes a protein that shows characteristic accumulation and destruction during mitotic cell cycles. The cyclin A polypeptide is associated with a protein that cross-reacts with an antibody against the conserved 'PSTAIR' epitope of p34cdc2, and the cyclin A-cdc2 complex exhibits protein kinase activity that oscillates with the cell cycle. This kinase activity rises more smoothly than that of the cyclin B-cdc2 complexes and reaches a peak earlier in the cell cycle; indeed, cyclin A is destroyed before nuclear envelope breakdown. None of the cyclin-cdc2 complexes show simple relationships between the concentration of the cyclin moiety and the kinase activity. All three cyclin associated kinases (A, B1 and B2) phosphorylate identical sites on histones with the consensus XSPXK/R, although they show significant differences in their substrate preferences. We discuss possible models for the different roles of the A- and B-type cyclins in the control of cell division. Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. Fig. 8. Fig. 9. PMID:2143983

Genetic and physical interactions between factors involved in both cell cycle progression and pre-mRNA splicing in Saccharomyces cerevisiae.

PubMed Central

Ben-Yehuda, S; Dix, I; Russell, C S; McGarvey, M; Beggs, J D; Kupiec, M

2000-01-01

The PRP17/CDC40 gene of Saccharomyces cerevisiae functions in two different cellular processes: pre-mRNA splicing and cell cycle progression. The Prp17/Cdc40 protein participates in the second step of the splicing reaction and, in addition, prp17/cdc40 mutant cells held at the restrictive temperature arrest in the G2 phase of the cell cycle. Here we describe the identification of nine genes that, when mutated, show synthetic lethality with the prp17/cdc40Delta allele. Six of these encode known splicing factors: Prp8p, Slu7p, Prp16p, Prp22p, Slt11p, and U2 snRNA. The other three, SYF1, SYF2, and SYF3, represent genes also involved in cell cycle progression and in pre-mRNA splicing. Syf1p and Syf3p are highly conserved proteins containing several copies of a repeated motif, which we term RTPR. This newly defined motif is shared by proteins involved in RNA processing and represents a subfamily of the known TPR (tetratricopeptide repeat) motif. Using two-hybrid interaction screens and biochemical analysis, we show that the SYF gene products interact with each other and with four other proteins: Isy1p, Cef1p, Prp22p, and Ntc20p. We discuss the role played by these proteins in splicing and cell cycle progression. PMID:11102353

Genetic and physical interactions between factors involved in both cell cycle progression and pre-mRNA splicing in Saccharomyces cerevisiae.

PubMed

Ben-Yehuda, S; Dix, I; Russell, C S; McGarvey, M; Beggs, J D; Kupiec, M

2000-12-01

The PRP17/CDC40 gene of Saccharomyces cerevisiae functions in two different cellular processes: pre-mRNA splicing and cell cycle progression. The Prp17/Cdc40 protein participates in the second step of the splicing reaction and, in addition, prp17/cdc40 mutant cells held at the restrictive temperature arrest in the G2 phase of the cell cycle. Here we describe the identification of nine genes that, when mutated, show synthetic lethality with the prp17/cdc40Delta allele. Six of these encode known splicing factors: Prp8p, Slu7p, Prp16p, Prp22p, Slt11p, and U2 snRNA. The other three, SYF1, SYF2, and SYF3, represent genes also involved in cell cycle progression and in pre-mRNA splicing. Syf1p and Syf3p are highly conserved proteins containing several copies of a repeated motif, which we term RTPR. This newly defined motif is shared by proteins involved in RNA processing and represents a subfamily of the known TPR (tetratricopeptide repeat) motif. Using two-hybrid interaction screens and biochemical analysis, we show that the SYF gene products interact with each other and with four other proteins: Isy1p, Cef1p, Prp22p, and Ntc20p. We discuss the role played by these proteins in splicing and cell cycle progression.

The Trophic Life Cycle Stage of the Opportunistic Fungal Pathogen Pneumocystis murina Hinders the Ability of Dendritic Cells To Stimulate CD4+ T Cell Responses

PubMed Central

Evans, Heather M.; Simpson, Andrew; Shen, Shu; Stromberg, Arnold J.; Pickett, Carol L.

2017-01-01

ABSTRACT The life cycle of the opportunistic fungal pathogen Pneumocystis murina consists of a trophic stage and an ascus-like cystic stage. Infection with the cyst stage induces proinflammatory immune responses, while trophic forms suppress the cytokine response to multiple pathogen-associated molecular patterns (PAMPs), including β-glucan. A targeted gene expression assay was used to evaluate the dendritic cell response following stimulation with trophic forms alone, with a normal mixture of trophic forms and cysts, or with β-glucan. We demonstrate that stimulation with trophic forms downregulated the expression of multiple genes normally associated with the response to infection, including genes encoding transcription factors. Trophic forms also suppressed the expression of genes related to antigen processing and presentation, including the gene encoding the major histocompatibility complex (MHC) class II transactivator, CIITA. Stimulation of dendritic cells with trophic forms, but not a mixture of trophic forms and cysts, reduced the expression of MHC class II and the costimulatory molecule CD40 on the surface of the cells. These defects in the expression of MHC class II and costimulatory molecules corresponded with a reduced capacity for trophic form-loaded dendritic cells to stimulate CD4+ T cell proliferation and polarization. These data are consistent with the delayed innate and adaptive responses previously observed in immunocompetent mice inoculated with trophic forms compared to responses in mice inoculated with a mixture of trophic forms and cysts. We propose that trophic forms broadly inhibit the ability of dendritic cells to fulfill their role as antigen-presenting cells. PMID:28694293

Active Mechanisms of Vibration Encoding and Frequency Filtering in Central Mechanosensory Neurons.

PubMed

Azevedo, Anthony W; Wilson, Rachel I

2017-10-11

To better understand biophysical mechanisms of mechanosensory processing, we investigated two cell types in the Drosophila brain (A2 and B1 cells) that are postsynaptic to antennal vibration receptors. A2 cells receive excitatory synaptic currents in response to both directions of movement: thus, twice per vibration cycle. The membrane acts as a low-pass filter, so that voltage and spiking mainly track the vibration envelope rather than individual cycles. By contrast, B1 cells are excited by only forward or backward movement, meaning they are sensitive to vibration phase. They receive oscillatory synaptic currents at the stimulus frequency, and they bandpass filter these inputs to favor specific frequencies. Different cells prefer different frequencies, due to differences in their voltage-gated conductances. Both Na + and K + conductances suppress low-frequency synaptic inputs, so cells with larger voltage-gated conductances prefer higher frequencies. These results illustrate how membrane properties and voltage-gated conductances can extract distinct stimulus features into parallel channels. Copyright © 2017 Elsevier Inc. All rights reserved.

pRb phosphorylation regulates the proliferation of supporting cells in gentamicin-damaged neonatal avian utricle.

PubMed

Wu, Jingfang; Sun, Shan; Li, Wenyan; Chen, Yan; Li, Huawei

2014-10-01

The ability of nonmammalian vertebrates to regenerate hair cells (HCs) after damage-induced HC loss has stimulated and inspired research in the field of HC regeneration. The protein pRb encoded by retinoblastoma gene Rb1 forces sensory progenitor cells to exit cell cycle and maintain differentiated HCs and supporting cells (SCs) in a quiescent state. pRb function is regulated by phosphorylation through the MEK/ERK or the pRb/Raf-1 signaling pathway. In our previous study, we have shown that pRb phosphorylation is crucial for progenitor cell proliferation and survival during the early embryonic stage of avian otocyst sensory epithelium development. However, in damaged avian utricle, the role of pRb in regulating the cell cycling of SCs or HCs regeneration still remains unclear. To further elucidate the function of pRb phosphorylation on SCs re-entering the cell cycle triggered by gentamycin-induced HCs damage, we isolated neonatal chicken utricles and treated them with the MEK inhibitor U0126 or the pRb/Raf-1 inhibitor RRD-251, respectively in vitro. We found that after gentamycin-induced HCs damage, pRb phosphorylation is important for the quiescent SCs re-entering the cell cycle in the neonatal chicken utricle. In addition, the proliferation of SCs decreased in a dose-dependent manner in response to both U0126 and RRD-251, which indicates that both the MEK/ERK and the pRb/Raf-1 signaling pathway play important roles in pRb phosphorylation in damaged neonatal chicken utricle. Together, these findings on the function of pRb in damaged neonatal chicken utricle improve our understanding of the regulation of the cell cycle of SCs after HCs loss and may shed light on the mammalian HC regeneration from SCs in damaged organs.

TRAIP promotes DNA damage response during genome replication and is mutated in primordial dwarfism.

PubMed

Harley, Margaret E; Murina, Olga; Leitch, Andrea; Higgs, Martin R; Bicknell, Louise S; Yigit, Gökhan; Blackford, Andrew N; Zlatanou, Anastasia; Mackenzie, Karen J; Reddy, Kaalak; Halachev, Mihail; McGlasson, Sarah; Reijns, Martin A M; Fluteau, Adeline; Martin, Carol-Anne; Sabbioneda, Simone; Elcioglu, Nursel H; Altmüller, Janine; Thiele, Holger; Greenhalgh, Lynn; Chessa, Luciana; Maghnie, Mohamad; Salim, Mahmoud; Bober, Michael B; Nürnberg, Peter; Jackson, Stephen P; Hurles, Matthew E; Wollnik, Bernd; Stewart, Grant S; Jackson, Andrew P

2016-01-01

DNA lesions encountered by replicative polymerases threaten genome stability and cell cycle progression. Here we report the identification of mutations in TRAIP, encoding an E3 RING ubiquitin ligase, in patients with microcephalic primordial dwarfism. We establish that TRAIP relocalizes to sites of DNA damage, where it is required for optimal phosphorylation of H2AX and RPA2 during S-phase in response to ultraviolet (UV) irradiation, as well as fork progression through UV-induced DNA lesions. TRAIP is necessary for efficient cell cycle progression and mutations in TRAIP therefore limit cellular proliferation, providing a potential mechanism for microcephaly and dwarfism phenotypes. Human genetics thus identifies TRAIP as a component of the DNA damage response to replication-blocking DNA lesions.

Synchrony of clonal cell proliferation and contiguity of clonally related cells: production of mosaicism in the ventricular zone of developing mouse neocortex

NASA Technical Reports Server (NTRS)

Cai, L.; Hayes, N. L.; Nowakowski, R. S.

1997-01-01

We have analyzed clonal cell proliferation in the ventricular zone (VZ) of the early developing mouse neocortex with a replication-incompetent retrovirus encoding human placental alkaline phosphatase (AP). The retrovirus was injected into the lateral ventricles on embryonic day 11 (E11), i.e., at the onset of neuronogenesis. Three days postinjection, on E14, a total of 259 AP-labeled clones of various sizes were found in 7 fetal brains. There are approximately 7 cell cycles between E11 and E14 (), and there is a 1-2 cell cycle delay between retroviral injection and the production of a retrovirally labeled "founder" cell; thus, we estimate that the "age" of the clones was about 5-6 cell cycles. Almost one-half of the clones (48.3%) identified were pure proliferating clones containing cells only in the VZ. Another 18.5% contained both proliferating and postproliferative cells, and 33.2% contained only postproliferative cells. It was striking that over 90% of the clonally related proliferating cells occurred in clusters of two or more apparently contiguous cells, and about 73% of the proliferating cells occurred in clusters of three or more cells. Regardless of the number of cells in the clone, these clusters were tightly packed and confined to a single level of the VZ. This clustering of proliferating cells indicates that clonally related cells maintain neighbor-neighbor relationships as they undergo interkinetic nuclear migration and progress through several cell cycles, and, as a result, the ventricular zone is a mosaic of small clusters of clonally related and synchronously cycling cells. In addition, cells in the intermediate zone and the cortical plate were also frequently clustered, indicating that they became postproliferative at a similar time and that the output of the VZ is influenced by its mosaic structure.

The bornavirus-derived human protein EBLN1 promotes efficient cell cycle transit, microtubule organisation and genome stability.

PubMed

Myers, Katie N; Barone, Giancarlo; Ganesh, Anil; Staples, Christopher J; Howard, Anna E; Beveridge, Ryan D; Maslen, Sarah; Skehel, J Mark; Collis, Spencer J

2016-10-14

It was recently discovered that vertebrate genomes contain multiple endogenised nucleotide sequences derived from the non-retroviral RNA bornavirus. Strikingly, some of these elements have been evolutionary maintained as open reading frames in host genomes for over 40 million years, suggesting that some endogenised bornavirus-derived elements (EBL) might encode functional proteins. EBLN1 is one such element established through endogenisation of the bornavirus N gene (BDV N). Here, we functionally characterise human EBLN1 as a novel regulator of genome stability. Cells depleted of human EBLN1 accumulate DNA damage both under non-stressed conditions and following exogenously induced DNA damage. EBLN1-depleted cells also exhibit cell cycle abnormalities and defects in microtubule organisation as well as premature centrosome splitting, which we attribute in part, to improper localisation of the nuclear envelope protein TPR. Our data therefore reveal that human EBLN1 possesses important cellular functions within human cells, and suggest that other EBLs present within vertebrate genomes may also possess important cellular functions.

Developmental control of transcriptional and proliferative potency during the evolutionary emergence of animals

PubMed Central

Arenas-Mena, Cesar; Coffman, James A.

2016-01-01

Summary It is proposed that the evolution of complex animals required repressive genetic mechanisms for controlling the transcriptional and proliferative potency of cells. Unicellular organisms are transcriptionally potent, able to express their full genetic complement as the need arises through their life cycle, whereas differentiated cells of multicellular organisms can only express a fraction of their genomic potential. Likewise, whereas cell proliferation in unicellular organisms is primarily limited by nutrient availability, cell proliferation in multicellular organisms is developmentally regulated. Repressive genetic controls limiting the potency of cells at the end of ontogeny would have stabilized the gene expression states of differentiated cells and prevented disruptive proliferation, allowing the emergence of diverse cell types and functional shapes. We propose that distal cis-regulatory elements represent the primary innovations that set the stage for the evolution of developmental gene regulatory networks and the repressive control of key multipotency and cell-cycle control genes. The testable prediction of this model is that the genomes of extant animals, unlike those of our unicellular relatives, encode gene regulatory circuits dedicated to the developmental control of transcriptional and proliferative potency. PMID:26173445

Targeting Nucleotide Biosynthesis: A Strategy for Improving the Oncolytic Potential of DNA Viruses

PubMed Central

Irwin, Chad R.; Hitt, Mary M.; Evans, David H.

2017-01-01

The rapid growth of tumors depends upon elevated levels of dNTPs, and while dNTP concentrations are tightly regulated in normal cells, this control is often lost in transformed cells. This feature of cancer cells has been used to advantage to develop oncolytic DNA viruses. DNA viruses employ many different mechanisms to increase dNTP levels in infected cells, because the low concentration of dNTPs found in non-cycling cells can inhibit virus replication. By disrupting the virus-encoded gene(s) that normally promote dNTP biosynthesis, one can assemble oncolytic versions of these agents that replicate selectively in cancer cells. This review covers the pathways involved in dNTP production, how they are dysregulated in cancer cells, and the various approaches that have been used to exploit this biology to improve the tumor specificity of oncolytic viruses. In particular, we compare and contrast the ways that the different types of oncolytic virus candidates can directly modulate these processes. We limit our review to the large DNA viruses that naturally encode homologs of the cellular enzymes that catalyze dNTP biogenesis. Lastly, we consider how this knowledge might guide future development of oncolytic viruses. PMID:29018771

Histone modifications in the male germ line of Drosophila.

PubMed

Hennig, Wolfgang; Weyrich, Alexandra

2013-02-22

In the male germ line of Drosophila chromatin remains decondensed and highly transcribed during meiotic prophase until it is rapidly compacted. A large proportion of the cell cycle-regulated histone H3.1 is replaced by H3.3, a histone variant encoded outside the histone repeat cluster and not subject to cell cycle controlled expression. We investigated histone modification patterns in testes of D. melanogaster and D. hydei. In somatic cells of the testis envelope and in germ cells these modification patterns differ from those typically seen in eu- and heterochromatin of other somatic cells. During the meiotic prophase some modifications expected in active chromatin are not found or are found at low level. The absence of H4K16ac suggests that dosage compensation does not take place. Certain histone modifications correspond to either the cell cycle-regulated histone H3.1 or to the testis-specific variant H3.3. In spermatogonia we found H3K9 methylation in cytoplasmic histones, most likely corresponding to the H3.3 histone variant. Most histone modifications persist throughout the meiotic divisions. The majority of modifications persist until the early spermatid nuclei, and only a minority further persist until the final chromatin compaction stages before individualization of the spermatozoa. Histone modification patterns in the male germ line differ from expected patterns. They are consistent with an absence of dosage compensation of the X chromosome during the male meiotic prophase. The cell cycle-regulated histone variant H3.1 and H3.3, expressed throughout the cell cycle, also vary in their modification patterns. Postmeiotically, we observed a highly complex pattern of the histone modifications until late spermatid nuclear elongation stages. This may be in part due to postmeiotic transcription and in part to differential histone replacement during chromatin condensation.

miR-17-5p Regulates Endocytic Trafficking through Targeting TBC1D2/Armus

PubMed Central

Serva, Andrius; Knapp, Bettina; Tsai, Yueh-Tso; Claas, Christoph; Lisauskas, Tautvydas; Matula, Petr; Harder, Nathalie; Kaderali, Lars; Rohr, Karl; Erfle, Holger; Eils, Roland; Braga, Vania; Starkuviene, Vytaute

2012-01-01

miRNA cluster miR-17-92 is known as oncomir-1 due to its potent oncogenic function. miR-17-92 is a polycistronic cluster that encodes 6 miRNAs, and can both facilitate and inhibit cell proliferation. Known targets of miRNAs encoded by this cluster are largely regulators of cell cycle progression and apoptosis. Here, we show that miRNAs encoded by this cluster and sharing the seed sequence of miR-17 exert their influence on one of the most essential cellular processes – endocytic trafficking. By mRNA expression analysis we identified that regulation of endocytic trafficking by miR-17 can potentially be achieved by targeting of a number of trafficking regulators. We have thoroughly validated TBC1D2/Armus, a GAP of Rab7 GTPase, as a novel target of miR-17. Our study reveals regulation of endocytic trafficking as a novel function of miR-17, which might act cooperatively with other functions of miR-17 and related miRNAs in health and disease. PMID:23285084

A Cryptosporidium parvum genomic region encoding hemolytic activity.

PubMed Central

Steele, M I; Kuhls, T L; Nida, K; Meka, C S; Halabi, I M; Mosier, D A; Elliott, W; Crawford, D L; Greenfield, R A

1995-01-01

Successful parasitization by Cryptosporidium parvum requires multiple disruptions in both host and protozoan cell membranes as cryptosporidial sporozoites invade intestinal epithelial cells and subsequently develop into asexual and sexual life stages. To identify cryptosporidial proteins which may play a role in these membrane alterations, hemolytic activity was used as a marker to screen a C. parvum genomic expression library. A stable hemolytic clone (H4) containing a 5.5-kb cryptosporidial genomic fragment was identified. The hemolytic activity encoded on H4 was mapped to a 1-kb region that contained a complete 690-bp open reading frame (hemA) ending in a common stop codon. A 21-kDa plasmid-encoded recombinant protein was expressed in maxicells containing H4. Subclones of H4 which contained only a portion of hemA did not induce hemolysis on blood agar or promote expression of the recombinant protein in maxicells. Reverse transcriptase-mediated PCR analysis of total RNA isolated from excysted sporozoites and the intestines of infected adult mice with severe combined immunodeficiency demonstrated that hemA is actively transcribed during the cryptosporidial life cycle. PMID:7558289

Bombyx mori nucleopolyhedrovirus ORF101 encodes a budded virus envelope associated protein.

PubMed

Chen, Huiqing; Li, Mei; Huang, Guoping; Mai, Weijun; Chen, Keping; Zhou, Yajing

2014-08-01

Orf101 (Bm101) of Bombyx mori nucleopolyhedrovirus (BmNPV) is a highly conserved gene in lepidopteran nucleopolyhedroviruses, but its function remains unknown. In this study, Bm101 was characterized. Transcripts of Bm101 were detected from 24 through 96 h post infection (h p.i.) by RT-PCR. The corresponding protein was also detected from 24 to 96 h p.i. in BmNPV-infected BmN cells by Western blot analysis using a polyclonal antibody against Bm101. Western blot assay of occlusion-derived virus and budded virus (BV) preparations revealed that Bm101 encodes a 28-kDa structural protein that is associated with BV and is located in the envelope fraction of budded virions. In addition, confocal analysis showed that the protein was localized in the cytosol and cytoplasmic membrane in virus-infected cells. In conclusion, the available data suggest that Bm101 is a functional ORF of BmNPV and encodes a protein expressed in the late stage of the infection cycle that is associated with the BV envelope.

GABP transcription factor is required for development of chronic myelogenous leukemia via its control of PRKD2.

PubMed

Yang, Zhong-Fa; Zhang, Haojian; Ma, Leyuan; Peng, Cong; Chen, Yaoyu; Wang, Junling; Green, Michael R; Li, Shaoguang; Rosmarin, Alan G

2013-02-05

Hematopoietic stem cells (HSCs) are the source of all blood lineages, and HSCs must balance quiescence, self-renewal, and differentiation to meet lifelong needs for blood cell development. Transformation of HSCs by the breakpoint cluster region-ABL tyrosine kinase (BCR-ABL) oncogene causes chronic myelogenous leukemia (CML). The E-twenty six (ets) transcription factor GA binding protein (GABP) is a tetrameric transcription factor complex that contains GABPα and GABPβ proteins. Deletion in bone marrow of Gabpa, the gene that encodes the DNA-binding component, caused cell cycle arrest in HSCs and profound loss of hematopoietic progenitor cells. Loss of Gabpα prevented development of CML, although mice continued to generate BCR-ABL-expressing Gabpα-null cells for months that were serially transplantable and contributed to all lineages in secondary recipients. A bioinformatic screen identified the serine-threonine kinase protein kinase D2 (PRKD2) as a potential effector of GABP in HSCs. Prkd2 expression was markedly reduced in Gabpα-null HSCs and progenitor cells. Reduced expression of PRKD2 or pharmacologic inhibition decreased cell cycling, and PRKD2 rescued growth of Gabpα-null BCR-ABL-expressing cells. Thus, GABP is required for HSC cell cycle entry and CML development through its control of PRKD2. This offers a potential therapeutic target in leukemia.

Timing of Tissue-specific Cell Division Requires a Differential Onset of Zygotic Transcription during Metazoan Embryogenesis*

PubMed Central

Wong, Ming-Kin; Guan, Daogang; Ng, Kaoru Hon Chun; Ho, Vincy Wing Sze; An, Xiaomeng; Li, Runsheng; Ren, Xiaoliang

2016-01-01

Metazoan development demands not only precise cell fate differentiation but also accurate timing of cell division to ensure proper development. How cell divisions are temporally coordinated during development is poorly understood. Caenorhabditis elegans embryogenesis provides an excellent opportunity to study this coordination due to its invariant development and widespread division asynchronies. One of the most pronounced asynchronies is a significant delay of cell division in two endoderm progenitor cells, Ea and Ep, hereafter referred to as E2, relative to its cousins that mainly develop into mesoderm organs and tissues. To unravel the genetic control over the endoderm-specific E2 division timing, a total of 822 essential and conserved genes were knocked down using RNAi followed by quantification of cell cycle lengths using in toto imaging of C. elegans embryogenesis and automated lineage. Intriguingly, knockdown of numerous genes encoding the components of general transcription pathway or its regulatory factors leads to a significant reduction in the E2 cell cycle length but an increase in cell cycle length of the remaining cells, indicating a differential requirement of transcription for division timing between the two. Analysis of lineage-specific RNA-seq data demonstrates an earlier onset of transcription in endoderm than in other germ layers, the timing of which coincides with the birth of E2, supporting the notion that the endoderm-specific delay in E2 division timing demands robust zygotic transcription. The reduction in E2 cell cycle length is frequently associated with cell migration defect and gastrulation failure. The results suggest that a tissue-specific transcriptional activation is required to coordinate fate differentiation, division timing, and cell migration to ensure proper development. PMID:27056332

Neurotrophins Acting Via TRKB Receptors Activate the JAGGED1-NOTCH2 Cell-Cell Communication Pathway to Facilitate Early Ovarian Development

PubMed Central

Dorfman, Mauricio D.; Kerr, Bredford; Garcia-Rudaz, Cecilia; Paredes, Alfonso H.; Dissen, Gregory A.

2011-01-01

Tropomyosin-related kinase (TRK) receptor B (TRKB) mediates the supportive actions of neurotrophin 4/5 and brain-derived neurotrophic factor on early ovarian follicle development. Absence of TRKB receptors reduces granulosa cell (GC) proliferation and delays follicle growth. In the present study, we offer mechanistic insights into this phenomenon. DNA array and quantitative PCR analysis of ovaries from TrkB-null mice revealed that by the end of the first week of postnatal life, Jagged1, Hes1, and Hey2 mRNA abundance is reduced in the absence of TRKB receptors. Although Jagged1 encodes a NOTCH receptor ligand, Hes1 and Hey2 are downstream targets of the JAGGED1-NOTCH2 signaling system. Jagged1 is predominantly expressed in oocytes, and the abundance of JAGGED1 is decreased in TrkB−/− oocytes. Lack of TRKB receptors also resulted in reduced expression of c-Myc, a NOTCH target gene that promotes entry into the cell cycle, but did not alter the expression of genes encoding core regulators of cell-cycle progression. Selective restoration of JAGGED1 synthesis in oocytes of TrkB−/− ovaries via lentiviral-mediated transfer of the Jagged1 gene under the control of the growth differentiation factor 9 (Gdf9) promoter rescued c-Myc expression, GC proliferation, and follicle growth. These results suggest that neurotrophins acting via TRKB receptors facilitate early follicle growth by supporting a JAGGED1-NOTCH2 oocyte-to-GC communication pathway, which promotes GC proliferation via a c-MYC-dependent mechanism. PMID:22028443

Gene dosage imbalance during DNA replication controls bacterial cell-fate decision

NASA Astrophysics Data System (ADS)

Igoshin, Oleg

Genes encoding proteins in a common regulatory network are frequently located close to one another on the chromosome to facilitate co-regulation or couple gene expression to growth rate. Contrasting with these observations, here we demonstrate a functional role for the arrangement of Bacillus subtilis sporulation network genes on opposite sides of the chromosome. We show that the arrangement of two sporulation network genes, one located close to the origin, the other close to the terminus leads to a transient gene dosage imbalance during chromosome replication. This imbalance is detected by the sporulation network to produce cell-cycle coordinated pulses of the sporulation master regulator Spo0A~P. This pulsed response allows cells to decide between sporulation and continued vegetative growth during each cell-cycle spent in starvation. Furthermore, changes in DNA replication and cell-cycle parameters with decreased growth rate in starvation conditions enable cells to indirectly detect starvation without the need for evaluating specific metabolites. The simplicity of the uncovered coordination mechanism and starvation sensing suggests that it may be widely applicable in a variety of gene regulatory and stress-response settings. This work is supported by National Science Foundation Grants MCB-1244135, EAGER-1450867, MCB-1244423, NIH NIGMS Grant R01 GM088428 and HHMI International Student Fellowship.

Two pheromone precursor genes are transcriptionally expressed in the homothallic ascomycete Sordaria macrospora.

PubMed

Pöggeler, S

2000-06-01

In order to analyze the involvement of pheromones in cell recognition and mating in a homothallic fungus, two putative pheromone precursor genes, named ppg1 and ppg2, were isolated from a genomic library of Sordaria macrospora. The ppg1 gene is predicted to encode a precursor pheromone that is processed by a Kex2-like protease to yield a pheromone that is structurally similar to the alpha-factor of the yeast Saccharomyces cerevisiae. The ppg2 gene encodes a 24-amino-acid polypeptide that contains a putative farnesylated and carboxy methylated C-terminal cysteine residue. The sequences of the predicted pheromones display strong structural similarity to those encoded by putative pheromones of heterothallic filamentous ascomycetes. Both genes are expressed during the life cycle of S. macrospora. This is the first description of pheromone precursor genes encoded by a homothallic fungus. Southern-hybridization experiments indicated that ppg1 and ppg2 homologues are also present in other homothallic ascomycetes.

Genetic interaction between two insulin-dependent diabetes susceptibility loci, Idd2 and Idd13, in determining immunoregulatory DN T cell proportion.

PubMed

Collin, Roxanne; Doyon, Kathy; Mullins-Dansereau, Victor; Karam, Martin; Chabot-Roy, Geneviève; Hillhouse, Erin E; Orthwein, Alexandre; Lesage, Sylvie

2018-04-25

Several immune regulatory cell types participate in the protection against autoimmune diseases such as autoimmune diabetes. Of these immunoregulatory cells, we and others have shown that peripheral CD4 - CD8 - double negative (DN) T cells can induce antigen-specific immune tolerance. Particularly, we have described that diabetes-prone mice exhibit a lower number of peripheral DN T cells compared to diabetes-resistant mice. Identifying the molecular pathways that influence the size of the DN T cell pool in peripheral lymphoid organs may thus be of interest for maintaining antigen-specific immune tolerance. Hence, through immunogenetic approaches, we found that two genetic loci linked to autoimmune diabetes susceptibility, namely Idd2 and Idd13, independently contribute to the partial restoration of DN T cell proportion in secondary lymphoid organs. We now extend these findings to show an interaction between the Idd2 and Idd13 loci in determining the number of DN T cells in secondary lymphoid organs. Using bioinformatics tools, we link potential biological pathways arising from interactions of genes encoded within the two loci. By focusing on cell cycle, we validate that both the Idd2 and Idd13 loci influence RAD51 expression as well as DN T cell progression through the cell cycle. Altogether, we find that genetic interactions between Idd2 and Idd13 loci modulate cell cycle progression, which contributes, at least in part, to defining the proportion of DN T cells in secondary lymphoid organs.

Sex and menstrual cycle phase at encoding influence emotional memory for gist and detail

PubMed Central

Nielsen, Shawn E.; Ahmed, Imran; Cahill, Larry

2013-01-01

Sex influences on emotional memory have received increasing interest over the past decade. However, only a subset of this previous work explored the influence of sex on memory for central information (gist) and peripheral detail in emotional versus neutral contexts. Here we examined the influence of sex and menstrual cycle phase at encoding on memory for either an emotional or neutral story, specifically with respect to the retention of gist and peripheral detail. Healthy naturally cycling women and men viewed a brief, narrated, three-phase story containing neutral or emotionally arousing elements. One week later, participants received a surprise free recall test for story elements. The results indicate that naturally cycling women in the luteal (high hormone) phase of the menstrual cycle at encoding show enhanced memory for peripheral details, but not gist, when in the emotional compared with neutral stories (p<.05). In contrast, naturally cycling women in the follicular (low hormone) phase of the menstrual cycle at encoding did not show enhanced memory for gist or peripheral details in the emotional compared with neutral stories. Men show enhanced memory for gist, but not peripheral details, in the emotional versus neutral stories (p<.05). In addition, these sex influences on memory cannot be attributed to differences in attention or arousal; luteal women, follicular women, and men performed similarly on measures of attention (fixation time percentage) and arousal (pupil diameter changes) during the most arousing phase of the emotional story. These findings suggest that sex and menstrual cycle phase at encoding influence long term memory for different types of emotional information. PMID:23891713

A role for the ESCRT system in cell division in archaea.

PubMed

Samson, Rachel Y; Obita, Takayuki; Freund, Stefan M; Williams, Roger L; Bell, Stephen D

2008-12-12

Archaea are prokaryotic organisms that lack endomembrane structures. However, a number of hyperthermophilic members of the Kingdom Crenarchaea, including members of the Sulfolobus genus, encode homologs of the eukaryotic endosomal sorting system components Vps4 and ESCRT-III (endosomal sorting complex required for transport-III). We found that Sulfolobus ESCRT-III and Vps4 homologs underwent regulation of their expression during the cell cycle. The proteins interacted and we established the structural basis of this interaction. Furthermore, these proteins specifically localized to the mid-cell during cell division. Overexpression of a catalytically inactive mutant Vps4 in Sulfolobus resulted in the accumulation of enlarged cells, indicative of failed cell division. Thus, the archaeal ESCRT system plays a key role in cell division.

Investigating the Molecular Mechanism of TSO1 Function in Arabidopsis cell division and meristem development

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhongchi Liu

2004-10-01

Unlike animals, plants are constantly exposed to environmental mutagens including ultraviolet light and reactive oxygen species. Further, plant cells are totipotent with highly plastic developmental programs. An understanding of molecular mechanisms underlying the ability of plants to monitor and repair its DNA and to eliminate damaged cells are of great importance. Previously we have identified two genes, TSO1 and TSO2, from a flowering plant Arabidopsis thaliana. Mutations in these two genes cause callus-like flowers, fasciated shoot apical meristems, and abnormal cell division, indicating that TSO1 and TSO2 may encode important cell cycle regulators. Previous funding from DOE led to themore » molecular cloning of TSO1, which was shown to encode a novel nuclear protein with two CXC domains suspected to bind DNA. This DOE grant has allowed us to characterize and isolate TSO2 that encodes the small subunit of the ribonucleotide reductase (RNR). RNR comprises two large subunits (R1) an d two small subunits (R2), catalyzes a rate-limiting step in the production of deoxyribonucleotides needed for DNA replication and repair. Previous studies in yeast and mammals indicated that defective RNR often led to cell cycle arrest, growth retardation and p53-dependent apoptosis while abnormally elevated RNR activities led to higher mutation rates. Subsequently, we identified two additional R2 genes, R2A and R2B in the Arabidopsis genome. Using reverse genetics, mutations in R2A and R2B were isolated, and double and triple mutants among the three R2 genes (TSO2, R2A and R2B) were constructed and analyzed. We showed that Arabidopsis tso2 mutants, with reduced dNTP levels, were more sensitive to UV-C. While r2a or r2b single mutants did not exhibit any phenotypes, tso2 r2b double mutants were embryonic lethal and tso2 r2a double mutants were seedling lethal indicating redundant functions among the three R2 genes. Furthermore, tso2 r2a double mutants exhibited increased DNA dam age, massive programmed cell death, and the release of transcriptional gene silencing. Our data suggests that plants can initiate programmed cell death to eliminate damaged cells despite the absence of p53 in plant genome.« less

TRAIP promotes DNA damage response during genome replication and is mutated in primordial dwarfism

PubMed Central

Leitch, Andrea; Higgs, Martin R.; Bicknell, Louise S.; Yigit, Gökhan; Blackford, Andrew N.; Zlatanou, Anastasia; Mackenzie, Karen J.; Reddy, Kaalak; Halachev, Mihail; McGlasson, Sarah; Reijns, Martin A. M.; Fluteau, Adeline; Martin, Carol-Anne; Sabbioneda, Simone; Elcioglu, Nursel H.; Altmüller, Janine; Thiele, Holger; Greenhalgh, Lynn; Chessa, Luciana; Maghnie, Mohamad; Salim, Mahmoud; Bober, Michael B.; Nürnberg, Peter; Jackson, Stephen P.; Hurles, Matthew E.; Wollnik, Bernd; Stewart, Grant S.; Jackson, Andrew P.

2015-01-01

DNA lesions encountered by replicative polymerases threaten genome stability and cell cycle progression. Here we report the identification of mutations in TRAIP, encoding an E3 RING ubiquitin ligase, in patients with microcephalic primordial dwarfism/Seckel syndrome. We establish that TRAIP relocalizes to sites of DNA damage where it is required for optimal phosphorylation of H2AX and RPA2 during S-phase in response to UV irradiation, as well as fork progression through UV-induced DNA lesions. TRAIP is necessary for efficient cell cycle progression and mutations in TRAIP therefore limit cellular proliferation, providing a potential mechanism for microcephaly and dwarfism phenotypes. Human genetics thus identifies TRAIP as a novel component of the DNA damage response to replication-blocking DNA lesions. PMID:26595769

PPARγ ligand production is tightly linked to clonal expansion during initiation of adipocyte differentiation[S

PubMed Central

Hallenborg, Philip; Petersen, Rasmus Koefoed; Feddersen, Søren; Sundekilde, Ulrik; Hansen, Jacob B.; Blagoev, Blagoy; Madsen, Lise; Kristiansen, Karsten

2014-01-01

Adipocyte differentiation is orchestrated by the ligand-activated nuclear receptor PPARγ. Endogenous ligands comprise oxidized derivatives of arachidonic acid and structurally similar PUFAs. Although expression of PPARγ peaks in mature adipocytes, ligands are produced primarily at the onset of differentiation. Concomitant with agonist production, murine fibroblasts undergo two rounds of mitosis referred to as mitotic clonal expansion. Here we show that mouse embryonic fibroblasts deficient in either of two cell cycle inhibitors, the transcription factor p53 or its target gene encoding the cyclin-dependent kinase inhibitor p21, exhibit increased adipogenic potential. The antiadipogenic effect of p53 relied on its transcriptional activity and p21 expression but was circumvented by administration of an exogenous PPARγ agonist suggesting a linkage between cell cycling and PPARγ ligand production. Indeed, cell cycle inhibitory compounds decreased PPARγ ligand production in differentiating 3T3-L1 preadipocytes. Furthermore, these inhibitors abolished the release of arachidonic acid induced by the hormonal cocktail initiating adipogenesis. Collectively, our results suggest that murine fibroblasts require clonal expansion for PPARγ ligand production at the onset of adipocyte differentiation. PMID:25312885

The Cak1p Protein Kinase Is Required at G(1)/S and G(2)/M in the Budding Yeast Cell Cycle

PubMed Central

Sutton, A.; Freiman, R.

1997-01-01

The CAK1 gene encodes the major CDK-activating kinase (CAK) in budding yeast and is required for activation of Cdc28p for cell cycle progression from G(2) to M phase. Here we describe the isolation of a mutant allele of CAK1 in a synthetic lethal screen with the Sit4 protein phosphatase. Analysis of several different cak1 mutants shows that although the G(2) to M transition appears most sensitive to loss of Cak1p function, Cak1p is also required for activation of Cdc28p for progression from G(1) into S phase. Further characterization of these mutants suggests that, unlike the CAK identified from higher eukaryotes, Cak1p of budding yeast may not play a role in general transcription. Finally, although Cak1 protein levels and in vitro protein kinase activity do not fluctuate during the cell cycle, at least a fraction of Cak1p associates with higher molecular weight proteins, which may be important for its in vivo function. PMID:9286668

Cell cycle accumulation of the proliferating cell nuclear antigen PCN-1 transitions from continuous in the adult germline to intermittent in the early embryo of C. elegans.

PubMed

Kocsisova, Zuzana; Kornfeld, Kerry; Schedl, Tim

2018-05-30

The proliferating cell nuclear antigen (PCNA or PCN-1 in C. elegans), an essential processivity factor for DNA polymerase δ, has been widely used as a marker of S-phase. In C. elegans early embryos, PCN-1 accumulation is cyclic, localizing to the nucleus during S-phase and the cytoplasm during the rest of the cell cycle. The C. elegans larval and adult germline is an important model systems for studying cell cycle regulation, and it was observed that the cell cycle regulator cyclin E (CYE-1 in C. elegans) displays a non-cyclic, continuous accumulation pattern in this tissue. The accumulation pattern of PCN-1 has not been well defined in the larval and adult germline, and the objective of this study was to determine if the accumulation pattern is cyclic, as in other cells and organisms, or continuous, similar to cyclin E. To study the larval and adult germline accumulation of PCN-1 expressed from its native locus, we used CRISPR/Cas9 technology to engineer a novel allele of pcn-1 that encodes an epitope-tagged protein. S-phase nuclei were labeled using EdU nucleotide incorporation, and FLAG::PCN-1 was detected by antibody staining. All progenitor zone nuclei, including those that were not in S-phase (as they were negative for EdU staining) showed PCN-1 accumulation, indicating that PCN-1 accumulated during all cell cycle phases in the germline progenitor zone. The same result was observed with a GFP::PCN-1 fusion protein expressed from a transgene. pcn-1 loss-of-function mutations were analyzed, and pcn-1 was necessary for robust fertility and embryonic development. In the C. elegans early embryo as well as other organisms, PCN-1 accumulates in nuclei only during S-phase. By contrast, in the progenitor zone of the germline of C. elegans, PCN-1 accumulated in nuclei during all cell cycle stages. This pattern is similar to accumulation pattern of cyclin E. These observations support the model that mitotic cell cycle regulation in the germline stem and progenitor cells is distinct from somatic cells, as it does not heavily rely on cyclic accumulation of classic cell cycle proteins.

Zika Virus Alters the Expression Profile of microRNA-Related Genes in Liver, Lung, and Kidney Cell Lineages.

PubMed

Ferreira, Rafaella Nascimento; Holanda, Gustavo Moraes; Pinto Silva, Eliana Vieira; Casseb, Samir Mansour Moraes; Melo, Karla Fabiane Lopes; Carvalho, Carlos Alberto Marques; Lima, Juliana Abreu; Vasconcelos, Pedro Fernando Costa; Cruz, Ana Cecília Ribeiro

2018-06-07

Zika virus (ZIKV) is an arbovirus belonging to the genus Flavivirus (Flaviviridae). ZIKV infection is associated with alterations in various organs, including the liver, lungs, and kidneys. Studies on the influence of posttranscriptional control on viral infections have demonstrated that microRNAs (miRNAs) interfere with different stages of the replicative cycle of several viruses and may influence the disease outcome. To shed light on ZIKV-induced regulation of host miRNA-processing machinery in the above organs, we analyzed the expression of genes encoding key proteins of the miRNA pathway in different ZIKV-infected continuous primate cell lineages (HepG2, A549, and MA104) by reverse-transcription quantitative polymerase chain reaction (RT-qPCR). Expression of the genes encoding the miRNA-related proteins DGCR8, Ago1, and Ago3 in HepG2 cells and Drosha, Dicer, Ago2, and Ago3 in A549 and MA104 cells was significantly altered in the presence of ZIKV. Our results suggest that ZIKV modulates miRNA levels during infection in liver, lung, and kidney cells, which may be an additional mechanism of host cell subversion in these organs.

Independent Losses of Visual Perception Genes Gja10 and Rbp3 in Echolocating Bats (Order: Chiroptera)

PubMed Central

Shen, Bin; Fang, Tao; Dai, Mengyao; Jones, Gareth; Zhang, Shuyi

2013-01-01

A trade-off between the sensory modalities of vision and hearing is likely to have occurred in echolocating bats as the sophisticated mechanism of laryngeal echolocation requires considerable neural processing and has reduced the reliance of echolocating bats on vision for perceiving the environment. If such a trade-off exists, it is reasonable to hypothesize that some genes involved in visual function may have undergone relaxed selection or even functional loss in echolocating bats. The Gap junction protein, alpha 10 (Gja10, encoded by Gja10 gene) is expressed abundantly in mammal retinal horizontal cells and plays an important role in horizontal cell coupling. The interphotoreceptor retinoid-binding protein (Irbp, encoded by the Rbp3 gene) is mainly expressed in interphotoreceptor matrix and is known to be critical for normal functioning of the visual cycle. We sequenced Gja10 and Rbp3 genes in a taxonomically wide range of bats with divergent auditory characteristics (35 and 18 species for Gja10 and Rbp3, respectively). Both genes have became pseudogenes in species from the families Hipposideridae and Rhinolophidae that emit constant frequency echolocation calls with Doppler shift compensation at high-duty-cycles (the most sophisticated form of biosonar known), and in some bat species that emit echolocation calls at low-duty-cycles. Our study thus provides further evidence for the hypothesis that a trade-off occurs at the genetic level between vision and echolocation in bats. PMID:23874796

Independent losses of visual perception genes Gja10 and Rbp3 in echolocating bats (Order: Chiroptera).

PubMed

Shen, Bin; Fang, Tao; Dai, Mengyao; Jones, Gareth; Zhang, Shuyi

2013-01-01

A trade-off between the sensory modalities of vision and hearing is likely to have occurred in echolocating bats as the sophisticated mechanism of laryngeal echolocation requires considerable neural processing and has reduced the reliance of echolocating bats on vision for perceiving the environment. If such a trade-off exists, it is reasonable to hypothesize that some genes involved in visual function may have undergone relaxed selection or even functional loss in echolocating bats. The Gap junction protein, alpha 10 (Gja10, encoded by Gja10 gene) is expressed abundantly in mammal retinal horizontal cells and plays an important role in horizontal cell coupling. The interphotoreceptor retinoid-binding protein (Irbp, encoded by the Rbp3 gene) is mainly expressed in interphotoreceptor matrix and is known to be critical for normal functioning of the visual cycle. We sequenced Gja10 and Rbp3 genes in a taxonomically wide range of bats with divergent auditory characteristics (35 and 18 species for Gja10 and Rbp3, respectively). Both genes have became pseudogenes in species from the families Hipposideridae and Rhinolophidae that emit constant frequency echolocation calls with Doppler shift compensation at high-duty-cycles (the most sophisticated form of biosonar known), and in some bat species that emit echolocation calls at low-duty-cycles. Our study thus provides further evidence for the hypothesis that a trade-off occurs at the genetic level between vision and echolocation in bats.

Cyclin A and the retinoblastoma gene product complex with a common transcription factor.

PubMed

Bandara, L R; Adamczewski, J P; Hunt, T; La Thangue, N B

1991-07-18

The retinoblastoma gene (Rb) product is a negative regulator of cellular proliferation, an effect that could be mediated in part at the transcriptional level through its ability to complex with the sequence-specific transcription factor DRTF1. This interaction is modulated by adenovirus E1a, which sequesters the Rb protein and several other cellular proteins, including cyclin A, a molecule that undergoes cyclical accumulation and destruction during each cell cycle and which is required for cell cycle progression. Cyclin A, which also complexes with DRTF1, facilitates the efficient assembly of the Rb protein into the complex. This suggests a role for cyclin A in regulating transcription and defines a transcription factor through which molecules that regulate the cell cycle in a negative fashion, such as Rb, and in a positive fashion, such as cyclin A, interact. Mutant loss-of-function Rb alleles, which occur in a variety of tumour cells, also fail to complex with E1a and large T antigen. Here we report on a naturally occurring loss-of-function Rb allele encoding a protein that fails to complex with DRTF1. This might explain how mutation in the Rb gene prevents negative growth control.

Productive Replication and Evolution of HIV-1 in Ferret Cells

PubMed Central

Fadel, Hind J.; Saenz, Dyana T.; Guevara, Rebekah; von Messling, Veronika; Peretz, Mary

2012-01-01

A rodent or other small animal model for HIV-1 has not been forthcoming, with the principal obstacles being species-specific restriction mechanisms and deficits in HIV-1 dependency factors. Some Carnivorans may harbor comparatively fewer impediments. For example, in contrast to mice, the domestic cat genome encodes essential nonreceptor HIV-1 dependency factors. All Feliformia species and at least one Caniformia species also lack a major lentiviral restriction mechanism (TRIM5α/TRIMCyp proteins). Here we investigated cells from two species in another carnivore family, the Mustelidae, for permissiveness to the HIV-1 life cycle. Mustela putorius furo (domesticated ferret) primary cells and cell lines did not restrict HIV-1, feline immunodeficiency virus (FIV), equine infectious anemia virus (EIAV), or N-tropic murine leukemia virus (MLV) postentry and supported late HIV-1 life cycle steps comparably to human cells. The ferret TRIM5α gene exon 8, which encodes the B30.2 domain, was found to be pseudogenized. Strikingly, ferret (but not mink) cells engineered to express human HIV-1 entry receptors supported productive spreading replication, amplification, and serial passage of wild-type HIV-1. Nevertheless, produced virions had relatively reduced infectivity and the virus accrued G→A hypermutations, consistent with APOBEC3 protein pressure. Ferret cell-passaged HIV-1 also evolved amino acid changes in the capsid cyclophilin A binding loop. We conclude that the genome of this carnivore can provide essential nonreceptor HIV-1 dependency factors and that ferret APOBEC3 proteins with activity against HIV-1 are likely. Even so, unlike in cat cells, HIV-1 can replicate in ferret cells without vif substitution. The virus evolves in this novel nonprimate cell adaptive landscape. We suggest that further characterization of HIV-1 adaptation in ferret cells and delineation of Mustelidae restriction factor repertoires are warranted, with a view to the potential for an HIV-1 animal model. PMID:22171279

Single-Cell Genome and Group-Specific dsrAB Sequencing Implicate Marine Members of the Class Dehalococcoidia (Phylum Chloroflexi) in Sulfur Cycling

PubMed Central

Cooper, Myriel; Schreiber, Lars; Lloyd, Karen G.; Baker, Brett J.; Petersen, Dorthe G.; Jørgensen, Bo Barker; Stepanauskas, Ramunas; Reinhardt, Richard; Schramm, Andreas; Loy, Alexander; Adrian, Lorenz

2016-01-01

ABSTRACT The marine subsurface sediment biosphere is widely inhabited by bacteria affiliated with the class Dehalococcoidia (DEH), phylum Chloroflexi, and yet little is known regarding their metabolisms. In this report, genomic content from a single DEH cell (DEH-C11) with a 16S rRNA gene that was affiliated with a diverse cluster of 16S rRNA gene sequences prevalent in marine sediments was obtained from sediments of Aarhus Bay, Denmark. The distinctive gene content of this cell suggests metabolic characteristics that differ from those of known DEH and Chloroflexi. The presence of genes encoding dissimilatory sulfite reductase (Dsr) suggests that DEH could respire oxidized sulfur compounds, although Chloroflexi have never been implicated in this mode of sulfur cycling. Using long-range PCR assays targeting DEH dsr loci, dsrAB genes were amplified and sequenced from various marine sediments. Many of the amplified dsrAB sequences were affiliated with the DEH Dsr clade, which we propose equates to a family-level clade. This provides supporting evidence for the potential for sulfite reduction by diverse DEH species. DEH-C11 also harbored genes encoding reductases for arsenate, dimethyl sulfoxide, and halogenated organics. The reductive dehalogenase homolog (RdhA) forms a monophyletic clade along with RdhA sequences from various DEH-derived contigs retrieved from available metagenomes. Multiple facts indicate that this RdhA may not be a terminal reductase. The presence of other genes indicated that nutrients and energy may be derived from the oxidation of substituted homocyclic and heterocyclic aromatic compounds. Together, these results suggest that marine DEH play a previously unrecognized role in sulfur cycling and reveal the potential for expanded catabolic and respiratory functions among subsurface DEH. PMID:27143384

Human T-lymphotropic virus type-1 p30 alters cell cycle G2 regulation of T lymphocytes to enhance cell survival

PubMed Central

Datta, Antara; Silverman, Lee; Phipps, Andrew J; Hiraragi, Hajime; Ratner, Lee; Lairmore, Michael D

2007-01-01

Background Human T-lymphotropic virus type-1 (HTLV-1) causes adult T-cell leukemia/lymphoma and is linked to a number of lymphocyte-mediated disorders. HTLV-1 contains both regulatory and accessory genes in four pX open reading frames. pX ORF-II encodes two proteins, p13 and p30, whose roles are still being defined in the virus life cycle and in HTLV-1 virus-host cell interactions. Proviral clones of HTLV-1 with pX ORF-II mutations diminish the ability of the virus to maintain viral loads in vivo. p30 expressed exogenously differentially modulates CREB and Tax-responsive element-mediated transcription through its interaction with CREB-binding protein/p300 and while acting as a repressor of many genes including Tax, in part by blocking tax/rex RNA nuclear export, selectively enhances key gene pathways involved in T-cell signaling/activation. Results Herein, we analyzed the role of p30 in cell cycle regulation. Jurkat T-cells transduced with a p30 expressing lentivirus vector accumulated in the G2-M phase of cell cycle. We then analyzed key proteins involved in G2-M checkpoint activation. p30 expression in Jurkat T-cells resulted in an increase in phosphorylation at serine 216 of nuclear cell division cycle 25C (Cdc25C), had enhanced checkpoint kinase 1 (Chk1) serine 345 phosphorylation, reduced expression of polo-like kinase 1 (PLK1), diminished phosphorylation of PLK1 at tyrosine 210 and reduced phosphorylation of Cdc25C at serine 198. Finally, primary human lymphocyte derived cell lines immortalized by a HTLV-1 proviral clone defective in p30 expression were more susceptible to camptothecin induced apoptosis. Collectively these data are consistent with a cell survival role of p30 against genotoxic insults to HTLV-1 infected lymphocytes. Conclusion Collectively, our data are the first to indicate that HTLV-1 p30 expression results in activation of the G2-M cell cycle checkpoint, events that would promote early viral spread and T-cell survival. PMID:17634129

Mutations in CENPE define a novel kinetochore-centromeric mechanism for Microcephalic Primordial Dwarfism

PubMed Central

Mirzaa, Ghayda M.; Vitre, Benjamin; Carpenter, Gillian; Abramowicz, Iga; Gleeson, Joseph G.; Paciorkowski, Alex R.; Cleveland, Don W.; Dobyns, William B.; O’Driscoll, Mark

2015-01-01

Defects in centrosome, centrosomal-associated and spindle-associated proteins are the most frequent cause of Primary Microcephaly (PM) and Microcephalic Primordial Dwarfism (MPD) syndromes in humans. Mitotic progression and segregation defects, microtubule spindle abnormalities and impaired DNA damage-induced G2-M cell cycle checkpoint proficiency have been documented in cell lines from these patients. This suggests that impaired mitotic entry, progression and exit strongly contribute to PM and MPD. Considering the vast protein networks involved in coordinating this cell cycle stage, the list of potential target genes that could underlie novel developmental disorders is large. One such complex network, with a direct microtubule-mediated physical connection to the centrosome, is the kinetochore. This centromeric-associated structure nucleates microtubule attachments onto mitotic chromosomes. Here, we described novel compound heterozygous variants in CENPE in two siblings who exhibit a profound MPD associated with developmental delay, simplified gyri and other isolated abnormalities. CENPE encodes centromere-associated protein E (CENP-E), a core kinetochore component functioning to mediate chromosome congression initially of misaligned chromosomes and in subsequent spindle microtubule capture during mitosis. Firstly, we present a comprehensive clinical description of these patients. Then, using patient cells we document abnormalities in spindle microtubule organisation, mitotic progression and segregation, before modeling the cellular pathogenicity of these variants in an independent cell system. Our cellular analysis shows that a pathogenic defect in CENP-E, a kinetochore-core protein, largely phenocopies PCNT-mutated Microcephalic Osteodysplastic Primordial Dwarfism type II patient cells. PCNT encodes a centrosome-associated protein. These results highlight a common underlying pathomechanism. Our findings provide the first evidence for a kinetochore-based route to MPD in humans. PMID:24748105

Mutations in CENPE define a novel kinetochore-centromeric mechanism for microcephalic primordial dwarfism.

PubMed

Mirzaa, Ghayda M; Vitre, Benjamin; Carpenter, Gillian; Abramowicz, Iga; Gleeson, Joseph G; Paciorkowski, Alex R; Cleveland, Don W; Dobyns, William B; O'Driscoll, Mark

2014-08-01

Defects in centrosome, centrosomal-associated and spindle-associated proteins are the most frequent cause of primary microcephaly (PM) and microcephalic primordial dwarfism (MPD) syndromes in humans. Mitotic progression and segregation defects, microtubule spindle abnormalities and impaired DNA damage-induced G2-M cell cycle checkpoint proficiency have been documented in cell lines from these patients. This suggests that impaired mitotic entry, progression and exit strongly contribute to PM and MPD. Considering the vast protein networks involved in coordinating this cell cycle stage, the list of potential target genes that could underlie novel developmental disorders is large. One such complex network, with a direct microtubule-mediated physical connection to the centrosome, is the kinetochore. This centromeric-associated structure nucleates microtubule attachments onto mitotic chromosomes. Here, we described novel compound heterozygous variants in CENPE in two siblings who exhibit a profound MPD associated with developmental delay, simplified gyri and other isolated abnormalities. CENPE encodes centromere-associated protein E (CENP-E), a core kinetochore component functioning to mediate chromosome congression initially of misaligned chromosomes and in subsequent spindle microtubule capture during mitosis. Firstly, we present a comprehensive clinical description of these patients. Then, using patient cells we document abnormalities in spindle microtubule organization, mitotic progression and segregation, before modeling the cellular pathogenicity of these variants in an independent cell system. Our cellular analysis shows that a pathogenic defect in CENP-E, a kinetochore-core protein, largely phenocopies PCNT-mutated microcephalic osteodysplastic primordial dwarfism-type II patient cells. PCNT encodes a centrosome-associated protein. These results highlight a common underlying pathomechanism. Our findings provide the first evidence for a kinetochore-based route to MPD in humans.

UV light selectively coinduces supply pathways from primary metabolism and flavonoid secondary product formation in parsley

PubMed Central

Logemann, Elke; Tavernaro, Annette; Schulz, Wolfgang; Somssich, Imre E.; Hahlbrock, Klaus

2000-01-01

The UV light-induced synthesis of UV-protective flavonoids diverts substantial amounts of substrates from primary metabolism into secondary product formation and thus causes major perturbations of the cellular homeostasis. Results from this study show that the mRNAs encoding representative enzymes from various supply pathways are coinduced in UV-irradiated parsley cells (Petroselinum crispum) with two mRNAs of flavonoid glycoside biosynthesis, encoding phenylalanine ammonia-lyase and chalcone synthase. Strong induction was observed for mRNAs encoding glucose 6-phosphate dehydrogenase (carbohydrate metabolism, providing substrates for the shikimate pathway), 3-deoxyarabinoheptulosonate 7-phosphate synthase (shikimate pathway, yielding phenylalanine), and acyl-CoA oxidase (fatty acid degradation, yielding acetyl-CoA), and moderate induction for an mRNA encoding S-adenosyl-homocysteine hydrolase (activated methyl cycle, yielding S-adenosyl-methionine for B-ring methylation). Ten arbitrarily selected mRNAs representing various unrelated metabolic activities remained unaffected. Comparative analysis of acyl-CoA oxidase and chalcone synthase with respect to mRNA expression modes and gene promoter structure and function revealed close similarities. These results indicate a fine-tuned regulatory network integrating those functionally related pathways of primary and secondary metabolism that are specifically required for protective adaptation to UV irradiation. Although the response of parsley cells to UV light is considerably broader than previously assumed, it contrasts greatly with the extensive metabolic reprogramming observed previously in elicitor-treated or fungus-infected cells. PMID:10677554

Cell transformation by human adenoviruses.

PubMed

Endter, C; Dobner, T

2004-01-01

The last 40 years of molecular biological investigations into human adenoviruses have contributed enormously to our understanding of the basic principles of normal and malignant cell growth. Much of this knowledge stems from analyses of their productive infection cycle in permissive host cells. Also, initial observations concerning the carcinogenic potential of human adenoviruses subsequently revealed decisive insights into the molecular mechanisms of the origins of cancer, and established adenoviruses as a model system for explaining virus-mediated transformation processes. Today it is well established that cell transformation by human adenoviruses is a multistep process involving several gene products encoded in early transcription units 1A (E1A) and 1B (E1B). Moreover, a large body of evidence now indicates that alternative or additional mechanisms are engaged in adenovirus-mediated oncogenic transformation involving gene products encoded in early region 4 (E4) as well as epigenetic changes resulting from viral DNA integration. In particular, detailed studies on the tumorigenic potential of subgroup D adenovirus type 9 (Ad9) E4 have now revealed a new pathway that points to a novel, general mechanism of virus-mediated oncogenesis. In this chapter, we summarize the current state of knowledge about the oncogenes and oncogene products of human adenoviruses, focusing particularly on recent findings concerning the transforming and oncogenic properties of viral proteins encoded in the E1B and E4 transcription units.

A mitochondrial-like aconitase in the bacterium Bacteroides fragilis: implications for the evolution of the mitochondrial Krebs cycle.

PubMed

Baughn, Anthony D; Malamy, Michael H

2002-04-02

Aconitase and isocitrate dehydrogenase (IDH) enzyme activities were detected in anaerobically prepared cell extracts of the obligate anaerobe Bacteroides fragilis. The aconitase gene was located upstream of the genes encoding the other two components of the oxidative branch of the Krebs cycle, IDH and citrate synthase. Mutational analysis indicates that these genes are cotranscribed. A nonpolar in-frame deletion of the acnA gene that encodes the aconitase prevented growth in glucose minimal medium unless heme or succinate was added to the medium. These results imply that B. fragilis has two pathways for alpha-ketoglutarate biosynthesis-one from isocitrate and the other from succinate. Homology searches indicated that the B. fragilis aconitase is most closely related to aconitases of two other Cytophaga-Flavobacterium-Bacteroides (CFB) group bacteria, Cytophaga hutchinsonii and Fibrobacter succinogenes. Phylogenetic analysis indicates that the CFB group aconitases are most closely related to mitochondrial aconitases. In addition, the IDH of C. hutchinsonii was found to be most closely related to the mitochondrial/cytosolic IDH-2 group of eukaryotic organisms. These data suggest a common origin for these Krebs cycle enzymes in mitochondria and CFB group bacteria.

Molecular Aspects and Comparative Genomics of Bacteriophage Endolysins

PubMed Central

Oliveira, Hugo; Melo, Luís D. R.; Santos, Sílvio B.; Nóbrega, Franklin L.; Ferreira, Eugénio C.; Cerca, Nuno; Azeredo, Joana

2013-01-01

Phages are recognized as the most abundant and diverse entities on the planet. Their diversity is determined predominantly by their dynamic adaptation capacities when confronted with different selective pressures in an endless cycle of coevolution with a widespread group of bacterial hosts. At the end of the infection cycle, progeny virions are confronted with a rigid cell wall that hinders their release into the environment and the opportunity to start a new infection cycle. Consequently, phages encode hydrolytic enzymes, called endolysins, to digest the peptidoglycan. In this work, we bring to light all phage endolysins found in completely sequenced double-stranded nucleic acid phage genomes and uncover clues that explain the phage-endolysin-host ecology that led phages to recruit unique and specialized endolysins. PMID:23408602

Cell Cycle Dependent Regulation of Human Progesterone Receptor in Breast Cancer

DTIC Science & Technology

2004-10-01

wt PR or S400A PR (0.01-1.0 [tg each), CDK2 (ljig), and PRE-2x-TATA-luc reporter plasmid (lig) along with Renilla plasmid (10ng) as a control for...8 hours prior to treatment. Cells were collected following treatment with 10 nM R5020 or ETOH vehicle control for 18 hrs. Luciferase and renilla ...reporter, a renilla reporter construct as a transfection control, either wt PR-B or S400A mutant PR-B, and control parental vector or a vector encoding an

Cooperation between Epstein-Barr Virus Immune Evasion Proteins Spreads Protection from CD8+ T Cell Recognition across All Three Phases of the Lytic Cycle

PubMed Central

Quinn, Laura L.; Zuo, Jianmin; Abbott, Rachel J. M.; Shannon-Lowe, Claire; Tierney, Rosemary J.; Hislop, Andrew D.; Rowe, Martin

2014-01-01

CD8+ T cell responses to Epstein-Barr virus (EBV) lytic cycle expressed antigens display a hierarchy of immunodominance, in which responses to epitopes of immediate-early (IE) and some early (E) antigens are more frequently observed than responses to epitopes of late (L) expressed antigens. It has been proposed that this hierarchy, which correlates with the phase-specific efficiency of antigen presentation, may be due to the influence of viral immune-evasion genes. At least three EBV-encoded genes, BNLF2a, BGLF5 and BILF1, have the potential to inhibit processing and presentation of CD8+ T cell epitopes. Here we examined the relative contribution of these genes to modulation of CD8+ T cell recognition of EBV lytic antigens expressed at different phases of the replication cycle in EBV-transformed B-cells (LCLs) which spontaneously reactivate lytic cycle. Selective shRNA-mediated knockdown of BNLF2a expression led to more efficient recognition of immediate-early (IE)- and early (E)-derived epitopes by CD8+ T cells, while knock down of BILF1 increased recognition of epitopes from E and late (L)-expressed antigens. Contrary to what might have been predicted from previous ectopic expression studies in EBV-negative model cell lines, the shRNA-mediated inhibition of BGLF5 expression in LCLs showed only modest, if any, increase in recognition of epitopes expressed in any phase of lytic cycle. These data indicate that whilst BNLF2a interferes with antigen presentation with diminishing efficiency as lytic cycle progresses (IE>E>>L), interference by BILF1 increases with progression through lytic cycle (IE

mus304 encodes a novel DNA damage checkpoint protein required during Drosophila development

PubMed Central

Brodsky, Michael H.; Sekelsky, Jeff J.; Tsang, Garson; Hawley, R. Scott; Rubin, Gerald M.

2000-01-01

Checkpoints block cell cycle progression in eukaryotic cells exposed to DNA damaging agents. We show that several Drosophila homologs of checkpoint genes, mei-41, grapes, and 14-3-3ε, regulate a DNA damage checkpoint in the developing eye. We have used this assay to show that the mutagen-sensitive gene mus304 is also required for this checkpoint. mus304 encodes a novel coiled-coil domain protein, which is targeted to the cytoplasm. Similar to mei-41, mus304 is required for chromosome break repair and for genomic stability. mus304 animals also exhibit three developmental defects, abnormal bristle morphology, decreased meiotic recombination, and arrested embryonic development. We suggest that these phenotypes reflect distinct developmental consequences of a single underlying checkpoint defect. Similar mechanisms may account for the puzzling array of symptoms observed in humans with mutations in the ATM tumor suppressor gene. PMID:10733527

Herpesvirus deconjugases inhibit the IFN response by promoting TRIM25 autoubiquitination and functional inactivation of the RIG-I signalosome.

PubMed

Gupta, Soham; Ylä-Anttila, Päivi; Callegari, Simone; Tsai, Ming-Han; Delecluse, Henri-Jacques; Masucci, Maria G

2018-01-01

The N-terminal domains of the herpesvirus large tegument proteins encode a conserved cysteine protease with ubiquitin- and NEDD8-specific deconjugase activity. The proteins are expressed during the productive virus cycle and are incorporated into infectious virus particles, being delivered to the target cells upon primary infection. Members of this viral enzyme family were shown to regulate different aspects of the virus life cycle and the innate anti-viral response. However, only few substrates have been identified and the mechanisms of these effects remain largely unknown. In order to gain insights on the substrates and signaling pathways targeted by the viral enzymes, we have used co-immunoprecipitation and mass spectrometry to identify cellular proteins that interact with the Epstein-Barr virus encoded homologue BPLF1. Several members of the 14-3-3-family of scaffold proteins were found amongst the top hits of the BPLF1 interactome, suggesting that, through this interaction, BPLF1 may regulate a variety of cellular signaling pathways. Analysis of the shared protein-interaction network revealed that BPLF1 promotes the assembly of a tri-molecular complex including, in addition to 14-3-3, the ubiquitin ligase TRIM25 that participates in the innate immune response via ubiquitination of cytosolic pattern recognition receptor, RIG-I. The involvement of BPLF1 in the regulation of this signaling pathway was confirmed by inhibition of the type-I IFN responses in cells transfected with a catalytically active BPLF1 N-terminal domain or expressing the endogenous protein upon reactivation of the productive virus cycle. We found that the active viral enzyme promotes the dimerization and autoubiquitination of TRIM25. Upon triggering of the IFN response, RIG-I is recruited to the complex but ubiquitination is severely impaired, which functionally inactivates the RIG-I signalosome. The capacity to bind to and functionally inactivate the RIG-I signalosome is shared by the homologues encoded by other human herpesviruses.

Herpesvirus deconjugases inhibit the IFN response by promoting TRIM25 autoubiquitination and functional inactivation of the RIG-I signalosome

PubMed Central

Gupta, Soham; Callegari, Simone; Delecluse, Henri-Jacques

2018-01-01

The N-terminal domains of the herpesvirus large tegument proteins encode a conserved cysteine protease with ubiquitin- and NEDD8-specific deconjugase activity. The proteins are expressed during the productive virus cycle and are incorporated into infectious virus particles, being delivered to the target cells upon primary infection. Members of this viral enzyme family were shown to regulate different aspects of the virus life cycle and the innate anti-viral response. However, only few substrates have been identified and the mechanisms of these effects remain largely unknown. In order to gain insights on the substrates and signaling pathways targeted by the viral enzymes, we have used co-immunoprecipitation and mass spectrometry to identify cellular proteins that interact with the Epstein-Barr virus encoded homologue BPLF1. Several members of the 14-3-3-family of scaffold proteins were found amongst the top hits of the BPLF1 interactome, suggesting that, through this interaction, BPLF1 may regulate a variety of cellular signaling pathways. Analysis of the shared protein-interaction network revealed that BPLF1 promotes the assembly of a tri-molecular complex including, in addition to 14-3-3, the ubiquitin ligase TRIM25 that participates in the innate immune response via ubiquitination of cytosolic pattern recognition receptor, RIG-I. The involvement of BPLF1 in the regulation of this signaling pathway was confirmed by inhibition of the type-I IFN responses in cells transfected with a catalytically active BPLF1 N-terminal domain or expressing the endogenous protein upon reactivation of the productive virus cycle. We found that the active viral enzyme promotes the dimerization and autoubiquitination of TRIM25. Upon triggering of the IFN response, RIG-I is recruited to the complex but ubiquitination is severely impaired, which functionally inactivates the RIG-I signalosome. The capacity to bind to and functionally inactivate the RIG-I signalosome is shared by the homologues encoded by other human herpesviruses. PMID:29357390

Gene Expression of Pneumocystis murina after Treatment with Anidulafungin Results in Strong Signals for Sexual Reproduction, Cell Wall Integrity, and Cell Cycle Arrest, Indicating a Requirement for Ascus Formation for Proliferation.

PubMed

Cushion, Melanie T; Ashbaugh, Alan; Hendrix, Keeley; Linke, Michael J; Tisdale, Nikeya; Sayson, Steven G; Porollo, Aleksey

2018-05-01

The echinocandins are a class of antifungal agents that target β-1,3-d-glucan (BG) biosynthesis. In the ascigerous Pneumocystis species, treatment with these drugs depletes the ascus life cycle stage, which contains BG, but large numbers of forms which do not express BG remain in the infected lungs. In the present study, the gene expression profiles of Pneumocystis murina were compared between infected, untreated mice and mice treated with anidulafungin for 2 weeks to understand the metabolism of the persisting forms. Almost 80 genes were significantly up- or downregulated. Like other fungi exposed to echinocandins, genes associated with sexual replication, cell wall integrity, cell cycle arrest, and stress comprised the strongest upregulated signals in P. murina from the treated mice. The upregulation of the P. murina β-1,3-d-glucan endohydrolase and endo-1,3-glucanase was notable and may explain the disappearance of the existing asci in the lungs of treated mice since both enzymes can degrade BG. The biochemical measurement of BG in the lungs of treated mice and fluorescence microscopy with an anti-BG antibody supported the loss of BG. Downregulated signals included genes involved in cell replication, genome stability, and ribosomal biogenesis and function and the Pneumocystis -specific genes encoding the major surface glycoproteins (Msg). These studies suggest that P. murina attempted to undergo sexual replication in response to a stressed environment and was halted in any type of proliferative cycle, likely due to a lack of BG. Asci appear to be a required part of the life cycle stage of Pneumocystis , and BG may be needed to facilitate progression through the life cycle via sexual replication. Copyright © 2018 Cushion et al.

A Secreted Chemokine Binding Protein Encoded by Murine Gammaherpesvirus-68 Is Necessary for the Establishment of a Normal Latent Load

PubMed Central

Bridgeman, Anne; Stevenson, Philip G.; Simas, J. Pedro; Efstathiou, Stacey

2001-01-01

Herpesviruses encode a variety of proteins with the potential to disrupt chemokine signaling, and hence immune organization. However, little is known of how these might function in vivo. The B cell–tropic murine gammaherpesvirus-68 (MHV-68) is related to the Kaposi's sarcoma–associated herpesvirus (KSHV), but whereas KSHV expresses small chemokine homologues, MHV-68 encodes a broad spectrum chemokine binding protein (M3). Here we have analyzed the effect on viral pathogenesis of a targeted disruption of the M3 gene. After intranasal infection, an M3 deficiency had surprisingly little effect on lytic cycle replication in the respiratory tract or the initial spread of virus to lymphoid tissues. However, the amplification of latently infected B cells in the spleen that normally drives MHV-68–induced infectious mononucleosis failed to occur. Thus, there was a marked reduction in latent virus recoverable by in vitro reactivation, latency-associated viral tRNA transcripts detectable by in situ hybridization, total viral DNA load, and virus-driven B cell activation. In vivo CD8+ T cell depletion largely reversed this deficiency, suggesting that the chemokine neutralization afforded by M3 may function to block effective CD8+ T cell recruitment into lymphoid tissue during the expansion of latently infected B cell numbers. In the absence of M3, MHV-68 was unable to establish a normal latent load. PMID:11489949

Sensitization of breast cancer cells to doxorubicin via stable cell line generation and overexpression of DFF40.

PubMed

Bagheri, Fatemeh; Safarian, Shahrokh; Eslaminejad, Mohamadreza Baghaban; Sheibani, Nader

2015-12-01

There are a number of reports demonstrating a relationship between the alterations in DFF40 expression and development of some cancers. Here, increased DFF40 expression in T-47D cells in the presence of doxorubicin was envisaged for therapeutic usage. The T-47D cells were transfected with an eukaryotic expression vector encoding the DFF40 cDNA. Following incubation with doxorubicin, propidium iodide (PI) staining was used for cell cycle distribution analysis. The rates of apoptosis were determined by annexin V/PI staining. Apoptosis was also evaluated using the DNA laddering analysis. The viability of DFF40-transfected cells incubated with doxorubicin was significantly decreased compared with control cells. However, there were no substantial changes in the cell cycle distribution of pIRES2-DFF40 cells incubated with doxorubicin compared to control cells. The expression of DFF40, without doxorubicin incubation, had also no significant effect on the cell cycle distribution. There was no DNA laddering in cells transfected with the empty pIRES2 vector when incubated with doxorubicin. In contrast, DNA laddering was observed in DFF40 transfected cells in the presence of doxorubicin after 48 h. Also, the expression of DFF40 and DFF45 was increased in DFF40 transfected cells in the presence of doxorubicin enhancing cell death. Collectively our results indicated that co-treatment of DFF40-transfected cells with doxorubicin can enhance the killing of these tumor cells via apoptosis. Thus, modulation of DFF40 level may be a beneficial strategy for treatment of chemo-resistant cancers.

TP53INP1 is a novel p73 target gene that induces cell cycle arrest and cell death by modulating p73 transcriptional activity.

PubMed

Tomasini, Richard; Seux, Mylène; Nowak, Jonathan; Bontemps, Caroline; Carrier, Alice; Dagorn, Jean-Charles; Pébusque, Marie-Josèphe; Iovanna, Juan L; Dusetti, Nelson J

2005-12-08

TP53INP1 is an alternatively spliced gene encoding two nuclear protein isoforms (TP53INP1alpha and TP53INP1beta), whose transcription is activated by p53. When overexpressed, both isoforms induce cell cycle arrest in G1 and enhance p53-mediated apoptosis. TP53INP1s also interact with the p53 gene and regulate p53 transcriptional activity. We report here that TP53INP1 expression is induced during experimental acute pancreatitis in p53-/- mice and in cisplatin-treated p53-/- mouse embryo fibroblasts (MEFs). We demonstrate that ectopic expression of p73, a p53 homologue, leads to TP53INP1 induction in p53-deficient cells. In turn, TP53INP1s alters the transactivation capacity of p73 on several p53-target genes, including TP53INP1 itself, demonstrating a functional association between p73 and TP53INP1s. Also, when overexpressed in p53-deficient cells, TP53INP1s inhibit cell growth and promote cell death as assessed by cell cycle analysis and colony formation assays. Finally, we show that TP53INP1s potentiate the capacity of p73 to inhibit cell growth, that effect being prevented when the p53 mutant R175H is expressed or when p73 expression is blocked by a siRNA. These results suggest that TP53INP1s are functionally associated with p73 to regulate cell cycle progression and apoptosis, independently from p53.

Identification of Novel Saccharomyces cerevisiae Proteins with Nuclear Export Activity: Cell Cycle-Regulated Transcription Factor Ace2p Shows Cell Cycle-Independent Nucleocytoplasmic Shuttling

PubMed Central

Jensen, Torben Heick; Neville, Megan; Rain, Jean Christophe; McCarthy, Terri; Legrain, Pierre; Rosbash, Michael

2000-01-01

Nuclear export of proteins containing leucine-rich nuclear export signals (NESs) is mediated by the NES receptor CRM1/Crm1p. We have carried out a yeast two-hybrid screen with Crm1p as a bait. The Crm1p-interacting clones were subscreened for nuclear export activity in a visual assay utilizing the Crm1p-inhibitor leptomycin B (LMB). This approach identified three Saccharomyces cerevisiae proteins not previously known to have nuclear export activity. These proteins are the 5′ RNA triphosphatase Ctl1p, the cell cycle-regulated transcription factor Ace2p, and a protein encoded by the previously uncharacterized open reading frame YDR499W. Mutagenesis analysis show that YDR499Wp contains an NES that conforms to the consensus sequence for leucine-rich NESs. Mutagenesis of Ctl1p and Ace2p were unable to identify specific NES residues. However, a 29-amino-acid region of Ace2p, rich in hydrophobic residues, contains nuclear export activity. Ace2p accumulates in the nucleus at the end of mitosis and activates early-G1-specific genes. We now provide evidence that Ace2p is nuclear not only in late M-early G1 but also during other stages of the cell cycle. This feature of Ace2p localization explains its ability to activate genes such as CUP1, which are not expressed in a cell cycle-dependent manner. PMID:11027275

Microsporidia infection impacts the host cell's cycle and reduces host cell apoptosis

PubMed Central

Higes, Mariano; Sagastume, Soledad; Juarranz, Ángeles; Dias-Almeida, Joyce; Budge, Giles E.; Meana, Aránzazu; Boonham, Neil

2017-01-01

Intracellular parasites can alter the cellular machinery of host cells to create a safe haven for their survival. In this regard, microsporidia are obligate intracellular fungal parasites with extremely reduced genomes and hence, they are strongly dependent on their host for energy and resources. To date, there are few studies into host cell manipulation by microsporidia, most of which have focused on morphological aspects. The microsporidia Nosema apis and Nosema ceranae are worldwide parasites of honey bees, infecting their ventricular epithelial cells. In this work, quantitative gene expression and histology were studied to investigate how these two parasites manipulate their host’s cells at the molecular level. Both these microsporidia provoke infection-induced regulation of genes involved in apoptosis and the cell cycle. The up-regulation of buffy (which encodes a pro-survival protein) and BIRC5 (belonging to the Inhibitor Apoptosis protein family) was observed after infection, shedding light on the pathways that these pathogens use to inhibit host cell apoptosis. Curiously, different routes related to cell cycle were modified after infection by each microsporidia. In the case of N. apis, cyclin B1, dacapo and E2F2 were up-regulated, whereas only cyclin E was up-regulated by N. ceranae, in both cases promoting the G1/S phase transition. This is the first report describing molecular pathways related to parasite-host interactions that are probably intended to ensure the parasite’s survival within the cell. PMID:28152065

Microsporidia infection impacts the host cell's cycle and reduces host cell apoptosis.

PubMed

Martín-Hernández, Raquel; Higes, Mariano; Sagastume, Soledad; Juarranz, Ángeles; Dias-Almeida, Joyce; Budge, Giles E; Meana, Aránzazu; Boonham, Neil

2017-01-01

Intracellular parasites can alter the cellular machinery of host cells to create a safe haven for their survival. In this regard, microsporidia are obligate intracellular fungal parasites with extremely reduced genomes and hence, they are strongly dependent on their host for energy and resources. To date, there are few studies into host cell manipulation by microsporidia, most of which have focused on morphological aspects. The microsporidia Nosema apis and Nosema ceranae are worldwide parasites of honey bees, infecting their ventricular epithelial cells. In this work, quantitative gene expression and histology were studied to investigate how these two parasites manipulate their host's cells at the molecular level. Both these microsporidia provoke infection-induced regulation of genes involved in apoptosis and the cell cycle. The up-regulation of buffy (which encodes a pro-survival protein) and BIRC5 (belonging to the Inhibitor Apoptosis protein family) was observed after infection, shedding light on the pathways that these pathogens use to inhibit host cell apoptosis. Curiously, different routes related to cell cycle were modified after infection by each microsporidia. In the case of N. apis, cyclin B1, dacapo and E2F2 were up-regulated, whereas only cyclin E was up-regulated by N. ceranae, in both cases promoting the G1/S phase transition. This is the first report describing molecular pathways related to parasite-host interactions that are probably intended to ensure the parasite's survival within the cell.

Ovarian cycle-linked plasticity of δ-GABAA receptor subunits in hippocampal interneurons affects γ oscillations in vivo

PubMed Central

Barth, Albert M. I.; Ferando, Isabella; Mody, Istvan

2014-01-01

GABAA receptors containing δ subunits (δ-GABAARs) are GABA-gated ion channels with extra- and perisynaptic localization, strong sensitivity to neurosteroids (NS), and a high degree of plasticity. In selective brain regions they are expressed on specific principal cells and interneurons (INs), and generate a tonic conductance that controls neuronal excitability and oscillations. Plasticity of δ-GABAARs in principal cells has been described during states of altered NS synthesis including acute stress, puberty, ovarian cycle, pregnancy and the postpartum period, with direct consequences on neuronal excitability and network dynamics. The defining network events implicated in cognitive function, memory formation and encoding are γ oscillations (30–120 Hz), a well-timed loop of excitation and inhibition between principal cells and PV-expressing INs (PV + INs). The δ-GABAARs of INs can modify γ oscillations, and a lower expression of δ-GABAARs on INs during pregnancy alters γ frequency recorded in vitro. The ovarian cycle is another physiological event with large fluctuations in NS levels and δ-GABAARs. Stages of the cycle are paralleled by swings in memory performance, cognitive function, and mood in both humans and rodents. Here we show δ-GABAARs changes during the mouse ovarian cycle in hippocampal cell types, with enhanced expression during diestrus in principal cells and specific INs. The plasticity of δ-GABAARs on PV-INs decreases the magnitude of γ oscillations continuously recorded in area CA1 throughout several days in vivo during diestrus and increases it during estrus. Such recurring changes in γ magnitude were not observed in non-cycling wild-type (WT) females, cycling females lacking δ-GABAARs only on PV-INs (PV-Gabrd-/-), and in male mice during a time course equivalent to the ovarian cycle. Our findings may explain the impaired memory and cognitive performance experienced by women with premenstrual syndrome (PMS) or premenstrual dysphoric disorder (PMDD). PMID:25157218

The Genome of S-PM2, a “Photosynthetic” T4-Type Bacteriophage That Infects Marine Synechococcus Strains

PubMed Central

Mann, Nicholas H.; Clokie, Martha R. J.; Millard, Andrew; Cook, Annabel; Wilson, William H.; Wheatley, Peter J.; Letarov, Andrey; Krisch, H. M.

2005-01-01

Bacteriophage S-PM2 infects several strains of the abundant and ecologically important marine cyanobacterium Synechococcus. A large lytic phage with an isometric icosahedral head, S-PM2 has a contractile tail and by this criterion is classified as a myovirus (1). The linear, circularly permuted, 196,280-bp double-stranded DNA genome of S-PM2 contains 37.8% G+C residues. It encodes 239 open reading frames (ORFs) and 25 tRNAs. Of these ORFs, 19 appear to encode proteins associated with the cell envelope, including a putative S-layer-associated protein. Twenty additional S-PM2 ORFs have homologues in the genomes of their cyanobacterial hosts. There is a group I self-splicing intron within the gene encoding the D1 protein. A total of 40 ORFs, organized into discrete clusters, encode homologues of T4 proteins involved in virion morphogenesis, nucleotide metabolism, gene regulation, and DNA replication and repair. The S-PM2 genome encodes a few surprisingly large (e.g., 3,779 amino acids) ORFs of unknown function. Our analysis of the S-PM2 genome suggests that many of the unknown S-PM2 functions may be involved in the adaptation of the metabolism of the host cell to the requirements of phage infection. This hypothesis originates from the identification of multiple phage-mediated modifications of the host's photosynthetic apparatus that appear to be essential for maintaining energy production during the lytic cycle. PMID:15838046

Global transcriptomic response of Anoxybacillus sp. SK 3-4 to aluminum exposure.

PubMed

Lim, Jia Chun; Thevarajoo, Suganthi; Selvaratnam, Chitra; Goh, Kian Mau; Shamsir, Mohd Shahir; Ibrahim, Zaharah; Chong, Chun Shiong

2017-02-01

Anoxybacillus sp. SK 3-4 is a Gram-positive, rod-shaped bacterium and a member of family Bacillaceae. We had previously reported that the strain is an aluminum resistant thermophilic bacterium. This is the first report to provide a detailed analysis of the global transcriptional response of Anoxybacillus when the cells were exposed to 600 mg L -1 of aluminum. The transcriptome was sequenced using Illumina MiSeq sequencer. Total of 708 genes were differentially expressed (fold change >2.00) with 316 genes were up-regulated while 347 genes were down-regulated, in comparing to control with no aluminum added in the culture. Based on Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, the majority of genes encoding for cell metabolism such as glycolysis, sulfur metabolism, cysteine and methionine metabolism were up-regulated; while most of the gene associated with tricarboxylic acid cycle (TCA cycle) and valine, leucine and isoleucine metabolism were down-regulated. In addition, a significant number of the genes encoding ABC transporters, metal ions transporters, and some stress response proteins were also differentially expressed following aluminum exposure. The findings provide further insight and help us to understand on the resistance of Anoxybacillus sp. SK 3-4 toward aluminium. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

An investigation into anti-proliferative effects of microRNAs encoded by the miR-106a-363 cluster on human carcinoma cells and keratinocytes using microarray profiling of miRNA transcriptomes

PubMed Central

Khuu, Cuong; Jevnaker, Anne-Marthe; Bryne, Magne; Osmundsen, Harald

2014-01-01

Transfection of human oral squamous carcinoma cells (clone E10) with mimics for unexpressed miR-20b or miR-363-5p, encoded by the miR-106a-363 cluster (miR-20b, miR-106a, miR-363-3p, or miR-363-5p), caused 40–50% decrease in proliferation. Transfection with mimics for miR-18a or miR-92a, encoded by the miR-17-92 cluster (all members being expressed in E10 cells), had no effect on proliferation. In contrast, mimic for the sibling miRNA-19a yielded about 20% inhibition of proliferation. To investigate miRNA involvement profiling of miRNA transcriptomes were carried out using deoxyoligonucleotide microarrays. In transfectants for miR-19a, or miR-20b or miR-363-5p most differentially expressed miRNAs exhibited decreased expression, including some miRNAs encoded in paralogous miR-17-92—or miR-106b-25 cluster. Only in cells transfected with miR-19a mimic significantly increased expression of miR-20b observed—about 50-fold as judged by qRT-PCR. Further studies using qRT-PCR showed that transfection of E10 cells with mimic for miRNAs encoded by miR-17-92 - or miR-106a-363 - or the miR-106b-25 cluster confirmed selective effect on expression on sibling miRNAs. We conclude that high levels of miRNAs encoded by the miR-106a-363 cluster may contribute to inhibition of proliferation by decreasing expression of several sibling miRNAs encoded by miR-17-92 or by the miR-106b-25 cluster. The inhibition of proliferation observed in miR-19a-mimic transfectants is likely caused by the miR-19a-dependent increase in the levels of miR-20b and miR-106a. Bioinformatic analysis of differentially expressed miRNAs from miR-106a, miR-20b and miR-363-5p transfectants, but not miR-92a transfectants, yielded significant associations to “Cellular Growth and Proliferation” and “Cell Cycle.” Western blotting results showed that levels of affected proteins to differ between transfectants, suggesting that different anti-proliferative mechanisms may operate in these transfectants. PMID:25202322

A Protein Encoded by the Latency-Related Gene of Bovine Herpesvirus 1 Is Expressed in Trigeminal Ganglionic Neurons of Latently Infected Cattle and Interacts with Cyclin-Dependent Kinase 2 during Productive Infection

PubMed Central

Jiang, Yunquan; Hossain, Ashfaque; Winkler, Maria Teresa; Holt, Todd; Doster, Alan; Jones, Clinton

1998-01-01

Despite productive viral gene expression in the peripheral nervous system during acute infection, the bovine herpesvirus 1 (BHV-1) infection cycle is blocked in sensory ganglionic neurons and consequently latency is established. The only abundant viral transcript expressed during latency is the latency-related (LR) RNA. LR gene products inhibit S-phase entry, and binding of the LR protein (LRP) to cyclin A was hypothesized to block cell cycle progression. This study demonstrates LRP is a nuclear protein which is expressed in neurons of latently infected cattle. Affinity chromatography indicated that LRP interacts with cyclin-dependent kinase 2 (cdk2)-cyclin complexes or cdc2-cyclin complexes in transfected human cells or infected bovine cells. After partial purification using three different columns (DEAE-Sepharose, Econo S, and heparin-agarose), LRP was primarily associated with cdk2-cyclin E complexes, an enzyme which is necessary for G1-to-S-phase cell cycle progression. During acute infection of trigeminal ganglia or following dexamethasone-induced reactivation, BHV-1 induces expression of cyclin A in neurons (L. M. Schang, A. Hossain, and C. Jones, J. Virol. 70:3807–3814, 1996). Expression of S-phase regulatory proteins (cyclin A, for example) leads to neuronal apoptosis. Consequently, we hypothesize that interactions between LRP and cell cycle regulatory proteins promote survival of postmitotic neurons during acute infection and/or reactivation. PMID:9733854

A protein encoded by the latency-related gene of bovine herpesvirus 1 is expressed in trigeminal ganglionic neurons of latently infected cattle and interacts with cyclin-dependent kinase 2 during productive infection.

PubMed

Jiang, Y; Hossain, A; Winkler, M T; Holt, T; Doster, A; Jones, C

1998-10-01

Despite productive viral gene expression in the peripheral nervous system during acute infection, the bovine herpesvirus 1 (BHV-1) infection cycle is blocked in sensory ganglionic neurons and consequently latency is established. The only abundant viral transcript expressed during latency is the latency-related (LR) RNA. LR gene products inhibit S-phase entry, and binding of the LR protein (LRP) to cyclin A was hypothesized to block cell cycle progression. This study demonstrates LRP is a nuclear protein which is expressed in neurons of latently infected cattle. Affinity chromatography indicated that LRP interacts with cyclin-dependent kinase 2 (cdk2)-cyclin complexes or cdc2-cyclin complexes in transfected human cells or infected bovine cells. After partial purification using three different columns (DEAE-Sepharose, Econo S, and heparin-agarose), LRP was primarily associated with cdk2-cyclin E complexes, an enzyme which is necessary for G1-to-S-phase cell cycle progression. During acute infection of trigeminal ganglia or following dexamethasone-induced reactivation, BHV-1 induces expression of cyclin A in neurons (L. M. Schang, A. Hossain, and C. Jones, J. Virol. 70:3807-3814, 1996). Expression of S-phase regulatory proteins (cyclin A, for example) leads to neuronal apoptosis. Consequently, we hypothesize that interactions between LRP and cell cycle regulatory proteins promote survival of postmitotic neurons during acute infection and/or reactivation.

The R2R3 MYB Transcription Factors FOUR LIPS and MYB88 Regulate Female Reproductive Development

PubMed Central

Lamb, Rebecca S.

2012-01-01

Gamete formation is an important step in the life cycle of sexually reproducing organisms. In flowering plants, haploid spores are formed after the meiotic division of spore mother cells. These spores develop into male and female gametophytes containing gametes after undergoing mitotic divisions. In the female, the megaspore mother cell undergoes meiosis forming four megaspores, of which one is functional and three degenerate. The megaspore then undergoes three mitotic cycles thus generating an embryo sac with eight nuclei. The embryo sac undergoes cellularization to form the mature seven-celled female gametophyte. Entry into and progression through meiosis is essential for megasporogenesis and subsequent megagametogenesis, but control of this process is not well understood. FOUR LIPS (FLP) and its paralogue MYB88, encoding R2R3 MYB transcription factors, have been extensively studied for their role in limiting the terminal division in stomatal development by direct regulation of the expression of cell cycle genes. Here it is demonstrated that FLP and MYB88 also regulate female reproduction. Both FLP and MYB88 are expressed during ovule development and their loss significantly increases the number of ovules produced by the placenta. Despite the presence of excess ovules, single and double mutants exhibit reduced seed set due to reduced female fertility. The sterility results at least in part from defective meiotic entry and progression. Therefore, FLP and MYB88 are important regulators of entry into megasporogenesis, and probably act via the regulation of cell cycle genes. PMID:22915737

Love is a battlefield: programmed cell death during fertilization.

PubMed

Heydlauff, Juliane; Groß-Hardt, Rita

2014-03-01

Plant development and growth is sustained by the constant generation of tremendous amounts of cells, which become integrated into various types of tissues and organs. What is all too often overlooked is that this thriving life also requires the targeted degeneration of selected cells, which undergo cell death according to genetically encoded programmes or environmental stimuli. The side-by-side existence of generation and demise is particularly evident in the haploid phase of the flowering plants cycle. Here, the lifespan of terminally differentiated accessory cells contrasts with that of germ cells, which by definition live on to form the next generation. In fact, with research in recent years it is becoming increasingly clear that the gametophytes of flowering plants constitute an attractive and powerful system for investigating the molecular mechanisms underlying selective cell death.

The bornavirus-derived human protein EBLN1 promotes efficient cell cycle transit, microtubule organisation and genome stability

PubMed Central

Myers, Katie N.; Barone, Giancarlo; Ganesh, Anil; Staples, Christopher J.; Howard, Anna E.; Beveridge, Ryan D.; Maslen, Sarah; Skehel, J. Mark; Collis, Spencer J.

2016-01-01

It was recently discovered that vertebrate genomes contain multiple endogenised nucleotide sequences derived from the non-retroviral RNA bornavirus. Strikingly, some of these elements have been evolutionary maintained as open reading frames in host genomes for over 40 million years, suggesting that some endogenised bornavirus-derived elements (EBL) might encode functional proteins. EBLN1 is one such element established through endogenisation of the bornavirus N gene (BDV N). Here, we functionally characterise human EBLN1 as a novel regulator of genome stability. Cells depleted of human EBLN1 accumulate DNA damage both under non-stressed conditions and following exogenously induced DNA damage. EBLN1-depleted cells also exhibit cell cycle abnormalities and defects in microtubule organisation as well as premature centrosome splitting, which we attribute in part, to improper localisation of the nuclear envelope protein TPR. Our data therefore reveal that human EBLN1 possesses important cellular functions within human cells, and suggest that other EBLs present within vertebrate genomes may also possess important cellular functions. PMID:27739501

A little sugar goes a long way: The cell biology of O-GlcNAc

PubMed Central

2015-01-01

Unlike the complex glycans decorating the cell surface, the O-linked β-N-acetyl glucosamine (O-GlcNAc) modification is a simple intracellular Ser/Thr-linked monosaccharide that is important for disease-relevant signaling and enzyme regulation. O-GlcNAcylation requires uridine diphosphate–GlcNAc, a precursor responsive to nutrient status and other environmental cues. Alternative splicing of the genes encoding the O-GlcNAc cycling enzymes O-GlcNAc transferase (OGT) and O-GlcNAcase (OGA) yields isoforms targeted to discrete sites in the nucleus, cytoplasm, and mitochondria. OGT and OGA also partner with cellular effectors and act in tandem with other posttranslational modifications. The enzymes of O-GlcNAc cycling act preferentially on intrinsically disordered domains of target proteins impacting transcription, metabolism, apoptosis, organelle biogenesis, and transport. PMID:25825515

Identification of candidate transmission-blocking antigen genes in Theileria annulata and related vector-borne apicomplexan parasites.

PubMed

Lempereur, Laetitia; Larcombe, Stephen D; Durrani, Zeeshan; Karagenc, Tulin; Bilgic, Huseyin Bilgin; Bakirci, Serkan; Hacilarlioglu, Selin; Kinnaird, Jane; Thompson, Joanne; Weir, William; Shiels, Brian

2017-06-05

Vector-borne apicomplexan parasites are a major cause of mortality and morbidity to humans and livestock globally. The most important disease syndromes caused by these parasites are malaria, babesiosis and theileriosis. Strategies for control often target parasite stages in the mammalian host that cause disease, but this can result in reservoir infections that promote pathogen transmission and generate economic loss. Optimal control strategies should protect against clinical disease, block transmission and be applicable across related genera of parasites. We have used bioinformatics and transcriptomics to screen for transmission-blocking candidate antigens in the tick-borne apicomplexan parasite, Theileria annulata. A number of candidate antigen genes were identified which encoded amino acid domains that are conserved across vector-borne Apicomplexa (Babesia, Plasmodium and Theileria), including the Pfs48/45 6-cys domain and a novel cysteine-rich domain. Expression profiling confirmed that selected candidate genes are expressed by life cycle stages within infected ticks. Additionally, putative B cell epitopes were identified in the T. annulata gene sequences encoding the 6-cys and cysteine rich domains, in a gene encoding a putative papain-family cysteine peptidase, with similarity to the Plasmodium SERA family, and the gene encoding the T. annulata major merozoite/piroplasm surface antigen, Tams1. Candidate genes were identified that encode proteins with similarity to known transmission blocking candidates in related parasites, while one is a novel candidate conserved across vector-borne apicomplexans and has a potential role in the sexual phase of the life cycle. The results indicate that a 'One Health' approach could be utilised to develop a transmission-blocking strategy effective against vector-borne apicomplexan parasites of animals and humans.

MCM5: a new actor in the link between DNA replication and Meier-Gorlin syndrome.

PubMed

Vetro, Annalisa; Savasta, Salvatore; Russo Raucci, Annalisa; Cerqua, Cristina; Sartori, Geppo; Limongelli, Ivan; Forlino, Antonella; Maruelli, Silvia; Perucca, Paola; Vergani, Debora; Mazzini, Giuliano; Mattevi, Andrea; Stivala, Lucia Anna; Salviati, Leonardo; Zuffardi, Orsetta

2017-05-01

Meier-Gorlin syndrome (MGORS) is a rare disorder characterized by primordial dwarfism, microtia, and patellar aplasia/hypoplasia. Recessive mutations in ORC1, ORC4, ORC6, CDT1, CDC6, and CDC45, encoding members of the pre-replication (pre-RC) and pre-initiation (pre-IC) complexes, and heterozygous mutations in GMNN, a regulator of cell-cycle progression and DNA replication, have already been associated with this condition. We performed whole-exome sequencing (WES) in a patient with a clinical diagnosis of MGORS and identified biallelic variants in MCM5. This gene encodes a subunit of the replicative helicase complex, which represents a component of the pre-RC. Both variants, a missense substitution within a conserved domain critical for the helicase activity, and a single base deletion causing a frameshift and a premature stop codon, were predicted to be detrimental for the MCM5 function. Although variants of MCM5 have never been reported in specific human diseases, defect of this gene in zebrafish causes a phenotype of growth restriction overlapping the one associated with orc1 depletion. Complementation experiments in yeast showed that the plasmid carrying the missense variant was unable to rescue the lethal phenotype caused by mcm5 deletion. Moreover cell-cycle progression was delayed in patient's cells, as already shown for mutations in the ORC1 gene. Altogether our findings support the role of MCM5 as a novel gene involved in MGORS, further emphasizing that this condition is caused by impaired DNA replication.

Role of Viral miRNAs and Epigenetic Modifications in Epstein-Barr Virus-Associated Gastric Carcinogenesis.

PubMed

Giudice, Aldo; D'Arena, Giovanni; Crispo, Anna; Tecce, Mario Felice; Nocerino, Flavia; Grimaldi, Maria; Rotondo, Emanuela; D'Ursi, Anna Maria; Scrima, Mario; Galdiero, Massimiliano; Ciliberto, Gennaro; Capunzo, Mario; Franci, Gianluigi; Barbieri, Antonio; Bimonte, Sabrina; Montella, Maurizio

2016-01-01

MicroRNAs are short (21-23 nucleotides), noncoding RNAs that typically silence posttranscriptional gene expression through interaction with target messenger RNAs. Currently, miRNAs have been identified in almost all studied multicellular eukaryotes in the plant and animal kingdoms. Additionally, recent studies reported that miRNAs can also be encoded by certain single-cell eukaryotes and by viruses. The vast majority of viral miRNAs are encoded by the herpesviruses family. These DNA viruses including Epstein-Barr virus encode their own miRNAs and/or manipulate the expression of cellular miRNAs to facilitate respective infection cycles. Modulation of the control pathways of miRNAs expression is often involved in the promotion of tumorigenesis through a specific cascade of transduction signals. Notably, latent infection with Epstein-Barr virus is considered liable of causing several types of malignancies, including the majority of gastric carcinoma cases detected worldwide. In this review, we describe the role of the Epstein-Barr virus in gastric carcinogenesis, summarizing the functions of the Epstein-Barr virus-encoded viral proteins and related epigenetic alterations as well as the roles of Epstein-Barr virus-encoded and virally modulated cellular miRNAs.

A Genetically Encoded Probe for Live-Cell Imaging of H4K20 Monomethylation.

PubMed

Sato, Yuko; Kujirai, Tomoya; Arai, Ritsuko; Asakawa, Haruhiko; Ohtsuki, Chizuru; Horikoshi, Naoki; Yamagata, Kazuo; Ueda, Jun; Nagase, Takahiro; Haraguchi, Tokuko; Hiraoka, Yasushi; Kimura, Akatsuki; Kurumizaka, Hitoshi; Kimura, Hiroshi

2016-10-09

Eukaryotic gene expression is regulated in the context of chromatin. Dynamic changes in post-translational histone modification are thought to play key roles in fundamental cellular functions such as regulation of the cell cycle, development, and differentiation. To elucidate the relationship between histone modifications and cellular functions, it is important to monitor the dynamics of modifications in single living cells. A genetically encoded probe called mintbody (modification-specific intracellular antibody), which is a single-chain variable fragment tagged with a fluorescent protein, has been proposed as a useful visualization tool. However, the efficacy of intracellular expression of antibody fragments has been limited, in part due to different environmental conditions in the cytoplasm compared to the endoplasmic reticulum where secreted proteins such as antibodies are folded. In this study, we have developed a new mintbody specific for histone H4 Lys20 monomethylation (H4K20me1). The specificity of the H4K20me1-mintbody in living cells was verified using yeast mutants and mammalian cells in which this target modification was diminished. Expression of the H4K20me1-mintbody allowed us to monitor the oscillation of H4K20me1 levels during the cell cycle. Moreover, dosage-compensated X chromosomes were visualized using the H4K20me1-mintbody in mouse and nematode cells. Using X-ray crystallography and mutational analyses, we identified critical amino acids that contributed to stabilization and/or proper folding of the mintbody. Taken together, these data provide important implications for future studies aimed at developing functional intracellular antibodies. Specifically, the H4K20me1-mintbody provides a powerful tool to track this particular histone modification in living cells and organisms. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Regulation of leaf organ size by the Arabidopsis RPT2a 19S proteasome subunit.

PubMed

Sonoda, Yutaka; Sako, Kaori; Maki, Yuko; Yamazaki, Naoko; Yamamoto, Hiroko; Ikeda, Akira; Yamaguchi, Junji

2009-10-01

The ubiquitin/26S proteasome pathway plays a central role in the degradation of short-lived regulatory proteins, to control many cellular events. To further understand this pathway, we focused on the RPT2 subunit of the 26S proteasome regulatory particle. The Arabidopsis genome contains two genes, AtRPT2a and AtRPT2b, which encode paralog molecules of the RPT2 subunit, with a difference of only three amino acids in the protein sequences. Both genes showed similar mRNA accumulation patterns. However, the rpt2a mutant showed a specific phenotype of enlarged leaves caused by increased cell size, in correlation with increased ploidy. Detailed analyses revealed that cell expansion is increased in the rpt2a mutant by extended endoreduplication early in leaf development. The transcription of genes encoding cell cycle-related components, for DNA replication licensing and the G2/M phase, was also promoted in the rpt2a mutant, suggesting that extended endoreduplication was caused by increased DNA replication, and disrupted regulation of the G2/M checkpoint, at the proliferation stage of leaf development.

Chromosomal Arrangement of Phosphorelay Genes Couples Sporulation and DNA Replication.

PubMed

Narula, Jatin; Kuchina, Anna; Lee, Dong-Yeon D; Fujita, Masaya; Süel, Gürol M; Igoshin, Oleg A

2015-07-16

Genes encoding proteins in a common regulatory network are frequently located close to one another on the chromosome to facilitate co-regulation or couple gene expression to growth rate. Contrasting with these observations, here, we demonstrate a functional role for the arrangement of Bacillus subtilis sporulation network genes on opposite sides of the chromosome. We show that the arrangement of two sporulation network genes, one located close to the origin and the other close to the terminus, leads to a transient gene dosage imbalance during chromosome replication. This imbalance is detected by the sporulation network to produce cell-cycle coordinated pulses of the sporulation master regulator Spo0A∼P. This pulsed response allows cells to decide between sporulation and continued vegetative growth during each cell cycle spent in starvation. The simplicity of this coordination mechanism suggests that it may be widely applicable in a variety of gene regulatory and stress-response settings. VIDEO ABSTRACT. Copyright © 2015 Elsevier Inc. All rights reserved.

A Unique cis-Encoded Small Noncoding RNA Is Regulating Legionella pneumophila Hfq Expression in a Life Cycle-Dependent Manner.

PubMed

Oliva, Giulia; Sahr, Tobias; Rolando, Monica; Knoth, Maike; Buchrieser, Carmen

2017-01-10

Legionella pneumophila is an environmental bacterium that parasitizes protozoa, but it may also infect humans, thereby causing a severe pneumonia called Legionnaires' disease. To cycle between the environment and a eukaryotic host, L. pneumophila is regulating the expression of virulence factors in a life cycle-dependent manner: replicating bacteria do not express virulence factors, whereas transmissive bacteria are highly motile and infective. Here we show that Hfq is an important regulator in this network. Hfq is highly expressed in transmissive bacteria but is expressed at very low levels in replicating bacteria. A L. pneumophila hfq deletion mutant exhibits reduced abilities to infect and multiply in Acanthamoeba castellanii at environmental temperatures. The life cycle-dependent regulation of Hfq expression depends on a unique cis-encoded small RNA named Anti-hfq that is transcribed antisense of the hfq transcript and overlaps its 5' untranslated region. The Anti-hfq sRNA is highly expressed only in replicating L. pneumophila where it regulates hfq expression through binding to the complementary regions of the hfq transcripts. This results in reduced Hfq protein levels in exponentially growing cells. Both the small noncoding RNA (sRNA) and hfq mRNA are bound and stabilized by the Hfq protein, likely leading to the cleavage of the RNA duplex by the endoribonuclease RNase III. In contrast, after the switch to transmissive bacteria, the sRNA is not expressed, allowing now an efficient expression of the hfq gene and consequently Hfq. Our results place Hfq and its newly identified sRNA anti-hfq in the center of the regulatory network governing L. pneumophila differentiation from nonvirulent to virulent bacteria. The abilities of L. pneumophila to replicate intracellularly and to cause disease depend on its capacity to adapt to different extra- and intracellular environmental conditions. Therefore, a timely and fine-tuned expression of virulence factors and adaptation traits is crucial. Yet, the regulatory circuits governing the life cycle of L. pneumophila from replicating to virulent bacteria are only partly uncovered. Here we show that the life cycle-dependent regulation of the RNA chaperone Hfq relies on a small regulatory RNA encoded antisense to the hfq-encoding gene through a base pairing mechanism. Furthermore, Hfq regulates its own expression in an autoregulatory loop. The discovery of this RNA regulatory mechanism in L. pneumophila is an important step forward in the understanding of how the switch from inoffensive, replicating to highly virulent, transmissive L. pneumophila is regulated. Copyright © 2017 Oliva et al.

In silico gene expression analysis reveals glycolysis and acetate anaplerosis in IDH1 wild-type glioma and lactate and glutamate anaplerosis in IDH1-mutated glioma.

PubMed

Khurshed, Mohammed; Molenaar, Remco J; Lenting, Krissie; Leenders, William P; van Noorden, Cornelis J F

2017-07-25

Hotspot mutations in isocitrate dehydrogenase 1 (IDH1) initiate low-grade glioma and secondary glioblastoma and induce a neomorphic activity that converts α-ketoglutarate (α-KG) to the oncometabolite D-2-hydroxyglutarate (D-2-HG). It causes metabolic rewiring that is not fully understood. We investigated the effects of IDH1 mutations (IDH1MUT) on expression of genes that encode for metabolic enzymes by data mining The Cancer Genome Atlas. We analyzed 112 IDH1 wild-type (IDH1WT) versus 399 IDH1MUT low-grade glioma and 157 IDH1WT versus 9 IDH1MUT glioblastoma samples. In both glioma types, IDH1WT was associated with high expression levels of genes encoding enzymes that are involved in glycolysis and acetate anaplerosis, whereas IDH1MUT glioma overexpress genes encoding enzymes that are involved in the oxidative tricarboxylic acid (TCA) cycle. In vitro, we observed that IDH1MUT cancer cells have a higher basal respiration compared to IDH1WT cancer cells and inhibition of the IDH1MUT shifts the metabolism by decreasing oxygen consumption and increasing glycolysis. Our findings indicate that IDH1WT glioma have a typical Warburg phenotype whereas in IDH1MUT glioma the TCA cycle, rather than glycolytic lactate production, is the predominant metabolic pathway. Our data further suggest that the TCA in IDH1MUT glioma is driven by lactate and glutamate anaplerosis to facilitate production of α-KG, and ultimately D-2-HG. This metabolic rewiring may be a basis for novel therapies for IDH1MUT and IDH1WT glioma.

Chromatin reorganisation in Epstein-Barr virus-infected cells and its role in cancer development.

PubMed

West, Michelle J

2017-10-01

The oncogenic Epstein-Barr virus (EBV) growth transforms B cells and drives lymphoma and carcinoma development. The virus encodes four key transcription factors (EBNA2, EBNA3A, EBNA3B and EBNA3C) that hijack host cell factors to bind gene control elements and reprogramme infected B cells. These viral factors predominantly target long-range enhancers to alter the expression of host cell genes that control B cell growth and survival and facilitate virus persistence. Enhancer and super-enhancer binding by these EBNAs results in large-scale reorganisation of three-dimensional enhancer-promoter architecture to drive the overexpression of oncogenes, the silencing of tumour suppressors and the modulation of transcription, cell-cycle progression, migration and adhesion. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

ADP-ribosylation factor arf6p may function as a molecular switch of new end take off in fission yeast

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fujita, Atsushi

2008-02-01

Small GTPases act as molecular switches in a wide variety of cellular processes. In fission yeast Schizosaccharomyces pombe, the directions of cell growth change from a monopolar manner to a bipolar manner, which is known as 'New End Take Off' (NETO). Here I report the identification of a gene, arf6{sup +}, encoding an ADP-ribosylation factor small GTPase, that may be essential for NETO. arf6{delta} cells completely fail to undergo NETO. arf6p localizes at both cell ends and presumptive septa in a cell-cycle dependent manner. And its polarized localization is not dependent on microtubules, actin cytoskeletons and some NETO factors (bud6p,more » for3p, tea1p, tea3p, and tea4p). Notably, overexpression of a fast GDP/GTP-cycling mutant of arf6p can advance the timing of NETO. These findings suggest that arf6p functions as a molecular switch for the activation of NETO in fission yeast.« less

Histone H2A is required for normal centromere function in Saccharomyces cerevisiae

PubMed Central

Pinto, Inés; Winston, Fred

2000-01-01

Histones are structural and functional components of the eukaryotic chromosome, and their function is essential for normal cell cycle progression. In this work, we describe the characterization of two Saccharomyces cerevisiae cold-sensitive histone H2A mutants. Both mutants contain single amino acid replacements of residues predicted to be on the surface of the nucleosome and in close contact with DNA. We show that these H2A mutations cause an increase-in-ploidy phenotype, an increased rate of chromosome loss, and a defect in traversing the G2–M phase of the cell cycle. Moreover, these H2A mutations show genetic interactions with mutations in genes encoding kinetochore components. Finally, chromatin analysis of these H2A mutants has revealed an altered centromeric chromatin structure. Taken together, these results strongly suggest that histone H2A is required for proper centromere–kinetochore function during chromosome segregation. PMID:10747028

A gradient in the duration of the G1 phase in the murine neocortical proliferative epithelium

NASA Technical Reports Server (NTRS)

Miyama, S.; Takahashi, T.; Nowakowski, R. S.; Caviness, V. S. Jr

1997-01-01

Neuronogenesis in the neocortical pseudostratified ventricular epithelium (PVE) is initiated rostrolaterally and progresses caudo-medially as development progresses. Here we have measured the cytokinetic parameters and the fractional neuronal output parameter, Q, of laterally located early-maturing regions over the principal embryonic days (E12-E15) of neocortical neuronogenesis in the mouse. These measures are compared with ones previously made of a medial, late-maturing portion of the PVE. Laterally, as medially, the duration of the neuronogenetic interval is 6 days and comprises 11 integer cell cycles. Also, in both lateral and medial areas the length of G1 phase (TG1) increases nearly 4-fold and is the only cell cycle parameter to change. Q progresses essentially identically laterally and medially with respect to the succession of integer cell cycles. Most importantly, from E12 to E13 there is a steeply declining lateral to medial gradient in TG1. The gradient is due both to the lateral to medial graded stage of neuronogenesis and to the stepwise increase in TG1 with each integer cycle during the neuronogenetic interval. To our knowledge this gradient in TG1 of the cerebral PVE is the first cell biological gradient to be demonstrated experimentally in such an extensive proliferative epithelial sheet. We suggest that this gradient in TG1 is the cellular mechanism for positionally encoding a protomap of the neocortex within the PVE.

An sRNA and Cold Shock Protein Homolog-Based Feedforward Loop Post-transcriptionally Controls Cell Cycle Master Regulator CtrA

PubMed Central

Robledo, Marta; Schlüter, Jan-Philip; Loehr, Lars O.; Linne, Uwe; Albaum, Stefan P.; Jiménez-Zurdo, José I.; Becker, Anke

2018-01-01

Adjustment of cell cycle progression is crucial for bacterial survival and adaptation under adverse conditions. However, the understanding of modulation of cell cycle control in response to environmental changes is rather incomplete. In α-proteobacteria, the broadly conserved cell cycle master regulator CtrA underlies multiple levels of control, including coupling of cell cycle and cell differentiation. CtrA levels are known to be tightly controlled through diverse transcriptional and post-translational mechanisms. Here, small RNA (sRNA)-mediated post-transcriptional regulation is uncovered as an additional level of CtrA fine-tuning. Computational predictions as well as transcriptome and proteome studies consistently suggested targeting of ctrA and the putative cold shock chaperone cspA5 mRNAs by the trans-encoded sRNA (trans-sRNA) GspR (formerly SmelC775) in several Sinorhizobium species. GspR strongly accumulated in the stationary growth phase, especially in minimal medium (MM) cultures. Lack of the gspR locus confers a fitness disadvantage in competition with the wild type, while its overproduction hampers cell growth, suggesting that this riboregulator interferes with cell cycle progression. An eGFP-based reporter in vivo assay, involving wild-type and mutant sRNA and mRNA pairs, experimentally confirmed GspR-dependent post-transcriptional down-regulation of ctrA and cspA5 expression, which most likely occurs through base-pairing to the respective mRNA. The energetically favored secondary structure of GspR is predicted to comprise three stem-loop domains, with stem-loop 1 and stem-loop 3 targeting ctrA and cspA5 mRNA, respectively. Moreover, this work reports evidence for post-transcriptional control of ctrA by CspA5. Thus, this regulation and GspR-mediated post-transcriptional repression of ctrA and cspA5 expression constitute a coherent feed-forward loop, which may enhance the negative effect of GspR on CtrA levels. This novel regulatory circuit involving the riboregulator GspR, CtrA, and a cold shock chaperone may contribute to fine-tuning of ctrA expression. PMID:29740411

An sRNA and Cold Shock Protein Homolog-Based Feedforward Loop Post-transcriptionally Controls Cell Cycle Master Regulator CtrA.

PubMed

Robledo, Marta; Schlüter, Jan-Philip; Loehr, Lars O; Linne, Uwe; Albaum, Stefan P; Jiménez-Zurdo, José I; Becker, Anke

2018-01-01

Adjustment of cell cycle progression is crucial for bacterial survival and adaptation under adverse conditions. However, the understanding of modulation of cell cycle control in response to environmental changes is rather incomplete. In α-proteobacteria, the broadly conserved cell cycle master regulator CtrA underlies multiple levels of control, including coupling of cell cycle and cell differentiation. CtrA levels are known to be tightly controlled through diverse transcriptional and post-translational mechanisms. Here, small RNA (sRNA)-mediated post-transcriptional regulation is uncovered as an additional level of CtrA fine-tuning. Computational predictions as well as transcriptome and proteome studies consistently suggested targeting of ctrA and the putative cold shock chaperone cspA5 mRNAs by the trans- encoded sRNA ( trans- sRNA) GspR (formerly SmelC775) in several Sinorhizobium species. GspR strongly accumulated in the stationary growth phase, especially in minimal medium (MM) cultures. Lack of the gspR locus confers a fitness disadvantage in competition with the wild type, while its overproduction hampers cell growth, suggesting that this riboregulator interferes with cell cycle progression. An eGFP-based reporter in vivo assay, involving wild-type and mutant sRNA and mRNA pairs, experimentally confirmed GspR-dependent post-transcriptional down-regulation of ctrA and cspA5 expression, which most likely occurs through base-pairing to the respective mRNA. The energetically favored secondary structure of GspR is predicted to comprise three stem-loop domains, with stem-loop 1 and stem-loop 3 targeting ctrA and cspA5 mRNA, respectively. Moreover, this work reports evidence for post-transcriptional control of ctrA by CspA5. Thus, this regulation and GspR-mediated post-transcriptional repression of ctrA and cspA5 expression constitute a coherent feed-forward loop, which may enhance the negative effect of GspR on CtrA levels. This novel regulatory circuit involving the riboregulator GspR, CtrA, and a cold shock chaperone may contribute to fine-tuning of ctrA expression.

Cyclin-dependent kinase inhibitor Cdkn2c regulates B cell homeostasis and function in the NZM2410-derived murine lupus susceptibility locus Sle2c1

PubMed Central

Xu, Zhiwei; Potula, Hari-Hara SK; Vallurupalli, Anusha; Perry, Daniel; Baker, Henry; Croker, Byron P.; Dozmorov, Igor; Morel, Laurence

2013-01-01

Sle2c1 is an NZM2410 and NZB-derived lupus susceptibility locus that induces an expansion of the B1a cell compartment. B1a cells have a repertoire enriched for autoreactivity, and an expansion of this B cell subset occurs in several mouse models of lupus. A combination of genetic mapping and candidate gene analysis presents Cdkn2c, a gene encoding for cyclin-dependent kinase inhibitor p18INK4c (p18), as the top candidate gene for inducing the Slec2c1 associated expansion of B1a cells. A novel SNP in the NZB allele of the Cdkn2c promoter is associated with a significantly reduced Cdkn2c expression in the splenic B cells and Pc B1a cells from Sle2c1-carrying mice, which leads to a defective G1 cell cycle arrest in splenic B cells and increased proliferation of Pc B1a cells. As cell cycle is differentially regulated in B1a and B2 cells, these results suggest that Cdkn2c plays a critical role in B1a cell self-renewal, and that its impaired expression leads to an accumulation of these cells with high autoreactive potential. PMID:21543644

Distinct prophase arrest mechanisms in human male meiosis.

PubMed

Jan, Sabrina Z; Jongejan, Aldo; Korver, Cindy M; van Daalen, Saskia K M; van Pelt, Ans M M; Repping, Sjoerd; Hamer, Geert

2018-04-16

To prevent chromosomal aberrations being transmitted to the offspring, strict meiotic checkpoints are in place to remove aberrant spermatocytes. However, in about 1% of males these checkpoints cause complete meiotic arrest leading to azoospermia and subsequent infertility. Here, we unravel two clearly distinct meiotic arrest mechanisms that occur during prophase of human male meiosis. Type I arrested spermatocytes display severe asynapsis of the homologous chromosomes, disturbed XY-body formation and increased expression of the Y chromosome-encoded gene ZFY and seem to activate a DNA damage pathway leading to induction of p63, possibly causing spermatocyte apoptosis. Type II arrested spermatocytes display normal chromosome synapsis, normal XY-body morphology and meiotic crossover formation but have a lowered expression of several cell cycle regulating genes and fail to silence the X chromosome-encoded gene ZFX Discovery and understanding of these meiotic arrest mechanisms increases our knowledge of how genomic stability is guarded during human germ cell development. © 2018. Published by The Company of Biologists Ltd.

Epstein-Barr virus nuclear antigen 3C targets p53 and modulates its transcriptional and apoptotic activities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yi Fuming; Saha, Abhik; Murakami, Masanao

The p53 tumor suppressor gene is one of the most commonly mutated genes in human cancers and the corresponding encoded protein induces apoptosis or cell-cycle arrest at the G1/S checkpoint in response to DNA damage. To date, previous studies have shown that antigens encoded by human tumor viruses such as SV40 large T antigen, adenovirus E1A and HPV E6 interact with p53 and disrupt its functional activity. In a similar fashion, we now show that EBNA3C, one of the EBV latent antigens essential for the B-cell immortalization in vitro, interacts directly with p53. Additionally, we mapped the interaction of EBNA3Cmore » with p53 to the C-terminal DNA-binding and the tetramerization domain of p53, and the region of EBNA3C responsible for binding to p53 was mapped to the N-terminal domain of EBNA3C (residues 130-190), previously shown to interact with a number of important cell-cycle components, specifically SCF{sup Skp2}, cyclin A, and cMyc. Furthermore, we demonstrate that EBNA3C substantially represses the transcriptional activity of p53 in luciferase based reporter assays, and rescues apoptosis induced by ectopic p53 expression in SAOS-2 (p53{sup -/-}) cells. Interestingly, we also show that the DNA-binding ability of p53 is diminished in the presence of EBNA3C. Thus, the interaction between the p53 and EBNA3C provides new insights into the mechanism(s) by which the EBNA3C oncoprotein can alter cellular gene expression in EBV associated human cancers.« less

Screening the yeast genome for energetic metabolism pathways involved in a phenotypic response to the anti-cancer agent 3-bromopyruvate.

PubMed

Lis, Paweł; Jurkiewicz, Paweł; Cal-Bąkowska, Magdalena; Ko, Young H; Pedersen, Peter L; Goffeau, Andre; Ułaszewski, Stanisław

2016-03-01

In this study the detailed characteristic of the anti-cancer agent 3-bromopyruvate (3-BP) activity in the yeast Saccharomyces cerevisiae model is described, with the emphasis on its influence on energetic metabolism of the cell. It shows that 3-BP toxicity in yeast is strain-dependent and influenced by the glucose-repression system. Its toxic effect is mainly due to the rapid depletion of intracellular ATP. Moreover, lack of the Whi2p phosphatase results in strongly increased sensitivity of yeast cells to 3-BP, possibly due to the non-functional system of mitophagy of damaged mitochondria through the Ras-cAMP-PKA pathway. Single deletions of genes encoding glycolytic enzymes, the TCA cycle enzymes and mitochondrial carriers result in multiple effects after 3-BP treatment. However, it can be concluded that activity of the pentose phosphate pathway is necessary to prevent the toxicity of 3-BP, probably due to the fact that large amounts of NADPH are produced by this pathway, ensuring the reducing force needed for glutathione reduction, crucial to cope with the oxidative stress. Moreover, single deletions of genes encoding the TCA cycle enzymes and mitochondrial carriers generally cause sensitivity to 3-BP, while totally inactive mitochondrial respiration in the rho0 mutant resulted in increased resistance to 3-BP.

Screening the yeast genome for energetic metabolism pathways involved in a phenotypic response to the anti-cancer agent 3-bromopyruvate

PubMed Central

Lis, Paweł; Jurkiewicz, Paweł; Cal-Bąkowska, Magdalena; Ko, Young H.; Pedersen, Peter L.; Goffeau, Andre; Ułaszewski, Stanisław

2016-01-01

In this study the detailed characteristic of the anti-cancer agent 3-bromopyruvate (3-BP) activity in the yeast Saccharomyces cerevisiae model is described, with the emphasis on its influence on energetic metabolism of the cell. It shows that 3-BP toxicity in yeast is strain-dependent and influenced by the glucose-repression system. Its toxic effect is mainly due to the rapid depletion of intracellular ATP. Moreover, lack of the Whi2p phosphatase results in strongly increased sensitivity of yeast cells to 3-BP, possibly due to the non-functional system of mitophagy of damaged mitochondria through the Ras-cAMP-PKA pathway. Single deletions of genes encoding glycolytic enzymes, the TCA cycle enzymes and mitochondrial carriers result in multiple effects after 3-BP treatment. However, it can be concluded that activity of the pentose phosphate pathway is necessary to prevent the toxicity of 3-BP, probably due to the fact that large amounts of NADPH are produced by this pathway, ensuring the reducing force needed for glutathione reduction, crucial to cope with the oxidative stress. Moreover, single deletions of genes encoding the TCA cycle enzymes and mitochondrial carriers generally cause sensitivity to 3-BP, while totally inactive mitochondrial respiration in the rho0 mutant resulted in increased resistance to 3-BP. PMID:26862728

Periodic expression of nuclear and mitochondrial DNA replication genes during the trypanosomatid cell cycle.

PubMed

Pasion, S G; Brown, G W; Brown, L M; Ray, D S

1994-12-01

In trypanosomatids, DNA replication in the nucleus and in the single mitochondrion (or kinetoplast) initiates nearly simultaneously, suggesting that the DNA synthesis (S) phases of the nucleus and the mitochondrion are coordinately regulated. To investigate the basis for the temporal link between nuclear and mitochondrial DNA synthesis phases the expression of the genes encoding DNA ligase I, the 51 and 28 kDa subunits of replication protein A, dihydrofolate reductase and the mitochondrial type II topoisomerase were analyzed during the cell cycle progression of synchronous cultures of Crithidia fasciculata. These DNA replication genes were all expressed periodically, with peak mRNA levels occurring just prior to or at the peak of DNA synthesis in the synchronized cultures. A plasmid clone (pdN-1) in which TOP2, the gene encoding the mitochondrial topoisomerase, was disrupted by the insertion of a NEO drug-resistance cassette was found to express both a truncated TOP2 mRNA and a truncated topoisomerase polypeptide. The truncated mRNA was also expressed periodically coordinate with the expression of the endogenous TOP2 mRNA indicating that cis elements necessary for periodic expression are contained within cloned sequences. The expression of both TOP2 and nuclear DNA replication genes at the G1/S boundary suggests that regulated expression of these genes may play a role in coordinating nuclear and mitochondrial S phases in trypanosomatids.

Cloning and characterization of a cell cycle-regulated gene encoding topoisomerase I from Nicotiana tabacum that is inducible by light, low temperature and abscisic acid.

PubMed

Mudgil, Y; Singh, B N; Upadhyaya, K C; Sopory, S K; Reddy, M K

2002-05-01

We have cloned a full-length 2874-bp cDNA coding for tobacco topoisomerase I, with an ORF of 2559 bp encoding a protein of 852 amino acids with a calculated molecular mass of 95 kDa and an estimated pI of 9.51. The deduced amino acid sequence shows homology to other eukaryotic topoisomerases I. Tobacco topoisomerase I was over-expressed in Escherichia coli, and the purified recombinant protein was found to relax both positively and negatively super-coiled DNA in the absence of the divalent cation Mg(2+)and ATP. These characteristic features indicate that the tobacco enzyme is a type I topoisomerase. The recombinant protein could be phosphorylated at (a) threonine residue(s) by protein kinase C. However, phosphorylation did not cause any change in its enzymatic activity. The genomic organization of the topoisomerase I gene revealed the presence of 8 exons and 7 introns in the region corresponding to the ORF and one intron in the 3' UTR region. Transcript analysis using RT-PCR showed basal constitutive expression in all organs examined, and the gene was expressed at all stages of the cell cycle--but the level of expression increased during the G1-S phase. The transcript level also increased following exposure to light, low-temperature stress and abscisic acid, a stress hormone.

Live-Cell Imaging of Filoviruses.

PubMed

Schudt, Gordian; Dolnik, Olga; Becker, Stephan

2017-01-01

Observation of molecular processes inside living cells is fundamental to a deeper understanding of virus-host interactions in filoviral-infected cells. These observations can provide spatiotemporal insights into protein synthesis, protein-protein interaction dynamics, and transport processes of these highly pathogenic viruses. Thus, live-cell imaging provides the possibility for antiviral screening in real time and gives mechanistic insights into understanding filovirus assembly steps that are dependent on cellular factors, which then represent potential targets against this highly fatal disease. Here we describe analysis of living filovirus-infected cells under maximum biosafety (i.e., BSL4) conditions using plasmid-driven expression of fluorescently labeled viral and cellular proteins and/or viral genome-encoded expression of fluorescently labeled proteins. Such multiple-color and multidimensional time-lapse live-cell imaging analyses are a powerful method to gain a better understanding of the filovirus infection cycle.

Megakaryocyte polyploidization is associated with decreased expression of polo-like kinase (PLK).

PubMed

Yagi, M; Roth, G J

2006-09-01

During differentiation, megakaryocytes (MK), the bone marrow precursors of circulating blood platelets, undergo polyploidization, repeated rounds of DNA replication without cell division. Mature normal MK may contain a DNA content of up to 128N, in contrast to normal diploid (2N) cells. The extent of polyploidy may influence the number of platelets produced by the MK. Therefore, understanding the molecular mechanisms regulating polyploidization could identify events involved in controlling both cell division and thrombopoiesis. We investigated the expression of several proteins involved in mitosis in cultured mouse MK, and tested the effect of expression on polyploidization. Western blot and immunofluorescent analyses were used to assess expression of cell cycle proteins in cultured MK. Populations of polyploidizing MK were separated on the basis of DNA content by flow cytometry. The gene encoding mouse polo-like kinase 1 (PLK-1) was introduced into MK by retroviral transduction, and its effects measured by flow cytometry. Polyploid mouse MK expressed lower levels of two proteins, p55CDC and PLK-1, whose activity is necessary for cell cycle progression and completion of mitosis. Comparison of sorted 2N/4N and polyploid MK indicated that PLK-1 expression was absent in polyploid MK, while expression of other cell cycle proteins was similar in both populations. Forced expression of PLK-1 during MK differentiation was associated with decreased polyploidization. These experiments suggest that PLK-1 is an important regulator of polyploidization in differentiating MK.

The proliferation marker pKi-67 organizes the nucleolus during the cell cycle depending on Ran and cyclin B.

PubMed

Schmidt, Mirko H H; Broll, Rainer; Bruch, Hans-Peter; Bögler, Oliver; Duchrow, Michael

2003-01-01

The proliferation marker pKi-67 ('Ki-67 antigen') is commonly used in clinical and research pathology to detect proliferating cells, as it is only expressed during cell-cycle progression. Despite the fact that this antigen has been known for nearly two decades, there is still no adequate understanding of its function. This study has therefore identified proteins that interact with pKi-67, using a yeast two-hybrid system. A mammalian two-hybrid system and immunoprecipitation studies were used to verify these interactions. Among other cell-cycle regulatory proteins, two binding partners associated with the small GTPase Ran were identified. In addition, DNA-structural and nucleolus-associated proteins binding to pKi-67 were found. Moreover, it was demonstrated that the N-terminal domain of pKi-67 is capable of self-binding to its own repeat region encoded by exon 13. Since RanBP, a protein involved in the transport of macromolecules over the nuclear lamina, was found to be a binding partner, a possible effect of pKi-67 on the localization of cell-cycle regulatory proteins was proposed. To test this hypothesis, a tetracycline-responsive gene expression system was used to induce the pKi-67 fragments previously used for the two-hybrid screens in HeLa cells. Subsequent immunostaining revealed the translocation of cyclin B1 from cytoplasm to nucleoli in response to this expression. It is suggested that pKi-67 is a Ran-associated protein with a role in the disintegration and reformation of the nucleolus and thereby in entry into and exit from the M-phase. Copyright 2002 John Wiley & Sons, Ltd.

Expression patterns of genes encoding plasma membrane aquaporins during fruit development in cucumber (Cucumis sativus L.).

PubMed

Shi, Jin; Wang, Jinfang; Li, Ren; Li, Dianbo; Xu, Fengfeng; Sun, Qianqian; Zhao, Bin; Mao, Ai-Jun; Guo, Yang-Dong

2015-11-01

Aquaporins are membrane channels precisely regulating water movement through cell membranes in most living organisms. Despite the advances in the physiology of fruit development, their participation during fruit development in cucumber still barely understood. In this paper, the expressions of 12 genes encoding plasma membrane intrinsic proteins (PIPs) were analyzed during cucumber fruit development in our work. Based on the homology search with known PIPs from rice, Arabidopsis and strawberry, 12 cucumber PIP genes subfamily members were identified. Cellular localization assays indicated that CsPIPs were localized in the plasma membrane. The qRT-PCR analysis of CsPIPs showed that 12 CsPIPs were differentially expressed during fruit development. These results suggest that 12 genes encoding plasma membrane intrinsic proteins (CsPIPs) play very important roles in cucumber life cycle and the data generated will be helpful in understanding their precise roles during fruit development in cucumber. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

The Us3 Protein of Herpes Simplex Virus 1 Inhibits T Cell Signaling by Confining Linker for Activation of T Cells (LAT) Activation via TRAF6 Protein*

PubMed Central

Yang, Yin; Wu, Songfang; Wang, Yu; Pan, Shuang; Lan, Bei; Liu, Yaohui; Zhang, Liming; Leng, Qianli; Chen, Da; Zhang, Cuizhu; He, Bin; Cao, Youjia

2015-01-01

Herpes simplex virus 1 (HSV-1) is the most prevalent human virus and causes global morbidity because the virus is able to infect multiple cell types. Remarkably, HSV infection switches between lytic and latent cycles, where T cells play a critical role. However, the precise way of virus-host interactions is incompletely understood. Here we report that HSV-1 productively infected Jurkat T-cells and inhibited antigen-induced T cell receptor activation. We discovered that HSV-1-encoded Us3 protein interrupted TCR signaling and interleukin-2 production by inactivation of the linker for activation of T cells. This study unveils a mechanism by which HSV-1 intrudes into early events of TCR-mediated cell signaling and may provide novel insights into HSV infection, during which the virus escapes from host immune surveillance. PMID:25907557

Targeting survivin as a potential new treatment for chondrosarcoma of bone

PubMed Central

de Jong, Y; van Oosterwijk, J G; Kruisselbrink, A B; Briaire-de Bruijn, I H; Agrogiannis, G; Baranski, Z; Cleven, A H G; Cleton-Jansen, A-M; van de Water, B; Danen, E H J; Bovée, J V M G

2016-01-01

Chondrosarcomas are malignant cartilage-forming bone tumors, which are intrinsically resistant to chemo- and radiotherapy, leaving surgical removal as the only curative treatment option. Therefore, our aim was to identify genes involved in chondrosarcoma cell survival that could serve as a target for therapy. siRNA screening for 51 apoptosis-related genes in JJ012 chondrosarcoma cells identified BIRC5, encoding survivin, as essential for chondrosarcoma survival. Using immunohistochemistry, nuclear as well as cytoplasmic survivin expression was analyzed in 207 chondrosarcomas of different subtypes. Nuclear survivin has been implicated in cell-cycle regulation while cytoplasmic localization is important for its anti-apoptotic function. RT–PCR was performed to determine expression of the most common survivin isoforms. Sensitivity to YM155, a survivin inhibitor currently in phase I/II clinical trial for other tumors, was examined in 10 chondrosarcoma cell lines using viability assay, apoptosis assay and cell-cycle analysis. Survivin expression was found in all chondrosarcoma patient samples. Higher expression of nuclear and cytoplasmic survivin was observed with increasing histological grade in central chondrosarcomas. Inhibition of survivin using YM155 showed that especially TP53 mutant cell lines were sensitive, but no caspase 3/7 or PARP cleavage was observed. Rather, YM155 treatment resulted in a block in S phase in two out of three chondrosarcoma cell lines, indicating that survivin is more involved in cell-cycle regulation than in apoptosis. Thus, survivin is important for chondrosarcoma survival and chondrosarcoma patients might benefit from survivin inhibition using YM155, for which TP53 mutational status can serve as a predictive biomarker. PMID:27159675

Cadmium inhibits the protein degradation of Sml1 by inhibiting the phosphorylation of Sml1 in Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baek, In-Joon; Kang, Hyun-Jun; Chang, Miwha

Highlights: Black-Right-Pointing-Pointer Cd inhibits Sml1-p formation. Black-Right-Pointing-Pointer Cd affects cell cycle. Black-Right-Pointing-Pointer Cd inhibits Sml1 ubiquitination. -- Abstract: Cadmium is a toxic metal, and the mechanism of cadmium toxicity in living organisms has been well studied. Here, we used Saccharomyces cerevisiae as a model system to examine the detailed molecular mechanism of cell growth defects caused by cadmium. Using a plate assay of a yeast deletion mutant collection, we found that deletion of SML1, which encodes an inhibitor of Rnr1, resulted in cadmium resistance. Sml1 protein levels increased when cells were treated with cadmium, even though the mRNA levels ofmore » SML1 remained unchanged. Using northern and western blot analyses, we found that cadmium inhibited Sml1 degradation by inhibiting Sml1 phosphorylation. Sml1 protein levels increased when cells were treated with cadmium due to disruption of the dependent protein degradation pathway. Furthermore, cadmium promoted cell cycle progression into the G2 phase. The same result was obtained using cells in which SML1 was overexpressed. Deletion of SML1 delayed cell cycle progression. These results are consistent with Sml1 accumulation and with growth defects caused by cadmium stress. Interestingly, although cadmium treatment led to increase Sml1 levels, intracellular dNTP levels also increased because of Rnr3 upregulation due to cadmium stress. Taken together, these results suggest that cadmium specifically affects the phosphorylation of Sml1 and that Sml1 accumulates in cells.« less

Does the entorhinal cortex use the Fourier transform?

PubMed Central

Orchard, Jeff; Yang, Hao; Ji, Xiang

2013-01-01

Some neurons in the entorhinal cortex (EC) fire bursts when the animal occupies locations organized in a hexagonal grid pattern in their spatial environment. Place cells have also been observed, firing bursts only when the animal occupies a particular region of the environment. Both of these types of cells exhibit theta-cycle modulation, firing bursts in the 4–12 Hz range. Grid cells fire bursts of action potentials that precess with respect to the theta cycle, a phenomenon dubbed “theta precession.” Various models have been proposed to explain these phenomena, and how they relate to navigation. Among the most promising are the oscillator interference models. The bank-of-oscillators model proposed by Welday et al. (2011) exhibits all these features. However, their simulations are based on theoretical oscillators, and not implemented entirely with spiking neurons. We extend their work in a number of ways. First, we place the oscillators in a frequency domain and reformulate the model in terms of Fourier theory. Second, this perspective suggests a division of labor for implementing spatial maps: position vs. map layout. The animal's position is encoded in the phases of the oscillators, while the spatial map shape is encoded implicitly in the weights of the connections between the oscillators and the read-out nodes. Third, it reveals that the oscillator phases all need to conform to a linear relationship across the frequency domain. Fourth, we implement a partial model of the EC using spiking leaky integrate-and-fire (LIF) neurons. Fifth, we devise new coupling mechanisms, enlightened by the global phase constraint, and show they are capable of keeping spiking neural oscillators in consistent formation. Our model demonstrates place cells, grid cells, and phase precession. The Fourier model also gives direction for future investigations, such as integrating sensory feedback to combat drift, or explaining why grid cells exist at all. PMID:24376415

NF-κB controls four genes encoding core enzymes of tricarboxylic acid cycle.

PubMed

Zhou, Fei; Xu, Xinhui; Wu, Jian; Wang, Danyang; Wang, Jinke

2017-07-20

NF-κB may promote tumor progression by altering cell metabolism. Hence, finding its target genes that are involved in cell metabolism is helpful for understanding its role in tumor growth. Here we discovered four metabolism-related target genes of this transcription factor. By analyzing a chromatin immunoprecipitation followed by deep sequencing (ChIP-Seq) data that characterizing the global binding sites (BSs) of NF-κB RelA in the TNFα-stimulated HeLa cells, we found that four genes that encode core enzymes of the tricarboxylic acid (TCA) cycle, including IDH1, IDH3A, ACO2, and SUCLA2, were multiply bound by this transcription factor. The subsequent bioinformatic analysis revealed that the NF-κB BSs contained many canonical κB sequences and the NF-κB-like DNA-binding motifs. Detection of ChIPed DNA with polymerase chain reaction (ChIP-PCR) also indicated that the NF-κB BSs were bound by NF-κB in both TNFα-treated HeLa and HepG2 cells. The reporter construct showed that the NF-κB BSs could activate the luciferase expression in cells in a NF-κB-specific manner. The quantitative PCR and Western blot detections demonstrated that NF-κB could regulate the expressions of IDH1, IDH3A, and ACO2 genes at both mRNA and protein levels and that of SUCLA2 gene at mRNA level in the TNFα-treated HeLa and HepG2 cells. Based on these investigations we identified the four genes as new target genes of NF-κB. The finding provides new insights into the role of NF-κB in cellular energetic metabolism, which may be beneficial for understanding the metabolic physiology of tumor growth. Copyright © 2017. Published by Elsevier B.V.

SPK1 is an essential S-phase-specific gene of Saccharomyces cerevisiae that encodes a nuclear serine/threonine/tyrosine kinase.

PubMed

Zheng, P; Fay, D S; Burton, J; Xiao, H; Pinkham, J L; Stern, D F

1993-09-01

SPK1 was originally discovered in an immunoscreen for tyrosine-protein kinases in Saccharomyces cerevisiae. We have used biochemical and genetic techniques to investigate the function of this gene and its encoded protein. Hybridization of an SPK1 probe to an ordered genomic library showed that SPK1 is adjacent to PEP4 (chromosome XVI L). Sporulation of spk1/+ heterozygotes gave rise to spk1 spores that grew into microcolonies but could not be further propagated. These colonies were greatly enriched for budded cells, especially those with large buds. Similarly, eviction of CEN plasmids bearing SPK1 from cells with a chromosomal SPK1 disruption yielded viable cells with only low frequency. Spk1 protein was identified by immunoprecipitation and immunoblotting. It was associated with protein-Ser, Thr, and Tyr kinase activity in immune complex kinase assays. Spk1 was localized to the nucleus by immunofluorescence. The nucleotide sequence of the SPK1 5' noncoding region revealed that SPK1 contains two MluI cell cycle box elements. These elements confer S-phase-specific transcription to many genes involved in DNA synthesis. Northern (RNA) blotting of synchronized cells verified that the SPK1 transcript is coregulated with other MluI box-regulated genes. The SPK1 upstream region also includes a domain highly homologous to sequences involved in induction of RAD2 and other excision repair genes by agents that induce DNA damage. spk1 strains were hypersensitive to UV irradiation. Taken together, these findings indicate that SPK1 is a dual-specificity (Ser/Thr and Tyr) protein kinase that is essential for viability. The cell cycle-dependent transcription, presence of DNA damage-related sequences, requirement for UV resistance, and nuclear localization of Spk1 all link this gene to a crucial S-phase-specific role, probably as a positive regulator of DNA synthesis.

Rapid Titration of Measles and Other Viruses: Optimization with Determination of Replication Cycle Length

PubMed Central

Grigorov, Boyan; Rabilloud, Jessica; Lawrence, Philip; Gerlier, Denis

2011-01-01

Background Measles virus (MV) is a member of the Paramyxoviridae family and an important human pathogen causing strong immunosuppression in affected individuals and a considerable number of deaths worldwide. Currently, measles is a re-emerging disease in developed countries. MV is usually quantified in infectious units as determined by limiting dilution and counting of plaque forming unit either directly (PFU method) or indirectly from random distribution in microwells (TCID50 method). Both methods are time-consuming (up to several days), cumbersome and, in the case of the PFU assay, possibly operator dependent. Methods/Findings A rapid, optimized, accurate, and reliable technique for titration of measles virus was developed based on the detection of virus infected cells by flow cytometry, single round of infection and titer calculation according to the Poisson's law. The kinetics follow up of the number of infected cells after infection with serial dilutions of a virus allowed estimation of the duration of the replication cycle, and consequently, the optimal infection time. The assay was set up to quantify measles virus, vesicular stomatitis virus (VSV), and human immunodeficiency virus type 1 (HIV-1) using antibody labeling of viral glycoprotein, virus encoded fluorescent reporter protein and an inducible fluorescent-reporter cell line, respectively. Conclusion Overall, performing the assay takes only 24–30 hours for MV strains, 12 hours for VSV, and 52 hours for HIV-1. The step-by-step procedure we have set up can be, in principle, applicable to accurately quantify any virus including lentiviral vectors, provided that a virus encoded gene product can be detected by flow cytometry. PMID:21915289

Reverse Genetics System Demonstrates that Rotavirus Nonstructural Protein NSP6 Is Not Essential for Viral Replication in Cell Culture.

PubMed

Komoto, Satoshi; Kanai, Yuta; Fukuda, Saori; Kugita, Masanori; Kawagishi, Takahiro; Ito, Naoto; Sugiyama, Makoto; Matsuura, Yoshiharu; Kobayashi, Takeshi; Taniguchi, Koki

2017-11-01

The use of overlapping open reading frames (ORFs) to synthesize more than one unique protein from a single mRNA has been described for several viruses. Segment 11 of the rotavirus genome encodes two nonstructural proteins, NSP5 and NSP6. The NSP6 ORF is present in the vast majority of rotavirus strains, and therefore the NSP6 protein would be expected to have a function in viral replication. However, there is no direct evidence of its function or requirement in the viral replication cycle yet. Here, taking advantage of a recently established plasmid-only-based reverse genetics system that allows rescue of recombinant rotaviruses entirely from cloned cDNAs, we generated NSP6-deficient viruses to directly address its significance in the viral replication cycle. Viable recombinant NSP6-deficient viruses could be engineered. Single-step growth curves and plaque formation of the NSP6-deficient viruses confirmed that NSP6 expression is of limited significance for RVA replication in cell culture, although the NSP6 protein seemed to promote efficient virus growth. IMPORTANCE Rotavirus is one of the most important pathogens of severe diarrhea in young children worldwide. The rotavirus genome, consisting of 11 segments of double-stranded RNA, encodes six structural proteins (VP1 to VP4, VP6, and VP7) and six nonstructural proteins (NSP1 to NSP6). Although specific functions have been ascribed to each of the 12 viral proteins, the role of NSP6 in the viral replication cycle remains unknown. In this study, we demonstrated that the NSP6 protein is not essential for viral replication in cell culture by using a recently developed plasmid-only-based reverse genetics system. This reverse genetics approach will be successfully applied to answer questions of great interest regarding the roles of rotaviral proteins in replication and pathogenicity, which can hardly be addressed by conventional approaches. Copyright © 2017 American Society for Microbiology.

Single-cell sequencing of Thiomargarita reveals genomic flexibility for adaptation to dynamic redox conditions

DOE PAGES

Winkel, Matthias; Salman-Carvalho, Verena; Woyke, Tanja; ...

2016-06-21

Large, colorless sulfur-oxidizing bacteria (LSB) of the family Beggiatoaceae form thick mats at sulfidic sediment surfaces, where they efficiently detoxify sulfide before it enters the water column. The genus Thiomargarita harbors the largest known free-living bacteria with cell sizes of up to 750 μm in diameter. In addition to their ability to oxidize reduced sulfur compounds, some Thiornargarita spp. are known to store large amounts of nitrate, phosphate and elemental sulfur internally. To date little is known about their energy yielding metabolic pathways, and how these pathways compare to other Beggiatoaceae. Here, we present a draft single-cell genome of amore » chain-forming " Candidatus Thiomargarita nelsonii Thio36", and conduct a comparative analysis to five draft and one full genome of other members of the Beggiatoaceae. " Ca. T. nelsonii Thio36" is able to respire nitrate to both ammonium and dinitrogen, which allows them to flexibly respond to environmental changes. Genes for sulfur oxidation and inorganic carbon fixation confirmed that " Ca. T. nelsonii Thio36" can function as a chemolithoautotroph. Carbon can be fixed via the Calvin-Benson-Bassham cycle, which is common among the Beggiatoaceae. In addition we found key genes of the reductive tricarboxylic acid cycle that point toward an alternative CO 2 fixation pathway. Surprisingly, " Ca. T. nelsonii Thio36" also encodes key genes of the C2-cycle that convert 2-phosphoglycolate to 3-phosphoglycerate during photorespiration in higher plants and cyanobacteria. Moreover, we identified a novel trait of a flavin-based energy bifurcation pathway coupled to a Na +-translocating membrane complex (Rnf). The coupling of these pathways may be key to surviving long periods of anoxia. As other Beggiatoaceae " Ca. T. nelsonii Thio36" encodes many genes similar to those of (filamentous) cyanobacteria. In conclusion, the genome of " Ca. T. nelsonii Thio36" provides additional insight into the ecology of giant sulfur-oxidizing bacteria, and reveals unique genomic features for the Thiomargarita lineage within the Beggiatoaceae.« less

CDK4/6 or MAPK blockade enhances efficacy of EGFR inhibition in oesophageal squamous cell carcinoma.

PubMed

Zhou, Jin; Wu, Zhong; Wong, Gabrielle; Pectasides, Eirini; Nagaraja, Ankur; Stachler, Matthew; Zhang, Haikuo; Chen, Ting; Zhang, Haisheng; Liu, Jie Bin; Xu, Xinsen; Sicinska, Ewa; Sanchez-Vega, Francisco; Rustgi, Anil K; Diehl, J Alan; Wong, Kwok-Kin; Bass, Adam J

2017-01-06

Oesophageal squamous cell carcinoma is a deadly disease where systemic therapy has relied upon empiric chemotherapy despite the presence of genomic alterations pointing to candidate therapeutic targets, including recurrent amplification of the gene encoding receptor tyrosine kinase epidermal growth factor receptor (EGFR). Here, we demonstrate that EGFR-targeting small-molecule inhibitors have efficacy in EGFR-amplified oesophageal squamous cell carcinoma (ESCC), but may become quickly ineffective. Resistance can occur following the emergence of epithelial-mesenchymal transition and by reactivation of the mitogen-activated protein kinase (MAPK) pathway following EGFR blockade. We demonstrate that blockade of this rebound activation with MEK (mitogen-activated protein kinase kinase) inhibition enhances EGFR inhibitor-induced apoptosis and cell cycle arrest, and delays resistance to EGFR monotherapy. Furthermore, genomic profiling shows that cell cycle regulators are altered in the majority of EGFR-amplified tumours and a combination of cyclin-dependent kinase 4/6 (CDK4/6) and EGFR inhibitors prevents the emergence of resistance in vitro and in vivo. These data suggest that upfront combination strategies targeting EGFR amplification, guided by adaptive pathway reactivation or by co-occurring genomic alterations, should be tested clinically.

Stimulation of the cell cycle and maize transformation by disruption of the plant retinoblastoma pathway

PubMed Central

Gordon-Kamm, William; Dilkes, Brian P.; Lowe, Keith; Hoerster, George; Sun, Xifan; Ross, Margit; Church, Laura; Bunde, Chris; Farrell, Jeff; Hill, Patrea; Maddock, Sheila; Snyder, Jane; Sykes, Louisa; Li, Zhongsen; Woo, Young-min; Bidney, Dennis; Larkins, Brian A.

2002-01-01

The genome of the Mastreviruses encodes a replication-associated protein (RepA) that interacts with members of the plant retinoblastoma-related protein family, which are putative cell cycle regulators. Expression of ZmRb1, a maize retinoblastoma-related gene, and RepA inhibited and stimulated, respectively, cell division in tobacco cell cultures. The effect of RepA was mitigated by over-expression of ZmRb1. RepA increased transformation frequency and callus growth rate of high type II maize germplasm. RepA-containing transgenic maize calli remained embryogenic, were readily regenerable, and produced fertile plants that transmitted transgene expression in a Mendelian fashion. In high type II, transformation frequency increased with the strength of the promoter driving RepA expression. When a construct in which RepA was expressed behind its native LIR promoter was used, primary transformation frequencies did not improve for two elite Pioneer maize inbreds. However, when LIR:RepA-containing transgenic embryos were used in subsequent rounds of transformation, frequencies were higher in the RepA+ embryos. These data demonstrate that RepA can stimulate cell division and callus growth in culture, and improve maize transformation. PMID:12185243

Epigenomic Reprogramming of Adult Cardiomyocyte-Derived Cardiac Progenitor Cells

PubMed Central

Zhang, Yiqiang; Zhong, Jiang F; Qiu, Hongyu; Robb MacLellan, W.; Marbán, Eduardo; Wang, Charles

2015-01-01

It has been believed that mammalian adult cardiomyocytes (ACMs) are terminally-differentiated and are unable to proliferate. Recently, using a bi-transgenic ACM fate mapping mouse model and an in vitro culture system, we demonstrated that adult mouse cardiomyocytes were able to dedifferentiate into cardiac progenitor-like cells (CPCs). However, little is known about the molecular basis of their intrinsic cellular plasticity. Here we integrate single-cell transcriptome and whole-genome DNA methylation analyses to unravel the molecular mechanisms underlying the dedifferentiation and cell cycle reentry of mouse ACMs. Compared to parental cardiomyocytes, dedifferentiated mouse cardiomyocyte-derived CPCs (mCPCs) display epigenomic reprogramming with many differentially-methylated regions, both hypermethylated and hypomethylated, across the entire genome. Correlated well with the methylome, our transcriptomic data showed that the genes encoding cardiac structure and function proteins are remarkably down-regulated in mCPCs, while those for cell cycle, proliferation, and stemness are significantly up-regulated. In addition, implantation of mCPCs into infarcted mouse myocardium improves cardiac function with augmented left ventricular ejection fraction. Our study demonstrates that the cellular plasticity of mammalian cardiomyocytes is the result of a well-orchestrated epigenomic reprogramming and a subsequent global transcriptomic alteration. PMID:26657817

The Endocrine Dyscrasia that Accompanies Menopause and Andropause Induces Aberrant Cell Cycle Signaling that Triggers Cell Cycle Reentry of Post-mitotic Neurons, Neurodysfunction, Neurodegeneration and Cognitive Disease

PubMed Central

Atwood, Craig S.; Bowen, Richard L.

2016-01-01

Sex hormones are the physiological factors that regulate neurogenesis during embryogenesis and continuing through adulthood. These hormones support the formation of brain structures such as dendritic spines, axons and synapses required for the capture of information (memories). Intriguingly, a recent animal study has demonstrated that induction of neurogenesis results in the loss of previously encoded memories in animals (e.g. infantile amnesia). In this connection, much evidence now indicates that Alzheimer’s disease (AD) also involves aberrant re-entry of post-mitotic neurons into the cell cycle. Cell cycle abnormalities appear very early in the disease, prior to the appearance of plaques and tangles, and explain the biochemical, neuropathological and cognitive changes observed with disease progression. Since sex hormones control when and how neurons proliferate and differentiate, the endocrine dyscrasia that accompanies menopause and andropause is a key signaling event that impacts neurogenesis and the acquisition, processing, storage and recall of memories. Here we review the biochemical, epidemiological and clinical evidence that alterations in endocrine signaling with menopause and andropause drive the aberrant re-entry of post-mitotic neurons into an abortive cell cycle with neurite retraction that leads to neuron dysfunction and death. When the reproductive axis is in balance, luteinizing hormone (LH), and its fetal homolog, human chorionic gonadotropin (hCG), promote pluripotent human and totipotent murine embryonic stem cell and neuron proliferation. However, strong evidence supports menopausal/andropausal elevations in the ratio of LH:sex steroids as driving aberrant mitotic events mediated by the upregulation of tumor necrosis factor, amyloid-β precursor protein processing towards the production of mitogenic Aβ, and the activation of Cdk5, a key regulator of cell cycle progression and tau phosphorylation (a cardinal feature of both neurogenesis and neurodegeneration). Cognitive studies also demonstrate the negative consequences of a high LH:sex steroid ratio on human cognitive performance. Prospective epidemiological and clinical evidence in humans supports lowering the ratio of circulating gonadotropins-GnRH to sex steroids in reducing the incidence of AD and halting cognitive decline. Together, these data support endocrine dyscrasia and the subsequent loss of cell cycle control as an important etiological event in the development of neurodegenerative diseases including AD, stroke and Parkinson’s disease. PMID:26188949

[Intercellular communication-based robust circadian oscillation of the suprachiasmatic nucleus in the brain: mechanisms beyond intracellular clock machinery].

PubMed

Doi, Masao

2013-12-01

Recent advances in circadian biology strongly suggest that there are still genes involved in the generation and maintenance of biological rhythms that remain to be identified. It has been generally appreciated that circadian rhythms are generated intracellularly through transcription/translation-based autoregulatory feedback circuits of the clock genes. However, the existence of new intracellular clock machinery that cannot be explained by existing clock genes has recently been reported. This clock manifests as oxidation-reduction cycles of peroxiredoxin proteins, implying that as-yet-undiscovered clock genes may exist within cells to regulate redox cycling. Moreover, great strides have also been made in understanding the cell-cell communication-based robust circadian oscillations of the suprachiasmatic nucleus (SCN), the central pacemaker in the brain. Thousands of neurons that constitute the SCN maintain a high degree of synchrony in a way that allows the SCN neurons to create coherent signals as a whole. Inactivation of the genes involved in the cell-cell synchronization of the SCN, which include the genes encoding VIP, VPAC2, and RGS16, leads to altered circadian rhythms in behavior and physiologies. The purpose of this review is to provide an overview of recent advances in the circadian biology, with a special emphasis on the importance of cell-cell interactions within the SCN.

Hippocampal awake replay in fear memory retrieval

PubMed Central

Wu, Chun-Ting; Haggerty, Daniel; Kemere, Caleb; Ji, Daoyun

2017-01-01

Hippocampal place cells are key to episodic memories. How these cells participate in memory retrieval remains unclear. Here, after rats acquired a fear memory by receiving mild foot-shocks at a shock zone of a track, we analyzed place cells when the animals were placed back to the track and displayed an apparent memory retrieval behavior: avoidance of the shock zone. We found that place cells representing the shock zone were reactivated, despite the fact that the animals did not enter the shock zone. This reactivation occurred in ripple-associated awake replay of place cell sequences encoding the paths from the animal’s current positions to the shock zone, but not in place cell sequences within individual cycles of theta oscillation. The result reveals a specific place cell pattern underlying the inhibitory avoidance behavior and provides strong evidence for the involvement of awake replay in fear memory retrieval. PMID:28218916

The Caulobacter crescentus phage phiCbK: genomics of a canonical phage

PubMed Central

2012-01-01

Background The bacterium Caulobacter crescentus is a popular model for the study of cell cycle regulation and senescence. The large prolate siphophage phiCbK has been an important tool in C. crescentus biology, and has been studied in its own right as a model for viral morphogenesis. Although a system of some interest, to date little genomic information is available on phiCbK or its relatives. Results Five novel phiCbK-like C. crescentus bacteriophages, CcrMagneto, CcrSwift, CcrKarma, CcrRogue and CcrColossus, were isolated from the environment. The genomes of phage phiCbK and these five environmental phage isolates were obtained by 454 pyrosequencing. The phiCbK-like phage genomes range in size from 205 kb encoding 318 proteins (phiCbK) to 280 kb encoding 448 proteins (CcrColossus), and were found to contain nonpermuted terminal redundancies of 10 to 17 kb. A novel method of terminal ligation was developed to map genomic termini, which confirmed termini predicted by coverage analysis. This suggests that sequence coverage discontinuities may be useable as predictors of genomic termini in phage genomes. Genomic modules encoding virion morphogenesis, lysis and DNA replication proteins were identified. The phiCbK-like phages were also found to encode a number of intriguing proteins; all contain a clearly T7-like DNA polymerase, and five of the six encode a possible homolog of the C. crescentus cell cycle regulator GcrA, which may allow the phage to alter the host cell’s replicative state. The structural proteome of phage phiCbK was determined, identifying the portal, major and minor capsid proteins, the tail tape measure and possible tail fiber proteins. All six phage genomes are clearly related; phiCbK, CcrMagneto, CcrSwift, CcrKarma and CcrRogue form a group related at the DNA level, while CcrColossus is more diverged but retains significant similarity at the protein level. Conclusions Due to their lack of any apparent relationship to other described phages, this group is proposed as the founding cohort of a new phage type, the phiCbK-like phages. This work will serve as a foundation for future studies on morphogenesis, infection and phage-host interactions in C. crescentus. PMID:23050599

Draft genome sequence of Actinotignum schaalii DSM 15541T: Genetic insights into the lifestyle, cell fitness and virulence.

PubMed

Yassin, Atteyet F; Langenberg, Stefan; Huntemann, Marcel; Clum, Alicia; Pillay, Manoj; Palaniappan, Krishnaveni; Varghese, Neha; Mikhailova, Natalia; Mukherjee, Supratim; Reddy, T B K; Daum, Chris; Shapiro, Nicole; Ivanova, Natalia; Woyke, Tanja; Kyrpides, Nikos C

2017-01-01

The permanent draft genome sequence of Actinotignum schaalii DSM 15541T is presented. The annotated genome includes 2,130,987 bp, with 1777 protein-coding and 58 rRNA-coding genes. Genome sequence analysis revealed absence of genes encoding for: components of the PTS systems, enzymes of the TCA cycle, glyoxylate shunt and gluconeogensis. Genomic data revealed that A. schaalii is able to oxidize carbohydrates via glycolysis, the nonoxidative pentose phosphate and the Entner-Doudoroff pathways. Besides, the genome harbors genes encoding for enzymes involved in the conversion of pyruvate to lactate, acetate and ethanol, which are found to be the end products of carbohydrate fermentation. The genome contained the gene encoding Type I fatty acid synthase required for de novo FAS biosynthesis. The plsY and plsX genes encoding the acyltransferases necessary for phosphatidic acid biosynthesis were absent from the genome. The genome harbors genes encoding enzymes responsible for isoprene biosynthesis via the mevalonate (MVA) pathway. Genes encoding enzymes that confer resistance to reactive oxygen species (ROS) were identified. In addition, A. schaalii harbors genes that protect the genome against viral infections. These include restriction-modification (RM) systems, type II toxin-antitoxin (TA), CRISPR-Cas and abortive infection system. A. schaalii genome also encodes several virulence factors that contribute to adhesion and internalization of this pathogen such as the tad genes encoding proteins required for pili assembly, the nanI gene encoding exo-alpha-sialidase, genes encoding heat shock proteins and genes encoding type VII secretion system. These features are consistent with anaerobic and pathogenic lifestyles. Finally, resistance to ciprofloxacin occurs by mutation in chromosomal genes that encode the subunits of DNA-gyrase (GyrA) and topisomerase IV (ParC) enzymes, while resistant to metronidazole was due to the frxA gene, which encodes NADPH-flavin oxidoreductase.

A family of ParA-like ATPases promotes cell pole maturation by facilitating polar localization of chemotaxis proteins

PubMed Central

Ringgaard, Simon; Schirner, Kathrin; Davis, Brigid M.; Waldor, Matthew K.

2011-01-01

Stochastic processes are thought to mediate localization of membrane-associated chemotaxis signaling clusters in peritrichous bacteria. Here, we identified a new family of ParA-like ATPases (designated ParC [for partitioning chemotaxis]) encoded within chemotaxis operons of many polar-flagellated γ-proteobacteria that actively promote polar localization of chemotaxis proteins. In Vibrio cholerae, a single ParC focus is found at the flagellated old pole in newborn cells, and later bipolar ParC foci develop as the cell matures. The cell cycle-dependent redistribution of ParC occurs by its release from the old pole and subsequent relocalization at the new pole, consistent with a “diffusion and capture” model for ParC dynamics. Chemotaxis proteins encoded in the same cluster as ParC have a similar unipolar-to-bipolar transition; however, they reach the new pole after the arrival of ParC. Cells lacking ParC exhibit aberrantly localized foci of chemotaxis proteins, reduced chemotaxis, and altered motility, which likely accounts for their enhanced colonization of the proximal small intestine in an animal model of cholera. Collectively, our findings indicate that ParC promotes the efficiency of chemotactic signaling processes. In particular, ParC-facilitated development of a functional chemotaxis apparatus at the new pole readies this site for its development into a functional old pole after cell division. PMID:21764856

Regulation of xylose metabolism in recombinant Saccharomyces cerevisiae

PubMed Central

Salusjärvi, Laura; Kankainen, Matti; Soliymani, Rabah; Pitkänen, Juha-Pekka; Penttilä, Merja; Ruohonen, Laura

2008-01-01

Background Considerable interest in the bioconversion of lignocellulosic biomass into ethanol has led to metabolic engineering of Saccharomyces cerevisiae for fermentation of xylose. In the present study, the transcriptome and proteome of recombinant, xylose-utilising S. cerevisiae grown in aerobic batch cultures on xylose were compared with those of glucose-grown cells both in glucose repressed and derepressed states. The aim was to study at the genome-wide level how signalling and carbon catabolite repression differ in cells grown on either glucose or xylose. The more detailed knowledge whether xylose is sensed as a fermentable carbon source, capable of catabolite repression like glucose, or is rather recognised as a non-fermentable carbon source is important for further engineering this yeast for more efficient anaerobic fermentation of xylose. Results Genes encoding respiratory proteins, proteins of the tricarboxylic acid and glyoxylate cycles, and gluconeogenesis were only partially repressed by xylose, similar to the genes encoding their transcriptional regulators HAP4, CAT8 and SIP1-2 and 4. Several genes that are repressed via the Snf1p/Mig1p-pathway during growth on glucose had higher expression in the cells grown on xylose than in the glucose repressed cells but lower than in the glucose derepressed cells. The observed expression profiles of the transcription repressor RGT1 and its target genes HXT2-3, encoding hexose transporters suggested that extracellular xylose was sensed by the glucose sensors Rgt2p and Snf3p. Proteome analyses revealed distinct patterns in phosphorylation of hexokinase 2, glucokinase and enolase isoenzymes in the xylose- and glucose-grown cells. Conclusion The results indicate that the metabolism of yeast growing on xylose corresponds neither to that of fully glucose repressed cells nor that of derepressed cells. This may be one of the major reasons for the suboptimal fermentation of xylose by recombinant S. cerevisiae strains. Phosphorylation of different isoforms of glycolytic enzymes suggests that regulation of glycolysis also occurred at a post-translational level, supporting prior findings. PMID:18533012

Live or let die: manipulation of cellular suicide programs by murine cytomegalovirus.

PubMed

Handke, Wiebke; Krause, Eva; Brune, Wolfram

2012-11-01

Cytomegaloviruses (CMVs) are large double-stranded DNA viruses that replicate slowly and cause life-long persisting infections in their hosts. To achieve this, the CMVs had to evolve numerous countermeasures against innate and adaptive immune responses. Induction of programmed cell death is one important host defense mechanism against intracellular pathogens such as viruses. For a multicellular organism, it is advantageous to let infected cells die in order to thwart viral replication and dissemination. For a virus, by contrast, it is better to inhibit cell death and keep infected cells alive until the viral replication cycle has been completed. As a matter of fact, the CMVs encode a number of proteins devoted to interfering with different forms of programmed cell death: apoptosis and necroptosis. In this review, we summarize the known functions of the four best characterized cell death inhibitors of murine cytomegalovirus (MCMV), which are encoded by open reading frames, M36, m38.5, m41.1, and M45. The viral proteins interact with key molecules within different cell death pathways, namely caspase-8, Bax, Bak, and RIP1/RIP3. In addition, we discuss which events during MCMV infection might trigger apoptosis or necrosis and how MCMV's countermeasures compare to those of other herpesviruses. Since both, MCMV and its natural host, are amenable to genetic manipulation, the mouse model for CMV infection provides a particularly suitable system to study mechanisms of cell death induction and inhibition.

Mapping methyl jasmonate-mediated transcriptional reprogramming of metabolism and cell cycle progression in cultured Arabidopsis cells

PubMed Central

Pauwels, Laurens; Morreel, Kris; De Witte, Emilie; Lammertyn, Freya; Van Montagu, Marc; Boerjan, Wout; Inzé, Dirk; Goossens, Alain

2008-01-01

Jasmonates (JAs) are plant-specific signaling molecules that steer a diverse set of physiological and developmental processes. Pathogen attack and wounding inflicted by herbivores induce the biosynthesis of these hormones, triggering defense responses both locally and systemically. We report on alterations in the transcriptome of a fast-dividing cell culture of the model plant Arabidopsis thaliana after exogenous application of methyl JA (MeJA). Early MeJA response genes encoded the JA biosynthesis pathway proteins and key regulators of MeJA responses, including most JA ZIM domain proteins and MYC2, together with transcriptional regulators with potential, but yet unknown, functions in MeJA signaling. In a second transcriptional wave, MeJA reprogrammed cellular metabolism and cell cycle progression. Up-regulation of the monolignol biosynthesis gene set resulted in an increased production of monolignols and oligolignols, the building blocks of lignin. Simultaneously, MeJA repressed activation of M-phase genes, arresting the cell cycle in G2. MeJA-responsive transcription factors were screened for their involvement in early signaling events, in particular the regulation of JA biosynthesis. Parallel screens based on yeast one-hybrid and transient transactivation assays identified both positive (MYC2 and the AP2/ERF factor ORA47) and negative (the C2H2 Zn finger proteins STZ/ZAT10 and AZF2) regulators, revealing a complex control of the JA autoregulatory loop and possibly other MeJA-mediated downstream processes. PMID:18216250

Mobilization of LINE-1 retrotransposons is restricted by Tex19.1 in mouse embryonic stem cells

PubMed Central

MacLennan, Marie; García-Cañadas, Marta; Reichmann, Judith; Khazina, Elena; Wagner, Gabriele; Playfoot, Christopher J; Salvador-Palomeque, Carmen; Mann, Abigail R; Peressini, Paula; Sanchez, Laura; Dobie, Karen; Read, David; Hung, Chao-Chun; Eskeland, Ragnhild; Meehan, Richard R; Weichenrieder, Oliver; García-Pérez, Jose Luis; Adams, Ian R

2017-01-01

Mobilization of retrotransposons to new genomic locations is a significant driver of mammalian genome evolution, but these mutagenic events can also cause genetic disorders. In humans, retrotransposon mobilization is mediated primarily by proteins encoded by LINE-1 (L1) retrotransposons, which mobilize in pluripotent cells early in development. Here we show that TEX19.1, which is induced by developmentally programmed DNA hypomethylation, can directly interact with the L1-encoded protein L1-ORF1p, stimulate its polyubiquitylation and degradation, and restrict L1 mobilization. We also show that TEX19.1 likely acts, at least in part, through promoting the activity of the E3 ubiquitin ligase UBR2 towards L1-ORF1p. Moreover, loss of Tex19.1 increases L1-ORF1p levels and L1 mobilization in pluripotent mouse embryonic stem cells, implying that Tex19.1 prevents de novo retrotransposition in the pluripotent phase of the germline cycle. These data show that post-translational regulation of L1 retrotransposons plays a key role in maintaining trans-generational genome stability in mammals. DOI: http://dx.doi.org/10.7554/eLife.26152.001 PMID:28806172

Potential role for a B-catenin coactivator (high mobility group AT-hook 1 protein) during the latency-reactivation cycle of bovine herpesverus 1

USDA-ARS?s Scientific Manuscript database

The latency-related (LR)-RNA encoded by bovine herpes virus 1 (BoHV-1) is abundantly expressed in latently infected sensory neurons. Although the LR gene encodes several products, ORF2 appears to play a dominant role during the latency-reactivation cycle because a mutant virus containing stop codons...

Origins of correlated spiking in the mammalian olfactory bulb

PubMed Central

Gerkin, Richard C.; Tripathy, Shreejoy J.; Urban, Nathaniel N.

2013-01-01

Mitral/tufted (M/T) cells of the main olfactory bulb transmit odorant information to higher brain structures. The relative timing of action potentials across M/T cells has been proposed to encode this information and to be critical for the activation of downstream neurons. Using ensemble recordings from the mouse olfactory bulb in vivo, we measured how correlations between cells are shaped by stimulus (odor) identity, common respiratory drive, and other cells’ activity. The shared respiration cycle is the largest source of correlated firing, but even after accounting for all observable factors a residual positive noise correlation was observed. Noise correlation was maximal on a ∼100-ms timescale and was seen only in cells separated by <200 µm. This correlation is explained primarily by common activity in groups of nearby cells. Thus, M/T-cell correlation principally reflects respiratory modulation and sparse, local network connectivity, with odor identity accounting for a minor component. PMID:24082089

Adaptive and Qualitative Changes in Encoding Strategy With Experience: Evidence From the Test-Expectancy Paradigm

PubMed Central

Finley, Jason R.; Benjamin, Aaron S.

2012-01-01

Three experiments demonstrated learners’ abilities to adaptively and qualitatively accommodate their encoding strategies to the demands of an upcoming test. Stimuli were word pairs. In Experiment 1, test expectancy was induced for either cued recall (of targets given cues) or free recall (of targets only) across 4 study–test cycles of the same test format, followed by a final critical cycle featuring either the expected or the unexpected test format. For final tests of both cued and free recall, participants who had expected that test format outperformed those who had not. This disordinal interaction, supported by recognition and self-report data, demonstrated not mere differences in effort based on anticipated test difficulty, but rather qualitative and appropriate differences in encoding strategies based on expected task demands. Participants also came to appropriately modulate metacognitive monitoring (Experiment 2) and study-time allocation (Experiment 3) across study–test cycles. Item and associative recognition performance, as well as self-report data, revealed shifts in encoding strategies across trials; these results were used to characterize and evaluate the different strategies that participants employed for cued versus free recall and to assess the optimality of participants’ metacognitive control of encoding strategies. Taken together, these data illustrate a sophisticated form of metacognitive control, in which learners qualitatively shift encoding strategies to match the demands of anticipated tests. PMID:22103783

Translational Upregulation of an Individual p21Cip1 Transcript Variant by GCN2 Regulates Cell Proliferation and Survival under Nutrient Stress

PubMed Central

Lehman, Stacey L.; Cerniglia, George J.; Johannes, Gregg J.; Ye, Jiangbin; Ryeom, Sandra; Koumenis, Constantinos

2015-01-01

Multiple transcripts encode for the cell cycle inhibitor p21Cip1. These transcripts produce identical proteins but differ in their 5’ untranslated regions (UTRs). Although several stresses that induce p21 have been characterized, the mechanisms regulating the individual transcript variants and their functional significance are unknown. Here we demonstrate through 35S labeling, luciferase reporter assays, and polysome transcript profiling that activation of the Integrated Stress Response (ISR) kinase GCN2 selectively upregulates the translation of a p21 transcript variant containing 5’ upstream open reading frames (uORFs) through phosphorylation of the eukaryotic translation initiation factor eIF2α. Mutational analysis reveals that the uORFs suppress translation under basal conditions, but promote translation under stress. Functionally, ablation of p21 ameliorates G1/S arrest and reduces cell survival in response to GCN2 activation. These findings uncover a novel mechanism of p21 post-transcriptional regulation, offer functional significance for the existence of multiple p21 transcripts, and support a key role for GCN2 in regulating the cell cycle under stress. PMID:26102367

Unexpected Function of the Glucanosyltransferase Gas1 in the DNA Damage Response Linked to Histone H3 Acetyltransferases in Saccharomyces cerevisiae

PubMed Central

Eustice, Moriah; Pillus, Lorraine

2014-01-01

Chromatin organization and structure are crucial for transcriptional regulation, DNA replication, and damage repair. Although initially characterized in remodeling cell wall glucans, the β-1,3-glucanosyltransferase Gas1 was recently discovered to regulate transcriptional silencing in a manner separable from its activity at the cell wall. However, the function of Gas1 in modulating chromatin remains largely unexplored. Our genetic characterization revealed that GAS1 had critical interactions with genes encoding the histone H3 lysine acetyltransferases Gcn5 and Sas3. Specifically, whereas the gas1gcn5 double mutant was synthetically lethal, deletion of both GAS1 and SAS3 restored silencing in Saccharomyces cerevisiae. The loss of GAS1 also led to broad DNA damage sensitivity with reduced Rad53 phosphorylation and defective cell cycle checkpoint activation following exposure to select genotoxins. Deletion of SAS3 in the gas1 background restored both Rad53 phosphorylation and checkpoint activation following exposure to genotoxins that trigger the DNA replication checkpoint. Our analysis thus uncovers previously unsuspected functions for both Gas1 and Sas3 in DNA damage response and cell cycle regulation. PMID:24532730

Molecular Characterization of Plant Ubiquitin-Conjugating Enzymes Belonging to the UbcP4/E2-C/UBCx/UbcH10 Gene Family1

PubMed Central

Criqui, Marie Claire; de Almeida Engler, Janice; Camasses, Alain; Capron, Arnaud; Parmentier, Yves; Inzé, Dirk; Genschik, Pascal

2002-01-01

The anaphase promoting complex or cyclosome is the ubiquitin-ligase that targets destruction box-containing proteins for proteolysis during the cell cycle. Anaphase promoting complex or cyclosome and its activator (the fizzy and fizzy-related) proteins work together with ubiquitin-conjugating enzymes (UBCs) (E2s). One class of E2s (called E2-C) seems specifically involved in cyclin B1 degradation. Although it has recently been shown that mammalian E2-C is regulated at the protein level during the cell cycle, not much is known concerning the expression of these genes. Arabidopsis encodes two genes belonging to the E2-C gene family (called UBC19 and UBC20). We found that UBC19 is able to complement fission yeast (Schizosaccharomyces pombe) UbcP4-140 mutant, indicating that the plant protein can functionally replace its yeast ortholog for protein degradation during mitosis. In situ hybridization experiments were performed to study the expression of the E2-C genes in various tissues of plants. Their transcripts were always, but not exclusively, found in tissues active for cell division. Thus, the UBC19/20 E2s may have a key function during cell cycle, but may also be involved in ubiquitylation reactions occurring during differentiation and/or in differentiated cells. Finally, we showed that a translational fusion protein between UBC19 and green fluorescent protein localized both in the cytosol and the nucleus in stable transformed tobacco (Nicotiana tabacum cv Bright Yellow 2) cells. PMID:12427990

Mitochondrial Regulation of Cell Cycle and Proliferation

PubMed Central

Antico Arciuch, Valeria Gabriela; Elguero, María Eugenia; Poderoso, Juan José

2012-01-01

Abstract Eukaryotic mitochondria resulted from symbiotic incorporation of α-proteobacteria into ancient archaea species. During evolution, mitochondria lost most of the prokaryotic bacterial genes and only conserved a small fraction including those encoding 13 proteins of the respiratory chain. In this process, many functions were transferred to the host cells, but mitochondria gained a central role in the regulation of cell proliferation and apoptosis, and in the modulation of metabolism; accordingly, defective organelles contribute to cell transformation and cancer, diabetes, and neurodegenerative diseases. Most cell and transcriptional effects of mitochondria depend on the modulation of respiratory rate and on the production of hydrogen peroxide released into the cytosol. The mitochondrial oxidative rate has to remain depressed for cell proliferation; even in the presence of O2, energy is preferentially obtained from increased glycolysis (Warburg effect). In response to stress signals, traffic of pro- and antiapoptotic mitochondrial proteins in the intermembrane space (B-cell lymphoma-extra large, Bcl-2-associated death promoter, Bcl-2 associated X-protein and cytochrome c) is modulated by the redox condition determined by mitochondrial O2 utilization and mitochondrial nitric oxide metabolism. In this article, we highlight the traffic of the different canonical signaling pathways to mitochondria and the contributions of organelles to redox regulation of kinases. Finally, we analyze the dynamics of the mitochondrial population in cell cycle and apoptosis. Antioxid. Redox Signal. 16, 1150–1180. PMID:21967640

Genetic structure of the mating-type locus of Chlamydomonas reinhardtii.

PubMed Central

Ferris, Patrick J; Armbrust, E Virginia; Goodenough, Ursula W

2002-01-01

Portions of the cloned mating-type (MT) loci (mt(+) and mt(-)) of Chlamydomonas reinhardtii, defined as the approximately 1-Mb domains of linkage group VI that are under recombinational suppression, were subjected to Northern analysis to elucidate their coding capacity. The four central rearranged segments of the loci were found to contain both housekeeping genes (expressed during several life-cycle stages) and mating-related genes, while the sequences unique to mt(+) or mt(-) carried genes expressed only in the gametic or zygotic phases of the life cycle. One of these genes, Mtd1, is a candidate participant in gametic cell fusion; two others, Mta1 and Ezy2, are candidate participants in the uniparental inheritance of chloroplast DNA. The identified housekeeping genes include Pdk, encoding pyruvate dehydrogenase kinase, and GdcH, encoding glycine decarboxylase complex subunit H. Unusual genetic configurations include three genes whose sequences overlap, one gene that has inserted into the coding region of another, several genes that have been inactivated by rearrangements in the region, and genes that have undergone tandem duplication. This report extends our original conclusion that the MT locus has incurred high levels of mutational change. PMID:11805055

Reprogramming One-Carbon Metabolic Pathways To Decouple l-Serine Catabolism from Cell Growth in Corynebacterium glutamicum.

PubMed

Zhang, Yun; Shang, Xiuling; Lai, Shujuan; Zhang, Yu; Hu, Qitiao; Chai, Xin; Wang, Bo; Liu, Shuwen; Wen, Tingyi

2018-02-16

l-Serine, the principal one-carbon source for DNA biosynthesis, is difficult for microorganisms to accumulate due to the coupling of l-serine catabolism and microbial growth. Here, we reprogrammed the one-carbon unit metabolic pathways in Corynebacterium glutamicum to decouple l-serine catabolism from cell growth. In silico model-based simulation showed a negative influence on glyA-encoding serine hydroxymethyltransferase flux with l-serine productivity. Attenuation of glyA transcription resulted in increased l-serine accumulation, and a decrease in purine pools, poor growth and longer cell shapes. The gcvTHP-encoded glycine cleavage (Gcv) system from Escherichia coli was introduced into C. glutamicum, allowing glycine-derived 13 CH 2 to be assimilated into intracellular purine synthesis, which resulted in an increased amount of one-carbon units. Gcv introduction not only restored cell viability and morphology but also increased l-serine accumulation. Moreover, comparative proteomic analysis indicated that abundance changes of the enzymes involved in one-carbon unit cycles might be responsible for maintaining one-carbon unit homeostasis. Reprogramming of the one-carbon metabolic pathways allowed cells to reach a comparable growth rate to accumulate 13.21 g/L l-serine by fed-batch fermentation in minimal medium. This novel strategy provides new insights into the regulation of cellular properties and essential metabolite accumulation by introducing an extrinsic pathway.

Determination of the transforming activities of adenovirus oncogenes.

PubMed

Speiseder, Thomas; Nevels, Michael; Dobner, Thomas

2014-01-01

The last 50 years of molecular biological investigations into human adenoviruses (Ads) have contributed enormously to our understanding of the basic principles of normal and malignant cell growth. Much of this knowledge stems from analyses of the Ad productive infection cycle in permissive host cells. Also, initial observations concerning the transforming potential of human Ads subsequently revealed decisive insights into the molecular mechanisms of the origins of cancer and established Ads as a model system for explaining virus-mediated transformation processes. Today it is well established that cell transformation by human Ads is a multistep process involving several gene products encoded in early transcription units 1A (E1A) and 1B (E1B). Moreover, a large body of evidence now indicates that alternative or additional mechanisms are engaged in Ad-mediated oncogenic transformation involving gene products encoded in early region 4 (E4) as well as epigenetic changes resulting from viral DNA integration. In particular, studies on the transforming potential of several E4 gene products have now revealed new pathways that point to novel general mechanisms of virus-mediated oncogenesis. In this chapter we describe in vitro and in vivo assays to determine the transforming and oncogenic activities of the E1A, E1B, and E4 oncoproteins in primary baby rat kidney cells, human amniotic fluid cells and athymic nude mice.

Purification of full-length VP22 from cells infected with HSV-1: A two-pronged approach for the solubilization and purification of viral proteins for use in biochemical studies

PubMed Central

Dewberry, Ebony J.; Dunkerley, Eric; Duffy, Carol

2012-01-01

Summary VP22, encoded by the UL49 gene, is one of the most abundant proteins of the herpes simplex virus type 1 (HSV-1) tegument and has been shown to be important for virus replication and spread. However, the exact role(s) played by VP22 in the HSV-1 replication cycle have yet to be delineated. The lack of a procedure to purify full-length VP22 has limited molecular studies on VP22 function. A procedure was developed for the purification of soluble, full-length VP22 from cells infected with HSV-1. A recombinant virus encoding His-tagged VP22 was generated and found to express VP22 at levels comparable to the wild type virus upon infection of Vero cells. By experimenting with a wide variety of cell lysis buffer conditions, several buffers that promote the solubility of full-length VP22 were identified. Buffers that gave the highest levels of solubility were then used in immobilized metal ion affinity chromatography experiments to identify conditions that provided the greatest level of VP22 binding and recovery from cobalt and nickel affinity resins. Using this strategy soluble, full-length VP22 was purified from cells infected with HSV-1. PMID:22569534

Expansion of Genes Encoding piRNA-Associated Argonaute Proteins in the Pea Aphid: Diversification of Expression Profiles in Different Plastic Morphs

PubMed Central

Lu, Hsiao-ling; Tanguy, Sylvie; Rispe, Claude; Gauthier, Jean-Pierre; Walsh, Tom; Gordon, Karl; Edwards, Owain; Tagu, Denis; Chang, Chun-che; Jaubert-Possamai, Stéphanie

2011-01-01

Piwi-interacting RNAs (piRNAs) are known to regulate transposon activity in germ cells of several animal models that propagate sexually. However, the role of piRNAs during asexual reproduction remains almost unknown. Aphids that can alternate sexual and asexual reproduction cycles in response to seasonal changes of photoperiod provide a unique opportunity to study piRNAs and the piRNA pathway in both reproductive modes. Taking advantage of the recently sequenced genome of the pea aphid Acyrthosiphon pisum, we found an unusually large lineage-specific expansion of genes encoding the Piwi sub-clade of Argonaute proteins. In situ hybridisation showed differential expressions between the duplicated piwi copies: while Api-piwi2 and Api-piwi6 are “specialised” in germ cells their most closely related copy, respectively Api-piwi5 and Api-piwi3, are expressed in the somatic cells. The differential expression was also identified in duplicated ago3: Api-ago3a in germ cells and Api-ago3b in somatic cells. Moreover, analyses of expression profiles of the expanded piwi and ago3 genes by semi-quantitative RT-PCR showed that expressions varied according to the reproductive types. These specific expression patterns suggest that expanded aphid piwi and ago3 genes have distinct roles in asexual and sexual reproduction. PMID:22162754

Oil Bodies and Oleosins in Physcomitrella Possess Characteristics Representative of Early Trends in Evolution1[W][OA

PubMed Central

Huang, Chien-Yu; Chung, Chun-I; Lin, Yao-Cheng; Hsing, Yue-Ie Caroline; Huang, Anthony H.C.

2009-01-01

Searches of sequenced genomes of diverse organisms revealed that the moss Physcomitrella patens is the most primitive organism possessing oleosin genes. Microscopy examination of Physcomitrella revealed that oil bodies (OBs) were abundant in the photosynthetic vegetative gametophyte and the reproductive spore. Chromatography illustrated the neutral lipids in OBs isolated from the gametophyte to be largely steryl esters and triacylglycerols, and SDS-PAGE showed the major proteins to be oleosins. Reverse transcription-PCR revealed the expression of all three oleosin genes to be tissue specific. This tissue specificity was greatly altered via alternative splicing, a control mechanism of oleosin gene expression unknown in higher plants. During the production of sex organs at the tips of gametophyte branches, the number of OBs in the top gametophyte tissue decreased concomitant with increases in the number of peroxisomes and level of transcripts encoding the glyoxylate cycle enzymes; thus, the OBs are food reserves for gluconeogenesis. In spores during germination, peroxisomes adjacent to OBs, along with transcripts encoding the glyoxylate cycle enzymes, appeared; thus, the spore OBs are food reserves for gluconeogenesis and equivalent to seed OBs. The one-cell-layer gametophyte could be observed easily with confocal microscopy for the subcellular OBs and other structures. Transient expression of various gene constructs transformed into gametophyte cells revealed that all OBs were linked to the endoplasmic reticulum (ER), that oleosins were synthesized in extended regions of the ER, and that two different oleosins were colocated in all OBs. PMID:19420327

The Epstein-Barr virus (EBV) nuclear antigen 1 BamHI F promoter is activated on entry of EBV-transformed B cells into the lytic cycle.

PubMed Central

Lear, A L; Rowe, M; Kurilla, M G; Lee, S; Henderson, S; Kieff, E; Rickinson, A B

1992-01-01

In Epstein-Barr virus (EBV)-positive Burkitt's lymphoma cell lines exhibiting the latency I form of infection (i.e., EBV nuclear antigen 1 [EBNA1] positive in the absence of other latent proteins), the EBNA1 mRNA has a unique BamHI Q/U/K splice structure and is expressed from a novel promoter, Fp, located near the BamHI FQ boundary. This contrasts with the situation in EBV-transformed lymphoblastoid cell lines (LCLs) exhibiting the latency III form of infection (i.e., positive for all latent proteins), in which transcription from the upstream Cp or Wp promoters is the principal source of EBNA mRNAs. We carried out cDNA amplifications with oligonucleotide primer-probe combinations to determine whether Fp is ever active in an LCL environment. The results clearly showed that some LCLs express a Q/U/K-spliced EBNA1 mRNA in addition to the expected Cp/Wp-initiated transcripts; this seemed inconsistent with the concept of Cp/Wp and Fp as mutually exclusive promoters. Here we show that Fp is indeed silent in latency III cells but is activated at an early stage following the switch from latency III into the virus lytic cycle. Four pieces of evidence support this conclusion: (i) examples of coincident Cp/Wp and Fp usage in LCLs are restricted to those lines in which a small subpopulation of cells have spontaneously entered the lytic cycle; (ii) transcripts initiating from Fp can readily be demonstrated in spontaneously productive lines by S1 nuclease protection; (iii) the presence of Fp-initiated transcripts is not affected by acyclovir blockade of the late lytic cycle; and (iv) infection of latently infected LCLs with a recombinant vaccinia virus encoding the EBV immediate-early protein BZLF1, a transcriptional transactivator which normally initiates the lytic cycle, results in the appearance of the diagnostic Q/U/K-spliced transcripts. Images PMID:1331531

Transgenic cells with increased plastoquinone levels and methods of use

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sayre, Richard T.; Subramanian, Sowmya; Cahoon, Edgar

Disclosed herein are transgenic cells expressing a heterologous nucleic acid encoding a prephenate dehydrogenase (PDH) protein, a heterologous nucleic acid encoding a homogentisate solanesyl transferase (HST) protein, a heterologous nucleic acid encoding a deoxyxylulose phosphate synthase (DXS) protein, or a combination of two or more thereof. In particular examples, the disclosed transgenic cells have increased plastoquinone levels. Also disclosed are methods of increasing cell growth rates or production of biomass by cultivating transgenic cells expressing a heterologous nucleic acid encoding a PDH protein, a heterologous nucleic acid encoding an HST protein, a heterologous nucleic acid encoding a DXS protein, ormore » a combination of two or more thereof under conditions sufficient to produce cell growth or biomass.« less

Spi1 GTPase interacts with RCC1 to maintain interdependency of cell cycle events.

PubMed

Matsumoto, T; Beach, D

1991-01-01

A mutant which can enter mitosis at any cell cycle stage has been isolated and characterized in fission yeast. The pim1 (premature initiation of mitosis) mutant prearrested at G1/S can develop a mitotic spindle and has tightly condensed chromosomes upon shift to the restrictive temperature. pim1-induced mitosis requires maturation promoting factor (MPF) activity, but not the essential mitotic inducer, cdc25. The pim1+ gene encodes a homolog of regulator of chromosome condensation 1 (RCC1), a regulator of onset of mitosis in mammalian cells. A multicopy suppressor of pim1, spi1, was isolated, and found to encode a 25 kDa GTPase. The primary sequence of the spi1 GTPase shows extensive identity (80%) to human TC4, whose function is unknown. The spi1/TC4 GTPase defines a novel class in the "ras-like" GTPase family, which is distinct from ras, rho, or ypt. Disruption of the spi1+ gene causes genomic instability in a heterozygous diploid. These genetic data suggest that pim1+ and spi1+ interact to coordinate correct entry into mitosis. Immunological experiments demonstrate that the pim1+ and spi1+ products are physically associated. Mutation in the pim1 gene results in lowered affinity of the protein for the spi1 protein in vitro, which may explain why high dosages of the spi1 protein can rescue the pim1 mutant in vivo. The pim1/spi1 complex dissociates in the presence of Mg2+ and GTP. The current data suggests that pim1+ acts as a GTP exchanger for the spi1 GTPase.

Roles of the 2 microns gene products in stable maintenance of the 2 microns plasmid of Saccharomyces cerevisiae.

PubMed Central

Reynolds, A E; Murray, A W; Szostak, J W

1987-01-01

We have examined the replication and segregation of the Saccharomyces cerevisiae 2 microns circle. The amplification of the plasmid at low copy numbers requires site-specific recombination between the 2 microns inverted repeat sequences catalyzed by the plasmid-encoded FLP gene. No other 2 microns gene products are required. The overexpression of FLP in a strain carrying endogenous 2 microns leads to uncontrolled plasmid replication, longer cell cycles, and cell death. Two different assays show that the level of Flp activity decreases with increasing 2 microns copy number. This regulation requires the products of the REP1 and REP2 genes. These gene products also act together to ensure that 2 microns molecules are randomly segregated between mother and daughter cells at cell division. Images PMID:3316982

Functional genomic characterization of neoblast-like stem cells in larval Schistosoma mansoni

PubMed Central

Wang, Bo; Collins, James J; Newmark, Phillip A

2013-01-01

Schistosomes infect hundreds of millions of people in the developing world. Transmission of these parasites relies on a stem cell-driven, clonal expansion of larvae inside a molluscan intermediate host. How this novel asexual reproductive strategy relates to current models of stem cell maintenance and germline specification is unclear. Here, we demonstrate that this proliferative larval cell population (germinal cells) shares some molecular signatures with stem cells from diverse organisms, in particular neoblasts of planarians (free-living relatives of schistosomes). We identify two distinct germinal cell lineages that differ in their proliferation kinetics and expression of a nanos ortholog. We show that a vasa/PL10 homolog is required for proliferation and maintenance of both populations, whereas argonaute2 and a fibroblast growth factor receptor-encoding gene are required only for nanos-negative cells. Our results suggest that an ancient stem cell-based developmental program may have enabled the evolution of the complex life cycle of parasitic flatworms. DOI: http://dx.doi.org/10.7554/eLife.00768.001 PMID:23908765

A single ataxia telangiectasia gene with a product similar to PI-3 kinase.

PubMed

Savitsky, K; Bar-Shira, A; Gilad, S; Rotman, G; Ziv, Y; Vanagaite, L; Tagle, D A; Smith, S; Uziel, T; Sfez, S; Ashkenazi, M; Pecker, I; Frydman, M; Harnik, R; Patanjali, S R; Simmons, A; Clines, G A; Sartiel, A; Gatti, R A; Chessa, L; Sanal, O; Lavin, M F; Jaspers, N G; Taylor, A M; Arlett, C F; Miki, T; Weissman, S M; Lovett, M; Collins, F S; Shiloh, Y

1995-06-23

A gene, ATM, that is mutated in the autosomal recessive disorder ataxia telangiectasia (AT) was identified by positional cloning on chromosome 11q22-23. AT is characterized by cerebellar degeneration, immunodeficiency, chromosomal instability, cancer predisposition, radiation sensitivity, and cell cycle abnormalities. The disease is genetically heterogeneous, with four complementation groups that have been suspected to represent different genes. ATM, which has a transcript of 12 kilobases, was found to be mutated in AT patients from all complementation groups, indicating that it is probably the sole gene responsible for this disorder. A partial ATM complementary DNA clone of 5.9 kilobases encoded a putative protein that is similar to several yeast and mammalian phosphatidylinositol-3' kinases that are involved in mitogenic signal transduction, meiotic recombination, and cell cycle control. The discovery of ATM should enhance understanding of AT and related syndromes and may allow the identification of AT heterozygotes, who are at increased risk of cancer.

Human Cytomegalovirus Infection Upregulates the Mitochondrial Transcription and Translation Machineries

PubMed Central

Weekes, M. P.; Antrobus, R.; Rorbach, J.; van Haute, L.; Umrania, Y.; Smith, D. L.; Minczuk, M.; Lehner, P. J.; Sinclair, J. H.

2016-01-01

ABSTRACT Infection with human cytomegalovirus (HCMV) profoundly affects cellular metabolism. Like in tumor cells, HCMV infection increases glycolysis, and glucose carbon is shifted from the mitochondrial tricarboxylic acid cycle to the biosynthesis of fatty acids. However, unlike in many tumor cells, where aerobic glycolysis is accompanied by suppression of mitochondrial oxidative phosphorylation, HCMV induces mitochondrial biogenesis and respiration. Here, we affinity purified mitochondria and used quantitative mass spectrometry to determine how the mitochondrial proteome changes upon HCMV infection. We found that the mitochondrial transcription and translation systems are induced early during the viral replication cycle. Specifically, proteins involved in biogenesis of the mitochondrial ribosome were highly upregulated by HCMV infection. Inhibition of mitochondrial translation with chloramphenicol or knockdown of HCMV-induced ribosome biogenesis factor MRM3 abolished the HCMV-mediated increase in mitochondrially encoded proteins and significantly impaired viral growth under bioenergetically restricting conditions. Our findings demonstrate how HCMV manipulates mitochondrial biogenesis to support its replication. PMID:27025248

The Transcription Factor Rbf1 Is the Master Regulator for b-Mating Type Controlled Pathogenic Development in Ustilago maydis

PubMed Central

Vranes, Miroslav; Wahl, Ramon; Pothiratana, Chetsada; Schuler, David; Vincon, Volker; Finkernagel, Florian; Flor-Parra, Ignacio; Kämper, Jörg

2010-01-01

In the phytopathogenic basidiomycete Ustilago maydis, sexual and pathogenic development are tightly connected and controlled by the heterodimeric bE/bW transcription factor complex encoded by the b-mating type locus. The formation of the active bE/bW heterodimer leads to the formation of filaments, induces a G2 cell cycle arrest, and triggers pathogenicity. Here, we identify a set of 345 bE/bW responsive genes which show altered expression during these developmental changes; several of these genes are associated with cell cycle coordination, morphogenesis and pathogenicity. 90% of the genes that show altered expression upon bE/bW-activation require the zinc finger transcription factor Rbf1, one of the few factors directly regulated by the bE/bW heterodimer. Rbf1 is a novel master regulator in a multilayered network of transcription factors that facilitates the complex regulatory traits of sexual and pathogenic development. PMID:20700446

The Myxococcus xanthus Spore Cuticula Protein C Is a Fragment of FibA, an Extracellular Metalloprotease Produced Exclusively in Aggregated Cells

PubMed Central

Lee, Bongsoo; Mann, Petra; Grover, Vidhi; Treuner-Lange, Anke; Kahnt, Jörg; Higgs, Penelope I.

2011-01-01

Myxococcus xanthus is a soil bacterium with a complex life cycle involving distinct cell fates, including production of environmentally resistant spores to withstand periods of nutrient limitation. Spores are surrounded by an apparently self-assembling cuticula containing at least Proteins S and C; the gene encoding Protein C is unknown. During analyses of cell heterogeneity in M. xanthus, we observed that Protein C accumulated exclusively in cells found in aggregates. Using mass spectrometry analysis of Protein C either isolated from spore cuticula or immunoprecipitated from aggregated cells, we demonstrate that Protein C is actually a proteolytic fragment of the previously identified but functionally elusive zinc metalloprotease, FibA. Subpopulation specific FibA accumulation is not due to transcriptional regulation suggesting post-transcriptional regulation mechanisms mediate its heterogeneous accumulation patterns. PMID:22174937

Lentivirus-Mediated knockdown of tectonic family member 1 inhibits medulloblastoma cell proliferation

PubMed Central

Jing, Junjie; Wang, Chengfeng; Liang, Qinchuan; Zhao, Yang; Zhao, Qingshuang; Wang, Shousen; Ma, Jie

2015-01-01

Tectonic family member 1 (TCTN1) encodes a member of the tectonic family which are evolutionarily conserved secreted and transmembrane proteins, involving in a diverse variety of developmental processes. It has been demonstrated that tectonics expressed in regions that participate in Hedgehog (Hh) signaling during mouse embryonic development and was imperative for Hh-mediated patterning of the ventral neural tube. However, the expression and regulation of tectonics in human tumor is still not clear. In this study, shRNA-expressing lentivirus was constructed to knockdown TCTN1 in medulloblastoma cell line Daoy. The results showed that knockdown of TCTN1 inhibited cell proliferation and colony formation in Daoy cell line, also caused cell cycle arrest at the G2/M boundary. Taken all together, our data suggest that TCTN1 might play an important role in the progression of medulloblastoma. PMID:26550235

Bovine Herpes Virus 1 (BHV-1) and Herpes Simplex Virus Type 1 (HSV-1) Promote Survival of Latently Infected Sensory Neurons, in Part by Inhibiting Apoptosis

PubMed Central

Jones, Clinton

2013-01-01

α-Herpesvirinae subfamily members, including herpes simplex virus type 1 (HSV-1) and bovine herpes virus 1 (BHV-1), initiate infection in mucosal surfaces. BHV-1 and HSV-1 enter sensory neurons by cell-cell spread where a burst of viral gene expression occurs. When compared to non-neuronal cells, viral gene expression is quickly extinguished in sensory neurons resulting in neuronal survival and latency. The HSV-1 latency associated transcript (LAT), which is abundantly expressed in latently infected neurons, inhibits apoptosis, viral transcription, and productive infection, and directly or indirectly enhances reactivation from latency in small animal models. Three anti-apoptosis genes can be substituted for LAT, which will restore wild type levels of reactivation from latency to a LAT null mutant virus. Two small non-coding RNAs encoded by LAT possess anti-apoptosis functions in transfected cells. The BHV-1 latency related RNA (LR-RNA), like LAT, is abundantly expressed during latency. The LR-RNA encodes a protein (ORF2) and two microRNAs that are expressed in certain latently infected neurons. Wild-type expression of LR gene products is required for stress-induced reactivation from latency in cattle. ORF2 has anti-apoptosis functions and interacts with certain cellular transcription factors that stimulate viral transcription and productive infection. ORF2 is predicted to promote survival of infected neurons by inhibiting apoptosis and sequestering cellular transcription factors which stimulate productive infection. In addition, the LR encoded microRNAs inhibit viral transcription and apoptosis. In summary, the ability of BHV-1 and HSV-1 to interfere with apoptosis and productive infection in sensory neurons is crucial for the life-long latency-reactivation cycle in their respective hosts. PMID:25278776

Functional characterization of Bombyx mori nucleopolyhedrovirus mutant lacking late expression factor 9.

PubMed

Zhang, Y; Shi, Y; Yu, H; Li, J; Quan, Y; Shu, T; Nie, Z; Zhang, Y; Yu, W

Baculoviridae is a family of invertebrate viruses with large double-stranded DNA genomes. Proteins encoded by some late expression factor (lef ) genes are involved in the regulation of viral gene expression. Lef-9 is one of four transcription-specific Lefs, which are components of the virus-encoded RNA polymerase, and can initiate and transcribe late and very late genes. As a multifunctional protein encoded by the Bombyx mori nucleopolyhedrovirus (BmNPV), Lef-9 may be involved in the regulation of viral propagation. However, the underlying mechanism remains unclear. To determine the role of lef-9 in baculovirus infection, lef-9-knockout virus (lef-9-KO-Bacmid virus) was constructed using the Red recombination system, and the Bac-to-Bac system was used to prepare lef-9-repaired virus (lef-9-Re-Bacmid virus). The lef-9-KO virus did not produce infectious viruses or show infection activity, while the lef-9-repaired virus recovered both. Quantitative real-time polymerase chain reaction (qRT-PCR) analysis of the transcription levels in wild-type-Bacmid, lef-9-KO-Bacmid, and lef-9-Re-Bacmid viruses showed that the lef-9-KO bacmid had little effect on viral genome replication. However, the transcription levels of the early and late viral genes, lef-3, ie-1, vp39, and p10, were significantly lower in BmN cells transfected with lef-9-KO-Bacmids than in the controls. Electron microscopy showed no visible enveloped virions in cells transfected with lef-9-KO-Bacmids, while many mature virions in cells transfected with lef-9-Re-Bacmid and wt-Bacmid were present. Thus, lef-9 was not essential for viral genome replication, but significantly affected viral gene transcription and expression in all periods of cell life cycle.

Regulation of Aerobic Energy Metabolism in Podospora anserina by Two Paralogous Genes Encoding Structurally Different c-Subunits of ATP Synthase.

PubMed

Sellem, Carole H; di Rago, Jean-Paul; Lasserre, Jean-Paul; Ackerman, Sharon H; Sainsard-Chanet, Annie

2016-07-01

Most of the ATP in living cells is produced by an F-type ATP synthase. This enzyme uses the energy of a transmembrane electrochemical proton gradient to synthesize ATP from ADP and inorganic phosphate. Proton movements across the membrane domain (FO) of the ATP synthase drive the rotation of a ring of 8-15 c-subunits, which induces conformational changes in the catalytic part (F1) of the enzyme that ultimately promote ATP synthesis. Two paralogous nuclear genes, called Atp9-5 and Atp9-7, encode structurally different c-subunits in the filamentous fungus Podospora anserina. We have in this study identified differences in the expression pattern for the two genes that correlate with the mitotic activity of cells in vegetative mycelia: Atp9-7 is transcriptionally active in non-proliferating (stationary) cells while Atp9-5 is expressed in the cells at the extremity (apex) of filaments that divide and are responsible for mycelium growth. When active, the Atp9-5 gene sustains a much higher rate of c-subunit synthesis than Atp9-7. We further show that the ATP9-7 and ATP9-5 proteins have antagonist effects on the longevity of P. anserina. Finally, we provide evidence that the ATP9-5 protein sustains a higher rate of mitochondrial ATP synthesis and yield in ATP molecules per electron transferred to oxygen than the c-subunit encoded by Atp9-7. These findings reveal that the c-subunit genes play a key role in the modulation of ATP synthase production and activity along the life cycle of P. anserina. Such a degree of sophistication for regulating aerobic energy metabolism has not been described before.

The suppression of apoptosis by α-herpesvirus

PubMed Central

You, Yu; Cheng, An-Chun; Wang, Ming-Shu; Jia, Ren-Yong; Sun, Kun-Feng; Yang, Qiao; Wu, Ying; Zhu, Dekang; Chen, Shun; Liu, Ma-Feng; Zhao, Xin-Xin; Chen, Xiao-Yue

2017-01-01

Apoptosis, an important innate immune mechanism that eliminates pathogen-infected cells, is primarily triggered by two signalling pathways: the death receptor pathway and the mitochondria-mediated pathway. However, many viruses have evolved various strategies to suppress apoptosis by encoding anti-apoptotic factors or regulating apoptotic signalling pathways, which promote viral propagation and evasion of the host defence. During its life cycle, α-herpesvirus utilizes an elegant multifarious anti-apoptotic strategy to suppress programmed cell death. This progress article primarily focuses on the current understanding of the apoptosis-inhibition mechanisms of α-herpesvirus anti-apoptotic genes and their expression products and discusses future directions, including how the anti-apoptotic function of herpesvirus could be targeted therapeutically. PMID:28406478

Function of the ING family of PHD proteins in cancer.

PubMed

Gong, Wei; Suzuki, Keiko; Russell, Michael; Riabowol, Karl

2005-05-01

The ING genes encode a family of at least seven proteins with conserved plant homeodomain (PHD)-type zinc fingers in their C-termini. The founding member, ING1, is capable of binding to and affecting the activity of histone acetyltransferase (HAT), histone deacetylase (HDAC), and factor acetyltransferase (FAT) protein complexes. Some ING proteins are involved in transcriptional regulation of genes, such as the p53-inducible genes p21 and Bax. Others have been found to affect post-translational modifications, exemplified by the ING2-induced acetylation of p53 on the same site deacetylated by the Sir2 HDAC. Upon UV irradiation, ING1 causes cell cycle arrest and interacts with proliferating cell nuclear antigen to promote DNA repair or induce apoptosis in cells to prevent tumorigenesis depending upon the severity of DNA damage. It is very likely that, by linking DNA repair, apoptosis and chromatin remodeling to the transcriptional regulation of critical genes, ING1 exerts it tumor suppressor functions by helping maintain genomic stability. Therefore, ING proteins, which are down-regulated in a broad variety of cancer types, are able to restrict cell growth and proliferation, induce apoptosis, and modulate cell cycle progression, which strongly supports the notion that ING family proteins act as class II tumor suppressors.

Time-Resolved Visualisation of Nearly-Native Influenza A Virus Progeny Ribonucleoproteins and Their Individual Components in Live Infected Cells

PubMed Central

Avilov, Sergiy; Magnus, Julie; Cusack, Stephen; Naffakh, Nadia

2016-01-01

Influenza viruses are a global health concern because of the permanent threat of novel emerging strains potentially capable of causing pandemics. Viral ribonucleoproteins (vRNPs) containing genomic RNA segments, nucleoprotein oligomers, and the viral polymerase, play a central role in the viral replication cycle. Our knowledge about critical events such as vRNP assembly and interactions with other viral and cellular proteins is poor and could be substantially improved by time lapse imaging of the infected cells. However, such studies are limited by the difficulty to achieve live-cell compatible labeling of active vRNPs. Previously we designed the first unimpaired recombinant influenza WSN-PB2-GFP11 virus allowing fluorescent labeling of the PB2 subunit of the viral polymerase (Avilov et al., J.Virol. 2012). Here, we simultaneously labeled the viral PB2 protein using the above-mentioned strategy, and virus-encoded progeny RNPs through spontaneous incorporation of transiently expressed NP-mCherry fusion proteins during RNP assembly in live infected cells. This dual labeling enabled us to visualize progeny vRNPs throughout the infection cycle and to characterize independently the mobility, oligomerization status and interactions of vRNP components in the nuclei of live infected cells. PMID:26978069

Ablation of an Ovarian Tumor Family Deubiquitinase Exposes the Underlying Regulation Governing the Plasticity of Cell Cycle Progression in Toxoplasma gondii.

PubMed

Dhara, Animesh; de Paula Baptista, Rodrigo; Kissinger, Jessica C; Snow, E Charles; Sinai, Anthony P

2017-11-21

The Toxoplasma genome encodes the capacity for distinct architectures underlying cell cycle progression in a life cycle stage-dependent manner. Replication in intermediate hosts occurs by endodyogeny, whereas a hybrid of schizogony and endopolygeny occurs in the gut of the definitive feline host. Here, we characterize the consequence of the loss of a cell cycle-regulated o varian tu mor (OTU family) deubiquitinase, OTUD3A of Toxoplasma gondii (TgOTUD3A; TGGT1_258780), in T. gondii tachyzoites. Rather than the mutation being detrimental, mutant parasites exhibited a fitness advantage, outcompeting the wild type. This phenotype was due to roughly one-third of TgOTUD3A-knockout (TgOTUD3A-KO) tachyzoites exhibiting deviations from endodyogeny by employing replication strategies that produced 3, 4, or 5 viable progeny within a gravid mother instead of the usual 2. We established the mechanistic basis underlying these altered replication strategies to be a dysregulation of centrosome duplication, causing a transient loss of stoichiometry between the inner and outer cores that resulted in a failure to terminate S phase at the attainment of 2N ploidy and/or the decoupling of mitosis and cytokinesis. The resulting dysregulation manifested as deviations in the normal transitions from S phase to mitosis (S/M) (endopolygeny-like) or M phase to cytokinesis (M/C) (schizogony-like). Notably, these imbalances are corrected prior to cytokinesis, resulting in the generation of normal progeny. Our findings suggest that decisions regarding the utilization of specific cell cycle architectures are controlled by a ubiquitin-mediated mechanism that is dependent on the absolute threshold levels of an as-yet-unknown target(s). Analysis of the TgOTUD3A-KO mutant provides new insights into mechanisms underlying the plasticity of apicomplexan cell cycle architecture. IMPORTANCE Replication by Toxoplasma gondii can occur by 3 distinct cell cycle architectures. Endodyogeny is used by asexual stages, while a hybrid of schizogony and endopolygeny is used by merozoites in the definitive feline host. Here, we establish that the disruption of an o varian- tu mor (OTU) family deubiquitinase, TgOTUD3A, in tachyzoites results in dysregulation of the mechanism controlling the selection of replication strategy in a subset of parasites. The mechanistic basis for these altered cell cycles lies in the unique biology of the bipartite centrosome that is associated with the transient loss of stoichiometry between the inner and outer centrosome cores in the TgOTUD3A-KO mutant. This highlights the importance of ubiquitin-mediated regulation in the transition from the nuclear to the budding phases of the cell cycle and provides new mechanistic insights into the regulation of the organization of the apicomplexan cell cycle. Copyright © 2017 Dhara et al.

Anti-TNFα therapy for inflammatory bowel diseases is associated with Epstein-Barr virus lytic activation.

PubMed

Lapsia, Sameer; Koganti, Siva; Spadaro, Salvatore; Rajapakse, Ramona; Chawla, Anupama; Bhaduri-McIntosh, Sumita

2016-02-01

Anti-TNFα therapy, known to suppress T-cell immunity, is increasingly gaining popularity for treatment of autoimmune diseases including inflammatory bowel diseases (IBD). T-cell suppression increases the risk of B-cell EBV-lymphoproliferative diseases and lymphomas. Since EBV-lytic activation is essential for development of EBV-lymphomas and there have been reports of EBV-lymphomas in patients treated with anti-TNFα therapy, we investigated if patients treated with anti-TNFα antibodies demonstrate greater EBV-lytic activity in blood. Peripheral blood mononuclear cells from 10 IBD patients solely on anti-TNFα therapy compared to 3 control groups (10 IBD patients not on immunosuppressive therapy, 10 patients with abdominal pain but without IBD, and 10 healthy subjects) were examined for the percentage of T-cells, EBV load and EBV-lytic transcripts. Patients on anti-TNFα therapy had significantly fewer T-cells, greater EBV load, and increased levels of transcripts from EBV-lytic genes of all kinetic classes compared to controls. Furthermore, exposure of EBV-infected B-cell lines to anti-TNFα antibodies resulted in increased levels of BZLF1 mRNA; BZLF1 encodes for ZEBRA, the viral latency-to-lytic cycle switch. Thus, IBD patients treated with anti-TNFα antibodies have greater EBV loads likely due to enhanced EBV-lytic gene expression and anti-TNFα antibodies may be sufficient to activate the EBV lytic cycle. Findings from this pilot study lay the groundwork for additional scientific and clinical investigation into the effects of anti-TNFα therapy on the life cycle of EBV, a ubiquitous oncovirus that causes lymphomas in the setting of immunocompromise. © 2015 Wiley Periodicals, Inc.

The endocrine dyscrasia that accompanies menopause and andropause induces aberrant cell cycle signaling that triggers re-entry of post-mitotic neurons into the cell cycle, neurodysfunction, neurodegeneration and cognitive disease.

PubMed

Atwood, Craig S; Bowen, Richard L

2015-11-01

This article is part of a Special Issue "SBN 2014". Sex hormones are physiological factors that promote neurogenesis during embryonic and fetal development. During childhood and adulthood these hormones support the maintenance of brain structure and function via neurogenesis and the formation of dendritic spines, axons and synapses required for the capture, processing and retrieval of information (memories). Not surprisingly, changes in these reproductive hormones that occur with menopause and during andropause are strongly correlated with neurodegeneration and cognitive decline. In this connection, much evidence now indicates that Alzheimer's disease (AD) involves aberrant re-entry of post-mitotic neurons into the cell cycle. Cell cycle abnormalities appear very early in the disease, prior to the appearance of plaques and tangles, and explain the biochemical, neuropathological and cognitive changes observed with disease progression. Intriguingly, a recent animal study has demonstrated that induction of adult neurogenesis results in the loss of previously encoded memories while decreasing neurogenesis after memory formation during infancy mitigated forgetting. Here we review the biochemical, epidemiological and clinical evidence that alterations in sex hormone signaling associated with menopause and andropause drive the aberrant re-entry of post-mitotic neurons into an abortive cell cycle that leads to neurite retraction, neuron dysfunction and neuron death. When the reproductive axis is in balance, gonadotropins such as luteinizing hormone (LH), and its fetal homolog, human chorionic gonadotropin (hCG), promote pluripotent human and totipotent murine embryonic stem cell and neuron proliferation. However, strong evidence supports menopausal/andropausal elevations in the LH:sex steroid ratio as driving aberrant mitotic events. These include the upregulation of tumor necrosis factor; amyloid-β precursor protein processing towards the production of mitogenic Aβ; and the activation of Cdk5, a key regulator of cell cycle progression and tau phosphorylation (a cardinal feature of both neurogenesis and neurodegeneration). Cognitive and biochemical studies confirm the negative consequences of a high LH:sex steroid ratio on dendritic spine density and human cognitive performance. Prospective epidemiological and clinical evidence in humans supports the premise that rebalancing the ratio of circulating gonadotropins:sex steroids reduces the incidence of AD. Together, these data support endocrine dyscrasia and the subsequent loss of cell cycle control as an important etiological event in the development of neurodegenerative diseases including AD, stroke and Parkinson's disease. Published by Elsevier Inc.

EG-07CELL CYCLE SIGNATURE AND TUMOR PHYLOGENY ARE ENCODED IN THE EVOLUTIONARY DYNAMICS OF DNA METHYLATION IN GLIOMA

PubMed Central

Mazor, Tali; Pankov, Aleksandr; Johnson, Brett E.; Hong, Chibo; Bell, Robert J.A.; Smirnov, Ivan V.; Reis, Gerald F.; Phillips, Joanna J.; Barnes, Michael; Bollen, Andrew W.; Taylor, Barry S.; Molinaro, Annette M.; Olshen, Adam B.; Song, Jun S.; Berger, Mitchel S.; Chang, Susan M.; Costello, Joseph F.

2014-01-01

The clonal evolution of tumor cell populations can be reconstructed from patterns of genetic alterations. In contrast, tumor epigenetic states, including DNA methylation, are reversible and sensitive to the tumor microenvironment, presumably precluding the use of epigenetics to discover tumor phylogeny. Here we examined the spatial and temporal dynamics of DNA methylation in a clinically and genetically characterized cohort of IDH1-mutant low-grade gliomas and their patient-matched recurrences. WHO grade II gliomas are diffuse, infiltrative tumors that frequently recur and may undergo malignant progression to a higher grade with a worse prognosis. The extent to which epigenetic alterations contribute to the evolution of low-grade gliomas, including malignant progression, is unknown. While all gliomas in the cohort exhibited the hypermethylation signature associated with IDH1 mutation, low-grade gliomas that underwent malignant progression to high-grade glioblastoma (GBM) had a unique signature of DNA hypomethylation enriched for active enhancers, as well as sites of age-related hypermethylation in the brain. Genes with promoter hypomethylation and concordant transcriptional upregulation during evolution to GBM were enriched in cell cycle function, evolving in concert with genetic alterations that deregulate the G1/S cell cycle checkpoint. Despite the plasticity of tumor epigenetic states, phyloepigenetic trees robustly recapitulated phylogenetic trees derived from somatic mutations in the same patients. These findings highlight widespread co-dependency of genetic and epigenetic events throughout the clonal evolution of initial and recurrent glioma.

Multifunctional Nature of the Arenavirus RING Finger Protein Z

PubMed Central

Fehling, Sarah Katharina; Lennartz, Frank; Strecker, Thomas

2012-01-01

Arenaviruses are a family of enveloped negative-stranded RNA viruses that can cause severe human disease ranging from encephalitis symptoms to fulminant hemorrhagic fever. The bi‑segmented RNA genome encodes four polypeptides: the nucleoprotein NP, the surface glycoprotein GP, the polymerase L, and the RING finger protein Z. Although it is the smallest arenavirus protein with a length of 90 to 99 amino acids and a molecular weight of approx. 11 kDa, the Z protein has multiple functions in the viral life cycle including (i) regulation of viral RNA synthesis, (ii) orchestration of viral assembly and budding, (iii) interaction with host cell proteins, and (iv) interferon antagonism. In this review, we summarize our current understanding of the structural and functional role of the Z protein in the arenavirus replication cycle. PMID:23202512

Differential encoding of spatial information among retinal on cone bipolar cells

PubMed Central

Purgert, Robert J.

2015-01-01

The retina is the first stage of visual processing. It encodes elemental features of visual scenes. Distinct cone bipolar cells provide the substrate for this to occur. They encode visual information, such as color and luminance, a principle known as parallel processing. Few studies have directly examined whether different forms of spatial information are processed in parallel among cone bipolar cells. To address this issue, we examined the spatial information encoded by mouse ON cone bipolar cells, the subpopulation excited by increments in illumination. Two types of spatial processing were identified. We found that ON cone bipolar cells with axons ramifying in the central inner plexiform layer were tuned to preferentially encode small stimuli. By contrast, ON cone bipolar cells with axons ramifying in the proximal inner plexiform layer, nearest the ganglion cell layer, were tuned to encode both small and large stimuli. This dichotomy in spatial tuning is attributable to amacrine cells providing stronger inhibition to central ON cone bipolar cells compared with proximal ON cone bipolar cells. Furthermore, background illumination altered this difference in spatial tuning. It became less pronounced in bright light, as amacrine cell-driven inhibition became pervasive among all ON cone bipolar cells. These results suggest that differential amacrine cell input determined the distinct spatial encoding properties among ON cone bipolar cells. These findings enhance the known parallel processing capacity of the retina. PMID:26203104

New insights into an X-traordinary viral protein

PubMed Central

Schaller, Torsten; Bauby, Hélène; Hué, Stéphane; Malim, Michael H.; Goujon, Caroline

2014-01-01

Vpx is a protein encoded by members of the HIV-2/SIVsmm and SIVrcm/SIVmnd-2 lineages of primate lentiviruses, and is packaged into viral particles. Vpx plays a critical role during the early steps of the viral life cycle and has been shown to counteract SAMHD1, a restriction factor in myeloid and resting T cells. However, it is becoming evident that Vpx is a multifunctional protein in that SAMHD1 antagonism is likely not its sole role. This review summarizes the current knowledge on this X-traordinary protein. PMID:24782834

The Nucleocapsid Protein of Coronaviruses Acts as a Viral Suppressor of RNA Silencing in Mammalian Cells.

PubMed

Cui, Lei; Wang, Haiying; Ji, Yanxi; Yang, Jie; Xu, Shan; Huang, Xingyu; Wang, Zidao; Qin, Lei; Tien, Po; Zhou, Xi; Guo, Deyin; Chen, Yu

2015-09-01

RNA interference (RNAi) is a process of eukaryotic posttranscriptional gene silencing that functions in antiviral immunity in plants, nematodes, and insects. However, recent studies provided strong supports that RNAi also plays a role in antiviral mechanism in mammalian cells. To combat RNAi-mediated antiviral responses, many viruses encode viral suppressors of RNA silencing (VSR) to facilitate their replication. VSRs have been widely studied for plant and insect viruses, but only a few have been defined for mammalian viruses currently. We identified a novel VSR from coronaviruses, a group of medically important mammalian viruses including Severe acute respiratory syndrome coronavirus (SARS-CoV), and showed that the nucleocapsid protein (N protein) of coronaviruses suppresses RNAi triggered by either short hairpin RNAs or small interfering RNAs in mammalian cells. Mouse hepatitis virus (MHV) is closely related to SARS-CoV in the family Coronaviridae and was used as a coronavirus replication model. The replication of MHV increased when the N proteins were expressed in trans, while knockdown of Dicer1 or Ago2 transcripts facilitated the MHV replication in mammalian cells. These results support the hypothesis that RNAi is a part of the antiviral immunity responses in mammalian cells. IMPORTANCE RNAi has been well known to play important antiviral roles from plants to invertebrates. However, recent studies provided strong supports that RNAi is also involved in antiviral response in mammalian cells. An important indication for RNAi-mediated antiviral activity in mammals is the fact that a number of mammalian viruses encode potent suppressors of RNA silencing. Our results demonstrate that coronavirus N protein could function as a VSR through its double-stranded RNA binding activity. Mutational analysis of N protein allowed us to find out the critical residues for the VSR activity. Using the MHV-A59 as the coronavirus replication model, we showed that ectopic expression of SARS-CoV N protein could promote MHV replication in RNAi-active cells but not in RNAi-depleted cells. These results indicate that coronaviruses encode a VSR that functions in the replication cycle and provide further evidence to support that RNAi-mediated antiviral response exists in mammalian cells.

Antileukaemic effect of PI3K-mTOR inhibitors in acute myeloid leukaemia-gene expression profiles reveal CDC25B expression as determinate of pharmacological effect.

PubMed

Reikvam, Håkon; Tamburini, Jerome; Skrede, Silje; Holdhus, Rita; Poulain, Laury; Ersvaer, Elisabeth; Hatfield, Kimberley J; Bruserud, Øystein

2014-01-01

Acute myeloid leukaemia (AML) is a heterogeneous malignancy. Intracellular signalling through the phosphatidylinositol 3-kinase (PI3K)-Akt-mammalian target of rapamycin (mTOR) pathway is important for regulation of cellular growth and metabolism, and inhibitors of this pathway is considered for AML treatment. Primary human AML cells, derived from 96 consecutive adult patients, were examined. The effects of two mTOR inhibitors (rapamycin, temsirolimus) and two PI3K inhibitors (GDC-0941, 3-methyladenine) were studied, and we investigated cytokine-dependent proliferation, regulation of apoptosis and global gene expression profiles. Only a subset of patients demonstrated strong antiproliferative effects of PI3K-mTOR inhibitors. Unsupervised hierarchical clustering analysis identified two main clusters of patients; one subset showing weak or absent antiproliferative effects (59%) and another group showing a strong growth inhibition for all drugs and concentrations examined (41%). Global gene expression analyses showed that patients with AML cell resistance against PI3K-mTOR inhibitors showed increased mRNA expression of the CDC25B gene that encodes the cell cycle regulator Cell Division Cycle 25B. The antileukaemic effect of PI3K-Akt-mTOR inhibition varies between patients, and resistance to these inhibitors is associated with the expression of the cell cycle regulator CDC25B, which is known to crosstalk with the PI3K-Akt-mTOR pathway and mediate rapamycin resistance in experimental models. © 2013 John Wiley & Sons Ltd.

Suppression of cell division by pKi-67 antisense-RNA and recombinant protein.

PubMed

Duchrow, M; Schmidt, M H; Zingler, M; Anemüller, S; Bruch, H P; Broll, R

2001-01-01

The human antigen defined by the monoclonal antibody Ki-67 (pKi-67) is a human nuclear protein strongly associated with cell proliferation and found in all tissues studied. It is widely used as a marker of proliferating cells, yet its function is unknown. To investigate its function we suppressed pKi-67 expression by antisense RNA and overexpressed a partial structure of pKi-67 in HeLa cells. A BrdU-incorporation assay showed a significant decrease in DNA synthesis after antisense inhibition. Cell cycle analysis indicated a higher proportion of cells in G1 phase and a lower proportion of cells in S phase while the number of G(2)/M phase cells remained constant. Overexpression of a recombinant protein encoding three of the repetitive elements from exon 13 of pKi-67 had a similar effect to that obtained by antisense inhibition. The similarity of the effect of expressing 'Ki-67 repeats' and pKi-67 antisense RNA could be explained by a negative effect on the folding of the endogenous protein in the endoplasmatic reticulum. Furthermore excessive self-association of pKi-67 via the repeat structure could inhibit its nuclear transport, preventing it from getting to its presumptive site of action. We conclude that the Ki-67 protein has an important role in the regulation of the cell cycle, which is mediated in part by its repetitive elements. Copyright 2001 S. Karger AG, Basel

Abscisic Acid Participates in the Control of Cell Cycle Initiation Through Heme Homeostasis in the Unicellular Red Alga Cyanidioschyzon merolae.

PubMed

Kobayashi, Yuki; Ando, Hiroyuki; Hanaoka, Mitsumasa; Tanaka, Kan

2016-05-01

ABA is a phytohormone that is synthesized in response to abiotic stresses and other environmental changes, inducing various physiological responses. While ABA has been found in unicellular photosynthetic organisms, such as cyanobacteria and eukaryotic algae, its function in these organisms is poorly understood. Here, we found that ABA accumulated in the unicellular red alga Cyanidioschyzon merolae under conditions of salt stress and that the cell cycle G1/S transition was inhibited when ABA was added to the culture medium. A gene encoding heme-scavenging tryptophan-rich sensory protein-related protein (CmTSPO; CMS231C) was positively regulated by ABA, as in Arabidopsis, and CmTSPO bound heme in vitro. The intracellular content of total heme was increased by addition of ABA, but unfettered heme decreased, presumably due to scavenging by CmTSPO. The inhibition of DNA replication by ABA was negated by addition of heme to the culture medium. Thus, we propose a regulatory role for ABA and heme in algal cell cycle initiation. Finally, we found that a C. merolae mutant that is defective in ABA production was more susceptible to salt stress, indicating the importance of ABA to stress resistance in red algae. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Crybb2 deficiency impairs fertility in female mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gao, Qian; Sun, Li-Li; Department of Laboratory Diagnosis, Changhai Hospital, Second Military Medical University, Shanghai 200433

Highlights: • Crybb2 deletion impaired female fertility. • Crybb2 deletion dramatically affected the production of reproduction-related hormones and hormone response. • Crybb2 deletion impaired follicular development and inhibited the proliferation of granulosa cells. • Crybb2 deletion promoted follicular atresia and apoptosis in granulosa cells. - Abstract: Beta-B2-crystallin (CRYBB2), encoded by Crybb2 gene, is a major protein in the mammalian eye lens that plays an important role in maintaining the transparency of the ocular lens. However, CRYBB2 also plays important roles in many extra-lenticular tissues and organs such as the retina, brain and testis. Our previous studies demonstrated that male Crybb2more » deficient (Crybb2{sup −/−}) mice have reduced fertility compared with wild-type (WT) mice, while female Crybb2{sup −/−} mice exhibited reduced ovary weights and shorter estrous cycle percentages. Here we specifically investigated the role of CRYBB2 in the female reproductive system. Our studies revealed that ovaries from female Crybb2{sup −/−} mice exhibited significantly reduced numbers of primordial, secondary and pre-ovulatory follicles when compared with WT mice, while the rate of atretic follicles was also increased. Additionally, fewer eggs were collected from the oviduct of Crybb2{sup −/−} female mice after superovulation. Estrogen levels were higher in the metestrus and diestrus cycles of female Crybb2{sup −/−} mice, while progesterone levels were lower in diestrus cycles. Furthermore, the expression of survival and cell cycle genes, Bcl-2, Cdk4 and Ccnd2, were significantly decreased in granulosa cells isolated from female Crybb2{sup −/−} mice, consistent with the predominant expression of CRYBB2 in ovarian granulosa cells. Our results reveal a critical role for CRYBB2 in female fertility and specific effects on the proliferation and survival status of ovarian granulosa cells.« less

Structural and genomic properties of the hyperthermophilic archaeal virus ATV with an extracellular stage of the reproductive cycle.

PubMed

Prangishvili, David; Vestergaard, Gisle; Häring, Monika; Aramayo, Ricardo; Basta, Tamara; Rachel, Reinhard; Garrett, Roger A

2006-06-23

A novel virus, ATV, of the hyperthermophilic archaeal genus Acidianus has the unique property of undergoing a major morphological development outside of, and independently of, the host cell. Virions are extruded from host cells as lemon-shaped tail-less particles, after which they develop long tails at each pointed end, at temperatures close to that of the natural habitat, 85 degrees C. The extracellularly developed tails constitute tubes, which terminate in an anchor-like structure that is not observed in the tail-less particles. A thin filament is located within the tube, which exhibits a periodic structure. Tail development produces a one half reduction in the volume of the virion, concurrent with a slight expansion of the virion surface. The circular, double-stranded DNA genome contains 62,730 bp and is exceptional for a crenarchaeal virus in that it carries four putative transposable elements as well as genes, which previously have been associated only with archaeal self-transmissable plasmids. In total, it encodes 72 predicted proteins, including 11 structural proteins with molecular masses in the range of 12 to 90 kDa. Several of the larger proteins are rich in coiled coil and/or low complexity sequence domains, which are unusual for archaea. One protein, in particular P800, resembles an intermediate filament protein in its structural properties. It is modified in the two-tailed, but not in the tail-less, virion particles and it may contribute to viral tail development. Exceptionally for a crenarchaeal virus, infection with ATV results either in viral replication and subsequent cell lysis or in conversion of the infected cell to a lysogen. The lysogenic cycle involves integration of the viral genome into the host chromosome, probably facilitated by the virus-encoded integrase and this process can be interrupted by different stress factors.

The use of cell microinjection for the in vivo analysis of viral transcriptional regulatory protein domains.

PubMed

Green, Maurice; Thorburn, Andrew; Kern, Robert; Loewenstein, Paul M

2007-01-01

Microinjection of mammalian cells provides a powerful method for analyzing in vivo functions of viral genes and viral gene products. By microinjection, a controlled amount (ranging from several to many thousands of copies) of a viral or cellular gene, a protein product of a gene, a polypeptide fragment encoding a specific protein domain, or an RNA molecule can be delivered into a target cell and the functional consequences analyzed. Microinjection can be used to deliver antibody targeted to a specific protein domain in order to analyze the requirement of the protein for specific cell functions such as cell cycle progression, transcription of specific genes, or intracellular transport. This chapter describes examples of the successful use of microinjection to probe adenovirus E1A regulatory mechanisms. Detailed methods are provided for manual and semiautomatic microinjection of mammalian cells as well as bioassay protocols for microinjected cells including immunofluorescence, colorimetic, in situ hybridization, and autoradiography.

Influenza polymerase encoding mRNAs utilize atypical mRNA nuclear export.

PubMed

Larsen, Sean; Bui, Steven; Perez, Veronica; Mohammad, Adeba; Medina-Ramirez, Hilario; Newcomb, Laura L

2014-08-28

Influenza is a segmented negative strand RNA virus. Each RNA segment is encapsulated by influenza nucleoprotein and bound by the viral RNA dependent RNA polymerase (RdRP) to form viral ribonucleoproteins responsible for RNA synthesis in the nucleus of the host cell. Influenza transcription results in spliced mRNAs (M2 and NS2), intron-containing mRNAs (M1 and NS1), and intron-less mRNAs (HA, NA, NP, PB1, PB2, and PA), all of which undergo nuclear export into the cytoplasm for translation. Most cellular mRNA nuclear export is Nxf1-mediated, while select mRNAs utilize Crm1. Here we inhibited Nxf1 and Crm1 nuclear export prior to infection with influenza A/Udorn/307/1972(H3N2) virus and analyzed influenza intron-less mRNAs using cellular fractionation and reverse transcription-quantitative polymerase chain reaction (RT-qPCR). We examined direct interaction between Nxf1 and influenza intron-less mRNAs using immuno purification of Nxf1 and RT-PCR of associated RNA. Inhibition of Nxf1 resulted in less influenza intron-less mRNA export into the cytoplasm for HA and NA influenza mRNAs in both human embryonic kidney cell line (293 T) and human lung adenocarcinoma epithelial cell line (A549). However, in 293 T cells no change was observed for mRNAs encoding the components of the viral ribonucleoproteins; NP, PA, PB1, and PB2, while in A549 cells, only PA, PB1, and PB2 mRNAs, encoding the RdRP, remained unaffected; NP mRNA was reduced in the cytoplasm. In A549 cells NP, NA, HA, mRNAs were found associated with Nxf1 but PA, PB1, and PB2 mRNAs were not. Crm1 inhibition also resulted in no significant difference in PA, PB1, and PB2 mRNA nuclear export. These results further confirm Nxf1-mediated nuclear export is functional during the influenza life cycle and hijacked for select influenza mRNA nuclear export. We reveal a cell type difference for Nxf1-mediated nuclear export of influenza NP mRNA, a reminder that cell type can influence molecular mechanisms. Importantly, we conclude that in both A549 and 293 T cells, PA, PB1, and PB2 mRNA nuclear export is Nxf1 and Crm1 independent. Our data support the hypothesis that PA, PB1, and PB2 mRNAs, encoding the influenza RdRP, utilize atypical mRNA nuclear export.

GABA metabolism pathway genes, UGA1 and GAD1, regulate replicative lifespan in Saccharomycescerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kamei, Yuka; Tamura, Takayuki; Yoshida, Ryo

2011-04-01

Highlights: {yields}We demonstrate that two genes in the yeast GABA metabolism pathway affect aging. {yields} Deletion of the UGA1 or GAD1 genes extends replicative lifespan. {yields} Addition of GABA to wild-type cultures has no effect on lifespan. {yields} Intracellular GABA levels do not differ in longevity mutants and wild-type cells. {yields} Levels of tricarboxylic acid cycle intermediates positively correlate with lifespan. -- Abstract: Many of the genes involved in aging have been identified in organisms ranging from yeast to human. Our previous study showed that deletion of the UGA3 gene-which encodes a zinc-finger transcription factor necessary for {gamma}-aminobutyric acid (GABA)-dependentmore » induction of the UGA1 (GABA aminotransferase), UGA2 (succinate semialdehyde dehydrogenase), and UGA4 (GABA permease) genes-extends replicative lifespan in the budding yeast Saccharomycescerevisiae. Here, we found that deletion of UGA1 lengthened the lifespan, as did deletion of UGA3; in contrast, strains with UGA2 or UGA4 deletions exhibited no lifespan extension. The {Delta}uga1 strain cannot deaminate GABA to succinate semialdehyde. Deletion of GAD1, which encodes the glutamate decarboxylase that converts glutamate into GABA, also increased lifespan. Therefore, two genes in the GABA metabolism pathway, UGA1 and GAD1, were identified as aging genes. Unexpectedly, intracellular GABA levels in mutant cells (except for {Delta}uga2 cells) did not differ from those in wild-type cells. Addition of GABA to culture media, which induces transcription of the UGA structural genes, had no effect on replicative lifespan of wild-type cells. Multivariate analysis of {sup 1}H nuclear magnetic resonance spectra for the whole-cell metabolite levels demonstrated a separation between long-lived and normal-lived strains. Gas chromatography-mass spectrometry analysis of identified metabolites showed that levels of tricarboxylic acid cycle intermediates positively correlated with lifespan extension. These results strongly suggest reduced activity of the GABA-metabolizing enzymes extends lifespan by shifting carbon metabolism toward respiration, as calorie restriction does.« less

Memory, priority encoding, and overcoming high-value proactive interference in younger and older adults.

PubMed

Friedman, Michael C; Castel, Alan D

2013-01-01

It is often necessary to remember important information while directing attention away from encoding less valuable information. To examine how aging influences the ability to control and update the encoding of high-value information, younger and older adults studied six lists of words that varied in terms of the point values associated with each word. The words were paired with the same high and low point values for three study-test cycles, but on the fourth and subsequent cycles the value-word pairings were switched such that the lowest value pairs became the highest values (and vice versa). For the first three study-test cycles, younger adults outperformed older adults in terms of the number of words recalled and overall point totals, but performance was similar in terms of selectively remembering high-value words. When the values were switched, both groups displayed substantial interference from the previous pairings. Although both groups improved with additional study-test cycles, only younger adults were able to fully recover from the interference effects. A similar, and more pronounced, set of results were obtained when positive and negative point values were paired with the words. The findings are interpreted in a value-directed remembering framework, emphasizing the role of benefits and costs of strategic encoding and age-related differences in the effects of interference on memory.

Ultraviolet stress delays chromosome replication in light/dark synchronized cells of the marine cyanobacterium Prochlorococcus marinus PCC9511

PubMed Central

2010-01-01

Background The marine cyanobacterium Prochlorococcus is very abundant in warm, nutrient-poor oceanic areas. The upper mixed layer of oceans is populated by high light-adapted Prochlorococcus ecotypes, which despite their tiny genome (~1.7 Mb) seem to have developed efficient strategies to cope with stressful levels of photosynthetically active and ultraviolet (UV) radiation. At a molecular level, little is known yet about how such minimalist microorganisms manage to sustain high growth rates and avoid potentially detrimental, UV-induced mutations to their DNA. To address this question, we studied the cell cycle dynamics of P. marinus PCC9511 cells grown under high fluxes of visible light in the presence or absence of UV radiation. Near natural light-dark cycles of both light sources were obtained using a custom-designed illumination system (cyclostat). Expression patterns of key DNA synthesis and repair, cell division, and clock genes were analyzed in order to decipher molecular mechanisms of adaptation to UV radiation. Results The cell cycle of P. marinus PCC9511 was strongly synchronized by the day-night cycle. The most conspicuous response of cells to UV radiation was a delay in chromosome replication, with a peak of DNA synthesis shifted about 2 h into the dark period. This delay was seemingly linked to a strong downregulation of genes governing DNA replication (dnaA) and cell division (ftsZ, sepF), whereas most genes involved in DNA repair (such as recA, phrA, uvrA, ruvC, umuC) were already activated under high visible light and their expression levels were only slightly affected by additional UV exposure. Conclusions Prochlorococcus cells modified the timing of the S phase in response to UV exposure, therefore reducing the risk that mutations would occur during this particularly sensitive stage of the cell cycle. We identified several possible explanations for the observed timeshift. Among these, the sharp decrease in transcript levels of the dnaA gene, encoding the DNA replication initiator protein, is sufficient by itself to explain this response, since DNA synthesis starts only when the cellular concentration of DnaA reaches a critical threshold. However, the observed response likely results from a more complex combination of UV-altered biological processes. PMID:20670397

Expression and function of system N glutamine transporters (SN1/SN2 or SNAT3/SNAT5) in retinal ganglion cells.

PubMed

Umapathy, Nagavedi S; Dun, Ying; Martin, Pamela M; Duplantier, Jennifer N; Roon, Penny; Prasad, Puttur; Smith, Sylvia B; Ganapathy, Vadivel

2008-11-01

Glutamine transport is essential for the glutamate-glutamine cycle, which occurs between neurons and glia. System N, consisting of SN1 (SNAT3) and SN2 (SNAT5), is the principal mediator of glutamine transport in retinal Müller cells. Mediators of glutamine transport in retinal ganglion cells were investigated. The relative contributions of various transport systems for glutamine uptake (systems N, A, L, y+L, ASCT, and ATB(0,+)) were examined in RGC-5 cells based on differential features of the individual transport systems. mRNA for the genes encoding members of these transport systems were analyzed by RT-PCR. Based on these data, SN1 and SN2 were analyzed in mouse retina, RGC-5 cells, and primary mouse ganglion cells (GCs) by in situ hybridization (ISH), immunofluorescence (IF), and Western blotting. Three transport systems--N, A, and L--participated in glutamine uptake in RGC-5 cells. System N was the principal contributor; systems A and L contributed considerably less. ISH and IF revealed SN1 and SN2 expression in the ganglion, inner nuclear, and photoreceptor cell layers. SN1 and SN2 colocalized with the ganglion cell marker Thy 1.2 and with the Müller cell marker vimentin, confirming their presence in both retinal cell types. SN1 and SN2 proteins were detected in primary mouse GCs. These findings suggest that in addition to its role in glutamine uptake in retinal glial cells, system N contributes significantly to glutamine uptake in ganglion cells and, hence, contributes to the retinal glutamate-glutamine cycle.

Molecular cloning of TA16, a transcriptional repressor that may mediate glucocorticoid-induced growth arrest of leiomyosarcoma cells.

PubMed

Fan, W; Ma, J X; Cheng, L; Norris, J S

1997-08-01

The DDT1 MF2 smooth muscle tumor cell line was derived from an estrogen/androgen-induced leiomyosarcoma that arose in the ductus deferens of a Syrian hamster. The growth of this cell line is arrested at the G0/G1 phase of the cell cycle after treatment with glucocorticoids. To identify the putative gene(s) that are potentially involved in this hormone-induced cell growth arrest, we have used a differential screening technique to clone those genes whose expression is induced or up-regulated by glucocorticoids. A number of glucocorticoid response genes were thereby isolated from the leiomyosarcoma cells. One of these clones, termed TA16, was found to be markedly up-regulated by glucocorticoids in DDT1 MF2 cells, but only marginally changed in GR1 cells, a glucocorticoid-resistant variant that was selected from the wild type DDT1 MF2 cell. Isolation and sequencing of its intact cDNA indicated that the TA16 encodes a protein 485 amino acids long, and its sequence is closely homologous to a novel transcriptional repressor that presumably represses the transcription activity of some zinc finger transcriptional factors through a direct interaction. Transfection assays demonstrated that introduction of an antisense TA16 cDNA expression vector, controlled by an MMTV promoter, into the DDT1 MF2 cell significantly relieved the glucocorticoid-induced cell growth arrest. This finding suggests that TA16 might participate in the mediation of glucocorticoid-induced cell cycle arrest in leiomyosarcoma cells.

RNAi-Mediated Knockdown of Catalase Causes Cell Cycle Arrest in SL-1 Cells and Results in Low Survival Rate of Spodoptera litura (Fabricius)

PubMed Central

Hu, Meiying; Chen, Shaohua; Muhammad, Rizwan-ul-Haq; Dong, Xiaolin; Gong, Liang

2013-01-01

Deregulated reactive oxygen species (ROS) production can lead to the disruption of structural and functional integrity of cells as a consequence of reactive interaction between ROS and various biological components. Catalase (CAT) is a common enzyme existing in nearly all organisms exposed to oxygen, which decomposes harmful hydrogen peroxide, into water and oxygen. In this study, the full length sequence that encodes CAT-like protein from Spodoptera litura named siltCAT (GenBank accession number: JQ_663444) was cloned and characterized. Amino acid sequence alignment showed siltCAT shared relatively high conservation with other insect, especially the conserved residues which defined heme and NADPH orientation. Expression pattern analysis showed that siltCAT mRNA was mainly expressed in the fat body, midgut, cuticle and malpighian tube, and as well as over last instar larvae, pupa and adult stages. RNA interference was used to silence CAT gene in SL-1 cells and the fourth-instar stage of S. litura larvae respectively. Our results provided evidence that CAT knockdown induced ROS generation, cell cycle arrest and apoptosis in SL-1 cells. It also confirmed the decrease in survival rate because of increased ROS production in experimental groups injected with double-stranded RNA of CAT (dsCAT). This study implied that ROS scavenging by CAT is important for S. litura survival. PMID:23555693

Nutrient Dependence of RNase E Essentiality in Escherichia coli

PubMed Central

Tamura, Masaru; Moore, Christopher J.

2013-01-01

Escherichia coli cells normally require RNase E activity to form colonies (colony-forming ability [CFA]). The CFA-defective phenotype of cells lacking RNase E is partly reversed by overexpression of the related endoribonuclease RNase G or by mutation of the gene encoding the RNA helicase DeaD. We found that the carbon source utilization by rne deaD doubly mutant bacteria differs from that of rne+ cells and from that of cells mutated in deaD alone and that the loss of rne function in these bacteria limits conversion of the glycolytic pathway product phosphoenolpyruvate to the tricarboxylic acid (TCA) cycle intermediate oxaloacetic acid. We show that the mechanism underlying this effect is reduced production of the enzyme phosphoenolpyruvate carboxylase (PPC) and that adventitious overexpression of PPC, which facilitates phosphoenolpyruvate utilization and connects the glycolytic pathway with the TCA cycle, restored CFA to rne deaD mutant bacteria cultured on carbon sources that otherwise were unable to sustain growth. We further show that bacteria producing full-length RNase E, which allows formation of degradosomes, have nutritional requirements different from those of cells supplied with only the N-terminal catalytic region of RNase E and that mitigation of RNase E deficiency by overexpression of a related RNase, RNase G, is also affected by carbon source. Our results reveal previously unsuspected effects of RNase E deficiency and degradosome formation on nutrient utilization by E. coli cells. PMID:23275245

Determination of the transforming activities of adenovirus oncogenes.

PubMed

Nevels, Michael; Dobner, Thomas

2007-01-01

The last 50 yr of molecular biological investigations into human adenoviruses (Ads) have contributed enormously to our understanding of the basic principles of normal and malignant cell growth. Much of this knowledge stems from analyses of the Ad productive infection cycle in permissive host cells. Also, initial observations concerning the transforming potential of human Ads subsequently revealed decisive insights into the molecular mechanisms of the origins of cancer and established Ads as a model system for explaining virus-mediated transformation processes. Today it is well established that cell transformation by human Ads is a multistep process involving several gene products encoded in early transcription units 1A (E1A) and 1B (E1B). Moreover, a large body of evidence now indicates that alternative or additional mechanisms are engaged in Ad-mediated oncogenic transformation involving gene products encoded in early region 4 (E4) as well as epigenetic changes resulting from viral DNA integration. In particular, studies on the transforming potential of several E4 gene products have now revealed new pathways that point to novel general mechanisms of virus-mediated oncogenesis. In this chapter we describe in vitro and in vivo assays to determine the transforming and oncogenic activities of the E1A, E1B, and E4 oncoproteins in primary baby rat kidney cells and athymic nude mice.

Human T-cell leukemia virus-I tax oncoprotein functionally targets a subnuclear complex involved in cellular DNA damage-response.

PubMed

Haoudi, Abdelali; Daniels, Rodney C; Wong, Eric; Kupfer, Gary; Semmes, O John

2003-09-26

The virally encoded oncoprotein Tax has been implicated in HTLV-1-mediated cellular transformation. The exact mechanism by which this protein contributes to the oncogenic process is not known. However, it has been hypothesized that Tax induces genomic instability via repression of cellular DNA repair. We examined the effect of de novo Tax expression upon the cell cycle, because appropriate activation of cell cycle checkpoints is essential to a robust damage-repair response. Upon induction of tax expression, Jurkat T-cells displayed a pronounced accumulation in G2/M that was reversible by caffeine. We examined the G2-specific checkpoint signaling response in these cells and found activation of the ATM/chk2-mediated pathway, whereas the ATR/chk1-mediated response was unaffected. Immunoprecipitation with anti-chk2 antibody results in co-precipitation of Tax demonstrating a direct interaction of Tax with a chk2-containing complex. We also show that Tax targets a discrete nuclear site and co-localizes with chk2 and not chk1. This nuclear site, previously identified as Tax Speckled Structures (TSS), also contains the early damage response factor 53BP1. The recruitment of 53BP1 to TSS is dependent upon ATM signaling and requires expression of Tax. Specifically, Tax expression induces redistribution of diffuse nuclear 53BP1 to the TSS foci. Taken together these data suggest that the TSS describe a unique nuclear site involved in DNA damage recognition, repair response, and cell cycle checkpoint activation. We suggest that association of Tax with this multifunctional subnuclear site results in disruption of a subset of the site-specific activities and contributes to cellular genomic instability.

Inhibition of PKR Activation by the Proline-Rich RNA Binding Domain of the Herpes Simplex Virus Type 1 Us11 Protein

PubMed Central

Poppers, Jeremy; Mulvey, Matthew; Khoo, David; Mohr, Ian

2000-01-01

Upon activation by double-stranded RNA in virus-infected cells, the cellular PKR kinase phosphorylates the translation initiation factor eukaryotic initiation factor 2 (eIF2) and thereby inhibits protein synthesis. The γ34.5 and Us11 gene products encoded by herpes simplex virus type 1 (HSV-1) are dedicated to preventing the accumulation of phosphorylated eIF2. While the γ34.5 gene specifies a regulatory subunit for protein phosphatase 1α, the Us11 gene encodes an RNA binding protein that also prevents PKR activation. γ34.5 mutants fail to grow on a variety of human cells as phosphorylated eIF2 accumulates and protein synthesis ceases prior to the completion of the viral life cycle. We demonstrate that expression of a 68-amino-acid fragment of Us11 containing a novel proline-rich basic RNA binding domain allows for sustained protein synthesis and enhanced growth of γ34.5 mutants. Furthermore, this fragment is sufficient to inhibit activation of the cellular PKR kinase in a cell-free system, suggesting that the intrinsic activities of this small fragment, notably RNA binding and ribosome association, may be required to prevent PKR activation. PMID:11070019

Inhibition of PKR activation by the proline-rich RNA binding domain of the herpes simplex virus type 1 Us11 protein.

PubMed

Poppers, J; Mulvey, M; Khoo, D; Mohr, I

2000-12-01

Upon activation by double-stranded RNA in virus-infected cells, the cellular PKR kinase phosphorylates the translation initiation factor eukaryotic initiation factor 2 (eIF2) and thereby inhibits protein synthesis. The gamma 34.5 and Us11 gene products encoded by herpes simplex virus type 1 (HSV-1) are dedicated to preventing the accumulation of phosphorylated eIF2. While the gamma 34.5 gene specifies a regulatory subunit for protein phosphatase 1 alpha, the Us11 gene encodes an RNA binding protein that also prevents PKR activation. gamma 34.5 mutants fail to grow on a variety of human cells as phosphorylated eIF2 accumulates and protein synthesis ceases prior to the completion of the viral life cycle. We demonstrate that expression of a 68-amino-acid fragment of Us11 containing a novel proline-rich basic RNA binding domain allows for sustained protein synthesis and enhanced growth of gamma 34.5 mutants. Furthermore, this fragment is sufficient to inhibit activation of the cellular PKR kinase in a cell-free system, suggesting that the intrinsic activities of this small fragment, notably RNA binding and ribosome association, may be required to prevent PKR activation.

Deregulation of tumor angiogenesis and blockade of tumor growth in PPARbeta-deficient mice.

PubMed

Müller-Brüsselbach, Sabine; Kömhoff, Martin; Rieck, Markus; Meissner, Wolfgang; Kaddatz, Kerstin; Adamkiewicz, Jürgen; Keil, Boris; Klose, Klaus J; Moll, Roland; Burdick, Andrew D; Peters, Jeffrey M; Müller, Rolf

2007-08-08

The peroxisome proliferator-activated receptor-beta (PPARbeta) has been implicated in tumorigenesis, but its precise role remains unclear. Here, we show that the growth of syngeneic Pparb wild-type tumors is impaired in Pparb(-/-) mice, concomitant with a diminished blood flow and an abundance of hyperplastic microvascular structures. Matrigel plugs containing pro-angiogenic growth factors harbor increased numbers of morphologically immature, proliferating endothelial cells in Pparb(-/-) mice, and retroviral transduction of Pparb triggers microvessel maturation. We have identified the Cdkn1c gene encoding the cell cycle inhibitor p57(Kip2) as a PPARbeta target gene and a mediator of the PPARbeta-mediated inhibition of cell proliferation, which provides a possible mechanistic explanation for the observed tumor endothelial hyperplasia and deregulation of tumor angiogenesis in Pparb(-/-) mice. Our data point to an unexpected essential role for PPARbeta in constraining tumor endothelial cell proliferation to allow for the formation of functional tumor microvessels.

Battle against cancer: an everlasting saga of p53.

PubMed

Hao, Qian; Cho, William C

2014-12-01

Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress-p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.

Heterochromatin-Encoded Satellite RNAs Induce Breast Cancer.

PubMed

Zhu, Quan; Hoong, Nien; Aslanian, Aaron; Hara, Toshiro; Benner, Christopher; Heinz, Sven; Miga, Karen H; Ke, Eugene; Verma, Sachin; Soroczynski, Jan; Yates, John R; Hunter, Tony; Verma, Inder M

2018-06-07

Heterochromatic repetitive satellite RNAs are extensively transcribed in a variety of human cancers, including BRCA1 mutant breast cancer. Aberrant expression of satellite RNAs in cultured cells induces the DNA damage response, activates cell cycle checkpoints, and causes defects in chromosome segregation. However, the mechanism by which satellite RNA expression leads to genomic instability is not well understood. Here we provide evidence that increased levels of satellite RNAs in mammary glands induce tumor formation in mice. Using mass spectrometry, we further show that genomic instability induced by satellite RNAs occurs through interactions with BRCA1-associated protein networks required for the stabilization of DNA replication forks. Additionally, de-stabilized replication forks likely promote the formation of RNA-DNA hybrids in cells expressing satellite RNAs. These studies lay the foundation for developing novel therapeutic strategies that block the effects of non-coding satellite RNAs in cancer cells. Copyright © 2018 Elsevier Inc. All rights reserved.

Peptidoglycan architecture can specify division planes in Staphylococcus aureus.

PubMed

Turner, Robert D; Ratcliffe, Emma C; Wheeler, Richard; Golestanian, Ramin; Hobbs, Jamie K; Foster, Simon J

2010-06-15

Division in Staphylococci occurs equatorially and on specific sequentially orthogonal planes in three dimensions, resulting, after incomplete cell separation, in the 'bunch of grapes' cluster organization that defines the genus. The shape of Staphylococci is principally maintained by peptidoglycan. In this study, we use Atomic Force Microscopy (AFM) and fluorescence microscopy with vancomycin labelling to examine purified peptidoglycan architecture and its dynamics in Staphylococcus aureus and correlate these with the cell cycle. At the presumptive septum, cells were found to form a large belt of peptidoglycan in the division plane before the centripetal formation of the septal disc; this often had a 'piecrust' texture. After division, the structures remain as orthogonal ribs, encoding the location of past division planes in the cell wall. We propose that this epigenetic information is used to enable S. aureus to divide in sequentially orthogonal planes, explaining how a spherical organism can maintain division plane localization with fidelity over many generations.

6-Phosphofructokinase and ribulose-5-phosphate 3-epimerase in methylotrophic Bacillus methanolicus ribulose monophosphate cycle.

PubMed

Le, Simone Balzer; Heggeset, Tonje Marita Bjerkan; Haugen, Tone; Nærdal, Ingemar; Brautaset, Trygve

2017-05-01

D-Ribulose-5-phosphate-3-epimerase (RPE) and 6-phosphofructokinase (PFK) catalyse two reactions in the ribulose monophosphate (RuMP) cycle in Bacillus methanolicus. The B. methanolicus wild-type strain MGA3 possesses two putative rpe and pfk genes encoded on plasmid pBM19 (rpe1-MGA3 and pfk1-MGA3) and on the chromosome (rpe2-MGA3 and pfk2-MGA3). The wild-type strain PB1 also encodes putative rpe and pfk genes on plasmid pBM20 (rpe1-PB1 and pfk1-PB1*); however, it only harbours a chromosomal pfk gene (pfk2-PB1). Transcription of the plasmid-encoded genes was 10-fold to 15-fold upregulated in cells growing on methanol compared to mannitol, while the chromosomal genes were transcribed at similar levels under both conditions in both strains. All seven gene products were recombinantly produced in Escherichia coli, purified and biochemically characterized. All three RPEs were active as hexamers, catalytically stimulated by Mg 2+ and Mn 2+ and displayed similar K' values (56-75 μM) for ribulose 5-phosphate. Rpe2-MGA3 showed displayed 2-fold lower V max (49 U/mg) and a significantly reduced thermostability compared to the two Rpe1 proteins. Pfk1-PB1* was shown to be non-functional. The PFKs were active both as octamers and as tetramers, were catalytically stimulated by Mg 2+ and Mn 2+ , and displayed similar thermostabilities. The PFKs have similar K m values for fructose 6-phosphate (0.61-0.94 μM) and for ATP (0.38-0.82 μM), while Pfk1-MGA3 had a 2-fold lower V max (6.3 U/mg) compared to the two Pfk2 proteins. Our results demonstrate that MGA3 and PB1 exert alternative solutions to plasmid-dependent methylotrophy, including genetic organization, regulation, and biochemistry of RuMP cycle enzymes.

Adaptation of Saccharomyces cerevisiae to the Herbicide 2,4-Dichlorophenoxyacetic Acid, Mediated by Msn2p- and Msn4p-Regulated Genes: Important Role of SPI1

PubMed Central

Simões, T.; Teixeira, M. C.; Fernandes, A. R.; Sá-Correia, Isabel

2003-01-01

The possible roles of 13 Msn2p- and Msn4p-regulated genes in the adaptation of Saccharomyces cerevisiae to the herbicide 2,4-d-dichlorophenoxyacetic acid (2,4-D) were examined. Single deletion of genes involved in defense against oxidizing agents (CTT1, GRX1, and GRX2/TTR1) or encoding chaperones of the HSP70 family (SSA1, SSA4, and SSE2) showed a slight effect. A more significant role was observed for the heat shock genes HSP78, HSP26, HSP104, HSP12, and HSP42, most of which encode molecular chaperones. However, the SPI1 gene, encoding a member of the glycosylphosphatidylinositol-anchored cell wall protein family, emerged as the major determinant of 2,4-D resistance. SPI1 expression reduced the loss of viability of an unadapted yeast population suddenly exposed to the herbicide, allowing earlier growth resumption. Significantly, yeast adaptation to 2,4-D involves the rapid and transient Msn2p- and Msn4p-mediated activation (fivefold) of SPI1 transcription. SPI1 mRNA levels were reduced to values slightly above those in unstressed cells when the adapted population started duplication in the presence of 2,4-D. Since SPI1 deletion leads to the higher β-1,3-glucanase sensitivity of 2,4-D-stressed cells, it was hypothesized that adaptation may involve an Spi1p-mediated increase in the diffusional restriction of the liposoluble acid form of the herbicide across the cell envelope. Such a cell response would avoid a futile cycle due to acid reentry into the cell counteracting the active export of the anionic form, presumably through an inducible plasma membrane transporter(s). Consistent with this concept, the concentration of 14C-labeled 2,4-D in 2,4-D-energized adapted Δspi1 mutant cells and the consequent intracellular acidification are higher than in wild-type cells. PMID:12839777

Cyclomodulins in Urosepsis Strains of Escherichia coli▿

PubMed Central

Dubois, Damien; Delmas, Julien; Cady, Anne; Robin, Frédéric; Sivignon, Adeline; Oswald, Eric; Bonnet, Richard

2010-01-01

Determinants of urosepsis in Escherichia coli remain incompletely defined. Cyclomodulins (CMs) are a growing functional family of toxins that hijack the eukaryotic cell cycle. Four cyclomodulin types are actually known in E. coli: cytotoxic necrotizing factors (CNFs), cycle-inhibiting factor (Cif), cytolethal distending toxins (CDTs), and the pks-encoded toxin. In the present study, the distribution of CM-encoding genes and the functionality of these toxins were investigated in 197 E. coli strains isolated from patients with community-acquired urosepsis (n = 146) and from uninfected subjects (n = 51). This distribution was analyzed in relation to the phylogenetic background, clinical origin, and antibiotic resistance of the strains. It emerged from this study that strains harboring the pks island and the cnf1 gene (i) were strongly associated with the B2 phylogroup (P, <0.001), (ii) frequently harbored both toxin-encoded genes in phylogroup B2 (33%), and (iii) were predictive of a urosepsis origin (P, <0.001 to 0.005). However, the prevalences of the pks island among phylogroup B2 strains, in contrast to those of the cnf1 gene, were not significantly different between fecal and urosepsis groups, suggesting that the pks island is more important for the colonization process and the cnf1 gene for virulence. pks- or cnf1-harboring strains were significantly associated with susceptibility to antibiotics (amoxicillin, cotrimoxazole, and quinolones [P, <0.001 to 0.043]). Otherwise, only 6% and 1% of all strains harbored the cdtB and cif genes, respectively, with no particular distribution by phylogenetic background, antimicrobial susceptibility, or clinical origin. PMID:20375237

Inactivation of AMMECR1 is associated with growth, bone, and heart alterations.

PubMed

Moysés-Oliveira, Mariana; Giannuzzi, Giuliana; Fish, Richard J; Rosenfeld, Jill A; Petit, Florence; Soares, Maria de Fatima; Kulikowski, Leslie Domenici; Di-Battista, Adriana; Zamariolli, Malú; Xia, Fan; Liehr, Thomas; Kosyakova, Nadezda; Carvalheira, Gianna; Parker, Michael; Seaby, Eleanor G; Ennis, Sarah; Gilbert, Rodney D; Hagelstrom, R Tanner; Cremona, Maria L; Li, Wenhui L; Malhotra, Alka; Chandrasekhar, Anjana; Perry, Denise L; Taft, Ryan J; McCarrier, Julie; Basel, Donald G; Andrieux, Joris; Stumpp, Taiza; Antunes, Fernanda; Pereira, Gustavo José; Neerman-Arbez, Marguerite; Meloni, Vera Ayres; Drummond-Borg, Margaret; Melaragno, Maria Isabel; Reymond, Alexandre

2018-02-01

We report five individuals with loss-of-function of the X-linked AMMECR1: a girl with a balanced X-autosome translocation and inactivation of the normal X-chromosome; two boys with maternally inherited and de novo nonsense variants; and two half-brothers with maternally inherited microdeletion variants. They present with short stature, cardiac and skeletal abnormalities, and hearing loss. Variants of unknown significance in AMMECR1 in four male patients from two families with partially overlapping phenotypes were previously reported. AMMECR1 is coexpressed with genes implicated in cell cycle regulation, five of which were previously associated with growth and bone alterations. Our knockdown of the zebrafish orthologous gene resulted in phenotypes reminiscent of patients' features. The increased transcript and encoded protein levels of AMMECR1L, an AMMECR1 paralog, in the t(X;9) patient's cells indicate a possible partial compensatory mechanism. AMMECR1 and AMMECR1L proteins dimerize and localize to the nucleus as suggested by their nucleic acid-binding RAGNYA folds. Our results suggest that AMMECR1 is potentially involved in cell cycle control and linked to a new syndrome with growth, bone, heart, and kidney alterations with or without elliptocytosis. © 2017 Wiley Periodicals, Inc.

Inhibin binding protein in rats: alternative transcripts and regulation in the pituitary across the estrous cycle.

PubMed

Bernard, D J; Woodruff, T K

2001-04-01

Inhibin binding protein (InhBP) and the transforming growth factor-beta (TGF beta) type III receptor, beta glycan, have been identified as putative inhibin coreceptors. Here we cloned the InhBP cDNA in rats and predict that it encodes a large membrane-spanning protein that is part of the Ig superfamily, as has been described for humans. Two abundant InhBP transcripts (4.4 and 1.8 kb) were detected in the adult rat pituitary. The larger transcript encodes the full-length protein while the 1.8-kb transcript (InhBP-short or InhBP-S) corresponds to a splice variant of the receptor. This truncated isoform contains only the N-terminal signal peptide and first two (of 12) Ig-like domains observed in the full-length InhBP (InhBP-long or InhBP-L). InhBP-S does not contain a transmembrane domain and is predicted to be a soluble protein. Beta glycan was also detected in the pituitary; however, it was most abundant within the intermediate lobe. Although we also observed beta glycan immunopositive cells in the anterior pituitary, they rarely colocalized with FSH beta-producing cells. We next examined physiological regulation of the coreceptors across the rat estrous cycle. Like circulating inhibin A and inhibin B levels, pituitary InhBP-L and InhBP-S mRNA levels were dynamically regulated across the cycle and were negatively correlated with serum FSH levels. Expression of both forms of InhBP was also positively correlated with serum inhibin B, but not inhibin A, levels. These data are particularly interesting in light of our in vitro observations that InhBP may function as an inhibin B-specific coreceptor. Pituitary beta glycan mRNA levels did not fluctuate across the cycle nor did they correlate with serum FSH. These observations, coupled with its pattern of expression within the pituitary, indicate that beta glycan likely functions as more than merely an inhibin coreceptor within the pituitary. A direct role for InhBP or beta glycan in regulation of pituitary FSH by inhibin in vivo has yet to be determined, but the demonstration of dynamic regulation of pituitary InhBP and its negative relation to serum FSH across the estrous cycle is an important step in this direction.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Winkel, Matthias; Salman-Carvalho, Verena; Woyke, Tanja

Large, colorless sulfur-oxidizing bacteria (LSB) of the family Beggiatoaceae form thick mats at sulfidic sediment surfaces, where they efficiently detoxify sulfide before it enters the water column. The genus Thiomargarita harbors the largest known free-living bacteria with cell sizes of up to 750 μm in diameter. In addition to their ability to oxidize reduced sulfur compounds, some Thiornargarita spp. are known to store large amounts of nitrate, phosphate and elemental sulfur internally. To date little is known about their energy yielding metabolic pathways, and how these pathways compare to other Beggiatoaceae. Here, we present a draft single-cell genome of amore » chain-forming " Candidatus Thiomargarita nelsonii Thio36", and conduct a comparative analysis to five draft and one full genome of other members of the Beggiatoaceae. " Ca. T. nelsonii Thio36" is able to respire nitrate to both ammonium and dinitrogen, which allows them to flexibly respond to environmental changes. Genes for sulfur oxidation and inorganic carbon fixation confirmed that " Ca. T. nelsonii Thio36" can function as a chemolithoautotroph. Carbon can be fixed via the Calvin-Benson-Bassham cycle, which is common among the Beggiatoaceae. In addition we found key genes of the reductive tricarboxylic acid cycle that point toward an alternative CO 2 fixation pathway. Surprisingly, " Ca. T. nelsonii Thio36" also encodes key genes of the C2-cycle that convert 2-phosphoglycolate to 3-phosphoglycerate during photorespiration in higher plants and cyanobacteria. Moreover, we identified a novel trait of a flavin-based energy bifurcation pathway coupled to a Na +-translocating membrane complex (Rnf). The coupling of these pathways may be key to surviving long periods of anoxia. As other Beggiatoaceae " Ca. T. nelsonii Thio36" encodes many genes similar to those of (filamentous) cyanobacteria. In conclusion, the genome of " Ca. T. nelsonii Thio36" provides additional insight into the ecology of giant sulfur-oxidizing bacteria, and reveals unique genomic features for the Thiomargarita lineage within the Beggiatoaceae.« less

Methods to Assess Mitochondrial Morphology in Mammalian Cells Mounting Autophagic or Mitophagic Responses.

PubMed

Marchi, S; Bonora, M; Patergnani, S; Giorgi, C; Pinton, P

2017-01-01

It is widely acknowledged that mitochondria are highly active structures that rapidly respond to cellular and environmental perturbations by changing their shape, number, and distribution. Mitochondrial remodeling is a key component of diverse biological processes, ranging from cell cycle progression to autophagy. In this chapter, we describe different methodologies for the morphological study of the mitochondrial network. Instructions are given for the preparation of samples for fluorescent microscopy, based on genetically encoded strategies or the employment of synthetic fluorescent dyes. We also propose detailed protocols to analyze mitochondrial morphometric parameters from both three-dimensional and bidimensional datasets. Finally, we describe a protocol for the visualization and quantification of mitochondrial structures through electron microscopy. © 2017 Elsevier Inc. All rights reserved.

Systems-level analysis of risk genes reveals the modular nature of schizophrenia.

PubMed

Liu, Jiewei; Li, Ming; Luo, Xiong-Jian; Su, Bing

2018-05-19

Schizophrenia (SCZ) is a complex mental disorder with high heritability. Genetic studies (especially recent genome-wide association studies) have identified many risk genes for schizophrenia. However, the physical interactions among the proteins encoded by schizophrenia risk genes remain elusive and it is not known whether the identified risk genes converge on common molecular networks or pathways. Here we systematically investigated the network characteristics of schizophrenia risk genes using the high-confidence protein-protein interactions (PPI) from the human interactome. We found that schizophrenia risk genes encode a densely interconnected PPI network (P = 4.15 × 10 -31 ). Compared with the background genes, the schizophrenia risk genes in the interactome have significantly higher degree (P = 5.39 × 10 -11 ), closeness centrality (P = 7.56 × 10 -11 ), betweeness centrality (P = 1.29 × 10 -11 ), clustering coefficient (P = 2.22 × 10 -2 ), and shorter average shortest path length (P = 7.56 × 10 -11 ). Based on the densely interconnected PPI network, we identified 48 hub genes and 4 modules formed by highly interconnected schizophrenia genes. We showed that the proteins encoded by schizophrenia hub genes have significantly more direct physical interactions. Gene ontology (GO) analysis revealed that cell adhesion, cell cycle, immune system response, and GABR-receptor complex categories were enriched in the modules formed by highly interconnected schizophrenia risk genes. Our study reveals that schizophrenia risk genes encode a densely interconnected molecular network and demonstrates the modular nature of schizophrenia. Copyright © 2018 Elsevier B.V. All rights reserved.

Novel microRNA-like viral small regulatory RNAs arising during human hepatitis A virus infection.

PubMed

Shi, Jiandong; Sun, Jing; Wang, Bin; Wu, Meini; Zhang, Jing; Duan, Zhiqing; Wang, Haixuan; Hu, Ningzhu; Hu, Yunzhang

2014-10-01

MicroRNAs (miRNAs), including host miRNAs and viral miRNAs, play vital roles in regulating host-virus interactions. DNA viruses encode miRNAs that regulate the viral life cycle. However, it is generally believed that cytoplasmic RNA viruses do not encode miRNAs, owing to inaccessible cellular miRNA processing machinery. Here, we provide a comprehensive genome-wide analysis and identification of miRNAs that were derived from hepatitis A virus (HAV; Hu/China/H2/1982), which is a typical cytoplasmic RNA virus. Using deep-sequencing and in silico approaches, we identified 2 novel virally encoded miRNAs, named hav-miR-1-5p and hav-miR-2-5p. Both of the novel virally encoded miRNAs were clearly detected in infected cells. Analysis of Dicer enzyme silencing demonstrated that HAV-derived miRNA biogenesis is Dicer dependent. Furthermore, we confirmed that HAV mature miRNAs were generated from viral miRNA precursors (pre-miRNAs) in host cells. Notably, naturally derived HAV miRNAs were biologically and functionally active and induced post-transcriptional gene silencing (PTGS). Genomic location analysis revealed novel miRNAs located in the coding region of the viral genome. Overall, our results show that HAV naturally generates functional miRNA-like small regulatory RNAs during infection. This is the first report of miRNAs derived from the coding region of genomic RNA of a cytoplasmic RNA virus. These observations demonstrate that a cytoplasmic RNA virus can naturally generate functional miRNAs, as DNA viruses do. These findings also contribute to improved understanding of host-RNA virus interactions mediated by RNA virus-derived miRNAs. © FASEB.

Transcriptional analysis of the conidiation pattern shift of the entomopathogenic fungus Metarhizium acridum in response to different nutrients.

PubMed

Wang, Zhenglong; Jin, Kai; Xia, Yuxian

2016-08-09

Most fungi, including entomopathogenic fungi, have two different conidiation patterns, normal and microcycle conidiation, under different culture conditions, eg, in media containing different nutrients. However, the mechanisms underlying the conidiation pattern shift are poorly understood. In this study, Metarhizium acridum undergoing microcycle conidiation on sucrose yeast extract agar (SYA) medium shifted to normal conidiation when the medium was supplemented with sucrose, nitrate, or phosphate. By linking changes in nutrients with the conidiation pattern shift and transcriptional changes, we obtained conidiation pattern shift libraries by Solexa/Illumina deep-sequencing technology. A comparative analysis demonstrated that the expression of 137 genes was up-regulated during the shift to normal conidiation, while the expression of 436 genes was up-regulated at the microcycle conidiation stage. A comparison of subtractive libraries revealed that 83, 216, and 168 genes were related to sucrose-induced, nitrate-induced, and phosphate-induced conidiation pattern shifts, respectively. The expression of 217 genes whose expression was specific to microcycle conidiation was further analyzed by the gene expression profiling via multigene concatemers method using mRNA isolated from M. acridum grown on SYA and the four normal conidiation media. The expression of 142 genes was confirmed to be up-regulated on standard SYA medium. Of these 142 genes, 101 encode hypothetical proteins or proteins of unknown function, and only 41 genes encode proteins with putative functions. Of these 41 genes, 18 are related to cell growth, 10 are related to cell proliferation, three are related to the cell cycle, three are related to cell differentiation, two are related to cell wall synthesis, two are related to cell division, and seven have other functions. These results indicate that the conidiation pattern shift in M. acridum mainly results from changes in cell growth and proliferation. The results indicate that M. acridum shifts conidiation pattern from microcycle conidiation to normal conidiation when there is increased sucrose, nitrate, or phosphate in the medium during microcycle conidiation. The regulation of conidiation patterning is a complex process involving the cell cycle and metabolism of M. acridum. This study provides essential information about the molecular mechanism of the induction of the conidiation pattern shift by single nutrients.

Random codon re-encoding induces stable reduction of replicative fitness of Chikungunya virus in primate and mosquito cells.

PubMed

Nougairede, Antoine; De Fabritus, Lauriane; Aubry, Fabien; Gould, Ernest A; Holmes, Edward C; de Lamballerie, Xavier

2013-02-01

Large-scale codon re-encoding represents a powerful method of attenuating viruses to generate safe and cost-effective vaccines. In contrast to specific approaches of codon re-encoding which modify genome-scale properties, we evaluated the effects of random codon re-encoding on the re-emerging human pathogen Chikungunya virus (CHIKV), and assessed the stability of the resultant viruses during serial in cellulo passage. Using different combinations of three 1.4 kb randomly re-encoded regions located throughout the CHIKV genome six codon re-encoded viruses were obtained. Introducing a large number of slightly deleterious synonymous mutations reduced the replicative fitness of CHIKV in both primate and arthropod cells, demonstrating the impact of synonymous mutations on fitness. Decrease of replicative fitness correlated with the extent of re-encoding, an observation that may assist in the modulation of viral attenuation. The wild-type and two re-encoded viruses were passaged 50 times either in primate or insect cells, or in each cell line alternately. These viruses were analyzed using detailed fitness assays, complete genome sequences and the analysis of intra-population genetic diversity. The response to codon re-encoding and adaptation to culture conditions occurred simultaneously, resulting in significant replicative fitness increases for both re-encoded and wild type viruses. Importantly, however, the most re-encoded virus failed to recover its replicative fitness. Evolution of these viruses in response to codon re-encoding was largely characterized by the emergence of both synonymous and non-synonymous mutations, sometimes located in genomic regions other than those involving re-encoding, and multiple convergent and compensatory mutations. However, there was a striking absence of codon reversion (<0.4%). Finally, multiple mutations were rapidly fixed in primate cells, whereas mosquito cells acted as a brake on evolution. In conclusion, random codon re-encoding provides important information on the evolution and genetic stability of CHIKV viruses and could be exploited to develop a safe, live attenuated CHIKV vaccine.

Evolution of the enzymes of the citric acid cycle and the glyoxylate cycle of higher plants. A case study of endosymbiotic gene transfer.

PubMed

Schnarrenberger, Claus; Martin, William

2002-02-01

The citric acid or tricarboxylic acid cycle is a central element of higher-plant carbon metabolism which provides, among other things, electrons for oxidative phosphorylation in the inner mitochondrial membrane, intermediates for amino-acid biosynthesis, and oxaloacetate for gluconeogenesis from succinate derived from fatty acids via the glyoxylate cycle in glyoxysomes. The tricarboxylic acid cycle is a typical mitochondrial pathway and is widespread among alpha-proteobacteria, the group of eubacteria as defined under rRNA systematics from which mitochondria arose. Most of the enzymes of the tricarboxylic acid cycle are encoded in the nucleus in higher eukaryotes, and several have been previously shown to branch with their homologues from alpha-proteobacteria, indicating that the eukaryotic nuclear genes were acquired from the mitochondrial genome during the course of evolution. Here, we investigate the individual evolutionary histories of all of the enzymes of the tricarboxylic acid cycle and the glyoxylate cycle using protein maximum likelihood phylogenies, focusing on the evolutionary origin of the nuclear-encoded proteins in higher plants. The results indicate that about half of the proteins involved in this eukaryotic pathway are most similar to their alpha-proteobacterial homologues, whereas the remainder are most similar to eubacterial, but not specifically alpha-proteobacterial, homologues. A consideration of (a) the process of lateral gene transfer among free-living prokaryotes and (b) the mechanistics of endosymbiotic (symbiont-to-host) gene transfer reveals that it is unrealistic to expect all nuclear genes that were acquired from the alpha-proteobacterial ancestor of mitochondria to branch specifically with their homologues encoded in the genomes of contemporary alpha-proteobacteria. Rather, even if molecular phylogenetics were to work perfectly (which it does not), then some nuclear-encoded proteins that were acquired from the alpha-proteobacterial ancestor of mitochondria should, in phylogenetic trees, branch with homologues that are no longer found in most alpha-proteobacterial genomes, and some should reside on long branches that reveal affinity to eubacterial rather than archaebacterial homologues, but no particular affinity for any specific eubacterial donor.

Interleukin 17-producing γδT cells promote hepatic regeneration in mice.

PubMed

Rao, Raghavendra; Graffeo, Christopher S; Gulati, Rishabh; Jamal, Mohsin; Narayan, Suchithra; Zambirinis, Constantinos P; Barilla, Rocky; Deutsch, Michael; Greco, Stephanie H; Ochi, Atsuo; Tomkötter, Lena; Blobstein, Reuven; Avanzi, Antonina; Tippens, Daniel M; Gelbstein, Yisroel; Van Heerden, Eliza; Miller, George

2014-08-01

Subsets of leukocytes synergize with regenerative growth factors to promote hepatic regeneration. γδT cells are early responders to inflammation-induced injury in a number of contexts. We investigated the role of γδT cells in hepatic regeneration using mice with disruptions in Tcrd (encodes the T-cell receptor δ chain) and Clec7a (encodes C-type lectin domain family 7 member a, also known as DECTIN1). We performed partial hepatectomies on wild-type C57BL/6, CD45.1, Tcrd(-/-), or Clec7a(-/-) mice. Cells were isolated from livers of patients and mice via mechanical and enzymatic digestion. γδT cells were purified by fluorescence-activated cell sorting. In mice, partial hepatectomy up-regulated expression of CCL20 and ligands of Dectin-1, which was associated with recruitment and activation of γδT cells and their increased production of interleukin (IL)-17 family cytokines. Recruited γδT cells induced production of IL-6 by antigen-presenting cells and suppressed expression of interferon gamma by natural killer T cells, promoting hepatocyte proliferation. Absence of IL-17-producing γδT cells or deletion of Dectin-1 prevented development of regenerative phenotypes in subsets of innate immune cells. This slowed liver regeneration and was associated with reduced expression of regenerative growth factors and cell cycle regulators. Conversely, exogenous administration of IL-17 family cytokines or Dectin-1 ligands promoted regeneration. More broadly, we found that γδT cells are required for inflammatory responses mediated by IL-17 and Dectin-1. γδT cells regulate hepatic regeneration by producing IL-22 and IL-17, which have direct mitogenic effects on hepatocytes and promote a regenerative phenotype in hepatic leukocytes, respectively. Dectin-1 ligation is required for γδT cells to promote hepatic regeneration. Copyright © 2014 AGA Institute. Published by Elsevier Inc. All rights reserved.

Interleukin 17-Producing γδT Cells Promote Hepatic Regeneration in Mice

PubMed Central

Rao, Raghavendra; Graffeo, Christopher S.; Gulati, Rishabh; Jamal, Mohsin; Narayan, Suchithra; Zambirinis, Constantinos; Barilla, Rocky; Deutsch, Michael; Greco, Stephanie; Ochi, Atsuo; Tomkötter, Lena; Blobstein, Reuven; Avanzi, Antonina; Tippens, Daniel M.; Gelbstein, Yisroel; Heerden, Eliza Van; Miller, George

2014-01-01

Background & Aims Subsets of leukocytes synergize with regenerative growth factors to promote hepatic regeneration. γδT cells are early responders to inflammation-induced injury in a number of contexts. We investigated the role of γδT cells in hepatic regeneration using mice with disruptions in Tcrd (encodes the T cell receptor δ chain) and Clec7a (encodes C-type lectin domain family 7 member a, also known as DECTIN1). Methods We performed partial hepatectomies on wild-type C57BL/6, CD45.1, Tcrd−/−, or Clec7a−/− mice. Cells were isolated from livers of patients and mice via mechanical and enzymatic digestion. γδT cells were purified by fluorescence-activated cell sorting. Results In mice, partial hepatectomy upregulated expression of CCL20 and ligands of Dectin-1, associated with recruitment and activation of γδT cells and their increased production of interleukin (IL)17 family cytokines. Recruited γδT cells induced production of IL6 by antigen-presenting cells and suppressed expression of interferon γ by natural killer T cells, promoting hepatocyte proliferation. Absence of IL17-producing γδT cells or deletion of Dectin-1 prevented development of regenerative phenotypes in subsets of innate immune cells. This slowed liver regeneration and was associated with reduced expression of regenerative growth factors and cell cycle regulators. Conversely, exogenous administration of IL17 family cytokines or Dectin-1 ligands promoted regeneration. More broadly, we found that γδT cells are required for inflammatory responses mediated by IL17 and Dectin-1. Conclusions γδT cells regulate hepatic regeneration by producing IL22 and IL17, which have direct mitogenic effects on hepatocytes and promote a regenerative phenotype in hepatic leukocytes, respectively. Dectin-1 ligation is required for γδT cells to promote hepatic regeneration. PMID:24801349

An Efficient Method for Electroporation of Small Interfering RNAs into ENCODE Project Tier 1 GM12878 and K562 Cell Lines.

PubMed

Muller, Ryan Y; Hammond, Ming C; Rio, Donald C; Lee, Yeon J

2015-12-01

The Encyclopedia of DNA Elements (ENCODE) Project aims to identify all functional sequence elements in the human genome sequence by use of high-throughput DNA/cDNA sequencing approaches. To aid the standardization, comparison, and integration of data sets produced from different technologies and platforms, the ENCODE Consortium selected several standard human cell lines to be used by the ENCODE Projects. The Tier 1 ENCODE cell lines include GM12878, K562, and H1 human embryonic stem cell lines. GM12878 is a lymphoblastoid cell line, transformed with the Epstein-Barr virus, that was selected by the International HapMap Project for whole genome and transcriptome sequencing by use of the Illumina platform. K562 is an immortalized myelogenous leukemia cell line. The GM12878 cell line is attractive for the ENCODE Projects, as it offers potential synergy with the International HapMap Project. Despite the vast amount of sequencing data available on the GM12878 cell line through the ENCODE Project, including transcriptome, chromatin immunoprecipitation-sequencing for histone marks, and transcription factors, no small interfering siRNA-mediated knockdown studies have been performed in the GM12878 cell line, as cationic lipid-mediated transfection methods are inefficient for lymphoid cell lines. Here, we present an efficient and reproducible method for transfection of a variety of siRNAs into the GM12878 and K562 cell lines, which subsequently results in targeted protein depletion.

Molecular characterization of two serine proteases expressed in gut tissue of the African trypanosome vector, Glossina morsitans morsitans.

PubMed

Yan, J; Cheng, Q; Li, C B; Aksoy, S

2001-02-01

Serine proteases are major insect gut enzymes involved in digestion of dietary proteins, and in addition they have been implicated in the process of pathogen establishment in several vector insects. The medically important vector, tsetse fly (Diptera:Glossinidiae), is involved in the transmission of African trypanosomes, which cause devastating diseases in animals and humans. Both the male and female tsetse can transmit trypanosomes and both are strict bloodfeeders throughout all stages of their development. Here, we describe the characterization of two putative serine protease-encoding genes, Glossina serine protease-1 (Gsp1) and Glossina serine protease-2 (Gsp2) from gut tissue. Both putative cDNA products represent prepro peptides with hydrophobic signal peptide sequences associated with their 5'-end terminus. The Gsp1 cDNA encodes a putative mature protein of 245 amino acids with a molecular mass of 26 428 Da, while the predicted size of the 228 amino acid mature peptide encoded by Gsp2 cDNA is 24 573 Da. Both deduced peptides contain the Asp/His/Ser catalytic triad and the conserved residues surrounding it which are characteristic of serine proteases. In addition, both proteins have the six-conserved cysteine residues to form the three-cysteine bonds typically present in invertebrate serine proteases. Based on the presence of substrate specific residues, the Gsp1 gene encodes a chymotrypsin-like protease while Gsp2 gene encodes for a protein with trypsin-like activity. Both proteins are encoded by few loci in tsetse genome, being present in one or two copies only. The mRNA expression levels for the genes do not vary extensively throughout the digestive cycle, and high levels of mRNAs can be readily detected in the gut tissue of newly emerged flies. The levels of trypsin and chymotrypsin activities in the gut lumen increase following blood feeding and change significantly in the gut cells throughout the digestion cycle. Hence, the regulation of expression for trypsin and chymotrypsin occurs at the post-transcriptional level in tsetse. Both the coding sequences and patterns of expression of Gsp1 and Gsp2 genes are similar to the serine proteases that have been reported from the bloodfeeding insect Stomoxys calcitrans.

Coordinated metabolic transitions during Drosophila embryogenesis and the onset of aerobic glycolysis.

PubMed

Tennessen, Jason M; Bertagnolli, Nicolas M; Evans, Janelle; Sieber, Matt H; Cox, James; Thummel, Carl S

2014-03-12

Rapidly proliferating cells such as cancer cells and embryonic stem cells rely on a specialized metabolic program known as aerobic glycolysis, which supports biomass production from carbohydrates. The fruit fly Drosophila melanogaster also utilizes aerobic glycolysis to support the rapid growth that occurs during larval development. Here we use singular value decomposition analysis of modENCODE RNA-seq data combined with GC-MS-based metabolomic analysis to analyze the changes in gene expression and metabolism that occur during Drosophila embryogenesis, spanning the onset of aerobic glycolysis. Unexpectedly, we find that the most common pattern of co-expressed genes in embryos includes the global switch to glycolytic gene expression that occurs midway through embryogenesis. In contrast to the canonical aerobic glycolytic pathway, however, which is accompanied by reduced mitochondrial oxidative metabolism, the expression of genes involved in the tricarboxylic cycle (TCA cycle) and the electron transport chain are also upregulated at this time. Mitochondrial activity, however, appears to be attenuated, as embryos exhibit a block in the TCA cycle that results in elevated levels of citrate, isocitrate, and α-ketoglutarate. We also find that genes involved in lipid breakdown and β-oxidation are upregulated prior to the transcriptional initiation of glycolysis, but are downregulated before the onset of larval development, revealing coordinated use of lipids and carbohydrates during development. These observations demonstrate the efficient use of nutrient stores to support embryonic development, define sequential metabolic transitions during this stage, and demonstrate striking similarities between the metabolic state of late-stage fly embryos and tumor cells. Copyright © 2014 Tennessen et al.

Drosophila melanogaster Activating Transcription Factor 4 Regulates Glycolysis During Endoplasmic Reticulum Stress

PubMed Central

Lee, Ji Eun; Oney, McKenna; Frizzell, Kimberly; Phadnis, Nitin; Hollien, Julie

2015-01-01

Endoplasmic reticulum (ER) stress results from an imbalance between the load of proteins entering the secretory pathway and the ability of the ER to fold and process them. The response to ER stress is mediated by a collection of signaling pathways termed the unfolded protein response, which plays important roles in development and disease. Here we show that in Drosophila melanogaster S2 cells, ER stress induces a coordinated change in the expression of genes involved in carbon metabolism. Genes encoding enzymes that carry out glycolysis were up-regulated, whereas genes encoding proteins in the tricarboxylic acid cycle and respiratory chain complexes were down-regulated. The unfolded protein response transcription factor Atf4 was necessary for the up-regulation of glycolytic enzymes and Lactate dehydrogenase (Ldh). Furthermore, Atf4 binding motifs in promoters for these genes could partially account for their regulation during ER stress. Finally, flies up-regulated Ldh and produced more lactate when subjected to ER stress. Together, these results suggest that Atf4 mediates a shift from a metabolism based on oxidative phosphorylation to one more heavily reliant on glycolysis, reminiscent of aerobic glycolysis or the Warburg effect observed in cancer and other proliferative cells. PMID:25681259

Metaphase to Anaphase (mat) Transition–Defective Mutants inCaenorhabditis elegans

PubMed Central

Golden, Andy; Sadler, Penny L.; Wallenfang, Matthew R.; Schumacher, Jill M.; Hamill, Danielle R.; Bates, Gayle; Bowerman, Bruce; Seydoux, Geraldine; Shakes, Diane C.

2000-01-01

The metaphase to anaphase transition is a critical stage of the eukaryotic cell cycle, and, thus, it is highly regulated. Errors during this transition can lead to chromosome segregation defects and death of the organism. In genetic screens for temperature-sensitive maternal effect embryonic lethal (Mel) mutants, we have identified 32 mutants in the nematode Caenorhabditis elegans in which fertilized embryos arrest as one-cell embryos. In these mutant embryos, the oocyte chromosomes arrest in metaphase of meiosis I without transitioning to anaphase or producing polar bodies. An additional block in M phase exit is evidenced by the failure to form pronuclei and the persistence of phosphohistone H3 and MPM-2 antibody staining. Spermatocyte meiosis is also perturbed; primary spermatocytes arrest in metaphase of meiosis I and fail to produce secondary spermatocytes. Analogous mitotic defects cause M phase delays in mitotic germline proliferation. We have named this class of mutants “mat” for metaphase to anaphase transition defective. These mutants, representing six different complementation groups, all map near genes that encode subunits of the anaphase promoting complex or cyclosome, and, here, we show that one of the genes, emb-27, encodes the C. elegans CDC16 ortholog. PMID:11134076

Cell cycle, differentiation and tissue-independent expression of ribosomal protein L37.

PubMed

Su, S; Bird, R C

1995-09-15

A unique human cDNA (hG1.16) that encodes a mRNA of 450 nucleotides was isolated from a subtractive library derived from HeLa cells. The relative expression level of hG1.16 during different cell-cycle phases was determined by Northern-blot analysis of cells synchronized by double-thymidine block and serum deprivation/refeeding. hG1.16 was constitutively expressed during all phases of the cell cycle, including the quiescent phase when even most constitutively expressed genes experience some suppression of expression. The expression level of hG1.16 did not change during terminal differentiation of myoblasts to myotubes, during which cells become permanently post-mitotic. Examination of other tissues revealed that the relative expression level of hG1.16 was constitutive in all embryonic mouse tissues examined, including brain, eye, heart, kidney, liver, lung and skeletal muscle. This was unusual in that expression was not down-modulated during differentiation and did not vary appreciably between tissue types. Analysis by inter-species Northern-blot analysis revealed that hG1.16 was highly conserved among all vertebrates studied (from fish to humans but not in insects). DNA sequence analysis of hG1.16 revealed a high level of similarity to rat ribosomal protein L37, identifying hG1.16 as a new member of this multigene family. The deduced amino acid sequence of hG1.16 was identical to rat ribosomal protein L37 that contained 97 amino acids, many of which are highly positively charged (15 arginine and 14 lysine residues with a predicted M(r) of 11,065). hG1.16 protein has a single C2-C2 zinc-finger-like motif which is also present in rat ribosomal protein L37. Using primers designed from the sequence of hG1.16, unique bovine and rat cDNAs were also isolated by 5'-rapid-amplification of cDNA ends. DNA sequences of bovine and rat G1.16, clones were 92.8% and 92.2% similar to human G1.16 while the deduced amino acid sequences derived from bovine and rat cDNAs each differed by a single amino acid from the sequence of hG1.16 and the published rat L37 sequence. Southern-blot analysis revealed that hG1.16 exists in multiple copies in human, rat and mouse genomes. These G1.16 clones encode unique human, rat and bovine members of the ribosomal protein L37 gene family, which are constitutively expressed even during transitions from quiescence to active cell proliferation or terminal differentiation, in all tissues and all vertebrates investigated.

Simulation of the M13 life cycle II: Investigation of the control mechanisms of M13 infection and establishment of the carrier state.

PubMed

Smeal, Steven W; Schmitt, Margaret A; Pereira, Ronnie Rodrigues; Prasad, Ashok; Fisk, John D

2017-01-01

Bacteriophage M13 is a true parasite of bacteria, able to co-opt the infected cell and control the production of progeny across many cellular generations. Here, our genetically-structured simulation of M13 is applied to quantitatively dissect the interplay between the host cellular environment and the controlling interactions governing the phage life cycle during the initial establishment of infection and across multiple cell generations. Multiple simulations suggest that phage-encoded feedback interactions constrain the utilization of host DNA polymerase, RNA polymerase and ribosomes. The simulation reveals the importance of p5 translational attenuation in controlling the production of phage double-stranded DNA and suggests an underappreciated role for p5 translational self-attenuation in resource allocation. The control elements active in a single generation are sufficient to reproduce the experimentally-observed multigenerational curing of the phage infection. Understanding the subtleties of regulation will be important for maximally exploiting M13 particles as scaffolds for nanoscale devices. Copyright © 2016 Elsevier Inc. All rights reserved.

Lysinuric protein intolerance (LPI): a multi organ disease by far more complex than a classic urea cycle disorder.

PubMed

Ogier de Baulny, Hélène; Schiff, Manuel; Dionisi-Vici, Carlo

2012-05-01

Lysinuric protein intolerance (LPI) is an inherited defect of cationic amino acid (lysine, arginine and ornithine) transport at the basolateral membrane of intestinal and renal tubular cells caused by mutations in SLC7A7 encoding the y(+)LAT1 protein. LPI has long been considered a relatively benign urea cycle disease, when appropriately treated with low-protein diet and l-citrulline supplementation. However, the severe clinical course of this disorder suggests that LPI should be regarded as a severe multisystem disease with uncertain outcome. Specifically, immune dysfunction potentially attributable to nitric oxide (NO) overproduction secondary to arginine intracellular trapping (due to defective efflux from the cell) might be a crucial pathophysiological route explaining many of LPI complications. The latter comprise severe lung disease with pulmonary alveolar proteinosis, renal disease, hemophagocytic lymphohistiocytosis with subsequent activation of macrophages, various auto-immune disorders and an incompletely characterized immune deficiency. These results have several therapeutic implications, among which lowering the l-citrulline dosage may be crucial, as excessive citrulline may worsen intracellular arginine accumulation. Copyright © 2012 Elsevier Inc. All rights reserved.

Genome-wide Analysis of the H3K4 Histone Demethylase RBP2 Reveals a Transcriptional Program Controlling Differentiation

PubMed Central

Lopez-Bigas, Nuria; Kisiel, Tomasz A.; DeWaal, Dannielle C.; Holmes, Katie B.; Volkert, Tom L.; Gupta, Sumeet; Love, Jennifer; Murray, Heather L.; Young, Richard A.; Benevolenskaya, Elizaveta V.

2010-01-01

SUMMARY Retinoblastoma protein (pRB) mediates cell-cycle withdrawal and differentiation by interacting with a variety of proteins. RB-Binding Protein 2 (RBP2) has been shown to be a key effector. We sought to determine transcriptional regulation by RBP2 genome-wide by using location analysis and gene expression profiling experiments. We describe that RBP2 shows high correlation with the presence of H3K4me3 and its target genes are separated into two functionally distinct classes: differentiation-independent and differentiation-dependent genes. The former class is enriched by genes that encode mitochondrial proteins, while the latter is represented by cell-cycle genes. We demonstrate the role of RBP2 in mitochondrial biogenesis, which involves regulation of H3K4me3-modified nucleosomes. Analysis of expression changes upon RBP2 depletion depicted genes with a signature of differentiation control, analogous to the changes seen upon reintroduction of pRB. We conclude that, during differentiation, RBP2 exerts inhibitory effects on multiple genes through direct interaction with their promoters. PMID:18722178

Lamina-independent lamins in the nuclear interior serve important functions.

PubMed

Dechat, T; Gesson, K; Foisner, R

2010-01-01

Nuclear lamins were originally described as the main constituents of the nuclear lamina, a filamentous meshwork closely associated with the inner nuclear membrane. However, within recent years, it has become increasingly evident that a fraction of lamins also resides throughout the nuclear interior. As intermediate-filament-type proteins, lamins have been suggested to fulfill mainly structural functions such as providing shape and mechanical stability to the nucleus. But recent findings show that both peripheral and nucleoplasmic lamins also have important roles in essential cellular processes such as transcription, DNA replication, cell cycle progression, and chromatin organization. Furthermore, more than 300 mutations in the gene encoding A-type lamins have been associated with several human diseases now generally termed laminopathies and comprising muscular dystrophies, lipodystrophies, cardiomyopathies, and premature aging diseases. This review focuses on the lamina-independent pool of lamins in the nuclear interior, which surprisingly has not been studied in much detail so far. We discuss the properties and regulation of nucleoplasmic lamins during the cell cycle, their interaction partners, and their potential involvement in cellular processes and the development of laminopathies.

The c-myb proto-oncogene and microRNA-15a comprise an active autoregulatory feedback loop in human hematopoietic cells

PubMed Central

Zhao, Huiwu; Kalota, Anna; Jin, Shenghao

2009-01-01

The c-myb proto-oncogene encodes an obligate hematopoietic cell transcription factor important for lineage commitment, proliferation, and differentiation. Given its critical functions, c-Myb regulatory factors are of great interest but remain incompletely defined. Herein we show that c-Myb expression is subject to posttranscriptional regulation by microRNA (miRNA)–15a. Using a luciferase reporter assay, we found that miR-15a directly binds the 3′-UTR of c-myb mRNA. By transfecting K562 myeloid leukemia cells with a miR-15a mimic, functionality of binding was shown. The mimic decreased c-Myb expression, and blocked the cells in the G1 phase of cell cycle. Exogenous expression of c-myb mRNA lacking the 3′-UTR partially rescued the miR-15a induced cell-cycle block. Of interest, the miR-15a promoter contained several potential c-Myb protein binding sites. Occupancy of one canonical c-Myb binding site was demonstrated by chromatin immunoprecipitation analysis and shown to be required for miR-15a expression in K562 cells. Finally, in studies using normal human CD34+ cells, we showed that c-Myb and miR-15a expression were inversely correlated in cells undergoing erythroid differentiation, and that overexpression of miR-15a blocked both erythroid and myeloid colony formation in vitro. In aggregate, these findings suggest the presence of a c-Myb–miR-15a autoregulatory feedback loop of potential importance in human hematopoiesis. PMID:18818396

Regulation of the expression of the cell-cycle gene ftsZ by DicF antisense RNA. Division does not require a fixed number of FtsZ molecules.

PubMed

Tétart, F; Bouché, J P

1992-03-01

We show that the 53-nucleotide RNA molecule encoded by gene dicF blocks cell division in Escherichia coli by inhibiting the translation of ftsZ mRNA. Such a role for dicF had been predicted on the basis of the complementarity of DicF RNA with the ribosome-binding region of the ftsZ mRNA. An analysis of ftsZ expression at its chromosomal locus, and of an ftsZ-lacZ translational fusion controlled by promoters ftsZ1p and ftsZ2p only, indicates that ftsZ is not autoregulated. Partial inhibition of FtsZ synthesis leads to increased cell size. However, the number of FtsZ molecules per cell can be reduced threefold without affecting the division rate significantly. Our results suggest that septation is not triggered by a fixed number of newly synthesized FtsZ molecules per cell.

Seeing the forest and trees: whole-body and whole-brain imaging for circadian biology.

PubMed

Ode, K L; Ueda, H R

2015-09-01

Recent advances in methods for making mammalian organs translucent have made possible whole-body fluorescent imaging with single-cell resolution. Because organ-clearing methods can be used to image the heterogeneous nature of cell populations, they are powerful tools to investigate the hierarchical organization of the cellular circadian clock, and how the clock synchronizes a variety of physiological activities. In particular, methods compatible with genetically encoded fluorescent reporters have the potential to detect circadian activity in different brain regions and the circadian-phase distribution across the whole body. In this review, we summarize the current methods and strategy for making organs translucent (removal of lipids, decolourization of haemoglobin and adjusting the refractive index of the specimen). We then discuss possible applications to circadian biology. For example, the coupling of circadian rhythms among different brain regions, brain activity in sleep-wake cycles and the role of migrating cells such as immune cells and cancer cells in chronopharmacology. © 2015 John Wiley & Sons Ltd.

P16INK4a MEDIATED SUPPRESSION OF TELOMERASE IN NORMAL AND MALIGNANT HUMAN BREAST CELLS

PubMed Central

Bazarov, Alexey V.; van Sluis, Marjolein; Hines, Curtis; Bassett, Ekaterina; Beliveau, Alain; Campeau, Eric; Mukhopadhyay, Rituparna; Lee, Won Jae; Melodyev, Sonya; Zaslavsky, Yuri; Lee, Leonard; Rodier, Francis; Chicas, Agustin; Lowe, Scott W.; Benhattar, Jean; Ren, Bing; Campisi, Judith; Yaswen, Paul

2010-01-01

Summary The cyclin-dependent kinase inhibitor p16INK4a (CDKN2A) is an important tumor-suppressor gene frequently inactivated in human tumors. p16 suppresses the development of cancer by triggering an irreversible arrest of cell proliferation termed cellular senescence. Here, we describe another anti-oncogenic function of p16 in addition to its ability to halt cell cycle progression. We show that transient expression of p16 stably represses the hTERT gene, encoding the catalytic subunit of telomerase, in both normal and malignant breast epithelial cells. Short-term p16 expression increases the amount of histone H3 trimethylated on lysine 27 (H3K27) bound to the hTERT promoter, resulting in transcriptional silencing, likely mediated by polycomb complexes. Our results indicate that transient p16 exposure may prevent malignant progression in dividing cells by irreversible repression of genes, such as hTERT, whose activity is necessary for extensive self-renewal. PMID:20569236

Insensitivity of chromosome I and the cell cycle to blockage of replication and segregation of Vibrio cholerae chromosome II.

PubMed

Kadoya, Ryosuke; Chattoraj, Dhruba K

2012-01-01

Vibrio cholerae has two chromosomes (chrI and chrII) whose replication and segregation are under different genetic controls. The region covering the replication origin of chrI resembles that of the Escherichia coli chromosome, and both origins are under control of the highly conserved initiator, DnaA. The origin region of chrII resembles that of plasmids that have iterated initiator-binding sites (iterons) and is under control of the chrII-specific initiator, RctB. Both chrI and chrII encode chromosome-specific orthologs of plasmid partitioning proteins, ParA and ParB. Here, we have interfered with chrII replication, segregation, or both, using extra copies of sites that titrate RctB or ParB. Under these conditions, replication and segregation of chrI remain unaffected for at least 1 cell cycle. In this respect, chrI behaves similarly to the E. coli chromosome when plasmid maintenance is disturbed in the same cell. Apparently, no checkpoint exists to block cell division before the crippled chromosome is lost by a failure to replicate or to segregate. Whether blocking chrI replication can affect chrII replication remains to be tested. Chromosome replication, chromosome segregation, and cell division are the three main events of the cell cycle. They occur in an orderly fashion once per cell cycle. How the sequence of events is controlled is only beginning to be answered in bacteria. The finding of bacteria that possess more than one chromosome raises the important question: how are different chromosomes coordinated in their replication and segregation? It appears that in the evolution of the two-chromosome genome of V. cholerae, either the secondary chromosome adapted to the main chromosome to ensure its maintenance or it is maintained independently, as are bacterial plasmids. An understanding of chromosome coordination is expected to bear on the evolutionary process of chromosome acquisition and on the efficacy of possible strategies for selective elimination of a pathogen by targeting a specific chromosome.

Heat shock protein 90 inhibitor NVP-AUY922 exerts potent activity against adult T-cell leukemia-lymphoma cells.

PubMed

Taniguchi, Hiroaki; Hasegawa, Hiroo; Sasaki, Daisuke; Ando, Koji; Sawayama, Yasushi; Imanishi, Daisuke; Taguchi, Jun; Imaizumi, Yoshitaka; Hata, Tomoko; Tsukasaki, Kunihiro; Uno, Naoki; Morinaga, Yoshitomo; Yanagihara, Katsunori; Miyazaki, Yasushi

2014-12-01

Adult T-cell leukemia-lymphoma (ATL), an aggressive neoplasm etiologically associated with HTLV-1, is a chemoresistant malignancy. Heat shock protein 90 (HSP90) is involved in folding and functions as a chaperone for multiple client proteins, many of which are important in tumorigenesis. In this study, we examined NVP-AUY922 (AUY922), a second generation isoxazole-based non-geldanamycin HSP90 inhibitor, and confirmed its effects on survival of ATL-related cell lines. Analysis using FACS revealed that AUY922 induced cell-cycle arrest and apoptosis; it also inhibited the growth of primary ATL cells, but not of normal PBMCs. AUY922 caused strong upregulation of HSP70, a surrogate marker of HSP90 inhibition, and a dose-dependent decrease in HSP90 client proteins associated with cell survival, proliferation, and cell cycle in the G1 phase, including phospho-Akt, Akt, IKKα, IKKβ, IKKγ, Cdk4, Cdk6, and survivin. Interestingly, AUY922 induced downregulation of the proviral integration site for Moloney murine leukemia virus (PIM) in ATL cells. The PIM family (PIM-1, -2, -3) is made up of oncogenes that encode a serine/threonine protein kinase family. As PIM kinases have multiple functions involved in cell proliferation, survival, differentiation, apoptosis, and tumorigenesis, their downregulation could play an important role in AUY922-induced death of ATL cells. In fact, SGI-1776, a pan-PIM kinase inhibitor, successfully inhibited the growth of primary ATL cells as well as ATL-related cell lines. Our findings suggest that AUY922 is an effective therapeutic agent for ATL, and PIM kinases may be a novel therapeutic target. © 2014 The Authors. Cancer Science published by Wiley Publishing Asia Pty Ltd on behalf of Japanese Cancer Association.

Heat shock protein 90 inhibitor NVP-AUY922 exerts potent activity against adult T-cell leukemia–lymphoma cells

PubMed Central

Taniguchi, Hiroaki; Hasegawa, Hiroo; Sasaki, Daisuke; Ando, Koji; Sawayama, Yasushi; Imanishi, Daisuke; Taguchi, Jun; Imaizumi, Yoshitaka; Hata, Tomoko; Tsukasaki, Kunihiro; Uno, Naoki; Morinaga, Yoshitomo; Yanagihara, Katsunori; Miyazaki, Yasushi

2014-01-01

Adult T-cell leukemia–lymphoma (ATL), an aggressive neoplasm etiologically associated with HTLV-1, is a chemoresistant malignancy. Heat shock protein 90 (HSP90) is involved in folding and functions as a chaperone for multiple client proteins, many of which are important in tumorigenesis. In this study, we examined NVP-AUY922 (AUY922), a second generation isoxazole-based non-geldanamycin HSP90 inhibitor, and confirmed its effects on survival of ATL-related cell lines. Analysis using FACS revealed that AUY922 induced cell-cycle arrest and apoptosis; it also inhibited the growth of primary ATL cells, but not of normal PBMCs. AUY922 caused strong upregulation of HSP70, a surrogate marker of HSP90 inhibition, and a dose-dependent decrease in HSP90 client proteins associated with cell survival, proliferation, and cell cycle in the G1 phase, including phospho-Akt, Akt, IKKα, IKKβ, IKKγ, Cdk4, Cdk6, and survivin. Interestingly, AUY922 induced downregulation of the proviral integration site for Moloney murine leukemia virus (PIM) in ATL cells. The PIM family (PIM-1, -2, -3) is made up of oncogenes that encode a serine/threonine protein kinase family. As PIM kinases have multiple functions involved in cell proliferation, survival, differentiation, apoptosis, and tumorigenesis, their downregulation could play an important role in AUY922-induced death of ATL cells. In fact, SGI-1776, a pan-PIM kinase inhibitor, successfully inhibited the growth of primary ATL cells as well as ATL-related cell lines. Our findings suggest that AUY922 is an effective therapeutic agent for ATL, and PIM kinases may be a novel therapeutic target. PMID:25263741

Overexpression of Nitrogen Permease Regulator Like-2 (NPRL2) Enhances Sensitivity to Irinotecan (CPT-11) in Colon Cancer Cells by Activating the DNA Damage Checkpoint Pathway.

PubMed

Liu, Shasha; Liu, Bingrong

2018-03-09

BACKGROUND Colorectal cancer (CRC) is the third most common cancer worldwide, making it is a serious threat to human health. It is imperative to develop new therapeutics to improve the CRC treatment efficiency. The aim of this study was to investigate the role of NPRL2 in improving sensitivity to CPT-11 in colon cancer cells. MATERIAL AND METHODS NPRL2 overexpression was established by transfecting the recombinant lentivirus-encoding NPRL2 gene into HCT116 colon cancer cells. Cell proliferation was identified using Cell Counting Kit-8 (CCK8) assay. Cell cycle and apoptosis were examined by flow cytometry. An immunofluorescence staining assay was conducted to examine the expression of γ-H2AX. Wound-healing and Transwell assays were utilized to show cell migration and invasion capability. The expression of apoptosis-related proteins (cleaved caspase-3, caspase-9, cleaved PARP, BAX, and Bcl-2), invasion-related proteins (MMP2, MMP9, p-PI3K, and p-AKT), and DNA damage checkpoint pathway proteins (p-ATM, p-Chk2, Cdc25C, Cdc2, and Cyclin B1) were quantified by Western blotting. RESULTS A CCK8 assay revealed that the overexpression of NPRL2 improved the sensitivity of CPT-11 in HCT116 cells (P<0.05). Functionally, NPRL2 overexpression elevated the sensitivity of CPT-11 by preventing colon cancer cell proliferation, cell movement, and invasion, and promoting cell apoptosis and G2/M cell cycle arrest. Mechanistically, NPRL2 overexpression enhanced CPT-11 sensitivity by activating the DNA damage checkpoint pathway. CONCLUSIONS NPRL2 overexpression enhances sensitivity to CPT-11 treatment in colon cancer cells, and it may serve as a molecular therapeutic agent to treat patients with CRC.

Expression and Function of System N Glutamine Transporters (SN1/SN2 or SNAT3/SNAT5) in Retinal Ganglion Cells

PubMed Central

Umapathy, Nagavedi S.; Dun, Ying; Martin, Pamela M.; Duplantier, Jennifer N.; Roon, Penny; Prasad, Puttur; Smith, Sylvia B.; Ganapathy, Vadivel

2008-01-01

Purpose Glutamine transport is essential for the glutamate-glutamine cycle, which occurs between neurons and glia. System N, consisting of SN1 (SNAT3) and SN2 (SNAT5), is the principal mediator of glutamine transport in retinal Müller cells. Mediators of glutamine transport in retinal ganglion cells were investigated. Methods The relative contributions of various transport systems for glutamine uptake (systems N, A, L, y+L, ASCT, and ATB0,+) were examined in RGC-5 cells based on differential features of the individual transport systems. mRNA for the genes encoding members of these transport systems were analyzed by RT-PCR. Based on these data, SN1 and SN2 were analyzed in mouse retina, RGC-5 cells, and primary mouse ganglion cells (GCs) by in situ hybridization (ISH), immunofluorescence (IF), and Western blotting. Results Three transport systems—N, A, and L—participated in glutamine uptake in RGC-5 cells. System N was the principal contributor; systems A and L contributed considerably less. ISH and IF revealed SN1 and SN2 expression in the ganglion, inner nuclear, and photoreceptor cell layers. SN1 and SN2 colocalized with the ganglion cell marker Thy 1.2 and with the Müller cell marker vimentin, confirming their presence in both retinal cell types. SN1 and SN2 proteins were detected in primary mouse GCs. Conclusions These findings suggest that in addition to its role in glutamine uptake in retinal glial cells, system N contributes significantly to glutamine uptake in ganglion cells and, hence, contributes to the retinal glutamate-glutamine cycle. PMID:18689705

Temporal Control of Plant Organ Growth by TCP Transcription Factors.

PubMed

Huang, Tengbo; Irish, Vivian F

2015-06-29

The Arabidopsis petal is a simple laminar organ whose development is largely impervious to environmental effects, making it an excellent model for dissecting the regulation of cell-cycle progression and post-mitotic cell expansion that together sculpt organ form. Arabidopsis petals grow via basipetal waves of cell division, followed by a phase of cell expansion. RABBIT EARS (RBE) encodes a C2H2 zinc finger transcriptional repressor and is required for petal development. During the early phase of petal initiation, RBE regulates a microRNA164-dependent pathway that controls cell proliferation at the petal primordium boundaries. The effects of rbe mutations on petal lamina growth suggest that RBE is also required to regulate later developmental events during petal organogenesis. Here, we demonstrate that, early in petal development, RBE represses the transcription of a suite of CIN-TCP genes that in turn act to inhibit the number and duration of cell divisions; the temporal alleviation of that repression results in the transition from cell division to post-mitotic cell expansion and concomitant petal maturation. Copyright © 2015 Elsevier Ltd. All rights reserved.

Natural Killer Cells Control Tumor Growth by Sensing a Growth Factor.

PubMed

Barrow, Alexander D; Edeling, Melissa A; Trifonov, Vladimir; Luo, Jingqin; Goyal, Piyush; Bohl, Benjamin; Bando, Jennifer K; Kim, Albert H; Walker, John; Andahazy, Mary; Bugatti, Mattia; Melocchi, Laura; Vermi, William; Fremont, Daved H; Cox, Sarah; Cella, Marina; Schmedt, Christian; Colonna, Marco

2018-01-25

Many tumors produce platelet-derived growth factor (PDGF)-DD, which promotes cellular proliferation, epithelial-mesenchymal transition, stromal reaction, and angiogenesis through autocrine and paracrine PDGFRβ signaling. By screening a secretome library, we found that the human immunoreceptor NKp44, encoded by NCR2 and expressed on natural killer (NK) cells and innate lymphoid cells, recognizes PDGF-DD. PDGF-DD engagement of NKp44 triggered NK cell secretion of interferon gamma (IFN)-γ and tumor necrosis factor alpha (TNF-α) that induced tumor cell growth arrest. A distinctive transcriptional signature of PDGF-DD-induced cytokines and the downregulation of tumor cell-cycle genes correlated with NCR2 expression and greater survival in glioblastoma. NKp44 expression in mouse NK cells controlled the dissemination of tumors expressing PDGF-DD more effectively than control mice, an effect enhanced by blockade of the inhibitory receptor CD96 or CpG-oligonucleotide treatment. Thus, while cancer cell production of PDGF-DD supports tumor growth and stromal reaction, it concomitantly activates innate immune responses to tumor expansion. Copyright © 2017 Elsevier Inc. All rights reserved.

The RXL motif of the African cassava mosaic virus Rep protein is necessary for rereplication of yeast DNA and viral infection in plants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hipp, Katharina; Rau, Peter; Schäfer, Benjamin

Geminiviruses, single-stranded DNA plant viruses, encode a replication-initiator protein (Rep) that is indispensable for virus replication. A potential cyclin interaction motif (RXL) in the sequence of African cassava mosaic virus Rep may be an alternative link to cell cycle controls to the known interaction with plant homologs of retinoblastoma protein (pRBR). Mutation of this motif abrogated rereplication in fission yeast induced by expression of wildtype Rep suggesting that Rep interacts via its RXL motif with one or several yeast proteins. The RXL motif is essential for viral infection of Nicotiana benthamiana plants, since mutation of this motif in infectious clonesmore » prevented any symptomatic infection. The cell-cycle link (Clink) protein of a nanovirus (faba bean necrotic yellows virus) was investigated that activates the cell cycle by binding via its LXCXE motif to pRBR. Expression of wildtype Clink and a Clink mutant deficient in pRBR-binding did not trigger rereplication in fission yeast. - Highlights: • A potential cyclin interaction motif is conserved in geminivirus Rep proteins. • In ACMV Rep, this motif (RXL) is essential for rereplication of fission yeast DNA. • Mutating RXL abrogated viral infection completely in Nicotiana benthamiana. • Expression of a nanovirus Clink protein in yeast did not induce rereplication. • Plant viruses may have evolved multiple routes to exploit host DNA synthesis.« less

Genome-Wide Mutagenesis of Dengue Virus Reveals Plasticity of the NS1 Protein and Enables Generation of Infectious Tagged Reporter Viruses

PubMed Central

Johnson, Stephen M.; Eltahla, Auda A.; Aloi, Maria; Aloia, Amanda L.; McDevitt, Christopher A.; Bull, Rowena A.

2017-01-01

ABSTRACT Dengue virus (DENV) is a major global pathogen that causes significant morbidity and mortality in tropical and subtropical areas worldwide. An improved understanding of the regions within the DENV genome and its encoded proteins that are required for the virus replication cycle will expedite the development of urgently required therapeutics and vaccines. We subjected an infectious DENV genome to unbiased insertional mutagenesis and used next-generation sequencing to identify sites that tolerate 15-nucleotide insertions during the virus replication cycle in hepatic cell culture. This revealed that the regions within capsid, NS1, and the 3′ untranslated region were the most tolerant of insertions. In contrast, prM- and NS2A-encoding regions were largely intolerant of insertions. Notably, the multifunctional NS1 protein readily tolerated insertions in regions within the Wing, connector, and β-ladder domains with minimal effects on viral RNA replication and infectious virus production. Using this information, we generated infectious reporter viruses, including a variant encoding the APEX2 electron microscopy tag in NS1 that uniquely enabled high-resolution imaging of its localization to the surface and interior of viral replication vesicles. In addition, we generated a tagged virus bearing an mScarlet fluorescent protein insertion in NS1 that, despite an impact on fitness, enabled live cell imaging of NS1 localization and traffic in infected cells. Overall, this genome-wide profile of DENV genome flexibility may be further dissected and exploited in reporter virus generation and antiviral strategies. IMPORTANCE Regions of genetic flexibility in viral genomes can be exploited in the generation of reporter virus tools and should arguably be avoided in antiviral drug and vaccine design. Here, we subjected the DENV genome to high-throughput insertional mutagenesis to identify regions of genetic flexibility and enable tagged reporter virus generation. In particular, the viral NS1 protein displayed remarkable tolerance of small insertions. This genetic flexibility enabled generation of several novel NS1-tagged reporter viruses, including an APEX2-tagged virus that we used in high-resolution imaging of NS1 localization in infected cells by electron microscopy. For the first time, this analysis revealed the localization of NS1 within viral replication factories known as “vesicle packets” (VPs), in addition to its acknowledged localization to the luminal surface of these VPs. Together, this genetic profile of DENV may be further refined and exploited in the identification of antiviral targets and the generation of reporter virus tools. PMID:28956770

A New lncRNA, APTR, Associates with and Represses the CDKN1A/p21 Promoter by Recruiting Polycomb Proteins

PubMed Central

Negishi, Masamitsu; Wongpalee, Somsakul P.; Sarkar, Sukumar; Park, Jonghoon; Lee, Kyung Yong; Shibata, Yoshiyuki; Reon, Brian J.; Abounader, Roger; Suzuki, Yutaka; Sugano, Sumio; Dutta, Anindya

2014-01-01

Long noncoding RNAs (lncRNAs) have emerged as a major regulator of cell physiology, but many of which have no known function. CDKN1A/p21 is an important inhibitor of the cell-cycle, regulator of the DNA damage response and effector of the tumor suppressor p53, playing a crucial role in tumor development and prevention. In order to identify a regulator for tumor progression, we performed an siRNA screen of human lncRNAs required for cell proliferation, and identified a novel lncRNA, APTR, that acts in trans to repress the CDKN1A/p21 promoter independent of p53 to promote cell proliferation. APTR associates with the promoter of CDKN1A/p21 and this association requires a complementary-Alu sequence encoded in APTR. A different module of APTR associates with and recruits the Polycomb repressive complex 2 (PRC2) to epigenetically repress the p21 promoter. A decrease in APTR is necessary for the induction of p21 after heat stress and DNA damage by doxorubicin, and the levels of APTR and p21 are anti-correlated in human glioblastomas. Our data identify a new regulator of the cell-cycle inhibitor CDKN1A/p21 that acts as a proliferative factor in cancer cell lines and in glioblastomas and demonstrate that Alu elements present in lncRNAs can contribute to targeting regulatory lncRNAs to promoters. PMID:24748121

Regulation of Lactobacillus plantarum contamination on the carbohydrate and energy related metabolisms of Saccharomyces cerevisiae during bioethanol fermentation.

PubMed

Dong, Shi-Jun; Lin, Xiang-Hua; Li, Hao

2015-11-01

During the industrial bioethanol fermentation, Saccharomyces cerevisiae cells are often stressed by bacterial contaminants, especially lactic acid bacteria. Generally, lactic acid bacteria contamination can inhibit S. cerevisiae cell growth through secreting lactic acid and competing with yeast cells for micronutrients and living space. However, whether are there still any other influences of lactic acid bacteria on yeast or not? In this study, Lactobacillus plantarum ATCC 8014 was co-cultivated with S. cerevisiae S288c to mimic the L. plantarum contamination in industrial bioethanol fermentation. The contaminative L. plantarum-associated expression changes of genes involved in carbohydrate and energy related metabolisms in S. cerevisiae cells were determined by quantitative real-time polymerase chain reaction to evaluate the influence of L. plantarum on carbon source utilization and energy related metabolism in yeast cells during bioethanol fermentation. Contaminative L. plantarum influenced the expression of most of genes which are responsible for encoding key enzymes involved in glucose related metabolisms in S. cerevisiae. Specific for, contaminated L. plantarum inhibited EMP pathway but promoted TCA cycle, glyoxylate cycle, HMP, glycerol synthesis pathway, and redox pathway in S. cerevisiae cells. In the presence of L. plantarum, the carbon flux in S. cerevisiae cells was redistributed from fermentation to respiratory and more reducing power was produced to deal with the excess NADH. Moreover, L. plantarum contamination might confer higher ethanol tolerance to yeast cells through promoting accumulation of glycerol. These results also highlighted our knowledge about relationship between contaminative lactic acid bacteria and S. cerevisiae during bioethanol fermentation. Copyright © 2015 Elsevier Ltd. All rights reserved.

Anti-tumour therapeutic efficacy of OX40L in murine tumour model.

PubMed

Ali, Selman A; Ahmad, Murrium; Lynam, June; McLean, Cornelia S; Entwisle, Claire; Loudon, Peter; Choolun, Esther; McArdle, Stephanie E B; Li, Geng; Mian, Shahid; Rees, Robert C

2004-09-09

OX40 ligand (OX40L), a member of TNF superfamily, is a co-stimulatory molecule involved in T cell activation. Systemic administration of mOX40L fusion protein significantly inhibited the growth of experimental lung metastasis and subcutaneous (s.c.) established colon (CT26) and breast (4T1) carcinomas. Vaccination with OX40L was significantly enhanced by combination treatment with intra-tumour injection of a disabled infectious single cycle-herpes simplex virus (DISC-HSV) vector encoding murine granulocyte macrophage-colony stimulating factor (mGM-CSF). Tumour rejection in response to OX40L therapy required functional CD4+ and CD8+ T cells and correlated with splenocyte cytotoxic T lymphocytes (CTLs) activity against the AH-1 gp70 peptide of the tumour associated antigen expressed by CT26 cells. These results demonstrate the potential role of the OX40L in cancer immunotherapy.

Receptor tyrosine kinase mutations in developmental syndromes and cancer: two sides of the same coin

PubMed Central

McDonell, Laura M.; Kernohan, Kristin D.; Boycott, Kym M.; Sawyer, Sarah L.

2015-01-01

Receptor tyrosine kinases (RTKs) are a family of ligand-binding cell surface receptors that regulate a wide range of essential cellular activities, including proliferation, differentiation, cell-cycle progression, survival and apoptosis. As such, these proteins play an important role during development and throughout life; germline mutations in genes encoding RTKs cause several developmental syndromes, while somatic alterations contribute to the pathogenesis of many aggressive cancers. This creates an interesting paradigm in which mutation timing, type and location in a gene leads to different cell signaling and biological responses, and ultimately phenotypic outcomes. In this review, we highlight the roles of RTKs in developmental disorders and cancer. The multifaceted roles of these receptors, their genetic signatures and their signaling during developmental morphogenesis and oncogenesis are discussed. Additionally, we propose that comparative analysis of RTK mutations responsible for developmental syndromes may shed light on those driving tumorigenesis. PMID:26152202

Independent rate and temporal coding in hippocampal pyramidal cells.

PubMed

Huxter, John; Burgess, Neil; O'Keefe, John

2003-10-23

In the brain, hippocampal pyramidal cells use temporal as well as rate coding to signal spatial aspects of the animal's environment or behaviour. The temporal code takes the form of a phase relationship to the concurrent cycle of the hippocampal electroencephalogram theta rhythm. These two codes could each represent a different variable. However, this requires the rate and phase to vary independently, in contrast to recent suggestions that they are tightly coupled, both reflecting the amplitude of the cell's input. Here we show that the time of firing and firing rate are dissociable, and can represent two independent variables: respectively the animal's location within the place field, and its speed of movement through the field. Independent encoding of location together with actions and stimuli occurring there may help to explain the dual roles of the hippocampus in spatial and episodic memory, or may indicate a more general role of the hippocampus in relational/declarative memory.

Pheochromocytoma: The First Metabolic Endocrine Cancer

PubMed Central

Jochmanova, Ivana; Pacak, Karel

2016-01-01

Dysregulated metabolism is one of the key characteristics of cancer cells. The most prominent alterations are present during regulation of cell respiration, which leads to a switch from oxidative phosphorylation to aerobic glycolysis. This metabolic shift results in activation of numerous signaling and metabolic pathways supporting cell proliferation and survival. Recent progress in genetics and metabolomics allowed us to take a closer look at the metabolic changes present in pheochromocytomas and paragangliomas (PHEOs/PGLs). These neuroendocrine tumors often exhibit dysregulation of mitochondrial metabolism, which is driven by mutations in genes encoding Krebs cycle enzymes or by activation of hypoxia signaling. Present metabolic changes are involved in processes associated with tumorigenesis, invasiveness, metastasis, and resistance to various cancer therapies. In this review, we discuss the metabolic nature of PHEOs/PGLs and how unveiling the metabolic disturbances present in tumors could lead to identification of new biomarkers and personalized cancer therapies. PMID:27742786

Stochastic Predator-Prey Dynamics of Transposons in the Human Genome

NASA Astrophysics Data System (ADS)

Xue, Chi; Goldenfeld, Nigel

2016-11-01

Transposable elements, or transposons, are DNA sequences that can jump from site to site in the genome during the life cycle of a cell, usually encoding the very enzymes which perform their excision. However, some transposons are parasitic, relying on the enzymes produced by the regular transposons. In this case, we show that a stochastic model, which takes into account the small copy numbers of the active transposons in a cell, predicts noise-induced predator-prey oscillations with a characteristic time scale that is much longer than the cell replication time, indicating that the state of the predator-prey oscillator is stored in the genome and transmitted to successive generations. Our work demonstrates the important role of the number fluctuations in the expression of mobile genetic elements, and shows explicitly how ecological concepts can be applied to the dynamics and fluctuations of living genomes.

In vivo and in vitro analyses of a Bombyx mori nucleopolyhedrovirus mutant lacking functional vfgf.

PubMed

Katsuma, Susumu; Horie, Satoshi; Daimon, Takaaki; Iwanaga, Masashi; Shimada, Toru

2006-11-10

All lepidopteran baculovirus genomes sequenced to date encode a viral fibroblast growth factor homolog (vfgf), suggesting that vfgf may play an important role in the infection cycle of lepidopteran baculoviruses. Here, we describe the characterization of a Bombyx mori nucleopolyhedrovirus (BmNPV) mutant lacking functional vfgf. We constructed a vfgf deletion mutant (BmFGFD) and characterized it in BmN cells and B. mori larvae. We observed that budded virus (BV) production was reduced in BmFGFD-infected BmN cells and B. mori larvae. The larval bioassays also revealed that deletion of vfgf did not reduce the infectivity; however, the mutant virus did take 20 h longer to kill B. mori larvae than wild-type BmNPV, when tested either by BV injection or by polyhedrin-inclusion body ingestion. These results suggest that BmNPV vfgf is involved in efficient virus production in BmN cells and B. mori larvae.

A pseudogene long noncoding RNA network regulates PTEN transcription and translation in human cells

PubMed Central

Johnsson, Per; Ackley, Amanda; Vidarsdottir, Linda; Lui, Weng-Onn; Corcoran, Martin; Grandér, Dan; Morris, Kevin V.

2013-01-01

PTEN is a tumor suppressor gene that has been shown to be under the regulatory control of a PTEN pseudogene expressed noncoding RNA, PTENpg1. Here, we characterize a previously unidentified PTENpg1 encoded antisense RNA (asRNA), which regulates PTEN transcription and PTEN mRNA stability. We find two PTENpg1 asRNA isoforms, alpha and beta. The alpha isoform functions in trans, localizes to the PTEN promoter, and epigenetically modulates PTEN transcription by the recruitment of DNMT3a and EZH2. In contrast, the beta isoform interacts with PTENpg1 through an RNA:RNA pairing interaction, which affects PTEN protein output via changes of PTENpg1 stability and microRNA sponge activity. Disruption of this asRNA-regulated network induces cell cycle arrest and sensitizes cells to doxorubicin, suggesting a biological function for the respective PTENpg1 expressed asRNAs. PMID:23435381

A pseudogene long-noncoding-RNA network regulates PTEN transcription and translation in human cells.

PubMed

Johnsson, Per; Ackley, Amanda; Vidarsdottir, Linda; Lui, Weng-Onn; Corcoran, Martin; Grandér, Dan; Morris, Kevin V

2013-04-01

PTEN is a tumor-suppressor gene that has been shown to be under the regulatory control of a PTEN pseudogene expressed noncoding RNA, PTENpg1. Here, we characterize a previously unidentified PTENpg1-encoded antisense RNA (asRNA), which regulates PTEN transcription and PTEN mRNA stability. We find two PTENpg1 asRNA isoforms, α and β. The α isoform functions in trans, localizes to the PTEN promoter and epigenetically modulates PTEN transcription by the recruitment of DNA methyltransferase 3a and Enhancer of Zeste. In contrast, the β isoform interacts with PTENpg1 through an RNA-RNA pairing interaction, which affects PTEN protein output through changes of PTENpg1 stability and microRNA sponge activity. Disruption of this asRNA-regulated network induces cell-cycle arrest and sensitizes cells to doxorubicin, which suggests a biological function for the respective PTENpg1 expressed asRNAs.

A cell-penetrating peptide analogue, P7, exerts antimicrobial activity against Escherichia coli ATCC25922 via penetrating cell membrane and targeting intracellular DNA.

PubMed

Li, Lirong; Shi, Yonghui; Cheng, Xiangrong; Xia, Shufang; Cheserek, Maureen Jepkorir; Le, Guowei

2015-01-01

The antibacterial activities and mechanism of a new P7 were investigated in this study. P7 showed antimicrobial activities against five harmful microorganisms which contaminate and spoil food (MIC=4-32 μM). Flow cytometry and scanning electron microscopy analyses demonstrated that P7 induced pore-formation on the cell surface and led to morphological changes but did not lyse cell. Confocal fluorescence microscopic observations and flow cytometry analysis expressed that P7 could penetrate the Escherichia coli cell membrane and accumulate in the cytoplasm. Moreover, P7 possessed a strong DNA binding affinity. Further cell cycle analysis and change in gene expression analysis suggested that P7 induced a decreased expression in the genes involved in DNA replication. Up-regulated expression genes encoding DNA damage repair. This study suggests that P7 could be applied as a candidate for the development of new food preservatives as it exerts its antibacterial activities by penetrating cell membranes and targets intracellular DNA. Copyright © 2014 Elsevier Ltd. All rights reserved.

Host-derived viral transporter protein for nitrogen uptake in infected marine phytoplankton

PubMed Central

Chambouvet, Aurélie; Milner, David S.; Attah, Victoria; Terrado, Ramón; Lovejoy, Connie; Moreau, Hervé; Derelle, Évelyne; Richards, Thomas A.

2017-01-01

Phytoplankton community structure is shaped by both bottom–up factors, such as nutrient availability, and top–down processes, such as predation. Here we show that marine viruses can blur these distinctions, being able to amend how host cells acquire nutrients from their environment while also predating and lysing their algal hosts. Viral genomes often encode genes derived from their host. These genes may allow the virus to manipulate host metabolism to improve viral fitness. We identify in the genome of a phytoplankton virus, which infects the small green alga Ostreococcus tauri, a host-derived ammonium transporter. This gene is transcribed during infection and when expressed in yeast mutants the viral protein is located to the plasma membrane and rescues growth when cultured with ammonium as the sole nitrogen source. We also show that viral infection alters the nature of nitrogen compound uptake of host cells, by both increasing substrate affinity and allowing the host to access diverse nitrogen sources. This is important because the availability of nitrogen often limits phytoplankton growth. Collectively, these data show that a virus can acquire genes encoding nutrient transporters from a host genome and that expression of the viral gene can alter the nutrient uptake behavior of host cells. These results have implications for understanding how viruses manipulate the physiology and ecology of phytoplankton, influence marine nutrient cycles, and act as vectors for horizontal gene transfer. PMID:28827361

Comprehensive single cell-resolution analysis of the role of chromatin regulators in early C. elegans embryogenesis.

PubMed

Krüger, Angela V; Jelier, Rob; Dzyubachyk, Oleh; Zimmerman, Timo; Meijering, Erik; Lehner, Ben

2015-02-15

Chromatin regulators are widely expressed proteins with diverse roles in gene expression, nuclear organization, cell cycle regulation, pluripotency, physiology and development, and are frequently mutated in human diseases such as cancer. Their inhibition often results in pleiotropic effects that are difficult to study using conventional approaches. We have developed a semi-automated nuclear tracking algorithm to quantify the divisions, movements and positions of all nuclei during the early development of Caenorhabditis elegans and have used it to systematically study the effects of inhibiting chromatin regulators. The resulting high dimensional datasets revealed that inhibition of multiple regulators, including F55A3.3 (encoding FACT subunit SUPT16H), lin-53 (RBBP4/7), rba-1 (RBBP4/7), set-16 (MLL2/3), hda-1 (HDAC1/2), swsn-7 (ARID2), and let-526 (ARID1A/1B) affected cell cycle progression and caused chromosome segregation defects. In contrast, inhibition of cir-1 (CIR1) accelerated cell division timing in specific cells of the AB lineage. The inhibition of RNA polymerase II also accelerated these division timings, suggesting that normal gene expression is required to delay cell cycle progression in multiple lineages in the early embryo. Quantitative analyses of the dataset suggested the existence of at least two functionally distinct SWI/SNF chromatin remodeling complex activities in the early embryo, and identified a redundant requirement for the egl-27 and lin-40 MTA orthologs in the development of endoderm and mesoderm lineages. Moreover, our dataset also revealed a characteristic rearrangement of chromatin to the nuclear periphery upon the inhibition of multiple general regulators of gene expression. Our systematic, comprehensive and quantitative datasets illustrate the power of single cell-resolution quantitative tracking and high dimensional phenotyping to investigate gene function. Furthermore, the results provide an overview of the functions of essential chromatin regulators during the early development of an animal. Copyright © 2014 Elsevier Inc. All rights reserved.

The Proteomic Profile of Deleted in Breast Cancer 1 (DBC1) Interactions Points to a Multifaceted Regulation of Gene Expression*

PubMed Central

Giguère, Sophie S. B.; Guise, Amanda J.; Jean Beltran, Pierre M.; Joshi, Preeti M.; Greco, Todd M.; Quach, Olivia L.; Kong, Jeffery; Cristea, Ileana M.

2016-01-01

Deleted in breast cancer 1 (DBC1) has emerged as an important regulator of multiple cellular processes, ranging from gene expression to cell cycle progression. DBC1 has been linked to tumorigenesis both as an inhibitor of histone deacetylases, HDAC3 and sirtuin 1, and as a transcriptional cofactor for nuclear hormone receptors. However, despite mounting interest in DBC1, relatively little is known about the range of its interacting partners and the scope of its functions. Here, we carried out a functional proteomics-based investigation of DBC1 interactions in two relevant cell types, T cells and kidney cells. Microscopy, molecular biology, biochemistry, and mass spectrometry studies allowed us to assess DBC1 mRNA and protein levels, localization, phosphorylation status, and protein interaction networks. The comparison of DBC1 interactions in these cell types revealed conserved regulatory roles for DBC1 in gene expression, chromatin organization and modification, and cell cycle progression. Interestingly, we observe previously unrecognized DBC1 interactions with proteins encoded by cancer-associated genes. Among these interactions are five components of the SWI/SNF complex, the most frequently mutated chromatin remodeling complex in human cancers. Additionally, we identified a DBC1 interaction with TBL1XR1, a component of the NCoR complex, which we validated by reciprocal isolation. Strikingly, we discovered that DBC1 associates with proteins that regulate the circadian cycle, including DDX5, DHX9, and SFPQ. We validated this interaction by colocalization and reciprocal isolation. Functional assessment of this association demonstrated that DBC1 protein levels are important for regulating CLOCK and BMAL1 protein oscillations in synchronized T cells. Our results suggest that DBC1 is integral to the maintenance of the circadian molecular clock. Furthermore, the identified interactions provide a valuable resource for the exploration of pathways involved in DBC1-associated tumorigenesis. PMID:26657080

MAPK signaling pathways and HDAC3 activity are disrupted during differentiation of emerin-null myogenic progenitor cells

PubMed Central

Collins, Carol M.; Ellis, Joseph A.

2017-01-01

ABSTRACT Mutations in the gene encoding emerin cause Emery–Dreifuss muscular dystrophy (EDMD). Emerin is an integral inner nuclear membrane protein and a component of the nuclear lamina. EDMD is characterized by skeletal muscle wasting, cardiac conduction defects and tendon contractures. The failure to regenerate skeletal muscle is predicted to contribute to the skeletal muscle pathology of EDMD. We hypothesize that muscle regeneration defects are caused by impaired muscle stem cell differentiation. Myogenic progenitors derived from emerin-null mice were used to confirm their impaired differentiation and analyze selected myogenic molecular pathways. Emerin-null progenitors were delayed in their cell cycle exit, had decreased myosin heavy chain (MyHC) expression and formed fewer myotubes. Emerin binds to and activates histone deacetylase 3 (HDAC3). Here, we show that theophylline, an HDAC3-specific activator, improved myotube formation in emerin-null cells. Addition of the HDAC3-specific inhibitor RGFP966 blocked myotube formation and MyHC expression in wild-type and emerin-null myogenic progenitors, but did not affect cell cycle exit. Downregulation of emerin was previously shown to affect the p38 MAPK and ERK/MAPK pathways in C2C12 myoblast differentiation. Using a pure population of myogenic progenitors completely lacking emerin expression, we show that these pathways are also disrupted. ERK inhibition improved MyHC expression in emerin-null cells, but failed to rescue myotube formation or cell cycle exit. Inhibition of p38 MAPK prevented differentiation in both wild-type and emerin-null progenitors. These results show that each of these molecular pathways specifically regulates a particular stage of myogenic differentiation in an emerin-dependent manner. Thus, pharmacological targeting of multiple pathways acting at specific differentiation stages may be a better therapeutic approach in the future to rescue muscle regeneration in vivo. PMID:28188262

Identification of a mouse B-type cyclin which exhibits developmentally regulated expression in the germ line

NASA Technical Reports Server (NTRS)

Chapman, D. L.; Wolgemuth, D. J.

1992-01-01

To begin to examine the function of cyclins in mammalian germ cells, we have screened an adult mouse testis cDNA library for the presence of B-type cyclins. We have isolated cDNAs that encode a murine B-type cyclin, which has been designated cycB1. cycB1 was shown to be expressed in several adult tissues and in the midgestation mouse embryo. In the adult tissues, the highest levels of cycB1 transcripts were seen in the testis and ovary, which contain germ cells at various stages of differentiation. The major transcripts corresponding to cycB1 are 1.7 and 2.5 kb, with the 1.7 kb species being the predominant testicular transcript and the 2.5 kb species more abundant in the ovary. Examination of cDNAs corresponding to the 2.5 kb and 1.7 kb mRNAs revealed that these transcripts encode identical proteins, differing only in the polyadenylation signal used and therefore in the length of their 3' untranslated regions. Northern blot and in situ hybridization analyses revealed that the predominant sites of cycB1 expression in the testis and ovary were in the germinal compartment, particularly in early round spermatids in the testis and growing oocytes in the ovary. Thus cycB1 is expressed in both meiotic and postmeiotic cells. This pattern of cycB1 expression further suggests that cycB1 may have different functions in the two cell types, only one of which correlates with progression of the cell cycle.

Evolution in the Cycles of Life.

PubMed

Bowman, John L; Sakakibara, Keiko; Furumizu, Chihiro; Dierschke, Tom

2016-11-23

The life cycles of eukaryotes alternate between haploid and diploid phases, which are initiated by meiosis and gamete fusion, respectively. In both ascomycete and basidiomycete fungi and chlorophyte algae, the haploid-to-diploid transition is regulated by a pair of paralogous homeodomain protein encoding genes. That a common genetic program controls the haploid-to-diploid transition in phylogenetically disparate eukaryotic lineages suggests this may be the ancestral function for homeodomain proteins. Multicellularity has evolved independently in many eukaryotic lineages in either one or both phases of the life cycle. Organisms, such as land plants, exhibiting a life cycle whereby multicellular bodies develop in both the haploid and diploid phases are often referred to as possessing an alternation of generations. We review recent progress on understanding the genetic basis for the land plant alternation of generations and highlight the roles that homeodomain-encoding genes may have played in the evolution of complex multicellularity in this lineage.

Non-canonical Phototransduction Mediates Synchronization of the Drosophila melanogaster Circadian Clock and Retinal Light Responses.

PubMed

Ogueta, Maite; Hardie, Roger C; Stanewsky, Ralf

2018-06-04

The daily light-dark cycles represent a key signal for synchronizing circadian clocks. Both insects and mammals possess dedicated "circadian" photoreceptors but also utilize the visual system for clock resetting. In Drosophila, circadian clock resetting is achieved by the blue-light photoreceptor cryptochrome (CRY), which is expressed within subsets of the brain clock neurons. In addition, rhodopsin-expressing photoreceptor cells contribute to light synchronization. Light resets the molecular clock by CRY-dependent degradation of the clock protein Timeless (TIM), although in specific subsets of key circadian pacemaker neurons, including the small ventral lateral neurons (s-LNvs), TIM and Period (PER) oscillations can be synchronized by light independent of CRY and canonical visual Rhodopsin phototransduction. Here, we show that at least three of the seven Drosophila rhodopsins can utilize an alternative transduction mechanism involving the same α-subunit of the heterotrimeric G protein operating in canonical visual phototransduction (Gq). Surprisingly, in mutants lacking the canonical phospholipase C-β (PLC-β) encoded by the no receptor potential A (norpA) gene, we uncovered a novel transduction pathway using a different PLC-β encoded by the Plc21C gene. This novel pathway is important for behavioral clock resetting to semi-natural light-dark cycles and mediates light-dependent molecular synchronization within the s-LNv clock neurons. The same pathway appears to be responsible for norpA-independent light responses in the compound eye. We show that Rhodopsin 5 (Rh5) and Rh6, present in the R8 subset of retinal photoreceptor cells, drive both the long-term circadian and rapid light responses in the eye. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Viral exploitation of the MEK/ERK pathway - A tale of vaccinia virus and other viruses.

PubMed

Bonjardim, Cláudio A

2017-07-01

The VACV replication cycle is remarkable in the sense that it is performed entirely in the cytoplasmic compartment of vertebrate cells, due to its capability to encode enzymes required either for regulating the macromolecular precursor pool or the biosynthetic processes. Although remarkable, this gene repertoire is not sufficient to confer the status of a free-living microorganism to the virus, and, consequently, the virus relies heavily on the host to successfully generate its progeny. During the complex virus-host interaction, viruses must deal not only with the host pathways to accomplish their temporal demands but also with pathways that counteract viral infection, including the inflammatory, innate and acquired immune responses. This review focuses on VACV and other DNA or RNA viruses that stimulate the MEK (MAPK - Mitogen Activated Protein Kinase)/ERK- Extracellular signal-Regulated Kinase) pathway as part of their replication cycle. Copyright © 2016 Elsevier Inc. All rights reserved.

Cortactin modulates RhoA activation and expression of Cip/Kip cyclin-dependent kinase inhibitors to promote cell cycle progression in 11q13-amplified head and neck squamous cell carcinoma cells.

PubMed

Croucher, David R; Rickwood, Danny; Tactacan, Carole M; Musgrove, Elizabeth A; Daly, Roger J

2010-11-01

The cortactin oncoprotein is frequently overexpressed in head and neck squamous cell carcinoma (HNSCC), often due to amplification of the encoding gene (CTTN). While cortactin overexpression enhances invasive potential, recent research indicates that it also promotes cell proliferation, but how cortactin regulates the cell cycle machinery is unclear. In this article we report that stable short hairpin RNA-mediated cortactin knockdown in the 11q13-amplified cell line FaDu led to increased expression of the Cip/Kip cyclin-dependent kinase inhibitors (CDKIs) p21(WAF1/Cip1), p27(Kip1), and p57(Kip2) and inhibition of S-phase entry. These effects were associated with increased binding of p21(WAF1/Cip1) and p27(Kip1) to cyclin D1- and E1-containing complexes and decreased retinoblastoma protein phosphorylation. Cortactin regulated expression of p21(WAF1/Cip1) and p27(Kip1) at the transcriptional and posttranscriptional levels, respectively. The direct roles of p21(WAF1/Cip1), p27(Kip1), and p57(Kip2) downstream of cortactin were confirmed by the transient knockdown of each CDKI by specific small interfering RNAs, which led to partial rescue of cell cycle progression. Interestingly, FaDu cells with reduced cortactin levels also exhibited a significant diminution in RhoA expression and activity, together with decreased expression of Skp2, a critical component of the SCF ubiquitin ligase that targets p27(Kip1) and p57(Kip2) for degradation. Transient knockdown of RhoA in FaDu cells decreased expression of Skp2, enhanced the level of Cip/Kip CDKIs, and attenuated S-phase entry. These findings identify a novel mechanism for regulation of proliferation in 11q13-amplified HNSCC cells, in which overexpressed cortactin acts via RhoA to decrease expression of Cip/Kip CDKIs, and highlight Skp2 as a downstream effector for RhoA in this process.

The role of BST2/tetherin in infection with the feline retroviruses

PubMed Central

Dietrich, Isabelle; Hosie, Margaret J.; Willett, Brian J.

2014-01-01

The recently identified host restriction factor tetherin (BST-2, CD317) potently inhibits the release of nascent retrovirus particles from infected cells. Recently, we reported the identification and characterization of tetherin as a novel feline retroviral restriction factor. Based on homology to human tetherin we identified a putative tetherin gene in the genome of the domestic cat (Felis catus) which was found to be expressed in different feline cell lines both prior to and post treatment with either type I or type II interferon (IFN). The predicted structure of feline tetherin (feTHN) was that of a type II single-pass transmembrane protein encoding an N-terminal transmembrane anchor, central predicted coiled-coil bearing extracellular domain to promote dimerization, and a C-terminal GPI-anchor, consistent with conservation of structure between human and feline tetherin. FeTHN displayed potent inhibition of feline immunodeficiency virus (FIV) and human immunodeficiency virus type 1 (HIV-1) particle release in single-cycle replication assays. Notably, feTHN activity was resistant to antagonism by HIV-1 Vpu. However, stable ectopic expression of feTHN mRNA in different feline cell lines had no inhibitory effect on the growth of diverse primary or cell culture-adapted strains of FIV. Hence, whereas feline tetherin efficiently blocks viral particle release in single-cycle replication assays, it might not prevent dissemination of feline retroviruses in vivo. PMID:21715020

Dynamic Epstein-Barr Virus Gene Expression on the Path to B-Cell Transformation

PubMed Central

Price, Alexander M.; Luftig, Micah A.

2016-01-01

Epstein-Barr Virus is an oncogenic human herpesvirus in the γ-herpesvirinae sub-family that contains a 170–180 kb double stranded DNA genome. In vivo, EBV commonly infects B and epithelial cells and persists for the life of the host in a latent state in the memory B cell compartment of the peripheral blood. EBV can be reactivated from its latent state leading to increased expression of lytic genes that primarily encode for enzymes necessary to replicate the viral genome as well as structural components of the virion. Lytic cycle proteins also aid in immune evasion, inhibition of apoptosis, and the modulation of other host responses to infection. In vitro, EBV has the potential to infect primary human B cells and induce cellular proliferation to yield effectively immortalized lymphoblastoid cell lines, or LCLs. EBV immortalization of B cells in vitro serves as a model system for studying EBV-mediated lymphomagenesis. While much is known about the steady state viral gene expression within EBV immortalized LCLs and other EBV-positive cell lines, relatively little is known about the early events after primary B-cell infection. It was previously thought that upon latent infection EBV only expressed the well-characterized latency associated transcripts found in LCLs. However, recent work has characterized the early, but transient, expression of lytic genes necessary for efficient transformation as well as delayed responses in the known latency genes. This review summarizes these recent findings that show how dynamic and controlled expression of multiple EBV genes can control the activation of B cells, entry into the cell cycle, inhibition of apoptosis, and control of innate and adaptive immune responses. PMID:24373315

Resveratrol Suppresses Growth and Migration of Myelodysplastic Cells by Inhibiting the Expression of Elevated Cyclin D1 (CCND1).

PubMed

Zhou, Wei; Xu, Shilin; Ying, Yi; Zhou, Ruiqing; Chen, Xiaowei

2017-11-01

Myelodysplastic syndromes (MDS) are a group of heterogeneous diseases characterized by poorly formed blood cells. We wanted to elucidate the underlying molecular mechanism to better determine pathogenesis, prognosis, diagnosis, and treatment for patients with MDS. We compared gene expression levels between normal and MDS tissue samples by immunohistochemical analysis. We studied the proliferation, survival, and migration of MDS cells using the EDU assay, colony formation, and transwell assays. We assessed the apoptotic rate and cell cycle status using flow cytometry and Hoechst staining. Finally, we evaluated RNA and protein expressions using polymerase chain reaction and Western blots, respectively. We found that resveratrol suppressed SKM-1 (an advanced MDS cell line) proliferation in a dose-dependent manner. Consistent with this finding, the EDU and colony formation assays also showed that resveratrol inhibited SKM-1 growth. Moreover, flow cytometry and Hoechst 33258 staining demonstrated that resveratrol induced apoptosis and a change in cell cycle status in SKM-1 cells, while the transwell assay showed that resveratrol reduced the migratory ability of SKM-1 cells. Resveratrol also decreased the expression of CCND1 (a gene that encodes the cyclin D1 protein) and increased expressions of KMT2A [lysine (K)-specific methyltransferase 2A] and caspase-3, suggesting that resveratrol exerts its effect by regulating CCND1 in SKM-1 cells. In addition, a combination of resveratrol and the PI3K/AKT inhibitor LY294002 exhibited a stronger inhibitory effect on the SKM-1 cells, compared with resveratrol alone. Our study proved that resveratrol suppresses SKM-1 growth and migration by inhibiting CCND1 expression. This finding provides novel insights into the pathogenesis of MDS and might help develop new diagnosis and treatment for patients with MDS.

Identification and Characterization of Alternative Promoters, Transcripts and Protein Isoforms of Zebrafish R2 Gene

PubMed Central

Shang, Hanqiao; Li, Qing; Feng, Guohui; Cui, Zongbin

2011-01-01

Ribonucleotide reductase (RNR) is the rate-limiting enzyme in the de novo synthesis of deoxyribonucleoside triphosphates. Expression of RNR subunits is closely associated with DNA replication and repair. Mammalian RNR M2 subunit (R2) functions exclusively in DNA replication of normal cells due to its S phase-specific expression and late mitotic degradation. Herein, we demonstrate the control of R2 expression through alternative promoters, splicing and polyadenylation sites in zebrafish. Three functional R2 promoters were identified to generate six transcript variants with distinct 5′ termini. The proximal promoter contains a conserved E2F binding site and two CCAAT boxes, which are crucial for the transcription of R2 gene during cell cycle. Activity of the distal promoter can be induced by DNA damage to generate four transcript variants through alternative splicing. In addition, two novel splice variants were found to encode distinct N-truncated R2 isoforms containing residues for enzymatic activity but no KEN box essential for its proteolysis. These two N-truncated R2 isoforms remained in the cytoplasm and were able to interact with RNR M1 subunit (R1). Thus, our results suggest that multilayered mechanisms control the differential expression and function of zebrafish R2 gene during cell cycle and under genotoxic stress. PMID:21887375

Identification and characterization of alternative promoters, transcripts and protein isoforms of zebrafish R2 gene.

PubMed

Shang, Hanqiao; Li, Qing; Feng, Guohui; Cui, Zongbin

2011-01-01

Ribonucleotide reductase (RNR) is the rate-limiting enzyme in the de novo synthesis of deoxyribonucleoside triphosphates. Expression of RNR subunits is closely associated with DNA replication and repair. Mammalian RNR M2 subunit (R2) functions exclusively in DNA replication of normal cells due to its S phase-specific expression and late mitotic degradation. Herein, we demonstrate the control of R2 expression through alternative promoters, splicing and polyadenylation sites in zebrafish. Three functional R2 promoters were identified to generate six transcript variants with distinct 5' termini. The proximal promoter contains a conserved E2F binding site and two CCAAT boxes, which are crucial for the transcription of R2 gene during cell cycle. Activity of the distal promoter can be induced by DNA damage to generate four transcript variants through alternative splicing. In addition, two novel splice variants were found to encode distinct N-truncated R2 isoforms containing residues for enzymatic activity but no KEN box essential for its proteolysis. These two N-truncated R2 isoforms remained in the cytoplasm and were able to interact with RNR M1 subunit (R1). Thus, our results suggest that multilayered mechanisms control the differential expression and function of zebrafish R2 gene during cell cycle and under genotoxic stress.

Identification of cdc25 gene in pinewood nematode, Bursaphelenchus xylophilus, and its function in reproduction.

PubMed

Choi, Ye-Na; Oh, Bong-Kyeong; Kawasaki, Ichiro; Oh, Wan-Suk; Lee, Yi; Paik, Young-Ki; Shim, Yhong-Hee

2010-02-28

The cdc25 gene, which is highly conserved in many eukaryotes, encodes a phosphatase that plays essential roles in cell cycle regulation. We identified a cdc25 ortholog in the pinewood nematode, Bursaphelenchus xylophilus. The B. xylophilus ortholog (Bx-cdc25) was found to be highly similar to Caenorhabditis elegans cdc-25.2 in sequence as well as in gene structure, both having long intron 1. The Bx-cdc25 gene was determined to be composed of seven exons and six introns in a 2,580 bp region, and was shown to encode 360 amino acids of a protein containing a highly-conserved phosphatase domain. Bx-cdc25 mRNA was hardly detectable throughout the juvenile stages but was highly expressed in eggs and in both female and male adults. Functional conservation during germline development between C. elegans cdc25 and Bx-cdc25 was revealed by Bx-cdc25 RNA interference in C. elegans.

Mutation for nonsyndromic mental retardation in the trans-2-enoyl-CoA reductase TER gene involved in fatty acid elongation impairs the enzyme activity and stability, leading to change in sphingolipid profile.

PubMed

Abe, Kensuke; Ohno, Yusuke; Sassa, Takayuki; Taguchi, Ryo; Çalışkan, Minal; Ober, Carole; Kihara, Akio

2013-12-20

Very long-chain fatty acids (VLCFAs, chain length >C20) exist in tissues throughout the body and are synthesized by repetition of the fatty acid (FA) elongation cycle composed of four successive enzymatic reactions. In mammals, the TER gene is the only gene encoding trans-2-enoyl-CoA reductase, which catalyzes the fourth reaction in the FA elongation cycle. The TER P182L mutation is the pathogenic mutation for nonsyndromic mental retardation. This mutation substitutes a leucine for a proline residue at amino acid 182 in the TER enzyme. Currently, the mechanism by which the TER P182L mutation causes nonsyndromic mental retardation is unknown. To understand the effect of this mutation on the TER enzyme and VLCFA synthesis, we have biochemically characterized the TER P182L mutant enzyme using yeast and mammalian cells transfected with the TER P182L mutant gene and analyzed the FA elongation cycle in the B-lymphoblastoid cell line with the homozygous TER P182L mutation (TER(P182L/P182L) B-lymphoblastoid cell line). We have found that TER P182L mutant enzyme exhibits reduced trans-2-enoyl-CoA reductase activity and protein stability, thereby impairing VLCFA synthesis and, in turn, altering the sphingolipid profile (i.e. decreased level of C24 sphingomyelin and C24 ceramide) in the TER(P182L/P182L) B-lymphoblastoid cell line. We have also found that in addition to the TER enzyme-catalyzed fourth reaction, the third reaction in the FA elongation cycle is affected by the TER P182L mutation. These findings provide new insight into the biochemical defects associated with this genetic mutation.

A novel family of katanin-like 2 protein isoforms (KATNAL2), interacting with nucleotide-binding proteins Nubp1 and Nubp2, are key regulators of different MT-based processes in mammalian cells.

PubMed

Ververis, Antonis; Christodoulou, Andri; Christoforou, Maria; Kamilari, Christina; Lederer, Carsten W; Santama, Niovi

2016-01-01

Katanins are microtubule (MT)-severing AAA proteins with high phylogenetic conservation throughout the eukaryotes. They have been functionally implicated in processes requiring MT remodeling, such as spindle assembly in mitosis and meiosis, assembly/disassembly of flagella and cilia and neuronal morphogenesis. Here, we uncover a novel family of katanin-like 2 proteins (KATNAL2) in mouse, consisting of five alternatively spliced isoforms encoded by the Katnal2 genomic locus. We further demonstrate that in vivo these isoforms are able to interact with themselves, with each other and moreover directly and independently with MRP/MinD-type P-loop NTPases Nubp1 and Nubp2, which are integral components of centrioles, negative regulators of ciliogenesis and implicated in centriole duplication in mammalian cells. We find KATNAL2 localized on interphase MTs, centrioles, mitotic spindle, midbody and the axoneme and basal body of sensory cilia in cultured murine cells. shRNAi of Katnal2 results in inefficient cytokinesis and severe phenotypes of enlarged cells and nuclei, increased numbers of centrioles and the manifestation of aberrant multipolar mitotic spindles, mitotic defects, chromosome bridges, multinuclearity, increased MT acetylation and an altered cell cycle pattern. Silencing or stable overexpression of KATNAL2 isoforms drastically reduces ciliogenesis. In conclusion, KATNAL2s are multitasking enzymes involved in the same cell type in critically important processes affecting cytokinesis, MT dynamics, and ciliogenesis and are also implicated in cell cycle progression.

Deregulation of tumor angiogenesis and blockade of tumor growth in PPARβ-deficient mice

PubMed Central

Müller-Brüsselbach, Sabine; Kömhoff, Martin; Rieck, Markus; Meissner, Wolfgang; Kaddatz, Kerstin; Adamkiewicz, Jürgen; Keil, Boris; Klose, Klaus J; Moll, Roland; Burdick, Andrew D; Peters, Jeffrey M; Müller, Rolf

2007-01-01

The peroxisome proliferator-activated receptor-β (PPARβ) has been implicated in tumorigenesis, but its precise role remains unclear. Here, we show that the growth of syngeneic Pparb wild-type tumors is impaired in Pparb−/− mice, concomitant with a diminished blood flow and an abundance of hyperplastic microvascular structures. Matrigel plugs containing pro-angiogenic growth factors harbor increased numbers of morphologically immature, proliferating endothelial cells in Pparb−/− mice, and retroviral transduction of Pparb triggers microvessel maturation. We have identified the Cdkn1c gene encoding the cell cycle inhibitor p57Kip2 as a PPARβ target gene and a mediator of the PPARβ-mediated inhibition of cell proliferation, which provides a possible mechanistic explanation for the observed tumor endothelial hyperplasia and deregulation of tumor angiogenesis in Pparb−/− mice. Our data point to an unexpected essential role for PPARβ in constraining tumor endothelial cell proliferation to allow for the formation of functional tumor microvessels. PMID:17641685

Prevention of the neurocristopathy Treacher Collins syndrome through inhibition of p53 function.

PubMed

Jones, Natalie C; Lynn, Megan L; Gaudenz, Karin; Sakai, Daisuke; Aoto, Kazushi; Rey, Jean-Phillipe; Glynn, Earl F; Ellington, Lacey; Du, Chunying; Dixon, Jill; Dixon, Michael J; Trainor, Paul A

2008-02-01

Treacher Collins syndrome (TCS) is a congenital disorder of craniofacial development arising from mutations in TCOF1, which encodes the nucleolar phosphoprotein Treacle. Haploinsufficiency of Tcof1 perturbs mature ribosome biogenesis, resulting in stabilization of p53 and the cyclin G1-mediated cell-cycle arrest that underpins the specificity of neuroepithelial apoptosis and neural crest cell hypoplasia characteristic of TCS. Here we show that inhibition of p53 prevents cyclin G1-driven apoptotic elimination of neural crest cells while rescuing the craniofacial abnormalities associated with mutations in Tcof1 and extending life span. These improvements, however, occur independently of the effects on ribosome biogenesis; thus suggesting that it is p53-dependent neuroepithelial apoptosis that is the primary mechanism underlying the pathogenesis of TCS. Our work further implies that neuroepithelial and neural crest cells are particularly sensitive to cellular stress during embryogenesis and that suppression of p53 function provides an attractive avenue for possible clinical prevention of TCS craniofacial birth defects and possibly those of other neurocristopathies.

Induction of type 1 iodothyronine deiodinase expression inhibits proliferation and migration of renal cancer cells.

PubMed

Poplawski, Piotr; Rybicka, Beata; Boguslawska, Joanna; Rodzik, Katarzyna; Visser, Theo J; Nauman, Alicja; Piekielko-Witkowska, Agnieszka

2017-02-15

Type 1 iodothyronine deiodinase (DIO1) regulates peripheral metabolism of thyroid hormones that control cellular proliferation, differentiation and metabolism. The significance of DIO1 in cancer is unknown. In this study we hypothesized that diminished expression of DIO1, observed in renal cancer, contributes to the carcinogenic process in the kidney. Here, we demonstrate that ectopic expression of DIO1 in renal cancer cells changes the expression of genes controlling cell cycle, including cyclin E1 and E2F5, and results in inhibition of proliferation. The expression of genes encoding collagens (COL1A1, COL4A2, COL5A1), integrins (ITGA4, ITGA5, ITGB3) and transforming growth factor-β-induced (TGFBI) is significantly altered in renal cancer cells with induced expression of DIO1. Finally, we show that overexpression of DIO1 inhibits migration of renal cancer cells. In conclusion, we demonstrate for the first time that loss of DIO1 contributes to renal carcinogenesis and that its induced expression protects cells against cancerous proliferation and migration. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

p16(INK4a) -mediated suppression of telomerase in normal and malignant human breast cells.

PubMed

Bazarov, Alexey V; Van Sluis, Marjolein; Hines, William C; Bassett, Ekaterina; Beliveau, Alain; Campeau, Eric; Mukhopadhyay, Rituparna; Lee, Won Jae; Melodyev, Sonya; Zaslavsky, Yuri; Lee, Leonard; Rodier, Francis; Chicas, Agustin; Lowe, Scott W; Benhattar, Jean; Ren, Bing; Campisi, Judith; Yaswen, Paul

2010-10-01

The cyclin-dependent kinase inhibitor p16(INK4a) (CDKN2A) is an important tumor suppressor gene frequently inactivated in human tumors. p16 suppresses the development of cancer by triggering an irreversible arrest of cell proliferation termed cellular senescence. Here, we describe another anti-oncogenic function of p16 in addition to its ability to halt cell cycle progression. We show that transient expression of p16 stably represses the hTERT gene, encoding the catalytic subunit of telomerase, in both normal and malignant breast epithelial cells. Short-term p16 expression increases the amount of histone H3 trimethylated on lysine 27 (H3K27) bound to the hTERT promoter, resulting in transcriptional silencing, likely mediated by polycomb complexes. Our results indicate that transient p16 exposure may prevent malignant progression in dividing cells by irreversible repression of genes, such as hTERT, whose activity is necessary for extensive self-renewal. © 2010 The Authors Aging Cell © 2010 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland.

Identification and characterization of INMAP, a novel interphase nucleus and mitotic apparatus protein that is involved in spindle formation and cell cycle progression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shen, Enzhi; Lei, Yan; Liu, Qian

2009-04-15

A novel protein that associates with interphase nucleus and mitotic apparatus (INMAP) was identified by screening HeLa cDNA expression library with an autoimmune serum followed by tandem mass spectrometry. Its complete cDNA sequence of 1.818 kb encodes 343 amino acids with predicted molecular mass of 38.2 kDa and numerous phosphorylation sites. The sequence is identical with nucleotides 1-1800 bp of an unnamed gene (GenBank accession no. (7022388)) and highly homologous with the 3'-terminal sequence of POLR3B. A monoclonal antibody against INMAP reacted with similar proteins in S. cerevisiae, Mel and HeLa cells, suggesting that it is a conserved protein. Confocalmore » microscopy using either GFP-INMAP fusion protein or labeling with the monoclonal antibody revealed that the protein localizes as distinct dots in the interphase nucleus, but during mitosis associates closely with the spindle. Double immunolabeling using specific antibodies showed that the INMAP co-localizes with {alpha}-tubulin, {gamma}-tubulin, and NuMA. INMAP also co-immunoprecipitated with these proteins in their native state. Stable overexpression of INMAP in HeLa cell lines leads to defects in the spindle, mitotic arrest, formation of polycentrosomal and multinuclear cells, inhibition of growth, and apoptosis. We propose that INMAP is a novel protein that plays essential role in spindle formation and cell-cycle progression.« less

3D Spatially Resolved Models of the Intracellular Dynamics of the Hepatitis C Genome Replication Cycle

PubMed Central

Reiter, Sebastian; Grillo, Alfio; Herrmann, Eva; Wittum, Gabriel

2017-01-01

Mathematical models of virus dynamics have not previously acknowledged spatial resolution at the intracellular level despite substantial arguments that favor the consideration of intracellular spatial dependence. The replication of the hepatitis C virus (HCV) viral RNA (vRNA) occurs within special replication complexes formed from membranes derived from endoplasmatic reticulum (ER). These regions, termed membranous webs, are generated primarily through specific interactions between nonstructural virus-encoded proteins (NSPs) and host cellular factors. The NSPs are responsible for the replication of the vRNA and their movement is restricted to the ER surface. Therefore, in this study we developed fully spatio-temporal resolved models of the vRNA replication cycle of HCV. Our simulations are performed upon realistic reconstructed cell structures—namely the ER surface and the membranous webs—based on data derived from immunostained cells replicating HCV vRNA. We visualized 3D simulations that reproduced dynamics resulting from interplay of the different components of our models (vRNA, NSPs, and a host factor), and we present an evaluation of the concentrations for the components within different regions of the cell. Thus far, our model is restricted to an internal portion of a hepatocyte and is qualitative more than quantitative. For a quantitative adaption to complete cells, various additional parameters will have to be determined through further in vitro cell biology experiments, which can be stimulated by the results described in the present study. PMID:28973992

Genome‐wide gene expression dynamics of the fungal pathogen Dothistroma septosporum throughout its infection cycle of the gymnosperm host Pinus radiata

PubMed Central

Guo, Yanan; Sim, Andre D.; Kabir, M. Shahjahan; Chettri, Pranav; Ozturk, Ibrahim K.; Hunziker, Lukas; Ganley, Rebecca J.; Cox, Murray P.

2015-01-01

Summary We present genome‐wide gene expression patterns as a time series through the infection cycle of the fungal pine needle blight pathogen, Dothistroma septosporum, as it invades its gymnosperm host, Pinus radiata. We determined the molecular changes at three stages of the disease cycle: epiphytic/biotrophic (early), initial necrosis (mid) and mature sporulating lesion (late). Over 1.7 billion combined plant and fungal reads were sequenced to obtain 3.2 million fungal‐specific reads, which comprised as little as 0.1% of the sample reads early in infection. This enriched dataset shows that the initial biotrophic stage is characterized by the up‐regulation of genes encoding fungal cell wall‐modifying enzymes and signalling proteins. Later necrotrophic stages show the up‐regulation of genes for secondary metabolism, putative effectors, oxidoreductases, transporters and starch degradation. This in‐depth through‐time transcriptomic study provides our first snapshot of the gene expression dynamics that characterize infection by this fungal pathogen in its gymnosperm host. PMID:25919703

Essential role for calcium waves in migration of human vascular smooth muscle cells.

PubMed

Espinosa-Tanguma, Ricardo; O'Neil, Caroline; Chrones, Tom; Pickering, J Geoffrey; Sims, Stephen M

2011-08-01

Vascular smooth muscle cell (SMC) migration is characterized by extension of the lamellipodia at the leading edge, lamellipodial attachment to substrate, and release of the rear (uropod) of the cell, all of which enable forward movement. However, little is known regarding the role of intracellular cytosolic Ca(2+) concentration ([Ca(2+)](i)) in coordinating these distinct activities of migrating SMCs. The objective of our study was to determine whether regional changes of Ca(2+) orchestrate the migratory cycle in human vascular SMCs. We carried out Ca(2+) imaging using digital fluorescence microscopy of fura-2 loaded human smooth muscle cells. We found that motile SMCs exhibited Ca(2+) waves that characteristically swept from the rear of polarized cells toward the leading edge. Ca(2+) waves were less evident in nonpolarized, stationary cells, although acute stimulation of these SMCs with the agonists platelet-derived growth factor-BB or histamine could elicit transient rise of [Ca(2+)](i). To investigate a role for Ca(2+) waves in the migratory cycle, we loaded cells with the Ca(2+) chelator BAPTA, which abolished Ca(2+) waves and significantly reduced retraction, supporting a causal role for Ca(2+) in initiation of retraction. However, lamellipod motility was still evident in BAPTA-loaded cells. The incidence of Ca(2+) oscillations was reduced when Ca(2+) release from intracellular stores was disrupted with the sarcoplasmic reticulum Ca(2+)-ATPase inhibitor thapsigargin or by treatment with the inositol 1,4,5-trisphosphate receptor blocker 2-aminoethoxy-diphenyl borate or xestospongin C, implicating Ca(2+) stores in generation of waves. We conclude that Ca(2+) waves are essential for migration of human vascular SMCs and can encode cell polarity.

ABCC6 knockdown in HepG2 cells induces a senescent-like cell phenotype.

PubMed

Miglionico, Rocchina; Ostuni, Angela; Armentano, Maria Francesca; Milella, Luigi; Crescenzi, Elvira; Carmosino, Monica; Bisaccia, Faustino

2017-01-01

Pseudoxanthoma elasticum (PXE) is characterized by progressive ectopic mineralization of elastic fibers in dermal, ocular and vascular tissues. No effective treatment exists. It is caused by inactivating mutations in the gene encoding for the ATP-binding cassette, sub-family C member 6 transporter (ABCC6), which is mainly expressed in the liver. The ABCC6 substrate (s) and the PXE pathomechanism remain unknown. Recent studies have shown that overexpression of ABCC6 in HEK293 cells results in efflux of ATP, which is rapidly converted into nucleoside monophosphates and pyrophosphate (PPi). Since the latter inhibits mineralization, it was proposed that the absence of circulating PPi in PXE patients results in the characteristic ectopic mineralization. These studies also demonstrated that the presence of ABCC6 modifies cell secretory activity and suggested that ABCC6 can change the cell phenotype. Stable ABCC6 knockdown HepG2 clones were generated using small hairpin RNA (shRNA) technology. The intracellular glutathione and ROS levels were determined. Experiments using cell cycle analysis, real-time PCR and western blot were performed on genes involved in the senescence phenotype. To shed light on the physiological role of ABCC6, we focused on the phenotype of HepG2 cells that lack ABCC6 activity. Interestingly, we found that ABCC6 knockdown HepG2 cells show: 1) intracellular reductive stress; 2) cell cycle arrest in G1 phase; 3) upregulation of p21 Cip p53 independent; and 4) downregulation of lamin A/C. These findings show that the absence of ABCC6 profoundly changes the HepG2 phenotype, suggesting that the PXE syndrome is a complex metabolic disease that is not exclusively related to the absence of pyrophosphate in the bloodstream.

Extremely Low-Frequency Electromagnetic Fields Cause G1 Phase Arrest through the Activation of the ATM-Chk2-p21 Pathway

PubMed Central

Huang, Chao-Ying; Chang, Cheng-Wei; Chen, Chaang-Ray; Chuang, Chun-Yu; Chiang, Chi-Shiun; Shu, Wun-Yi; Fan, Tai-Ching; Hsu, Ian C.

2014-01-01

In daily life, humans are exposed to the extremely low-frequency electromagnetic fields (ELF-EMFs) generated by electric appliances, and public concern is increasing regarding the biological effects of such exposure. Numerous studies have yielded inconsistent results regarding the biological effects of ELF-EMF exposure. Here we show that ELF-EMFs activate the ATM-Chk2-p21 pathway in HaCaT cells, inhibiting cell proliferation. To present well-founded results, we comprehensively evaluated the biological effects of ELF-EMFs at the transcriptional, protein, and cellular levels. Human HaCaT cells from an immortalized epidermal keratinocyte cell line were exposed to a 1.5 mT, 60 Hz ELF-EMF for 144 h. The ELF-EMF could cause G1 arrest and decrease colony formation. Protein expression experiments revealed that ELF-EMFs induced the activation of the ATM/Chk2 signaling cascades. In addition, the p21 protein, a regulator of cell cycle progression at G1 and G2/M, exhibited a higher level of expression in exposed HaCaT cells compared with the expression of sham-exposed cells. The ELF-EMF-induced G1 arrest was diminished when the CHK2 gene expression (which encodes checkpoint kinase 2; Chk2) was suppressed by specific small interfering RNA (siRNA). These findings indicate that ELF-EMFs activate the ATM-Chk2-p21 pathway in HaCaT cells, resulting in cell cycle arrest at the G1 phase. Based on the precise control of the ELF-EMF exposure and rigorous sham-exposure experiments, all transcriptional, protein, and cellular level experiments consistently supported the conclusion. This is the first study to confirm that a specific pathway is triggered by ELF-EMF exposure. PMID:25111195

Chronological Lifespan in Yeast Is Dependent on the Accumulation of Storage Carbohydrates Mediated by Yak1, Mck1 and Rim15 Kinases

PubMed Central

Tang, Yingzhi; Quan, Zhenzhen; Zhang, Zhe; Oliver, Stephen G.; Zhang, Nianshu

2016-01-01

Upon starvation for glucose or any other macronutrient, yeast cells exit from the mitotic cell cycle and acquire a set of characteristics that are specific to quiescent cells to ensure longevity. Little is known about the molecular determinants that orchestrate quiescence entry and lifespan extension. Using starvation-specific gene reporters, we screened a subset of the yeast deletion library representing the genes encoding ‘signaling’ proteins. Apart from the previously characterised Rim15, Mck1 and Yak1 kinases, the SNF1/AMPK complex, the cell wall integrity pathway and a number of cell cycle regulators were shown to be necessary for proper quiescence establishment and for extension of chronological lifespan (CLS), suggesting that entry into quiescence requires the integration of starvation signals transmitted via multiple signaling pathways. The CLS of these signaling mutants, and those of the single, double and triple mutants of RIM15, YAK1 and MCK1 correlates well with the amount of storage carbohydrates but poorly with transition-phase cell cycle status. Combined removal of the glycogen and trehalose biosynthetic genes, especially GSY2 and TPS1, nearly abolishes the accumulation of storage carbohydrates and severely reduces CLS. Concurrent overexpression of GSY2 and TSL1 or supplementation of trehalose to the growth medium ameliorates the severe CLS defects displayed by the signaling mutants (rim15Δyak1Δ or rim15Δmck1Δ). Furthermore, we reveal that the levels of intracellular reactive oxygen species are cooperatively controlled by Yak1, Rim15 and Mck1, and the three kinases mediate the TOR1-regulated accumulation of storage carbohydrates and CLS extension. Our data support the hypothesis that metabolic reprogramming to accumulate energy stores and the activation of anti-oxidant defence systems are coordinated by Yak1, Rim15 and Mck1 kinases to ensure quiescence entry and lifespan extension in yeast. PMID:27923067

Chronological Lifespan in Yeast Is Dependent on the Accumulation of Storage Carbohydrates Mediated by Yak1, Mck1 and Rim15 Kinases.

PubMed

Cao, Lu; Tang, Yingzhi; Quan, Zhenzhen; Zhang, Zhe; Oliver, Stephen G; Zhang, Nianshu

2016-12-01

Upon starvation for glucose or any other macronutrient, yeast cells exit from the mitotic cell cycle and acquire a set of characteristics that are specific to quiescent cells to ensure longevity. Little is known about the molecular determinants that orchestrate quiescence entry and lifespan extension. Using starvation-specific gene reporters, we screened a subset of the yeast deletion library representing the genes encoding 'signaling' proteins. Apart from the previously characterised Rim15, Mck1 and Yak1 kinases, the SNF1/AMPK complex, the cell wall integrity pathway and a number of cell cycle regulators were shown to be necessary for proper quiescence establishment and for extension of chronological lifespan (CLS), suggesting that entry into quiescence requires the integration of starvation signals transmitted via multiple signaling pathways. The CLS of these signaling mutants, and those of the single, double and triple mutants of RIM15, YAK1 and MCK1 correlates well with the amount of storage carbohydrates but poorly with transition-phase cell cycle status. Combined removal of the glycogen and trehalose biosynthetic genes, especially GSY2 and TPS1, nearly abolishes the accumulation of storage carbohydrates and severely reduces CLS. Concurrent overexpression of GSY2 and TSL1 or supplementation of trehalose to the growth medium ameliorates the severe CLS defects displayed by the signaling mutants (rim15Δyak1Δ or rim15Δmck1Δ). Furthermore, we reveal that the levels of intracellular reactive oxygen species are cooperatively controlled by Yak1, Rim15 and Mck1, and the three kinases mediate the TOR1-regulated accumulation of storage carbohydrates and CLS extension. Our data support the hypothesis that metabolic reprogramming to accumulate energy stores and the activation of anti-oxidant defence systems are coordinated by Yak1, Rim15 and Mck1 kinases to ensure quiescence entry and lifespan extension in yeast.

Hippocampal place cell encoding of sloping terrain.

PubMed

Porter, Blake S; Schmidt, Robert; Bilkey, David K

2018-05-21

Effective navigation relies on knowledge of one's environment. A challenge to effective navigation is accounting for the time and energy costs of routes. Irregular terrain in ecological environments poses a difficult navigational problem as organisms ought to avoid effortful slopes to minimize travel costs. Route planning and navigation have previously been shown to involve hippocampal place cells and their ability to encode and store information about an organism's environment. However, little is known about how place cells may encode the slope of space and associated energy costs as experiments are traditionally carried out in flat, horizontal environments. We set out to investigate how dorsal-CA1 place cells in rats encode systematic changes to the slope of an environment by tilting a shuttle box from flat to 15° and 25° while minimizing external cue change. Overall, place cell encoding of tilted space was as robust as their encoding of flat ground as measured by traditional place cell metrics such as firing rates, spatial information, coherence, and field size. A large majority of place cells did, however, respond to slope by undergoing partial, complex remapping when the environment was shifted from one tilt angle to another. The propensity for place cells to remap did not, however, depend on the vertical distance the field shifted. Changes in slope also altered the temporal coding of information as measured by the rate of theta phase precession of place cell spikes, which decreased with increasing tilt angles. Together these observations indicate that place cells are sensitive to relatively small changes in terrain slope and that terrain slope may be an important source of information for organizing place cell ensembles. The terrain slope information encoded by place cells could be utilized by efferent regions to determine energetically advantageous routes to goal locations. This article is protected by copyright. All rights reserved. © 2018 Wiley Periodicals, Inc.

Role of WDHD1 in Human Papillomavirus-Mediated Oncogenesis Identified by Transcriptional Profiling of E7-Expressing Cells

PubMed Central

Zhou, Yunying; Zhang, Qishu; Gao, Ge; Zhang, Xiaoli; Liu, Yafei; Yuan, Shoudao

2016-01-01

ABSTRACT The E7 oncoprotein of the high-risk human papillomavirus (HPV) plays a major role in HPV-induced carcinogenesis. E7 abrogates the G1 cell cycle checkpoint and induces genomic instability, but the mechanism is not fully understood. In this study, we performed RNA sequencing (RNA-seq) to characterize the transcriptional profile of keratinocytes expressing HPV 16 (HPV-16) E7. At the transcriptome level, 236 genes were differentially expressed between E7 and vector control cells. A subset of the differentially expressed genes, most of them novel to E7-expressing cells, was further confirmed by real-time PCR. Of interest, the activities of multiple transcription factors were altered in E7-expressing cells. Through bioinformatics analysis, pathways altered in E7-expressing cells were investigated. The upregulated genes were enriched in cell cycle and DNA replication, as well as in the DNA metabolic process, transcription, DNA damage, DNA repair, and nucleotide metabolism. Specifically, we focused our studies on the gene encoding WDHD1 (WD repeat and high mobility group [HMG]-box DNA-binding protein), one of the genes that was upregulated in E7-expressing cells. WDHD1 is a component of the replisome that regulates DNA replication. Recent studies suggest that WDHD1 may also function as a DNA replication initiation factor as well as a G1 checkpoint regulator. We found that in E7-expressing cells, the steady-state level of WDHD1 protein was increased along with the half-life. Moreover, downregulation of WDHD1 reduced E7-induced G1 checkpoint abrogation and rereplication, demonstrating a novel function for WDHD1. These studies shed light on mechanisms by which HPV induces genomic instability and have therapeutic implications. IMPORTANCE The high-risk HPV types induce cervical cancer and encode an E7 oncoprotein that plays a major role in HPV-induced carcinogenesis. However, the mechanism by which E7 induces carcinogenesis is not fully understood; specific anti-HPV agents are not available. In this study, we performed RNA-seq to characterize transcriptional profiling of keratinocytes expressing HPV-16 E7 and identified more than 200 genes that were differentially expressed between E7 and vector control cells. Through bioinformatics analysis, pathways altered in E7-expressing cells were identified. Significantly, the WDHD1 gene, one of the genes that is upregulated in E7-expressing cells, was found to play an important role in E7-induced G1 checkpoint abrogation and rereplication. These studies shed light on mechanisms by which HPV induces genomic instability and have therapeutic implications. PMID:27099318

Regulation of autotrophic CO2 fixation in the archaeon Thermoproteus neutrophilus.

PubMed

Ramos-Vera, W Hugo; Labonté, Valérie; Weiss, Michael; Pauly, Julia; Fuchs, Georg

2010-10-01

Thermoproteus neutrophilus, a hyperthermophilic, chemolithoautotrophic, anaerobic crenarchaeon, uses a novel autotrophic CO(2) fixation pathway, the dicarboxylate/hydroxybutyrate cycle. The regulation of the central carbon metabolism was studied on the level of whole cells, enzyme activity, the proteome, transcription, and gene organization. The organism proved to be a facultative autotroph, which prefers organic acids as carbon sources that can easily feed into the metabolite pools of this cycle. Addition of the preferred carbon sources acetate, pyruvate, succinate, and 4-hydroxybutyrate to cultures resulted in stimulation of the growth rate and a diauxic growth response. The characteristic enzyme activities of the carbon fixation cycle, fumarate hydratase, fumarate reductase, succinyl coenzyme A (CoA) synthetase, and enzymes catalyzing the conversion of succinyl-CoA to crotonyl-CoA, were differentially downregulated in the presence of acetate and, to a lesser extent, in the presence of other organic substrates. This regulation pattern correlated well with the differential expression profile of the proteome as well as with the transcription of the encoding genes. The genes encoding phosphoenolpyruvate (PEP) carboxylase, fumarate reductase, and four enzymes catalyzing the conversion of succinyl-CoA to crotonyl-CoA are clustered. Two putative operons, one comprising succinyl-CoA reductase plus 4-hydroxybutyrate-CoA ligase genes and the other comprising 4-hydroxybutyryl-CoA dehydratase plus fumarate reductase genes, were divergently transcribed into leaderless mRNAs. The promoter regions were characterized and used for isolating DNA binding proteins. Besides an Alba protein, a 18-kDa protein characteristic for autotrophic Thermoproteales that bound specifically to the promoter region was identified. This system may be suitable for molecular analysis of the transcriptional regulation of autotrophy-related genes.

Drosophila melanogaster activating transcription factor 4 regulates glycolysis during endoplasmic reticulum stress.

PubMed

Lee, Ji Eun; Oney, McKenna; Frizzell, Kimberly; Phadnis, Nitin; Hollien, Julie

2015-02-13

Endoplasmic reticulum (ER) stress results from an imbalance between the load of proteins entering the secretory pathway and the ability of the ER to fold and process them. The response to ER stress is mediated by a collection of signaling pathways termed the unfolded protein response, which plays important roles in development and disease. Here we show that in Drosophila melanogaster S2 cells, ER stress induces a coordinated change in the expression of genes involved in carbon metabolism. Genes encoding enzymes that carry out glycolysis were up-regulated, whereas genes encoding proteins in the tricarboxylic acid cycle and respiratory chain complexes were down-regulated. The unfolded protein response transcription factor Atf4 was necessary for the up-regulation of glycolytic enzymes and Lactate dehydrogenase (Ldh). Furthermore, Atf4 binding motifs in promoters for these genes could partially account for their regulation during ER stress. Finally, flies up-regulated Ldh and produced more lactate when subjected to ER stress. Together, these results suggest that Atf4 mediates a shift from a metabolism based on oxidative phosphorylation to one more heavily reliant on glycolysis, reminiscent of aerobic glycolysis or the Warburg effect observed in cancer and other proliferative cells. Copyright © 2015 Lee et al.

Identification of a functional element in the promoter of the silkworm (Bombyx mori) fat body-specific gene Bmlp3.

PubMed

Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou

2014-08-01

30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.

Transcriptomic analysis of Arabidopsis developing stems: a close-up on cell wall genes

PubMed Central

Minic, Zoran; Jamet, Elisabeth; San-Clemente, Hélène; Pelletier, Sandra; Renou, Jean-Pierre; Rihouey, Christophe; Okinyo, Denis PO; Proux, Caroline; Lerouge, Patrice; Jouanin, Lise

2009-01-01

Background Different strategies (genetics, biochemistry, and proteomics) can be used to study proteins involved in cell biogenesis. The availability of the complete sequences of several plant genomes allowed the development of transcriptomic studies. Although the expression patterns of some Arabidopsis thaliana genes involved in cell wall biogenesis were identified at different physiological stages, detailed microarray analysis of plant cell wall genes has not been performed on any plant tissues. Using transcriptomic and bioinformatic tools, we studied the regulation of cell wall genes in Arabidopsis stems, i.e. genes encoding proteins involved in cell wall biogenesis and genes encoding secreted proteins. Results Transcriptomic analyses of stems were performed at three different developmental stages, i.e., young stems, intermediate stage, and mature stems. Many genes involved in the synthesis of cell wall components such as polysaccharides and monolignols were identified. A total of 345 genes encoding predicted secreted proteins with moderate or high level of transcripts were analyzed in details. The encoded proteins were distributed into 8 classes, based on the presence of predicted functional domains. Proteins acting on carbohydrates and proteins of unknown function constituted the two most abundant classes. Other proteins were proteases, oxido-reductases, proteins with interacting domains, proteins involved in signalling, and structural proteins. Particularly high levels of expression were established for genes encoding pectin methylesterases, germin-like proteins, arabinogalactan proteins, fasciclin-like arabinogalactan proteins, and structural proteins. Finally, the results of this transcriptomic analyses were compared with those obtained through a cell wall proteomic analysis from the same material. Only a small proportion of genes identified by previous proteomic analyses were identified by transcriptomics. Conversely, only a few proteins encoded by genes having moderate or high level of transcripts were identified by proteomics. Conclusion Analysis of the genes predicted to encode cell wall proteins revealed that about 345 genes had moderate or high levels of transcripts. Among them, we identified many new genes possibly involved in cell wall biogenesis. The discrepancies observed between results of this transcriptomic study and a previous proteomic study on the same material revealed post-transcriptional mechanisms of regulation of expression of genes encoding cell wall proteins. PMID:19149885

Up-regulation of miR-95-3p in hepatocellular carcinoma promotes tumorigenesis by targeting p21 expression

PubMed Central

Ye, Jian; Yao, Yufeng; Song, Qixue; Li, Sisi; Hu, Zhenkun; Yu, Yubing; Hu, Changqing; Da, Xingwen; Li, Hui; Chen, Qiuyun; Wang, Qing K.

2016-01-01

Hepatocellular carcinoma (HCC) is one of the most common malignant cancers. To elucidate new regulatory mechanisms for heptocarcinogenesis, we investigated the regulation of p21, a cyclin-dependent kinase (CDK) inhibitor encoded by CDKN1A, in HCC. The expression level of p21 is decreased with the progression of HCC. Luciferase assays with a luciferase-p21-3′ UTR reporter and its serial deletions identified a 15-bp repressor element at the 3′-UTR of CDKN1A, which contains a binding site for miR-95-3p. Mutation of the binding site eliminated the regulatory effect of miR-95-3p on p21 expression. Posttranscriptional regulation of p21 expression by miR-95-3p is mainly on the protein level (suppression of translation). Overexpression of miR-95-3p in two different HCC cell lines, HepG2 and SMMC7721, significantly promoted cell proliferation, cell cycle progression and cell migration, whereas a miR-95-3p specific inhibitor decreased cell proliferation, cell cycle progression and cell migration. The effects of miR-95-3p on cellular functions were rescued by overexpression of p21. Overexpression of miR-95-3p promoted cell proliferation and tumor growth in HCC xenograft mouse models. Expression of miR-95-3p was significantly higher in HCC samples than in adjacent non-cancerous samples. These results demonstrate that miR-95-3p is a potential new marker for HCC and regulates hepatocarcinogenesis by directly targeting CDKN1A/p21 expression. PMID:27698442

HNRNPLL stabilizes mRNAs for DNA replication proteins and promotes cell cycle progression in colorectal cancer cells.

PubMed

Sakuma, Keiichiro; Sasaki, Eiichi; Kimura, Kenya; Komori, Koji; Shimizu, Yasuhiro; Yatabe, Yasushi; Aoki, Masahiro

2018-06-05

HNRNPLL (heterogeneous nuclear ribonucleoprotein L-like), an RNA-binding protein that regulates alternative splicing of pre-mRNAs, has been shown to regulate differentiation of lymphocytes, as well as metastasis of colorectal cancer cells. Here we show that HNRNPLL promotes cell cycle progression and hence proliferation of colorectal cancer cells. Functional annotation analysis of those genes whose expression levels were changed by three-fold or more in RNA sequencing analysis between SW480 cells overexpressing HNRNPLL and those knocked down for HNRNPLL revealed enrichment of DNA replication-related genes by HNRNPLL overexpression. Among 13 genes detected in the DNA replication pathway, PCNA, RFC3, and FEN1 showed reproducible upregulation by HNRNPLL overexpression both at mRNA and protein levels in SW480 and HT29 cells. Importantly, knockdown of any of these genes alone suppressed the proliferation promoting effect induced by HNRNPLL overexpression. RNA-immunoprecipitation assay presented a binding of FLAG-tagged HNRNPLL to mRNA of these genes, and HNRNPLL overexpression significantly suppressed the downregulation of these genes during 12 hours of actinomycin D treatment, suggesting a role of HNRNPLL in mRNA stability. Finally, analysis of a public RNA sequencing dataset of clinical samples suggested a link between overexpression of HNRNPLL and that of PCNA, RFC3, and FEN1. This link was further supported by immunohistochemistry of colorectal cancer clinical samples, whereas expression of CDKN1A, which is known to inhibit the cooperative function of PCNA, RFC3, and FEN1, was negatively associated with HNRNPLL expression. These results indicate that HNRNPLL stabilizes mRNAs encoding regulators of DNA replication and promotes colorectal cancer cell proliferation. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

miR-221 and miR-222 expression affects the proliferation potential of human prostate carcinoma cell lines by targeting p27Kip1.

PubMed

Galardi, Silvia; Mercatelli, Neri; Giorda, Ezio; Massalini, Simone; Frajese, Giovanni Vanni; Ciafrè, Silvia Anna; Farace, Maria Giulia

2007-08-10

MicroRNAs are short regulatory RNAs that negatively modulate protein expression at a post-transcriptional level and are deeply involved in the pathogenesis of several types of cancers. Here we show that miR-221 and miR-222, encoded in tandem on chromosome X, are overexpressed in the PC3 cellular model of aggressive prostate carcinoma, as compared with LNCaP and 22Rv1 cell line models of slowly growing carcinomas. In all cell lines tested, we show an inverse relationship between the expression of miR-221 and miR-222 and the cell cycle inhibitor p27(Kip1). We recognize two target sites for the microRNAs in the 3' untranslated region of p27 mRNA, and we show that miR-221/222 ectopic overexpression directly results in p27 down-regulation in LNCaP cells. In those cells, we demonstrate that the ectopic overexpression of miR-221/222 strongly affects their growth potential by inducing a G(1) to S shift in the cell cycle and is sufficient to induce a powerful enhancement of their colony-forming potential in soft agar. Consistently, miR-221 and miR-222 knock-down through antisense LNA oligonucleotides increases p27(Kip1) in PC3 cells and strongly reduces their clonogenicity in vitro. Our results suggest that miR-221/222 can be regarded as a new family of oncogenes, directly targeting the tumor suppressor p27(Kip1), and that their overexpression might be one of the factors contributing to the oncogenesis and progression of prostate carcinoma through p27(Kip1) down-regulation.

RNA-dependent RNA polymerases from flaviviruses and Picornaviridae.

PubMed

Lescar, Julien; Canard, Bruno

2009-12-01

Flaviviruses and picornaviruses are positive-strand RNA viruses that encode the RNA-dependent RNA polymerase (RdRp) required for replicating the viral genome in infected cells. Because of their specific and essential role in the virus life cycle, RdRps are prime targets for antiviral drugs. Recent structural data have shed light on the different strategies used by RdRps from flaviviruses and Picornaviridae to initiate RNA polymerization. New details about the catalytic mechanism, the role of metal ions, how these RdRps interact with other nonstructural (NS) viral and host-cell proteins as well as with the viral RNA genome have also been published. These advances contribute to give a more complete picture of the 3D structure and mechanism of a membrane-bound viral replication complex for these two classes of medically important human pathogens.

NTCP opens the door for hepatitis B virus infection.

PubMed

Yan, Huan; Liu, Yang; Sui, Jianhua; Li, Wenhui

2015-09-01

A liver bile acids transporter, sodium taurocholate cotransporting polypeptide (NTCP, encoded by SLC10A1) was recently identified as a functional receptor for hepatitis B virus (HBV) and its satellite hepatitis D virus (HDV). NTCP-complemented human hepatoma HepG2 cells (HepG2-NTCP) were shown to support infection of HBV and HDV in vitro, providing a much-needed and convenient cell culture system for the viruses. Identification of NTCP as a functional receptor for HBV has significantly advanced our understanding of the viral life cycle and opened new opportunities for developing anti-HBV interventions. This article forms part of a symposium in Antiviral Research on "An unfinished story: from the discovery of the Australia antigen to the development of new curative therapies for hepatitis B". Copyright © 2015 Elsevier B.V. All rights reserved.

Molecular piracy: manipulation of the ubiquitin system by Kaposi's sarcoma-associated herpesvirus.

PubMed

Fujimuro, Masahiro; Hayward, S Diane; Yokosawa, Hideyoshi

2007-01-01

Ubiquitination, one of several post-translational protein modifications, plays a key role in the regulation of cellular events, including protein degradation, signal transduction, endocytosis, protein trafficking, apoptosis and immune responses. Ubiquitin attachment at the lysine residue of cellular factors acts as a signal for endocytosis and rapid degradation by the 26S proteasome. It has recently been observed that viruses, especially oncogenic herpesviruses, utilise molecular piracy by encoding their own proteins to interfere with regulation of cell signalling. Kaposi's sarcoma- associated herpesvirus (KSHV) manipulates the ubiquitin system to facilitate cell proliferation, anti-apoptosis and evasion from immunity. In this review, we will describe the strategies used by KSHV at distinct stages of the viral life-cycle to control the ubiquitin system and promote oncogenesis and viral persistence. (c) 2007 John Wiley & Sons, Ltd.

Lipid degradation promotes prostate cancer cell survival.

PubMed

Itkonen, Harri M; Brown, Michael; Urbanucci, Alfonso; Tredwell, Gregory; Ho Lau, Chung; Barfeld, Stefan; Hart, Claire; Guldvik, Ingrid J; Takhar, Mandeep; Heemers, Hannelore V; Erho, Nicholas; Bloch, Katarzyna; Davicioni, Elai; Derua, Rita; Waelkens, Etienne; Mohler, James L; Clarke, Noel; Swinnen, Johan V; Keun, Hector C; Rekvig, Ole P; Mills, Ian G

2017-06-13

Prostate cancer is the most common male cancer and androgen receptor (AR) is the major driver of the disease. Here we show that Enoyl-CoA delta isomerase 2 (ECI2) is a novel AR-target that promotes prostate cancer cell survival. Increased ECI2 expression predicts mortality in prostate cancer patients (p = 0.0086). ECI2 encodes for an enzyme involved in lipid metabolism, and we use multiple metabolite profiling platforms and RNA-seq to show that inhibition of ECI2 expression leads to decreased glucose utilization, accumulation of fatty acids and down-regulation of cell cycle related genes. In normal cells, decrease in fatty acid degradation is compensated by increased consumption of glucose, and here we demonstrate that prostate cancer cells are not able to respond to decreased fatty acid degradation. Instead, prostate cancer cells activate incomplete autophagy, which is followed by activation of the cell death response. Finally, we identified a clinically approved compound, perhexiline, which inhibits fatty acid degradation, and replicates the major findings for ECI2 knockdown. This work shows that prostate cancer cells require lipid degradation for survival and identifies a small molecule inhibitor with therapeutic potential.

Human T lymphocytes express N-methyl-D-aspartate receptors functionally active in controlling T cell activation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miglio, Gianluca; Varsaldi, Federica; Lombardi, Grazia

2005-12-30

The aim of this study was to investigate the expression and the functional role of N-methyl-D-aspartate (NMDA) receptors in human T cells. RT-PCR analysis showed that human resting peripheral blood lymphocytes (PBL) and Jurkat T cells express genes encoding for both NR1 and NR2B subunits: phytohemagglutinin (PHA)-activated PBL also expresses both these genes and the NR2A and NR2D genes. Cytofluorimetric analysis showed that NR1 expression increases as a consequence of PHA (10 {mu}g/ml) treatment. D-(-)-2-Amino-5-phosphonopentanoic acid (D-AP5), and (+)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine [(+)-MK 801], competitive and non-competitive NMDA receptor antagonists, respectively, inhibited PHA-induced T cell proliferation, whereas they did not affect IL-2 (10more » U/ml)-induced proliferation of PHA blasts. These effects were due to the prevention of T cell activation (inhibition of cell aggregate formation and CD25 expression), but not to cell cycle arrest or death. These results demonstrate that human T lymphocytes express NMDA receptors, which are functionally active in controlling cell activation.« less

Silencing of genes involved in Anaplasma marginale-tick interactions affects the pathogen developmental cycle in Dermacentor variabilis.

PubMed

Kocan, Katherine M; Zivkovic, Zorica; Blouin, Edmour F; Naranjo, Victoria; Almazán, Consuelo; Mitra, Ruchira; de la Fuente, José

2009-07-16

The cattle pathogen, Anaplasma marginale, undergoes a developmental cycle in ticks that begins in gut cells. Transmission to cattle occurs from salivary glands during a second tick feeding. At each site of development two forms of A. marginale (reticulated and dense) occur within a parasitophorous vacuole in the host cell cytoplasm. However, the role of tick genes in pathogen development is unknown. Four genes, found in previous studies to be differentially expressed in Dermacentor variabilis ticks in response to infection with A. marginale, were silenced by RNA interference (RNAi) to determine the effect of silencing on the A. marginale developmental cycle. These four genes encoded for putative glutathione S-transferase (GST), salivary selenoprotein M (SelM), H+ transporting lysosomal vacuolar proton pump (vATPase) and subolesin. The impact of gene knockdown on A. marginale tick infections, both after acquiring infection and after a second transmission feeding, was determined and studied by light microscopy. Silencing of these genes had a different impact on A. marginale development in different tick tissues by affecting infection levels, the densities of colonies containing reticulated or dense forms and tissue morphology. Salivary gland infections were not seen in any of the gene-silenced ticks, raising the question of whether these ticks were able to transmit the pathogen. The results of this RNAi and light microscopic analyses of tick tissues infected with A. marginale after the silencing of genes functionally important for pathogen development suggest a role for these molecules during pathogen life cycle in ticks.

Identification and functional characterization of effectors in expressed sequence tags from various life cycle stages of the potato cyst nematode Globodera pallida.

PubMed

Jones, John T; Kumar, Amar; Pylypenko, Liliya A; Thirugnanasambandam, Amarnath; Castelli, Lydia; Chapman, Sean; Cock, Peter J A; Grenier, Eric; Lilley, Catherine J; Phillips, Mark S; Blok, Vivian C

2009-11-01

In this article, we describe the analysis of over 9000 expressed sequence tags (ESTs) from cDNA libraries obtained from various life cycle stages of Globodera pallida. We have identified over 50 G. pallida effectors from this dataset using bioinformatics analysis, by screening clones in order to identify secreted proteins up-regulated after the onset of parasitism and using in situ hybridization to confirm the expression in pharyngeal gland cells. A substantial gene family encoding G. pallida SPRYSEC proteins has been identified. The expression of these genes is restricted to the dorsal pharyngeal gland cell. Different members of the SPRYSEC family of proteins from G. pallida show different subcellular localization patterns in plants, with some localized to the cytoplasm and others to the nucleus and nucleolus. Differences in subcellular localization may reflect diverse functional roles for each individual protein or, more likely, variety in the compartmentalization of plant proteins targeted by the nematode. Our data are therefore consistent with the suggestion that the SPRYSEC proteins suppress host defences, as suggested previously, and that they achieve this through interaction with a range of host targets.

The 38K-Mediated Specific Dephosphorylation of the Viral Core Protein P6.9 Plays an Important Role in the Nucleocapsid Assembly of Autographa californica Multiple Nucleopolyhedrovirus.

PubMed

Lai, Qingying; Wu, Wenbi; Li, Ao; Wang, Wei; Yuan, Meijin; Yang, Kai

2018-05-01

Encapsidation of the viral genomes, leading to the assembly of the nucleocapsids to form infectious progeny virions, is a key step in many virus life cycles. Baculovirus nucleocapsid assembly is a complex process that involves many proteins. Our previous studies showed that the deletion of the core gene 38K ( ac98 ) interrupted the nucleocapsid assembly by producing capsid sheaths devoid of viral genomes by an unknown mechanism. All homologs of 38K contain conserved motifs of the haloacid dehalogenase superfamily, which are involved in phosphoryl transfer. The requirements of these motifs for nucleocapsid assembly, confirmed in the present study, suggest that 38K may be a functioning haloacid dehalogenase. P6.9 is also encoded by a core gene ( ac100 ) and is required for viral genome encapsidation. It has been reported that multiple phosphorylated species of P6.9 are present in virus-infected cells, while only an unphosphorylated species is detected in the budded virus. Therefore, whether 38K mediates the dephosphorylation of P6.9 was investigated. An additional phosphorylated species of P6.9 in 38K -deleted or -mutated virus-transfected cells was detected, and the dephosphorylated sites mediated by 38K were determined by mass spectrometry. To assess the effects of dephosphorylation of P6.9 mediated by 38K on virus replication, these sites were mutated to glutamic acids (phosphorylation-mimic mutant) or to alanines (phosphorylation-deficient mutant). Studies showed that the nucleocapsid assembly was interrupted in phosphorylation-mimic mutant virus-transfected cells. Taken together, our findings demonstrate that 38K mediates the dephosphorylation of specific sites at the C terminus of P6.9, which is essential for viral genome encapsidation. IMPORTANCE Genome packaging is a fundamental process in the virus life cycle, and viruses have different strategies to perform this step. For several double-stranded DNA (dsDNA) viruses, the procapsid is formed before genome encapsidation, which may require basic proteins that help to neutralize the nucleic acid charge repulsion to facilitate the compaction of the genome within the confined capsid space. Baculovirus encodes a small basic protein, P6.9, which is required for a variety of processes in the virus infection cycle. The phosphorylation of P6.9 is thought to result in nucleocapsid uncoating, while the dephosphorylation of P6.9 is involved in viral DNA encapsidation during nucleocapsid assembly. Here, we demonstrate that a haloacid dehalogenase homolog encoded by baculovirus core gene 38K is involved in nucleocapsid assembly by mediating the dephosphorylation of 5 specific sites at the C terminus of P6.9. This finding contributes to the understanding of the mechanisms of virus nucleocapsid assembly. Copyright © 2018 Lai et al.

The 38K-Mediated Specific Dephosphorylation of the Viral Core Protein P6.9 Plays an Important Role in the Nucleocapsid Assembly of Autographa californica Multiple Nucleopolyhedrovirus

PubMed Central

Lai, Qingying; Li, Ao; Wang, Wei; Yuan, Meijin

2018-01-01

ABSTRACT Encapsidation of the viral genomes, leading to the assembly of the nucleocapsids to form infectious progeny virions, is a key step in many virus life cycles. Baculovirus nucleocapsid assembly is a complex process that involves many proteins. Our previous studies showed that the deletion of the core gene 38K (ac98) interrupted the nucleocapsid assembly by producing capsid sheaths devoid of viral genomes by an unknown mechanism. All homologs of 38K contain conserved motifs of the haloacid dehalogenase superfamily, which are involved in phosphoryl transfer. The requirements of these motifs for nucleocapsid assembly, confirmed in the present study, suggest that 38K may be a functioning haloacid dehalogenase. P6.9 is also encoded by a core gene (ac100) and is required for viral genome encapsidation. It has been reported that multiple phosphorylated species of P6.9 are present in virus-infected cells, while only an unphosphorylated species is detected in the budded virus. Therefore, whether 38K mediates the dephosphorylation of P6.9 was investigated. An additional phosphorylated species of P6.9 in 38K-deleted or -mutated virus-transfected cells was detected, and the dephosphorylated sites mediated by 38K were determined by mass spectrometry. To assess the effects of dephosphorylation of P6.9 mediated by 38K on virus replication, these sites were mutated to glutamic acids (phosphorylation-mimic mutant) or to alanines (phosphorylation-deficient mutant). Studies showed that the nucleocapsid assembly was interrupted in phosphorylation-mimic mutant virus-transfected cells. Taken together, our findings demonstrate that 38K mediates the dephosphorylation of specific sites at the C terminus of P6.9, which is essential for viral genome encapsidation. IMPORTANCE Genome packaging is a fundamental process in the virus life cycle, and viruses have different strategies to perform this step. For several double-stranded DNA (dsDNA) viruses, the procapsid is formed before genome encapsidation, which may require basic proteins that help to neutralize the nucleic acid charge repulsion to facilitate the compaction of the genome within the confined capsid space. Baculovirus encodes a small basic protein, P6.9, which is required for a variety of processes in the virus infection cycle. The phosphorylation of P6.9 is thought to result in nucleocapsid uncoating, while the dephosphorylation of P6.9 is involved in viral DNA encapsidation during nucleocapsid assembly. Here, we demonstrate that a haloacid dehalogenase homolog encoded by baculovirus core gene 38K is involved in nucleocapsid assembly by mediating the dephosphorylation of 5 specific sites at the C terminus of P6.9. This finding contributes to the understanding of the mechanisms of virus nucleocapsid assembly. PMID:29444944

Expression profiles of adult T-cell leukemia–lymphoma and associations with clinical responses to zidovudine and interferon α

PubMed Central

ALIZADEH, ASH A.; BOHEN, SEAN P.; LOSSOS, CHEN; MARTINEZ-CLIMENT, JOSE A.; RAMOS, JUAN CARLOS; CUBEDO-GIL, ELENA; HARRINGTON, WILLIAM J.; LOSSOS, IZIDORE S.

2014-01-01

Adult T-cell leukemia–lymphoma (ATLL) is an HTLV-1-associated lymphoproliferative malignancy that is frequently fatal. We compared gene expression profiles (GEPs) of leukemic specimens from nine patients with ATLL at the time of diagnosis and immediately after combination therapy with zidovudine (AZT) and interferon α (IFNα). GEPs were also related to genetic aberrations determined by comparative genomic hybridization. We identified several genes anomalously over-expressed in the ATLL leukemic cells at the mRNA level, including LYN, CSPG2, and LMO2, and confirmed LMO2 expression in ATLL cells at the protein level. In vivo AZT–IFNα therapy evoked a marked induction of interferon-induced genes accompanied by repression of cell-cycle regulated genes, including those encoding ribosomal proteins. Remarkably, patients not responding to AZT–IFNα differed most from responding patients in lower expression of these same IFN-responsive genes, as well as components of the antigen processing and presentation apparatus. Demonstration of specific gene expression signatures associated with response to AZT–IFNα therapy may provide novel insights into the mechanisms of action in ATLL. PMID:20370541

Selenium Pretreatment Alleviated LPS-Induced Immunological Stress Via Upregulation of Several Selenoprotein Encoding Genes in Murine RAW264.7 Cells.

PubMed

Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua

2018-04-18

This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P < 0.05) mRNA profiles of 9 inflammation-related genes in cells, while short-time Se pretreatment modestly reversed (P < 0.05) the LPS-induced upregulation of 7 genes (COX-2, ICAM-1, IL-1β, IL-6, IL-10, iNOS, and MCP-1) and further increased (P < 0.05) expression of IFN-β and TNF-α in stressed cells. Meanwhile, LPS decreased (P < 0.05) mRNA levels of 18 selenoprotein encoding genes and upregulated mRNA levels of TXNRD1 and TXNRD3 in cells. Se pretreatment recovered (P < 0.05) expression of 3 selenoprotein encoding genes (GPX1, SELENOH, and SELENOW) in a dose-dependent manner and increased (P < 0.05) expression of another 5 selenoprotein encoding genes (SELENOK, SELENOM, SELENOS, SELENOT, and TXNRD2) only at a high level (2.0 μmol Se/L). Taken together, LPS-induced immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.

Molecular Mechanisms of HTLV-1 Cell-to-Cell Transmission

PubMed Central

Gross, Christine; Thoma-Kress, Andrea K.

2016-01-01

The tumorvirus human T-cell lymphotropic virus type 1 (HTLV-1), a member of the delta-retrovirus family, is transmitted via cell-containing body fluids such as blood products, semen, and breast milk. In vivo, HTLV-1 preferentially infects CD4+ T-cells, and to a lesser extent, CD8+ T-cells, dendritic cells, and monocytes. Efficient infection of CD4+ T-cells requires cell-cell contacts while cell-free virus transmission is inefficient. Two types of cell-cell contacts have been described to be critical for HTLV-1 transmission, tight junctions and cellular conduits. Further, two non-exclusive mechanisms of virus transmission at cell-cell contacts have been proposed: (1) polarized budding of HTLV-1 into synaptic clefts; and (2) cell surface transfer of viral biofilms at virological synapses. In contrast to CD4+ T-cells, dendritic cells can be infected cell-free and, to a greater extent, via viral biofilms in vitro. Cell-to-cell transmission of HTLV-1 requires a coordinated action of steps in the virus infectious cycle with events in the cell-cell adhesion process; therefore, virus propagation from cell-to-cell depends on specific interactions between cellular and viral proteins. Here, we review the molecular mechanisms of HTLV-1 transmission with a focus on the HTLV-1-encoded proteins Tax and p8, their impact on host cell factors mediating cell-cell contacts, cytoskeletal remodeling, and thus, virus propagation. PMID:27005656

Wnt signaling regulates pancreatic β cell proliferation

PubMed Central

Rulifson, Ingrid C.; Karnik, Satyajit K.; Heiser, Patrick W.; ten Berge, Derk; Chen, Hainan; Gu, Xueying; Taketo, Makoto M.; Nusse, Roel; Hebrok, Matthias; Kim, Seung K.

2007-01-01

There is widespread interest in defining factors and mechanisms that stimulate proliferation of pancreatic islet cells. Wnt signaling is an important regulator of organ growth and cell fates, and genes encoding Wnt-signaling factors are expressed in the pancreas. However, it is unclear whether Wnt signaling regulates pancreatic islet proliferation and differentiation. Here we provide evidence that Wnt signaling stimulates islet β cell proliferation. The addition of purified Wnt3a protein to cultured β cells or islets promoted expression of Pitx2, a direct target of Wnt signaling, and Cyclin D2, an essential regulator of β cell cycle progression, and led to increased β cell proliferation in vitro. Conditional pancreatic β cell expression of activated β-catenin, a crucial Wnt signal transduction protein, produced similar phenotypes in vivo, leading to β cell expansion, increased insulin production and serum levels, and enhanced glucose handling. Conditional β cell expression of Axin, a potent negative regulator of Wnt signaling, led to reduced Pitx2 and Cyclin D2 expression by β cells, resulting in reduced neonatal β cell expansion and mass and impaired glucose tolerance. Thus, Wnt signaling is both necessary and sufficient for islet β cell proliferation, and our study provides previously unrecognized evidence of a mechanism governing endocrine pancreas growth and function. PMID:17404238

Design and Synthesis of Biaryl DNA-Encoded Libraries.

PubMed

Ding, Yun; Franklin, G Joseph; DeLorey, Jennifer L; Centrella, Paolo A; Mataruse, Sibongile; Clark, Matthew A; Skinner, Steven R; Belyanskaya, Svetlana

2016-10-10

DNA-encoded library technology (ELT) is a powerful tool for the discovery of new small-molecule ligands to various protein targets. Here we report the design and synthesis of biaryl DNA-encoded libraries based on the scaffold of 5-formyl 3-iodobenzoic acid. Three reactions on DNA template, acylation, Suzuki-Miyaura coupling and reductive amination, were applied in the library synthesis. The three cycle library of 3.5 million diversity has delivered potent hits for phosphoinositide 3-kinase α (PI3Kα).

Evolutionary Convergence of Cell-Specific Gene Expression in Independent Lineages of C4 Grasses1[W][OPEN

PubMed Central

John, Christopher R.; Smith-Unna, Richard D.; Woodfield, Helen; Covshoff, Sarah; Hibberd, Julian M.

2014-01-01

Leaves of almost all C4 lineages separate the reactions of photosynthesis into the mesophyll (M) and bundle sheath (BS). The extent to which messenger RNA profiles of M and BS cells from independent C4 lineages resemble each other is not known. To address this, we conducted deep sequencing of RNA isolated from the M and BS of Setaria viridis and compared these data with publicly available information from maize (Zea mays). This revealed a high correlation (r = 0.89) between the relative abundance of transcripts encoding proteins of the core C4 pathway in M and BS cells in these species, indicating significant convergence in transcript accumulation in these evolutionarily independent C4 lineages. We also found that the vast majority of genes encoding proteins of the C4 cycle in S. viridis are syntenic to homologs used by maize. In both lineages, 122 and 212 homologous transcription factors were preferentially expressed in the M and BS, respectively. Sixteen shared regulators of chloroplast biogenesis were identified, 14 of which were syntenic homologs in maize and S. viridis. In sorghum (Sorghum bicolor), a third C4 grass, we found that 82% of these trans-factors were also differentially expressed in either M or BS cells. Taken together, these data provide, to our knowledge, the first quantification of convergence in transcript abundance in the M and BS cells from independent lineages of C4 grasses. Furthermore, the repeated recruitment of syntenic homologs from large gene families strongly implies that parallel evolution of both structural genes and trans-factors underpins the polyphyletic evolution of this highly complex trait in the monocotyledons. PMID:24676859

Identification of a gene set to evaluate the potential effects of loud sounds from seismic surveys on the ears of fishes: a study with Salmo salar

PubMed Central

Andrews, C D; Payne, J F; Rise, M L

2014-01-01

Functional genomic studies were carried out on the inner ear of Atlantic salmon Salmo salar following exposure to a seismic airgun. Microarray analyses revealed 79 unique transcripts (passing background threshold), with 42 reproducibly up-regulated and 37 reproducibly down-regulated in exposed v. control fish. Regarding the potential effects on cellular energetics and cellular respiration, altered transcripts included those with roles in oxygen transport, the glycolytic pathway, the Krebs cycle and the electron transport chain. Of these, a number of transcripts encoding haemoglobins that are important in oxygen transport were up-regulated and among the most highly expressed. Up-regulation of transcripts encoding nicotinamide riboside kinase 2, which is also important in energy production and linked to nerve cell damage, points to evidence of neuronal damage in the ear following noise exposure. Transcripts related to protein modification or degradation also indicated potential damaging effects of sound on ear tissues. Notable in this regard were transcripts associated with the proteasome–ubiquitin pathway, which is involved in protein degradation, with the transcript encoding ubiquitin family domain-containing protein 1 displaying the highest response to exposure. The differential expression of transcripts observed for some immune responses could potentially be linked to the rupture of cell membranes. Meanwhile, the altered expression of transcripts for cytoskeletal proteins that contribute to the structural integrity of the inner ear could point to repair or regeneration of ear tissues including auditory hair cells. Regarding potential effects on hormones and vitamins, the protein carrier for thyroxine and retinol (vitamin A), namely transthyretin, was altered at the transcript expression level and it has been suggested from studies in mammalian systems that retinoic acid may play a role in the regeneration of damaged hair cells. The microarray experiment identified the transcript encoding growth hormone I as up-regulated by loud sound, supporting previous evidence linking growth hormone to hair cell regeneration in fishes. Quantitative (q) reverse transcription (RT) polymerase chain reaction (qRT-PCR) analyses confirmed dysregulation of some microarray-identified transcripts and in some cases revealed a high level of biological variability in the exposed group. These results support the potential utility of molecular biomarkers to evaluate the effect of seismic surveys on fishes with studies on the ears being placed in a priority category for development of exposure–response relationships. Knowledge of such relationships is necessary for addressing the question of potential size of injury zones. PMID:24814183

Aerobic Exercise During Encoding Impairs Hippocampus-Dependent Memory.

PubMed

Soga, Keishi; Kamijo, Keita; Masaki, Hiroaki

2017-08-01

We investigated how aerobic exercise during encoding affects hippocampus-dependent memory through a source memory task that assessed hippocampus-independent familiarity and hippocampus-dependent recollection processes. Using a within-participants design, young adult participants performed a memory-encoding task while performing a cycling exercise or being seated. The subsequent retrieval phase was conducted while sitting on a chair. We assessed behavioral and event-related brain potential measures of familiarity and recollection processes during the retrieval phase. Results indicated that source accuracy was lower for encoding with exercise than for encoding in the resting condition. Event-related brain potential measures indicated that the parietal old/new effect, which has been linked to recollection processing, was observed in the exercise condition, whereas it was absent in the rest condition, which is indicative of exercise-induced hippocampal activation. These findings suggest that aerobic exercise during encoding impairs hippocampus-dependent memory, which may be attributed to inefficient source encoding during aerobic exercise.

Regulation of cation transport in Saccharomyces cerevisiae by the salt tolerance gene HAL3.

PubMed Central

Ferrando, A; Kron, S J; Rios, G; Fink, G R; Serrano, R

1995-01-01

Dynamic regulation of ion transport is essential for homeostasis as cells confront changes in their environment. The gene HAL3 encodes a novel component of this regulatory circuit in the yeast Saccharomyces cerevisiae. Overexpression of HAL3 improves growth of wild-type cells exposed to toxic concentrations of sodium and lithium and suppresses the salt sensitivity conferred by mutation of the calcium-dependent protein phosphatase calcineurin. Null mutants of HAL3 display salt sensitivity. The sequence of HAL3 gives little clue to its function. However, alterations in intracellular cation concentrations associated with changes in HAL3 expression suggest that HAL3 activity may directly increase cytoplasmic K+ and decrease Na+ and Li+. Cation efflux in S. cerevisiae is mediated by the P-type ATPase encoded by the ENA1/PMR24 gene, a putative plasma membrane Na+ pump whose expression is salt induced. Acting in concert with calcineurin, HAL3 is necessary for full activation of ENA1 expression. This functional complementarity is also reflected in the participation of both proteins in recovery from alpha-factor-induced growth arrest. Recently, HAL3 was isolated as a gene (named SIS2) which when overexpressed partially relieves loss of transcription of G1 cyclins in mutants lacking the protein phosphatase Sit4p. Therefore, HAL3 influences cell cycle control and ion homeostasis, acting in parallel to the protein phosphatases Sit4p and calcineurin. PMID:7565698

Therapeutic Implications of Activation of the Host Gene (Dleu2) Promoter for miR-15a/16-1 in Chronic Lymphocytic Leukemia (CLL)

PubMed Central

Kasar, S; Underbayev, C; Yuan, Y; Hanlon, M; Aly, S; Chang, V; Batish, M; Gavrilova, T; Badiane, F; Degheidy, H; Marti, G; Raveche, E

2014-01-01

Genetic lesions and other regulatory events lead to silencing of the 13q14 locus in a majority of chronic lymphocytic leukemia (CLL) patients. This locus encodes a pair of critical pro-apoptotic microRNAs, miR-15a/16-1. Decreased levels of miR-15a/16-1 are critical for the increased survival exhibited by CLL cells. Similarly, in a de novo murine model of CLL, the NZB strain, germline-encoded regulation of the syntenic region resulted in decreased miR-15a/16-1. In this paper we have identified additional molecular mechanisms regulating miR-15a/16-1 levels and shown that the transcription factor BSAP (B cell Specific Activator Protein) directly interacts with Dleu2, the host gene containing the mir-15a/16-1 loci and via negative regulation of the Dleu2 promoter results in repression of mir-15a/16 expression. CLL patient B cell expression levels of BSAP were increased compared to control sources of B cells. With the use of siRNA mediated repression, the levels of BSAP were decreased in vitro in the NZB derived malignant B1 cell line, LNC, and in ex vivo CLL patient PBMC. BSAP knockdown led to an increase in the expression of miR-15a/16-1 and an increase in apoptosis and a cell cycle arrest in both the cell line and patient PBMC. Moreover, using Dleu2 promoter analysis by chromatin immunoprecipitation (ChIP) assay we have shown that BSAP directly interacts with the Dleu2 promoter. Derepression of the Dleu2 promoter via inhibition of histone deacetylation combined with BSAP knockdown increased miR-15a/16 expression and increased malignant B cell death. In summary, therapy targeting enhanced host gene Dleu2 transcription may augment CLL therapy. PMID:23995789

Overexpression of a DENND1A isoform produces a polycystic ovary syndrome theca phenotype

PubMed Central

McAllister, Jan M.; Modi, Bhavi; Miller, Bruce A.; Biegler, Jessica; Bruggeman, Richard; Legro, Richard S.; Strauss, Jerome F.

2014-01-01

Polycystic ovary syndrome (PCOS), characterized by increased ovarian androgen biosynthesis, anovulation, and infertility, affects 5–7% of reproductive-age women. Genome-wide association studies identified PCOS candidate loci that were replicated in subsequent reports, including DENND1A, which encodes a protein associated with clathrin-coated pits where cell-surface receptors reside. However, these studies provided no information about functional roles for DENND1A in the pathogenesis of PCOS. DENND1A protein was located in the cytoplasm as well as nuclei of theca cells, suggesting a possible role in gene regulation. DENND1A immunostaining was more intense in the theca of PCOS ovaries. Using theca cells isolated and propagated from normal cycling and PCOS women, we found that DENND1A variant 2 (DENND1A.V2) protein and mRNA levels are increased in PCOS theca cells. Exosomal DENND1A.V2 RNA was significantly elevated in urine from PCOS women compared with normal cycling women. Forced overexpression of DENND1A.V2 in normal theca cells resulted in a PCOS phenotype of augmented CYP17A1 and CYP11A1 gene transcription, mRNA abundance, and androgen biosynthesis. Knock-down of DENND1A.V2 in PCOS theca cells reduced androgen biosynthesis and CYP17A1 and CYP11A1 gene transcription. An IgG specific to DENND1A.V2 also reduced androgen biosynthesis and CYP17 and CYP11A1 mRNA when added to the medium of cultured PCOS theca cells. We conclude that the PCOS candidate gene, DENND1A, plays a key role in the hyperandrogenemia associated with PCOS. These observations have both diagnostic and therapeutic implications for this common disorder. PMID:24706793

Auxotrophic recombinant Mycobacterium bovis BCG overexpressing Ag85B enhances cytotoxicity on superficial bladder cancer cells in vitro.

PubMed

Begnini, Karine Rech; Rizzi, Caroline; Campos, Vinicius Farias; Borsuk, Sibele; Schultze, Eduarda; Yurgel, Virginia Campello; Nedel, Fernanda; Dellagostin, Odir Antônio; Collares, Tiago; Seixas, Fabiana Kömmling

2013-02-01

BCG therapy remains at the forefront of immunotherapy for treating patients with superficial bladder cancer. The high incidence of local side effects and the presence of non-responder diseases have led to efforts to improve the therapy. Hence, we proposed that an auxotrophic recombinant BCG strain overexpressing Ag85B (BCG ∆leuD/Ag85B), could enhance the cytotoxicity to the human bladder carcinoma cell line 5637. The rBCG was generated using an expression plasmid encoding the mycobacterial antigen Ag85B to transform a BCG ∆leuD strain. The inhibitory effect of BCG ∆leuD/Ag85B on 5637 cells was determined by the MTT method, morphology observation and a LIVE/DEAD assay. Gene expression profiles for apoptotic, cell cycle-related and oxidative stress-related genes were investigated by qRT-PCR. Bax, bcl-2 and p53 induction by BCG ∆leuD/Ag85B treatment was evaluated by Western blotting. BCG ∆leuD/Ag85B revealed a superior cytotoxicity effect compared to the control strains used in this study. The results showed that the expression level of pro-apoptotic and cell cycle-related genes increased after BCG ∆leuD/Ag85B treatment, whereas the mRNA levels of anti-apoptotic genes decreased. Interestingly, BCG ∆leuD/Ag85B also increased the mRNA level of antioxidant enzymes in the bladder cancer cell line. Bax and p53 proteins levels increased following treatment. In conclusion, these results suggest that treatment with BCG ∆leuD/Ag85B enhances cytotoxicity for superficial bladder cancer cells in vitro. Therefore, rBCG therapy may have potential benefits in the treatment of bladder cancer.

Cytochrome b5 gene and protein of Candida tropicalis and methods relating thereto

DOEpatents

Craft, David L.; Madduri, Krishna M.; Loper, John C.

2003-01-01

A novel gene has been isolated which encodes cytochrome b5 (CYTb5) protein of the .omega.-hydroxylase complex of C. tropicalis 20336. Vectors including this gene, and transformed host cells are provided. Methods of increasing the production of a CYTb5 protein are also provided which involve transforming a host cell with a gene encoding this protein and culturing the cells. Methods of increasing the production of a dicarboxylic acid are also provided which involve increasing in the host cell the number of genes encoding this protein.

Genome-Based Metabolic Mapping and 13C Flux Analysis Reveal Systematic Properties of an Oleaginous Microalga Chlorella protothecoides

DOE PAGES

Wu, Chao; Xiong, Wei; Dai, Junbiao; ...

2014-12-15

We report that integrated and genome-based flux balance analysis, metabolomics, and 13C-label profiling of phototrophic and heterotrophic metabolism in Chlorella protothecoides, an oleaginous green alga for biofuel. The green alga Chlorella protothecoides, capable of autotrophic and heterotrophic growth with rapid lipid synthesis, is a promising candidate for biofuel production. Based on the newly available genome knowledge of the alga, we reconstructed the compartmentalized metabolic network consisting of 272 metabolic reactions, 270 enzymes, and 461 encoding genes and simulated the growth in different cultivation conditions with flux balance analysis. Phenotype-phase plane analysis shows conditions achieving theoretical maximum of the biomass andmore » corresponding fatty acid-producing rate for phototrophic cells (the ratio of photon uptake rate to CO 2 uptake rate equals 8.4) and heterotrophic ones (the glucose uptake rate to O 2 consumption rate reaches 2.4), respectively. Isotope-assisted liquid chromatography-mass spectrometry/mass spectrometry reveals higher metabolite concentrations in the glycolytic pathway and the tricarboxylic acid cycle in heterotrophic cells compared with autotrophic cells. We also observed enhanced levels of ATP, nicotinamide adenine dinucleotide (phosphate), reduced, acetyl-Coenzyme A, and malonyl-Coenzyme A in heterotrophic cells consistently, consistent with a strong activity of lipid synthesis. To profile the flux map in experimental conditions, we applied nonstationary 13C metabolic flux analysis as a complementing strategy to flux balance analysis. We found that the result reveals negligible photorespiratory fluxes and a metabolically low active tricarboxylic acid cycle in phototrophic C. protothecoides. In comparison, high throughput of amphibolic reactions and the tricarboxylic acid cycle with no glyoxylate shunt activities were measured for heterotrophic cells. Lastly, taken together, the metabolic network modeling assisted by experimental metabolomics and 13C labeling better our understanding on global metabolism of oleaginous alga, paving the way to the systematic engineering of the microalga for biofuel production.« less

The 19q12 bladder cancer GWAS signal: association with cyclin E function and aggressive disease

PubMed Central

Fu, Yi-Ping; Kohaar, Indu; Moore, Lee E.; Lenz, Petra; Figueroa, Jonine D.; Tang, Wei; Porter-Gill, Patricia; Chatterjee, Nilanjan; Scott-Johnson, Alexandra; Garcia-Closas, Montserrat; Muchmore, Brian; Baris, Dalsu; Paquin, Ashley; Ylaya, Kris; Schwenn, Molly; Apolo, Andrea B.; Karagas, Margaret R.; Tarway, McAnthony; Johnson, Alison; Mumy, Adam; Schned, Alan; Guedez, Liliana; Jones, Michael A.; Kida, Masatoshi; Monawar Hosain, GM; Malats, Nuria; Kogevinas, Manolis; Tardon, Adonina; Serra, Consol; Carrato, Alfredo; Garcia-Closas, Reina; Lloreta, Josep; Wu, Xifeng; Purdue, Mark; Andriole, Gerald L.; Grubb, Robert L.; Black, Amanda; Landi, Maria T.; Caporaso, Neil E.; Vineis, Paolo; Siddiq, Afshan; Bueno-de-Mesquita, H. Bas; Trichopoulos, Dimitrios; Ljungberg, Börje; Severi, Gianluca; Weiderpass, Elisabete; Krogh, Vittorio; Dorronsoro, Miren; Travis, Ruth C.; Tjønneland, Anne; Brennan, Paul; Chang-Claude, Jenny; Riboli, Elio; Prescott, Jennifer; Chen, Constance; De Vivo, Immaculata; Govannucci, Edward; Hunter, David; Kraft, Peter; Lindstrom, Sara; Gapstur, Susan M.; Jacobs, Eric J.; Diver, W. Ryan; Albanes, Demetrius; Weinstein, Stephanie J.; Virtamo, Jarmo; Kooperberg, Charles; Hohensee, Chancellor; Rodabough, Rebecca J.; Cortessis, Victoria K.; Conti, David V.; Gago-Dominguez, Manuela; Stern, Mariana C.; Pike, Malcolm C.; Van Den Berg, David; Yuan, Jian-Min; Haiman, Christopher A.; Cussenot, Olivier; Cancel-Tassin, Geraldine; Roupret, Morgan; Comperat, Eva; Porru, Stefano; Carta, Angela; Pavanello, Sofia; Arici, Cecilia; Mastrangelo, Giuseppe; Grossman, H. Barton; Wang, Zhaoming; Deng, Xiang; Chung, Charles C.; Hutchinson, Amy; Burdette, Laurie; Wheeler, William; Fraumeni, Joseph; Chanock, Stephen J.; Hewitt, Stephen M.; Silverman, Debra T.; Rothman, Nathaniel; Prokunina-Olsson, Ludmila

2014-01-01

A genome-wide association study (GWAS) of bladder cancer identified a genetic marker rs8102137 within the 19q12 region as a novel susceptibility variant. This marker is located upstream of the CCNE1 gene, which encodes cyclin E, a cell cycle protein. We performed genetic fine mapping analysis of the CCNE1 region using data from two bladder cancer GWAS (5,942 cases and 10,857 controls). We found that the original GWAS marker rs8102137 represents a group of 47 linked SNPs (with r2≥0.7) associated with increased bladder cancer risk. From this group we selected a functional promoter variant rs7257330, which showed strong allele-specific binding of nuclear proteins in several cell lines. In both GWAS, rs7257330 was associated only with aggressive bladder cancer, with a combined per-allele odds ratio (OR) =1.18 (95%CI=1.09-1.27, p=4.67×10−5 vs. OR =1.01 (95%CI=0.93-1.10, p=0.79) for non-aggressive disease, with p=0.0015 for case-only analysis. Cyclin E protein expression analyzed in 265 bladder tumors was increased in aggressive tumors (p=0.013) and, independently, with each rs7257330-A risk allele (ptrend=0.024). Over-expression of recombinant cyclin E in cell lines caused significant acceleration of cell cycle. In conclusion, we defined the 19q12 signal as the first GWAS signal specific for aggressive bladder cancer. Molecular mechanisms of this genetic association may be related to cyclin E over-expression and alteration of cell cycle in carriers of CCNE1 risk variants. In combination with established bladder cancer risk factors and other somatic and germline genetic markers, the CCNE1 variants could be useful for inclusion into bladder cancer risk prediction models. PMID:25320178

Infection of Mouse Macrophages by Seasonal Influenza Viruses Can Be Restricted at the Level of Virus Entry and at a Late Stage in the Virus Life Cycle

PubMed Central

Londrigan, Sarah L.; Short, Kirsty R.; Ma, Joel; Gillespie, Leah; Rockman, Steven P.; Brooks, Andrew G.

2015-01-01

ABSTRACT Airway epithelial cells are susceptible to infection with seasonal influenza A viruses (IAV), resulting in productive virus replication and release. Macrophages (MΦ) are also permissive to IAV infection; however, virus replication is abortive. Currently, it is unclear how productive infection of MΦ is impaired or the extent to which seasonal IAV replicate in MΦ. Herein, we compared mouse MΦ and epithelial cells for their ability to support genomic replication and transcription, synthesis of viral proteins, assembly of virions, and release of infectious progeny following exposure to genetically defined IAV. We confirm that seasonal IAV differ in their ability to utilize cell surface receptors for infectious entry and that this represents one level of virus restriction. Following virus entry, we demonstrate synthesis of all eight segments of genomic viral RNA (vRNA) and mRNA, as well as seven distinct IAV proteins, in IAV-infected mouse MΦ. Although newly synthesized hemagglutinin (HA) and neuraminidase (NA) glycoproteins are incorporated into the plasma membrane and expressed at the cell surface, electron microscopy confirmed that virus assembly was defective in IAV-infected MΦ, defining a second level of restriction late in the virus life cycle. IMPORTANCE Seasonal influenza A viruses (IAV) and highly pathogenic avian influenza viruses (HPAI) infect macrophages, but only HPAI replicate productively in these cells. Herein, we demonstrate that impaired virus uptake into macrophages represents one level of restriction limiting infection by seasonal IAV. Following uptake, seasonal IAV do not complete productive replication in macrophages, representing a second level of restriction. Using murine macrophages, we demonstrate that productive infection is blocked late in the virus life cycle, such that virus assembly is defective and newly synthesized virions are not released. These studies represent an important step toward identifying host-encoded factors that block replication of seasonal IAV, but not HPAI, in macrophages. PMID:26423941

Infection of Mouse Macrophages by Seasonal Influenza Viruses Can Be Restricted at the Level of Virus Entry and at a Late Stage in the Virus Life Cycle.

PubMed

Londrigan, Sarah L; Short, Kirsty R; Ma, Joel; Gillespie, Leah; Rockman, Steven P; Brooks, Andrew G; Reading, Patrick C

2015-12-01

Airway epithelial cells are susceptible to infection with seasonal influenza A viruses (IAV), resulting in productive virus replication and release. Macrophages (MΦ) are also permissive to IAV infection; however, virus replication is abortive. Currently, it is unclear how productive infection of MΦ is impaired or the extent to which seasonal IAV replicate in MΦ. Herein, we compared mouse MΦ and epithelial cells for their ability to support genomic replication and transcription, synthesis of viral proteins, assembly of virions, and release of infectious progeny following exposure to genetically defined IAV. We confirm that seasonal IAV differ in their ability to utilize cell surface receptors for infectious entry and that this represents one level of virus restriction. Following virus entry, we demonstrate synthesis of all eight segments of genomic viral RNA (vRNA) and mRNA, as well as seven distinct IAV proteins, in IAV-infected mouse MΦ. Although newly synthesized hemagglutinin (HA) and neuraminidase (NA) glycoproteins are incorporated into the plasma membrane and expressed at the cell surface, electron microscopy confirmed that virus assembly was defective in IAV-infected MΦ, defining a second level of restriction late in the virus life cycle. Seasonal influenza A viruses (IAV) and highly pathogenic avian influenza viruses (HPAI) infect macrophages, but only HPAI replicate productively in these cells. Herein, we demonstrate that impaired virus uptake into macrophages represents one level of restriction limiting infection by seasonal IAV. Following uptake, seasonal IAV do not complete productive replication in macrophages, representing a second level of restriction. Using murine macrophages, we demonstrate that productive infection is blocked late in the virus life cycle, such that virus assembly is defective and newly synthesized virions are not released. These studies represent an important step toward identifying host-encoded factors that block replication of seasonal IAV, but not HPAI, in macrophages. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Progesterone at Encoding Predicts Subsequent Emotional Memory

ERIC Educational Resources Information Center

Ertman, Nicole; Andreano, Joseph M.; Cahill, Larry

2011-01-01

Significant sex differences in the well-documented relationship between stress hormones and memory have emerged in recent studies. The potentiating effects of glucocorticoids on memory vary across the menstrual cycle, suggesting a potential interaction between these stress hormones and endogenously cycling sex hormones. Here, we show that memory…

Coordinated dynamic encoding in the retina using opposing forms of plasticity

PubMed Central

Kastner, David B.; Baccus, Stephen A.

2011-01-01

The range of natural inputs encoded by a neuron often exceeds its dynamic range. To overcome this limitation, neural populations divide their inputs among different cell classes, as with rod and cone photoreceptors, and adapt by shifting their dynamic range. We report that the dynamic behavior of retinal ganglion cells in salamanders, mice, and rabbits is divided into two opposing forms of short-term plasticity in different cell classes. One population of cells exhibited sensitization—a persistent elevated sensitivity following a strong stimulus. This novel dynamic behavior compensates for the information loss caused by the known process of adaptation occurring in a separate cell population. The two populations divide the dynamic range of inputs, with sensitizing cells encoding weak signals, and adapting cells encoding strong signals. In the two populations, the linear, threshold and adaptive properties are linked to preserve responsiveness when stimulus statistics change, with one population maintaining the ability to respond when the other fails. PMID:21909086

Metabolomics and transcriptomics profiles reveal the dysregulation of the tricarboxylic acid cycle and related mechanisms in prostate cancer.

PubMed

Shao, Yaping; Ye, Guozhu; Ren, Shancheng; Piao, Hai-Long; Zhao, Xinjie; Lu, Xin; Wang, Fubo; Ma, Wang; Li, Jia; Yin, Peiyuan; Xia, Tian; Xu, Chuanliang; Yu, Jane J; Sun, Yinghao; Xu, Guowang

2018-07-15

Genetic alterations drive metabolic reprograming to meet increased biosynthetic precursor and energy demands for cancer cell proliferation and survival in unfavorable environments. A systematic study of gene-metabolite regulatory networks and metabolic dysregulation should reveal the molecular mechanisms underlying prostate cancer (PCa) pathogenesis. Herein, we performed gas chromatography-mass spectrometry (GC-MS)-based metabolomics and RNA-seq analyses in prostate tumors and matched adjacent normal tissues (ANTs) to elucidate the molecular alterations and potential underlying regulatory mechanisms in PCa. Significant accumulation of metabolic intermediates and enrichment of genes in the tricarboxylic acid (TCA) cycle were observed in tumor tissues, indicating TCA cycle hyperactivation in PCa tissues. In addition, the levels of fumarate and malate were highly correlated with the Gleason score, tumor stage and expression of genes encoding related enzymes and were significantly related to the expression of genes involved in branched chain amino acid degradation. Using an integrated omics approach, we further revealed the potential anaplerotic routes from pyruvate, glutamine catabolism and branched chain amino acid (BCAA) degradation contributing to replenishing metabolites for TCA cycle. Integrated omics techniques enable the performance of network-based analyses to gain a comprehensive and in-depth understanding of PCa pathophysiology and may facilitate the development of new and effective therapeutic strategies. © 2018 UICC.

ATR inhibition controls aggressive prostate tumors deficient in Y-linked histone demethylase KDM5D.

PubMed

Komura, Kazumasa; Yoshikawa, Yuki; Shimamura, Teppei; Chakraborty, Goutam; Gerke, Travis A; Hinohara, Kunihiko; Chadalavada, Kalyani; Jeong, Seong Ho; Armenia, Joshua; Du, Shin-Yi; Mazzu, Ying Z; Taniguchi, Kohei; Ibuki, Naokazu; Meyer, Clifford A; Nanjangud, Gouri J; Inamoto, Teruo; Lee, Gwo-Shu Mary; Mucci, Lorelei A; Azuma, Haruhito; Sweeney, Christopher J; Kantoff, Philip W

2018-06-04

Epigenetic modifications control cancer development and clonal evolution in various cancer types. Here, we show that loss of the male-specific histone demethylase lysine-specific demethylase 5D (KDM5D) encoded on the Y chromosome epigenetically modifies histone methylation marks and alters gene expression, resulting in aggressive prostate cancer. Fluorescent in situ hybridization demonstrated that segmental or total deletion of the Y chromosome in prostate cancer cells is one of the causes of decreased KDM5D mRNA expression. The result of ChIP-sequencing analysis revealed that KDM5D preferably binds to promoter regions with coenrichment of the motifs of crucial transcription factors that regulate the cell cycle. Loss of KDM5D expression with dysregulated H3K4me3 transcriptional marks was associated with acceleration of the cell cycle and mitotic entry, leading to increased DNA-replication stress. Analysis of multiple clinical data sets reproducibly showed that loss of expression of KDM5D confers a poorer prognosis. Notably, we also found stress-induced DNA damage on the serine/threonine protein kinase ATR with loss of KDM5D. In KDM5D-deficient cells, blocking ATR activity with an ATR inhibitor enhanced DNA damage, which led to subsequent apoptosis. These data start to elucidate the biological characteristics resulting from loss of KDM5D and also provide clues for a potential novel therapeutic approach for this subset of aggressive prostate cancer.

RAN1 is involved in plant cold resistance and development in rice (Oryza sativa).

PubMed

Xu, Peipei; Cai, Weiming

2014-07-01

Of the diverse abiotic stresses, low temperature is one of the major limiting factors that lead to a series of morphological, physiological, biochemical, and molecular changes in plants. Ran, an evolutionarily conserved small G-protein family, has been shown to be essential for the nuclear translocation of proteins. It also mediates the regulation of cell cycle progression in mammalian cells. However, little is known about Ran function in rice (Oryza sativa). We report here that Ran gene OsRAN1 is essential for the molecular improvement of rice for cold tolerance. Ran also affects plant morphogenesis in transgenic Arabidopsis thaliana. OsRAN1 is ubiquitously expressed in rice tissues with the highest expression in the spike. The levels of mRNA encoding OsRAN1 were greatly increased by cold and indoleacetic acid treatment rather than by addition of salt and polyethylene glycol. Further, OsRAN1 overexpression in Arabidopsis increased tiller number, and altered root development. OsRAN1 overexpression in rice improves cold tolerance. The levels of cellular free Pro and sugar levels were highly increased in transgenic plants under cold stress. Under cold stress, OsRAN1 maintained cell division and cell cycle progression, and also promoted the formation of an intact nuclear envelope. The results suggest that OsRAN1 protein plays an important role in the regulation of cellular mitosis and the auxin signalling pathway. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Local neuropeptide signaling modulates serotonergic transmission to shape the temporal organization of C. elegans egg-laying behavior

PubMed Central

Banerjee, Navonil; Bhattacharya, Raja; Francis, Michael M.

2017-01-01

Animal behaviors are often composed of distinct alternating behavioral states. Neuromodulatory signals are thought to be critical for establishing stable behavioral states and for orchestrating transitions between them. However, we have only a limited understanding of how neuromodulatory systems act in vivo to alter circuit performance and shape behavior. To address these questions, we have investigated neuromodulatory signaling in the context of Caenorhabditis elegans egg-laying. Egg-laying activity cycles between discrete states–short bursts of egg deposition (active phases) that alternate with prolonged quiescent periods (inactive phases). Here using genetic, pharmacological and optogenetic approaches for cell-specific activation and inhibition, we show that a group of neurosecretory cells (uv1) located in close spatial proximity to the egg-laying neuromusculature direct the temporal organization of egg-laying by prolonging the duration of inactive phases. We demonstrate that the modulatory effects of the uv1 cells are mediated by peptides encoded by the nlp-7 and flp-11 genes that act locally to inhibit circuit activity, primarily by inhibiting vesicular release of serotonin from HSN motor neurons. This peptidergic inhibition is achieved, at least in part, by reducing synaptic vesicle abundance in the HSN motor neurons. By linking the in vivo actions of specific neuropeptide signaling systems with the generation of stable behavioral outcomes, our study reveals how cycles of neuromodulation emanating from non-neuronal cells can fundamentally shape the organization of a behavioral program. PMID:28384151

Structural and functional characterisation of FOXO/Acan-DAF-16 from the parasitic nematode Angiostrongylus cantonensis.

PubMed

Yan, Baolong; Sun, Weiwei; Yan, Lanzhu; Zhang, Liangliang; Zheng, Yuan; Zeng, Yuzhen; Huang, Huicong; Liang, Shaohui

2016-12-01

Fork head box transcription factors subfamily O (FoxO) is regarded to be significant in cell-cycle control, cell differentiation, ageing, stress response, apoptosis, tumour formation and DNA damage repair. In the free-living nematode Caenorhabditis elegans, the FoxO transcription factor is encoded by Ce-daf-16, which is negatively regulated by insulin-like signaling (IIS) and involved in promoting dauer formation through bringing about its hundreds of downstream genes expression. In nematode parasites, orthologues of daf-16 from several species have been identified, with functions in rescue of dauer phenotypes determined in a surrogate system C. elegans. In this study, we identified the FoxO encoding gene, Acan-daf-16, from the parasitic nematode Angiostrongylus cantonensis, and determined the genomic structures, transcripts and functions far more thorough in longevity, stress resistance and dauer formation. Acan-daf-16 encodes two proteins, Acan-DAF-16A and Acan-DAF-16B, consisting of 555 and 491 amino acids, respectively. Both isoforms possess the highly conserved fork head domains. Acan-daf-16A and Acan-daf-16B are expressed from distinct promoters. The expression patterns of Acan-daf-16 isoforms in the C. elegans surrogate system showed that p Acan-daf-16a:gfp was expressed in all cells of C. elegans, including the pharynx, and the expression of p Acan-daf-16b:gfp was restricted to the pharynx. In addition to the same genomic organization to the orthologue in C. elegans, Ce-daf-16, both Acan-DAF-16 isoforms could restore the C. elegans daf-16(mg54) mutation in longevity, dauer formation and stress resistance, in spite of the partial complementation of Acan-DAF-16B isoform in longevity. These findings provide further evidence of the functional conservation of DAF-16s between parasitic nematodes and the free-living nematode C. elegans. Copyright © 2016. Published by Elsevier B.V.

Integration of multiple determinants in the neuronal computation of economic values.

PubMed

Raghuraman, Anantha P; Padoa-Schioppa, Camillo

2014-08-27

Economic goods may vary on multiple dimensions (determinants). A central conjecture in decision neuroscience is that choices between goods are made by comparing subjective values computed through the integration of all relevant determinants. Previous work identified three groups of neurons in the orbitofrontal cortex (OFC) of monkeys engaged in economic choices: (1) offer value cells, which encode the value of individual offers; (2) chosen value cells, which encode the value of the chosen good; and (3) chosen juice cells, which encode the identity of the chosen good. In principle, these populations could be sufficient to generate a decision. Critically, previous work did not assess whether offer value cells (the putative input to the decision) indeed encode subjective values as opposed to physical properties of the goods, and/or whether offer value cells integrate multiple determinants. To address these issues, we recorded from the OFC while monkeys chose between risky outcomes. Confirming previous observations, three populations of neurons encoded the value of individual offers, the value of the chosen option, and the value-independent choice outcome. The activity of both offer value cells and chosen value cells encoded values defined by the integration of juice quantity and probability. Furthermore, both populations reflected the subjective risk attitude of the animals. We also found additional groups of neurons encoding the risk associated with a particular option, the risky nature of the chosen option, and whether the trial outcome was positive or negative. These results provide substantial support for the conjecture described above and for the involvement of OFC in good-based decisions. Copyright © 2014 the authors 0270-6474/14/3311583-21$15.00/0.

Inhibition of Expression of the S100A8 Gene Encoding the S100 Calcium-Binding Protein A8 Promotes Apoptosis by Suppressing the Phosphorylation of Protein Kinase B (Akt) in Endometrial Carcinoma and HEC-1A Cells.

PubMed

Liu, Chang; Xing, Guangyang; Wu, Cailiang; Zhu, Jun; Wei, Min; Liu, Dajiang; Ge, Yan; Chen, Yao; Lei, Ting; Yang, Yongxiu

2018-03-29

BACKGROUND The aim of this study was to investigate the expression and silencing of the S100A8 gene, which encodes the S100 calcium-binding protein A8 (S100A8), and apoptosis and phosphorylation of protein kinase B (Akt) in tissue samples of endometrial carcinoma and HEC-1A endometrial adenocarcinoma cells in vitro. MATERIAL AND METHODS Immunohistochemistry (IHC) was used to detect expression of the S100A8 protein in 74 tissue samples of endometrial cancer and 22 normal endometrial tissue samples. A stable S100A8 gene knockdown cell line was constructed using lentiviral packing short hairpin RNA (shRNA) transfected into HEC-1A cells. S100A8 mRNA and S100A8 protein levels were detected by quantitative reverse transcription-polymerase chain reaction (qRT-PCR) and Western blotting. The effects of expression of the S100A8 gene by endometrial cancer cells was investigated by the MTT assay, cell cycle and apoptotic assays, qRT-PCR, and Western blotting. RESULTS IHC showed high levels of expression of S100A8 protein in endometrial carcinoma tissues, and HEC-1A adenocarcinoma cells (in G1 and G2). Increased expression of S100A8 protein was found endometrial cancer tissues compared with normal endometrial tissues (79.7% vs. 4.5%). S100A8 gene knockdown reduced cell proliferation in the HEC-1A cells compared with control cells, induced cell apoptosis, inhibited the phosphorylation of protein kinase B (Akt), and induced the expression of pro-apoptotic genes, including the cytochrome C gene, CYCS, BAD, BAX, FOXO1, FOXO3, CASP9, and CASP3. CONCLUSIONS In endometrial carcinoma cells, down-regulation of the S100A8 gene induced cell apoptosis via inhibition of the phosphorylated or active form of protein kinase B (Akt).

Inhibition of Expression of the S100A8 Gene Encoding the S100 Calcium-Binding Protein A8 Promotes Apoptosis by Suppressing the Phosphorylation of Protein Kinase B (Akt) in Endometrial Carcinoma and HEC-1A Cells

PubMed Central

Liu, Chang; Xing, Guangyang; Wu, Cailiang; Zhu, Jun; Wei, Min; Liu, Dajiang; Ge, Yan; Chen, Yao; Lei, Ting

2018-01-01

Background The aim of this study was to investigate the expression and silencing of the S100A8 gene, which encodes the S100 calcium-binding protein A8 (S100A8), and apoptosis and phosphorylation of protein kinase B (Akt) in tissue samples of endometrial carcinoma and HEC-1A endometrial adenocarcinoma cells in vitro. Material/Methods Immunohistochemistry (IHC) was used to detect expression of the S100A8 protein in 74 tissue samples of endometrial cancer and 22 normal endometrial tissue samples. A stable S100A8 gene knockdown cell line was constructed using lentiviral packing short hairpin RNA (shRNA) transfected into HEC-1A cells. S100A8 mRNA and S100A8 protein levels were detected by quantitative reverse transcription-polymerase chain reaction (qRT-PCR) and Western blotting. The effects of expression of the S100A8 gene by endometrial cancer cells was investigated by the MTT assay, cell cycle and apoptotic assays, qRT-PCR, and Western blotting. Results IHC showed high levels of expression of S100A8 protein in endometrial carcinoma tissues, and HEC-1A adenocarcinoma cells (in G1 and G2). Increased expression of S100A8 protein was found endometrial cancer tissues compared with normal endometrial tissues (79.7% vs. 4.5%). S100A8 gene knockdown reduced cell proliferation in the HEC-1A cells compared with control cells, induced cell apoptosis, inhibited the phosphorylation of protein kinase B (Akt), and induced the expression of pro-apoptotic genes, including the cytochrome C gene, CYCS, BAD, BAX, FOXO1, FOXO3, CASP9, and CASP3. Conclusions In endometrial carcinoma cells, down-regulation of the S100A8 gene induced cell apoptosis via inhibition of the phosphorylated or active form of protein kinase B (Akt). PMID:29595187

A new metabolic cell wall labeling method reveals peptidoglycan in Chlamydia trachomatis

PubMed Central

Liechti, G.; Kuru, E.; Hall, E.; Kalinda, A.; Brun, Y. V.; VanNieuwenhze, M.; Maurelli, A. T.

2014-01-01

Peptidoglycan (PG), an essential structure in the cell walls of the vast majority of bacteria, is critical for division and maintaining cell shape and hydrostatic pressure1. Bacteria comprising the Chlamydiales were thought to be one of the few exceptions. Chlamydia encodes genes for PG biosynthesis2–7 and exhibits susceptibility to "anti-PG" antibiotics8,9, yet attempts to detect PG in any chlamydial species have proven unsuccessful (the ‘chlamydial anomaly’10). We employed a novel approach to metabolically label chlamydial PG using D-amino acid dipeptide probes and click chemistry. Replicating Chlamydia trachomatis was labeled with the probes throughout its biphasic, developmental life cycle, and differential probe incorporation experiments conducted in the presence of ampicillin is consistent with the presence of chlamydial PG modifying enzymes. These findings culminate 50 years of speculation and debate concerning the chlamydial anomaly and are the strongest evidence to date that chlamydial species possess functional PG. PMID:24336210

Downstream of human NDR kinases: impacting on c-myc and p21 protein stability to control cell cycle progression.

PubMed

Cornils, Hauke; Kohler, Reto S; Hergovich, Alexander; Hemmings, Brian A

2011-06-15

The mammalian genome encodes four members of the NDR/LATS kinase family: NDR1 (STK38), NDR2 (STK38L), LATS1 and LATS2, which are highly conserved from yeast to man. Members of the NDR/LATS kinase family have been implicated in a variety of biological processes ranging from cell division and morphology to apoptosis and tumor suppression. In mammals, LATS1/2 function as central parts of the HIPPO tumor suppressor pathway by restricting the activity of the YAP/TAZ proto-oncogenes. Recent evidence suggested that NDR1/2 are also part of an extended HIPPO tumor suppressor pathway. Apart from functions in apoptosis signaling and tumor suppression, NDR1/2 have been implicated in controlling centrosome duplication and mitotic chromosome alignment downstream of the HIPPO kinase homologs MST1 and MST2. Significantly, we also reported recently that NDR1/2 are controlling G 1/S transition downstream of a third MST family member MST3. Intriguingly, this newly described MST3-NDR1/2 axis promotes G 1 progression by stabilizing c-myc and preventing p21 accumulation, indicating a potential pro-tumorigenic role for NDR kinases. Here, we discuss these novel cell cycle functions of NDR kinases in a broader context and elaborate on possible explanations for the opposing functions of NDR kinases in normal and tumor biology.

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

PubMed

Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

2018-05-24

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

A C-terminal HSP90 inhibitor restores glucocorticoid sensitivity and relieves a mouse allograft model of Cushing disease.

PubMed

Riebold, Mathias; Kozany, Christian; Freiburger, Lee; Sattler, Michael; Buchfelder, Michael; Hausch, Felix; Stalla, Günter K; Paez-Pereda, Marcelo

2015-03-01

One function of the glucocorticoid receptor (GR) in corticotroph cells is to suppress the transcription of the gene encoding proopiomelanocortin (POMC), the precursor of the stress hormone adrenocorticotropin (ACTH). Cushing disease is a neuroendocrine condition caused by partially glucocorticoid-resistant corticotroph adenomas that excessively secrete ACTH, which leads to hypercortisolism. Mutations that impair GR function explain glucocorticoid resistance only in sporadic cases. However, the proper folding of GR depends on direct interactions with the chaperone heat shock protein 90 (HSP90, refs. 7,8). We show here that corticotroph adenomas overexpress HSP90 compared to the normal pituitary. N- and C-terminal HSP90 inhibitors act at different steps of the HSP90 catalytic cycle to regulate corticotroph cell proliferation and GR transcriptional activity. C-terminal inhibitors cause the release of mature GR from HSP90, which promotes its exit from the chaperone cycle and potentiates its transcriptional activity in a corticotroph cell line and in primary cultures of human corticotroph adenomas. In an allograft mouse model, the C-terminal HSP90 inhibitor silibinin showed anti-tumorigenic effects, partially reverted hormonal alterations, and alleviated symptoms of Cushing disease. These results suggest that the pathogenesis of Cushing disease caused by overexpression of heat shock proteins and consequently misregulated GR sensitivity may be overcome pharmacologically with an appropriate HSP90 inhibitor.

Transcript Profiling of Individual Twin Blastomeres Derived by Splitting Two-Cell Stage Murine Embryos1

PubMed Central

Roberts, R. Michael; Katayama, Mika; Magnuson, Scott R.; Falduto, Michael T.; Torres, Karen E.O.

2010-01-01

In invertebrates and amphibians, informational macromolecules in egg cytoplasm are organized to provide direction to the formation of embryonic lineages, but it is unclear whether vestiges of such prepatterning exist in mammals. Here we examined whether twin blastomeres from 2-cell stage mouse embryos differ in mRNA content. mRNA from 26 blastomeres derived from 13 embryos approximately mid-way through their second cell cycle was subjected to amplification. Twenty amplified samples were hybridized to arrays. Of those samples that hybridized successfully, 12 samples in six pairs were used in the final analysis. Probes displaying normalized values >0.25 (n = 4573) were examined for consistent bias in expression within blastomere pairs. Although transcript content varied between both individual embryos and twin blastomeres, no consistent asymmetries were observed for the majority of genes, with only 178 genes displaying a >1.4-fold difference in expression across all six pairs. Although class discovery clustering showed that blastomere pairs separated into two distinct groups in terms of their differentially expressed genes, when the data were tested for significance of asymmetrical expression, only 39 genes with >1.4-fold change ratios in six of six blastomere pairs passed the two-sample t-test (P < 0.05). Transcripts encoding proteins implicated in RNA processing and cytoskeletal organization were among the most abundant, differentially distributed mRNA, suggesting that a stochastically based lack of synchrony in cell cycle progression between the two cells might explain at least some and possibly all of the asymmetries in transcript composition. PMID:21076082

Physalis floridana Cell Number Regulator1 encodes a cell membrane-anchored modulator of cell cycle and negatively controls fruit size

PubMed Central

Li, Zhichao; He, Chaoying

2015-01-01

Physalis species show a significant variation in berry size; however, the underlying molecular basis is unknown. In this work, we showed that cell division difference in the ovaries might contribute to the ultimate berry size variation within Physalis species, and that mRNA abundance of Physalis floridana Cell Number Regulator1 (PfCNR1), the putative orthologue of the tomato fruit weight 2.2 (FW2.2), was negatively correlated with cell division in the ovaries. Moreover, heterochronic expression variation of the PfCNR1 genes in the ovaries concomitantly correlated with berry weight variation within Physalis species. In transgenic Physalis, multiple organ sizes could be negatively controlled by altering PfCNR1 levels, and cell division instead of cell expansion was primarily affected. PfCNR1 was shown to be anchored in the plasma membrane and to interact with PfAG2 (an AGAMOUS-like protein determining ovary identity). The expression of PfCYCD2;1, a putative orthologue of the mitosis-specific gene CyclinD2;1 in the cell cycle was negatively correlated with the PfCNR1 mRNA levels. PfAG2 was found to selectively bind to the CArG-box in the PfCYCD2;1 promoter and to repress PfCYCD2;1 expression, thus suggesting a PfAG2-mediated pathway for PfCNR1 to regulate cell division. The interaction of PfCNR1 with PfAG2 enhanced the repression of PfCYCD2;1 expression. The nuclear import of PfAG2 was essential in the proposed pathway. Our data provide new insights into the developmental pathways of a cell membrane-anchored protein that modulates cell division and governs organ size determination. This study also sheds light on the link between organ identity and organ growth in plants. PMID:25305759

The molecular genetics of Usher syndrome.

PubMed

Ahmed, Z M; Riazuddin, S; Riazuddin, S; Wilcox, E R

2003-06-01

Association of sensorineural deafness and progressive retinitis pigmentosa with and without a vestibular abnormality is the hallmark of Usher syndrome and involves at least 12 loci among three different clinical subtypes. Genes identified for the more commonly inherited loci are USH2A (encoding usherin), MYO7A (encoding myosin VIIa), CDH23 (encoding cadherin 23), PCDH15 (encoding protocadherin 15), USH1C (encoding harmonin), USH3A (encoding clarin 1), and USH1G (encoding SANS). Transcripts from all these genes are found in many tissues/cell types other than the inner ear and retina, but all are uniquely critical for retinal and cochlear cell function. Many of these protein products have been demonstrated to have direct interactions with each other and perform an essential role in stereocilia homeostasis.

ATM kinase inhibition in glial cells activates the innate immune response and causes neurodegeneration in Drosophila.

PubMed

Petersen, Andrew J; Rimkus, Stacey A; Wassarman, David A

2012-03-13

To investigate the mechanistic basis for central nervous system (CNS) neurodegeneration in the disease ataxia-telangiectasia (A-T), we analyzed flies mutant for the causative gene A-T mutated (ATM). ATM encodes a protein kinase that functions to monitor the genomic integrity of cells and control cell cycle, DNA repair, and apoptosis programs. Mutation of the C-terminal amino acid in Drosophila ATM inhibited the kinase activity and caused neuron and glial cell death in the adult brain and a reduction in mobility and longevity. These data indicate that reduced ATM kinase activity is sufficient to cause neurodegeneration in A-T. ATM kinase mutant flies also had elevated expression of innate immune response genes in glial cells. ATM knockdown in glial cells, but not neurons, was sufficient to cause neuron and glial cell death, a reduction in mobility and longevity, and elevated expression of innate immune response genes in glial cells, indicating that a non-cell-autonomous mechanism contributes to neurodegeneration in A-T. Taken together, these data suggest that early-onset CNS neurodegeneration in A-T is similar to late-onset CNS neurodegeneration in diseases such as Alzheimer's in which uncontrolled inflammatory response mediated by glial cells drives neurodegeneration.

Self-organizing maps based on limit cycle attractors.

PubMed

Huang, Di-Wei; Gentili, Rodolphe J; Reggia, James A

2015-03-01

Recent efforts to develop large-scale brain and neurocognitive architectures have paid relatively little attention to the use of self-organizing maps (SOMs). Part of the reason for this is that most conventional SOMs use a static encoding representation: each input pattern or sequence is effectively represented as a fixed point activation pattern in the map layer, something that is inconsistent with the rhythmic oscillatory activity observed in the brain. Here we develop and study an alternative encoding scheme that instead uses sparsely-coded limit cycles to represent external input patterns/sequences. We establish conditions under which learned limit cycle representations arise reliably and dominate the dynamics in a SOM. These limit cycles tend to be relatively unique for different inputs, robust to perturbations, and fairly insensitive to timing. In spite of the continually changing activity in the map layer when a limit cycle representation is used, map formation continues to occur reliably. In a two-SOM architecture where each SOM represents a different sensory modality, we also show that after learning, limit cycles in one SOM can correctly evoke corresponding limit cycles in the other, and thus there is the potential for multi-SOM systems using limit cycles to work effectively as hetero-associative memories. While the results presented here are only first steps, they establish the viability of SOM models based on limit cycle activity patterns, and suggest that such models merit further study. Copyright © 2014 Elsevier Ltd. All rights reserved.

A genome survey of Moniliophthora perniciosa gives new insights into Witches' Broom Disease of cacao

PubMed Central

Mondego, Jorge MC; Carazzolle, Marcelo F; Costa, Gustavo GL; Formighieri, Eduardo F; Parizzi, Lucas P; Rincones, Johana; Cotomacci, Carolina; Carraro, Dirce M; Cunha, Anderson F; Carrer, Helaine; Vidal, Ramon O; Estrela, Raíssa C; García, Odalys; Thomazella, Daniela PT; de Oliveira, Bruno V; Pires, Acássia BL; Rio, Maria Carolina S; Araújo, Marcos Renato R; de Moraes, Marcos H; Castro, Luis AB; Gramacho, Karina P; Gonçalves, Marilda S; Neto, José P Moura; Neto, Aristóteles Góes; Barbosa, Luciana V; Guiltinan, Mark J; Bailey, Bryan A; Meinhardt, Lyndel W; Cascardo, Julio CM; Pereira, Gonçalo AG

2008-01-01

Background The basidiomycete fungus Moniliophthora perniciosa is the causal agent of Witches' Broom Disease (WBD) in cacao (Theobroma cacao). It is a hemibiotrophic pathogen that colonizes the apoplast of cacao's meristematic tissues as a biotrophic pathogen, switching to a saprotrophic lifestyle during later stages of infection. M. perniciosa, together with the related species M. roreri, are pathogens of aerial parts of the plant, an uncommon characteristic in the order Agaricales. A genome survey (1.9× coverage) of M. perniciosa was analyzed to evaluate the overall gene content of this phytopathogen. Results Genes encoding proteins involved in retrotransposition, reactive oxygen species (ROS) resistance, drug efflux transport and cell wall degradation were identified. The great number of genes encoding cytochrome P450 monooxygenases (1.15% of gene models) indicates that M. perniciosa has a great potential for detoxification, production of toxins and hormones; which may confer a high adaptive ability to the fungus. We have also discovered new genes encoding putative secreted polypeptides rich in cysteine, as well as genes related to methylotrophy and plant hormone biosynthesis (gibberellin and auxin). Analysis of gene families indicated that M. perniciosa have similar amounts of carboxylesterases and repertoires of plant cell wall degrading enzymes as other hemibiotrophic fungi. In addition, an approach for normalization of gene family data using incomplete genome data was developed and applied in M. perniciosa genome survey. Conclusion This genome survey gives an overview of the M. perniciosa genome, and reveals that a significant portion is involved in stress adaptation and plant necrosis, two necessary characteristics for a hemibiotrophic fungus to fulfill its infection cycle. Our analysis provides new evidence revealing potential adaptive traits that may play major roles in the mechanisms of pathogenicity in the M. perniciosa/cacao pathosystem. PMID:19019209

NAD(P)H-hydrate dehydratase- a metabolic repair enzyme and its role in Bacillus subtilis stress adaptation.

PubMed

Petrovova, Miroslava; Tkadlec, Jan; Dvoracek, Lukas; Streitova, Eliska; Licha, Irena

2014-01-01

One of the strategies for survival stress conditions in bacteria is a regulatory adaptive system called general stress response (GSR), which is dependent on the SigB transcription factor in Bacillus sp. The GSR is one of the largest regulon in Bacillus sp., including about 100 genes; however, most of the genes that show changes in expression during various stresses have not yet been characterized or assigned a biochemical function for the encoded proteins. Previously, we characterized the Bacillus subtilis168 osmosensitive mutant, defective in the yxkO gene (encoding a putative ribokinase), which was recently assigned in vitro as an ADP/ATP-dependent NAD(P)H-hydrate dehydratase and was demonstrated to belong to the SigB operon. We show the impact of YxkO on the activity of SigB-dependent Pctc promoter and adaptation to osmotic and ethanol stress and potassium limitation respectively. Using a 2DE approach, we compare the proteomes of WT and mutant strains grown under conditions of osmotic and ethanol stress. Both stresses led to changes in the protein level of enzymes that are involved in motility (flagellin), citrate cycle (isocitrate dehydrogenase, malate dehydrogenase), glycolysis (phosphoglycerate kinase), and decomposition of Amadori products (fructosamine-6-phosphate deglycase). Glutamine synthetase revealed a different pattern after osmotic stress. The patterns of enzymes for branched amino acid metabolism and cell wall synthesis (L-alanine dehydrogenase, aspartate-semialdehyde dehydrogenase, ketol-acid reductoisomerase) were altered after ethanol stress. We performed the first characterization of a Bacillus subtilis168 knock-out mutant in the yxkO gene that encodes a metabolite repair enzyme. We show that such enzymes could play a significant role in the survival of stressed cells.

Bacterial bioluminescence regulates expression of a host cryptochrome gene in the squid-Vibrio symbiosis.

PubMed

Heath-Heckman, Elizabeth A C; Peyer, Suzanne M; Whistler, Cheryl A; Apicella, Michael A; Goldman, William E; McFall-Ngai, Margaret J

2013-04-02

The symbiosis between the squid Euprymna scolopes and its luminous symbiont, Vibrio fischeri, is characterized by daily transcriptional rhythms in both partners and daily fluctuations in symbiont luminescence. In this study, we sought to determine whether symbionts affect host transcriptional rhythms. We identified two transcripts in host tissues (E. scolopes cry1 [escry1] and escry2) that encode cryptochromes, proteins that influence circadian rhythms in other systems. Both genes cycled daily in the head of the squid, with a pattern similar to that of other animals, in which expression of certain cry genes is entrained by environmental light. In contrast, escry1 expression cycled in the symbiont-colonized light organ with 8-fold upregulation coincident with the rhythms of bacterial luminescence, which are offset from the day/night light regime. Colonization of the juvenile light organ by symbionts was required for induction of escry1 cycling. Further, analysis with a mutant strain defective in light production showed that symbiont luminescence is essential for cycling of escry1; this defect could be complemented by presentation of exogenous blue light. However, blue-light exposure alone did not induce cycling in nonsymbiotic animals, but addition of molecules of the symbiont cell envelope to light-exposed animals did recover significant cycling activity, showing that light acts in synergy with other symbiont features to induce cycling. While symbiont luminescence may be a character specific to rhythms of the squid-vibrio association, resident microbial partners could similarly influence well-documented daily rhythms in other systems, such as the mammalian gut.

Bacterial Bioluminescence Regulates Expression of a Host Cryptochrome Gene in the Squid-Vibrio Symbiosis

PubMed Central

Heath-Heckman, Elizabeth A. C.; Peyer, Suzanne M.; Whistler, Cheryl A.; Apicella, Michael A.; Goldman, William E.; McFall-Ngai, Margaret J.

2013-01-01

ABSTRACT The symbiosis between the squid Euprymna scolopes and its luminous symbiont, Vibrio fischeri, is characterized by daily transcriptional rhythms in both partners and daily fluctuations in symbiont luminescence. In this study, we sought to determine whether symbionts affect host transcriptional rhythms. We identified two transcripts in host tissues (E. scolopes cry1 [escry1] and escry2) that encode cryptochromes, proteins that influence circadian rhythms in other systems. Both genes cycled daily in the head of the squid, with a pattern similar to that of other animals, in which expression of certain cry genes is entrained by environmental light. In contrast, escry1 expression cycled in the symbiont-colonized light organ with 8-fold upregulation coincident with the rhythms of bacterial luminescence, which are offset from the day/night light regime. Colonization of the juvenile light organ by symbionts was required for induction of escry1 cycling. Further, analysis with a mutant strain defective in light production showed that symbiont luminescence is essential for cycling of escry1; this defect could be complemented by presentation of exogenous blue light. However, blue-light exposure alone did not induce cycling in nonsymbiotic animals, but addition of molecules of the symbiont cell envelope to light-exposed animals did recover significant cycling activity, showing that light acts in synergy with other symbiont features to induce cycling. While symbiont luminescence may be a character specific to rhythms of the squid-vibrio association, resident microbial partners could similarly influence well-documented daily rhythms in other systems, such as the mammalian gut. PMID:23549919

Molecular Basis of Latency in Pathogenic Human Viruses

NASA Astrophysics Data System (ADS)

Garcia-Blanco, Mariano A.; Cullen, Bryan R.

1991-11-01

Several human viruses are able to latently infect specific target cell populations in vivo. Analysis of the replication cycles of herpes simplex virus, Epstein-Barr virus, and human immunodeficiency virus suggests that the latent infections established by these human pathogens primarily result from a lack of host factors critical for the expression of viral early gene products. The subsequent activation of specific cellular transcription factors in response to extracellular stimuli can induce the expression of these viral regulatory proteins and lead to a burst of lytic viral replication. Latency in these eukaryotic viruses therefore contrasts with latency in bacteriophage, which is maintained primarily by the expression of virally encoded repressors of lytic replication.

Self-assembly of the general membrane-remodeling protein PVAP into sevenfold virus-associated pyramids.

PubMed

Daum, Bertram; Quax, Tessa E F; Sachse, Martin; Mills, Deryck J; Reimann, Julia; Yildiz, Özkan; Häder, Sabine; Saveanu, Cosmin; Forterre, Patrick; Albers, Sonja-Verena; Kühlbrandt, Werner; Prangishvili, David

2014-03-11

Viruses have developed a wide range of strategies to escape from the host cells in which they replicate. For egress some archaeal viruses use a pyramidal structure with sevenfold rotational symmetry. Virus-associated pyramids (VAPs) assemble in the host cell membrane from the virus-encoded protein PVAP and open at the end of the infection cycle. We characterize this unusual supramolecular assembly using a combination of genetic, biochemical, and electron microscopic techniques. By whole-cell electron cryotomography, we monitored morphological changes in virus-infected host cells. Subtomogram averaging reveals the VAP structure. By heterologous expression of PVAP in cells from all three domains of life, we demonstrate that the protein integrates indiscriminately into virtually any biological membrane, where it forms sevenfold pyramids. We identify the protein domains essential for VAP formation in PVAP truncation mutants by their ability to remodel the cell membrane. Self-assembly of PVAP into pyramids requires at least two different, in-plane and out-of-plane, protein interactions. Our findings allow us to propose a model describing how PVAP arranges to form sevenfold pyramids and suggest how this small, robust protein may be used as a general membrane-remodeling system.

Lighting Up the Force: Investigating Mechanisms of Mechanotransduction Using Fluorescent Tension Probes

PubMed Central

Jurchenko, Carol

2015-01-01

The ability of cells to sense the physical nature of their surroundings is critical to the survival of multicellular organisms. Cellular response to physical cues from adjacent cells and the extracellular matrix leads to a dynamic cycle in which cells respond by remodeling their local microenvironment, fine-tuning cell stiffness, polarity, and shape. Mechanical regulation is important in cellular development, normal morphogenesis, and wound healing. The mechanisms by which these finely balanced mechanotransduction events occur, however, are not well understood. In large part, this is due to the limited availability of tools to study molecular mechanotransduction events in live cells. Several classes of molecular tension probes have been recently developed which are rapidly transforming the study of mechanotransduction. Molecular tension probes are primarily based on fluorescence resonance energy transfer (FRET) and report on piconewton scale tension events in live cells. In this minireview, we describe the two main classes of tension probes, genetically encoded tension sensors and immobilized tension sensors, and discuss the advantages and limitations of each type. We discuss future opportunities to address major biological questions and outline the challenges facing the next generation of molecular tension probes. PMID:26031334

Sec13 safeguards the integrity of the endoplasmic reticulum and organogenesis of the digestive system in zebrafish.

PubMed

Niu, Xubo; Gao, Chuan; Jan Lo, Li; Luo, Yue; Meng, Chunmei; Hong, Jian; Hong, Wanjin; Peng, Jinrong

2012-07-15

The Sec13-Sec31 heterotetramer serves as the outer coat in the COPII complex, which mediates protein trafficking from the endoplasmic reticulum (ER) to the Golgi apparatus. Although it has been studied in depth in yeast and cultured cells, the role of COPII in organogenesis in a multicellular organism has not. We report here that a zebrafish sec13(sq198) mutant, which exhibits a phenotype of hypoplastic digestive organs, has a mutation in the sec13 gene. The mutant gene encodes a carboxyl-terminus-truncated Sec13 that loses its affinity to Sec31a, which leads to disintegration of the ER structure in various differentiated cells in sec13(sq198), including chondrocytes, intestinal epithelial cells and hepatocytes. Disruption of the ER structure activates an unfolded protein response that eventually causes the cells to undergo cell-cycle arrest and cell apoptosis, which arrest the growth of developing digestive organs in the mutant. Our data provide the first direct genetic evidence that COPII function is essential for the organogenesis of the digestive system. Copyright © 2012 Elsevier Inc. All rights reserved.

Dnd1-mediated epigenetic control of teratoma formation in mouse

PubMed Central

Gu, Wei; Mochizuki, Kentaro; Otsuka, Kei; Hamada, Ryohei; Takehara, Asuka

2018-01-01

ABSTRACT Spontaneous testicular teratoma develops from primordial germ cells (PGCs) in embryos; however, the molecular mechanisms underlying teratoma formation are not fully understood. Mutation of the dead-end 1 (Dnd1) gene, which encodes an RNA-binding protein, drastically enhances teratoma formation in the 129/Sv mouse strain. To elucidate the mechanism of Dnd1 mutation-induced teratoma formation, we focused on histone H3 lysine 27 (H3K27) trimethylation (me3), and found that the levels of H3K27me3 and its responsible methyltransferase, enhancer of zeste homolog 2 (Ezh2), were decreased in the teratoma-forming cells of Dnd1 mutant embryos. We also showed that Dnd1 suppressed miR-26a-mediated inhibition of Ezh2 expression, and that Dnd1 deficiency resulted in decreased H3K27me3 of a cell-cycle regulator gene, Ccnd1. In addition, Ezh2 expression or Ccnd1 deficiency repressed the reprogramming of PGCs into pluripotent stem cells, which mimicked the conversion of embryonic germ cells into teratoma-forming cells. These results revealed an epigenetic molecular linkage between Dnd1 and the suppression of testicular teratoma formation. PMID:29378702

Regulated Forms of Cell Death in Fungi

PubMed Central

Gonçalves, A. Pedro; Heller, Jens; Daskalov, Asen; Videira, Arnaldo; Glass, N. Louise

2017-01-01

Cell death occurs in all domains of life. While some cells die in an uncontrolled way due to exposure to external cues, other cells die in a regulated manner as part of a genetically encoded developmental program. Like other eukaryotic species, fungi undergo programmed cell death (PCD) in response to various triggers. For example, exposure to external stress conditions can activate PCD pathways in fungi. Calcium redistribution between the extracellular space, the cytoplasm and intracellular storage organelles appears to be pivotal for this kind of cell death. PCD is also part of the fungal life cycle, in which it occurs during sexual and asexual reproduction, aging, and as part of development associated with infection in phytopathogenic fungi. Additionally, a fungal non-self-recognition mechanism termed heterokaryon incompatibility (HI) also involves PCD. Some of the molecular players mediating PCD during HI show remarkable similarities to major constituents involved in innate immunity in metazoans and plants. In this review we discuss recent research on fungal PCD mechanisms in comparison to more characterized mechanisms in metazoans. We highlight the role of PCD in fungi in response to exogenic compounds, fungal development and non-self-recognition processes and discuss identified intracellular signaling pathways and molecules that regulate fungal PCD. PMID:28983298

Adaptive and Qualitative Changes in Encoding Strategy with Experience: Evidence from the Test-Expectancy Paradigm

ERIC Educational Resources Information Center

Finley, Jason R.; Benjamin, Aaron S.

2012-01-01

Three experiments demonstrated learners' abilities to adaptively and qualitatively accommodate their encoding strategies to the demands of an upcoming test. Stimuli were word pairs. In Experiment 1, test expectancy was induced for either cued recall (of targets given cues) or free recall (of targets only) across 4 study-test cycles of the same…

Reovirus Nonstructural Protein σNS Acts as an RNA-Stability Factor Promoting Viral Genome Replication.

PubMed

Zamora, Paula F; Hu, Liya; Knowlton, Jonathan J; Lahr, Roni M; Moreno, Rodolfo A; Berman, Andrea J; Prasad, B V Venkataram; Dermody, Terence S

2018-05-16

Viral nonstructural proteins, which are not packaged into virions, are essential for replication of most viruses. Reovirus, a nonenveloped, double-stranded RNA (dsRNA) virus, encodes three nonstructural proteins that are required for viral replication and dissemination in the host. Reovirus nonstructural protein σNS is a single-stranded RNA (ssRNA)-binding protein that must be expressed in infected cells for production of viral progeny. However, activities of σNS during individual steps of the reovirus replication cycle are poorly understood. We explored the function of σNS by disrupting its expression during infection using cells expressing a small interfering RNA (siRNA) targeting the σNS-encoding S3 gene and found that σNS is required for viral genome replication. Using complementary biochemical assays, we determined that σNS forms complexes with viral and nonviral RNAs. We also discovered that σNS increases RNA half-life using in vitro and cell-based RNA degradation experiments. Cryo-electron microscopy revealed that σNS and ssRNAs organize into long, filamentous structures. Collectively, our findings indicate that σNS functions as an RNA-binding protein that increases viral RNA half-life. These results suggest that σNS forms RNA-protein complexes in preparation for genome replication. IMPORTANCE Following infection, viruses synthesize nonstructural proteins that mediate viral replication and promote dissemination. Viruses from the Reoviridae family encode nonstructural proteins that are required for the formation of progeny viruses. Although nonstructural proteins of different Reoviridae family viruses are diverged in primary sequence, these proteins are functionally homologous and appear to facilitate conserved mechanisms of dsRNA virus replication. Using in vitro and cell-culture approaches, we found that the mammalian reovirus nonstructural protein σNS binds and stabilizes viral RNA and is required for genome synthesis. This work contributes new knowledge about basic mechanisms of dsRNA virus replication and provides a foundation for future studies to determine how viruses in the Reoviridae family assort and replicate their genomes. Copyright © 2018 American Society for Microbiology.

Discovery of a Potent Class of PI3Kα Inhibitors with Unique Binding Mode via Encoded Library Technology (ELT).

PubMed

Yang, Hongfang; Medeiros, Patricia F; Raha, Kaushik; Elkins, Patricia; Lind, Kenneth E; Lehr, Ruth; Adams, Nicholas D; Burgess, Joelle L; Schmidt, Stanley J; Knight, Steven D; Auger, Kurt R; Schaber, Michael D; Franklin, G Joseph; Ding, Yun; DeLorey, Jennifer L; Centrella, Paolo A; Mataruse, Sibongile; Skinner, Steven R; Clark, Matthew A; Cuozzo, John W; Evindar, Ghotas

2015-05-14

In the search of PI3K p110α wild type and H1047R mutant selective small molecule leads, an encoded library technology (ELT) campaign against the desired target proteins was performed which led to the discovery of a selective chemotype for PI3K isoforms from a three-cycle DNA encoded library. An X-ray crystal structure of a representative inhibitor from this chemotype demonstrated a unique binding mode in the p110α protein.

Discovery of a Potent Class of PI3Kα Inhibitors with Unique Binding Mode via Encoded Library Technology (ELT)

PubMed Central

2015-01-01

In the search of PI3K p110α wild type and H1047R mutant selective small molecule leads, an encoded library technology (ELT) campaign against the desired target proteins was performed which led to the discovery of a selective chemotype for PI3K isoforms from a three-cycle DNA encoded library. An X-ray crystal structure of a representative inhibitor from this chemotype demonstrated a unique binding mode in the p110α protein. PMID:26005528

Activation of WIP1 Phosphatase by HTLV-1 Tax Mitigates the Cellular Response to DNA Damage

PubMed Central

Dayaram, Tajhal; Lemoine, Francene J.; Donehower, Lawrence A.; Marriott, Susan J.

2013-01-01

Genomic instability stemming from dysregulation of cell cycle checkpoints and DNA damage response (DDR) is a common feature of many cancers. The cancer adult T cell leukemia (ATL) can occur in individuals infected with human T cell leukemia virus type 1 (HTLV-1), and ATL cells contain extensive chromosomal abnormalities, suggesting that they have defects in the recognition or repair of DNA damage. Since Tax is the transforming protein encoded by HTLV-1, we asked whether Tax can affect cell cycle checkpoints and the DDR. Using a combination of flow cytometry and DNA repair assays we showed that Tax-expressing cells exit G1 phase and initiate DNA replication prematurely following damage. Reduced phosphorylation of H2AX (γH2AX) and RPA2, phosphoproteins that are essential to properly initiate the DDR, was also observed in Tax-expressing cells. To determine the cause of decreased DDR protein phosphorylation in Tax-expressing cells, we examined the cellular phosphatase, WIP1, which is known to dephosphorylate γH2AX. We found that Tax can interact with Wip1 in vivo and in vitro, and that Tax-expressing cells display elevated levels of Wip1 mRNA. In vitro phosphatase assays showed that Tax can enhance Wip1 activity on a γH2AX peptide target by 2-fold. Thus, loss of γH2AX in vivo could be due, in part, to increased expression and activity of WIP1 in the presence of Tax. siRNA knockdown of WIP1 in Tax-expressing cells rescued γH2AX in response to damage, confirming the role of WIP1 in the DDR. These studies demonstrate that Tax can disengage the G1/S checkpoint by enhancing WIP1 activity, resulting in reduced DDR. Premature G1 exit of Tax-expressing cells in the presence of DNA lesions creates an environment that tolerates incorporation of random mutations into the host genome. PMID:23405243

BM61 of Bombyx mori nucleopolyhedrovirus: its involvement in the egress of nucleocapsids from the nucleus.

PubMed

Shen, Hongxing; Chen, Keping

2012-04-05

All lepidopteran baculovirus genomes sequenced encode a homolog of the Bombyx mori nucleopolyhedrovirus orf61 gene (Bm61). To determine the role of Bm61 in the baculoviral life cycle, we constructed a Bm61 knockout virus and characterized it in cells. We observed that the Bm61 deletion bacmid led to a defect in production of infectious budded virus (BV). Quantitative PCR analysis of BV in the media culturing the transfected cell indicated that BV was not produced due to Bm61 deletion. Electron microscope analysis showed that in the knockout of Bm61, nucleocapsids were not transported from the nucleus to the cytoplasm. From these results we concluded that BM61 is required in the BV pathway for the egress of nucleocapsids from the nucleus to the cytoplasm. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Nucleic Acid Encoding A Lectin-Derived Progenitor Cell Preservation Factor

DOEpatents

Colucci, M. Gabriella; Chrispeels, Maarten J.; Moore, Jeffrey G.

2001-10-30

The invention relates to an isolated nucleic acid molecule that encodes a protein that is effective to preserve progenitor cells, such as hematopoietic progenitor cells. The nucleic acid comprises a sequence defined by SEQ ID NO:1, a homolog thereof, or a fragment thereof. The encoded protein has an amino acid sequence that comprises a sequence defined by SEQ ID NO:2, a homolog thereof, or a fragment thereof that contains an amino acid sequence TNNVLQVT. Methods of using the encoded protein for preserving progenitor cells in vitro, ex vivo, and in vivo are also described. The invention, therefore, include methods such as myeloablation therapies for cancer treatment wherein myeloid reconstitution is facilitated by means of the specified protein. Other therapeutic utilities are also enabled through the invention, for example, expanding progenitor cell populations ex vivo to increase chances of engraftation, improving conditions for transporting and storing progenitor cells, and facilitating gene therapy to treat and cure a broad range of life-threatening hematologic diseases.

Viruses and miRNAs: More Friends than Foes.

PubMed

Bruscella, Patrice; Bottini, Silvia; Baudesson, Camille; Pawlotsky, Jean-Michel; Feray, Cyrille; Trabucchi, Michele

2017-01-01

There is evidence that eukaryotic miRNAs (hereafter called host miRNAs) play a role in the replication and propagation of viruses. Expression or targeting of host miRNAs can be involved in cellular antiviral responses. Most times host miRNAs play a role in viral life-cycles and promote infection through complex regulatory pathways. miRNAs can also be encoded by a viral genome and be expressed in the host cell. Viral miRNAs can share common sequences with host miRNAs or have totally different sequences. They can regulate a variety of biological processes involved in viral infection, including apoptosis, evasion of the immune response, or modulation of viral life-cycle phases. Overall, virus/miRNA pathway interaction is defined by a plethora of complex mechanisms, though not yet fully understood. This article review summarizes recent advances and novel biological concepts related to the understanding of miRNA expression, control and function during viral infections. The article also discusses potential therapeutic applications of this particular host-pathogen interaction.

Viruses and miRNAs: More Friends than Foes

PubMed Central

Bruscella, Patrice; Bottini, Silvia; Baudesson, Camille; Pawlotsky, Jean-Michel; Feray, Cyrille; Trabucchi, Michele

2017-01-01

There is evidence that eukaryotic miRNAs (hereafter called host miRNAs) play a role in the replication and propagation of viruses. Expression or targeting of host miRNAs can be involved in cellular antiviral responses. Most times host miRNAs play a role in viral life-cycles and promote infection through complex regulatory pathways. miRNAs can also be encoded by a viral genome and be expressed in the host cell. Viral miRNAs can share common sequences with host miRNAs or have totally different sequences. They can regulate a variety of biological processes involved in viral infection, including apoptosis, evasion of the immune response, or modulation of viral life-cycle phases. Overall, virus/miRNA pathway interaction is defined by a plethora of complex mechanisms, though not yet fully understood. This article review summarizes recent advances and novel biological concepts related to the understanding of miRNA expression, control and function during viral infections. The article also discusses potential therapeutic applications of this particular host–pathogen interaction. PMID:28555130

Bm65 is essential for the propagation of Bombyx mori nucleopolyhedrovirus.

PubMed

Tang, Qi; Li, Guohui; Yao, Qin; Chen, Liang; Feng, Fan; Yuan, Yi; Chen, Keping

2013-01-01

Orf65 (Bm65) of Bombyx mori nucleopolyhedrovirus (BmNPV) is a highly conserved gene that encodes an unknown 104-amino acid protein. In the present study, we have shown the role of Bm65 in the baculovirus life cycle. 5'-RACE analysis showed that the transcription start site of Bm65 was 14 nucleotides upstream of the start codon ATG. The transcription profile of Bm65 was detected from 6 to 72 h postinfection (p. i.) by RT-PCR. A Bm65-knockout bacmid was constructed by homologous recombination to characterize the role of Bm65 in viral life cycle. Fluorescence microscopy showed that Bm65-knockout virus was unable to generate infectious budded virus in BmN cells. Furthermore, quantitative real-time PCR analysis demonstrated that Bm65 deletion did not affect the viral DNA replication. To conclude, Bm65 is essential for the propagation of BmNPV, but is unnecessary for the replication of viral DNA.

Prevention of the neurocristopathy Treacher Collins syndrome through inhibition of p53 function

PubMed Central

Jones, Natalie C; Lynn, Megan L; Gaudenz, Karin; Sakai, Daisuke; Aoto, Kazushi; Rey, Jean-Phillipe; Glynn, Earl F; Ellington, Lacey; Du, Chunying; Dixon, Jill; Dixon, Michael J; Trainor, Paul A

2010-01-01

Treacher Collins syndrome (TCS) is a congenital disorder of craniofacial development arising from mutations in TCOF1, which encodes the nucleolar phosphoprotein Treacle. Haploinsufficiency of Tcof1 perturbs mature ribosome biogenesis, resulting in stabilization of p53 and the cyclin G1–mediated cell-cycle arrest that underpins the specificity of neuroepithelial apoptosis and neural crest cell hypoplasia characteristic of TCS. Here we show that inhibition of p53 prevents cyclin G1–driven apoptotic elimination of neural crest cells while rescuing the craniofacial abnormalities associated with mutations in Tcof1 and extending life span. These improvements, however, occur independently of the effects on ribosome biogenesis; thus suggesting that it is p53-dependent neuroepithelial apoptosis that is the primary mechanism underlying the pathogenesis of TCS. Our work further implies that neuroepithelial and neural crest cells are particularly sensitive to cellular stress during embryogenesis and that suppression of p53 function provides an attractive avenue for possible clinical prevention of TCS craniofacial birth defects and possibly those of other neurocristopathies. PMID:18246078

Meta-omic signatures of microbial metal and nitrogen cycling in marine oxygen minimum zones

PubMed Central

Glass, Jennifer B.; Kretz, Cecilia B.; Ganesh, Sangita; Ranjan, Piyush; Seston, Sherry L.; Buck, Kristen N.; Landing, William M.; Morton, Peter L.; Moffett, James W.; Giovannoni, Stephen J.; Vergin, Kevin L.; Stewart, Frank J.

2015-01-01

Iron (Fe) and copper (Cu) are essential cofactors for microbial metalloenzymes, but little is known about the metalloenyzme inventory of anaerobic marine microbial communities despite their importance to the nitrogen cycle. We compared dissolved O2, NO3−, NO2−, Fe and Cu concentrations with nucleic acid sequences encoding Fe and Cu-binding proteins in 21 metagenomes and 9 metatranscriptomes from Eastern Tropical North and South Pacific oxygen minimum zones and 7 metagenomes from the Bermuda Atlantic Time-series Station. Dissolved Fe concentrations increased sharply at upper oxic-anoxic transition zones, with the highest Fe:Cu molar ratio (1.8) occurring at the anoxic core of the Eastern Tropical North Pacific oxygen minimum zone and matching the predicted maximum ratio based on data from diverse ocean sites. The relative abundance of genes encoding Fe-binding proteins was negatively correlated with O2, driven by significant increases in genes encoding Fe-proteins involved in dissimilatory nitrogen metabolisms under anoxia. Transcripts encoding cytochrome c oxidase, the Fe- and Cu-containing terminal reductase in aerobic respiration, were positively correlated with O2 content. A comparison of the taxonomy of genes encoding Fe- and Cu-binding vs. bulk proteins in OMZs revealed that Planctomycetes represented a higher percentage of Fe genes while Thaumarchaeota represented a higher percentage of Cu genes, particularly at oxyclines. These results are broadly consistent with higher relative abundance of genes encoding Fe-proteins in the genome of a marine planctomycete vs. higher relative abundance of genes encoding Cu-proteins in the genome of a marine thaumarchaeote. These findings highlight the importance of metalloenzymes for microbial processes in oxygen minimum zones and suggest preferential Cu use in oxic habitats with Cu > Fe vs. preferential Fe use in anoxic niches with Fe > Cu. PMID:26441925

Meta-omic signatures of microbial metal and nitrogen cycling in marine oxygen minimum zones.

PubMed

Glass, Jennifer B; Kretz, Cecilia B; Ganesh, Sangita; Ranjan, Piyush; Seston, Sherry L; Buck, Kristen N; Landing, William M; Morton, Peter L; Moffett, James W; Giovannoni, Stephen J; Vergin, Kevin L; Stewart, Frank J

2015-01-01

Iron (Fe) and copper (Cu) are essential cofactors for microbial metalloenzymes, but little is known about the metalloenyzme inventory of anaerobic marine microbial communities despite their importance to the nitrogen cycle. We compared dissolved O2, NO[Formula: see text], NO[Formula: see text], Fe and Cu concentrations with nucleic acid sequences encoding Fe and Cu-binding proteins in 21 metagenomes and 9 metatranscriptomes from Eastern Tropical North and South Pacific oxygen minimum zones and 7 metagenomes from the Bermuda Atlantic Time-series Station. Dissolved Fe concentrations increased sharply at upper oxic-anoxic transition zones, with the highest Fe:Cu molar ratio (1.8) occurring at the anoxic core of the Eastern Tropical North Pacific oxygen minimum zone and matching the predicted maximum ratio based on data from diverse ocean sites. The relative abundance of genes encoding Fe-binding proteins was negatively correlated with O2, driven by significant increases in genes encoding Fe-proteins involved in dissimilatory nitrogen metabolisms under anoxia. Transcripts encoding cytochrome c oxidase, the Fe- and Cu-containing terminal reductase in aerobic respiration, were positively correlated with O2 content. A comparison of the taxonomy of genes encoding Fe- and Cu-binding vs. bulk proteins in OMZs revealed that Planctomycetes represented a higher percentage of Fe genes while Thaumarchaeota represented a higher percentage of Cu genes, particularly at oxyclines. These results are broadly consistent with higher relative abundance of genes encoding Fe-proteins in the genome of a marine planctomycete vs. higher relative abundance of genes encoding Cu-proteins in the genome of a marine thaumarchaeote. These findings highlight the importance of metalloenzymes for microbial processes in oxygen minimum zones and suggest preferential Cu use in oxic habitats with Cu > Fe vs. preferential Fe use in anoxic niches with Fe > Cu.

A short synthetic peptide fragment of human C2ORF40 has therapeutic potential in breast cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Chaoyang; Zhang, Pengju; Jiang, Anli

C2ORF40 encodes a secreted protein which is cleaved to generate soluble peptides by proteolytic processing and this process is believed to be necessary for C2ORF40 to exert cell type specific biological activity. Here, we reported a short mimic peptide of human C2ORF40 acts potential therapeutic efficacy in human cancer cells in vitro and in vivo. We synthesized a short peptide of human C2ORF40, named C2ORF40 mimic peptide fragment and assessed its biological function on cancer cell growth, migration and tumorigenesis. Cell growth assay showed that C2ORF40 mimic peptide fragment significantly suppressed cell proliferation of breast and lung cancer cells. Moreover,more » C2ORF40 mimic peptide fragment significantly inhibited the migration and invasion of breast cancer cells. Furthermore, we showed that this peptide suppressed tumorigenesis in breast tumor xenograft model. Cell cycle assay indicated that the C2ORF40 mimic peptide fragment suppressed the growth of tumor cells through inducing mitotic phase arrest. In conclusion, our results firstly suggested that this short synthetic peptide of human C2ORF40 may be a candidate tumor therapeutic agent.« less

Solving the influence maximization problem reveals regulatory organization of the yeast cell cycle.

PubMed

Gibbs, David L; Shmulevich, Ilya

2017-06-01

The Influence Maximization Problem (IMP) aims to discover the set of nodes with the greatest influence on network dynamics. The problem has previously been applied in epidemiology and social network analysis. Here, we demonstrate the application to cell cycle regulatory network analysis for Saccharomyces cerevisiae. Fundamentally, gene regulation is linked to the flow of information. Therefore, our implementation of the IMP was framed as an information theoretic problem using network diffusion. Utilizing more than 26,000 regulatory edges from YeastMine, gene expression dynamics were encoded as edge weights using time lagged transfer entropy, a method for quantifying information transfer between variables. By picking a set of source nodes, a diffusion process covers a portion of the network. The size of the network cover relates to the influence of the source nodes. The set of nodes that maximizes influence is the solution to the IMP. By solving the IMP over different numbers of source nodes, an influence ranking on genes was produced. The influence ranking was compared to other metrics of network centrality. Although the top genes from each centrality ranking contained well-known cell cycle regulators, there was little agreement and no clear winner. However, it was found that influential genes tend to directly regulate or sit upstream of genes ranked by other centrality measures. The influential nodes act as critical sources of information flow, potentially having a large impact on the state of the network. Biological events that affect influential nodes and thereby affect information flow could have a strong effect on network dynamics, potentially leading to disease. Code and data can be found at: https://github.com/gibbsdavidl/miergolf.

Characterisation of single domain ATP-binding cassette protien homologues of Theileria parva.

PubMed

Kibe, M K; Macklin, M; Gobright, E; Bishop, R; Urakawa, T; ole-MoiYoi, O K

2001-09-01

Two distinct genes encoding single domain, ATP-binding cassette transport protein homologues of Theileria parva were cloned and sequenced. Neither of the genes is tandemly duplicated. One gene, TpABC1, encodes a predicted protein of 593 amino acids with an N-terminal hydrophobic domain containing six potential membrane-spanning segments. A single discontinuous ATP-binding element was located in the C-terminal region of TpABC1. The second gene, TpABC2, also contains a single C-terminal ATP-binding motif. Copies of TpABC2 were present at four loci in the T. parva genome on three different chromosomes. TpABC1 exhibited allelic polymorphism between stocks of the parasite. Comparison of cDNA and genomic sequences revealed that TpABC1 contained seven short introns, between 29 and 84 bp in length. The full-length TpABC1 protein was expressed in insect cells using the baculovirus system. Application of antibodies raised against the recombinant antigen to western blots of T. parva piroplasm lysates detected an 85 kDa protein in this life-cycle stage.

Mitoregulin: A lncRNA-Encoded Microprotein that Supports Mitochondrial Supercomplexes and Respiratory Efficiency.

PubMed

Stein, Colleen S; Jadiya, Pooja; Zhang, Xiaoming; McLendon, Jared M; Abouassaly, Gabrielle M; Witmer, Nathan H; Anderson, Ethan J; Elrod, John W; Boudreau, Ryan L

2018-06-26

Mitochondria are composed of many small proteins that control protein synthesis, complex assembly, metabolism, and ion and reactive oxygen species (ROS) handling. We show that a skeletal muscle- and heart-enriched long non-coding RNA, LINC00116, encodes a highly conserved 56-amino-acid microprotein that we named mitoregulin (Mtln). Mtln localizes to the inner mitochondrial membrane, where it binds cardiolipin and influences protein complex assembly. In cultured cells, Mtln overexpression increases mitochondrial membrane potential, respiration rates, and Ca 2+ retention capacity while decreasing mitochondrial ROS and matrix-free Ca 2+ . Mtln-knockout mice display perturbations in mitochondrial respiratory (super)complex formation and activity, fatty acid oxidation, tricarboxylic acid (TCA) cycle enzymes, and Ca 2+ retention capacity. Blue-native gel electrophoresis revealed that Mtln co-migrates alongside several complexes, including the complex I assembly module, complex V, and supercomplexes. Under denaturing conditions, Mtln remains in high-molecular-weight complexes, supporting its role as a sticky molecular tether that enhances respiratory efficiency by bolstering protein complex assembly and/or stability. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

The heterologous expression of a chrysanthemum TCP-P transcription factor CmTCP14 suppresses organ size and delays senescence in Arabidopsis thaliana.

PubMed

Zhang, Ting; Qu, Yixin; Wang, Haibin; Wang, Jingjing; Song, Aiping; Hu, Yueheng; Chen, Sumei; Jiang, Jiafu; Chen, Fadi

2017-06-01

TCP transcription factors are important for plant growth and development, but their activity in chrysanthemum (Chrysanthemum morifolium) has not been thoroughly explored. Here, a chrysanthemum TCP-P sequence, which encodes a protein harboring the conserved basic helix-loop-helix (bHLH) motif, was shown to be related phylogenetically to the Arabidopsis thaliana gene AtTCP14. A yeast-one hybrid assay showed that the encoding protein had no transcriptional activation ability, and a localization experiment indicated that it was localized in the nucleus. Transcription profiling established that the gene was most active in the stem and leaf. Its heterologous expression in A. thaliana down-regulated certain cell cycle-related genes, reduced the size of various organs and increased the chlorophyll and carotenoid contents of the leaf which led to delayed senescence and a prolonged flowering period. Moreover, by screening the cDNA library of chrysanthemum, we found that the CmTCP14 can interact with CmFTL2 and some CmDELLAs. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Human cytomegalovirus inhibits antigen presentation by a sequential multistep process.

PubMed Central

Ahn, K; Angulo, A; Ghazal, P; Peterson, P A; Yang, Y; Früh, K

1996-01-01

The human cytomegalovirus (HCMV) genomic unique short (US) region encodes a family of homologous genes essential for the inhibition of major histocompatibility complex (MHC) class I-mediated antigen presentation during viral infection. Here we show that US3, the only immediate early (IE) gene within the US region, encodes an endoplasmic reticulum-resident glycoprotein that prevents intracellular transport of MHC class I molecules. In contrast to the rapid degradation of newly synthesized MHC class I heavy chains mediated by the early gene product US11, we found that US3 retains stable MHC class I heterodimers in the endoplasmic reticulum that are loaded with peptides while retained in the ER. Consistent with the expression pattern of US3 and US11, MHC class I molecules are retained but not degraded during the IE period of infection. Our data identify the first nonregulatory role of an IE protein of HCMV and suggest that HCMV uses different T-cell escape strategies at different times during the infectious cycle. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8855296

Mutations in ORC1, encoding the largest subunit of the origin recognition complex, cause microcephalic primordial dwarfism resembling Meier-Gorlin syndrome.

PubMed

Bicknell, Louise S; Walker, Sarah; Klingseisen, Anna; Stiff, Tom; Leitch, Andrea; Kerzendorfer, Claudia; Martin, Carol-Anne; Yeyati, Patricia; Al Sanna, Nouriya; Bober, Michael; Johnson, Diana; Wise, Carol; Jackson, Andrew P; O'Driscoll, Mark; Jeggo, Penny A

2011-02-27

Studies into disorders of extreme growth failure (for example, Seckel syndrome and Majewski osteodysplastic primordial dwarfism type II) have implicated fundamental cellular processes of DNA damage response signaling and centrosome function in the regulation of human growth. Here we report that mutations in ORC1, encoding a subunit of the origin recognition complex, cause microcephalic primordial dwarfism resembling Meier-Gorlin syndrome. We establish that these mutations disrupt known ORC1 functions including pre-replicative complex formation and origin activation. ORC1 deficiency perturbs S-phase entry and S-phase progression. Additionally, we show that Orc1 depletion in zebrafish is sufficient to markedly reduce body size during rapid embryonic growth. Our data suggest a model in which ORC1 mutations impair replication licensing, slowing cell cycle progression and consequently impeding growth during development, particularly at times of rapid proliferation. These findings establish a novel mechanism for the pathogenesis of microcephalic dwarfism and show a surprising but important developmental impact of impaired origin licensing.

Gardenia jasminoides Encodes an Inhibitor-2 Protein for Protein Phosphatase Type 1

NASA Astrophysics Data System (ADS)

Gao, Lan; Li, Hao-Ming

2017-08-01

Protein phosphatase-1 (PP1) regulates diverse, essential cellular processes such as cell cycle progression, protein synthesis, muscle contraction, carbohydrate metabolism, transcription and neuronal signaling. Inhibitor-2 (I-2) can inhibit the activity of PP1 and has been found in diverse organisms. In this work, a Gardenia jasminoides fruit cDNA library was constructed, and the GjI-2 cDNA was isolated from the cDNA library by sequencing method. The GjI-2 cDNA contains a predicted 543 bp open reading frame that encodes 180 amino acids. The bioinformatics analysis suggested that the GjI-2 has conserved PP1c binding motif, and contains a conserved phosphorylation site, which is important in regulation of its activity. The three-dimensional model structure of GjI-2 was buite, its similar with the structure of I-2 from mouse. The results suggest that GjI-2 has relatively conserved RVxF, FxxR/KxR/K and HYNE motif, and these motifs are involved in interaction with PP1.

OXP1/YKL215c encodes an ATP-dependent 5-oxoprolinase in Saccharomyces cerevisiae: functional characterization, domain structure and identification of actin-like ATP-binding motifs in eukaryotic 5-oxoprolinases.

PubMed

Kumar, Akhilesh; Bachhawat, Anand Kumar

2010-06-01

OXP1/YKL215c, an uncharacterized ORF of Saccharomyces cerevisiae, encodes a functional ATP-dependent 5-oxoprolinase of 1286 amino acids. The yeast 5-oxoprolinase activity was demonstrated in vivo by utilization of 5-oxoproline as a source of glutamate and OTC, a 5-oxoproline sulfur analogue, as a source of sulfur in cells overexpressing OXP1. In vitro characterization by expression and purification of the recombinant protein in S. cerevisiae revealed that the enzyme exists and functions as a dimer, and has a K(m) of 159 microM and a V(max) of 3.5 nmol h(-1) microg(-1) protein. The enzyme was found to be functionally separable in two distinct domains. An 'actin-like ATPase motif' could be identified in 5-oxprolinases, and mutation of key residues within this motif led to complete loss in ATPase and 5-oxoprolinase activity of the enzyme. The results are discussed in the light of the previously postulated truncated gamma-glutamyl cycle of yeasts.

Molecular cloning, structural analysis, and expression of a human IRLB, MYC promoter-binding protein: new DENN domain-containing protein family emerges.

PubMed

Semova, Natalia; Kapanadze, Bagrat; Corcoran, Martin; Kutsenko, Alexei; Baranova, Ancha; Semov, Alexandre

2003-09-01

IRLB was originally identified as a partial cDNA clone, encoding a 191-aa protein binding the interferon-stimulated response element (ISRE) in the P2 promoter of human MYC. Here, we cloned the full-size IRLB using different bioinformatics tools and an RT-PCR approach. The full-size gene encompasses 131 kb within chromosome 15q22 and consists of 32 exons. IRLB is transcribed as a 6.6-kb mRNA encoding a protein of 1865 aa. IRLB is ubiquitously expressed and its expression is regulated in a growth- and cell cycle-dependent manner. In addition to the ISRE-binding domain IRLB contains a tripartite DENN domain, a nuclear localization signal, two PPRs, and a calmodulin-binding domain. The presence of DENN domains predicts possible interactions of IRLB with GTPases from the Rab family or regulation of growth-induced MAPKs. Strongly homologous proteins were identified in all available vertebrate genomes as well as in Caenorhabditis elegans and Drosophila melanogaster. In human and mouse a family of IRLB proteins exists, consisting of at least three members.

Interactome analysis of the lymphocytic choriomeningitis virus nucleoprotein in infected cells reveals ATPase Na+/K+ transporting subunit Alpha 1 and prohibitin as host-cell factors involved in the life cycle of mammarenaviruses

PubMed Central

Iwasaki, Masaharu; Caì, Yíngyún; de la Torre, Juan C.

2018-01-01

Several mammalian arenaviruses (mammarenaviruses) cause hemorrhagic fevers in humans and pose serious public health concerns in their endemic regions. Additionally, mounting evidence indicates that the worldwide-distributed, prototypic mammarenavirus, lymphocytic choriomeningitis virus (LCMV), is a neglected human pathogen of clinical significance. Concerns about human-pathogenic mammarenaviruses are exacerbated by of the lack of licensed vaccines, and current anti-mammarenavirus therapy is limited to off-label use of ribavirin that is only partially effective. Detailed understanding of virus/host-cell interactions may facilitate the development of novel anti-mammarenavirus strategies by targeting components of the host-cell machinery that are required for efficient virus multiplication. Here we document the generation of a recombinant LCMV encoding a nucleoprotein (NP) containing an affinity tag (rLCMV/Strep-NP) and its use to capture the NP-interactome in infected cells. Our proteomic approach combined with genetics and pharmacological validation assays identified ATPase Na+/K+ transporting subunit alpha 1 (ATP1A1) and prohibitin (PHB) as pro-viral factors. Cell-based assays revealed that ATP1A1 and PHB are involved in different steps of the virus life cycle. Accordingly, we observed a synergistic inhibitory effect on LCMV multiplication with a combination of ATP1A1 and PHB inhibitors. We show that ATP1A1 inhibitors suppress multiplication of Lassa virus and Candid#1, a live-attenuated vaccine strain of Junín virus, suggesting that the requirement of ATP1A1 in virus multiplication is conserved among genetically distantly related mammarenaviruses. Our findings suggest that clinically approved inhibitors of ATP1A1, like digoxin, could be repurposed to treat infections by mammarenaviruses pathogenic for humans. PMID:29462184

Expression of two isoforms of CD44 in human endometrium.

PubMed

Behzad, F; Seif, M W; Campbell, S; Aplin, J D

1994-10-01

The distribution of the cell-surface adhesion glycoprotein CD44 in human endometrium was examined by immunofluorescence using six monoclonal antibodies to epitopes common to all forms of the molecule, and by reverse transcription-polymerase chain reaction (RT-PCR). Immunoreactivity was observed throughout the menstrual cycle in stroma, vessels, glandular, and luminal epithelium. Variations in staining intensity were observed, especially in the epithelial compartment. CD44 was also expressed strongly by decidualized stromal cells of first-trimester pregnancy. No systematic variation of immunoreactivity was observed with stages of the normal cycle, but a fraction (25%) of the specimens lacked reactivity in the epithelium. To determine the molecular size of the epithelial isoform, an immunoprecipitation technique was developed using surface-radioiodinated, detergent-extracted glands. This indicated the presence at the cell surface of a single dominant CD44E species with an approximate molecular mass of 130 kDa. RT-PCR was used to investigate the isoforms present in whole endometrial tissue, isolated gland fragments, and Ishikawa endometrial carcinoma cells. Complementary DNA produced from total endometrial mRNA was PCR-amplified across the splice junction between exons 5 and 15. Transcripts corresponding to the hyaluronate receptor CD44H as well as a larger isoform were identified. CD44H was absent, or very scarce, in cDNA from purified gland epithelium. In contrast, Ishikawa cells expressed this form abundantly. The glands and Ishikawa cells also expressed CD44E containing sequences encoded by exons 12, 13, and 14. These data demonstrate the presence of CD44 in human endometrium and decidua, and show that different isoforms of CD44 are associated with tissue compartments in which different functional roles can be anticipated.

S6K links cell fate, cell cycle and nutrient response in C. elegans germline stem/progenitor cells

PubMed Central

Korta, Dorota Z.; Tuck, Simon; Hubbard, E. Jane Albert

2012-01-01

Coupling of stem/progenitor cell proliferation and differentiation to organismal physiological demands ensures the proper growth and homeostasis of tissues. However, in vivo mechanisms underlying this control are poorly characterized. We investigated the role of ribosomal protein S6 kinase (S6K) at the intersection of nutrition and the establishment of a stem/progenitor cell population using the C. elegans germ line as a model. We find that rsks-1 (which encodes the worm homolog of mammalian p70S6K) is required germline-autonomously for proper establishment of the germline progenitor pool. In the germ line, rsks-1 promotes cell cycle progression and inhibits larval progenitor differentiation, promotes growth of adult tumors and requires a conserved TOR phosphorylation site. Loss of rsks-1 and ife-1 (eIF4E) together reduces the germline progenitor pool more severely than either single mutant and similarly to reducing the activity of let-363 (TOR) or daf-15 (RAPTOR). Moreover, rsks-1 acts in parallel with the glp-1 (Notch) and daf-2 (insulin-IGF receptor) pathways, and does not share the same genetic dependencies with its role in lifespan control. We show that overall dietary restriction and amino acid deprivation cause germline defects similar to a subset of rsks-1 mutant phenotypes. Consistent with a link between diet and germline proliferation via rsks-1, loss of rsks-1 renders the germ line largely insensitive to the effects of dietary restriction. Our studies establish the C. elegans germ line as an in vivo model to understand TOR-S6K signaling in proliferation and differentiation and suggest that this pathway is a key nutrient-responsive regulator of germline progenitors. PMID:22278922

mei-41 and bub1 block mitosis at two distinct steps in response to incomplete DNA replication in Drosophila embryos.

PubMed

Garner, M; van Kreeveld, S; Su, T T

2001-10-16

Drosophila double park encodes a homolog of Cdt1 that functions in initiation of DNA replication in fission yeast and Xenopus. dup mutants complete the first 15 embryonic cell cycles, presumably via maternal dup products, and show defects in the 16(th) S phase (S16). Cells carrying dup(a1) allele forgo S16 altogether but enter mitosis 16 (M16). We find that the timing of entry into M16 is similar in dup(a1) and heterozygous or wild-type (wt) controls. In contrast, we find that mutant cells carrying another allele, dup(a3), undergo a partial S16 and delay the entry into M16. Thus, initiation of S16 appears necessary for delaying M16. This delay is absent in double mutants of dup(a3) and mei-41 (Drosophila ATR), indicating that a mei-41-dependent checkpoint acts to delay the entry into mitosis in response to incomplete DNA replication. dup(a3) and dup(a1) mutant cells that enter M16 become arrested in M16. We find that mitotic cyclins are stabilized and that a spindle checkpoint protein, Bub1, localizes onto chromosomes during mitotic arrest in dup mutants. These features suggest an arrest prior to metaphase-anaphase transition. dup(a3) bub1 double mutant cells exit M16, indicating that a bub1-mediated checkpoint acts to block mitotic exit in dup mutants. To our knowledge, this is the first report of (1) incomplete DNA replication affecting both the entry into and the exit from mitosis in a single cell cycle via different mechanisms and (2) the role of bub1 in regulating mitotic exit in response to incomplete DNA replication.

Identification and molecular characterization of the Choristoneura fumiferana multicapsid nucleopolyhedrovirus genomic region encoding the regulatory genes pkip, p47, lef-12, and gta.

PubMed

Lapointe, R; Back, D W; Ding, Q; Carstens, E B

2000-05-25

Choristoneura fumiferana multicapsid nucleopolyhedrovirus (CfMNPV) is a baculovirus pathogenic to spruce budworm, the most damaging insect pest in Canadian forestry. CfMNPV is less virulent to its host insect and its replication cycle is slower than the baculovirus type species Autographa californica multicapsid nucleopolyhedrovirus (AcMNPV) but the basis of these characteristics is not known. We have now identified, localized, and determined the sequence of the region of CfMNPV carrying potentially important regulatory genes including p47, lef-12, gta, and pkip. DNA database searches revealed that this region of CfMNPV is most closely related to the homologous OpMNPV genes. Transcription analysis demonstrated that CfMNPV P47 is encoded by a 1.6-kb transcript, LEF-12 is encoded by a 2.6-kb transcript, and GTA is encoded by a 2.1-kb transcript. Transcripts for these genes were detectable at 6 h postinfection but all of them showed a burst in expression levels between 12 and 24 h postinfection corresponding to the time of initiation of CfMNPV DNA replication. A polyclonal antibody, raised against CfMNPV P47, detected a nuclear 43-kDa polypeptide from 12 to 72 h postinfection, demonstrating that the CfMNPV p47 gene product is first expressed at a time corresponding to the burst of transcriptional activity between the early and the late phases. Both AcMNPV and CfMNPV P47 translocate to the nucleus of infected cells. Copyright 2000 Academic Press.

The Bean pod mottle virus RNA2-encoded 58-kilodalton protein P58 is required in cis for RNA2 accumulation

USDA-ARS?s Scientific Manuscript database

Bean pod mottle virus (BPMV) is a bipartite, positive sense (+) RNA plant virus in the Secoviridae family. Its RNA1 encodes proteins required for genome replication, whereas RNA2 primarily encodes proteins needed for virion assembly and cell-to-cell movement. However, the function of a 58 kilo-dalto...

Inactivation of Phaeodactylum tricornutum urease gene using transcription activator-like effector nuclease-based targeted mutagenesis

DOE PAGES

Weyman, Philip D.; Beeri, Karen; Lefebvre, Stephane C.; ...

2014-10-10

Diatoms are unicellular photosynthetic algae with promise for green production of fuels and other chemicals. Recent genome-editing techniques have greatly improved the potential of many eukaryotic genetic systems, including diatoms, to enable knowledge-based studies and bioengineering. Using a new technique, transcription activator-like effector nucleases (TALENs), the gene encoding the urease enzyme in the model diatom, Phaeodactylum tricornutum, was targeted for interruption. The knockout cassette was identified within the urease gene by PCR and Southern blot analyses of genomic DNA. The lack of urease protein was confirmed by Western blot analyses in mutant cell lines that were unable to grow onmore » urea as the sole nitrogen source. Untargeted metabolomic analysis revealed a build-up of urea, arginine and ornithine in the urease knockout lines. All three intermediate metabolites are upstream of the urease reaction within the urea cycle, suggesting a disruption of the cycle despite urea production. Numerous high carbon metabolites were enriched in the mutant, implying a breakdown of cellular C and N repartitioning. The presented method improves the molecular toolkit for diatoms and clarifies the role of urease in the urea cycle.« less

Systems Approaches to Predict the Functions of Glycoside Hydrolases during the Life Cycle of Aspergillus niger Using Developmental Mutants ∆brlA and ∆flbA

PubMed Central

van Munster, Jolanda M.; Nitsche, Benjamin M.; Akeroyd, Michiel; Dijkhuizen, Lubbert; van der Maarel, Marc J. E. C.; Ram, Arthur F. J.

2015-01-01

Background The filamentous fungus Aspergillus niger encounters carbon starvation in nature as well as during industrial fermentations. In response, regulatory networks initiate and control autolysis and sporulation. Carbohydrate-active enzymes play an important role in these processes, for example by modifying cell walls during spore cell wall biogenesis or in cell wall degradation connected to autolysis. Results In this study, we used developmental mutants (ΔflbA and ΔbrlA) which are characterized by an aconidial phenotype when grown on a plate, but also in bioreactor-controlled submerged cultivations during carbon starvation. By comparing the transcriptomes, proteomes, enzyme activities and the fungal cell wall compositions of a wild type A. niger strain and these developmental mutants during carbon starvation, a global overview of the function of carbohydrate-active enzymes is provided. Seven genes encoding carbohydrate-active enzymes, including cfcA, were expressed during starvation in all strains; they may encode enzymes involved in cell wall recycling. Genes expressed in the wild-type during starvation, but not in the developmental mutants are likely involved in conidiogenesis. Eighteen of such genes were identified, including characterized sporulation-specific chitinases and An15g02350, member of the recently identified carbohydrate-active enzyme family AA11. Eight of the eighteen genes were also expressed, independent of FlbA or BrlA, in vegetative mycelium, indicating that they also have a role during vegetative growth. The ΔflbA strain had a reduced specific growth rate, an increased chitin content of the cell wall and specific expression of genes that are induced in response to cell wall stress, indicating that integrity of the cell wall of strain ΔflbA is reduced. Conclusion The combination of the developmental mutants ΔflbA and ΔbrlA resulted in the identification of enzymes involved in cell wall recycling and sporulation-specific cell wall modification, which contributes to understanding cell wall remodeling mechanisms during development. PMID:25629352

Characterization of Sinorhizobium sp. LM21 Prophages and Virus-Encoded DNA Methyltransferases in the Light of Comparative Genomic Analyses of the Sinorhizobial Virome

PubMed Central

Decewicz, Przemyslaw; Radlinska, Monika; Dziewit, Lukasz

2017-01-01

The genus Sinorhizobium/Ensifer mostly groups nitrogen-fixing bacteria that create root or stem nodules on leguminous plants and transform atmospheric nitrogen into ammonia, which improves the productivity of the plants. Although these biotechnologically-important bacteria are commonly found in various soil environments, little is known about their phages. In this study, the genome of Sinorhizobium sp. LM21 isolated from a heavy-metal-contaminated copper mine in Poland was investigated for the presence of prophages and DNA methyltransferase-encoding genes. In addition to the previously identified temperate phage, ΦLM21, and the phage-plasmid, pLM21S1, the analysis revealed the presence of three prophage regions. Moreover, four novel phage-encoded DNA methyltransferase (MTase) genes were identified and the enzymes were characterized. It was shown that two of the identified viral MTases methylated the same target sequence (GANTC) as cell cycle-regulated methyltransferase (CcrM) of the bacterial host strain, LM21. This discovery was recognized as an example of the evolutionary convergence between enzymes of sinorhizobial viruses and their host, which may play an important role in virus cycle. In the last part of the study, thorough comparative analyses of 31 sinorhizobial (pro)phages (including active sinorhizobial phages and novel putative prophages retrieved and manually re-annotated from Sinorhizobium spp. genomes) were performed. The networking analysis revealed the presence of highly conserved proteins (e.g., holins and endolysins) and a high diversity of viral integrases. The analysis also revealed a large number of viral DNA MTases, whose genes were frequently located within the predicted replication modules of analyzed prophages, which may suggest their important regulatory role. Summarizing, complex analysis of the phage protein similarity network enabled a new insight into overall sinorhizobial virome diversity. PMID:28672885

Enlargement of Ribbons in Zebrafish Hair Cells Increases Calcium Currents But Disrupts Afferent Spontaneous Activity and Timing of Stimulus Onset

PubMed Central

Schreck, Mary; Petralia, Ronald S.; Wang, Ya-Xian; Zhang, Qiuxiang

2017-01-01

In sensory hair cells of auditory and vestibular organs, the ribbon synapse is required for the precise encoding of a wide range of complex stimuli. Hair cells have a unique presynaptic structure, the synaptic ribbon, which organizes both synaptic vesicles and calcium channels at the active zone. Previous work has shown that hair-cell ribbon size is correlated with differences in postsynaptic activity. However, additional variability in postsynapse size presents a challenge to determining the specific role of ribbon size in sensory encoding. To selectively assess the impact of ribbon size on synapse function, we examined hair cells in transgenic zebrafish that have enlarged ribbons, without postsynaptic alterations. Morphologically, we found that enlarged ribbons had more associated vesicles and reduced presynaptic calcium-channel clustering. Functionally, hair cells with enlarged ribbons had larger global and ribbon-localized calcium currents. Afferent neuron recordings revealed that hair cells with enlarged ribbons resulted in reduced spontaneous spike rates. Additionally, despite larger presynaptic calcium signals, we observed fewer evoked spikes with longer latencies from stimulus onset. Together, our work indicates that hair-cell ribbon size influences the spontaneous spiking and the precise encoding of stimulus onset in afferent neurons. SIGNIFICANCE STATEMENT Numerous studies support that hair-cell ribbon size corresponds with functional sensitivity differences in afferent neurons and, in the case of inner hair cells of the cochlea, vulnerability to damage from noise trauma. Yet it is unclear whether ribbon size directly influences sensory encoding. Our study reveals that ribbon enlargement results in increased ribbon-localized calcium signals, yet reduces afferent spontaneous activity and disrupts the timing of stimulus onset, a distinct aspect of auditory and vestibular encoding. These observations suggest that varying ribbon size alone can influence sensory encoding, and give further insight into how hair cells transduce signals that cover a wide dynamic range of stimuli. PMID:28546313

Clock genes and their genomic distributions in three species of salmonid fishes: Associations with genes regulating sexual maturation and cell cycling

PubMed Central

2010-01-01

Background Clock family genes encode transcription factors that regulate clock-controlled genes and thus regulate many physiological mechanisms/processes in a circadian fashion. Clock1 duplicates and copies of Clock3 and NPAS2-like genes were partially characterized (genomic sequencing) and mapped using family-based indels/SNPs in rainbow trout (RT)(Oncorhynchus mykiss), Arctic charr (AC)(Salvelinus alpinus), and Atlantic salmon (AS)(Salmo salar) mapping panels. Results Clock1 duplicates mapped to linkage groups RT-8/-24, AC-16/-13 and AS-2/-18. Clock3/NPAS2-like genes mapped to RT-9/-20, AC-20/-43, and AS-5. Most of these linkage group regions containing the Clock gene duplicates were derived from the most recent 4R whole genome duplication event specific to the salmonids. These linkage groups contain quantitative trait loci (QTL) for life history and growth traits (i.e., reproduction and cell cycling). Comparative synteny analyses with other model teleost species reveal a high degree of conservation for genes in these chromosomal regions suggesting that functionally related or co-regulated genes are clustered in syntenic blocks. For example, anti-müllerian hormone (amh), regulating sexual maturation, and ornithine decarboxylase antizymes (oaz1 and oaz2), regulating cell cycling, are contained within these syntenic blocks. Conclusions Synteny analyses indicate that regions homologous to major life-history QTL regions in salmonids contain many candidate genes that are likely to influence reproduction and cell cycling. The order of these genes is highly conserved across the vertebrate species examined, and as such, these genes may make up a functional cluster of genes that are likely co-regulated. CLOCK, as a transcription factor, is found within this block and therefore has the potential to cis-regulate the processes influenced by these genes. Additionally, clock-controlled genes (CCGs) are located in other life-history QTL regions within salmonids suggesting that at least in part, trans-regulation of these QTL regions may also occur via Clock expression. PMID:20670436

Functional characterization of rpn3 uncovers a distinct 19S proteasomal subunit requirement for ubiquitin-dependent proteolysis of cell cycle regulatory proteins in budding yeast.

PubMed

Bailly, E; Reed, S I

1999-10-01

By selectively eliminating ubiquitin-conjugated proteins, the 26S proteasome plays a pivotal role in a large variety of cellular regulatory processes, particularly in the control of cell cycle transitions. Access of ubiquitinated substrates to the inner catalytic chamber within the 20S core particle is mediated by the 19S regulatory particle (RP), whose subunit composition in budding yeast has been recently elucidated. In this study, we have investigated the cell cycle defects resulting from conditional inactivation of one of these RP components, the essential non-ATPase Rpn3/Sun2 subunit. Using temperature-sensitive mutant alleles, we show that rpn3 mutations do not prevent the G(1)/S transition but cause a metaphase arrest, indicating that the essential Rpn3 function is limiting for mitosis. rpn3 mutants appear severely compromised in the ubiquitin-dependent proteolysis of several physiologically important proteasome substrates. Thus, RPN3 function is required for the degradation of the G(1)-phase cyclin Cln2 targeted by SCF; the S-phase cyclin Clb5, whose ubiquitination is likely to involve a combination of E3 (ubiquitin protein ligase) enzymes; and anaphase-promoting complex targets, such as the B-type cyclin Clb2 and the anaphase inhibitor Pds1. Our results indicate that the Pds1 degradation defect of the rpn3 mutants most likely accounts for the metaphase arrest phenotype observed. Surprisingly, but consistent with the lack of a G(1) arrest phenotype in thermosensitive rpn3 strains, the Cdk inhibitor Sic1 exhibits a short half-life regardless of the RPN3 genotype. In striking contrast, Sic1 turnover is severely impaired by a temperature-sensitive mutation in RPN12/NIN1, encoding another essential RP subunit. While other interpretations are possible, these data strongly argue for the requirement of distinct RP subunits for efficient proteolysis of specific cell cycle regulators. The potential implications of these data are discussed in the context of possible Rpn3 function in multiubiquitin-protein conjugate recognition by the 19S proteasomal regulatory particle.

A mutation affecting carbon catabolite repression suppresses growth defects in pyruvate carboxylase mutants from Saccharomyces cerevisiae.

PubMed

Blázquez, M A; Gamo, F J; Gancedo, C

1995-12-18

Yeasts with disruptions in the genes PYC1 and PYC2 encoding the isoenzymes of pyruvate carboxylase cannot grow in a glucose-ammonium medium (Stucka et al. (1991) Mol. Gen. Genet. 229, 307-315). We have isolated a dominant mutation, BPC1-1, that allows growth in this medium of yeasts with interrupted PYC1 and PYC2 genes. The BPC1-1 mutation abolishes catabolite repression of a series of genes and allows expression of the enzymes of the glyoxylate cycle during growth in glucose. A functional glyoxylate cycle is necessary for suppression as a disruption of gene ICL1 encoding isocitrate lyase abolished the phenotypic effect of BPC1-1 on growth in glucose-ammonium. Concurrent expression from constitutive promoters of genes ICL1 and MLS1 (encoding malate synthase) also suppressed the growth phenotype of pyc1 pyc2 mutants. The mutation BPC1-1 is either allelic or closely linked to the mutation DGT1-1.

Rv0004 is a new essential member of the mycobacterial DNA replication machinery

PubMed Central

Hooppaw, Anna J.; Richardson, Kirill; Lee, Hark Joon; Kimmey, Jacqueline M.; Aldridge, Bree B.

2017-01-01

DNA replication is fundamental for life, yet a detailed understanding of bacterial DNA replication is limited outside the organisms Escherichia coli and Bacillus subtilis. Many bacteria, including mycobacteria, encode no identified homologs of helicase loaders or regulators of the initiator protein DnaA, despite these factors being essential for DNA replication in E. coli and B. subtilis. In this study we discover that a previously uncharacterized protein, Rv0004, from the human pathogen Mycobacterium tuberculosis is essential for bacterial viability and that depletion of Rv0004 leads to a block in cell cycle progression. Using a combination of genetic and biochemical approaches, we found that Rv0004 has a role in DNA replication, interacts with DNA and the replicative helicase DnaB, and affects DnaB-DnaA complex formation. We also identify a conserved domain in Rv0004 that is predicted to structurally resemble the N-terminal protein-protein interaction domain of DnaA. Mutation of a single conserved tryptophan within Rv0004’s DnaA N-terminal-like domain leads to phenotypes similar to those observed upon Rv0004 depletion and can affect the association of Rv0004 with DnaB. In addition, using live cell imaging during depletion of Rv0004, we have uncovered a previously unappreciated role for DNA replication in coordinating mycobacterial cell division and cell size. Together, our data support that Rv0004 encodes a homolog of the recently identified DciA family of proteins found in most bacteria that lack the DnaC-DnaI helicase loaders in E. coli and B. subtilis. Therefore, the mechanisms of Rv0004 elucidated here likely apply to other DciA homologs and reveal insight into the diversity of bacterial strategies in even the most conserved biological processes. PMID:29176877

Rv0004 is a new essential member of the mycobacterial DNA replication machinery.

PubMed

Mann, Katherine M; Huang, Deborah L; Hooppaw, Anna J; Logsdon, Michelle M; Richardson, Kirill; Lee, Hark Joon; Kimmey, Jacqueline M; Aldridge, Bree B; Stallings, Christina L

2017-11-01

DNA replication is fundamental for life, yet a detailed understanding of bacterial DNA replication is limited outside the organisms Escherichia coli and Bacillus subtilis. Many bacteria, including mycobacteria, encode no identified homologs of helicase loaders or regulators of the initiator protein DnaA, despite these factors being essential for DNA replication in E. coli and B. subtilis. In this study we discover that a previously uncharacterized protein, Rv0004, from the human pathogen Mycobacterium tuberculosis is essential for bacterial viability and that depletion of Rv0004 leads to a block in cell cycle progression. Using a combination of genetic and biochemical approaches, we found that Rv0004 has a role in DNA replication, interacts with DNA and the replicative helicase DnaB, and affects DnaB-DnaA complex formation. We also identify a conserved domain in Rv0004 that is predicted to structurally resemble the N-terminal protein-protein interaction domain of DnaA. Mutation of a single conserved tryptophan within Rv0004's DnaA N-terminal-like domain leads to phenotypes similar to those observed upon Rv0004 depletion and can affect the association of Rv0004 with DnaB. In addition, using live cell imaging during depletion of Rv0004, we have uncovered a previously unappreciated role for DNA replication in coordinating mycobacterial cell division and cell size. Together, our data support that Rv0004 encodes a homolog of the recently identified DciA family of proteins found in most bacteria that lack the DnaC-DnaI helicase loaders in E. coli and B. subtilis. Therefore, the mechanisms of Rv0004 elucidated here likely apply to other DciA homologs and reveal insight into the diversity of bacterial strategies in even the most conserved biological processes.

An Elk transcription factor is required for Runx-dependent survival signaling in the sea urchin embryo.

PubMed

Rizzo, Francesca; Coffman, James A; Arnone, Maria Ina

2016-08-01

Elk proteins are Ets family transcription factors that regulate cell proliferation, survival, and differentiation in response to ERK (extracellular-signal regulated kinase)-mediated phosphorylation. Here we report the embryonic expression and function of Sp-Elk, the single Elk gene of the sea urchin Strongylocentrotus purpuratus. Sp-Elk is zygotically expressed throughout the embryo beginning at late cleavage stage, with peak expression occurring at blastula stage. Morpholino antisense-mediated knockdown of Sp-Elk causes blastula-stage developmental arrest and embryo disintegration due to apoptosis, a phenotype that is rescued by wild-type Elk mRNA. Development is also rescued by Elk mRNA encoding a serine to aspartic acid substitution (S402D) that mimics ERK-mediated phosphorylation of a conserved site that enhances DNA binding, but not by Elk mRNA encoding an alanine substitution at the same site (S402A). This demonstrates both that the apoptotic phenotype of the morphants is specifically caused by Elk depletion, and that phosphorylation of serine 402 of Sp-Elk is critical for its anti-apoptotic function. Knockdown of Sp-Elk results in under-expression of several regulatory genes involved in cell fate specification, cell cycle control, and survival signaling, including the transcriptional regulator Sp-Runt-1 and its target Sp-PKC1, both of which were shown previously to be required for cell survival during embryogenesis. Both Sp-Runt-1 and Sp-PKC1 have sequences upstream of their transcription start sites that specifically bind Sp-Elk. These results indicate that Sp-Elk is the signal-dependent activator of a feed-forward gene regulatory circuit, consisting also of Sp-Runt-1 and Sp-PKC1, which actively suppresses apoptosis in the early embryo. Copyright © 2016 Elsevier Inc. All rights reserved.

Increased mitochondrial-encoded gene transcription in immortal DF-1 cells.

PubMed

Kim, H; You, S; Kim, I J; Farris, J; Foster, L K; Foster, D N

2001-05-01

We have established, in continuous cell culture, a spontaneously immortalized chicken embryo fibroblast (CEF) cell line (DF-1) as well as several other immortal CEF cell lines. The immortal DF-1 cells divided more rapidly than primary and other immortal CEF cells. To identify the genes involved in rapidly dividing DF-1 cells, we have used differential display RT-PCR. Of the numerous genes analyzed, three mitochondrial-encoded genes (ATPase 8/6, 16S rRNA, and cytochrome b) were shown to express at higher levels in DF-1 cells compared to primary and other immortal CEF cells. The inhibition of mitochondrial translation by treatment with chloramphenicol markedly decreased ATP production and cell proliferation in DF-1 cells, while not affecting growth in either primary or other immortal CEF cells. This result suggests a correlation between rapid cell proliferation and the increased mitochondrial respiratory functions. We also determined that the increased transcription of mitochondrial-encoded genes in DF-1 cells is due to increased de novo transcript synthesis as shown by mitochondrial run-on assays, and not the result of either increased mitochondrial biogenesis or mitochondrial transcript half-lives. Together, the present studies suggest that the transcriptional activation of mitochondrial-encoded genes and the elevated respiratory function should be one of the characteristics of rapidly dividing immortal cells. Copyright 2001 Academic Press.

Simultaneous inhibition of pan-phosphatidylinositol-3-kinases and MEK as a potential therapeutic strategy in peripheral T-cell lymphomas.

PubMed

Martín-Sánchez, Esperanza; Rodríguez-Pinilla, Socorro M; Sánchez-Beato, Margarita; Lombardía, Luis; Domínguez-González, Beatriz; Romero, Diana; Odqvist, Lina; García-Sanz, Pablo; Wozniak, Magdalena B; Kurz, Guido; Blanco-Aparicio, Carmen; Mollejo, Manuela; Alves, F Javier; Menárguez, Javier; González-Palacios, Fernando; Rodríguez-Peralto, José Luis; Ortiz-Romero, Pablo L; García, Juan F; Bischoff, James R; Piris, Miguel A

2013-01-01

Peripheral T-cell lymphomas are very aggressive hematologic malignancies for which there is no targeted therapy. New, rational approaches are necessary to improve the very poor outcome in these patients. Phosphatidylinositol-3-kinase is one of the most important pathways in cell survival and proliferation. We hypothesized that phosphatidylinositol-3-kinase inhibitors could be rationally selected drugs for treating peripheral T-cell lymphomas. Several phosphatidylinositol-3-kinase isoforms were inhibited genetically (using small interfering RNA) and pharmacologically (with CAL-101 and GDC-0941 compounds) in a panel of six peripheral and cutaneous T-cell lymphoma cell lines. Cell viability was measured by intracellular ATP content; apoptosis and cell cycle changes were checked by flow cytometry. Pharmacodynamic biomarkers were assessed by western blot. The PIK3CD gene, which encodes the δ isoform of phosphatidylinositol-3-kinase, was overexpressed in cell lines and primary samples, and correlated with survival pathways. However, neither genetic nor specific pharmacological inhibition of phosphatidylinositol-3-kinase δ affected cell survival. In contrast, the pan-phosphatidylinositol-3-kinase inhibitor GDC-0941 arrested all T-cell lymphoma cell lines in the G1 phase and induced apoptosis in a subset of them. We identified phospho-GSK3β and phospho-p70S6K as potential biomarkers of phosphatidylinositol-3-kinase inhibitors. Interestingly, an increase in ERK phosphorylation was observed in some GDC -0941-treated T-cell lymphoma cell lines, suggesting the presence of a combination of phosphatidylinositol-3-kinase and MEK inhibitors. A highly synergistic effect was found between the two inhibitors, with the combination enhancing cell cycle arrest at G0/G1 in all T-cell lymphoma cell lines, and reducing cell viability in primary tumor T cells ex vivo. These results suggest that the combined treatment of pan-phosphatidylinositol-3-kinase + MEK inhibitors could be more effective than single phosphatidylinositol-3-kinase inhibitor treatment, and therefore, that this combination could be of therapeutic value for treating peripheral and cutaneous T-cell lymphomas.

Multiple enzyme activities of flavivirus proteins.

PubMed

Padmanabhan, R; Mueller, N; Reichert, E; Yon, C; Teramoto, T; Kono, Y; Takhampunya, R; Ubol, S; Pattabiraman, N; Falgout, B; Ganesh, V K; Murthy, K

2006-01-01

Dengue viruses (DENV) have 5'-capped RNA genomes of (+) polarity and encode a single polyprotein precursor that is processed into mature viral proteins. NS2B, NS3 and NS5 proteins catalyse/activate enzyme activities that are required for key processes in the virus life cycle. The heterodimeric NS2B/NS3 is a serine protease required for processing. Using a high-throughput protease assay, we screened a small molecule chemical library and identified -200 compounds having > or = 50% inhibition. Moreover, NS3 exhibits RNA-stimulated NTPase, RNA helicase and the 5'-RNA triphosphatase activities. The NTPase and the 5'-RTPase activities of NS3 are stimulated by interaction with NS5. Moreover, the conserved, positively charged motif in DENV-2 NS3, 184RKRK, is required for RNA binding and modulates the RNA-dependent enzyme activities of NS3. To study viral replication, a variety of methods are used such as the in vitro RNA-dependent RNA polymerase assays that utilize lysates from DENV-2-infected mosquito or mammalian cells or the purified NS5 along with exogenous short subgenomic viral RNAs or the replicative intracellular membrane-bound viral RNAs as templates. In addition, a cell-based DENV-2 replicon RNA encoding a luciferase reporter is also used to examine the role of cis-acting elements within the 3' UTR and the RKRK motif in viral replication.

Mutations in glycyl-tRNA synthetase impair mitochondrial metabolism in neurons.

PubMed

Boczonadi, Veronika; Meyer, Kathrin; Gonczarowska-Jorge, Humberto; Griffin, Helen; Roos, Andreas; Bartsakoulia, Marina; Bansagi, Boglarka; Ricci, Giulia; Palinkas, Fanni; Zahedi, René P; Bruni, Francesco; Kaspar, Brian; Lochmüller, Hanns; Boycott, Kym M; Müller, Juliane S; Horvath, Rita

2018-06-15

The nuclear-encoded glycyl-tRNA synthetase gene (GARS) is essential for protein translation in both cytoplasm and mitochondria. In contrast, different genes encode the mitochondrial and cytosolic forms of most other tRNA synthetases. Dominant GARS mutations were described in inherited neuropathies, while recessive mutations cause severe childhood-onset disorders affecting skeletal muscle and heart. The downstream events explaining tissue-specific phenotype-genotype relations remained unclear. We investigated the mitochondrial function of GARS in human cell lines and in the GarsC210R mouse model. Human-induced neuronal progenitor cells (iNPCs) carrying dominant and recessive GARS mutations showed alterations of mitochondrial proteins, which were more prominent in iNPCs with dominant, neuropathy-causing mutations. Although comparative proteomic analysis of iNPCs showed significant changes in mitochondrial respiratory chain complex subunits, assembly genes, Krebs cycle enzymes and transport proteins in both recessive and dominant mutations, proteins involved in fatty acid oxidation were only altered by recessive mutations causing mitochondrial cardiomyopathy. In contrast, significant alterations of the vesicle-associated membrane protein-associated protein B (VAPB) and its downstream pathways such as mitochondrial calcium uptake and autophagy were detected in dominant GARS mutations. The role of VAPB has been supported by similar results in the GarsC210R mice. Our data suggest that altered mitochondria-associated endoplasmic reticulum (ER) membranes (MAM) may be important disease mechanisms leading to neuropathy in this condition.

The N-Terminal CCHC Zinc Finger Motif Mediates Homodimerization of Transcription Factor BCL11B.

PubMed

Grabarczyk, Piotr; Winkler, Passorn; Delin, Martin; Sappa, Praveen K; Bekeschus, Sander; Hildebrandt, Petra; Przybylski, Grzegorz K; Völker, Uwe; Hammer, Elke; Schmidt, Christian A

2018-03-01

The BCL11B gene encodes a Krüppel-like, sequence-specific zinc finger (ZF) transcription factor that acts as either a repressor or an activator, depending on its posttranslational modifications. The importance of BCL11B in numerous biological processes in multiple organs has been well established in mouse knockout models. The phenotype of the first de novo monoallelic germ line missense mutation in the BCL11B gene (encoding N441K) strongly implies that the mutant protein acts in a dominant-negative manner by neutralizing the unaffected protein through the formation of a nonfunctional dimer. Using a Förster resonance energy transfer-assisted fluorescence-activated cell sorting (FACS-FRET) assay and affinity purification followed by mass spectrometry (AP-MS), we show that the N-terminal CCHC zinc finger motif is necessary and sufficient for the formation of the BCL11B dimer. Mutation of the CCHC ZF in BCL11B abolishes its transcription-regulatory activity. In addition, unlike wild-type BCL11B, this mutant is incapable of inducing cell cycle arrest and protecting against DNA damage-driven apoptosis. Our results confirm the BCL11B dimerization hypothesis and prove its importance for BCL11B function. By mapping the relevant regions to the CCHC domain, we describe a previously unidentified mechanism of transcription factor homodimerization. Copyright © 2018 American Society for Microbiology.

Tracking brain motion during the cardiac cycle using spiral cine-DENSE MRI

PubMed Central

Zhong, Xiaodong; Meyer, Craig H.; Schlesinger, David J.; Sheehan, Jason P.; Epstein, Frederick H.; Larner, James M.; Benedict, Stanley H.; Read, Paul W.; Sheng, Ke; Cai, Jing

2009-01-01

Cardiac-synchronized brain motion is well documented, but the accurate measurement of such motion on the pixel-by-pixel basis has been hampered by the lack of proper imaging technique. In this article, the authors present the implementation of an autotracking spiral cine displacement-encoded stimulation echo (DENSE) magnetic resonance imaging (MRI) technique for the measurement of pulsatile brain motion during the cardiac cycle. Displacement-encoded dynamic MR images of three healthy volunteers were acquired throughout the cardiac cycle using the spiral cine-DENSE pulse sequence gated to the R wave of an electrocardiogram. Pixelwise Lagrangian displacement maps were computed, and 2D displacement as a function of time was determined for selected regions of interests. Different intracranial structures exhibited characteristic motion amplitude, direction, and pattern throughout the cardiac cycle. Time-resolved displacement curves revealed the pathway of pulsatile motion from brain stem to peripheral brain lobes. These preliminary results demonstrated that the spiral cine-DENSE MRI technique can be used to measure cardiac-synchronized pulsatile brain motion on the pixel-by-pixel basis with high temporal∕spatial resolution and sensitivity. PMID:19746774

Tcof1/Treacle is required for neural crest cell formation and proliferation deficiencies that cause craniofacial abnormalities.

PubMed

Dixon, Jill; Jones, Natalie C; Sandell, Lisa L; Jayasinghe, Sachintha M; Crane, Jennifer; Rey, Jean-Philippe; Dixon, Michael J; Trainor, Paul A

2006-09-05

Neural crest cells are a migratory cell population that give rise to the majority of the cartilage, bone, connective tissue, and sensory ganglia in the head. Abnormalities in the formation, proliferation, migration, and differentiation phases of the neural crest cell life cycle can lead to craniofacial malformations, which constitute one-third of all congenital birth defects. Treacher Collins syndrome (TCS) is characterized by hypoplasia of the facial bones, cleft palate, and middle and external ear defects. Although TCS results from autosomal dominant mutations of the gene TCOF1, the mechanistic origins of the abnormalities observed in this condition are unknown, and the function of Treacle, the protein encoded by TCOF1, remains poorly understood. To investigate the developmental basis of TCS we generated a mouse model through germ-line mutation of Tcof1. Haploinsufficiency of Tcof1 leads to a deficiency in migrating neural crest cells, which results in severe craniofacial malformations. We demonstrate that Tcof1/Treacle is required cell-autonomously for the formation and proliferation of neural crest cells. Tcof1/Treacle regulates proliferation by controlling the production of mature ribosomes. Therefore, Tcof1/Treacle is a unique spatiotemporal regulator of ribosome biogenesis, a deficiency that disrupts neural crest cell formation and proliferation, causing the hypoplasia characteristic of TCS craniofacial anomalies.

Bmi1 represses Ink4a/Arf and Hox genes to regulate stem cells in the rodent incisor

PubMed Central

Biehs, Brian; Hu, Jimmy Kuang-Hsien; Strauli, Nicolas B.; Sangiorgi, Eugenio; Jung, Heekyung; Heber, Ralf-Peter; Ho, Sunita; Goodwin, Alice F.; Dasen, Jeremy S.; Capecchi, Mario R.; Klein, Ophir D.

2013-01-01

The polycomb group gene Bmi1 is required for maintenance of adult stem cells in many organs1, 2. Inactivation of Bmi1 leads to impaired stem cell self-renewal due to deregulated gene expression. One critical target of BMI1 is Ink4a/Arf, which encodes the cell cycle inhibitors p16ink4a and p19Arf3. However, deletion of Ink4a/Arf only partially rescues Bmi1 null phenotypes4, indicating that other important targets of BMI1 exist. Here, using the continuously-growing mouse incisor as a model system, we report that Bmi1 is expressed by incisor stem cells and that deletion of Bmi1 resulted in fewer stem cells, perturbed gene expression, and defective enamel production. Transcriptional profiling revealed that Hox expression is normally repressed by BMI1 in the adult, and functional assays demonstrated that BMI1-mediated repression of Hox genes preserves the undifferentiated state of stem cells. As Hox gene upregulation has also been reported in other systems when Bmi1 is inactivated1, 2, 5–7, our findings point to a general mechanism whereby BMI1-mediated repression of Hox genes is required for the maintenance of adult stem cells and for prevention of inappropriate differentiation. PMID:23728424

Hematopoietic stem cells are acutely sensitive to Acd shelterin gene inactivation

PubMed Central

Jones, Morgan; Osawa, Gail; Regal, Joshua A.; Weinberg, Daniel N.; Taggart, James; Kocak, Hande; Friedman, Ann; Ferguson, David O.; Keegan, Catherine E.; Maillard, Ivan

2013-01-01

The shelterin complex plays dual functions in telomere homeostasis by recruiting telomerase and preventing the activation of a DNA damage response at telomeric ends. Somatic stem cells require telomerase activity, as evidenced by progressive stem cell loss leading to bone marrow failure in hereditary dyskeratosis congenita. Recent work demonstrates that dyskeratosis congenita can also arise from mutations in specific shelterin genes, although little is known about shelterin functions in somatic stem cells. We found that mouse hematopoietic stem cells (HSCs) are acutely sensitive to inactivation of the shelterin gene Acd, encoding TPP1. Homozygosity for a hypomorphic acd allele preserved the emergence and expansion of fetal HSCs but led to profoundly defective function in transplantation assays. Upon complete Acd inactivation, HSCs expressed p53 target genes, underwent cell cycle arrest, and were severely depleted within days, leading to hematopoietic failure. TPP1 loss induced increased telomeric fusion events in bone marrow progenitors. However, unlike in epidermal stem cells, p53 deficiency did not rescue TPP1-deficient HSCs, indicating that shelterin dysfunction has unique effects in different stem cell populations. Because the consequences of telomere shortening are progressive and unsynchronized, acute loss of shelterin function represents an attractive alternative for studying telomere crisis in hematopoietic progenitors. PMID:24316971

G-protein-coupled receptor 137 accelerates proliferation of urinary bladder cancer cells in vitro.

PubMed

Du, Yiheng; Bi, Wenhuan; Zhang, Fei; Wu, Wenbo; Xia, Shujie; Liu, Haitao

2015-01-01

Urinary bladder cancer is a worldwide concern because of its level of incidence and recurrence. To search an effective therapeutic strategy for urinary bladder cancer, it is important to identify proteins involved in tumorigenesis that could serve as potential targets for diagnosis and treatment. G-protein-coupled receptors (GPRs) constitute a large protein family of receptors that sense molecules outside the cell and activate signal transduction pathways and cellular responses inside the cell. GPR137 is a newly discovered human gene encoding orphan GPRs. In this study, we aimed to investigate the physiological role of GPR137 in urinary bladder cancer. The effect of GPR137 on cell growth was examined via an RNA interference (RNAi) lentivirus system in two human urinary bladder cancer cell lines BT5637 and T24. Lentivirus-mediated RNAi could specifically suppressed GPR137 expression in vitro, resulting in alleviated cell viability and impaired colony formation, as well as blocks G0/G1 and S phases of the cell cycle. These results suggested GPR137 as an essential player in urinary bladder cancer cell growth, and it may serve as a potential target for gene therapy in the treatment of urinary bladder cancer. © 2014 International Union of Biochemistry and Molecular Biology, Inc.

Placing Ion Channels into a Signaling Network of T Cells: From Maturing Thymocytes to Healthy T Lymphocytes or Leukemic T Lymphoblasts

PubMed Central

Delgado-Enciso, Iván; Best-Aguilera, Carlos; Rojas-Sotelo, Rocío Monserrat; Pottosin, Igor

2015-01-01

T leukemogenesis is a multistep process, where the genetic errors during T cell maturation cause the healthy progenitor to convert into the leukemic precursor that lost its ability to differentiate but possesses high potential for proliferation, self-renewal, and migration. A new misdirecting “leukemogenic” signaling network appears, composed by three types of participants which are encoded by (1) genes implicated in determined stages of T cell development but deregulated by translocations or mutations, (2) genes which normally do not participate in T cell development but are upregulated, and (3) nondifferentially expressed genes which become highly interconnected with genes expressed differentially. It appears that each of three groups may contain genes coding ion channels. In T cells, ion channels are implicated in regulation of cell cycle progression, differentiation, activation, migration, and cell death. In the present review we are going to reveal a relationship between different genetic defects, which drive the T cell neoplasias, with calcium signaling and ion channels. We suggest that changes in regulation of various ion channels in different types of the T leukemias may provide the intracellular ion microenvironment favorable to maintain self-renewal capacity, arrest differentiation, induce proliferation, and enhance motility. PMID:25866806

Spatially Fourier-encoded photoacoustic microscopy using a digital micromirror device.

PubMed

Liang, Jinyang; Gao, Liang; Li, Chiye; Wang, Lihong V

2014-02-01

We have developed spatially Fourier-encoded photoacoustic (PA) microscopy using a digital micromirror device. The spatial intensity distribution of laser pulses is Fourier-encoded, and a series of such encoded PA measurements allows one to decode the spatial distribution of optical absorption. The throughput and Fellgett advantages were demonstrated by imaging a chromium target. By using 63 spatial elements, the signal-to-noise ratio in the recovered PA signal was enhanced by ∼4×. The system was used to image two biological targets, a monolayer of red blood cells and melanoma cells.

Spatially Fourier-encoded photoacoustic microscopy using a digital micromirror device

PubMed Central

Liang, Jinyang; Gao, Liang; Li, Chiye; Wang, Lihong V.

2014-01-01

We have developed spatially Fourier-encoded photoacoustic microscopy using a digital micromirror device. The spatial intensity distribution of laser pulses is Fourier-encoded, and a series of such encoded photoacoustic measurements allows one to decode the spatial distribution of optical absorption. The throughput and Fellgett advantages were demonstrated by imaging a chromium target. By using 63 spatial elements, the signal-to-noise ratio in the recovered photoacoustic signal was enhanced by ~4×. The system was used to image two biological targets, a monolayer of red blood cells and melanoma cells. PMID:24487832

Molecular Characterization of a Novel Temperate Sinorhizobium Bacteriophage, ФLM21, Encoding DNA Methyltransferase with CcrM-Like Specificity

PubMed Central

Dziewit, Lukasz; Oscik, Karolina; Bartosik, Dariusz

2014-01-01

ABSTRACT ΦLM21 is a temperate phage isolated from Sinorhizobium sp. strain LM21 (Alphaproteobacteria). Genomic analysis and electron microscopy suggested that ΦLM21 is a member of the family Siphoviridae. The phage has an isometric head and a long noncontractile tail. The genome of ΦLM21 has 50,827 bp of linear double-stranded DNA encoding 72 putative proteins, including proteins responsible for the assembly of the phage particles, DNA packaging, transcription, replication, and lysis. Virion proteins were characterized using mass spectrometry, leading to the identification of the major capsid and tail components, tape measure, and a putative portal protein. We have confirmed the activity of two gene products, a lytic enzyme (a putative chitinase) and a DNA methyltransferase, sharing sequence specificity with the cell cycle-regulating methyltransferase (CcrM) of the bacterial host. Interestingly, the genome of Sinorhizobium phage ΦLM21 shows very limited similarity to other known phage genome sequences and is thus considered unique. IMPORTANCE Prophages are known to play an important role in the genomic diversification of bacteria via horizontal gene transfer. The influence of prophages on pathogenic bacteria is very well documented. However, our knowledge of the overall impact of prophages on the survival of their lysogenic, nonpathogenic bacterial hosts is still limited. In particular, information on prophages of the agronomically important Sinorhizobium species is scarce. In this study, we describe the isolation and molecular characterization of a novel temperate bacteriophage, ΦLM21, of Sinorhizobium sp. LM21. Since we have not found any similar sequences, we propose that this bacteriophage is a novel species. We conducted a functional analysis of selected proteins. We have demonstrated that the phage DNA methyltransferase has the same sequence specificity as the cell cycle-regulating methyltransferase CcrM of its host. We point out that this phenomenon of mimicking the host regulatory mechanisms by viruses is quite common in bacteriophages. PMID:25187538

Protection of Mice from Fatal Measles Encephalitis by Vaccination with Vaccinia Virus Recombinants Encoding Either the Hemagglutinin or the Fusion Protein

NASA Astrophysics Data System (ADS)

Drillien, Robert; Spehner, Daniele; Kirn, Andre; Giraudon, Pascale; Buckland, Robin; Wild, Fabian; Lecocq, Jean-Pierre

1988-02-01

Vaccinia virus recombinants encoding the hemagglutinin or fusion protein of measles virus have been constructed. Infection of cell cultures with the recombinants led to the synthesis of authentic measles proteins as judged by their electrophoretic mobility, recognition by antibodies, glycosylation, proteolytic cleavage, and presentation on the cell surface. Mice vaccinated with a single dose of the recombinant encoding the hemagglutinin protein developed antibodies capable of both inhibiting hemagglutination activity and neutralizing measles virus, whereas animals vaccinated with the recombinant encoding the fusion protein developed measles neutralizing antibodies. Mice vaccinated with either of the recombinants resisted a normally lethal intracerebral inoculation of a cell-associated measles virus subacute sclerosing panencephalitis strain.

Anionic Carbosilane Dendrimers Destabilize the GP120-CD4 Complex Blocking HIV-1 Entry and Cell to Cell Fusion.

PubMed

Guerrero-Beltran, Carlos; Rodriguez-Izquierdo, Ignacio; Serramia, Ma Jesus; Araya-Durán, Ingrid; Márquez-Miranda, Valeria; Gomez, Rafael; de la Mata, Francisco Javier; Leal, Manuel; González-Nilo, Fernando; Muñoz-Fernández, M Angeles

2018-05-16

Cell-to-cell transmission is the most effective pathway for the spread of human immunodeficiency virus (HIV-1). Infected cells expose virus-encoded fusion proteins on their surface as a consequence of HIV-1 replicative cycle that interacts with noninfected cells through CD4 receptor and CXCR4 coreceptor leading to the formation of giant multinucleated cells known as syncytia. Our group previously described the potent activity of dendrimers against CCR5-tropic viruses. Nevertheless, the study of G1-S4, G2-S16, and G3-S16 dendrimers in the context of X4-HIV-1 tropic cell-cell fusion referred to syncytium formation remains still unknown. These dendrimers showed a suitable biocompatibility in all cell lines studied and our results demonstrated that anionic carbosilane dendrimers G1-S4, G2-S16, and G3-S16 significantly inhibit the X4-HIV-1 infection, as well as syncytia formation, in a dose dependent manner. We also demonstrated that G2-S16 and G1-S4 significantly reduced syncytia formation in HIV-1 Env-mediated cell-to-cell fusion model. Molecular modeling and in silico models showed that G2-S16 dendrimer interfered with gp120-CD4 complex and demonstrated its potential use for a treatment.

Interaction of the Tobacco mosaic virus movement protein with microtubules during the cell cycle in tobacco BY-2 cells.

PubMed

Boutant, Emmanuel; Fitterer, Chantal; Ritzenthaler, Christophe; Heinlein, Manfred

2009-10-01

Cell-to-cell movement of Tobacco mosaic virus (TMV) involves the interaction of virus-encoded 30-kDa movement protein (MP) with microtubules. In cells behind the infection front that accumulate high levels of MP, this activity is reflected by the formation of stabilized MP/microtubule complexes. The ability of MP to bind along and stabilize microtubules is conserved upon expression in mammalian cells. In mammalian cells, the protein also leads to inhibition of mitosis and cell division through a microtubule-independent process correlated with the loss of centrosomal gamma-tubulin and of centrosomal microtubule-nucleation activity. Since MP has the capacity to interact with plant factors involved in microtubule nucleation and dynamics, we used inducible expression in BY-2 cells to test whether MP expression inhibits mitosis and cell division also in plants. We demonstrate that MP:GFP associates with all plant microtubule arrays and, unlike in mammalian cells, does not interfere with mitosis. Thus, MP function and the interaction of MP with factors of the cytoskeleton do not entail an inhibition of mitosis in plants. We also report that the protein targets primary plasmodesmata in BY-2 cells immediately upon or during cytokinesis and that the accumulation of MP in plasmodesmata occurs in the presence of inhibitors of the cytoskeleton and the secretory pathway.

mRNA-binding protein TIA-1 reduces cytokine expression in human endometrial stromal cells and is down-regulated in ectopic endometrium.

PubMed

Karalok, Hakan Mete; Aydin, Ebru; Saglam, Ozlen; Torun, Aysenur; Guzeloglu-Kayisli, Ozlem; Lalioti, Maria D; Kristiansson, Helena; Duke, Cindy M P; Choe, Gina; Flannery, Clare; Kallen, Caleb B; Seli, Emre

2014-12-01

Cytokines and growth factors play important roles in endometrial function and the pathogenesis of endometriosis. mRNAs encoding cytokines and growth factors undergo rapid turnover; primarily mediated by adenosine- and uridine-rich elements (AREs) located in their 3'-untranslated regions. T-cell intracellular antigen (TIA-1), an mRNA-binding protein, binds to AREs in target transcripts, leading to decreased gene expression. The purpose of this article was to determine whether TIA-1 plays a role in the regulation of endometrial cytokine and growth factor expression during the normal menstrual cycle and whether TIA-1 expression is altered in women with endometriosis. Eutopic endometrial tissue obtained from women without endometriosis (n = 30) and eutopic and ectopic endometrial tissues from women with endometriosis (n = 17) were immunostained for TIA-1. Staining intensities were evaluated by histological scores (HSCOREs). The regulation of endometrial TIA-1 expression by immune factors and steroid hormones was studied by treating primary cultured human endometrial stromal cells (HESCs) with vehicle, lipopolysaccharide, TNF-α, IL-6, estradiol, or progesterone, followed by protein blot analyses. HESCs were engineered to over- or underexpress TIA-1 to test whether TIA-1 regulates IL-6 or TNF-α expression in these cells. We found that TIA-1 is expressed in endometrial stromal and glandular cells throughout the menstrual cycle and that this expression is significantly higher in the perimenstrual phase. In women with endometriosis, TIA-1 expression in eutopic and ectopic endometrium was reduced compared with TIA-1 expression in eutopic endometrium of unaffected control women. Lipopolysaccharide and TNF-α increased TIA-1 expression in HESCs in vitro, whereas IL-6 or steroid hormones had no effect. In HESCs, down-regulation of TIA-1 resulted in elevated IL-6 and TNF-α expression, whereas TIA-1 overexpression resulted in decreased IL-6 and TNF-α expression. Endometrial TIA-1 is regulated throughout the menstrual cycle, TIA-1 modulates the expression of immune factors in endometrial cells, and downregulation of TIA-1 may contribute to the pathogenesis of endometriosis.

mRNA-Binding Protein TIA-1 Reduces Cytokine Expression in Human Endometrial Stromal Cells and Is Down-Regulated in Ectopic Endometrium

PubMed Central

Karalok, Hakan Mete; Aydin, Ebru; Saglam, Ozlen; Torun, Aysenur; Guzeloglu-Kayisli, Ozlem; Lalioti, Maria D.; Kristiansson, Helena; Duke, Cindy M. P.; Choe, Gina; Flannery, Clare; Kallen, Caleb B.

2014-01-01

Background: Cytokines and growth factors play important roles in endometrial function and the pathogenesis of endometriosis. mRNAs encoding cytokines and growth factors undergo rapid turnover; primarily mediated by adenosine- and uridine-rich elements (AREs) located in their 3′-untranslated regions. T-cell intracellular antigen (TIA-1), an mRNA-binding protein, binds to AREs in target transcripts, leading to decreased gene expression. Objective: The purpose of this article was to determine whether TIA-1 plays a role in the regulation of endometrial cytokine and growth factor expression during the normal menstrual cycle and whether TIA-1 expression is altered in women with endometriosis. Methods: Eutopic endometrial tissue obtained from women without endometriosis (n = 30) and eutopic and ectopic endometrial tissues from women with endometriosis (n = 17) were immunostained for TIA-1. Staining intensities were evaluated by histological scores (HSCOREs). The regulation of endometrial TIA-1 expression by immune factors and steroid hormones was studied by treating primary cultured human endometrial stromal cells (HESCs) with vehicle, lipopolysaccharide, TNF-α, IL-6, estradiol, or progesterone, followed by protein blot analyses. HESCs were engineered to over- or underexpress TIA-1 to test whether TIA-1 regulates IL-6 or TNF-α expression in these cells. Results: We found that TIA-1 is expressed in endometrial stromal and glandular cells throughout the menstrual cycle and that this expression is significantly higher in the perimenstrual phase. In women with endometriosis, TIA-1 expression in eutopic and ectopic endometrium was reduced compared with TIA-1 expression in eutopic endometrium of unaffected control women. Lipopolysaccharide and TNF-α increased TIA-1 expression in HESCs in vitro, whereas IL-6 or steroid hormones had no effect. In HESCs, down-regulation of TIA-1 resulted in elevated IL-6 and TNF-α expression, whereas TIA-1 overexpression resulted in decreased IL-6 and TNF-α expression. Conclusions: Endometrial TIA-1 is regulated throughout the menstrual cycle, TIA-1 modulates the expression of immune factors in endometrial cells, and downregulation of TIA-1 may contribute to the pathogenesis of endometriosis. PMID:25140393

Integrated analysis of rice transcriptomic and metabolomic responses to elevated night temperatures identifies sensitivity- and tolerance-related profiles.

PubMed

Glaubitz, Ulrike; Li, Xia; Schaedel, Sandra; Erban, Alexander; Sulpice, Ronan; Kopka, Joachim; Hincha, Dirk K; Zuther, Ellen

2017-01-01

Transcript and metabolite profiling were performed on leaves from six rice cultivars under high night temperature (HNT) condition. Six genes were identified as central for HNT response encoding proteins involved in transcription regulation, signal transduction, protein-protein interactions, jasmonate response and the biosynthesis of secondary metabolites. Sensitive cultivars showed specific changes in transcript abundance including abiotic stress responses, changes of cell wall-related genes, of ABA signaling and secondary metabolism. Additionally, metabolite profiles revealed a highly activated TCA cycle under HNT and concomitantly increased levels in pathways branching off that could be corroborated by enzyme activity measurements. Integrated data analysis using clustering based on one-dimensional self-organizing maps identified two profiles highly correlated with HNT sensitivity. The sensitivity profile included genes of the functional bins abiotic stress, hormone metabolism, cell wall, signaling, redox state, transcription factors, secondary metabolites and defence genes. In the tolerance profile, similar bins were affected with slight differences in hormone metabolism and transcription factor responses. Metabolites of the two profiles revealed involvement of GABA signaling, thus providing a link to the TCA cycle status in sensitive cultivars and of myo-inositol as precursor for inositol phosphates linking jasmonate signaling to the HNT response specifically in tolerant cultivars. © 2016 John Wiley & Sons Ltd.

Identification and characterization of vp7 gene in Bombyx mori cytoplasmic polyhedrosis virus.

PubMed

He, Lei; Hu, Xiaolong; Zhu, Min; Liang, Zi; Chen, Fei; Zhu, Liyuan; Kuang, Sulan; Cao, Guangli; Xue, Renyu; Gong, Chengliang

2017-09-05

The genome of Bombyx mori cytoplasmic polyhedrosis virus (BmCPV) contains 10 double stranded RNA segments (S1-S10). The segment 7 (S7) encodes 50kDa protein which is considered as a structural protein. The expression pattern and function of p50 in the virus life cycle are still unclear. In this study, the viral structural protein 7 (VP7) polyclonal antibody was prepared with immunized mouse to explore the presence of small VP7 gene-encoded proteins in Bombyx mori cytoplasmic polyhedrosis virus. The expression pattern of vp7 gene was investigated by its overexpression in BmN cells. In addition to VP7, supplementary band was identified with western blotting technique. The virion, BmCPV infected cells and midguts were also examined using western blotting technique. 4, 2 and 5 bands were detected in the corresponding samples, respectively. The replication of BmCPV genome in the cultured cells and midgut of silkworm was decreased by reducing the expression level of vp7 gene using RNA interference. In immunoprecipitation experiments, using a polyclonal antiserum directed against the VP7, one additional shorter band in BmCPV infected midguts was detected, and then the band was analyzed with mass spectrum (MS), the MS results showed thatone candidate interacted protein (VP7 voltage-dependent anion-selective channel-like isoform, VDAC) was identified from silkworm. We concluded that the novel viral product was generated with a leaky scanning mechanism and the VDAC may be an interacted protein with VP7. Copyright © 2017 Elsevier B.V. All rights reserved.

Tip60 degradation by adenovirus relieves transcriptional repression of viral transcriptional activator EIA.

PubMed

Gupta, A; Jha, S; Engel, D A; Ornelles, D A; Dutta, A

2013-10-17

Adenoviruses are linear double-stranded DNA viruses that infect human and rodent cell lines, occasionally transform them and cause tumors in animal models. The host cell challenges the virus in multifaceted ways to restrain viral gene expression and DNA replication, and sometimes even eliminates the infected cells by programmed cell death. To combat these challenges, adenoviruses abrogate the cellular DNA damage response pathway. Tip60 is a lysine acetyltransferase that acetylates histones and other proteins to regulate gene expression, DNA damage response, apoptosis and cell cycle regulation. Tip60 is a bona fide tumor suppressor as mice that are haploid for Tip60 are predisposed to tumors. We have discovered that Tip60 is degraded by adenovirus oncoproteins EIB55K and E4orf6 by a proteasome-mediated pathway. Tip60 binds to the immediate early adenovirus promoter and suppresses adenovirus EIA gene expression, which is a master regulator of adenovirus transcription, at least partly through retention of the virally encoded repressor pVII on this promoter. Thus, degradation of Tip60 by the adenoviral early proteins is important for efficient viral early gene transcription and for changes in expression of cellular genes.

Reduced expression of fumarate hydratase in clear cell renal cancer mediates HIF-2α accumulation and promotes migration and invasion.

PubMed

Sudarshan, Sunil; Shanmugasundaram, Karthigayan; Naylor, Susan L; Lin, Shu; Livi, Carolina B; O'Neill, Christine F; Parekh, Dipen J; Yeh, I-Tien; Sun, Lu-Zhe; Block, Karen

2011-01-01

Germline mutations of FH, the gene that encodes for the tricarboxylic acid TCA (TCA) cycle enzyme fumarate hydratase, are associated with an inherited form of cancer referred to as Hereditary Leiomyomatosis and Renal Cell Cancer (HLRCC). Individuals with HLRCC are predisposed to the development of highly malignant and lethal renal cell carcinoma (RCC). The mechanisms of tumorigenesis proposed have largely focused on the biochemical consequences of loss of FH enzymatic activity. While loss of the tumor suppressor gene von Hippel Lindau (VHL) is thought to be an initiating event for the majority of RCCs, a role for FH in sporadic renal cancer has not been explored. Here we report that FH mRNA and protein expression are reduced in clear cell renal cancer, the most common histologic variant of kidney cancer. Moreover, we demonstrate that reduced FH leads to the accumulation of hypoxia inducible factor- 2α (HIF-2α), a transcription factor known to promote renal carcinogenesis. Finally, we demonstrate that overexpression of FH in renal cancer cells inhibits cellular migration and invasion. These data provide novel insights into the tumor suppressor functions of FH in sporadic kidney cancer.

Towards understanding the biological function of hopanoids (Invited)

NASA Astrophysics Data System (ADS)

Doughty, D. M.; Hunter, R.; Summons, R. E.; Newman, D. K.

2010-12-01

Rhodopseudomonas palustris TIE-1 expresses bacterial hopanoid lipids that are structurally similar and evolutionarily related to eukaryotic sterols. The genome of R. palustris TIE-1 contains two copies of the hpnN gene (hpnN1 and hpnN2) that are orthologs of genes encoding eukaryotic sterol and lipid transporters. Hopanoid localization to the outer membrane was found to be dependent upon hpnN1. Since the cell cycle of R. palustris TIE-1 is obligately bimodal with each cell division resulting in the generation of one mother and one swarmer cell, evidence was obtained that hopanoids where specifically localized to the outer membrane of mother cells. The sequestration of hopanoids to the mother cells was also disrupted by the deletion of the hpnN1 gene. Mutants lacking the hopanoid transporters were able to grow normally at 30 °C but showed decreased growth at 38 °C. The hopanoid transporter mutant formed cellular filaments when grown at elevated temperature. Because sedimentary steranes and hopanes comprise some of the earliest evidence for the emergence of distinct bacteria and eukaryotic phyla, a better appreciation of the function of hopanoids will improve our ability to interpret the evolution of life on Earth.

Role of pectolytic enzymes in the programmed separation of cells from the root cap of higher plants. Final report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hawes, M.C.

1995-03-01

The objective of this research was to develop a model system to study border cell separation in transgenic pea roots. In addition, the hypothesis that genes encoding pectolytic enzymes in the root cap play a role in the programmed separation of root border cells from the root tip was tested. The following objectives have been accomplished: (1) the use of transgenic hairy roots to study border cell separation has been optimized for Pisum sativum; (2) a cDNA encoding a root cap pectinmethylesterase (PME) has been cloned; (3) PME and polygalacturonase activities in cell walls of the root cap have beenmore » characterized and shown to be correlated with border cell separation. A fusion gene encoding pectate lyase has also been transformed into pea hairy root cells.« less

A Novel Nonparametric Approach for Neural Encoding and Decoding Models of Multimodal Receptive Fields.

PubMed

Agarwal, Rahul; Chen, Zhe; Kloosterman, Fabian; Wilson, Matthew A; Sarma, Sridevi V

2016-07-01

Pyramidal neurons recorded from the rat hippocampus and entorhinal cortex, such as place and grid cells, have diverse receptive fields, which are either unimodal or multimodal. Spiking activity from these cells encodes information about the spatial position of a freely foraging rat. At fine timescales, a neuron's spike activity also depends significantly on its own spike history. However, due to limitations of current parametric modeling approaches, it remains a challenge to estimate complex, multimodal neuronal receptive fields while incorporating spike history dependence. Furthermore, efforts to decode the rat's trajectory in one- or two-dimensional space from hippocampal ensemble spiking activity have mainly focused on spike history-independent neuronal encoding models. In this letter, we address these two important issues by extending a recently introduced nonparametric neural encoding framework that allows modeling both complex spatial receptive fields and spike history dependencies. Using this extended nonparametric approach, we develop novel algorithms for decoding a rat's trajectory based on recordings of hippocampal place cells and entorhinal grid cells. Results show that both encoding and decoding models derived from our new method performed significantly better than state-of-the-art encoding and decoding models on 6 minutes of test data. In addition, our model's performance remains invariant to the apparent modality of the neuron's receptive field.

Balanced ionotropic receptor dynamics support signal estimation via voltage-dependent membrane noise.

PubMed

Marcoux, Curtis M; Clarke, Stephen E; Nesse, William H; Longtin, Andre; Maler, Leonard

2016-01-01

Encoding behaviorally relevant stimuli in a noisy background is critical for animals to survive in their natural environment. We identify core biophysical and synaptic mechanisms that permit the encoding of low-frequency signals in pyramidal neurons of the weakly electric fish Apteronotus leptorhynchus, an animal that can accurately encode even miniscule amplitude modulations of its self-generated electric field. We demonstrate that slow NMDA receptor (NMDA-R)-mediated excitatory postsynaptic potentials (EPSPs) are able to summate over many interspike intervals (ISIs) of the primary electrosensory afferents (EAs), effectively eliminating the baseline EA ISI correlations from the pyramidal cell input. Together with a dynamic balance of NMDA-R and GABA-A-R currents, this permits stimulus-evoked changes in EA spiking to be transmitted efficiently to target electrosensory lobe (ELL) pyramidal cells, for encoding low-frequency signals. Interestingly, AMPA-R activity is depressed and appears to play a negligible role in the generation of action potentials. Instead, we hypothesize that cell-intrinsic voltage-dependent membrane noise supports the encoding of perithreshold sensory input; this noise drives a significant proportion of pyramidal cell spikes. Together, these mechanisms may be sufficient for the ELL to encode signals near the threshold of behavioral detection. Copyright © 2016 the American Physiological Society.

Deletion of Pofut1 in Mouse Skeletal Myofibers Induces Muscle Aging-Related Phenotypes in cis and in trans

PubMed Central

Zygmunt, Deborah A.; Singhal, Neha; Kim, Mi-Lyang; Cramer, Megan L.; Crowe, Kelly E.; Xu, Rui; Jia, Ying; Adair, Jessica; Martinez-Pena y Valenzuela, Isabel; Akaaboune, Mohammed; White, Peter; Janssen, Paulus M.

2017-01-01

ABSTRACT Sarcopenia, the loss of muscle mass and strength during normal aging, involves coordinate changes in skeletal myofibers and the cells that contact them, including satellite cells and motor neurons. Here we show that the protein O-fucosyltransferase 1 gene (Pofut1), which encodes a glycosyltransferase required for NotchR-mediated cell-cell signaling, has reduced expression in aging skeletal muscle. Moreover, premature postnatal deletion of Pofut1 in skeletal myofibers can induce aging-related phenotypes in cis within skeletal myofibers and in trans within satellite cells and within motor neurons via the neuromuscular junction. Changed phenotypes include reduced skeletal muscle size and strength, decreased myofiber size, increased slow fiber (type 1) density, increased muscle degeneration and regeneration in aged muscles, decreased satellite cell self-renewal and regenerative potential, and increased neuromuscular fragmentation and occasional denervation. Pofut1 deletion in skeletal myofibers reduced NotchR signaling in young adult muscles, but this effect was lost with age. Increasing muscle NotchR signaling also reduced muscle size. Gene expression studies point to regulation of cell cycle genes, muscle myosins, NotchR and Wnt pathway genes, and connective tissue growth factor by Pofut1 in skeletal muscle, with additional effects on α dystroglycan glycosylation. PMID:28265002

Developmentally regulated HEART STOPPER, a mitochondrially targeted L18 ribosomal protein gene, is required for cell division, differentiation, and seed development in Arabidopsis

PubMed Central

Zhang, Hongyu; Luo, Ming; Day, Robert C.; Talbot, Mark J.; Ivanova, Aneta; Ashton, Anthony R.; Chaudhury, Abed M.; Macknight, Richard C.; Hrmova, Maria; Koltunow, Anna M.

2015-01-01

Evidence is presented for the role of a mitochondrial ribosomal (mitoribosomal) L18 protein in cell division, differentiation, and seed development after the characterization of a recessive mutant, heart stopper (hes). The hes mutant produced uncellularized endosperm and embryos arrested at the late globular stage. The mutant embryos differentiated partially on rescue medium with some forming callus. HES (At1g08845) encodes a mitochondrially targeted member of a highly diverged L18 ribosomal protein family. The substitution of a conserved amino residue in the hes mutant potentially perturbs mitoribosomal function via altered binding of 5S rRNA and/or influences the stability of the 50S ribosomal subunit, affecting mRNA binding and translation. Consistent with this, marker genes for mitochondrial dysfunction were up-regulated in the mutant. The slow growth of the endosperm and embryo indicates a defect in cell cycle progression, which is evidenced by the down-regulation of cell cycle genes. The down-regulation of other genes such as EMBRYO DEFECTIVE genes links the mitochondria to the regulation of many aspects of seed development. HES expression is developmentally regulated, being preferentially expressed in tissues with active cell division and differentiation, including developing embryos and the root tips. The divergence of the L18 family, the tissue type restricted expression of HES, and the failure of other L18 members to complement the hes phenotype suggest that the L18 proteins are involved in modulating development. This is likely via heterogeneous mitoribosomes containing different L18 members, which may result in differential mitochondrial functions in response to different physiological situations during development. PMID:26105995

Tumor regression induced by intratumor therapy with a disabled infectious single cycle (DISC) herpes simplex virus (HSV) vector, DISC/HSV/murine granulocyte-macrophage colony-stimulating factor, correlates with antigen-specific adaptive immunity.

PubMed

Ali, Selman A; Lynam, June; McLean, Cornelia S; Entwisle, Claire; Loudon, Peter; Rojas, José M; McArdle, Stephanie E B; Li, Geng; Mian, Shahid; Rees, Robert C

2002-04-01

Direct intratumor injection of a disabled infectious single cycle HSV-2 virus encoding the murine GM-CSF gene (DISC/mGM-CSF) into established murine colon carcinoma CT26 tumors induced a significant delay in tumor growth and complete tumor regression in up to 70% of animals. Pre-existing immunity to HSV did not reduce the therapeutic efficacy of DISC/mGM-CSF, and, when administered in combination with syngeneic dendritic cells, further decreased tumor growth and increased the incidence of complete tumor regression. Direct intratumor injection of DISC/mGM-CSF also inhibited the growth of CT26 tumor cells implanted on the contralateral flank or seeded into the lungs following i.v. injection of tumor cells (experimental lung metastasis). Proliferation of splenocytes in response to Con A was impaired in progressor and tumor-bearer, but not regressor, mice. A potent tumor-specific CTL response was generated from splenocytes of all mice with regressing, but not progressing tumors following in vitro peptide stimulation; this response was specific for the gp70 AH-1 peptide SPSYVYHQF and correlated with IFN-gamma, but not IL-4 cytokine production. Depletion of CD8(+) T cells from regressor splenocytes before in vitro stimulation with the relevant peptide abolished their cytolytic activity, while depletion of CD4(+) T cells only partially inhibited CTL generation. Tumor regression induced by DISC/mGM-CSF virus immunotherapy provides a unique model for evaluating the immune mechanism(s) involved in tumor rejection, upon which tumor immunotherapy regimes may be based.

CDC14A phosphatase is essential for hearing and male fertility in mouse and human.

PubMed

Imtiaz, Ayesha; Belyantseva, Inna A; Beirl, Alisha J; Fenollar-Ferrer, Cristina; Bashir, Rasheeda; Bukhari, Ihtisham; Bouzid, Amal; Shaukat, Uzma; Azaiez, Hela; Booth, Kevin T; Kahrizi, Kimia; Najmabadi, Hossein; Maqsood, Azra; Wilson, Elizabeth A; Fitzgerald, Tracy S; Tlili, Abdelaziz; Olszewski, Rafal; Lund, Merete; Chaudhry, Taimur; Rehman, Atteeq U; Starost, Matthew F; Waryah, Ali M; Hoa, Michael; Dong, Lijin; Morell, Robert J; Smith, Richard J H; Riazuddin, Sheikh; Masmoudi, Saber; Kindt, Katie S; Naz, Sadaf; Friedman, Thomas B

2018-03-01

The Cell Division-Cycle-14 gene encodes a dual-specificity phosphatase necessary in yeast for exit from mitosis. Numerous disparate roles of vertebrate Cell Division-Cycle-14 (CDC14A) have been proposed largely based on studies of cultured cancer cells in vitro. The in vivo functions of vertebrate CDC14A are largely unknown. We generated and analyzed mutations of zebrafish and mouse CDC14A, developed a computational structural model of human CDC14A protein and report four novel truncating and three missense alleles of CDC14A in human families segregating progressive, moderate-to-profound deafness. In five of these families segregating pathogenic variants of CDC14A, deaf males are infertile, while deaf females are fertile. Several recessive mutations of mouse Cdc14a, including a CRISPR/Cas9-edited phosphatase-dead p.C278S substitution, result in substantial perinatal lethality, but survivors recapitulate the human phenotype of deafness and male infertility. CDC14A protein localizes to inner ear hair cell kinocilia, basal bodies and sound-transducing stereocilia. Auditory hair cells of postnatal Cdc14a mutants develop normally, but subsequently degenerate causing deafness. Kinocilia of germ-line mutants of mouse and zebrafish have normal lengths, which does not recapitulate the published cdc14aa knockdown morphant phenotype of short kinocilia. In mutant male mice, degeneration of seminiferous tubules and spermiation defects result in low sperm count, and abnormal sperm motility and morphology. These findings for the first time define a new monogenic syndrome of deafness and male infertility revealing an absolute requirement in vivo of vertebrate CDC14A phosphatase activity for hearing and male fertility.

The mating type-like loci of Candida glabrata.

PubMed

Yáñez-Carrillo, Patricia; Robledo-Márquez, Karina A; Ramírez-Zavaleta, Candy Y; De Las Peñas, Alejandro; Castaño, Irene

2014-01-01

Candida glabrata, a haploid and opportunistic fungal pathogen that has not known sexual cycle, has conserved the majority of the genes required for mating and cell type identity. The C. glabrata genome contains three mating-type-like loci called MTL1, MTL2 and MTL3. The three loci encode putative transcription factors, a1, α1 and α2 that regulate cell type identity and sexual reproduction in other fungi like the closely related Saccharomyces cerevisiae. MTL1 can contain either a or α information. MTL2, which contains a information and MTL3 with α information, are relatively close to two telomeres. MTL1 and MTL2 are transcriptionally active, while MTL3 is subject to an incomplete silencing nucleated at the telomere that depends on the silencing proteins Sir2, Sir3, Sir4, yKu70/80, Rif1, Rap1 and Sum1. C. glabrata does not seem to maintain cell type identity, as cell type-specific genes are expressed regardless of the type (or even absence) of mating information. These data highlight important differences in the control of mating and cell type identity between the non-pathogenic yeast S. cerevisiae and C. glabrata, which might explain the absence of a sexual cycle in C. glabrata. The fact that C. glabrata has conserved the vast majority of the genes involved in mating might suggest that some of these genes perhaps have been rewired to control other processes important for the survival inside the host as a commensal or as a human pathogen. This manuscript is part of the series of works presented at the "V International Workshop: Molecular genetic approaches to the study of human pathogenic fungi" (Oaxaca, Mexico, 2012). Copyright © 2013 Revista Iberoamericana de Micología. Published by Elsevier Espana. All rights reserved.

Biological properties of human skeletal myoblasts genetically modified to simultaneously overexpress the pro-angiogenic factors vascular endothelial growth factor-A and fibroblast growth factor-4.

PubMed

Zimna, A; Janeczek, A; Rozwadowska, N; Fraczek, M; Kucharzewska, P; Rucinski, M; Mietkiewski, T; Kurpisz, M

2014-04-01

Myocardial infarction results in cardiomyocyte loss and may eventually lead to cardiac failure. Skeletal myoblast transplantation into the scar area may compensate for this observed cell loss by strengthening the weakened myocardium and inducing myogenesis. Moreover, skeletal myoblasts may serve as potential transgene carriers for the myocardium (i.e., delivering pro-angiogenic factors, which may potentially improve blood perfusion in infarcted heart). We examined the influence of the simultaneous overexpression of two potent pro-angiogenic factors, fibroblast growth factor-4 (FGF-4) and vascular endothelial growth factor (VEGF), on human primary myoblast proliferation, cell cycle, resistance to hypoxic stress conditions and myogenic gene expression, as well as the induction of pro-angiogenic activities. We used a bicistronic plasmid vector encoding two factors introduced via an efficient myoblast electroporation method. The levels of overexpressed proteins were assessed, and their functionality at capillary formation was evaluated. This combined approach led to a high level of non-viral transient overexpression of both pro-angiogenic proteins, which proved to be potent regulators of blood vessel development assayed in capillary formation tests. We demonstrated in in vitro conditions that the transfection of human skeletal myoblasts with both FGF-4 and VEGF did not affect their basic biological properties such as the cell cycle, proliferation or expression of myogenic lineage-specific genes, and the modified cells adapted to oxidative stress conditions. Overall, the results obtained suggest that the applied combined approach with the use of two pro-angiogenic genes overexpressed in skeletal muscle stem cells may be an interesting alternative for the effective therapy of myocardial infarction in animal models and/or prospective clinical trials.

Hydra myc2, a unique pre-bilaterian member of the myc gene family, is activated in cell proliferation and gametogenesis

PubMed Central

Hartl, Markus; Glasauer, Stella; Valovka, Taras; Breuker, Kathrin; Hobmayer, Bert; Bister, Klaus

2014-01-01

ABSTRACT The myc protooncogene encodes the Myc transcription factor which is the essential part of the Myc–Max network controlling fundamental cellular processes. Deregulation of myc leads to tumorigenesis and is a hallmark of many human cancers. We have recently identified homologs of myc (myc1, myc2) and max in the early diploblastic cnidarian Hydra and have characterized myc1 in detail. Here we show that myc2 is transcriptionally activated in the interstitial stem cell system. Furthermore, in contrast to myc1, myc2 expression is also detectable in proliferating epithelial stem cells throughout the gastric region. myc2 but not myc1 is activated in cycling precursor cells during early oogenesis and spermatogenesis, suggesting that the Hydra Myc2 protein has a possible non-redundant function in cell cycle progression. The Myc2 protein displays the principal design and properties of vertebrate Myc proteins. In complex with Max, Myc2 binds to DNA with similar affinity as Myc1–Max heterodimers. Immunoprecipitation of Hydra chromatin revealed that both Myc1 and Myc2 bind to the enhancer region of CAD, a classical Myc target gene in mammals. Luciferase reporter gene assays showed that Myc1 but not Myc2 transcriptionally activates the CAD promoter. Myc2 has oncogenic potential when tested in primary avian fibroblasts but to a lower degree as compared to Myc1. The identification of an additional myc gene in Cnidaria, a phylum that diverged prior to bilaterians, with characteristic expression patterns in tissue homeostasis and developmental processes suggests that principle functions of myc genes have arisen very early in metazoan evolution. PMID:24771621

Transcriptomic and proteomic dynamics in the metabolism of a diazotrophic cyanobacterium, Cyanothece sp. PCC 7822 during a diurnal light-dark cycle.

PubMed

Welkie, David; Zhang, Xiaohui; Markillie, Meng Lye; Taylor, Ronald; Orr, Galya; Jacobs, Jon; Bhide, Ketaki; Thimmapuram, Jyothi; Gritsenko, Marina; Mitchell, Hugh; Smith, Richard D; Sherman, Louis A

2014-12-29

Cyanothece sp. PCC 7822 is an excellent cyanobacterial model organism with great potential to be applied as a biocatalyst for the production of high value compounds. Like other unicellular diazotrophic cyanobacterial species, it has a tightly regulated metabolism synchronized to the light-dark cycle. Utilizing transcriptomic and proteomic methods, we quantified the relationships between transcription and translation underlying central and secondary metabolism in response to nitrogen free, 12 hour light and 12 hour dark conditions. By combining mass-spectrometry based proteomics and RNA-sequencing transcriptomics, we quantitatively measured a total of 6766 mRNAs and 1322 proteins at four time points across a 24 hour light-dark cycle. Photosynthesis, nitrogen fixation, and carbon storage relevant genes were expressed during the preceding light or dark period, concurrent with measured nitrogenase activity in the late light period. We describe many instances of disparity in peak mRNA and protein abundances, and strong correlation of light dependent expression of both antisense and CRISPR-related gene expression. The proteins for nitrogenase and the pentose phosphate pathway were highest in the dark, whereas those for glycolysis and the TCA cycle were more prominent in the light. Interestingly, one copy of the psbA gene encoding the photosystem II (PSII) reaction center protein D1 (psbA4) was highly upregulated only in the dark. This protein likely cannot catalyze O2 evolution and so may be used by the cell to keep PSII intact during N2 fixation. The CRISPR elements were found exclusively at the ends of the large plasmid and we speculate that their presence is crucial to the maintenance of this plasmid. This investigation of parallel transcriptional and translational activity within Cyanothece sp. PCC 7822 provided quantitative information on expression levels of metabolic pathways relevant to engineering efforts. The identification of expression patterns for both mRNA and protein affords a basis for improving biofuel production in this strain and for further genetic manipulations. Expression analysis of the genes encoded on the 6 plasmids provided insight into the possible acquisition and maintenance of some of these extra-chromosomal elements.

Contribution of stress and sex hormones to memory encoding.

PubMed

Merz, Christian J

2017-08-01

Distinct stages of the menstrual cycle and the intake of oral contraceptives (OC) affect sex hormone levels, stress responses, and memory processes critically involved in the pathogenesis of mental disorders. To characterize the interaction of sex and stress hormones on memory encoding, 30 men, 30 women in the early follicular phase of the menstrual cycle (FO), 30 women in the luteal phase (LU), and 30 OC women were exposed to either a stress (socially evaluated cold-pressor test) or a control condition prior to memory encoding and immediate recall of neutral, positive, and negative words. On the next day, delayed free and cued recall was tested. Sex hormone levels verified distinct estradiol, progesterone, and testosterone levels between groups. Stress increased blood pressure, cortisol concentrations, and ratings of stress appraisal in all four groups as well as cued recall performance of negative words in men. Stress exposure in OC women led to a blunted cortisol response and rather enhanced cued recall of neutral words. Thus, pre-encoding stress facilitated emotional cued recall performance in men only, but not women with different sex hormone statuses pointing to the pivotal role of circulating sex hormones in modulation of learning and memory processes. Copyright © 2017 Elsevier Ltd. All rights reserved.

Characterization and functional analysis of a slow-cycling subpopulation in colorectal cancer enriched by cell cycle inducer combined chemotherapy.

PubMed

Wu, Feng-Hua; Mu, Lei; Li, Xiao-Lan; Hu, Yi-Bing; Liu, Hui; Han, Lin-Tao; Gong, Jian-Ping

2017-10-03

The concept of cancer stem cells has been proposed in various malignancies including colorectal cancer. Recent studies show direct evidence for quiescence slow-cycling cells playing a role in cancer stem cells. There exists an urgent need to isolate and better characterize these slow-cycling cells. In this study, we developed a new model to enrich slow-cycling tumor cells using cell-cycle inducer combined with cell cycle-dependent chemotherapy in vitro and in vivo . Our results show that Short-term exposure of colorectal cancer cells to chemotherapy combined with cell-cycle inducer enriches for a cell-cycle quiescent tumor cell population. Specifically, these slow-cycling tumor cells exhibit increased chemotherapy resistance in vitro and tumorigenicity in vivo . Notably, these cells are stem-cell like and participate in metastatic dormancy. Further exploration indicates that slow-cycling colorectal cancer cells in our model are less sensitive to cytokine-induced-killer cell mediated cytotoxic killing in vivo and in vitro . Collectively, our cell cycle inducer combined chemotherapy exposure model enriches for a slow-cycling, dormant, chemo-resistant tumor cell sub-population that are resistant to cytokine induced killer cell based immunotherapy. Studying unique signaling pathways in dormant tumor cells enriched by cell cycle inducer combined chemotherapy treatment is expected to identify novel therapeutic targets for preventing tumor recurrence.

Characterization and functional analysis of a slow-cycling subpopulation in colorectal cancer enriched by cell cycle inducer combined chemotherapy

PubMed Central

Wu, Feng-Hua; Mu, Lei; Li, Xiao-Lan; Hu, Yi-Bing; Liu, Hui; Han, Lin-Tao; Gong, Jian-Ping

2017-01-01

The concept of cancer stem cells has been proposed in various malignancies including colorectal cancer. Recent studies show direct evidence for quiescence slow-cycling cells playing a role in cancer stem cells. There exists an urgent need to isolate and better characterize these slow-cycling cells. In this study, we developed a new model to enrich slow-cycling tumor cells using cell-cycle inducer combined with cell cycle-dependent chemotherapy in vitro and in vivo. Our results show that Short-term exposure of colorectal cancer cells to chemotherapy combined with cell-cycle inducer enriches for a cell-cycle quiescent tumor cell population. Specifically, these slow-cycling tumor cells exhibit increased chemotherapy resistance in vitro and tumorigenicity in vivo. Notably, these cells are stem-cell like and participate in metastatic dormancy. Further exploration indicates that slow-cycling colorectal cancer cells in our model are less sensitive to cytokine-induced-killer cell mediated cytotoxic killing in vivo and in vitro. Collectively, our cell cycle inducer combined chemotherapy exposure model enriches for a slow-cycling, dormant, chemo-resistant tumor cell sub-population that are resistant to cytokine induced killer cell based immunotherapy. Studying unique signaling pathways in dormant tumor cells enriched by cell cycle inducer combined chemotherapy treatment is expected to identify novel therapeutic targets for preventing tumor recurrence. PMID:29108242

Polo boxes and Cut23 (Apc8) mediate an interaction between polo kinase and the anaphase-promoting complex for fission yeast mitosis

PubMed Central

May, Karen M.; Reynolds, Nicola; Cullen, C. Fiona; Yanagida, Mitsuhiro; Ohkura, Hiroyuki

2002-01-01

The fission yeast plo1 + gene encodes a polo-like kinase, a member of a conserved family of kinases which play multiple roles during the cell cycle. We show that Plo1 kinase physically interacts with the anaphase-promoting complex (APC)/cyclosome through the noncatalytic domain of Plo1 and the tetratricopeptide repeat domain of the subunit, Cut23. A new cut23 mutation, which specifically disrupts the interaction with Plo1, results in a metaphase arrest. This arrest can be rescued by high expression of Plo1 kinase. We suggest that this physical interaction is crucial for mitotic progression by targeting polo kinase activity toward the APC. PMID:11777938

Cellular localization and expression of template-activating factor I in different cell types.

PubMed

Nagata, K; Saito, S; Okuwaki, M; Kawase, H; Furuya, A; Kusano, A; Hanai, N; Okuda, A; Kikuchi, A

1998-05-01

Template-activating factors I (TAF-I) alpha and beta have been identified as chromatin remodeling factors from human HeLa cells. TAF-I beta corresponds to the protein encoded by the set gene, which was found in an acute undifferentiated leukemia as a fusion version with the can gene via chromosomal translocation. To determine the localization of TAF-I, we raised both polyclonal and monoclonal antibodies against TAF-I. The proteins that react to the antibodies are present not only in human cells but also in mouse, frog, insect, and yeast cells. The mouse TAF-I homologue is ubiquitous in a variety of tissue cells, including liver, kidney, spleen, lung, heart, and brain. It is of interest that the amounts of TAF-I alpha and beta vary among hemopoietic cells and some specific cell types do not contain TAF-I alpha. The level of the TAF-I proteins does not change significantly during the cell cycle progression in either HeLa cells synchronized with an excess concentration of thymidine or NIH 3T3 cells released from the serum-depleted state. TAF-I is predominantly located in nuclei, while TAF-I that is devoid of its acidic region, the region which is essential for the TAF-I activity, shows both nuclear and cytoplasmic localization. The localization of TAF-I in conjunction with the regulation of its activity is discussed.

Integration of adeno-associated virus vectors in CD34+ human hematopoietic progenitor cells after transduction.

PubMed

Fisher-Adams, G; Wong, K K; Podsakoff, G; Forman, S J; Chatterjee, S

1996-07-15

Gene transfer vectors based on adeno-associated virus (AAV) appear promising because of their high transduction frequencies regardless of cell cycle status and ability to integrate into chromosomal DNA. We tested AAV-mediated gene transfer into a panel of human bone marrow or umbilical cord-derived CD34+ hematopoietic progenitor cells, using vectors encoding several transgenes under the control of viral and cellular promoters. Gene transfer was evaluated by (1) chromosomal integration of vector sequences and (2) analysis of transgene expression. Southern hybridization and fluorescence in situ hybridization analysis of transduced CD34 genomic DNA showed the presence of integrated vector sequences in chromosomal DNA in a portion of transduced cells and showed that integrated vector sequences were replicated along with cellular DNA during mitosis. Transgene expression in transduced CD34 cells in suspension cultures and in myeloid colonies differentiating in vitro from transduced CD34 cells approximated that predicted by the multiplicity of transduction. This was true in CD34 cells from different donors, regardless of the transgene or selective pressure. Comparisons of CD34 cell transduction either before or after cytokine stimulation showed similar gene transfer frequencies. Our findings suggest that AAV transduction of CD34+ hematopoietic progenitor cells is efficient, can lead to stable integration in a population of transduced cells, and may therefore provide the basis for safe and efficient ex vivo gene therapy of the hematopoietic system.

Encoding of Tactile Stimuli by Mechanoreceptors and Interneurons of the Medicinal Leech

PubMed Central

Kretzberg, Jutta; Pirschel, Friederice; Fathiazar, Elham; Hilgen, Gerrit

2016-01-01

For many animals processing of tactile information is a crucial task in behavioral contexts like exploration, foraging, and stimulus avoidance. The leech, having infrequent access to food, developed an energy efficient reaction to tactile stimuli, avoiding unnecessary muscle movements: The local bend behavior moves only a small part of the body wall away from an object touching the skin, while the rest of the animal remains stationary. Amazingly, the precision of this localized behavioral response is similar to the spatial discrimination threshold of the human fingertip, although the leech skin is innervated by an order of magnitude fewer mechanoreceptors and each midbody ganglion contains only 400 individually identified neurons in total. Prior studies suggested that this behavior is controlled by a three-layered feed-forward network, consisting of four mechanoreceptors (P cells), approximately 20 interneurons and 10 individually characterized motor neurons, all of which encode tactile stimulus location by overlapping, symmetrical tuning curves. Additionally, encoding of mechanical force was attributed to three types of mechanoreceptors reacting to distinct intensity ranges: T cells for touch, P cells for pressure, and N cells for strong, noxious skin stimulation. In this study, we provide evidences that tactile stimulus encoding in the leech is more complex than previously thought. Combined electrophysiological, anatomical, and voltage sensitive dye approaches indicate that P and T cells both play a major role in tactile information processing resulting in local bending. Our results indicate that tactile encoding neither relies on distinct force intensity ranges of different cell types, nor location encoding is restricted to spike count tuning. Instead, we propose that P and T cells form a mixed type population, which simultaneously employs temporal response features and spike counts for multiplexed encoding of touch location and force intensity. This hypothesis is supported by our finding that previously identified local bend interneurons receive input from both P and T cells. Some of these interneurons seem to integrate mechanoreceptor inputs, while others appear to use temporal response cues, presumably acting as coincidence detectors. Further voltage sensitive dye studies can test these hypotheses how a tiny nervous system performs highly precise stimulus processing. PMID:27840612

The cerebellum for jocks and nerds alike.

PubMed

Popa, Laurentiu S; Hewitt, Angela L; Ebner, Timothy J

2014-01-01

Historically the cerebellum has been implicated in the control of movement. However, the cerebellum's role in non-motor functions, including cognitive and emotional processes, has also received increasing attention. Starting from the premise that the uniform architecture of the cerebellum underlies a common mode of information processing, this review examines recent electrophysiological findings on the motor signals encoded in the cerebellar cortex and then relates these signals to observations in the non-motor domain. Simple spike firing of individual Purkinje cells encodes performance errors, both predicting upcoming errors as well as providing feedback about those errors. Further, this dual temporal encoding of prediction and feedback involves a change in the sign of the simple spike modulation. Therefore, Purkinje cell simple spike firing both predicts and responds to feedback about a specific parameter, consistent with computing sensory prediction errors in which the predictions about the consequences of a motor command are compared with the feedback resulting from the motor command execution. These new findings are in contrast with the historical view that complex spikes encode errors. Evaluation of the kinematic coding in the simple spike discharge shows the same dual temporal encoding, suggesting this is a common mode of signal processing in the cerebellar cortex. Decoding analyses show the considerable accuracy of the predictions provided by Purkinje cells across a range of times. Further, individual Purkinje cells encode linearly and independently a multitude of signals, both kinematic and performance errors. Therefore, the cerebellar cortex's capacity to make associations across different sensory, motor and non-motor signals is large. The results from studying how Purkinje cells encode movement signals suggest that the cerebellar cortex circuitry can support associative learning, sequencing, working memory, and forward internal models in non-motor domains.

The cerebellum for jocks and nerds alike

PubMed Central

Popa, Laurentiu S.; Hewitt, Angela L.; Ebner, Timothy J.

2014-01-01

Historically the cerebellum has been implicated in the control of movement. However, the cerebellum's role in non-motor functions, including cognitive and emotional processes, has also received increasing attention. Starting from the premise that the uniform architecture of the cerebellum underlies a common mode of information processing, this review examines recent electrophysiological findings on the motor signals encoded in the cerebellar cortex and then relates these signals to observations in the non-motor domain. Simple spike firing of individual Purkinje cells encodes performance errors, both predicting upcoming errors as well as providing feedback about those errors. Further, this dual temporal encoding of prediction and feedback involves a change in the sign of the simple spike modulation. Therefore, Purkinje cell simple spike firing both predicts and responds to feedback about a specific parameter, consistent with computing sensory prediction errors in which the predictions about the consequences of a motor command are compared with the feedback resulting from the motor command execution. These new findings are in contrast with the historical view that complex spikes encode errors. Evaluation of the kinematic coding in the simple spike discharge shows the same dual temporal encoding, suggesting this is a common mode of signal processing in the cerebellar cortex. Decoding analyses show the considerable accuracy of the predictions provided by Purkinje cells across a range of times. Further, individual Purkinje cells encode linearly and independently a multitude of signals, both kinematic and performance errors. Therefore, the cerebellar cortex's capacity to make associations across different sensory, motor and non-motor signals is large. The results from studying how Purkinje cells encode movement signals suggest that the cerebellar cortex circuitry can support associative learning, sequencing, working memory, and forward internal models in non-motor domains. PMID:24987338

Murine Gammaherpesvirus 68 LANA and SOX Homologs Counteract ATM-Driven p53 Activity during Lytic Viral Replication

PubMed Central

Sifford, Jeffrey M.; Stahl, James A.; Salinas, Eduardo

2015-01-01

ABSTRACT Tumor suppressor p53 is activated in response to numerous cellular stresses, including viral infection. However, whether murine gammaherpesvirus 68 (MHV68) provokes p53 during the lytic replication cycle has not been extensively evaluated. Here, we demonstrate that MHV68 lytic infection induces p53 phosphorylation and stabilization in a manner that is dependent on the DNA damage response (DDR) kinase ataxia telangiectasia mutated (ATM). The induction of p53 during MHV68 infection occurred in multiple cell types, including splenocytes of infected mice. ATM and p53 activation required early viral gene expression but occurred independently of viral DNA replication. At early time points during infection, p53-responsive cellular genes were induced, coinciding with p53 stabilization and phosphorylation. However, p53-related gene expression subsided as infection progressed, even though p53 remained stable and phosphorylated. Infected cells also failed to initiate p53-dependent gene expression and undergo apoptosis in response to treatment with exogenous p53 agonists. The inhibition of p53 responses during infection required the expression of the MHV68 homologs of the shutoff and exonuclease protein (muSOX) and latency-associated nuclear antigen (mLANA). Interestingly, mLANA, but not muSOX, was necessary to prevent p53-mediated death in MHV68-infected cells under the conditions tested. This suggests that muSOX and mLANA are differentially required for inhibiting p53 in specific settings. These data reveal that DDR responses triggered by MHV68 infection promote p53 activation. However, MHV68 encodes at least two proteins capable of limiting the potential consequences of p53 function. IMPORTANCE Gammaherpesviruses are oncogenic herpesviruses that establish lifelong chronic infections. Defining how gammaherpesviruses overcome host responses to infection is important for understanding how these viruses infect and cause disease. Here, we establish that murine gammaherpesvirus 68 induces the activation of tumor suppressor p53. p53 activation was dependent on the DNA damage response kinase ataxia telangiectasia mutated. Although active early after infection, p53 became dominantly inhibited as the infection cycle progressed. Viral inhibition of p53 was mediated by the murine gammaherpesvirus 68 homologs of muSOX and mLANA. The inhibition of the p53 pathway enabled infected cells to evade p53-mediated cell death responses. These data demonstrate that a gammaherpesvirus encodes multiple proteins to limit p53-mediated responses to productive viral infection, which likely benefits acute viral replication and the establishment of chronic infection. PMID:26676792

Cell culture compositions

DOEpatents

Dunn-Coleman, Nigel; Goedegebuur, Frits; Ward, Michael; Yiao, Jian

2014-03-18

The present invention provides a novel endoglucanase nucleic acid sequence, designated egl6 (SEQ ID NO:1 encodes the full length endoglucanase; SEQ ID NO:4 encodes the mature form), and the corresponding endoglucanase VI amino acid sequence ("EGVI"; SEQ ID NO:3 is the signal sequence; SEQ ID NO:2 is the mature sequence). The invention also provides expression vectors and host cells comprising a nucleic acid sequence encoding EGVI, recombinant EGVI proteins and methods for producing the same.

A Novel Human Ghrelin Variant (In1-Ghrelin) and Ghrelin-O-Acyltransferase Are Overexpressed in Breast Cancer: Potential Pathophysiological Relevance

PubMed Central

Gahete, Manuel D.; Córdoba-Chacón, José; Hergueta-Redondo, Marta; Martínez-Fuentes, Antonio J.; Kineman, Rhonda D.; Moreno-Bueno, Gema

2011-01-01

The human ghrelin gene, which encodes the ghrelin and obestatin peptides, contains 5 exons (Ex), with Ex1-Ex4 encoding a 117 amino-acid (aa) preproprotein that is known to be processed to yield a 28-aa (ghrelin) and/or a 23-aa (obestatin) mature peptides, which possess biological activities in multiple tissues. However, the ghrelin gene also encodes additional peptides through alternative splicing or post-translational modifications. Indeed, we previously identified a spliced mRNA ghrelin variant in mouse (In2-ghrelin-variant), which is regulated in a tissue-dependent manner by metabolic status and may thus be of biological relevance. Here, we have characterized a new human ghrelin variant that contains Ex0-1, intron (In) 1, and Ex2 and lacks Ex3-4. This human In1-ghrelin variant would encode a new prepropeptide that conserves the first 12aa of native-ghrelin (including the Ser3-potential octanoylation site) but has a different C-terminal tail. Expression of In1-variant was detected in 22 human tissues and its levels were positively correlated with those of ghrelin-O-acyltransferase (GOAT; p = 0.0001) but not with native-ghrelin expression, suggesting that In1-ghrelin could be a primary substrate for GOAT in human tissues. Interestingly, levels of In1-ghrelin variant expression in breast cancer samples were 8-times higher than those of normal mammary tissue, and showed a strong correlation in breast tumors with GOAT (p = 0.0001), ghrelin receptor-type 1b (GHSR1b; p = 0.049) and cyclin-D3 (a cell-cycle inducer/proliferation marker; p = 0.009), but not with native-ghrelin or GHSR1a expression. Interestingly, In1-ghrelin variant overexpression increased basal proliferation of MDA-MB-231 breast cancer cells. Taken together, our results provide evidence that In1-ghrelin is a novel element of the ghrelin family with a potential pathophysiological role in breast cancer. PMID:21829727

Hepatitis C Virus core+1/ARF Protein Modulates the Cyclin D1/pRb Pathway and Promotes Carcinogenesis.

PubMed

Moustafa, Savvina; Karakasiliotis, Ioannis; Mavromara, Penelope

2018-05-01

Viruses often encompass overlapping reading frames and unconventional translation mechanisms in order to maximize the output from a minimum genome and to orchestrate their timely gene expression. Hepatitis C virus (HCV) possesses such an unconventional open reading frame (ORF) within the core-coding region, encoding an additional protein, initially designated ARFP, F, or core+1. Two predominant isoforms of core+1/ARFP have been reported, core+1/L, initiating from codon 26, and core+1/S, initiating from codons 85/87 of the polyprotein coding region. The biological significance of core+1/ARFP expression remains elusive. The aim of the present study was to gain insight into the functional and pathological properties of core+1/ARFP through its interaction with the host cell, combining in vitro and in vivo approaches. Our data provide strong evidence that the core+1/ARFP of HCV-1a stimulates cell proliferation in Huh7-based cell lines expressing either core+1/S or core+1/L isoforms and in transgenic liver disease mouse models expressing core+1/S protein in a liver-specific manner. Both isoforms of core+1/ARFP increase the levels of cyclin D1 and phosphorylated Rb, thus promoting the cell cycle. In addition, core+1/S was found to enhance liver regeneration and oncogenesis in transgenic mice. The induction of the cell cycle together with increased mRNA levels of cell proliferation-related oncogenes in cells expressing the core+1/ARFP proteins argue for an oncogenic potential of these proteins and an important role in HCV-associated pathogenesis. IMPORTANCE This study sheds light on the biological importance of a unique HCV protein. We show here that core+1/ARFP of HCV-1a interacts with the host machinery, leading to acceleration of the cell cycle and enhancement of liver carcinogenesis. This pathological mechanism(s) may complement the action of other viral proteins with oncogenic properties, leading to the development of hepatocellular carcinoma. In addition, given that immunological responses to core+1/ARFP have been correlated with liver disease severity in chronic HCV patients, we expect that the present work will assist in clarifying the pathophysiological relevance of this protein as a biomarker of disease progression. Copyright © 2018 American Society for Microbiology.

The bglA Gene of Aspergillus kawachii Encodes Both Extracellular and Cell Wall-Bound β-Glucosidases

PubMed Central

Iwashita, Kazuhiro; Nagahara, Tatsuya; Kimura, Hitoshi; Takano, Makoto; Shimoi, Hitoshi; Ito, Kiyoshi

1999-01-01

We cloned the genomic DNA and cDNA of bglA, which encodes β-glucosidase in Aspergillus kawachii, based on a partial amino acid sequence of purified cell wall-bound β-glucosidase CB-1. The nucleotide sequence of the cloned bglA gene revealed a 2,933-bp open reading frame with six introns that encodes an 860-amino-acid protein. Based on the deduced amino acid sequence, we concluded that the bglA gene encodes cell wall-bound β-glucosidase CB-1. The amino acid sequence exhibited high levels of homology with the amino acid sequences of fungal β-glucosidases classified in subfamily B. We expressed the bglA cDNA in Saccharomyces cerevisiae and detected the recombinant β-glucosidase in the periplasm fraction of the recombinant yeast. A. kawachii can produce two extracellular β-glucosidases (EX-1 and EX-2) in addition to the cell wall-bound β-glucosidase. A. kawachii in which the bglA gene was disrupted produced none of the three β-glucosidases, as determined by enzyme assays and a Western blot analysis. Thus, we concluded that the bglA gene encodes both extracellular and cell wall-bound β-glucosidases in A. kawachii. PMID:10584016

Biochemical Validation of the Glyoxylate Cycle in the Cyanobacterium Chlorogloeopsis fritschii Strain PCC 9212.

PubMed

Zhang, Shuyi; Bryant, Donald A

2015-05-29

Cyanobacteria are important photoautotrophic bacteria with extensive but variable metabolic capacities. The existence of the glyoxylate cycle, a variant of the TCA cycle, is still poorly documented in cyanobacteria. Previous studies reported the activities of isocitrate lyase and malate synthase, the key enzymes of the glyoxylate cycle in some cyanobacteria, but other studies concluded that these enzymes are missing. In this study the genes encoding isocitrate lyase and malate synthase from Chlorogloeopsis fritschii PCC 9212 were identified, and the recombinant enzymes were biochemically characterized. Consistent with the presence of the enzymes of the glyoxylate cycle, C. fritschii could assimilate acetate under both light and dark growth conditions. Transcript abundances for isocitrate lyase and malate synthase increased, and C. fritschii grew faster, when the growth medium was supplemented with acetate. Adding acetate to the growth medium also increased the yield of poly-3-hydroxybutyrate. When the genes encoding isocitrate lyase and malate synthase were expressed in Synechococcus sp. PCC 7002, the acetate assimilation capacity of the resulting strain was greater than that of wild type. Database searches showed that the genes for the glyoxylate cycle exist in only a few other cyanobacteria, all of which are able to fix nitrogen. This study demonstrates that the glyoxylate cycle exists in a few cyanobacteria, and that this pathway plays an important role in the assimilation of acetate for growth in one of those organisms. The glyoxylate cycle might play a role in coordinating carbon and nitrogen metabolism under conditions of nitrogen fixation. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

High resolution extensometer based on optical encoder for measurement of small landslide displacements

NASA Astrophysics Data System (ADS)

Afandi, M. I.; Adinanta, H.; Setiono, A.; Qomaruddin; Widiyatmoko, B.

2018-03-01

There are many ways to measure landslide displacement using sensors such as multi-turn potentiometer, fiber optic strain sensor, GPS, geodetic measurement, ground penetrating radar, etc. The proposed way is to use an optical encoder that produces pulse signal with high stability of measurement resolution despite voltage source instability. The landslide measurement using extensometer based on optical encoder has the ability of high resolution for wide range measurement and for a long period of time. The type of incremental optical encoder provides information about the pulse and direction of a rotating shaft by producing quadrature square wave cycle per increment of shaft movement. The result of measurement using 2,000 pulses per resolution of optical encoder has been obtained. Resolution of extensometer is 36 μm with speed limit of about 3.6 cm/s. System test in hazard landslide area has been carried out with good reliability for small landslide displacement monitoring.

A novel approach of an absolute coding pattern based on Hamiltonian graph

NASA Astrophysics Data System (ADS)

Wang, Ya'nan; Wang, Huawei; Hao, Fusheng; Liu, Liqiang

2017-02-01

In this paper, a novel approach of an optical type absolute rotary encoder coding pattern is presented. The concept is based on the principle of the absolute encoder to find out a unique sequence that ensures an unambiguous shaft position of any angular. We design a single-ring and a n-by-2 matrix absolute encoder coding pattern by using the variations of Hamiltonian graph principle. 12 encoding bits is used in the single-ring by a linear array CCD to achieve an 1080-position cycle encoding. Besides, a 2-by-2 matrix is used as an unit in the 2-track disk to achieve a 16-bits encoding pattern by using an area array CCD sensor (as a sample). Finally, a higher resolution can be gained by an electronic subdivision of the signals. Compared with the conventional gray or binary code pattern (for a 2n resolution), this new pattern has a higher resolution (2n*n) with less coding tracks, which means the new pattern can lead to a smaller encoder, which is essential in the industrial production.

Influence of RNase E deficiency on the production of stx2-bearing phages and Shiga toxin in an RNase E-inducible strain of enterohaemorrhagic Escherichia coli (EHEC) O157:H7.

PubMed

Thuraisamy, Thujitha; Lodato, Patricia B

2018-05-01

In enterohaemorrhagic Escherichia coli (EHEC), stx1 or stx2 genes encode Shiga toxin (Stx1 or Stx2, respectively) and are carried by prophages. The production and release of both stx phages and toxin occur upon initiation of the phage lytic cycle. Phages can further disseminate stx genes by infecting naïve bacteria in the intestine. Here, the effect of RNase E deficiency on these two virulence traits was investigated. Cultures of the EHEC strains TEA028-rne containing low versus normal RNase E levels or the parental strain (TEA028) were treated with mitomycin C (MMC) to induce the phage lytic cycle. Phages and Stx2 titres were quantified by the double-agar assay and the receptor ELISA technique, respectively. RNase E deficiency in MMC-treated cells significantly reduced the yield of infectious stx2 phages. Delayed cell lysis and the appearance of encapsidated phage DNA copies suggest a slow onset of the lytic cycle. However, these observations do not entirely explain the decrease of phage yields. stx1 phages were not detected under normal or deficient RNase E levels. After an initial delay, high levels of toxin were finally produced in MMC-treated cultures. RNase E scarcity reduces stx2 phage production but not toxin. Normal concentrations of RNase E are likely required for correct phage morphogenesis. Our future work will address the mechanism of RNase E action on phage morphogenesis.

Directed evolution of polymerase function by compartmentalized self-replication.

PubMed

Ghadessy, F J; Ong, J L; Holliger, P

2001-04-10

We describe compartmentalized self-replication (CSR), a strategy for the directed evolution of enzymes, especially polymerases. CSR is based on a simple feedback loop consisting of a polymerase that replicates only its own encoding gene. Compartmentalization serves to isolate individual self-replication reactions from each other. In such a system, adaptive gains directly (and proportionally) translate into genetic amplification of the encoding gene. CSR has applications in the evolution of polymerases with novel and useful properties. By using three cycles of CSR, we obtained variants of Taq DNA polymerase with 11-fold higher thermostability than the wild-type enzyme or with a >130-fold increased resistance to the potent inhibitor heparin. Insertion of an extra stage into the CSR cycle before the polymerase reaction allows its application to enzymes other than polymerases. We show that nucleoside diphosphate kinase and Taq polymerase can form such a cooperative CSR cycle based on reciprocal catalysis, whereby nucleoside diphosphate kinase produces the substrates required for the replication of its own gene. We also find that in CSR the polymerase genes themselves evolve toward more efficient replication. Thus, polymerase genes and their encoded polypeptides cooperate to maximize postselection copy number. CSR should prove useful for the directed evolution of enzymes, particularly DNA or RNA polymerases, as well as for the design and study of in vitro self-replicating systems mimicking prebiotic evolution and viral replication.

Single-cell heterogeneity and cell-cycle-related viral gene bursts in the human leukaemia virus HTLV-1

PubMed Central

Billman, Martin R; Rueda, David; Bangham, Charles R M

2017-01-01

Background: The human leukaemia virus HTLV-1 expresses essential accessory genes that manipulate the expression, splicing and transport of viral mRNAs.  Two of these genes, tax and hbz, also promote proliferation of the infected cell, and both genes are thought to contribute to oncogenesis in adult T-cell leukaemia/lymphoma.  The regulation of HTLV-1 proviral latency is not understood.  tax, on the proviral plus strand, is usually silent in freshly-isolated cells, whereas the minus-strand-encoded hbz gene is persistently expressed at a low level.  However, the persistently activated host immune response to Tax indicates frequent expression of tax in vivo.  Methods: We used single-molecule RNA-FISH to quantify the expression of HTLV-1 transcripts at the single-cell level in a total of >19,000 cells from five T-cell clones, naturally infected with HTLV-1, isolated by limiting dilution from peripheral blood of HTLV-1-infected subjects.  Results: We found strong heterogeneity both within and between clones in the expression of the proviral plus-strand (detected by hybridization to the tax gene) and the minus-strand ( hbz gene). Both genes are transcribed in bursts; tax expression is enhanced in the absence of hbz, while hbz expression increased in cells with high tax expression. Surprisingly, we found that hbz expression is strongly associated with the S and G 2/M phases of the cell cycle, independent of tax expression.  Contrary to current belief, hbz is not expressed in all cells at all times, even within one clone.  In hbz-positive cells, the abundance of hbz transcripts showed a very strong positive linear correlation with nuclear volume. Conclusions: The occurrence of intense, intermittent plus-strand gene bursts in independent primary HTLV-1-infected T-cell clones from unrelated individuals strongly suggests that the HTLV-1 plus-strand is expressed in bursts in vivo.  Our results offer an explanation for the paradoxical correlations observed between the host immune response and HTLV-1 transcription. PMID:29062917

Cerebellar granule cells encode the expectation of reward

PubMed Central

Wagner, Mark J; Kim, Tony Hyun; Savall, Joan; Schnitzer, Mark J; Luo, Liqun

2017-01-01

The human brain contains ~60 billion cerebellar granule cells1, which outnumber all other neurons combined. Classical theories posit that a large, diverse population of granule cells allows for highly detailed representations of sensorimotor context, enabling downstream Purkinje cells to sense fine contextual changes2–6. Although evidence suggests a role for cerebellum in cognition7–10, granule cells are known to encode only sensory11–13 and motor14 context. Using two-photon calcium imaging in behaving mice, here we show that granule cells convey information about the expectation of reward. Mice initiated voluntary forelimb movements for delayed water reward. Some granule cells responded preferentially to reward or reward omission, whereas others selectively encoded reward anticipation. Reward responses were not restricted to forelimb movement, as a Pavlovian task evoked similar responses. Compared to predictable rewards, unexpected rewards elicited markedly different granule cell activity despite identical stimuli and licking responses. In both tasks, reward signals were widespread throughout multiple cerebellar lobules. Tracking the same granule cells over several days of learning revealed that cells with reward-anticipating responses emerged from those that responded at the start of learning to reward delivery, whereas reward omission responses grew stronger as learning progressed. The discovery of predictive, non-sensorimotor encoding in granule cells is a major departure from current understanding of these neurons and dramatically enriches contextual information available to postsynaptic Purkinje cells, with important implications for cognitive processing in the cerebellum. PMID:28321129

Cyclic stretch-induced the cytoskeleton rearrangement and gene expression of cytoskeletal regulators in human periodontal ligament cells.

PubMed

Wu, Yaqin; Zhuang, Jiabao; Zhao, Dan; Zhang, Fuqiang; Ma, Jiayin; Xu, Chun

2017-10-01

This study aimed to explore the mechanism of the stretch-induced cell realignment and cytoskeletal rearrangement by identifying several mechanoresponsive genes related to cytoskeletal regulators in human PDL cells. After the cells were stretched by 1, 10 and 20% strains for 0.5, 1, 2, 4, 6, 12 or 24 h, the changes of the morphology and content of microfilaments were recorded and calculated. Meanwhile, the expression of 84 key genes encoding cytoskeletal regulators after 6 and 24 h stretches with 20% strain was detected by using real-time PCR array. Western blot was applied to identify the protein expression level of several cytoskeletal regulators encoded by these differentially expressed genes. The confocal fluorescent staining results confirmed that stretch-induced realignment of cells and rearrangement of microfilaments. Among the 84 genes screened, one gene was up-regulated while two genes were down-regulated after 6 h stretch. Meanwhile, three genes were up-regulated while two genes were down-regulated after 24 h stretch. These genes displaying differential expression included genes regulating polymerization/depolymerization of microfilaments (CDC42EP2, FNBP1L, NCK2, PIKFYVE, WASL), polymerization/depolymerization of microtubules (STMN1), interacting between microfilaments and microtubules (MACF1), as well as a phosphatase (PPP1R12B). Among the proteins encoded by these genes, the protein expression level of Cdc42 effector protein-2 (encoded by CDC42EP2) and Stathmin-1 (encoded by STMN1) was down-regulated, while the protein expression level of N-WASP (encoded by WASL) was up-regulated. The present study confirmed the cyclic stretch-induced cellular realignment and rearrangement of microfilaments in the human PDL cells and indicated several force-sensitive genes with regard to cytoskeletal regulators.

Measuring sickle cell morphology in flow using spectrally encoded flow cytometry (Conference Presentation)

NASA Astrophysics Data System (ADS)

Kviatkovsky, Inna; Zeidan, Adel; Yeheskely-Hayon, Daniella; Dann, Eldad J.; Yelin, Dvir

2017-02-01

During a sickle cell crisis in sickle cell anemia patients, deoxygenated red blood cells may change their mechanical properties and block small blood vessels, causing pain, local tissue damage and even organ failure. Measuring these cellular structural and morphological changes is important for understanding the factors contributing to vessel blockage and developing an effective treatment. In this work, we use spectrally encoded flow cytometry for confocal, high-resolution imaging of flowing blood cells from sickle cell anemia patients. A wide variety of cell morphologies were observed by analyzing the interference patterns resulting from reflections from the front and back faces of the cells' membrane. Using numerical simulation for calculating the two-dimensional reflection pattern from the cells, we propose an analytical expression for the three-dimensional shape of a characteristic sickle cell and compare it to a previous from the literature. In vitro spectrally encoded flow cytometry offers new means for analyzing the morphology of sickle cells in stress-free environment, and could provide an effective tool for studying the unique physiological properties of these cells.