Engineering the metal sensitive sites in Macrolampis sp2 firefly luciferase and use as a novel bioluminescent ratiometric biosensor for heavy metals.

PubMed

Gabriel, Gabriele V M; Viviani, Vadim R

2016-12-01

Most luminescent biosensors for heavy metals are fluorescent and rely on intensity measurements, whereas a few are ratiometric and rely on spectral changes. Bioluminescent biosensors for heavy metals are less common. Firefly luciferases have been coupled to responsive promoters for mercury and arsenium, and used as light on biosensors. Firefly luciferase bioluminescence spectrum is naturally sensitive to heavy metal cations such as zinc and mercury and to pH. Although pH sensitivity of firefly luciferases was shown to be useful for ratiometric estimation of intracellular pH, its potential use for ratiometric estimation of heavy metals was never considered. Using the yellow-emitting Macrolampis sp2 firefly luciferase and site-directed mutagenesis, we show that the residues H310 and E354 constitute two critical sites for metal sensitivity that can be engineered to increase sensitivity to zinc, nickel, and mercury. A linear relationship between cation concentration and the ratio of bioluminescence intensities at 550 and 610 nm allowed, for the first time, the ratiometric estimation of heavy metals concentrations down to 0.10 mM, demonstrating the potential applicability of firefly luciferases as enzymatic and intracellular ratiometric metal biosensors.

Testing New Drugs for Treatment of Melanoma Patients Applying Connectivity Map Database Analysis with Melanoma Gene Signatures

DTIC Science & Technology

2012-10-01

use of R packages implemented in Bioconductor. Each dataset was normalized from raw data using the Frozen RMA (fRMA) algorithm . We applied the same...because development of the specific algorithms and fine tuning of the analytic strategy to accomplish this task was not immediately straightforward. We...express firefly luciferase using a retrovirus that encodes a fusion of luciferase and neomycin phosphotransferase (LucNeo), will be implanted and followed

A new blue-shifted luciferase from the Brazilian Amydetes fanestratus (Coleoptera: Lampyridae) firefly: molecular evolution and structural/functional properties.

PubMed

Viviani, Vadim R; Amaral, Danilo; Prado, Rogilene; Arnoldi, Frederico G C

2011-12-01

Firefly luciferases usually produce bioluminescence in the yellow-green region, with colors in the green and yellow-orange extremes of the spectrum being less common. Several firefly luciferases have already been cloned and sequenced, and site-directed mutagenesis studies have already identified important regions and residues for bioluminescence colors. However the structural determinants and mechanisms of bioluminescence colors turned out to be elusive, mainly when comparing luciferases with a high degree of divergence. Thus comparison of more similar luciferases producing colors in the two extremes of the spectrum could be revealing. The South-American fauna of fireflies remains largely unstudied, with some unique taxa that are not found anywhere else in the world and that produce a wide range of bioluminescence colors. Among them, fireflies of the genus Amydetes are especially interesting because its taxonomical status as an independent subfamily or as a tribe is not yet solved, and because they usually produce a continuous bright blue-shifted bioluminescence. In this work we cloned the cDNA for the luciferase of the Atlantic rain forest Amydetes fanestratus firefly, which is found near Sorocaba municipality (São Paulo, Brazil). Despite showing a higher degree of identity with the South-American Cratomorphus, the European Lampyris and the Asiatic Pyrocoelia, phylogenetical analysis of the luciferase sequence support the inclusion of Amydetes as an independent subfamily. Amydetes luciferase displays one of the most blue-shifted emission spectra (λ(max) = 538 nm) among beetle luciferases, with lower pH-sensitivity and higher affinity for ATP when compared to other luciferases, making this luciferase attractive for sensitive ATP and reporter assays.

Crystal structure of native and a mutant of Lampyris turkestanicus luciferase implicate in bioluminescence color shift.

PubMed

Kheirabadi, Mitra; Sharafian, Zohreh; Naderi-Manesh, Hossein; Heineman, Udo; Gohlke, Ulrich; Hosseinkhani, Saman

2013-12-01

Firefly bioluminescence reaction in the presence of Mg(2+), ATP and molecular oxygen is carried out by luciferase. The luciferase structure alterations or modifications of assay conditions determine the bioluminescence color of firefly luciferase. Among different beetle luciferases, Phrixothrix hirtus railroad worm emits either yellow or red bioluminescence color. Sequence alignment analysis shows that the red-emitter luciferase from Phrixothrix hirtus has an additional arginine residue at 353 that is absent in other firefly luciferases. It was reported that insertion of Arg in an important flexible loop350-359 showed changes in bioluminescence color from green to red and the optimum temperature activity was also increased. To explain the color tuning mechanism of firefly luciferase, the structure of native and a mutant (E354R/356R/H431Y) of Lampyris turkestanicus luciferase is determined at 2.7Å and 2.2Å resolutions, respectively. The comparison of structure of both types of Lampyris turkestanicus luciferases reveals that the conformation of this flexible loop is significantly changed by addition of two Arg in this region. Moreover, its surface accessibility is affected considerably and some ionic bonds are made by addition of two positive charge residues. Furthermore, we noticed that the hydrogen bonding pattern of His431 with the flexible loop is changed by replacing this residue with Tyr at this position. Juxtaposition of a flexible loop (residues 351-359) in firefly luciferase and corresponding ionic and hydrogen bonds are essential for color emission. © 2013.

Modulation of Beta-catenin Activity With PKD1 Prostate Cancer

DTIC Science & Technology

2009-04-01

mutated site as a negative control (FOPFlash) with pRL-TK ( Renilla luciferase) in C4-2- PKD1-GFP cells activated with Bryostatin 1 or DMSO. The...firefly and Renilla luciferase activities were measured with the Dual-Luciferase Reporter (DLR) Assay System. After normalizing the firefly luciferase...activity to that of Renilla luciferase, the FOPFlash reporter plasmid luciferase values were subtracted from the normalized values obtained with the

Discovery, adaptation and transcriptional activity of two tick promoters: Construction of a dual luciferase reporter system for optimization of RNA interference in rhipicephalus (boophilus) microplus cell lines.

PubMed

Tuckow, A P; Temeyer, K B

2015-08-01

Dual luciferase reporter systems are valuable tools for functional genomic studies, but have not previously been developed for use in tick cell culture. We evaluated expression of available luciferase constructs in tick cell cultures derived from Rhipicephalus (Boophilus) microplus, an important vector of bovine babesiosis and anaplasmosis. Commercial promoters were evaluated for transcriptional activity driving luciferase expression in the tick cell lines. The human phosphoglycerate kinase (PGK) promoter resulted in detectable firefly luciferase activity within 2 days post-transfection of the R. microplus cell line BME26, with maximal activity at 5 days post-transfection. Several other promoters were weaker or inactive in the tick cells, prompting identification and assessment of transcriptional activity of the homologous ribosomal protein L4 (rpL4, GenBank accession no.: KM516205) and elongation factor 1α (EF-1α, GenBank accession no.: KM516204) promoters cloned from R. microplus. Evaluation of luciferase expression driven by various promoters in tick cell culture resulted in selection of the R. microplus rpL4 promoter and the human PGK promoter driving transcription of sequences encoding modified firefly and NanoLuc® luciferases for construction of a dual luciferase reporter system for use in tick cell culture. Published 2015. This article is a U.S. Government work and is in the public domain in the USA.

Regulation of AR and (Beta)-Catenin Signaling by Pin 1 in Prostate Cancer

DTIC Science & Technology

2005-10-01

Renilla luciferase activities were determined using a dual-luciferase reporter assay kit (Promega, Madison, WI), and Renilla activities were not...consistently affected by any of the cotransfected vectors. The firefly luciferase was divided by the control Renilla luciferase and the results, given as...transfected with pTopflash (50 ng) and CMV- Renilla (2.5 ng) reporter plasmids. Firefly versus Renilla luciferase activities were determined and

The influence of the loop between residues 223-235 in beetle luciferase bioluminescence spectra: a solvent gate for the active site of pH-sensitive luciferases.

PubMed

Viviani, Vadim R; Silva Neto, Antonio J; Arnoldi, Frederico G C; Barbosa, João A R G; Ohmiya, Yoshihiro

2008-01-01

Beetle luciferases emit a wide range of bioluminescence colors, ranging from green to red. Firefly luciferases can shift the spectrum to red in response to pH and temperature changes, whereas click beetle and railroadworm luciferases do not. Despite many studies on firefly luciferases, the origin of pH-sensitivity is far from being understood. Through comparative site-directed mutagenesis and modeling studies, using the pH-sensitive luciferases (Macrolampis and Cratomorphus distinctus fireflies) and the pH-insensitive luciferases (Pyrearinus termitilluminans, Phrixotrix viviani and Phrixotrix hirtus) cloned by our group, here we show that substitutions dramatically affecting bioluminescence colors in both groups of luciferases are clustered in the loop between residues 223-235 (Photinus pyralis sequence). The substitutions at positions 227, 228 and 229 (P. pyralis sequence) cause dramatic redshift and temporal shift in both groups of luciferases, indicating their involvement in labile interactions. Modeling studies showed that the residues Y227 and N229 are buried in the protein core, fixing the loop to other structural elements participating at the bottom of the luciferin binding site. Changes in pH and temperature (in firefly luciferases), as well as point mutations in this loop, may disrupt the interactions of these structural elements exposing the active site and modulating bioluminescence colors.

Identification of Small Molecules Targeting the Posttranscriptional Control of ERG Expression

DTIC Science & Technology

2012-10-01

ied. To establish a cell line expressing lucife rase-ERG fusion protein, the vector along pRL-CMV-Rluc expressing Renilla luciferase gene was...expanded, and examined for the e xpression of t wo different luciferases. A clone expressing both Firefly luciferase and Renilla luciferase was selected...treated with the individual chemical at 10 μM for 24 h. The dual luciferase activities were measured. The ratio of Firefly to Renilla lu ciferase

Bifunctional role of leucine 300 of firefly luciferase in structural rigidity.

PubMed

Yousefi, Farzad; Ataei, Farangis; Mortazavi, Mojtaba; Hosseinkhani, Saman

2017-08-01

Firefly luciferase is susceptible to thermal inactivation, thereby its intracellular half-life decreased. Previous reports indicated that L 300 R mutation (LRR mutant) in E 354 R/Arg 356 double mutant (ERR mutant) from Lampyris turkestanicus luciferase has increased its thermal stability and rigidity through induction of some ionic bonds with Asp 270 and 271. Disruption of the deduced ionic bonds in an ultra-rigid mutant of firefly luciferase did not reverse the flexibility of the protein. In this study, we investigated the effects of this residue to find the truth behind an extraordinary increase in thermal stability and rigidity of luciferase after replacement of leucine 300 by arginine based on previous reports. For this purpose, L 300 R, L 300 K and L 300 E mutations were performed to compare the effects of these mutations on the native firefly luciferase. In spite of increase of intrinsic fluorescence of the mutants a slight increase in thermostability and retention of kinetic properties was observed. Based on our results, we can conclude that L 300 R mutation in LRR mutant accompanying with alteration in a flexible loop (352-359) increased thermostability and rigidity of luciferase. Copyright © 2017 Elsevier B.V. All rights reserved.

Impact of Site-Directed Mutant Luciferase on Quantitative Green and Orange/Red Emission Intensities in Firefly Bioluminescence

NASA Astrophysics Data System (ADS)

Wang, Yu; Akiyama, Hidefumi; Terakado, Kanako; Nakatsu, Toru

2013-08-01

Firefly bioluminescence has attracted great interest because of its high quantum yield and intriguing modifiable colours. Modifications to the structure of the enzyme luciferase can change the emission colour of firefly bioluminescence, and the mechanism of the colour change has been intensively studied by biochemists, structural biologists, optical physicists, and quantum-chemistry theorists. Here, we report on the quantitative spectra of firefly bioluminescence catalysed by wild-type and four site-directed mutant luciferases. While the mutation caused different emission spectra, the spectra differed only in the intensity of the green component (λmax ~ 560 nm). In contrast, the orange (λmax ~ 610 nm) and red (λmax ~ 650 nm) components present in all the spectra were almost unaffected by the modifications to the luciferases and changes in pH. Our results reveal that the intensity of the green component is the unique factor that is influenced by the luciferase structure and other reaction conditions.

Study of firefly luciferin oxidation and isomerism as possible inhibition pathways for firefly bioluminescence

NASA Astrophysics Data System (ADS)

Pinto da Silva, Luís; Esteves da Silva, Joaquim C. G.

2014-01-01

Firefly bioluminescence presents a light emitting profile with a form of a flash, due to the firefly luciferase-catalyzed formation of inhibitory products. These impair the binding of the substrate luciferin to the active site of the enzyme. However, this luciferase catalyzed pathways may not be the only ones responsible for the flash profile. The oxidation and isomerisation of the substrate luciferin lead to the formation of compounds that are also known inhibitors of firefly bioluminescence. So, the objective of this Letter was to analyze if these reactions could be capable of interfering with the bioluminescence reaction.

Reporter enzyme inhibitor study to aid assembly of orthogonal reporter gene assays.

PubMed

Ho, Pei-i; Yue, Kimberley; Pandey, Pramod; Breault, Lyne; Harbinski, Fred; McBride, Aaron J; Webb, Brian; Narahari, Janaki; Karassina, Natasha; Wood, Keith V; Hill, Adam; Auld, Douglas S

2013-05-17

Reporter gene assays (RGAs) are commonly used to measure biological pathway modulation by small molecules. Understanding how such compounds interact with the reporter enzyme is critical to accurately interpret RGA results. To improve our understanding of reporter enzymes and to develop optimal RGA systems, we investigated eight reporter enzymes differing in brightness, emission spectrum, stability, and substrate requirements. These included common reporter enzymes such as firefly luciferase (Photinus pyralis), Renilla reniformis luciferase, and β-lactamase, as well as mutated forms of R. reniformis luciferase emitting either blue- or green-shifted luminescence, a red-light emitting form of Luciola cruciata firefly luciferase, a mutated form of Gaussia princeps luciferase, and a proprietary luciferase termed "NanoLuc" derived from the luminescent sea shrimp Oplophorus gracilirostris. To determine hit rates and structure-activity relationships, we screened a collection of 42,460 PubChem compounds at 10 μM using purified enzyme preparations. We then compared hit rates and chemotypes of actives for each enzyme. The hit rates ranged from <0.1% for β-lactamase to as high as 10% for mutated forms of Renilla luciferase. Related luciferases such as Renilla luciferase mutants showed high degrees of inhibitor overlap (40-70%), while unrelated luciferases such as firefly luciferases, Gaussia luciferase, and NanoLuc showed <10% overlap. Examination of representative inhibitors in cell-based assays revealed that inhibitor-based enzyme stabilization can lead to increases in bioluminescent signal for firefly luciferase, Renilla luciferase, and NanoLuc, with shorter half-life reporters showing increased activation responses. From this study we suggest strategies to improve the construction and interpretation of assays employing these reporter enzymes.

Biosynthesis-inspired deracemizative production of d-luciferin by combining luciferase and thioesterase.

PubMed

Maeda, Juri; Kato, Dai-Ichiro; Okuda, Masatoshi; Takeo, Masahiro; Negoro, Seiji; Arima, Kazunari; Ito, Yuji; Niwa, Kazuki

2017-08-01

Due to the strict enantioselectivity of firefly luciferase, only d-luciferin can be used as a substrate for bioluminescence reactions. Unfortunately, luciferin racemizes easily and accumulation of nonluminous l-luciferin has negative influences on the light emitting reaction. Thus, maintaining the enantiopurity of luciferin in the reaction mixture is one of the most important demands in bioluminescence applications using firefly luciferase. In fireflies, however, l-luciferin is the biosynthetic precursor of d-luciferin, which is produced from the L-form undergoing deracemization. This deracemization consists of three successive reactions: l-enantioselective thioesterification by luciferase, in situ epimerization, and hydrolysis by thioesterase. In this work, we introduce a deracemizative luminescence system inspired by the biosynthetic pathway of d-luciferin using a combination of firefly luciferase from Luciola cruciata (LUC-G) and fatty acyl-CoA thioesterase II from Escherichia coli (TESB). The enzymatic reaction property analysis indicated the importance of the concentration balance between LUC-G and TESB for efficient d-luciferin production and light emission. Using this deracemizative luminescence system, a highly sensitive quantitative analysis method for l-cysteine was constructed. This LUC-G-TESB combination system can improve bioanalysis applications using the firefly bioluminescence reaction by efficient deracemization of D-luciferin. Copyright © 2017 Elsevier B.V. All rights reserved.

A Luciferase Reporter Gene System for High-Throughput Screening of γ-Globin Gene Activators.

PubMed

Xie, Wensheng; Silvers, Robert; Ouellette, Michael; Wu, Zining; Lu, Quinn; Li, Hu; Gallagher, Kathleen; Johnson, Kathy; Montoute, Monica

2016-01-01

Luciferase reporter gene assays have long been used for drug discovery due to their high sensitivity and robust signal. A dual reporter gene system contains a gene of interest and a control gene to monitor non-specific effects on gene expression. In our dual luciferase reporter gene system, a synthetic promoter of γ-globin gene was constructed immediately upstream of the firefly luciferase gene, followed downstream by a synthetic β-globin gene promoter in front of the Renilla luciferase gene. A stable cell line with the dual reporter gene was cloned and used for all assay development and HTS work. Due to the low activity of the control Renilla luciferase, only the firefly luciferase activity was further optimized for HTS. Several critical factors, such as cell density, serum concentration, and miniaturization, were optimized using tool compounds to achieve maximum robustness and sensitivity. Using the optimized reporter assay, the HTS campaign was successfully completed and approximately 1000 hits were identified. In this chapter, we also describe strategies to triage hits that non-specifically interfere with firefly luciferase.

Sensitive Dual Color in vivo Bioluminescence Imaging Using a New Red Codon Optimized Firefly Luciferase and a Green Click Beetle Luciferase

DTIC Science & Technology

2011-04-01

Sensitive Dual Color In Vivo Bioluminescence Imaging Using a New Red Codon Optimized Firefly Luciferase and a Green Click Beetle Luciferase Laura...20 nm). Spectral unmixing algorithms were applied to the images where good separation of signals was observed. Furthermore, HEK293 cells that...spectral emissions using a suitable spectral unmixing algorithm . This new D-luciferin-dependent reporter gene couplet opens up the possibility in the future

FIREFLY LUCIFERASE ATP ASSAY DEVELOPMENT FOR MONITORING BACTERIAL CONCENTRATIONS IN WATER SUPPLIES

EPA Science Inventory

This research program was initiated to develop a rapid, automatable system for measuring total viable microorganisms in potable drinking water supplies using the firefly luciferase ATP assay. The assay was adapted to an automatable flow system that provided comparable sensitivity...

Luciferin Amides Enable in Vivo Bioluminescence Detection of Endogenous Fatty Acid Amide Hydrolase Activity.

PubMed

Mofford, David M; Adams, Spencer T; Reddy, G S Kiran Kumar; Reddy, Gadarla Randheer; Miller, Stephen C

2015-07-15

Firefly luciferase is homologous to fatty acyl-CoA synthetases. We hypothesized that the firefly luciferase substrate d-luciferin and its analogs are fatty acid mimics that are ideally suited to probe the chemistry of enzymes that release fatty acid products. Here, we synthesized luciferin amides and found that these molecules are hydrolyzed to substrates for firefly luciferase by the enzyme fatty acid amide hydrolase (FAAH). In the presence of luciferase, these molecules enable highly sensitive and selective bioluminescent detection of FAAH activity in vitro, in live cells, and in vivo. The potency and tissue distribution of FAAH inhibitors can be imaged in live mice, and luciferin amides serve as exemplary reagents for greatly improved bioluminescence imaging in FAAH-expressing tissues such as the brain.

Luciferin Amides Enable in Vivo Bioluminescence Detection of Endogenous Fatty Acid Amide Hydrolase Activity

PubMed Central

2015-01-01

Firefly luciferase is homologous to fatty acyl-CoA synthetases. We hypothesized that the firefly luciferase substrate d-luciferin and its analogs are fatty acid mimics that are ideally suited to probe the chemistry of enzymes that release fatty acid products. Here, we synthesized luciferin amides and found that these molecules are hydrolyzed to substrates for firefly luciferase by the enzyme fatty acid amide hydrolase (FAAH). In the presence of luciferase, these molecules enable highly sensitive and selective bioluminescent detection of FAAH activity in vitro, in live cells, and in vivo. The potency and tissue distribution of FAAH inhibitors can be imaged in live mice, and luciferin amides serve as exemplary reagents for greatly improved bioluminescence imaging in FAAH-expressing tissues such as the brain. PMID:26120870

Step-wise addition of disulfide bridge in firefly luciferase controls color shift through a flexible loop: a thermodynamic perspective.

PubMed

Nazari, Mahboobeh; Hosseinkhani, Saman; Hassani, Leila

2013-02-01

Multi-color bioluminescence is developed using the introduction of single/double disulfide bridges in firefly luciferase. The bioluminescence reaction, which uses luciferin, Mg(2+)-ATP and molecular oxygen to yield an electronically excited oxyluciferin, is carried out by the luciferase and emits visible light. The bioluminescence color of firefly luciferases is determined by the luciferase sequence and assay conditions. It has been proposed that the stability of a protein may increase through the introduction of a disulfide bridge that decreases the configurational entropy of unfolding. Single and double disulfide bridges are introduced into Photinus pyralis firefly luciferase to make separate mutant enzymes with a single/double bridge (C(81)-A(105)C, L(306)C-L(309)C, P(451)C-V(469)C; C(81)-A(105)C/P(451)C-V(469)C, and A(296)C-A(326)C/P(451)C-V(469)C). By introduction of disulfide bridges using site-directed mutagenesis in Photinus pyralis luciferase the color of emitted light was changed to red or kept in different extents. The bioluminescence color shift occurred with displacement of a critical loop in the luciferase structure without any change in green emitter mutants. Thermodynamic analysis revealed that among mutants, L(306)C-L(309)C shows a remarkable stability against urea denaturation and also a considerable increase in kinetic stability and a clear shift in bioluminescence spectra towards red.

Histone Methylation and Epigenetic Silencing in Breast Cancer

DTIC Science & Technology

2010-07-01

bars show relative luciferase expression levels (firefly versus Renilla control) in SKBR3 cells treated with a control non-targeted dsRNA (NT2) and red...luciferase expression levels (firefly versus Renilla control) in SKBR3 cells treated with a control non-targeted dsRNA (NT2) and red bars depict

A transgenic rat with ubiquitous expression of firefly luciferase gene

NASA Astrophysics Data System (ADS)

Hakamata, Yoji; Murakami, Takashi; Kobayashi, Eiji

2006-02-01

In vivo imaging strategies provide cellular and molecular events in real time that helps us to understand biological processes in living animals. The development of molecular tags such as green fluorescent proteins and luciferase from the firefly Photinus pyralis has lead to a revolution in the visualization of complex biochemical processes. We developed a novel inbred transgenic rat strain containing firefly luciferase based on the transgenic (Tg) technique in rats. This Tg rat expressed the luciferase gene ubiquitously under control of the ROSA26 promoter. Cellular immune responsiveness against the luciferase protein was evaluated using conventional skin grafting and resulted in the long-term acceptance of Tg rat skin on wild-type rats. Strikingly, organ transplant with heart and small bowel demonstrated organ viability and graft survival, suggesting that cells from luciferase-Tg are transplantable to track their fate. Taking advantage of the less immunogenic luciferase, we also tested the role of hepatocyte-infusion in a liver injury model, and bone marrow-derived cells in a skin defect model. Employed in conjunction with modern advances in optical imaging, this luciferase-Tg rat system provides an innovative animal tool and a new means of facilitating biomedical research such as in the case of regeneration medicine.

Searching for Extant Life on Mars - The ATP-Firefly LuciferinLuciferase Technique

NASA Astrophysics Data System (ADS)

Obousy, R. K.; Tziolas, A. C.; Kaltsas, K.; Sims, M. R.; Grant, W. D.

We have investigated the use of the ATP-Firefly Luciferin/Luciferase (FFL) enzymic photoluminescent reaction as a possible means of detecting extant life in the Martian environment. Experiments carried out by the authors illustrate the capacity of the method to successfully detect extant forms of life on Mars assuming ATP is an intrinsic part of the biochemistry of such life-forms. A photodiode based apparatus, built to test the assumptions and applicability of the ATP-Firefly Luciferase/Luciferin technique to an exobiologically inclined mission to Mars, revealed the adequate resolution and reproducibility of the methodology plus areas of improvement. Also detailed are extraction, delivery and analysis system concepts, proposed for future Mars missions.

Genetic Manipulation of Schistosoma haematobium, the Neglected Schistosome

PubMed Central

Rinaldi, Gabriel; Okatcha, Tunika I.; Popratiloff, Anastas; Ayuk, Mary A.; Suttiprapa, Sutas; Mann, Victoria H.; Liang, Yung-san; Lewis, Fred A.; Loukas, Alex; Brindley, Paul J.

2011-01-01

Background Minimal information on the genome and proteome of Schistosoma haematobium is available, in marked contrast to the situation with the other major species of human schistosomes for which draft genome sequences have been reported. Accordingly, little is known about functional genomics in S. haematobium, including the utility or not of RNA interference techniques that, if available, promise to guide development of new interventions for schistosomiasis haematobia. Methods/Findings Here we isolated and cultured developmental stages of S. haematobium, derived from experimentally infected hamsters. Targeting different developmental stages, we investigated the utility of soaking and/or square wave electroporation in order to transfect S. haematobium with nucleic acid reporters including Cy3-labeled small RNAs, messenger RNA encoding firefly luciferase, and short interfering RNAs (siRNAs). Three hours after incubation of S. haematobium eggs in 50 ng/µl Cy3-labeled siRNA, fluorescent foci were evident indicating that labeled siRNA had penetrated into miracidia developing within the egg shell. Firefly luciferase activity was detected three hours after square wave electroporation of the schistosome eggs and adult worms in 150 ng/µl of mRNA. RNA interference knockdown (silencing) of reporter luciferase activity was seen following the introduction of dsRNA specific for luciferase mRNA in eggs, schistosomules and mixed sex adults. Moreover, introduction of an endogenous gene-specific siRNA into adult schistosomes silenced transcription of tetraspanin 2 (Sh-tsp-2), the apparent orthologue of the Schistosoma mansoni gene Sm-tsp-2 which encodes the surface localized structural and signaling protein Sm-TSP-2. Together, knockdown of reporter luciferase and Sh-tsp-2 indicated the presence of an intact RNAi pathway in S. haematobium. Also, we employed laser scanning confocal microscopy to view the adult stages of S. haematobium. Conclusions These findings and approaches should facilitate analysis of gene function in S. haematobium, which in turn could facilitate the characterization of prospective intervention targets for this neglected tropical disease pathogen. PMID:22022628

Creation of High Efficient Firefly Luciferase

NASA Astrophysics Data System (ADS)

Nakatsu, Toru

Firefly emits visible yellow-green light. The bioluminescence reaction is carried out by the enzyme luciferase. The bioluminescence of luciferase is widely used as an excellent tool for monitoring gene expression, the measurement of the amount of ATP and in vivo imaging. Recently a study of the cancer metastasis is carried out by in vivo luminescence imaging system, because luminescence imaging is less toxic and more useful for long-term assay than fluorescence imaging by GFP. However the luminescence is much dimmer than fluorescence. Then bioluminescence imaging in living organisms demands the high efficient luciferase which emits near infrared lights or enhances the emission intensity. Here I introduce an idea for creating the high efficient luciferase based on the crystal structure.

Biochemical characteristics and gene expression profiles of two paralogous luciferases from the Japanese firefly Pyrocoelia atripennis (Coleoptera, Lampyridae, Lampyrinae): insight into the evolution of firefly luciferase genes.

PubMed

Bessho-Uehara, Manabu; Konishi, Kaori; Oba, Yuichi

2017-08-09

Two paralogous genes of firefly luciferase, Luc1 and Luc2, have been isolated from the species in two subfamilies, Luciolinae and Photurinae, of the family Lampyridae. The gene expression profiles have previously been examined only in the species of Luciolinae. Here we isolated Luc1 and Luc2 genes from the Japanese firefly Pyrocoelia atripennis. This is the first report of the presence of both Luc1 and Luc2 genes in the species of the subfamily Lampyrinae and of the exon-intron structure of Luc2 in the family Lampyridae. The luminescence of both gene products peaked at 547 nm under neutral buffer conditions, and the spectrum of Luc1, but not Luc2, was red-shifted under acidic conditions, as observed for Luc2 in the Luciolinae species. The semi-quantitative reverse transcription-polymerase chain reaction suggested that Luc1 was expressed in lanterns of all the stages except eggs, while Luc2 was expressed in the non-lantern bodies of eggs, prepupae, pupae, and female adults. These expression profiles are consistent with those in the Luciolinae species. Considering the distant phylogenetic relationship between Lampyrinae and Luciolinae in Lampyridae, we propose that fireflies generally possess two different luciferase genes and the biochemical properties and gene expression profiles for each paralog are conserved among lampyrid species.

GENERATION OF TWO NOVEL CELL LINES THAT STABLY EXPRESS HAR AND FIREFLY LUCIFERASE GENES FOR ENDOCRINE SCREENING

EPA Science Inventory

Generation of Two Novel Cell Lines that Stably Express hAR and Firefly Luciferase Genes for Endocrine Screening
K.L. Bobseine*1, W.R. Kelce2, P.C. Hartig*1, and L.E. Gray, Jr.1
1USEPA, NHEERL, Reproductive Toxicology Division, RTP, NC, 2Searle, Reproductive Toxicology Divi...

Molecular Origin of Color Variation in Firefly (Beetle) Bioluminescence: A Chemical Basis for Biological Imaging.

PubMed

Hirano, Takashi

2016-01-01

Firefly shows bioluminescence by "luciferin-luciferase" (L-L) reaction using luciferin, luciferase, ATP and O2. The chemical photon generation by an enzymatic reaction is widely utilized for analytical methods including biological imaging in the life science fields. To expand photondetecting analyses with firefly bioluminescence, it is important for users to understand the chemical basis of the L-L reaction. In particular, the emission color variation of the L-L reaction is one of the distinguishing characteristics for multicolor luciferase assay and in vivo imaging. From the viewpoint of fundamental chemistry, this review explains the recent progress in the studies on the molecular mechanism of emission color variation after showing the outline of the reaction mechanism of the whole L-L reaction. On the basis of the mechanism, the progresses in organic synthesis of luciferin analogs modulating their emission colors are also presented to support further developments of red/near infrared in vivo biological imaging utility of firefly bioluminescence.

Biosynthesis of firefly luciferin in adult lantern: decarboxylation of L-cysteine is a key step for benzothiazole ring formation in firefly luciferin synthesis.

PubMed

Oba, Yuichi; Yoshida, Naoki; Kanie, Shusei; Ojika, Makoto; Inouye, Satoshi

2013-01-01

Bioluminescence in fireflies and click beetles is produced by a luciferase-luciferin reaction. The luminescence property and protein structure of firefly luciferase have been investigated, and its cDNA has been used for various assay systems. The chemical structure of firefly luciferin was identified as the D-form in 1963 and studies on the biosynthesis of firefly luciferin began early in the 1970's. Incorporation experiments using (14)C-labeled compounds were performed, and cysteine and benzoquinone/hydroquinone were proposed to be biosynthetic component for firefly luciferin. However, there have been no clear conclusions regarding the biosynthetic components of firefly luciferin over 30 years. Incorporation studies were performed by injecting stable isotope-labeled compounds, including L-[U-(13)C3]-cysteine, L-[1-(13)C]-cysteine, L-[3-(13)C]-cysteine, 1,4-[D6]-hydroquinone, and p-[2,3,5,6-D]-benzoquinone, into the adult lantern of the living Japanese firefly Luciola lateralis. After extracting firefly luciferin from the lantern, the incorporation of stable isotope-labeled compounds into firefly luciferin was identified by LC/ESI-TOF-MS. The positions of the stable isotope atoms in firefly luciferin were determined by the mass fragmentation of firefly luciferin. We demonstrated for the first time that D- and L-firefly luciferins are biosynthesized in the lantern of the adult firefly from two L-cysteine molecules with p-benzoquinone/1,4-hydroquinone, accompanied by the decarboxylation of L-cysteine.

Two techniques for eliminating luminol interference material and flow system configurations for luminol and firefly luciferase systems

NASA Technical Reports Server (NTRS)

Thomas, R. R.

1976-01-01

Two methods for eliminating luminol interference materials are described. One method eliminates interference from organic material by pre-reacting a sample with dilute hydrogen peroxide. The reaction rate resolution method for eliminating inorganic forms of interference is also described. The combination of the two methods makes the luminol system more specific for bacteria. Flow system designs for both the firefly luciferase and luminol bacteria detection systems are described. The firefly luciferase flow system incorporating nitric acid extraction and optimal dilutions has a functional sensitivity of 3 x 100,000 E. coli/ml. The luminol flow system incorporates the hydrogen peroxide pretreatment and the reaction rate resolution techniques for eliminating interference. The functional sensitivity of the luminol flow system is 1 x 10,000 E. coli/ml.

Comparative theoretical study of the binding of luciferyl-adenylate and dehydroluciferyl-adenylate to firefly luciferase

NASA Astrophysics Data System (ADS)

Pinto da Silva, Luís; Vieira, João; Esteves da Silva, Joaquim C. G.

2012-08-01

This is the first report of a study employing a computational approach to study the binding of (D/L)-luciferyl-adenlyates and dehydroluciferyl-adenylate to firefly luciferase. A semi-empirical/molecular mechanics methodology was used to study the interaction between these ligands and active site molecules. All adenylates are complexed with the enzyme, mostly due to electrostatic interactions with cationic residues. Dehydroluciferyl-adenylate is expected to be a competitive inhibitor of luciferyl-adenylate, as their binding mechanism and affinity to luciferase are very similar. Both luciferyl-adenylates adopt the L-orientation in the active site of luciferase.

Quantum/molecular mechanics study of firefly bioluminescence on luciferase oxidative conformation

NASA Astrophysics Data System (ADS)

Pinto da Silva, Luís; Esteves da Silva, Joaquim C. G.

2014-07-01

This is the first report of a computational study of the color tuning mechanism of firefly bioluminescence, using the oxidative conformation of luciferase. The results of these calculations demonstrated that the electrostatic field generated by luciferase is fundamental both for the emission shift and efficiency. Further calculations indicated that a shift in emission is achieved by modulating the energy, at different degrees, of the emissive and ground states. These differences in energy modulation will then lead to changes in the energy gap between the states.

GENERATION OF TWO STABLE CELL LINES THAT EXPRESS HER-ALPHA OR HER-ALPHA AND -BETA AND FIREFLY LUCIFERASE GENES FOR ENDOCRINE SCREENING

EPA Science Inventory

Generation of Two Stable Cell Lines that Express hERa or
hERa and b and Firefly Luciferase Genes for Endocrine Screening

K.L. Bobseine*1, W.R. Kelce2, P.C. Hartig*1, and L.E. Gray, Jr.1

1USEPA, NHEERL, Reproductive Toxicology Division, RTP, NC, 2Searle, Reprod...

Design and introduction of a disulfide bridge in firefly luciferase: increase of thermostability and decrease of pH sensitivity.

PubMed

Imani, Mehdi; Hosseinkhani, Saman; Ahmadian, Shahin; Nazari, Mahboobeh

2010-08-01

The thermal sensitivity and pH-sensitive spectral properties of firefly luciferase have hampered its application in a variety of fields. It is proposed that the stability of a protein can be increased by introduction of disulfide bridge that decreases the configurational entropy of unfolding. A disulfide bridge is introduced into Photinus pyralis firefly luciferase to make two separate mutant enzymes with a single bridge. Even though the A103C/S121C mutant showed remarkable thermal stability, its specific activity decreased, whereas the A296C/A326C mutant showed tremendous thermal stability, relative pH insensitivity and 7.3-fold increase of specific activity. Moreover, the bioluminescence emission spectrum of A296C/A326C was resistant against higher temperatures (37 degrees C). Far-UV CD analysis showed slight secondary structure changes for both mutants. Thermal denaturation analysis showed that conformational stabilities of A103C/S121C and A296C/A326C are more than native firefly luciferase. It is proposed that since A296 and A326 are situated in the vicinity of the enzyme active site microenvironment in comparison with A103 and S121, the formation of a disulfide bridge in this region has more impact on enzyme kinetic characteristics.

Mutagenesis of solvent-exposed amino acids in Photinus pyralis luciferase improves thermostability and pH-tolerance

PubMed Central

Law, G. H. Erica; Gandelman, Olga A.; Tisi, Laurence C.; Lowe, Christopher R.; Murray, James A. H.

2006-01-01

Firefly luciferase catalyses a two-step reaction, using ATP-Mg2+, firefly luciferin and molecular oxygen as substrates, leading to the efficient emission of yellow–green light. We report the identification of novel luciferase mutants which combine improved pH-tolerance and thermostability and that retain the specific activity of the wild-type enzyme. These were identified by the mutagenesis of solvent-exposed non-conserved hydrophobic amino acids to hydrophilic residues in Photinus pyralis firefly luciferase followed by in vivo activity screening. Mutants F14R, L35Q, V182K, I232K and F465R were found to be the preferred substitutions at the respective positions. The effects of these amino acid replacements are additive, since combination of the five substitutions produced an enzyme with greatly improved pH-tolerance and stability up to 45 °C. All mutants, including the mutant with all five substitutions, showed neither a decrease in specific activity relative to the recombinant wild-type enzyme, nor any substantial differences in kinetic constants. It is envisaged that the combined mutant will be superior to wild-type luciferase for many in vitro and in vivo applications. PMID:16551268

Laboratory procedures manual for the firefly luciferase assay for adenosine triphosphate (ATP)

NASA Technical Reports Server (NTRS)

Chappelle, E. W.; Picciolo, G. L.; Curtis, C. A.; Knust, E. A.; Nibley, D. A.; Vance, R. B.

1975-01-01

A manual on the procedures and instruments developed for the adenosine triphosphate (ATP) luciferase assay is presented. Data cover, laboratory maintenance, maintenance of bacterial cultures, bacteria measurement, reagents, luciferase procedures, and determination of microbal susceptibility to antibiotics.

Problem areas in the use of the firefly luciferase assay for bacterial detection

NASA Technical Reports Server (NTRS)

Picciolo, G. L.; Chappelle, E. W.; Knust, E. A.; Tuttle, S. A.; Curtis, C. A.

1975-01-01

By purifying the firefly luciferase extract and adding all necessary chemicals but ATP in excess, an assay for ATP was performed by measuring the amount of light produced when a sample containing soluble ATP is added to the luciferase reaction mixture. Instrumentation, applications, and basic characteristics of the luciferase assay are presented. Effect of the growth medium and length of time grown in this medium on ATP per viable E. coli values is shown in graphic form, along with an ATP concentration curve showing relative light units versus ATP injected. Reagent functions and concentration methods are explored. Efforts to develop a fast automatable system to detect the presence of bacteria in biological fluids, especially urine, resulted in the optimization of procedures for use with different types of samples.

Full color modulation of firefly luciferase through engineering with unified Stark effect.

PubMed

Cai, Duanjun; Marques, Miguel A L; Nogueira, Fernando

2013-11-07

The firefly luciferase has been a unique marking tool used in various bioimaging techniques. Extensive color modulation is strongly required to meet special marking demands; however, intentional and accurate wavelength tuning has yet to be achieved. Here, we demonstrate that the color shift of the firefly chromophore (OxyLH2-1) by internal and external fields can be described as a unified Stark shift. Electrostatic microenvironmental effects on fluorescent spectroscopy are modeled in vacuo through effective electric fields by using time-dependent density functional theory. A complete visible fluorescence spectrum of firefly chromophore is depicted, which enables one to control the emission in a specific color. As an application, the widely observed pH-correlated color shift is proved to be associated with the local Stark field generated by the trace water-ions (vicinal hydronium and hydroxide ions) at active sites close to the OxyLH2-1.

Regulation of AR and (beta)-Catenin Signaling by Pin 1 in Prostate Cancer

DTIC Science & Technology

2006-10-01

hrs. cells were harvested for Luciferase reporter Assay. C, CV-1 cells were transfected with Renilla (2.5ng), G5-Luc (10ng), pBIND-LBD (50ng), pACT-AR...stimulation, cells were cultured in 5 to 10% CDS-FBS. Firefly and internal control Renilla lucif- erase activities were determined using a dual luciferase...reporter assay kit (Pro- mega, Madison, WI), and Renilla activities were not consistently affected by any of the cotransfected vectors. The firefly

Genome-Wide Analysis of Translational Control in Tuberous Sclerosis Complex

DTIC Science & Technology

2012-07-01

particular non-AUG codons in the 5’UTR. However, these data was “noisy” and required a machine-learning algorithm to identify TIS codons. We develop...To investigate how nutrient signaling affects the folding of nascent chains, we used firefly luciferase (Luc) as a reporter because of its high...folding as the structural basis for the rapid de novo folding of firefly luciferase. Nat Struct Biol 6(7):697-705. 12. Gupta R, Kasturi P, Bracher A

Faster experimental validation of microRNA targets using cold fusion cloning and a dual firefly-Renilla luciferase reporter assay.

PubMed

Alvarez, M Lucrecia

2014-01-01

Different target prediction algorithms have been developed to provide a list of candidate target genes for a given animal microRNAs (miRNAs). However, these computational approaches provide both false-positive and false-negative predictions. Therefore, the target genes of a specific miRNA identified in silico should be experimentally validated. In this chapter, we describe a step-by-step protocol for the experimental validation of a direct miRNA target using a faster Dual Firefly-Renilla Luciferase Reporter Assay. We describe how to construct reporter plasmids using the simple, fast, and highly efficient cold fusion cloning technology, which does not require ligase, phosphatase, or restriction enzymes. In addition, we provide a protocol for co-transfection of reporter plasmids with either miRNA mimics or miRNA inhibitors in human embryonic kidney 293 (HEK293) cells, as well as a description on how to measure Firefly and Renilla luciferase activity using the Dual-Glo Luciferase Assay kit. As an example of the use of this technology, we will validate glucose-6-phosphate dehydrogenase (G6PD) as a direct target of miR-1207-5p.

A new indicator cell line established to monitor bovine foamy virus infection.

PubMed

Guo, Hong-Yan; Liang, Zhi-Bin; Li, Yue; Tan, Juan; Chen, Qi-Min; Qiao, Wen-Tao

2011-10-01

In order to improve the accuracy for quantitating the bovine foamy virus (BFV) in vitro, we developed a baby hamster kidney cell (BHK)-21-derived indicator cell line containing a plasmid that encodes the firefly luciferase driven by the BFV long terminal repeat promoter (LTR, from -7 to 1012). The BFV titer could be determined by detecting the luciferase expression since the viral trans-activator BTas protein activates the promoter activity of the LTR. One clone, designated BFVL, was selected from ten neomycin-resistant clones. BFVL showed a specific and inducible dose- and time-dependent luciferase activity in response to BFV infection. Although the changes in luciferase activity of BFVL peaked at 84 h post infection, it was possible to differentiate infected and uninfected cells at 48 h post infection. A linear relationship was established between the multiplicity of infection (MOI) of BFV and the activated ratio of luciferase expression in BFVL. Moreover, the sensitivity of the BFVL-based assay for detecting infectious BFV was 10,000 times higher than the conventional CPE-based assay at 48 h post infection. These findings suggest that the BFVL-based assay is rapid, easy, sensitive, quantitative and specific for detection of BFV infection.

Effects of Epigenetic Modulation on Reporter Gene Expression: Implications for Stem Cell Imaging

PubMed Central

Krishnan, Manickam; Park, Jinha M.; Cao, Feng; Wang, Dongxu; Paulmurugan, Ramasay; Tseng, Jeffrey R.; Gonzalgo, Mark L.; Gambhir, Sanjiv S.; Wu, Joseph C.

2013-01-01

Tracking stem cell localization, survival, differentiation, and proliferation following transplantation in living subjects is essential for understanding stem cell biology and physiology. In this study, we investigated the long-term stability of reporter gene expression in an embryonic rat cardiomyoblast cell line and the role of epigenetic modulation on reversing reporter gene silencing. Cells were stably transfected with plasmids carrying cytomegalovirus promoter driving firefly luciferase reporter gene (CMV-Fluc) and passaged repeatedly for 3–8 months. Within the highest expressor clone, the firefly luciferase activity decreased progressively from passage-1 (843±28) to passage-20 (250±10) to passage-40 (44±3) to passage-60 (3±1 RLU/µg) (P<0.05 vs. passage-1). Firefly luciferase activity was maximally rescued by treatment with 5-azacytidine (DNA methyltransferase inhibitor) compared to trichostatin A (histone deacetylase inhibitor) and retinoic acid (transcriptional activator) (P<0.05). Increasing dosages of 5-azacytidine treatment led to higher levels of firefly luciferase mRNA (RT-PCR) and protein (Western blots) and inversely lower levels of methylation in the CMV promoter (DNA nucleotide sequence). These in vitro results were extended to in vivo bioluminescence imaging (BLI) of cell transplant in living animals. Cells treated with 5-azacytidine were monitored for 2 weeks compared to 1 week for untreated cells (P<0.05). These findings should have important implications for reporter gene-based imaging of stem cell transplantation. PMID:16246867

Optical imaging of Renilla luciferase, synthetic Renilla luciferase, and firefly luciferase reporter gene expression in living mice.

PubMed

Bhaumik, S; Lewis, X Z; Gambhir, S S

2004-01-01

We have recently demonstrated that Renilla luciferase (Rluc) is a promising bioluminescence reporter gene that can be used for noninvasive optical imaging of reporter gene expression in living mice, with the aid of a cooled charged couple device (CCD) camera. In the current study, we explore the expression of a novel synthetic Renilla luciferase reporter gene (hRluc) in living mice, which has previously been reported to be a more sensitive reporter than native Rluc in mammalian cells. We explore the strategies of simultaneous imaging of both Renilla luciferase enzyme (RL) and synthetic Renilla luciferase enzyme (hRL):coelenterazine (substrate for RL/hRL) in the same living mouse. We also demonstrate that hRL:coelenterazine can yield a higher signal when compared to Firefly luciferase enzyme (FL): D-Luciferin, both in cell culture studies and when imaged from cells at the surface and from lungs of living mice. These studies demonstrate that hRluc should be a useful primary reporter gene with high sensitivity when used alone or in conjunction with other bioluminescence reporter genes for imaging in living rodents. (c) 2004 Society of Photo-Optical Instrumentation Engineers.

Brominated Luciferins Are Versatile Bioluminescent Probes

DOE PAGES

Steinhardt, Rachel C.; Rathbun, Colin M.; Krull, Brandon T.; ...

2016-12-08

Here, we report a set of brominated luciferins for bioluminescence imaging. These regioisomeric scaffolds were accessed by using a common synthetic route. All analogues produced light with firefly luciferase, although varying levels of emission were observed. Differences in photon output were analyzed by computation and photophysical measurements. The brightest brominated luciferin was further evaluated in cell and animal models. At low doses, the analogue outperformed the native substrate in cells. The remaining luciferins, although weak emitters with firefly luciferase, were inherently capable of light production and thus potential substrates for orthogonal mutant enzymes.

AR-NcoR Interaction as a Therapeutic Target for Prostate Cancer Prevention and Treatment

DTIC Science & Technology

2005-10-01

mutant AR, VP16-NCoRc, ARE4-luciferase reporter, and control pRL-CMV ( Renilla ) reporter. They were then treated for 24 hrs with 10 nM DHT, 10 nM RU486...or no hormone. Firefly versus Renilla luciferase activities were measure from triplicate samples. Relative light units (RLU) reflect normalized...firefly/ Renilla (+SD). NCoR binding to the RU486 liganded AR is mediated by the C-terminal N1 CoRNR box in NCoR. As NCoR deletion mutants indicated

Novel multistep BRET-FRET energy transfer using nanoconjugates of firefly proteins, quantum dots, and red fluorescent proteins

NASA Astrophysics Data System (ADS)

Alam, Rabeka; Zylstra, Joshua; Fontaine, Danielle M.; Branchini, Bruce R.; Maye, Mathew M.

2013-05-01

Sequential bioluminescence resonance energy transfer (BRET) and fluorescence resonance energy transfer (FRET) from firefly luciferase to red fluorescent proteins using quantum dot or rod acceptor/donor linkers is described. The effect of morphology and tuned optical properties on the efficiency of this unique BRET-FRET system was evaluated.Sequential bioluminescence resonance energy transfer (BRET) and fluorescence resonance energy transfer (FRET) from firefly luciferase to red fluorescent proteins using quantum dot or rod acceptor/donor linkers is described. The effect of morphology and tuned optical properties on the efficiency of this unique BRET-FRET system was evaluated. Electronic supplementary information (ESI) available: Experimental details, Fig. S1 and Table S1-S4. See DOI: 10.1039/c3nr01842c

Click beetle luciferase mutant and near infrared naphthyl-luciferins for improved bioluminescence imaging.

PubMed

Hall, Mary P; Woodroofe, Carolyn C; Wood, Monika G; Que, Ivo; Van't Root, Moniek; Ridwan, Yanto; Shi, Ce; Kirkland, Thomas A; Encell, Lance P; Wood, Keith V; Löwik, Clemens; Mezzanotte, Laura

2018-01-09

The sensitivity of bioluminescence imaging in animals is primarily dependent on the amount of photons emitted by the luciferase enzyme at wavelengths greater than 620 nm where tissue penetration is high. This area of work has been dominated by firefly luciferase and its substrate, D-luciferin, due to the system's peak emission (~ 600 nm), high signal to noise ratio, and generally favorable biodistribution of D-luciferin in mice. Here we report on the development of a codon optimized mutant of click beetle red luciferase that produces substantially more light output than firefly luciferase when the two enzymes are compared in transplanted cells within the skin of black fur mice or in deep brain. The mutant enzyme utilizes two new naphthyl-luciferin substrates to produce near infrared emission (730 nm and 743 nm). The stable luminescence signal and near infrared emission enable unprecedented sensitivity and accuracy for performing deep tissue multispectral tomography in mice.

Illuminating insights into firefly luciferase and other bioluminescent reporters used in chemical biology

PubMed Central

Thorne, Natasha; Inglese, James; Auld, Douglas S.

2010-01-01

Summary Understanding luciferase enzymology and the structure of compounds that modulate luciferase activity can be used to improve the design of luminescence-based assays. This review provides an overview of these popular reporters with an emphasis on the commonly used firefly luciferase from Photinus pyralis (FLuc). Large-scale chemical profile studies have identified a variety of scaffolds that inhibit FLuc. In some cell-based assays these inhibitors can act in a counter-intuitive way –leading to a gain in luminescent signal. Although formerly attributed to transcriptional activation, intracellular stabilization of FLuc is the primary mechanism underlying this observation. FLuc inhibition/stabilization can be complex, as illustrated by the compound PTC124, which is converted by FLuc in the presence of ATP to a high affinity multi-substrate-adduct inhibitor, PTC124-AMP. The potential influence these findings can have on drug discovery efforts is provided here. PMID:20609414

Posttranslationally caused bioluminescence burst of the Escherichia coli luciferase reporter strain.

PubMed

Ideguchi, Yamato; Oshikoshi, Yuta; Ryo, Masashi; Motoki, Shogo; Kuwano, Takashi; Tezuka, Takafumi; Aoki, Setsuyuki

2016-01-01

We continuously monitored bioluminescence from a wild-type reporter strain of Escherichia coli (lacp::luc+/WT), which carries the promoter of the lac operon (lacp) fused with the firefly luciferase gene (luc+). This strain showed a bioluminescence burst when shifted into the stationary growth phase. Bioluminescence profiles of other wild-type reporter strains (rpsPp::luc+ and argAp::luc+) and gene-deletion reporter strains (lacp::luc+/crp- and lacp::luc+/lacI-) indicate that transcriptional regulation is not responsible for generation of the burst. Consistently, changes in the luciferase protein levels did not recapitulate the profile of the burst. On the other hand, dissolved oxygen levels increased over the period across the burst, suggesting that the burst is, at least partially, caused by an increase in intracellular oxygen levels. We discuss limits of the firefly luciferase when used as a reporter for gene expression and its potential utility for monitoring metabolic changes in cells.

Characterization of BRCA2 Transcriptional Regulation

DTIC Science & Technology

2000-08-01

Renilla luciferase vector (Promega) with 4 ll of Fugene-6 was used for each transfection. The pRL-TK Renilla luciferase activity was used to control for...experiments, cells received 0.5 jig of BRCA2 promoter construct, 0.1 jig of pRL-TK Renilla luciferase vector, and 0.5 jig of the indicated expression...Myc, and pCMV-Max. Firefly lucifer- ase and renilla luciferase assays were performed using the Dual-Luciferase Reporter Assay Sys- tem (Promega

Inhibition of Th17 Cell Differentiation as a Treatment for Multiple Sclerosis

DTIC Science & Technology

2013-10-01

luciferase reporter construct into the cells. This reporter construct allows for both measurement of the transfection efficiency by Renilla luciferase...miR326 (delivered either by lentivirus or cotransfection) should result in reduced Firefly luminescence, with no change in Renilla luminescence. The...using Lipofectamine. After 48 hours Dual Glo substrate was added to the cells and luciferase activity and Renilla Luciferase activity were measured

Characterization of luciferases and its paralogue in the Panamanian luminous click beetle Pyrophorus angustus: a click beetle luciferase lacks the fatty acyl-CoA synthetic activity.

PubMed

Oba, Yuichi; Kumazaki, Mizuho; Inouye, Satoshi

2010-02-15

Two luciferase genes (dPaLuc and vPaLuc) and one paralogue of luciferase (PaLL) were isolated from the Panamanian luminous click beetle, Pyrophorus angustus (Elateridae, Pyrophorinae). The transcripts of dPaLuc and vPaLuc were predominantly detected in the body parts with dorsal photophore and ventral photophore, respectively, and the transcript of PaLL was detected in both parts. The gene products of dPaLuc and vPaLuc possessed luminescence activity with firefly luciferin (lambda(max)=536 and 566 nm, respectively) but did not show significant activity of fatty acyl-CoA synthesis. On the other hand, the gene product of PaLL had fatty acyl-CoA synthetic activity with very weak luminescence activity. The catalytic properties of click beetle luciferase are different from our previous results that firefly luciferase has both luminescence activity and fatty acyl-CoA synthetic activity. These results suggested that the ancestral fatty acyl-CoA synthetase in the Pyrophorinae lineage has undergone gene duplication event, followed by specialization of one copy in luciferase. Subsequently, the luciferase was duplicated again and the two copies diverged in their luminescent color and expression pattern. Copyright 2009 Elsevier B.V. All rights reserved.

Quenching the firefly bioluminescence by various ions.

PubMed

Zhang, Huateng; Bai, Haixiu; Jiang, Tianyu; Ma, Zhao; Cheng, Yanna; Zhou, Yubin; Du, Lupei; Li, Minyong

2016-02-01

The luciferase reporter gene assay system is broadly applied in various biomedical aspects, including signaling pathway dissection, transcriptional activity analysis, and genetic toxicity testing. It significantly improves the experimental accuracy and reduces the experimental error by the addition of an internal control. In the current research, we discovered some specific ions that could selectively inhibit firefly luciferase while having a negligible effect on renilla luciferase in vitro in the dual-reporter gene assay. We showed that these ionic compounds had a high potential of being utilized as quench-and-activate reagents in the dual-reporter assay. Furthermore, results from kinetic studies on ion-mediated quenching effects indicated that different ions have distinct inhibition modes. Our study is anticipated to guide a more affordable design of quench-and-activate reagents in biomedicine and pharmaceutical analysis.

Transgenic mouse model harboring the transcriptional fusion ccl20-luciferase as a novel reporter of pro-inflammatory response.

PubMed

Crispo, Martina; Van Maele, Laurye; Tabareau, Julien; Cayet, Delphine; Errea, Agustina; Ferreira, Ana María; Rumbo, Martin; Sirard, Jean Claude

2013-01-01

The chemokine CCL20, the unique ligand of CCR6 functions as an attractant of immune cells. Expression of CCL20 is induced by Toll-like Receptor (TLR) signaling or proinflammatory cytokine stimulation. However CCL20 is also constitutively produced at specific epithelial sites of mucosa. This expression profile is achieved by transcriptional regulation. In the present work we characterized regulatory features of mouse Ccl20 gene. Transcriptional fusions between the mouse Ccl20 promoter and the firefly luciferase (luc) encoding gene were constructed and assessed in in vitro and in vivo assays. We found that liver CCL20 expression and luciferase activity were upregulated by systemic administration of the TLR5 agonist flagellin. Using shRNA and dominant negative form specific for mouse TLR5, we showed that this expression was controlled by TLR5. To address in situ the regulation of gene activity, a transgenic mouse line harboring a functional Ccl20-luc fusion was generated. The luciferase expression was highly concordant with Ccl20 expression in different tissues. Our data indicate that the transgenic mouse model can be used to monitor activation of innate response in vivo.

Transgenic Mouse Model Harboring the Transcriptional Fusion Ccl20-Luciferase as a Novel Reporter of Pro-Inflammatory Response

PubMed Central

Crispo, Martina; Van Maele, Laurye; Tabareau, Julien; Cayet, Delphine; Errea, Agustina; Ferreira, Ana María; Rumbo, Martin; Sirard, Jean Claude

2013-01-01

The chemokine CCL20, the unique ligand of CCR6 functions as an attractant of immune cells. Expression of CCL20 is induced by Toll-like Receptor (TLR) signaling or proinflammatory cytokine stimulation. However CCL20 is also constitutively produced at specific epithelial sites of mucosa. This expression profile is achieved by transcriptional regulation. In the present work we characterized regulatory features of mouse Ccl20 gene. Transcriptional fusions between the mouse Ccl20 promoter and the firefly luciferase (luc) encoding gene were constructed and assessed in in vitro and in vivo assays. We found that liver CCL20 expression and luciferase activity were upregulated by systemic administration of the TLR5 agonist flagellin. Using shRNA and dominant negative form specific for mouse TLR5, we showed that this expression was controlled by TLR5. To address in situ the regulation of gene activity, a transgenic mouse line harboring a functional Ccl20-luc fusion was generated. The luciferase expression was highly concordant with Ccl20 expression in different tissues. Our data indicate that the transgenic mouse model can be used to monitor activation of innate response in vivo. PMID:24265691

Glu311 and Arg337 Stabilize a Closed Active-site Conformation and Provide a Critical Catalytic Base and Countercation for Green Bioluminescence in Beetle Luciferases.

PubMed

Viviani, V R; Simões, A; Bevilaqua, V R; Gabriel, G V M; Arnoldi, F G C; Hirano, T

2016-08-30

Beetle luciferases elicit the emission of different bioluminescence colors from green to red. Whereas firefly luciferases emit yellow-green light and are pH-sensitive, undergoing a typical red-shift at acidic pH and higher temperatures and in the presence of divalent heavy metals, click beetle and railroadworm luciferases emit a wider range of colors from green to red but are pH-independent. Despite many decades of study, the structural determinants and mechanisms of bioluminescence colors and pH sensitivity remain enigmatic. Here, through modeling studies, site-directed mutagenesis, and spectral and kinetic studies using recombinant luciferases from the three main families of bioluminescent beetles that emit different colors of light (Macrolampis sp2 firefly, Phrixotrix hirtus railroadworm, and Pyrearinus termitilluminans click beetle), we investigated the role of E311 and R337 in bioluminescence color determination. All mutations of these residues in firefly luciferase produced red mutants, indicating that the preservation of opposite charges and the lengths of the side chains of E311 and R337 are essential for keeping a salt bridge that stabilizes a closed hydrophobic conformation favorable for green light emission. Kinetic studies indicate that residue R337 is important for binding luciferin and creating a positively charged environment around excited oxyluciferin phenolate. In Pyrearinus green-emitting luciferase, the R334A mutation causes a 27 nm red-shift, whereas in Phrixotrix red-emitting luciferase, the L334R mutation causes a blue-shift that is no longer affected by guanidine. These results provide compelling evidence that the presence of arginine at position 334 is essential for blue-shifting the emission spectra of most beetle luciferases. Therefore, residues E311 and R337 play both structural and catalytic roles in bioluminescence color determination, by stabilizing a closed hydrophobic conformation favorable for green light emission, and also providing a base to accept excited oxyluciferin phenol proton, and a countercation to shield the negative charge of E311 and to stabilize excited oxyluciferin phenolate, blue-shifting emission spectra in most beetle luciferases.

Mass spectrometry analysis and transcriptome sequencing reveal glowing squid crystal proteins are in the same superfamily as firefly luciferase

PubMed Central

Gimenez, Gregory; Metcalf, Peter; Paterson, Neil G.; Sharpe, Miriam L.

2016-01-01

The Japanese firefly squid Hotaru-ika (Watasenia scintillans) produces intense blue light from photophores at the tips of two arms. These photophores are densely packed with protein microcrystals that catalyse the bioluminescent reaction using ATP and the substrate coelenterazine disulfate. The squid is the only organism known to produce light using protein crystals. We extracted microcrystals from arm tip photophores and identified the constituent proteins using mass spectrometry and transcriptome libraries prepared from arm tip tissue. The crystals contain three proteins, wsluc1–3, all members of the ANL superfamily of adenylating enzymes. They share 19 to 21% sequence identity with firefly luciferases, which produce light using ATP and the unrelated firefly luciferin substrate. We propose that wsluc1–3 form a complex that crystallises inside the squid photophores, and that in the crystal one or more of the proteins catalyses the production of light using coelenterazine disulfate and ATP. These results suggest that ANL superfamily enzymes have independently evolved in distant species to produce light using unrelated substrates. PMID:27279452

Near infrared bioluminescence resonance energy transfer from firefly luciferase—quantum dot bionanoconjugates

NASA Astrophysics Data System (ADS)

Alam, Rabeka; Karam, Liliana M.; Doane, Tennyson L.; Zylstra, Joshua; Fontaine, Danielle M.; Branchini, Bruce R.; Maye, Mathew M.

2014-12-01

The bioluminescence resonance energy transfer (BRET) between firefly luciferase enzymes and semiconductive quantum dots (QDs) with near infrared emission is described. The QD were phase transferred to aqueous buffers using a histidine mediated phase transfer route, and incubated with a hexahistidine tagged, green emitting variant of firefly luciferase from Photinus pyralis (PPyGRTS). The PPyGRTS were bound to the QD interface via the hexahistidine tag, which effectively displaces the histidine layer and binds directly to the QD interfaces, allowing for short donor-acceptor distances (˜5.5 nm). Due to this, high BRET efficiency ratios of ˜5 were obtained. These PPyGRTS-QD bio-nano conjugates were characterized by transmission electron microscopy, thermal gravimetric analysis, Fourier transform infrared spectroscopy and BRET emission studies. The final optimized conjugate was easily observable by night vision imaging, demonstrating the potential of these materials in imaging and signaling/sensing applications.

Suitability of Macrolampis firefly and Pyrearinus click beetle luciferases for bacterial light off toxicity biosensor.

PubMed

Gabriel, Gabriele V M; Lopes, P S; Viviani, V R

2014-01-15

Bioluminescence is widely used in biosensors. For water toxicity analysis, the naturally bioluminescent bacteria Vibrio fischeri have been used extensively. We investigated the suitability of two new beetle luciferases for Escherichia coli light off biosensors: Macrolampis firefly and Pyrearinus termitilluminans click beetle luciferases. The bioluminescence detection assay using this system is very sensitive, being comparable or superior to V. fischeri. The luciferase of P. termitilluminans produces a strong and sustained bioluminescence that is useful for less sensitive and inexpensive assays that require integration of the emission, whereas Macrolampis luciferase displays a flash-like luminescence that is useful for fast and more sensitive assays. The effect of heavy metals and sanitizing agents was analyzed. Zinc, copper, 1-propanol, and iodide had inhibitory effects on bioluminescence and growth assays; however, in these cases the bioluminescence was not a very reliable indicator of cell growth and metabolic activity because these agents also inhibited the luciferase. On the other hand, mercury and silver strongly affected cell bioluminescence and growth but not the luciferase activity, indicating that bioluminescence was a reliable indicator of cell growth and metabolic activity in this case. Finally, bioluminescent E. coli immobilized in agarose matrix gave a more stable format for environmental assays. Copyright © 2013 Elsevier Inc. All rights reserved.

The Bioluminescence Resonance Energy Transfer from Firefly Luciferase to a Synthetic Dye and its Application for the Rapid Homogeneous Immunoassay of Progesterone.

PubMed

Smirnova, Daria V; Samsonova, Jeanne V; Ugarova, Natalia N

2016-01-01

The sensitive BRET system for the homogeneous immunoassay of a low-molecular weight antigen was developed using progesterone as an example. Two thermostable mutants of the Luciola mingrelica firefly luciferase (Luc)-the "red" mutant with λmax.em = 590 nm (RedLuc) and the "green" mutant with λmax.em = 550 nm (GreenLuc)-were tested as the donors. The water-soluble Alexa Fluor 610× (AF) dye was selected as the acceptor because its two absorption maxima, located at 550 and 610 nm, are close to the bioluminescence maxima of the GreenLuc and RedLuc, respectively. The methods for the synthesis of the luciferase-progesterone (Luc-Pg) conjugate and the conjugate of the dye and the polyclonal antiprogesterone antibody (AF-Ab) were developed. Both conjugates retained their functional properties, had high antigen-antibody binding activity, and demonstrated a high BRET signal. The homogeneous immunoassay system based on the BRET from the firefly luciferase to the synthetic dye was established to assay progesterone as a model antigen. Optimization of the assay conditions, the composition of the reaction mixture, and the concentrations of the donor and the acceptor made it possible to reach the minimum detectable progesterone concentration of 0.5 ng mL(-1) . © 2015 The American Society of Photobiology.

Protein sterilization method of firefly luciferase using reduced pressure and molecular sieves

NASA Technical Reports Server (NTRS)

Chappelle, E. W.; Rich, E., Jr. (Inventor)

1973-01-01

The sterilization of the protein fruitfly luciferase under conditions that prevent denaturation is examined. Denaturation is prevented by heating the protein in contact with molecular seives and under a reduced pressure of the order of 0.00005 millimeters of mercury.

Highly specific expression of luciferase gene in lungs of naive nude mice directed by prostate-specific antigen promoter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li Hongwei; Department of Neurological Surgery, University of Virginia Health System, Charlottesville, VA 22908; Li Jinzhong

PSA promoter has been demonstrated the utility for tissue-specific toxic gene therapy in prostate cancer models. Characterization of foreign gene overexpression in normal animals elicited by PSA promoter should help evaluate therapy safety. Here we constructed an adenovirus vector (AdPSA-Luc), containing firefly luciferase gene under the control of the 5837 bp long prostate-specific antigen promoter. A charge coupled device video camera was used to non-invasively image expression of firefly luciferase in nude mice on days 3, 7, 11 after injection of 2 x 10{sup 9} PFU of AdPSA-Luc virus via tail vein. The result showed highly specific expression of themore » luciferase gene in lungs of mice from day 7. The finding indicates the potential limitations of the suicide gene therapy of prostate cancer based on selectivity of PSA promoter. By contrary, it has encouraging implications for further development of vectors via PSA promoter to enable gene therapy for pulmonary diseases.« less

Comparison of human optimized bacterial luciferase, firefly luciferase, and green fluorescent protein for continuous imaging of cell culture and animal models

NASA Astrophysics Data System (ADS)

Close, Dan M.; Hahn, Ruth E.; Patterson, Stacey S.; Baek, Seung J.; Ripp, Steven A.; Sayler, Gary S.

2011-04-01

Bioluminescent and fluorescent reporter systems have enabled the rapid and continued growth of the optical imaging field over the last two decades. Of particular interest has been noninvasive signal detection from mammalian tissues under both cell culture and whole animal settings. Here we report on the advantages and limitations of imaging using a recently introduced bacterial luciferase (lux) reporter system engineered for increased bioluminescent expression in the mammalian cellular environment. Comparison with the bioluminescent firefly luciferase (Luc) system and green fluorescent protein system under cell culture conditions demonstrated a reduced average radiance, but maintained a more constant level of bioluminescent output without the need for substrate addition or exogenous excitation to elicit the production of signal. Comparison with the Luc system following subcutaneous and intraperitoneal injection into nude mice hosts demonstrated the ability to obtain similar detection patterns with in vitro experiments at cell population sizes above 2.5 × 104 cells but at the cost of increasing overall image integration time.

Luciferin-Regenerating Enzyme Mediates Firefly Luciferase Activation Through Direct Effects of D-Cysteine on Luciferase Structure and Activity.

PubMed

Hemmati, Roohullah; Hosseinkhani, Saman; Sajedi, Reza H; Azad, Taha; Tashakor, Amin; Bakhtiari, Nuredin; Ataei, Farangis

2015-01-01

Luciferin-regenerating enzyme (LRE) contributes to in vitro recycling of D-luciferin. In this study, reinvestigation of the luciferase-based LRE assay is reported. Here, using quick change site-directed mutagenesis seven T-LRE (Lampyris turkestanicusLRE) mutants were constructed and the most functional mutant of T-LRE (T(69)R) was selected for this research and the effects of D- and L-cysteine on T(69)R T-LRE-luciferase-coupled assay are examined. Our results demonstrate that bioluminescent signal of T(69)R T-LRE-luciferase-coupled assay increases and then reach equilibrium state in the presence of 5 mm D-cysteine. In addition, results reveal that 5 mm D- and L-cysteine in the absence of T(69)R T-LRE cause a significant increase in bioluminescence intensity of luciferase over a long time as well as decrease in decay rate. Based on activity measurements, far-UV CD analysis, ANS fluorescence and DLS (Dynamic light scattering) results, D-cysteine increases the activity of luciferase due to weak redox potential, antiaggregatory effects, induction of changes in conformational structure and kinetics properties. In conclusion, in spite of previous reports on the effect of LRE on luciferase bioluminescent intensity, the majority of increase in luciferase light output and time-course originate from the direct effects of D-cysteine on structure and activity of firefly luciferase. © 2015 The American Society of Photobiology.

Identification and characterization of the Luc2-type luciferase in the Japanese firefly, Luciola parvula, involved in a dim luminescence in immobile stages.

PubMed

Bessho-Uehara, Manabu; Oba, Yuichi

2017-09-01

Nocturnal Japanese fireflies, Luciola parvula, emit from their lanterns a yellow light, one of the most red-shifted colors found among fireflies. Previously, we isolated and characterized two different types of luciferase gene, Luc1 and Luc2, from the fireflies Luciola cruciata and Luciola lateralis; Luc1 is responsible for the green-yellow luminescence of larval and adult lanterns, whereas Luc2 is responsible for the dim greenish glow of eggs and pupal bodies. The biological role of firefly lanterns in adults is related to sexual communication, but why the eggs and pupae glow remains uncertain. In this study, we isolated the gene Luc2 from L. parvula, and compared its expression profiles and enzymatic characteristics with those of Luc1. A semi-quantitative reverse transcription polymerase chain reaction showed that Luc1 was predominantly expressed in larvae, prepupae, pupae and adults, whereas Luc2 was expressed in eggs, prepupae, pupae and adult females. Enzymatic analyses showed that the luminescent color of Luc1 matches the visual sensitivity of L. parvula eyes, whereas that of Luc2 is very different from it. These results suggest that the biological role of Luc2 expressed in immobile stages is not intraspecific communication. Copyright © 2017 John Wiley & Sons, Ltd.

Caged ATP - an internal calibration method for ATP bioluminescence assays.

PubMed

Calvert, R M; Hopkins, H C; Reilly, M J; Forsythe, S J

2000-03-01

ATP bioluminescence, based on the firefly luciferase system, is used for the rapid determination of hygienic practices in the food industry. This study has demonstrated the use of caged ATP as an internal ATP standard and quantified the effects of industrial cleansing solutions, alcoholic beverages and pH on firefly luciferase activity. The light signal was quenched 6-47% by five cleansing solutions at standard working concentrations. Ethanol at 1% (v/v) inhibited bioluminescence by 15% (w/v) whereas concentrations above 4% enhanced the light output. The light signal was quenched by 20-25% at pH values below pH 4 and above pH 10.

Several methods for concentrating bacteria in fluid samples

NASA Technical Reports Server (NTRS)

Thomas, R. R.

1976-01-01

The sensitivities of the firefly luciferase - ATP flow system and luminol flow system were established as 300,000 E. coli per milliliter and 10,000 E. coli per milliliter respectively. To achieve the detection limit of 1,000 bacteria per milliliter previously established, a method of concentrating microorganisms using a sartorius membrane filter system is investigated. Catalase in 50% ethanol is found to be a stable luminol standard and can be used up to 24 hours with only a 10% loss of activity. The luminol reagent is also stable over a 24 hour period. A method of preparing relatively inexpensive luciferase from desiccated firefly tails is developed.

Beyond D-luciferin: Expanding the Scope of Bioluminescence Imaging in vivo

PubMed Central

Adams, Spencer T.; Miller, Stephen C.

2014-01-01

The light-emitting chemical reaction catalyzed by the enzyme firefly luciferase is widely used for noninvasive imaging in live mice. However, photon emission from the luciferase is critically dependent on the chemical properties of its substrate, D-luciferin. In this review, we describe recent work to replace the natural luciferase substrate with synthetic analogs that extend the scope of bioluminescence imaging. PMID:25078002

Characterization of BRCA2 Transcriptional Regulation

DTIC Science & Technology

2001-12-01

tig of BRCA2 promoter construct and 0.1 and we verify the role of USF in regulation of basal activity of jig of pRL-TK Renilla luciferase vector...Promega) with 4 1 l of Fugene-6 the promoter. was used for each transfection. The pRL-TK Renilla luciferase activity was used to control for transfection...pCMV-CREB, pCMV-Myc, BRCA2 Reporter Constructs-A BAC clone (B489G) containing the 5’ and pCMV-Max. Firefly luciferase and Renilla luciferase assays

Large-scale protein-protein interaction analysis in Arabidopsis mesophyll protoplasts by split firefly luciferase complementation.

PubMed

Li, Jian-Feng; Bush, Jenifer; Xiong, Yan; Li, Lei; McCormack, Matthew

2011-01-01

Protein-protein interactions (PPIs) constitute the regulatory network that coordinates diverse cellular functions. There are growing needs in plant research for creating protein interaction maps behind complex cellular processes and at a systems biology level. However, only a few approaches have been successfully used for large-scale surveys of PPIs in plants, each having advantages and disadvantages. Here we present split firefly luciferase complementation (SFLC) as a highly sensitive and noninvasive technique for in planta PPI investigation. In this assay, the separate halves of a firefly luciferase can come into close proximity and transiently restore its catalytic activity only when their fusion partners, namely the two proteins of interest, interact with each other. This assay was conferred with quantitativeness and high throughput potential when the Arabidopsis mesophyll protoplast system and a microplate luminometer were employed for protein expression and luciferase measurement, respectively. Using the SFLC assay, we could monitor the dynamics of rapamycin-induced and ascomycin-disrupted interaction between Arabidopsis FRB and human FKBP proteins in a near real-time manner. As a proof of concept for large-scale PPI survey, we further applied the SFLC assay to testing 132 binary PPIs among 8 auxin response factors (ARFs) and 12 Aux/IAA proteins from Arabidopsis. Our results demonstrated that the SFLC assay is ideal for in vivo quantitative PPI analysis in plant cells and is particularly powerful for large-scale binary PPI screens.

Surface charge modification increases firefly luciferase rigidity without alteration in bioluminescence spectra.

PubMed

Mortazavi, Mojtaba; Hosseinkhani, Saman

2017-01-01

Protein engineering can provide useful approaches for loop anchoring and mutation of surface-exposed loop residues to Arg for the design of thermostable proteins. In this context and due to the high proportion of surface loops, some of the solvent-exposed residues in the Lampyris turkestanicus luciferase were mutated to Arg. Using the red-emitter mutant luciferase (E354R/Arg356), the single (-Q35R, -I182R, -I232R and -L300R), double (-Q35R/I232R) and triple (-Q35R/I232R/I182R) mutant luciferases were introduced. The relative remaining activity of -I232R, double and triple mutants increased significantly compared to the wild-type at 40°C. The optimal temperature of these mutants increased up to 40°C which were 15°C more than wild-type luciferase. It is anticipated that these mutations increased the local interactions that finally improved the thermostability and optimum temperature of luciferase. It should be noted that Arg substitution at amino acid positions 35, 182 and 232 had no effect on the bioluminescence emission spectra. Furthermore, these mutations have not significantly changed the specific activities of firefly luciferases. Finally, with the use of the homology modeling and molecular docking, the effects of these substitutions were evaluated. In conclusion, this study provides beneficial insights on how the thermal stability of luciferase can be improved by protein engineering for biological applications. Copyright © 2016 Elsevier Inc. All rights reserved.

A method to rapidly and accurately compare relative efficacies of non-invasive imaging reporter genes in a mouse model, and its application to luciferase reporters

PubMed Central

Gil, Jose S.; Machado, Hidevaldo B.; Herschman, Harvey R.

2013-01-01

Purpose Our goal is to develop a simple, quantitative, robust method to compare the efficacy of imaging reporter genes in culture and in vivo. We describe an adenoviral vector-liver transduction procedure, and compare the luciferase reporter efficacies. Procedures Alternative reporter genes are expressed in a common adenoviral vector. Vector amounts used in vivo are based on cell culture titrations, ensuring the same transduction efficacy is used for each vector. After imaging, in vivo and in vitro values are normalized to hepatic vector transduction using quantitative real-time PCR. Results We assayed standard firefly luciferase (FLuc), enhanced firefly luciferase (EFLuc), luciferase 2 (Luc2), humanized Renilla luciferase (hRLuc), Renilla luciferase 8.6-535 (RLuc8.6), and a membrane-bound Gaussia luciferase variant (extGLuc) in cell culture and in vivo. We observed a greater that 100-fold increase in bioluminescent signal for both EFLuc and Luc2 when compared to FLuc, and a greater than 106-fold increase for RLuc8.6 when compared to hRLuc. ExtGLuc was not detectable in liver. Conclusions Our findings contrast, in some cases, with conclusions drawn in prior comparisons of these reporter genes, and demonstrate the need for a standardized method to evaluate alternative reporter genes in vivo. Our procedure can be adapted for reporter genes that utilize alternative imaging modalities (fluorescence, bioluminescence, MRI, SPECT, PET). PMID:21850545

Theoretical tuning of the firefly bioluminescence spectra by the modification of oxyluciferin

NASA Astrophysics Data System (ADS)

Cheng, Yuan-Yuan; Zhu, Jia; Liu, Ya-Jun

2014-01-01

Extending the firefly bioluminescence is of practical significance for the improved visualization of living cells and the development of a multicolor reporter. Tuning the color of bioluminescence in fireflies mainly involves the modification of luciferase and luciferin. In this Letter, we theoretically studied the emission spectra of 9 firefly oxyluciferin analogs in the gas phase and in solutions. Three density functionals, including B3LYP, CAM-B3LYP and M06-2X, were employed to theoretically predict the efficiently luminescent analogs. The reliable functionals for calculating the targeted systems were suggested. The luminescence efficiency, solvent effects, and substituent effects are discussed based on the calculated results.

The Role of Lymphangiogenesis in Orthotopic Prostatic Tumor-Environment on Regional and Systemic Metastasis

DTIC Science & Technology

2008-01-01

expressing Renilla luciferase and VEGF-C shRNA or irrelevant firefly luciferase shRNA (Ctrl) were implanted orthotopically as before. To determine the...on metastasis in Pten knockout model (Month 10-24): a) Generate Ubc/sVEGFR-3 and Ubc/ Renilla luciferase (RL) lentiviral vectors by subcloning...progression (month 10-12) c) Monitor efficiency of Ubc/lentiviral transduction and expression in Pten (-/-) prostate using optical imaging of Renilla

An ultrasensitive NanoLuc-based luminescence system for monitoring Plasmodium berghei throughout its life cycle.

PubMed

De Niz, Mariana; Stanway, Rebecca R; Wacker, Rahel; Keller, Derya; Heussler, Volker T

2016-04-21

Bioluminescence imaging is widely used for cell-based assays and animal imaging studies, both in biomedical research and drug development. Its main advantages include its high-throughput applicability, affordability, high sensitivity, operational simplicity, and quantitative outputs. In malaria research, bioluminescence has been used for drug discovery in vivo and in vitro, exploring host-pathogen interactions, and studying multiple aspects of Plasmodium biology. While the number of fluorescent proteins available for imaging has undergone a great expansion over the last two decades, enabling simultaneous visualization of multiple molecular and cellular events, expansion of available luciferases has lagged behind. The most widely used bioluminescent probe in malaria research is the Photinus pyralis firefly luciferase, followed by the more recently introduced Click-beetle and Renilla luciferases. Ultra-sensitive imaging of Plasmodium at low parasite densities has not been previously achieved. With the purpose of overcoming these challenges, a Plasmodium berghei line expressing the novel ultra-bright luciferase enzyme NanoLuc, called PbNLuc has been generated, and is presented in this work. NanoLuc shows at least 150 times brighter signal than firefly luciferase in vitro, allowing single parasite detection in mosquito, liver, and sexual and asexual blood stages. As a proof-of-concept, the PbNLuc parasites were used to image parasite development in the mosquito, liver and blood stages of infection, and to specifically explore parasite liver stage egress, and pre-patency period in vivo. PbNLuc is a suitable parasite line for sensitive imaging of the entire Plasmodium life cycle. Its sensitivity makes it a promising line to be used as a reference for drug candidate testing, as well as the characterization of mutant parasites to explore the function of parasite proteins, host-parasite interactions, and the better understanding of Plasmodium biology. Since the substrate requirements of NanoLuc are different from those of firefly luciferase, dual bioluminescence imaging for the simultaneous characterization of two lines, or two separate biological processes, is possible, as demonstrated in this work.

Firewalls Prevent Systemic Dissemination of Vectors Derived from Human Adenovirus Type 5 and Suppress Production of Transgene-Encoded Antigen in a Murine Model of Oral Vaccination

PubMed Central

Revaud, Julien; Unterfinger, Yves; Rol, Nicolas; Suleman, Muhammad; Shaw, Julia; Galea, Sandra; Gavard, Françoise; Lacour, Sandrine A.; Coulpier, Muriel; Versillé, Nicolas; Havenga, Menzo; Klonjkowski, Bernard; Zanella, Gina; Biacchesi, Stéphane; Cordonnier, Nathalie; Corthésy, Blaise; Ben Arous, Juliette; Richardson, Jennifer P.

2018-01-01

To define the bottlenecks that restrict antigen expression after oral administration of viral-vectored vaccines, we tracked vectors derived from the human adenovirus type 5 at whole body, tissue, and cellular scales throughout the digestive tract in a murine model of oral delivery. After intragastric administration of vectors encoding firefly luciferase or a model antigen, detectable levels of transgene-encoded protein or mRNA were confined to the intestine, and restricted to delimited anatomical zones. Expression of luciferase in the form of multiple small bioluminescent foci in the distal ileum, cecum, and proximal colon suggested multiple crossing points. Many foci were unassociated with visible Peyer's patches, implying that transduced cells lay in proximity to villous rather than follicle-associated epithelium, as supported by detection of transgene-encoded antigen in villous epithelial cells. Transgene-encoded mRNA but not protein was readily detected in Peyer's patches, suggesting that post-transcriptional regulation of viral gene expression might limit expression of transgene-encoded antigen in this tissue. To characterize the pathways by which the vector crossed the intestinal epithelium and encountered sentinel cells, a fluorescent-labeled vector was administered to mice by the intragastric route or inoculated into ligated intestinal loops comprising a Peyer's patch. The vector adhered selectively to microfold cells in the follicle-associated epithelium, and, after translocation to the subepithelial dome region, was captured by phagocytes that expressed CD11c and lysozyme. In conclusion, although a large number of crossing events took place throughout the intestine within and without Peyer's patches, multiple firewalls prevented systemic dissemination of vector and suppressed production of transgene-encoded protein in Peyer's patches. PMID:29423380

A novel dual luciferase assay for the simultaneous monitoring of HIV infection and cell viability.

PubMed

Mitsuki, Yu-Ya; Yamamoto, Takuya; Mizukoshi, Fuminori; Momota, Masatoshi; Terahara, Kazutaka; Yoshimura, Kazuhisa; Harada, Shigeyoshi; Tsunetsugu-Yokota, Yasuko

2016-05-01

Human immunodeficiency virus type 1 (HIV-1) reporter cell lines are critical tools for drug development. However, one disadvantage of HIV-1 reporter cell lines is that reductions in reporter gene activity need to be normalized to cytotoxicity, i.e., live cell numbers. Here, we developed a dual luciferase assay based on a R. reniformis luciferase (hRLuc)-expressing R5-type HIV-1 (NLAD8-hRLuc) and a CEM cell line expressing CCR5 and firefly luciferase (R5CEM-FiLuc). The NLAD8-hRLuc reporter virus was replication competent in peripheral blood mononuclear cells. The level of hRLuc was correlated with p24 antigen levels (p<0.001, R=0.862). The target cell line, R5CEM-FiLuc, stably expressed the firefly luciferase (FiLuc) reporter gene and allowed the simultaneous monitoring of compound cytotoxicity. The dual reporter assay combining a NLAD8-hRLuc virus with R5CEM-FiLuc cells permitted the accurate determination of drug susceptibility for entry, reverse transcriptase, integrase, and protease inhibitors at different multiplicities of infection. This dual reporter assay provides a rapid and direct method for the simultaneous monitoring of HIV infection and cell viability. Copyright © 2016 Elsevier B.V. All rights reserved.

Real time imaging of live cell ATP leaking or release events by chemiluminescence microscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yun

The purpose of this research was to expand the chemiluminescence microscopy applications in live bacterial/mammalian cell imaging and to improve the detection sensitivity for ATP leaking or release events. We first demonstrated that chemiluminescence (CL) imaging can be used to interrogate single bacterial cells. While using a luminometer allows detecting ATP from cell lysate extracted from at least 10 bacterial cells, all previous cell CL detection never reached this sensitivity of single bacteria level. We approached this goal with a different strategy from before: instead of breaking bacterial cell membrane and trying to capture the transiently diluted ATP with themore » firefly luciferase CL assay, we introduced the firefly luciferase enzyme into bacteria using the modern genetic techniques and placed the CL reaction substrate D-luciferin outside the cells. By damaging the cell membrane with various antibacterial drugs including antibiotics such as Penicillins and bacteriophages, the D-luciferin molecules diffused inside the cell and initiated the reaction that produces CL light. As firefly luciferases are large protein molecules which are retained within the cells before the total rupture and intracellular ATP concentration is high at the millmolar level, the CL reaction of firefly luciferase, ATP and D-luciferin can be kept for a relatively long time within the cells acting as a reaction container to generate enough photons for detection by the extremely sensitive intensified charge coupled device (ICCD) camera. The result was inspiring as various single bacterium lysis and leakage events were monitored with 10-s temporal resolution movies. We also found a new way of enhancing diffusion D-luciferin into cells by dehydrating the bacteria. Then we started with this novel single bacterial CL imaging technique, and applied it for quantifying gene expression levels from individual bacterial cells. Previous published result in single cell gene expression quantification mainly used a fluorescence method; CL detection is limited because of the difficulty to introduce enough D-luciferin molecules. Since dehydration could easily cause proper size holes in bacterial cell membranes and facilitate D-luciferin diffusion, we used this method and recorded CL from individual cells each hour after induction. The CL light intensity from each individual cell was integrated and gene expression levels of two strain types were compared. Based on our calculation, the overall sensitivity of our system is already approaching the single enzyme level. The median enzyme number inside a single bacterium from the higher expression strain after 2 hours induction was quantified to be about 550 molecules. Finally we imaged ATP release from astrocyte cells. Upon mechanical stimulation, astrocyte cells respond by increasing intracellular Ca 2+ level and releasing ATP to extracellular spaces as signaling molecules. The ATP release imaged by direct CL imaging using free firefly luciferase and D-luciferin outside cells reflects the transient release as well as rapid ATP diffusion. Therefore ATP release detection at the cell surface is critical to study the ATP release mechanism and signaling propagation pathway. We realized this cell surface localized ATP release imaging detection by immobilizing firefly luciferase to streptavidin beads that attached to the cell surface via streptavidin-biotin interactions. Both intracellular Ca 2+ propagation wave and extracellular ATP propagation wave at the cell surface were recorded with fluorescence and CL respectively. The results imply that at close distances from the stimulation center (<120 μm) extracellular ATP pathway is faster, while at long distances (>120 μm) intracellular Ca 2+ signaling through gap junctions seems more effective.« less

MicroRNA Inhibitors as Anticancer Therapies

DTIC Science & Technology

2007-08-17

Promoter activity was determined by co-transfection of the pGL3 promoter reporter (400 ng/well) with pRLSV40 ( Renilla luciferase, Promega)(100 ng/well) into...performed in triplicate and standard deviations calculated. Activitywas defined as Firefly/ Renilla ratio, normalized to control vector transfection. For...was defined as Firefly/ Renilla ratio normalized to activity in the absence of transfected E2F1. 5-RACE Mapping of Transcript—HEK-293 cells were tran

The Role of AHR in Breast Cancer Development

DTIC Science & Technology

2005-07-01

Carlsbad, CA) was used according to the manufacturer’s instructions to transfect cells. The renilla luciferase vectorphRL-TK (0.5 [tg/well) was co...the firefly and renilla signals. Briefly, cells were lysed in equal volumes of cell lysis buffer (Promega) and RPMI for 20 min, transferred to a 96...well white wall plate, and analyzed using a Reporter Luminometer (Promega). The renilla signal was read after quenching the firefly output, thus

Long-term ex vivo and in vivo monitoring of tumor progression by using dual luciferases.

PubMed

Morita, Naoki; Haga, Sanae; Ohmiya, Yoshihiro; Ozaki, Michitaka

2016-03-15

We propose a new concept of tumor progression monitoring using dual luciferases in living animals to reduce stress for small animals and the cost of luciferin. The secreted Cypridina luciferase (CLuc) was used as an ex vivo indicator to continuously monitor tumor progression. On the other hand, the non-secreted firefly luciferase was used as an in vivo indicator to analyze the spatial distribution of the tumor at suitable time points indicated by CLuc. Thus, the new monitoring systems that use dual luciferases are available, allowing long-term bioluminescence imaging under minimal stress for the experimental animals. Copyright © 2015 Elsevier Inc. All rights reserved.

Immunocompetent Mouse Model for Tracking Cancer Progression | NCI Technology Transfer Center | TTC

Cancer.gov

The National Cancer Institute seeks licensees or research collaborators to develop and commercialize transgenic mice having immunocompetent rat growth hormone-firefly Luciferase-enhanced green fluorescent protein.

Analytical Applications of Bioluminescence and Chemiluminescence

NASA Technical Reports Server (NTRS)

Chappelle, E. W. (Editor); Picciolo, G. L. (Editor)

1975-01-01

Bioluminescence and chemiluminescence studies were used to measure the amount of adenosine triphosphate and therefore the amount of energy available. Firefly luciferase - luciferin enzyme system was emphasized. Photometer designs are also considered.

Rational and random mutagenesis of firefly luciferase to identify an efficient emitter of red bioluminescence

NASA Astrophysics Data System (ADS)

Branchini, Bruce R.; Southworth, Tara L.; Khattak, Neelum F.; Murtiashaw, Martha H.; Fleet, Sarah E.

2004-06-01

Firefly luciferase, which emits yellow-green (557 nm) light, and the corresponding cDNA have been used successfully as a bioluminescence reporter of gene expression. One particularly exciting application is in the area of in vivo bioluminescence imaging. Our interest is in developing improved reagents by identifying Photinus pyralis luciferase mutants that efficiently emit red bioluminescence. In this way, the proven advantages of the P. pyralis protein can be combined with the potential advantages of a red-shifted emitter. Using site-directed mutagenesis techniques, we have identified many mutants emitting red bioluminescence. Unfortunately, these enzymes generally have significantly decreased bioluminescence activity. Interestingly, we discovered a mutation, Ile351Ala, that produced a moderate 16 nm red-shift, while maintaining excellent bioluminescence activity. We then undertook a random mutagenesis approach to identify luciferase mutants that emit further red-shifted bioluminescence with minimal loss of activity. Libraries of mutants were created using an error-prone PCR method and the Ile351Ala luciferase mutant as the template DNA. The libraries were screened by in vivo bacterial assays and the promising mutants were purified to enable accurate determination of bioluminescence emission spectra and total bioluminescence activity. We will report the characterization results, including the identification of the randomly altered amino acids, of several mutants that catalyze bioluminescence with emission maxima of approximately 600 nm.

Watch out for reporter gene assays with Renilla luciferase and paclitaxel.

PubMed

Theile, Dirk; Spalwisz, Adriana; Weiss, Johanna

2013-06-15

Luminescence-based reporter gene assays are widely used in biochemistry. Signals from reporter genes (e.g., firefly luminescence) are usually normalized to signals from constantly luminescing luciferases such as Renilla luciferase. This normalization step can be performed by modern luminometry devices automatically providing final results. Here we demonstrate paclitaxel to strikingly enhance Renilla luminescence, thereby potentially flawing results from reporter gene assays. In consequence, these data advocate for careful examination of raw data and militate against automatic data processing. Copyright © 2013 Elsevier Inc. All rights reserved.

Assessing activity of Hepatitis A virus 3C protease using a cyclized luciferase-based biosensor.

PubMed

Zhou, Junwei; Wang, Dang; Xi, Yongqiang; Zhu, Xinyu; Yang, Yuting; Lv, Mengting; Luo, Chuanzhen; Chen, Jiyao; Ye, Xu; Fang, Liurong; Xiao, Shaobo

2017-07-08

Hepatitis A is an acute infection caused by Hepatitis A virus (HAV), which is widely distributed throughout the world. The HAV 3C cysteine protease (3C pro ), an important nonstructural protein, is responsible for most cleavage within the viral polyprotein and is critical for the processes of viral replication. Our group has previously demonstrated that HAV 3C pro cleaves human NF-κB essential modulator (NEMO), a kinase required in interferon signaling. Based on this finding, we generated four luciferase-based biosensors containing the NEMO sequence (PVLKAQ↓ADIYKA) that is cleaved by HAV 3C pro and/or the Nostoc punctiforme DnaE intein, to monitor the activity of HAV 3C pro in human embryonic kidney cells (HEK-293T). Western blotting showed that HAV 3C pro recognized and cleaved the NEMO cleavage sequence incorporated in the four biosensors, whereas only one cyclized luciferase-based biosensor (233-DnaE-HAV, 233DH) showed a measurable and reliable increase in firefly luciferase activity, with very low background, in the presence of HAV 3C pro . With this biosensor (233DH), we monitored HAV 3C pro activity in HEK-293T cells, and tested it against a catalytically deficient mutant HAV 3C pro and other virus-encoded proteases. The results showed that the activity of this luciferase biosensor is specifically dependent on HAV 3C pro . Collectively, our data demonstrate that the luciferase biosensor developed here might provide a rapid, sensitive, and efficient evaluation of HAV 3C pro activity, and should extend our better understanding of the biological relevance of HAV 3C pro . Copyright © 2017 Elsevier Inc. All rights reserved.

SpyTag/SpyCatcher Cyclization Enhances the Thermostability of Firefly Luciferase

PubMed Central

Si, Meng; Xu, Qing

2016-01-01

SpyTag can spontaneously form a covalent isopeptide bond with its protein partner SpyCatcher. Firefly luciferase from Photinus pyralis was cyclized in vivo by fusing SpyCatcher at the N terminus and SpyTag at the C terminus. Circular LUC was more thermostable and alkali-tolerant than the wild type, without compromising the specific activity. Structural analysis indicated that the cyclized LUC increased the thermodynamic stability of the structure and remained more properly folded at high temperatures when compared with the wild type. We also prepared an N-terminally and C-terminally shortened form of the SpyCatcher protein and cyclization using this truncated form led to even more thermostability than the original form. Our findings suggest that cyclization with SpyTag and SpyCatcher is a promising and effective strategy to enhance thermostability of enzymes. PMID:27658030

A comparison of certain extracting agents for extraction of adenosine triphosphate (ATP) from microorganisms for use in the firefly luciferase ATP assay

NASA Technical Reports Server (NTRS)

Knust, E. A.; Chappelle, E. W.; Picciolo, G. L.

1975-01-01

Firefly luciferase ATP assay is used in clinical and industrial applications, such as determination of urinary infection levels, microbial susceptibility testing, and monitoring of yeast levels in beverages. Three categories of extractants were investigated for their extracting efficiency. They were ionizing organic solvents, nonionizing organic solvents, and inorganic acids. Dimethylsulfoxide and formamide represented the ionizing organic solvents, while n-butanol, chloroform, ethanol, acetone, and methylene chloride were used for the nonionizing organic solvents. Nitric acid and perchloric acid were chosen for the inorganic acids category. Pathogens were tested with each solvent. They included: Saccharomyces carlsbergensis, E. coli, Staphylococcus aureus, Klebsiella pneumoniae, Enterobacter species, Proteus mirabilis, Proteus vulgaris, Staphylococcus epidermidis, Streptococcus faecalis, Pseudomonas aeruginosa, and Candida albicans. These results are shown in graphic representations.

miR-Sens--a retroviral dual-luciferase reporter to detect microRNA activity in primary cells.

PubMed

Beillard, Emmanuel; Ong, Siau Chi; Giannakakis, Antonis; Guccione, Ernesto; Vardy, Leah A; Voorhoeve, P Mathijs

2012-05-01

MicroRNA-mRNA interactions are commonly validated and deconstructed in cell lines transfected with luciferase reporters. However, due to cell type-specific variations in microRNA or RNA-binding protein abundance, such assays may not reliably reflect microRNA activity in other cell types that are less easily transfected. In order to measure miRNA activity in primary cells, we constructed miR-Sens, a MSCV-based retroviral vector that encodes both a Renilla luciferase reporter gene controlled by microRNA binding sites in its 3' UTR and a Firefly luciferase normalization gene. miR-Sens sensors can be efficiently transduced in primary cells such as human fibroblasts and mammary epithelial cells, and allow the detection of overexpressed and, more importantly, endogenous microRNAs. Notably, we find that the relative luciferase activity is correlated to the miRNA expression, allowing quantitative measurement of microRNA activity. We have subsequently validated the miR-Sens 3' UTR vectors with known human miRNA-372, miRNA-373, and miRNA-31 targets (LATS2 and TXNIP). Overall, we observe that miR-Sens-based assays are highly reproducible, allowing detection of the independent contribution of multiple microRNAs to 3' UTR-mediated translational control of LATS2. In conclusion, miR-Sens is a new tool for the efficient study of microRNA activity in primary cells or panels of cell lines. This vector will not only be useful for studies on microRNA biology, but also more broadly on other factors influencing the translation of mRNAs.

miR-Sens—a retroviral dual-luciferase reporter to detect microRNA activity in primary cells

PubMed Central

Beillard, Emmanuel; Ong, Siau Chi; Giannakakis, Antonis; Guccione, Ernesto; Vardy, Leah A.; Voorhoeve, P. Mathijs

2012-01-01

MicroRNA–mRNA interactions are commonly validated and deconstructed in cell lines transfected with luciferase reporters. However, due to cell type-specific variations in microRNA or RNA-binding protein abundance, such assays may not reliably reflect microRNA activity in other cell types that are less easily transfected. In order to measure miRNA activity in primary cells, we constructed miR-Sens, a MSCV-based retroviral vector that encodes both a Renilla luciferase reporter gene controlled by microRNA binding sites in its 3′ UTR and a Firefly luciferase normalization gene. miR-Sens sensors can be efficiently transduced in primary cells such as human fibroblasts and mammary epithelial cells, and allow the detection of overexpressed and, more importantly, endogenous microRNAs. Notably, we find that the relative luciferase activity is correlated to the miRNA expression, allowing quantitative measurement of microRNA activity. We have subsequently validated the miR-Sens 3′ UTR vectors with known human miRNA-372, miRNA-373, and miRNA-31 targets (LATS2 and TXNIP). Overall, we observe that miR-Sens-based assays are highly reproducible, allowing detection of the independent contribution of multiple microRNAs to 3′ UTR–mediated translational control of LATS2. In conclusion, miR-Sens is a new tool for the efficient study of microRNA activity in primary cells or panels of cell lines. This vector will not only be useful for studies on microRNA biology, but also more broadly on other factors influencing the translation of mRNAs. PMID:22417692

Bioluminescent magnetic nanoparticles as potential imaging agents for mammalian spermatozoa.

PubMed

Vasquez, Erick S; Feugang, Jean M; Willard, Scott T; Ryan, Peter L; Walters, Keisha B

2016-03-17

Nanoparticles have emerged as key materials for developing applications in nanomedicine, nanobiotechnology, bioimaging and theranostics. Existing bioimaging technologies include bioluminescent resonance energy transfer-conjugated quantum dots (BRET-QDs). Despite the current use of BRET-QDs for bioimaging, there are strong concerns about QD nanocomposites containing cadmium which exhibits potential cellular toxicity. In this study, bioluminescent composites comprised of magnetic nanoparticles and firefly luciferase (Photinus pyralis) are examined as potential light-emitting agents for imaging, detection, and tracking mammalian spermatozoa. Characterization was carried out using infrared spectroscopy, TEM and cryo-TEM imaging, and ζ-potential measurements to demonstrate the successful preparation of these nanocomposites. Binding interactions between the synthesized nanoparticles and spermatozoon were characterized using confocal and atomic/magnetic force microscopy. Bioluminescence imaging and UV-visible-NIR microscopy results showed light emission from sperm samples incubated with the firefly luciferase-modified nanoparticles. Therefore, these newly synthesized luciferase-modified magnetic nanoparticles show promise as substitutes for QD labeling, and can potentially also be used for in vivo manipulation and tracking, as well as MRI techniques. These preliminary data indicate that luciferase-magnetic nanoparticle composites can potentially be used for spermatozoa detection and imaging. Their magnetic properties add additional functionality to allow for manipulation, sorting, or tracking of cells using magnetic techniques.

Enhanced Beetle Luciferase for High-Resolution Bioluminescence Imaging

PubMed Central

Nakajima, Yoshihiro; Yamazaki, Tomomi; Nishii, Shigeaki; Noguchi, Takako; Hoshino, Hideto; Niwa, Kazuki; Viviani, Vadim R.; Ohmiya, Yoshihiro

2010-01-01

We developed an enhanced green-emitting luciferase (ELuc) to be used as a bioluminescence imaging (BLI) probe. ELuc exhibits a light signal in mammalian cells that is over 10-fold stronger than that of the firefly luciferase (FLuc), which is the most widely used luciferase reporter gene. We showed that ELuc produces a strong light signal in primary cells and tissues and that it enables the visualization of gene expression with high temporal resolution at the single-cell level. Moreover, we successfully imaged the nucleocytoplasmic shuttling of importin α by fusing ELuc at the intracellular level. These results demonstrate that the use of ELuc allows a BLI spatiotemporal resolution far greater than that provided by FLuc. PMID:20368807

Hsa-miR-195 targets PCMT1 in hepatocellular carcinoma that increases tumor life span.

PubMed

Amer, Marwa; Elhefnawi, M; El-Ahwany, Eman; Awad, A F; Gawad, Nermen Abdel; Zada, Suher; Tawab, F M Abdel

2014-11-01

MicroRNAs are small 19-25 nucleotides which have been shown to play important roles in the regulation of gene expression in many organisms. Downregulation or accumulation of miRNAs implies either tumor suppression or oncogenic activation. In this study, differentially expressed hsa-miR-195 in hepatocellular carcinoma (HCC) was identified and analyzed. The prediction was done using a consensus approach of tools. The validation steps were done at two different levels in silico and in vitro. FGF7, GHR, PCMT1, CITED2, PEX5, PEX13, NOVA1, AXIN2, and TSPYL2 were detected with high significant (P < 0.005). These genes are involved in important pathways in cancer like MAPK signaling pathway, Jak-STAT signaling pathways, regulation of actin cytoskeleton, angiogenesis, Wnt signaling pathway, and TGF-beta signaling pathway. In vitro target validation was done for protein-L-isoaspartate (D-aspartate) O-methyltransferase (PCMT1). The co-transfection of pmirGLO-PCMT1 and pEGP-miR-195 showed highly significant results. Firefly luciferase was detected using Lumiscensor and t test analysis was done. Firefly luciferase expression was significantly decreased (P < 0.001) in comparison to the control. The low expression of firefly luciferase validates the method of target prediction that we used in this work by working on PCMT1 as a target for miR-195. Furthermore, the rest of the predicted genes are suspected to be real targets for hsa-miR-195. These target genes control almost all the hallmarks of liver cancer which can be used as therapeutic targets in cancer treatment.

Disruption of bbe02 by Insertion of a Luciferase Gene Increases Transformation Efficiency of Borrelia burgdorferi and Allows Live Imaging in Lyme Disease Susceptible C3H Mice

PubMed Central

Chan, Kamfai; Alter, Laura; Barthold, Stephen W.; Parveen, Nikhat

2015-01-01

Lyme disease is the most prevalent tick-borne disease in North America and Europe. The causative agent, Borrelia burgdorferi persists in the white-footed mouse. Infection with B. burgdorferi can cause acute to persistent multisystemic Lyme disease in humans. Some disease manifestations are also exhibited in the mouse model of Lyme disease. Genetic manipulation of B. burgdorferi remains difficult. First, B. burgdorferi contains a large number of endogenous plasmids with unique sequences encoding unknown functions. The presence of these plasmids needs to be confirmed after each genetic manipulation. Second, the restriction modification defense systems, including that encoded by bbe02 gene lead to low transformation efficiency in B. burgdorferi. Therefore, studying the molecular basis of Lyme pathogenesis is a challenge. Furthermore, investigation of the role of a specific B. burgdorferi protein throughout infection requires a large number of mice, making it labor intensive and expensive. To overcome the problems associated with low transformation efficiency and to reduce the number of mice needed for experiments, we disrupted the bbe02 gene of a highly infectious and pathogenic B. burgdorferi strain, N40 D10/E9 through insertion of a firefly luciferase gene. The bbe02 mutant shows higher transformation efficiency and maintains luciferase activity throughout infection as detected by live imaging of mice. Infectivity and pathogenesis of this mutant were comparable to the wild-type N40 strain. This mutant will serve as an ideal parental strain to examine the roles of various B. burgdorferi proteins in Lyme pathogenesis in the mouse model in the future. PMID:26069970

The MERADCOM (Mobility Equipment Research and Development Command) in vitro Biosensor Program.

DTIC Science & Technology

1982-06-01

a negligible decay rate at ATP concentrations less than 1 jim." This development has further increased the great value of the firefly luciferase...formation NADH molecules at a high rate which results in an ampli- fied light signal of the bacterial luciferase readout system. As above, the light...exclusively the oxidation of O-D-glucose. Enzymes are also efficient catalysts facilitating chemical reactions at rates which range from 10 thousand to 1

Comparison of red-shifted firefly luciferase Ppy RE9 and conventional Luc2 as bioluminescence imaging reporter genes for in vivo imaging of stem cells

NASA Astrophysics Data System (ADS)

Liang, Yajie; Walczak, Piotr; Bulte, Jeff W. M.

2012-01-01

One critical issue for noninvasive imaging of transplanted bioluminescent cells is the large amount of light absorption in tissue when emission wavelengths below 600 nm are used. Luciferase with a red-shifted spectrum can potentially bypass this limitation. We assessed and compared a mutant of firefly luciferase (Ppy RE9, PRE9) against the yellow luciferase luc2 gene for use in cell transplantation studies. C17.2 neural stem cells expressing PRE9-Venus and luc2-Venus were sorted by flow cytometry and assessed for bioluminescence in vitro in culture and in vivo after transplantation into the brain of immunodeficient Rag2-/- mice. We found that the luminescence from PRE9 was stable, with a peak emission at 620 nm, shifted to the red compared to that of luc2. The emission peak for PRE9 was pH-independent, in contrast to luc2, and much less affected by tissue absorbance compared to that of luc2. However, the total emitted light radiance from PRE9 was substantially lower than that of luc2, both in vitro and in vivo. We conclude that PRE9 has favorable properties as compared to luc2 in terms of pH independence, red-shifted spectrum, tissue light penetration, and signal quantification, justifying further optimization of protein expression and enzymatic activity.

Luciferase assay to study the activity of a cloned promoter DNA fragment.

PubMed

Solberg, Nina; Krauss, Stefan

2013-01-01

Luciferase based assays have become an invaluable tool for the analysis of cloned promoter DNA fragments, both for verifying the ability of a potential promoter fragment to drive the expression of a luciferase reporter gene in various cellular contexts, and for dissecting binding elements in the promoter. Here, we describe the use of the Dual-Luciferase(®) Reporter Assay System created by Promega (Promega Corporation, Wisconsin, USA) to study the cloned 6.7 kilobases (kb) mouse (m) Tcf3 promoter DNA fragment in mouse embryonic derived neural stem cells (NSC). In this system, the expression of the firefly luciferase driven by the cloned mTcf3 promoter DNA fragment (including transcription initiation sites) is correlated with a co-transfected control reporter expressing Renilla luciferase from the herpes simplex virus (HSV) thymidine kinase promoter. Using an internal control reporter allows to normalize the activity of the experimental reporter to the internal control, which minimizes experimental variability.

An Optimized Transient Dual Luciferase Assay for Quantifying MicroRNA Directed Repression of Targeted Sequences

PubMed Central

Moyle, Richard L.; Carvalhais, Lilia C.; Pretorius, Lara-Simone; Nowak, Ekaterina; Subramaniam, Gayathery; Dalton-Morgan, Jessica; Schenk, Peer M.

2017-01-01

Studies investigating the action of small RNAs on computationally predicted target genes require some form of experimental validation. Classical molecular methods of validating microRNA action on target genes are laborious, while approaches that tag predicted target sequences to qualitative reporter genes encounter technical limitations. The aim of this study was to address the challenge of experimentally validating large numbers of computationally predicted microRNA-target transcript interactions using an optimized, quantitative, cost-effective, and scalable approach. The presented method combines transient expression via agroinfiltration of Nicotiana benthamiana leaves with a quantitative dual luciferase reporter system, where firefly luciferase is used to report the microRNA-target sequence interaction and Renilla luciferase is used as an internal standard to normalize expression between replicates. We report the appropriate concentration of N. benthamiana leaf extracts and dilution factor to apply in order to avoid inhibition of firefly LUC activity. Furthermore, the optimal ratio of microRNA precursor expression construct to reporter construct and duration of the incubation period post-agroinfiltration were determined. The optimized dual luciferase assay provides an efficient, repeatable and scalable method to validate and quantify microRNA action on predicted target sequences. The optimized assay was used to validate five predicted targets of rice microRNA miR529b, with as few as six technical replicates. The assay can be extended to assess other small RNA-target sequence interactions, including assessing the functionality of an artificial miRNA or an RNAi construct on a targeted sequence. PMID:28979287

Activation of Alternative Wnt Signaling Pathways in Human Mammary Gland and breast Cancer Cells

DTIC Science & Technology

2005-06-01

or SuperFopFlash with mutated elements (control) and a renilla -luciferase construct in all wells. Transfections were performed in triplicates using...0.18 ýtg of reporter plasmid, 0.02 ug of renilla - luciferase plasmid and 0.45 jig of inducer plasmid in total with 1.3 [A of Lipofectin in OptiMEM...and then were incubated overnight with fresh full endothelial culture media. Cell lysates were prepared the next day and both firefly and renilla

Molecular Imaging of Tumor Angiogenesis and Therapeutic Effects with Dual Bioluminescence.

PubMed

Wang, Ran; Zhang, Kaiyue; Tao, Hongyan; Du, Wei; Wang, Di; Huang, Ziwei; Zhou, Manqian; Xu, Yang; Wang, Yuebing; Liu, Na; Wang, Hui; Li, Zongjin

2017-01-01

Angiogenesis is critical for the growth of tumor by supplying nutrients and oxygen that exacerbates the metastasis and progression of cancer. Noninvasive imaging of angiogenesis during the tumor therapeutic processes may provide novel opportunities for image-guided tumor management. Here, we want to develop a mouse animal model for assessing cancer progression and angiogenesis in the same individuals by molecular imaging. Breast cancer model was developed with mouse breast cancer cell line 4T1 carrying a reporter system encoding a triple fusion (TF) reporter gene consisting of renilla luciferase (Rluc), red fluorescent protein (RFP) and herpes simplex virus truncated thymidine kinase (HSV-ttk) in transgenic mice, which expressed firefly luciferase (Fluc) under the promoter of vascular endothelial growth factor receptor 2 (Vegfr2-luc). The mice were subsequently treated with ganciclovir (GCV) and the tumor angiogenesis was tracked by Fluc imaging and the growth status of tumor was monitored by imaging of Rluc simultaneously. Overall, this traceable breast cancer model can simultaneously image the tumor growth and angiogenesis in single individual, which may facilitate a better understanding the mechanisms of angiogenesis in the progression and regression of tumor. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Application of firefly luciferase assay for adenosine triphosphate (ATP) to antimicrobial drug sensitivity testing

NASA Technical Reports Server (NTRS)

Picciolo, G. L.; Tuttle, S. A.; Schrock, C. G.; Deming, J. W.; Barza, M. J.; Wienstein, L.; Chappelle, E. W.

1977-01-01

The development of a rapid method for determining microbial susceptibilities to antibiotics using the firefly luciferase assay for adenosine triphosphate (ATP) is documented. The reduction of bacterial ATP by an antimicrobial agent was determined to be a valid measure of drug effect in most cases. The effect of 12 antibiotics on 8 different bacterial species gave a 94 percent correlation with the standard Kirby-Buer-Agar disc diffusion method. A 93 percent correlation was obtained when the ATP assay method was applied directly to 50 urine specimens from patients with urinary tract infections. Urine samples were centrifuged first to that bacterial pellets could be suspended in broth. No primary isolation or subculturing was required. Mixed cultures in which one species was predominant gave accurate results for the most abundant organism. Since the method is based on an increase in bacterial ATP with time, the presence of leukocytes did not interfere with the interpretation of results. Both the incubation procedure and the ATP assays are compatible with automation.

Long Term Non-Invasive Imaging of Embryonic Stem Cells Using Reporter Genes

PubMed Central

Sun, Ning; Lee, Andrew; Wu, Joseph C.

2013-01-01

Development of non-invasive and accurate methods to track cell fate following delivery will greatly expedite transition of embryonic stem (ES) cell therapy to the clinic. Here we describe a protocol for the in vivo monitoring of stem cell survival, proliferation, and migration using reporter genes. We established stable ES cell lines constitutively expressing double fusion (DF; enhanced green fluorescent protein and firefly luciferase) or triple fusion (TF; monomeric red fluorescent protein, firefly luciferase, and herpes simplex virus thymidine kinase) reporter genes using lentiviral transduction. We used fluorescence activated cell sorting to purify these populations in vitro, bioluminescence imaging and positron emission tomography imaging to track them in vivo, and fluorescence immunostaining to confirm the results ex vivo. Unlike other methods of cell tracking such as iron particle and radionuclide labeling, reporter genes are inherited genetically and can be used to monitor cell proliferation and survival for the lifetime of transplanted cells and their progeny. PMID:19617890

Monitoring protein-protein interactions using split synthetic renilla luciferase protein-fragment-assisted complementation.

PubMed

Paulmurugan, R; Gambhir, S S

2003-04-01

In this study we developed an inducible synthetic renilla luciferase protein-fragment-assisted complementation-based bioluminescence assay to quantitatively measure real time protein-protein interactions in mammalian cells. We identified suitable sites to generate fragments of N and C portions of the protein that yield significant recovered activity through complementation. We validate complementation-based activation of split synthetic renilla luciferase protein driven by the interaction of two strongly interacting proteins, MyoD and Id, in five different cell lines utilizing transient transfection studies. The expression level of the system was also modulated by tumor necrosis factor alpha through NFkappaB-promoter/enhancer elements used to drive expression of the N portion of synthetic renilla luciferase reporter gene. This new system should help in studying protein-protein interactions and when used with other split reporters (e.g., split firefly luciferase) should help to monitor different components of an intracellular network.

Monitoring Protein–Protein Interactions Using Split Synthetic Renilla Luciferase Protein-Fragment-Assisted Complementation

PubMed Central

Paulmurugan, R.; Gambhir, S. S.

2014-01-01

In this study we developed an inducible synthetic renilla luciferase protein-fragment-assisted complementation-based bioluminescence assay to quantitatively measure real time protein–protein interactions in mammalian cells. We identified suitable sites to generate fragments of N and C portions of the protein that yield significant recovered activity through complementation. We validate complementation-based activation of split synthetic renilla luciferase protein driven by the interaction of two strongly interacting proteins, MyoD and Id, in five different cell lines utilizing transient transfection studies. The expression level of the system was also modulated by tumor necrosis factor α through NFκB-promoter/enhancer elements used to drive expression of the N portion of synthetic renilla luciferase reporter gene. This new system should help in studying protein–protein interactions and when used with other split reporters (e.g., split firefly luciferase) should help to monitor different components of an intracellular network. PMID:12705589

Pyrearinus termitilluminans larval click beetle luciferase: active site properties, structure and function relationships and comparison with other beetle luciferases.

PubMed

Silva Neto, A J; Scorsato, V; Arnoldi, F G C; Viviani, V R

2009-12-01

Several beetle luciferases have been cloned and sequenced. However, most studies on structure and function relationships and bioanalytical applications were done with firefly luciferases, which are pH sensitive. Several years ago we cloned Pyrearinus termitilluminans larval click beetle luciferase, which displays the most blue-shifted bioluminescence among beetle luciferases and is pH insensitive. This enzyme was expressed in E. coli, purified, and its properties investigated. This luciferase shows slower luminescence kinetics, K(M) values comparable to other beetle luciferases and high catalytic constant. Fluorescence studies with 8-anilino-1-naphtalene-sulfonic acid (1,8-ANS) and modeling studies suggest that the luciferin binding site of this luciferase is very hydrophobic, supporting the solvent and orientation polarizability effects as determining mechanisms for bioluminescence colors. Although pH insensitive in the range between pH 6-8, at pH 10 this luciferase displays a remarkable red-shift and broadening of the bioluminescence spectrum. Modeling studies suggest that the residue C312 may play an important role in bioluminescence color modulation. Compared to other beetle luciferases, Pyrearinus termitilluminans luciferase also displays higher thermostability and sustained luminescence in a bacterial cell environment, which makes this luciferase particularly suitable for in vivo cell analysis and bioimaging.

Fireflies in the Coalmine: Luciferase Technologies in Next-Generation Toxicity Testing

EPA Science Inventory

Whole-animal studies have been the mainstay of toxicity testing for decades. These approaches are too expensive and laborious to effectively characterize all of the chemicals currently in commercial use. In addition, there are social and ethical pressures to reduce, refine and re...

A Genetic Approach to the Identification of Plant Genes Involved in Viral Movement

DTIC Science & Technology

1999-09-30

Arabidopsis.. We plan to create two transgenic plant lines of Arabidopsis, one that expresses the firefly luciferase (Luc) gene, and one that... transgenic plant lines that express Luc or CD upon infection with RCNMV. Phenotypically these lines will either be luminescent (Luc) or sensitive to 5

Automated detection of bacteria in urine

NASA Technical Reports Server (NTRS)

Fleig, A. J.; Picciolo, G. L.; Chappelle, E. W.; Kelbaugh, B. N.

1972-01-01

A method for detecting the presence of bacteria in urine was developed which utilizes the bioluminescent reaction of adenosine triphosphate with luciferin and luciferase derived from the tails of fireflies. The method was derived from work on extraterrestrial life detection. A device was developed which completely automates the assay process.

Novel Cell-Based Assays for Detecting Low Levels of Active Ricin Following Decontamination

DTIC Science & Technology

2011-12-01

fluorescent protein, are powerful tools, which have been used for detection assays for ricin protein ( DeWet , 1987). Zhao et al. (2005) have reported a...toxic Type 2 Ribosome-Inactivating Proteins. FEBS Lett. 2004, 563, pp 219–222. DeWet , J.R. et al. Firefly Luciferase Gene: Structure and

Bioluminescent system for dynamic imaging of cell and animal behavior

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hara-Miyauchi, Chikako; Laboratory for Cell Function Dynamics, Brain Science Institute, RIKEN, Saitama 351-0198; Department of Biophysics and Biochemistry, Graduate School of Health Care Sciences, Tokyo Medical and Dental University, Tokyo 113-8510

2012-03-09

Highlights: Black-Right-Pointing-Pointer We combined a yellow variant of GFP and firefly luciferase to make ffLuc-cp156. Black-Right-Pointing-Pointer ffLuc-cp156 showed improved photon yield in cultured cells and transgenic mice. Black-Right-Pointing-Pointer ffLuc-cp156 enabled video-rate bioluminescence imaging of freely-moving animals. Black-Right-Pointing-Pointer ffLuc-cp156 mice enabled tracking real-time drug delivery in conscious animals. -- Abstract: The current utility of bioluminescence imaging is constrained by a low photon yield that limits temporal sensitivity. Here, we describe an imaging method that uses a chemiluminescent/fluorescent protein, ffLuc-cp156, which consists of a yellow variant of Aequorea GFP and firefly luciferase. We report an improvement in photon yield by over threemore » orders of magnitude over current bioluminescent systems. We imaged cellular movement at high resolution including neuronal growth cones and microglial cell protrusions. Transgenic ffLuc-cp156 mice enabled video-rate bioluminescence imaging of freely moving animals, which may provide a reliable assay for drug distribution in behaving animals for pre-clinical studies.« less

Interaction of firefly luciferase and silver nanoparticles and its impact on enzyme activity

NASA Astrophysics Data System (ADS)

Käkinen, Aleksandr; Ding, Feng; Chen, Pengyu; Mortimer, Monika; Kahru, Anne; Ke, Pu Chun

2013-08-01

We report on the dose-dependent inhibition of firefly luciferase activity induced by exposure of the enzyme to 20 nm citrate-coated silver nanoparticles (AgNPs). The inhibition mechanism was examined by characterizing the physicochemical properties and biophysical interactions of the enzyme and the AgNPs. Consistently, binding of the enzyme induced an increase in zeta potential from -22 to 6 mV for the AgNPs, triggered a red-shift of 44 nm in the absorbance peak of the AgNPs, and rendered a ‘protein corona’ of 20 nm in thickness on the nanoparticle surfaces. However, the secondary structures of the enzyme were only marginally affected upon formation of the protein corona, as verified by circular dichroism spectroscopy measurement and multiscale discrete molecular dynamics simulations. Rather, inductively coupled plasma mass spectrometry measurement revealed a significant ion release from the AgNPs. The released silver ions could readily react with the cysteine residues and N-groups of the enzyme to alter the physicochemical environment of their neighboring catalytic site and subsequently impair the enzymatic activity.

Identification of a cis-Regulatory Element Involved in Phytochrome Down-Regulated Expression of the Pea Small GTPase Gene pra21

PubMed Central

Inaba, Takehito; Nagano, Yukio; Sakakibara, Toshihiro; Sasaki, Yukiko

1999-01-01

The pra2 gene encodes a pea (Pisum sativum) small GTPase belonging to the YPT/rab family, and its expression is down-regulated by light, mediated by phytochrome. We have isolated and characterized a genomic clone of this gene and constructed a fusion DNA of its 5′-upstream region in front of the gene for firefly luciferase. Using this construct in a transient assay, we determined a pra2 cis-regulatory region sufficient to direct the light down-regulation of the luciferase reporter gene. Both 5′- and internal deletion analyses revealed that the 93-bp sequence between −734 and −642 from the transcriptional start site was important for phytochrome down-regulation. Gain-of-function analysis showed that this 93-bp region could confer light down-regulation when fused to the cauliflower mosaic virus 35S promoter. Furthermore, linker-scanning analysis showed that a 12-bp sequence within the 93-bp region mediated phytochrome down-regulation. Gel-retardation analysis showed the presence of a nuclear factor that was specifically bound to the 12-bp sequence in vitro. These results indicate that this element is a cis-regulatory element involved in phytochrome down-regulated expression. PMID:10364400

Multimodal Fluorescence and Bioluminescence Imaging Reveals Transfection Potential of Intratracheally Administered Polyplexes for Breast Cancer Lung Metastases.

PubMed

Geyer, Antonia; Taschauer, Alexander; Alioglu, Fatih; Anton, Martina; Maier, Julia; Drothler, Elisabeth; Simlinger, Manuela; Yavuz, Sümeyye; Sami, Haider; Ogris, Manfred

2017-12-01

Local delivery of anticancer agents or gene therapeutics to lung tumors can circumvent side effects or accumulation in non-target organs, but accessibility via the alveolar side of the blood-air barrier remains challenging. Polyplexes based on plasmid and linear polyethylenimine (LPEI) transfect healthy lung tissue when applied intravenously (i.v.) in the mouse, but direct delivery into the lungs results in low transfection of lung tissue. Nevertheless, LPEI could offer the potential to transfect lung tumors selectively, if accessible from the alveolar side. This study combined near infrared fluorescent protein 720 (iRFP720) and firefly luciferase as reporter genes for detection of tumor lesions and transfection efficiency of LPEI polyplexes, after intratracheal microspraying in mice bearing 4T1 triple negative breast cancer lung metastases. Simultaneous flow cytometric analysis of iRFP720 and enhanced green fluorescent protein expression in vitro demonstrated the potential to combine these reporter genes within transfection studies. Polyplex biophysics was characterized by single nanoparticle tracking analysis (NTA) to monitor physical integrity after microspraying in vitro. 4T1 cells were transduced with iRFP720-encoding lentivirus and evaluated by flow cytometry for stable iRFP720 expression. Growth of 4T1-iRFP720 cells was monitored in Balb/c mice by tomographic near infrared imaging, tissue and tumor morphology by computed tomography and magnetic resonance imaging. In 4T1-iRFP720 tumor-bearing mice, intratracheal administration of luciferase-encoding plasmid DNA by LPEI polyplexes resulted in successful tumor transfection, as revealed by bioluminescence imaging.

Establishment of a luciferase assay-based screening system: Fumitremorgin C selectively inhibits cellular proliferation of immortalized astrocytes expressing an active form of AKT

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang Lei; Sasai, Ken; Akagi, Tsuyoshi

2008-08-29

The AKT pathway is frequently activated in glioblastoma, and as such, inhibitors of this pathway could prove very useful as anti-glioblastoma therapies. Here we established immortalized astrocytes expressing Renilla luciferase as well as those expressing both an active form of AKT and firefly luciferase. Since both luciferase activities represent the numbers of corresponding cell lines, novel inhibitors of the AKT pathway can be identified by treating co-cultures containing the two types of luciferase-expressing cells with individual compounds. Indeed, such a screening system succeeded in identifying fumitremorgin C as an efficient inhibitor of the AKT pathway, which was further confirmed bymore » the ability of fumitremorgin C to selectively inhibit the growth of immortalized astrocytes expressing an active form of AKT. The present study proposes a broadly applicable approach for identifying therapeutic agents that target the pathways and/or molecules responsible for cancer development.« less

Dual-Color Click Beetle Luciferase Heteroprotein Fragment Complementation Assays

PubMed Central

Villalobos, Victor; Naik, Snehal; Bruinsma, Monique; Dothager, Robin S.; Pan, Mei-Hsiu; Samrakandi, Mustapha; Moss, Britney; Elhammali, Adnan; Piwnica-Worms, David

2010-01-01

Summary Understanding the functional complexity of protein interactions requires mapping biomolecular complexes within the cellular environment over biologically-relevant time scales. Herein we describe a novel set of reversible, multicolored heteroprotein complementation fragments based on various firefly and click beetle luciferases that utilize the same substrate, D-luciferin. Luciferase heteroprotein fragment complementation systems enabled dual-color quantification of two discreet pairs of interacting proteins simultaneously or two distinct proteins interacting with a third shared protein in live cells. Using real-time analysis of click beetle green and click beetle red luciferase heteroprotein fragment complementation applied to β-TrCP, an E3-ligase common to the regulation of both β-catenin and IκBα, GSK3β was identified as a novel candidate kinase regulating IκBα processing. These dual-color protein interaction switches may enable directed dynamic analysis of a variety of protein interactions in living cells. PMID:20851351

[Microplate luminometry for toxicity bioassay of chemicals on luciferase].

PubMed

Ge, Hui-Lin; Liu, Shu-Shen; Chen, Fu; Luo, Jin-Hui; Lü, Dai-Zhu; Su, Bing-Xia

2013-10-01

A new microplate luminometry for the toxicity bioassay of chemicals on firefly luciferase, was developed using the multifunctional microplate reader (SpectraMax M5) to measure the luminous intensity of luciferase. Efects of luciferase concentration, luciferin concentration, ATP concentration, pH, temperature, and reaction time on the luminescence were systematically investigated. It was found that ATP exerted a biphasic response on the luciferase luminescence and the maximum relative light units (RLU) occurred at an ATP concentration of 1.1 x 10(-4) mol x L(-1). The method was successfully employed in the toxic effect test of NaF, NaCl, KBr and NaBF4 on luciferase. Using nonlinear least square technique, the dose-response curves (DRC) of the 4 chemicals were accurately fitted with the coefficient of determination (R2) between the fitted and observed responses being greater than 0.99. The median effective concentration (EC50) of the 4 chemicals were accurately measured from the DRC models. Compared with some literatures, the bioassay is a fast easy-operate and cost-effective method with high accuracy.

Cycloheximide- and puromycin-induced heat resistance: different effects on cytoplasmic and nuclear luciferases

PubMed Central

Michels, Annemieke A; Kanon, Bart; Konings, Antonius W.T; Bensaude, Olivier; Kampinga, Harm H

2000-01-01

Inhibition of translation can result in cytoprotection against heat shock. The mechanism of this protection has remained elusive so far. Here, the thermoprotective effects of the translation inhibitor cycloheximide (CHX) and puromycin were investigated, using as reporter firefly luciferase localized either in the nucleus or in the cytoplasm. A short preincubation of O23 cells with either translation inhibitor was found to attenuate the heat inactivation of a luciferase directed into the cytoplasm, whereas the heat sensitivity of a nuclear-targeted luciferase remained unaffected. After a long-term CHX pretreatment, both luciferases were more heat resistant. Both the cytoplasmic and the nuclear luciferase are protected against heat-induced inactivation in thermotolerant cells and in cells overexpressing heat shock protein (Hsp)70. CHX incubations further attenuated cytoplasmic luciferase inactivation in thermotolerant and in Hsp70 overexpressing cells, even when Hsp70-mediated protection was saturated. It is concluded that protection by translation inhibition is unlikely due to an increase in the pool of free Hsps normally engaged in translation and released from the nascent polypeptide chains on the ribosomes. Rather, a decrease in nascent chains and thermolabile polypeptides may account for the heat resistance promoted by inhibitors of translation. PMID:11005376

Extracts of Fruits and Vegetables Activate the Antioxidant Response Element in IMR-32 Cells.

PubMed

Orena, Stephen; Owen, Jennifer; Jin, Fuxia; Fabian, Morgan; Gillitt, Nicholas D; Zeisel, Steven H

2015-09-01

The biological effects of antioxidant nutrients are mediated in part by activation of antioxidant response elements (AREs) on genes for enzymes involved in endogenous pathways that prevent free radical damage. Traditional approaches for identifying antioxidant molecules in foods, such as total phenolic compound (TP) content or oxygen radical absorption capacity (ORAC), do not measure capacity to activate AREs. The goal of this study was to develop an assay to assess the ARE activation capacity of fruit and vegetable extracts and determine whether such capacity was predicted by TP content and/or ORAC activity. Fruits and vegetables were homogenized, extracted with acidified ethanol, lyophilized, and resuspended in growth medium. Human IMR-32 neuroblastoma cells, transfected with an ARE-firefly luciferase reporter, were exposed to extracts for 5 h. Firefly luciferase was normalized to constitutively expressed Renilla luciferase with tertiary butylhydroquinone (tBHQ) as a positive control. TP content and ORAC activity were measured for each extract. Relations between TPs and ORAC and ARE activity were determined. A total of 107 of 134 extracts tested significantly activated the ARE-luciferase reporter from 1.2- to 58-fold above that of the solvent control (P < 0.05) in human IMR-32 cells. ARE activity, TP content, and ORAC ranked higher in peels than in associated flesh. Despite this relation, ARE activity did not correlate with TP content (Spearman ρ = 0.05, P = 0.57) and only modestly but negatively correlated with ORAC (Spearman ρ = -0.24, P < 0.01). Many extracts activated the ARE more than predicted by the TP content or ORAC. The ARE reporter assay identified many active fruit and vegetable extracts in human IMR-32 cells. There are components of fruits and vegetables that activate the ARE but are not phenolic compounds and are low in ORAC. The ARE-luciferase reporter assay is likely a better predictor of the antioxidant benefits of fruits and vegetables than TP or ORAC. © 2015 American Society for Nutrition.

Transcriptome analysis reveals candidate genes involved in luciferin metabolism in Luciola aquatilis (Coleoptera: Lampyridae)

PubMed Central

Vongsangnak, Wanwipa; Chumnanpuen, Pramote

2016-01-01

Bioluminescence, which living organisms such as fireflies emit light, has been studied extensively for over half a century. This intriguing reaction, having its origins in nature where glowing insects can signal things such as attraction or defense, is now widely used in biotechnology with applications of bioluminescence and chemiluminescence. Luciferase, a key enzyme in this reaction, has been well characterized; however, the enzymes involved in the biosynthetic pathway of its substrate, luciferin, remains unsolved at present. To elucidate the luciferin metabolism, we performed a de novo transcriptome analysis using larvae of the firefly species, Luciola aquatilis. Here, a comparative analysis is performed with the model coleopteran insect Tribolium casteneum to elucidate the metabolic pathways in L. aquatilis. Based on a template luciferin biosynthetic pathway, combined with a range of protein and pathway databases, and various prediction tools for functional annotation, the candidate genes, enzymes, and biochemical reactions involved in luciferin metabolism are proposed for L. aquatilis. The candidate gene expression is validated in the adult L. aquatilis using reverse transcription PCR (RT-PCR). This study provides useful information on the bio-production of luciferin in the firefly and will benefit to future applications of the valuable firefly bioluminescence system. PMID:27761329

The origin of luciferase activity in Zophobas mealworm AMP/CoA-ligase (protoluciferase): luciferin stereoselectivity as a switch for the oxygenase activity.

PubMed

Viviani, Vadim R; Scorsato, Valeria; Prado, Rogilene A; Pereira, Jose G C; Niwa, Kazuki; Ohmiya, Yoshihiro; Barbosa, João A R G

2010-08-01

Beetle luciferases evolved from AMP/CoA-ligases. However, it is unclear how the new luciferase activity evolved. In order to clarify this question, we compared the luminescence and catalytic properties of a recently cloned luciferase-like enzyme from Zophobas mealworm, an AMP/CoA-ligase displaying weak luminescence activity, with those of cloned luciferases from the three main families of luminescent beetles: Phrixthrix hirtus railroad worm; Pyrearinus termitilluminans click beetle and Photinus pyralis firefly. The catalytic constant of the mealworm enzyme was 2-4 orders of magnitude lower than that of beetle luciferases, but 3 orders of magnitude above the non-catalyzed chemiluminescence of luciferyl-adenylate in buffer. Studies with D- and L-luciferin and their adenylates show that the luminescence reaction of the luciferase-like enzyme and beetle luciferases are stereoselective for D-luciferin and its adenylate, and that the selectivity is determined mainly at the adenylation step. Modelling studies showed that the luciferin binding site cavity of this enzyme is smaller and more hydrophobic than that of beetle luciferases. Therefore Zophobas mealworm enzyme displays true luciferase activity, keeping the attributes of an ancient protoluciferase. These results suggest that stereoselectivity for D-luciferin may have been a key event for the origin of oxygenase/luciferase activity in AMP/CoA-ligases, and that efficient luciferase activity may have further evolved mainly by increasing the catalytic constant of the oxidative reaction and the quantum yield of bioluminescence.

Transgenic mice that accept Luciferase- or GFP-expressing syngeneic tumor cells at high efficiencies.

PubMed

Aoyama, Naoki; Miyoshi, Hiroyuki; Miyachi, Hitoshi; Sonoshita, Masahiro; Okabe, Masaru; Taketo, Makoto Mark

2018-05-11

Jellyfish green fluorescent protein (GFP) and firefly luciferase can serve as versatile tracking markers for identification and quantification of transplanted cancer cells in vivo. However, immune reactions against these markers can hamper the formation of syngraft tumors and metastasis that follows. Here, we report two transgenic (Tg) mouse lines that express nonfunctional mutant marker proteins, namely modified firefly luciferase (Luc2) or enhanced GFP (EGFP). These mice, named as Tg-mLuc2 and Tg-mEGFP, turned out to be immunologically tolerant to the respective tracking markers and thus efficiently accepted syngeneic cancer cells expressing the active forms of the markers. We then injected intrarectally the F 1 hybrid Tg mice (BALB/c × C57BL/6J) with Colon-26 (C26) colon cancer cells that originated from a BALB/c mouse. Even when C26 cells expressed active Luc2 or EGFP, they formed primary tumors in the Tg mice with only 10 4 cells per mouse compared with more than 10 6 cells required in the nontransgenic BALB/c hosts. Furthermore, we detected metastatic foci of C26 cells in the liver and lungs of the Tg mice by tracking the specific reporter activities. These results show the usefulness of the Tg mouse lines as recipients for transplantation experiments with the non-self tracking marker-expressing cells. © 2018 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

Reporter Proteins in Whole-Cell Optical Bioreporter Detection Systems, Biosensor Integrations, and Biosensing Applications

PubMed Central

Close, Dan M.; Ripp, Steven; Sayler, Gary S.

2009-01-01

Whole-cell, genetically modified bioreporters are designed to emit detectable signals in response to a target analyte or related group of analytes. When integrated with a transducer capable of measuring those signals, a biosensor results that acts as a self-contained analytical system useful in basic and applied environmental, medical, pharmacological, and agricultural sciences. Historically, these devices have focused on signaling proteins such as green fluorescent protein, aequorin, firefly luciferase, and/or bacterial luciferase. The biochemistry and genetic development of these sensor systems as well as the advantages, challenges, and common applications of each one will be discussed. PMID:22291559

Liposomes as protective capsules for active silica sol-gel biocomposite synthesis.

PubMed

Li, Ye; Yip, Wai Tak

2005-09-21

Using liposome to shield an enzyme from hostile chemical environments during the sol-gel formation process has resulted in a novel approach to synthesizing silica sol-gel biocomposite materials. By reporting the encapsulation of horseradish peroxidase and firefly luciferase, we demonstrate that this new protocol can produce silica biocomposites that are more active than trapping the enzymes directly into hydrogels.

Flexible Measurement of Bioluminescent Reporters Using an Automated Longitudinal Luciferase Imaging Gas- and Temperature-optimized Recorder (ALLIGATOR).

PubMed

Crosby, Priya; Hoyle, Nathaniel P; O'Neill, John S

2017-12-13

Luciferase-based reporters of cellular gene expression are in widespread use for both longitudinal and end-point assays of biological activity. In circadian rhythms research, for example, clock gene fusions with firefly luciferase give rise to robust rhythms in cellular bioluminescence that persist over many days. Technical limitations associated with photomultiplier tubes (PMT) or conventional microscopy-based methods for bioluminescence quantification have typically demanded that cells and tissues be maintained under quite non-physiological conditions during recording, with a trade-off between sensitivity and throughput. Here, we report a refinement of prior methods that allows long-term bioluminescence imaging with high sensitivity and throughput which supports a broad range of culture conditions, including variable gas and humidity control, and that accepts many different tissue culture plates and dishes. This automated longitudinal luciferase imaging gas- and temperature-optimized recorder (ALLIGATOR) also allows the observation of spatial variations in luciferase expression across a cell monolayer or tissue, which cannot readily be observed by traditional methods. We highlight how the ALLIGATOR provides vastly increased flexibility for the detection of luciferase activity when compared with existing methods.

Use of a special Brazilian red-light emitting railroad worm Luciferase in bioassays of NEK7 protein Kinase and Creatine Kinase.

PubMed

Marina Perez, Arina; Aquino, Bruno; Viviani, Vadim; Kobarg, Jörg

2017-07-19

Luciferases, enzymes that catalyze bioluminescent reactions in different organisms, have been extensively used for bioanalytical purposes. The most well studied bioluminescent system is that of firefly and other beetles, which depends on a luciferase, a benzothiazolic luciferin and ATP, and it is being widely used as a bioanalytical reagent to quantify ATP. Protein kinases are proteins that modify other proteins by transferring phosphate groups from a nucleoside triphosphate, usually ATP. Here, we used a red-light emitting luciferase from Phrixotrix hirtus railroad worm to determine the activity of kinases in a coupled assay, based on luminescence that is generated when luciferase is in the presence of its substrate, the luciferin, and ATP. In this work we used, after several optimization reactions, creatine kinase isoforms as well as NEK7 protein kinase in the absence or presence of ATP analogous inhibitors  to validate this new luminescence method. With this new approach we validated a luminescence method to quantify kinase activity, with different substrates and inhibition screening tests, using a novel red-light emitting luciferase as a reporter enzyme.

Proton mediated control of biochemical reactions with bioelectronic pH modulation

NASA Astrophysics Data System (ADS)

Deng, Yingxin; Miyake, Takeo; Keene, Scott; Josberger, Erik E.; Rolandi, Marco

2016-04-01

In Nature, protons (H+) can mediate metabolic process through enzymatic reactions. Examples include glucose oxidation with glucose dehydrogenase to regulate blood glucose level, alcohol dissolution into carboxylic acid through alcohol dehydrogenase, and voltage-regulated H+ channels activating bioluminescence in firefly and jellyfish. Artificial devices that control H+ currents and H+ concentration (pH) are able to actively influence biochemical processes. Here, we demonstrate a biotransducer that monitors and actively regulates pH-responsive enzymatic reactions by monitoring and controlling the flow of H+ between PdHx contacts and solution. The present transducer records bistable pH modulation from an “enzymatic flip-flop” circuit that comprises glucose dehydrogenase and alcohol dehydrogenase. The transducer also controls bioluminescence from firefly luciferase by affecting solution pH.

Robust red-emission spectra and yields in firefly bioluminescence against temperature changes

NASA Astrophysics Data System (ADS)

Mochizuki, Toshimitsu; Wang, Yu; Hiyama, Miyabi; Akiyama, Hidefumi

2014-05-01

We measured the quantitative spectra of firefly (Photinus pyralis) bioluminescence at various temperatures to investigate the temperature dependence of the luciferin-luciferase reaction at 15-34 °C. The quantitative spectra were decomposed very well into red (1.9 eV), orange (2.0 eV), and green (2.2 eV) Gaussian components. The intensity of the green component was the only temperature sensitive quantity that linearly decreased as the temperature increased at pH 7 and 8. We found the quantitative bioluminescence spectra to be robust below 2.0 eV against temperature and other experimental conditions. The revealed robustness of the red emissions should be useful for quantitative applications such as adenosine-5'-triphosphate detection.

Development of Neh2-Luciferase Reporter and Its Application for High Throughput Screening and Real-Time Monitoring of Nrf2 Activators

PubMed Central

Smirnova, Natalya A.; Haskew-Layton, Renee E.; Basso, Manuela; Hushpulian, Dmitry M.; Payappilly, Jimmy B.; Speer, Rachel E.; Ahn, Young-Hoon; Rakhman, Ilay; Cole, Philip A.; Pinto, John T.; Ratan, Rajiv R.; Gazaryan, Irina G.

2011-01-01

SUMMARY The NF-E2-related factor 2 (Nrf2) is a key transcriptional regulator of antioxidant defense and detoxification. To directly monitor stabilization of Nrf2, we fused its Neh2 domain, responsible for the interaction with its nucleocytoplasmic regulator, Keap1, to firefly luciferase (Neh2-luciferase). We show that Neh2 domain is sufficient for recognition, ubiquitination, and proteasomal degradation of Neh2-luciferase fusion protein. The Neh2-luc reporter system allows direct monitoring of the adaptive response to redox stress and classification of drugs based on the time course of reporter activation. The reporter was used to screen the Spectrum library of 2000 biologically active compounds to identify activators of Nrf2. The most robust and yet nontoxic Nrf2 activators found—nordihydroguaiaretic acid, fisetin, and gedunin—induced astrocyte-dependent neuroprotection from oxidative stress via an Nrf2-dependent mechanism. PMID:21700211

Cloning and characterization of a tuberous root-specific promoter from cassava (Manihot esculenta Crantz).

PubMed

Koehorst-van Putten, Herma J J; Wolters, Anne-Marie A; Pereira-Bertram, Isolde M; van den Berg, Hans H J; van der Krol, Alexander R; Visser, Richard G F

2012-12-01

In order to obtain a tuberous root-specific promoter to be used in the transformation of cassava, a 1,728 bp sequence containing the cassava granule-bound starch synthase (GBSSI) promoter was isolated. The sequence proved to contain light- and sugar-responsive cis elements. Part of this sequence (1,167 bp) was cloned into binary vectors to drive expression of the firefly luciferase gene. Cassava cultivar Adira 4 was transformed with this construct or a control construct in which the luciferase gene was cloned behind the 35S promoter. Luciferase activity was measured in leaves, stems, roots and tuberous roots. As expected, the 35S promoter induced luciferase activity in all organs at similar levels, whereas the GBSSI promoter showed very low expression in leaves, stems and roots, but very high expression in tuberous roots. These results show that the cassava GBSSI promoter is an excellent candidate to achieve tuberous root-specific expression in cassava.

Light without substrate amendment: the bacterial luciferase gene cassette as a mammalian bioreporter

NASA Astrophysics Data System (ADS)

Close, Dan M.; Xu, Tingting; Smartt, Abby E.; Jegier, Pat; Ripp, Steven A.; Sayler, Gary S.

2011-06-01

Bioluminescent production represents a facile method for bioreporter detection in mammalian tissues. The lack of endogenous bioluminescent reactions in these tissues allows for high signal to noise ratios even at low signal strength compared to fluorescent signal detection. While the luciferase enzymes commonly employed for bioluminescent detection are those from class Insecta (firefly and click beetle luciferases), these are handicapped in that they require concurrent administration of a luciferin compound to elicit a bioluminescent signal. The bacterial luciferase (lux) gene cassette offers the advantages common to other bioluminescent proteins, but is simultaneously capable of synthesizing its own luciferin substrates using endogenously available cellular compounds. The longstanding shortcoming of the lux cassette has been its recalcitrance to function in the mammalian cellular environment. This paper will present an overview of the work completed to date to overcome this limitation and provide examples of mammalian lux-based bioreporter technologies that could provide the framework for advanced, biomedically relevant real-time sensor development.

In Vivo Follow-up of Brain Tumor Growth via Bioluminescence Imaging and Fluorescence Tomography

PubMed Central

Genevois, Coralie; Loiseau, Hugues; Couillaud, Franck

2016-01-01

Reporter gene-based strategies are widely used in experimental oncology. Bioluminescence imaging (BLI) using the firefly luciferase (Fluc) as a reporter gene and d-luciferin as a substrate is currently the most widely employed technique. The present paper compares the performances of BLI imaging with fluorescence imaging using the near infrared fluorescent protein (iRFP) to monitor brain tumor growth in mice. Fluorescence imaging includes fluorescence reflectance imaging (FRI), fluorescence diffuse optical tomography (fDOT), and fluorescence molecular Imaging (FMT®). A U87 cell line was genetically modified for constitutive expression of both the encoding Fluc and iRFP reporter genes and assayed for cell, subcutaneous tumor and brain tumor imaging. On cultured cells, BLI was more sensitive than FRI; in vivo, tumors were first detected by BLI. Fluorescence of iRFP provided convenient tools such as flux cytometry, direct detection of the fluorescent protein on histological slices, and fluorescent tomography that allowed for 3D localization and absolute quantification of the fluorescent signal in brain tumors. PMID:27809256

In Vivo Follow-up of Brain Tumor Growth via Bioluminescence Imaging and Fluorescence Tomography.

PubMed

Genevois, Coralie; Loiseau, Hugues; Couillaud, Franck

2016-10-31

Reporter gene-based strategies are widely used in experimental oncology. Bioluminescence imaging (BLI) using the firefly luciferase (Fluc) as a reporter gene and d-luciferin as a substrate is currently the most widely employed technique. The present paper compares the performances of BLI imaging with fluorescence imaging using the near infrared fluorescent protein (iRFP) to monitor brain tumor growth in mice. Fluorescence imaging includes fluorescence reflectance imaging (FRI), fluorescence diffuse optical tomography (fDOT), and fluorescence molecular Imaging (FMT ® ). A U87 cell line was genetically modified for constitutive expression of both the encoding Fluc and iRFP reporter genes and assayed for cell, subcutaneous tumor and brain tumor imaging. On cultured cells, BLI was more sensitive than FRI; in vivo, tumors were first detected by BLI. Fluorescence of iRFP provided convenient tools such as flux cytometry, direct detection of the fluorescent protein on histological slices, and fluorescent tomography that allowed for 3D localization and absolute quantification of the fluorescent signal in brain tumors.

Real-time monitoring of artemin in vivo chaperone activity using luciferase as an intracellular reporter.

PubMed

Takalloo, Zeinab; Sajedi, Reza H; Hosseinkhani, Saman; Asghari, S Mohsen

2016-11-15

Artemin is an abundant thermostable protein in Artemia encysted embryos and considered as a stress protein, as its highly regulated expression is associated with stress resistance. Artemin cDNA was previously isolated and cloned from Artemia urmiana and artemin was found as an efficient molecular chaperone in vitro. Here, co-transformation of E. coli was performed with two expression vectors containing artemin and firefly luciferase for in vivo studies. The time-course of luciferase inactivation at low and elevated temperatures showed that luciferase was rapidly inactivated in control cells, but it was found that luciferase was protected significantly in artemin expressing cells. More interestingly, luciferase activity was completely regained in heat treated artemin expressing cells at room temperature. In addition, in both stress conditions, similar to residual activity of luciferase, cell viability in induced cultures over-expressing artemin was significantly higher than non-expressed artemin cells. It can be suggested that artemin confers impressive resistance in stressful conditions when introduced into E. coli cells, which is due to that it protects proteins against aggregation. Such luciferase co-expression system can be used as a real-time reporter to investigate the activity of chaperone proteins in vivo and provide a rapid and simple test for molecular chaperones. Copyright © 2016 Elsevier Inc. All rights reserved.

Use of Humanized RS-ATL8 Reporter System for Detection of Allergen-Specific IgE Sensitization in Human Food Allergy.

PubMed

Ali, Eman Ali; Nakamura, Ryosuke; Falcone, Franco H

2017-01-01

Allergen-specific Immunoglobulin E (IgE) determination lies at the heart of diagnosis of sensitization to food and other allergens. In the past few years, reporter systems capable of detecting the presence of allergen-specific IgE have been developed by several labs. These rely on humanized rat basophil leukemia cell lines stably transfected with reporter genes such as firefly luciferase. In this chapter, we describe protocols for the use of the RS-ATL8 cell line (IgE cross-linking-induced luciferase expression; EXiLE) in 96-well and 384-well formats. We also describe optional treatment steps for enveloped virus and complement inactivation.

A quantitative and high-throughput assay of human papillomavirus DNA replication.

PubMed

Gagnon, David; Fradet-Turcotte, Amélie; Archambault, Jacques

2015-01-01

Replication of the human papillomavirus (HPV) double-stranded DNA genome is accomplished by the two viral proteins E1 and E2 in concert with host DNA replication factors. HPV DNA replication is an established model of eukaryotic DNA replication and a potential target for antiviral therapy. Assays to measure the transient replication of HPV DNA in transfected cells have been developed, which rely on a plasmid carrying the viral origin of DNA replication (ori) together with expression vectors for E1 and E2. Replication of the ori-plasmid is typically measured by Southern blotting or PCR analysis of newly replicated DNA (i.e., DpnI digested DNA) several days post-transfection. Although extremely valuable, these assays have been difficult to perform in a high-throughput and quantitative manner. Here, we describe a modified version of the transient DNA replication assay that circumvents these limitations by incorporating a firefly luciferase expression cassette in cis of the ori. Replication of this ori-plasmid by E1 and E2 results in increased levels of firefly luciferase activity that can be accurately quantified and normalized to those of Renilla luciferase expressed from a control plasmid, thus obviating the need for DNA extraction, digestion, and analysis. We provide a detailed protocol for performing the HPV type 31 DNA replication assay in a 96-well plate format suitable for small-molecule screening and EC50 determinations. The quantitative and high-throughput nature of the assay should greatly facilitate the study of HPV DNA replication and the identification of inhibitors thereof.

Molecular basis for the high-affinity binding and stabilization of firefly luciferase by PTC124

DOE Office of Scientific and Technical Information (OSTI.GOV)

Auld, Douglas S.; Lovell, Scott; Thorne, Natasha

2010-04-07

Firefly luciferase (FLuc), an ATP-dependent bioluminescent reporter enzyme, is broadly used in chemical biology and drug discovery assays. PTC124 Ataluren; (3-[5-(2-fluorophenyl)-1,2,4-oxadiazol-3-yl]benzoic acid) discovered in an FLuc-based assay targeting nonsense codon suppression, is an unusually potent FLuc-inhibitor. Paradoxically, PTC124 and related analogs increase cellular FLuc activity levels by posttranslational stabilization. In this study, we show that FLuc inhibition and stabilization is the result of an inhibitory product formed during the FLuc-catalyzed reaction between its natural substrate, ATP, and PTC124. A 2.0 {angstrom} cocrystal structure revealed the inhibitor to be the acyl-AMP mixed-anhydride adduct PTC124-AMP, which was subsequently synthesized and shown tomore » be a high-affinity multisubstrate adduct inhibitor (MAI; KD = 120 pM) of FLuc. Biochemical assays, liquid chromatography/mass spectrometry, and near-attack conformer modeling demonstrate that formation of this novel MAI is absolutely dependent upon the precise positioning and reactivity of a key meta-carboxylate of PTC124 within the FLuc active site. We also demonstrate that the inhibitory activity of PTC124-AMP is relieved by free coenzyme A, a component present at high concentrations in luciferase detection reagents used for cell-based assays. This explains why PTC124 can appear to increase, instead of inhibit, FLuc activity in cell-based reporter gene assays. To our knowledge, this is an unusual example in which the 'off-target' effect of a small molecule is mediated by an MAI mechanism.« less

Proton mediated control of biochemical reactions with bioelectronic pH modulation

DOE PAGES

Deng, Yingxin; Miyake, Takeo; Keene, Scott; ...

2016-04-07

In Nature, protons (H +) can mediate metabolic process through enzymatic reactions. Examples include glucose oxidation with glucose dehydrogenase to regulate blood glucose level, alcohol dissolution into carboxylic acid through alcohol dehydrogenase, and voltage-regulated H + channels activating bioluminescence in firefly and jellyfish. Artificial devices that control H + currents and H + concentration (pH) are able to actively influence biochemical processes. Here, we demonstrate a biotransducer that monitors and actively regulates pH-responsive enzymatic reactions by monitoring and controlling the flow of H + between PdH x contacts and solution. The present transducer records bistable pH modulation from an “enzymaticmore » flip-flop” circuit that comprises glucose dehydrogenase and alcohol dehydrogenase. Furthermore, the transducer also controls bioluminescence from firefly luciferase by affecting solution pH.« less

Proton mediated control of biochemical reactions with bioelectronic pH modulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deng, Yingxin; Miyake, Takeo; Keene, Scott

In Nature, protons (H +) can mediate metabolic process through enzymatic reactions. Examples include glucose oxidation with glucose dehydrogenase to regulate blood glucose level, alcohol dissolution into carboxylic acid through alcohol dehydrogenase, and voltage-regulated H + channels activating bioluminescence in firefly and jellyfish. Artificial devices that control H + currents and H + concentration (pH) are able to actively influence biochemical processes. Here, we demonstrate a biotransducer that monitors and actively regulates pH-responsive enzymatic reactions by monitoring and controlling the flow of H + between PdH x contacts and solution. The present transducer records bistable pH modulation from an “enzymaticmore » flip-flop” circuit that comprises glucose dehydrogenase and alcohol dehydrogenase. Furthermore, the transducer also controls bioluminescence from firefly luciferase by affecting solution pH.« less

Quantitative bioluminescence imaging of transgene expression in intact porcine antral follicles in vitro.

PubMed

Jung, Song-yi; Willard, Scott T

2014-01-30

The porcine oocyte maturation in vivo occurs within the ovarian follicle and is regulated by the interactions between oocytes and surrounding follicular components, including theca, granulosa, and cumulus cells, and follicular fluid. Therefore, the antral follicle is an essential microenvironment for efficient oocyte maturation and its developmental competence. Quantitative bioluminescence imaging of firefly luciferase reporter genes in an intact antral follicle would allow investigation of changes in cellular and molecular events and in the context of the whole follicles. In this study, we investigate factors influencing bioluminescence measurements as a first step towards developing a new bioluminescence imaging system for intact antral follicles. We analyzed the time course of bioluminescence emitted from transfected living intact follicles using a cationic lipid mediated gene transfer method with increasing doses (1-3 μg) of firefly luciferase reporter gene (pGL4). In addition, a standard luciferase assay was used to confirm the luciferase expression in granulosa cells in the transfected intact antral follicles. Finally, the dose effects of substrate, D-luciferin, were determined for optimal quantitative bioluminescence imaging of intact porcine antral follicles in vitro. The level of luciferase activity of follicles with 3 μg pGL4 was significantly (P < 0.05) greater than the 1 μg and 2 μg groups at 1 min after D-luciferin injection. The bioluminescence intensity of transfected follicles reached a peak at 1 min, and then it was significantly (P < 0.05) reduced within 2 min after injection of D-luciferin; with the level of bioluminescence emission remained constant from 2.5 to 10 min. The bioluminescence emission was maximal with 300 μg of D-luciferin. The results of this study suggested that the investigation of factors influencing bioluminescence measurements is a critical step toward developing a new bioluminescence imaging model. This study is the first to demonstrate that reporter genes can be transferred to intact granulosa cells with a lipid-mediated gene transfer method within intact follicles in vitro, and the level of transgene expression can be assessed by bioluminescence imaging in living intact antral follicles.

Deciphering the Mechanism of Alternative Cleavage and Polyadenylation in Mantle Cell Lymphoma (MCL)

DTIC Science & Technology

2013-10-01

also has human firefly luciferase cloned within the same reporter system allowing for intra-plasmid normalization of transfection eliminating problems...collaboration with Dr. Wei Li, a Bioinformaticist from Baylor College of Medicine whose lab specializes in developing complex algorithms to analyze genome...wide sequencing data. Dr. Wei Li and his postdoctoral fellow, Dr. Zheng Xia developed a customized algorithm that is able to detect and quantify

New Breed of Mice May Improve Accuracy for Preclinical Testing of Cancer Drugs | Poster

Cancer.gov

A new breed of lab animals, dubbed “glowing head mice,” may do a better job than conventional mice in predicting the success of experimental cancer drugs—while also helping to meet an urgent need for more realistic preclinical animal models. The mice were developed to tolerate often-used light-emitting molecules, such as luciferase from fireflies and green fluorescent protein

Hepa1-6-FLuc cell line with the stable expression of firefly luciferase retains its primary properties with promising bioluminescence imaging ability.

PubMed

Li, Yasha; Liu, Mengnan; Cui, Jiejie; Yang, Ke; Zhao, Li; Gong, Mengjia; Wang, Yi; He, Yun; He, Tongchuan; Bi, Yang

2018-05-01

Reliable animal models are required for the in vivo study of the molecular mechanisms and effects of chemotherapeutic drugs in hepatocarcinoma. In vivo tracing techniques based on firefly luciferase (FLuc) may optimize the non-invasive monitoring of experimental animals. The present study established a murine Hepa1-6-FLuc cell line that stably expressed a retrovirus-delivered FLuc protein gene. The cell morphology, proliferation, migration and invasion ability of Hepa1-6-FLuc cells were the same as that of the Hepa1-6 cells, and thus is suitable to replace Hepa1-6 cells in the construction of hepatocarcinoma animal models. No differences in subcutaneous tumor mass and its pathomorphology from implanted Hepa1-6-FLuc cells were observed compared with Hepa1-6 control tumors. Bioluminescence imaging indicated that the Luc signal of the Hepa1-6-FLuc cells was consistently strengthened with increases in tumor mass; however, the Luc signal of Hepa1-6-AdFLuc became weaker and eventually disappeared during tumor development. Therefore, compared with the transient expression by adenovirus, stable expression of the FLuc gene in Hepa1-6 cells may better reflect cell proliferation and survival in vivo , and provide a reliable source for the establishment of hepatocarcinoma models.

Identification of the physiological promoter for spinocerebellar ataxia 2 gene reveals a CpG island for promoter activity situated into the exon 1 of this gene and provides data about the origin of the nonmethylated state of these types of islands.

PubMed

Aguiar, J; Santurlidis, S; Nowok, J; Alexander, C; Rudnicki, D; Gispert, S; Schulz, W; Auburger, G

1999-01-19

In order to further use the spinocerebellar ataxia 2 (SCA2) promoter for transgenic mice models of "CAG repeat" neurodegeneration, different fragments of this 5' end were ligated into pGL3-Luc plasmid to obtain the better promoter-activity of the physiological promoter for SCA2. Base-par composition of the SCA2-5' region, and promoter prediction algorithms such as TSSW and TSSG, together with the high firefly luciferase expression after 48 hours of transient transfection in mammalian cells lines, showed a typical CpG island for promoter-activity. The promoter activity was specifically localized into the exon 1 of the SCA2 gene. The higher expression of firefly luciferase in the embryonal F9 cells by the use of SCA2 promoter, rather than by the use of CMV promoter may be related with the origin of the nonmethylated CpG island during the early embryogenesis. Analysis of the 5' region from HD gene revealed to a CpG island, which could be containing the physiological promoter for this gene. Copyright 1999 Academic Press.

Noninvasive imaging of cationic lipid-mediated delivery of optical and PET reporter genes in living mice.

PubMed

Iyer, Meera; Berenji, Manijeh; Templeton, Nancy S; Gambhir, Sanjiv S

2002-10-01

Gene therapy involves the safe and effective delivery of one or more genes of interest to target cells in vivo. The advantages of using nonviral delivery systems include ease of preparation, low toxicity, and weak immunogenicity. Nonviral delivery methods, when combined with a noninvasive, clinically applicable imaging assay, will greatly aid in the optimization of gene therapy approaches for cancer. We demonstrate cationic lipid-mediated noninvasive monitoring of reporter gene expression of firefly (Photinus pyralis) luciferase (fl) and a mutant herpes simplex virus type I thymidine kinase (HSV1-sr39tk, tk) in living mice using a cooled charge coupled device (CCD) camera and positron emission tomography (PET), respectively. We observe a high level of fl and tk reporter gene expression predominantly in the lungs after a single injection of the extruded DOTAP:cholesterol DNA liposome complexes by way of the tail vein, seen to be time- and dose-dependent. We observe a good correlation between the in vivo bioluminescent signal and the ex vivo firefly luciferase enzyme (FL) activity in different organs. We further demonstrate the feasibility of noninvasively imaging both optical and PET reporter gene expression in the same animal using the CCD camera and microPET, respectively.

A potential role for imaging technology in anticancer efficacy evaluations.

PubMed

Hollingshead, M G; Bonomi, C A; Borgel, S D; Carter, J P; Shoemaker, R; Melillo, G; Sausville, E A

2004-04-01

The introduction of imaging methods suitable for rodents offers opportunities for new anticancer efficacy models. Traditional models do not provide the level of sensitivity afforded by these precise and quantitative techniques. Bioluminescent endpoints, now feasible because of sensitive charge-coupled device cameras, can be non-invasively detected in live animals. Currently, the most common luminescence endpoint is firefly luciferase, which, in the presence of O(2) and ATP, catalyses the cleavage of the substrate luciferin and results in the emission of a photon of light. In vivo implantation of tumour cells transfected with the luciferase gene allows sequential monitoring of tumour growth within the viscera by measuring these photon signals. Furthermore, tumour cell lines containing the luciferase gene transcribed from an inducible promoter offer opportunities to study molecular-target modulation without the need for ex vivo evaluations of serial tumour samples. In conjunction with this, transgenic mice bearing a luciferase reporter mechanism can be used to monitor the tumour microenvironment as well as to signal when transforming events occur. This technology has the potential to reshape the efficacy evaluations and drug-testing algorithms of the future.

The Role of AhR in Breast Cancer Development

DTIC Science & Technology

2006-07-01

was used according to the manufacturer’s instructions to transfect cells. The Renilla luciferase vector phRL-TK (0.05 g) was cotransfected with...sequential reading of the Firefly and Renilla signals. Cells were lysed according to the manufacturer’s directions (Promega, Madison, WI, USA...transferred to 96-well white wall plates, and analysed using a Reporter Luminometer (Promega, Madison, WI, USA). The Renilla signal was 7 read after

Improve T Cell Therapy in Neuroblastoma

DTIC Science & Technology

2015-09-01

bioluminescence was then measured overtime. The graph is representative of one of 4 experiments using CMV-CTLs from 4 donors. Panel E. Kaplan-Meier...whole-cell vaccine expressing the iC9 gene and labeled with an enhanced firefly luciferase. Tumor growth was measured by in vivo imaging. Panel E...down regulation in LTE -T cells is not caused by specific culture conditions. T lymphocytes were activated with immobilized OKT3 (1 μg ml) and

Inhibition of metastatic tumor growth in mouse lung by repeated administration of polyethylene glycol-conjugated catalase: quantitative analysis with firefly luciferase-expressing melanoma cells.

PubMed

Hyoudou, Kenji; Nishikawa, Makiya; Umeyama, Yukari; Kobayashi, Yuki; Yamashita, Fumiyoshi; Hashida, Mitsuru

2004-11-15

To develop a novel and effective approach to inhibit tumor metastasis based on controlled delivery of catalase, we first evaluated the characteristics of the disposition and proliferation of tumor cells. Then, we examined the effects of polyethylene glycol-conjugated catalase (PEG-catalase) on tumor metastasis. On the basis of the results obtained, PEG-catalase was repetitively administered to completely suppress the growth of tumor cells. Murine melanoma B16-BL6 cells were stably transfected with firefly luciferase gene to obtain B16-BL6/Luc cells. These cells were injected intravenously into syngeneic C57BL/6 mice. PEG-catalase was injected intravenously, and the effect was evaluated by measuring the luciferase activity as the indicator of the number of tumor cells. At 1 hour after injection of B16-BL6/Luc cells, 60 to 90% of the injected cells were recovered in the lung. The numbers decreased to 2 to 4% at 24 hours, then increased. An injection of PEG-catalase just before inoculation significantly reduced the number of tumor cells at 24 hours. Injection of PEG-catalase at 1 or 3 days after inoculation was also effective in reducing the cell numbers. Daily dosing of PEG-catalase greatly inhibited the proliferation and the number assayed at 14 days after inoculation was not significantly different from the minimal number observed at 1 day, suggesting that the growth had been markedly suppressed by the treatment. These findings indicate that sustained catalase activity in the blood circulation can prevent the multiple processes of tumor metastasis in the lung, which could lead to a state of tumor dormancy.

Integrated Optoelectronic Networks for Application-Driven Multicore Computing

DTIC Science & Technology

2017-05-08

hybrid photonic torus, the all-optical Corona crossbar, and the hybrid hierarchical Firefly crossbar. • The key challenges for waveguide photonics...improves SXR but with relatively higher EDP overhead. Our evaluation results indicate that the encoding schemes improve worst-case-SXR in Corona and...photonic crossbar architectures ( Corona and Firefly) indicate that our approach improves worst-case signal-to-noise ratio (SNR) by up to 51.7

Bacterial expression and re-engineering of Gaussia princeps luciferase and its use as a reporter protein.

PubMed

Wu, Nan; Rathnayaka, Tharangani; Kuroda, Yutaka

2015-10-01

Bioluminescence, the generation of visible light in a living organism, is widely observed in nature, and a large variety of bioluminescent proteins have been discovered and characterized. Luciferase is a generic term for bioluminescent enzymes that catalyze the emission of light through the oxidization of a luciferin (also a generic term). Luciferase are not necessarily evolutionary related and do not share sequence or structural similarities. Some luciferases, such as those from fireflies and Renilla, have been thoroughly characterized and are being used in a wide range of applications in bio-imaging. Gaussia luciferase (GLuc) from the marine copepod Gaussia princeps is the smallest known luciferase, and it is attracting much attention as a potential reporter protein. GLuc identification is relatively recent, and its structure and its biophysical properties remain to be fully characterized. Here, we review the bacterial production of natively folded GLuc with special emphasis on its disulfide bond formation and the re-engineering of its bioluminescence properties. We also compare the bioluminescent properties under a strictly controlled in vitro condition of selected GLuc's variants using extensively purified proteins with native disulfide bonds. Furthermore, we discuss and predict the domain structure and location of the catalytic core based on literature and on bioinformatics analysis. Finally, we review some examples of GLuc's emerging use in biomolecular imaging and biochemical assay systems. Copyright © 2015 Elsevier B.V. All rights reserved.

Systemic activation of NF-κB driven luciferase activity in transgenic mice fed advanced glycation end products modified albumin.

PubMed

Nass, Norbert; Bayreuther, Kristina; Simm, Andreas

2017-04-01

Advanced glycation end products (AGEs) are stable end products of the Maillard reaction and accumulate with progressing ageing and degenerative diseases. Significant amounts of AGE-modified peptides are also consumed with processed food. AGEs bind to specific receptors, especially the receptor of AGEs (RAGE). Activation of RAGE then evokes intracellular signalling, finally resulting in the activation of the NF-κB transcription factor and therefore a proinflammatory state. We here analysed, whether NF-κB is activated in short term upon feeding an AGE-modified protein in-vivo. Transgenic mice expressing firefly luciferase under the control of an NF-κB responsive promoter were intraperitoneally injected or fed with AGE-modified- or control albumin and luciferase expression was analysed by in-vivo imaging and by in-vitro by determination of luciferase enzyme activity in heart, lung, gut, spleen, liver and kidney. In all organs, an activation of the luciferase reporter gene was observed in response to AGE-BSA feeding, however with different intensity and timing. The gut exhibited highest luciferase activity and this activity peaked 6-8 h post AGE-feeding. In heart and kidney, luciferase activity increased for up to 12 h post feeding. All other organs tested, exhibited highest activity at 10 h after AGE-consumption. Altogether, these data demonstrate that feeding AGE-modified protein resulted in a transient and systemic activation of the NF-κB reporter.

Recombinant porcine reproductive and respiratory syndrome virus expressing luciferase genes provide a new indication of viral propagation in both permissive and target cells.

PubMed

Gao, Fei; Qu, Zehui; Li, Liwei; Yu, Lingxue; Jiang, Yifeng; Zhou, Yanjun; Yang, Shen; Zheng, Hao; Huang, Qinfeng; Tong, Wu; Tong, Guangzhi

2016-08-01

Porcine reproductive and respiratory syndrome virus (PRRSV) has a condensed single-stranded positive-sense RNA genome that contains several overlapping regions. The transcription regulatory sequence (TRS) is the important cis-acting element participating in PRRSV discontinuous transcription process. Based on reverse genetic system of type 2 highly pathogenic PRRSV cell-passage attenuated strain pHuN4-F112, firefly luciferase or Renilla luciferase genes were inserted between ORF1b and ORF2. An extra TRS6 was embedded behind the foreign luciferase genes. pA-Fluc and pA-Rluc were constructed and successfully rescued in MARC-145 cells. The phenotypical characteristics of the progeny virus were indistinguishable from those of vHuN4-F112 and were genetically stable for at least 25 cell passages. Mutant virus-infected cells were lysed at different time points to assess luciferase activities and measure foreign gene expression levels. The results showed identical variations in the luciferase activities of the recombinants in MARC-145 cells, indicating that they were suitable for monitoring viral propagation in PRRSV-permissive cell cultures. They were also used to infect pulmonary alveolar macrophages, which yielded similar variations in luciferase activities. Therefore, vA-Fluc and vA-Rluc present powerful new tools to monitor PRRSV propagation in both passaged and target cells. Copyright © 2016 Elsevier Ltd. All rights reserved.

Brazilian Bioluminescent Beetles: Reflections on Catching Glimpses of Light in the Atlantic Forest and Cerrado.

PubMed

Bechara, Etelvino J H; Stevani, Cassius V

2018-01-01

Bioluminescence - visible and cold light emission by living organisms - is a worldwide phenomenon, reported in terrestrial and marine environments since ancient times. Light emission from microorganisms, fungi, plants and animals may have arisen as an evolutionary response against oxygen toxicity and was appropriated for sexual attraction, predation, aposematism, and camouflage. Light emission results from the oxidation of a substrate, luciferin, by molecular oxygen, catalyzed by a luciferase, producing oxyluciferin in the excited singlet state, which decays to the ground state by fluorescence emission. Brazilian Atlantic forests and Cerrados are rich in luminescent beetles, which produce the same luciferin but slightly mutated luciferases, which result in distinct color emissions from green to red depending on the species. This review focuses on chemical and biological aspects of Brazilian luminescent beetles (Coleoptera) belonging to the Lampyridae (fireflies), Elateridae (click-beetles), and Phengodidae (railroad-worms) families. The ATP-dependent mechanism of bioluminescence, the role of luciferase tuning the color of light emission, the "luminous termite mounds" in Central Brazil, the cooperative roles of luciferase and superoxide dismutase against oxygen toxicity, and the hypothesis on the evolutionary origin of luciferases are highlighted. Finally, we point out analytical uses of beetle bioluminescence for biological, clinical, environmental, and industrial samples.

NanoLuc reporter for dual luciferase imaging in living animals.

PubMed

Stacer, Amanda C; Nyati, Shyam; Moudgil, Pranav; Iyengar, Rahul; Luker, Kathryn E; Rehemtulla, Alnawaz; Luker, Gary D

2013-10-01

Bioluminescence imaging is widely used for cell-based assays and animal imaging studies in biomedical research and drug development, capitalizing on the high signal to background of this technique. A relatively small number of luciferases are available for imaging studies, substantially limiting the ability to image multiple molecular and cellular events, as done commonly with fluorescence imaging. To advance dual reporter bioluminescence molecular imaging, we tested a recently developed, adenosine triphosphate–independent luciferase enzyme from Oplophorus gracilirostris (NanoLuc [NL]) as a reporter for animal imaging. We demonstrated that NL could be imaged in superficial and deep tissues in living mice, although the detection of NL in deep tissues was limited by emission of predominantly blue light by this enzyme. Changes in bioluminescence from NL over time could be used to quantify tumor growth, and secreted NL was detectable in small volumes of serum. We combined NL and firefly luciferase reporters to quantify two key steps in transforming growth factor β signaling in intact cells and living mice, establishing a novel dual luciferase imaging strategy for quantifying signal transduction and drug targeting. Our results establish NL as a new reporter for bioluminescence imaging studies in intact cells and living mice that will expand imaging of signal transduction in normal physiology, disease, and drug development.

NanoLuc Reporter for Dual Luciferase Imaging in Living Animals

PubMed Central

Stacer, Amanda C.; Nyati, Shyam; Moudgil, Pranav; Iyengar, Rahul; Luker, Kathryn E.; Rehemtulla, Alnawaz; Luker, Gary D.

2014-01-01

Bioluminescence imaging is utilized widely for cell-based assays and animal imaging studies in biomedical research and drug development, capitalizing on high signal-to-background of this technique. A relatively small number of luciferases are available for imaging studies, substantially limiting the ability to image multiple molecular and cellular events as done commonly with fluorescence imaging. To advance dual reporter bioluminescence molecular imaging, we tested a recently developed, ATP-independent luciferase enzyme from Oplophorus gracilirostris (NanoLuc, NL) as a reporter for animal imaging. We demonstrated that NL could be imaged in superficial and deep tissues in living mice, although detection of NL in deep tissues was limited by emission of predominantly blue light by this enzyme. Changes in bioluminescence from NL over time could be used to quantify tumor growth, and secreted NL was detectable in small volumes of serum. We combined NL and firefly luciferase reporters to quantify two key steps in TGF-β signaling in intact cells and living mice, establishing a novel dual luciferase imaging strategy for quantifying signal transduction and drug targeting. Our results establish NL as new reporter for bioluminescence imaging studies in intact cells and living mice that will expand imaging of signal transduction in normal physiology, disease, and drug development. PMID:24371848

A Luciferase Functional Quantitative Assay for Measuring NF-ĸB Promoter Transactivation Mediated by HTLV-1 and HTLV-2 Tax Proteins.

PubMed

Bergamo, Elisa; Diani, Erica; Bertazzoni, Umberto; Romanelli, Maria Grazia

2017-01-01

HTLV-1 and HTLV-2 viruses express Tax transactivator proteins required for viral genome transcription and capable of transforming cells in vivo and in vitro. Although Tax oncogenic potential needs to be further elucidated, it is well established that Tax proteins activate, among others, transcription factors of the NF-ĸB family, which are involved in immune and inflammatory responses, cell growth, apoptosis, stress responses and oncogenesis. Here, we describe a reporter gene assay applied for quantitative analysis of Tax-dependent NF-ĸB activation. The procedure is based on co-transfection of two individual vectors containing the cDNA for firefly and Renilla luciferase enzymes and vectors expressing Tax proteins. The luciferase expression is driven by cis-NF-ĸB promoter regulatory elements responsive to Tax transactivating factor. This assay is particularly useful to investigate Tax influence on NF-ĸB activation mediated by viral or host factors.

Gene silencing in primary and metastatic tumors by small interfering RNA delivery in mice: quantitative analysis using melanoma cells expressing firefly and sea pansy luciferases.

PubMed

Takahashi, Yuki; Nishikawa, Makiya; Kobayashi, Naoki; Takakura, Yoshinobu

2005-07-20

Silencing of oncogenes or other genes contributing to tumor malignancy or progression by RNA interference (RNAi) offers a promising approach to treating tumor patients. To achieve RNAi-based tumor therapy, a small interfering RNA (siRNA) or siRNA-expressing vector needs to be delivered to tumor cells, but little information about its in vivo delivery has been reported. In this study, we examined whether the expression of the target gene in tumor cells can be suppressed by the delivery of RNAi effectors to primary and metastatic tumor cells. To quantitatively evaluate the RNAi effects in tumor cells, mouse melanoma B16-BL6 cells were stably transfected with both firefly (a model target gene) and sea pansy (an internal standard gene) luciferase genes to obtain B16-BL6/dual Luc cells. The target gene expression in subcutaneous primary tumors of B16-BL6/dual Luc cells was significantly suppressed by direct injection of the RNAi effectors followed by electroporation. The expression in metastatic hepatic tumors was also significantly reduced by an intravenous injection of either RNAi effector by the hydrodynamics-based procedure. These results indicate that the both RNAi effectors have a potential to silence target gene in tumor cells in vivo when successfully delivered to tumor cells.

Effect of cadmium on lake water bacteria as determined by the luciferase assay of adenosine triphosphate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seyfried, P.L.; Horgan, C.B.L.

1981-10-01

A firefly luciferase assay of bacterial adenosine triphosphate (ATP) was developed to measure the toxic effects of cadmium ions on aquatic organisms. Toxicity was monitored using intracellular (I/C) ATP (in micrograms per litre) as well as plate counts (colony-forming units per millilitre). The bacteria, which belonged mainly to the families Enterobacteriaceae and Pseudomonadaceae, exhibited varying degrees of resistance to up to 100 ppm cadmium when grown in a glucose-salts medium at pH 6.8. Among the organisms tested, cadmium resistance decreased in the following order: Pseudomonas vesicularis > P. aeruginosa > Enterobacter sp. > P. fluorescens > Chromobacter sp. > Serratiamore » sp. A rise in the pH of the growth medium from 5 to 7 resulted in increased toxicity of cadmium.« less

A rapid method for the determination of microbial susceptibility using the firefly luciferase assay for adenosine triphosphate (ATP)

NASA Technical Reports Server (NTRS)

Vellend, H.; Tuttle, S. A.; Barza, M.; Weinstein, L.; Picciolo, G. L.; Chappelle, E. W.

1975-01-01

Luciferase assay for adenosine triphosphate (ATP) was optimized for pure bacteria in broth in order to evaluate if changes in bacterial ATP content could be used as a rapid measure of antibiotic effect on microorganisms. Broth cultures of log phase bacteria were incubated at 310 K (37 C) for 2.5 hours at antimicrobial concentrations which resulted in the best discrimination between sensitive and resistant strains. Eighty-seven strains of 11 bacterial species were studied for their susceptibility to 12 commonly used antimicrobial agents: ampicillin, Penicillin G, nafcillin, carbenicillin, cephalothin, tetracycline, erythromycin, clindamycin, gentamicin, nitrofurantoin, colistin, and chloramplenicol. The major advantage of the ATP system over existing methods of rapid microbial susceptibility testing is that the assay can be made specific for bacterial ATP.

Quantitative bioluminescence imaging of transgene expression in intact porcine antral follicles in vitro

PubMed Central

2014-01-01

Background The porcine oocyte maturation in vivo occurs within the ovarian follicle and is regulated by the interactions between oocytes and surrounding follicular components, including theca, granulosa, and cumulus cells, and follicular fluid. Therefore, the antral follicle is an essential microenvironment for efficient oocyte maturation and its developmental competence. Quantitative bioluminescence imaging of firefly luciferase reporter genes in an intact antral follicle would allow investigation of changes in cellular and molecular events and in the context of the whole follicles. In this study, we investigate factors influencing bioluminescence measurements as a first step towards developing a new bioluminescence imaging system for intact antral follicles. Methods We analyzed the time course of bioluminescence emitted from transfected living intact follicles using a cationic lipid mediated gene transfer method with increasing doses (1-3 μg) of firefly luciferase reporter gene (pGL4). In addition, a standard luciferase assay was used to confirm the luciferase expression in granulosa cells in the transfected intact antral follicles. Finally, the dose effects of substrate, D-luciferin, were determined for optimal quantitative bioluminescence imaging of intact porcine antral follicles in vitro. Results The level of luciferase activity of follicles with 3 μg pGL4 was significantly (P < 0.05) greater than the 1 μg and 2 μg groups at 1 min after D-luciferin injection. The bioluminescence intensity of transfected follicles reached a peak at 1 min, and then it was significantly (P < 0.05) reduced within 2 min after injection of D-luciferin; with the level of bioluminescence emission remained constant from 2.5 to 10 min. The bioluminescence emission was maximal with 300 μg of D-luciferin. Conclusions The results of this study suggested that the investigation of factors influencing bioluminescence measurements is a critical step toward developing a new bioluminescence imaging model. This study is the first to demonstrate that reporter genes can be transferred to intact granulosa cells with a lipid-mediated gene transfer method within intact follicles in vitro, and the level of transgene expression can be assessed by bioluminescence imaging in living intact antral follicles. PMID:24479789

Multiplex detection of protein-protein interactions using a next generation luciferase reporter.

PubMed

Verhoef, Lisette G G C; Mattioli, Michela; Ricci, Fernanda; Li, Yao-Cheng; Wade, Mark

2016-02-01

Cell-based assays of protein-protein interactions (PPIs) using split reporter proteins can be used to identify PPI agonists and antagonists. Generally, such assays measure one PPI at a time, and thus counterscreens for on-target activity must be run in parallel or at a subsequent stage; this increases both the cost and time during screening. Split luciferase systems offer advantages over those that use split fluorescent proteins (FPs). This is since split luciferase offers a greater signal:noise ratio and, unlike split FPs, the PPI can be reversed upon small molecule treatment. While multiplexed PPI assays using luciferase have been reported, they suffer from low signal:noise and require fairly complex spectral deconvolution during analysis. Furthermore, the luciferase enzymes used are large, which limits the range of PPIs that can be interrogated due to steric hindrance from the split luciferase fragments. Here, we report a multiplexed PPI assay based on split luciferases from Photinus pyralis (firefly luciferase, FLUC) and the deep-sea shrimp, Oplophorus gracilirostris (NanoLuc, NLUC). Specifically, we show that the binding of the p53 tumor suppressor to its two major negative regulators, MDM2 and MDM4, can be simultaneously measured within the same sample, without the requirement for complex filters or deconvolution. We provide chemical and genetic validation of this system using MDM2-targeted small molecules and mutagenesis, respectively. Combined with the superior signal:noise and smaller size of split NanoLuc, this multiplexed PPI assay format can be exploited to study the induction or disruption of pairwise interactions that are prominent in many cell signaling pathways. Copyright © 2015 Elsevier B.V. All rights reserved.

Comparison of bioluminescent kinase assays using substrate depletion and product formation.

PubMed

Tanega, Cordelle; Shen, Min; Mott, Bryan T; Thomas, Craig J; MacArthur, Ryan; Inglese, James; Auld, Douglas S

2009-12-01

Assays for ATPases have been enabled for high-throughput screening (HTS) by employing firefly luciferase to detect the remaining ATP in the assay. However, for any enzyme assay, measurement of product formation is a more sensitive assay design. Recently, technologies that allow detection of the ADP product from ATPase reactions have been described using fluorescent methods of detection. We describe here the characterization of a bioluminescent assay that employs firefly luciferase in a coupled-enzyme assay format to enable detection of ADP levels from ATPase assays (ADP-Glo, Promega Corp.). We determined the performance of the ADP-Glo assay in 1,536-well microtiter plates using the protein kinase Clk4 and a 1,352 member kinase focused combinatorial library. The ADP-Glo assay was compared to the Clk4 assay performed using a bioluminescence ATP-depletion format (Kinase-Glo, Promega Corp). We performed this analysis using quantitative HTS (qHTS) where we determined potency values for all library members and identified approximately 300 compounds with potencies ranging from as low as 50 nM to >10 microM, yielding a robust dataset for the comparison. Both assay formats showed high performance (Z'-factors approximately 0.9) and showed a similar potency distribution for the actives. We conclude that the bioluminescence ADP detection assay system is a viable generic alternative to the widely used ATP-depletion assay for ATPases and discuss the advantages and disadvantages of both approaches.

Small heat shock protein AgsA: an effective stabilizer of enzyme activities.

PubMed

Tomoyasu, Toshifumi; Tabata, Atsushi; Ishikawa, Yoko; Whiley, Robert A; Nagamune, Hideaki

2013-01-01

A small heat shock protein, AgsA, possesses chaperone activity that can reduce the amount of heat-aggregated protein in vivo, and suppress the aggregation of chemical- and heat-denatured proteins in vitro. Therefore, we examined the ability of AgsA to stabilize the activity of several enzymes by using this chaperone activity. We observed that AgsA can stabilize the enzymatic activities of Renilla (Renilla reniformis) luciferase, firefly (Photinus pyralis) luciferase, and β-galactosidase, and showed comparable or greater stabilization of these enzymes than bovine serum albumin (BSA), a well-known stabilizer of enzyme activities. In particular, AgsA revealed better stabilization of Renilla luciferase and β-galactosidase than BSA under disulfide bond-reducing conditions with dithiothreitol. In addition, AgsA also increased the enzymatic performance of β-galactosidase and various restriction enzymes to a comparable or greater extent than BSA. These data indicate that AgsA may be useful as a general stabilizer of enzyme activities. Copyright © 2012 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Replication Competent Molecular Clones of HIV-1 Expressing Renilla Luciferase Facilitate the Analysis of Antibody Inhibition in PBMC

PubMed Central

Edmonds, Tara G.; Ding, Haitao; Yuan, Xing; Wei, Qing; Smith, Kendra S.; Conway, Joan A.; Wieczorek, Lindsay; Brown, Bruce; Polonis, Victoria; West, John T.; Montefiori, David C.; Kappes, John C.; Ochsenbauer, Christina

2010-01-01

Effective vaccine development for human immunodeficiency virus type 1 (HIV-1) will require assays that ascertain the capacity of vaccine immunogens to elicit neutralizing antibodies (NAb) to diverse HIV-1 strains. To facilitate NAb assessment in peripheral blood mononuclear cell (PBMC)-based assays, we developed an assay-adaptable platform based on a Renilla luciferase (LucR) expressing HIV-1 proviral backbone. LucR was inserted into pNL4-3 DNA, preserving all viral open reading frames. The proviral genome was engineered to facilitate expression of diverse HIV-1 env sequences, allowing analysis in an isogenic background. The resulting Env-IMC-LucR viruses are infectious, and LucR is stably expressed over multiple replications in PBMC. HIV-1 neutralization, targeting TZM-bl cells, was highly correlative comparing virus (LucR) and cell (firefly luciferase) readouts. In PBMC, NAb activity can be analyzed either within a single or multiple cycles of replication. These results represent advancement toward a standardizable PBMC-based neutralization assay for assessing HIV-1 vaccine immunogen efficacy. PMID:20863545

Replication competent molecular clones of HIV-1 expressing Renilla luciferase facilitate the analysis of antibody inhibition in PBMC.

PubMed

Edmonds, Tara G; Ding, Haitao; Yuan, Xing; Wei, Qing; Smith, Kendra S; Conway, Joan A; Wieczorek, Lindsay; Brown, Bruce; Polonis, Victoria; West, John T; Montefiori, David C; Kappes, John C; Ochsenbauer, Christina

2010-12-05

Effective vaccine development for human immunodeficiency virus type 1 (HIV-1) will require assays that ascertain the capacity of vaccine immunogens to elicit neutralizing antibodies (NAb) to diverse HIV-1 strains. To facilitate NAb assessment in peripheral blood mononuclear cell (PBMC)-based assays, we developed an assay-adaptable platform based on a Renilla luciferase (LucR) expressing HIV-1 proviral backbone. LucR was inserted into pNL4-3 DNA, preserving all viral open reading frames. The proviral genome was engineered to facilitate expression of diverse HIV-1 env sequences, allowing analysis in an isogenic background. The resulting Env-IMC-LucR viruses are infectious, and LucR is stably expressed over multiple replications in PBMC. HIV-1 neutralization, targeting TZM-bl cells, was highly correlative comparing virus (LucR) and cell (firefly luciferase) readouts. In PBMC, NAb activity can be analyzed either within a single or multiple cycles of replication. These results represent advancement toward a standardizable PBMC-based neutralization assay for assessing HIV-1 vaccine immunogen efficacy. Copyright © 2010 Elsevier Inc. All rights reserved.

Bioluminescence imaging of a tumor-selective, thymidine kinase-defective vaccinia virus Guang9 strain after intratumoral or intraperitoneal administration in mice

PubMed Central

Ding, Yuedi; Fan, Jun; Deng, Lili; Peng, Ying; Zhang, Jue; Huang, Biao

2017-01-01

Vaccinia virus has been used as an oncolytic virus because of its capacity to preferentially infect tumors rather than normal tissues. The vaccinia Tian Tan strain, used as a vaccine against smallpox for millions of people in China, is a promising candidate for cancer therapy. In this study, we constructed an attenuated Tian Tan strain of Guang9 with a disrupted thymidine kinase gene to enhance tumor selectivity and an inserted firefly luciferase to monitor the viral distribution by in vivo bioluminescence imaging. Living animal imaging confirmed the high specificity of vaccinia Guang9 for tumor targeting after intratumoral and intraperitoneal administration. In addition, the vaccinia Guang9 strain produced higher in vivo luciferase activity and endured longer in immunocompromised nude mice than in immunocompetent C57BL/6 mice, all of which had been tumor-challenged. The luciferase activity and viral titers in excised tissues confirmed these conclusions. These data provide evidence for the safety and efficacy of the clinical application of vaccinia virus, which would be a promising approach for cancer therapy. PMID:29179469

In vivo bioluminescence imaging validation of a human biopsy-derived orthotopic mouse model of glioblastoma multiforme.

PubMed

Jarzabek, Monika A; Huszthy, Peter C; Skaftnesmo, Kai O; McCormack, Emmet; Dicker, Patrick; Prehn, Jochen H M; Bjerkvig, Rolf; Byrne, Annette T

2013-05-01

Glioblastoma multiforme (GBM), the most aggressive brain malignancy, is characterized by extensive cellular proliferation, angiogenesis, and single-cell infiltration into the brain. We have previously shown that a xenograft model based on serial xenotransplantation of human biopsy spheroids in immunodeficient rodents maintains the genotype and phenotype of the original patient tumor. The present work further extends this model for optical assessment of tumor engraftment and growth using bioluminescence imaging (BLI). A method for successful lentiviral transduction of the firefly luciferase gene into multicellular spheroids was developed and implemented to generate optically active patient tumor cells. Luciferase-expressing spheroids were injected into the brains of immunodeficient mice. BLI photon counts and tumor volumes from magnetic resonance imaging (MRI) were correlated. Luciferase-expressing tumors recapitulated the histopathologic hallmarks of human GBMs and showed proliferation rates and microvessel density counts similar to those of wild-type xenografts. Moreover, we detected widespread invasion of luciferase-positive tumor cells in the mouse brains. Herein we describe a novel optically active model of GBM that closely mimics human pathology with respect to invasion, angiogenesis, and proliferation indices. The model may thus be routinely used for the assessment of novel anti-GBM therapeutic approaches implementing well-established and cost-effective optical imaging strategies.

Rational Design of a Triple Reporter Gene for Multimodality Molecular Imaging

PubMed Central

Hsieh, Ya-Ju; Ke, Chien-Chih; Yeh, Skye Hsin-Hsien; Lin, Chien-Feng; Chen, Fu-Du; Lin, Kang-Ping; Chen, Ran-Chou; Liu, Ren-Shyan

2014-01-01

Multimodality imaging using noncytotoxic triple fusion (TF) reporter genes is an important application for cell-based tracking, drug screening, and therapy. The firefly luciferase (fl), monomeric red fluorescence protein (mrfp), and truncated herpes simplex virus type 1 thymidine kinase SR39 mutant (ttksr39) were fused together to create TF reporter gene constructs with different order. The enzymatic activities of TF protein in vitro and in vivo were determined by luciferase reporter assay, H-FEAU cellular uptake experiment, bioluminescence imaging, and micropositron emission tomography (microPET). The TF construct expressed in H1299 cells possesses luciferase activity and red fluorescence. The tTKSR39 activity is preserved in TF protein and mediates high levels of H-FEAU accumulation and significant cell death from ganciclovir (GCV) prodrug activation. In living animals, the luciferase and tTKSR39 activities of TF protein have also been successfully validated by multimodality imaging systems. The red fluorescence signal is relatively weak for in vivo imaging but may expedite FACS-based selection of TF reporter expressing cells. We have developed an optimized triple fusion reporter construct DsRedm-fl-ttksr39 for more effective and sensitive in vivo animal imaging using fluorescence, bioluminescence, and PET imaging modalities, which may facilitate different fields of biomedical research and applications. PMID:24809057

Plasmodium falciparum Transfected with Ultra Bright NanoLuc Luciferase Offers High Sensitivity Detection for the Screening of Growth and Cellular Trafficking Inhibitors

PubMed Central

Elsworth, Brendan; Charnaud, Sarah C.; Sanders, Paul R.; Crabb, Brendan S.; Gilson, Paul R.

2014-01-01

Drug discovery is a key part of malaria control and eradication strategies, and could benefit from sensitive and affordable assays to quantify parasite growth and to help identify the targets of potential anti-malarial compounds. Bioluminescence, achieved through expression of exogenous luciferases, is a powerful tool that has been applied in studies of several aspects of parasite biology and high throughput growth assays. We have expressed the new reporter NanoLuc (Nluc) luciferase in Plasmodium falciparum and showed it is at least 100 times brighter than the commonly used firefly luciferase. Nluc brightness was explored as a means to achieve a growth assay with higher sensitivity and lower cost. In addition we attempted to develop other screening assays that may help interrogate libraries of inhibitory compounds for their mechanism of action. To this end parasites were engineered to express Nluc in the cytoplasm, the parasitophorous vacuole that surrounds the intraerythrocytic parasite or exported to the red blood cell cytosol. As proof-of-concept, these parasites were used to develop functional screening assays for quantifying the effects of Brefeldin A, an inhibitor of protein secretion, and Furosemide, an inhibitor of new permeation pathways used by parasites to acquire plasma nutrients. PMID:25392998

In vivo gene delivery and expression by bacteriophage lambda vectors.

PubMed

Lankes, H A; Zanghi, C N; Santos, K; Capella, C; Duke, C M P; Dewhurst, S

2007-05-01

Bacteriophage vectors have potential as gene transfer and vaccine delivery vectors because of their low cost, safety and physical stability. However, little is known concerning phage-mediated gene transfer in mammalian hosts. We therefore performed experiments to examine phage-mediated gene transfer in vivo. Mice were inoculated with recombinant lambda phage containing a mammalian expression cassette encoding firefly luciferase (luc). Efficient, dose-dependent in vivo luc expression was detected, which peaked within 24 h of delivery and declined to undetectable levels within a week. Display of an integrin-binding peptide increased cellular internalization of phage in vitro and enhanced phage-mediated gene transfer in vivo. Finally, in vivo depletion of phagocytic cells using clodronate liposomes had only a minor effect on the efficiency of phage-mediated gene transfer. Unmodified lambda phage particles are capable of transducing mammalian cells in vivo, and may be taken up -- at least in part -- by nonphagocytic mechanisms. Surface modifications that enhance phage uptake result in more efficient in vivo gene transfer. These experiments shed light on the mechanisms involved in phage-mediated gene transfer in vivo, and suggest new approaches that may enhance the efficiency of this process.

Diversity in ATP concentrations in a single bacterial cell population revealed by quantitative single-cell imaging

PubMed Central

Yaginuma, Hideyuki; Kawai, Shinnosuke; Tabata, Kazuhito V.; Tomiyama, Keisuke; Kakizuka, Akira; Komatsuzaki, Tamiki; Noji, Hiroyuki; Imamura, Hiromi

2014-01-01

Recent advances in quantitative single-cell analysis revealed large diversity in gene expression levels between individual cells, which could affect the physiology and/or fate of each cell. In contrast, for most metabolites, the concentrations were only measureable as ensemble averages of many cells. In living cells, adenosine triphosphate (ATP) is a critically important metabolite that powers many intracellular reactions. Quantitative measurement of the absolute ATP concentration in individual cells has not been achieved because of the lack of reliable methods. In this study, we developed a new genetically-encoded ratiometric fluorescent ATP indicator “QUEEN”, which is composed of a single circularly-permuted fluorescent protein and a bacterial ATP binding protein. Unlike previous FRET-based indicators, QUEEN was apparently insensitive to bacteria growth rate changes. Importantly, intracellular ATP concentrations of numbers of bacterial cells calculated from QUEEN fluorescence were almost equal to those from firefly luciferase assay. Thus, QUEEN is suitable for quantifying the absolute ATP concentration inside bacteria cells. Finally, we found that, even for a genetically-identical Escherichia coli cell population, absolute concentrations of intracellular ATP were significantly diverse between individual cells from the same culture, by imaging QUEEN signals from single cells. PMID:25283467

A real-time bioluminescent HTS method for measuring protein kinase activity influenced neither by ATP concentration nor by luciferase inhibition.

PubMed

Lundin, Arne; Eriksson, Jonas

2008-08-01

The firefly luciferin-luciferase reaction has been used to set up an assay for protein kinase based on measuring ATP consumption rate as the first-order rate constant for the kinase reaction. The assay obviates the problems encountered with previous bioluminescent protein kinase assays such as interference with the luciferase reaction from library compounds, nonlinear standard curves, and limited dynamic ranges. In the assay described in the present paper luciferase and luciferin are present during the entire kinase reaction, and the light emission can be measured continuously. In an HTS situation the light emission is measured only twice, i.e., initially and after a predetermined time. After a fivefold reduction of the ATP concentration a Z' value of 0.96 was obtained. Light emission data from samples with kinase are normalized with light emission data from blanks without kinase. First-order rate constants for the kinase reaction calculated from normalized light emission are not affected by a moderate degree of inactivation of luciferase and luciferin during the measuring time. The constants have the same value at all ATP concentrations much lower than the K(m) of the luciferase and the kinase. These factors make the assay very robust and influenced neither by ATP concentration nor by luciferase inhibition. The measuring time depends on the kinase activity and can be varied from minutes to more than 8 h provided the kinase is stable and the evaporation of water from the wells is acceptable. The assay is linear with respect to kinase activity over three orders of magnitude. The new reagents also allowed us to determine K(m) values for ATP and for Kemptide.

Highly sensitive luciferase reporter assay using a potent destabilization sequence of calpain 3.

PubMed

Yasunaga, Mayu; Murotomi, Kazutoshi; Abe, Hiroko; Yamazaki, Tomomi; Nishii, Shigeaki; Ohbayashi, Tetsuya; Oshimura, Mitsuo; Noguchi, Takako; Niwa, Kazuki; Ohmiya, Yoshihiro; Nakajima, Yoshihiro

2015-01-20

Reporter assays that use luciferases are widely employed for monitoring cellular events associated with gene expression in vitro and in vivo. To improve the response of the luciferase reporter to acute changes of gene expression, a destabilization sequence is frequently used to reduce the stability of luciferase protein in the cells, which results in an increase of sensitivity of the luciferase reporter assay. In this study, we identified a potent destabilization sequence (referred to as the C9 fragment) consisting of 42 amino acid residues from human calpain 3 (CAPN3). Whereas the half-life of Emerald Luc (ELuc) from the Brazilian click beetle Pyrearinus termitilluminans was reduced by fusing PEST (t1/2=9.8 to 2.8h), the half-life of C9-fused ELuc was significantly shorter (t1/2=1.0h) than that of PEST-fused ELuc when measurements were conducted at 37°C. In addition, firefly luciferase (luc2) was also markedly destabilized by the C9 fragment compared with the humanized PEST sequence. These results indicate that the C9 fragment from CAPN3 is a much more potent destabilization sequence than the PEST sequence. Furthermore, real-time bioluminescence recording of the activation kinetics of nuclear factor-κB after transient treatment with tumor necrosis factor α revealed that the response of C9-fused ELuc is significantly greater than that of PEST-fused ELuc, demonstrating that the use of the C9 fragment realizes a luciferase reporter assay that has faster response speed compared with that provided by the PEST sequence. Copyright © 2014 Elsevier B.V. All rights reserved.

The luciferin binding site residues C/T311 (S314) influence the bioluminescence color of beetle luciferases through main-chain interaction with oxyluciferin phenolate.

PubMed

Viviani, V R; Amaral, D T; Neves, D R; Simões, A; Arnoldi, F G C

2013-01-08

Beetle luciferases emit different bioluminescence colors from green to red; however, no clear relationship between the identity of the luciferin binding site residues and bioluminescence colors was found in different luciferases, and it is unclear whether critical interactions affecting emission spectra occur on the thiazolyl or on the benzothiazolyl sides of the luciferin binding site. Through homology modeling and site-directed mutagenesis using our multicolor set of beetle luciferases (Pyrearinus termitilluminans larval click beetle, Pte, λ(max) = 534 nm; Phrixothrix hirtus railroad worm red emitting, PxRE, λ(max) = 623 nm; and Macrolampis sp2 firefly, Mac, λ(max) = 564 nm), we show that the residues C/T311 (S314) play an important role in bioluminescence color determination. Modeling studies indicate that the main-chain carbonyls of these residues are close to both oxyluciferin phenolate and AMP, whereas the side chains pack against second-shell residues. The C311(S314)A mutation considerably red shifts the spectra of the green-yellow-emitting luciferases (Pte λ(max) = 534 to 590 nm; Mac λ(max) = 564 to 583/613 nm) and affects the K(M) values for luciferin and ATP, but not the spectrum of the red-emitting luciferase. On the other hand, whereas the exchange between C/T311 (S314) caused smaller effects on the emission spectra of green-yellow-emitting luciferases, the C311T substitution (naturally found in green-emitting railroad worm luciferases) resulted in the largest reported blue shift in P. hirtus red-emitting luciferase (λ(max) = 623 to 606 nm). Altogether, these results indicate that the stability of residues C/T311 (S314) and the size of the cavity around oxyluciferin phenolate affect bioluminescence colors and suggest, for the first time, the occurrence of a critical interaction between main-chain carbonyls of position 311 (314) residues and oxyluciferin phenolate.

High-throughput Titration of Luciferase-expressing Recombinant Viruses

PubMed Central

Garcia, Vanessa; Krishnan, Ramya; Davis, Colin; Batenchuk, Cory; Le Boeuf, Fabrice; Abdelbary, Hesham; Diallo, Jean-Simon

2014-01-01

Standard plaque assays to determine infectious viral titers can be time consuming, are not amenable to a high volume of samples, and cannot be done with viruses that do not form plaques. As an alternative to plaque assays, we have developed a high-throughput titration method that allows for the simultaneous titration of a high volume of samples in a single day. This approach involves infection of the samples with a Firefly luciferase tagged virus, transfer of the infected samples onto an appropriate permissive cell line, subsequent addition of luciferin, reading of plates in order to obtain luminescence readings, and finally the conversion from luminescence to viral titers. The assessment of cytotoxicity using a metabolic viability dye can be easily incorporated in the workflow in parallel and provide valuable information in the context of a drug screen. This technique provides a reliable, high-throughput method to determine viral titers as an alternative to a standard plaque assay. PMID:25285536

Transient transfection of intraerythrocytic Babesia gibsoni using elongation factor-1 alpha promoter.

PubMed

Liu, Mingming; Asada, Masahito; Cao, Shinuo; Adjou Moumouni, Paul Franck; Vudriko, Patrick; Efstratiou, Artemis; Hakimi, Hassan; Masatani, Tatsunori; Sunaga, Fujiko; Kawazu, Shin-Ichiro; Yamagishi, Junya; Xuan, Xuenan

2017-09-01

The development of gene manipulation techniques has been reported in many protozoan parasites over the past few years. However, these techniques have not yet been established for Babesia gibsoni. Here, we report for the first time, the successful transient transfection of B. gibsoni. The plasmid containing the firefly luciferase reporter gene (pBS-ELA) was transfected into B. gibsoni by an AMAXA 4D Nucleofector™ device. Transfection using program FA113 and Lonza buffer SF showed the highest luciferase expression. Twenty micrograms of plasmid produced the highest relative transfection efficiency. The fluorescent protein-expressing parasites were determined by GFP-containing plasmid (pBS-EGA) at 48 and 72h post transfection. This finding is the first step towards a stable transfection method for B. gibsoni, which may contribute to a better understanding of the biology of the parasite. Copyright © 2017 Elsevier B.V. All rights reserved.

Titration-based screening for evaluation of natural product extracts: identification of an aspulvinone family of luciferase inhibitors

PubMed Central

Cruz, Patricia G.; Auld, Douglas S.; Schultz, Pamela J.; Lovell, Scott; Battaile, Kevin P.; MacArthur, Ryan; Shen, Min; Tamayo-Castillo, Giselle; Inglese, James; Sherman, David H.

2011-01-01

The chemical diversity of nature has tremendous potential for discovery of new molecular probes and medicinal agents. However, sensitivity of HTS assays to interfering components of crude extracts derived from plants, macro- and microorganisms has curtailed their use in lead discovery efforts. Here we describe a process for leveraging the concentration-response curves (CRCs) obtained from quantitative HTS to improve the initial selection of “actives” from a library of partially fractionated natural product extracts derived from marine actinomycetes and fungi. By using pharmacological activity, the first-pass CRC paradigm aims to improve the probability that labor-intensive subsequent steps of re-culturing, extraction and bioassay-guided isolation of active component(s) target the most promising strains and growth conditions. We illustrate how this process identified a family of fungal metabolites as potent inhibitors of firefly luciferase, subsequently resolved in molecular detail by x-ray crystallography. PMID:22118678

Titration-based screening for evaluation of natural product extracts: identification of an aspulvinone family of luciferase inhibitors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cruz, P.G.; Auld, D.S.; Schultz, P.J.

2011-11-28

The chemical diversity of nature has tremendous potential for the discovery of molecular probes and medicinal agents. However, sensitivity of HTS assays to interfering components of crude extracts derived from plants, and macro- and microorganisms has curtailed their use in lead discovery. Here, we describe a process for leveraging the concentration-response curves obtained from quantitative HTS to improve the initial selection of actives from a library of partially fractionated natural product extracts derived from marine actinomycetes and fungi. By using pharmacological activity, the first-pass CRC paradigm improves the probability that labor-intensive subsequent steps of reculturing, extraction, and bioassay-guided isolation ofmore » active component(s) target the most promising strains and growth conditions. We illustrate how this process identified a family of fungal metabolites as potent inhibitors of firefly luciferase, subsequently resolved in molecular detail by X-ray crystallography.« less

The dark and bright sides of an enzyme: a three dimensional structure of the N-terminal domain of Zophobas morio luciferase-like enzyme, inferences on the biological function and origin of oxygenase/luciferase activity.

PubMed

Prado, R A; Santos, C R; Kato, D I; Murakami, M T; Viviani, V R

2016-05-11

Beetle luciferases, the enzymes responsible for bioluminescence, are special cases of CoA-ligases which have acquired a novel oxygenase activity, offering elegant models to investigate the structural origin of novel catalytic functions in enzymes. What the original function of their ancestors was, and how the new oxygenase function emerged leading to bioluminescence remains unclear. To address these questions, we solved the crystal structure of a recently cloned Malpighian luciferase-like enzyme of unknown function from Zophobas morio mealworms, which displays weak luminescence with ATP and the xenobiotic firefly d-luciferin. The three dimensional structure of the N-terminal domain showed the expected general fold of CoA-ligases, with a unique carboxylic substrate binding pocket, permitting the binding and CoA-thioesterification activity with a broad range of carboxylic substrates, including short-, medium-chain and aromatic acids, indicating a generalist function consistent with a xenobiotic-ligase. The thioesterification activity with l-luciferin, but not with the d-enantiomer, confirms that the oxygenase activity emerged from a stereoselective impediment of the thioesterification reaction with the latter, favoring the alternative chemiluminescence oxidative reaction. The structure and site-directed mutagenesis support the involvement of the main-chain amide carbonyl of the invariant glycine G323 as the catalytic base for luciferin C4 proton abstraction during the oxygenase activity in this enzyme and in beetle luciferases (G343).

A synthetic luciferin improves in vivo bioluminescence imaging of gene expression in cardiovascular brain regions.

PubMed

Simonyan, Hayk; Hurr, Chansol; Young, Colin N

2016-10-01

Bioluminescence imaging is an effective tool for in vivo investigation of molecular processes. We have demonstrated the applicability of bioluminescence imaging to spatiotemporally monitor gene expression in cardioregulatory brain nuclei during the development of cardiovascular disease, via incorporation of firefly luciferase into living animals, combined with exogenous d-luciferin substrate administration. Nevertheless, d-luciferin uptake into the brain tissue is low, which decreases the sensitivity of bioluminescence detection, particularly when considering small changes in gene expression in tiny central areas. Here, we tested the hypothesis that a synthetic luciferin, cyclic alkylaminoluciferin (CycLuc1), would be superior to d-luciferin for in vivo bioluminescence imaging in cardiovascular brain regions. Male C57B1/6 mice underwent targeted delivery of an adenovirus encoding the luciferase gene downstream of the CMV promoter to the subfornical organ (SFO) or paraventricular nucleus of hypothalamus (PVN), two crucial cardioregulatory neural regions. While bioluminescent signals could be obtained following d-luciferin injection (150 mg/kg), CycLuc1 administration resulted in a three- to fourfold greater bioluminescent emission from the SFO and PVN, at 10- to 20-fold lower substrate concentrations (7.5-15 mg/kg). This CycLuc1-mediated enhancement in bioluminescent emission was evident early following substrate administration (i.e., 6-10 min) and persisted for up to 1 h. When the exposure time was reduced from 60 s to 1,500 ms, minimal signal in the PVN was detectable with d-luciferin, whereas bioluminescent images could be reliably captured with CycLuc1. These findings demonstrate that bioluminescent imaging with the synthetic luciferin CycLuc1 provides an improved physiological genomics tool to investigate molecular events in discrete cardioregulatory brain nuclei. Copyright © 2016 the American Physiological Society.

Sensitive dual color in vivo bioluminescence imaging using a new red codon optimized firefly luciferase and a green click beetle luciferase.

PubMed

Mezzanotte, Laura; Que, Ivo; Kaijzel, Eric; Branchini, Bruce; Roda, Aldo; Löwik, Clemens

2011-04-22

Despite a plethora of bioluminescent reporter genes being cloned and used for cell assays and molecular imaging purposes, the simultaneous monitoring of multiple events in small animals is still challenging. This is partly attributable to the lack of optimization of cell reporter gene expression as well as too much spectral overlap of the color-coupled reporter genes. A new red emitting codon-optimized luciferase reporter gene mutant of Photinus pyralis, Ppy RE8, has been developed and used in combination with the green click beetle luciferase, CBG99. Human embryonic kidney cells (HEK293) were transfected with vectors that expressed red Ppy RE8 and green CBG99 luciferases. Populations of red and green emitting cells were mixed in different ratios. After addition of the shared single substrate, D-luciferin, bioluminescent (BL) signals were imaged with an ultrasensitive cooled CCD camera using a series of band pass filters (20 nm). Spectral unmixing algorithms were applied to the images where good separation of signals was observed. Furthermore, HEK293 cells that expressed the two luciferases were injected at different depth in the animals. Spectrally-separate images and quantification of the dual BL signals in a mixed population of cells was achieved when cells were either injected subcutaneously or directly into the prostate. We report here the re-engineering of different luciferase genes for in vitro and in vivo dual color imaging applications to address the technical issues of using dual luciferases for imaging. In respect to previously used dual assays, our study demonstrated enhanced sensitivity combined with spatially separate BL spectral emissions using a suitable spectral unmixing algorithm. This new D-luciferin-dependent reporter gene couplet opens up the possibility in the future for more accurate quantitative gene expression studies in vivo by simultaneously monitoring two events in real time.

Prediction of luciferase inhibitors by the high-performance MIEC-GBDT approach based on interaction energetic patterns.

PubMed

Chen, Fu; Sun, Huiyong; Liu, Hui; Li, Dan; Li, Youyong; Hou, Tingjun

2017-04-12

High-throughput screening (HTS) is widely applied in many fields ranging from drug discovery to clinical diagnostics and toxicity assessment. Firefly luciferase is commonly used as a reporter to monitor the effect of chemical compounds on the activity of a specific target or pathway in HTS. However, the false positive rate of luciferase-based HTS is relatively high because many artifacts or promiscuous compounds that have direct interaction with the luciferase reporter enzyme are usually identified as active compounds (hits). Therefore, it is necessary to develop a rapid screening method to identify these compounds that can inhibit the luciferase activity directly. In this study, a virtual screening (VS) classification model called MIEC-GBDT (MIEC: Molecular Interaction Energy Components; GBDT: Gradient Boosting Decision Tree) was developed to distinguish luciferase inhibitors from non-inhibitors. The MIECs calculated by Molecular Mechanics/Generalized Born Surface Area (MM/GBSA) free energy decomposition were used to energetically characterize the binding pattern of each small molecule at the active site of luciferase, and then the GBDT algorithm was employed to construct the classifiers based on MIECs. The predictions to the test set show that the optimized MIEC-GBDT model outperformed molecular docking and MM/GBSA rescoring. The best MIEC-GBDT model based on the MIECs with the energy terms of ΔG ele , ΔG vdW , ΔG GB , and ΔG SA achieves the prediction accuracies of 87.2% and 90.3% for the inhibitors and non-inhibitors in the test sets, respectively. Moreover, the energetic analysis of the vital residues suggests that the energetic contributions of the vital residues to the binding of inhibitors are quite different from those to the binding of non-inhibitors. These results suggest that the MIEC-GBDT model is reliable and can be used as a powerful tool to identify potential interference compounds in luciferase-based HTS experiments.

Sensitive Dual Color In Vivo Bioluminescence Imaging Using a New Red Codon Optimized Firefly Luciferase and a Green Click Beetle Luciferase

PubMed Central

Mezzanotte, Laura; Que, Ivo; Kaijzel, Eric; Branchini, Bruce; Roda, Aldo; Löwik, Clemens

2011-01-01

Background Despite a plethora of bioluminescent reporter genes being cloned and used for cell assays and molecular imaging purposes, the simultaneous monitoring of multiple events in small animals is still challenging. This is partly attributable to the lack of optimization of cell reporter gene expression as well as too much spectral overlap of the color-coupled reporter genes. A new red emitting codon-optimized luciferase reporter gene mutant of Photinus pyralis, Ppy RE8, has been developed and used in combination with the green click beetle luciferase, CBG99. Principal Findings Human embryonic kidney cells (HEK293) were transfected with vectors that expressed red Ppy RE8 and green CBG99 luciferases. Populations of red and green emitting cells were mixed in different ratios. After addition of the shared single substrate, D-luciferin, bioluminescent (BL) signals were imaged with an ultrasensitive cooled CCD camera using a series of band pass filters (20 nm). Spectral unmixing algorithms were applied to the images where good separation of signals was observed. Furthermore, HEK293 cells that expressed the two luciferases were injected at different depth in the animals. Spectrally-separate images and quantification of the dual BL signals in a mixed population of cells was achieved when cells were either injected subcutaneously or directly into the prostate. Significance We report here the re-engineering of different luciferase genes for in vitro and in vivo dual color imaging applications to address the technical issues of using dual luciferases for imaging. In respect to previously used dual assays, our study demonstrated enhanced sensitivity combined with spatially separate BL spectral emissions using a suitable spectral unmixing algorithm. This new D-luciferin-dependent reporter gene couplet opens up the possibility in the future for more accurate quantitative gene expression studies in vivo by simultaneously monitoring two events in real time. PMID:21544210

A dual function fusion protein of Herpes simplex virus type 1 thymidine kinase and firefly luciferase for noninvasive in vivo imaging of gene therapy in malignant glioma.

PubMed

Söling, Ariane; Theiss, Christian; Jungmichel, Stephanie; Rainov, Nikolai G

2004-08-04

BACKGROUND: Suicide gene therapy employing the prodrug activating system Herpes simplex virus type 1 thymidine kinase (HSV-TK)/ ganciclovir (GCV) has proven to be effective in killing experimental brain tumors. In contrast, glioma patients treated with HSV-TK/ GCV did not show significant treatment benefit, most likely due to insufficient transgene delivery to tumor cells. Therefore, this study aimed at developing a strategy for real-time noninvasive in vivo monitoring of the activity of a therapeutic gene in brain tumor cells. METHODS: The HSV-TK gene was fused to the firefly luciferase (Luc) gene and the fusion construct HSV-TK-Luc was expressed in U87MG human malignant glioma cells. Nude mice with subcutaneous gliomas stably expressing HSV-TK-Luc were subjected to GCV treatment and tumor response to therapy was monitored in vivo by serial bioluminescence imaging. Bioluminescent signals over time were compared with tumor volumes determined by caliper. RESULTS: Transient and stable expression of the HSV-TK-Luc fusion protein in U87MG glioma cells demonstrated close correlation of both enzyme activities. Serial optical imaging of tumor bearing mice detected in all cases GCV induced death of tumor cells expressing the fusion protein and proved that bioluminescence can be reliably used for repetitive and noninvasive quantification of HSV-TK/ GCV mediated cell kill in vivo. CONCLUSION: This approach may represent a valuable tool for the in vivo evaluation of gene therapy strategies for treatment of malignant disease.

Bioluminescence of beetle luciferases with 6'-amino-D-luciferin analogues reveals excited keto-oxyluciferin as the emitter and phenolate/luciferin binding site interactions modulate bioluminescence colors.

PubMed

Viviani, Vadim R; Neves, Deimison Rodrigues; Amaral, Danilo Trabuco; Prado, Rogilene A; Matsuhashi, Takuto; Hirano, Takashi

2014-08-19

Beetle luciferases produce different bioluminescence colors from green to red using the same d-luciferin substrate. Despite many studies of the mechanisms and structural determinants of bioluminescence colors with firefly luciferases, the identity of the emitters and the specific active site interactions responsible for bioluminescence color modulation remain elusive. To address these questions, we analyzed the bioluminescence spectra with 6'-amino-D-luciferin (aminoluciferin) and its 5,5-dimethyl analogue using a set of recombinant beetle luciferases that naturally elicit different colors and different pH sensitivities (pH-sensitive, Amydetes vivianii λmax=538 nm, Macrolampis sp2 λmax=564 nm; pH-insensitive, Phrixotrix hirtus λmax=623 nm, Phrixotrix vivianii λmax=546 nm, and Pyrearinus termitilluminans λmax=534 nm), a luciferase-like enzyme (Tenebrionidae, Zophobas morio λmax=613 nm), and mutants of C311 (S314). The green-yellow-emitting luciferases display red-shifted bioluminescence spectra with aminoluciferin in relation to those with D-luciferin, whereas the red-emitting luciferases displayed blue-shifted spectra. Bioluminescence spectra with 5,5-dimethylaminoluciferin, in which enolization is blocked, were almost identical to those of aminoluciferin. Fluorescence probing using 2-(4-toluidino)naphthalene-6-sulfonate and inference with aminoluciferin confirm that the luciferin binding site of the red-shifted luciferases is more polar than in the case of the green-yellow-emitting luciferases. Altogether, the results show that the keto form of excited oxyluciferin is the emitter in beetle bioluminescence and that bioluminescence colors are essentially modulated by interactions of the 6'-hydroxy group of oxyluciferin and basic moieties under the influence of the microenvironment polarity of the active site: a strong interaction between a base moiety and oxyluciferin phenol in a hydrophobic microenvironment promotes green-yellow emission, whereas a more polar environment weakens such interaction promoting red shifts. In pH-sensitive luciferases, a pH-mediated switch from a closed hydrophobic conformation to a more open polar conformation promotes the typical red shift.

Development of a cell-based high throughput luciferase enzyme fragment complementation assay to identify nuclear-factor-e2-related transcription factor 2 activators.

PubMed

Xie, Wensheng; Pao, Christina; Graham, Taylor; Dul, Ed; Lu, Quinn; Sweitzer, Thomas D; Ames, Robert S; Li, Hu

2012-12-01

Nuclear-factor-E2-related transcription factor 2 (Nrf2) regulates a large panel of Phase II genes and plays an important role in cell survival. Nrf2 activation has been shown as preventing cigarette smoke-induced alveolar enlargement in mice. Therefore, activation of the Nrf2 protein by small-molecule activators represents an attractive therapeutic strategy that is used for chronic obstructive pulmonary disease. In this article, we describe a cell-based luciferase enzyme fragment complementation assay that identifies Nrf2 activators. This assay is based on the interaction of Nrf2 with its nuclear partner MafK or runt-related transcription factor 2 (RunX2) and is dependent on the reconstitution of a "split" luciferase. Firefly luciferase is split into two fragments, which are genetically fused to Nrf2 and MafK or RunX2, respectively. BacMam technology was used to deliver the fusion constructs into cells for expression of the tagged proteins. When the BacMam-transduced cells were treated with Nrf2 activators, the Nrf2 protein was stabilized and translocated into the nucleus where it interacted with MafK or RunX2. The interaction of Nrf2 and MafK or RunX2 brought together the two luciferase fragments that form an active luciferase. The assay was developed in a 384-well format and was optimized by titrating the BacMam concentration, transduction time, cell density, and fetal bovine serum concentration. It was further validated with known Nrf2 activators. Our data show that this assay is robust, sensitive, and amenable to high throughput screening of a large compound collection for the identification of novel Nrf2 activators.

Renilla luciferase-based quantitation of Potato virus A infection initiated with Agrobacterium infiltration of N. benthamiana leaves.

PubMed

Eskelin, K; Suntio, T; Hyvärinen, S; Hafren, A; Mäkinen, K

2010-03-01

A quantitation method based on the sensitive detection of Renilla luciferase (Rluc) activity was developed and optimized for Potato virus A (PVA; genus Potyviridae) gene expression. This system is based on infections initiated by Agrobacterium infiltration and subsequent detection of the translation of PVA::Rluc RNA, which is enhanced by viral replication, first within the cells infected initially and later by translation and replication within new cells after spread of the virus. Firefly luciferase (Fluc) was used as an internal control to normalize the Rluc activity. An approximately 10-fold difference in the Rluc/Fluc activity ratio between a movement-deficient and a replication-deficient mutant was observed starting from 48h post Agrobacterium infiltration (h.p.i.). The Rluc activity derived from wild type (wt) PVA increased significantly between 48 and 72h.p.i. and the Rluc/Fluc activity deviated clearly from that of the mutant viruses. Quantitation of the Rluc and Fluc mRNAs by semi-quantitative RT-PCR indicated that increases and decreases in the Renillareniformis luciferase (rluc) mRNA levels coincided with changes in Rluc activity. However, a subtle increase in the mRNA level led to pronounced changes in Rluc activity. PVA CP accumulation was quantitated by enzyme-linked immunosorbent assay. The increase in Rluc activity correlated closely with virus accumulation. Copyright (c) 2009 Elsevier B.V. All rights reserved.

The role of proline substitutions within flexible regions on thermostability of luciferase.

PubMed

Yu, Haoran; Zhao, Yang; Guo, Chao; Gan, Yiru; Huang, He

2015-01-01

Improving the stability of firefly luciferase has been a critical issue for its wider industrial applications. Studies about hyperthermophile proteins show that flexibility could be an effective indicator to find out weak spots to engineering thermostability of proteins. However, the relationship among flexibility, activity and stability in most of proteins is unclear. Proline is the most rigid residue and can be introduced to rigidify flexible regions to enhance thermostability of proteins. We firstly apply three different methods, molecular dynamics (MD) simulation, B-FITTER and framework rigidity optimized dynamics algorithm (FRODA) to determine the flexible regions of Photinus pyralis luciferase: Fragment 197-207; Fragment 471-481 and Fragment 487-495. Then, introduction of proline is used to rigidify these flexible regions. Two mutants D476P and H489P within most flexible regions are finally designed. In the results, H489P mutant shows improved thermostability while maintaining its catalytic efficiency compared to that of wild type luciferase. Flexibility analysis confirms that the overall rigidity and local rigidity of H489P mutant are greatly strengthened. D476P mutant shows decreased thermosatbility and the reason for this is elucidated at the molecular level. S307P mutation is randomly chosen outside the flexible regions as a control. Thermostability analysis shows that S307P mutation has decreased kinetic stability and enhanced thermodynamic stability. Copyright © 2014 Elsevier B.V. All rights reserved.

A portable bioluminescence engineered cell-based biosensor for on-site applications.

PubMed

Roda, Aldo; Cevenini, Luca; Michelini, Elisa; Branchini, Bruce R

2011-04-15

We have developed a portable biosensing device based on genetically engineered bioluminescent (BL) cells. Cells were immobilized on a 4 × 3 multiwell cartridge using a new biocompatible matrix that preserved their vitality. Using a fiber optic taper, the cartridge was placed in direct contact with a cooled CCD sensor to image and quantify the BL signals. Yeast and bacterial cells were engineered to express recognition elements, whose interaction with the analyte led to luciferase expression, via reporter gene technology. Three different biosensors were developed. The first detects androgenic compounds using yeast cells carrying a green-emitting P. pyralis luciferase regulated by the human androgen receptor and a red mutant of the same species as internal vitality control. The second biosensor detects two classes of compounds (androgens and estrogens) using yeast strains engineered to express green-or red-emitting mutant firefly luciferases in response to androgens or estrogens, respectively. The third biosensor detects lactose analogue isopropyl β-d-1-thiogalactopyranoside using two E. coli strains. One strain exploits the lac operon as recognition element for the expression of P. pyralis luciferase. The other strain serves as a vitality control expressing Gaussia princeps luciferase, which requires a different luciferin substrate. The immobilized cells were stable for up to 1 month. The analytes could be detected at nanomolar levels with good precision and accuracy when the specific signal was corrected using the internal vitality control. This portable device can be used for on-site multiplexed bioassays for different compound classes. Copyright © 2011 Elsevier B.V. All rights reserved.

Structural and dynamical insight into thermally induced functional inactivation of firefly luciferase

PubMed Central

Jazayeri, Fatemeh S.; Hosseinkhani, Saman

2017-01-01

Luciferase is the key component of light production in bioluminescence process. Extensive and advantageous application of this enzyme in biotechnology is restricted due to its low thermal stability. Here we report the effect of heating up above Tm on the structure and dynamical properties of luciferase enzyme compared to temperature at 298 K. In this way we demonstrate that the number of hydrogen bonds between N- and C-domain is increased for the free enzyme at 325 K. Increased inter domain hydrogen bonds by three at 325 K suggests that inter domain contact is strengthened. The appearance of simultaneous strong salt bridge and hydrogen bond between K529 and D422 and increased existence probability between R533 and E389 could mechanistically explain stronger contact between N- and C-domain. Mutagenesis studies demonstrated the importance of K529 and D422 experimentally. Also the significant reduction in SASA for experimentally important residues K529, D422 and T343 which are involved in active site region was observed. Principle component analysis (PCA) in our study shows that the dynamical behavior of the enzyme is changed upon heating up which mainly originated from the change of motion modes and associated extent of those motions with respect to 298 K. These findings could explain why heating up of the enzyme or thermal fluctuation of protein conformation reduces luciferase activity in course of time as a possible mechanism of thermal functional inactivation. According to these results we proposed two strategies to improve thermal stability of functional luciferase. PMID:28672033

Novel Bioluminescent Activatable Reporter for Src Tyrosine Kinase Activity in Living Mice

PubMed Central

Leng, Weibing; Li, Dezhi; Chen, Liang; Xia, Hongwei; Tang, Qiulin; Chen, Baoqin; Gong, Qiyong; Gao, Fabao; Bi, Feng

2016-01-01

Aberrant activation of the Src kinase is implicated in the development of a variety of human malignancies. However, it is almost impossible to monitor Src activity in an in vivo setting with current biochemical techniques. To facilitate the noninvasive investigation of the activity of Src kinase both in vitro and in vivo, we developed a genetically engineered, activatable bioluminescent reporter using split-luciferase complementation. The bioluminescence of this reporter can be used as a surrogate for Src activity in real time. This hybrid luciferase reporter was constructed by sandwiching a Src-dependent conformationally responsive unit (SH2 domain-Srcpep) between the split luciferase fragments. The complementation bioluminescence of this reporter was dependent on the Src activity status. In our study, Src kinase activity in cultured cells and tumor xenografts was monitored quantitatively and dynamically in response to clinical small-molecular kinase inhibitors, dasatinib and saracatinib. This system was also applied for high-throughput screening of Src inhibitors against a kinase inhibitor library in living cells. These results provide unique insights into drug development and pharmacokinetics/phoarmocodynamics of therapeutic drugs targeting Src signaling pathway enabling the optimization of drug administration schedules for maximum benefit. Using both Firefly and Renilla luciferase imaging, we have successfully monitored Src tyrosine kinase activity and Akt serine/threonine kinase activity concurrently in one tumor xenograft. This dual luciferase reporter imaging system will be helpful in exploring the complex signaling networks in vivo. The strategies reported here can also be extended to study and image other important kinases and the cross-talks among them. PMID:26941850

Quantitative, non-invasive imaging of radiation-induced DNA double strand breaks in vivo

PubMed Central

Li, Wenrong; Li, Fang; Huang, Qian; Shen, Jingping; Wolf, Frank; He, Yujun; Liu, Xinjian; Hu, Y. Angela; Bedford, Joel. S.; Li, Chuan-Yuan

2011-01-01

DNA double strand breaks is a major form of DNA damage and a key mechanism through which radiotherapy and some chemotherapeutic agents kill cancer cells. Despite its importance, measuring DNA double strand breaks is still a tedious task that is normally carried out by gel electrophoresis or immunofluorescence staining. Here we report a novel approach to image and quantify DNA double strand breaks in live mammalian cells through bi-fragment luciferase reconstitution. N- and C- terminal fragments of firefly luciferase gene were fused with H2AX and MDC1 genes, respectively. Our strategy was based on the established fact that at the sites of DNA double strand breaks, H2AX protein is phosphoryated and physically associates with the MDC1 protein, thus bringing together N- and C- luciferase fragments and reconstituting luciferase activity. Our strategy allowed serial, non-invasive quantification of DNA double strand breaks in cells irradiated with x-rays and 56Fe ions. Furthermore, it allowed for the evaluation of DNA double strand breaks (DSBs) non-invasively in vivo in irradiated tumors over two weeks. Surprisingly, we detected a second wave of DSB induction in irradiated tumor cells days after radiation exposure in addition to the initial rapid induction of DSBs. We conclude that our new split-luciferase based method for imaging γ-H2AX-MDC1 interaction is a powerful new tool to study DNA double strand break repair kinetics in vivo with considerable advantage for experiments requiring observations over an extended period of time. PMID:21527553

Picoliter DNA Sequencing Chemistry on an Electrowetting-based Digital Microfluidic Platform

PubMed Central

Ferguson Welch, Erin R.; Lin, Yan-You; Madison, Andrew; Fair, R.B.

2011-01-01

The results of investigations into performing DNA sequencing chemistry on a picoliter-scale electrowetting digital microfluidic platform are reported. Pyrosequencing utilizes pyrophosphate produced during nucleotide base addition to initiate a process ending with detection through a chemiluminescence reaction using firefly luciferase. The intensity of light produced during the reaction can be quantified to determine the number of bases added to the DNA strand. The logic-based control and discrete fluid droplets of a digital microfluidic device lend themselves well to the pyrosequencing process. Bead-bound DNA is magnetically held in a single location, and wash or reagent droplets added or split from it to circumvent product dilution. Here we discuss the dispensing, control, and magnetic manipulation of the paramagnetic beads used to hold target DNA. We also demonstrate and characterize the picoliter-scale reaction of luciferase with adenosine triphosphate to represent the detection steps of pyrosequencing and all necessary alterations for working on this scale. PMID:21298802

A sensitive HIV-1 envelope induced fusion assay identifies fusion enhancement of thrombin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheng, De-Chun; Zhong, Guo-Cai; Su, Ju-Xiang

2010-01-22

To evaluate the interaction between HIV-1 envelope glycoprotein (Env) and target cell receptors, various cell-cell-fusion assays have been developed. In the present study, we established a novel fusion system. In this system, the expression of the sensitive reporter gene, firefly luciferase (FL) gene, in the target cells was used to evaluate cell fusion event. Simultaneously, constitutively expressed Renilla luciferase (RL) gene was used to monitor effector cell number and viability. FL gave a wider dynamic range than other known reporters and the introduction of RL made the assay accurate and reproducible. This system is especially beneficial for investigation of potentialmore » entry-influencing agents, for its power of ruling out the false inhibition or enhancement caused by the artificial cell-number variation. As a case study, we applied this fusion system to observe the effect of a serine protease, thrombin, on HIV Env-mediated cell-cell fusion and have found the fusion enhancement activity of thrombin over two R5-tropic HIV strains.« less

Computational investigation of the effect of pH on the color of firefly bioluminescence by DFT.

PubMed

Pinto da Silva, Luís; Esteves da Silva, Joaquim C G

2011-04-04

In spite of recent advances towards understanding the mechanism of firefly bioluminescence, there is no consensus about which oxyluciferin (OxyLH(2)) species are the red and yellow-green emitters. The crystal structure of Luciola cruciata luciferase (LcLuc) revealed different conformations for the various steps of the bioluminescence reaction, with different degrees of polarity and rigidity of the active-site microenvironment. In this study, these different conformations of luciferase (Luc) are simulated and their effects on the different chemical equilibria of OxyLH(2) are investigated as a function of pH by means of density functional theory with the PBE0 functional. In particular, the thermodynamic properties and the absorption spectra of each species, as well as their relative stabilities in the ground and excited states, were computed in the different conformations of Luc. From the calculations it is possible to derive the acid dissociation and tautomeric constants, and the corresponding distribution diagrams. It is observed that the anionic keto form of OxyLH(2) is both the red and the yellow-green emitter. Consequently, the effect of Luc conformations on the structural and electronic properties of the Keto-(-1) form are studied. Finally, insights into the Luc-catalyzed light-emitting reaction are derived from the calculations. The multicolor bioluminescence can be explained by interactions of the emitter with active-site molecules, the effects of which on light emission are modulated by the internal dielectric constant of the different conformations. These interactions can suffer also from rearrangement due to entry of external solvent and changes in the protonation state of some amino acid residues and adenosine monophosphate (AMP). Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Transient, Inducible, Placenta-Specific Gene Expression in Mice

PubMed Central

Fan, Xiujun; Petitt, Matthew; Gamboa, Matthew; Huang, Mei; Dhal, Sabita; Druzin, Maurice L.; Wu, Joseph C.

2012-01-01

Molecular understanding of placental functions and pregnancy disorders is limited by the absence of methods for placenta-specific gene manipulation. Although persistent placenta-specific gene expression has been achieved by lentivirus-based gene delivery methods, developmentally and physiologically important placental genes have highly stage-specific functions, requiring controllable, transient expression systems for functional analysis. Here, we describe an inducible, placenta-specific gene expression system that enables high-level, transient transgene expression and monitoring of gene expression by live bioluminescence imaging in mouse placenta at different stages of pregnancy. We used the third generation tetracycline-responsive tranactivator protein Tet-On 3G, with 10- to 100-fold increased sensitivity to doxycycline (Dox) compared with previous versions, enabling unusually sensitive on-off control of gene expression in vivo. Transgenic mice expressing Tet-On 3G were created using a new integrase-based, site-specific approach, yielding high-level transgene expression driven by a ubiquitous promoter. Blastocysts from these mice were transduced with the Tet-On 3G-response element promoter-driving firefly luciferase using lentivirus-mediated placenta-specific gene delivery and transferred into wild-type pseudopregnant recipients for placenta-specific, Dox-inducible gene expression. Systemic Dox administration at various time points during pregnancy led to transient, placenta-specific firefly luciferase expression as early as d 5 of pregnancy in a Dox dose-dependent manner. This system enables, for the first time, reliable pregnancy stage-specific induction of gene expression in the placenta and live monitoring of gene expression during pregnancy. It will be widely applicable to studies of both placental development and pregnancy, and the site-specific Tet-On G3 mouse will be valuable for studies in a broad range of tissues. PMID:23011919

Simultaneous measurement of adenosine triphosphate release and aggregation potentiates human platelet aggregation responses for some subjects, including persons with Quebec platelet disorder.

PubMed

Hayward, C P M; Moffat, K A; Castilloux, J-F; Liu, Y; Seecharan, J; Tasneem, S; Carlino, S; Cormier, A; Rivard, G E

2012-04-01

Platelet aggregometry and dense granule adenosine triphosphate (ATP) release assays are helpful to diagnose platelet disorders. Some laboratories simultaneously measure aggregation and ATP release using Chronolume® a commercial reagent containing D-luciferin, firefly luciferase and magnesium. Chronolume® can potentiate sub-maximal aggregation responses, normalising canine platelet disorder findings. We investigated if Chronolume® potentiates human platelet aggregation responses after observing discrepancies suspicious of potentiation. Among patients simultaneously tested by light transmission aggregometry (LTA) on two instruments, 18/43 (42%), including 14/24 (58%) with platelet disorders, showed full secondary aggregation with one or more agonists only in tests with Chronolume®. As subjects with Quebec platelet disorder (QPD) did not show the expected absent secondary aggregation responses to epinephrine in tests with Chronolume®, the reason for the discrepancy was investigated using samples from 10 QPD subjects. Like sub-threshold ADP (0.75 μM), Chronolume® significantly increased QPD LTA responses to epinephrine (p<0.0001) and it increased both initial and secondary aggregation responses, leading to dense granule release. This potentiation was not restricted to QPD and it was mimicked adding 1-2 mM magnesium, but not D-luciferin or firefly luciferase, to LTA assays. Chronolume® potentiated the ADP aggregation responses of QPD subjects with a reduced response. Furthermore, it increased whole blood aggregation responses of healthy control samples to multiple agonists, tested at concentrations used for the diagnosis of platelet disorders (p values <0.05). Laboratories should be aware that measuring ATP release with Chronolume® can potentiate LTA and whole blood aggregation responses, which alters findings for some human platelet disorders, including QPD.

Evaluation of Gaussia luciferase and foot-and-mouth disease virus 2A translational interrupter chimeras as polycistronic reporters for transgene expression.

PubMed

Puckette, Michael; Burrage, Thomas; Neilan, John G; Rasmussen, Max

2017-06-12

The Gaussia princeps luciferase is used as a stand-alone reporter of transgene expression for in vitro and in vivo expression systems due to the rapid and easy monitoring of luciferase activity. We sought to simultaneously quantitate production of other recombinant proteins by transcriptionally linking the Gaussia princeps luciferase gene to other genes of interest through the foot-and-mouth disease virus 2A translational interrupter sequence. We produced six plasmids, each encoding a single open reading frame, with the foot-and-mouth disease virus 2A sequence placed either N-terminal or C-terminal to the Gaussia princeps luciferase gene. Two plasmids included novel Gaussia princeps luciferase variants with the position 1 methionine deleted. Placing a foot-and-mouth disease virus 2A translational interrupter sequence on either the N- or C-terminus of the Gaussia princeps luciferase gene did not prevent the secretion or luminescence of resulting chimeric luciferase proteins. We also measured the ability of another polycistronic plasmid vector with a 2A-luciferase sequence placed downstream of the foot-and-mouth disease virus P1 and 3C protease genes to produce of foot-and-mouth disease virus-like particles and luciferase activity from transfected cells. Incorporation of the 2A-luciferase sequence into a transgene encoding foot-and-mouth disease virus structural proteins retained luciferase activity and the ability to form virus-like particles. We demonstrated a mechanism for the near real-time, sequential, non-destructive quantitative monitoring of transcriptionally-linked recombinant proteins and a valuable method for monitoring transgene expression in recombinant vaccine constructs.

High throughput selection of antibiotic-resistant transgenic Arabidopsis plants.

PubMed

Nagashima, Yukihiro; Koiwa, Hisashi

2017-05-15

Kanamycin resistance is the most frequently used antibiotic-resistance marker for Arabidopsis transformations, however, this method frequently causes escape of untransformed plants, particularly at the high seedling density during the selection. Here we developed a robust high-density selection method using top agar for Arabidopsis thaliana. Top agar effectively suppressed growth of untransformed wild-type plants on selection media at high density. Survival of the transformed plants during the selection were confirmed by production of green true leaves and expression of a firefly luciferase reporter gene. Top agar method allowed selection using a large amount of seeds in Arabidopsis transformation. Copyright © 2017 Elsevier Inc. All rights reserved.

Molecular Cloning of Secreted Luciferases from Marine Planktonic Copepods.

PubMed

Takenaka, Yasuhiro; Ikeo, Kazuho; Shigeri, Yasushi

2016-01-01

Secreted luciferases isolated from copepod crustaceans are frequently used for nondisruptive reporter-gene assays, such as the continuous, automated and/or high-throughput monitoring of gene expression in living cells. All known copepod luciferases share highly conserved amino acid residues in two similar, repeated domains in the sequence. The similarity in the domains are ideal nature for designing PCR primers to amplify cDNA fragments of unidentified copepod luciferases from bioluminescent copepod crustaceans. Here, we introduce how to establish a cDNA encoding novel copepod luciferases from a copepod specimen by PCR with degenerated primers.

Effect of tape stripping and adjuvants on immune response after intradermal DNA electroporation.

PubMed

Vandermeulen, Gaëlle; Daugimont, Liévin; Richiardi, Hervé; Vanderhaeghen, Marie-Lise; Lecouturier, Nathalie; Ucakar, Bernard; Préat, Véronique

2009-07-01

DNA vaccines require both efficient delivery methods and appropriate adjuvants. Based on their mechanisms of action, we hypothesised that some adjuvants could enhance vaccine immunogenicity or direct the response towards Th1 profile after intradermal DNA electroporation. After intradermal electroporation of plasmid DNA encoding luciferase, mice received hyaluronidase, imiquimod, monophosphoryl lipid A or were tape stripped in order to modulate the immune response against the encoded protein. We measured total immunoglobulin G, IgG1, IgG2a titres and the cytokines produced by splenocyte cultures to assess both humoral and cellular response. The effect of tape stripping on the response against intradermally delivered ovalbumin protein was also assessed. Neither hyaluronidase nor imiquimod improved the immune response against the encoded luciferase. Monophosphoryl lipid A did not modify the cytokines production but increased the anti-luciferase IgG2a titres. Tape stripping significantly increased anti-luciferase IgG2a and IFN-gamma responses. It also enhanced the humoral response after intradermal injection of the ovalbumin protein. Tape stripping is able to increase the Th1 immune response against both DNA and protein vaccines. Therefore, tape stripping appears to have interesting adjuvant effect on intradermal vaccination.

A homogeneous biochemiluminescent assay for detection of influenza

NASA Astrophysics Data System (ADS)

Hui, Kwok Min; Li, Xiao Jing; Pan, Lu; Li, X. J.

2015-05-01

Current methods of rapid detection of influenza are based on detection of the nucleic acids or antigens of influenza viruses. Since influenza viruses constantly mutate leading to appearance of new strains or variants of viruses, these detection methods are susceptible to genetic changes in influenza viruses. Type A and B influenza viruses contain neuraminidase, an essential enzyme for virus replication which enables progeny influenza viruses leave the host cells to infect new cells. Here we describe an assay method, the homogeneous biochemiluminescent assay (HBA), for rapid detection of influenza by detecting viral neuraminidase activity. The assay mimics the light production process of a firefly: a viral neuraminidase specific substrate containing a luciferin moiety is cleaved in the presence of influenza virus to release luciferin, which becomes a substrate to firefly luciferase in a light production system. All reagents can be formulated in a single reaction mix so that the assay involves only one manual step, i.e., sample addition. Presence of Type A or B influenza virus in the sample leads to production of strong, stable and easily detectable light signal, which lasts for hours. Thus, this influenza virus assay is suitable for use in point-of-care settings.

In Vitro and in Vivo Molecular Imaging of Estrogen Receptor α and β Homo- and Heterodimerization: Exploration of New Modes of Receptor Regulation

PubMed Central

Tamrazi, Anobel; Massoud, Tarik F.; Katzenellenbogen, John A.; Gambhir, Sanjiv S.

2011-01-01

Estrogen receptor (ER) biology reflects the actions of estrogens through the two receptors, ERα and ERβ, although little is known regarding the preference for formation of ER homo- vs. heterodimers, and how this is affected by the level of ligand occupancy and preferential ligand affinity for one of the ER subtypes. In this report, we use a split optical reporter-protein complementation system to demonstrate the physical interaction between ERα and ERβ in response to different ER ligands in cells and, for the first time, by in vivo imaging in living animals. The genetically encoded reporter vectors constructed with the ligand-binding domains of ERα and ERβ, fused to split firefly or Renilla luciferase (Fluc or hRluc) fragments, were used for this study. This molecular proteomic technique was used to detect ERα/ERα or ERβ/ERβ homodimerization, or ERα/ERβ heterodimerization induced by ER subtype-selective and nonselective ligands, and selective ER modulators (SERM), as well as in dimers in which one mutant monomer was unable to bind estradiol. The SERM-bound ERα and ERβ form the strongest dimers, and subtype-preferential homodimerization was seen with ERα-selective ligands (methyl piperidino pyrazole/propyl pyrazole triol) and the ERβ-selective ligands (diarylpropionitrile/tetrahydrochrysene/genistein). We also demonstrated that a single ligand-bound monomer can form homo- or heterodimers with an apo-monomer. Xenografts of human embryonic kidney 293T cells imaged in living mice by bioluminescence showed real-time ligand induction of ERα/ERβ heterodimerization and reversal of dimerization upon ligand withdrawal. The results from this study demonstrate the value of the split luciferase-based complementation system for studying ER-subtype interactions in cells and for evaluating them in living animals by noninvasive imaging. They also probe what combinations of ERα and ERβ dimers might be the mediators of the effects of different types of ER ligands given at different doses. PMID:22052998

Molecular Imaging of Phosphorylation Events for Drug Development

PubMed Central

Chan, C. T.; Paulmurugan, R.; Reeves, R. E.; Solow-Cordero, D.; Gambhir, S. S.

2014-01-01

Purpose Protein phosphorylation mediated by protein kinases controls numerous cellular processes. A genetically encoded, generalizable split firefly luciferase (FL)-assisted complementation system was developed for noninvasive monitoring phosphorylation events and efficacies of kinase inhibitors in cell culture and in small living subjects by optical bioluminescence imaging. Procedures An Akt sensor (AST) was constructed to monitor Akt phosphorylation and the effect of different PI-3K and Akt inhibitors. Specificity of AST was determined using a non-phosphorylable mutant sensor containing an alanine substitution (ASA). Results The PI-3K inhibitor LY294002 and Akt kinase inhibitor perifosine led to temporal- and dose-dependent increases in complemented FL activities in 293T human kidney cancer cells stably expressing AST (293T/AST) but not in 293T/ASA cells. Inhibition of endogenous Akt phosphorylation and kinase activities by perifosine also correlated with increase in complemented FL activities in 293T/AST cells but not in 293T/ASA cells. Treatment of nude mice bearing 293T/AST xenografts with perifosine led to a 2-fold increase in complemented FL activities compared to that of 293T/ASA xenografts. Our system was used to screen a small chemical library for novel modulators of Akt kinase activity. Conclusion This generalizable approach for noninvasive monitoring of phosphorylation events will accelerate the discovery and validation of novel kinase inhibitors and modulators of phosphorylation events. PMID:19048345

Imaging of bioluminescent LNCaP-luc-M6 tumors: a new animal model for the study of metastatic human prostate cancer.

PubMed

Scatena, Caroline D; Hepner, Mischa A; Oei, Yoko A; Dusich, Joan M; Yu, Shang-Fan; Purchio, Tony; Contag, Pamela R; Jenkins, Darlene E

2004-05-15

Animal experiments examining hormone-sensitive metastatic prostate cancer using the human LNCaP cell line have been limited to endpoint analyses. To permit longitudinal studies, we generated a luciferase-expressing cell line and used bioluminescent imaging (BLI) to non-invasively monitor the in vivo growth of primary LNCaP tumors and metastasis. LNCaP.FGC cells were transfected to constitutively express firefly luciferase. LNCaP-luc-M6 cells were tested for bioluminescent signal intensity and hormone responsiveness in vitro. The cells were implanted in subcutaneous and orthotopic sites in SCID-bg mice and imaged over time. The LNCaP-luc-M6 cells formed subcutaneous and orthotopic tumors in SCID-bg mice, and nearly all tumor-bearing animals developed pulmonary metastases. Early detection and temporal growth of primary tumors and metastatic lesions was successfully monitored by BLI. The LNCaP-luc-M6 cell line is a bioluminescent, hormone-sensitive prostate cancer cell line applicable for BLI studies to non-invasively monitor subcutaneous and orthotopic prostate tumor growth and metastasis in vivo. Copyright 2004 Wiley-Liss, Inc.

A bright cyan-excitable orange fluorescent protein facilitates dual-emission microscopy and enhances bioluminescence imaging in vivo

PubMed Central

Chu, Jun; Oh, Young-Hee; Sens, Alex; Ataie, Niloufar; Dana, Hod; Macklin, John J.; Laviv, Tal; Welf, Erik S.; Dean, Kevin M.; Zhang, Feijie; Kim, Benjamin B.; Tang, Clement Tran; Hu, Michelle; Baird, Michelle A.; Davidson, Michael W.; Kay, Mark A.; Fiolka, Reto; Yasuda, Ryohei; Kim, Douglas S.; Ng, Ho-Leung; Lin, Michael Z.

2016-01-01

Orange-red fluorescent proteins (FPs) are widely used in biomedical research for multiplexed epifluorescence microscopy with GFP-based probes, but their different excitation requirements make multiplexing with new advanced microscopy methods difficult. Separately, orange-red FPs are useful for deep-tissue imaging in mammals due to the relative tissue transmissibility of orange-red light, but their dependence on illumination limits their sensitivity as reporters in deep tissues. Here we describe CyOFP1, a bright engineered orange-red FP that is excitable by cyan light. We show that CyOFP1 enables single-excitation multiplexed imaging with GFP-based probes in single-photon and two-photon microscopy, including time-lapse imaging in light-sheet systems. CyOFP1 also serves as an efficient acceptor for resonance energy transfer from the highly catalytic blue-emitting luciferase NanoLuc. An optimized fusion of CyOFP1 and NanoLuc, called Antares, functions as a highly sensitive bioluminescent reporter in vivo, producing substantially brighter signals from deep tissues than firefly luciferase and other bioluminescent proteins. PMID:27240196

New Breed of Mice May Improve Accuracy for Preclinical Testing of Cancer Drugs | Poster

Cancer.gov

A new breed of lab animals, dubbed “glowing head mice,” may do a better job than conventional mice in predicting the success of experimental cancer drugs—while also helping to meet an urgent need for more realistic preclinical animal models. The mice were developed to tolerate often-used light-emitting molecules, such as luciferase from fireflies and green fluorescent protein (GFP) from jellyfish. These “optical reporters” are useful for monitoring the effect of experimental therapies in live animals over time because they emit an immediate and easily detected light signal showing whether a tumor inside the animal’s body is shrinking as desired.

The Mechanism of Action of Unique Small Molecules that Inhibit the Pim Protein Kinase Blocking Prostate Cancer Cell Growth

DTIC Science & Technology

2010-05-01

shown. (E) Cap-dependent ( gray bars) and IRES-dependent (black bars) translation in MEFs as measured by Renilla and Firefly luciferase activities...AGC ATC AAC C; EPHA2-R, GTG ACC TCG TAC TTC CAC ACT C. HER3-F, CGA TGC TGA GAA CCA ATA CCA G; HER3-R, ATA GCC TGT CAC TTC TCG AAT C. INSR-F, GGA AGT...TAC GTC TGA TTC GAG G; INSR-R, TGA GTG ATG GTG AGG TTG TG. IGF1R-F, CCT GCA CAA CTC CAT CTT CGT G; IGF1R-R, CGG TGA TGT TGT AGG TGT CTG C. EGFR-F

Detailed assessment of gene activation levels by multiple hypoxia-responsive elements under various hypoxic conditions.

PubMed

Takeuchi, Yasuto; Inubushi, Masayuki; Jin, Yong-Nan; Murai, Chika; Tsuji, Atsushi B; Hata, Hironobu; Kitagawa, Yoshimasa; Saga, Tsuneo

2014-12-01

HIF-1/HRE pathway is a promising target for the imaging and the treatment of intractable malignancy (HIF-1; hypoxia-inducible factor 1, HRE; hypoxia-responsive element). The purposes of our study are: (1) to assess the gene activation levels resulting from various numbers of HREs under various hypoxic conditions, (2) to evaluate the bidirectional activity of multiple HREs, and (3) to confirm whether multiple HREs can induce gene expression in vivo. Human colon carcinoma HCT116 cells were transiently transfected by the constructs containing a firefly luciferase reporter gene and various numbers (2, 4, 6, 8, 10, and 12) of HREs (nHRE+, nHRE-). The relative luciferase activities were measured under various durations of hypoxia (6, 12, 18, and 24 h), O2 concentrations (1, 2, 4, 8, and 16 %), and various concentrations of deferoxamine mesylate (20, 40, 80, 160, and 320 µg/mL growth medium). The bidirectional gene activation levels by HREs were examined in the constructs (dual-luc-nHREs) containing firefly and Renilla luciferase reporter genes at each side of nHREs. Finally, to test whether the construct containing 12HRE and the NIS reporter gene (12HRE-NIS) can induce gene expression in vivo, SPECT imaging was performed in a mouse xenograft model. (1) gene activation levels by HREs tended to increase with increasing HRE copy number, but a saturation effect was observed in constructs with more than 6 or 8 copies of an HRE, (2) gene activation levels by HREs increased remarkably during 6-12 h of hypoxia, but not beyond 12 h, (3) gene activation levels by HREs decreased with increasing O2 concentrations, but could be detected even under mild hypoxia at 16 % O2, (4) the bidirectionally proportional activity of the HRE was confirmed regardless of the hypoxic severity, and (5) NIS expression driven by 12 tandem copies of an HRE in response to hypoxia could be visualized on in vivo SPECT imaging. The results of this study will help in the understanding and assessment of the activity of multiple HREs under hypoxia and become the basis for hypoxia-targeted imaging and therapy in the future.

Bioluminescent indicators for Ca2+ based on split Renilla luciferase complementation in living cells.

PubMed

Kaihara, Asami; Umezawa, Yoshio; Furukawa, Tetsushi

2008-01-01

Genetically encoded bioluminescent indicators for intracellular Ca2+ are described here with CaM-M13 interaction-induced complementation of split Renilla luciferase. The Ca2+-induced interaction between CaM and M13 leads to complementation of the N- and C-terminal halves of split Renilla luciferase in living cells. This intramolecular interaction results in the spontaneous and simultaneous emission of bioluminescence split Renilla luciferase. This is how intracellular Ca2+ is illuminated with the intramolecular complementation of split Renilla luciferase. The Ca2+-dependent spontaneous and simultaneous emission of bioluminescence promises to reveal Ca2+ dynamics in living cells, and also in vivo using the present indicators.

Demonstration of protein-fragment complementation assay using purified firefly luciferase fragments

PubMed Central

2013-01-01

Background Human interactome is predicted to contain 150,000 to 300,000 protein-protein interactions, (PPIs). Protein-fragment complementation assay (PCA) is one of the most widely used methods to detect PPI, as well as Förster resonance energy transfer (FRET). To date, successful applications of firefly luciferase (Fluc)-based PCA have been reported in vivo, in cultured cells and in cell-free lysate, owing to its high sensitivity, high signal-to-background (S/B) ratio, and reversible response. Here we show the assay also works with purified proteins with unexpectedly rapid kinetics. Results Split Fluc fragments both fused with a rapamycin-dependently interacting protein pair were made and expressed in E. coli system, and purified to homogeneity. When the proteins were used for PCA to detect rapamycin-dependent PPI, they enabled a rapid detection (~1 s) of PPI with high S/B ratio. When Fn7-8 domains (7 nm in length) that was shown to abrogate GFP mutant-based FRET was inserted between split Fluc and FKBP12 as a rigid linker, it still showed some response, suggesting less limitation in interacting partner’s size. Finally, the stability of the probe was investigated. Preincubation of the probes at 37 degreeC up to 1 h showed marked decrease of the luminescent signal to 1.5%, showing the limited stability of this system. Conclusion Fluc PCA using purified components will enable a rapid and handy detection of PPIs with high S/B ratio, avoiding the effects of concomitant components. Although the system might not be suitable for large-scale screening due to its limited stability, it can detect an interaction over larger distance than by FRET. This would be the first demonstration of Fluc PCA in vitro, which has a distinct advantage over other PPI assays. Our system enables detection of direct PPIs without risk of perturbation by PPI mediators in the complex cellular milieu. PMID:23536995

Engineered Luciferase Reporter from a Deep Sea Shrimp Utilizing a Novel Imidazopyrazinone Substrate

PubMed Central

2012-01-01

Bioluminescence methodologies have been extraordinarily useful due to their high sensitivity, broad dynamic range, and operational simplicity. These capabilities have been realized largely through incremental adaptations of native enzymes and substrates, originating from luminous organisms of diverse evolutionary lineages. We engineered both an enzyme and substrate in combination to create a novel bioluminescence system capable of more efficient light emission with superior biochemical and physical characteristics. Using a small luciferase subunit (19 kDa) from the deep sea shrimp Oplophorus gracilirostris, we have improved luminescence expression in mammalian cells ∼2.5 million-fold by merging optimization of protein structure with development of a novel imidazopyrazinone substrate (furimazine). The new luciferase, NanoLuc, produces glow-type luminescence (signal half-life >2 h) with a specific activity ∼150-fold greater than that of either firefly (Photinus pyralis) or Renilla luciferases similarly configured for glow-type assays. In mammalian cells, NanoLuc shows no evidence of post-translational modifications or subcellular partitioning. The enzyme exhibits high physical stability, retaining activity with incubation up to 55 °C or in culture medium for >15 h at 37 °C. As a genetic reporter, NanoLuc may be configured for high sensitivity or for response dynamics by appending a degradation sequence to reduce intracellular accumulation. Appending a signal sequence allows NanoLuc to be exported to the culture medium, where reporter expression can be measured without cell lysis. Fusion onto other proteins allows luminescent assays of their metabolism or localization within cells. Reporter quantitation is achievable even at very low expression levels to facilitate more reliable coupling with endogenous cellular processes. PMID:22894855

Influenza A Virus Encoding Secreted Gaussia Luciferase as Useful Tool to Analyze Viral Replication and Its Inhibition by Antiviral Compounds and Cellular Proteins

PubMed Central

Palanisamy, Navaneethan; Goedecke, Ulrike; Jäger, Nils; Pöhlmann, Stefan; Winkler, Michael

2014-01-01

Reporter genes inserted into viral genomes enable the easy and rapid quantification of virus replication, which is instrumental to efficient in vitro screening of antiviral compounds or in vivo analysis of viral spread and pathogenesis. Based on a published design, we have generated several replication competent influenza A viruses carrying either fluorescent proteins or Gaussia luciferase. Reporter activity could be readily quantified in infected cultures, but the virus encoding Gaussia luciferase was more stable than viruses bearing fluorescent proteins and was therefore analyzed in detail. Quantification of Gaussia luciferase activity in the supernatants of infected culture allowed the convenient and highly sensitive detection of viral spread, and enzymatic activity correlated with the number of infectious particles released from infected cells. Furthermore, the Gaussia luciferase encoding virus allowed the sensitive quantification of the antiviral activity of the neuraminidase inhibitor (NAI) zanamivir and the host cell interferon-inducible transmembrane (IFITM) proteins 1–3, which are known to inhibit influenza virus entry. Finally, the virus was used to demonstrate that influenza A virus infection is sensitive to a modulator of endosomal cholesterol, in keeping with the concept that IFITMs inhibit viral entry by altering cholesterol levels in the endosomal membrane. In sum, we report the characterization of a novel influenza A reporter virus, which allows fast and sensitive detection of viral spread and its inhibition, and we show that influenza A virus entry is sensitive to alterations of endosomal cholesterol levels. PMID:24842154

Factors modulating expression of Renilla luciferase from control plasmids used in luciferase reporter gene assays1

PubMed Central

Shifera, Amde Selassie; Hardin, John A.

2009-01-01

The Renilla luciferase gene is commonly used as an internal control in luciferase-based reporter gene assays to normalize the values of the experimental reporter gene for variations that could be caused by transfection efficiency and sample handling. Various plasmids encoding Renilla luciferase under different promoter constructs are commercially available. The validity of the use of Renilla luciferase as an internal control is based on the assumption that it is constitutively expressed in transfected cells and that its constitutive expression is not modulated by experimental factors that could result in either the upregulation or the downregulation of the amounts of the enzyme produced. During the past ten years, a number of reports have appeared that identified a variety of conditions that could alter the basal constitutive expression of Renilla luciferase. The use of Renilla luciferase in those circumstances would not be valid and an alternative way of normalization would be necessary. This review covers the factors that have been reported thus far as modulating the expression of Renilla luciferase from plasmid constructs. PMID:19788887

xTract: software for characterizing conformational changes of protein complexes by quantitative cross-linking mass spectrometry.

PubMed

Walzthoeni, Thomas; Joachimiak, Lukasz A; Rosenberger, George; Röst, Hannes L; Malmström, Lars; Leitner, Alexander; Frydman, Judith; Aebersold, Ruedi

2015-12-01

Chemical cross-linking in combination with mass spectrometry generates distance restraints of amino acid pairs in close proximity on the surface of native proteins and protein complexes. In this study we used quantitative mass spectrometry and chemical cross-linking to quantify differences in cross-linked peptides obtained from complexes in spatially discrete states. We describe a generic computational pipeline for quantitative cross-linking mass spectrometry consisting of modules for quantitative data extraction and statistical assessment of the obtained results. We used the method to detect conformational changes in two model systems: firefly luciferase and the bovine TRiC complex. Our method discovers and explains the structural heterogeneity of protein complexes using only sparse structural information.

Modeling and image reconstruction in spectrally resolved bioluminescence tomography

NASA Astrophysics Data System (ADS)

Dehghani, Hamid; Pogue, Brian W.; Davis, Scott C.; Patterson, Michael S.

2007-02-01

Recent interest in modeling and reconstruction algorithms for Bioluminescence Tomography (BLT) has increased and led to the general consensus that non-spectrally resolved intensity-based BLT results in a non-unique problem. However, the light emitted from, for example firefly Luciferase, is widely distributed over the band of wavelengths from 500 nm to 650 nm and above, with the dominant fraction emitted from tissue being above 550 nm. This paper demonstrates the development of an algorithm used for multi-wavelength 3D spectrally resolved BLT image reconstruction in a mouse model. It is shown that using a single view data, bioluminescence sources of up to 15 mm deep can be successfully recovered given correct information about the underlying tissue absorption and scatter.

Development and Validation of a Novel Dual Luciferase Reporter Gene Assay to Quantify Ebola Virus VP24 Inhibition of IFN Signaling

PubMed Central

Frau, Aldo; Sgarbanti, Marco; Orsatti, Roberto

2018-01-01

The interferon (IFN) system is the first line of defense against viral infections. Evasion of IFN signaling by Ebola viral protein 24 (VP24) is a critical event in the pathogenesis of the infection and, hence, VP24 is a potential target for drug development. Since no drugs target VP24, the identification of molecules able to inhibit VP24, restoring and possibly enhancing the IFN response, is a goal of concern. Accordingly, we developed a dual signal firefly and Renilla luciferase cell-based drug screening assay able to quantify IFN-mediated induction of Interferon Stimulated Genes (ISGs) and its inhibition by VP24. Human Embryonic Kidney 293T (HEK293T) cells were transiently transfected with a luciferase reporter gene construct driven by the promoter of ISGs, Interferon-Stimulated Response Element (ISRE). Stimulation of cells with IFN-α activated the IFN cascade leading to the expression of ISRE. Cotransfection of cells with a plasmid expressing VP24 cloned from a virus isolated during the last 2014 outbreak led to the inhibition of ISRE transcription, quantified by a luminescent signal. To adapt this system to test a large number of compounds, we performed it in 96-well plates; optimized the assay analyzing different parameters; and validated the system by calculating the Z′- and Z-factor, which showed values of 0.62 and 0.53 for IFN-α stimulation assay and VP24 inhibition assay, respectively, indicative of robust assay performance. PMID:29495311

Development and Validation of a Novel Dual Luciferase Reporter Gene Assay to Quantify Ebola Virus VP24 Inhibition of IFN Signaling.

PubMed

Fanunza, Elisa; Frau, Aldo; Sgarbanti, Marco; Orsatti, Roberto; Corona, Angela; Tramontano, Enzo

2018-02-24

The interferon (IFN) system is the first line of defense against viral infections. Evasion of IFN signaling by Ebola viral protein 24 (VP24) is a critical event in the pathogenesis of the infection and, hence, VP24 is a potential target for drug development. Since no drugs target VP24, the identification of molecules able to inhibit VP24, restoring and possibly enhancing the IFN response, is a goal of concern. Accordingly, we developed a dual signal firefly and Renilla luciferase cell-based drug screening assay able to quantify IFN-mediated induction of Interferon Stimulated Genes (ISGs) and its inhibition by VP24. Human Embryonic Kidney 293T (HEK293T) cells were transiently transfected with a luciferase reporter gene construct driven by the promoter of ISGs, Interferon-Stimulated Response Element (ISRE). Stimulation of cells with IFN-α activated the IFN cascade leading to the expression of ISRE. Cotransfection of cells with a plasmid expressing VP24 cloned from a virus isolated during the last 2014 outbreak led to the inhibition of ISRE transcription, quantified by a luminescent signal. To adapt this system to test a large number of compounds, we performed it in 96-well plates; optimized the assay analyzing different parameters; and validated the system by calculating the Z'- and Z-factor, which showed values of 0.62 and 0.53 for IFN-α stimulation assay and VP24 inhibition assay, respectively, indicative of robust assay performance.

A scalable assessment of Plasmodium falciparum transmission in the standard membrane-feeding assay, using transgenic parasites expressing green fluorescent protein-luciferase.

PubMed

Stone, Will J R; Churcher, Thomas S; Graumans, Wouter; van Gemert, Geert-Jan; Vos, Martijn W; Lanke, Kjerstin H W; van de Vegte-Bolmer, Marga G; Siebelink-Stoter, Rianne; Dechering, Koen J; Vaughan, Ashley M; Camargo, Nelly; Kappe, Stefan H I; Sauerwein, Robert W; Bousema, Teun

2014-11-01

The development of drugs and vaccines to reduce malaria transmission is an important part of eradication plans. The transmission-reducing activity (TRA) of these agents is currently determined in the standard membrane-feeding assay (SMFA), based on subjective microscopy-based readouts and with limitations in upscaling and throughput. Using a Plasmodium falciparum strain expressing the firefly luciferase protein, we present a luminescence-based approach to SMFA evaluation that eliminates the requirement for mosquito dissections in favor of a simple approach in which whole mosquitoes are homogenized and examined directly for luciferase activity. Analysis of 6860 Anopheles stephensi mosquitoes across 68 experimental feeds shows that the luminescence assay was as sensitive as microscopy for infection detection. The mean luminescence intensity of individual and pooled mosquitoes accurately quantifies mean oocyst intensity and generates comparable TRA estimates. The luminescence assay presented here could increase SMFA throughput so that 10-30 experimental feeds could be evaluated in a single 96-well plate. This new method of assessing Plasmodium infection and transmission intensity could expedite the screening of novel drug compounds, vaccine candidates, and sera from malaria-exposed individuals for TRA. Luminescence-based estimates of oocyst intensity in individual mosquitoes should be interpreted with caution. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Expression kinetics of nucleoside-modified mRNA delivered in lipid nanoparticles to mice by various routes.

PubMed

Pardi, Norbert; Tuyishime, Steven; Muramatsu, Hiromi; Kariko, Katalin; Mui, Barbara L; Tam, Ying K; Madden, Thomas D; Hope, Michael J; Weissman, Drew

2015-11-10

In recent years, in vitro transcribed messenger RNA (mRNA) has emerged as a potential therapeutic platform. To fulfill its promise, effective delivery of mRNA to specific cell types and tissues needs to be achieved. Lipid nanoparticles (LNPs) are efficient carriers for short-interfering RNAs and have entered clinical trials. However, little is known about the potential of LNPs to deliver mRNA. Here, we generated mRNA-LNPs by incorporating HPLC purified, 1-methylpseudouridine-containing mRNA comprising codon-optimized firefly luciferase into stable LNPs. Mice were injected with 0.005-0.250mg/kg doses of mRNA-LNPs by 6 different routes and high levels of protein translation could be measured using in vivo imaging. Subcutaneous, intramuscular and intradermal injection of the LNP-encapsulated mRNA translated locally at the site of injection for up to 10days. For several days, high levels of protein production could be achieved in the lung from the intratracheal administration of mRNA. Intravenous and intraperitoneal and to a lesser extent intramuscular and intratracheal deliveries led to trafficking of mRNA-LNPs systemically resulting in active translation of the mRNA in the liver for 1-4 days. Our results demonstrate that LNPs are appropriate carriers for mRNA in vivo and have the potential to become valuable tools for delivering mRNA encoding therapeutic proteins. Copyright © 2015 Elsevier B.V. All rights reserved.

Synergistic effect of ultrasound and PEI on DNA transfection in vitro

PubMed Central

Deshpande, Mangesh C.; Prausnitz, Mark R.

2007-01-01

Ultrasound and poly(ethylenimine) (PEI) have each separately been shown to increase DNA transfection efficiency. This study tested the hypothesis that the combination of ultrasound and PEI can have a synergistic effect to increase DNA transfection. This in vitro study assessed transfection efficiency of two different DNA plasmids encoding green fluorescent protein and firefly luciferase in two different cells types, a primary culture of human aortic smooth muscle cells and an immortal line of human prostrate cancer cells. We found that ultrasound sonication increased transfection up to 18-fold, DNA complexation with PEI increased transfection up to 90-fold, and the combination of ultrasound and PEI synergistically increased transfection up to 200-fold, which resulted in reporter gene expression by 34% of cells. Kinetic measurements found that the effects of ultrasound alone acted quickly, whereas increased transfection by PEI either alone or in combination with ultrasound strongly benefited from a 4-h incubation with the DNA plasmid after sonication. Although serum reduced absolute expression levels, it did not affect the relative increase in transfection when ultrasound was added to PEI enhancement. Flow cytometry measurements showed that sonication increased intracellular uptake of labelled DNA complexed to PEI by 55% relative to PEI complexation alone. Electrophoresis assay showed no damage to DNA or PEI-DNA complexes after sonication. Overall, these results suggest that the combination of ultrasound and PEI can have a synergistic effect to increase DNA transfection. PMID:17258835

The effect of growth phase and medium on the use of the firefly adenosine triphosphate (ATP) assay for the quantitation of bacteria

NASA Technical Reports Server (NTRS)

Bush, V. N.; Picciolo, G. L.; Chappelle, E. W.

1975-01-01

Luciferase assay for adenosine triphosphate (ATP) was used as a rapid method to determine the number of bacteria in a urine sample after nonbacterial components were removed. Accurate cellular ATP values, determined when bacteria were grown in an environment similar to that in which they were found, were necessary for the calculation of bacterial titer in urine. Cellular ATP values vary depending on the extraction method, the cell growth phase, and cell growth conditions. ATP per cell values of stationary E. coli grown in urine were two times greater than ATP per cell values of cells grown in trypticase soy broth. Glucose and urea were examined as possible components responsible for the cellular ATP variation.

Chemiluminescent activation of the antiviral activity of hypericin: a molecular flashlight.

PubMed Central

Carpenter, S; Fehr, M J; Kraus, G A; Petrich, J W

1994-01-01

Hypericin is a naturally occurring photosensitizer that displays potent antiviral activity in the presence of light. The absence of light in many regions of the body may preclude the use of hypericin and other photosensitizers as therapeutic compounds for the treatment of viral infections in vivo. The chemiluminescent oxidation of luciferin by the luciferase from the North American firefly Photinus pyralis was found to generate sufficiently intense and long-lived emission to induce antiviral activity of hypericin. Light-induced virucidal activity of hypericin was demonstrated against equine infectious anemia virus, a lentivirus structurally, genetically, and antigenically related to the human immunodeficiency virus. The implications for exploiting chemiluminescence as a "molecular flashlight" for effecting photodynamic therapy against virus-infected cells and tumor cells are discussed. PMID:7991618

Use of a Fluorometric Imaging Plate Reader in high-throughput screening

NASA Astrophysics Data System (ADS)

Groebe, Duncan R.; Gopalakrishnan, Sujatha; Hahn, Holly; Warrior, Usha; Traphagen, Linda; Burns, David J.

1999-04-01

High-throughput screening (HTS) efforts at Abbott Laboratories have been greatly facilitated by the use of a Fluorometric Imaging Plate Reader. The FLIPR consists of an incubated cabinet with integrated 96-channel pipettor and fluorometer. An argon laser is used to excite fluorophores in a 96-well microtiter plate and the emitted fluorometer. An argon laser is used to excite fluorophores in a 96-well microtiter plate and the emitted fluorescence is imaged by a cooled CCD camera. The image data is downloaded from the camera and processed to average the signal form each well of the microtiter pate for each time point. The data is presented in real time on the computer screen, facilitating interpretation and trouble-shooting. In addition to fluorescence, the camera can also detect luminescence form firefly luciferase.

Optimization and Validation of the TZM-bl Assay for Standardized Assessments of Neutralizing Antibodies Against HIV-1

PubMed Central

Sarzotti-Kelsoe, Marcella; Bailer, Robert T; Turk, Ellen; Lin, Chen-li; Bilska, Miroslawa; Greene, Kelli M.; Gao, Hongmei; Todd, Christopher A.; Ozaki, Daniel A.; Seaman, Michael S.; Mascola, John R.; Montefiori, David C.

2014-01-01

The TZM-bl assay measures antibody-mediated neutralization of HIV-1 as a function of reductions in HIV-1 Tat-regulated firefly luciferase (Luc) reporter gene expression after a single round of infection with Env-pseudotyped viruses. This assay has become the main endpoint neutralization assay used for the assessment of preclinical and clinical trial samples by a growing number of laboratories worldwide. Here we present the results of the formal optimization and validation of the TZM-bl assay, performed in compliance with Good Clinical Laboratory Practice (GCLP) guidelines. The assay was evaluated for specificity, accuracy, precision, limits of detection and quantitation, linearity, range and robustness. The validated manual TZM-bl assay was also adapted, optimized and qualified to an automated 384-well format. PMID:24291345

Controlling DNA compaction with cationic amphiphiles for efficient delivery systems A step forward towards non-viral Gene Therapy

NASA Astrophysics Data System (ADS)

Savarala, Sushma

The synthesis of pyridinium cationic lipids, their counter-ion exchange, and the transfection of lipoplexes consisting of these lipids with firefly luciferase plasmid DNA (6.7 KDa), into lung, prostate and breast cancer cell lines was investigated. The transfection ability of these newly synthesized compounds was found to be twice as high as DOTAP/cholesterol and Lipofectamine TM (two commercially available successful transfection agents). The compaction of the DNA onto silica (SiO2) nanoparticles was also investigated. For this purpose, it was necessary to study the stability and fusion studies of colloidal systems composed of DMPC (1,2-dimyristoyl-sn-glycero-3-phosphocholine), a zwitterionic lipid, and mixtures of DMPC with cationic DMTAP (1,2-dimyristoyl-3-trimethylammonium-propane).

Visualizing and quantifying protein secretion using a Renilla luciferase-GFP fusion protein.

PubMed

Liu, J; Wang, Y; Szalay, A A; Escher, A

2000-01-01

We have shown previously that an engineered form of Renilla luciferase (SRUC) can be secreted as a functional enzyme by mammalian cells, and that fusing wild-type Renilla luciferase with the green fluorescent protein from Aequorea victoria (GFP) yields a chimeric protein retaining light-emission properties similar to that of unfused Renilla luciferase and GFP. In the work presented here, SRUC was fused with GFP to determine whether it could be used to both visualize and quantify protein secretion in mammalian cells. Simian COS-7 and Chinese hamster ovary (CHO) cells were transiently transfected with gene constructs encoding a secreted or an intracellular version of a Renilla luciferase-GFP fusion protein. Renilla luciferase activity was measured from COS-7 cell lysates and culture media, and GFP activity was detected in CHO cells using fluorescence microscopy. Data indicated that the SRUC-GFP fusion protein was secreted as a chimeric protein that had both Renilla luciferase and GFP activity. This fusion protein could be a useful marker for the study of protein secretion in mammalian cells. Copyright 2000 John Wiley & Sons, Ltd.

Continuous bioluminescent monitoring of cytoplasmic ATP in single isolated rat hepatocytes during metabolic poisoning.

PubMed Central

Koop, A; Cobbold, P H

1993-01-01

We have devised a technique for monitoring cytoplasmic ATP continuously in single hepatocytes. Single isolated rat hepatocytes were injected with the ATP-dependent luminescent protein firefly luciferase, and then superfused with 45 microM luciferin in air-equilibrated medium. Signals of approx. 10-200 photoelectron counts per second could be recorded from individual healthy cells for up to 3 h. The response of the luminescent signal to chemical hypoxia (2-5 mM CN- and 5-10 mM 2-deoxyglucose) was monitored. We found a great cell-to-cell variability in the time course of the ATP decline in response to CN-, 2-deoxyglucose or to their combination; the time for the signal to fall to 10% of the original (corresponding to approx. 100 microM ATP) ranged from approx. 20 to 75 min. This resistance of the cytoplasmic ATP concentration to depletion after blockade of oxidative phosphorylation and glycolysis could be abolished by pretreatment of the cells with etomoxir, which blocks mitochondrial beta-oxidation. Etomoxir alone had no effect on the luciferase signal, but etomoxir-pre-treated cells showed a prompt fall in the luciferase signal starting within 1-2 min of application of cyanide and 2-deoxyglucose and falling to 10% of the original signal in approx. 6-10 min. The technique allows cytoplasmic ATP changes to be monitored in single hepatocytes at concentrations of 1 mM or lower, but more precise calibration of the signal will require correction for the effects of cytoplasmic pH changes. PMID:8216212

Firefly luciferase-based dynamic bioluminescence imaging: a noninvasive technique to assess tumor angiogenesis.

PubMed

Sun, Amy; Hou, Lewis; Prugpichailers, Tiffany; Dunkel, Jason; Kalani, Maziyar A; Chen, Xiaoyuan; Kalani, M Yashar S; Tse, Victor

2010-04-01

Bioluminescence imaging (BLI) is emerging as a cost-effective, high-throughput, noninvasive, and sensitive imaging modality to monitor cell growth and trafficking. We describe the use of dynamic BLI as a noninvasive method of assessing vessel permeability during brain tumor growth. With the use of stereotactic technique, 10 firefly luciferase-transfected GL26 mouse glioblastoma multiforme cells were injected into the brains of C57BL/6 mice (n = 80). After intraperitoneal injection of D-luciferin (150 mg/kg), serial dynamic BLI was performed at 1-minute intervals (30 seconds exposure) every 2 to 3 days until death of the animals. The maximum intensity was used as an indirect measurement of tumor growth. The adjusted slope of initial intensity (I90/Im) was used as a proxy to monitor the flow rate of blood into the vascular tree. Using a modified Evans blue perfusion protocol, we calculated the relative permeability of the vascular tree at various time points. Daily maximum intensity correlated strongly with tumor volume. At postinjection day 23, histology and BLI demonstrated an exponential growth of the tumor mass. Slopes were calculated to reflect the flow in the vessels feeding the tumor (adjusted slope = I90/Im). The increase in BLI intensity was correlated with a decrease in adjusted slope, reflecting a decrease in the rate of blood flow as tumor volume increased (y = 93.8e-0.49, R2 = 0.63). Examination of calculated slopes revealed a peak in permeability around postinjection day 20 (n = 42, P < .02 by 1-way analysis of variance) and showed a downward trend in relation to both postinjection day and maximum intensity observed; as angiogenesis progressed, tumor vessel caliber increased dramatically, resulting in sluggish but increased flow. This trend was correlated with Evans blue histology, revealing an increase in Evans blue dye uptake into the tumor, as slope calculated by BLI increases. Dynamic BLI is a practical, noninvasive technique that can semiquantitatively monitor changes in vascular permeability and therefore facilitate the study of tumor angiogenesis in animal models of disease.

Feedback inhibition by thiols outranks glutathione depletion: a luciferase-based screen reveals glutathione-deficient γ -ECS and glutathione synthetase mutants impaired in cadmium-induced sulfate assimilation

PubMed Central

Jobe, Timothy O.; Sung, Dong-Yul; Akmakjian, Garo; Pham, Allis; Komives, Elizabeth A.; Mendoza-Cózatl, David G.; Schroeder, Julian I.

2015-01-01

Summary Plants exposed to heavy metals rapidly induce changes in gene expression that activate and enhance detoxification mechanisms, including toxic-metal chelation and the scavenging of reactive oxygen species. However, the mechanisms mediating toxic heavy metal-induced gene expression remain largely unknown. To genetically elucidate cadmium-specific transcriptional responses in Arabidopsis, we designed a genetic screen based on the activation of a cadmium-inducible reporter gene. Microarray studies identified a high-affinity sulfate transporter (SULTR1;2) among the most robust and rapid cadmium-inducible transcripts. The SULTR1;2 promoter (2.2 kb) was fused with the firefly luciferase reporter gene to quantitatively report the transcriptional response of plants exposed to cadmium. Stably transformed luciferase reporter lines were ethyl methanesulfonate (EMS) mutagenized, and stable M2 seedlings were screened for an abnormal luciferase response during exposure to cadmium. The screen identified non-allelic mutant lines that fell into one of three categories: (i) super response to cadmium (SRC) mutants; (ii) constitutive response to cadmium (CRC) mutants; or (iii) non-response and reduced response to cadmium (NRC) mutants. Two nrc mutants, nrc1 and nrc2, were mapped, cloned and further characterized. The nrc1 mutation was mapped to the γ-glutamylcysteine synthetase gene and the nrc2 mutation was identified as the first viable recessive mutant allele in the glutathione synthetase gene. Moreover, genetic, HPLC mass spectrometry, and gene expression analysis of the nrc1 and nrc2 mutants, revealed that intracellular glutathione depletion alone would be insufficient to induce gene expression of sulfate uptake and assimilation mechanisms. Our results modify the glutathione-depletion driven model for sulfate assimilation gene induction during cadmium stress, and suggest that an enhanced oxidative state and depletion of upstream thiols, in addition to glutathione depletion, are necessary to induce the transcription of sulfate assimilation genes during early cadmium stress. PMID:22283708

ATPase inhibitor based luciferase assay for prolonged and enhanced ATP pool measurement as an efficient fish freshness indicator.

PubMed

Ranjan, Rajeev; Priyanka, B S; Thakur, M S

2014-07-01

The nucleotide degradation pathway in somatic cells leads to the accumulation of products such as hypoxanthine and inosine, which are commonly used as fish and meat freshness indicators. Assays based on these molecules cannot differentiate the postmortem time over a short period of time (5-10 h). Further, quantification of these degradation products is cumbersome, costly and time-consuming. For the proposed assay, optimal concentrations of 30 and 2 mM, respectively, for the ATPase inhibitors sodium orthovanadate and EDTA were found. Further, it was observed that a firefly luciferase based assay could enhance the sensitivity levels up to 165-fold at 30 °C. In addition, it was observed that the sensitivity for ATP assay was enhanced up to 60-fold even after 12 h. The limit of detection for the ATP assay was 1 pM, unlike other conventional methods, which are sensitive only up to micromolar levels. Moreover, as little as 0.044 g fish fillet was required for the assay, and no time-consuming sample preparation was necessary. Luminescence of prolonged duration was observed in harvested fish kept at -20 °C in comparison with fish kept at 4 and 30 °C, which reflects the shelf life of fish preserved at lower temperatures.

Development and modification of a recombinant cell bioassay to directly detect halogenated and polycyclic aromatic hydrocarbons in serum.

PubMed

Ziccardi, M H; Gardner, I A; Denison, M S

2000-03-01

Polycyclic and halogenated aromatic hydrocarbons (PAHs/HAHs) are a diverse group of widespread and persistent environmental contaminants that can cause a variety of detrimental effects in vertebrates. As most available methods to detect these contaminants are expensive, labor and time intensive, and require large amounts of tissue for extraction and analysis, several rapid mechanistically based bioassay systems have been developed to detect these chemicals. Here we describe application and optimization of a recently developed recombinant mouse cell bioassay system that responds to both PAHs and HAHs with the rapid induction of firefly luciferase for the detection of these chemicals in whole serum samples. This chemically activated luciferase expression (CALUX) bioassay has been modified to allow rapid (4-h) and direct analysis of small volumes (25-50 microl) of whole serum in a 96-well microtiter plate format without the need for solvent extraction. This bioassay can detect as little as 10 parts per trillion of the most potent HAH, 2,3,7,8-TCDD, and is also sensitive to other HAHs and PAHs. The use of simple procedures corrects for interplate and intraplate variability and the Ah receptor dependence of the induction response is accounted for by use of the antagonist 4-amino-3-methoxyflavone.

Core - shell upconversion nanoparticle - semiconductor heterostructures for photodynamic therapy

NASA Astrophysics Data System (ADS)

Dou, Qing Qing; Rengaramchandran, Adith; Selvan, Subramanian Tamil; Paulmurugan, Ramasamy; Zhang, Yong

2015-02-01

Core-shell nanoparticles (CSNPs) with diverse chemical compositions have been attracting greater attention in recent years. However, it has been a challenge to develop CSNPs with different crystal structures due to the lattice mismatch of the nanocrystals. Here we report a rational design of core-shell heterostructure consisting of NaYF4:Yb,Tm upconversion nanoparticle (UCN) as the core and ZnO semiconductor as the shell for potential application in photodynamic therapy (PDT). The core-shell architecture (confirmed by TEM and STEM) enables for improving the loading efficiency of photosensitizer (ZnO) as the semiconductor is directly coated on the UCN core. Importantly, UCN acts as a transducer to sensitize ZnO and trigger the generation of cytotoxic reactive oxygen species (ROS) to induce cancer cell death. We also present a firefly luciferase (FLuc) reporter gene based molecular biosensor (ARE-FLuc) to measure the antioxidant signaling response activated in cells during the release of ROS in response to the exposure of CSNPs under 980 nm NIR light. The breast cancer cells (MDA-MB-231 and 4T1) exposed to CSNPs showed significant release of ROS as measured by aminophenyl fluorescein (APF) and ARE-FLuc luciferase assays, and ~45% cancer cell death as measured by MTT assay, when illuminated with 980 nm NIR light.

Chemical stress sensitive luminescent human cells: Molecular biology approach using inducible Drosophila melanogaster hsp22 promoter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mandon, C.A.; Diaz, C.; Arrigo, A.-P.

2005-09-23

A whole-cell bioassay has been developed for the total toxicity testing of liquid samples. The method is based on the induction of the bioluminescent activity of genetically manipulated mammalian cells. For that purpose, transfection was used to introduce, in HeLa cells, a DNA sensing element that responds to chemical stress agents (heavy metals, genotoxic agents, and endocrine-disrupting chemicals). Such element was designed to direct the expression of a reporting gene (firefly luciferase) through the activation of Drosophila melanogaster hsp22 promoter. A molecular approach was conducted to optimize hsp22 promoter element in order to decrease the background expression level of themore » reporting gene and to increase the sensitivity of the bioassay for testing endocrine disruptors. As a result, in the presence of 20-100 {mu}M cadmium chloride, a 6-fold increase in luciferase expression was obtained using a specially designed truncated hsp22 promoter construction. The following chemicals known to be found in the polluted samples were tested: CdCl{sub 2}, Cd(NO{sub 3}){sub 2}, NaAsO{sub 2}, alachlore, fentine acetate, thiram, and maneb. The stressing effect of each of them was sensitively detected by the present bioassay in the 0.05-50 {mu}M concentration range.« less

In vivo bioluminescence imaging reveals copper deficiency in a murine model of nonalcoholic fatty liver disease

PubMed Central

Heffern, Marie C.; Park, Hyo Min; Au-Yeung, Ho Yu; Van de Bittner, Genevieve C.; Ackerman, Cheri M.; Stahl, Andreas; Chang, Christopher J.

2016-01-01

Copper is a required metal nutrient for life, but global or local alterations in its homeostasis are linked to diseases spanning genetic and metabolic disorders to cancer and neurodegeneration. Technologies that enable longitudinal in vivo monitoring of dynamic copper pools can help meet the need to study the complex interplay between copper status, health, and disease in the same living organism over time. Here, we present the synthesis, characterization, and in vivo imaging applications of Copper-Caged Luciferin-1 (CCL-1), a bioluminescent reporter for tissue-specific copper visualization in living animals. CCL-1 uses a selective copper(I)-dependent oxidative cleavage reaction to release d-luciferin for subsequent bioluminescent reaction with firefly luciferase. The probe can detect physiological changes in labile Cu+ levels in live cells and mice under situations of copper deficiency or overload. Application of CCL-1 to mice with liver-specific luciferase expression in a diet-induced model of nonalcoholic fatty liver disease reveals onset of hepatic copper deficiency and altered expression levels of central copper trafficking proteins that accompany symptoms of glucose intolerance and weight gain. The data connect copper dysregulation to metabolic liver disease and provide a starting point for expanding the toolbox of reactivity-based chemical reporters for cell- and tissue-specific in vivo imaging. PMID:27911810

In vivo regulation of the beta-myosin heavy chain gene in soleus muscle of suspended and weight-bearing rats

NASA Technical Reports Server (NTRS)

Giger, J. M.; Haddad, F.; Qin, A. X.; Baldwin, K. M.

2000-01-01

In the weight-bearing hindlimb soleus muscle of the rat, approximately 90% of muscle fibers express the beta-myosin heavy chain (beta-MHC) isoform protein. Hindlimb suspension (HS) causes the MHC isoform population to shift from beta toward the fast MHC isoforms. Our aim was to establish a model to test the hypothesis that this shift in expression is transcriptionally regulated through specific cis elements of the beta-MHC promoter. With the use of a direct gene transfer approach, we determined the activity of different length beta-MHC promoter fragments, linked to a firefly luciferase reporter gene, in soleus muscle of control and HS rats. In weight-bearing rats, the relative luciferase activity of the longest beta-promoter fragment (-3500 bp) was threefold higher than the shorter promoter constructs, which suggests that an enhancer sequence is present in the upstream promoter region. After 1 wk of HS, the reporter activities of the -3500-, -914-, and -408-bp promoter constructs were significantly reduced ( approximately 40%), compared with the control muscles. However, using the -215-bp construct, no differences in promoter activity were observed between HS and control muscles, which indicates that the response to HS in the rodent appears to be regulated within the -408 and -215 bp of the promoter.

A multi-group firefly algorithm for numerical optimization

NASA Astrophysics Data System (ADS)

Tong, Nan; Fu, Qiang; Zhong, Caiming; Wang, Pengjun

2017-08-01

To solve the problem of premature convergence of firefly algorithm (FA), this paper analyzes the evolution mechanism of the algorithm, and proposes an improved Firefly algorithm based on modified evolution model and multi-group learning mechanism (IMGFA). A Firefly colony is divided into several subgroups with different model parameters. Within each subgroup, the optimal firefly is responsible for leading the others fireflies to implement the early global evolution, and establish the information mutual system among the fireflies. And then, each firefly achieves local search by following the brighter firefly in its neighbors. At the same time, learning mechanism among the best fireflies in various subgroups to exchange information can help the population to obtain global optimization goals more effectively. Experimental results verify the effectiveness of the proposed algorithm.

Developmental and Wound-, Cold-, Desiccation-, Ultraviolet-B-Stress-Induced Modulations in the Expression of the Petunia Zinc Finger Transcription Factor Gene ZPT2-21

PubMed Central

van der Krol, Alexander R.; van Poecke, Remco M.P.; Vorst, Oscar F.J.; Voogt, Charlotte; van Leeuwen, Wessel; Borst-Vrensen, Tanja W.M.; Takatsuji, Hiroshi; van der Plas, Linus H.W.

1999-01-01

The ZPT2-2 gene belongs to the EPF gene family in petunia (Petunia hybrida), which encodes proteins with TFIIIA-type zinc-finger DNA-binding motifs. To elucidate a possible function for ZPT2-2, we analyzed its pattern of expression in relation to different developmental and physiological stress signals. The activity of the ZPT2-2 promoter was analyzed using a firefly luciferase (LUC) reporter gene, allowing for continuous measurements of transgene activity in planta. We show that ZPT2-2::LUC is active in all plant tissues, but is strongly modulated in cotyledons upon germination, in leaves in response to desiccation, cold treatment, wounding, or ultraviolet-B light, and in petal tissue in response to pollination of the stigma. Analysis of mRNA levels indicated that the modulations in ZPT2-2::LUC expression reflect modulations in endogenous ZPT2-2 gene expression. The change in ZPT2-2::LUC activity by cold treatment, wounding, desiccation, and ultraviolet-B light suggest that the phytohormones ethylene and jasmonic acid are involved in regulating the expression of ZPT2-2. Although up-regulation of expression of ZPT2-2 can be blocked by inhibitors of ethylene perception, expression in plants is not induced by exogenously applied ethylene. The application of jasmonic acid does result in an up-regulation of gene activity and, thus, ZPT2-2 may play a role in the realization of the jasmonic acid hormonal responses in petunia. PMID:10594102

The smallest natural high-active luciferase: cloning and characterization of novel 16.5-kDa luciferase from copepod Metridia longa.

PubMed

Markova, Svetlana V; Larionova, Marina D; Burakova, Ludmila P; Vysotski, Eugene S

2015-01-30

Coelenterazine-dependent copepod luciferases containing natural signal peptide for secretion are a very convenient analytical tool as they enable monitoring of intracellular events with high sensitivity, without destroying cells or tissues. This property is well suited for application in biomedical research and development of cell-based assays for high throughput screening. We report the cloning of cDNA gene encoding a novel secreted non-allelic 16.5-kDa isoform (MLuc7) of Metridia longa luciferase, which, in fact, is the smallest natural luciferase of known for today. Despite the small size, isoform contains 10 conservative Cys residues suggesting the presence of up to 5 SS bonds. This hampers the efficient production of functionally active recombinant luciferase in bacterial expression systems. With the use of the baculovirus expression system, we produced substantial amounts of the proper folded MLuc7 luciferase with a yield of ∼3 mg/L of a high purity protein. We demonstrate that MLuc7 produced in insect cells is highly active and extremely thermostable, and is well suited as a secreted reporter when expressed in mammalian cells ensuring higher sensitivity of detection as compared to another Metridia luciferase isoform (MLuc164) which is widely employed in real-time imaging. Copyright © 2014 Elsevier Inc. All rights reserved.

Optimisation of intradermal DNA electrotransfer for immunisation.

PubMed

Vandermeulen, Gaëlle; Staes, Edith; Vanderhaeghen, Marie Lise; Bureau, Michel Francis; Scherman, Daniel; Préat, Véronique

2007-12-04

The development of DNA vaccines requires appropriate delivery technologies. Electrotransfer is one of the most efficient methods of non-viral gene transfer. In the present study, intradermal DNA electrotransfer was first optimised. Strong effects of the injection method and the dose of DNA on luciferase expression were demonstrated. Pre-treatments were evaluated to enhance DNA diffusion in the skin but neither hyaluronidase injection nor iontophoresis improved efficiency of intradermal DNA electrotransfer. Then, DNA immunisation with a weakly immunogenic model antigen, luciferase, was investigated. After intradermal injection of the plasmid encoding luciferase, electrotransfer (HV 700 V/cm 100 micros, LV 200 V/cm 400 ms) was required to induce immune response. The response was Th1-shifted compared to immunisation with the luciferase recombinant protein. Finally, DNA electrotransfer in the skin, the muscle or the ear pinna was compared. Muscle DNA electrotransfer resulted in the highest luciferase expression and the best IgG response. Nevertheless electrotransfer into the skin, the muscle and the ear pinna all resulted in IFN-gamma secretion by luciferase-stimulated splenocytes suggesting that an efficient Th1 response was induced in all case.

Multimodality Molecular Imaging of Cardiac Cell Transplantation: Part I. Reporter Gene Design, Characterization, and Optical in Vivo Imaging of Bone Marrow Stromal Cells after Myocardial Infarction

PubMed Central

Parashurama, Natesh; Ahn, Byeong-Cheol; Ziv, Keren; Ito, Ken; Paulmurugan, Ramasamy; Willmann, Jürgen K.; Chung, Jaehoon; Ikeno, Fumiaki; Swanson, Julia C.; Merk, Denis R.; Lyons, Jennifer K.; Yerushalmi, David; Teramoto, Tomohiko; Kosuge, Hisanori; Dao, Catherine N.; Ray, Pritha; Patel, Manishkumar; Chang, Ya-fang; Mahmoudi, Morteza; Cohen, Jeff Eric; Goldstone, Andrew Brooks; Habte, Frezghi; Bhaumik, Srabani; Yaghoubi, Shahriar; Robbins, Robert C.; Dash, Rajesh; Yang, Phillip C.; Brinton, Todd J.; Yock, Paul G.; McConnell, Michael V.

2016-01-01

Purpose To use multimodality reporter-gene imaging to assess the serial survival of marrow stromal cells (MSC) after therapy for myocardial infarction (MI) and to determine if the requisite preclinical imaging end point was met prior to a follow-up large-animal MSC imaging study. Materials and Methods Animal studies were approved by the Institutional Administrative Panel on Laboratory Animal Care. Mice (n = 19) that had experienced MI were injected with bone marrow–derived MSC that expressed a multimodality triple fusion (TF) reporter gene. The TF reporter gene (fluc2-egfp-sr39ttk) consisted of a human promoter, ubiquitin, driving firefly luciferase 2 (fluc2), enhanced green fluorescent protein (egfp), and the sr39tk positron emission tomography reporter gene. Serial bioluminescence imaging of MSC-TF and ex vivo luciferase assays were performed. Correlations were analyzed with the Pearson product-moment correlation, and serial imaging results were analyzed with a mixed-effects regression model. Results Analysis of the MSC-TF after cardiac cell therapy showed significantly lower signal on days 8 and 14 than on day 2 (P = .011 and P = .001, respectively). MSC-TF with MI demonstrated significantly higher signal than MSC-TF without MI at days 4, 8, and 14 (P = .016). Ex vivo luciferase activity assay confirmed the presence of MSC-TF on days 8 and 14 after MI. Conclusion Multimodality reporter-gene imaging was successfully used to assess serial MSC survival after therapy for MI, and it was determined that the requisite preclinical imaging end point, 14 days of MSC survival, was met prior to a follow-up large-animal MSC study. © RSNA, 2016 Online supplemental material is available for this article. PMID:27308957

The silencing suppressor (NSs) protein of the plant virus Tomato spotted wilt virus enhances heterologous protein expression and baculovirus pathogenicity in cells and lepidopteran insects.

PubMed

de Oliveira, Virgínia Carla; da Silva Morgado, Fabricio; Ardisson-Araújo, Daniel Mendes Pereira; Resende, Renato Oliveira; Ribeiro, Bergmann Morais

2015-11-01

In this work, we showed that cell death induced by a recombinant (vAcNSs) Autographa californica multiple nucleopolyhedrovirus (AcMNPV) expressing the silencing suppressor (NSs) protein of Tomato spotted wilt virus (TSWV) was enhanced on permissive and semipermissive cell lines. The expression of a heterologous gene (firefly luciferase) during co-infection of insect cells with vAcNSs and a second recombinant baculovirus (vAgppolhfluc) was shown to increase when compared to single vAgppolhfluc infections. Furthermore, the vAcNSs mean time-to-death values were significantly lower than those for wild-type AcMNPV on larvae of Spodoptera frugiperda and Anticarsia gemmatalis. These results showed that the TSWV-NSs protein could efficiently increase heterologous protein expression in insect cells as well as baculovirus pathogenicity and virulence, probably by suppressing the gene-silencing machinery in insects.

Development of a chemiluminescent and bioluminescent system for the detection of bacteria in wastewater effluent

NASA Technical Reports Server (NTRS)

Thomas, R. R.

1975-01-01

Automated chemiluminescent and bioluminescent sensors were developed for continuous monitoring of microbial levels in wastewater effluent. Development of the chemiluminescent system included optimization of reagent concentrations as well as two new techniques which will allow for increased sensitivity and specificity. The optimal reagent concentrations are 0.0025 M luminol and 0.0125 M sodium perborate in 0.75N sodium hydroxide before addition of sample. The methods developed to increase specificity include (1) extraction of porphyrins from bacteria collected in a filter using 0.1N NaOH - 50 percent Ethanol, and (2) use of the specific reaction rate characteristics for the different luminol catalysts. Since reaction times are different for each catalyst, the reaction can be made specific for bacteria by measuring only the light emission from the particular reaction time zone specific for bacteria. Developments of the bioluminescent firefly luciferase system were in the area of flow system design.

A DNA-scaffold platform enhances a multi-enzymatic cycling reaction.

PubMed

Mashimo, Yasumasa; Mie, Masayasu; Kobatake, Eiry

2018-04-01

We explored the co-localization of multiple enzymes on a DNA backbone via a DNA-binding protein, Gene-A* (A*-tag) to increase the efficiency of cascade enzymatic reactions. Firefly luciferase (FLuc) and pyruvate orthophosphate dikinase (PPDK) were genetically fused with A*-tag and modified with single-stranded (ss) DNA via A*-tag. The components were assembled on ssDNA by hybridization, thereby enhancing the efficiency of the cascading bioluminescent reaction producing light emission from pyrophosphate. The activity of A*-tag in each enzyme was investigated with dye-labeled DNA. Co-localization of the enzymes via hybridization was examined using a gel shift assay. The multi-enzyme complex showed significant improvement in the overall efficiency of the cascading reaction in comparison to a mixture of free enzymes. A*-tag is highly convenient for ssDNA modification of versatile enzymes, and it can be used for construction of functional DNA-enzyme complexes.

Optogenetic control of ATP release

NASA Astrophysics Data System (ADS)

Lewis, Matthew A.; Joshi, Bipin; Gu, Ling; Feranchak, Andrew; Mohanty, Samarendra K.

2013-03-01

Controlled release of ATP can be used for understanding extracellular purinergic signaling. While coarse mechanical forces and hypotonic stimulation have been utilized in the past to initiate ATP release from cells, these methods are neither spatially accurate nor temporally precise. Further, these methods cannot be utilized in a highly effective cell-specific manner. To mitigate the uncertainties regarding cellular-specificity and spatio-temporal release of ATP, we herein demonstrate use of optogenetics for ATP release. ATP release in response to optogenetic stimulation was monitored by Luciferin-Luciferase assay (North American firefly, photinus pyralis) using luminometer as well as mesoscopic bioluminescence imaging. Our result demonstrates repetitive release of ATP subsequent to optogenetic stimulation. It is thus feasible that purinergic signaling can be directly detected via imaging if the stimulus can be confined to single cell or in a spatially-defined group of cells. This study opens up new avenue to interrogate the mechanisms of purinergic signaling.

Enhancing the response of CALUX and CAFLUX cell bioassays for quantitative detection of dioxin-like compounds

PubMed Central

ZHAO, Bin; BASTON, David S.; KHAN, Elaine; SORRENTINO, Claudio; DENISON, Michael S.

2011-01-01

Reporter genes produce a protein product in transfected cells that can be easily measured in intact or lysed cells and they have been extensively used in numerous basic and applied research applications. Over the past 10 years, reporter gene assays have been widely accepted and used for analysis of 2,3,7,8-tetrachlorodibenzo-p-dioxin and related dioxin-like compounds in various types of matrices, such as biological, environmental, food and feed samples, given that high-resolution instrumental analysis techniques are impractical for large-scale screening analysis. The most sensitive cell-based reporter gene bioassay systems developed are the mechanism-based CALUX (Chemically Activated Luciferase Expression) and CAFLUX (Chemically Activated Fluorescent Expression) bioassays, which utilize recombinant cell lines containing stably transfected dioxin (AhR)-responsive firefly luciferase or enhanced green fluorescent protein (EGFP) reporter genes, respectively. While the current CALUX and CAFLUX bioassays are very sensitive, increasing their lower limit of sensitivity, magnitude of response and dynamic range for chemical detection would significantly increase their utility, particularly for those samples that contain low levels of dioxin-like HAHs (i.e., serum). In this study, we report that the addition of modulators of cell signaling pathways or modification of cell culture conditions results in significant improvement in the magnitude and overall responsiveness of the existing CALUX and CAFLUX cell bioassays. PMID:21394221

Human Adipose Tissue Stem Cells Promote the Growth of Acute Lymphoblastic Leukemia Cells in NOD/SCID Mice.

PubMed

Lee, Myoung Woo; Park, Yoo Jin; Kim, Dae Seong; Park, Hyun Jin; Jung, Hye Lim; Lee, Ji Won; Sung, Ki Woong; Koo, Hong Hoe; Yoo, Keon Hee

2018-06-01

In this study, the effect of adipose tissue stem cells (ASCs) on the growth of acute lymphoblastic leukemia (ALL) cells was examined in an in vivo model. We established ALL cell lines expressing firefly luciferase (ALL/fLuc) by lentiviral infection that were injected intraperitoneally to NOD/SCID mice. The luciferase activities were significantly higher in mice co-injected with 10 5 ALL/fLuc cells and ASCs than in those injected with ALL/fLuc cells alone. Co-injection of 10 5 ALL/fLuc cells and ASCs in differing ratios into mice gradually increased the bioluminescence intensity in all groups, and mice co-injected with 1 or 2 × 10 6 ASCs showed higher bioluminescence intensity than those receiving lower numbers. Interestingly, in the mice injected with 10 5 or 10 7 ALL/fLuc cells alone, the formation of tumor masses was not observed for at least five weeks. Moreover, co-injection of 10 7 ALL/fLuc cells and 5 × 10 5 ASCs into mice increased the bioluminescence intensity in all groups, and showed significantly higher bioluminescence intensity compared to mice co-injected with human normal fibroblast HS68 cells. Overall, ASCs promote the growth of ALL cells in vivo, suggesting that ASCs negatively influence hematologic malignancy, which should be considered in developing cell therapy using ASCs.

A Screenable In Vivo Assay for Mitochondrial Modulators Using Transgenic Bioluminescent Caenorhabditis elegans.

PubMed

Lagido, Cristina; McLaggan, Debbie; Glover, L Anne

2015-10-16

The multicellular model organism Caenorhabditis elegans is a small nematode of approximately 1 mm in size in adulthood that is genetically and experimentally tractable. It is economical and easy to culture and dispense in liquid medium which makes it well suited for medium-throughput screening. We have previously validated the use of transgenic luciferase expressing C. elegans strains to provide rapid in vivo assessment of the nematode's ATP levels.(1-3) Here we present the required materials and procedure to carry out bioassays with the bioluminescent C. elegans strains PE254 or PE255 (or any of their derivative strains). The protocol allows for in vivo detection of sublethal effects of drugs that may identify mitochondrial toxicity, as well as for in vivo detection of potential beneficial drug effects. Representative results are provided for the chemicals paraquat, rotenone, oxaloacetate and for four firefly luciferase inhibitory compounds. The methodology can be scaled up to provide a platform for screening drug libraries for compounds capable of modulating mitochondrial function. Pre-clinical evaluation of drug toxicity is often carried out on immortalized cancerous human cell lines which derive ATP mostly from glycolysis and are often tolerant of mitochondrial toxicants.(4,5) In contrast, C. elegans depends on oxidative phosphorylation to sustain development into adulthood, drawing a parallel with humans and providing a unique opportunity for compound evaluation in the physiological context of a whole live multicellular organism.

Quantitative analysis of poliomyelitis-like paralysis in mice induced by a poliovirus replicon.

PubMed

Arita, Minetaro; Nagata, Noriyo; Sata, Tetsutaro; Miyamura, Tatsuo; Shimizu, Hiroyuki

2006-11-01

Poliovirus (PV) infection causes severe paralysis, typically of the legs, by destruction of the motor neurons in the spinal cord. In this study, the relationship between PV replication in the spinal cord, damage in the motor neurons and poliomyelitis-like paralysis was analysed in transgenic mice expressing the human PV receptor (TgPVR21). First, a PV replicon encoding firefly luciferase in place of the capsid genes (PV-Fluc mc) was trans-encapsidated in 293T cells and the trans-encapsidated PV-Fluc mc (TE-PV-Fluc mc) was then inoculated into the spinal cords of TgPVR21 mice. TE-PV-Fluc mc was recovered with a titre of 6.3 x 10(7) infectious units ml(-1), which was comparable to those of PV1 strains. TgPVR21 mice inoculated with TE-PV-Fluc mc showed non-lethal paralysis of the hindlimbs, with severity ranging from a decline in grip strength to complete flaccid paralysis. The replication of TE-PV-Fluc mc in the spinal cord reached peak levels at 10 h post-inoculation (p.i.), followed by the appearance of paralysis at as early as 12 h p.i., reaching a plateau at 16 h p.i. Histological analysis showed a correlation between the lesion and the severity of the clinical symptoms in most mice. However, severe paralysis could also be observed with an apparently low lesion score, where as few as 5.3 x 10(2) motor neurons (1.4 % of the susceptible cells in the lumbar cord) were infected by TE-PV-Fluc mc. These results indicate that PV replication in a small population of the motor neurons was critical for severe residual poliomyelitis-like paralysis in TgPVR21 mice.

Feedback inhibition by thiols outranks glutathione depletion: a luciferase-based screen reveals glutathione-deficient γ-ECS and glutathione synthetase mutants impaired in cadmium-induced sulfate assimilation.

PubMed

Jobe, Timothy O; Sung, Dong-Yul; Akmakjian, Garo; Pham, Allis; Komives, Elizabeth A; Mendoza-Cózatl, David G; Schroeder, Julian I

2012-06-01

Plants exposed to heavy metals rapidly induce changes in gene expression that activate and enhance detoxification mechanisms, including toxic-metal chelation and the scavenging of reactive oxygen species. However, the mechanisms mediating toxic heavy metal-induced gene expression remain largely unknown. To genetically elucidate cadmium-specific transcriptional responses in Arabidopsis, we designed a genetic screen based on the activation of a cadmium-inducible reporter gene. Microarray studies identified a high-affinity sulfate transporter (SULTR1;2) among the most robust and rapid cadmium-inducible transcripts. The SULTR1;2 promoter (2.2 kb) was fused with the firefly luciferase reporter gene to quantitatively report the transcriptional response of plants exposed to cadmium. Stably transformed luciferase reporter lines were ethyl methanesulfonate (EMS) mutagenized, and stable M(2) seedlings were screened for an abnormal luciferase response during exposure to cadmium. The screen identified non-allelic mutant lines that fell into one of three categories: (i) super response to cadmium (SRC) mutants; (ii) constitutive response to cadmium (CRC) mutants; or (iii) non-response and reduced response to cadmium (NRC) mutants. Two nrc mutants, nrc1 and nrc2, were mapped, cloned and further characterized. The nrc1 mutation was mapped to the γ-glutamylcysteine synthetase gene and the nrc2 mutation was identified as the first viable recessive mutant allele in the glutathione synthetase gene. Moreover, genetic, HPLC mass spectrometry, and gene expression analysis of the nrc1 and nrc2 mutants, revealed that intracellular glutathione depletion alone would be insufficient to induce gene expression of sulfate uptake and assimilation mechanisms. Our results modify the glutathione-depletion driven model for sulfate assimilation gene induction during cadmium stress, and suggest that an enhanced oxidative state and depletion of upstream thiols, in addition to glutathione depletion, are necessary to induce the transcription of sulfate assimilation genes during early cadmium stress. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

The cAMP-dependent protein kinase inhibitor H-89 attenuates the bioluminescence signal produced by Renilla Luciferase.

PubMed

Herbst, Katie J; Allen, Michael D; Zhang, Jin

2009-05-21

Investigations into the regulation and functional roles of kinases such as cAMP-dependent protein kinase (PKA) increasingly rely on cellular assays. Currently, there are a number of bioluminescence-based assays, for example reporter gene assays, that allow the study of the regulation, activity, and functional effects of PKA in the cellular context. Additionally there are continuing efforts to engineer improved biosensors that are capable of detecting real-time PKA signaling dynamics in cells. These cell-based assays are often utilized to test the involvement of PKA-dependent processes by using H-89, a reversible competitive inhibitor of PKA. We present here data to show that H-89, in addition to being a competitive PKA inhibitor, attenuates the bioluminescence signal produced by Renilla luciferase (RLuc) variants in a population of cells and also in single cells. Using 10 microM of luciferase substrate and 10 microM H-89, we observed that the signal from RLuc and RLuc8, an eight-point mutation variant of RLuc, in cells was reduced to 50% (+/-15%) and 54% (+/-14%) of controls exposed to the vehicle alone, respectively. In vitro, we showed that H-89 decreased the RLuc8 bioluminescence signal but did not compete with coelenterazine-h for the RLuc8 active site, and also did not affect the activity of Firefly luciferase. By contrast, another competitive inhibitor of PKA, KT5720, did not affect the activity of RLuc8. The identification and characterization of the adverse effect of H-89 on RLuc signal will help deconvolute data previously generated from RLuc-based assays looking at the functional effects of PKA signaling. In addition, for the current application and future development of bioluminscence assays, KT5720 is identified as a more suitable PKA inhibitor to be used in conjunction with RLuc-based assays. These principal findings also provide an important lesson to fully consider all of the potential effects of experimental conditions on a cell-based assay readout before drawing conclusions from the data.

Coelenterazine-binding protein of Renilla muelleri: cDNA cloning, overexpression, and characterization as a substrate of luciferase.

PubMed

Titushin, Maxim S; Markova, Svetlana V; Frank, Ludmila A; Malikova, Natalia P; Stepanyuk, Galina A; Lee, John; Vysotski, Eugene S

2008-02-01

The Renilla bioluminescent system in vivo is comprised of three proteins--the luciferase, green-fluorescent protein, and coelenterazine-binding protein (CBP), previously called luciferin-binding protein (LBP). This work reports the cloning of the full-size cDNA encoding CBP from soft coral Renilla muelleri, its overexpression and properties of the recombinant protein. The apo-CBP was quantitatively converted to CBP by simple incubation with coelenterazine. The physicochemical properties of this recombinant CBP are determined to be practically the same as those reported for the CBP (LBP) of R. reniformis. CBP is a member of the four-EF-hand Ca(2+)-binding superfamily of proteins with only three of the EF-hand loops having the Ca(2+)-binding consensus sequences. There is weak sequence homology with the Ca(2+)-regulated photoproteins but only as a result of the necessary Ca(2+)-binding loop structure. In combination with Renilla luciferase, addition of only one Ca(2+) is sufficient to release the coelenterazine as a substrate for the luciferase for bioluminescence. This combination of the two proteins generates bioluminescence with higher reaction efficiency than using free coelenterazine alone as the substrate for luciferase. This increased quantum yield, a difference of bioluminescence spectra, and markedly different kinetics, implicate that a CBP-luciferase complex might be involved.

Development and evaluation of yeast-based GFP and luciferase reporter assays for chemical-induced genotoxicity and oxidative damage.

PubMed

Suzuki, Hajime; Sakabe, Takahiro; Hirose, Yuu; Eki, Toshihiko

2017-01-01

We aimed to develop the bioassays for genotixicity and/or oxidative damage using the recombinant yeast. A genotoxicity assay was developed using recombinant Saccharomyces cerevisiae strain BY4741 with a green fluorescent protein (GFP) reporter plasmid, driven by the DNA damage-responsive RNR3 promoter. Enhanced fluorescence induction was observed in DNA repair-deficient strains treated with methyl methanesulfonate, but not with hydrogen peroxide. A GFP reporter yeast strain driven by the oxidative stress-responsive TRX2 promoter was newly developed to assess oxidative damage, but fluorescence was poorly induced by oxidants. In place of GFP, yeast strains with luciferase gene reporter plasmids (luc2 and luc2CP, encoding stable and unstable luciferase, respectively) were prepared. Transient induction of luciferase activity was clearly detected only in a TRX2 promoter-driven luc2CP reporter strain within 90 min of oxidant exposure. However, luciferase was strongly induced by hydroxyurea in the RNR3 promoter-driven luc2 and GFP reporter strains over 8 h after the exposure, suggesting that the RNR3 promoter is continuously upregulated by DNA damage, whereas the TRX2 promoter is transiently activated by oxidative agents. Luciferase activity levels were also increased in a TRX2-promoter-driven luc2CP reporter strain treated with tert-butyl hydroperoxide and menadione and weakly induced with diamide and diethyl maleate. Weakly enhanced luciferase activity induction was detected in the sod1Δ, sod2Δ, and rad27Δ strains treated with hydrogen peroxide compared with that in the wild-type strain. In conclusion, tests using GFP and stable luciferase reporters are useful for genotoxicity, and oxidative damage can be clearly detected by assay with an unstable luciferase reporter.

Firefly algorithm with chaos

NASA Astrophysics Data System (ADS)

Gandomi, A. H.; Yang, X.-S.; Talatahari, S.; Alavi, A. H.

2013-01-01

A recently developed metaheuristic optimization algorithm, firefly algorithm (FA), mimics the social behavior of fireflies based on the flashing and attraction characteristics of fireflies. In the present study, we will introduce chaos into FA so as to increase its global search mobility for robust global optimization. Detailed studies are carried out on benchmark problems with different chaotic maps. Here, 12 different chaotic maps are utilized to tune the attractive movement of the fireflies in the algorithm. The results show that some chaotic FAs can clearly outperform the standard FA.

One-pot non-enzymatic formation of firefly luciferin in a neutral buffer from p-benzoquinone and cysteine

PubMed Central

Kanie, Shusei; Nishikawa, Toshio; Ojika, Makoto; Oba, Yuichi

2016-01-01

Firefly luciferin, the substrate for the bioluminescence reaction of luminous beetles, possesses a benzothiazole ring, which is rare in nature. Here, we demonstrate a novel one-pot reaction to give firefly luciferin in a neutral buffer from p-benzoquinone and cysteine without any synthetic reagents or enzymes. The formation of firefly luciferin was low in yield in various neutral buffers, whereas it was inhibited or completely prevented in acidic or basic buffers, in organic solvents, or under a nitrogen atmosphere. Labelling analysis of the firefly luciferin using stable isotopic cysteines showed that the benzothiazole ring was formed via the decarboxylation and carbon-sulfur bond rearrangement of cysteine. These findings imply that the biosynthesis of firefly luciferin can be developed/evolved from the non-enzymatic production of firefly luciferin using common primary biosynthetic units, p-benzoquinone and cysteine. PMID:27098929

One-pot non-enzymatic formation of firefly luciferin in a neutral buffer from p-benzoquinone and cysteine.

PubMed

Kanie, Shusei; Nishikawa, Toshio; Ojika, Makoto; Oba, Yuichi

2016-04-21

Firefly luciferin, the substrate for the bioluminescence reaction of luminous beetles, possesses a benzothiazole ring, which is rare in nature. Here, we demonstrate a novel one-pot reaction to give firefly luciferin in a neutral buffer from p-benzoquinone and cysteine without any synthetic reagents or enzymes. The formation of firefly luciferin was low in yield in various neutral buffers, whereas it was inhibited or completely prevented in acidic or basic buffers, in organic solvents, or under a nitrogen atmosphere. Labelling analysis of the firefly luciferin using stable isotopic cysteines showed that the benzothiazole ring was formed via the decarboxylation and carbon-sulfur bond rearrangement of cysteine. These findings imply that the biosynthesis of firefly luciferin can be developed/evolved from the non-enzymatic production of firefly luciferin using common primary biosynthetic units, p-benzoquinone and cysteine.

Assessment of environmental factors that affect the fireflies for ecotourism in Unesco Tasik Chini biosphere reserve

NASA Astrophysics Data System (ADS)

Roslan, Norzeana; Sulaiman, Norela

2015-09-01

This study was conducted to study the firefly species found in Tasik Chini, the soil factors that suitable for larval development fireflies flashes, and the sociological aspects of the community's availability to engage in firefly ecotourism. This was achieved through firefly sampling, soil analysis, abiotic data collection and by questionnaire surveys from local community perceptions and knowledge on fireflies and ecotourism. Fireflies sampling were conducted from December 2011 to January 2013 at Kampung Melai and Kampung Cenahan. Three non-synchronize fireflies genus were found, namely Colophotia sp., Pygoluciola sp., and Pyrocoelia sp. A total of 25 questionnaires were given to four groups of respondents consisting orang asli (5 respondents), boat operator (2 respondents), resort workers (5 respondents) and FELDA residents (13 respondents). The questionnaires were analysed using Rasch Winstep Software based on Rasch Measurement Model. Results of the survey indicated that the local community was not ready for ecotourism in their area. Meanwhile, the soil pH was very acidic and the heavy metals concentration was high, which is not good for the development of firefly larvae. In conclusion, Tasik Chini was not having the potential for ecotourism. Despite the fact, improvement of soils with soil remediation methods can be apply for enhancing larvae development and having more awareness campaign of ecotourism to local community.

Optimization of Enzyme-Substrate Pairing for Bioluminescence Imaging of Gene Transfer Using Renilla and Gaussia Luciferases

PubMed Central

Kimura, Takahiro; Hiraoka, Kei; Kasahara, Noriyuki; Logg, Christopher R.

2010-01-01

Background Bioluminescence imaging (BLI) permits the noninvasive quantitation and localization of transduction and expression by gene transfer vectors. The tendency of tissue to attenuate light in the optical region, however, limits the sensitivity of BLI. Improvements in light output from bioluminescent reporter systems would allow the detection of lower levels of expression, smaller numbers of cells and expression from deeper and more attenuating tissues within an animal. Methods With the goal of identifying substrates that allow improved sensitivity with Renilla luciferase (RLuc) and Gaussia luciferase (GLuc) reporter genes, we evaluated native coelenterazine and three of its most promising derivatives in BLI of cultured cells transduced with retroviral vectors encoding these reporters. Of the eight enzyme-substrate pairs tested, the two that performed best were further evaluated in mice to compare their effectiveness for imaging vector-modified cells in live animals. Results In cell culture, we observed striking differences in luminescence levels from the various enzyme-substrate combinations and found that the two luciferases exhibited markedly distinct abilities to generate light with the substrates. The most effective pairs were RLuc with the synthetic coelenterazine derivative ViviRen, and GLuc with native coelenterazine. In animals, these two pairs allowed similar detection sensitivities, which were 8–15 times higher than that of the prototypical RLuc-native coelenterazine combination. Conclusions Our results demonstrate that substrate selection can dramatically influence the detection sensitivity of RLuc and GLuc and that appropriate selection of substrate can greatly improve the performance of reporter genes encoding these enzymes for monitoring gene transfer by BLI. PMID:20527045

Optimization of enzyme-substrate pairing for bioluminescence imaging of gene transfer using Renilla and Gaussia luciferases.

PubMed

Kimura, Takahiro; Hiraoka, Kei; Kasahara, Noriyuki; Logg, Christopher R

2010-06-01

Bioluminescence imaging (BLI) permits the non-invasive quantification and localization of transduction and expression by gene transfer vectors. The tendency of tissue to attenuate light in the optical region, however, limits the sensitivity of BLI. Improvements in light output from bioluminescent reporter systems would allow the detection of lower levels of expression, smaller numbers of cells and expression from deeper and more attenuating tissues within an animal. With the goal of identifying substrates that allow improved sensitivity with Renilla luciferase (RLuc) and Gaussia luciferase (GLuc) reporter genes, we evaluated native coelenterazine and three of its most promising derivatives in BLI of cultured cells transduced with retroviral vectors encoding these reporters. Of the eight enzyme-substrate pairs tested, the two that performed best were further evaluated in mice to compare their effectiveness for imaging vector-modified cells in live animals. In cell culture, we observed striking differences in luminescence levels from the various enzyme-substrate combinations and found that the two luciferases exhibited markedly distinct abilities to generate light with the substrates. The most effective pairs were RLuc with the synthetic coelenterazine derivative ViviRen, and GLuc with native coelenterazine. In animals, these two pairs allowed similar detection sensitivities, which were eight- to 15-fold higher than that of the prototypical RLuc-native coelenterazine combination. Substrate selection can dramatically influence the detection sensitivity of RLuc and GLuc and appropriate choice of substrate can greatly improve the performance of reporter genes encoding these enzymes for monitoring gene transfer by BLI.

The HSV-1 Latency-Associated Transcript Functions to Repress Latent Phase Lytic Gene Expression and Suppress Virus Reactivation from Latently Infected Neurons

PubMed Central

Nicoll, Michael P.; Hann, William; Shivkumar, Maitreyi; Harman, Laura E. R.; Connor, Viv; Coleman, Heather M.; Proença, João T.; Efstathiou, Stacey

2016-01-01

Herpes simplex virus 1 (HSV-1) establishes life-long latent infection within sensory neurons, during which viral lytic gene expression is silenced. The only highly expressed viral gene product during latent infection is the latency-associated transcript (LAT), a non-protein coding RNA that has been strongly implicated in the epigenetic regulation of HSV-1 gene expression. We have investigated LAT-mediated control of latent gene expression using chromatin immunoprecipitation analyses and LAT-negative viruses engineered to express firefly luciferase or β-galactosidase from a heterologous lytic promoter. Whilst we were unable to determine a significant effect of LAT expression upon heterochromatin enrichment on latent HSV-1 genomes, we show that reporter gene expression from latent HSV-1 genomes occurs at a greater frequency in the absence of LAT. Furthermore, using luciferase reporter viruses we have observed that HSV-1 gene expression decreases during long-term latent infection, with a most marked effect during LAT-negative virus infection. Finally, using a fluorescent mouse model of infection to isolate and culture single latently infected neurons, we also show that reactivation occurs at a greater frequency from cultures harbouring LAT-negative HSV-1. Together, our data suggest that the HSV-1 LAT RNA represses HSV-1 gene expression in small populations of neurons within the mouse TG, a phenomenon that directly impacts upon the frequency of reactivation and the maintenance of the transcriptionally active latent reservoir. PMID:27055281

NanoLuc: A Small Luciferase is Brightening up the Field of Bioluminescence

PubMed Central

Cai, Weibo

2016-01-01

The biomedical field has greatly benefited from the discovery of bioluminescent proteins. Currently, scientists employ bioluminescent systems for numerous biomedical applications, ranging from highly sensitive cellular assays to bioluminescence-based molecular imaging. Traditionally, these systems are based on Firefly and Renilla luciferases; however, the applicability of these enzymes is limited by their size, stability, and luminescence efficiency. NanoLuc (NLuc), a novel bioluminescence platform, offers several advantages over established systems, including enhanced stability, smaller size, and >150-fold increase in luminescence. In addition, the substrate for NLuc displays enhanced stability and lower background activity, opening up new possibilities in the field of bioluminescence imaging. The NLuc system is incredibly versatile and may be utilized for a wide array of applications. The increased sensitivity, high stability, and small size of the NLuc system have the potential to drastically change the field of reporter assays in the future. However, as with all such technology, NLuc has limitations (including a non-ideal emission for in vivo applications and its unique substrate) which may cause it to find restricted use in certain areas of molecular biology. As this unique technology continues to broaden, NLuc may have a significant impact in both preclinical and clinical fields, with potential roles in disease detection, molecular imaging, and therapeutic monitoring. This review will present the NLuc technology to the scientific community in a non-biased manner, allowing the audience to adopt their own views of this novel system. PMID:27045664

Identification of a functional element in the promoter of the silkworm (Bombyx mori) fat body-specific gene Bmlp3.

PubMed

Xu, Hanfu; Deng, Dangjun; Yuan, Lin; Wang, Yuancheng; Wang, Feng; Xia, Qingyou

2014-08-01

30K proteins are a group of structurally related proteins that play important roles in the life cycle of the silkworm Bombyx mori and are largely synthesized and regulated in a time-dependent manner in the fat body. Little is known about the upstream regulatory elements associated with the genes encoding these proteins. In the present study, the promoter of Bmlp3, a fat body-specific gene encoding a 30K protein family member, was characterized by joining sequences containing the Bmlp3 promoter with various amounts of 5' upstream sequences to a luciferase reporter gene. The results indicated that the sequences from -150 to -250bp and -597 to -675bp upstream of the Bmlp3 transcription start site were necessary for high levels of luciferase activity. Further analysis showed that a 21-bp sequence located between -230 and -250 was specifically recognized by nuclear factors from silkworm fat bodies and BmE cells, and could enhance luciferase reporter-gene expression 2.8-fold in BmE cells. This study provides new insights into the Bmlp3 promoter and contributes to the further clarification of the function and developmental regulation of Bmlp3. Copyright © 2014. Published by Elsevier B.V.

MicroRNA-23b mediates urokinase and c-met downmodulation and a decreased migration of human hepatocellular carcinoma cells.

PubMed

Salvi, Alessandro; Sabelli, Cristiano; Moncini, Silvia; Venturin, Marco; Arici, Bruna; Riva, Paola; Portolani, Nazario; Giulini, Stefano M; De Petro, Giuseppina; Barlati, Sergio

2009-06-01

Urokinase-type plasminogen activator (uPA) and c-met play a major role in cancer invasion and metastasis. Evidence has suggested that uPA and c-met overexpression may be coordinated in human hepatocellular carcinoma (HCC). In the present study, to understand whether the expression of these genes might be coregulated by specific microRNAs (miRs) in human cells, we predicted that Homo sapiens microRNA-23b could recognize two sites in the 3'-UTR of uPA and four sites in the c-met 3'-UTR by the algorithm pictar. The miR-23b expression analysis in human tumor and normal cells revealed an inverse trend with uPA and c-met expression, indicating that uPA and c-met negative regulation might depend on miR-23b expression. Transfection of miR-23b molecules in HCC cells (SKHep1C3) led to inhibition of protein expression of the target genes and caused a decrease in cell migration and proliferation capabilities. Furthermore, anti-miR-23b transfection in human normal AB2 dermal fibroblasts upregulated the expression of endogenous uPA and c-met. Cotransfection experiments in HCC cells of the miR-23b with pGL4.71 Renilla luciferase reporter gene constructs, containing the putative uPA and c-met 3'-UTR target sites, and with the pGL3 firefly luciferase-expressing vector showed a decrease in the relative luciferase activity. This would indicate that miR-23b can recognize target sites in the 3'-UTR of uPA and of c-met mRNAs and translationally repress the expression of uPA and c-met in HCC cells. The evidence obtained shows that overexpression of miR-23b leads to uPA and c-met downregulation and to decreased migration and proliferation abilities of HCC cells.

Lowering effect of firefly squid powder on triacylglycerol content and glucose-6-phosphate dehydrogenase activity in rat liver.

PubMed

Takeuchi, Hiroyuki; Morita, Ritsuko; Shirai, Yoko; Nakagawa, Yoshihisa; Terashima, Teruya; Ushikubo, Shun; Matsuo, Tatsuhiro

2014-01-01

Effects of dietary firefly squid on serum and liver lipid levels were investigated. Male Wistar rats were fed a diet containing 5% freeze-dried firefly squid or Japanese flying squid for 2 weeks. There was no significant difference in the liver triacylglycerol level between the control and Japanese flying squid groups, but the rats fed the firefly squid diet had a significantly lower liver triacylglycerol content than those fed the control diet. No significant difference was observed in serum triacylglycerol levels between the control and firefly squid groups. The rats fed the firefly squid had a significantly lower activity of liver glucose-6-phosphate dehydrogenase compared to the rats fed the control diet. There was no significant difference in liver fatty acid synthetase activity among the three groups. Hepatic gene expression and lipogenic enzyme activity were investigated; a DNA microarray showed that the significantly enriched gene ontology category of down-regulated genes in the firefly squid group was "lipid metabolic process". The firefly squid group had lower mRNA level of glucose-6-phosphate dehydrogenase compared to the controls. These results suggest that an intake of firefly squid decreases hepatic triacylglycerol in rats, and the reduction of mRNA level and enzyme activity of glucose-6-phosphate dehydrogenase might be related to the mechanisms.

An effective hybrid firefly algorithm with harmony search for global numerical optimization.

PubMed

Guo, Lihong; Wang, Gai-Ge; Wang, Heqi; Wang, Dinan

2013-01-01

A hybrid metaheuristic approach by hybridizing harmony search (HS) and firefly algorithm (FA), namely, HS/FA, is proposed to solve function optimization. In HS/FA, the exploration of HS and the exploitation of FA are fully exerted, so HS/FA has a faster convergence speed than HS and FA. Also, top fireflies scheme is introduced to reduce running time, and HS is utilized to mutate between fireflies when updating fireflies. The HS/FA method is verified by various benchmarks. From the experiments, the implementation of HS/FA is better than the standard FA and other eight optimization methods.

Molecular imaging of RNA interference therapy targeting PHD2 for treatment of myocardial ischemia.

PubMed

Huang, Mei; Wu, Joseph C

2011-01-01

Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments.

Photomodulating Gene Expression by Using Caged siRNAs with Single-Aptamer Modification.

PubMed

Zhang, Liangliang; Chen, Changmai; Fan, Xinli; Tang, Xinjing

2018-06-18

Caged siRNAs incorporating terminal modification were rationally designed for photochemical regulation of gene silencing induced by RNA interference (RNAi). Through the conjugation of a single oligonucleotide aptamer at the 5' terminus of the antisense RNA strand, enhancement of the blocking effect for RNA-induced silencing complex (RISC) formation/processing was expected, due both/either to the aptamers themselves and/or to their interaction with large binding proteins. Two oligonucleotide aptamers (AS1411 and MUC-1) were chosen for aptamer-siRNA conjugation through a photolabile linker. This caging strategy was successfully used to photoregulate gene expression both of firefly luciferase and of green fluorescent protein (GFP) in cells. Further patterning experiments revealed that spatial regulation of GFP expression was successfully achieved by using the aptamer-modified caged siRNA and light activation. We expect that further optimized caged siRNAs featuring aptamer conjugation will be promising for practical applications to spatiotemporal photoregulation of gene expression in the future. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

[Rapid bioluminescent antibiotic susceptibility assay].

PubMed

Frundzhian, V G; Ugarova, N N; Blatun, L A; Terekhova, R P; Rusanova, E V

2009-01-01

Rapid testing of pathogen susceptibility to antibiotics is of great practical value for rational chemotherapy of pyoinflammatory deseases and postoperative complications of microbial etiology. The standard microbiological methods, i.e., the disk diffusion method and the method of serial dilutions are labour- and time-consuming (not less than 18-36 hours). The method of the authors is based on measuring bioluminescence resulting from interaction of adenosine-5'-triphosphate (ATP) and ATP reagent, a standard reaction mixture of firefly luciferase (an enzyme) and luciferin. The bioluminescence intensity is proportional to the ATP concentration in the reaction mixture and the ATP concentration is proportional to the number of the pathogen viable cells in the sample. The bioluminescence intensity value in the pathogen suspension aliquots with and without (control) the antibiotic were compared after the incubation for 5 hours and the coefficient of the microbial cell growth inhibition was calculated. Satisfactory correlation (R2 > 88%) of the results of the bioluminescent assay and the assay with the disk diffusion method and the method of serial dilutions was observed.

Real-time bioluminescence imaging of macroencapsulated fibroblasts reveals allograft protection in rhesus monkeys (Macaca mulatta).

PubMed

Tarantal, Alice F; Lee, C Chang I; Itkin-Ansari, Pamela

2009-07-15

Encapsulation of cells has the potential to eliminate the need for immunosuppression for cellular transplantation. Recently, the TheraCyte device was shown to provide long-term immunoprotection of murine islets in a mouse model of diabetes. In this report, translational studies were undertaken using skin fibroblasts from an unrelated rhesus monkey donor that were transduced with an HIV-1-derived lentiviral vector expressing firefly luciferase permitting the use of bioluminescence imaging (BLI) to monitor cell survival over time and in a noninvasive manner. Encapsulated cells were transplanted subcutaneously (n=2), or cells were injected without encapsulation (n=1) and outcomes compared. BLI was performed to monitor cell survival. The BLI signal from the encapsulated cells remained robust postinsertion and in one animal persisted for up to 1 year. In contrast, the control animal that received unencapsulated cells exhibited a complete loss of cell signal within 14 days. These data demonstrate that TheraCyte encapsulation of allogeneic cells provides robust immune protection in transplanted rhesus monkeys.

In vivo quantitative bioluminescence tomography using heterogeneous and homogeneous mouse models.

PubMed

Liu, Junting; Wang, Yabin; Qu, Xiaochao; Li, Xiangsi; Ma, Xiaopeng; Han, Runqiang; Hu, Zhenhua; Chen, Xueli; Sun, Dongdong; Zhang, Rongqing; Chen, Duofang; Chen, Dan; Chen, Xiaoyuan; Liang, Jimin; Cao, Feng; Tian, Jie

2010-06-07

Bioluminescence tomography (BLT) is a new optical molecular imaging modality, which can monitor both physiological and pathological processes by using bioluminescent light-emitting probes in small living animal. Especially, this technology possesses great potential in drug development, early detection, and therapy monitoring in preclinical settings. In the present study, we developed a dual modality BLT prototype system with Micro-computed tomography (MicroCT) registration approach, and improved the quantitative reconstruction algorithm based on adaptive hp finite element method (hp-FEM). Detailed comparisons of source reconstruction between the heterogeneous and homogeneous mouse models were performed. The models include mice with implanted luminescence source and tumor-bearing mice with firefly luciferase report gene. Our data suggest that the reconstruction based on heterogeneous mouse model is more accurate in localization and quantification than the homogeneous mouse model with appropriate optical parameters and that BLT allows super-early tumor detection in vivo based on tomographic reconstruction of heterogeneous mouse model signal.

The 5' non-translated region of Varroa destructor virus 1 (genus Iflavirus): structure prediction and IRES activity in Lymantria dispar cells.

PubMed

Ongus, Juliette R; Roode, Els C; Pleij, Cornelis W A; Vlak, Just M; van Oers, Monique M

2006-11-01

Structure prediction of the 5' non-translated region (NTR) of four iflavirus RNAs revealed two types of potential internal ribosome entry site (IRES), which are discriminated by size and level of complexity, in this group of viruses. In contrast to the intergenic IRES of dicistroviruses, the potential 5' IRES structures of iflaviruses do not have pseudoknots. To test the activity of one of these, a bicistronic construct was made in which the 5' NTR of Varroa destructor virus 1 (VDV-1) containing a putative IRES was cloned in between two reporter genes, enhanced green fluorescent protein and firefly luciferase (Fluc). The presence of the 5' NTR of VDV-1 greatly enhanced the expression levels of the second reporter gene (Fluc) in Lymantria dispar Ld652Y cells. The 5' NTR was active in a host-specific manner, as it showed lower activity in Spodoptera frugiperda Sf21 cells and no activity in Drosophila melanogaster S2 cells.

Luminogenic cytochrome P450 assays.

PubMed

Cali, James J; Ma, Dongping; Sobol, Mary; Simpson, Daniel J; Frackman, Susan; Good, Troy D; Daily, William J; Liu, David

2006-08-01

Luminogenic cytochrome P450 (CYP) assays couple CYP enzyme activity to firefly luciferase luminescence in a technology called P450-Glo(TM) (Promega). Luminogenic substrates are used in assays of human CYP1A1, -1A2, -1B1, -2C8, -2C9, -2C19, -2D6, -2J2, -3A4, -3A7, -4A11, -4F3B, -4F12 and -19. The assays detect dose-dependent CYP inhibition by test compounds against recombinant CYP enzymes or liver microsomes. Induction or inhibition of CYP activities in cultured hepatocytes is measured in a nonlytic approach that leaves cells intact for additional analysis. Luminogenic CYP assays offer advantages of speed and safety over HPLC and radiochemical-based methods. Compared with fluorogenic methods the approach offers advantages of improved sensitivity and decreased interference between optical properties of test compound and CYP substrate. These homogenous assays are sensitive and robust tools for high-throughput CYP screening in early drug discovery.

Identification of a small molecule inhibitor of Ebola virus genome replication and transcription using in silico screening.

PubMed

Easton, Victoria; McPhillie, Martin; Garcia-Dorival, Isabel; Barr, John N; Edwards, Thomas A; Foster, Richard; Fishwick, Colin; Harris, Mark

2018-06-02

Ebola virus (EBOV) causes a severe haemorrhagic fever in humans and has a mortality rate over 50%. With no licensed drug treatments available, EBOV poses a significant threat. Investigations into possible therapeutics have been severely hampered by the classification of EBOV as a BSL4 pathogen. Here, we describe a drug discovery pathway combining in silico screening of compounds predicted to bind to a hydrophobic pocket on the nucleoprotein (NP); with a robust and rapid EBOV minigenome assay for inhibitor validation at BSL2. One compound (MCCB4) was efficacious (EC 50 4.8 μM), exhibited low cytotoxicity (CC 50  > 100 μM) and was specific, with no effect on either a T7 RNA polymerase driven firefly luciferase or a Bunyamwera virus minigenome. Further investigations revealed that this small molecule inhibitor was able to outcompete established replication complexes, an essential aspect for a potential EBOV treatment. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Molecular Imaging of RNA Interference Therapy Targeting PHD2 for Treatment of Myocardial Ischemia

PubMed Central

Huang, Mei; Wu, Joseph C.

2011-01-01

Summary Coronary artery disease is the number one cause of morbidity and mortality in the Western world. It typically occurs when heart muscle receives inadequate blood supply due to rupture of atherosclerotic plaques. During ischemia, up-regulation of hypoxia inducible factor-1 alpha (HIF-1α) transcriptional factor can activate several downstream angiogenic genes. However, HIF-1α is naturally degraded by prolyl hydroxylase-2 (PHD2) protein. Recently, we cloned the mouse PHD2 gene by comparing the homolog gene in human and rat. The best candidate shRNA sequence for inhibiting PHD2 was inserted behind H1 promoter, followed by a separate hypoxia response element (HRE)-incorporated promoter driving a firefly luciferase (Fluc) reporter gene. This construct allowed us to monitor gene expression noninvasively and was used to test the hypothesis that inhibition of PHD2 by short hairpin RNA interference (shRNA) can lead to significant improvement in angiogenesis and contractility as revealed by in vitro and in vivo experiments. PMID:21194030

Longitudinal Monitoring of Antibody Responses against Tumor Cells Using Magneto-nanosensors with a Nanoliter of Blood.

PubMed

Lee, Jung-Rok; Chan, Carmel T; Ruderman, Daniel; Chuang, Hui-Yen; Gaster, Richard S; Atallah, Michelle; Mallick, Parag; Lowe, Scott W; Gambhir, Sanjiv S; Wang, Shan X

2017-11-08

Each immunoglobulin isotype has unique immune effector functions. The contribution of these functions in the elimination of pathogens and tumors can be determined by monitoring quantitative temporal changes in isotype levels. Here, we developed a novel technique using magneto-nanosensors based on the effect of giant magnetoresistance (GMR) for longitudinal monitoring of total and antigen-specific isotype levels with high precision, using as little as 1 nL of serum. Combining in vitro serologic measurements with in vivo imaging techniques, we investigated the role of the antibody response in the regression of firefly luciferase (FL)-labeled lymphoma cells in spleen, kidney, and lymph nodes in a syngeneic Burkitt's lymphoma mouse model. Regression status was determined by whole body bioluminescent imaging (BLI). The magneto-nanosensors revealed that anti-FL IgG2a and total IgG2a were elevated and sustained in regression mice compared to non-regression mice (p < 0.05). This platform shows promise for monitoring immunotherapy, vaccination, and autoimmunity.

An Effective Hybrid Firefly Algorithm with Harmony Search for Global Numerical Optimization

PubMed Central

Guo, Lihong; Wang, Gai-Ge; Wang, Heqi; Wang, Dinan

2013-01-01

A hybrid metaheuristic approach by hybridizing harmony search (HS) and firefly algorithm (FA), namely, HS/FA, is proposed to solve function optimization. In HS/FA, the exploration of HS and the exploitation of FA are fully exerted, so HS/FA has a faster convergence speed than HS and FA. Also, top fireflies scheme is introduced to reduce running time, and HS is utilized to mutate between fireflies when updating fireflies. The HS/FA method is verified by various benchmarks. From the experiments, the implementation of HS/FA is better than the standard FA and other eight optimization methods. PMID:24348137

The construction of support vector machine classifier using the firefly algorithm.

PubMed

Chao, Chih-Feng; Horng, Ming-Huwi

2015-01-01

The setting of parameters in the support vector machines (SVMs) is very important with regard to its accuracy and efficiency. In this paper, we employ the firefly algorithm to train all parameters of the SVM simultaneously, including the penalty parameter, smoothness parameter, and Lagrangian multiplier. The proposed method is called the firefly-based SVM (firefly-SVM). This tool is not considered the feature selection, because the SVM, together with feature selection, is not suitable for the application in a multiclass classification, especially for the one-against-all multiclass SVM. In experiments, binary and multiclass classifications are explored. In the experiments on binary classification, ten of the benchmark data sets of the University of California, Irvine (UCI), machine learning repository are used; additionally the firefly-SVM is applied to the multiclass diagnosis of ultrasonic supraspinatus images. The classification performance of firefly-SVM is also compared to the original LIBSVM method associated with the grid search method and the particle swarm optimization based SVM (PSO-SVM). The experimental results advocate the use of firefly-SVM to classify pattern classifications for maximum accuracy.

The Construction of Support Vector Machine Classifier Using the Firefly Algorithm

PubMed Central

Chao, Chih-Feng; Horng, Ming-Huwi

2015-01-01

The setting of parameters in the support vector machines (SVMs) is very important with regard to its accuracy and efficiency. In this paper, we employ the firefly algorithm to train all parameters of the SVM simultaneously, including the penalty parameter, smoothness parameter, and Lagrangian multiplier. The proposed method is called the firefly-based SVM (firefly-SVM). This tool is not considered the feature selection, because the SVM, together with feature selection, is not suitable for the application in a multiclass classification, especially for the one-against-all multiclass SVM. In experiments, binary and multiclass classifications are explored. In the experiments on binary classification, ten of the benchmark data sets of the University of California, Irvine (UCI), machine learning repository are used; additionally the firefly-SVM is applied to the multiclass diagnosis of ultrasonic supraspinatus images. The classification performance of firefly-SVM is also compared to the original LIBSVM method associated with the grid search method and the particle swarm optimization based SVM (PSO-SVM). The experimental results advocate the use of firefly-SVM to classify pattern classifications for maximum accuracy. PMID:25802511

The NSF Firefly Cubesat: Progress and status

NASA Astrophysics Data System (ADS)

Rowland, D. E.; Weatherwax, A. T.; Klenzing, J. H.; Hill, J.

2009-12-01

Firefly is a science investigation into the linkage between lightning and Terrestrial Gamma ray Flashes (TGFs). Firefly combines a gamma ray / electron scintillation detector, VLF radio receiver, and optical photometers to perform the first simultaneous measurements of lightning and TGFs from a single platform. Firefly will push the boundaries of TGF detection and build on the successes of past missions such as RHESSI, CGRO, AGILE, and Fermi by pursuing focused TGF science. In particular, Firefly will address the following science questions: a) What types of lightning do and do not produce TGFs? b) What is the occurrence rate of weak TGFs? c) How strong are TGFs, and to what extent were previous measurements affected by pileup and detector limitations? d) What is the relative timing of gamma ray, optical, and VLF signatures of TGFs? e) What are the characteristics of energetic electrons associated with TGFs? Firefly is scheduled for launch in August 2010, and will be delivered to the launch vehicle in spring 2010. We will present an update on the Firefly status, student training activities, tools we have developed for the community, and lessons learned.

A Comparison of Red Fluorescent Proteins to Model DNA Vaccine Expression by Whole Animal In Vivo Imaging.

PubMed

Kinnear, Ekaterina; Caproni, Lisa J; Tregoning, John S

2015-01-01

DNA vaccines can be manufactured cheaply, easily and rapidly and have performed well in pre-clinical animal studies. However, clinical trials have so far been disappointing, failing to evoke a strong immune response, possibly due to poor antigen expression. To improve antigen expression, improved technology to monitor DNA vaccine transfection efficiency is required. In the current study, we compared plasmid encoded tdTomato, mCherry, Katushka, tdKatushka2 and luciferase as reporter proteins for whole animal in vivo imaging. The intramuscular, subcutaneous and tattooing routes were compared and electroporation was used to enhance expression. We observed that overall, fluorescent proteins were not a good tool to assess expression from DNA plasmids, with a highly heterogeneous response between animals. Of the proteins used, intramuscular delivery of DNA encoding either tdTomato or luciferase gave the clearest signal, with some Katushka and tdKatushka2 signal observed. Subcutaneous delivery was weakly visible and nothing was observed following DNA tattooing. DNA encoding haemagglutinin was used to determine whether immune responses mirrored visible expression levels. A protective immune response against H1N1 influenza was induced by all routes, even after a single dose of DNA, though qualitative differences were observed, with tattooing leading to high antibody responses and subcutaneous DNA leading to high CD8 responses. We conclude that of the reporter proteins used, expression from DNA plasmids can best be assessed using tdTomato or luciferase. But, the disconnect between visible expression level and immunogenicity suggests that in vivo whole animal imaging of fluorescent proteins has limited utility for predicting DNA vaccine efficacy.

Identification of a peroxisome proliferator-responsive element upstream of the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase.

PubMed Central

Zhang, B; Marcus, S L; Sajjadi, F G; Alvares, K; Reddy, J K; Subramani, S; Rachubinski, R A; Capone, J P

1992-01-01

Ciprofibrate, a hypolipidemic drug that acts as a peroxisome proliferator, induces the transcription of genes encoding peroxisomal beta-oxidation enzymes. To identify cis-acting promoter elements involved in this induction, 5.8 kilobase pairs of promoter sequence from the gene encoding rat peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase (EC 4.2.1.17/EC 1.1.1.35) was inserted upstream of a luciferase reporter gene. Transfection of this expression vector into rat hepatoma H4IIEC3 cells in the presence of ciprofibrate resulted in a 5- to 10-fold, cell type-specific increase in luciferase activity as compared to cells transfected in the absence of drug. A peroxisome proliferator-responsive element (PPRE) was localized to a 196-nucleotide region centered at position -2943 from the transcription start site. This PPRE conferred ciprofibrate responsiveness on a heterologous promoter and functioned independently of orientation or position. Gel retardation analysis with nuclear extracts demonstrated that ciprofibrate-treated or untreated H4IIEC3 cells, but not HeLa cells or monkey kidney cells, contained sequence-specific DNA binding factors that interact with the PPRE. These results have implications for understanding the mechanisms of coordinated transcriptional induction of genes encoding peroxisomal proteins by hypolipidemic agents and other peroxisome proliferators. Images PMID:1502166

Firefly Algorithm, Lévy Flights and Global Optimization

NASA Astrophysics Data System (ADS)

Yang, Xin-She

Nature-inspired algorithms such as Particle Swarm Optimization and Firefly Algorithm are among the most powerful algorithms for optimization. In this paper, we intend to formulate a new metaheuristic algorithm by combining Lévy flights with the search strategy via the Firefly Algorithm. Numerical studies and results suggest that the proposed Lévy-flight firefly algorithm is superior to existing metaheuristic algorithms. Finally implications for further research and wider applications will be discussed.

Firefly: embracing future web technologies

NASA Astrophysics Data System (ADS)

Roby, W.; Wu, X.; Goldina, T.; Joliet, E.; Ly, L.; Mi, W.; Wang, C.; Zhang, Lijun; Ciardi, D.; Dubois-Felsmann, G.

2016-07-01

At IPAC/Caltech, we have developed the Firefly web archive and visualization system. Used in production for the last eight years in many missions, Firefly gives the scientist significant capabilities to study data. Firefly provided the first completely web based FITS viewer as well as a growing set of tabular and plotting visualizers. Further, it will be used for the science user interface of the LSST telescope which goes online in 2021. Firefly must meet the needs of archive access and visualization for the 2021 LSST telescope and must serve astronomers beyond the year 2030. Recently, our team has faced the fact that the technology behind Firefly software was becoming obsolete. We were searching for ways to utilize the current breakthroughs in maintaining stability, testability, speed, and reliability of large web applications, which Firefly exemplifies. In the last year, we have ported the Firefly to cutting edge web technologies. Embarking on this massive overhaul is no small feat to say the least. Choosing the technologies that will maintain a forward trajectory in a future development project is always hard and often overwhelming. When a team must port 150,000 lines of code for a production-level product there is little room to make poor choices. This paper will give an overview of the most modern web technologies and lessons learned in our conversion from GWT based system to React/Redux based system.

The Human Splice Variant Δ16HER2 Induces Rapid Tumor Onset in a Reporter Transgenic Mouse

PubMed Central

Iezzi, Manuela; Zenobi, Santa; Montani, Maura; Pietrella, Lucia; Kalogris, Cristina; Rossini, Anna; Ciravolo, Valentina; Castagnoli, Lorenzo; Tagliabue, Elda; Pupa, Serenella M.; Musiani, Piero; Monaci, Paolo; Menard, Sylvie; Amici, Augusto

2011-01-01

Several transgenic mice models solidly support the hypothesis that HER2 (ERBB2) overexpression or mutation promotes tumorigenesis. Recently, a HER2 splice variant lacking exon-16 (Δ16HER2) has been detected in human breast carcinomas. This alternative protein, a normal byproduct of HER2, has an increased transforming potency compared to wild-type (wt) HER2 receptors. To examine the ability of Δ16HER2 to transform mammary epithelium in vivo and to monitor Δ16HER2-driven tumorigenesis in live mice, we generated and characterized a mouse line that transgenically expresses both human Δ16HER2 and firefly luciferase under the transcriptional control of the MMTV promoter. All the transgenic females developed multifocal mammary tumors with a rapid onset and an average latency of 15.11 weeks. Immunohistochemical analysis revealed the concurrent expression of luciferase and the human Δ16HER2 oncogene only in the mammary gland and in strict correlation with tumor development. Transgenic Δ16HER2 expressed on the tumor cell plasma membrane from spontaneous mammary adenocarcinomas formed constitutively active homodimers able to activate the oncogenic signal transduction pathway mediated through Src kinase. These new transgenic animals demonstrate the ability of the human Δ16HER2 isoform to transform “per se” mammary epithelium in vivo. The high tumor incidence as well as the short latency strongly suggests that the Δ16HER2 splice variant represents the transforming form of the HER2 oncoprotein. PMID:21559085

Noninvasive bioluminescence imaging of normal and spontaneously transformed prostate tissue in mice.

PubMed

Lyons, Scott K; Lim, Ed; Clermont, Anne O; Dusich, Joan; Zhu, Lingyun; Campbell, Kenneth D; Coffee, Richard J; Grass, David S; Hunter, John; Purchio, Tony; Jenkins, Darlene

2006-05-01

Several transgenic mouse models of prostate cancer have been developed recently that are able to recapitulate many key biological features of the human condition. It would, therefore, be desirable to employ these models to test the efficacy of new therapeutics before clinical trial; however, the variable onset and non-visible nature of prostate tumor development limit their use for such applications. We now report the generation of a transgenic reporter mouse that should obviate these limitations by enabling noninvasive in vivo bioluminescence imaging of normal and spontaneously transformed prostate tissue in the mouse. We used an 11-kb fragment of the human prostate-specific antigen (PSA) promoter to achieve specific and robust expression of firefly luciferase in the prostate glands of transgenic mice. Ex vivo bioluminescence imaging and in situ hybridization analysis confirmed that luciferase expression was restricted to the epithelium in all four lobes of the prostate. We also show that PSA-Luc mice exhibit decreased but readily detectable levels of in vivo bioluminescence over extended time periods following androgen ablation. These results suggest that this reporter should enable in vivo imaging of both androgen-dependent and androgen-independent prostate tumor models. As proof-of-principle, we show that we could noninvasively image SV40 T antigen-induced prostate tumorigenesis in mice with PSA-Luc. Furthermore, we show that our noninvasive imaging strategy can be successfully used to image tumor response to androgen ablation in transgenic mice and, as a result, that we can rapidly identify individual animals capable of sustaining tumor growth in the absence of androgen.

Development of a Fish Cell Biosensor System for Genotoxicity Detection Based on DNA Damage-Induced Trans-Activation of p21 Gene Expression

PubMed Central

Geng, Deyu; Zhang, Zhixia; Guo, Huarong

2012-01-01

p21CIP1/WAF1 is a p53-target gene in response to cellular DNA damage. Here we report the development of a fish cell biosensor system for high throughput genotoxicity detection of new drugs, by stably integrating two reporter plasmids of pGL3-p21-luc (human p21 promoter linked to firefly luciferase) and pRL-CMV-luc (CMV promoter linked to Renilla luciferase) into marine flatfish flounder gill (FG) cells, referred to as p21FGLuc. Initial validation of this genotoxicity biosensor system showed that p21FGLuc cells had a wild-type p53 signaling pathway and responded positively to the challenge of both directly acting genotoxic agents (bleomycin and mitomycin C) and indirectly acting genotoxic agents (cyclophosphamide with metabolic activation), but negatively to cyclophosphamide without metabolic activation and the non-genotoxic agents ethanol and D-mannitol, thus confirming a high specificity and sensitivity, fast and stable response to genotoxic agents for this easily maintained fish cell biosensor system. This system was especially useful in the genotoxicity detection of Di(2-ethylhexyl) phthalate (DEHP), a rodent carcinogen, but negatively reported in most non-mammalian in vitro mutation assays, by providing a strong indication of genotoxicity for DEHP. A limitation for this biosensor system was that it might give false positive results in response to sodium butyrate and any other agents, which can trans-activate the p21 gene in a p53-independent manner. PMID:25585933

Melanopsin resets circadian rhythms in cells by inducing clock gene Period1

NASA Astrophysics Data System (ADS)

Yamashita, Shuhei; Uehara, Tomoe; Matsuo, Minako; Kikuchi, Yo; Numano, Rika

2014-02-01

The biochemical, physiological and behavioral processes are under the control of internal clocks with the period of approximately 24 hr, circadian rhythms. The expression of clock gene Period1 (Per1) oscillates autonomously in cells and is induced immediately after a light pulse. Per1 is an indispensable member of the central clock system to maintain the autonomous oscillator and synchronize environmental light cycle. Per1 expression could be detected by Per1∷luc and Per1∷GFP plasmid DNA in which firefly luciferase and Green Fluorescence Protein were rhythmically expressed under the control of the mouse Per1 promoter in order to monitor mammalian circadian rhythms. Membrane protein, MELANOPSIN is activated by blue light in the morning on the retina and lead to signals transduction to induce Per1 expression and to reset the phase of circadian rhythms. In this report Per1 induction was measured by reporter signal assay in Per1∷luc and Per1∷GFP fibroblast cell at the input process of circadian rhythms. To the result all process to reset the rhythms by Melanopsin is completed in single cell like in the retina projected to the central clock in the brain. Moreover, the phase of circadian rhythm in Per1∷luc cells is synchronized by photo-activated Melanopsin, because the definite peak of luciferase activity in one dish was found one day after light illumination. That is an available means that physiological circadian rhythms could be real-time monitor as calculable reporter (bioluminescent and fluorescent) chronological signal in both single and groups of cells.

A high throughput screening for TLR3-IRF3 signaling pathway modulators identifies several antipsychotic drugs as TLR inhibitors1

PubMed Central

Zhu, Jianzhong; Smith, Kevin; Hsieh, Paishiun N.; Mburu, Yvonne K.; Chattopadhyay, Saurabh; Sen, Ganes C.; Sarkar, Saumendra N.

2010-01-01

Toll-like Receptor 3 (TLR3) is one of the major innate immune sensors of double stranded RNA (dsRNA). The signal transduction pathway activated by TLR3, upon binding to dsRNA, leads to the activation of two major transcription factors: NF-κB and IRF3. In an effort to identify specific chemical modulators of TLR3-IRF3 signal transduction pathway we developed a cell-based read out system. Using the interferon stimulated gene 56 (ISG56) promoter driven firefly luciferase gene stably integrated in a TLR3 expressing HEK293 cell line, we were able to generate a cell line where treatment with dsRNA resulted in a dose dependent induction of luciferase activity. A screen of two pharmacologically active compound libraries using this system, identified a number of TLR3-IRF3 signaling pathway modulators. Among them we focused on a subset of inhibitors and characterized their mode of action. Several antipsychotic drugs, such as Sertraline, Trifluoperazine and Fluphenazine were found to be direct inhibitors of the innate immune signaling pathway. These inhibitors also showed the ability to inhibit ISG56 induction mediated by TLR4 and TLR7/8 pathways. Interestingly, they did not show significant effect on TLR3, TLR7 and TLR8 mediated NF-κB activation. Detailed analysis of the signaling pathway indicated that these drugs may be exerting their inhibitory effects on IRF3 via PI3K signaling pathway. The data presented here provides mechanistic explanation of possible anti-inflammatory roles of some antipsychotic drugs. PMID:20382888

Performance evaluation of firefly algorithm with variation in sorting for non-linear benchmark problems

NASA Astrophysics Data System (ADS)

Umbarkar, A. J.; Balande, U. T.; Seth, P. D.

2017-06-01

The field of nature inspired computing and optimization techniques have evolved to solve difficult optimization problems in diverse fields of engineering, science and technology. The firefly attraction process is mimicked in the algorithm for solving optimization problems. In Firefly Algorithm (FA) sorting of fireflies is done by using sorting algorithm. The original FA is proposed with bubble sort for ranking the fireflies. In this paper, the quick sort replaces bubble sort to decrease the time complexity of FA. The dataset used is unconstrained benchmark functions from CEC 2005 [22]. The comparison of FA using bubble sort and FA using quick sort is performed with respect to best, worst, mean, standard deviation, number of comparisons and execution time. The experimental result shows that FA using quick sort requires less number of comparisons but requires more execution time. The increased number of fireflies helps to converge into optimal solution whereas by varying dimension for algorithm performed better at a lower dimension than higher dimension.

Japanese Interest in “Hotaru” (Fireflies) and “Kabuto-Mushi” (Japanese Rhinoceros Beetles) Corresponds with Seasonality in Visible Abundance

PubMed Central

Takada, Kenta

2012-01-01

Seasonal changes in the popularity of fireflies [usually Genji-fireflies (Luciola cruciata Motschulsky) in Japan] and Japanese rhinoceros beetles [Allomyrina dichotoma (Linne)] were investigated to examine whether contemporary Japanese are interested in visible emergence of these insects as seasonal events. The popularity of fireflies and Japanese rhinoceros beetles was assessed by the Google search volume of their Japanese names, “Hotaru” and “Kabuto-mushi” in Japanese Katakana script using Google Trends. The search volume index for fireflies and Japanese rhinoceros beetles was distributed across seasons with a clear peak in only particular times of each year from 2004 to 2011. In addition, the seasonal peak of popularity for fireflies occurred at the beginning of June, whereas that for Japanese rhinoceros beetles occurred from the middle of July to the beginning of August. Thus seasonal peak of each species coincided with the peak period of the emergence of each adult stage. These findings indicated that the Japanese are interested in these insects primarily during the time when the two species are most visibly abundant. Although untested, this could suggest that fireflies and Japanese rhinoceros beetles are perceived by the general public as indicators or symbols of summer in Japan. PMID:26466535

Long-read sequence assembly of the firefly Pyrocoelia pectoralis genome

PubMed Central

Fu, Xinhua; Li, Jingjing; Tian, Yu; Quan, Weipeng; Zhang, Shu; Liu, Qian; Liang, Fan; Zhu, Xinlei; Zhang, Liangsheng

2017-01-01

Abstract Background Fireflies are a family of insects within the beetle order Coleoptera, or winged beetles, and they are one of the most well-known and loved insect species because of their bioluminescence. However, the firefly is in danger of extinction because of the massive destruction of its living environment. In order to improve the understanding of fireflies and protect them effectively, we sequenced the whole genome of the terrestrial firefly Pyrocoelia pectoralis. Findings Here, we developed a highly reliable genome resource for the terrestrial firefly Pyrocoelia pectoralis (E. Oliv., 1883; Coleoptera: Lampyridae) using single molecule real time (SMRT) sequencing on the PacBio Sequel platform. In total, 57.8 Gb of long reads were generated and assembled into a 760.4-Mb genome, which is close to the estimated genome size and covered 98.7% complete and 0.7% partial insect Benchmarking Universal Single-Copy Orthologs. The k-mer analysis showed that this genome is highly heterozygous. However, our long-read assembly demonstrates continuousness with a contig N50 length of 3.04 Mb and the longest contig length of 13.69 Mb. Furthermore, 135 589 SSRs and 341 Mb of repeat sequences were detected. A total of 23 092 genes were predicted; 88.44% of genes were annotated with one or more related functions. Conclusions We assembled a high-quality firefly genome, which will not only provide insights into the conservation and biodiversity of fireflies, but also provide a wealth of information to study the mechanisms of their sexual communication, bio-luminescence, and evolution. PMID:29186486

Trehalose-Based Block Copolycations Promote Polyplex Stabilization for Lyophilization and in Vivo pDNA Delivery

PubMed Central

2015-01-01

The development and thorough characterization of nonviral delivery agents for nucleic acid and genome editing therapies are of high interest to the field of nanomedicine. Indeed, this vehicle class offers the ability to tune chemical architecture/biological activity and readily package nucleic acids of various sizes and morphologies for a variety of applications. Herein, we present the synthesis and characterization of a class of trehalose-based block copolycations designed to stabilize polyplex formulations for lyophilization and in vivo administration. A 6-methacrylamido-6-deoxy trehalose (MAT) monomer was synthesized from trehalose and polymerized via reversible addition–fragmentation chain transfer (RAFT) polymerization to yield pMAT43. The pMAT43 macro-chain transfer agent was then chain-extended with aminoethylmethacrylamide (AEMA) to yield three different pMAT-b-AEMA cationic-block copolymers, pMAT-b-AEMA-1 (21 AEMA repeats), -2 (44 AEMA repeats), and -3 (57 AEMA repeats). These polymers along with a series of controls were used to form polyplexes with plasmids encoding firefly luciferase behind a strong ubiquitous promoter. The trehalose-coated polyplexes were characterized in detail and found to be resistant to colloidal aggregation in culture media containing salt and serum. The trehalose-polyplexes also retained colloidal stability and promoted high gene expression following lyophilization and reconstitution. Cytotoxicity, cellular uptake, and transfection ability were assessed in vitro using both human glioblastoma (U87) and human liver carcinoma (HepG2) cell lines wherein pMAT-b-AEMA-2 was found to have the optimal combination of high gene expression and low toxicity. pMAT-b-AEMA-2 polyplexes were evaluated in mice via slow tail vein infusion. The vehicle displayed minimal toxicity and discouraged nonspecific internalization in the liver, kidney, spleen, and lungs as determined by quantitative polymerase chain reaction (qPCR) and fluorescence imaging experiments. Hydrodynamic infusion of the polyplexes, however, led to very specific localization of the polyplexes to the mouse liver and promoted excellent gene expression in vivo. PMID:26807438

The Major Portal of Entry of Koi Herpesvirus in Cyprinus carpio Is the Skin▿

PubMed Central

Costes, B.; Raj, V. Stalin; Michel, B.; Fournier, G.; Thirion, M.; Gillet, L.; Mast, J.; Lieffrig, F.; Bremont, M.; Vanderplasschen, A.

2009-01-01

Koi herpesvirus (KHV), recently designated Cyprinid herpesvirus 3, is the causative agent of a lethal disease in koi and common carp. In the present study, we investigated the portal of entry of KHV in carp by using bioluminescence imaging. Taking advantage of the recent cloning of the KHV genome as a bacterial artificial chromosome (BAC), we produced a recombinant plasmid encoding a firefly luciferase (LUC) expression cassette inserted in the intergenic region between open reading frame (ORF) 136 and ORF 137. Two viral strains were then reconstituted from the modified plasmid, the FL BAC 136 LUC excised strain and the FL BAC 136 LUC TK revertant strain, including a disrupted and a wild-type thymidine kinase (TK) locus, respectively. In vitro, the two recombinant strains replicated comparably to the parental FL strain. The FL BAC 136 LUC TK revertant strain was shown in vitro to induce a bioluminescent signal allowing the detection of single positive cells as early as 24 h postinfection, while in vivo, it induced KHV infection in carp that was indistinguishable from that induced by the parental FL strain. To identify the KHV portal of entry, carp were analyzed by bioluminescence imaging at different times postinfection with the FL BAC 136 LUC TK revertant strain. These analyses demonstrated that the skin of the fish covering the fins and also the body is the major portal of entry for KHV in carp. Finally, to further demonstrate the role of the skin as the KHV portal of entry, we constructed an original system, nicknamed “U-tube,” to perform percutaneous infection restricted to the posterior part of the fish. All the data obtained in the present study demonstrate that the skin, and not the gills, is the major portal of entry for KHV in carp. PMID:19153228

Arterial cannula shape optimization by means of the rotational firefly algorithm

NASA Astrophysics Data System (ADS)

Tesch, K.; Kaczorowska, K.

2016-03-01

This article presents global optimization results of arterial cannula shapes by means of the newly modified firefly algorithm. The search for the optimal arterial cannula shape is necessary in order to minimize losses and prepare the flow that leaves the circulatory support system of a ventricle (i.e. blood pump) before it reaches the heart. A modification of the standard firefly algorithm, the so-called rotational firefly algorithm, is introduced. It is shown that the rotational firefly algorithm allows for better exploration of search spaces which results in faster convergence and better solutions in comparison with its standard version. This is particularly pronounced for smaller population sizes. Furthermore, it maintains greater diversity of populations for a longer time. A small population size and a low number of iterations are necessary to keep to a minimum the computational cost of the objective function of the problem, which comes from numerical solution of the nonlinear partial differential equations. Moreover, both versions of the firefly algorithm are compared to the state of the art, namely the differential evolution and covariance matrix adaptation evolution strategies.

Naturally Inspired Firefly Controller For Stabilization Of Double Inverted Pendulum

NASA Astrophysics Data System (ADS)

Srikanth, Kavirayani; Nagesh, Gundavarapu

2015-12-01

A double inverted pendulum plant as an established model that is analyzed as part of this work was tested under the influence of time delay, where the controller was fine tuned using a firefly algorithm taking into considering the fitness function of variation of the cart position and to minimize the cart position displacement and still stabilize it effectively. The naturally inspired algorithm which imitates the fireflies definitely is an energy efficient method owing to the inherent logic of the way the fireflies respond collectively and has shown that critical time delays makes the system healthy.

Building Twilight "Light Sensors" to Study the Effects of Light Pollution on Fireflies

ERIC Educational Resources Information Center

Thancharoen, Anchana; Branham, Marc A.; Lloyd, James E.

2008-01-01

Light pollution negatively affects many nocturnal organisms. We outline two experiments that can be conducted by students to examine the effects of light pollution on firefly behavior. Inexpensive electronic light sensors, which are easy to construct and calibrate, are used to sample light levels along transects in spaces where fireflies are…

Real-time Bioluminescence Imaging of Macroencapsulated Fibroblasts Reveals Allograft Protection in Rhesus Monkeys (Macaca mulatta)

PubMed Central

Tarantal, Alice F.; Lee, C. Chang I.; Itkin-Ansari, Pamela

2009-01-01

Background Encapsulation of cells has the potential to eliminate the need for immunosuppression for cellular transplantation. Recently, the TheraCyte® device was shown to provide long-term immunoprotection of murine islets in the NOD/SCID mouse model of diabetes. In this report, translational studies were undertaken using skin fibroblasts from an unrelated rhesus monkey donor that were transduced with an HIV-1-derived lentiviral vector expressing firefly luciferase permitting the use of bioluminescence imaging (BLI) to monitor cell survival over time and in a noninvasive manner. Methods Encapsulated cells were transplanted subcutaneously (N=2) or cells were injected without encapsulation (N=1) and outcomes compared. BLI was performed to monitor cell survival. Results The BLI signal from the encapsulated cells remained robust post-insertion, and in one animal persisted for up to 1 year. In contrast, the control animal that received unencapsulated cells exhibited a complete loss of cell signal within 14 days. Conclusions These data demonstrate that TheraCyte® encapsulation of allogeneic cells provides robust immune protection in transplanted rhesus monkeys. PMID:19584678

Synthesis of galactosyl compounds for targeted gene delivery.

PubMed

Ren, T; Zhang, G; Liu, D

2001-11-01

Cell-specific DNA delivery offers a great potential for targeted gene therapy. Toward this end, we have synthesized a series of compounds carrying galactose residues as a targeting ligand for asialoglycoprotein receptors of hepatocytes and primary amine groups as a functional domain for DNA binding. Biological activity of these galactosyl compounds in DNA delivery was evaluated in HepG2 and BL-6 cells and compared with respect to the number of galactose residues as well as primary amine groups in each molecule. Transfection experiments using a firefly luciferase gene as a reporter revealed that compounds with multivalent binding properties were more active in DNA delivery. An optimal transfection activity in HepG2 cells requires seven primary amine groups and a minimum of two galactose residues in each molecule. The transfection activity of compounds carrying multi-galactose residues can be inhibited by asialofetuin, a natural substrate for asialoglycoprotein receptors of hepatocytes, suggesting that gene transfer by these galactosyl compounds is asialoglycoprotein receptor-mediated. These results provide direct evidence in support of our new strategy for the use of small and synthetic compounds for cell specific and targeted gene delivery.

Intra-adrenal murine TH-MYCN neuroblastoma tumors grow more aggressive and exhibit a distinct tumor microenvironment relative to their subcutaneous equivalents.

PubMed

Kroesen, Michiel; Brok, Ingrid C; Reijnen, Daphne; van Hout-Kuijer, Maaike A; Zeelenberg, Ingrid S; Den Brok, Martijn H; Hoogerbrugge, Peter M; Adema, Gosse J

2015-05-01

In around half of the patients with neuroblastoma (NBL), the primary tumor is located in one of the adrenal glands. We have previously reported on a transplantable TH-MYCN model of subcutaneous (SC) growing NBL in C57Bl/6 mice for immunological studies. In this report, we describe an orthotopic TH-MYCN transplantable model where the tumor cells were injected intra-adrenally (IA) by microsurgery. Strikingly, 9464D cells grew out much faster in IA tumors compared to the subcutis. Tumors were infiltrated by equal numbers of lymphocytes and myeloid cells. Within the myeloid cell population, however, tumor-infiltrating macrophages were more abundant in IA tumors compared to SC tumors and expressed lower levels of MHC class II, indicative of a more immunosuppressive phenotype. Using 9464D cells stably expressing firefly luciferase, enhanced IA tumor growth could be confirmed using bioluminescence. Collectively, these data show that the orthotopic IA localization of TH-MYCN cells impacts the NBL tumor microenvironment, resulting in a more stringent NBL model to study novel immunotherapeutic approaches for NBL.

Bioinspired photonic structures by the reflector layer of firefly lantern for highly efficient chemiluminescence

PubMed Central

Chen, Linfeng; Shi, Xiaodi; Li, Mingzhu; Hu, Junping; Sun, Shufeng; Su, Bin; Wen, Yongqiang; Han, Dong; Jiang, Lei; Song, Yanlin

2015-01-01

Fireflies have drawn considerable attention for thousands of years due to their highly efficient bioluminescence, which is important for fundamental research and photonic applications. However, there are few reports on the reflector layer (RL) of firefly lantern, which contributes to the bright luminescence. Here we presented the detailed microstructure of the RL consisting of random hollow granules, which had high reflectance in the range from 450 nm to 800 nm. Inspired by the firefly lantern, artificial films with high reflectance in the visible region were fabricated using hollow silica microparticles mimicking the structure of the RL. Additionally, the bioinspired structures provided an efficient RL for the chemiluminescence system and could substantially enhance the initial chemiluminescence intensity. The work not only provides new insight into the bright bioluminescence of fireflies, but also is importance for the design of photonic materials for theranostics, detection, and imaging. PMID:26264643

Renilla luciferase- Aequorea GFP (Ruc-GFP) fusion protein, a novel dual reporter for real-time imaging of gene expression in cell cultures and in live animals.

PubMed

Wang, Y; Yu, Y A; Shabahang, S; Wang, G; Szalay, A A

2002-10-01

Light-emitting reporter proteins play an increasing role in the study of gene expression in vitro and in vivo. Here we present a ruc-gfp fusion gene construct generated by fusing a cDNA for Renilla luciferase (ruc) in-frame with a cDNA encoding the "humanized" GFP (gfp) from Aequorea. A plasmid containing the fusion gene construct was successfully transformed into, and expressed in, mammalian cells. The transformed cells exhibited both Renilla luciferase activity in the presence of coelenterazine and GFP fluorescence upon excitation with UV light. Spectrofluorometry of cells containing the Ruc-GFP fusion protein, in the absence of wavelengths capable of exciting GFP fluorescence but in the presence of the luciferase substrate, coelenterazine, showed an emission spectrum with two peaks at 475 nm and 508 nm. These two peaks correspond to the emission maximum of Renilla luciferase at 475 nm and that of GFP at 508 nm. The peak at 508 nm generated in the presence of coelenterazine alone (without UV excitation) is the result of intramolecular energy transfer from Renilla luciferase to Aequorea GFP. Southern analysis of genomic DNA purified from transformed Chinese hamster ovary (CHO) cells and fluorescence in situ hybridization (FISH) to metaphase chromosomes confirmed the integration of the ruc-gfp fusion gene on a single chromosome. The bifunctional Ruc-GFP fusion protein allows the detection of gene expression at the single-cell level based on green fluorescence, and in a group of cells based on luminescence emission. Furthermore, animal experiments revealed that light emission from the Ruc-GFP fusion protein can be detected externally in the organs or tissues of live animals bearing the gene construct.

Pivotal role of oxidative stress in tumor metastasis under diabetic conditions in mice.

PubMed

Ikemura, Mai; Nishikawa, Makiya; Kusamori, Kosuke; Fukuoka, Miho; Yamashita, Fumiyoshi; Hashida, Mitsuru

2013-09-10

Diabetic patients are reported to have a high incidence and mortality of cancer, but little is known about the linkage. In this study, we investigated whether high oxidative stress is involved in the acceleration of tumor metastasis in diabetic mice. Murine melanoma B16-BL6 cells stably labeled with firefly luciferase (B16-BL6/Luc) were inoculated into the tail vein of streptozotocin (STZ)-treated or untreated mice. A luciferase assay demonstrated that tumor cells were present largely in the lung of untreated mice, whereas large numbers of tumor cells were detected in both the lung and liver of STZ-treated mice. Repeated injections of polyethylene glycol-conjugated catalase (PEG-catalase), a long-circulating derivative, reduced the elevated fasting blood glucose levels and plasma lipoperoxide levels of STZ-treated mice, but had no significant effects on these parameters in untreated mice. In addition, the injections significantly reduced the number of tumor cells in the lung and liver in both untreated and STZ-treated mice. Culture of B16-BL6/Luc cells in medium containing over 45 mg/dl glucose hardly affected the proliferation of the cells, whereas the addition of plasma of STZ-treated mice to the medium significantly increased the number of cells. Plasma samples of STZ-treated mice receiving PEG-catalase exhibited no such effect on proliferation. These findings indicate that a hyperglycemia-induced increase in oxidative stress is involved in the acceleration of tumor metastasis, and the removal of systemic hydrogen peroxide by PEG-catalase can inhibit the progression of diabetic conditions and tumor metastasis in diabetes. Copyright © 2013 Elsevier B.V. All rights reserved.

IRES-mediated translation of foot-and-mouth disease virus (FMDV) in cultured cells derived from FMDV-susceptible and -insusceptible animals.

PubMed

Kanda, Takehiro; Ozawa, Makoto; Tsukiyama-Kohara, Kyoko

2016-03-31

Foot-and-mouth disease virus (FMDV) possess a positive sense, single stranded RNA genome. Internal ribosomal entry site (IRES) element exists within its 5' untranslated region (5'UTR) of the viral RNA. Translation of the viral RNA is initiated by internal entry of the 40S ribosome within the IRES element. This process is facilitated by cellular factors known as IRES trans-acting factors (ITAFs). Foot-and-mouth disease (FMD) is host-restricted disease for cloven-hoofed animals such as cattle and pigs, but the factors determining the host range have not been identified yet. Although, ITAFs are known to promote IRES-mediated translation, these findings were confirmed only in cells derived from FMDV-insusceptible animals so far. We evaluated and compared the IRES-mediated translation activities among cell lines derived from four different animal species using bicistronic luciferase reporter plasmid, which possesses an FMDV-IRES element between Renilla and Firefly luciferase genes. Furthermore, we analyzed the effect of the cellular factors on IRES-mediated translation by silencing the cellular factors using siRNA in both FMDV-susceptible and -insusceptible animal cells. Our data indicated that IRES-mediated translational activity was not linked to FMDV host range. ITAF45 promoted IRES-mediated translation in all cell lines, and the effects of poly-pyrimidine tract binding protein (PTB) and eukaryotic initiation factor 4E-binding protein 1 (4E-BP1) were observed only in FMDV-susceptible cells. Thus, PTB and 4E-BP1 may influence the host range of FMDV. IRES-mediated translation activity of FMDV was not predictive of its host range. ITAF45 promoted IRES-mediated translation in all cells, and the effects of PTB and 4E-BP1 were observed only in FMDV-susceptible cells.

Optimisations and Challenges Involved in the Creation of Various Bioluminescent and Fluorescent Influenza A Virus Strains for In Vitro and In Vivo Applications

PubMed Central

Herfst, Sander; Bestebroer, Theo M.; Vaes, Vincent P.; van der Hoeven, Barbara; Koster, Abraham J.; Kremers, Gert-Jan; Scott, Dana P.; Gultyaev, Alexander P.; Sorell, Erin M.; de Graaf, Miranda; Bárcena, Montserrat; Rimmelzwaan, Guus F.; Fouchier, Ron A.

2015-01-01

Bioluminescent and fluorescent influenza A viruses offer new opportunities to study influenza virus replication, tropism and pathogenesis. To date, several influenza A reporter viruses have been described. These strategies typically focused on a single reporter gene (either bioluminescent or fluorescent) in a single virus backbone. However, whilst bioluminescence is suited to in vivo imaging, fluorescent viruses are more appropriate for microscopy. Therefore, the idea l reporter virus varies depending on the experiment in question, and it is important that any reporter virus strategy can be adapted accordingly. Herein, a strategy was developed to create five different reporter viruses in a single virus backbone. Specifically, enhanced green fluorescent protein (eGFP), far-red fluorescent protein (fRFP), near-infrared fluorescent protein (iRFP), Gaussia luciferase (gLUC) and firefly luciferase (fLUC) were inserted into the PA gene segment of A/PR/8/34 (H1N1). This study provides a comprehensive characterisation of the effects of different reporter genes on influenza virus replication and reporter activity. In vivo reporter gene expression, in lung tissues, was only detected for eGFP, fRFP and gLUC expressing viruses. In vitro, the eGFP-expressing virus displayed the best reporter stability and could be used for correlative light electron microscopy (CLEM). This strategy was then used to create eGFP-expressing viruses consisting entirely of pandemic H1N1, highly pathogenic avian influenza (HPAI) H5N1 and H7N9. The HPAI H5N1 eGFP-expressing virus infected mice and reporter gene expression was detected, in lung tissues, in vivo. Thus, this study provides new tools and insights for the creation of bioluminescent and fluorescent influenza A reporter viruses. PMID:26241861

Bakuchiol Is a Phenolic Isoprenoid with Novel Enantiomer-selective Anti-influenza A Virus Activity Involving Nrf2 Activation*

PubMed Central

Shoji, Masaki; Arakaki, Yumie; Esumi, Tomoyuki; Kohnomi, Shuntaro; Yamamoto, Chihiro; Suzuki, Yutaka; Takahashi, Etsuhisa; Konishi, Shiro; Kido, Hiroshi; Kuzuhara, Takashi

2015-01-01

Influenza represents a substantial threat to human health and requires novel therapeutic approaches. Bakuchiol is a phenolic isoprenoid compound present in Babchi (Psoralea corylifolia L.) seeds. We examined the anti-influenza viral activity of synthetic bakuchiol using Madin-Darby canine kidney cells. We found that the naturally occurring form, (+)-(S)-bakuchiol, and its enantiomer, (−)-(R)-bakuchiol, inhibited influenza A viral infection and growth and reduced the expression of viral mRNAs and proteins in these cells. Furthermore, these compounds markedly reduced the mRNA expression of the host cell influenza A virus-induced immune response genes, interferon-β and myxovirus-resistant protein 1. Interestingly, (+)-(S)-bakuchiol had greater efficacy than (−)-(R)-bakuchiol, indicating that chirality influenced anti-influenza virus activity. In vitro studies indicated that bakuchiol did not strongly inhibit the activities of influenza surface proteins or the M2 ion channel, expressed in Chinese hamster ovary cells. Analysis of luciferase reporter assay data unexpectedly indicated that bakuchiol may induce some host cell factor(s) that inhibited firefly and Renilla luciferases. Next generation sequencing and KeyMolnet analysis of influenza A virus-infected and non-infected cells exposed to bakuchiol revealed activation of transcriptional regulation by nuclear factor erythroid 2-related factor (Nrf), and an Nrf2 reporter assay showed that (+)-(S)-bakuchiol activated Nrf2. Additionally, (+)-(S)-bakuchiol up-regulated the mRNA levels of two Nrf2-induced genes, NAD(P)H quinone oxidoreductase 1 and glutathione S-transferase A3. These findings demonstrated that bakuchiol had enantiomer-selective anti-influenza viral activity involving a novel effect on the host cell oxidative stress response. PMID:26446794

Quantifying spontaneous metastasis in a syngeneic mouse melanoma model using real time PCR.

PubMed

Deng, Wentao; McLaughlin, Sarah L; Klinke, David J

2017-08-07

Modeling metastasis in vivo with animals is a priority for both revealing mechanisms of tumor dissemination and developing therapeutic methods. While conventional intravenous injection of tumor cells provides an efficient and consistent system for studying tumor cell extravasation and colonization, studying spontaneous metastasis derived from orthotopic tumor sites has the advantage of modeling more aspects of the metastatic cascade, but is challenging as it is difficult to detect small numbers of metastatic cells. In this work, we developed an approach for quantifying spontaneous metastasis in the syngeneic mouse B16 system using real time PCR. We first transduced B16 cells with lentivirus expressing firefly luciferase Luc2 gene for bioluminescence imaging. Next, we developed a real time quantitative PCR (qPCR) method for the detection of luciferase-expressing, metastatic tumor cells in mouse lungs and other organs. To illustrate the approach, we quantified lung metastasis in both spontaneous and experimental scenarios using B16F0 and B16F10 cells in C57BL/6Ncrl and NOD-Scid Gamma (NSG) mice. We tracked B16 melanoma metastasis with both bioluminescence imaging and qPCR, which were found to be self-consistent. Using this assay, we can quantitatively detect one Luc2 positive tumor cell out of 10 4 tissue cells, which corresponds to a metastatic burden of 1.8 × 10 4 metastatic cells per whole mouse lung. More importantly, the qPCR method was at least a factor of 10 more sensitive in detecting metastatic cell dissemination and should be combined with bioluminescence imaging as a high-resolution, end-point method for final metastatic cell quantitation. Given the rapid growth of primary tumors in many mouse models, assays with improved sensitivity can provide better insight into biological mechanisms that underpin tumor metastasis.

Genetic modification of embryonic stem cells with VEGF enhances cell survival and improves cardiac function.

PubMed

Xie, Xiaoyan; Cao, Feng; Sheikh, Ahmad Y; Li, Zongjin; Connolly, Andrew J; Pei, Xuetao; Li, Ren-Ke; Robbins, Robert C; Wu, Joseph C

2007-01-01

Cardiac stem cell therapy remains hampered by acute donor cell death posttransplantation and the lack of reliable methods for tracking cell survival in vivo. We hypothesize that cells transfected with inducible vascular endothelial growth factor 165 (VEGF(165)) can improve their survival as monitored by novel molecular imaging techniques. Mouse embryonic stem (ES) cells were transfected with an inducible, bidirectional tetracycline (Bi-Tet) promoter driving VEGF(165) and renilla luciferase (Rluc). Addition of doxycycline induced Bi-Tet expression of VEGF(165) and Rluc significantly compared to baseline (p<0.05). Expression of VEGF(165) enhanced ES cell proliferation and inhibited apoptosis as determined by Annexin-V staining. For noninvasive imaging, ES cells were transduced with a double fusion (DF) reporter gene consisting of firefly luciferase and enhanced green fluorescence protein (Fluc-eGFP). There was a robust correlation between cell number and Fluc activity (R(2)=0.99). Analysis by immunostaining, histology, and RT-PCR confirmed that expression of Bi-Tet and DF systems did not affect ES cell self-renewal or pluripotency. ES cells were differentiated into beating embryoid bodies expressing cardiac markers such as troponin, Nkx2.5, and beta-MHC. Afterward, 5 x 10(5) cells obtained from these beating embryoid bodies or saline were injected into the myocardium of SV129 mice (n=36) following ligation of the left anterior descending (LAD) artery. Bioluminescence imaging (BLI) and echocardiography showed that VEGF(165) induction led to significant improvements in both transplanted cell survival and cardiac function (p<0.05). This is the first study to demonstrate imaging of embryonic stem cell-mediated gene therapy targeting cardiovascular disease. With further validation, this platform may have broad applications for current basic research and further clinical studies.

In-vivo luminescence model for the study of tumor regression and regrowth following combination regimens with differentiation-promoting agents and photodynamic therapy

NASA Astrophysics Data System (ADS)

Rollakanti, K.; Anand, S.; Maytin, E. V.

2013-03-01

Photodynamic therapy with aminolevulinic acid can be modified by pretreatment regimens with drugs such as 5- Fluorouracil (5-FU) or Vitamin D (calcitriol) that enhance accumulation of protoporphyrin IX (PpIX) within tumor tissue which presumably will enhance the therapeutic response to light. However, histological approaches for monitoring therapeutic responses are poorly suited for studying long term survival because large numbers of mice need to be sacrificed. To address this limitation, a non-invasive model to monitor tumor regression and regrowth has been established. Breast cancer cells, stably transfected with firefly luciferase (MDA-Luc cell line), are implanted orthotopically in nude mice (0.25 - 1 x 106 cells/site), and monitored 0-60 min after s.c. injection of luciferin, with Xenogen in-vivo imaging system. Luminescence is detectable at day 1 post-implantation. Tumors are suitable for experimentation on day 6, when daily injections of pretreatment agents (5-FU, 300 mg/kg; calcitriol, 1 μg/kg) begin. On day 9, ALA (75 mg/kg i.p.) is given for 4 hr, followed by illumination (633 nm, 100 J/cm2). Tumor luminescence post- PDT is monitored daily and compared with caliper measurements. Pretreatments (5-FU, calcitriol) by themselves do not inhibit luciferase expression, and all tumors grow at a similar rate during the pretreatment period. Results from in vivo survival experiments can be correlated to survival responses of MDA-Luc cells grown in monolayer cultures +/- PDT and +/- pretreatments, and additional mechanistic information (e.g. Ki67 and E-cadherin expression) obtained. In summary, this noninvasive model will permit testing of the therapeutic survival advantages of various pretreatments during cPDT.

OsLOL1, a C2C2-type zinc finger protein, interacts with OsbZIP58 to promote seed germination through the modulation of gibberellin biosynthesis in Oryza sativa.

PubMed

Wu, Jiahe; Zhu, Chuanfeng; Pang, Jinhuan; Zhang, Xiangrong; Yang, Chunlin; Xia, Guixian; Tian, Yingchuan; He, Chaozu

2014-12-01

Seed germination is a key developmental process in the plant life cycle that is influenced by various environmental cues and phytohormones through gene expression and a series of metabolism pathways. In the present study, we investigated a C2C2-type finger protein, OsLOL1, which promotes gibberellin (GA) biosynthesis and affects seed germination in Oryza sativa (rice). We used OsLOL1 antisense and sense transgenic lines to explore OsLOL1 functions. Seed germination timing in antisense plants was restored to wild type when exogenous GA3 was applied. The reduced expression of the GA biosynthesis gene OsKO2 and the accumulation of ent-kaurene were observed during germination in antisense plants. Based on yeast two-hybrid and firefly luciferase complementation analyses, OsLOL1 interacted with the basic leucine zipper protein OsbZIP58. The results from electrophoretic mobility shift and dual-luciferase reporter assays showed that OsbZIP58 binds the G-box cis-element of the OsKO2 promoter and activates LUC reporter gene expression, and that interaction between OsLOL1 and OsbZIP58 activates OsKO2 gene expression. In addition, OsLOL1 decreased SOD1 gene expression and accelerated programmed cell death (PCD) in the aleurone layer of rice grains. These findings demonstrate that the interaction between OsLOL1 and OsbZIP58 influences GA biosynthesis through the activation of OsKO2 via OsbZIP58, thereby stimulating aleurone PCD and seed germination. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

Natural compounds isolated from Brazilian plants are potent inhibitors of hepatitis C virus replication in vitro.

PubMed

Jardim, A C G; Igloi, Z; Shimizu, J F; Santos, V A F F M; Felippe, L G; Mazzeu, B F; Amako, Y; Furlan, M; Harris, M; Rahal, P

2015-03-01

Compounds extracted from plants can provide an alternative approach to new therapies. They present characteristics such as high chemical diversity, lower cost of production and milder or inexistent side effects compared with conventional treatment. The Brazilian flora represents a vast, largely untapped, resource of potential antiviral compounds. In this study, we investigate the antiviral effects of a panel of natural compounds isolated from Brazilian plants species on hepatitis C virus (HCV) genome replication. To do this we used firefly luciferase-based HCV sub-genomic replicons of genotypes 2a (JFH-1), 1b and 3a and the compounds were assessed for their effects on both HCV replication and cellular toxicity. Initial screening of compounds was performed using the maximum non-toxic concentration and 4 compounds that exhibited a useful therapeutic index (favourable ratio of cytotoxicity to antiviral potency) were selected for extra analysis. The compounds APS (EC50=2.3μM), a natural alkaloid isolated from Maytrenus ilicifolia, and the lignans 3(∗)43 (EC50=4.0μM), 3(∗)20 (EC50=8.2μM) and 5(∗)362 (EC50=38.9μM) from Peperomia blanda dramatically inhibited HCV replication as judged by reductions in luciferase activity and HCV protein expression in both the subgenomic and infectious systems. We further show that these compounds are active against a daclatasvir resistance mutant subgenomic replicon. Consistent with inhibition of genome replication, production of infectious JFH-1 virus was significantly reduced by all 4 compounds. These data are the first description of Brazilian natural compounds possessing anti-HCV activity and further analyses are being performed in order to investigate the mode of action of those compounds. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

High-throughput, luciferase-based reverse genetics systems for identifying inhibitors of Marburg and Ebola viruses.

PubMed

Uebelhoer, Luke S; Albariño, César G; McMullan, Laura K; Chakrabarti, Ayan K; Vincent, Joel P; Nichol, Stuart T; Towner, Jonathan S

2014-06-01

Marburg virus (MARV) and Ebola virus (EBOV), members of the family Filoviridae, represent a significant challenge to global public health. Currently, no licensed therapies exist to treat filovirus infections, which cause up to 90% mortality in human cases. To facilitate development of antivirals against these viruses, we established two distinct screening platforms based on MARV and EBOV reverse genetics systems that express secreted Gaussia luciferase (gLuc). The first platform is a mini-genome replicon to screen viral replication inhibitors using gLuc quantification in a BSL-2 setting. The second platform is complementary to the first and expresses gLuc as a reporter gene product encoded in recombinant infectious MARV and EBOV, thereby allowing for rapid quantification of viral growth during treatment with antiviral compounds. We characterized these viruses by comparing luciferase activity to virus production, and validated luciferase activity as an authentic real-time measure of viral growth. As proof of concept, we adapt both mini-genome and infectious virus platforms to high-throughput formats, and demonstrate efficacy of several antiviral compounds. We anticipate that both approaches will prove highly useful in the development of anti-filovirus therapies, as well as in basic research on the filovirus life cycle. Published by Elsevier B.V.

Identification of DNA-binding proteins using multi-features fusion and binary firefly optimization algorithm.

PubMed

Zhang, Jian; Gao, Bo; Chai, Haiting; Ma, Zhiqiang; Yang, Guifu

2016-08-26

DNA-binding proteins (DBPs) play fundamental roles in many biological processes. Therefore, the developing of effective computational tools for identifying DBPs is becoming highly desirable. In this study, we proposed an accurate method for the prediction of DBPs. Firstly, we focused on the challenge of improving DBP prediction accuracy with information solely from the sequence. Secondly, we used multiple informative features to encode the protein. These features included evolutionary conservation profile, secondary structure motifs, and physicochemical properties. Thirdly, we introduced a novel improved Binary Firefly Algorithm (BFA) to remove redundant or noisy features as well as select optimal parameters for the classifier. The experimental results of our predictor on two benchmark datasets outperformed many state-of-the-art predictors, which revealed the effectiveness of our method. The promising prediction performance on a new-compiled independent testing dataset from PDB and a large-scale dataset from UniProt proved the good generalization ability of our method. In addition, the BFA forged in this research would be of great potential in practical applications in optimization fields, especially in feature selection problems. A highly accurate method was proposed for the identification of DBPs. A user-friendly web-server named iDbP (identification of DNA-binding Proteins) was constructed and provided for academic use.

Firefly, Firefly: First Grade Students Learn, Talk, and Write about Light

ERIC Educational Resources Information Center

Mesa, Jennifer; Sorensen, Kirsten

2016-01-01

Inspired by a song to be sung by her daughter's first-grade class in an upcoming musical, a parent volunteer teacher used fireflies as the focus of a science lesson to build on the children's interest and experiences. She developed a 5E lesson (Bybee et al. 2006) using the backwards-design approach (Wiggins and McTighe 2005) to ensure meaningful…

Rayleigh wave nonlinear inversion based on the Firefly algorithm

NASA Astrophysics Data System (ADS)

Zhou, Teng-Fei; Peng, Geng-Xin; Hu, Tian-Yue; Duan, Wen-Sheng; Yao, Feng-Chang; Liu, Yi-Mou

2014-06-01

Rayleigh waves have high amplitude, low frequency, and low velocity, which are treated as strong noise to be attenuated in reflected seismic surveys. This study addresses how to identify useful shear wave velocity profile and stratigraphic information from Rayleigh waves. We choose the Firefly algorithm for inversion of surface waves. The Firefly algorithm, a new type of particle swarm optimization, has the advantages of being robust, highly effective, and allows global searching. This algorithm is feasible and has advantages for use in Rayleigh wave inversion with both synthetic models and field data. The results show that the Firefly algorithm, which is a robust and practical method, can achieve nonlinear inversion of surface waves with high resolution.

Testing a Firefly-Inspired Synchronization Algorithm in a Complex Wireless Sensor Network

PubMed Central

Hao, Chuangbo; Song, Ping; Yang, Cheng; Liu, Xiongjun

2017-01-01

Data acquisition is the foundation of soft sensor and data fusion. Distributed data acquisition and its synchronization are the important technologies to ensure the accuracy of soft sensors. As a research topic in bionic science, the firefly-inspired algorithm has attracted widespread attention as a new synchronization method. Aiming at reducing the design difficulty of firefly-inspired synchronization algorithms for Wireless Sensor Networks (WSNs) with complex topologies, this paper presents a firefly-inspired synchronization algorithm based on a multiscale discrete phase model that can optimize the performance tradeoff between the network scalability and synchronization capability in a complex wireless sensor network. The synchronization process can be regarded as a Markov state transition, which ensures the stability of this algorithm. Compared with the Miroll and Steven model and Reachback Firefly Algorithm, the proposed algorithm obtains better stability and performance. Finally, its practicality has been experimentally confirmed using 30 nodes in a real multi-hop topology with low quality links. PMID:28282899

Testing a Firefly-Inspired Synchronization Algorithm in a Complex Wireless Sensor Network.

PubMed

Hao, Chuangbo; Song, Ping; Yang, Cheng; Liu, Xiongjun

2017-03-08

Data acquisition is the foundation of soft sensor and data fusion. Distributed data acquisition and its synchronization are the important technologies to ensure the accuracy of soft sensors. As a research topic in bionic science, the firefly-inspired algorithm has attracted widespread attention as a new synchronization method. Aiming at reducing the design difficulty of firefly-inspired synchronization algorithms for Wireless Sensor Networks (WSNs) with complex topologies, this paper presents a firefly-inspired synchronization algorithm based on a multiscale discrete phase model that can optimize the performance tradeoff between the network scalability and synchronization capability in a complex wireless sensor network. The synchronization process can be regarded as a Markov state transition, which ensures the stability of this algorithm. Compared with the Miroll and Steven model and Reachback Firefly Algorithm, the proposed algorithm obtains better stability and performance. Finally, its practicality has been experimentally confirmed using 30 nodes in a real multi-hop topology with low quality links.

Variation in opsin genes correlates with signaling ecology in North American fireflies

PubMed Central

Sander, Sarah E.; Hall, David W.

2015-01-01

Genes underlying signal reception should evolve to maximize signal detection in a particular environment. In animals, opsins, the protein component of visual pigments, are predicted to evolve according to this expectation. Fireflies are known for their bioluminescent mating signals. The eyes of nocturnal species are expected to maximize detection of conspecific signal colors emitted in the typical low-light environment. This is not expected for species that have transitioned to diurnal activity in bright daytime environments. Here we test the hypothesis that opsin gene sequence plays a role in modifying firefly eye spectral sensitivity. We use genome and transcriptome sequencing in four firefly species, transcriptome sequencing in six additional species, and targeted gene sequencing in 28 other species to identify all opsin genes present in North American fireflies and to elucidate amino acid sites under positive selection. We also determine whether amino acid substitutions in opsins are linked to evolutionary changes in signal mode, signal color, and light environment. We find only two opsins, one long wavelength and one ultraviolet, in all firefly species and identify 25 candidate sites that may be involved in determining spectral sensitivity. In addition, we find elevated rates of evolution at transitions to diurnal activity, and changes in selective constraint on LW opsin associated with changes in light environment. Our results suggest that changes in eye spectral sensitivity are at least partially due to opsin sequence. Fireflies continue to be a promising system in which to investigate the evolution of signals, receptors, and signaling environments. PMID:26289828

Suppression of nemo-like kinase by miR-71 in Echinococcus multilocularis.

PubMed

Guo, Xiaola; Zhang, Xueyong; Yang, Jing; Jin, Xiaoliang; Ding, Juntao; Xiang, Haitao; Ayaz, Mazhar; Luo, Xuenong; Zheng, Yadong

2017-12-01

Echinococcus multilocularis metacestodes are a causative pathogen for alveolar echinococcosis in human beings, and have been found to express miRNAs including emu-miR-71. miR-71 is evolutionarily conserved and highly expressed across platyhelminths, but little is known about its role. Here it was shown that emu-miR-71 was differentially expressed in protoscoleces and was unlikely to be expressed in neoblasts. The results of the luciferase assay indicated that emu-miR-71 was able to bind in vitro to the 3'-UTR of emu-nlk, encoding a key regulator of cell division, causing significant downregulation of luciferase activity (p < 0.01) compared to the negative control and the construct with mutations in the binding site. Consistent with the decreased luciferase activity, transfection of emu-miR-71 mimics into protoscoleces notably repressed emu-NLK (p < 0.05). These results demonstrate the suppression of emu-nlk by emu-miR-71, potentially involved in the protoscolex development. Copyright © 2017 Elsevier Inc. All rights reserved.

Intelligent Design of Nano-Scale Molecular Imaging Agents

PubMed Central

Kim, Sung Bae; Hattori, Mitsuru; Ozawa, Takeaki

2012-01-01

Visual representation and quantification of biological processes at the cellular and subcellular levels within living subjects are gaining great interest in life science to address frontier issues in pathology and physiology. As intact living subjects do not emit any optical signature, visual representation usually exploits nano-scale imaging agents as the source of image contrast. Many imaging agents have been developed for this purpose, some of which exert nonspecific, passive, and physical interaction with a target. Current research interest in molecular imaging has mainly shifted to fabrication of smartly integrated, specific, and versatile agents that emit fluorescence or luminescence as an optical readout. These agents include luminescent quantum dots (QDs), biofunctional antibodies, and multifunctional nanoparticles. Furthermore, genetically encoded nano-imaging agents embedding fluorescent proteins or luciferases are now gaining popularity. These agents are generated by integrative design of the components, such as luciferase, flexible linker, and receptor to exert a specific on–off switching in the complex context of living subjects. In the present review, we provide an overview of the basic concepts, smart design, and practical contribution of recent nano-scale imaging agents, especially with respect to genetically encoded imaging agents. PMID:23235326

Intelligent design of nano-scale molecular imaging agents.

PubMed

Kim, Sung Bae; Hattori, Mitsuru; Ozawa, Takeaki

2012-12-12

Visual representation and quantification of biological processes at the cellular and subcellular levels within living subjects are gaining great interest in life science to address frontier issues in pathology and physiology. As intact living subjects do not emit any optical signature, visual representation usually exploits nano-scale imaging agents as the source of image contrast. Many imaging agents have been developed for this purpose, some of which exert nonspecific, passive, and physical interaction with a target. Current research interest in molecular imaging has mainly shifted to fabrication of smartly integrated, specific, and versatile agents that emit fluorescence or luminescence as an optical readout. These agents include luminescent quantum dots (QDs), biofunctional antibodies, and multifunctional nanoparticles. Furthermore, genetically encoded nano-imaging agents embedding fluorescent proteins or luciferases are now gaining popularity. These agents are generated by integrative design of the components, such as luciferase, flexible linker, and receptor to exert a specific on-off switching in the complex context of living subjects. In the present review, we provide an overview of the basic concepts, smart design, and practical contribution of recent nano-scale imaging agents, especially with respect to genetically encoded imaging agents.

Expression of foreign genes in filamentous cyanobacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuritz, T.; Wolk, C.P.

1993-06-01

Several advantages make cyanobacteria attractive hosts for biodegradative genes and possibly for other exogenous genes that have practical uses. The authors have obtained expression in Anabaena sp. strain PCC 7120 and Nostoc ellipsosporum of a dechlorination operon, fcbAB, from Arthrobacter globiformis, and have also developed a simple method for qualitative assessment of dechlorination by microorganisms, such as cyanobacteria, whose metabolism is dependent on the presence of chloride in the medium. Transcription of fcbAB under the control of a variety of promoters was monitored by placing luxAB (encoding luciferase) downstream from fcbAB, and by measuring light emission from luciferase. They believemore » that the system that they have described has value as a means to screen for factors influencing transcription of foreign genes in cyanobacteria.« less

Flash Bulletin: Fireflies

ERIC Educational Resources Information Center

Brown, Debbie

1984-01-01

Explains the flashes of light emitted by fireflies as competition, species-specific code, species identification and mating behavior and ecology. Suggests activities to conduct to study the insects and their behavior. (ERB)

Optimal Battery Sizing in Photovoltaic Based Distributed Generation Using Enhanced Opposition-Based Firefly Algorithm for Voltage Rise Mitigation

PubMed Central

Wong, Ling Ai; Shareef, Hussain; Mohamed, Azah; Ibrahim, Ahmad Asrul

2014-01-01

This paper presents the application of enhanced opposition-based firefly algorithm in obtaining the optimal battery energy storage systems (BESS) sizing in photovoltaic generation integrated radial distribution network in order to mitigate the voltage rise problem. Initially, the performance of the original firefly algorithm is enhanced by utilizing the opposition-based learning and introducing inertia weight. After evaluating the performance of the enhanced opposition-based firefly algorithm (EOFA) with fifteen benchmark functions, it is then adopted to determine the optimal size for BESS. Two optimization processes are conducted where the first optimization aims to obtain the optimal battery output power on hourly basis and the second optimization aims to obtain the optimal BESS capacity by considering the state of charge constraint of BESS. The effectiveness of the proposed method is validated by applying the algorithm to the 69-bus distribution system and by comparing the performance of EOFA with conventional firefly algorithm and gravitational search algorithm. Results show that EOFA has the best performance comparatively in terms of mitigating the voltage rise problem. PMID:25054184

Optimal battery sizing in photovoltaic based distributed generation using enhanced opposition-based firefly algorithm for voltage rise mitigation.

PubMed

Wong, Ling Ai; Shareef, Hussain; Mohamed, Azah; Ibrahim, Ahmad Asrul

2014-01-01

This paper presents the application of enhanced opposition-based firefly algorithm in obtaining the optimal battery energy storage systems (BESS) sizing in photovoltaic generation integrated radial distribution network in order to mitigate the voltage rise problem. Initially, the performance of the original firefly algorithm is enhanced by utilizing the opposition-based learning and introducing inertia weight. After evaluating the performance of the enhanced opposition-based firefly algorithm (EOFA) with fifteen benchmark functions, it is then adopted to determine the optimal size for BESS. Two optimization processes are conducted where the first optimization aims to obtain the optimal battery output power on hourly basis and the second optimization aims to obtain the optimal BESS capacity by considering the state of charge constraint of BESS. The effectiveness of the proposed method is validated by applying the algorithm to the 69-bus distribution system and by comparing the performance of EOFA with conventional firefly algorithm and gravitational search algorithm. Results show that EOFA has the best performance comparatively in terms of mitigating the voltage rise problem.

Adaptive firefly algorithm: parameter analysis and its application.

PubMed

Cheung, Ngaam J; Ding, Xue-Ming; Shen, Hong-Bin

2014-01-01

As a nature-inspired search algorithm, firefly algorithm (FA) has several control parameters, which may have great effects on its performance. In this study, we investigate the parameter selection and adaptation strategies in a modified firefly algorithm - adaptive firefly algorithm (AdaFa). There are three strategies in AdaFa including (1) a distance-based light absorption coefficient; (2) a gray coefficient enhancing fireflies to share difference information from attractive ones efficiently; and (3) five different dynamic strategies for the randomization parameter. Promising selections of parameters in the strategies are analyzed to guarantee the efficient performance of AdaFa. AdaFa is validated over widely used benchmark functions, and the numerical experiments and statistical tests yield useful conclusions on the strategies and the parameter selections affecting the performance of AdaFa. When applied to the real-world problem - protein tertiary structure prediction, the results demonstrated improved variants can rebuild the tertiary structure with the average root mean square deviation less than 0.4Å and 1.5Å from the native constrains with noise free and 10% Gaussian white noise.

Adaptive Firefly Algorithm: Parameter Analysis and its Application

PubMed Central

Shen, Hong-Bin

2014-01-01

As a nature-inspired search algorithm, firefly algorithm (FA) has several control parameters, which may have great effects on its performance. In this study, we investigate the parameter selection and adaptation strategies in a modified firefly algorithm — adaptive firefly algorithm (AdaFa). There are three strategies in AdaFa including (1) a distance-based light absorption coefficient; (2) a gray coefficient enhancing fireflies to share difference information from attractive ones efficiently; and (3) five different dynamic strategies for the randomization parameter. Promising selections of parameters in the strategies are analyzed to guarantee the efficient performance of AdaFa. AdaFa is validated over widely used benchmark functions, and the numerical experiments and statistical tests yield useful conclusions on the strategies and the parameter selections affecting the performance of AdaFa. When applied to the real-world problem — protein tertiary structure prediction, the results demonstrated improved variants can rebuild the tertiary structure with the average root mean square deviation less than 0.4Å and 1.5Å from the native constrains with noise free and 10% Gaussian white noise. PMID:25397812

Genome size of 14 species of fireflies (Insecta, Coleoptera, Lampyridae)

PubMed Central

Liu, Gui-Chun; Dong, Zhi-Wei; He, Jin-Wu; Zhao, Ruo-Ping; Wang, Wen; Li, Xue-Yan

2017-01-01

Eukaryotic genome size data are important both as the basis for comparative research into genome evolution and as estimators of the cost and difficulty of genome sequencing programs for non-model organisms. In this study, the genome size of 14 species of fireflies (Lampyridae) (two genera in Lampyrinae, three genera in Luciolinae, and one genus in subfamily incertae sedis) were estimated by propidium iodide (PI)-based flow cytometry. The haploid genome sizes of Lampyridae ranged from 0. 42 to 1. 31 pg, a 3. 1-fold span. Genome sizes of the fireflies varied within the tested subfamilies and genera. Lamprigera and Pyrocoelia species had large and small genome sizes, respectively. No correlation was found between genome size and morphological traits such as body length, body width, eye width, and antennal length. Our data provide additional information on genome size estimation of the firefly family Lampyridae. Furthermore, this study will help clarify the cost and difficulty of genome sequencing programs for non-model organisms and will help promote studies on firefly genome evolution. PMID:29280364

Dragonflies and Fireflies

ERIC Educational Resources Information Center

Mannlein, Sally

2009-01-01

Most first-graders are interested in insects. In this article, the author describes a lesson, "Dragonflies and Fireflies," which is a first-grade lesson showing drawing, symmetry, neighboring colors (analogous) and watercolor techniques.

Bioluminescence.

ERIC Educational Resources Information Center

Jones, M. Gail

1993-01-01

Describes bioluminescence and the chemistry of how it occurs. Presents information for conducting the following classroom activities: (1) firefly mimic; (2) modeling deep-sea fish; (3) sea fireflies; and (4) the chemistry of light. (PR)

75 FR 39143 - Airworthiness Directives; Arrow Falcon Exporters, Inc. (previously Utah State University); AST...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-07-08

... Firefly Aviation Helicopter Services, and Erickson Air-Crane); Rotorcraft Development Corporation..., Inc. (Previously Firefly Aviation Helicopter Services, and Erickson Air-Crane); Rotorcraft Development...

Distinct expression profile of HCMV encoded miRNAs in plasma from oral lichen planus patients.

PubMed

Ding, Meng; Wang, Xiang; Wang, Cheng; Liu, Xiaoshuang; Zen, Ke; Wang, Wenmei; Zhang, Chen-Yu; Zhang, Chunni

2017-06-07

Oral lichen planus (OLP) is a T cell-mediated autoimmune disease. The aetiology and molecular mechanisms of OLP remain unclear. Human cytomegalovirus (HCMV) infection is a causal factor in the development of various diseases, but the clinical relevance of HCMV in OLP has not been thoroughly investigated. In the present study, we firstly examined twenty-three HCMV-encoded microRNA (miRNA) expression profiles in plasma from training set that including 21 OLP patients and 18 healthy controls using RT-qPCR technology. Dysregulated miRNAs were subsequently confirmed in another larger cohort refereed as validation set consisting of 40 OLP patients and 33 healthy controls. HCMV DNA in peripheral blood leukocytes (PBLs) was also measured in an additional cohort of 13 OLP patients and 12 control subjects. Furthermore, bioinformatics analyses, luciferase reporter assay and western blotting were also performed to predict and verify the direct potential targets of HCMV-encoded miRNAs. The RT-qPCR results showed that the plasma levels of five HCMV-encoded miRNAs including hcmv-miR-UL112-3p, hcmv-miR-UL22a-5p, hcmv-miR-UL148d, hcmv-miR-UL36-5p and hcmv-miR-UL59 were significantly increased in OLP patients in both training and validation sets. HCMV DNA in PBLs was also significantly higher in OLP patients than in control subjects. Additionally, by using a combination of luciferase reporter assay and western blotting, we demonstrated that cytomegalovirus UL16-binding protein 1, a molecule that mediates the killing of virus-infected cells by natural killer cells, is a direct target of hcmv-miR-UL59. Our results demonstrate a distinct expression pattern of HCMV-encoded miRNAs in OLP patients, which may provide insight into the relationship between HCMV infection and OLP, and warrants additional study in the diagnosis and aetiology of OLP.

Activation of cAMP-dependent signaling pathway induces mouse organic anion transporting polypeptide 2 expression.

PubMed

Chen, Chuan; Cheng, Xingguo; Dieter, Matthew Z; Tanaka, Yuji; Klaassen, Curtis D

2007-04-01

Rodent Oatp2 is a hepatic uptake transporter for such compounds as cardiac glycosides. In the present study, we found that fasting resulted in a 2-fold induction of Oatp2 expression in liver of mice. Because the cAMP-protein kinase A (PKA) signaling pathway is activated during fasting, the role of this pathway in Oatp2 induction during fasting was examined. In Hepa-1c1c7 cells, adenylyl cyclase activator forskolin as well as two cellular membrane-permeable cAMP analogs, dibutyryl cAMP and 8-bromo-cAMP, induced Oatp2 mRNA expression in a time- and dose-dependent manner. These three chemicals induced reporter gene activity in cells transfected with a luciferase reporter gene construct containing a 7.6-kilobase (kb) 5'-flanking region of mouse Oatp2. Transient transfection of cells with 5'-deletion constructs derived from the 7.6-kb Oatp2 promoter reporter gene construct, as well as 7.6-kb constructs in which a consensus cAMP response element (CRE) half-site CGTCA (-1808/-1804 bp) was mutated or deleted, confirms that this CRE site was required for the induction of luciferase activity by forskolin. Luciferase activity driven by the Oatp2 promoter containing this CRE site was induced in cells cotransfected with a plasmid encoding the protein kinase A catalytic subunit. Cotransfection of cells with a plasmid encoding the dominant-negative CRE binding protein (CREB) completely abolished the inducibility of the reporter gene activity by forskolin. In conclusion, induction of Oatp2 expression in liver of fasted mice may be caused by activation of the cAMP-dependent signaling pathway, with the CRE site (-1808/-1804) and CREB being the cis- and trans-acting factors mediating the induction, respectively.

Functional overload increases beta-MHC promoter activity in rodent fast muscle via the proximal MCAT (betae3) site.

PubMed

Giger, Julia M; Haddad, Fadia; Qin, Anqi X; Baldwin, Kenneth M

2002-03-01

Functional overload (OL) of the rat plantaris muscle by the removal of synergistic muscles induces a shift in the myosin heavy chain (MHC) isoform expression profile from the fast isoforms toward the slow type I, or, beta-MHC isoform. Different length rat beta-MHC promoters were linked to a firefly luciferase reporter gene and injected in control and OL plantaris muscles. Reporter activities of -3,500, -914, -408, and -215 bp promoters increased in response to 1 wk of OL. The smallest -171 bp promoter was not responsive to OL. Mutation analyses of putative regulatory elements within the -171 and -408 bp region were performed. The -408 bp promoters containing mutations of the betae1, distal muscle CAT (MCAT; betae2), CACC, or A/T-rich (GATA), were still responsive to OL. Only the proximal MCAT (betae3) mutation abolished the OL response. Gel mobility shift assays revealed a significantly higher level of complex formation of the betae3 probe with nuclear protein from OL plantaris compared with control plantaris. These results suggest that the betae3 site functions as a putative OL-responsive element in the rat beta-MHC gene promoter.

Interaction of Osmotic Stress, Temperature, and Abscisic Acid in the Regulation of Gene Expression in Arabidopsis

PubMed Central

Xiong, Liming; Ishitani, Manabu; Zhu, Jian-Kang

1999-01-01

The impact of simultaneous environmental stresses on plants and how they respond to combined stresses compared with single stresses is largely unclear. By using a transgene (RD29A-LUC) consisting of the firefly luciferase coding sequence (LUC) driven by the stress-responsive RD29A promoter, we investigated the interactive effects of temperature, osmotic stress, and the phytohormone abscisic acid (ABA) in the regulation of gene expression in Arabidopsis seedlings. Results indicated that both positive and negative interactions exist among the studied stress factors in regulating gene expression. At a normal growth temperature (22°C), osmotic stress and ABA act synergistically to induce the transgene expression. Low temperature inhibits the response to osmotic stress or to combined treatment of osmotic stress and ABA, whereas low temperature and ABA treatments are additive in inducing transgene expression. Although high temperature alone does not activate the transgene, it significantly amplifies the effects of ABA and osmotic stress. The effect of multiple stresses in the regulation of RD29A-LUC expression in signal transduction mutants was also studied. The results are discussed in the context of cold and osmotic stress signal transduction pathways. PMID:9880362

Bright to Dim Oscillatory Response of the Neurospora Circadian Oscillator

PubMed Central

Gooch, Van D.; Johnson, Alicia E.; Larrondo, Luis F.; Loros, Jennifer J.; Dunlap, Jay C.

2014-01-01

The fungus Neurospora crassa constitutes an important model system extensively used in chronobiology. Several studies have addressed how environmental cues, such as light, can reset or synchronize a circadian system. By means of an optimized firefly luciferase reporter gene and a controllable lighting system, we show that Neurospora can display molecular circadian rhythms in dim light when cultures receive bright light prior to entering dim light conditions. We refer to this behavior as the “bright to dim oscillatory response” (BDOR). The bright light treatment can be applied up to 76 h prior to dim exposure, and it can be as short as 15 min in duration. We have characterized this response in respect to the duration of the light pulse, the time of the light pulse before dim, the intensity of dim light, and the oscillation dynamics in dim light. Although the molecular mechanism that drives the BDOR remains obscure, these findings suggest that a long-term memory of bright light exists as part of the circadian molecular components. It is important to consider the ecological significance of such dim light responses in respect to how organisms naturally maintain their timing mechanism in moonlight. PMID:24492882

Bright to dim oscillatory response of the Neurospora circadian oscillator.

PubMed

Gooch, Van D; Johnson, Alicia E; Larrondo, Luis F; Loros, Jennifer J; Dunlap, Jay C

2014-02-01

The fungus Neurospora crassa constitutes an important model system extensively used in chronobiology. Several studies have addressed how environmental cues, such as light, can reset or synchronize a circadian system. By means of an optimized firefly luciferase reporter gene and a controllable lighting system, we show that Neurospora can display molecular circadian rhythms in dim light when cultures receive bright light prior to entering dim light conditions. We refer to this behavior as the "bright to dim oscillatory response" (BDOR). The bright light treatment can be applied up to 76 h prior to dim exposure, and it can be as short as 15 min in duration. We have characterized this response in respect to the duration of the light pulse, the time of the light pulse before dim, the intensity of dim light, and the oscillation dynamics in dim light. Although the molecular mechanism that drives the BDOR remains obscure, these findings suggest that a long-term memory of bright light exists as part of the circadian molecular components. It is important to consider the ecological significance of such dim light responses in respect to how organisms naturally maintain their timing mechanism in moonlight.

Extrachromosomal HPV-16 LCR transcriptional activation by HDACi opposed by cellular differentiation and DNA integration.

PubMed

Bojilova, Ekaterina Dimitrova; Weyn, Christine; Antoine, Marie-Hélène; Fontaine, Véronique

2016-11-15

Histone deacetylase inhibitors (HDACi) have been shown to render HPV-carrying cells susceptible to intrinsic and extrinsic apoptotic signals. As such, these epigenetic drugs have entered clinical trials in the effort to treat cervical cancer. Here, we studied the effect of common HDACi, with an emphasis on Trichostatin A (TSA), on the transcriptional activity of the HPV-16 Long Control Region (LCR) in order to better understand the impact of these agents in the context of the HPV life cycle and infection. HDACi strongly induced transcription of the firefly luciferase reporter gene under the control of the HPV-16 LCR in a variety of cell lines. In the HaCaT keratinocyte cell line undergoing differentiation induced by TSA, we observed a reduction in LCR-controlled transcription. Three major AP-1 binding sites in the HPV-16 LCR are involved in the regulation by TSA. However, whatever the status of differentiation of the HaCaT cells, TSA induced integration of extra-chromosomal transfected DNA into the cellular genome. Although these data suggest caution using HDACi in the treatment of HR HPV infection, further in vivo studies are necessary to better assess the risk.

Extrachromosomal HPV-16 LCR transcriptional activation by HDACi opposed by cellular differentiation and DNA integration

PubMed Central

Bojilova, Ekaterina Dimitrova; Weyn, Christine; Antoine, Marie-Hélène; Fontaine, Véronique

2016-01-01

Histone deacetylase inhibitors (HDACi) have been shown to render HPV-carrying cells susceptible to intrinsic and extrinsic apoptotic signals. As such, these epigenetic drugs have entered clinical trials in the effort to treat cervical cancer. Here, we studied the effect of common HDACi, with an emphasis on Trichostatin A (TSA), on the transcriptional activity of the HPV-16 Long Control Region (LCR) in order to better understand the impact of these agents in the context of the HPV life cycle and infection. HDACi strongly induced transcription of the firefly luciferase reporter gene under the control of the HPV-16 LCR in a variety of cell lines. In the HaCaT keratinocyte cell line undergoing differentiation induced by TSA, we observed a reduction in LCR-controlled transcription. Three major AP-1 binding sites in the HPV-16 LCR are involved in the regulation by TSA. However, whatever the status of differentiation of the HaCaT cells, TSA induced integration of extra-chromosomal transfected DNA into the cellular genome. Although these data suggest caution using HDACi in the treatment of HR HPV infection, further in vivo studies are necessary to better assess the risk. PMID:27705914

Changes in the regulation of heat shock gene expression in neuronal cell differentiation.

PubMed

Oza, Jay; Yang, Jingxian; Chen, Kuang Yu; Liu, Alice Y-C

2008-01-01

Neuronal differentiation of the NG108-15 neuroblastoma-glioma hybrid cells is accompanied by a marked attenuation in the heat shock induction of the Hsp70-firefly luciferase reporter gene activity. Analysis of the amount and activation of heat shock factor 1, induction of mRNA(hsp), and the synthesis and accumulation of heat shock proteins (HSPs) in the undifferentiated and differentiated cells suggest a transcriptional mechanism for this attenuation. Concomitant with a decreased induction of the 72-kDa Hsp70 protein in the differentiated cells, there is an increased abundance of the constitutive 73-kDa Hsc70, a protein known to function in vesicle trafficking. Assessment of sensitivity of the undifferentiated and differentiated cells against stress-induced cell death reveals a significantly greater vulnerability of the differentiated cells toward the cytotoxic effects of arsenite and glutamate/glycine. This study shows that changes in regulation of the HSP and HSC proteins are components of the neuronal cell differentiation program and that the attenuated induction of HSPs likely contributes to neuronal vulnerability whereas the increased expression of Hsc70 likely has a role in neural-specific functions.

Firefly courtship as the basis of the synchronization-response principle

NASA Astrophysics Data System (ADS)

Ramírez Ávila, G. M.; Deneubourg, J.-L.; Guisset, J.-L.; Wessel, N.; Kurths, J.

2011-06-01

Response to synchronization seems to be a widespread phenomenon specially in biological systems. We highlight this phenomenon studying the courtship of flashing fireflies in which a typical collective rhythm occurring only among the males arises and it is followed by a response of the females. Based on a model issued from electronic fireflies, we explain the synchronization of the males and the active responses of the females in the courtship of mingled (both sexes) populations of fireflies. The model also explains the courtship behavior of other species whose interactions follow the same logic even if their physical features are different. Moreover, the model can make predictions on the behavior of mingled and mixed (natural and artificial) groups of such animals. This finding could be considered as the basis of a new principle, namely the synchronization-response.

Using Firefly Tools to Enhance Archive Web Pages

NASA Astrophysics Data System (ADS)

Roby, W.; Wu, X.; Ly, L.; Goldina, T.

2013-10-01

Astronomy web developers are looking for fast and powerful HTML 5/AJAX tools to enhance their web archives. We are exploring ways to make this easier for the developer. How could you have a full FITS visualizer or a Web 2.0 table that supports paging, sorting, and filtering in your web page in 10 minutes? Can it be done without even installing any software or maintaining a server? Firefly is a powerful, configurable system for building web-based user interfaces to access astronomy science archives. It has been in production for the past three years. Recently, we have made some of the advanced components available through very simple JavaScript calls. This allows a web developer, without any significant knowledge of Firefly, to have FITS visualizers, advanced table display, and spectrum plots on their web pages with minimal learning curve. Because we use cross-site JSONP, installing a server is not necessary. Web sites that use these tools can be created in minutes. Firefly was created in IRSA, the NASA/IPAC Infrared Science Archive (http://irsa.ipac.caltech.edu). We are using Firefly to serve many projects including Spitzer, Planck, WISE, PTF, LSST and others.

Experimental tests of light-pollution impacts on nocturnal insect courtship and dispersal.

PubMed

Firebaugh, Ariel; Haynes, Kyle J

2016-12-01

Though a number of effects of artificial light pollution on behavior and physiology have been described, there is little understanding of their consequences for the growth and distribution of populations. Here, we document impacts of light pollution on aspects of firefly population ecology and underlying mating behaviors. Many firefly species have a unique communication system whereby bioluminescent flashes are used in courtship displays to find and attract mates. We performed a series of manipulative field experiments in which we quantified the effects of adding artificial nighttime lighting on abundances and total flashing activity of fireflies, courtship behaviors and mating between tethered females and free-flying males, and dispersal distances of marked individuals. We show that light pollution reduces flashing activities in a dark-active firefly species (Photuris versicolor) by 69.69 % and courtship behavior and mating success in a twilight-active species (Photinus pyralis). Though courtship behavior and mating success of Photinus pyralis was reduced by light pollution, we found no effects of light pollution on male dispersal in this species. Our findings suggest that light pollution is likely to adversely impact firefly populations, and contribute to wider discussions about the ecological consequences of sensory pollution.

Forecasting Jakarta composite index (IHSG) based on chen fuzzy time series and firefly clustering algorithm

NASA Astrophysics Data System (ADS)

Ningrum, R. W.; Surarso, B.; Farikhin; Safarudin, Y. M.

2018-03-01

This paper proposes the combination of Firefly Algorithm (FA) and Chen Fuzzy Time Series Forecasting. Most of the existing fuzzy forecasting methods based on fuzzy time series use the static length of intervals. Therefore, we apply an artificial intelligence, i.e., Firefly Algorithm (FA) to set non-stationary length of intervals for each cluster on Chen Method. The method is evaluated by applying on the Jakarta Composite Index (IHSG) and compare with classical Chen Fuzzy Time Series Forecasting. Its performance verified through simulation using Matlab.

The oxygenating constituent of 3,6-diketocamphane monooxygenase from the CAM plasmid of Pseudomonas putida: the first crystal structure of a type II Baeyer–Villiger monooxygenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Isupov, Michail N.; Schröder, Ewald; Gibson, Robert P.

The first crystal structure of a type II Baeyer–Villiger monooxygenase reveals a different ring orientation of its FMN cofactor compared with other related bacterial luciferase-family enzymes. The three-dimensional structures of the native enzyme and the FMN complex of the overexpressed form of the oxygenating component of the type II Baeyer–Villiger 3,6-diketocamphane monooxygenase have been determined to 1.9 Å resolution. The structure of this dimeric FMN-dependent enzyme, which is encoded on the large CAM plasmid of Pseudomonas putida, has been solved by a combination of multiple anomalous dispersion from a bromine crystal soak and molecular replacement using a bacterial luciferase model.more » The orientation of the isoalloxazine ring of the FMN cofactor in the active site of this TIM-barrel fold enzyme differs significantly from that previously observed in enzymes of the bacterial luciferase-like superfamily. The Ala77 residue is in a cis conformation and forms a β-bulge at the C-terminus of β-strand 3, which is a feature observed in many proteins of this superfamily.« less

Two different domains of the luciferase gene in the heterotrophic dinoflagellate Noctiluca scintillans occur as two separate genes in photosynthetic species

PubMed Central

Liu, Liyun; Hastings, J. Woodland

2007-01-01

Noctiluca scintillans, a heterotrophic unarmored unicellular bioluminescent dinoflagellate, occurs widely in the oceans, often as a bloom. Molecular phylogenetic analysis based on 18S ribosomal DNA sequences consistently has placed this species on the basal branch of dinoflagellates. Here, we report that the structural organization of its luciferase gene is strikingly different from that of the seven luminous species previously characterized, all of which are photosynthetic. The Noctiluca gene codes for a polypeptide that consists of two distinct but contiguous domains. One, which is located in the N-terminal portion, is shorter than but similar in sequence to the individual domains of the three-domain luciferases found in all other luminous dinoflagellates studied. The other, situated in the C-terminal part, has sequence similarity to the luciferin-binding protein of the luminous dinoflagellate Lingulodinium polyedrum, encoded there by a separate gene. Western analysis shows that the native protein has the same size (≈100 kDa) as the heterologously expressed polypeptide, indicating that it is not a polyprotein. Thus, sequences found in two proteins in the L. polyedrum bioluminescence system are present in a single polypeptide in Noctiluca. PMID:17130452

Expression, Purification, and Characterization of a Recombinant Flavin Reductase from the Luminescent Marine Bacterium "Photobacterium Leiognathi": A Set of Exercises for Students

ERIC Educational Resources Information Center

Crowley, Thomas E.

2010-01-01

In "Photobacterium," the flavin reductase encoded by "lux"G regenerates the reduced form of flavin mononucleotide (FMN). Reduced FMN is one of the substrates of the luciferase enzyme that catalyzes a light-emitting reaction. A set of experiments, that employs a "lux"G-expression plasmid construct (pGhis) and is suitable for an undergraduate…

A comparison of the pro-angiogenic potential of human induced pluripotent stem cell derived endothelial cells and induced endothelial cells in a murine model of peripheral arterial disease.

PubMed

Clayton, Zoe E; Yuen, Gloria S C; Sadeghipour, Sara; Hywood, Jack D; Wong, Jack W T; Huang, Ngan F; Ng, Martin K C; Cooke, John P; Patel, Sanjay

2017-05-01

Endothelial cells derived from human induced pluripotent stem cells (iPSC-ECs) promote angiogenesis, and more recently induced endothelial cells (iECs) have been generated via fibroblast trans-differentiation. These cell types have potential as treatments for peripheral arterial disease (PAD). However, it is unknown whether different reprogramming methods produce cells that are equivalent in terms of their pro-angiogenic capabilities. We aimed to directly compare iPSC-ECs and iECs in an animal model of PAD, in order to identify which cell type, if any, displays superior therapeutic potential. IPSC-ECs and iECs were generated from human fibroblasts, and transduced with a reporter construct encoding GFP and firefly luciferase for bioluminescence imaging (BLI). Endothelial phenotype was confirmed using in vitro assays. NOD-SCID mice underwent hindlimb ischaemia surgery and received an intramuscular injection of either 1×10 6 iPSC-ECs, 1×10 6 iECs or control vehicle only. Perfusion recovery was measured by laser Doppler. Hindlimb muscle samples were taken for histological analyses. Perfusion recovery was enhanced in iPSC-EC treated mice on day 14 (Control vs. iPSC-EC; 0.35±0.04 vs. 0.54±0.08, p<0.05) and in iEC treated mice on days 7 (Control vs. iEC; 0.23±0.02 vs. 0.44±0.06, p<0.05), 10 (0.31±0.04 vs. 0.64±0.07, p<0.001) and 14 (0.35±0.04 vs. 0.68±0.07, p<0.001) post-treatment. IEC-treated mice also had greater capillary density in the ischaemic gastrocnemius muscle (Control vs. iEC; 125±10 vs. 179±11 capillaries/image; p<0.05). BLI detected iPSC-EC and iEC presence in vivo for two weeks post-treatment. IPSC-ECs and iECs exhibit similar, but not identical, endothelial functionality and both cell types enhance perfusion recovery after hindlimb ischaemia. Copyright © 2017 Elsevier B.V. All rights reserved.

Machining Parameters Optimization using Hybrid Firefly Algorithm and Particle Swarm Optimization

NASA Astrophysics Data System (ADS)

Farahlina Johari, Nur; Zain, Azlan Mohd; Haszlinna Mustaffa, Noorfa; Udin, Amirmudin

2017-09-01

Firefly Algorithm (FA) is a metaheuristic algorithm that is inspired by the flashing behavior of fireflies and the phenomenon of bioluminescent communication and the algorithm is used to optimize the machining parameters (feed rate, depth of cut, and spindle speed) in this research. The algorithm is hybridized with Particle Swarm Optimization (PSO) to discover better solution in exploring the search space. Objective function of previous research is used to optimize the machining parameters in turning operation. The optimal machining cutting parameters estimated by FA that lead to a minimum surface roughness are validated using ANOVA test.

FIREFLY: A cubesat mission to study terrestrial gamma-ray flashes

NASA Astrophysics Data System (ADS)

Klenzing, J. H.; Rowland, D. E.; Hill, J.; Weatherwax, A. T.

2009-12-01

FIREFLY is small satellite mission to investigate the link between atmospheric lightning and terrestrial gamma-ray flashes scheduled to launch in late 2010. The instrumentation includes a Gamma-Ray Detector (GRD), VLF receiver, and photometer. GRD will measure the energy and arrival time of x-ray and gamma-ray photons, as well as the energetic electron flux by using a phoswitch-style layered scintillator. The current status of the instrumentation will be discussed, including laboratory tests and simulations of the GRD. FIREFLY is the second in a series of NSF-funded cubesats designed to study the upper atmosphere.

Flash signal evolution in Photinus fireflies: character displacement and signal exploitation in a visual communication system.

PubMed

Stanger-Hall, Kathrin F; Lloyd, James E

2015-03-01

Animal communication is an intriguing topic in evolutionary biology. In this comprehensive study of visual signal evolution, we used a phylogenetic approach to study the evolution of the flash communication system of North American fireflies. The North American firefly genus Photinus contains 35 described species with simple ON-OFF visual signals, and information on habitat types, sympatric congeners, and predators. This makes them an ideal study system to test hypotheses on the evolution of male and female visual signal traits. Our analysis of 34 Photinus species suggests two temporal pattern generators: one for flash duration and one for flash intervals. Reproductive character displacement was a main factor for signal divergence in male flash duration among sympatric Photinus species. Male flash pattern intervals (i.e., the duration of the dark periods between signals) were positively correlated with the number of sympatric Photuris fireflies, which include predators of Photinus. Females of different Photinus species differ in their response preferences to male traits. As in other communication systems, firefly male sexual signals seem to be a compromise between optimizing mating success (sexual selection) and minimizing predation risk (natural selection). An integrative model for Photinus signal evolution is proposed. © 2015 The Author(s).

Molecular characterization of firefly nuptial gifts: a multi-omics approach sheds light on postcopulatory sexual selection.

PubMed

Al-Wathiqui, Nooria; Fallon, Timothy R; South, Adam; Weng, Jing-Ke; Lewis, Sara M

2016-12-22

Postcopulatory sexual selection is recognized as a key driver of reproductive trait evolution, including the machinery required to produce endogenous nuptial gifts. Despite the importance of such gifts, the molecular composition of the non-gametic components of male ejaculates and their interactions with female reproductive tracts remain poorly understood. During mating, male Photinus fireflies transfer to females a spermatophore gift manufactured by multiple reproductive glands. Here we combined transcriptomics of both male and female reproductive glands with proteomics and metabolomics to better understand the synthesis, composition and fate of the spermatophore in the common Eastern firefly, Photinus pyralis. Our transcriptome of male glands revealed up-regulation of proteases that may enhance male fertilization success and activate female immune response. Using bottom-up proteomics we identified 208 functionally annotated proteins that males transfer to the female in their spermatophore. Targeted metabolomic analysis also provided the first evidence that Photinus nuptial gifts contain lucibufagin, a firefly defensive toxin. The reproductive tracts of female fireflies showed increased gene expression for several proteases that may be involved in egg production. This study offers new insights into the molecular composition of male spermatophores, and extends our understanding of how nuptial gifts may mediate postcopulatory interactions between the sexes.

Hands-on Science. How Fireflies Communicate.

ERIC Educational Resources Information Center

Kepler, Lynne

1995-01-01

One creative way that elementary science educators can teach their students about animal communication is to give them glow sticks and a set of cards with descriptions of what different firefly flash signals mean. The paper describes such a project and presents related activities. (SM)

Modulation of collagen-induced arthritis by adenovirus-mediated intra-articular expression of modified collagen type II.

PubMed

Tang, Bo; Cullins, David L; Zhou, Jing; Zawaski, Janice A; Park, Hyelee; Brand, David D; Hasty, Karen A; Gaber, M Waleed; Stuart, John M; Kang, Andrew H; Myers, Linda K

2010-01-01

Rheumatoid arthritis (RA) is a systemic disease manifested by chronic inflammation in multiple articular joints, including the knees and small joints of the hands and feet. We have developed a unique modification to a clinically accepted method for delivering therapies directly to the synovium. Our therapy is based on our previous discovery of an analog peptide (A9) with amino acid substitutions made at positions 260 (I to A), 261 (A to B), and 263 (F to N) that could profoundly suppress immunity to type II collagen (CII) and arthritis in the collagen-induced arthritis model (CIA). We engineered an adenoviral vector to contain the CB11 portion of recombinant type II collagen and used PCR to introduce point mutations at three sites within (CII124-402, 260A, 261B, 263D), (rCB11-A9) so that the resulting molecule contained the A9 sequence at the exact site of the wild-type sequence. We used this construct to target intra-articular tissues of mice and utilized the collagen-induced arthritis model to show that this treatment strategy provided a sustained, local therapy for individual arthritic joints, effective whether given to prevent arthritis or as a treatment. We also developed a novel system for in vivo bioimaging, using the firefly luciferase reporter gene to allow serial bioluminescence imaging to show that luciferase can be detected as late as 18 days post injection into the joint. Our therapy is unique in that we target synovial cells to ultimately shut down T cell-mediated inflammation. Its effectiveness is based on its ability to transform potential inflammatory T cells and/or bystander T cells into therapeutic (regulatory-like) T cells which secrete interleukin (IL)-4. We believe this approach has potential to effectively suppress RA with minimal side effects.

Modulation of collagen-induced arthritis by adenovirus-mediated intra-articular expression of modified collagen type II

PubMed Central

2010-01-01

Introduction Rheumatoid arthritis (RA) is a systemic disease manifested by chronic inflammation in multiple articular joints, including the knees and small joints of the hands and feet. We have developed a unique modification to a clinically accepted method for delivering therapies directly to the synovium. Our therapy is based on our previous discovery of an analog peptide (A9) with amino acid substitutions made at positions 260 (I to A), 261 (A to B), and 263 (F to N) that could profoundly suppress immunity to type II collagen (CII) and arthritis in the collagen-induced arthritis model (CIA). Methods We engineered an adenoviral vector to contain the CB11 portion of recombinant type II collagen and used PCR to introduce point mutations at three sites within (CII124-402, 260A, 261B, 263D), (rCB11-A9) so that the resulting molecule contained the A9 sequence at the exact site of the wild-type sequence. Results We used this construct to target intra-articular tissues of mice and utilized the collagen-induced arthritis model to show that this treatment strategy provided a sustained, local therapy for individual arthritic joints, effective whether given to prevent arthritis or as a treatment. We also developed a novel system for in vivo bioimaging, using the firefly luciferase reporter gene to allow serial bioluminescence imaging to show that luciferase can be detected as late as 18 days post injection into the joint. Conclusions Our therapy is unique in that we target synovial cells to ultimately shut down T cell-mediated inflammation. Its effectiveness is based on its ability to transform potential inflammatory T cells and/or bystander T cells into therapeutic (regulatory-like) T cells which secrete interleukin (IL)-4. We believe this approach has potential to effectively suppress RA with minimal side effects. PMID:20615221

Bioluminescence methodology for the detection of protein-protein interactions within the voltage-gated sodium channel macromolecular complex.

PubMed

Shavkunov, Alexander; Panova, Neli; Prasai, Anesh; Veselenak, Ron; Bourne, Nigel; Stoilova-McPhie, Svetla; Laezza, Fernanda

2012-04-01

Protein-protein interactions are critical molecular determinants of ion channel function and emerging targets for pharmacological interventions. Yet, current methodologies for the rapid detection of ion channel macromolecular complexes are still lacking. In this study we have adapted a split-luciferase complementation assay (LCA) for detecting the assembly of the voltage-gated Na+ (Nav) channel C-tail and the intracellular fibroblast growth factor 14 (FGF14), a functionally relevant component of the Nav channelosome that controls gating and targeting of Nav channels through direct interaction with the channel C-tail. In the LCA, two complementary N-terminus and C-terminus fragments of the firefly luciferase were fused, respectively, to a chimera of the CD4 transmembrane segment and the C-tail of Nav1.6 channel (CD4-Nav1.6-NLuc) or FGF14 (CLuc-FGF14). Co-expression of CLuc-FGF14 and CD4-Nav1.6-NLuc in live cells led to a robust assembly of the FGF14:Nav1.6 C-tail complex, which was attenuated by introducing single-point mutations at the predicted FGF14:Nav channel interface. To evaluate the dynamic regulation of the FGF14:Nav1.6 C-tail complex by signaling pathways, we investigated the effect of kinase inhibitors on the complex formation. Through a platform of counter screenings, we show that the p38/MAPK inhibitor, PD169316, and the IκB kinase inhibitor, BAY 11-7082, reduce the FGF14:Nav1.6 C-tail complementation, highlighting a potential role of the p38MAPK and the IκB/NFκB pathways in controlling neuronal excitability through protein-protein interactions. We envision the methodology presented here as a new valuable tool to allow functional evaluations of protein-channel complexes toward probe development and drug discovery targeting ion channels implicated in human disorders.

A Novel Hybrid Firefly Algorithm for Global Optimization.

PubMed

Zhang, Lina; Liu, Liqiang; Yang, Xin-She; Dai, Yuntao

Global optimization is challenging to solve due to its nonlinearity and multimodality. Traditional algorithms such as the gradient-based methods often struggle to deal with such problems and one of the current trends is to use metaheuristic algorithms. In this paper, a novel hybrid population-based global optimization algorithm, called hybrid firefly algorithm (HFA), is proposed by combining the advantages of both the firefly algorithm (FA) and differential evolution (DE). FA and DE are executed in parallel to promote information sharing among the population and thus enhance searching efficiency. In order to evaluate the performance and efficiency of the proposed algorithm, a diverse set of selected benchmark functions are employed and these functions fall into two groups: unimodal and multimodal. The experimental results show better performance of the proposed algorithm compared to the original version of the firefly algorithm (FA), differential evolution (DE) and particle swarm optimization (PSO) in the sense of avoiding local minima and increasing the convergence rate.

A Novel Hybrid Firefly Algorithm for Global Optimization

PubMed Central

Zhang, Lina; Liu, Liqiang; Yang, Xin-She; Dai, Yuntao

2016-01-01

Global optimization is challenging to solve due to its nonlinearity and multimodality. Traditional algorithms such as the gradient-based methods often struggle to deal with such problems and one of the current trends is to use metaheuristic algorithms. In this paper, a novel hybrid population-based global optimization algorithm, called hybrid firefly algorithm (HFA), is proposed by combining the advantages of both the firefly algorithm (FA) and differential evolution (DE). FA and DE are executed in parallel to promote information sharing among the population and thus enhance searching efficiency. In order to evaluate the performance and efficiency of the proposed algorithm, a diverse set of selected benchmark functions are employed and these functions fall into two groups: unimodal and multimodal. The experimental results show better performance of the proposed algorithm compared to the original version of the firefly algorithm (FA), differential evolution (DE) and particle swarm optimization (PSO) in the sense of avoiding local minima and increasing the convergence rate. PMID:27685869

Wireless sensor placement for structural monitoring using information-fusing firefly algorithm

NASA Astrophysics Data System (ADS)

Zhou, Guang-Dong; Yi, Ting-Hua; Xie, Mei-Xi; Li, Hong-Nan

2017-10-01

Wireless sensor networks (WSNs) are promising technology in structural health monitoring (SHM) applications for their low cost and high efficiency. The limited wireless sensors and restricted power resources in WSNs highlight the significance of optimal wireless sensor placement (OWSP) during designing SHM systems to enable the most useful information to be captured and to achieve the longest network lifetime. This paper presents a holistic approach, including an optimization criterion and a solution algorithm, for optimally deploying self-organizing multi-hop WSNs on large-scale structures. The combination of information effectiveness represented by the modal independence and the network performance specified by the network connectivity and network lifetime is first formulated to evaluate the performance of wireless sensor configurations. Then, an information-fusing firefly algorithm (IFFA) is developed to solve the OWSP problem. The step sizes drawn from a Lévy distribution are adopted to drive fireflies toward brighter individuals. Following the movement with Lévy flights, information about the contributions of wireless sensors to the objective function as carried by the fireflies is fused and applied to move inferior wireless sensors to better locations. The reliability of the proposed approach is verified via a numerical example on a long-span suspension bridge. The results demonstrate that the evaluation criterion provides a good performance metric of wireless sensor configurations, and the IFFA outperforms the simple discrete firefly algorithm.

Toward a General Approach for RNA-Templated Hierarchical Assembly of Split-Proteins

PubMed Central

Furman, Jennifer L.; Badran, Ahmed H.; Ajulo, Oluyomi; Porter, Jason R.; Stains, Cliff I.; Segal, David J.; Ghosh, Indraneel

2010-01-01

The ability to conditionally turn on a signal or induce a function in the presence of a user-defined RNA target has potential applications in medicine and synthetic biology. Although sequence-specific pumilio repeat proteins can target a limited set of ssRNA sequences, there are no general methods for targeting ssRNA with designed proteins. As a first step toward RNA recognition, we utilized the RNA binding domain of argonaute, implicated in RNA interference, for specifically targeting generic 2-nucleotide, 3' overhangs of any dsRNA. We tested the reassembly of a split-luciferase enzyme guided by argonaute-mediated recognition of newly generated nucleotide overhangs when ssRNA is targeted by a designed complementary guide sequence. This approach was successful when argonaute was utilized in conjunction with a pumilio repeat and expanded the scope of potential ssRNA targets. However, targeting any desired ssRNA remained elusive as two argonaute domains provided minimal reassembled split-luciferase. We next designed and tested a second hierarchical assembly, wherein ssDNA guides are appended to DNA hairpins that serve as a scaffold for high affinity zinc fingers attached to split-luciferase. In the presence of a ssRNA target containing adjacent sequences complementary to the guides, the hairpins are brought into proximity, allowing for zinc finger binding and concomitant reassembly of the fragmented luciferase. The scope of this new approach was validated by specifically targeting RNA encoding VEGF, hDM2, and HER2. These approaches provide potentially general design paradigms for the conditional reassembly of fragmented proteins in the presence of any desired ssRNA target. PMID:20681585

The novel extremely psychrophilic luciferase from Metridia longa: Properties of a high-purity protein produced in insect cells.

PubMed

Larionova, Marina D; Markova, Svetlana V; Vysotski, Eugene S

2017-01-29

The bright bioluminescence of copepod Metridia longa is conditioned by a small secreted coelenterazine-dependent luciferase (MLuc). To date, three isoforms of MLuc differing in length, sequences, and some properties were cloned and successfully applied as high sensitive bioluminescent reporters. In this work, we report cloning of a novel group of genes from M. longa encoding extremely psychrophilic isoforms of MLuc (MLuc2-type). The novel isoforms share only ∼54-64% of protein sequence identity with the previously cloned isoforms and, consequently, are the product of a separate group of paralogous genes. The MLuc2 isoform with consensus sequence was produced as a natively folded protein using baculovirus/insect cell expression system, purified, and characterized. The MLuc2 displays a very high bioluminescent activity and high thermostability similar to those of the previously characterized M. longa luciferase isoform MLuc7. However, in contrast to MLuc7 revealing the highest activity at 12-17 °C and 0.5 M NaCl, the bioluminescence optima of MLuc2 isoforms are at ∼5 °C and 1 M NaCl. The MLuc2 adaptation to cold is also accompanied by decrease of melting temperature and affinity to substrate suggesting a more conformational flexibility of a protein structure. The luciferase isoforms with different temperature optima may provide adaptability of the M. longa bioluminescence to the changes of water temperature during diurnal vertical migrations. Copyright © 2016 Elsevier Inc. All rights reserved.

Molecular cloning and identification of the transcriptional regulatory domain of the goat neurokinin B gene TAC3.

PubMed

Suetomi, Yuta; Matsuda, Fuko; Uenoyama, Yoshihisa; Maeda, Kei-ichiro; Tsukamura, Hiroko; Ohkura, Satoshi

2013-10-01

Neurokinin B (NKB), encoded by TAC3, is thought to be an important accelerator of pulsatile gonadotropin-releasing hormone release. This study aimed to clarify the transcriptional regulatory mechanism of goat TAC3. First, we determined the full-length mRNA sequence of goat TAC3 from the hypothalamus to be 820 b, including a 381 b coding region, with the putative transcription start site located 143-b upstream of the start codon. The deduced amino acid sequence of NKB, which is produced from preproNKB, was completely conserved among goat, cattle, and human. Next, we cloned 5'-upstream region of goat TAC3 up to 3400 b from the translation initiation site, and this region was highly homologous with cattle TAC3 (89%). We used this goat TAC3 5'-upstream region to perform luciferase assays. We created a luciferase reporter vector containing DNA constructs from -2706, -1837, -834, -335, or -197 to +166 bp (the putative transcription start site was designated as +1) of goat TAC3 and these were transiently transfected into mouse hypothalamus-derived N7 cells and human neuroblastoma-derived SK-N-AS cells. The luciferase activity gradually increased with the deletion of the 5'-upstream region, suggesting that the transcriptional suppressive region is located between -2706 and -336 bp and that the core promoter exists downstream of -197 bp. Estradiol treatment did not lead to significant suppression of luciferase activity of any constructs, suggesting the existence of other factor(s) that regulate goat TAC3 transcription.

Let there be bioluminescence – Development of a biophotonic imaging platform for in situ analyses of oral biofilms in animal models

PubMed Central

Merritt, Justin; Senpuku, Hidenobu; Kreth, Jens

2016-01-01

Summary In the current study, we describe a novel biophotonic imaging-based reporter system that is particularly useful for the study of virulence in polymicrobial infections and interspecies interactions within animal models. A suite of luciferase enzymes was compared using three early colonizing species of the human oral flora (Streptococcus mutans, Streptococcus gordonii, and Streptococcus sanguinis) to determine the utility of the different reporters for multiplexed imaging studies in vivo. Using the multiplex approach, we were able to track individual species within a dual species oral infection model in mice with both temporal and spatial resolution. We also demonstrate how biophotonic imaging of multiplexed luciferase reporters could be adapted for real-time quantification of bacterial gene expression in situ. By creating an inducible dual-luciferase expressing reporter strain of S. mutans, we were able to exogenously control and measure expression of nlmAB (encoding the bacteriocin mutacin IV) within mice to assess its importance for the persistence ability of S. mutans in the oral cavity. The imaging system described in the current study circumvents many of the inherent limitations of current animal model systems, which should now make it feasible to test hypotheses that were previously impractical to model. PMID:26119252

Synchronizing Fireflies

ERIC Educational Resources Information Center

Zhou, Ying; Gall, Walter; Nabb, Karen Mayumi

2006-01-01

"Imagine a tenth of a mile of river front with an unbroken line of trees with fireflies on ever leaf flashing in synchronism. ... Then, if one's imagination is sufficiently vivid, he may form some conception of this amazing spectacle." So wrote the naturalist Hugh Smith. In this article we consider how one might model mathematically the…

Analyzing the impact of the Firefly Trail on economic development in northeast Georgia : final report.

DOT National Transportation Integrated Search

2016-10-01

This research report contains the findings of the analysis undertaken to measure the economic impact of the proposed Firefly Trail on the local economy. An input-output model was constructed to study the economic impact of the project on the local ec...

Continuous, real-time bioimaging of chemical bioavailability and toxicology using autonomously bioluminescent human cell lines

NASA Astrophysics Data System (ADS)

Xu, Tingting; Close, Dan M.; Webb, James D.; Price, Sarah L.; Ripp, Steven A.; Sayler, Gary S.

2013-05-01

Bioluminescent imaging is an emerging biomedical surveillance strategy that uses external cameras to detect in vivo light generated in small animal models of human physiology or in vitro light generated in tissue culture or tissue scaffold mimics of human anatomy. The most widely utilized of reporters is the firefly luciferase (luc) gene; however, it generates light only upon addition of a chemical substrate, thus only generating intermittent single time point data snapshots. To overcome this disadvantage, we have demonstrated substrate-independent bioluminescent imaging using an optimized bacterial bioluminescence (lux) system. The lux reporter produces bioluminescence autonomously using components found naturally within the cell, thereby allowing imaging to occur continuously and in real-time over the lifetime of the host. We have validated this technology in human cells with demonstrated chemical toxicological profiling against exotoxin exposures at signal strengths comparable to existing luc systems (~1.33 × 107 photons/second). As a proof-in-principle demonstration, we have engineered breast carcinoma cells to express bioluminescence for real-time screening of endocrine disrupting chemicals and validated detection of 17β-estradiol (EC50 = ~ 10 pM). These and other applications of this new reporter technology will be discussed as potential new pathways towards improved models of target chemical bioavailability, toxicology, efficacy, and human safety.

Bioluminescent imaging demonstrates transplanted human embryonic stem cell-derived CD34+ cells preferentially develop into endothelial cells

PubMed Central

Tian, Xinghui; Hexum, Melinda K.; Penchev, Vesselin R.; Taylor, Russell J.; Shultz, Leonard D.; Kaufman, Dan S

2010-01-01

Human embryonic stem cells (hESCs) provide an important resource for novel regenerative medicine therapies and have been used to derive diverse cell populations, including hematopoietic and endothelial cells. However, it remains a challenge to achieve significant engraftment of hESC-derived blood cells when transplanted into animal models. To better understand mechanisms that enhance or limit the in vivo developmental potential of hESC-derived cells, we utilized hESCs that express firefly luciferase (luc) to allow non-invasive, real-time bioluminescent imaging of hESC-derived CD34+ cells transplanted into the liver of neonatal immunodeficient mice. Serial imaging demonstrated stable engraftment and expansion of the luc+ hESC-derived cells in vivo over several months. While we found that these hESC-derived CD34+ cells have bipotential ability to generate both hematopoietic and endothelial lineages in vitro, these studies demonstrate preferential differentiation into endothelial cells in vivo, with only low levels of hematopoietic cell engraftment. Therefore, these studies reveal key differences in the developmental potential of hESC-derived cells using in vitro and in vivo analyses. While transplanted hESC-derived CD34+ cells are well suited for revascularization therapies, additional measures are needed to provide higher levels of long-term hematopoietic engraftment. PMID:19711457

A multimodality imaging model to track viable breast cancer cells from single arrest to metastasis in the mouse brain

PubMed Central

Parkins, Katie M.; Hamilton, Amanda M.; Makela, Ashley V.; Chen, Yuanxin; Foster, Paula J.; Ronald, John A.

2016-01-01

Cellular MRI involves sensitive visualization of iron-labeled cells in vivo but cannot differentiate between dead and viable cells. Bioluminescence imaging (BLI) measures cellular viability, and thus we explored combining these tools to provide a more holistic view of metastatic cancer cell fate in mice. Human breast carcinoma cells stably expressing Firefly luciferase were loaded with iron particles, injected into the left ventricle, and BLI and MRI were performed on days 0, 8, 21 and 28. The number of brain MR signal voids (i.e., iron-loaded cells) on day 0 significantly correlated with BLI signal. Both BLI and MRI signals decreased from day 0 to day 8, indicating a loss of viable cells rather than a loss of iron label. Total brain MR tumour volume on day 28 also correlated with BLI signal. Overall, BLI complemented our sensitive cellular MRI technologies well, allowing us for the first time to screen animals for successful injections, and, in addition to MR measures of cell arrest and tumor burden, provided longitudinal measures of cancer cell viability in individual animals. We predict this novel multimodality molecular imaging framework will be useful for evaluating the efficacy of emerging anti-cancer drugs at different stages of the metastatic cascade. PMID:27767185

A multimodality imaging model to track viable breast cancer cells from single arrest to metastasis in the mouse brain.

PubMed

Parkins, Katie M; Hamilton, Amanda M; Makela, Ashley V; Chen, Yuanxin; Foster, Paula J; Ronald, John A

2016-10-21

Cellular MRI involves sensitive visualization of iron-labeled cells in vivo but cannot differentiate between dead and viable cells. Bioluminescence imaging (BLI) measures cellular viability, and thus we explored combining these tools to provide a more holistic view of metastatic cancer cell fate in mice. Human breast carcinoma cells stably expressing Firefly luciferase were loaded with iron particles, injected into the left ventricle, and BLI and MRI were performed on days 0, 8, 21 and 28. The number of brain MR signal voids (i.e., iron-loaded cells) on day 0 significantly correlated with BLI signal. Both BLI and MRI signals decreased from day 0 to day 8, indicating a loss of viable cells rather than a loss of iron label. Total brain MR tumour volume on day 28 also correlated with BLI signal. Overall, BLI complemented our sensitive cellular MRI technologies well, allowing us for the first time to screen animals for successful injections, and, in addition to MR measures of cell arrest and tumor burden, provided longitudinal measures of cancer cell viability in individual animals. We predict this novel multimodality molecular imaging framework will be useful for evaluating the efficacy of emerging anti-cancer drugs at different stages of the metastatic cascade.

Epidermal growth factor targeting of bacteriophage to the choroid plexus for gene delivery to the central nervous system via cerebrospinal fluid.

PubMed

Gonzalez, Ana Maria; Leadbeater, Wendy; Podvin, Sonia; Borboa, Alexandra; Burg, Michael; Sawada, Ritsuko; Rayner, James; Sims, Karen; Terasaki, Tetsuya; Johanson, Conrad; Stopa, Edward; Eliceiri, Brian; Baird, Andrew

2010-11-04

Because the choroid plexus normally controls the production and composition of cerebrospinal fluid and, as such, its many functions of the central nervous system, we investigated whether ligand-mediated targeting could deliver genes to its secretory epithelium. We show here that when bacteriophages are targeted with epidermal growth factor, they acquire the ability to enter choroid epithelial cells grown in vitro as cell cultures, ex vivo as tissue explants or in vivo by intracerebroventricular injection. The binding and internalization of these particles activate EGF receptors on targeted cells, and the dose- and time-dependent internalization of particles is inhibited by the presence of excess ligand. When the phage genome is further reengineered to contain like green fluorescent protein or firefly luciferase under control of the cytomegalovirus promoter, gene expression is detectable in the choroid plexus and ependymal epithelium by immunohistochemistry or by noninvasive imaging, respectively. Taken together, these data support the hypothesis that reengineered ligand-mediated gene delivery should be considered a viable strategy to increase the specificity of gene delivery to the central nervous system and bypass the blood-brain barrier so as to exploit the biological effectiveness of the choroid plexus as a portal of entry into the brain. Copyright © 2010 Elsevier B.V. All rights reserved.

A novel pre-clinical in vivo mouse model for malignant brain tumor growth and invasion.

PubMed

Shelton, Laura M; Mukherjee, Purna; Huysentruyt, Leanne C; Urits, Ivan; Rosenberg, Joshua A; Seyfried, Thomas N

2010-09-01

Glioblastoma multiforme (GBM) is a rapidly progressive disease of morbidity and mortality and is the most common form of primary brain cancer in adults. Lack of appropriate in vivo models has been a major roadblock to developing effective therapies for GBM. A new highly invasive in vivo GBM model is described that was derived from a spontaneous brain tumor (VM-M3) in the VM mouse strain. Highly invasive tumor cells could be identified histologically on the hemisphere contralateral to the hemisphere implanted with tumor cells or tissue. Tumor cells were highly expressive for the chemokine receptor CXCR4 and the proliferation marker Ki-67 and could be identified invading through the pia mater, the vascular system, the ventricular system, around neurons, and over white matter tracts including the corpus callosum. In addition, the brain tumor cells were labeled with the firefly luciferase gene, allowing for non-invasive detection and quantitation through bioluminescent imaging. The VM-M3 tumor has a short incubation time with mortality occurring in 100% of the animals within approximately 15 days. The VM-M3 brain tumor model therefore can be used in a pre-clinical setting for the rapid evaluation of novel anti-invasive therapies.

Gene silencing activity of siRNA polyplexes based on thiolated N,N,N-trimethylated chitosan.

PubMed

Varkouhi, Amir K; Verheul, Rolf J; Schiffelers, Raymond M; Lammers, Twan; Storm, Gert; Hennink, Wim E

2010-12-15

N,N,N-Trimethylated chitosan (TMC) is a biodegradable polymer emerging as a promising nonviral vector for nucleic acid and protein delivery. In the present study, we investigated whether the introduction of thiol groups in TMC enhances the extracellular stability of the complexes based on this polymer and promotes the intracellular release of siRNA. The gene silencing activity and the cellular cytotoxicity of polyplexes based on thiolated TMC were compared with those based on the nonthiolated counterpart and the regularly used lipidic transfection agent Lipofectamine. Incubation of H1299 human lung cancer cells expressing firefly luciferase with siRNA/thiolated TMC polyplexes resulted in 60-80% gene silencing activity, whereas complexes based on nonthiolated TMC showed less silencing (40%). The silencing activity of the complexes based on Lipofectamine 2000 was about 60-70%. Importantly, the TMC-SH polyplexes retained their silencing activity in the presence of hyaluronic acid, while nonthiolated TMC polyplexes hardly showed any silencing activity, demonstrating their stability against competing anionic macromolecules. Under the experimental conditions tested, the cytotoxicity of the thiolated and nonthiolated siRNA complexes was lower than those based on Lipofectamine. Given the good extracellular stability and good silencing activity, it is concluded that polyplexes based on TMC-SH are attractive systems for further in vivo evaluations.

Development of bioluminescent chick chorioallantoic membrane (CAM) models for primary pancreatic cancer cells: a platform for drug testing

PubMed Central

Rovithi, Maria; Avan, Amir; Funel, Niccola; Leon, Leticia G.; Gomez, Valentina E.; Wurdinger, Thomas; Griffioen, Arjan W.; Verheul, Henk M. W.; Giovannetti, Elisa

2017-01-01

The aim of the present study was to develop chick-embryo chorioallantoic membrane (CAM) bioluminescent tumor models employing low passage cell cultures obtained from primary pancreatic ductal adenocarcinoma (PDAC) cells. Primary PDAC cells transduced with lentivirus expressing Firefly-luciferase (Fluc) were established and inoculated onto the CAM membrane, with >80% engraftment. Fluc signal reliably correlated with tumor growth. Tumor features were evaluated by immunohistochemistry and genetic analyses, including analysis of mutations and mRNA expression of PDAC pivotal genes, as well as microRNA (miRNA) profiling. These studies showed that CAM tumors had histopathological and genetic characteristic comparable to the original tumors. We subsequently tested the modulation of key miRNAs and the activity of gemcitabine and crizotinib on CAM tumors, showing that combination treatment resulted in 63% inhibition of tumor growth as compared to control (p < 0.01). These results were associated with reduced expression of miR-21 and increased expression of miR-155. Our study provides the first evidence that transduced primary PDAC cells can form tumors on the CAM, retaining several histopathological and (epi)genetic characteristics of original tumors. Moreover, our results support the use of these models for drug testing, providing insights on molecular mechanisms underlying antitumor activity of new drugs/combinations. PMID:28304379

Synthetic dual-input mammalian genetic circuits enable tunable and stringent transcription control by chemical and light.

PubMed

Chen, Xianjun; Li, Ting; Wang, Xue; Du, Zengmin; Liu, Renmei; Yang, Yi

2016-04-07

Programmable transcription factors can enable precise control of gene expression triggered by a chemical inducer or light. To obtain versatile transgene system with combined benefits of a chemical inducer and light inducer, we created various chimeric promoters through the assembly of different copies of the tet operator and Gal4 operator module, which simultaneously responded to a tetracycline-responsive transcription factor and a light-switchable transactivator. The activities of these chimeric promoters can be regulated by tetracycline and blue light synergistically or antagonistically. Further studies of the antagonistic genetic circuit exhibited high spatiotemporal resolution and extremely low leaky expression, which therefore could be used to spatially and stringently control the expression of highly toxic protein Diphtheria toxin A for light regulated gene therapy. When transferring plasmids engineered for the gene switch-driven expression of a firefly luciferase (Fluc) into mice, the Fluc expression levels of the treated animals directly correlated with the tetracycline and light input program. We suggest that dual-input genetic circuits using TET and light that serve as triggers to achieve expression profiles may enable the design of robust therapeutic gene circuits for gene- and cell-based therapies. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Synergistic effects between analogs of DNA and RNA improve the potency of siRNA-mediated gene silencing

PubMed Central

Deleavey, Glen F.; Watts, Jonathan K.; Alain, Tommy; Robert, Francis; Kalota, Anna; Aishwarya, Veenu; Pelletier, Jerry; Gewirtz, Alan M.; Sonenberg, Nahum; Damha, Masad J.

2010-01-01

We report that combining a DNA analog (2′F-ANA) with rigid RNA analogs [2′F-RNA and/or locked nucleic acid (LNA)] in siRNA duplexes can produce gene silencing agents with enhanced potency. The favored conformations of these two analogs are different, and combining them in a 1–1 pattern led to reduced affinity, whereas alternating short continuous regions of individual modifications increased affinity relative to an RNA:RNA duplex. Thus, the binding affinity at key regions of the siRNA duplex could be tuned by changing the pattern of incorporation of DNA-like and RNA-like nucleotides. These heavily or fully modified duplexes are active against a range of mRNA targets. Effective patterns of modification were chosen based on screens using two sequences targeting firefly luciferase. We then applied the most effective duplex designs to the knockdown of the eIF4E binding proteins 4E-BP1 and 4E-BP2. We identified modified duplexes with potency comparable to native siRNA. Modified duplexes showed dramatically enhanced stability to serum nucleases, and were characterized by circular dichroism and thermal denaturation studies. Chemical modification significantly reduced the immunostimulatory properties of these siRNAs in human peripheral blood mononuclear cells. PMID:20413581

Experimental Infection of Syrian Hamsters with Aerosolized Nipah virus.

PubMed

Escaffre, Olivier; Hill, Terence; Ikegami, Tetsuro; Juelich, Terry L; Smith, Jennifer K; Zhang, Lihong; Perez, David E; Atkins, Colm; Park, Arnold; Lawrence, William S; Sivasubramani, Satheesh K; Peel, Jennifer E; Peterson, Johnny W; Lee, Benhur; Freiberg, Alexander N

2018-06-15

Nipah virus (NiV) is a paramyxovirus (genus henipavirus) that can cause severe respiratory illness and encephalitis in humans. Transmission occurs through consumption of NiV-contaminated foods, and contact with NiV-infected animals or human body fluids. However, it is unclear whether aerosols derived from aforesaid sources or others also contribute to transmission, and current knowledge on NiV-induced pathogenicity after small particle aerosol exposure is still limited. infectivity, pathogenicity and real-time dissemination of aerosolized NiV in Syrian hamsters was evaluated using NiV-Malaysia (NiV-M) and/or its recombinant expressing firefly luciferase (rNiV-Fluc NP). both viruses had an equivalent pathogenicity in hamsters that developed respiratory and neurological symptoms of disease, similar to using intranasal route, with no direct correlations to the dose. Finally, we show that virus replication was predominantly initiated in the lower respiratory tract, and although delayed, also intensely in the oronasal cavity and possibly the brain, with gradual increase of signal in these regions until at least day 5-6 post-infection. hamsters infected with small-particle aerosolized NiV undergo similar clinical manifestations of the disease as previously described using liquid inoculum, and exhibit histopathological lesions consistent with NiV patient reports. NiV droplets could therefore play a role in transmission by close contact.

Evaluation of monkeypox virus infection of prairie dogs (Cynomys ludovicianus) using in vivo bioluminescent imaging

USGS Publications Warehouse

Falendysz, Elizabeth A.; Londoño-Navas, Angela M.; Meteyer, Carol U.; Pussini, Nicola; Lopera, Juan G.; Osorio, Jorge E.; Rocke, Tonie E.

2014-01-01

Monkeypox (MPX) is a re-emerging zoonotic disease that is endemic in Central and West Africa, where it can cause a smallpox-like disease in humans. Despite many epidemiologic and field investigations of MPX, no definitive reservoir species has been identified. Using recombinant viruses expressing the firefly luciferase (luc) gene, we previously demonstrated the suitability of in vivo bioluminescent imaging (BLI) to study the pathogenesis of MPX in animal models. Here, we evaluated BLI as a novel approach for tracking MPX virus infection in black-tailed prairie dogs (Cynomys ludovicianus). Prairie dogs were affected during a multistate outbreak of MPX in the US in 2003 and have since been used as an animal model of this disease. Our BLI results were compared with PCR and virus isolation from tissues collected postmortem. Virus was easily detected and quantified in skin and superficial tissues by BLI before and during clinical phases, as well as in subclinical secondary cases, but was not reliably detected in deep tissues such as the lung. Although there are limitations to viral detection in larger wild rodent species, BLI can enhance the use of prairie dogs as an animal model of MPX and can be used for the study of infection, disease progression, and transmission in potential wild rodent reservoirs.

Image-guided genomic analysis of tissue response to laser-induced thermal stress

NASA Astrophysics Data System (ADS)

Mackanos, Mark A.; Helms, Mike; Kalish, Flora; Contag, Christopher H.

2011-05-01

The cytoprotective response to thermal injury is characterized by transcriptional activation of ``heat shock proteins'' (hsp) and proinflammatory proteins. Expression of these proteins may predict cellular survival. Microarray analyses were performed to identify spatially distinct gene expression patterns responding to thermal injury. Laser injury zones were identified by expression of a transgene reporter comprised of the 70 kD hsp gene and the firefly luciferase coding sequence. Zones included the laser spot, the surrounding region where hsp70-luc expression was increased, and a region adjacent to the surrounding region. A total of 145 genes were up-regulated in the laser irradiated region, while 69 were up-regulated in the adjacent region. At 7 hours the chemokine Cxcl3 was the highest expressed gene in the laser spot (24 fold) and adjacent region (32 fold). Chemokines were the most common up-regulated genes identified. Microarray gene expression was successfully validated using qRT- polymerase chain reaction for selected genes of interest. The early response genes are likely involved in cytoprotection and initiation of the healing response. Their regulatory elements will benefit creating the next generation reporter mice and controlling expression of therapeutic proteins. The identified genes serve as drug development targets that may prevent acute tissue damage and accelerate healing.

A multimodality imaging model to track viable breast cancer cells from single arrest to metastasis in the mouse brain

NASA Astrophysics Data System (ADS)

Parkins, Katie M.; Hamilton, Amanda M.; Makela, Ashley V.; Chen, Yuanxin; Foster, Paula J.; Ronald, John A.

2016-10-01

Cellular MRI involves sensitive visualization of iron-labeled cells in vivo but cannot differentiate between dead and viable cells. Bioluminescence imaging (BLI) measures cellular viability, and thus we explored combining these tools to provide a more holistic view of metastatic cancer cell fate in mice. Human breast carcinoma cells stably expressing Firefly luciferase were loaded with iron particles, injected into the left ventricle, and BLI and MRI were performed on days 0, 8, 21 and 28. The number of brain MR signal voids (i.e., iron-loaded cells) on day 0 significantly correlated with BLI signal. Both BLI and MRI signals decreased from day 0 to day 8, indicating a loss of viable cells rather than a loss of iron label. Total brain MR tumour volume on day 28 also correlated with BLI signal. Overall, BLI complemented our sensitive cellular MRI technologies well, allowing us for the first time to screen animals for successful injections, and, in addition to MR measures of cell arrest and tumor burden, provided longitudinal measures of cancer cell viability in individual animals. We predict this novel multimodality molecular imaging framework will be useful for evaluating the efficacy of emerging anti-cancer drugs at different stages of the metastatic cascade.

Surfactant Protein-C Promoter Variants Associated with Neonatal Respiratory Distress Syndrome Reduce Transcription

PubMed Central

Wambach, Jennifer A.; Yang, Ping; Wegner, Daniel J.; An, Ping; Hackett, Brian P.; Cole, F. S.; Hamvas, Aaron

2010-01-01

Dominant mutations in coding regions of the surfactant protein-C gene (SFTPC) cause respiratory distress syndrome (RDS) in infants. However, the contribution of variants in noncoding regions of SFTPC to pulmonary phenotypes is unknown. Using a case-control group of infants ≥34 weeks gestation (n=538), we used complete resequencing of SFTPC and its promoter, genotyping, and logistic regression to identify 80 single nucleotide polymorphisms (SNPs). Three promoter SNPs were statistically associated with neonatal RDS among European descent infants. To assess the transcriptional effects of these three promoter SNPs, we selectively mutated the SFTPC promoter and performed transient transfection using MLE-15 cells and a firefly luciferase reporter vector. Each promoter SNP decreased SFTPC transcription. The combination of two variants in high linkage dysequilibrium also decreased SFTPC transcription. In silico evaluation of transcription factor binding demonstrated that the rare allele at g.-1167 disrupts a SOX (SRY-related high mobility group box) consensus motif and introduces a GATA-1 site, at g.-2385 removes a MZF-1 (myeloid zinc finger) binding site, and at g.-1647 removes a potential methylation site. This combined statistical, in vitro, and in silico approach suggests that reduced SFTPC transcription contributes to the genetic risk for neonatal RDS in developmentally susceptible infants. PMID:20539253

Nanostructured biosensor using bioluminescence quenching technique for glucose detection.

PubMed

Chen, Longyan; Chen, Longyi; Dotzert, Michelle; Melling, C W James; Zhang, Jin

2017-08-22

Most methods for monitoring glucose level require an external energy source which may limit their application, particularly in vivo test. Bioluminescence technique offers an alternative way to provide emission light without external energy source by using bioluminescent proteins found from firefly or marine vertebrates and invertebrates. For quick and non-invasive detection of glucose, we herein developed a nanostructured biosensor by applying the bioluminescence technique. Luciferase bioluminescence protein (Rluc) is conjugated with β-cyclodextrin (β-CD). The bioluminescence intensity of Rluc can be quenched by 8 ± 3 nm gold nanoparticles (Au NPs) when Au NPs covalently bind to β-CD. In the presence of glucose, Au NPs are replaced and leave far from Rluc through a competitive reaction, which results in the restored bioluminescence intensity of Rluc. A linear relationship is observed between the restored bioluminescence intensity and the logarithmic glucose concentration in the range of 1-100 µM. In addition, the selectivity of this designed sensor has been evaluated. The performance of the senor for determination of the concentration of glucose in the blood of diabetic rats is studied for comparison with that of the concentration of glucose in aqueous. This study demonstrates the design of a bioluminescence sensor for quickly detecting the concentration of glucose sensitively.

DHA is a more potent inhibitor of breast cancer metastasis to bone and related osteolysis than EPA

PubMed Central

Rahman, M.; Veigas, Maria; Williams, Paul J.; Fernandes, Gabriel

2013-01-01

Breast cancer patients often develop bone metastasis evidenced by osteolytic lesions, leading to severe pain and bone fracture. Attenuation of breast cancer metastasis to bone and associated osteolysis by fish oil (FO), rich in EPA and DHA, has been demonstrated previously. However, it was not known whether EPA and DHA differentially or similarly affect breast cancer bone metastasis and associated osteolysis. In vitro culture of parental and luciferase gene encoded MDA-MB-231 human breast cancer cell lines treated with EPA and DHA revealed that DHA inhibits proliferation and invasion of breast cancer cells more potently than EPA. Intra-cardiac injection of parental and luciferase gene encoded MDA-MB-231 cells to athymic NCr nu/nu mice demonstrated that DHA treated mice had significantly less breast cancer cell burden in bone, and also significantly less osteolytic lesions than EPA treated mice. In vivo cell migration assay as measured by luciferase intensity revealed that DHA attenuated cell migration specifically to the bone. Moreover, the DHA treated group showed reduced levels of CD44 and TRAP positive area in bone compared to EPA treated group. Breast cancer cell burden and osteolytic lesions were also examined in intra-tibially breast cancer cell injected mice and found less breast cancer cell growth and associated osteolysis in DHA treated mice as compared to EPA treated mice. Finally, doxorubicin resistant MCF-7 (MCF-7dox) human breast cancer cell line was used to examine if DHA can improve sensitization of MCF-7dox cells to doxorubicin. DHA improved the inhibitory effect of doxorubicin on proliferation and invasion of MCF-7dox cells. Interestingly, drug resistance gene P-gp was also down-regulated in DHA plus doxorubicin treated cells. In conclusion, DHA attenuates breast cancer bone metastasis and associated osteolysis more potently than EPA, possibly by inhibiting migration of breast cancer cell to the bone as well as by inhibiting osteoclastic bone resorption. PMID:24062211

Highly active promoters and native secretion signals for protein production during extremely low growth rates in Aspergillus niger.

PubMed

Wanka, Franziska; Arentshorst, Mark; Cairns, Timothy C; Jørgensen, Thomas; Ram, Arthur F J; Meyer, Vera

2016-08-20

The filamentous ascomycete Aspergillus niger is used in many industrial processes for the production of enzymes and organic acids by batch and fed-batch cultivation. An alternative technique is continuous cultivation, which promises improved yield and optimized pipeline efficiency. In this work, we have used perfusion (retentostat) cultivation to validate two promoters that are suitable for A. niger continuous cultivation of industrially relevant products. Firstly, promoters of genes encoding either an antifungal protein (Panafp) or putative hydrophobin (PhfbD) were confirmed as active throughout retentostat culture by assessing mRNA and protein levels using a luciferase (mluc) reporter system. This demonstrated the anafp promoter mediates a high but temporally variable expression profile, whereas the hfbD promoter mediates a semi-constant, moderate-to-high protein expression during retentostat culture. In order to assess whether these promoters were suitable to produce heterologous proteins during retentostat cultivation, the secreted antifungal protein (AFP) from Aspergillus giganteus, which has many potential biotechnological applications, was expressed in A. niger during retentostat cultivation. Additionally, this assay was used to concomitantly validate that native secretion signals encoded in anafp and hfbD genes can be harnessed for secretion of heterologous proteins. Afp mRNA and protein abundance were comparable to luciferase measurements throughout retentostat cultivation, validating the use of Panafp and PhfbD for perfusion cultivation. Finally, a gene encoding the highly commercially relevant thermal hysteresis protein (THP) was expressed in this system, which did not yield detectable protein. Both hfbD and anafp promoters are suitable for production of useful products in A. niger during perfusion cultivation. These findings provide a platform for further optimisations for high production of heterologous proteins with industrial relevance.

Thermal buckling optimisation of composite plates using firefly algorithm

NASA Astrophysics Data System (ADS)

Kamarian, S.; Shakeri, M.; Yas, M. H.

2017-07-01

Composite plates play a very important role in engineering applications, especially in aerospace industry. Thermal buckling of such components is of great importance and must be known to achieve an appropriate design. This paper deals with stacking sequence optimisation of laminated composite plates for maximising the critical buckling temperature using a powerful meta-heuristic algorithm called firefly algorithm (FA) which is based on the flashing behaviour of fireflies. The main objective of present work was to show the ability of FA in optimisation of composite structures. The performance of FA is compared with the results reported in the previous published works using other algorithms which shows the efficiency of FA in stacking sequence optimisation of laminated composite structures.

Total evidence phylogeny and the evolution of adult bioluminescence in fireflies (Coleoptera: Lampyridae).

PubMed

Martin, Gavin J; Branham, Marc A; Whiting, Michael F; Bybee, Seth M

2017-02-01

Fireflies are some of the most captivating organisms on the planet. They have a rich history as subjects of scientific study, especially in relation to their bioluminescent behavior. Yet, the phylogenetic relationships of fireflies are still poorly understood. Here, we present the first total evidence approach to reconstruct lampyrid phylogeny using both a molecular matrix from six loci and an extensive morphological matrix. Using this phylogeny we test the hypothesis that adult bioluminescence evolved after the origin of the firefly clade. The ancestral state of adult bioluminescence is recovered as non-bioluminescent with one to six gains and five to ten subsequent losses. The monophyly of the family, as well as the subfamilies is also tested. Ototretinae, Cyphonocerinae, Luciolinae (incl. Pristolycus), Amydetinae, "cheguevarinae" sensu Jeng 2008, and Photurinae are highly supported as monophyletic. With the exception of four taxa, Lampyrinae is also recovered as monophyletic with high support. Based on phylogenetic and morphological data Lamprohiza, Phausis, and Lamprigera are transferred to Lampyridae incertae sedis. Copyright © 2016 Elsevier Inc. All rights reserved.

Firefly algorithm for cardinality constrained mean-variance portfolio optimization problem with entropy diversity constraint.

PubMed

Bacanin, Nebojsa; Tuba, Milan

2014-01-01

Portfolio optimization (selection) problem is an important and hard optimization problem that, with the addition of necessary realistic constraints, becomes computationally intractable. Nature-inspired metaheuristics are appropriate for solving such problems; however, literature review shows that there are very few applications of nature-inspired metaheuristics to portfolio optimization problem. This is especially true for swarm intelligence algorithms which represent the newer branch of nature-inspired algorithms. No application of any swarm intelligence metaheuristics to cardinality constrained mean-variance (CCMV) portfolio problem with entropy constraint was found in the literature. This paper introduces modified firefly algorithm (FA) for the CCMV portfolio model with entropy constraint. Firefly algorithm is one of the latest, very successful swarm intelligence algorithm; however, it exhibits some deficiencies when applied to constrained problems. To overcome lack of exploration power during early iterations, we modified the algorithm and tested it on standard portfolio benchmark data sets used in the literature. Our proposed modified firefly algorithm proved to be better than other state-of-the-art algorithms, while introduction of entropy diversity constraint further improved results.

Firefly Algorithm for Cardinality Constrained Mean-Variance Portfolio Optimization Problem with Entropy Diversity Constraint

PubMed Central

2014-01-01

Portfolio optimization (selection) problem is an important and hard optimization problem that, with the addition of necessary realistic constraints, becomes computationally intractable. Nature-inspired metaheuristics are appropriate for solving such problems; however, literature review shows that there are very few applications of nature-inspired metaheuristics to portfolio optimization problem. This is especially true for swarm intelligence algorithms which represent the newer branch of nature-inspired algorithms. No application of any swarm intelligence metaheuristics to cardinality constrained mean-variance (CCMV) portfolio problem with entropy constraint was found in the literature. This paper introduces modified firefly algorithm (FA) for the CCMV portfolio model with entropy constraint. Firefly algorithm is one of the latest, very successful swarm intelligence algorithm; however, it exhibits some deficiencies when applied to constrained problems. To overcome lack of exploration power during early iterations, we modified the algorithm and tested it on standard portfolio benchmark data sets used in the literature. Our proposed modified firefly algorithm proved to be better than other state-of-the-art algorithms, while introduction of entropy diversity constraint further improved results. PMID:24991645

Simulation of optical signaling among nano-bio-sensors: enhancing of bioimaging contrast.

PubMed

SalmanOgli, A; Behzadi, S; Rostami, A

2014-09-01

In this article, the nanoparticle-dye systems is designed and simulated to illustrate the possibility of enhancement in optical imaging contrast. For this, the firefly optimization technique is used as an optical signaling mechanism among agents (nanoparticle-dye) because fireflies attract together due to their flashing light and optical signaling that is produced by a process of bioluminescence (also it has been investigated that other parameters such as neural response and brain function have essential role in attracting fireflies to each other). The first parameter is coincided with our work, because the nanoparticle-dye systems have ability to augment of received light and its amplification cause that the designed complex system act as a brightness particle. This induced behavior of nanoparticles can be considered as an optical communication and signaling. Indeed by functionalization of nanoparticles and then due to higher brightness of the tumor site because of active targeting, the other particles can be guided to reach toward the target point and the signaling among agents is done by optical relation similar to firefly nature. Moreover, the fundamental of this work is the use of surface plasmon resonance and plasmons hybridization, in which photonic signals can be manipulated on the nanoscale and can be used in biomedical applications such as electromagnetic field enhancement. Finally, it can be mentioned that by simultaneously using plasmon hybridization, near-field augmentation, and firefly algorithm, the optical imaging contrast can be impressively improved.

A new approach to optic disc detection in human retinal images using the firefly algorithm.

PubMed

Rahebi, Javad; Hardalaç, Fırat

2016-03-01

There are various methods and algorithms to detect the optic discs in retinal images. In recent years, much attention has been given to the utilization of the intelligent algorithms. In this paper, we present a new automated method of optic disc detection in human retinal images using the firefly algorithm. The firefly intelligent algorithm is an emerging intelligent algorithm that was inspired by the social behavior of fireflies. The population in this algorithm includes the fireflies, each of which has a specific rate of lighting or fitness. In this method, the insects are compared two by two, and the less attractive insects can be observed to move toward the more attractive insects. Finally, one of the insects is selected as the most attractive, and this insect presents the optimum response to the problem in question. Here, we used the light intensity of the pixels of the retinal image pixels instead of firefly lightings. The movement of these insects due to local fluctuations produces different light intensity values in the images. Because the optic disc is the brightest area in the retinal images, all of the insects move toward brightest area and thus specify the location of the optic disc in the image. The results of implementation show that proposed algorithm could acquire an accuracy rate of 100 % in DRIVE dataset, 95 % in STARE dataset, and 94.38 % in DiaRetDB1 dataset. The results of implementation reveal high capability and accuracy of proposed algorithm in the detection of the optic disc from retinal images. Also, recorded required time for the detection of the optic disc in these images is 2.13 s for DRIVE dataset, 2.81 s for STARE dataset, and 3.52 s for DiaRetDB1 dataset accordingly. These time values are average value.

Heat Shock Protein 70 Enhances Mucosal Immunity against Human Norovirus When Coexpressed from a Vesicular Stomatitis Virus Vector

PubMed Central

Ma, Yuanmei; Duan, Yue; Wei, Yongwei; Liang, Xueya; Niewiesk, Stefan; Oglesbee, Michael

2014-01-01

ABSTRACT Human norovirus (NoV) accounts for 95% of nonbacterial gastroenteritis worldwide. Currently, there is no vaccine available to combat human NoV as it is not cultivable and lacks a small-animal model. Recently, we demonstrated that recombinant vesicular stomatitis virus (rVSV) expressing human NoV capsid protein (rVSV-VP1) induced strong immunities in mice (Y. Ma and J. Li, J. Virol. 85:2942–2952, 2011). To further improve the safety and efficacy of the vaccine candidate, heat shock protein 70 (HSP70) was inserted into the rVSV-VP1 backbone vector. A second construct was generated in which the firefly luciferase (Luc) gene was inserted in place of HSP70 as a control for the double insertion. The resultant recombinant viruses (rVSV-HSP70-VP1 and rVSV-Luc-VP1) were significantly more attenuated in cell culture and viral spread in mice than rVSV-VP1. At the inoculation dose of 1.0 × 106 PFU, rVSV-HSP70-VP1 triggered significantly higher vaginal IgA than rVSV-VP1 and significantly higher fecal and vaginal IgA responses than rVSV-Luc-VP1, although serum IgG and T cell responses were similar. At the inoculation dose of 5.0 × 106 PFU, rVSV-HSP70-VP1 stimulated significantly higher T cell, fecal, and vaginal IgA responses than rVSV-VP1. Fecal and vaginal IgA responses were also significantly increased when combined vaccination of rVSV-VP1 and rVSV-HSP70 was used. Collectively, these data indicate that (i) insertion of an additional gene (HSP70 or Luc) into the rVSV-VP1 backbone further attenuates the VSV-based vaccine in vitro and in vivo, thus improving the safety of the vaccine candidate, and (ii) HSP70 enhances the human NoV-specific mucosal and T cell immunities triggered by a VSV-based human NoV vaccine. IMPORTANCE Human norovirus (NoV) is responsible for more than 95% of acute nonbacterial gastroenteritis worldwide. Currently, there is no vaccine for this virus. Development of a live attenuated vaccine for human NoV has not been possible because it is uncultivable. Thus, a live vector-based vaccine may provide an alternative vaccine strategy. In this study, we developed a vesicular stomatitis virus (VSV)-based human NoV vaccine candidate. We constructed rVSV-HSP70-VP1, coexpressing heat shock protein (HSP70) and capsid (VP1) genes of human NoV, and rVSV-Luc-VP1, coexpressing firefly luciferase (Luc) and VP1 genes. We found that VSVs with a double gene insertion were significantly more attenuated than VSV with a single VP1 insertion (rVSV-VP1). Furthermore, we found that coexpression or coadministration of HSP70 from VSV vector significantly enhanced human NoV-specific mucosal immunity. Collectively, we developed an improved live vectored vaccine candidate for human NoV which will be useful for future clinical studies. PMID:24574391

A Firefly Learning Module for Environmental Sustainable Development in Samutsongkhram Province, Thailand

ERIC Educational Resources Information Center

To-Im, Jongdee; Klunklueng, Arunwan

2012-01-01

A firefly learning module for the sustainable development was developed for Thai secondary school students in the study province. A deeper connection between environment, social and economic dimensions, which lies at the core of sustainability, became the key issue for this learning module. Also an important dimension of the module was the…

Firefly algorithm versus genetic algorithm as powerful variable selection tools and their effect on different multivariate calibration models in spectroscopy: A comparative study

NASA Astrophysics Data System (ADS)

Attia, Khalid A. M.; Nassar, Mohammed W. I.; El-Zeiny, Mohamed B.; Serag, Ahmed

2017-01-01

For the first time, a new variable selection method based on swarm intelligence namely firefly algorithm is coupled with three different multivariate calibration models namely, concentration residual augmented classical least squares, artificial neural network and support vector regression in UV spectral data. A comparative study between the firefly algorithm and the well-known genetic algorithm was developed. The discussion revealed the superiority of using this new powerful algorithm over the well-known genetic algorithm. Moreover, different statistical tests were performed and no significant differences were found between all the models regarding their predictabilities. This ensures that simpler and faster models were obtained without any deterioration of the quality of the calibration.

The oxygenating constituent of 3,6-diketocamphane monooxygenase from the CAM plasmid of Pseudomonas putida: the first crystal structure of a type II Baeyer-Villiger monooxygenase.

PubMed

Isupov, Michail N; Schröder, Ewald; Gibson, Robert P; Beecher, Jean; Donadio, Giuliana; Saneei, Vahid; Dcunha, Stephlina A; McGhie, Emma J; Sayer, Christopher; Davenport, Colin F; Lau, Peter C; Hasegawa, Yoshie; Iwaki, Hiroaki; Kadow, Maria; Balke, Kathleen; Bornscheuer, Uwe T; Bourenkov, Gleb; Littlechild, Jennifer A

2015-11-01

The three-dimensional structures of the native enzyme and the FMN complex of the overexpressed form of the oxygenating component of the type II Baeyer-Villiger 3,6-diketocamphane monooxygenase have been determined to 1.9 Å resolution. The structure of this dimeric FMN-dependent enzyme, which is encoded on the large CAM plasmid of Pseudomonas putida, has been solved by a combination of multiple anomalous dispersion from a bromine crystal soak and molecular replacement using a bacterial luciferase model. The orientation of the isoalloxazine ring of the FMN cofactor in the active site of this TIM-barrel fold enzyme differs significantly from that previously observed in enzymes of the bacterial luciferase-like superfamily. The Ala77 residue is in a cis conformation and forms a β-bulge at the C-terminus of β-strand 3, which is a feature observed in many proteins of this superfamily.

Genetically Encoded Molecular Tension Probe for Tracing Protein-Protein Interactions in Mammalian Cells.

PubMed

Kim, Sung Bae; Nishihara, Ryo; Citterio, Daniel; Suzuki, Koji

2016-02-17

Optical imaging of protein-protein interactions (PPIs) facilitates comprehensive elucidation of intracellular molecular events. We demonstrate an optical measure for visualizing molecular tension triggered by any PPI in mammalian cells. Twenty-three kinds of candidate designs were fabricated, in which a full-length artificial luciferase (ALuc) was sandwiched between two model proteins of interest, e.g., FKBP and FRB. One of the designs greatly enhanced the bioluminescence in response to varying concentrations of rapamycin. It is confirmed with negative controls that the elevated bioluminescence is solely motivated from the molecular tension. The probe design was further modified toward eliminating the C-terminal end of ALuc and was found to improve signal-to-background ratios, named "a combinational probe". The utilities were elucidated with detailed substrate selectivity, bioluminescence imaging of live cells, and different PPI models. This study expands capabilities of luciferases as a tool for analyses of molecular dynamics and cell signaling in living subjects.

Firefly: an optical lithographic system for the fabrication of holographic security labels

NASA Astrophysics Data System (ADS)

Calderón, Jorge; Rincón, Oscar; Amézquita, Ricardo; Pulido, Iván.; Amézquita, Sebastián.; Bernal, Andrés.; Romero, Luis; Agudelo, Viviana

2016-03-01

This paper introduces Firefly, an optical lithography origination system that has been developed to produce holographic masters of high quality. This mask-less lithography system has a resolution of 418 nm half-pitch, and generates holographic masters with the optical characteristics required for security applications of level 1 (visual verification), level 2 (pocket reader verification) and level 3 (forensic verification). The holographic master constitutes the main core of the manufacturing process of security holographic labels used for the authentication of products and documents worldwide. Additionally, the Firefly is equipped with a software tool that allows for the hologram design from graphic formats stored in bitmaps. The software is capable of generating and configuring basic optical effects such as animation and color, as well as effects of high complexity such as Fresnel lenses, engraves and encrypted images, among others. The Firefly technology gathers together optical lithography, digital image processing and the most advanced control systems, making possible a competitive equipment that challenges the best technologies in the industry of holographic generation around the world. In this paper, a general description of the origination system is provided as well as some examples of its capabilities.

Firefly Mating Algorithm for Continuous Optimization Problems

PubMed Central

Ritthipakdee, Amarita; Premasathian, Nol; Jitkongchuen, Duangjai

2017-01-01

This paper proposes a swarm intelligence algorithm, called firefly mating algorithm (FMA), for solving continuous optimization problems. FMA uses genetic algorithm as the core of the algorithm. The main feature of the algorithm is a novel mating pair selection method which is inspired by the following 2 mating behaviors of fireflies in nature: (i) the mutual attraction between males and females causes them to mate and (ii) fireflies of both sexes are of the multiple-mating type, mating with multiple opposite sex partners. A female continues mating until her spermatheca becomes full, and, in the same vein, a male can provide sperms for several females until his sperm reservoir is depleted. This new feature enhances the global convergence capability of the algorithm. The performance of FMA was tested with 20 benchmark functions (sixteen 30-dimensional functions and four 2-dimensional ones) against FA, ALC-PSO, COA, MCPSO, LWGSODE, MPSODDS, DFOA, SHPSOS, LSA, MPDPGA, DE, and GABC algorithms. The experimental results showed that the success rates of our proposed algorithm with these functions were higher than those of other algorithms and the proposed algorithm also required fewer numbers of iterations to reach the global optima. PMID:28808442

Firefly Mating Algorithm for Continuous Optimization Problems.

PubMed

Ritthipakdee, Amarita; Thammano, Arit; Premasathian, Nol; Jitkongchuen, Duangjai

2017-01-01

This paper proposes a swarm intelligence algorithm, called firefly mating algorithm (FMA), for solving continuous optimization problems. FMA uses genetic algorithm as the core of the algorithm. The main feature of the algorithm is a novel mating pair selection method which is inspired by the following 2 mating behaviors of fireflies in nature: (i) the mutual attraction between males and females causes them to mate and (ii) fireflies of both sexes are of the multiple-mating type, mating with multiple opposite sex partners. A female continues mating until her spermatheca becomes full, and, in the same vein, a male can provide sperms for several females until his sperm reservoir is depleted. This new feature enhances the global convergence capability of the algorithm. The performance of FMA was tested with 20 benchmark functions (sixteen 30-dimensional functions and four 2-dimensional ones) against FA, ALC-PSO, COA, MCPSO, LWGSODE, MPSODDS, DFOA, SHPSOS, LSA, MPDPGA, DE, and GABC algorithms. The experimental results showed that the success rates of our proposed algorithm with these functions were higher than those of other algorithms and the proposed algorithm also required fewer numbers of iterations to reach the global optima.

Firefly algorithm versus genetic algorithm as powerful variable selection tools and their effect on different multivariate calibration models in spectroscopy: A comparative study.

PubMed

Attia, Khalid A M; Nassar, Mohammed W I; El-Zeiny, Mohamed B; Serag, Ahmed

2017-01-05

For the first time, a new variable selection method based on swarm intelligence namely firefly algorithm is coupled with three different multivariate calibration models namely, concentration residual augmented classical least squares, artificial neural network and support vector regression in UV spectral data. A comparative study between the firefly algorithm and the well-known genetic algorithm was developed. The discussion revealed the superiority of using this new powerful algorithm over the well-known genetic algorithm. Moreover, different statistical tests were performed and no significant differences were found between all the models regarding their predictabilities. This ensures that simpler and faster models were obtained without any deterioration of the quality of the calibration. Copyright © 2016 Elsevier B.V. All rights reserved.

Parainfluenza virus chimeric mini-replicons indicate a novel regulatory element in the leader promoter.

PubMed

Matsumoto, Yusuke; Ohta, Keisuke; Goto, Hideo; Nishio, Machiko

2016-07-01

Gene expression of paramyxoviruses is regulated by genome-encoded cis-acting elements; however, whether all the required elements for viral growth have been identified is not clear. Using a mini-replicon system, it has been shown that human parainfluenza virus type 2 (hPIV2) polymerase can recognize the promoter elements of parainfluenza virus type 5 (PIV5), but reporter activity is lower in this case. We constructed a series of luciferase-encoding chimeric PIV2/5 mini-genomes that are basically hPIV2, but whose leader (le), mRNA start signal and trailer sequence are partially replaced with those of PIV5. Studies of the chimeric PIV2/5 mini-replicons demonstrated that replacement of hPIV2 le with PIV5 le results in remarkably weak luciferase expression. Further mutagenesis identified the responsible region as positions 25-30 of the PIV5 le. Using recombinant hPIV2, the impact of this region on viral life cycles was assessed. Insertion of the mutation at this region facilitated viral growth, genomic replication and mRNA transcription at the early stage of infection, which elicited severe cell damage. In contrast, at the late infection stage it caused a reduction in viral transcription. Here, we identify a novel cis-acting element in the internal region of an le sequence that is involved in the regulation of polymerase, and which contributes to maintaining a balance between viral growth and cytotoxicity.

Effective suppression of dengue virus using a novel group-I intron that induces apoptotic cell death upon infection through conditional expression of the Bax C-terminal domain.

PubMed

Carter, James R; Keith, James H; Fraser, Tresa S; Dawson, James L; Kucharski, Cheryl A; Horne, Kate M; Higgs, Stephen; Fraser, Malcolm J

2014-06-13

Approximately 100 million confirmed infections and 20,000 deaths are caused by Dengue virus (DENV) outbreaks annually. Global warming and rapid dispersal have resulted in DENV epidemics in formally non-endemic regions. Currently no consistently effective preventive measures for DENV exist, prompting development of transgenic and paratransgenic vector control approaches. Production of transgenic mosquitoes refractory for virus infection and/or transmission is contingent upon defining antiviral genes that have low probability for allowing escape mutations, and are equally effective against multiple serotypes. Previously we demonstrated the effectiveness of an anti-viral group I intron targeting U143 of the DENV genome in mediating trans-splicing and expression of a marker gene with the capsid coding domain. In this report we examine the effectiveness of coupling expression of ΔN Bax to trans-splicing U143 intron activity as a means of suppressing DENV infection of mosquito cells. Targeting the conserved DENV circularization sequence (CS) by U143 intron trans-splicing activity appends a 3' exon RNA encoding ΔN Bax to the capsid coding region of the genomic RNA, resulting in a chimeric protein that induces premature cell death upon infection. TCID50-IFA analyses demonstrate an enhancement of DENV suppression for all DENV serotypes tested over the identical group I intron coupled with the non-apoptotic inducing firefly luciferase as the 3' exon. These cumulative results confirm the increased effectiveness of this αDENV-U143-ΔN Bax group I intron as a sequence specific antiviral that should be useful for suppression of DENV in transgenic mosquitoes. Annexin V staining, caspase 3 assays, and DNA ladder observations confirm DCA-ΔN Bax fusion protein expression induces apoptotic cell death. This report confirms the relative effectiveness of an anti-DENV group I intron coupled to an apoptosis-inducing ΔN Bax 3' exon that trans-splices conserved sequences of the 5' CS region of all DENV serotypes and induces apoptotic cell death upon infection. Our results confirm coupling the targeted ribozyme capabilities of the group I intron with the generation of an apoptosis-inducing transcript increases the effectiveness of infection suppression, improving the prospects of this unique approach as a means of inducing transgenic refractoriness in mosquitoes for all serotypes of this important disease.

Dissecting limiting factors of the Protein synthesis Using Recombinant Elements (PURE) system

PubMed Central

Li, Jun; Zhang, Chi; Huang, Poyi; Kuru, Erkin; Forster-Benson, Eliot T. C.; Church, George M.

2017-01-01

ABSTRACT Reconstituted cell-free protein synthesis systems such as the Protein synthesis Using Recombinant Elements (PURE) system give high-throughput and controlled access to in vitro protein synthesis. Here we show that compared with the commercial S30 crude extract based RTS 100 E. coli HY system, the PURE system has less mRNA degradation and produces up to ∼6-fold full-length proteins. However the majority of polypeptides PURE produces are partially translated or inactive since the signal from firefly luciferase (Fluc) translated in PURE is only ∼2/3rd of that measured using the RTS 100 E. coli HY S30 system. Both of the 2 batch systems suffer from low ribosome recycling efficiency when translating proteins from 82 kD to 224 kD. A systematic fed-batch analysis of PURE shows replenishment of 6 small molecule substrates individually or in combination before energy depletion increased Fluc protein yield by ∼1.5 to ∼2-fold, while creatine phosphate and magnesium have synergistic effects when added to the PURE system. Additionally, while adding EF-P to PURE reduced full-length protein translated, it increased the fraction of functional protein and reduced partially translated protein probably by slowing down the translation process. Finally, ArfA, rather than YaeJ or PrfH, helped reduce ribosome stalling when translating Fluc and improved system productivity in a template-dependent fashion. PMID:28702280

On-command drug release from nanochains inhibits growth of breast tumors

PubMed Central

Peiris, Pubudu M.; Tam, Morgan; Vicente, Peter; Abramowski, Aaron; Toy, Randall; Bauer, Lisa; Mayer, Aaron; Pansky, Jenna; Doolittle, Elizabeth; Tucci, Samantha; Schmidt, Erik; Shoup, Christopher; Rao, Swetha; Murray, Kaitlyn; Gopalakrishnan, Ramamurthy; Keri, Ruth A.; Basilion, James P.; Griswold, Mark A.; Karathanasis, Efstathios

2013-01-01

Purpose To evaluate the ability of radiofrequency (RF)-triggered drug release from a multicomponent chain-shaped nanoparticle to inhibit the growth of an aggressive breast tumor. Methods A two-step solid phase chemistry was employed to synthesize doxorubicin-loaded nanochains, which were composed of three iron oxide nanospheres and one doxorubicin-loaded liposome assembled in a 100-nm-long linear nanochain. The nanochains were tested in the Luc-GFP-4T1 orthotopic mouse model, which is a highly aggressive breast cancer model. The Luc-GFP-4T1 cell line stably expresses firefly luciferase, which allowed the non-invasive in vivo imaging of tumor response to the treatment using bioluminescence imaging (BLI). Results Longitudinal BLI imaging showed that a single nanochain treatment followed by application of RF resulted in an at least 100-fold lower BLI signal compared to the groups treated with nanochains (without RF) or free doxorubicin followed by RF. A statistically significant increase in survival time of the nanochain-treated animals followed by RF (64.3 days) was observed when compared to the nanochain-treated group without RF (35.7 days), free doxorubicin-treated group followed by RF (38.5 days), and the untreated group (30.5 days; n=5 animals per group). Conclusions These studies showed that the combination of RF and nanochains has the potential to effectively treat highly aggressive cancers and prolong survival. PMID:23934254

On-command drug release from nanochains inhibits growth of breast tumors.

PubMed

Peiris, Pubudu M; Tam, Morgan; Vicente, Peter; Abramowski, Aaron; Toy, Randall; Bauer, Lisa; Mayer, Aaron; Pansky, Jenna; Doolittle, Elizabeth; Tucci, Samantha; Schmidt, Erik; Shoup, Christopher; Rao, Swetha; Murray, Kaitlyn; Gopalakrishnan, Ramamurthy; Keri, Ruth A; Basilion, James P; Griswold, Mark A; Karathanasis, Efstathios

2014-06-01

To evaluate the ability of radiofrequency (RF)-triggered drug release from a multicomponent chain-shaped nanoparticle to inhibit the growth of an aggressive breast tumor. A two-step solid phase chemistry was employed to synthesize doxorubicin-loaded nanochains, which were composed of three iron oxide nanospheres and one doxorubicin-loaded liposome assembled in a 100-nm-long linear nanochain. The nanochains were tested in the 4T1-LUC-GFP orthotopic mouse model, which is a highly aggressive breast cancer model. The 4T1-LUC-GFP cell line stably expresses firefly luciferase, which allowed the non-invasive in vivo imaging of tumor response to the treatment using bioluminescence imaging (BLI). Longitudinal BLI imaging showed that a single nanochain treatment followed by application of RF resulted in an at least 100-fold lower BLI signal compared to the groups treated with nanochains (without RF) or free doxorubicin followed by RF. A statistically significant increase in survival time of the nanochain-treated animals followed by RF (64.3 days) was observed when compared to the nanochain-treated group without RF (35.7 days), free doxorubicin-treated group followed by RF (38.5 days), and the untreated group (30.5 days; n=5 animals per group). These studies showed that the combination of RF and nanochains has the potential to effectively treat highly aggressive cancers and prolong survival.

A novel quantitative high-throughput screen identifies drugs that both activate SUMO conjugation via the inhibition of microRNAs 182 and 183 and facilitate neuroprotection in a model of oxygen and glucose deprivation

PubMed Central

Bernstock, Joshua D; Lee, Yang-ja; Peruzzotti-Jametti, Luca; Southall, Noel; Johnson, Kory R; Maric, Dragan; Volpe, Giulio; Kouznetsova, Jennifer; Zheng, Wei; Pluchino, Stefano

2015-01-01

The conjugation/de-conjugation of Small Ubiquitin-like Modifier (SUMO) has been shown to be associated with a diverse set of physiologic/pathologic conditions. The clinical significance and ostensible therapeutic utility offered via the selective control of the global SUMOylation process has become readily apparent in ischemic pathophysiology. Herein, we describe the development of a novel quantitative high-throughput screening (qHTS) system designed to identify small molecules capable of increasing SUMOylation via the regulation/inhibition of members of the microRNA (miRNA)-182 family. This assay employs a SHSY5Y human neuroblastoma cell line stably transfected with a dual firefly-Renilla luciferase reporter system for identification of specific inhibitors of either miR-182 or miR-183. In this study, we have identified small molecules capable of inducing increased global conjugation of SUMO in both SHSY5Y cells and rat E18-derived primary cortical neurons. The protective effects of a number of the identified compounds were confirmed via an in vitro ischemic model (oxygen/glucose deprivation). Of note, this assay can be easily repurposed to allow high-throughput analyses of the potential drugability of other relevant miRNA(s) in ischemic pathobiology. PMID:26661196

A versatile coupled cell-free transcription-translation system based on tobacco BY-2 cell lysates.

PubMed

Buntru, Matthias; Vogel, Simon; Stoff, Katrin; Spiegel, Holger; Schillberg, Stefan

2015-05-01

Cell-free protein synthesis is a powerful method for the high-throughput production of recombinant proteins, especially proteins that are difficult to express in living cells. Here we describe a coupled cell-free transcription-translation system based on tobacco BY-2 cell lysates (BYLs). Using a combination of fractional factorial designs and response surface models, we developed a cap-independent system that produces more than 250 μg/mL of functional enhanced yellow fluorescent protein (eYFP) and about 270 μg/mL of firefly luciferase using plasmid templates, and up to 180 μg/mL eYFP using linear templates (PCR products) in 18 h batch reactions. The BYL contains actively-translocating microsomal vesicles derived from the endoplasmic reticulum, promoting the formation of disulfide bonds, glycosylation and the cotranslational integration of membrane proteins. This was demonstrated by expressing a functional full-size antibody (∼ 150 μg/mL), the model enzyme glucose oxidase (GOx) (∼ 7.3 U/mL), and a transmembrane growth factor (∼ 25 μg/mL). Subsequent in vitro treatment of GOx with peptide-N-glycosidase F confirmed the presence of N-glycans. Our results show that the BYL can be used as a high-throughput expression and screening platform that is particularly suitable for complex and cytotoxic proteins. © 2014 Wiley Periodicals, Inc.

RUNX1 promote invasiveness in pancreatic ductal adenocarcinoma through regulating miR-93

PubMed Central

Cheng, Yin; Yang, Haiyan; Sun, Yang; Zhang, Hongkai; Yu, Shuangni; Lu, Zhaohui; Chen, Jie

2017-01-01

Runt-related transcription factor 1(RUNX1), a key factor in hematopoiesis that mediates specification and homeostasis of hematopoietic stem and progenitor cells (HSPCs), is also overexpressed in several solid human cancers, and correlated with tumor progression. However, the expression and function of RUNX1 in pancreatic ductal adenocarcinoma were still unclear. Here, we show that RUNX1 is highly expressed in pancreatic adenocarcinoma tissues and knocking down of RUNX1 attenuated aggressiveness in pancreatic cell lines. Moreover, we found that RUNX1 could negatively regulate the expression of miR-93. Bioinformatics method showed that there are two binding sites in the the promotor region of miR-93 precursor and through ChIP-qPCR and firefly luciferase reporter assay, we vertified that these two binding sites each have transcriptive activity in one pancreatic cell lines. This result supported our presumption that RUNX1 regulate miR-93 through binding to the promotor region of miR-93. Besides, the expression and function of miR-93 is quite the opposite, miR-93 overexpression suppresses migration and invasiveness in pancreatic cell lines supporting that RUNX1 negatively regulated miR-93. Our findings provided evidence regarding the role of RUNX1 as an oncogene through the inhibition of miR-93. Targeting RUNX1 can be a potential therapeutic strategy in pancreatic cancer. PMID:29245924

Exploration of jasmonate signalling via automated and standardized transient expression assays in tobacco cells.

PubMed

De Sutter, Valerie; Vanderhaeghen, Rudy; Tilleman, Sofie; Lammertyn, Freya; Vanhoutte, Isabelle; Karimi, Mansour; Inzé, Dirk; Goossens, Alain; Hilson, Pierre

2005-12-01

Although sequence information and genome annotation are improving at an impressive pace, functional ontology is still non-existent or rudimentary for most genes. In this regard, transient expression assays are very valuable for identification of short functional segments in particular pathways, because they can be performed rapidly and at a scale unattainable in stably transformed tissues. Vectors were constructed and protocols developed for systematic transient assays in plant protoplasts. To enhance throughput and reproducibility, protoplast treatments were performed entirely by a liquid-handling robot in multiwell plates, including polyethylene glycol/Ca2+ cell transfection with plasmid mixtures, washes and lysis. All transcriptional readouts were measured using a dual firefly/Renilla luciferase assay, in which the former was controlled by a reporter promoter and the latter by the 35S CaMV promoter, which served as internal normalization standard. The automated protocols were suitable for transient assays in protoplasts prepared from cell cultures of Nicotiana tabacum Bright Yellow-2 and Arabidopsis thaliana. They were implemented in a screen to discover potential regulators of genes coding for key enzymes in nicotine biosynthesis. Two novel tobacco transcription factors were found, NtORC1 and NtJAP1, that positively regulate the putrescine N-methyltransferase (PMT) promoter. In addition, combinatorial tests showed that these two factors act synergistically to induce PMT transcriptional activity. The development and use of high-throughput plant transient expression assays are discussed.

Monitoring and quantitative assessment of tumor burden using in vivo bioluminescence imaging

NASA Astrophysics Data System (ADS)

Chen, Chia-Chi; Hwang, Jeng-Jong; Ting, Gann; Tseng, Yun-Long; Wang, Shyh-Jen; Whang-Peng, Jaqueline

2007-02-01

In vivo bioluminescence imaging (BLI) is a sensitive imaging modality that is rapid and accessible, and may comprise an ideal tool for evaluating tumor growth. In this study, the kinetic of tumor growth has been assessed in C26 colon carcinoma bearing BALB/c mouse model. The ability of BLI to noninvasively quantitate the growth of subcutaneous tumors transplanted with C26 cells genetically engineered to stably express firefly luciferase and herpes simplex virus type-1 thymidine kinase (C26/ tk-luc). A good correlation ( R2=0.998) of photon emission to the cell number was found in vitro. Tumor burden and tumor volume were monitored in vivo over time by quantitation of photon emission using Xenogen IVIS 50 and standard external caliper measurement, respectively. At various time intervals, tumor-bearing mice were imaged to determine the correlation of in vivo BLI to tumor volume. However, a correlation of BLI to tumor volume was observed when tumor volume was smaller than 1000 mm 3 ( R2=0.907). γ Scintigraphy combined with [ 131I]FIAU was another imaging modality used for verifying the previous results. In conclusion, this study showed that bioluminescence imaging is a powerful and quantitative tool for the direct assay to monitor tumor growth in vivo. The dual reporter genes transfected tumor-bearing animal model can be applied in the evaluation of the efficacy of new developed anti-cancer drugs.

Dissecting limiting factors of the Protein synthesis Using Recombinant Elements (PURE) system

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Jun; Zhang, Chi; Huang, Poyi

Reconstituted cell-free protein synthesis systems such as the Protein synthesis Using Recombinant Elements (PURE) system give high-throughput and controlled access to in vitro protein synthesis. Here we show that compared with the commercial S30 crude extract based RTS 100 E. coli HY system, the PURE system has less mRNA degradation and produces up to ~6-fold full-length proteins. However the majority of polypeptides PURE produces are partially translated or inactive since the signal from firefly luciferase (Fluc) translated in PURE is only ~2/3 rd of that measured using the RTS 100 E. coli HY S30 system. Both of the 2 batchmore » systems suffer from low ribosome recycling efficiency when translating proteins from 82 k D to 224 k D. A systematic fed-batch analysis of PURE shows replenishment of 6 small molecule substrates individually or in combination before energy depletion increased Fluc protein yield by ~1.5 to ~2-fold, while creatine phosphate and magnesium have synergistic effects when added to the PURE system. Additionally, while adding EF-P to PURE reduced full-length protein translated, it increased the fraction of functional protein and reduced partially translated protein probably by slowing down the translation process. Finally, ArfA, rather than YaeJ or PrfH, helped reduce ribosome stalling when translating Fluc and improved system productivity in a template-dependent fashion.« less

Acute diabetes insipidus mediated by vasopressinase after placental abruption.

PubMed

Wallia, Amisha; Bizhanova, Aigerim; Huang, Wenyu; Goldsmith, Susan L; Gossett, Dana R; Kopp, Peter

2013-03-01

Postpartum, diabetes insipidus (DI) can be part of Sheehan's syndrome or lymphocytic hypophysitis in combination with anterior pituitary hormone deficiencies. In contrast, acute onset of isolated DI in the postpartum period is unusual. This patient presented at 33 weeks gestation with placental abruption, prompting a cesarean delivery of twins. Immediately after delivery, she developed severe DI. The DI could be controlled with the vasopressinase-resistant 1-deamino-8-D-arginine vasopressin (DDAVP), but not with arginine vasopressin (AVP), and it resolved within a few weeks. The aim of this study was to demonstrate that the postpartum DI in this patient was caused by the release of placental vasopressinase into the maternal bloodstream. Cells were transiently transfected with the AVP receptor 2 (AVPR2) and treated with either AVP or DDAVP in the presence of the patient's serum collected postpartum or 10 weeks after delivery. The response to the different treatments was evaluated by measuring the activity of a cAMP-responsive firefly luciferase reporter construct. The in vitro studies demonstrate that the patient's postpartum serum disrupts activation of the AVPR2 by AVP, but not by the vasopressinase-resistant DDAVP. Placental abruption can rarely be associated with acute postpartum DI caused by release of placental vasopressinase into the bloodstream. This clinical entity must be considered in patients with placental abruption and when evaluating patients presenting with DI after delivery.

Identifying apicoplast-targeting antimalarials using high-throughput compatible approaches

PubMed Central

Ekland, Eric H.; Schneider, Jessica; Fidock, David A.

2011-01-01

Malarial parasites have evolved resistance to all previously used therapies, and recent evidence suggests emerging resistance to the first-line artemisinins. To identify antimalarials with novel mechanisms of action, we have developed a high-throughput screen targeting the apicoplast organelle of Plasmodium falciparum. Antibiotics known to interfere with this organelle, such as azithromycin, exhibit an unusual phenotype whereby the progeny of drug-treated parasites die. Our screen exploits this phenomenon by assaying for “delayed death” compounds that exhibit a higher potency after two cycles of intraerythrocytic development compared to one. We report a primary assay employing parasites with an integrated copy of a firefly luciferase reporter gene and a secondary flow cytometry-based assay using a nucleic acid stain paired with a mitochondrial vital dye. Screening of the U.S. National Institutes of Health Clinical Collection identified known and novel antimalarials including kitasamycin. This inexpensive macrolide, used for agricultural applications, exhibited an in vitro IC50 in the 50 nM range, comparable to the 30 nM activity of our control drug, azithromycin. Imaging and pharmacologic studies confirmed kitasamycin action against the apicoplast, and in vivo activity was observed in a murine malaria model. These assays provide the foundation for high-throughput campaigns to identify novel chemotypes for combination therapies to treat multidrug-resistant malaria.—Ekland, E. H., Schneider, J., Fidock, D. A. Identifying apicoplast-targeting antimalarials using high-throughput compatible approaches. PMID:21746861

Rapid bacteriological screening of cosmetic raw materials by using bioluminescence.

PubMed

Nielsen, P; Van Dellen, E

1989-01-01

Incoming cosmetic raw materials are routinely tested for microbial content. Standard plate count methods require up to 72 h. A rapid, sensitive, and inexpensive raw material screening method was developed that detects the presence of bacteria by means of ATP (bioluminescence). With a 24-h broth enrichment, the minimum bacterial ATP detection threshold of 1 cfu/g sample can be achieved using purified firefly luciferin-luciferase and an ATP releasing reagent. By using this rapid screen, microbiologically free material may be released for production within 24 h, while contaminated material undergoes further quantitative and identification testing. In order for a raw material to be validated for this method it must be evaluated for (1) a potential nonmicrobial light-contributing reaction resulting in a false positive or, (2) degradation of the ATP giving a false negative, and (3) confirmation that the raw material has not overwhelmed the buffering capacity of the enrichment broth. The key criteria for a rapid screen was the sensitivity to detect less than one colony forming unit per g product, the speed to do this within 24 h, and cost efficiency. Bioluminescence meets these criteria. With an enrichment step, it can detect less than one cfu/g sample. After the enrichment step, analysis time per sample is approximately 2 min and the cost for material and reagents is less than one dollar per sample.

Dissecting limiting factors of the Protein synthesis Using Recombinant Elements (PURE) system

DOE PAGES

Li, Jun; Zhang, Chi; Huang, Poyi; ...

2017-05-09

Reconstituted cell-free protein synthesis systems such as the Protein synthesis Using Recombinant Elements (PURE) system give high-throughput and controlled access to in vitro protein synthesis. Here we show that compared with the commercial S30 crude extract based RTS 100 E. coli HY system, the PURE system has less mRNA degradation and produces up to ~6-fold full-length proteins. However the majority of polypeptides PURE produces are partially translated or inactive since the signal from firefly luciferase (Fluc) translated in PURE is only ~2/3 rd of that measured using the RTS 100 E. coli HY S30 system. Both of the 2 batchmore » systems suffer from low ribosome recycling efficiency when translating proteins from 82 k D to 224 k D. A systematic fed-batch analysis of PURE shows replenishment of 6 small molecule substrates individually or in combination before energy depletion increased Fluc protein yield by ~1.5 to ~2-fold, while creatine phosphate and magnesium have synergistic effects when added to the PURE system. Additionally, while adding EF-P to PURE reduced full-length protein translated, it increased the fraction of functional protein and reduced partially translated protein probably by slowing down the translation process. Finally, ArfA, rather than YaeJ or PrfH, helped reduce ribosome stalling when translating Fluc and improved system productivity in a template-dependent fashion.« less

Cell Cycle Dependent Regulation of Human Progesterone Receptor in Breast Cancer

DTIC Science & Technology

2004-10-01

wt PR or S400A PR (0.01-1.0 [tg each), CDK2 (ljig), and PRE-2x-TATA-luc reporter plasmid (lig) along with Renilla plasmid (10ng) as a control for...8 hours prior to treatment. Cells were collected following treatment with 10 nM R5020 or ETOH vehicle control for 18 hrs. Luciferase and renilla ...reporter, a renilla reporter construct as a transfection control, either wt PR-B or S400A mutant PR-B, and control parental vector or a vector encoding an

The potential application of a transcriptionally regulated oncolytic herpes simplex virus for human cancer therapy

PubMed Central

Miao, L; Fraefel, C; Sia, K C; Newman, J P; Mohamed-Bashir, S A; Ng, W H; Lam, P Y P

2014-01-01

Background: Emerging studies have shown the potential benefit of arming oncolytic viruses with therapeutic genes. However, most of these therapeutic genes are placed under the regulation of ubiquitous viral promoters. Our goal is to generate a safer yet potent oncolytic herpes simplex virus type-1 (HSV-1) for cancer therapy. Methods: Using bacterial artificial chromosome (BAC) recombineering, a cell cycle-regulatable luciferase transgene cassette was replaced with the infected cell protein 6 (ICP6) coding region (encoded for UL39 or large subunit of ribonucleotide reductase) of the HSV-1 genome. These recombinant viruses, YE-PC8, were further tested for its proliferation-dependent luciferase gene expression. Results: The ability of YE-PC8 to confer proliferation-dependent transgene expression was demonstrated by injecting similar amount of viruses into the tumour-bearing region of the brain and the contralateral normal brain parenchyma of the same mouse. The results showed enhanced levels of luciferase activities in the tumour region but not in the normal brain parenchyma. Similar findings were observed in YE-PC8-infected short-term human brain patient-derived glioma cells compared with normal human astrocytes. intratumoural injection of YE-PC8 viruses resulted in 77% and 80% of tumour regression in human glioma and human hepatocellular carcinoma xenografts, respectively. Conclusion: YE-PC8 viruses confer tumour selectivity in proliferating cells and may be developed further as a feasible approach to treat human cancers. PMID:24196790

Extension of the firefly algorithm and preference rules for solving MINLP problems

NASA Astrophysics Data System (ADS)

Costa, M. Fernanda P.; Francisco, Rogério B.; Rocha, Ana Maria A. C.; Fernandes, Edite M. G. P.

2017-07-01

An extension of the firefly algorithm (FA) for solving mixed-integer nonlinear programming (MINLP) problems is presented. Although penalty functions are nowadays frequently used to handle integrality conditions and inequality and equality constraints, this paper proposes the implementation within the FA of a simple rounded-based heuristic and four preference rules to find and converge to MINLP feasible solutions. Preliminary numerical experiments are carried out to validate the proposed methodology.

Bouc-Wen hysteresis model identification using Modified Firefly Algorithm

NASA Astrophysics Data System (ADS)

Zaman, Mohammad Asif; Sikder, Urmita

2015-12-01

The parameters of Bouc-Wen hysteresis model are identified using a Modified Firefly Algorithm. The proposed algorithm uses dynamic process control parameters to improve its performance. The algorithm is used to find the model parameter values that results in the least amount of error between a set of given data points and points obtained from the Bouc-Wen model. The performance of the algorithm is compared with the performance of conventional Firefly Algorithm, Genetic Algorithm and Differential Evolution algorithm in terms of convergence rate and accuracy. Compared to the other three optimization algorithms, the proposed algorithm is found to have good convergence rate with high degree of accuracy in identifying Bouc-Wen model parameters. Finally, the proposed method is used to find the Bouc-Wen model parameters from experimental data. The obtained model is found to be in good agreement with measured data.

A clustering method of Chinese medicine prescriptions based on modified firefly algorithm.

PubMed

Yuan, Feng; Liu, Hong; Chen, Shou-Qiang; Xu, Liang

2016-12-01

This paper is aimed to study the clustering method for Chinese medicine (CM) medical cases. The traditional K-means clustering algorithm had shortcomings such as dependence of results on the selection of initial value, trapping in local optimum when processing prescriptions form CM medical cases. Therefore, a new clustering method based on the collaboration of firefly algorithm and simulated annealing algorithm was proposed. This algorithm dynamically determined the iteration of firefly algorithm and simulates sampling of annealing algorithm by fitness changes, and increased the diversity of swarm through expansion of the scope of the sudden jump, thereby effectively avoiding premature problem. The results from confirmatory experiments for CM medical cases suggested that, comparing with traditional K-means clustering algorithms, this method was greatly improved in the individual diversity and the obtained clustering results, the computing results from this method had a certain reference value for cluster analysis on CM prescriptions.

Firefly: A HOT camera core for thermal imagers with enhanced functionality

NASA Astrophysics Data System (ADS)

Pillans, Luke; Harmer, Jack; Edwards, Tim

2015-06-01

Raising the operating temperature of mercury cadmium telluride infrared detectors from 80K to above 160K creates new applications for high performance infrared imagers by vastly reducing the size, weight and power consumption of the integrated cryogenic cooler. Realizing the benefits of Higher Operating Temperature (HOT) requires a new kind of infrared camera core with the flexibility to address emerging applications in handheld, weapon mounted and UAV markets. This paper discusses the Firefly core developed to address these needs by Selex ES in Southampton UK. Firefly represents a fundamental redesign of the infrared signal chain reducing power consumption and providing compatibility with low cost, low power Commercial Off-The-Shelf (COTS) computing technology. This paper describes key innovations in this signal chain: a ROIC purpose built to minimize power consumption in the proximity electronics, GPU based image processing of infrared video, and a software customisable infrared core which can communicate wirelessly with other Battlespace systems.

Application of firefly algorithm to the dynamic model updating problem

NASA Astrophysics Data System (ADS)

Shabbir, Faisal; Omenzetter, Piotr

2015-04-01

Model updating can be considered as a branch of optimization problems in which calibration of the finite element (FE) model is undertaken by comparing the modal properties of the actual structure with these of the FE predictions. The attainment of a global solution in a multi dimensional search space is a challenging problem. The nature-inspired algorithms have gained increasing attention in the previous decade for solving such complex optimization problems. This study applies the novel Firefly Algorithm (FA), a global optimization search technique, to a dynamic model updating problem. This is to the authors' best knowledge the first time FA is applied to model updating. The working of FA is inspired by the flashing characteristics of fireflies. Each firefly represents a randomly generated solution which is assigned brightness according to the value of the objective function. The physical structure under consideration is a full scale cable stayed pedestrian bridge with composite bridge deck. Data from dynamic testing of the bridge was used to correlate and update the initial model by using FA. The algorithm aimed at minimizing the difference between the natural frequencies and mode shapes of the structure. The performance of the algorithm is analyzed in finding the optimal solution in a multi dimensional search space. The paper concludes with an investigation of the efficacy of the algorithm in obtaining a reference finite element model which correctly represents the as-built original structure.

FIREFLY (Fitting IteRativEly For Likelihood analYsis): a full spectral fitting code

NASA Astrophysics Data System (ADS)

Wilkinson, David M.; Maraston, Claudia; Goddard, Daniel; Thomas, Daniel; Parikh, Taniya

2017-12-01

We present a new spectral fitting code, FIREFLY, for deriving the stellar population properties of stellar systems. FIREFLY is a chi-squared minimization fitting code that fits combinations of single-burst stellar population models to spectroscopic data, following an iterative best-fitting process controlled by the Bayesian information criterion. No priors are applied, rather all solutions within a statistical cut are retained with their weight. Moreover, no additive or multiplicative polynomials are employed to adjust the spectral shape. This fitting freedom is envisaged in order to map out the effect of intrinsic spectral energy distribution degeneracies, such as age, metallicity, dust reddening on galaxy properties, and to quantify the effect of varying input model components on such properties. Dust attenuation is included using a new procedure, which was tested on Integral Field Spectroscopic data in a previous paper. The fitting method is extensively tested with a comprehensive suite of mock galaxies, real galaxies from the Sloan Digital Sky Survey and Milky Way globular clusters. We also assess the robustness of the derived properties as a function of signal-to-noise ratio (S/N) and adopted wavelength range. We show that FIREFLY is able to recover age, metallicity, stellar mass, and even the star formation history remarkably well down to an S/N ∼ 5, for moderately dusty systems. Code and results are publicly available.1

pHlash: A New Genetically Encoded and Ratiometric Luminescence Sensor of Intracellular pH

PubMed Central

Robertson, J. Brian; Johnson, Carl Hirschie

2012-01-01

We report the development of a genetically encodable and ratiometic pH probe named “pHlash” that utilizes Bioluminescence Resonance Energy Transfer (BRET) rather than fluorescence excitation. The pHlash sensor–composed of a donor luciferase that is genetically fused to a Venus fluorophore–exhibits pH dependence of its spectral emission in vitro. When expressed in either yeast or mammalian cells, pHlash reports basal pH and cytosolic acidification in vivo. Its spectral ratio response is H+ specific; neither Ca++, Mg++, Na+, nor K+ changes the spectral form of its luminescence emission. Moreover, it can be used to image pH in single cells. This is the first BRET-based sensor of H+ ions, and it should allow the approximation of pH in cytosolic and organellar compartments in applications where current pH probes are inadequate. PMID:22905204

pHlash: a new genetically encoded and ratiometric luminescence sensor of intracellular pH.

PubMed

Zhang, Yunfei; Xie, Qiguang; Robertson, J Brian; Johnson, Carl Hirschie

2012-01-01

We report the development of a genetically encodable and ratiometic pH probe named "pHlash" that utilizes Bioluminescence Resonance Energy Transfer (BRET) rather than fluorescence excitation. The pHlash sensor-composed of a donor luciferase that is genetically fused to a Venus fluorophore-exhibits pH dependence of its spectral emission in vitro. When expressed in either yeast or mammalian cells, pHlash reports basal pH and cytosolic acidification in vivo. Its spectral ratio response is H(+) specific; neither Ca(++), Mg(++), Na(+), nor K(+) changes the spectral form of its luminescence emission. Moreover, it can be used to image pH in single cells. This is the first BRET-based sensor of H(+) ions, and it should allow the approximation of pH in cytosolic and organellar compartments in applications where current pH probes are inadequate.

A hyperbolastic type-I diffusion process: Parameter estimation by means of the firefly algorithm.

PubMed

Barrera, Antonio; Román-Román, Patricia; Torres-Ruiz, Francisco

2018-01-01

A stochastic diffusion process, whose mean function is a hyperbolastic curve of type I, is presented. The main characteristics of the process are studied and the problem of maximum likelihood estimation for the parameters of the process is considered. To this end, the firefly metaheuristic optimization algorithm is applied after bounding the parametric space by a stagewise procedure. Some examples based on simulated sample paths and real data illustrate this development. Copyright © 2017 Elsevier B.V. All rights reserved.

Human olfactory receptor responses to odorants

PubMed Central

Mainland, Joel D; Li, Yun R; Zhou, Ting; Liu, Wen Ling L; Matsunami, Hiroaki

2015-01-01

Although the human olfactory system is capable of discriminating a vast number of odors, we do not currently understand what chemical features are encoded by olfactory receptors. In large part this is due to a paucity of data in a search space covering the interactions of hundreds of receptors with billions of odorous molecules. Of the approximately 400 intact human odorant receptors, only 10% have a published ligand. Here we used a heterologous luciferase assay to screen 73 odorants against a clone library of 511 human olfactory receptors. This dataset will allow other researchers to interrogate the combinatorial nature of olfactory coding. PMID:25977809

Experimental Investigation and Optimization of TIG Welding Parameters on Aluminum 6061 Alloy Using Firefly Algorithm

NASA Astrophysics Data System (ADS)

Kumar, Rishi; Mevada, N. Ramesh; Rathore, Santosh; Agarwal, Nitin; Rajput, Vinod; Sinh Barad, AjayPal

2017-08-01

To improve Welding quality of aluminum (Al) plate, the TIG Welding system has been prepared, by which Welding current, Shielding gas flow rate and Current polarity can be controlled during Welding process. In the present work, an attempt has been made to study the effect of Welding current, current polarity, and shielding gas flow rate on the tensile strength of the weld joint. Based on the number of parameters and their levels, the Response Surface Methodology technique has been selected as the Design of Experiment. For understanding the influence of input parameters on Ultimate tensile strength of weldment, ANOVA analysis has been carried out. Also to describe and optimize TIG Welding using a new metaheuristic Nature - inspired algorithm which is called as Firefly algorithm which was developed by Dr. Xin-She Yang at Cambridge University in 2007. A general formulation of firefly algorithm is presented together with an analytical, mathematical modeling to optimize the TIG Welding process by a single equivalent objective function.

A Firefly Algorithm-based Approach for Pseudo-Relevance Feedback: Application to Medical Database.

PubMed

Khennak, Ilyes; Drias, Habiba

2016-11-01

The difficulty of disambiguating the sense of the incomplete and imprecise keywords that are extensively used in the search queries has caused the failure of search systems to retrieve the desired information. One of the most powerful and promising method to overcome this shortcoming and improve the performance of search engines is Query Expansion, whereby the user's original query is augmented by new keywords that best characterize the user's information needs and produce more useful query. In this paper, a new Firefly Algorithm-based approach is proposed to enhance the retrieval effectiveness of query expansion while maintaining low computational complexity. In contrast to the existing literature, the proposed approach uses a Firefly Algorithm to find the best expanded query among a set of expanded query candidates. Moreover, this new approach allows the determination of the length of the expanded query empirically. Experimental results on MEDLINE, the on-line medical information database, show that our proposed approach is more effective and efficient compared to the state-of-the-art.

Characterization of cis-acting elements required for autorepression of the equine herpesvirus 1 IE gene

PubMed Central

Kim, Seongman; Dai, Gan; O’Callaghan, Dennis J.; Kim, Seong Kee

2012-01-01

The immediate-early protein (IEP), the major regulatory protein encoded by the IE gene of equine herpesvirus 1 (EHV-1), plays a crucial role as both transcription activator and repressor during a productive lytic infection. To investigate the mechanism by which the EHV-1 IEP inhibits its own promoter, IE promoter-luciferase reporter plasmids containing wild-type and mutant IEP-binding site (IEBS) were constructed and used for luciferase reporter assays. The IEP inhibited transcription from its own promoter in the presence of a consensus IEBS (5’-ATCGT-3’) located near the transcription initiation site but did not inhibit when the consensus sequence was deleted. To determine whether the distance between the TATA box and the IEBS affects transcriptional repression, the IEBS was displaced from the original site by the insertion of synthetic DNA sequences. Luciferase reporter assays revealed that the IEP is able to repress its own promoter when the IEBS is located within 26-bp from the TATA box. We also found that the proper orientation and position of the IEBS were required for the repression by the IEP. Interestingly, the level of repression was significantly reduced when a consensus TATA sequence was deleted from the promoter region, indicating that the IEP efficiently inhibits its own promoter in a TATA box-dependent manner. Taken together, these results suggest that the EHV-1 IEP delicately modulates autoregulation of its gene through the consensus IEBS that is near the transcription initiation site and the TATA box. PMID:22265772

Characterization of cis-acting elements required for autorepression of the equine herpesvirus 1 IE gene.

PubMed

Kim, Seongman; Dai, Gan; O'Callaghan, Dennis J; Kim, Seong Kee

2012-04-01

The immediate-early protein (IEP), the major regulatory protein encoded by the IE gene of equine herpesvirus 1 (EHV-1), plays a crucial role as both transcription activator and repressor during a productive lytic infection. To investigate the mechanism by which the EHV-1 IEP inhibits its own promoter, IE promoter-luciferase reporter plasmids containing wild-type and mutant IEP-binding site (IEBS) were constructed and used for luciferase reporter assays. The IEP inhibited transcription from its own promoter in the presence of a consensus IEBS (5'-ATCGT-3') located near the transcription initiation site but did not inhibit when the consensus sequence was deleted. To determine whether the distance between the TATA box and the IEBS affects transcriptional repression, the IEBS was displaced from the original site by the insertion of synthetic DNA sequences. Luciferase reporter assays revealed that the IEP is able to repress its own promoter when the IEBS is located within 26-bp from the TATA box. We also found that the proper orientation and position of the IEBS were required for the repression by the IEP. Interestingly, the level of repression was significantly reduced when a consensus TATA sequence was deleted from the promoter region, indicating that the IEP efficiently inhibits its own promoter in a TATA box-dependent manner. Taken together, these results suggest that the EHV-1 IEP delicately modulates autoregulation of its gene through the consensus IEBS that is near the transcription initiation site and the TATA box. Copyright © 2012. Published by Elsevier B.V.

Molecular imaging of the biological effects of quercetin and quercetin-rich foods.

PubMed

Moskaug, Jan Øivind; Carlsen, Harald; Myhrstad, Mari; Blomhoff, Rune

2004-04-01

The human diet contains several thousands of organic plant molecules (i.e. phytochemicals), many of which have significant bioactivities. The specific physiological effects of these compounds are impossible to predict from in vitro studies using cell cultures and cell-free model systems. Nutrigenomics, which may be defined as the application of genomic tools to study the integrated effects of nutrients on gene regulation, however, holds great promise in increasing the understanding of how nutrients affect molecular events in an organism. Quercetin, a phytochemical belonging to the flavonoids, has antioxidant activities, inhibit protein kinases, inhibit DNA topoisomerases and regulate gene expression. The aim of the present review is to describe some of the many effects of quercetin, and how molecular imaging using transgenic reporter mice may serve as a tool to study the integrated influence of quercetin and other dietary phytochemicals on gene expression in vivo. We are using the bioluminescence emitted from firefly luciferase as the reporter since light originating from the inside of a cell or organism can be detected externally in an intact living organism. Molecular imaging using reporter models is therefore a unique technology to study the integrated effects of environmental insults and dietary substances on the influence of gene expression in disease development. We utilize these in vivo models to elucidate the role of various flavonoids, such as quercetin, for modulating gene expression related to oxidative stress and the antioxidant defence system.

ATP as a biomarker of viable microorganisms in clean-room facilities

NASA Technical Reports Server (NTRS)

Venkateswaran, Kasthuri; Hattori, Noriaki; La Duc, Myron T.; Kern, Roger

2003-01-01

A new firefly luciferase bioluminescence assay method that differentiates free extracellular ATP (dead cells, etc.) from intracellular ATP (viable microbes) was used to determine the viable microbial cleanliness of various clean-room facilities. For comparison, samples were taken from both clean-rooms, where the air was filtered to remove particles >0.5 microm, and ordinary rooms with unfiltered air. The intracellular ATP was determined after enzymatically degrading the sample's free ATP. Also for comparison, cultivable microbial populations were counted on nutrient-rich trypticase soy agar (TSA) plates. Both the cultivable and ATP-based determinations indicate that the microbial burden was lower in clean-room facilities than in ordinary rooms. However, there was no direct correlation between the two sets of measurements because the two assays measured very different populations. A large fraction of the samples yielded no colony formers on TSA, but were positive for intracellular ATP. Subsequently, genomic DNA was isolated directly from selected samples and 16S rDNA fragments were cloned and sequenced, identifying nearest neighbors, many of which are known to be noncultivable in the media employed. It was concluded that viable microbial contamination can be reliably monitored by measurement of intracellular ATP, and that this method may be considered superior to cultivable colony counts due to its speed and its ability to report the presence of viable but noncultivable organisms. When the detection of nonviable microbes is of interest, the ATP assay can be supplemented with DNA analysis.

Discovery of Clinically Approved Agents That Promote Suppression of Cystic Fibrosis Transmembrane Conductance Regulator Nonsense Mutations.

PubMed

Mutyam, Venkateshwar; Du, Ming; Xue, Xiaojiao; Keeling, Kim M; White, E Lucile; Bostwick, J Robert; Rasmussen, Lynn; Liu, Bo; Mazur, Marina; Hong, Jeong S; Falk Libby, Emily; Liang, Feng; Shang, Haibo; Mense, Martin; Suto, Mark J; Bedwell, David M; Rowe, Steven M

2016-11-01

Premature termination codons (PTCs) in the cystic fibrosis transmembrane conductance regulator (CFTR) gene cause cystic fibrosis (CF). Several agents are known to suppress PTCs but are poorly efficacious or toxic. To determine whether there are clinically available agents that elicit translational readthrough and improve CFTR function sufficient to confer therapeutic benefit to patients with CF with PTCs. Two independent screens, firefly luciferase and CFTR-mediated transepithelial chloride conductance assay, were performed on a library of 1,600 clinically approved compounds using fisher rat thyroid cells stably transfected with stop codons. Select agents were further evaluated using secondary screening assays including short circuit current analysis on primary cells from patients with CF. In addition, the effect of CFTR modulators (ivacaftor) was tested in combination with the most efficacious agents. From the primary screen, 48 agents were selected as potentially active. Following confirmatory tests in the transepithelial chloride conductance assay and prioritizing agents based on favorable pharmacologic properties, eight agents were advanced for secondary screening. Ivacaftor significantly increased short circuit current following forskolin stimulation in cells treated with pyranoradine tetraphosphate, potassium p-aminobenzoate, and escin as compared with vehicle control. Escin, an herbal agent, consistently induced readthrough activity as demonstrated by enhanced CFTR expression and function in vitro. Clinically approved drugs identified as potential readthrough agents, in combination with ivacaftor, may induce nonsense suppression to restore therapeutic levels of CFTR function. One or more agents may be suitable to advance to human testing.

Leishmanicidal compounds of Nectria pseudotrichia, an endophytic fungus isolated from the plant Caesalpinia echinata (Brazilwood).

PubMed

Cota, Betania Barros; Tunes, Luiza Guimarães; Maia, Daniela Nabak Bueno; Ramos, Jonas Pereira; Oliveira, Djalma Menezes de; Kohlhoff, Markus; Alves, Tânia Maria de Almeida; Souza-Fagundes, Elaine Maria; Campos, Fernanda Fraga; Zani, Carlos Leomar

2018-02-01

BACKGROUND In a screen of extracts from plants and fungi to detect antileishmanial activity, we found that the ethyl acetate extract of the fungus Nectria pseudotrichia, isolated from the tree Caesalpinia echinata (Brazilwood), is a promising source of bioactive compounds. OBJECTIVES The aims of this study were to isolate and determine the chemical structures of the compounds responsible for the antileishmanial activity of the organic extract from N. pseudotrichia. METHODS Compounds were isolated by chromatographic fractionation using semi-preparative high-performance liquid chromatography, and their chemical structures were determined by analytical and spectral data and by comparison with published data. The antileishmanial activity of the isolated compounds was evaluated in intracellular amastigote forms of Leishmania (Viannia) braziliensis expressing firefly luciferase as reporter gene, and cytotoxicity was determined in Vero and THP-1 mammalian cell lines by MTT assay. FINDINGS Fractionation of the extract yielded seven compounds: 10-acetyl trichoderonic acid A (1), 6'-acetoxy-piliformic acid (2), 5',6'-dehydropiliformic acid (3), piliformic acid (4), hydroheptelidic acid (5), xylaric acid D (6), and cytochalasin D (7). Compounds 1, 2 and 3 are reported here for the first time. Compounds 1, 2, and 5 were more active, with IC50 values of 21.4, 28.3, and 24.8 µM, respectively, and showed low toxicity to Vero and THP-1 cells. MAIN CONCLUSIONS N. pseudotrichia produces secondary metabolites that are more toxic to intracellular amastigote forms of L. (V.) braziliensis than to mammalian cells.

NtLTP4, a lipid transfer protein that enhances salt and drought stresses tolerance in Nicotiana tabacum.

PubMed

Xu, Yang; Zheng, Xinxin; Song, Yunzhi; Zhu, Lifei; Yu, Zipeng; Gan, Liming; Zhou, Shumei; Liu, Hongmei; Wen, Fujiang; Zhu, Changxiang

2018-06-11

Lipid transfer proteins (LTPs), a class of small, ubiquitous proteins, play critical roles in various environmental stresses. However, their precise biological functions remain unknown. Here we isolated an extracellular matrix-localised LTP, NtLTP4, from Nicotiana tabacum. The overexpression of NtLTP4 in N. tabacum enhanced resistance to salt and drought stresses. Upon exposure to high salinity, NtLTP4-overexpressing lines (OE lines) accumulated low Na + levels. Salt-responsive genes, including Na + /H + exchangers (NHX1) and high-affinity K + transporter1 (HKT1), were dramatically higher in OE lines than in wild-type lines. NtLTP4 might regulate transcription levels of NHX1 and HKT1 to alleviate the toxicity of Na + . Interestingly, OE lines enhanced the tolerance of N. tabacum to drought stress by reducing the transpiration rate. Moreover, NtLTP4 could increase reactive oxygen species (ROS)-scavenging enzyme activity and expression levels to scavenge excess ROS under drought and high salinity conditions. We used a two-hybrid yeast system and screened seven putative proteins that interact with NtLTP4 in tobacco. An MAPK member, wound-induced protein kinase, was confirmed to interact with NtLTP4 via co-immunoprecipitation and a firefly luciferase complementation imaging assay. Taken together, this is the first functional analysis of NtLTP4, and proves that NtLTP4 positively regulates salt and drought stresses in N. tabacum.

Reporter Gene-Facilitated Detection of Compounds in Arabidopsis Leaf Extracts that Activate the Karrikin Signaling Pathway.

PubMed

Sun, Yueming K; Flematti, Gavin R; Smith, Steven M; Waters, Mark T

2016-01-01

Karrikins are potent germination stimulants generated by the combustion of plant matter. Treatment of Arabidopsis with karrikins triggers a signaling process that is dependent upon a putative receptor protein KARRIKIN INSENSITIVE 2 (KAI2). KAI2 is a homolog of DWARF 14 (D14), the receptor for endogenous strigolactone hormones. Genetic analyses suggest that KAI2 also perceives endogenous signal(s) that are not strigolactones. Activation of KAI2 by addition of karrikins to Arabidopsis plants induces expression of transcripts including D14-LIKE 2 ( DLK2 ). We constructed the synthetic reporter gene DLK2 : LUC in Arabidopsis , which comprises the firefly luciferase gene ( LUC ) driven by the DLK2 promoter. Here we describe a luminescence-based reporter assay with Arabidopsis seeds to detect chemical signals that can activate the KAI2 signaling pathway. We demonstrate that the DLK2 : LUC assay can selectively and sensitively detect karrikins and a functionally similar synthetic strigolactone analog. Crucially we show that crude extracts from Arabidopsis leaves can also activate DLK2 : LUC in a KAI2-dependent manner. Our work provides the first direct evidence for the existence of endogenous chemical signals that can activate the KAI2-mediated signaling pathway in Arabidopsis . This sensitive reporter system can now be used for the bioassay-guided purification and identification of putative endogenous KAI2 ligands or their precursors, and endogenous compounds that might modulate the KAI2 signaling pathway.

Reporter Gene-Facilitated Detection of Compounds in Arabidopsis Leaf Extracts that Activate the Karrikin Signaling Pathway

PubMed Central

Sun, Yueming K.; Flematti, Gavin R.; Smith, Steven M.; Waters, Mark T.

2016-01-01

Karrikins are potent germination stimulants generated by the combustion of plant matter. Treatment of Arabidopsis with karrikins triggers a signaling process that is dependent upon a putative receptor protein KARRIKIN INSENSITIVE 2 (KAI2). KAI2 is a homolog of DWARF 14 (D14), the receptor for endogenous strigolactone hormones. Genetic analyses suggest that KAI2 also perceives endogenous signal(s) that are not strigolactones. Activation of KAI2 by addition of karrikins to Arabidopsis plants induces expression of transcripts including D14-LIKE 2 (DLK2). We constructed the synthetic reporter gene DLK2:LUC in Arabidopsis, which comprises the firefly luciferase gene (LUC) driven by the DLK2 promoter. Here we describe a luminescence-based reporter assay with Arabidopsis seeds to detect chemical signals that can activate the KAI2 signaling pathway. We demonstrate that the DLK2:LUC assay can selectively and sensitively detect karrikins and a functionally similar synthetic strigolactone analog. Crucially we show that crude extracts from Arabidopsis leaves can also activate DLK2:LUC in a KAI2-dependent manner. Our work provides the first direct evidence for the existence of endogenous chemical signals that can activate the KAI2-mediated signaling pathway in Arabidopsis. This sensitive reporter system can now be used for the bioassay-guided purification and identification of putative endogenous KAI2 ligands or their precursors, and endogenous compounds that might modulate the KAI2 signaling pathway. PMID:27994609

Metabolic inactivation of the circadian transmitter, pigment dispersing factor (PDF), by neprilysin-like peptidases in Drosophila.

PubMed

Isaac, R Elwyn; Johnson, Erik C; Audsley, Neil; Shirras, Alan D

2007-12-01

Recent studies have firmly established pigment dispersing factor (PDF), a C-terminally amidated octodecapeptide, as a key neurotransmitter regulating rhythmic circadian locomotory behaviours in adult Drosophila melanogaster. The mechanisms by which PDF functions as a circadian peptide transmitter are not fully understood, however; in particular, nothing is known about the role of extracellular peptidases in terminating PDF signalling at synapses. In this study we show that PDF is susceptible to hydrolysis by neprilysin, an endopeptidase that is enriched in synaptic membranes of mammals and insects. Neprilysin cleaves PDF at the internal Ser7-Leu8 peptide bond to generate PDF1-7 and PDF8-18. Neither of these fragments were able to increase intracellular cAMP levels in HEK293 cells cotransfected with the Drosophila PDF receptor cDNA and a firefly luciferase reporter gene, confirming that such cleavage results in PDF inactivation. The Ser7-Leu8 peptide bond was also the principal cleavage site when PDF was incubated with membranes prepared from heads of adult Drosophila. This endopeptidase activity was inhibited by the neprilysin inhibitors phosphoramidon (IC(50,) 0.15 micromol l(-1)) and thiorphan (IC(50,) 1.2 micromol l(-1)). We propose that cleavage by a member of the Drosophila neprilysin family of endopeptidases is the most likely mechanism for inactivating synaptic PDF and that neprilysin might have an important role in regulating PDF signals within circadian neural circuits.

Orthotopic glioblastoma stem-like cell xenograft model in mice to evaluate intra-arterial delivery of bevacizumab: from bedside to bench.

PubMed

Burkhardt, Jan-Karl; Hofstetter, Christoph P; Santillan, Alejandro; Shin, Benjamin J; Foley, Conor P; Ballon, Douglas J; Pierre Gobin, Y; Boockvar, John A

2012-11-01

Bevacizumab (BV), a humanized monocolonal antibody directed against vascular endothelial growth factor (VEGF), is a standard intravenous (IV) treatment for recurrent glioblastoma multiforme (GBM), that has been introduced recently as an intra-arterial (IA) treatment modality in humans. Since preclinical models have not been reported, we sought to develop a tumor stem cell (TSC) xenograft model to investigate IA BV delivery in vivo. Firefly luciferase transduced patient TSC were injected into the cortex of 35 nude mice. Tumor growth was monitored weekly using bioluminescence imaging. Mice were treated with either intraperitoneal (IP) or IA BV, with or without blood-brain barrier disruption (BBBD), or with IP saline injection (controls). Tumor tissue was analyzed using immunohistochemistry and western blot techniques. Tumor formation occurred in 31 of 35 (89%) mice with a significant signal increase over time (p=0.018). Post mortem histology revealed an infiltrative growth of TSC xenografts in a similar pattern compared to the primary human GBM. Tumor tissue analyzed at 24 hours after treatment revealed that IA BV treatment with BBBD led to a significantly higher intratumoral BV concentration compared to IA BV alone, IP BV or controls (p<0.05). Thus, we have developed a TSC-based xenograft mouse model that allows us to study IA chemotherapy. However, further studies are needed to analyze the treatment effects after IA BV to assess tumor progression and overall animal survival. Copyright © 2012 Elsevier Ltd. All rights reserved.

Simultaneous imaging of temporal changes of NF-κB activity and viable tumor cells in Huh7/NF-κB-tk-luc2/rfp tumor-bearing mice.

PubMed

Wang, Wei-Hsun; Chiang, I-Tsang; Liu, Yu-Chang; Hsu, Fei-Ting; Chen, Hong-Wen; Chen, Chuan-Lin; Lee, Yi-Jang; Lin, Wuu-Jyh; Hwang, Jeng-Jong

2013-01-01

Few studies have reported that the effect of sorafenib on advanced human hepatocellular carcinoma (HCC) is taking place via the inhibition of NF-κB signal transduction. Here we constructed a human HCC Huh7 stable clone with NF-κB-responsive element to drive dual reporter genes, herpes simplex virus thymidine kinase (tk) and firefly luciferase (luc2), and co-transfected with a third red fluorescent protein (rfp) gene, renamed as Huh7/NF-κB-tk-luc2/rfp cells, and combined with bioluminescent imaging (BLI) and red fluorescent protein imaging (RFPI) to monitor the effect of sorafenib on NF-κB activation and tumor inhibition. The results show that sorafenib could suppress the NF-κB-DNA binding activity, and the expression of downstream effector proteins. Notably, the relative photon fluxes obtained from RFPI and BLI, which represent the viable tumor cells and cells with NF-κB activation, decreased after sorafenib treatment by 50 to 65%, and 87.5 to >90%, respectively, suggesting that NF-κB activation is suppressed in viable HCC cells by sorafenib. Simultaneous molecular imaging of the temporal change of NF-κB activity and of viable cells in the same Huh7/NF-κB-tk-luc2/rfp tumors of the animal may reflect the real status of NF-κB activity and the viable tumor cells at the time of imaging.

Preliminary in vivo evaluation of [131I]-2-iodo-D-phenylalanine as a potential radionuclide therapeutic agent in R1M-fluc rhabdomyosarcoma tumor-bearing NuNu mice using bioluminescent imaging.

PubMed

Bauwens, Matthias; Wimana, Lena; Keyaerts, Marleen; Peleman, Cindy; Lahoutte, Tony; Kersemans, Ken; Snykers, Sarah; Vinken, Mathieu; Mertens, John; Bossuyt, Axel

2010-04-01

Carrier-added [(123)I]-2-iodo-D-phenylalanine (CA [(123)I]-2-I-D-Phe) was previously found to have a preferential retention in tumors with a high tumor background contrast in animal models. A previous human dosimetry study demonstrated a favorable biodistribution and radiation burden in human subjects. The aim of this study was to investigate the potential of CA [(131)I]-2-I-D-Phe as an agent for radionuclide therapy. Sixty (60) nude athymic mice were inoculated subcutaneously with firefly luciferase-transduced R1M rhabdomyosarcoma cells. The mice in the therapy group were injected intravenously (i.v.) with 148 MBq [(131)I]-2-I-D-Phe (432 GBq/mmol) in kit solution. Controls were injected with kit solution without radioactivity, with physiological saline, or with 148 MBq [(131)I](-) in physiological saline. Tumor growth was quantified using bioluminescent imaging and caliper measurements. [(131)I]-2-I-D-Phe clearly reduced tumor growth in the treated mice compared with the control groups. A tumor growth-rate reduction of at least 33% was found for mice receiving a therapeutic dose. There were no serious adverse side-effects of the therapy. In conclusion, i.v. injection of CA 148 MBq [(131)I]-2-I-D-Phe specifically reduces tumor growth in athymic nude mice without relevant side-effects on the animals' health.

Efficient transfer of genetic material into mammalian cells using Starburst polyamidoamine dendrimers.

PubMed Central

Kukowska-Latallo, J F; Bielinska, A U; Johnson, J; Spindler, R; Tomalia, D A; Baker, J R

1996-01-01

Starburst polyamidoamine dendrimers are a new class of synthetic polymers with unique structural and physical characteristics. These polymers were investigated for the ability to bind DNA and enhance DNA transfer and expression in a variety of mammalian cell lines. Twenty different types of polyamidoamine dendrimers were synthesized, and the polymer structure was confirmed using well-defined analytical techniques. The efficiency of plasmid DNA transfection using dendrimers was examined using two reporter gene systems: firefly luciferase and bacterial beta-galactosidase. The transfections were performed using various dendrimers, and levels of expression of the reporter protein were determined. Highly efficient transfection of a broad range of eukaryotic cells and cell lines was achieved with minimal cytotoxicity using the DNA/dendrimer complexes. However, the ability to transfect cells was restricted to certain types of dendrimers and in some situations required the presence of additional compounds, such as DEAE-dextran, that appeared to alter the nature of the complex. A few cell lines demonstrated enhanced transfection with the addition of chloroquine, indicating endosomal localization of the complexes. The capability of a dendrimer to transfect cells appeared to depend on the size, shape, and number of primary amino groups on the surface of the polymer. However, the specific dendrimer most efficient in achieving transfection varied between different types of cells. These studies demonstrate that Starburst dendrimers can transfect a wide variety of cell types in vitro and offer an efficient method for producing permanently transfected cell lines. Images Fig. 1 Fig. 2 Fig. 4 PMID:8643500

ATP as a biomarker of viable microorganisms in clean-room facilities.

PubMed

Venkateswaran, Kasthuri; Hattori, Noriaki; La Duc, Myron T; Kern, Roger

2003-03-01

A new firefly luciferase bioluminescence assay method that differentiates free extracellular ATP (dead cells, etc.) from intracellular ATP (viable microbes) was used to determine the viable microbial cleanliness of various clean-room facilities. For comparison, samples were taken from both clean-rooms, where the air was filtered to remove particles >0.5 microm, and ordinary rooms with unfiltered air. The intracellular ATP was determined after enzymatically degrading the sample's free ATP. Also for comparison, cultivable microbial populations were counted on nutrient-rich trypticase soy agar (TSA) plates. Both the cultivable and ATP-based determinations indicate that the microbial burden was lower in clean-room facilities than in ordinary rooms. However, there was no direct correlation between the two sets of measurements because the two assays measured very different populations. A large fraction of the samples yielded no colony formers on TSA, but were positive for intracellular ATP. Subsequently, genomic DNA was isolated directly from selected samples and 16S rDNA fragments were cloned and sequenced, identifying nearest neighbors, many of which are known to be noncultivable in the media employed. It was concluded that viable microbial contamination can be reliably monitored by measurement of intracellular ATP, and that this method may be considered superior to cultivable colony counts due to its speed and its ability to report the presence of viable but noncultivable organisms. When the detection of nonviable microbes is of interest, the ATP assay can be supplemented with DNA analysis.

Ultrasound-induced hyperthermia for the spatio-temporal control of gene expression in bone repair

NASA Astrophysics Data System (ADS)

Wilson, Christopher; Padilla, Frédéric; Zhang, Man; Vilaboa, Nuria; Kripfgans, Oliver; Fowlkes, Brian; Franceschi, Renny

2012-10-01

Spatial and temporal control over the expression of growth/differentiation factors is of great interest for regeneration of bone, but technologies capable of providing tight and active control over gene expression remain elusive. We propose the use of focused ultrasound for the targeted activation of heat shock-sensitive expression systems in engineered bone. We report in vitro results with cells that express firefly luciferase (fLuc) under the control of a heat shock protein promoter. Cells were embedded in fibrin scaffolds and exposed to focused ultrasound, using a custom 3.3MHz transducer (focal length 4", f-number 1.33", focal dimension 1.2mm lateral FWHM) in CW mode for 2-20 minutes at intensities ISPTA=120-440 W/cm2. The kinetics of ultrasound-mediated activation of the cells was compared with that of strictly thermal activation. Bioluminescence imaging revealed fLuc expression in an area ≥2.5mm in diameter at the position of the ultrasound focus, and the diameter and intensity of the signal increased with the amplitude of the acoustic energy. We also found that ultrasound activated fLuc expression with substantially shorter exposures than thermal activation. Our results demonstrate the potential for focused ultrasound to selectively activate the expression of a gene of interest in an engineered tissue and suggest that focused ultrasound activates the heat shock pathway by a combination of thermal and non-thermal mechanisms.

A route from darkness to light: emergence and evolution of luciferase activity in AMP-CoA-ligases inferred from a mealworm luciferase-like enzyme.

PubMed

Viviani, V R; Prado, R A; Neves, D R; Kato, D; Barbosa, J A

2013-06-11

The origin of luciferases and of bioluminescence is enigmatic. In beetles, luciferases seem to have evolved from AMP-CoA-ligases. How the new oxygenase luminogenic function originated from AMP-ligases leading to luciferases is one of the most challenging mysteries of bioluminescence. Comparison of the cloned luciferase-like enzyme from the nonluminescent Zophobas morio mealworm and beetle luciferases showed that the oxygenase activity may have emerged as a stereoselective oxidative drift with d-luciferin, a substrate that cannot be easily thioesterified to CoA as in the case of the l-isomer. While the overall kcat displayed by beetle luciferases is orders of magnitude greater than that of the luciferase-like enzyme, the respective oxidation rates and quantum yields of bioluminescence are roughly similar, suggesting that the rate constant of the AMP-ligase activity exerted on the new d-luciferin substrate in beetle protoluciferases was the main enzymatic property that suffered optimization during the evolution of luciferases. The luciferase-like enzyme and luciferases boost the rate of luciferyl-adenylate chemiluminescent oxidation by factors of 10(6) and 10(7), respectively, as compared to the substrate spontaneous oxidation in buffer. A similar enhancement of luciferyl-adenylate chemiluminescence is provided by nucleophilic aprotic solvents, implying that the peptide bonds in the luciferin binding site of beetle luciferase could provide a similar catalytically favorable environment. These data suggest that the luciferase-like enzyme and other similar AMP-ligases are potential alternative oxygenases. Site-directed mutagenesis studies of the luciferase-like enzyme and the red light-producing luciferase of Phrixotrix hirtus railroadworm confirm here a critical role for T/S345 in luciferase function. Mutations such as I327T/S in the luciferase-like enzyme, which simultaneously increases luciferase activity and promotes blue shifts in the emission spectrum, could have been critical for evolving functional bioluminescence from red-emitting protoluciferases. Through the combination of I327T/S mutations and N-terminal fusion, the luminescence activity of this enzyme was increased to visible levels, with the development of a totally new orange-emitting luciferase. These results open the possibility of engineering luciferase activity in a set of AMP-CoA-ligases.

Dual luciferase assay for secreted luciferases based on Gaussia and NanoLuc.

PubMed

Heise, Kerstin; Oppermann, Henry; Meixensberger, Jürgen; Gebhardt, Rolf; Gaunitz, Frank

2013-05-01

Just recently, NanoLuc, a new engineered luciferase based on the small subunit of the luciferase from Oplophorus gracilirostris was introduced. Like the luciferase from Gaussia princeps, this luciferase is secreted into the medium. Both luciferases are the smallest and brightest luciferases known and well-suited for reporter assays. In our experiments, we demonstrate that both luciferases can be used together in a dual-reporter assay by solving the problem that NanoLuc produces a significant signal with coelenterazine, which is the substrate for Gaussia luciferase. We found that the background signal from NanoLuc with coelenterazine can be calculated from the determination of NanoLuc activity in the presence of its substrate furimazine. This in turn allows the precise determination of the activity of Gaussia which does not produce light in the presence of furimazine. Based on this observation, we developed a high sensitive dual secreted luciferase assay which allows the determination of both activities in a single cotransfection experiment. We demonstrate the versatility and robustness of the assay for the normalization of reporter gene activities. Since Gaussia luciferase and NanoLuc are nonhomologous reporters, the method to determine both luciferase activities may also be useful for coincidence reporter gene systems for high-throughput screening.

Development of red-shifted mutants derived from luciferase of Brazilian click beetle Pyrearinus termitilluminans

NASA Astrophysics Data System (ADS)

Nishiguchi, Tomoki; Yamada, Toshimichi; Nasu, Yusuke; Ito, Mashiho; Yoshimura, Hideaki; Ozawa, Takeaki

2015-10-01

Luciferase, a bioluminescent protein, has been used as an analytical tool to visualize intracellular phenomena. Luciferase with red light emission is particularly useful for bioluminescence imaging because of its high transmittance in mammalian tissues. However, the luminescence intensity of existing luciferases with their emission over 600 nm is insufficient for imaging studies because of their weak intensities. We developed mutants of Emerald luciferase (Eluc) from Brazilian click beetle (Pyrearinus termitilluminans), which emits the strongest bioluminescence among beetle luciferases. We successively introduced four amino acid mutations into the luciferase based on a predicted structure of Eluc using homology modeling. Results showed that quadruple mutations R214K/H241K/S246H/H347A into the beetle luciferase emit luminescence with emission maximum at 626 nm, 88-nm red-shift from the wild-type luciferase. This mutant luciferase is anticipated for application in in vivo multicolor imaging in living samples.

Computational analysis and functional expression of ancestral copepod luciferase.

PubMed

Takenaka, Yasuhiro; Noda-Ogura, Akiko; Imanishi, Tadashi; Yamaguchi, Atsushi; Gojobori, Takashi; Shigeri, Yasushi

2013-10-10

We recently reported the cDNA sequences of 11 copepod luciferases from the superfamily Augaptiloidea in the order Calanoida. They were classified into two groups, Metridinidae and Heterorhabdidae/Lucicutiidae families, by phylogenetic analyses. To elucidate the evolutionary processes, we have now further isolated 12 copepod luciferases from Augaptiloidea species (Metridia asymmetrica, Metridia curticauda, Pleuromamma scutullata, Pleuromamma xiphias, Lucicutia ovaliformis and Heterorhabdus tanneri). Codon-based synonymous/nonsynonymous tests of positive selection for 25 identified copepod luciferases suggested that positive Darwinian selection operated in the evolution of Heterorhabdidae luciferases, whereas two types of Metridinidae luciferases had diversified via neutral mechanism. By in silico analysis of the decoded amino acid sequences of 25 copepod luciferases, we inferred two protein sequences as ancestral copepod luciferases. They were expressed in HEK293 cells where they exhibited notable luciferase activity both in intracellular lysates and cultured media, indicating that the luciferase activity was established before evolutionary diversification of these copepod species. © 2013.

Development of red-shifted mutants derived from luciferase of Brazilian click beetle Pyrearinus termitilluminans.

PubMed

Nishiguchi, Tomoki; Yamada, Toshimichi; Nasu, Yusuke; Ito, Mashiho; Yoshimura, Hideaki; Ozawa, Takeaki

2015-10-01

Luciferase, a bioluminescent protein, has been used as an analytical tool to visualize intracellular phenomena. Luciferase with red light emission is particularly useful for bioluminescence imaging because of its high transmittance in mammalian tissues. However, the luminescence intensity of existing luciferases with their emission over 600 nm is insufficient for imaging studies because of their weak intensities. We developed mutants of Emerald luciferase (Eluc) from Brazilian click beetle (Pyrearinus termitilluminans), which emits the strongest bioluminescence among beetle luciferases. We successively introduced four amino acid mutations into the luciferase based on a predicted structure of Eluc using homology modeling. Results showed that quadruple mutations R214K/H241K/S246H/H347A into the beetle luciferase emit luminescence with emission maximum at 626 nm, 88-nm red-shift from the wild-type luciferase. This mutant luciferase is anticipated for application in in vivo multicolor imaging in living samples.

The Renilla luciferase gene as a reference gene for normalization of gene expression in transiently transfected cells.

PubMed

Jiwaji, Meesbah; Daly, Rónán; Pansare, Kshama; McLean, Pauline; Yang, Jingli; Kolch, Walter; Pitt, Andrew R

2010-12-31

The importance of appropriate normalization controls in quantitative real-time polymerase chain reaction (qPCR) experiments has become more apparent as the number of biological studies using this methodology has increased. In developing a system to study gene expression from transiently transfected plasmids, it became clear that normalization using chromosomally encoded genes is not ideal, at it does not take into account the transfection efficiency and the significantly lower expression levels of the plasmids. We have developed and validated a normalization method for qPCR using a co-transfected plasmid. The best chromosomal gene for normalization in the presence of the transcriptional activators used in this study, cadmium, dexamethasone, forskolin and phorbol-12-myristate 13-acetate was first identified. qPCR data was analyzed using geNorm, Normfinder and BestKeeper. Each software application was found to rank the normalization controls differently with no clear correlation. Including a co-transfected plasmid encoding the Renilla luciferase gene (Rluc) in this analysis showed that its calculated stability was not as good as the optimised chromosomal genes, most likely as a result of the lower expression levels and transfection variability. Finally, we validated these analyses by testing two chromosomal genes (B2M and ActB) and a co-transfected gene (Rluc) under biological conditions. When analyzing co-transfected plasmids, Rluc normalization gave the smallest errors compared to the chromosomal reference genes. Our data demonstrates that transfected Rluc is the most appropriate normalization reference gene for transient transfection qPCR analysis; it significantly reduces the standard deviation within biological experiments as it takes into account the transfection efficiencies and has easily controllable expression levels. This improves reproducibility, data validity and most importantly, enables accurate interpretation of qPCR data.

A negative regulator encoded by a rice WRKY gene represses both abscisic acid and gibberellins signaling in aleurone cells.

PubMed

Zhang, Zhong-Lin; Shin, Margaret; Zou, Xiaolu; Huang, Jianzhi; Ho, Tun-hua David; Shen, Qingxi J

2009-05-01

Abscisic acid (ABA) and gibberellins (GAs) control several developmental processes including seed maturation, dormancy, and germination. The antagonism of these two hormones is well-documented. However, recent data from transcription profiling studies indicate that they can function as agonists in regulating the expression of many genes although the underlying mechanism is unclear. Here we report a rice WRKY gene, OsWRKY24, which encodes a protein that functions as a negative regulator of both GA and ABA signaling. Overexpression of OsWRKY24 via particle bombardment-mediated transient expression in aleurone cells represses the expression of two reporter constructs: the beta-glucuronidase gene driven by the GA-inducible Amy32b alpha-amylase promoter (Amy32b-GUS) and the ABA-inducible HVA22 promoter (HVA22-GUS). OsWRKY24 is unlikely a general repressor because it has little effect on the expression of the luciferase reporter gene driven by a constitutive ubiquitin promoter (UBI-Luciferase). As to the GA signaling, OsWRKY24 differs from OsWRKY51 and -71, two negative regulators specifically function in the GA signaling pathway, in several ways. First, OsWRKY24 contains two WRKY domains while OsWRKY51 and -71 have only one; both WRKY domains are essential for the full repressing activity of OsWRKY24. Second, binding of OsWRKY24 to the Amy32b promoter appears to involve sequences in addition to the TGAC cores of the W-boxes. Third, unlike OsWRKY71, OsWRKY24 is stable upon GA treatment. Together, these data demonstrate that OsWRKY24 is a novel type of transcriptional repressor that inhibits both GA and ABA signaling.

Combined image guided monitoring the pharmacokinetics of rapamycin loaded human serum albumin nanoparticles with a split luciferase reporter

NASA Astrophysics Data System (ADS)

Wang, Fu; Yang, Kai; Wang, Zhe; Ma, Ying; Gutkind, J. Silvio; Hida, Naoki; Niu, Gang; Tian, Jie

2016-02-01

Imaging guided techniques have been increasingly employed to investigate the pharmacokinetics (PK) and biodistribution of nanoparticle based drug delivery systems. In most cases, however, the PK profiles of drugs could vary significantly from those of drug delivery carriers upon administration in the blood circulation, which complicates the interpretation of image findings. Herein we applied a genetically encoded luciferase reporter in conjunction with near infrared (NIR) fluorophores to investigate the respective PK profiles of a drug and its carrier in a biodegradable drug delivery system. In this system, a prototype hydrophobic agent, rapamycin (Rapa), was encapsulated into human serum albumin (HSA) to form HSA Rapa nanoparticles, which were then labeled with Cy5 fluorophore to facilitate the fluorescence imaging of HSA carrier. Meanwhile, we employed transgenetic HN12 cells that were modified with a split luciferase reporter, whose bioluminescence function is regulated by Rapa, to reflect the PK profile of the encapsulated agent. It was interesting to discover that there existed an obvious inconsistency of PK behaviors between HSA carrier and rapamycin in vitro and in vivo through near infrared fluorescence imaging (NIFRI) and bioluminescence imaging (BLI) after treatment with Cy5 labeled HSA Rapa. Nevertheless, HSA Rapa nanoparticles manifested favorable in vivo PK and tumor suppression efficacy in a follow-up therapeutic study. The developed strategy of combining a molecular reporter and a fluorophore in this study could be extended to other drug delivery systems to provide profound insights for non-invasive real-time evaluation of PK profiles of drug-loaded nanoparticles in pre-clinical studies.Imaging guided techniques have been increasingly employed to investigate the pharmacokinetics (PK) and biodistribution of nanoparticle based drug delivery systems. In most cases, however, the PK profiles of drugs could vary significantly from those of drug delivery carriers upon administration in the blood circulation, which complicates the interpretation of image findings. Herein we applied a genetically encoded luciferase reporter in conjunction with near infrared (NIR) fluorophores to investigate the respective PK profiles of a drug and its carrier in a biodegradable drug delivery system. In this system, a prototype hydrophobic agent, rapamycin (Rapa), was encapsulated into human serum albumin (HSA) to form HSA Rapa nanoparticles, which were then labeled with Cy5 fluorophore to facilitate the fluorescence imaging of HSA carrier. Meanwhile, we employed transgenetic HN12 cells that were modified with a split luciferase reporter, whose bioluminescence function is regulated by Rapa, to reflect the PK profile of the encapsulated agent. It was interesting to discover that there existed an obvious inconsistency of PK behaviors between HSA carrier and rapamycin in vitro and in vivo through near infrared fluorescence imaging (NIFRI) and bioluminescence imaging (BLI) after treatment with Cy5 labeled HSA Rapa. Nevertheless, HSA Rapa nanoparticles manifested favorable in vivo PK and tumor suppression efficacy in a follow-up therapeutic study. The developed strategy of combining a molecular reporter and a fluorophore in this study could be extended to other drug delivery systems to provide profound insights for non-invasive real-time evaluation of PK profiles of drug-loaded nanoparticles in pre-clinical studies. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr07308a

GAS-611 firefly in zero gravity

NASA Technical Reports Server (NTRS)

Williams, Tony

1988-01-01

The Get Away Special 611 (GAS-611) project will carry a small, self-contained biological experiment into a microgravity environment for a period of 120 hours. The payload will be a colony of Lampyridae (fireflies). The ability of this beetle to produce light with an efficiency of 98 pct will be evaluated in the micro-G environment. The chemical process that occurs could be assisted by the earth's gravitational pull and the very complex tracheae system found within this species of beetle. The effects of microgravity on mating and beetle larvae will also be studied.

A puzzling homology: a brittle star using a putative cnidarian-type luciferase for bioluminescence.

PubMed

Delroisse, Jérôme; Ullrich-Lüter, Esther; Blaue, Stefanie; Ortega-Martinez, Olga; Eeckhaut, Igor; Flammang, Patrick; Mallefet, Jérôme

2017-04-01

Bioluminescence relies on the oxidation of a luciferin substrate catalysed by a luciferase enzyme. Luciferins and luciferases are generic terms used to describe a large variety of substrates and enzymes. Whereas luciferins can be shared by phylogenetically distant organisms which feed on organisms producing them, luciferases have been thought to be lineage-specific enzymes. Numerous light emission systems would then have co-emerged independently along the tree of life resulting in a plethora of non-homologous luciferases. Here, we identify for the first time a candidate luciferase of a luminous echinoderm, the ophiuroid Amphiura filiformis Phylogenomic analyses identified the brittle star predicted luciferase as homologous to the luciferase of the sea pansy Renilla (Cnidaria), contradicting with the traditional viewpoint according to which luciferases would generally be of convergent origins. The similarity between the Renilla and Amphiura luciferases allowed us to detect the latter using anti- Renilla luciferase antibodies. Luciferase expression was specifically localized in the spines which were demonstrated to be the bioluminescent organs in vivo However, enzymes homologous to the Renilla luciferase but unable to trigger light emission were also identified in non-luminous echinoderms and metazoans. Our findings strongly indicate that those enzymes, belonging to the haloalkane dehalogenase family, might then have been convergently co-opted into luciferases in cnidarians and echinoderms. In these two benthic suspension-feeding species, similar ecological pressures would constitute strong selective forces for the functional shift of these enzymes and the emergence of bioluminescence. © 2017 The Authors.

A puzzling homology: a brittle star using a putative cnidarian-type luciferase for bioluminescence

PubMed Central

Ullrich-Lüter, Esther; Blaue, Stefanie; Ortega-Martinez, Olga; Eeckhaut, Igor; Flammang, Patrick; Mallefet, Jérôme

2017-01-01

Bioluminescence relies on the oxidation of a luciferin substrate catalysed by a luciferase enzyme. Luciferins and luciferases are generic terms used to describe a large variety of substrates and enzymes. Whereas luciferins can be shared by phylogenetically distant organisms which feed on organisms producing them, luciferases have been thought to be lineage-specific enzymes. Numerous light emission systems would then have co-emerged independently along the tree of life resulting in a plethora of non-homologous luciferases. Here, we identify for the first time a candidate luciferase of a luminous echinoderm, the ophiuroid Amphiura filiformis. Phylogenomic analyses identified the brittle star predicted luciferase as homologous to the luciferase of the sea pansy Renilla (Cnidaria), contradicting with the traditional viewpoint according to which luciferases would generally be of convergent origins. The similarity between the Renilla and Amphiura luciferases allowed us to detect the latter using anti-Renilla luciferase antibodies. Luciferase expression was specifically localized in the spines which were demonstrated to be the bioluminescent organs in vivo. However, enzymes homologous to the Renilla luciferase but unable to trigger light emission were also identified in non-luminous echinoderms and metazoans. Our findings strongly indicate that those enzymes, belonging to the haloalkane dehalogenase family, might then have been convergently co-opted into luciferases in cnidarians and echinoderms. In these two benthic suspension-feeding species, similar ecological pressures would constitute strong selective forces for the functional shift of these enzymes and the emergence of bioluminescence. PMID:28381628

The Induction Effect of Am80 and TSA on ESC Differentiation via Regulation of Stra8 in Chicken.

PubMed

Zhang, Yani; Zuo, Qisheng; Liu, Zhiyong; Li, Dong; Tang, Beibei; Xiao, Tian-Rong; Lian, Chao; Wang, Yingjie; Jin, Kai; Wang, Yilin; Zhang, Wenhui; Li, Bichun

2015-01-01

Stra8 encodes stimulated by retinoic acid gene 8, a protein that is important for initiation of meiosis in mammals and birds. This study was aimed at identifying the active control area of chicken STRA8 gene core promoter, to screen optimum inducers of the STRA8 gene, thus to enhance the differentiation of embryonic stem cells (ESCs) into spermatogonial stem cells. Fragments of chicken STRA8 gene promoter were cloned into fluorescent reporter plasmids and transfected into DF-1 cells. Then Dual-Luciferase® Reporter Assay System was used to identify the activity of the STRA8 gene under different inducers. Our studies showed that the promoter fragment -1055 bp to +54 bp of Suqin chicken Stra8 revealed the strongest activity. The dual-luciferase® reporter showed that Tamibarotene (Am80) and TrichostatinA (TSA) could significantly enhance STRA8 transcription. The in vitro inductive culture of chicken ESCs demonstrated that spermatogonial stem cells (SSC)-like cells appeared and Integrinβ1 protein was expressed on day 10, indicating that Am80 and TSA can promote ESCs differentiation into SSCs via regulation of Stra8.

The Induction Effect of Am80 and TSA on ESC Differentiation via Regulation of Stra8 in Chicken

PubMed Central

Zhang, Yani; Zuo, Qisheng; Liu, Zhiyong; Li, Dong; Tang, Beibei; Xiao, Tian-rong; Lian, Chao; Wang, Yingjie; Jin, Kai; Wang, Yilin; Zhang, Wenhui; Li, Bichun

2015-01-01

Stra8 encodes stimulated by retinoic acid gene 8, a protein that is important for initiation of meiosis in mammals and birds. This study was aimed at identifying the active control area of chicken STRA8 gene core promoter, to screen optimum inducers of the STRA8 gene, thus to enhance the differentiation of embryonic stem cells (ESCs) into spermatogonial stem cells. Fragments of chicken STRA8 gene promoter were cloned into fluorescent reporter plasmids and transfected into DF-1 cells. Then Dual-Luciferase® Reporter Assay System was used to identify the activity of the STRA8 gene under different inducers. Our studies showed that the promoter fragment −1055 bp to +54 bp of Suqin chicken Stra8 revealed the strongest activity. The dual-luciferase® reporter showed that Tamibarotene (Am80) and TrichostatinA (TSA) could significantly enhance STRA8 transcription. The in vitro inductive culture of chicken ESCs demonstrated that spermatogonial stem cells (SSC)-like cells appeared and Integrinβ1 protein was expressed on day 10, indicating that Am80 and TSA can promote ESCs differentiation into SSCs via regulation of Stra8. PMID:26606052

Role of Cyclin D1 and cdk Inhibitors in Breast Cancer Pathogenesis

DTIC Science & Technology

2001-10-01

0.1 [tg of a Renilla luciferase expression plasmid (pRL-SV40 Promega) to normalize for transfection efficiency. After an overnight recovery, the...saline, collected, lysed, and analyzed for luciferase and Renilla luciferase activity by using the Dual-Luciferase reporter assay system (Promega...Cyclin A promoter-driven luciferase activity was then normalized to a constant activity of Renilla luciferase. 7 Results In our previous reports we

Predoctoral Fellowship to Study an ER Variant Identified from Breast Hyperplasias.

DTIC Science & Technology

1999-07-01

Spl and Sp3 in Drosophila SL2 cells, which do not express any of the Spl family members. The plasmid pNull- Renilla (Promega) was co- transfected for...10 M. Luciferase values were normalized to Renilla luciferase expression. Fold induction was calculated relative to the normalized luciferase...to 10 M. Luciferase values were normalized to Renilla luciferase expression. Fold induction was calculated relative to the normalized luciferase

Evidence for transcriptional interference in a dual-luciferase reporter system.

PubMed

Wu, Guo-Qing; Wang, Xiao; Zhou, Hong-Ying; Chai, Ke-Qun; Xue, Qian; Zheng, Ai-Hong; Zhu, Xiu-Ming; Xiao, Jian-Yong; Ying, Xu-Hua; Wang, Fu-Wei; Rui, Tao; Xu, Li-Yun; Zhang, Yong-Kui; Liao, Yi-Ji; Xie, Dan; Lu, Li-Qin; Huang, Dong-Sheng

2015-12-01

The dual-luciferase reporter assay is widely used for microRNA target identification and the functional validation of predicted targets. To determine whether curcumin regulates expression of the histone methyltransferase enhancer of zeste homolog 2 (EZH2) by targeting its 3'untranslated region (3'UTR), two luciferase reporter systems containing exactly the same sequence of the EZH2 3'UTR were used to perform dual-luciferase reporter assays. Surprisingly, there were certain discrepancies between the luciferase activities derived from these two reporter constructs. We normalized luciferase activity to an internal control to determine the amount of the reporter construct successfully transfected into cells, induced a transcriptional block with flavopiridol, quantified renilla luciferase mRNA levels, and compared the absolute luciferase activity among the different groups. The results suggested that curcumin promoted the transcription of the luciferase genes located downstream of the simian vacuolating virus 40 (SV40) early enhancer/promoter, but not those located downstream of the human cytomegalovirus (CMV) immediate-early or the herpes simplex virus thymidine kinase (HSV-TK) promoters. These results explain the discrepancies between the two luciferase reporter systems. The current study underscores the importance of taking caution when interpreting the results of dual-luciferase reporter assays and provides strategies to overcome the potential pitfall accompanying dual-luciferase reporter systems.

Evidence for transcriptional interference in a dual-luciferase reporter system

PubMed Central

Wu, Guo-Qing; Wang, Xiao; Zhou, Hong-Ying; Chai, Ke-Qun; Xue, Qian; Zheng, Ai-Hong; Zhu, Xiu-Ming; Xiao, Jian-Yong; Ying, Xu-Hua; Wang, Fu-Wei; Rui, Tao; Xu, Li-Yun; Zhang, Yong-Kui; Liao, Yi-Ji; Xie, Dan; Lu, Li-Qin; Huang, Dong-Sheng

2015-01-01

The dual-luciferase reporter assay is widely used for microRNA target identification and the functional validation of predicted targets. To determine whether curcumin regulates expression of the histone methyltransferase enhancer of zeste homolog 2 (EZH2) by targeting its 3′untranslated region (3′UTR), two luciferase reporter systems containing exactly the same sequence of the EZH2 3′UTR were used to perform dual-luciferase reporter assays. Surprisingly, there were certain discrepancies between the luciferase activities derived from these two reporter constructs. We normalized luciferase activity to an internal control to determine the amount of the reporter construct successfully transfected into cells, induced a transcriptional block with flavopiridol, quantified renilla luciferase mRNA levels, and compared the absolute luciferase activity among the different groups. The results suggested that curcumin promoted the transcription of the luciferase genes located downstream of the simian vacuolating virus 40 (SV40) early enhancer/promoter, but not those located downstream of the human cytomegalovirus (CMV) immediate-early or the herpes simplex virus thymidine kinase (HSV-TK) promoters. These results explain the discrepancies between the two luciferase reporter systems. The current study underscores the importance of taking caution when interpreting the results of dual-luciferase reporter assays and provides strategies to overcome the potential pitfall accompanying dual-luciferase reporter systems. PMID:26620302

Preclinical Evaluation of Robotic-Assisted Sentinel Lymph Node Fluorescence Imaging

PubMed Central

Liss, Michael A.; Farshchi-Heydari, Salman; Qin, Zhengtao; Hickey, Sean A.; Hall, David J.; Kane, Christopher J.; Vera, David R.

2015-01-01

An ideal substance to provide convenient and accurate targeting for sentinel lymph node (SLN) mapping during robotic-assisted surgery has yet to be found. We used an animal model to determine the ability of the FireFly camera system to detect fluorescent SLNs after administration of a dual-labeled molecular imaging agent. Methods We injected the footpads of New Zealand White rabbits with 1.7 or 8.4 nmol of tilmanocept labeled with 99mTc and a near-infrared fluorophore, IRDye800CW. One and 36 h after injection, popliteal lymph nodes, representing the SLNs, were dissected with the assistance of the FireFly camera system, a fluorescence-capable endoscopic imaging system. After excision of the paraaortic lymph nodes, which represented non-SLNs, we assayed all lymph nodes for radioactivity and fluorescence intensity. Results Fluorescence within all popliteal lymph nodes was easily detected by the FireFly camera system. Fluorescence within the lymph channel could be imaged during the 1-h studies. When compared with the paraaortic lymph nodes, the popliteal lymph nodes retain greater than 95% of the radioactivity at both 1 and 36 h after injection. At both doses (1.7 and 8.4 nmol), the popliteal nodes had higher (P < 0.050) optical fluorescence intensity than the paraaortic nodes at the 1- and 36-h time points. Conclusion The FireFly camera system can easily detect tilmanocept labeled with a near-infrared fluorophore at least 36 h after administration. This ability will permit image acquisition and subsequent verification of fluorescence-labeled SLNs during robotic-assisted surgery. PMID:25024425

Preclinical evaluation of robotic-assisted sentinel lymph node fluorescence imaging.

PubMed

Liss, Michael A; Farshchi-Heydari, Salman; Qin, Zhengtao; Hickey, Sean A; Hall, David J; Kane, Christopher J; Vera, David R

2014-09-01

An ideal substance to provide convenient and accurate targeting for sentinel lymph node (SLN) mapping during robotic-assisted surgery has yet to be found. We used an animal model to determine the ability of the FireFly camera system to detect fluorescent SLNs after administration of a dual-labeled molecular imaging agent. We injected the footpads of New Zealand White rabbits with 1.7 or 8.4 nmol of tilmanocept labeled with (99m)Tc and a near-infrared fluorophore, IRDye800CW. One and 36 h after injection, popliteal lymph nodes, representing the SLNs, were dissected with the assistance of the FireFly camera system, a fluorescence-capable endoscopic imaging system. After excision of the paraaortic lymph nodes, which represented non-SLNs, we assayed all lymph nodes for radioactivity and fluorescence intensity. Fluorescence within all popliteal lymph nodes was easily detected by the FireFly camera system. Fluorescence within the lymph channel could be imaged during the 1-h studies. When compared with the paraaortic lymph nodes, the popliteal lymph nodes retain greater than 95% of the radioactivity at both 1 and 36 h after injection. At both doses (1.7 and 8.4 nmol), the popliteal nodes had higher (P < 0.050) optical fluorescence intensity than the paraaortic nodes at the 1- and 36-h time points. The FireFly camera system can easily detect tilmanocept labeled with a near-infrared fluorophore at least 36 h after administration. This ability will permit image acquisition and subsequent verification of fluorescence-labeled SLNs during robotic-assisted surgery. © 2014 by the Society of Nuclear Medicine and Molecular Imaging, Inc.

Towards a unified understanding of event-related changes in the EEG: the firefly model of synchronization through cross-frequency phase modulation.

PubMed

Burgess, Adrian P

2012-01-01

Although event-related potentials (ERPs) are widely used to study sensory, perceptual and cognitive processes, it remains unknown whether they are phase-locked signals superimposed upon the ongoing electroencephalogram (EEG) or result from phase-alignment of the EEG. Previous attempts to discriminate between these hypotheses have been unsuccessful but here a new test is presented based on the prediction that ERPs generated by phase-alignment will be associated with event-related changes in frequency whereas evoked-ERPs will not. Using empirical mode decomposition (EMD), which allows measurement of narrow-band changes in the EEG without predefining frequency bands, evidence was found for transient frequency slowing in recognition memory ERPs but not in simulated data derived from the evoked model. Furthermore, the timing of phase-alignment was frequency dependent with the earliest alignment occurring at high frequencies. Based on these findings, the Firefly model was developed, which proposes that both evoked and induced power changes derive from frequency-dependent phase-alignment of the ongoing EEG. Simulated data derived from the Firefly model provided a close match with empirical data and the model was able to account for i) the shape and timing of ERPs at different scalp sites, ii) the event-related desynchronization in alpha and synchronization in theta, and iii) changes in the power density spectrum from the pre-stimulus baseline to the post-stimulus period. The Firefly Model, therefore, provides not only a unifying account of event-related changes in the EEG but also a possible mechanism for cross-frequency information processing.

Towards a Unified Understanding of Event-Related Changes in the EEG: The Firefly Model of Synchronization through Cross-Frequency Phase Modulation

PubMed Central

Burgess, Adrian P.

2012-01-01

Although event-related potentials (ERPs) are widely used to study sensory, perceptual and cognitive processes, it remains unknown whether they are phase-locked signals superimposed upon the ongoing electroencephalogram (EEG) or result from phase-alignment of the EEG. Previous attempts to discriminate between these hypotheses have been unsuccessful but here a new test is presented based on the prediction that ERPs generated by phase-alignment will be associated with event-related changes in frequency whereas evoked-ERPs will not. Using empirical mode decomposition (EMD), which allows measurement of narrow-band changes in the EEG without predefining frequency bands, evidence was found for transient frequency slowing in recognition memory ERPs but not in simulated data derived from the evoked model. Furthermore, the timing of phase-alignment was frequency dependent with the earliest alignment occurring at high frequencies. Based on these findings, the Firefly model was developed, which proposes that both evoked and induced power changes derive from frequency-dependent phase-alignment of the ongoing EEG. Simulated data derived from the Firefly model provided a close match with empirical data and the model was able to account for i) the shape and timing of ERPs at different scalp sites, ii) the event-related desynchronization in alpha and synchronization in theta, and iii) changes in the power density spectrum from the pre-stimulus baseline to the post-stimulus period. The Firefly Model, therefore, provides not only a unifying account of event-related changes in the EEG but also a possible mechanism for cross-frequency information processing. PMID:23049827

Luciferase Protein Complementation Assays for Bioluminescence Imaging of Cells and Mice

PubMed Central

Luker, Gary D.; Luker, Kathryn E.

2015-01-01

Summary Protein fragment complementation assays (PCAs) with luciferase reporters currently are the preferred method for detecting and quantifying protein-protein interactions in living animals. At the most basic level, PCAs involve fusion of two proteins of interest to enzymatically inactive fragments of luciferase. Upon association of the proteins of interest, the luciferase fragments are capable of reconstituting enzymatic activity to generate luminescence in vivo. In addition to bi-molecular luciferase PCAs, unimolecular biosensors for hormones, kinases, and proteases also have been developed using target peptides inserted between inactive luciferase fragments. Luciferase PCAs offer unprecedented opportunities to quantify dynamics of protein-protein interactions in intact cells and living animals, but successful use of luciferase PCAs in cells and mice involves careful consideration of many technical factors. This chapter discusses the design of luciferase PCAs appropriate for animal imaging, including construction of reporters, incorporation of reporters into cells and mice, imaging techniques, and data analysis. PMID:21153371

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Ultrawidefield microscope for high-speed fluorescence imaging and targeted optogenetic stimulation.

PubMed

Werley, Christopher A; Chien, Miao-Ping; Cohen, Adam E

2017-12-01

The rapid increase in the number and quality of fluorescent reporters and optogenetic actuators has yielded a powerful set of tools for recording and controlling cellular state and function. To achieve the full benefit of these tools requires improved optical systems with high light collection efficiency, high spatial and temporal resolution, and patterned optical stimulation, in a wide field of view (FOV). Here we describe our 'Firefly' microscope, which achieves these goals in a Ø6 mm FOV. The Firefly optical system is optimized for simultaneous photostimulation and fluorescence imaging in cultured cells. All but one of the optical elements are commercially available, yet the microscope achieves 10-fold higher light collection efficiency at its design magnification than the comparable commercially available microscope using the same objective. The Firefly microscope enables all-optical electrophysiology ('Optopatch') in cultured neurons with a throughput and information content unmatched by other neuronal phenotyping systems. This capability opens possibilities in disease modeling and phenotypic drug screening. We also demonstrate applications of the system to voltage and calcium recordings in human induced pluripotent stem cell derived cardiomyocytes.

An evolutionary firefly algorithm for the estimation of nonlinear biological model parameters.

PubMed

Abdullah, Afnizanfaizal; Deris, Safaai; Anwar, Sohail; Arjunan, Satya N V

2013-01-01

The development of accurate computational models of biological processes is fundamental to computational systems biology. These models are usually represented by mathematical expressions that rely heavily on the system parameters. The measurement of these parameters is often difficult. Therefore, they are commonly estimated by fitting the predicted model to the experimental data using optimization methods. The complexity and nonlinearity of the biological processes pose a significant challenge, however, to the development of accurate and fast optimization methods. We introduce a new hybrid optimization method incorporating the Firefly Algorithm and the evolutionary operation of the Differential Evolution method. The proposed method improves solutions by neighbourhood search using evolutionary procedures. Testing our method on models for the arginine catabolism and the negative feedback loop of the p53 signalling pathway, we found that it estimated the parameters with high accuracy and within a reasonable computation time compared to well-known approaches, including Particle Swarm Optimization, Nelder-Mead, and Firefly Algorithm. We have also verified the reliability of the parameters estimated by the method using an a posteriori practical identifiability test.

An Evolutionary Firefly Algorithm for the Estimation of Nonlinear Biological Model Parameters

PubMed Central

Abdullah, Afnizanfaizal; Deris, Safaai; Anwar, Sohail; Arjunan, Satya N. V.

2013-01-01

The development of accurate computational models of biological processes is fundamental to computational systems biology. These models are usually represented by mathematical expressions that rely heavily on the system parameters. The measurement of these parameters is often difficult. Therefore, they are commonly estimated by fitting the predicted model to the experimental data using optimization methods. The complexity and nonlinearity of the biological processes pose a significant challenge, however, to the development of accurate and fast optimization methods. We introduce a new hybrid optimization method incorporating the Firefly Algorithm and the evolutionary operation of the Differential Evolution method. The proposed method improves solutions by neighbourhood search using evolutionary procedures. Testing our method on models for the arginine catabolism and the negative feedback loop of the p53 signalling pathway, we found that it estimated the parameters with high accuracy and within a reasonable computation time compared to well-known approaches, including Particle Swarm Optimization, Nelder-Mead, and Firefly Algorithm. We have also verified the reliability of the parameters estimated by the method using an a posteriori practical identifiability test. PMID:23469172

Synchronous Firefly Algorithm for Cluster Head Selection in WSN.

PubMed

Baskaran, Madhusudhanan; Sadagopan, Chitra

2015-01-01

Wireless Sensor Network (WSN) consists of small low-cost, low-power multifunctional nodes interconnected to efficiently aggregate and transmit data to sink. Cluster-based approaches use some nodes as Cluster Heads (CHs) and organize WSNs efficiently for aggregation of data and energy saving. A CH conveys information gathered by cluster nodes and aggregates/compresses data before transmitting it to a sink. However, this additional responsibility of the node results in a higher energy drain leading to uneven network degradation. Low Energy Adaptive Clustering Hierarchy (LEACH) offsets this by probabilistically rotating cluster heads role among nodes with energy above a set threshold. CH selection in WSN is NP-Hard as optimal data aggregation with efficient energy savings cannot be solved in polynomial time. In this work, a modified firefly heuristic, synchronous firefly algorithm, is proposed to improve the network performance. Extensive simulation shows the proposed technique to perform well compared to LEACH and energy-efficient hierarchical clustering. Simulations show the effectiveness of the proposed method in decreasing the packet loss ratio by an average of 9.63% and improving the energy efficiency of the network when compared to LEACH and EEHC.

The evolution of adult light emission color in North American fireflies

PubMed Central

Hall, David W.; Sander, Sarah E.; Pallansch, Jennifer C.; Stanger-Hall, Kathrin F.

2016-01-01

Firefly species (Lampyridae) vary in the color of their adult bioluminescence. It has been hypothesized that color is selected to enhance detection by conspecifics. One mechanism to improve visibility of the signal is to increase contrast against ambient light. High contrast implies that fireflies active early in the evening will emit yellower luminescence to contrast against ambient light reflected from green vegetation, especially in habitats with high vegetation cover. Another mechanism to improve visibility is to use reflection off the background to enhance the light signal. Reflectance predicts that sedentary females will produce greener light to maximize reflection off the green vegetation on which they signal. To test these predictions, we recorded over 7500 light emission spectra and determined peak emission wavelength for 675 males, representing 24 species, at 57 field sites across the Eastern United States. We found support for both hypotheses: males active early in more vegetated habitats produced yellower flashes in comparison to later-active males with greener flashes. Further, in 2 of the 8 species with female data, female light emissions were significantly greener as compared to males. PMID:27412777

Endmember extraction from hyperspectral image based on discrete firefly algorithm (EE-DFA)

NASA Astrophysics Data System (ADS)

Zhang, Chengye; Qin, Qiming; Zhang, Tianyuan; Sun, Yuanheng; Chen, Chao

2017-04-01

This study proposed a novel method to extract endmembers from hyperspectral image based on discrete firefly algorithm (EE-DFA). Endmembers are the input of many spectral unmixing algorithms. Hence, in this paper, endmember extraction from hyperspectral image is regarded as a combinational optimization problem to get best spectral unmixing results, which can be solved by the discrete firefly algorithm. Two series of experiments were conducted on the synthetic hyperspectral datasets with different SNR and the AVIRIS Cuprite dataset, respectively. The experimental results were compared with the endmembers extracted by four popular methods: the sequential maximum angle convex cone (SMACC), N-FINDR, Vertex Component Analysis (VCA), and Minimum Volume Constrained Nonnegative Matrix Factorization (MVC-NMF). What's more, the effect of the parameters in the proposed method was tested on both synthetic hyperspectral datasets and AVIRIS Cuprite dataset, and the recommended parameters setting was proposed. The results in this study demonstrated that the proposed EE-DFA method showed better performance than the existing popular methods. Moreover, EE-DFA is robust under different SNR conditions.

The development of GADD45α luciferase reporter assays in human cells for assessing the genotoxicity of environmental pollutants.

PubMed

Xin, Lili; Wang, Jianshu; Wu, Yanhu; Guo, Sifan

2015-02-01

In order to assess the potential carcinogenic and genotoxic responses induced by environmental pollutants, genotoxicity test systems based on a GADD45α promoter-driven luciferase reporter in human A549 and HepG2 cells were established. Four different types of environmental toxicants including DNA alkylating agents, precarcinogenic agents, DNA cross-linking agents and non-carcinogenic agents, and three environmental samples collected from a coke oven plant were used to evaluate the test systems. After treated with the tested agents and environmental samples for 12 h, the cell viabilities and luciferase activities of the luciferase reporter cells were determined, respectively. Methyl methanesulfonate, benzo[a]pyrene, formaldehyde and the extractable organic matter (EOM) from coke oven emissions in ambient air generally produced significant induction of relative luciferase activity in a similar dose-dependent manner in A549- and HepG2-luciferase cells. No significant increases in relative luciferase activity were observed in pyrene-treated A549- or HepG2-luciferase cells. Significant increase in relative luciferase activity was already evident after 2.5 µM benzo[a]pyrene, 5 µM formaldehyde, 0.006 µg/L bottom-EOM, 0.10 µg/L side-EOM or 0.06 µg/L top-EOM, where no cytotoxic damage was observed. Compared with the A549-luciferase cells, the tested pollutants produced higher induction of relative luciferase activity in HepG2-luciferase cells. Therefore, the new genotoxicity test systems can detect different types of genotoxic agents and low concentrations of environmental samples. The luciferase reporter cells, especially the HepG2-luciferase cells, could provide a valuable tool for rapid screening of the genotoxic damage of environmental pollutants and their complex mixtures.

Polycistronic gene expression in Aspergillus niger.

PubMed

Schuetze, Tabea; Meyer, Vera

2017-09-25

Genome mining approaches predict dozens of biosynthetic gene clusters in each of the filamentous fungal genomes sequenced so far. However, the majority of these gene clusters still remain cryptic because they are not expressed in their natural host. Simultaneous expression of all genes belonging to a biosynthetic pathway in a heterologous host is one approach to activate biosynthetic gene clusters and to screen the metabolites produced for bioactivities. Polycistronic expression of all pathway genes under control of a single and tunable promoter would be the method of choice, as this does not only simplify cloning procedures, but also offers control on timing and strength of expression. However, polycistronic gene expression is a feature not commonly found in eukaryotic host systems, such as Aspergillus niger. In this study, we tested the suitability of the viral P2A peptide for co-expression of three genes in A. niger. Two genes descend from Fusarium oxysporum and are essential to produce the secondary metabolite enniatin (esyn1, ekivR). The third gene (luc) encodes the reporter luciferase which was included to study position effects. Expression of the polycistronic gene cassette was put under control of the Tet-On system to ensure tunable gene expression in A. niger. In total, three polycistronic expression cassettes which differed in the position of luc were constructed and targeted to the pyrG locus in A. niger. This allowed direct comparison of the luciferase activity based on the position of the luciferase gene. Doxycycline-mediated induction of the Tet-On expression cassettes resulted in the production of one long polycistronic mRNA as proven by Northern analyses, and ensured comparable production of enniatin in all three strains. Notably, gene position within the polycistronic expression cassette matters, as, luciferase activity was lowest at position one and had a comparable activity at positions two and three. The P2A peptide can be used to express at least three genes polycistronically in A. niger. This approach can now be applied to heterologously express entire secondary metabolite gene clusters polycistronically or to co-express any genes of interest in equimolar amounts.

Expression, purification and luminescence properties of coelenterazine-utilizing luciferases from Renilla, Oplophorus and Gaussia: comparison of substrate specificity for C2-modified coelenterazines.

PubMed

Inouye, Satoshi; Sahara-Miura, Yuiko; Sato, Jun-ichi; Iimori, Rie; Yoshida, Suguru; Hosoya, Takamitsu

2013-03-01

The cold-induced expression system in Escherichia coli is useful and we have applied this system to prepare the coelenterazine-utilizing luciferases including Renilla luciferase (RLase), a red-shifted variant of Renilla luciferase (RLase-547), the catalytic domain of Oplophorus luciferase (19kOLase) and Gaussia luciferase (GLase). The luminescence properties of the purified luciferases were characterized by using 10 kinds of C2-modified coelenterazine analogues as a substrate. The order of the maximal luminescence intensity for native coelenterazine was GLase (100%)>RLase (8.0%)>RLase-547 (0.73%)>19kOLase (0.09%) under our assay conditions. The substrate specificities of coelenterazine-utilizing luciferases for the C2-modified analogues showed significant differences, but the emission peaks catalyzed by coelenterazine-utilizing luciferases were not affected by the C2-substituted coelenterazine. These results suggest that the catalytic environment for the oxygenation process of coelenterazine and the excited species of coelenteramide might be different among coelenterazine-utilizing luciferases. Copyright © 2012 Elsevier Inc. All rights reserved.

Development of a rapid and quantitative method for the analysis of viral entry and release using a NanoLuc luciferase complementation assay.

PubMed

Sasaki, Michihito; Anindita, Paulina D; Phongphaew, Wallaya; Carr, Michael; Kobayashi, Shintaro; Orba, Yasuko; Sawa, Hirofumi

2018-01-02

Subviral particles (SVPs) self-assemble and are released from cells transfected with expression plasmids encoding flavivirus structural proteins. Flavivirus-like particles (VLPs), consisting of flavivirus structural proteins and a subgenomic replicon, can enter cells and cause single-round infections. Neither SVPs or VLPs possess complete viral RNA genomes, therefore are replication-incompetent systems; however, they retain the capacity to fuse and bud from target cells and follow the same maturation process as whole virions. SVPs and VLPs have been previously employed in studies analyzing entry and release steps of viral life cycles. In this study, we have developed quantitative methods for the detection of cellular entry and release of SVPs and VLPs by applying a luciferase complementation assay based on the high affinity interaction between the split NanoLuc luciferase protein, LgBiT and the small peptide, HiBiT. We introduced HiBiT into the structural protein of West Nile virus and generated SVPs and VLPs harboring HiBiT (SVP-HiBiT and VLP-HiBiT, respectively). As SVP-HiBiT emitted strong luminescence upon exposure to LgBiT and its substrate, the nascently budded SVP-HiBiT in the supernatant was readily quantified by luminometry. Similarly, the cellular entry of VLP-HiBiT generated luminescence when VLP-HiBiT was infected into LgBiT-expressing cells. These methods utilizing SVP-HiBiT and VLP-HiBiT will facilitate research into life cycles of flaviviruses, including WNV. Copyright © 2017 Elsevier B.V. All rights reserved.

A firefly algorithm for solving competitive location-design problem: a case study

NASA Astrophysics Data System (ADS)

Sadjadi, Seyed Jafar; Ashtiani, Milad Gorji; Ramezanian, Reza; Makui, Ahmad

2016-12-01

This paper aims at determining the optimal number of new facilities besides specifying both the optimal location and design level of them under the budget constraint in a competitive environment by a novel hybrid continuous and discrete firefly algorithm. A real-world application of locating new chain stores in the city of Tehran, Iran, is used and the results are analyzed. In addition, several examples have been solved to evaluate the efficiency of the proposed model and algorithm. The results demonstrate that the performed method provides good-quality results for the test problems.

Development of HSPA1A promoter-driven luciferase reporter gene assays in human cells for assessing the oxidative damage induced by silver nanoparticles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xin, Lili, E-mail: llxin@suda.edu.cn

The exponential increase in the total number of engineered nanoparticles in consumer products requires novel tools for rapid and cost-effective toxicology screening. In order to assess the oxidative damage induced by nanoparticles, toxicity test systems based on a human HSPA1A promoter-driven luciferase reporter in HepG2, LO2, A549, and HBE cells were established. After treated with heat shock and a group of silver nanoparticles (AgNPs) with different primary particle sizes, the cell viability, oxidative damage, and luciferase activity were determined. The time-dependent Ag{sup +} ions release from AgNPs in cell medium was also evaluated. Our results showed that heat shock producedmore » a strong time-dependent induction of relative luciferase activity in the four luciferase reporter cells. Surprisingly, at 4 h of recovery, the relative luciferase activity was > 98 × the control level in HepG2-luciferase cells. Exposure to different sizes of AgNPs resulted in activation of the HSPA1A promoter in a dose-dependent manner, even at low cytotoxic or non-cytotoxic doses. The smaller (5 nm) AgNPs were more potent in luciferase induction than the larger (50 and 75 nm) AgNPs. These results were generally in accordance with the oxidative damage indicated by malondialdehyde concentration, reactive oxygen species induction and glutathione depletion, and Ag{sup +} ions release in cell medium. Compared with the other three luciferase reporter cells, the luciferase signal in HepG2-luciferase cells is obviously more sensitive and stable. We conclude that the luciferase reporter cells, especially the HepG2-luciferase cells, could provide a valuable tool for rapid screening of the oxidative damage induced by AgNPs. - Highlights: • We established the stable HSPA1A promoter-driven luciferase reporter cells. • Silver nanoparticles induced dose-dependent increases in luciferase activity. • HSPA1A promoter activity is a sensitive and responsive indicator of oxidative stress. • HepG2-luciferase cells can be used to assess the toxicity of silver nanoparticles.« less

Expression, purification and characterization of the secreted luciferase of the copepod Metridia longa from Sf9 insect cells

PubMed Central

Stepanyuk, Galina A.; Xu, Hao; Wu, Chia-Kuei; Markova, Svetlana V.; Lee, John; Vysotski, Eugene S.; Wang, Bi-Cheng

2008-01-01

Metridia luciferase is a secreted luciferase from a marine copepod and uses coelenterazine as a substrate to produce a blue bioluminescence (λmax = 480 nm). This luciferase has been successfully applied as a bioluminescent reporter in mammalian cells. The main advantage of secreted luciferase as a reporter is the capability of measuring intracellular events without destroying the cells or tissues and this property is well suited for development of high throughput screening technologies. However because Metridia luciferase is a Cys-rich protein, E. coli expression systems produce an incorrectly folded protein, hindering its biochemical characterization and application for development of in vitro bioluminescent assays. Here we report the successful expression of Metridia luciferase with its signal peptide for secretion, in insect (Sf9) cells using the baculovirus expression system. Functionally active luciferase secreted by insect cells into the culture media has been efficiently purified with a yield of high purity protein of 2–3 mg/L. This Metridia luciferase expressed in the insect cell system is a monomeric protein showing 3.5-fold greater bioluminescence activity than luciferase expressed and purified from E. coli. The near coincidence of the experimental mass of Metridia luciferase purified from insect cells with that calculated from amino acid sequence, indicates that luciferase does not undergo posttranslational modifications such as phosphorylation or glycosylation and also, the cleavage site of the signal peptide for secretion is at VQA-KS, as predicted from sequence analysis. PMID:18595733

Development of HSPA1A promoter-driven luciferase reporter gene assays in human cells for assessing the oxidative damage induced by silver nanoparticles.

PubMed

Xin, Lili; Wang, Jianshu; Zhang, Leshuai W; Che, Bizhong; Dong, Guangzhu; Fan, Guoqiang; Cheng, Kaiming

2016-08-01

The exponential increase in the total number of engineered nanoparticles in consumer products requires novel tools for rapid and cost-effective toxicology screening. In order to assess the oxidative damage induced by nanoparticles, toxicity test systems based on a human HSPA1A promoter-driven luciferase reporter in HepG2, LO2, A549, and HBE cells were established. After treated with heat shock and a group of silver nanoparticles (AgNPs) with different primary particle sizes, the cell viability, oxidative damage, and luciferase activity were determined. The time-dependent Ag(+) ions release from AgNPs in cell medium was also evaluated. Our results showed that heat shock produced a strong time-dependent induction of relative luciferase activity in the four luciferase reporter cells. Surprisingly, at 4h of recovery, the relative luciferase activity was >98× the control level in HepG2-luciferase cells. Exposure to different sizes of AgNPs resulted in activation of the HSPA1A promoter in a dose-dependent manner, even at low cytotoxic or non-cytotoxic doses. The smaller (5nm) AgNPs were more potent in luciferase induction than the larger (50 and 75nm) AgNPs. These results were generally in accordance with the oxidative damage indicated by malondialdehyde concentration, reactive oxygen species induction and glutathione depletion, and Ag(+) ions release in cell medium. Compared with the other three luciferase reporter cells, the luciferase signal in HepG2-luciferase cells is obviously more sensitive and stable. We conclude that the luciferase reporter cells, especially the HepG2-luciferase cells, could provide a valuable tool for rapid screening of the oxidative damage induced by AgNPs. Copyright © 2016 Elsevier Inc. All rights reserved.